Sample records for distribution developmental expression

  1. Developmental expression and distribution of nesfatin-1/NUCB2 in the canine digestive system.

    PubMed

    Jiang, Shudong; Zhou, Weijuan; Zhang, Xingwang; Wang, Dengfeng; Zhu, Hui; Hong, Meizhen; Gong, Yajing; Ye, Jing; Fang, Fugui

    2016-03-01

    Nesfatin-1/NUCB2 is a neuropeptide that plays important roles in regulating food intake and energy homeostasis. The distribution of nesfatin-1/NUCB2 protein and mRNA has not been investigated in the canine digestive system. The present study was conducted to evaluate the expression of nesfatin-1/NUCB2 protein and NUCB2 mRNA in the canine digestive organs (esophagus, stomach, duodenum, jejunum, ileum, cecum, colon, rectum, liver and pancreas). The tissues of the digestive system were collected from dogs at different developmental stages (infantile, juvenile, pubertal and adult). Nesfatin-1/NUCB2 protein localization in the organs of adult dogs was detected by immunohistochemistry. The expression of NUCB2 mRNA at the four developmental stages was analyzed by real-time fluorescence quantitative PCR (qRT-PCR). Nesfatin-1/NUCB2 protein was distributed in the fundic gland region of the stomach, and the islet area and exocrine portions of the pancreas. However, NUCB2 mRNA was found in all digestive organs, although the expression levels in the pancreas and stomach were higher than those in liver, duodenum and other digestive tract tissues (P<0.05) at the four different developmental stages of the dogs. In this study, nesfatin-1/NUCB2 was found to be present at high levels in the stomach and pancreas at both the protein and mRNA levels; however, NUCB2 expression was found at lower levels in all of the digestive organs. These findings provide the basis of further investigations to elucidate the functions of nefatin-1 in the canine digestive system. Copyright © 2015 Elsevier GmbH. All rights reserved.

  2. [Expression of neural salient serine/arginine-rich protein 1 (NSSR1) in the development of mouse brain].

    PubMed

    Zhang, Wei; Fan, Li-mei; Li, Lin-lin; Peng, Zheng-yu

    2014-01-01

    To investigate the expression of neural salient serine/arginine-rich protein 1 (NSSR1) in the development of mouse brain. Brain samples were collected from mice with different developmental stages: 9, 12, 14 d before birth (E9, E12, E14) and 1 d, 3 weeks and 3 months after birth. The expression of NSSR1 in mouse brain at different developmental stages was detected by Western blot and the distribution of NSSR1 was analyzed by immunohistochemical staining. The expression and distribution of NSSR1 in mouse brain were compared among embryos, neonatal and adult animals. During embryogenesis, the expression of NSSR1 proteins increases significantly from 0.186(E9) to 0.445(E14) and reached a high level after birth. Immunohistochemical analysis showed that in E12 embryos, NSSR1 was specifically distributed in the marginal and mantle layers. The expression of NSSR1 in hippocampus was very low in neonatal animals but stronger in adults. In cerebellar cortex, NSSR1 was widely expressed in purkinje and granule cells of adult animals, but mainly expressed in Purkinje cells in neonates. The expression of NSSR1 is regulated by the development of mouse brain and presents dynamic changes.

  3. Developmental expression of VGF mRNA in the prenatal and postnatal rat.

    PubMed

    Snyder, S E; Pintar, J E; Salton, S R

    1998-04-27

    VGF is a developmentally regulated, secretory peptide precursor that is expressed by neurons and neuroendocrine cells and that has its transcription and secretion induced rapidly by neurotrophins and by depolarization. To gain insight into the possible functions and regulation of VGF in vivo, we have characterized the distribution of VGF mRNA in the developing rat nervous system. VGF expression was first detectable at embryonic day 11.5 in the primordia of cranial, sympathetic, and dorsal root ganglia, and its distribution expanded throughout development to include significant expression throughout the brain, spinal cord, and retina of the adult rat. The earliest expression of VGF, therefore, appeared in the peripheral nervous system as developing neurons settled in their designated ganglia. In many regions of the brain, VGF mRNA levels were found to be highest during periods when axonal outgrowth and synaptogenesis predominate. Areas of the central nervous system that contain predominantly dividing cells never displayed any VGF mRNA expression, nor did the vast majority of nonneural tissues.

  4. Developmental expression of human hemoglobins mediated by maturation of their subunit interfaces

    PubMed Central

    Manning, Lois R; Popowicz, Anthony M; Padovan, Julio; Chait, Brian T; Russell, J Eric; Manning, James M

    2010-01-01

    Different types of human hemoglobins (Hbs) consisting of various combinations of the embryonic, fetal, and adult Hb subunits are present at certain times during development representing a major paradigm of developmental biology that is still not understood and one which we address here. We show that the subunit interfaces of these Hbs have increasing bonding strengths as demonstrated by their distinct distribution of tetramers, dimers, and monomers during gel filtration at very low-Hb concentration. This maturation is mediated by competition between subunits for more favorable partners with stronger subunit interactions. Thus, the protein products of gene expression can themselves have a role in the developmental process due to their intrinsic properties. PMID:20572018

  5. Expression and Chloroplast Targeting of Cholesterol Oxidase in Transgenic Tobacco Plants

    PubMed Central

    Corbin, David R.; Grebenok, Robert J.; Ohnmeiss, Thomas E.; Greenplate, John T.; Purcell, John P.

    2001-01-01

    Cholesterol oxidase represents a novel type of insecticidal protein with potent activity against the cotton boll weevil (Anthonomus grandis grandis Boheman). We transformed tobacco (Nicotiana tabacum) plants with the cholesterol oxidase choM gene and expressed cytosolic and chloroplast-targeted versions of the ChoM protein. Transgenic leaf tissues expressing cholesterol oxidase exerted insecticidal activity against boll weevil larvae. Our results indicate that cholesterol oxidase can metabolize phytosterols in vivo when produced cytosolically or when targeted to chloroplasts. The transgenic plants exhibiting cytosolic expression accumulated low levels of saturated sterols known as stanols, and displayed severe developmental aberrations. In contrast, the transgenic plants expressing chloroplast-targeted cholesterol oxidase maintained a greater accumulation of stanols, and appeared phenotypically and developmentally normal. These results are discussed within the context of plant sterol distribution and metabolism. PMID:11457962

  6. Spatial distribution and expression of intracellular and extracellular acid phosphatases of cluster roots at different developmental stages in white lupin.

    PubMed

    Tang, Hongliang; Li, Xiaoqing; Zu, Chao; Zhang, Fusuo; Shen, Jianbo

    2013-09-15

    Acid phosphatases (APases) play a key role in phosphorus (P) acquisition and recycling in plants. White lupin (Lupinus albus L.) forms cluster roots (CRs) and produces large amounts of APases under P deficiency. However, the relationships between the activity of intracellular and extracellular APases (EC 3.1.3.2) and CR development are not fully understood. Here, comparative studies were conducted to examine the spatial variation pattern of APase activity during CR development using the enzyme-labelled fluorescence-97 (ELF-97) and the p-nitrophenyl phosphate methods. The activity of intracellular and extracellular APases was significantly enhanced under P deficiency in the non-CRs and CRs at different developmental stages. These two APases exhibited different spatial distribution patterns during CR development, and these distribution patterns were highly modified by P deficiency. The activity of extracellular APase increased steadily with CR development from meristematic, juvenile, mature to senescent stages under P deficiency. In comparison, P deficiency-induced increase in the activity of intracellular APase remained relatively constant during CR development. Increased activity of intracellular and extracellular APases was associated with enhanced expression of LaSAP1 encoding intracellular APase and LaSAP2 encoding extracellular APase. The expression levels of these two genes were significantly higher at transcriptional level in both mature and senescent CRs. Taken together, these findings demonstrate that both activity and gene expression of intracellular or extracellular APases exhibit a differential response pattern during CR development, depending on root types, CR developmental stages and P supply. Simultaneous in situ determination of intracellular and extracellular APase activity has proved to be an effective approach for studying spatial variation of APases during CR development. Copyright © 2013 Elsevier GmbH. All rights reserved.

  7. Aberrant ligand-induced activation of G protein-coupled estrogen receptor 1 (GPER) results in developmental malformations during vertebrate embryogenesis.

    PubMed

    Jayasinghe, B Sumith; Volz, David C

    2012-01-01

    G protein-coupled estrogen receptor 1 (GPER) is a G protein-coupled receptor (GPCR) unrelated to nuclear estrogen receptors but strongly activated by 17β-estradiol in both mammals and fish. To date, the distribution and functional characterization of GPER within reproductive and nonreproductive vertebrate organs have been restricted to juvenile and adult animals. In contrast, virtually nothing is known about the spatiotemporal distribution and function of GPER during vertebrate embryogenesis. Using zebrafish as an animal model, we investigated the potential functional role and expression of GPER during embryogenesis. Based on real-time PCR and whole-mount in situ hybridization, gper was expressed as early as 1 h postfertilization (hpf) and exhibited strong stage-dependent expression patterns during embryogenesis. At 26 and 38 hpf, gper mRNA was broadly distributed throughout the body, whereas from 50 to 98 hpf, gper expression was increasingly localized to the heart, brain, neuromasts, craniofacial region, and somite boundaries of developing zebrafish. Continuous exposure to a selective GPER agonist (G-1)-but not continuous exposure to a selective GPER antagonist (G-15)-from 5 to 96 hpf, or within three developmental windows ranging from 10 to 72 hpf, resulted in adverse concentration-dependent effects on survival, gross morphology, and somite formation within the trunk of developing zebrafish embryos. Importantly, based on co-exposure studies, G-15 blocked severe G-1-induced developmental toxicity, suggesting that G-1 toxicity is mediated via aberrant activation of GPER. Overall, our findings suggest that xenobiotic-induced GPER activation represents a potentially novel and understudied mechanism of toxicity for environmentally relevant chemicals that affect vertebrate embryogenesis.

  8. Roles of the sister chromatid cohesion apparatus in gene expression, development, and human syndromes

    PubMed Central

    Dorsett, Dale

    2006-01-01

    The sister chromatid cohesion apparatus mediates physical pairing of duplicated chromosomes. This pairing is essential for appropriate distribution of chromosomes into the daughter cells upon cell division. Recent evidence shows that the cohesion apparatus, which is a significant structural component of chromosomes during interphase, also affects gene expression and development. The Cornelia de Lange (CdLS) and Roberts/SC phocomelia (RBS/SC) genetic syndromes in humans are caused by mutations affecting components of the cohesion apparatus. Studies in Drosophila suggest that effects on gene expression are most likely responsible for developmental alterations in CdLS. Effects on chromatid cohesion are apparent in RBS/SC syndrome, but data from yeast and Drosophila point to the likelihood that changes in expression of genes located in heterochromatin could contribute to the developmental deficits. PMID:16819604

  9. Developmental changes in NMDA receptor expression in the platyfish brain

    NASA Technical Reports Server (NTRS)

    Flynn, K. M.; Schreibman, M. P.; Magliulo-Cepriano, L.

    1997-01-01

    We have examined the distribution of the N-methyl-D-aspartate (NMDA) receptor in the brain of a freshwater teleost using an antibody against the R1 subunit of the receptor (NMDAR1). The primary site of localization was the nucleus olfactoretinalis (NOR), a significant gonadotropin releasing hormone (GnRH)-containing brain nucleus. The number of cells expressing NMDAR1 in this nucleus was dependent upon developmental stage, with pubescent and mature animals displaying significantly more stained cells than immature and senescent animals. This is the first reported observation of age- and maturity-related NMDA receptor association with GnRH-containing brain areas.

  10. Monoallelic expression of the human FOXP2 speech gene

    PubMed Central

    Adegbola, Abidemi A.; Cox, Gerald F.; Bradshaw, Elizabeth M.; Hafler, David A.; Gimelbrant, Alexander; Chess, Andrew

    2015-01-01

    The recent descriptions of widespread random monoallelic expression (RMAE) of genes distributed throughout the autosomal genome indicate that there are more genes subject to RMAE on autosomes than the number of genes on the X chromosome where X-inactivation dictates RMAE of X-linked genes. Several of the autosomal genes that undergo RMAE have independently been implicated in human Mendelian disorders. Thus, parsing the relationship between allele-specific expression of these genes and disease is of interest. Mutations in the human forkhead box P2 gene, FOXP2, cause developmental verbal dyspraxia with profound speech and language deficits. Here, we show that the human FOXP2 gene undergoes RMAE. Studying an individual with developmental verbal dyspraxia, we identify a deletion 3 Mb away from the FOXP2 gene, which impacts FOXP2 gene expression in cis. Together these data suggest the intriguing possibility that RMAE impacts the haploinsufficiency phenotypes observed for FOXP2 mutations. PMID:25422445

  11. Monoallelic expression of the human FOXP2 speech gene.

    PubMed

    Adegbola, Abidemi A; Cox, Gerald F; Bradshaw, Elizabeth M; Hafler, David A; Gimelbrant, Alexander; Chess, Andrew

    2015-06-02

    The recent descriptions of widespread random monoallelic expression (RMAE) of genes distributed throughout the autosomal genome indicate that there are more genes subject to RMAE on autosomes than the number of genes on the X chromosome where X-inactivation dictates RMAE of X-linked genes. Several of the autosomal genes that undergo RMAE have independently been implicated in human Mendelian disorders. Thus, parsing the relationship between allele-specific expression of these genes and disease is of interest. Mutations in the human forkhead box P2 gene, FOXP2, cause developmental verbal dyspraxia with profound speech and language deficits. Here, we show that the human FOXP2 gene undergoes RMAE. Studying an individual with developmental verbal dyspraxia, we identify a deletion 3 Mb away from the FOXP2 gene, which impacts FOXP2 gene expression in cis. Together these data suggest the intriguing possibility that RMAE impacts the haploinsufficiency phenotypes observed for FOXP2 mutations.

  12. Specific subpopulations of hypothalamic leptin receptor-expressing neurons mediate the effects of early developmental leptin receptor deletion on energy balance.

    PubMed

    Rupp, Alan C; Allison, Margaret B; Jones, Justin C; Patterson, Christa M; Faber, Chelsea L; Bozadjieva, Nadejda; Heisler, Lora K; Seeley, Randy J; Olson, David P; Myers, Martin G

    2018-06-06

    To date, early developmental ablation of leptin receptor (LepRb) expression from circumscribed populations of hypothalamic neurons (e.g., arcuate nucleus (ARC) Pomc- or Agrp-expressing cells) has only minimally affected energy balance. In contrast, removal of LepRb from at least two large populations (expressing vGat or Nos1) spanning multiple hypothalamic regions produced profound obesity and metabolic dysfunction. Thus, we tested the notion that the total number of leptin-responsive hypothalamic neurons (rather than specific subsets of cells with a particular molecular or anatomical signature) subjected to early LepRb deletion might determine energy balance. We generated new mouse lines deleted for LepRb in ARC Ghrh Cre neurons or in Htr2c Cre neurons (representing roughly half of all hypothalamic LepRb neurons, distributed across many nuclei). We compared the phenotypes of these mice to previously-reported models lacking LepRb in Pomc, Agrp, vGat or Nos1 cells. The early developmental deletion of LepRb from vGat or Nos1 neurons produced dramatic obesity, but deletion of LepRb from Pomc, Agrp, Ghrh, or Htr2c neurons minimally altered energy balance. Although early developmental deletion of LepRb from known populations of ARC neurons fails to substantially alter body weight, the minimal phenotype of mice lacking LepRb in Htr2c cells suggests that the phenotype that results from early developmental LepRb deficiency depends not simply upon the total number of leptin-responsive hypothalamic LepRb cells. Rather, specific populations of LepRb neurons must play particularly important roles in body energy homeostasis; these as yet unidentified LepRb cells likely reside in the DMH. Copyright © 2018 The Authors. Published by Elsevier GmbH.. All rights reserved.

  13. A developmental basis for stochasticity in floral organ numbers

    PubMed Central

    Kitazawa, Miho S.; Fujimoto, Koichi

    2014-01-01

    Stochasticity ubiquitously inevitably appears at all levels from molecular traits to multicellular, morphological traits. Intrinsic stochasticity in biochemical reactions underlies the typical intercellular distributions of chemical concentrations, e.g., morphogen gradients, which can give rise to stochastic morphogenesis. While the universal statistics and mechanisms underlying the stochasticity at the biochemical level have been widely analyzed, those at the morphological level have not. Such morphological stochasticity is found in foral organ numbers. Although the floral organ number is a hallmark of floral species, it can distribute stochastically even within an individual plant. The probability distribution of the floral organ number within a population is usually asymmetric, i.e., it is more likely to increase rather than decrease from the modal value, or vice versa. We combined field observations, statistical analysis, and mathematical modeling to study the developmental basis of the variation in floral organ numbers among 50 species mainly from Ranunculaceae and several other families from core eudicots. We compared six hypothetical mechanisms and found that a modified error function reproduced much of the asymmetric variation found in eudicot floral organ numbers. The error function is derived from mathematical modeling of floral organ positioning, and its parameters represent measurable distances in the floral bud morphologies. The model predicts two developmental sources of the organ-number distributions: stochastic shifts in the expression boundaries of homeotic genes and a semi-concentric (whorled-type) organ arrangement. Other models species- or organ-specifically reproduced different types of distributions that reflect different developmental processes. The organ-number variation could be an indicator of stochasticity in organ fate determination and organ positioning. PMID:25404932

  14. RNAi pathways contribute to developmental history-dependent phenotypic plasticity in C. elegans

    PubMed Central

    Hall, Sarah E.; Chirn, Gung-Wei; Lau, Nelson C.; Sengupta, Piali

    2013-01-01

    Early environmental experiences profoundly influence adult phenotypes through complex mechanisms that are poorly understood. We previously showed that adult Caenorhabditis elegans that transiently passed through the stress-induced dauer larval stage (post-dauer adults) exhibit significant changes in gene expression profiles, chromatin states, and life history traits when compared with adults that bypassed the dauer stage (control adults). These wild-type, isogenic animals of equivalent developmental stages exhibit different signatures of molecular marks that reflect their distinct developmental trajectories. To gain insight into the mechanisms that contribute to these developmental history-dependent phenotypes, we profiled small RNAs from post-dauer and control adults by deep sequencing. RNA interference (RNAi) pathways are known to regulate genome-wide gene expression both at the chromatin and post-transcriptional level. By quantifying changes in endogenous small interfering RNA (endo-siRNA) levels in post-dauer as compared with control animals, our analyses identified a subset of genes that are likely targets of developmental history-dependent reprogramming through a complex RNAi-mediated mechanism. Mutations in specific endo-siRNA pathways affect expected gene expression and chromatin state changes for a subset of genes in post-dauer animals, as well as disrupt their increased brood size phenotype. We also find that both chromatin state and endo-siRNA distribution in dauers are unique, and suggest that remodeling in dauers provides a template for the subsequent establishment of adult post-dauer profiles. Our results indicate a role for endo-siRNA pathways as a contributing mechanism to early experience-dependent phenotypic plasticity in adults, and describe how developmental history can program adult physiology and behavior via epigenetic mechanisms. PMID:23329696

  15. Characterization of the cork oak transcriptome dynamics during acorn development.

    PubMed

    Miguel, Andreia; de Vega-Bartol, José; Marum, Liliana; Chaves, Inês; Santo, Tatiana; Leitão, José; Varela, Maria Carolina; Miguel, Célia M

    2015-06-25

    Cork oak (Quercus suber L.) has a natural distribution across western Mediterranean regions and is a keystone forest tree species in these ecosystems. The fruiting phase is especially critical for its regeneration but the molecular mechanisms underlying the biochemical and physiological changes during cork oak acorn development are poorly understood. In this study, the transcriptome of the cork oak acorn, including the seed, was characterized in five stages of development, from early development to acorn maturation, to identify the dominant processes in each stage and reveal transcripts with important functions in gene expression regulation and response to water. A total of 80,357 expressed sequence tags (ESTs) were de novo assembled from RNA-Seq libraries representative of the several acorn developmental stages. Approximately 7.6 % of the total number of transcripts present in Q. suber transcriptome was identified as acorn specific. The analysis of expression profiles during development returned 2,285 differentially expressed (DE) transcripts, which were clustered into six groups. The stage of development corresponding to the mature acorn exhibited an expression profile markedly different from other stages. Approximately 22 % of the DE transcripts putatively code for transcription factors (TF) or transcriptional regulators, and were found almost equally distributed among the several expression profile clusters, highlighting their major roles in controlling the whole developmental process. On the other hand, carbohydrate metabolism, the biological pathway most represented during acorn development, was especially prevalent in mid to late stages as evidenced by enrichment analysis. We further show that genes related to response to water, water deprivation and transport were mostly represented during the early (S2) and the last stage (S8) of acorn development, when tolerance to water desiccation is possibly critical for acorn viability. To our knowledge this work represents the first report of acorn development transcriptomics in oaks. The obtained results provide novel insights into the developmental biology of cork oak acorns, highlighting transcripts putatively involved in the regulation of the gene expression program and in specific processes likely essential for adaptation. It is expected that this knowledge can be transferred to other oak species of great ecological value.

  16. Preprotachykinin A mRNA expression in the rat brain during development.

    PubMed

    Brené, S; Lindefors, N; Friedman, W J; Persson, H

    1990-12-15

    Expression of preprotachykinin A (PPT-A) mRNA was analyzed by northern blots using mRNA prepared from rat brain at 12 different developmental stages ranging from embryonic day 15 (E15) to adult. A single PPT-A mRNA of 1.3 kb was detected throughout development. PPT-A mRNA was detected as early as E15 and an approximately 3-fold increase occurred at birth. This amount remained until 3 weeks of age when the level increased, reaching a peak at 5 weeks of age. Adult amounts were approximately 3-fold higher than the levels at birth. The distribution of PPT-A mRNA-expressing cells in rat brain was studied by in situ hybridization on sections from embryonic day 20, postnatal days 4 and 7 as well as adult. Cells expressing PPT-A mRNA were detected in the forebrain at all 4 ages analyzed. However, the hybridization pattern and the labeling intensity varied in different brain regions during development. In cingulate cortex, intense labeling was seen in numerous cells at embryonic day 20 and postnatal days 4 and 7, whereas in the adult cingulate cortex only a few scattered labeled cells were observed. In frontoparietal cortex labeled cells were found from postnatal day 4 to adult, with the highest density of labeled cells at P7. Developmental differences in both the distribution of PPT-A mRNA-expressing cells and the level of PPT-A mRNA expression were also found in caudate-putamen, lateral hypothalamus and amygdala. Thus, our results show several changes in PPT-A mRNA expression during ontogeny, indicating a region and time-specific regulation of PPT-A mRNA expression during brain maturation.

  17. RNA-Seq analysis of nodule development at five different developmental stages of soybean (Glycine max) inoculated with Bradyrhizobium japonicum strain 113-2

    PubMed Central

    Yuan, Song L.; Li, Rong; Chen, Hai F.; Zhang, Chan J.; Chen, Li M.; Hao, Qing N.; Chen, Shui L.; Shan, Zhi H.; Yang, Zhong L.; Zhang, Xiao J.; Qiu, De Z.; Zhou, Xin A.

    2017-01-01

    Nodule development directly affects nitrogen fixation efficiency during soybean growth. Although abundant genome-based information related to nodule development has been released and some studies have reported the molecular mechanisms that regulate nodule development, information on the way nodule genes operate in nodule development at different developmental stages of soybean is limited. In this report, notably different nodulation phenotypes in soybean roots inoculated with Bradyrhizobium japonicum strain 113-2 at five developmental stages (branching stage, flowering stage, fruiting stage, pod stage and harvest stage) were shown, and the expression of nodule genes at these five stages was assessed quantitatively using RNA-Seq. Ten comparisons were made between these developmental periods, and their differentially expressed genes were analysed. Some important genes were identified, primarily encoding symbiotic nitrogen fixation-related proteins, cysteine proteases, cystatins and cysteine-rich proteins, as well as proteins involving plant-pathogen interactions. There were no significant shifts in the distribution of most GO functional annotation terms and KEGG pathway enrichment terms between these five development stages. A cystatin Glyma18g12240 was firstly identified from our RNA-seq, and was likely to promote nodulation and delay nodule senescence. This study provides molecular material for further investigations into the mechanisms of nitrogen fixation at different soybean developmental stages. PMID:28169364

  18. The genetics of fat distribution.

    PubMed

    Schleinitz, Dorit; Böttcher, Yvonne; Blüher, Matthias; Kovacs, Peter

    2014-07-01

    Fat stored in visceral depots makes obese individuals more prone to complications than subcutaneous fat. There is good evidence that body fat distribution (FD) is controlled by genetic factors. WHR, a surrogate measure of FD, shows significant heritability of up to ∼60%, even after adjusting for BMI. Genetic variants have been linked to various forms of altered FD such as lipodystrophies; however, the polygenic background of visceral obesity has only been sparsely investigated in the past. Recent genome-wide association studies (GWAS) for measures of FD revealed numerous loci harbouring genes potentially regulating FD. In addition, genes with fat depot-specific expression patterns (in particular subcutaneous vs visceral adipose tissue) provide plausible candidate genes involved in the regulation of FD. Many of these genes are differentially expressed in various fat compartments and correlate with obesity-related traits, thus further supporting their role as potential mediators of metabolic alterations associated with a distinct FD. Finally, developmental genes may at a very early stage determine specific FD in later life. Indeed, genes such as TBX15 not only manifest differential expression in various fat depots, but also correlate with obesity and related traits. Moreover, recent GWAS identified several polymorphisms in developmental genes (including TBX15, HOXC13, RSPO3 and CPEB4) strongly associated with FD. More accurate methods, including cardiometabolic imaging, for assessment of FD are needed to promote our understanding in this field, where the main focus is now to unravel the yet unknown biological function of these novel 'fat distribution genes'.

  19. Expression profile and distribution of Efhc1 gene transcript during rodent brain development.

    PubMed

    Conte, Fábio F; Ribeiro, Patrícia A O; Marchesini, Rafael B; Pascoal, Vinícius D B; Silva, Joelcimar M; Oliveira, Amanda R; Gilioli, Rovílson; Sbragia, Lourenço; Bittencourt, Jackson C; Lopes-Cendes, Iscia

    2009-09-01

    One of the putative causative genes for juvenile myoclonic epilepsy (JME) is EFHC1. We report here the expression profile and distribution of Efhc1 messenger RNA (mRNA) during mouse and rat brain development. Real-time polymerase chain reaction revealed that there is no difference in the expression of Efhc1 mRNA between right and left hemispheres in both species. In addition, the highest levels of Efhc1 mRNA were found at intra-uterine stages in mouse and in adulthood in rat. In common, there was a progressive decrease in Efhc1 expression from 1-day-old neonates to 14-day-old animals in both species. In situ hybridization studies showed that rat and mouse Efhc1 mRNAs are expressed in ependymal cells of ventricle walls. Our findings suggest that Efhc1 expression is more important during initial phases of brain development and that at this stage it could be involved in key developmental mechanisms underlying JME.

  20. Transcriptional responses of metallothionein gene to different stress factors in Pacific abalone (Haliotis discus hannai).

    PubMed

    Lee, Sang Yoon; Nam, Yoon Kwon

    2016-11-01

    A novel metallothionein (MT) gene from the Pacific abalone H. discus hannai was characterized and its mRNA expression patterns (tissue distribution, developmental expression and differential expression in responsive to various in vivo stimulatory treatments) were examined. Abalone MT shares conserved structural features with previously known gastropod orthologs at both genomic (i.e., tripartite organization) and amino acid (conserved Cys motifs) levels. The 5'-flanking regulatory region of abalone MT gene displayed various transcription factor binding motifs particularly including ones related with metal regulation and stress/immune responses. Tissue distribution and basal expression patterns of MT mRNAs indicated a potential association between ovarian MT expression and sexual maturation. Developmental expression pattern suggested the maternal contribution of MT mRNAs to embryonic and early larval developments. Abalone MT mRNAs could be significantly induced by various heavy metals in different tissues (gill, hepatopancreas, muscle and hemocyte) in a tissue- and/or metal-dependent fashion. In addition, the abalone MT gene was highly modulated in responsive to other non-metal, stimulatory treatments such as immune challenge (LPS, polyI:C and bacterial injections), hypoxia (decrease from normoxia 8 ppm-2 ppm), thermal elevation (increase from 20 °C to 30 °C), and xenobiotic exposure (250 ppb of 17α-ethynylestradiol and 0.25 ppb of 2,3,7,8-tetrachlorodibenzodioxin) where differential expression patterns were toward either up- or down-regulation depending on types of stimulations and tissues examined. Taken together, our results highlight that MT is a multifunctional effector playing in wide criteria of cellular pathways especially associated with development and stress responses in this abalone species. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Comprehensive analysis of TCP transcription factors and their expression during cotton (Gossypium arboreum) fiber early development

    PubMed Central

    Ma, Jun; Liu, Fang; Wang, Qinglian; Wang, Kunbo; Jones, Don C.; Zhang, Baohong

    2016-01-01

    TCP proteins are plant-specific transcription factors implicated to perform a variety of physiological functions during plant growth and development. In the current study, we performed for the first time the comprehensive analysis of TCP gene family in a diploid cotton species, Gossypium arboreum, including phylogenetic analysis, chromosome location, gene duplication status, gene structure and conserved motif analysis, as well as expression profiles in fiber at different developmental stages. Our results showed that G. arboreum contains 36 TCP genes, distributing across all of the thirteen chromosomes. GaTCPs within the same subclade of the phylogenetic tree shared similar exon/intron organization and motif composition. In addition, both segmental duplication and whole-genome duplication contributed significantly to the expansion of GaTCPs. Many these TCP transcription factor genes are specifically expressed in cotton fiber during different developmental stages, including cotton fiber initiation and early development. This suggests that TCP genes may play important roles in cotton fiber development. PMID:26857372

  2. Comprehensive analysis of TCP transcription factors and their expression during cotton (Gossypium arboreum) fiber early development.

    PubMed

    Ma, Jun; Liu, Fang; Wang, Qinglian; Wang, Kunbo; Jones, Don C; Zhang, Baohong

    2016-02-09

    TCP proteins are plant-specific transcription factors implicated to perform a variety of physiological functions during plant growth and development. In the current study, we performed for the first time the comprehensive analysis of TCP gene family in a diploid cotton species, Gossypium arboreum, including phylogenetic analysis, chromosome location, gene duplication status, gene structure and conserved motif analysis, as well as expression profiles in fiber at different developmental stages. Our results showed that G. arboreum contains 36 TCP genes, distributing across all of the thirteen chromosomes. GaTCPs within the same subclade of the phylogenetic tree shared similar exon/intron organization and motif composition. In addition, both segmental duplication and whole-genome duplication contributed significantly to the expansion of GaTCPs. Many these TCP transcription factor genes are specifically expressed in cotton fiber during different developmental stages, including cotton fiber initiation and early development. This suggests that TCP genes may play important roles in cotton fiber development.

  3. Hepatic ontogeny and tissue distribution of mRNAs of epigenetic modifiers in mice using RNA-sequencing

    PubMed Central

    Lu, Hong; Cui, Julia; Gunewardena, Sumedha; Yoo, Byunggil; Zhong, Xiao-bo; Klaassen, Curtis

    2012-01-01

    Developmental regulation of gene expression is controlled by distinct epigenetic signatures catalyzed by various epigenetic modifiers. Little is known about the ontogeny and tissue distribution of these epigenetic modifiers. In the present study, we used a novel approach of RNA-sequencing to elucidate hepatic ontogeny and tissue distribution of mRNA expression of 142 epigenetic modifiers, including enzymes involved in DNA methylation/demethylation, histone acetylation/deacetylation, histone methylation/demethylation, histone phosphorylation and chromosome remodeling factors in male C57BL/6 mice. Livers from male C57BL/6 mice were collected at 12 ages from prenatal to adulthood. Many of these epigenetic modifiers were expressed at much higher levels in perinatal livers than adult livers, such as Dnmt1, Dnmt3a, Dnmt3b, Apobec3, Kat1, Ncoa4, Setd8, Ash2l, Dot1l, Cbx1, Cbx3, Cbx5, Cbx6, Ezh2, Suz12, Eed, Suv39h1, Suv420h2, Dek, Hdac1, Hdac2, Hdac7, Kdm2b, Kdm5c, Kdm7, Prmt1–5, Prmt7, Smarca4, Smarcb1, Chd4 and Ino80e. In contrast, hepatic mRNA expression of a few epigenetic modifiers increased during postnatal liver development, such as Smarca2, Kdm1b, Cbx7 and Chd3. In adult mice (60 d of age), most epigenetic modifiers were expressed at moderately (1–3-fold) higher levels in kidney and/or small intestine than liver. In conclusion, this study, for the first time, unveils developmental changes in mRNA abundance of all major known epigenetic modifiers in mouse liver. These data suggest that ontogenic changes in mRNA expression of epigenetic modifiers may play important roles in determining the addition and/or removal of corresponding epigenetic signatures during liver development. PMID:22772165

  4. Hepatic ontogeny and tissue distribution of mRNAs of epigenetic modifiers in mice using RNA-sequencing.

    PubMed

    Lu, Hong; Cui, Julia Yue; Gunewardena, Sumedha; Yoo, Byunggil; Zhong, Xiao-bo; Klaassen, Curtis D

    2012-08-01

    Developmental regulation of gene expression is controlled by distinct epigenetic signatures catalyzed by various epigenetic modifiers. Little is known about the ontogeny and tissue distribution of these epigenetic modifiers. In the present study, we used a novel approach of RNA-sequencing to elucidate hepatic ontogeny and tissue distribution of mRNA expression of 142 epigenetic modifiers, including enzymes involved in DNA methylation/demethylation, histone acetylation/deacetylation, histone methylation/demethylation, histone phosphorylation and chromosome remodeling factors in male C57BL/6 mice. Livers from male C57BL/6 mice were collected at 12 ages from prenatal to adulthood. Many of these epigenetic modifiers were expressed at much higher levels in perinatal livers than adult livers, such as Dnmt1, Dnmt3a, Dnmt3b, Apobec3, Kat1, Ncoa4, Setd8, Ash2l, Dot1l, Cbx1, Cbx3, Cbx5, Cbx6, Ezh2, Suz12, Eed, Suv39h1, Suv420h2, Dek, Hdac1, Hdac2, Hdac7, Kdm2b, Kdm5c, Kdm7, Prmt1-5, Prmt7, Smarca4, Smarcb1, Chd4 and Ino80e. In contrast, hepatic mRNA expression of a few epigenetic modifiers increased during postnatal liver development, such as Smarca2, Kdm1b, Cbx7 and Chd3. In adult mice (60 d of age), most epigenetic modifiers were expressed at moderately (1-3-fold) higher levels in kidney and/or small intestine than liver. In conclusion, this study, for the first time, unveils developmental changes in mRNA abundance of all major known epigenetic modifiers in mouse liver. These data suggest that ontogenic changes in mRNA expression of epigenetic modifiers may play important roles in determining the addition and/or removal of corresponding epigenetic signatures during liver development.

  5. Positron Emission Tomography Methods with Potential for Increased Understanding of Mental Retardation and Developmental Disabilities

    ERIC Educational Resources Information Center

    Sundaram, Senthil K.; Chugani, Harry T.; Chugani, Diane C.

    2005-01-01

    Positron emission tomography (PET) is a technique that enables imaging of the distribution of radiolabeled tracers designed to track biochemical and molecular processes in the body after intravenous injection or inhalation. New strategies for the use of radiolabeled tracers hold potential for imaging gene expression in the brain during development…

  6. Developmental programming by androgen affects the circadian timing system in female mice.

    PubMed

    Mereness, Amanda L; Murphy, Zachary C; Sellix, Michael T

    2015-04-01

    Circadian clocks play essential roles in the timing of events in the mammalian hypothalamo-pituitary-ovarian (HPO) axis. The molecular oscillator driving these rhythms has been localized to tissues of the HPO axis. It has been suggested that synchrony among these oscillators is a feature of normal reproductive function. The impact of fertility disorders on clock function and the role of the clock in the etiology of endocrine pathology remain unknown. Polycystic ovarian syndrome (PCOS) is a particularly devastating fertility disorder, affecting 5%-10% of women at childbearing age with features including a polycystic ovary, anovulation, and elevated serum androgen. Approximately 40% of these women have metabolic syndrome, marked by hyperinsulinemia, dyslipidemia, and insulin resistance. It has been suggested that developmental exposure to excess androgen contributes to the etiology of fertility disorders, including PCOS. To better define the role of the timing system in these disorders, we determined the effects of androgen-dependent developmental programming on clock gene expression in tissues of the metabolic and HPO axes. Female PERIOD2::luciferase (PER2::LUC) mice were exposed to androgen (dihydrotestosterone [DHT]) in utero (Days 16-18 of gestation) or for 9-10 wk (DHT pellet) beginning at weaning (pubertal androgen excess [PAE]). As expected, both groups of androgen-treated mice had disrupted estrous cycles. Analysis of PER2::LUC expression in tissue explants revealed that excess androgen produced circadian misalignment via tissue-dependent effects on phase distribution. In vitro treatment with DHT differentially affected the period of PER2::LUC expression in tissue explants and granulosa cells, indicating that androgen has direct and tissue-specific effects on clock gene expression that may account for the effects of developmental programming on the timing system. © 2015 by the Society for the Study of Reproduction, Inc.

  7. Genome-wide dynamics of alternative polyadenylation in rice

    PubMed Central

    Fu, Haihui; Yang, Dewei; Su, Wenyue; Ma, Liuyin; Shen, Yingjia; Ji, Guoli; Ye, Xinfu; Wu, Xiaohui

    2016-01-01

    Alternative polyadenylation (APA), in which a transcript uses one of the poly(A) sites to define its 3′-end, is a common regulatory mechanism in eukaryotic gene expression. However, the potential of APA in determining crop agronomic traits remains elusive. This study systematically tallied poly(A) sites of 14 different rice tissues and developmental stages using the poly(A) tag sequencing (PAT-seq) approach. The results indicate significant involvement of APA in developmental and quantitative trait loci (QTL) gene expression. About 48% of all expressed genes use APA to generate transcriptomic and proteomic diversity. Some genes switch APA sites, allowing differentially expressed genes to use alternate 3′ UTRs. Interestingly, APA in mature pollen is distinct where differential expression levels of a set of poly(A) factors and different distributions of APA sites are found, indicating a unique mRNA 3′-end formation regulation during gametophyte development. Equally interesting, statistical analyses showed that QTL tends to use APA for regulation of gene expression of many agronomic traits, suggesting a potential important role of APA in rice production. These results provide thus far the most comprehensive and high-resolution resource for advanced analysis of APA in crops and shed light on how APA is associated with trait formation in eukaryotes. PMID:27733415

  8. Selecting and validating reference genes for quantitative real-time PCR in Plutella xylostella (L.).

    PubMed

    You, Yanchun; Xie, Miao; Vasseur, Liette; You, Minsheng

    2018-05-01

    Gene expression analysis provides important clues regarding gene functions, and quantitative real-time PCR (qRT-PCR) is a widely used method in gene expression studies. Reference genes are essential for normalizing and accurately assessing gene expression. In the present study, 16 candidate reference genes (ACTB, CyPA, EF1-α, GAPDH, HSP90, NDPk, RPL13a, RPL18, RPL19, RPL32, RPL4, RPL8, RPS13, RPS4, α-TUB, and β-TUB) from Plutella xylostella were selected to evaluate gene expression stability across different experimental conditions using five statistical algorithms (geNorm, NormFinder, Delta Ct, BestKeeper, and RefFinder). The results suggest that different reference genes or combinations of reference genes are suitable for normalization in gene expression studies of P. xylostella according to the different developmental stages, strains, tissues, and insecticide treatments. Based on the given experimental sets, the most stable reference genes were RPS4 across different developmental stages, RPL8 across different strains and tissues, and EF1-α across different insecticide treatments. A comprehensive and systematic assessment of potential reference genes for gene expression normalization is essential for post-genomic functional research in P. xylostella, a notorious pest with worldwide distribution and a high capacity to adapt and develop resistance to insecticides.

  9. Quantitative developmental transcriptomes of the Mediterranean sea urchin Paracentrotus lividus.

    PubMed

    Gildor, Tsvia; Malik, Assaf; Sher, Noa; Avraham, Linor; Ben-Tabou de-Leon, Smadar

    2016-02-01

    Embryonic development progresses through the timely activation of thousands of differentially activated genes. Quantitative developmental transcriptomes provide the means to relate global patterns of differentially expressed genes to the emerging body plans they generate. The sea urchin is one of the classic model systems for embryogenesis and the models of its developmental gene regulatory networks are of the most comprehensive of their kind. Thus, the sea urchin embryo is an excellent system for studies of its global developmental transcriptional profiles. Here we produced quantitative developmental transcriptomes of the sea urchin Paracentrotus lividus (P. lividus) at seven developmental stages from the fertilized egg to prism stage. We generated de-novo reference transcriptome and identified 29,817 genes that are expressed at this time period. We annotated and quantified gene expression at the different developmental stages and confirmed the reliability of the expression profiles by QPCR measurement of a subset of genes. The progression of embryo development is reflected in the observed global expression patterns and in our principle component analysis. Our study illuminates the rich patterns of gene expression that participate in sea urchin embryogenesis and provide an essential resource for further studies of the dynamic expression of P. lividus genes. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. EphrinA5 protein distribution in the developing mouse brain

    PubMed Central

    2010-01-01

    Background EphrinA5 is one of the best-studied members of the Eph-ephrin family of guidance molecules, known to be involved in brain developmental processes. Using in situ hybridization, ephrinA5 mRNA expression has been detected in the retinotectal, the thalamocortical, and the olfactory systems; however, no study focused on the distribution of the protein. Considering that this membrane-anchored molecule may act far from the neuron soma expressing the transcript, it is of a crucial interest to localize ephrinA5 protein to better understand its function. Results Using immunohistochemistry, we found that ephrinA5 protein is highly expressed in the developing mouse brain from E12.5 to E16.5. The olfactory bulb, the cortex, the striatum, the thalamus, and the colliculi showed high intensity of labelling, suggesting its implication in topographic mapping of olfactory, retinocollicular, thalamocortical, corticothalamic and mesostriatal systems. In the olfactory nerve, we found an early ephrinA5 protein expression at E12.5 suggesting its implication in the guidance of primary olfactory neurons into the olfactory bulb. In the thalamus, we detected a dynamic graduated protein expression, suggesting its role in the corticothalamic patterning, whereas ephrinA5 protein expression in the target region of mesencephalic dopaminergic neurones indicated its involvement in the mesostriatal topographic mapping. Following E16.5, the signal faded gradually and was barely detectable at P0, suggesting a main role for ephrinA5 in primary molecular events in topographic map formation. Conclusion Our work shows that ephrinA5 protein is expressed in restrictive regions of the developing mouse brain. This expression pattern points out the potential sites of action of this molecule in the olfactory, retinotectal, thalamocortical, corticothalamic and mesostriatal systems, during development. This study is essential to better understand the role of ephrinA5 during developmental topographic mapping of connections and to further characterise the mechanisms involved in pathway restoration following cell transplantation in the damaged brain. PMID:20738842

  11. Comparative analysis of Six 3 and Six 6 distribution in the developing and adult mouse brain.

    PubMed

    Conte, Ivan; Morcillo, Julian; Bovolenta, Paola

    2005-11-01

    Six 3 and Six 6 genes are two closely related members of the Six/sine oculis family of homeobox containing transcription factors. Their expression and function at early stages of embryonic development has been widely addressed in a variety of species. However, their mRNA distribution during late embryonic, postnatal, and adult brain barely has been analyzed. Here, we show that despite their initial overlap in the anterior neural plate, the expression of Six 3 and Six 6 progressively segregates to different regions during mammalian brain development, maintaining only few areas of partial overlap in the thalamic and hypothalamic regions. Six 3, but not Six 6, is additionally expressed in the olfactory bulb, cerebral cortex, hippocampus, midbrain, and cerebellum. These distinct patterns support the idea that Six 3 and Six 6 are differentially required during forebrain development. Developmental Dynamics 234:718-725, 2005. (c) 2005 Wiley-Liss, Inc.

  12. Developmental decoupling of alternative phenotypes: insights from the transcriptomes of horn-polyphenic beetles

    PubMed Central

    Snell-Rood, Emilie C.; Cash, Amy; Han, Mira V.; Kijimoto, Teiya; Andrews, Justen; Moczek, Armin P.

    2010-01-01

    Developmental mechanisms play an important role in determining the costs, limits, and evolutionary consequences of phenotypic plasticity. One issue central to these claims is the hypothesis of developmental decoupling, where alternate morphs result from evolutionarily independent developmental pathways. We address this assumption through a microarray study that tests whether differences in gene expression between alternate morphs are as divergent as those between sexes, a classic example of developmental decoupling. We then examine whether genes with morph-biased expression are less conserved than genes with shared expression between morphs, as predicted if developmental decoupling relaxes pleiotropic constraints on divergence. We focus on the developing horns and brains of two species of horned beetles with spectacular sexual- and morph-dimorphism in the expression of horns and fighting behavior. We find that patterns of gene expression were as divergent between morphs as they were between sexes. However, overall patterns of gene expression were also highly correlated across morphs and sexes. Morph-biased genes were more evolutionarily divergent, suggesting a role of relaxed pleiotropic constraints or relaxed selection. Together these results suggest that alternate morphs are to some extent developmentally decoupled, and that this decoupling has significant evolutionary consequences. However, alternative morphs may not be as developmentally decoupled as sometimes assumed and such hypotheses of development should be revisited and refined. PMID:20731717

  13. Oscillatory Protein Expression Dynamics Endows Stem Cells with Robust Differentiation Potential

    PubMed Central

    Kaneko, Kunihiko

    2011-01-01

    The lack of understanding of stem cell differentiation and proliferation is a fundamental problem in developmental biology. Although gene regulatory networks (GRNs) for stem cell differentiation have been partially identified, the nature of differentiation dynamics and their regulation leading to robust development remain unclear. Herein, using a dynamical system modeling cell approach, we performed simulations of the developmental process using all possible GRNs with a few genes, and screened GRNs that could generate cell type diversity through cell-cell interactions. We found that model stem cells that both proliferated and differentiated always exhibited oscillatory expression dynamics, and the differentiation frequency of such stem cells was regulated, resulting in a robust number distribution. Moreover, we uncovered the common regulatory motifs for stem cell differentiation, in which a combination of regulatory motifs that generated oscillatory expression dynamics and stabilized distinct cellular states played an essential role. These findings may explain the recently observed heterogeneity and dynamic equilibrium in cellular states of stem cells, and can be used to predict regulatory networks responsible for differentiation in stem cell systems. PMID:22073296

  14. Proteomic analysis of maize grain development using iTRAQ reveals temporal programs of diverse metabolic processes.

    PubMed

    Yu, Tao; Li, Geng; Dong, Shuting; Liu, Peng; Zhang, Jiwang; Zhao, Bin

    2016-11-04

    Grain development in maize is an essential process in the plant's life cycle and is vital for use of the plant as a crop for animals and humans. However, little is known regarding the protein regulatory networks that control grain development. Here, isobaric tag for relative and absolute quantification (iTRAQ) technology was used to analyze temporal changes in protein expression during maize grain development. Maize grain proteins and changes in protein expression at eight developmental stages from 3 to 50 d after pollination (DAP) were performed using iTRAQ-based proteomics. Overall, 4751 proteins were identified; 2639 of these were quantified and 1235 showed at least 1.5-fold changes in expression levels at different developmental stages and were identified as differentially expressed proteins (DEPs). The DEPs were involved in different cellular and metabolic processes with a preferential distribution to protein synthesis/destination and metabolism categories. A K-means clustering analysis revealed coordinated protein expression associated with different functional categories/subcategories at different development stages. Our results revealed developing maize grain display different proteomic characteristics at distinct stages, such as numerous DEPs for cell growth/division were highly expressed during early stages, whereas those for starch biosynthesis and defense/stress accumulated in middle and late stages, respectively. We also observed coordinated expression of multiple proteins of the antioxidant system, which are essential for the maintenance of reactive oxygen species (ROS) homeostasis during grain development. Particularly, some DEPs, such as zinc metallothionein class II, pyruvate orthophosphate dikinase (PPDK) and 14-3-3 proteins, undergo major changes in expression at specific developmental stages, suggesting their roles in maize grain development. These results provide a valuable resource for analyzing protein function on a global scale and also provide new insights into the potential protein regulatory networks that control grain yield and quality.

  15. Developmental stage related patterns of codon usage and genomic GC content: searching for evolutionary fingerprints with models of stem cell differentiation

    PubMed Central

    2007-01-01

    Background The usage of synonymous codons shows considerable variation among mammalian genes. How and why this usage is non-random are fundamental biological questions and remain controversial. It is also important to explore whether mammalian genes that are selectively expressed at different developmental stages bear different molecular features. Results In two models of mouse stem cell differentiation, we established correlations between codon usage and the patterns of gene expression. We found that the optimal codons exhibited variation (AT- or GC-ending codons) in different cell types within the developmental hierarchy. We also found that genes that were enriched (developmental-pivotal genes) or specifically expressed (developmental-specific genes) at different developmental stages had different patterns of codon usage and local genomic GC (GCg) content. Moreover, at the same developmental stage, developmental-specific genes generally used more GC-ending codons and had higher GCg content compared with developmental-pivotal genes. Further analyses suggest that the model of translational selection might be consistent with the developmental stage-related patterns of codon usage, especially for the AT-ending optimal codons. In addition, our data show that after human-mouse divergence, the influence of selective constraints is still detectable. Conclusion Our findings suggest that developmental stage-related patterns of gene expression are correlated with codon usage (GC3) and GCg content in stem cell hierarchies. Moreover, this paper provides evidence for the influence of natural selection at synonymous sites in the mouse genome and novel clues for linking the molecular features of genes to their patterns of expression during mammalian ontogenesis. PMID:17349061

  16. Purification, developmental expression, and in silico characterization of α-amylase inhibitor from Echinochloa frumentacea.

    PubMed

    Panwar, Priyankar; Verma, A K; Dubey, Ashutosh

    2018-05-01

    Barnyard ( Echinochloa frumentacea ) and finger ( Eleusine coracana ) millet growing at northwestern Himalaya were explored for the α-amylase inhibitor (α-AI). The mature seeds of barnyard millet variety PRJ1 had maximum α-AI activity which increases in different developmental stage. α-AI was purified up to 22.25-fold from barnyard millet variety PRJ1. Semi-quantitative PCR of different developmental stages of barnyard millet seeds showed increased levels of the transcript from 7 to 28 days. Sequence analysis revealed that it contained 315 bp nucleotide which encodes 104 amino acid sequence with molecular weight 10.72 kDa. The predicted 3D structure of α-AI was 86.73% similar to a bifunctional inhibitor of ragi. In silico analysis of 71 α-AI protein sequences were carried out for biochemical features, homology search, multiple sequence alignment, phylogenetic tree construction, motif, and superfamily distribution of protein sequences. Analysis of multiple sequence alignment revealed the existence of conserved regions NPLP[S/G]CRWYVV[S/Q][Q/R]TCG[V/I] throughout sequences. Superfam analysis revealed that α-AI protein sequences were distributed among seven different superfamilies.

  17. Analysis of gene expression in a developmental context emphasizes distinct biological leitmotifs in human cancers

    PubMed Central

    Naxerova, Kamila; Bult, Carol J; Peaston, Anne; Fancher, Karen; Knowles, Barbara B; Kasif, Simon; Kohane, Isaac S

    2008-01-01

    Background In recent years, the molecular underpinnings of the long-observed resemblance between neoplastic and immature tissue have begun to emerge. Genome-wide transcriptional profiling has revealed similar gene expression signatures in several tumor types and early developmental stages of their tissue of origin. However, it remains unclear whether such a relationship is a universal feature of malignancy, whether heterogeneities exist in the developmental component of different tumor types and to which degree the resemblance between cancer and development is a tissue-specific phenomenon. Results We defined a developmental landscape by summarizing the main features of ten developmental time courses and projected gene expression from a variety of human tumor types onto this landscape. This comparison demonstrates a clear imprint of developmental gene expression in a wide range of tumors and with respect to different, even non-cognate developmental backgrounds. Our analysis reveals three classes of cancers with developmentally distinct transcriptional patterns. We characterize the biological processes dominating these classes and validate the class distinction with respect to a new time series of murine embryonic lung development. Finally, we identify a set of genes that are upregulated in most cancers and we show that this signature is active in early development. Conclusion This systematic and quantitative overview of the relationship between the neoplastic and developmental transcriptome spanning dozens of tissues provides a reliable outline of global trends in cancer gene expression, reveals potentially clinically relevant differences in the gene expression of different cancer types and represents a reference framework for interpretation of smaller-scale functional studies. PMID:18611264

  18. A multi-Poisson dynamic mixture model to cluster developmental patterns of gene expression by RNA-seq.

    PubMed

    Ye, Meixia; Wang, Zhong; Wang, Yaqun; Wu, Rongling

    2015-03-01

    Dynamic changes of gene expression reflect an intrinsic mechanism of how an organism responds to developmental and environmental signals. With the increasing availability of expression data across a time-space scale by RNA-seq, the classification of genes as per their biological function using RNA-seq data has become one of the most significant challenges in contemporary biology. Here we develop a clustering mixture model to discover distinct groups of genes expressed during a period of organ development. By integrating the density function of multivariate Poisson distribution, the model accommodates the discrete property of read counts characteristic of RNA-seq data. The temporal dependence of gene expression is modeled by the first-order autoregressive process. The model is implemented with the Expectation-Maximization algorithm and model selection to determine the optimal number of gene clusters and obtain the estimates of Poisson parameters that describe the pattern of time-dependent expression of genes from each cluster. The model has been demonstrated by analyzing a real data from an experiment aimed to link the pattern of gene expression to catkin development in white poplar. The usefulness of the model has been validated through computer simulation. The model provides a valuable tool for clustering RNA-seq data, facilitating our global view of expression dynamics and understanding of gene regulation mechanisms. © The Author 2014. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

  19. CB1 Cannabinoid Receptor Expression in the Striatum: Association with Corticostriatal Circuits and Developmental Regulation

    PubMed Central

    Van Waes, Vincent; Beverley, Joel A.; Siman, Homayoun; Tseng, Kuei Y.; Steiner, Heinz

    2012-01-01

    Corticostriatal circuits mediate various aspects of goal-directed behavior and are critically important for basal ganglia-related disorders. Activity in these circuits is regulated by the endocannabinoid system via stimulation of CB1 cannabinoid receptors. CB1 receptors are highly expressed in projection neurons and select interneurons of the striatum, but expression levels vary considerably between different striatal regions (functional domains). We investigated CB1 receptor expression within specific corticostriatal circuits by mapping CB1 mRNA levels in striatal sectors defined by their cortical inputs in rats. We also assessed changes in CB1 expression in the striatum during development. Our results show that CB1 expression is highest in juveniles (P25) and then progressively decreases toward adolescent (P40) and adult (P70) levels. At every age, CB1 receptors are predominantly expressed in sensorimotor striatal sectors, with considerably lower expression in associative and limbic sectors. Moreover, for most corticostriatal circuits there is an inverse relationship between cortical and striatal expression levels. Thus, striatal sectors with high CB1 expression (sensorimotor sectors) tend to receive inputs from cortical areas with low expression, while striatal sectors with low expression (associative/limbic sectors) receive inputs from cortical regions with higher expression (medial prefrontal cortex). In so far as CB1 mRNA levels reflect receptor function, our findings suggest differential CB1 signaling between different developmental stages and between sensorimotor and associative/limbic circuits. The regional distribution of CB1 receptor expression in the striatum further suggests that, in sensorimotor sectors, CB1 receptors mostly regulate GABA inputs from local axon collaterals of projection neurons, whereas in associative/limbic sectors, CB1 regulation of GABA inputs from interneurons and glutamate inputs may be more important. PMID:22416230

  20. MicroRNA, mRNA, and protein expression link development and aging in human and macaque brain

    PubMed Central

    Somel, Mehmet; Guo, Song; Fu, Ning; Yan, Zheng; Hu, Hai Yang; Xu, Ying; Yuan, Yuan; Ning, Zhibin; Hu, Yuhui; Menzel, Corinna; Hu, Hao; Lachmann, Michael; Zeng, Rong; Chen, Wei; Khaitovich, Philipp

    2010-01-01

    Changes in gene expression levels determine differentiation of tissues involved in development and are associated with functional decline in aging. Although development is tightly regulated, the transition between development and aging, as well as regulation of post-developmental changes, are not well understood. Here, we measured messenger RNA (mRNA), microRNA (miRNA), and protein expression in the prefrontal cortex of humans and rhesus macaques over the species' life spans. We find that few gene expression changes are unique to aging. Instead, the vast majority of miRNA and gene expression changes that occur in aging represent reversals or extensions of developmental patterns. Surprisingly, many gene expression changes previously attributed to aging, such as down-regulation of neural genes, initiate in early childhood. Our results indicate that miRNA and transcription factors regulate not only developmental but also post-developmental expression changes, with a number of regulatory processes continuing throughout the entire life span. Differential evolutionary conservation of the corresponding genomic regions implies that these regulatory processes, although beneficial in development, might be detrimental in aging. These results suggest a direct link between developmental regulation and expression changes taking place in aging. PMID:20647238

  1. Expression and imprinting of MAGEL2 suggest a role in Prader-willi syndrome and the homologous murine imprinting phenotype.

    PubMed

    Lee, S; Kozlov, S; Hernandez, L; Chamberlain, S J; Brannan, C I; Stewart, C L; Wevrick, R

    2000-07-22

    Prader-Willi syndrome (PWS) is caused by the loss of expression of imprinted genes in chromosome 15q11-q13. Affected individuals exhibit neonatal hypotonia, developmental delay and childhood-onset obesity. Necdin, a protein implicated in the terminal differentiation of neurons, is the only PWS candidate gene to reduce viability when disrupted in a mouse model. In this study, we have characterized MAGEL2 (also known as NDNL1), a gene with 51% amino acid sequence similarity to necdin and located 41 kb distal to NDN in the PWS deletion region. MAGEL2 is expressed predominantly in brain, the primary tissue affected in PWS and in several fetal tissues as shown by northern blot analysis. MAGEL2 is imprinted with monoallelic expression in control brain, and paternal-only expression in the central nervous system as demonstrated by its lack of expression in brain from a PWS-affected individual. The orthologous mouse gene (Magel2) is located within 150 kb of NDN:, is imprinted with paternal-only expression and is expressed predominantly in late developmental stages and adult brain as shown by northern blotting, RT-PCR and whole-mount RNA in situ hybridization. Magel2 distribution partially overlaps that of NDN:, with strong expression being detected in the central nervous system in mid-gestation mouse embryos by in situ hybridization. We hypothesize that, although loss of necdin expression may be important in the neonatal presentation of PWS, loss of MAGEL2 may be critical to abnormalities in brain development and dysmorphic features in individuals with PWS.

  2. Spatial fluctuations in expression of the heterocyst differentiation regulatory gene hetR in Anabaena filaments.

    PubMed

    Corrales-Guerrero, Laura; Tal, Asaf; Arbel-Goren, Rinat; Mariscal, Vicente; Flores, Enrique; Herrero, Antonia; Stavans, Joel

    2015-04-01

    Under nitrogen deprivation, filaments of the cyanobacterium Anabaena undergo a process of development, resulting in a one-dimensional pattern of nitrogen-fixing heterocysts separated by about ten photosynthetic vegetative cells. Many aspects of gene expression before nitrogen deprivation and during the developmental process remain to be elucidated. Furthermore, the coupling of gene expression fluctuations between cells along a multicellular filament is unknown. We studied the statistics of fluctuations of gene expression of HetR, a transcription factor essential for heterocyst differentiation, both under steady-state growth in nitrogen-rich conditions and at different times following nitrogen deprivation, using a chromosomally-encoded translational hetR-gfp fusion. Statistical analysis of fluorescence at the individual cell level in wild-type and mutant filaments demonstrates that expression fluctuations of hetR in nearby cells are coupled, with a characteristic spatial range of circa two to three cells, setting the scale for cellular interactions along a filament. Correlations between cells predominantly arise from intercellular molecular transfer and less from cell division. Fluctuations after nitrogen step-down can build up on those under nitrogen-replete conditions. We found that under nitrogen-rich conditions, basal, steady-state expression of the HetR inhibitor PatS, cell-cell communication influenced by the septal protein SepJ and positive HetR auto-regulation are essential determinants of fluctuations in hetR expression and its distribution along filaments. A comparison between the expression of hetR-gfp under nitrogen-rich and nitrogen-poor conditions highlights the differences between the two HetR inhibitors PatS and HetN, as well as the differences in specificity between the septal proteins SepJ and FraC/FraD. Activation, inhibition and cell-cell communication lie at the heart of developmental processes. Our results show that proteins involved in these basic ingredients combine together in the presence of inevitable stochasticity in gene expression, to control the coupled fluctuations of gene expression that give rise to a one-dimensional developmental pattern in this organism.

  3. Caste- and development-associated gene expression in a lower termite

    PubMed Central

    Scharf, Michael E; Wu-Scharf, Dancia; Pittendrigh, Barry R; Bennett, Gary W

    2003-01-01

    Background Social insects such as termites express dramatic polyphenism (the occurrence of multiple forms in a species on the basis of differential gene expression) both in association with caste differentiation and between castes after differentiation. We have used cDNA macroarrays to compare gene expression between polyphenic castes and intermediary developmental stages of the termite Reticulitermes flavipes. Results We identified differentially expressed genes from nine ontogenic categories. Quantitative PCR was used to quantify precise differences in gene expression between castes and between intermediary developmental stages. We found worker and nymph-biased expression of transcripts encoding termite and endosymbiont cellulases; presoldier-biased expression of transcripts encoding the storage/hormone-binding protein vitellogenin; and soldier-biased expression of gene transcripts encoding two transcription/translation factors, two signal transduction factors and four cytoskeletal/muscle proteins. The two transcription/translation factors showed significant homology to the bicaudal and bric-a-brac developmental genes of Drosophila. Conclusions Our results show differential expression of regulatory, structural and enzyme-coding genes in association with termite castes and their developmental precursor stages. They also provide the first glimpse into how insect endosymbiont cellulase gene expression can vary in association with the caste of a host. These findings shed light on molecular processes associated with termite biology, polyphenism, caste differentiation and development and highlight potentially interesting variations in developmental themes between termites, other insects, and higher animals. PMID:14519197

  4. Expression of a Rho guanine nucleotide exchange factor, Ect2, in the developing mouse pituitary.

    PubMed

    Islam, M S; Tsuji, T; Higashida, C; Takahashi, M; Higashida, H; Koizumi, K

    2010-05-01

    The pituitary gland is a highly mitotically active tissue after birth. Various cell types are known to undergo proliferation in the anterior pituitary. However, little is known about the mechanisms regulating mitotic activity in this tissue. When searching for genes specifically expressed in the pituitary gland among those that we previously screened in Drosophila, we found epithelial cell-transforming gene 2 (Ect2). Ect2 is a guanine nucleotide exchange factor for Rho GTPases, which is known to play an essential role in cytokinesis. Although there have been many cellular studies regarding the function of Ect2, the temporal and spatial expression patterns of Ect2 in vivo have not been determined. In the present study, we examined the postnatal developmental expression of Ect2 in the mouse pituitary. Enhanced Ect2 expression was detected in the mouse pituitary gland during the first 3 weeks after birth, which coincided well with the period of rapid pituitary expansion associated with increased growth rate. Immunostaining analysis showed that Ect2-expressing cells were distributed in the anterior and intermediate lobes, but not the posterior lobe, of the pituitary. These Ect2-expressing cells frequently incorporated the thymidine analogue, EdU (5-ethynyl-2'-deoxyuridine), indicating that these cells were mitotically active. Taken together, the results demonstrate the functional role of Ect2 in postnatal proliferating cells in the two lobes of the pituitary, thereby suggesting roles in developmental growth of the mammalian pituitary.

  5. The zebrafish orphan nuclear receptor genes nr2e1 and nr2e3 are expressed in developing eye and forebrain.

    PubMed

    Kitambi, Satish Srinivas; Hauptmann, Giselbert

    2007-02-01

    Mammalian Nr2e1 (Tailless, Mtll or Tlx) and Nr2e3 (photoreceptor-specific nuclear receptor, Pnr) are highly related orphan nuclear receptors, that are expressed in eye and forebrain-derived structures. In this study, we analyzed the developmental expression patterns of zebrafish nr2e1 and nr2e3. RT-PCR analysis showed that nr2e1 and nr2e3 are both expressed during embryonic and post-embryonic development. To examine the spatial distribution of nr2e1 and nr2e3 during development whole-mount in situ hybridization was performed. At tailbud stage, initial nr2e1 expression was localized to the rostral brain rudiment anterior to pax2.1 and eng2 expression at the prospective midbrain-hindbrain boundary. During subsequent stages, nr2e1 became widely expressed in fore- and midbrain primordia, eye and olfactory placodes. At 24hpf, strong nr2e1 expression was detected in telencephalon, hypothalamus, dorsal thalamus, pretectum, midbrain tectum, and retina. At 2dpf, the initially widespread nr2e1 expression became more restricted to distinct regions within the fore- and midbrain and to the retinal ciliary margin, the germinal zone which gives rise to retina and presumptive iris. Expression of nr2e3 was exclusively found in the developing retina and epiphysis. In both structures, nr2e3 expression was found in photoreceptor cells. The developmental expression profile of zebrafish nr2e1 and nr2e3 is consistent with evolutionary conserved functions in eye and rostral brain structures.

  6. Baicalin increases developmental competence of mouse embryos in vitro by inhibiting cellular apoptosis and modulating HSP70 and DNMT expression

    PubMed Central

    QI, Xiaonan; LI, Huatao; CONG, Xia; WANG, Xin; JIANG, Zhongling; CAO, Rongfeng; TIAN, Wenru

    2016-01-01

    Scutellaria baicalensis has been effectively used in Chinese traditional medicine to prevent miscarriages. However, little information is available on its mechanism of action. This study is designed specifically to reveal how baicalin, the main effective ingredient of S. baicalensis, improves developmental competence of embryos in vitro, using the mouse as a model. Mouse pronuclear embryos were cultured in KSOM medium supplemented with (0, 2, 4 and 8 μg/ml) baicalin. The results demonstrated that in vitro culture conditions significantly decreased the blastocyst developmental rate and blastocyst quality, possibly due to increased cellular stress and apoptosis. Baicalin (4 µg/ml) significantly increased 2- and 4-cell cleavage rates, morula developmental rate, and blastocyst developmental rate and cell number of in vitro-cultured mouse embryos. Moreover, baicalin increased the expression of Gja1, Cdh1, Bcl-2, and Dnmt3a genes, decreased the expression of Dnmt1 gene, and decreased cellular stress and apoptosis as it decreased the expression of HSP70, CASP3, and BAX and increased BCL-2 expression in blastocysts cultured in vitro. In conclusion, baicalin improves developmental competence of in vitro-cultured mouse embryos through inhibition of cellular apoptosis and HSP70 expression, and improvement of DNA methylation. PMID:27478062

  7. Differential Expression of Hox and Notch Genes in Larval and Adult Stages of Echinococcus granulosus.

    PubMed

    Dezaki, Ebrahim Saedi; Yaghoobi, Mohammad Mehdi; Taheri, Elham; Almani, Pooya Ghaseminejad; Tohidi, Farideh; Gottstein, Bruno; Harandi, Majid Fasihi

    2016-10-01

    This investigation aimed to evaluate the differential expression of HoxB7 and notch genes in different developmental stages of Echinococcus granulosus sensu stricto. The expression of HoxB7 gene was observed at all developmental stages. Nevertheless, significant fold differences in the expression level was documented in the juvenile worm with 3 or more proglottids, the germinal layer from infected sheep, and the adult worm from an experimentally infected dog. The notch gene was expressed at all developmental stages of E. granulosus ; however, the fold difference was significantly increased at the microcysts in monophasic culture medium and the germinal layer of infected sheep in comparison with other stages. The findings demonstrated that the 2 aforementioned genes evaluated in the present study were differentially expressed at different developmental stages of the parasite and may contribute to some important biological processes of E. granulosus .

  8. Molecular logic behind the three-way stochastic choices that expand butterfly colour vision.

    PubMed

    Perry, Michael; Kinoshita, Michiyo; Saldi, Giuseppe; Huo, Lucy; Arikawa, Kentaro; Desplan, Claude

    2016-07-14

    Butterflies rely extensively on colour vision to adapt to the natural world. Most species express a broad range of colour-sensitive Rhodopsin proteins in three types of ommatidia (unit eyes), which are distributed stochastically across the retina. The retinas of Drosophila melanogaster use just two main types, in which fate is controlled by the binary stochastic decision to express the transcription factor Spineless in R7 photoreceptors. We investigated how butterflies instead generate three stochastically distributed ommatidial types, resulting in a more diverse retinal mosaic that provides the basis for additional colour comparisons and an expanded range of colour vision. We show that the Japanese yellow swallowtail (Papilio xuthus, Papilionidae) and the painted lady (Vanessa cardui, Nymphalidae) butterflies have a second R7-like photoreceptor in each ommatidium. Independent stochastic expression of Spineless in each R7-like cell results in expression of a blue-sensitive (Spineless(ON)) or an ultraviolet (UV)-sensitive (Spineless(OFF)) Rhodopsin. In P. xuthus these choices of blue/blue, blue/UV or UV/UV sensitivity in the two R7 cells are coordinated with expression of additional Rhodopsin proteins in the remaining photoreceptors, and together define the three types of ommatidia. Knocking out spineless using CRISPR/Cas9 (refs 5, 6) leads to the loss of the blue-sensitive fate in R7-like cells and transforms retinas into homogeneous fields of UV/UV-type ommatidia, with corresponding changes in other coordinated features of ommatidial type. Hence, the three possible outcomes of Spineless expression define the three ommatidial types in butterflies. This developmental strategy allowed the deployment of an additional red-sensitive Rhodopsin in P. xuthus, allowing for the evolution of expanded colour vision with a greater variety of receptors. This surprisingly simple mechanism that makes use of two binary stochastic decisions coupled with local coordination may prove to be a general means of generating an increased diversity of developmental outcomes.

  9. Developmental ecology of annual killifish Millerichthys robustus (Cyprinodontiformes: Cynolebiidae).

    PubMed

    Domínguez-Castanedo, Omar; Valdesalici, Stefano; Rosales-Torres, Ana María

    2017-11-01

    Populations of annual killifishes persist in temporary water bodies over the dry season through the expression of diapause in their drought-resistant embryos. Environmental cues may influence expression of the diapause phenotype during embryonic incubation. Millerichthys robustus is the only annual killifish distributed in North America. The aim of this review is to analyze the ecology of M. robustus development and contrast this with that of annual killifishes in austral locations. The temporary water bodies inhabited by M. robustus present the following environmental conditions: flood, drought, and humidity. During the flooding period, the environment presents the lowest temperatures, shortest photoperiod, and highest precipitation, and embryos were found in diapause I. The drought period features the highest temperatures and lowest precipitation, and embryos were found in diapause II. In contrast, during the humid period at the beginning of the rainy season, embryos were found in diapause I, II, and III, associated with the longer photoperiod and high temperatures. These dynamics of the diapause phenotypes can be explained by a combination of the strategies of phenotypic plasticity during flood and drought periods, and bet-hedging during the humid period. Moreover, the microenvironmental conditions in which embryos were buried could influence developmental trajectories. Developmental Dynamics 246:802-806, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  10. Transcriptomic Analysis of Differentially Expressed Genes During Larval Development of Rapana venosa by Digital Gene Expression Profiling.

    PubMed

    Song, Hao; Yu, Zheng-Lin; Sun, Li-Na; Xue, Dong-Xiu; Zhang, Tao; Wang, Hai-Yan

    2016-07-07

    During the life cycle of shellfish, larval development, especially metamorphosis, has a vital influence on the dynamics, distribution, and recruitment of natural populations, as well as seed breeding. Rapana venosa, a carnivorous gastropod, is an important commercial shellfish in China, and is an ecological invader in the United States, Argentina, and France. However, information about the mechanism of its early development is still limited, because research in this area has long suffered from a lack of genomic resources. In this study, 15 digital gene expression (DGE) libraries from five developmental stages of R. venosa were constructed and sequenced on the IIIumina Hi-Sequation 2500 platform. Bioinformaticsanalysis identified numerous differentially and specifically expressed genes, which revealed that genes associated with growth, nervous system, digestive system, immune system, and apoptosis participate in important developmental processes. The functional analysis of differentially expressed genes was further implemented by gene ontology, and Kyoto encyclopedia of genes and genomes enrichment. DGE profiling provided a general picture of the transcriptomic activities during the early development of R. venosa, which may provide interesting hints for further study. Our data represent the first comparative transcriptomic information available for the early development of R. venosa, which is a prerequisite for a better understanding of the physiological traits controlling development. Copyright © 2016 Song et al.

  11. Aberrant expression and distribution of enzymes of the urea cycle and other ammonia metabolizing pathways in dogs with congenital portosystemic shunts.

    PubMed

    van Straten, Giora; van Steenbeek, Frank G; Grinwis, Guy C M; Favier, Robert P; Kummeling, Anne; van Gils, Ingrid H; Fieten, Hille; Groot Koerkamp, Marian J A; Holstege, Frank C P; Rothuizen, Jan; Spee, Bart

    2014-01-01

    The detoxification of ammonia occurs mainly through conversion of ammonia to urea in the liver via the urea cycle and glutamine synthesis. Congenital portosystemic shunts (CPSS) in dogs cause hyperammonemia eventually leading to hepatic encephalopathy. In this study, the gene expression of urea cycle enzymes (carbamoylphosphate synthetase (CPS1), ornithine carbamoyltransferase (OTC), argininosuccinate synthetase (ASS1), argininosuccinate lyase (ASL), and arginase (ARG1)), N-acetylglutamate synthase (NAGS), Glutamate dehydrogenase (GLUD1), and glutamate-ammonia ligase (GLUL) was evaluated in dogs with CPSS before and after surgical closure of the shunt. Additionally, immunohistochemistry was performed on urea cycle enzymes and GLUL on liver samples of healthy dogs and dogs with CPSS to investigate a possible zonal distribution of these enzymes within the liver lobule and to investigate possible differences in distribution in dogs with CPSS compared to healthy dogs. Furthermore, the effect of increasing ammonia concentrations on the expression of the urea cycle enzymes was investigated in primary hepatocytes in vitro. Gene-expression of CPS1, OTC, ASL, GLUD1 and NAGS was down regulated in dogs with CPSS and did not normalize after surgical closure of the shunt. In all dogs GLUL distribution was localized pericentrally. CPS1, OTC and ASS1 were localized periportally in healthy dogs, whereas in CPSS dogs, these enzymes lacked a clear zonal distribution. In primary hepatocytes higher ammonia concentrations induced mRNA levels of CPS1. We hypothesize that the reduction in expression of urea cycle enzymes, NAGS and GLUD1 as well as the alterations in zonal distribution in dogs with CPSS may be caused by a developmental arrest of these enzymes during the embryonic or early postnatal phase.

  12. Aberrant Expression and Distribution of Enzymes of the Urea Cycle and Other Ammonia Metabolizing Pathways in Dogs with Congenital Portosystemic Shunts

    PubMed Central

    van Straten, Giora; van Steenbeek, Frank G.; Grinwis, Guy C. M.; Favier, Robert P.; Kummeling, Anne; van Gils, Ingrid H.; Fieten, Hille; Groot Koerkamp, Marian J. A.; Holstege, Frank C. P.; Rothuizen, Jan; Spee, Bart

    2014-01-01

    The detoxification of ammonia occurs mainly through conversion of ammonia to urea in the liver via the urea cycle and glutamine synthesis. Congenital portosystemic shunts (CPSS) in dogs cause hyperammonemia eventually leading to hepatic encephalopathy. In this study, the gene expression of urea cycle enzymes (carbamoylphosphate synthetase (CPS1), ornithine carbamoyltransferase (OTC), argininosuccinate synthetase (ASS1), argininosuccinate lyase (ASL), and arginase (ARG1)), N-acetylglutamate synthase (NAGS), Glutamate dehydrogenase (GLUD1), and glutamate-ammonia ligase (GLUL) was evaluated in dogs with CPSS before and after surgical closure of the shunt. Additionally, immunohistochemistry was performed on urea cycle enzymes and GLUL on liver samples of healthy dogs and dogs with CPSS to investigate a possible zonal distribution of these enzymes within the liver lobule and to investigate possible differences in distribution in dogs with CPSS compared to healthy dogs. Furthermore, the effect of increasing ammonia concentrations on the expression of the urea cycle enzymes was investigated in primary hepatocytes in vitro. Gene-expression of CPS1, OTC, ASL, GLUD1 and NAGS was down regulated in dogs with CPSS and did not normalize after surgical closure of the shunt. In all dogs GLUL distribution was localized pericentrally. CPS1, OTC and ASS1 were localized periportally in healthy dogs, whereas in CPSS dogs, these enzymes lacked a clear zonal distribution. In primary hepatocytes higher ammonia concentrations induced mRNA levels of CPS1. We hypothesize that the reduction in expression of urea cycle enzymes, NAGS and GLUD1 as well as the alterations in zonal distribution in dogs with CPSS may be caused by a developmental arrest of these enzymes during the embryonic or early postnatal phase. PMID:24945279

  13. Vesicular glutamate transporters VGLUT1 and VGLUT2 in the developing mouse barrel cortex.

    PubMed

    Liguz-Lecznar, M; Skangiel-Kramska, J

    2007-04-01

    Three vesicular glutamate transporters have been identified in mammals. Two of them, VGLUT1 and VGLUT2, define the glutamatergic phenotype and their distribution in the brain is almost complementary. In the present study we examined the distribution and expression levels of these two VGLUTs during postnatal development of the mouse barrel cortex. We also investigated changes in the localization of VGLUT1 and VGLUT2 within particular compartments of the barrel field (barrels/septa) during its development. We found differences in the time course of developmental expression, with VGLUT1 peaking around P14, while VGLUT2 increased gradually until adulthood. Over the examined period (P3 - adult) both transporters had stronger expression in the barrel interiors, and in this compartment VGLUT2 dominated, whereas in the inter-barrel septa VGLUT1 dominated over VGLUT2. Furthermore, we found that some nerve terminals in the barrel cortex coexpressed both transporters until adulthood. Colocalization was observed within the barrels, but not within the septa.

  14. Thermotolerance and Heat-Shock Protein Gene Expression Patterns in Bemisia tabaci (Hemiptera: Aleyrodidae) Mediterranean in Relation to Developmental Stage.

    PubMed

    Jiang, Rui; Qi, Lan-Da; Du, Yu-Zhou; Li, Yuan-Xi

    2017-10-01

    Temperature plays an important role in the growth, development, and geographic distribution of insects. There is convincing evidence that heat-shock proteins (HSPs) play important roles in helping organisms adapt to thermal stress. To better understand the physiological and ecological influence of thermal stress on the different development stages of Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) Mediterranean species (MED), nymphs and adults were shocked with temperatures of 35, 38, and 41℃ for 1 and 2 h, respectively, and the survival rate, fecundity, and developmental duration were investigated in the laboratory. The expression levels of the hsp40, hsp70, and hsp90 genes were assessed using real-time PCR. The results indicate that the survival rates of the nymphs and adults decreased with increased temperature. A 2-h heat shock at 41℃ induced a significant reduction in fecundity in adults and an increase in developmental duration in young nymphs. Hsp90 showed higher temperature responses to thermal stress than hsp40 or hsp70. The expression levels of the hsps in the adults were significantly down-regulated by a 2-h heat shock at 41℃ compared with that by a 1-h treatment. A significant decrease in the expression levels of the hsps also occurred in the adults when the temperature increased from 38 to 41℃ for the 2-h treatment, whereas no significant decrease occurred in the nymphs. Compared with previous studies, we provide some evidence indicating that MED has the potential to adapt to a wider temperature range than the Middle East-Asia Minor 1 species. © The Author 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  15. Mas-allatotropin in the developing antennal lobe of the sphinx moth Manduca sexta: distribution, time course, developmental regulation, and colocalization with other neuropeptides.

    PubMed

    Utz, Sandra; Huetteroth, Wolf; Vömel, Matthias; Schachtner, Joachim

    2008-01-01

    The paired antennal lobes (ALs) of the sphinx moth Manduca sexta serve as a well-established model for studying development of the primary integration centers for odor information in the brain. To further reveal the role of neuropeptides during AL development, we have analyzed cellular distribution, developmental time course, and regulation of the neuropeptide M. sexta allatotropin (Mas-AT). On the basis of morphology and appearance during AL formation, seven major types of Mas-AT-immunoreactive (ir) cells could be distinguished. Mas-AT-ir cells are identified as local, projection, and centrifugal neurons, which are either persisting larval or newly added adult-specific neurons. Complementary immunostaining with antisera against two other neuropeptide families (A-type allatostatins, RFamides) revealed colocalization within three of the Mas-AT-ir cell types. On the basis of this neurochemistry, the most prominent type of Mas-AT-ir neurons, the local AT neurons (LATn), could be divided in three subpopulations. The appearance of the Mas-AT-ir cell types occurring during metamorphosis parallels the rising titer of the developmental hormone 20-hydroxyecdysone (20E). Artificially shifting the 20E titer to an earlier developmental time point resulted in the precocious occurrence of Mas-AT immunostaining. This result supports the hypothesis that the pupal rise of 20E is causative for Mas-AT expression during AL development. Comparing localization and developmental time course of Mas-AT and other neuropeptides with the time course of AL formation suggests various functions for these neuropeptides during development, including an involvement in the formation of the olfactory glomeruli.

  16. Interactions of sex and early life social experiences at two developmental stages shape nonapeptide receptor profiles.

    PubMed

    Hiura, Lisa C; Ophir, Alexander G

    2018-05-31

    Early life social experiences are critical to behavioral and cognitive development, and can have a tremendous influence on developing social phenotypes. Most work has focused on outcomes of experiences at a single stage of development (e.g., perinatal, or post-weaning). Few studies have assessed the impact of social experience at multiple developmental stages and across sex. Oxytocin and vasopressin are profoundly important for modulating social behavior and these nonapeptide systems are highly sensitive to developmental social experience, particularly in brain areas important for social behavior. We investigated whether oxytocin receptor (OTR) and vasopressin receptor (V1aR) distributions of prairie voles (Microtus ochrogaster) change as a function of parental composition within the natal nest or social composition after weaning. We raised pups either in the presence or absence of their fathers. At weaning, offspring were housed either individually or with a same-sex sibling. We also examined whether changes in receptor distributions are sexually dimorphic because the impact of the developmental environment on the nonapeptide system could be sex-dependent. We found that differences in nonapeptide receptor expression were region-, sex-, and rearing condition-specific, indicating a high level of complexity in the ways that early life experiences shape the social brain. We found many more differences in V1aR density compared to OTR density, indicating that nonapeptide receptors demonstrate differential levels of neural plasticity and sensitivity to environmental and biological variables. Our data highlight that critical factors including biological sex and multiple experiences across the developmental continuum interact in complex ways to shape the social brain. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  17. Chronic unpredictable stress decreases expression of brain-derived neurotrophic factor (BDNF) in mouse ovaries: relationship to oocytes developmental potential.

    PubMed

    Wu, Li-Min; Hu, Mei-Hong; Tong, Xian-Hong; Han, Hui; Shen, Ni; Jin, Ren-Tao; Wang, Wei; Zhou, Gui-Xiang; He, Guo-Ping; Liu, Yu-Sheng

    2012-01-01

    Brain-derived neurotropic factor (BDNF) was originally described in the nervous system but has been shown to be expressed in ovary tissues recently, acting as a paracrine/autocrine regulator required for developments of follicles and oocytes. Although it is generally accepted that chronic stress impairs female reproduction and decreases the expression of BDNF in limbic structures of central nervous system, which contributes to mood disorder. However, it is not known whether chronic stress affects oocytes developments, nor whether it affects expression of BDNF in ovary. Mice were randomly assigned into control group, stressed group, BDNF-treated group and BDNF-treated stressed group. The chronic unpredictable mild stress model was used to produce psychosocial stress in mice, and the model was verified by open field test and hypothalamic-pituitary-adrenal (HPA) axis activity. The methods of immunohistochemistry and western blotting were used to detect BDNF protein level and distribution. The number of retrieved oocytes, oocyte maturation, embryo cleavage and the rates of blastocyst formation after parthenogenetic activation were evaluated. Chronic unpredictable stress decreased the BDNF expression in antral follicles, but didn't affect the BDNF expression in primordial, primary and secondary follicles. Chronic unpredictable stress also decreased the number of retrieved oocytes and the rate of blastocyst formation, which was rescued by exogenous BDNF treatment. BDNF in mouse ovaries may be related to the decreased number of retrieved oocytes and impaired oocytes developmental potential induced by chronic unpredictable stress.

  18. Chronic Unpredictable Stress Decreases Expression of Brain-Derived Neurotrophic Factor (BDNF) in Mouse Ovaries: Relationship to Oocytes Developmental Potential

    PubMed Central

    Tong, Xian-Hong; Han, Hui; Shen, Ni; Jin, Ren-Tao; Wang, Wei; Zhou, Gui-Xiang; He, Guo-Ping; Liu, Yu-Sheng

    2012-01-01

    Background Brain-derived neurotropic factor (BDNF) was originally described in the nervous system but has been shown to be expressed in ovary tissues recently, acting as a paracrine/autocrine regulator required for developments of follicles and oocytes. Although it is generally accepted that chronic stress impairs female reproduction and decreases the expression of BDNF in limbic structures of central nervous system, which contributes to mood disorder. However, it is not known whether chronic stress affects oocytes developments, nor whether it affects expression of BDNF in ovary. Methods Mice were randomly assigned into control group, stressed group, BDNF-treated group and BDNF-treated stressed group. The chronic unpredictable mild stress model was used to produce psychosocial stress in mice, and the model was verified by open field test and hypothalamic-pituitary-adrenal (HPA) axis activity. The methods of immunohistochemistry and western blotting were used to detect BDNF protein level and distribution. The number of retrieved oocytes, oocyte maturation, embryo cleavage and the rates of blastocyst formation after parthenogenetic activation were evaluated. Results Chronic unpredictable stress decreased the BDNF expression in antral follicles, but didn’t affect the BDNF expression in primordial, primary and secondary follicles. Chronic unpredictable stress also decreased the number of retrieved oocytes and the rate of blastocyst formation, which was rescued by exogenous BDNF treatment. Conclusion BDNF in mouse ovaries may be related to the decreased number of retrieved oocytes and impaired oocytes developmental potential induced by chronic unpredictable stress. PMID:23284991

  19. Gene expression profiles in the cerebellum and hippocampus following exposure to a neurotoxicant, Aroclor 1254: Developmental effects

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Royland, Joyce E.; Wu, Jinfang; Zawia, Nasser H.

    2008-09-01

    The developmental consequences of exposure to the polychlorinated biphenyls (PCBs) have been widely studied, making PCBs a unique model to understand issues related to environmental mixture of persistent chemicals. PCB exposure in humans adversely affects neurocognitive development, causes psychomotor difficulties, and contributes to attention deficits in children, all of which seem to be associated with altered patterns of neuronal connectivity. In the present study, we examined gene expression profiles in the rat nervous system following PCB developmental exposure. Pregnant rats (Long-Evans) were dosed perinatally with 0 or 6 mg/kg/day of Aroclor 1254 from gestation day 6 through postnatal day (PND)more » 21. Gene expression in cerebellum and hippocampus from PND7 and PND14 animals was analyzed with an emphasis on developmental aspects. Changes in gene expression ({>=} 1.5 fold) in control animals identified normal developmental changes. These basal levels of expression were compared to data from Aroclor 1254-treated animals to determine the impact of gestational PCB exposure on developmental parameters. The results indicate that the expression of a number of developmental genes related to cell cycle, synaptic function, cell maintenance, and neurogenesis is significantly altered from PND7 to PND14. Aroclor 1254 treatment appears to dampen the overall growth-related gene expression levels in both regions with the effect being more pronounced in the cerebellum. Functional analysis suggests that Aroclor 1254 delays maturation of the developing nervous system, with the consequences dependent on the ontological state of the brain area and the functional role of the individual gene. Such changes may underlie learning and memory deficits observed in PCB exposed animals and humans.« less

  20. Brief Report: Representational Momentum for Dynamic Facial Expressions in Pervasive Developmental Disorder

    ERIC Educational Resources Information Center

    Uono, Shota; Sato, Wataru; Toichi, Motomi

    2010-01-01

    Individuals with pervasive developmental disorder (PDD) have difficulty with social communication via emotional facial expressions, but behavioral studies involving static images have reported inconsistent findings about emotion recognition. We investigated whether dynamic presentation of facial expression would enhance subjective perception of…

  1. Nestin is essential for zebrafish brain and eye development through control of progenitor cell apoptosis.

    PubMed

    Chen, Hua-Ling; Yuh, Chiou-Hwa; Wu, Kenneth K

    2010-02-19

    Nestin is expressed in neural progenitor cells (NPC) of developing brain. Despite its wide use as an NPC marker, the function of nestin in embryo development is unclear. As nestin is conserved in zebrafish and its predicted sequence is clustered with the mammalian nestin orthologue, we used zebrafish as a model to investigate its role in embryogenesis. Injection of nestin morpholino (MO) into fertilized eggs induced time- and dose-dependent brain and eye developmental defects. Nestin morphants exhibited characteristic morphological changes including small head, small eyes and hydrocephalus. Histological examinations show reduced hind- and mid-brain size, dilated ventricle, poorly organized retina and underdeveloped lens. Injection of control nestin MO did not induce brain or eye changes. Nestin MO injection reduced expression of ascl1b (achaete-scute complex-like 1b), a marker of NPCs, without affecting its distribution. Nestin MO did not influence Elavl3/4 (Embryonic lethal, abnormal vision, Drosophila-like 3/4) (a neuronal marker), or otx2 (a midbrain neuronal marker), but severely perturbed cranial motor nerve development and axon distribution. To determine whether the developmental defects are due to excessive NPC apoptosis and/or reduced NPC proliferation, we analyzed apoptosis by TUNEL assay and acridine orange staining and proliferation by BrdU incorporation, pcna and mcm5 expressions. Excessive apoptosis was noted in hindbrain and midbrain cells. Apoptotic signals were colocalized with ascl1b. Proliferation markers were not significantly altered by nestin MO. These results suggest that nestin is essential for zebrafish brain and eye development probably through control of progenitor cell apoptosis.

  2. Informatic selection of a neural crest-melanocyte cDNA set for microarray analysis

    PubMed Central

    Loftus, S. K.; Chen, Y.; Gooden, G.; Ryan, J. F.; Birznieks, G.; Hilliard, M.; Baxevanis, A. D.; Bittner, M.; Meltzer, P.; Trent, J.; Pavan, W.

    1999-01-01

    With cDNA microarrays, it is now possible to compare the expression of many genes simultaneously. To maximize the likelihood of finding genes whose expression is altered under the experimental conditions, it would be advantageous to be able to select clones for tissue-appropriate cDNA sets. We have taken advantage of the extensive sequence information in the dbEST expressed sequence tag (EST) database to identify a neural crest-derived melanocyte cDNA set for microarray analysis. Analysis of characterized genes with dbEST identified one library that contained ESTs representing 21 neural crest-expressed genes (library 198). The distribution of the ESTs corresponding to these genes was biased toward being derived from library 198. This is in contrast to the EST distribution profile for a set of control genes, characterized to be more ubiquitously expressed in multiple tissues (P < 1 × 10−9). From library 198, a subset of 852 clustered ESTs were selected that have a library distribution profile similar to that of the 21 neural crest-expressed genes. Microarray analysis demonstrated the majority of the neural crest-selected 852 ESTs (Mel1 array) were differentially expressed in melanoma cell lines compared with a non-neural crest kidney epithelial cell line (P < 1 × 10−8). This was not observed with an array of 1,238 ESTs that was selected without library origin bias (P = 0.204). This study presents an approach for selecting tissue-appropriate cDNAs that can be used to examine the expression profiles of developmental processes and diseases. PMID:10430933

  3. Identification and Characterization of Genes Required for Early Myxococcus xanthus Developmental Gene Expression

    PubMed Central

    Guo, Dongchuan; Wu, Yun; Kaplan, Heidi B.

    2000-01-01

    Starvation and cell density regulate the developmental expression of Myxococcus xanthus gene 4521. Three classes of mutants allow expression of this developmental gene during growth on nutrient agar, such that colonies of strains containing a Tn5 lac Ω4521 fusion are Lac+. One class of these mutants inactivates SasN, a negative regulator of 4521 expression; another class activates SasS, a sensor kinase-positive regulator of 4521 expression; and a third class blocks lipopolysaccharide (LPS) O-antigen biosynthesis. To identify additional positive regulators of 4521 expression, 11 Lac− TnV.AS transposon insertion mutants were isolated from a screen of 18,000 Lac+ LPS O-antigen mutants containing Tn5 lac Ω4521 (Tcr). Ten mutations identified genes that could encode positive regulators of 4521 developmental expression based on their ability to abolish 4521 expression during development in the absence of LPS O antigen and in an otherwise wild-type background. Eight of these mutations mapped to the sasB locus, which encodes the known 4521 regulators SasS and SasN. One mapped to sasS, whereas seven identified new genes. Three mutations mapped to a gene encoding an NtrC-like response regulator homologue, designated sasR, and four others mapped to a gene designated sasP. One mutation, designated ssp10, specifically suppressed the LPS O-antigen defect; the ssp10 mutation had no effect on 4521 expression in an otherwise wild-type background but reduced 4521 developmental expression in the absence of LPS O antigen to a level close to that of the parent strain. All of the mutations except those in sasP conferred defects during growth and development. These data indicate that a number of elements are required for 4521 developmental expression and that most of these are necessary for normal growth and fruiting body development. PMID:10913090

  4. Essential basal cytonemes take up Hedgehog in the Drosophila wing imaginal disc.

    PubMed

    Chen, Weitao; Huang, Hai; Hatori, Ryo; Kornberg, Thomas B

    2017-09-01

    Morphogen concentration gradients that extend across developmental fields form by dispersion from source cells. In the Drosophila wing disc, Hedgehog (Hh) produced by posterior compartment cells distributes in a concentration gradient to adjacent cells of the anterior compartment. We monitored Hh:GFP after pulsed expression, and analyzed the movement and colocalization of Hh, Patched (Ptc) and Smoothened (Smo) proteins tagged with GFP or mCherry and expressed at physiological levels from bacterial artificial chromosome transgenes. Hh:GFP moved to basal subcellular locations prior to release from posterior compartment cells that express it, and was taken up by basal cytonemes that extend to the source cells. Hh and Ptc were present in puncta that moved along the basal cytonemes and formed characteristic apical-basal distributions in the anterior compartment cells. The basal cytonemes required diaphanous , SCAR , N euroglian and S ynaptobrevin , and both the Hh gradient and Hh signaling declined under conditions in which the cytonemes were compromised. These findings show that in the wing disc, Hh distributions and signaling are dependent upon basal release and uptake, and on cytoneme-mediated movement. No evidence for apical dispersion was obtained. © 2017. Published by The Company of Biologists Ltd.

  5. The subcellular distribution of aquaporin 5 in the cochlea reveals a water shunt at the perilymph-endolymph barrier.

    PubMed

    Hirt, B; Penkova, Z H; Eckhard, A; Liu, W; Rask-Andersen, H; Müller, M; Löwenheim, H

    2010-07-28

    Aquaporins are membrane water channel proteins that have also been identified in the cochlea. Auditory function critically depends on the homeostasis of the cochlear fluids perilymph and endolymph. In particular, the ion and water regulation of the endolymph is essential for sensory transduction. Within the cochlear duct the lateral wall epithelium has been proposed to secrete endolymph by an aquaporin-mediated flow of water across its epithelial tight junction barrier. This study identifies interspecies differences in the cellular distribution of aquaporin 5 (AQP5) in the cochlear lateral wall of mice, rats, gerbils and guinea pigs. In addition the cellular expression pattern of AQP5 is described in the human cochlea. Developmental changes in rats demonstrate longitudinal and radial gradients along the cochlear duct. During early postnatal development a pancochlear expression is detected. However a regression to the apical quadrant and limitation to outer sulcus cells (OSCs) is observed in the adult. This developmental loss of AQP5 expression in the basal cochlear segments coincides with a morphological loss of contact between OSCs and the endolymph. At the subcellular level, AQP5 exhibits polarized expression in the apical plasma membrane of the OSCs. Complementary, the basolateral membrane in the root processes of the OSCs exhibits AQP4 expression. This differential localization of AQP5 and AQP4 in the apical and basolateral membranes of the same epithelial cell type suggests a direct aquaporin-mediated transcellular water shunt between the perilymph and endolymph in the OSCs of the cochlear lateral wall. In the human cochlea these findings may have pathophysiological implications attributed to a dysfunctional water regulation by AQP5 such as endolymphatic hydrops (i.e. in Meniere's disease) or sensorineural hearing loss (i.e. in Sjögren's syndrome). Copyright (c) 2010 IBRO. Published by Elsevier Ltd. All rights reserved.

  6. Transcriptome dynamics through alternative polyadenylation in developmental and environmental responses in plants revealed by deep sequencing

    PubMed Central

    Shen, Yingjia; Venu, R.C.; Nobuta, Kan; Wu, Xiaohui; Notibala, Varun; Demirci, Caghan; Meyers, Blake C.; Wang, Guo-Liang; Ji, Guoli; Li, Qingshun Q.

    2011-01-01

    Polyadenylation sites mark the ends of mRNA transcripts. Alternative polyadenylation (APA) may alter sequence elements and/or the coding capacity of transcripts, a mechanism that has been demonstrated to regulate gene expression and transcriptome diversity. To study the role of APA in transcriptome dynamics, we analyzed a large-scale data set of RNA “tags” that signify poly(A) sites and expression levels of mRNA. These tags were derived from a wide range of tissues and developmental stages that were mutated or exposed to environmental treatments, and generated using digital gene expression (DGE)–based protocols of the massively parallel signature sequencing (MPSS-DGE) and the Illumina sequencing-by-synthesis (SBS-DGE) sequencing platforms. The data offer a global view of APA and how it contributes to transcriptome dynamics. Upon analysis of these data, we found that ∼60% of Arabidopsis genes have multiple poly(A) sites. Likewise, ∼47% and 82% of rice genes use APA, supported by MPSS-DGE and SBS-DGE tags, respectively. In both species, ∼49%–66% of APA events were mapped upstream of annotated stop codons. Interestingly, 10% of the transcriptomes are made up of APA transcripts that are differentially distributed among developmental stages and in tissues responding to environmental stresses, providing an additional level of transcriptome dynamics. Examples of pollen-specific APA switching and salicylic acid treatment-specific APA clearly demonstrated such dynamics. The significance of these APAs is more evident in the 3034 genes that have conserved APA events between rice and Arabidopsis. PMID:21813626

  7. Evolution of developmental regulation in the vertebrate FgfD subfamily.

    PubMed

    Jovelin, Richard; Yan, Yi-Lin; He, Xinjun; Catchen, Julian; Amores, Angel; Canestro, Cristian; Yokoi, Hayato; Postlethwait, John H

    2010-01-15

    Fibroblast growth factors (Fgfs) encode small signaling proteins that help regulate embryo patterning. Fgfs fall into seven families, including FgfD. Nonvertebrate chordates have a single FgfD gene; mammals have three (Fgf8, Fgf17, and Fgf18); and teleosts have six (fgf8a, fgf8b, fgf17, fgf18a, fgf18b, and fgf24). What are the evolutionary processes that led to the structural duplication and functional diversification of FgfD genes during vertebrate phylogeny? To study this question, we investigated conserved syntenies, patterns of gene expression, and the distribution of conserved noncoding elements (CNEs) in FgfD genes of stickleback and zebrafish, and compared them with data from cephalochordates, urochordates, and mammals. Genomic analysis suggests that Fgf8, Fgf17, Fgf18, and Fgf24 arose in two rounds of whole genome duplication at the base of the vertebrate radiation; that fgf8 and fgf18 duplications occurred at the base of the teleost radiation; and that Fgf24 is an ohnolog that was lost in the mammalian lineage. Expression analysis suggests that ancestral subfunctions partitioned between gene duplicates and points to the evolution of novel expression domains. Analysis of CNEs, at least some of which are candidate regulatory elements, suggests that ancestral CNEs partitioned between gene duplicates. These results help explain the evolutionary pathways by which the developmentally important family of FgfD molecules arose and the deduced principles that guided FgfD evolution are likely applicable to the evolution of developmental regulation in many vertebrate multigene families. (c) 2009 Wiley-Liss, Inc.

  8. Developmental Changes in the Relationship Between the Infant's Attention and Emotion During Early Face-to-Face Communication: The 2-Month Transition

    ERIC Educational Resources Information Center

    Lavelli, Manuela; Fogel, Alan

    2005-01-01

    Weekly observations documented developmental changes in mother-infant face-to-face communication between birth and 3 months. Developmental trajectories for each dyad of the duration of infant facial expressions showed a change from the dominance of Simple Attention (without other emotion expressions) to active and emotionally positive forms of…

  9. FOXO Regulates Organ-Specific Phenotypic Plasticity In Drosophila

    PubMed Central

    Tang, Hui Yuan; Smith-Caldas, Martha S. B.; Driscoll, Michael V.; Salhadar, Samy; Shingleton, Alexander W.

    2011-01-01

    Phenotypic plasticity, the ability for a single genotype to generate different phenotypes in response to environmental conditions, is biologically ubiquitous, and yet almost nothing is known of the developmental mechanisms that regulate the extent of a plastic response. In particular, it is unclear why some traits or individuals are highly sensitive to an environmental variable while other traits or individuals are less so. Here we elucidate the developmental mechanisms that regulate the expression of a particularly important form of phenotypic plasticity: the effect of developmental nutrition on organ size. In all animals, developmental nutrition is signaled to growing organs via the insulin-signaling pathway. Drosophila organs differ in their size response to developmental nutrition and this reflects differences in organ-specific insulin-sensitivity. We show that this variation in insulin-sensitivity is regulated at the level of the forkhead transcription factor FOXO, a negative growth regulator that is activated when nutrition and insulin signaling are low. Individual organs appear to attenuate growth suppression in response to low nutrition through an organ-specific reduction in FOXO expression, thereby reducing their nutritional plasticity. We show that FOXO expression is necessary to maintain organ-specific differences in nutritional-plasticity and insulin-sensitivity, while organ-autonomous changes in FOXO expression are sufficient to autonomously alter an organ's nutritional-plasticity and insulin-sensitivity. These data identify a gene (FOXO) that modulates a plastic response through variation in its expression. FOXO is recognized as a key player in the response of size, immunity, and longevity to changes in developmental nutrition, stress, and oxygen levels. FOXO may therefore act as a more general regulator of plasticity. These data indicate that the extent of phenotypic plasticity may be modified by changes in the expression of genes involved in signaling environmental information to developmental processes. PMID:22102829

  10. Homologous recombination and non-homologous end-joining repair pathways in bovine embryos with different developmental competence

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Henrique Barreta, Marcos; Laboratorio de Biotecnologia e Reproducao Animal-BioRep, Universidade Federal de Santa Maria, Santa Maria, RS; Garziera Gasperin, Bernardo

    2012-10-01

    This study investigated the expression of genes controlling homologous recombination (HR), and non-homologous end-joining (NHEJ) DNA-repair pathways in bovine embryos of different developmental potential. It also evaluated whether bovine embryos can respond to DNA double-strand breaks (DSBs) induced with ultraviolet irradiation by regulating expression of genes involved in HR and NHEJ repair pathways. Embryos with high, intermediate or low developmental competence were selected based on the cleavage time after in vitro insemination and were removed from in vitro culture before (36 h), during (72 h) and after (96 h) the expected period of embryonic genome activation. All studied genes weremore » expressed before, during and after the genome activation period regardless the developmental competence of the embryos. Higher mRNA expression of 53BP1 and RAD52 was found before genome activation in embryos with low developmental competence. Expression of 53BP1, RAD51 and KU70 was downregulated at 72 h and upregulated at 168 h post-insemination in response to DSBs induced by ultraviolet irradiation. In conclusion, important genes controlling HR and NHEJ DNA-repair pathways are expressed in bovine embryos, however genes participating in these pathways are only regulated after the period of embryo genome activation in response to ultraviolet-induced DSBs.« less

  11. The gene expression database for mouse development (GXD): putting developmental expression information at your fingertips.

    PubMed

    Smith, Constance M; Finger, Jacqueline H; Kadin, James A; Richardson, Joel E; Ringwald, Martin

    2014-10-01

    Because molecular mechanisms of development are extraordinarily complex, the understanding of these processes requires the integration of pertinent research data. Using the Gene Expression Database for Mouse Development (GXD) as an example, we illustrate the progress made toward this goal, and discuss relevant issues that apply to developmental databases and developmental research in general. Since its first release in 1998, GXD has served the scientific community by integrating multiple types of expression data from publications and electronic submissions and by making these data freely and widely available. Focusing on endogenous gene expression in wild-type and mutant mice and covering data from RNA in situ hybridization, in situ reporter (knock-in), immunohistochemistry, reverse transcriptase-polymerase chain reaction, Northern blot, and Western blot experiments, the database has grown tremendously over the years in terms of data content and search utilities. Currently, GXD includes over 1.4 million annotated expression results and over 260,000 images. All these data and images are readily accessible to many types of database searches. Here we describe the data and search tools of GXD; explain how to use the database most effectively; discuss how we acquire, curate, and integrate developmental expression information; and describe how the research community can help in this process. Copyright © 2014 The Authors Developmental Dynamics published by Wiley Periodicals, Inc. on behalf of American Association of Anatomists.

  12. Characterization and potential role of microRNA in the Chinese dominant malaria mosquito Anopheles sinensis (Diptera: Culicidae) throughout four different life stages.

    PubMed

    Feng, Xinyu; Wu, Jiatong; Zhou, Shuisen; Wang, Jingwen; Hu, Wei

    2018-01-01

    microRNAs (miRNAs) are one kind of small non-coding RNAs widely distributed in insects. Many studies have shown that miRNAs play critical roles in development, differentiation, apoptosis, and innate immunity. However, there are a few reports describing miRNAs in Anopheles sinensis , the most common, and one of the dominant malaria mosquito in China. Here, we investigated the global miRNA expression profile across four different developmental stages including embryo, larval, pupal, and adult stages using Illumina Hiseq 2500 sequencing. In total, 164 miRNAs were obtained out of 107.46 million raw sequencing reads. 99 of them identified as known miRNAs, and the remaining 65 miRNAs were considered as novel. By analyzing the read counts of miRNAs in all developmental stages, 95 miRNAs showed stage-specific expression (q < 0.01 and |log2 (fold change)| > 1) in consecutive stages, indicating that these miRNAs may be involved in critical physiological activity during development. Sixteen miRNAs were identified to be commonly dysregulated throughout four developmental stages. Many miRNAs showed stage-specific expression, such as asi-miR-2943 was exclusively expressed in the embryo stage, and asi-miR-1891 could not be detected in larval stage. The expression of six selected differentially expressed miRNAs identified by qRT-PCR were consistent with our sequencing results. Furthermore, 5296 and 1902 target genes were identified for the dysregulated 68 known and 27 novel miRNAs respectively by combining miRanda and RNAhybrid prediction. GO annotation and KEGG pathway analysis for the predicted genes of dysregulated miRNAs revealed that they might be involved in a broad range of biological processes related with the development, such as membrane, organic substance transport and several key pathways including protein processing in endoplasmic reticulum, propanoate metabolism and folate biosynthesis. Thirty-two key miRNAs were identified by microRNA-gene network analysis. The present study represents the first global characterization of An. sinensis miRNAs in its four developmental stages. The presence and differential expression of An. sinensis miRNAs imply that such miRNAs may play critical roles in An. sinensis life cycle. A better understanding of the functions of these miRNAs will have great implication for the effective control of vector population and therefore interrupting malaria transmission.

  13. Development of N-Methyl-D-Aspartate Receptor Subunits in Avian Auditory Brainstem

    PubMed Central

    TANG, YE-ZHONG; CARR, CATHERINE E.

    2012-01-01

    N-methyl-D-aspartate (NMDA) receptor subunit-specific probes were used to characterize developmental changes in the distribution of excitatory amino acid receptors in the chicken’s auditory brainstem nuclei. Although NR1 subunit expression does not change greatly during the development of the cochlear nuclei in the chicken (Tang and Carr [2004] Hear. Res 191:79 – 89), there are significant developmental changes in NR2 subunit expression. We used in situ hybridization against NR1, NR2A, NR2B, NR2C, and NR2D to compare NR1 and NR2 expression during development. All five NMDA subunits were expressed in the auditory brainstem before embryonic day (E) 10, when electrical activity and synaptic responses appear in the nucleus magnocellularis (NM) and the nucleus laminaris (NL). At this time, the dominant form of the receptor appeared to contain NR1 and NR2B. NR2A appeared to replace NR2B by E14, a time that coincides with synaptic refinement and evoked auditory responses. NR2C did not change greatly during auditory development, whereas NR2D increased from E10 and remained at fairly high levels into adulthood. Thus changes in NMDA NR2 receptor subunits may contribute to the development of auditory brainstem responses in the chick. PMID:17366608

  14. Correlation between ZBED6 Gene Upstream CpG Island methylation and mRNA expression in cattle.

    PubMed

    Huang, Yong-Zhen; Zhang, Zi-Jing; He, Hua; Cao, Xiu-Kai; Song, Cheng-Chuang; Liu, Kun-Peng; Lan, Xian-Yong; Lei, Chu-Zhao; Qi, Xing-Lei; Bai, Yue-Yu; Chen, Hong

    2017-04-03

    DNA methylation is essential for the regulation of gene expression and important roles in muscle development. To assess the extent of epigenetic modifications and gene expression on the differentially methylated region (DMR) in ZBED6, we simultaneously examined DNA methylation and expression in six tissues from two different developmental stages (fetal bovine and adult bovine). The DNA methylation pattern was compared using bisulfite sequencing polymerase chain reaction (BSP) and combined bisulfite restriction analysis (COBRA). The result of quantitative real-time PCR (qPCR) analysis showed that ZBED6 has a broad tissue distribution and is highly expressed in adult bovine (P < 0.05 or P < 0.01). The DNA methylation level was significantly different in liver, lung and spleen between the two cattle groups (P < 0.05 or P < 0.01). The adult bovine group exhibited a significantly higher mRNA level and lower DNA methylation level than the fetal bovine group in liver, lung, and spleen. No significant association was detected between DNA methylation level and muscle, heart, and kidney at two different stages. In this study, the statistical analyses indicated that DNA methylation patterns are associated with mRNA level in some tissues, these results may be a useful parameter to investigate muscle developmental in cattle and as a model for studies in other species, potentially contributing to an improvement of growth performance selection in beef cattle breeding program.

  15. Predicting neuroblastoma using developmental signals and a logic-based model.

    PubMed

    Kasemeier-Kulesa, Jennifer C; Schnell, Santiago; Woolley, Thomas; Spengler, Jennifer A; Morrison, Jason A; McKinney, Mary C; Pushel, Irina; Wolfe, Lauren A; Kulesa, Paul M

    2018-07-01

    Genomic information from human patient samples of pediatric neuroblastoma cancers and known outcomes have led to specific gene lists put forward as high risk for disease progression. However, the reliance on gene expression correlations rather than mechanistic insight has shown limited potential and suggests a critical need for molecular network models that better predict neuroblastoma progression. In this study, we construct and simulate a molecular network of developmental genes and downstream signals in a 6-gene input logic model that predicts a favorable/unfavorable outcome based on the outcome of the four cell states including cell differentiation, proliferation, apoptosis, and angiogenesis. We simulate the mis-expression of the tyrosine receptor kinases, trkA and trkB, two prognostic indicators of neuroblastoma, and find differences in the number and probability distribution of steady state outcomes. We validate the mechanistic model assumptions using RNAseq of the SHSY5Y human neuroblastoma cell line to define the input states and confirm the predicted outcome with antibody staining. Lastly, we apply input gene signatures from 77 published human patient samples and show that our model makes more accurate disease outcome predictions for early stage disease than any current neuroblastoma gene list. These findings highlight the predictive strength of a logic-based model based on developmental genes and offer a better understanding of the molecular network interactions during neuroblastoma disease progression. Copyright © 2018. Published by Elsevier B.V.

  16. Expression and Cellular Distribution of Ubiquitin in Response to Injury in the Developing Spinal Cord of Monodelphis domestica

    PubMed Central

    Noor, Natassya M.; Møllgård, Kjeld; Wheaton, Benjamin J.; Steer, David L.; Truettner, Jessie S.; Dziegielewska, Katarzyna M.; Dietrich, W. Dalton; Smith, A. Ian; Saunders, Norman R.

    2013-01-01

    Ubiquitin, an 8.5 kDa protein associated with the proteasome degradation pathway has been recently identified as differentially expressed in segment of cord caudal to site of injury in developing spinal cord. Here we describe ubiquitin expression and cellular distribution in spinal cord up to postnatal day P35 in control opossums (Monodelphis domestica) and in response to complete spinal transection (T10) at P7, when axonal growth through site of injury occurs, and P28 when this is no longer possible. Cords were collected 1 or 7 days after injury, with age-matched controls and segments rostral to lesion were studied. Following spinal injury ubiquitin levels (western blotting) appeared reduced compared to controls especially one day after injury at P28. In contrast, after injury mRNA expression (qRT-PCR) was slightly increased at P7 but decreased at P28. Changes in isoelectric point of separated ubiquitin indicated possible post-translational modifications. Cellular distribution demonstrated a developmental shift between earliest (P8) and latest (P35) ages examined, from a predominantly cytoplasmic immunoreactivity to a nuclear expression; staining level and shift to nuclear staining was more pronounced following injury, except 7 days after transection at P28. After injury at P7 immunostaining increased in neurons and additionally in oligodendrocytes at P28. Mass spectrometry showed two ubiquitin bands; the heavier was identified as a fusion product, likely to be an ubiquitin precursor. Apparent changes in ubiquitin expression and cellular distribution in development and response to spinal injury suggest an intricate regulatory system that modulates these responses which, when better understood, may lead to potential therapeutic targets. PMID:23626776

  17. Developmental Differences in the Expression of Childhood Anxiety Symptoms and Fears.

    ERIC Educational Resources Information Center

    Weems, Carl F.; Costa, Natalie M.

    2005-01-01

    Objective: To examine age differences in the expression of childhood fears and anxiety symptoms. Method: A cross-sectional design was used to test recently formulated developmental hypotheses regarding the differential expression of childhood anxiety symptoms and fears in a community sample of youths (N = 145). Three groups of youths were…

  18. Impaired Integration of Emotional Faces and Affective Body Context in a Rare Case of Developmental Visual Agnosia

    PubMed Central

    Aviezer, Hillel; Hassin, Ran. R.; Bentin, Shlomo

    2011-01-01

    In the current study we examined the recognition of facial expressions embedded in emotionally expressive bodies in case LG, an individual with a rare form of developmental visual agnosia who suffers from severe prosopagnosia. Neuropsychological testing demonstrated that LG‘s agnosia is characterized by profoundly impaired visual integration. Unlike individuals with typical developmental prosopagnosia who display specific difficulties with face identity (but typically not expression) recognition, LG was also impaired at recognizing isolated facial expressions. By contrast, he successfully recognized the expressions portrayed by faceless emotional bodies handling affective paraphernalia. When presented with contextualized faces in emotional bodies his ability to detect the emotion expressed by a face did not improve even if it was embedded in an emotionally-congruent body context. Furthermore, in contrast to controls, LG displayed an abnormal pattern of contextual influence from emotionally-incongruent bodies. The results are interpreted in the context of a general integration deficit in developmental visual agnosia, suggesting that impaired integration may extend from the level of the face to the level of the full person. PMID:21482423

  19. Gene expression during blow fly development: improving the precision of age estimates in forensic entomology.

    PubMed

    Tarone, Aaron M; Foran, David R

    2011-01-01

    Forensic entomologists use size and developmental stage to estimate blow fly age, and from those, a postmortem interval. Since such estimates are generally accurate but often lack precision, particularly in the older developmental stages, alternative aging methods would be advantageous. Presented here is a means of incorporating developmentally regulated gene expression levels into traditional stage and size data, with a goal of more precisely estimating developmental age of immature Lucilia sericata. Generalized additive models of development showed improved statistical support compared to models that did not include gene expression data, resulting in an increase in estimate precision, especially for postfeeding third instars and pupae. The models were then used to make blind estimates of development for 86 immature L. sericata raised on rat carcasses. Overall, inclusion of gene expression data resulted in increased precision in aging blow flies. © 2010 American Academy of Forensic Sciences.

  20. [Effect of human oviductal embryotrophic factors on gene expression of mouse preimplantation embryos].

    PubMed

    Yao, Yuan-Qing; Lee, Kai-Fai; Xu, Jia-Seng; Ho, Pak-Chung; Yeung, Shu-Biu

    2007-09-01

    To investigate the effect of embryotrophic factors (ETF) from human oviductal cells on gene expression of mouse early developmental embryos and discuss the role of fallopian tube in early development of embryos. ETF was isolated from conditioned medium of human oviductal cell line by sequential liquid chromatographic systems. Mouse embryos were treated by ETF in vitro. Using differential display RT-PCR, the gene expression of embryos treated by ETF was compared with embryos without ETF treatment. The differentially expressed genes were separated, re-amplified, cloned and sequenced. Gene expression profiles of embryos with ETF treatment was different from embryos without this treatment. Eight differentially expressed genes were cloned and sequenced. These genes functioned in RNA degradation, synthesis, splicing, protein trafficking, cellular differentiation and embryo development. Embryotrophic factors from human oviductal cells affect gene expression of early developmental embryos. The human oviductal cells play wide roles in early developmental stages of embryos.

  1. Rapid video-referenced ratings of reciprocal social behavior in toddlers: A twin study

    PubMed Central

    Marrus, Natasha; Glowinski, Anne L.; Jacob, Theodore; Klin, Ami; Jones, Warren; Drain, Caroline E.; Holzhauer, Kieran E.; Hariprasad, Vaishnavi; Fitzgerald, Rob T.; Mortenson, Erika L.; Sant, Sayli M.; Cole, Lyndsey; Siegel, Satchel A.; Zhang, Yi; Agrawal, Arpana; Heath, Andrew; Constantino, John N.

    2015-01-01

    Background Reciprocal social behavior (RSB) is a developmental prerequisite for social competency, and deficits in RSB constitute a core feature of autism spectrum disorder (ASD). Although clinical screeners categorically ascertain risk of ASD in early childhood, rapid methods for quantitative measurement of RSB in toddlers are not yet established. Such measurements are critical for tracking developmental trajectories and incremental responses to intervention. Methods We developed and validated a 20-minute video-referenced rating scale, the video-referenced rating of reciprocal social behavior (vrRSB), for untrained caregivers to provide standardized ratings of quantitative variation in RSB. Parents of 252 toddler twins [Monozygotic (MZ)=31 pairs, Dizygotic (DZ)=95 pairs] ascertained through birth records, rated their twins’ RSB at two time points, on average 6 months apart, and completed two developmental measures, the Modified Checklist for Autism in Toddlers (M-CHAT) and the MacArthur Communicative Development Inventory Short Form (MCDI-s). Results Scores on the vrRSB were fully continuously distributed, with excellent 6-month test-retest reliability ([intraclass correlation coefficient] ICC=0.704, p<0.000). MZ twins displayed markedly greater trait concordance than DZ twins, (MZ ICC=0.863, p<0.000, DZ ICC=0.231, p<0.012). VrRSB score distributions were highly distinct for children passing versus failing the M-CHAT (t=−8.588, df=31, p<.000), incrementally improved from 18-24 months, and were inversely correlated with receptive and expressive vocabulary on the MCDI-s. Conclusions Like quantitative autistic trait ratings in school-aged children and adults, toddler scores on the vrRSB are continuously distributed and appear highly heritable. These ratings exhibited minimal measurement error, high inter-individual stability, and developmental progression in RSB as children matured from 18-24 months, supporting their potential utility for serially quantifying the severity of early autistic syndromes over time and in response to intervention. In addition, these findings inform the genetic-environmental structure of RSB in early typical development. PMID:25677414

  2. Tissue distribution and developmental expression of type XVI collagen in the mouse.

    PubMed

    Lai, C H; Chu, M L

    1996-04-01

    The expression of a recently identified collagen, alpha 1 (XVI), in adult mouse tissue and developing mouse embryo was examined by immunohistochemistry and in situ hybridization. A polyclonal antiserum was raised against a recombinant fusion protein, which contained a segment of 161 amino acids in the N-terminal noncollagenous domain of the human alpha 1 (XVI) collagen. Immunoprecipitation of metabolically labelled human or mouse fibroblast cell lysates with this antibody revealed a major, bacterial collagenase sensitive polypeptide of approximately 210 kDa. The size agrees with the prediction from the full-length cDNA. Immunofluorescence examination of adult mouse tissues using the affinity purified antibody revealed a rather broad distribution of the protein. The heart, kidney, intestine, ovary, testis, eye, arterial walls and smooth muscles all exhibited significant levels of expression, while the skeletal muscle, lung and brain showed very restricted and low signals. During development, no significant expression of the mRNA or protein was observed in embryo of day 8 of gestation, but strong signals was detected in placental trophoblasts. Expression in embryos was detectable first after day 11 of gestation with weak positive signals appearing in the heart. In later stages of development, stronger RNA hybridizations were observed in a variety of tissues, particularly in atrial and ventricular walls of the developing heart, spinal root neural fibers and skin. These data demonstrate that type XVI collagen represents another collagenous component widely distributed in the extracellular matrix and may contribute to the structural integrity of various tissues.

  3. Resveratrol Improves the Mitochondrial Function and Fertilization Outcome of Bovine Oocytes

    PubMed Central

    TAKEO, Shun; SATO, Daichi; KIMURA, Koji; MONJI, Yasunori; KUWAYAMA, Takehito; KAWAHARA-MIKI, Ryoka; IWATA, Hisataka

    2013-01-01

    The aim of the present study was to address the effect of resveratrol-mediated upregulation of sirtuin 1 (SIRT1) during oocyte maturation on mitochondrial function, the developmental ability of oocytes and on mechanisms responsible for blockage of polyspermic fertilization. Oocytes collected from slaughterhouse-derived ovaries were cultured in TCM-199 medium supplemented with 10% FCS and 0 or 20 µM resveratrol (Res). We examined the effect of Res on SIRT1 expression in in vitro-matured oocytes (Exp 1); fertilization and developmental ability (Exp 2); mitochondrial DNA copy number (Mt number), ATP content and mitochondrial membrane potential in matured oocytes (Exp 3); and the time required for proteinase to dissolve the zona pellucida following in vitro fertilization (as a marker of zona pellucida hardening), as well as on the distribution of cortical granules before and after fertilization (Exp 4). In Exp 1, the 20 µM Res treatment upregulated protein expression of SIRT1 in oocytes. In Exp 2, Res treatment improved the ratio of normal fertilization and the total cell number of blastocysts. In Exp 3, Res treatment significantly increased the ATP content in matured oocytes. Additionally, Res increased the overall Mt number and mitochondrial membrane potential, but the effect was donor-dependent. In Exp 4, Res-induced zona hardening improved the distribution and exocytosis of cortical granules after in vitro fertilization. In conclusion, Res improved the quality of oocytes by improving mitochondrial quantity and quality. In addition, Res added to the maturation medium enhanced SIRT1 protein expression in oocytes and improved fertilization via reinforcement of the mechanisms responsible for blockage of polyspermic fertilization. PMID:24390595

  4. Postnatal development of GABAergic interneurons in the neocortical subplate of mice.

    PubMed

    Qu, G-J; Ma, J; Yu, Y-C; Fu, Y

    2016-05-13

    The subplate (SP) plays important roles in developmental and functional events in the neocortex, such as thalamocortical and corticofugal projection, cortical oscillation generation and corticocortical connectivity. Although accumulated evidence indicates that SP interneurons are crucial for SP function, the molecular composition of SP interneurons as well as their developmental profile and distribution remain largely unclear. In this study, we systematically investigated dynamic development of SP thickness and chemical marker expression in SP interneurons in distinct cortical regions during the first postnatal month. We found that, although the relative area of the SP in the cerebral cortex significantly declined with postnatal development, the absolute thickness did not change markedly. We also found that somatostatin (SOM), the ionotropic serotonin receptor 3A (5HT3AR), and parvalbumin (PV) reliably identify three distinct non-overlapping subpopulations of SP interneurons. The SOM group, which represents ~30% of total SP interneurons, expresses neuronal nitric oxide synthase (nNOS) and calbindin (CB) and colocalizes entirely with neuropeptide Y (NPY). The 5HT3AR group, which accounts for ~60% of the total interneuronal population, expresses calretinin (CR) and GABA-A receptor subunit delta (GABAARδ). The PV group accounts for ~10% of total SP interneurons and coexpressed GABAARδ. Moreover, distinct interneuron subtypes show characteristic temporal and spatial distribution in the SP. nNOS(+) interneurons in the SP increase from the anterior motor cortex to posterior visual cortex, while CR(+) and CB(+) interneurons the opposite. Interestedly, the majority of GABAARδ(+) neurons in SP are non-GABAergic neurons in contrast to other cortical layers. These findings clarify and extend our understanding of SP interneurons in the developing cerebral cortex and will underpin further study of SP function. Copyright © 2016 IBRO. Published by Elsevier Ltd. All rights reserved.

  5. Spatially Restricted and Developmentally Dynamic Expression of Engrailed Genes in Multiple Cerebellar Cell Types

    PubMed Central

    Wilson, Sandra L.; Kalinovsky, Anna; Orvis, Grant D.

    2011-01-01

    The cerebellum is a highly organized structure partitioned into lobules along the anterior–posterior (A-P) axis and into striped molecular domains along the medial–lateral (M-L) axis. The Engrailed (En) homeobox genes are required for patterning the morphological and molecular domains along both axes, as well as for the establishment of the normal afferent topography required to generate a fully functional cerebellum. As a means to understand how the En genes regulate multiple levels of cerebellum construction, we characterized En1 and En2 expression around birth and at postnatal day (P)21 during the period when the cerebellum undergoes a remarkable transformation from a smooth ovoid structure to a highly foliated structure. We show that both En1 and En2 are expressed in many neuronal cell types in the cerebellum, and expression persists until at least P21. En1 and En2 expression, however, undergoes profound changes in their cellular and spatial distributions between embryonic stages and P21, and their expression domains become largely distinct. Comparison of the distribution of En-expressing Purkinje cells relative to early- and late-onset Purkinje cell M-L stripe proteins revealed that although En1- and En2-expressing Purkinje cell domains do not strictly align with those of ZEBRINII at P21, a clear pattern exists that is most evident at E17.5 by an inverse correlation between the level of En2 expression and PLCβ4 and EPHA4. PMID:21431469

  6. Developmental heterogeneity of cardiac fibroblasts does not predict pathological proliferation and activation.

    PubMed

    Ali, Shah R; Ranjbarvaziri, Sara; Talkhabi, Mahmood; Zhao, Peng; Subat, Ali; Hojjat, Armin; Kamran, Paniz; Müller, Antonia M S; Volz, Katharina S; Tang, Zhaoyi; Red-Horse, Kristy; Ardehali, Reza

    2014-09-12

    Fibrosis is mediated partly by extracellular matrix-depositing fibroblasts in the heart. Although these mesenchymal cells are reported to have multiple embryonic origins, the functional consequence of this heterogeneity is unknown. We sought to validate a panel of surface markers to prospectively identify cardiac fibroblasts. We elucidated the developmental origins of cardiac fibroblasts and characterized their corresponding phenotypes. We also determined proliferation rates of each developmental subset of fibroblasts after pressure overload injury. We showed that Thy1(+)CD45(-)CD31(-)CD11b(-)Ter119(-) cells constitute the majority of cardiac fibroblasts. We characterized these cells using flow cytometry, epifluorescence and confocal microscopy, and transcriptional profiling (using reverse transcription polymerase chain reaction and RNA-seq). We used lineage tracing, transplantation studies, and parabiosis to show that most adult cardiac fibroblasts derive from the epicardium, a minority arises from endothelial cells, and a small fraction from Pax3-expressing cells. We did not detect generation of cardiac fibroblasts by bone marrow or circulating cells. Interestingly, proliferation rates of fibroblast subsets on injury were identical, and the relative abundance of each lineage remained the same after injury. The anatomic distribution of fibroblast lineages also remained unchanged after pressure overload. Furthermore, RNA-seq analysis demonstrated that Tie2-derived and Tbx18-derived fibroblasts within each operation group exhibit similar gene expression profiles. The cellular expansion of cardiac fibroblasts after transaortic constriction surgery was not restricted to any single developmental subset. The parallel proliferation and activation of a heterogeneous population of fibroblasts on pressure overload could suggest that common signaling mechanisms stimulate their pathological response. © 2014 American Heart Association, Inc.

  7. Have studies of the developmental regulation of behavioral phenotypes revealed the mechanisms of gene-environment interactions?

    PubMed Central

    Hall, F. Scott; Perona, Maria T. G.

    2012-01-01

    This review addresses the recent convergence of our long-standing knowledge of the regulation of behavioral phenotypes by developmental experience with recent advances in our understanding of mechanisms regulating gene expression. This review supports a particular perspective on the developmental regulation of behavioral phenotypes: That the role of common developmental experiences (e.g. maternal interactions, peer interactions, exposure to a complex environment, etc.) is to fit individuals to the circumstances of their lives within bounds determined by long-standing (evolutionary) mechanisms that have shaped responses to critical and fundamental types of experience via those aspects of gene structure that regulate gene expression. The phenotype of a given species is not absolute for a given genotype but rather variable within bounds that are determined by mechanisms regulated by experience (e.g. epigenetic mechanisms). This phenotypic variation is not necessarily random, or evenly distributed along a continuum of description or measurement, but often highly disjointed, producing distinct, even opposing, phenotypes. The potentiality for these varying phenotypes is itself the product of evolution, the potential for alternative phenotypes itself conveying evolutionary advantage. Examples of such phenotypic variation, resulting from environmental or experiential influences, have a long history of study in neurobiology, and a number of these will be discussed in this review: neurodevelopmental experiences that produce phenotypic variation in visual perception, cognitive function, and emotional behavior. Although other examples will be discussed, particular emphasis will be made on the role of social behavior on neurodevelopment and phenotypic determination. It will be argued that an important purpose of some aspects of social behavior is regulation of neurobehavioral phenotypes by experience via genetic regulatory mechanisms. PMID:22643448

  8. Developmental Transcriptomic Features of the Carcinogenic Liver Fluke, Clonorchis sinensis

    PubMed Central

    Cho, Pyo Yun; Kim, Tae Im; Cho, Shin-Hyeong; Choi, Sang-Haeng; Park, Hong-Seog; Kim, Tong-Soo; Hong, Sung-Jong

    2011-01-01

    Clonorchis sinensis is the causative agent of the life-threatening disease endemic to China, Korea, and Vietnam. It is estimated that about 15 million people are infected with this fluke. C. sinensis provokes inflammation, epithelial hyperplasia, and periductal fibrosis in bile ducts, and may cause cholangiocarcinoma in chronically infected individuals. Accumulation of a large amount of biological information about the adult stage of this liver fluke in recent years has advanced our understanding of the pathological interplay between this parasite and its hosts. However, no developmental gene expression profiles of C. sinensis have been published. In this study, we generated gene expression profiles of three developmental stages of C. sinensis by analyzing expressed sequence tags (ESTs). Complementary DNA libraries were constructed from the adult, metacercaria, and egg developmental stages of C. sinensis. A total of 52,745 ESTs were generated and assembled into 12,830 C. sinensis assembled EST sequences, and then these assemblies were further categorized into groups according to biological functions and developmental stages. Most of the genes that were differentially expressed in the different stages were consistent with the biological and physical features of the particular developmental stage; high energy metabolism, motility and reproduction genes were differentially expressed in adults, minimal metabolism and final host adaptation genes were differentially expressed in metacercariae, and embryonic genes were differentially expressed in eggs. The higher expression of glucose transporters, proteases, and antioxidant enzymes in the adults accounts for active uptake of nutrients and defense against host immune attacks. The types of ion channels present in C. sinensis are consistent with its parasitic nature and phylogenetic placement in the tree of life. We anticipate that the transcriptomic information on essential regulators of development, bile chemotaxis, and physico-metabolic pathways in C. sinensis that presented in this study will guide further studies to identify novel drug targets and diagnostic antigens. PMID:21738807

  9. Effect of timing of development on total cell number and expression profile of HSP-70.1 and GLUT-1 in buffalo (Bubalus bubalis) oocytes and preimplantation embryos produced in vitro.

    PubMed

    Rajhans, Rajib; Kumar, G Sai; Dubey, Pawan K; Sharma, G Taru

    2010-03-29

    The present study was designed to compare the expression profile of two developmentally important genes (HSP-70.1 and GLUT-1) and TCN (total cell number) count in fast (group A) and slow (group B) cleaved buffalo embryos to access their in vitro developmental competence. Buffalo COCs (cumulus oocyte complexes) were collected from local abattoir ovaries and subjected to in vitro maturation in: TCM-199 supplemented with 10% FBS (fetal bovine serum), BSA (3 mg/ml), sodium pyruvate (0.25 mM) and 20 ng/ml EGF (epidermal growth factor) at 38.5 degrees C under 5% CO2. In vitro derived embryos were collected at 4-8, 8-16 cell, morula and blastocyst stages at specific time points for gene expression analysis and total cell count. A semiquantitative RT-PCR (reverse transcriptase-PCR) assay was used to determine the HSP-70.1 and GLUT-1 transcripts. Results showed that developmental competence and TCN count in fast (group A)-cleaving embryos was significantly (P<0.05) higher than in the slow group (group B). The gene transcript of HSP-70.1 and GLUT-1 was expressed in oocytes (immature and mature) and throughout the embryonic developmental stages in the fast group (group A), while in the slow (group B) cleaving embryos, the expression of HSP-70.1 was absent in all the embryonic developmental stages, and expression of GLUT-1 was absent after 8-16 cell stage. In conclusion, TCN count and expression profile of HSP-70.1 and GLUT-1 genes in buffalo embryos are different taking into account the cleavage rate. Quality of such embryos for research purposes, TCN and expression profiling of developmentally important genes should be employed to optimize the in vitro culture system to produce superior quality of embryos.

  10. Genome-wide transcriptome study in wheat identified candidate genes related to processing quality, majority of them showing interaction (quality x development) and having temporal and spatial distributions.

    PubMed

    Singh, Anuradha; Mantri, Shrikant; Sharma, Monica; Chaudhury, Ashok; Tuli, Rakesh; Roy, Joy

    2014-01-16

    The cultivated bread wheat (Triticum aestivum L.) possesses unique flour quality, which can be processed into many end-use food products such as bread, pasta, chapatti (unleavened flat bread), biscuit, etc. The present wheat varieties require improvement in processing quality to meet the increasing demand of better quality food products. However, processing quality is very complex and controlled by many genes, which have not been completely explored. To identify the candidate genes whose expressions changed due to variation in processing quality and interaction (quality x development), genome-wide transcriptome studies were performed in two sets of diverse Indian wheat varieties differing for chapatti quality. It is also important to understand the temporal and spatial distributions of their expressions for designing tissue and growth specific functional genomics experiments. Gene-specific two-way ANOVA analysis of expression of about 55 K transcripts in two diverse sets of Indian wheat varieties for chapatti quality at three seed developmental stages identified 236 differentially expressed probe sets (10-fold). Out of 236, 110 probe sets were identified for chapatti quality. Many processing quality related key genes such as glutenin and gliadins, puroindolines, grain softness protein, alpha and beta amylases, proteases, were identified, and many other candidate genes related to cellular and molecular functions were also identified. The ANOVA analysis revealed that the expression of 56 of 110 probe sets was involved in interaction (quality x development). Majority of the probe sets showed differential expression at early stage of seed development i.e. temporal expression. Meta-analysis revealed that the majority of the genes expressed in one or a few growth stages indicating spatial distribution of their expressions. The differential expressions of a few candidate genes such as pre-alpha/beta-gliadin and gamma gliadin were validated by RT-PCR. Therefore, this study identified several quality related key genes including many other genes, their interactions (quality x development) and temporal and spatial distributions. The candidate genes identified for processing quality and information on temporal and spatial distributions of their expressions would be useful for designing wheat improvement programs for processing quality either by changing their expression or development of single nucleotide polymorphisms (SNPs) markers.

  11. Genome-wide transcriptome study in wheat identified candidate genes related to processing quality, majority of them showing interaction (quality x development) and having temporal and spatial distributions

    PubMed Central

    2014-01-01

    Background The cultivated bread wheat (Triticum aestivum L.) possesses unique flour quality, which can be processed into many end-use food products such as bread, pasta, chapatti (unleavened flat bread), biscuit, etc. The present wheat varieties require improvement in processing quality to meet the increasing demand of better quality food products. However, processing quality is very complex and controlled by many genes, which have not been completely explored. To identify the candidate genes whose expressions changed due to variation in processing quality and interaction (quality x development), genome-wide transcriptome studies were performed in two sets of diverse Indian wheat varieties differing for chapatti quality. It is also important to understand the temporal and spatial distributions of their expressions for designing tissue and growth specific functional genomics experiments. Results Gene-specific two-way ANOVA analysis of expression of about 55 K transcripts in two diverse sets of Indian wheat varieties for chapatti quality at three seed developmental stages identified 236 differentially expressed probe sets (10-fold). Out of 236, 110 probe sets were identified for chapatti quality. Many processing quality related key genes such as glutenin and gliadins, puroindolines, grain softness protein, alpha and beta amylases, proteases, were identified, and many other candidate genes related to cellular and molecular functions were also identified. The ANOVA analysis revealed that the expression of 56 of 110 probe sets was involved in interaction (quality x development). Majority of the probe sets showed differential expression at early stage of seed development i.e. temporal expression. Meta-analysis revealed that the majority of the genes expressed in one or a few growth stages indicating spatial distribution of their expressions. The differential expressions of a few candidate genes such as pre-alpha/beta-gliadin and gamma gliadin were validated by RT-PCR. Therefore, this study identified several quality related key genes including many other genes, their interactions (quality x development) and temporal and spatial distributions. Conclusions The candidate genes identified for processing quality and information on temporal and spatial distributions of their expressions would be useful for designing wheat improvement programs for processing quality either by changing their expression or development of single nucleotide polymorphisms (SNPs) markers. PMID:24433256

  12. Biomarkers of adult and developmental neurotoxicity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Slikker, William; Bowyer, John F.

    2005-08-07

    Neurotoxicity may be defined as any adverse effect on the structure or function of the central and/or peripheral nervous system by a biological, chemical, or physical agent. A multidisciplinary approach is necessary to assess adult and developmental neurotoxicity due to the complex and diverse functions of the nervous system. The overall strategy for understanding developmental neurotoxicity is based on two assumptions: (1) significant differences in the adult versus the developing nervous system susceptibility to neurotoxicity exist and they are often developmental stage dependent; (2) a multidisciplinary approach using neurobiological, including gene expression assays, neurophysiological, neuropathological, and behavioral function is necessarymore » for a precise assessment of neurotoxicity. Application of genomic approaches to developmental studies must use the same criteria for evaluating microarray studies as those in adults including consideration of reproducibility, statistical analysis, homogenous cell populations, and confirmation with non-array methods. A study using amphetamine to induce neurotoxicity supports the following: (1) gene expression data can help define neurotoxic mechanism(s) (2) gene expression changes can be useful biomarkers of effect, and (3) the site-selective nature of gene expression in the nervous system may mandate assessment of selective cell populations.« less

  13. Dynamic Patterns of Clonal Evolution in Tumor Vasculature Underlie Alterations in Lymphocyte-Endothelial Recognition to Foster Tumor Immune Escape.

    PubMed

    Corey, Daniel M; Rinkevich, Yuval; Weissman, Irving L

    2016-03-15

    Although tumor blood vessels have been a major therapeutic target for cancer chemotherapy, little is known regarding the stepwise development of the tumor microenvironment. Here, we use a multicolor Cre-dependent marker system to trace clonality within the tumor microenvironment to show that tumor blood vessels follow a pattern of dynamic clonal evolution. In an advanced melanoma tumor microenvironment, the vast majority of tumor vasculature clones are derived from a common precursor. Quantitative lineage analysis reveals founder clones diminish in frequency and are replaced by subclones as tumors evolve. These tumor-specific blood vessels are characterized by a developmental switch to a more invasive and immunologically silent phenotype. Gene expression profiling and pathway analysis reveals selection for traits promoting upregulation of alternative angiogenic programs such as unregulated HGF-MET signaling and enhanced autocrine signaling through VEGF and PDGF. Furthermore, we show a developmental switch in the expression of functionally significant primary lymphocyte adhesion molecules on tumor endothelium, such as the loss in expression of the mucosal addressin MAdCAM-1, whose counter receptor a4β7 on lymphocytes controls lymphocyte homing. Changes in adhesive properties on tumor endothelial subclones are accompanied by decreases in expression of lymphocyte chemokines CXCL16, CXCL13, CXCL12, CXCL9, CXCL10, and CCL19. These evolutionary patterns in the expressed genetic program within tumor endothelium will have both a quantitative and functional impact on lymphocyte distribution that may well influence tumor immune function and underlie escape mechanisms from current antiangiogenic pharmacotherapies. ©2015 American Association for Cancer Research.

  14. Dynamic gene and protein expression patterns of the autism-associated met receptor tyrosine kinase in the developing mouse forebrain.

    PubMed

    Judson, Matthew C; Bergman, Mica Y; Campbell, Daniel B; Eagleson, Kathie L; Levitt, Pat

    2009-04-10

    The establishment of appropriate neural circuitry depends on the coordination of multiple developmental events across space and time. These events include proliferation, migration, differentiation, and survival-all of which can be mediated by hepatocyte growth factor (HGF) signaling through the Met receptor tyrosine kinase. We previously found a functional promoter variant of the MET gene to be associated with autism spectrum disorder, suggesting that forebrain circuits governing social and emotional function may be especially vulnerable to developmental disruptions in HGF/Met signaling. However, little is known about the spatiotemporal distribution of Met expression in the forebrain during the development of such circuits. To advance our understanding of the neurodevelopmental influences of Met activation, we employed complementary Western blotting, in situ hybridization, and immunohistochemistry to comprehensively map Met transcript and protein expression throughout perinatal and postnatal development of the mouse forebrain. Our studies reveal complex and dynamic spatiotemporal patterns of expression during this period. Spatially, Met transcript is localized primarily to specific populations of projection neurons within the neocortex and in structures of the limbic system, including the amygdala, hippocampus, and septum. Met protein appears to be principally located in axon tracts. Temporally, peak expression of transcript and protein occurs during the second postnatal week. This period is characterized by extensive neurite outgrowth and synaptogenesis, supporting a role for the receptor in these processes. Collectively, these data suggest that Met signaling may be necessary for the appropriate wiring of forebrain circuits, with particular relevance to the social and emotional dimensions of behavior. (c) 2009 Wiley-Liss, Inc.

  15. Developmental Progression in the Coral Acropora digitifera Is Controlled by Differential Expression of Distinct Regulatory Gene Networks

    PubMed Central

    Reyes-Bermudez, Alejandro; Villar-Briones, Alejandro; Ramirez-Portilla, Catalina; Hidaka, Michio; Mikheyev, Alexander S.

    2016-01-01

    Corals belong to the most basal class of the Phylum Cnidaria, which is considered the sister group of bilaterian animals, and thus have become an emerging model to study the evolution of developmental mechanisms. Although cell renewal, differentiation, and maintenance of pluripotency are cellular events shared by multicellular animals, the cellular basis of these fundamental biological processes are still poorly understood. To understand how changes in gene expression regulate morphogenetic transitions at the base of the eumetazoa, we performed quantitative RNA-seq analysis during Acropora digitifera’s development. We collected embryonic, larval, and adult samples to characterize stage-specific transcription profiles, as well as broad expression patterns. Transcription profiles reconstructed development revealing two main expression clusters. The first cluster grouped blastula and gastrula and the second grouped subsequent developmental time points. Consistently, we observed clear differences in gene expression between early and late developmental transitions, with higher numbers of differentially expressed genes and fold changes around gastrulation. Furthermore, we identified three coexpression clusters that represented discrete gene expression patterns. During early transitions, transcriptional networks seemed to regulate cellular fate and morphogenesis of the larval body. In late transitions, these networks seemed to play important roles preparing planulae for switch in lifestyle and regulation of adult processes. Although developmental progression in A. digitifera is regulated to some extent by differential coexpression of well-defined gene networks, stage-specific transcription profiles appear to be independent entities. While negative regulation of transcription is predominant in early development, cell differentiation was upregulated in larval and adult stages. PMID:26941230

  16. Adult Circadian Behavior in Drosophila Requires Developmental Expression of cycle, But Not period

    PubMed Central

    Kim, Min-Ho; Rao, Neethi Varadaraja; Bonilla, Gloribel; Wijnen, Herman

    2011-01-01

    Circadian clocks have evolved as internal time keeping mechanisms that allow anticipation of daily environmental changes and organization of a daily program of physiological and behavioral rhythms. To better examine the mechanisms underlying circadian clocks in animals and to ask whether clock gene expression and function during development affected subsequent daily time keeping in the adult, we used the genetic tools available in Drosophila to conditionally manipulate the function of the CYCLE component of the positive regulator CLOCK/CYCLE (CLK/CYC) or its negative feedback inhibitor PERIOD (PER). Differential manipulation of clock function during development and in adulthood indicated that there is no developmental requirement for either a running clock mechanism or expression of per. However, conditional suppression of CLK/CYC activity either via per over-expression or cyc depletion during metamorphosis resulted in persistent arrhythmic behavior in the adult. Two distinct mechanisms were identified that may contribute to this developmental function of CLK/CYC and both involve the ventral lateral clock neurons (LNvs) that are crucial to circadian control of locomotor behavior: (1) selective depletion of cyc expression in the LNvs resulted in abnormal peptidergic small-LNv dorsal projections, and (2) PER expression rhythms in the adult LNvs appeared to be affected by developmental inhibition of CLK/CYC activity. Given the conservation of clock genes and circuits among animals, this study provides a rationale for investigating a possible similar developmental role of the homologous mammalian CLOCK/BMAL1 complex. PMID:21750685

  17. Dynamic CRM occupancy reflects a temporal map of developmental progression.

    PubMed

    Wilczyński, Bartek; Furlong, Eileen E M

    2010-06-22

    Development is driven by tightly coordinated spatio-temporal patterns of gene expression, which are initiated through the action of transcription factors (TFs) binding to cis-regulatory modules (CRMs). Although many studies have investigated how spatial patterns arise, precise temporal control of gene expression is less well understood. Here, we show that dynamic changes in the timing of CRM occupancy is a prevalent feature common to all TFs examined in a developmental ChIP time course to date. CRMs exhibit complex binding patterns that cannot be explained by the sequence motifs or expression of the TFs themselves. The temporal changes in TF binding are highly correlated with dynamic patterns of target gene expression, which in turn reflect transitions in cellular function during different stages of development. Thus, it is not only the timing of a TF's expression, but also its temporal occupancy in refined time windows, which determines temporal gene expression. Systematic measurement of dynamic CRM occupancy may therefore serve as a powerful method to decode dynamic changes in gene expression driving developmental progression.

  18. Differential Responses to Wnt and PCP Disruption Predict Expression and Developmental Function of Conserved and Novel Genes in a Cnidarian

    PubMed Central

    Lapébie, Pascal; Ruggiero, Antonella; Barreau, Carine; Chevalier, Sandra; Chang, Patrick; Dru, Philippe; Houliston, Evelyn; Momose, Tsuyoshi

    2014-01-01

    We have used Digital Gene Expression analysis to identify, without bilaterian bias, regulators of cnidarian embryonic patterning. Transcriptome comparison between un-manipulated Clytia early gastrula embryos and ones in which the key polarity regulator Wnt3 was inhibited using morpholino antisense oligonucleotides (Wnt3-MO) identified a set of significantly over and under-expressed transcripts. These code for candidate Wnt signaling modulators, orthologs of other transcription factors, secreted and transmembrane proteins known as developmental regulators in bilaterian models or previously uncharacterized, and also many cnidarian-restricted proteins. Comparisons between embryos injected with morpholinos targeting Wnt3 and its receptor Fz1 defined four transcript classes showing remarkable correlation with spatiotemporal expression profiles. Class 1 and 3 transcripts tended to show sustained expression at “oral” and “aboral” poles respectively of the developing planula larva, class 2 transcripts in cells ingressing into the endodermal region during gastrulation, while class 4 gene expression was repressed at the early gastrula stage. The preferential effect of Fz1-MO on expression of class 2 and 4 transcripts can be attributed to Planar Cell Polarity (PCP) disruption, since it was closely matched by morpholino knockdown of the specific PCP protein Strabismus. We conclude that endoderm and post gastrula-specific gene expression is particularly sensitive to PCP disruption while Wnt-/β-catenin signaling dominates gene regulation along the oral-aboral axis. Phenotype analysis using morpholinos targeting a subset of transcripts indicated developmental roles consistent with expression profiles for both conserved and cnidarian-restricted genes. Overall our unbiased screen allowed systematic identification of regionally expressed genes and provided functional support for a shared eumetazoan developmental regulatory gene set with both predicted and previously unexplored members, but also demonstrated that fundamental developmental processes including axial patterning and endoderm formation in cnidarians can involve newly evolved (or highly diverged) genes. PMID:25233086

  19. Differential responses to Wnt and PCP disruption predict expression and developmental function of conserved and novel genes in a cnidarian.

    PubMed

    Lapébie, Pascal; Ruggiero, Antonella; Barreau, Carine; Chevalier, Sandra; Chang, Patrick; Dru, Philippe; Houliston, Evelyn; Momose, Tsuyoshi

    2014-09-01

    We have used Digital Gene Expression analysis to identify, without bilaterian bias, regulators of cnidarian embryonic patterning. Transcriptome comparison between un-manipulated Clytia early gastrula embryos and ones in which the key polarity regulator Wnt3 was inhibited using morpholino antisense oligonucleotides (Wnt3-MO) identified a set of significantly over and under-expressed transcripts. These code for candidate Wnt signaling modulators, orthologs of other transcription factors, secreted and transmembrane proteins known as developmental regulators in bilaterian models or previously uncharacterized, and also many cnidarian-restricted proteins. Comparisons between embryos injected with morpholinos targeting Wnt3 and its receptor Fz1 defined four transcript classes showing remarkable correlation with spatiotemporal expression profiles. Class 1 and 3 transcripts tended to show sustained expression at "oral" and "aboral" poles respectively of the developing planula larva, class 2 transcripts in cells ingressing into the endodermal region during gastrulation, while class 4 gene expression was repressed at the early gastrula stage. The preferential effect of Fz1-MO on expression of class 2 and 4 transcripts can be attributed to Planar Cell Polarity (PCP) disruption, since it was closely matched by morpholino knockdown of the specific PCP protein Strabismus. We conclude that endoderm and post gastrula-specific gene expression is particularly sensitive to PCP disruption while Wnt-/β-catenin signaling dominates gene regulation along the oral-aboral axis. Phenotype analysis using morpholinos targeting a subset of transcripts indicated developmental roles consistent with expression profiles for both conserved and cnidarian-restricted genes. Overall our unbiased screen allowed systematic identification of regionally expressed genes and provided functional support for a shared eumetazoan developmental regulatory gene set with both predicted and previously unexplored members, but also demonstrated that fundamental developmental processes including axial patterning and endoderm formation in cnidarians can involve newly evolved (or highly diverged) genes.

  20. Transcriptome profiles of embryos before and after cleavage in Eriocheir sinensis: identification of developmental genes at the earliest stages

    NASA Astrophysics Data System (ADS)

    Hui, Min; Cui, Zhaoxia; Liu, Yuan; Song, Chengwen

    2017-07-01

    In crab, embryogenesis is a complicated developmental program marked by a series of critical events. RNA-Sequencing technology offers developmental biologists a way to identify many more developmental genes than ever before. Here, we present a comprehensive analysis of the transcriptomes of Eriocheir sinensis oosperms (Os) and embryos at the 2-4 cell stage (Cs), which are separated by a cleavage event. A total of 18 923 unigenes were identified, and 403 genes matched with gene ontology (GO) terms related to developmental processes. In total, 432 differentially expressed genes (DEGs) were detected between the two stages. Nine DEGs were specifically expressed at only one stage. These DEGs may be relevant to stage-specific molecular events during development. A number of DEGs related to `hedgehog signaling pathway', `Wnt signaling pathway' `germplasm', `nervous system', `sensory perception' and `segment polarity' were identified as being up-regulated at the Cs stage. The results suggest that these embryonic developmental events begin before the early cleavage event in crabs, and that many of the genes expressed in the two transcriptomes might be maternal genes. Our study provides ample information for further research on the molecular mechanisms underlying crab development.

  1. Molecular shifts in limb identity underlie development of feathered feet in two domestic avian species

    PubMed Central

    Domyan, Eric T; Kronenberg, Zev; Infante, Carlos R; Vickrey, Anna I; Stringham, Sydney A; Bruders, Rebecca; Guernsey, Michael W; Park, Sungdae; Payne, Jason; Beckstead, Robert B; Kardon, Gabrielle; Menke, Douglas B; Yandell, Mark; Shapiro, Michael D

    2016-01-01

    Birds display remarkable diversity in the distribution and morphology of scales and feathers on their feet, yet the genetic and developmental mechanisms governing this diversity remain unknown. Domestic pigeons have striking variation in foot feathering within a single species, providing a tractable model to investigate the molecular basis of skin appendage differences. We found that feathered feet in pigeons result from a partial transformation from hindlimb to forelimb identity mediated by cis-regulatory changes in the genes encoding the hindlimb-specific transcription factor Pitx1 and forelimb-specific transcription factor Tbx5. We also found that ectopic expression of Tbx5 is associated with foot feathers in chickens, suggesting similar molecular pathways underlie phenotypic convergence between these two species. These results show how changes in expression of regional patterning genes can generate localized changes in organ fate and morphology, and provide viable molecular mechanisms for diversity in hindlimb scale and feather distribution. DOI: http://dx.doi.org/10.7554/eLife.12115.001 PMID:26977633

  2. The body electric 2.0: recent advances in developmental bioelectricity for regenerative and synthetic bioengineering.

    PubMed

    Mathews, Juanita; Levin, Michael

    2018-04-20

    Breakthroughs in biomedicine and synthetic bioengineering require predictive, rational control over anatomical structure and function. Recent successes in manipulating cellular and molecular hardware have not been matched by progress in understanding the patterning software implemented during embryogenesis and regeneration. A fundamental capability gap is driving desired changes in growth and form to address birth defects and traumatic injury. Here we review new tools, results, and conceptual advances in an exciting emerging field: endogenous non-neural bioelectric signaling, which enables cellular collectives to make global decisions and implement large-scale pattern homeostasis. Spatially distributed electric circuits regulate gene expression, organ morphogenesis, and body-wide axial patterning. Developmental bioelectricity facilitates the interface to organ-level modular control points that direct patterning in vivo. Cracking the bioelectric code will enable transformative progress in bioengineering and regenerative medicine. Copyright © 2018 Elsevier Ltd. All rights reserved.

  3. Quantitative analysis of random ameboid motion

    NASA Astrophysics Data System (ADS)

    Bödeker, H. U.; Beta, C.; Frank, T. D.; Bodenschatz, E.

    2010-04-01

    We quantify random migration of the social ameba Dictyostelium discoideum. We demonstrate that the statistics of cell motion can be described by an underlying Langevin-type stochastic differential equation. An analytic expression for the velocity distribution function is derived. The separation into deterministic and stochastic parts of the movement shows that the cells undergo a damped motion with multiplicative noise. Both contributions to the dynamics display a distinct response to external physiological stimuli. The deterministic component depends on the developmental state and ambient levels of signaling substances, while the stochastic part does not.

  4. A computational statistics approach for estimating the spatial range of morphogen gradients

    PubMed Central

    Kanodia, Jitendra S.; Kim, Yoosik; Tomer, Raju; Khan, Zia; Chung, Kwanghun; Storey, John D.; Lu, Hang; Keller, Philipp J.; Shvartsman, Stanislav Y.

    2011-01-01

    A crucial issue in studies of morphogen gradients relates to their range: the distance over which they can act as direct regulators of cell signaling, gene expression and cell differentiation. To address this, we present a straightforward statistical framework that can be used in multiple developmental systems. We illustrate the developed approach by providing a point estimate and confidence interval for the spatial range of the graded distribution of nuclear Dorsal, a transcription factor that controls the dorsoventral pattern of the Drosophila embryo. PMID:22007136

  5. Development of emotional facial recognition in late childhood and adolescence.

    PubMed

    Thomas, Laura A; De Bellis, Michael D; Graham, Reiko; LaBar, Kevin S

    2007-09-01

    The ability to interpret emotions in facial expressions is crucial for social functioning across the lifespan. Facial expression recognition develops rapidly during infancy and improves with age during the preschool years. However, the developmental trajectory from late childhood to adulthood is less clear. We tested older children, adolescents and adults on a two-alternative forced-choice discrimination task using morphed faces that varied in emotional content. Actors appeared to pose expressions that changed incrementally along three progressions: neutral-to-fear, neutral-to-anger, and fear-to-anger. Across all three morph types, adults displayed more sensitivity to subtle changes in emotional expression than children and adolescents. Fear morphs and fear-to-anger blends showed a linear developmental trajectory, whereas anger morphs showed a quadratic trend, increasing sharply from adolescents to adults. The results provide evidence for late developmental changes in emotional expression recognition with some specificity in the time course for distinct emotions.

  6. Disruption of an Evolutionarily Novel Synaptic Expression Pattern in Autism

    PubMed Central

    Jiang, Xi; Hu, Haiyang; Guijarro, Patricia; Mitchell, Amanda; Ely, John J.; Sherwood, Chet C.; Hof, Patrick R.; Qiu, Zilong; Pääbo, Svante; Akbarian, Schahram; Khaitovich, Philipp

    2016-01-01

    Cognitive defects in autism spectrum disorder (ASD) include socialization and communication: key behavioral capacities that separate humans from other species. Here, we analyze gene expression in the prefrontal cortex of 63 autism patients and control individuals, as well as 62 chimpanzees and macaques, from natal to adult age. We show that among all aberrant expression changes seen in ASD brains, a single aberrant expression pattern overrepresented in genes involved synaptic-related pathways is enriched in nucleotide variants linked to autism. Furthermore, only this pattern contains an excess of developmental expression features unique to humans, thus resulting in the disruption of human-specific developmental programs in autism. Several members of the early growth response (EGR) transcription factor family can be implicated in regulation of this aberrant developmental change. Our study draws a connection between the genetic risk architecture of autism and molecular features of cortical development unique to humans. PMID:27685936

  7. Genome wide analysis reveals Zic3 interaction with distal regulatory elements of stage specific developmental genes in zebrafish.

    PubMed

    Winata, Cecilia L; Kondrychyn, Igor; Kumar, Vibhor; Srinivasan, Kandhadayar G; Orlov, Yuriy; Ravishankar, Ashwini; Prabhakar, Shyam; Stanton, Lawrence W; Korzh, Vladimir; Mathavan, Sinnakaruppan

    2013-10-01

    Zic3 regulates early embryonic patterning in vertebrates. Loss of Zic3 function is known to disrupt gastrulation, left-right patterning, and neurogenesis. However, molecular events downstream of this transcription factor are poorly characterized. Here we use the zebrafish as a model to study the developmental role of Zic3 in vivo, by applying a combination of two powerful genomics approaches--ChIP-seq and microarray. Besides confirming direct regulation of previously implicated Zic3 targets of the Nodal and canonical Wnt pathways, analysis of gastrula stage embryos uncovered a number of novel candidate target genes, among which were members of the non-canonical Wnt pathway and the neural pre-pattern genes. A similar analysis in zic3-expressing cells obtained by FACS at segmentation stage revealed a dramatic shift in Zic3 binding site locations and identified an entirely distinct set of target genes associated with later developmental functions such as neural development. We demonstrate cis-regulation of several of these target genes by Zic3 using in vivo enhancer assay. Analysis of Zic3 binding sites revealed a distribution biased towards distal intergenic regions, indicative of a long distance regulatory mechanism; some of these binding sites are highly conserved during evolution and act as functional enhancers. This demonstrated that Zic3 regulation of developmental genes is achieved predominantly through long distance regulatory mechanism and revealed that developmental transitions could be accompanied by dramatic changes in regulatory landscape.

  8. Raman Spectroscopic Imaging of the Whole Ciona intestinalis Embryo during Development

    PubMed Central

    Nakamura, Mitsuru J.; Hotta, Kohji; Oka, Kotaro

    2013-01-01

    Intracellular composition and the distribution of bio-molecules play central roles in the specification of cell fates and morphogenesis during embryogenesis. Consequently, investigation of changes in the expression and distribution of bio-molecules, especially mRNAs and proteins, is an important challenge in developmental biology. Raman spectroscopic imaging, a non-invasive and label-free technique, allows simultaneous imaging of the intracellular composition and distribution of multiple bio-molecules. In this study, we explored the application of Raman spectroscopic imaging in the whole Ciona intestinalis embryo during development. Analysis of Raman spectra scattered from C. intestinalis embryos revealed a number of localized patterns of high Raman intensity within the embryo. Based on the observed distribution of bio-molecules, we succeeded in identifying the location and structure of differentiated muscle and endoderm within the whole embryo, up to the tailbud stage, in a label-free manner. Furthermore, during cell differentiation, we detected significant differences in cell state between muscle/endoderm daughter cells and daughter cells with other fates that had divided from the same mother cells; this was achieved by focusing on the Raman intensity of single Raman bands at 1002 or 1526 cm−1, respectively. This study reports the first application of Raman spectroscopic imaging to the study of identifying and characterizing differentiating tissues in a whole chordate embryo. Our results suggest that Raman spectroscopic imaging is a feasible label-free technique for investigating the developmental process of the whole embryo of C. intestinalis. PMID:23977129

  9. The developmental transcriptome atlas of the spoon worm Urechis unicinctus (Echiurida: Annelida).

    PubMed

    Park, Chungoo; Han, Yong-Hee; Lee, Sung-Gwon; Ry, Kyoung-Bin; Oh, Jooseong; Kern, Elizabeth M A; Park, Joong-Ki; Cho, Sung-Jin

    2018-03-01

    Echiurida is one of the most intriguing major subgroups of annelida because, unlike most other annelids, echiurids lack metameric body segmentation as adults. For this reason, transcriptome analyses from various developmental stages of echiurid species can be of substantial value for understanding precise expression levels and the complex regulatory networks during early and larval development. A total of 914 million raw RNA-Seq reads were produced from 14 developmental stages of Urechis unicinctus and were de novo assembled into contigs spanning 63,928,225 bp with an N50 length of 2700 bp. The resulting comprehensive transcriptome database of the early developmental stages of U. unicinctus consists of 20,305 representative functional protein-coding transcripts. Approximately 66% of unigenes were assigned to superphylum-level taxa, including Lophotrochozoa (40%). The completeness of the transcriptome assembly was assessed using benchmarking universal single-copy orthologs; 75.7% of the single-copy orthologs were presented in our transcriptome database. We observed 3 distinct patterns of global transcriptome profiles from 14 developmental stages and identified 12,705 genes that showed dynamic regulation patterns during the differentiation and maturation of U. unicinctus cells. We present the first large-scale developmental transcriptome dataset of U. unicinctus and provide a general overview of the dynamics of global gene expression changes during its early developmental stages. The analysis of time-course gene expression data is a first step toward understanding the complex developmental gene regulatory networks in U. unicinctus and will furnish a valuable resource for analyzing the functions of gene repertoires in various developmental phases.

  10. Nitric oxide synthase during early embryonic development in silkworm Bombyx mori: Gene expression, enzyme activity, and tissue distribution.

    PubMed

    Kitta, Ryo; Kuwamoto, Marina; Yamahama, Yumi; Mase, Keisuke; Sawada, Hiroshi

    2016-12-01

    To elucidate the mechanism for embryonic diapause or the breakdown of diapause in Bombyx mori, we biochemically analyzed nitric oxide synthase (NOS) during the embryogenesis of B. mori. The gene expression and enzyme activity of B. mori NOS (BmNOS) were examined in diapause, non-diapause, and HCl-treated diapause eggs. In the case of HCl-treated diapause eggs, the gene expression and enzyme activity of BmNOS were induced by HCl treatment. However, in the case of diapause and non-diapause eggs during embryogenesis, changes in the BmNOS activity and gene expressions did not coincide except 48-60 h after oviposition in diapause eggs. The results imply that changes in BmNOS activity during the embryogenesis of diapause and non-diapause eggs are regulated not only at the level of transcription but also post-transcription. The distribution and localization of BmNOS were also investigated with an immunohistochemical technique using antibodies against the universal NOS; the localization of BmNOS was observed mainly in the cytoplasm of yolk cells in diapause eggs and HCl-treated diapause eggs. These data suggest that BmNOS has an important role in the early embryonic development of the B. mori. © 2016 Japanese Society of Developmental Biologists.

  11. Sex-specific mouse liver gene expression: genome-wide analysis of developmental changes from pre-pubertal period to young adulthood

    PubMed Central

    2012-01-01

    Background Early liver development and the transcriptional transitions during hepatogenesis are well characterized. However, gene expression changes during the late postnatal/pre-pubertal to young adulthood period are less well understood, especially with regards to sex-specific gene expression. Methods Microarray analysis of male and female mouse liver was carried out at 3, 4, and 8 wk of age to elucidate developmental changes in gene expression from the late postnatal/pre-pubertal period to young adulthood. Results A large number of sex-biased and sex-independent genes showed significant changes during this developmental period. Notably, sex-independent genes involved in cell cycle, chromosome condensation, and DNA replication were down regulated from 3 wk to 8 wk, while genes associated with metal ion binding, ion transport and kinase activity were up regulated. A majority of genes showing sex differential expression in adult liver did not display sex differences prior to puberty, at which time extensive changes in sex-specific gene expression were seen, primarily in males. Thus, in male liver, 76% of male-specific genes were up regulated and 47% of female-specific genes were down regulated from 3 to 8 wk of age, whereas in female liver 67% of sex-specific genes showed no significant change in expression. In both sexes, genes up regulated from 3 to 8 wk were significantly enriched (p < E-76) in the set of genes positively regulated by the liver transcription factor HNF4α, as determined in a liver-specific HNF4α knockout mouse model, while genes down regulated during this developmental period showed significant enrichment (p < E-65) for negative regulation by HNF4α. Significant enrichment of the developmentally regulated genes in the set of genes subject to positive and negative regulation by pituitary hormone was also observed. Five sex-specific transcriptional regulators showed sex-specific expression at 4 wk (male-specific Ihh; female-specific Cdx4, Cux2, Tox, and Trim24) and may contribute to the developmental changes that lead to global acquisition of liver sex-specificity by 8 wk of age. Conclusions Overall, the observed changes in gene expression during postnatal liver development reflect the deceleration of liver growth and the induction of specialized liver functions, with widespread changes in sex-specific gene expression primarily occurring in male liver. PMID:22475005

  12. Epigenomic Landscape of Human Fetal Brain, Heart, and Liver.

    PubMed

    Yan, Liying; Guo, Hongshan; Hu, Boqiang; Li, Rong; Yong, Jun; Zhao, Yangyu; Zhi, Xu; Fan, Xiaoying; Guo, Fan; Wang, Xiaoye; Wang, Wei; Wei, Yuan; Wang, Yan; Wen, Lu; Qiao, Jie; Tang, Fuchou

    2016-02-26

    The epigenetic regulation of spatiotemporal gene expression is crucial for human development. Here, we present whole-genome chromatin immunoprecipitation followed by high throughput DNA sequencing (ChIP-seq) analyses of a wide variety of histone markers in the brain, heart, and liver of early human embryos shortly after their formation. We identified 40,181 active enhancers, with a large portion showing tissue-specific and developmental stage-specific patterns, pointing to their roles in controlling the ordered spatiotemporal expression of the developmental genes in early human embryos. Moreover, using sequential ChIP-seq, we showed that all three organs have hundreds to thousands of bivalent domains that are marked by both H3K4me3 and H3K27me3, probably to keep the progenitor cells in these organs ready for immediate differentiation into diverse cell types during subsequent developmental processes. Our work illustrates the potentially critical roles of tissue-specific and developmental stage-specific epigenomes in regulating the spatiotemporal expression of developmental genes during early human embryonic development. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. l-Ergothioneine improves the developmental potential of in vitro sheep embryos without influencing OCTN1-mediated cross-membrane transcript expression.

    PubMed

    Mishra, A; Reddy, I J; Dhali, A; Javvaji, P K

    2018-04-02

    SummaryThe objective of the study was to investigate the effect of l-ergothioneine (l-erg) (5 mM or 10 mM) supplementation in maturation medium on the developmental potential and OCTN1-dependant l-erg-mediated (10 mM) change in mRNA abundance of apoptotic (Bcl2, Bax, Casp3 and PCNA) and antioxidant (GPx, SOD1, SOD2 and CAT) genes in sheep oocytes and developmental stages of embryos produced in vitro. Oocytes matured with l-erg (10 mM) reduced their embryo toxicity by decreasing intracellular ROS and increasing intracellular GSH in matured oocytes that in turn improved developmental potential, resulting in significantly (P < 0.05) higher percentages of cleavage (53.72% vs 38.86, 46.56%), morulae (34.36% vs 20.62, 25.84%) and blastocysts (14.83% vs 6.98, 9.26%) compared with other lower concentrations (0 mM and 5 mM) of l-erg without change in maturation rate. l-Erg (10 mM) treatment did not influence the mRNA abundance of the majority of apoptotic and antioxidant genes studied in the matured oocytes and developmental stages of embryo. A gene expression study found that the SLC22A4 gene that encodes OCTN1, an integral membrane protein and specific transporter of l-erg was not expressed in oocytes and developmental stages of embryos. Therefore it was concluded from the study that although there was improvement in the developmental potential of sheep embryos by l-erg supplementation in maturation medium, there was no change in the expression of the majority of the genes studied due to the absence of the SLC22A4 gene in oocytes and embryos that encode OCTN1, which is responsible for transportation of l-erg across the membrane to alter gene expression.

  14. Insulin during in vitro oocyte maturation has an impact on development, mitochondria, and cytoskeleton in bovine day 8 blastocysts.

    PubMed

    Laskowski, Denise; Båge, Renée; Humblot, Patrice; Andersson, Göran; Sirard, Marc-André; Sjunnesson, Ylva

    2017-10-01

    Insulin is a key metabolic hormone that controls energy homeostasis in the body, including playing a specific role in regulating reproductive functions. Conditions associated with hyperinsulinemia can lower developmental rates in bovine in vitro embryo production and are linked to decreased fertility in humans, as in cases of obesity or type 2 diabetes. Embryo quality is important for fertility outcome and it can be assessed by choosing scoring standards for various characteristics, such as developmental stage, quality grade, cell number, mitochondrial pattern or actin cytoskeleton structure. Changes in the embryo's gene expression can reflect environmental impacts during maturation and may explain morphological differences. Together with morphological evaluation, this could enable better assessment and possibly prediction of the developmental potential of the embryo. The aim of this study was to use a bovine model to identify potential gene signatures of insulin-induced changes in the embryo by combining gene expression data and confocal microscopy evaluation. Bovine embryos were derived from oocytes matured in two different insulin concentrations (10 µg mL - 1 and 0.1 µg mL - 1 ), then stained to distinguish f-Actin, DNA and active mitochondria. The total cell number of the embryo, quality of the actin cytoskeleton and mitochondrial distribution were assessed and compared to an insulin-free control group. A microarray-based transcriptome analysis was used to investigate key genes involved in cell structure, mitochondrial function and cell division. Our results indicate that insulin supplementation during oocyte maturation leads to lower blastocyst rates and a different phenotype, characterised by an increased cell number and different actin and mitochondrial distribution patterns. These changes were reflected by an up-regulation of genes involved in cell division (MAP2K2; DHCR7), cell structure (LMNA; VIM; TUBB2B; TUBB3; TUBB4B) and mitochondrial activation (ATP5D; CYP11A1; NDUFB7; NDUFB10; NDUFS8). Taken together, we hypothesise that the increased proliferation in the insulin-treated groups might impair the developmental potential of the embryos by inducing metabolic stress on the molecular level, which could be detrimental for the survival of the embryo. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Sensory Processing Dysfunctions as Expressed among Children with Different Severities of Intellectual Developmental Disabilities

    ERIC Educational Resources Information Center

    Engel-Yeger, Batya; Hardal-Nasser, Reem; Gal, Eynat

    2011-01-01

    High frequency of sensory processing dysfunctions (SPD) is prevalent among children with intellectual developmental disabilities and contributes to their maladaptive behaviors. However, the knowledge about the expressions of SPD in different levels of IDD severity is limited. As SPD may reduce adaptive responses and limit participation, this…

  16. Regulatory RNA at the root of animals: dynamic expression of developmental lincRNAs in the calcisponge Sycon ciliatum.

    PubMed

    Bråte, Jon; Adamski, Marcin; Neumann, Ralf S; Shalchian-Tabrizi, Kamran; Adamska, Maja

    2015-12-22

    Long non-coding RNAs (lncRNAs) play important regulatory roles during animal development, and it has been hypothesized that an RNA-based gene regulation was important for the evolution of developmental complexity in animals. However, most studies of lncRNA gene regulation have been performed using model animal species, and very little is known about this type of gene regulation in non-bilaterians. We have therefore analysed RNA-Seq data derived from a comprehensive set of embryogenesis stages in the calcareous sponge Sycon ciliatum and identified hundreds of developmentally expressed intergenic lncRNAs (lincRNAs) in this species. In situ hybridization of selected lincRNAs revealed dynamic spatial and temporal expression during embryonic development. More than 600 lincRNAs constitute integral parts of differentially expressed gene modules, which also contain known developmental regulatory genes, e.g. transcription factors and signalling molecules. This study provides insights into the non-coding gene repertoire of one of the earliest evolved animal lineages, and suggests that RNA-based gene regulation was probably present in the last common ancestor of animals. © 2015 The Authors.

  17. Phenylpropanoid biosynthesis in leaves and glandular trichomes of basil (Ocimum basilicum L.).

    PubMed

    Deschamps, Cícero; Simon, James E

    2010-01-01

    Basil (Ocimum basilicum L.) essential oil phenylpropenes are synthesized and accumulate in peltate glandular trichomes and their content and composition depend on plant developmental stage. Studies on gene expression and enzymatic activity indicate that the phenylpropene biosynthetic genes are developmentally regulated. In this study, the methylchavicol accumulation in basil leaves and the enzyme activities and gene expression of both chavicol O-methyltransferase (CVOMT) and eugenol O-methyltransferase (EOMT) were investigated in all leaves at four plant developmental stages. Methylchavicol accumulation decreased over time as leaves matured. There was a significant correlation between methylchavicol accumulation and CVOMT (r(2) = 0.88) enzyme activity, suggesting that the levels of biosynthetic enzymes control the essential oil content. CVOMT and EOMT transcript expression levels, which decreased with leaf age, followed the same pattern in both whole leaves and isolated glandular trichomes, providing evidence that CVOMT transcript levels are developmentally regulated in basil glandular trichomes themselves and that differences in CVOMT expression observed in whole leaves are not solely the result of differences in glandular trichome density.

  18. Development-related expression patterns of protein-coding and miRNA genes involved in porcine muscle growth.

    PubMed

    Wang, F J; Jin, L; Guo, Y Q; Liu, R; He, M N; Li, M Z; Li, X W

    2014-11-27

    Muscle growth and development is associated with remarkable changes in protein-coding and microRNA (miRNA) gene expression. To determine the expression patterns of genes and miRNAs related to muscle growth and development, we measured the expression levels of 25 protein-coding and 16 miRNA genes in skeletal and cardiac muscles throughout 5 developmental stages by quantitative reverse transcription-polymerase chain reaction. The Short Time-Series Expression Miner (STEM) software clustering results showed that growth-related genes were downregulated at all developmental stages in both the psoas major and longissimus dorsi muscles, indicating their involvement in early developmental stages. Furthermore, genes related to muscle atrophy, such as forkhead box 1 and muscle ring finger, showed unregulated expression with increasing age, suggesting a decrease in protein synthesis during the later stages of skeletal muscle development. We found that development of the cardiac muscle was a complex process in which growth-related genes were highly expressed during embryonic development, but they did not show uniform postnatal expression patterns. Moreover, the expression level of miR-499, which enhances the expression of the β-myosin heavy chain, was significantly different in the psoas major and longissimus dorsi muscles, suggesting the involvement of miR-499 in the determination of skeletal muscle fiber types. We also performed correlation analyses of messenger RNA and miRNA expression. We found negative relationships between miR-486 and forkhead box 1, and miR-133a and serum response factor at all developmental stages, suggesting that forkhead box 1 and serum response factor are potential targets of miR-486 and miR-133a, respectively.

  19. Gene Duplication and Evolutionary Innovations in Hemoglobin-Oxygen Transport

    PubMed Central

    2016-01-01

    During vertebrate evolution, duplicated hemoglobin (Hb) genes diverged with respect to functional properties as well as the developmental timing of expression. For example, the subfamilies of genes that encode the different subunit chains of Hb are ontogenetically regulated such that functionally distinct Hb isoforms are expressed during different developmental stages. In some vertebrate taxa, functional differentiation between co-expressed Hb isoforms may also contribute to physiologically important divisions of labor. PMID:27053736

  20. Developmental expression of Hsp90, Hsp70 and HSF during morphogenesis in the vetigastropod Haliotis asinina.

    PubMed

    Gunter, Helen M; Degnan, Bernard M

    2007-08-01

    Heat shock proteins (Hsps) have dual functions, participating in both the stress response and a broad range of developmental processes. At physiological temperatures, it has been demonstrated in deuterostomes (vertebrates) and ecdysozoans (insects) that Hsps are expressed in tissues that are undergoing differentiation and morphogenesis. Here we investigate the developmental expression of Hsp70, Hsp90 and their regulatory transcription factor heat shock transcription factor (HSF) in the marine gastropod Haliotis asinina, a representative of the 3rd major lineage of bilaterian animals, the Lophotrochozoa. HasHsp70, HasHsp90 and HasHSF are maternally expressed in H. asinina and are progressively restricted to the micromere lineage during cleavage. During larval morphogenesis, they are expressed in unique and overlapping patterns in the prototroch, foot, and mantle. Hsp expression peaked in these tissues during periods of cell differentiation and morphogenesis, returning to lower levels after morphogenesis was complete. These patterns of Hsp and HSF expression in H. asinina are akin to those observed in ecdysozoans and deuterostomes, with Hsps being activated in cells and tissues undergoing morphogenesis.

  1. Glue protein production can be triggered by steroid hormone signaling independent of the developmental program in Drosophila melanogaster

    PubMed Central

    Kaieda, Yuya; Masuda, Ryota; Nishida, Ritsuo; Shimell, MaryJane; O’Connor, Michael B.; Ono, Hajime

    2018-01-01

    Steroid hormones regulate life stage transitions, allowing animals to appropriately follow a developmental timeline. During insect development, the steroid hormone ecdysone is synthesized and released in a regulated manner by the prothoracic gland (PG) and then hydroxylated to the active molting hormone, 20-hydroxyecdysone (20E), in peripheral tissues. We manipulated ecdysteroid titers, through temporally controlled over-expression of the ecdysteroid-inactivating enzyme, CYP18A1, in the PG using the GeneSwitch-GAL4 system in the fruit fly Drosophila melanogaster. We monitored expression of a 20E-inducible glue protein gene, Salivary gland secretion 3 (Sgs3), using a Sgs3:GFP fusion transgene. In wild type larvae, Sgs3-GFP expression is activated at the midpoint of the third larval instar stage in response to the rising endogenous level of 20E. By first knocking down endogenous 20E levels during larval development and then feeding 20E to these larvae at various stages, we found that Sgs3-GFP expression could be triggered at an inappropriate developmental stage after a certain time lag. This stage-precocious activation of Sgs3 required expression of the Broad-complex, similar to normal Sgs3 developmental regulation, and a small level of nutritional input. We suggest that these studies provide evidence for a tissue-autonomic regulatory system for a metamorphic event independent from the primary 20E driven developmental progression. PMID:28782527

  2. Glue protein production can be triggered by steroid hormone signaling independent of the developmental program in Drosophila melanogaster.

    PubMed

    Kaieda, Yuya; Masuda, Ryota; Nishida, Ritsuo; Shimell, MaryJane; O'Connor, Michael B; Ono, Hajime

    2017-10-01

    Steroid hormones regulate life stage transitions, allowing animals to appropriately follow a developmental timeline. During insect development, the steroid hormone ecdysone is synthesized and released in a regulated manner by the prothoracic gland (PG) and then hydroxylated to the active molting hormone, 20-hydroxyecdysone (20E), in peripheral tissues. We manipulated ecdysteroid titers, through temporally controlled over-expression of the ecdysteroid-inactivating enzyme, CYP18A1, in the PG using the GeneSwitch-GAL4 system in the fruit fly Drosophila melanogaster. We monitored expression of a 20E-inducible glue protein gene, Salivary gland secretion 3 (Sgs3), using a Sgs3:GFP fusion transgene. In wild type larvae, Sgs3-GFP expression is activated at the midpoint of the third larval instar stage in response to the rising endogenous level of 20E. By first knocking down endogenous 20E levels during larval development and then feeding 20E to these larvae at various stages, we found that Sgs3-GFP expression could be triggered at an inappropriate developmental stage after a certain time lag. This stage-precocious activation of Sgs3 required expression of the Broad-complex, similar to normal Sgs3 developmental regulation, and a small level of nutritional input. We suggest that these studies provide evidence for a tissue-autonomic regulatory system for a metamorphic event independent from the primary 20E driven developmental progression. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Transcriptomic analysis in the developing zebrafish embryo after compound exposure: Individual gene expression and pathway regulation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hermsen, Sanne A.B., E-mail: Sanne.Hermsen@rivm.nl; Department of Toxicogenomics, Maastricht University, P.O. Box 616, 6200 MD, Maastricht; Institute for Risk Assessment Sciences

    2013-10-01

    The zebrafish embryotoxicity test is a promising alternative assay for developmental toxicity. Classically, morphological assessment of the embryos is applied to evaluate the effects of compound exposure. However, by applying differential gene expression analysis the sensitivity and predictability of the test may be increased. For defining gene expression signatures of developmental toxicity, we explored the possibility of using gene expression signatures of compound exposures based on commonly expressed individual genes as well as based on regulated gene pathways. Four developmental toxic compounds were tested in concentration-response design, caffeine, carbamazepine, retinoic acid and valproic acid, and two non-embryotoxic compounds, D-mannitol andmore » saccharin, were included. With transcriptomic analyses we were able to identify commonly expressed genes, which were mostly development related, after exposure to the embryotoxicants. We also identified gene pathways regulated by the embryotoxicants, suggestive of their modes of action. Furthermore, whereas pathways may be regulated by all compounds, individual gene expression within these pathways can differ for each compound. Overall, the present study suggests that the use of individual gene expression signatures as well as pathway regulation may be useful starting points for defining gene biomarkers for predicting embryotoxicity. - Highlights: • The zebrafish embryotoxicity test in combination with transcriptomics was used. • We explored two approaches of defining gene biomarkers for developmental toxicity. • Four compounds in concentration-response design were tested. • We identified commonly expressed individual genes as well as regulated gene pathways. • Both approaches seem suitable starting points for defining gene biomarkers.« less

  4. Biased gene expression in early honeybee larval development

    PubMed Central

    2013-01-01

    Background Female larvae of the honeybee (Apis mellifera) develop into either queens or workers depending on nutrition. This nutritional stimulus triggers different developmental trajectories, resulting in adults that differ from each other in physiology, behaviour and life span. Results To understand how these trajectories are established we have generated a comprehensive atlas of gene expression throughout larval development. We found substantial differences in gene expression between worker and queen-destined larvae at 6 hours after hatching. Some of these early changes in gene expression are maintained throughout larval development, indicating that caste-specific developmental trajectories are established much earlier than previously thought. Within our gene expression data we identified processes that potentially underlie caste differentiation. Queen-destined larvae have higher expression of genes involved in transcription, translation and protein folding early in development with a later switch to genes involved in energy generation. Using RNA interference, we were able to demonstrate that one of these genes, hexamerin 70b, has a role in caste differentiation. Both queen and worker developmental trajectories are associated with the expression of genes that have alternative splice variants, although only a single variant of a gene tends to be differentially expressed in a given caste. Conclusions Our data, based on the biases in gene expression early in development together with published data, supports the idea that caste development in the honeybee consists of two phases; an initial biased phase of development, where larvae can still switch to the other caste by differential feeding, followed by commitment to a particular developmental trajectory. PMID:24350621

  5. Change in Gene Expression in Zebrafish as an Endpoint for Developmental Neurotoxicity Screening

    EPA Science Inventory

    Chemicals that adversely affect the developing nervous system may have long-term consequences on human health. Little information exists on a large number of environmental chemicals to guide the risk assessments for developmental neurotoxicity (DNT). As traditional developmental ...

  6. Distinct expression patterns of glycoprotein hormone-alpha2 and -beta5 in a basal chordate suggest independent developmental functions.

    PubMed

    Dos Santos, Sandra; Bardet, Claire; Bertrand, Stephanie; Escriva, Hector; Habert, Damien; Querat, Bruno

    2009-08-01

    The vertebrate glycoprotein hormones (GpHs), gonadotropins and thyrotropin, are heterodimers composed of a common alpha- and specific beta-subunit. The recombinant heterodimer of two additional, structurally related proteins identified in vertebrate and protostome genomes, the glycoproteins-alpha2 (GPA2) and-beta5 (GPB5), was shown to activate the thyrotropin receptor and was therefore named thyrostimulin. However, differences in tissue distribution and expression levels of these proteins suggested that they might act as nonassociated factors, prompting further investigation on these proteins. In this study we show that GPA2 and GPB5 appeared with the emergence of bilateria and were maintained in most groups. These genes are tightly associated at the genomic level, an association, however, lost in tetrapods. Our structural and genomic environment comparison reinforces the hypothesis of their phylogenetic relationships with GpH-alpha and -beta. In contrast, the glycosylation status of GPA2 and GPB5 is highly variable further questioning heterodimer secretory efficiency and activity. As a first step toward understanding their function, we investigated the spatiotemporal expression of GPA2 and GPB5 genes at different developmental stages in a basal chordate, the amphioxus. Expression of GPB5 was essentially ubiquitous with an anteroposterior gradient in embryos. GPA2 embryonic and larvae expression was restricted to specific areas and, interestingly, partially overlapped that of a GpH receptor-related gene. In conclusion, we speculate that GPA2 and GPB5 have nondispensable and coordinated functions related to a novelty appeared with bilateria. These proteins would be active during embryonic development in a manner that does not require their heterodimerization.

  7. Splitting of IVP bovine blastocyst affects morphology and gene expression of resulting demi-embryos during in vitro culture and in vivo elongation.

    PubMed

    Velasquez, Alejandra E; Castro, Fidel O; Veraguas, Daniel; Cox, Jose F; Lara, Evelyn; Briones, Mario; Rodriguez-Alvarez, Lleretny

    2016-02-01

    Embryo splitting might be used to increase offspring yield and for molecular analysis of embryo competence. How splitting affects developmental potential of embryos is unknown. This research aimed to study the effect of bovine blastocyst splitting on morphological and gene expression homogeneity of demi-embryos and on embryo competence during elongation. Grade I bovine blastocyst produced in vitro were split into halves and distributed in nine groups (3 × 3 setting according to age and stage before splitting; age: days 7-9; stage: early, expanded and hatched blastocysts). Homogeneity and survival rate in vitro after splitting (12 h, days 10 and 13) and the effect of splitting on embryo development at elongation after embryo transfer (day 17) were assessed morphologically and by RT-qPCR. The genes analysed were OCT4, SOX2, NANOG, CDX2, TP1, TKDP1, EOMES, and BAX. Approximately 90% of split embryos had a well conserved defined inner cell mass (ICM), 70% of the halves had similar size with no differences in gene expression 12 h after splitting. Split embryos cultured further conserved normal and comparable morphology at day 10 of development; this situation changes at day 13 when embryo morphology and gene expression differed markedly among demi-embryos. Split and non-split blastocysts were transferred to recipient cows and were recovered at day 17. Fifty per cent of non-split embryos were larger than 100 mm (33% for split embryos). OCT4, SOX2, TP1 and EOMES levels were down-regulated in elongated embryos derived from split blastocysts. In conclusion, splitting day-8 blastocysts yields homogenous demi-embryos in terms of developmental capability and gene expression, but the initiation of the filamentous stage seems to be affected by the splitting.

  8. Understanding development and stem cells using single cell-based analyses of gene expression

    PubMed Central

    Kumar, Pavithra; Tan, Yuqi

    2017-01-01

    In recent years, genome-wide profiling approaches have begun to uncover the molecular programs that drive developmental processes. In particular, technical advances that enable genome-wide profiling of thousands of individual cells have provided the tantalizing prospect of cataloging cell type diversity and developmental dynamics in a quantitative and comprehensive manner. Here, we review how single-cell RNA sequencing has provided key insights into mammalian developmental and stem cell biology, emphasizing the analytical approaches that are specific to studying gene expression in single cells. PMID:28049689

  9. Rapid video-referenced ratings of reciprocal social behavior in toddlers: a twin study.

    PubMed

    Marrus, Natasha; Glowinski, Anne L; Jacob, Theodore; Klin, Ami; Jones, Warren; Drain, Caroline E; Holzhauer, Kieran E; Hariprasad, Vaishnavi; Fitzgerald, Robert T; Mortenson, Erika L; Sant, Sayli M; Cole, Lyndsey; Siegel, Satchel A; Zhang, Yi; Agrawal, Arpana; Heath, Andrew C; Constantino, John N

    2015-12-01

    Reciprocal social behavior (RSB) is a developmental prerequisite for social competency, and deficits in RSB constitute a core feature of autism spectrum disorder (ASD). Although clinical screeners categorically ascertain risk of ASD in early childhood, rapid methods for quantitative measurement of RSB in toddlers are not yet established. Such measurements are critical for tracking developmental trajectories and incremental responses to intervention. We developed and validated a 20-min video-referenced rating scale, the video-referenced rating of reciprocal social behavior (vrRSB), for untrained caregivers to provide standardized ratings of quantitative variation in RSB. Parents of 252 toddler twins [Monozygotic (MZ) = 31 pairs, Dizygotic (DZ) = 95 pairs] ascertained through birth records, rated their twins' RSB at two time points, on average 6 months apart, and completed two developmental measures, the Modified Checklist for Autism in Toddlers (M-CHAT) and the MacArthur Communicative Development Inventory Short Form (MCDI-s). Scores on the vrRSB were fully continuously distributed, with excellent 6-month test-retest reliability ([intraclass correlation coefficient] ICC = 0.704, p < .000). MZ twins displayed markedly greater trait concordance than DZ twins, (MZ ICC = 0.863, p < .000, DZ ICC = 0.231, p < .012). VrRSB score distributions were highly distinct for children passing versus failing the M-CHAT (t = -8.588, df = 31, p < .000), incrementally improved from 18-24 months, and were inversely correlated with receptive and expressive vocabulary on the MCDI-s. Like quantitative autistic trait ratings in school-aged children and adults, toddler scores on the vrRSB are continuously distributed and appear highly heritable. These ratings exhibited minimal measurement error, high inter-individual stability, and developmental progression in RSB as children matured from 18-24 months, supporting their potential utility for serially quantifying the severity of early autistic syndromes over time and in response to intervention. In addition, these findings inform the genetic-environmental structure of RSB in early typical development. © 2015 Association for Child and Adolescent Mental Health.

  10. Gene expression profiling of the hippocampal dentate gyrus in an adult toxicity study captures a variety of neurodevelopmental dysfunctions in rat models of hypothyroidism.

    PubMed

    Shiraki, Ayako; Saito, Fumiyo; Akane, Hirotoshi; Akahori, Yumi; Imatanaka, Nobuya; Itahashi, Megu; Yoshida, Toshinori; Shibutani, Makoto

    2016-01-01

    We previously found that developmental hypothyroidism changed the expression of genes in the rat hippocampal dentate gyrus, a brain region where adult neurogenesis is known to occur. In the present study, we performed brain region-specific global gene expression profiling in an adult rat hypothyroidism model to see if it reflected the developmental neurotoxicity we saw in the developmental hypothyroidism model. Starting when male rats were 5 weeks old, we administered 6-propyl-2-thiouracil at a doses of 0, 0.1 and 10 mg kg(-1) body weight by gavage for 28 days. We selected four brain regions to represent both cerebral and cerebellar tissues: hippocampal dentate gyrus, cerebral cortex, corpus callosum and cerebellar vermis. We observed significant alterations in the expression of genes related to neural development (Eph family genes and Robo3) in the cerebral cortex and hippocampal dentate gyrus and in the expression of genes related to myelination (Plp1 and Mbp) in the hippocampal dentate gyrus. We observed only minor changes in the expression of these genes in the corpus callosum and cerebellar vermis. We used real-time reverse-transcription polymerase chain reaction to confirm Chrdl1, Hes5, Mbp, Plp1, Slit1, Robo3 and the Eph family transcript expression changes. The most significant changes in gene expression were found in the dentate gyrus. Considering that the gene expression profile of the adult dentate gyrus closely related to neurogenesis, 28-day toxicity studies looking at gene expression changes in adult hippocampal dentate gyrus may also detect possible developmental neurotoxic effects. Copyright © 2015 John Wiley & Sons, Ltd.

  11. A comparative view of early development in the corals Favia lizardensis, Ctenactis echinata, and Acropora millepora - morphology, transcriptome, and developmental gene expression.

    PubMed

    Okubo, Nami; Hayward, David C; Forêt, Sylvain; Ball, Eldon E

    2016-02-29

    Research into various aspects of coral biology has greatly increased in recent years due to anthropogenic threats to coral health including pollution, ocean warming and acidification. However, knowledge of coral early development has lagged. The present paper describes the embryonic development of two previously uncharacterized robust corals, Favia lizardensis (a massive brain coral) and Ctenactis echinata (a solitary coral) and compares it to that of the previously characterized complex coral, Acropora millepora, both morphologically and in terms of the expression of a set of key developmental genes. Illumina sequencing of mixed age embryos was carried out, resulting in embryonic transcriptomes consisting of 40605 contigs for C.echinata (N50 = 1080 bp) and 48536 contigs for F.lizardensis (N50 = 1496 bp). The transcriptomes have been annotated against Swiss-Prot and were sufficiently complete to enable the identification of orthologs of many key genes controlling development in bilaterians. Developmental series of images of whole mounts and sections reveal that the early stages of both species contain a blastocoel, consistent with their membership of the robust clade. In situ hybridization was used to examine the expression of the developmentally important genes brachyury, chordin and forkhead. The expression of brachyury and forkhead was consistent with that previously reported for Acropora and allowed us to confirm that the pseudo-blastopore sometimes seen in robust corals such as Favia spp. is not directly associated with gastrulation. C.echinata chordin expression, however, differed from that seen in the other two corals. Embryonic transcriptomes were assembled for the brain coral Favia lizardensis and the solitary coral Ctenactis echinata. Both species have a blastocoel in their early developmental stages, consistent with their phylogenetic position as members of the robust clade. Expression of the key developmental genes brachyury, chordin and forkhead was investigated, allowing comparison to that of their orthologs in Acropora, Nematostella and bilaterians and demonstrating that even within the Anthozoa there are significant differences in expression patterns.

  12. Molecular characterization of BrMYB28 and BrMYB29 paralogous transcription factors involved in the regulation of aliphatic glucosinolate profiles in Brassica rapa ssp. pekinensis.

    PubMed

    Baskar, Venkidasamy; Park, Se Won

    2015-07-01

    Glucosinolates (GSL) are one of the major secondary metabolites of the Brassicaceae family. In the present study, we aim at characterizing the multiple paralogs of aliphatic GSL regulators, such as BrMYB28 and BrMYB29 genes in Brassica rapa ssp. pekinensis, by quantitative real-time PCR (qRT-PCR) analysis in different tissues and at various developmental stages. An overlapping gene expression pattern between the BrMYBs as well as their downstream genes (DSGs) was found at different developmental stages. Among the BrMYB28 and BrMYB29 paralogous genes, the BrMYB28.3 and BrMYB29.1 genes were dominantly expressed in most of the developmental stages, compared to the other paralogs of the BrMYB genes. Furthermore, the differential expression pattern of the BrMYBs was observed under various stress treatments. Interestingly, BrMYB28.2 showed the least expression in most developmental stages, while its expression was remarkably high in different stress conditions. More specifically, the BrMYB28.2, BrMYB28.3, and BrMYB29.1 genes were highly responsive to various abiotic and biotic stresses, further indicating their possible role in stress tolerance. Moreover, the in silico cis motif analysis in the upstream regulatory regions of BrMYBs showed the presence of various putative stress-specific motifs, which further indicated their responsiveness to biotic and abiotic stresses. These observations suggest that the dominantly expressed BrMYBs, both in different developmental stages and under various stress treatments (BrMYB28.3 and BrMYB29.1), may be potential candidate genes for altering the GSL level through genetic modification studies in B. rapa ssp. pekinensis. Copyright © 2015. Published by Elsevier SAS.

  13. Dose–response analysis of phthalate effects on gene expression in rat whole embryo culture

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Robinson, Joshua F.; Department of Toxicogenomics, Maastricht University, Maastricht; Verhoef, Aart

    2012-10-01

    The rat postimplantation whole embryo culture (WEC) model serves as a potential screening tool for developmental toxicity. In this model, cultured rat embryos are exposed during early embryogenesis and evaluated for morphological effects. The integration of molecular-based markers may lead to improved objectivity, sensitivity and predictability of WEC in assessing developmental toxic properties of compounds. In this study, we investigated the concentration-dependent effects of two phthalates differing in potency, mono(2-ethylhexyl) phthalate (MEHP) and monomethyl phthalate (MMP, less toxic), on the transcriptome in WEC to examine gene expression in relation with dysmorphogenesis. MEHP was more potent than MMP in inducing genemore » expression changes as well as changes on morphology. MEHP induced significant enrichment of cholesterol/lipid/steroid (CLS) metabolism and apoptosis pathways which was associated with developmental toxicity. Regulation of genes within CLS metabolism pathways represented the most sensitive markers of MEHP exposure, more sensitive than classical morphological endpoints. As shown in direct comparisons with toxicogenomic in vivo studies, alterations in the regulation of CLS metabolism pathways has been previously identified to be associated with developmental toxicity due to phthalate exposure in utero. Our results support the application of WEC as a model to examine relative phthalate potency through gene expression and morphological responses. Additionally, our results further define the applicability domain of the WEC model for developmental toxicological investigations. -- Highlights: ► We examine the effect of two phthalates on gene expression and morphology in WEC. ► MEHP is more potent than MMP in inducing gene expression changes and dysmorphogenesis. ► MEHP significantly disrupts cholesterol metabolism pathways in a dose-dependent manner. ► Specific phthalate-related mechanisms in WEC are relevant to mechanisms in vivo.« less

  14. Expressed sequence tags from poplar wood tissues--a comparative analysis from multiple libraries.

    PubMed

    Déjardin, A; Leplé, J-C; Lesage-Descauses, M-C; Costa, G; Pilate, G

    2004-01-01

    Xylogenesis involves successive developmental processes--cambial division, cell expansion and differentiation, cell death--each occurring along a gradient from the cambium to the pith of the stem. Taking advantage of the high level of organisation of wood tissues, we isolated cambial zone (CZ), differentiating xylem (DX) and mature xylem (MX) from both tension wood (TW) and opposite wood (OW) of bent poplars. Four different cDNA libraries were then constructed and used to generate 10,062 EST, reflecting the genes expressed in the different wood tissues. For the most abundant clusters, the EST distributions were compared between libraries in order to identify genes specific or over-represented at some specific developmental stages. They clearly showed a developmental shift between CZ and DX, whereas there is a continuity of development between DX and MX. CZ was mainly characterized by clusters of genes involved in cell cycle, protein synthesis and fate. Interestingly, two clusters with no assigned function were found specific to the cambial zone. In DX and MX, clusters were mostly involved in methylation of lignin precursors and microtubule cytoskeleton. In addition, in DX, EST from TW and OW were compared: five clusters of arabinogalactan proteins, one for sucrose synthase and one for fructokinase were specific or over-represented in TW. Moreover, a putative transcription factor and a cluster of unknown function were also identified in DX-TW. The informative comparison of multiple libraries prepared from wood tissues led to the identification of genes--some with still unknown functions--putatively involved in xylogenesis and tension wood formation.

  15. Identification and validation of reference genes for qRT-PCR studies of the obligate aphid pathogenic fungus Pandora neoaphidis during different developmental stages.

    PubMed

    Zhang, Shutao; Chen, Chun; Xie, Tingna; Ye, Sudan

    2017-01-01

    The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR) at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae). Four statistical algorithms, including geNorm, NormFinder, BestKeeper and Delta Ct method were used to rank putative reference genes according to their expression stability and indicate the best reference gene or combination of reference genes for accurate normalization. The analysis of comprehensive ranking revealed that ACT1and 18Swas the most stably expressed genes throughout the developmental stages. To further validate the suitability of the reference genes identified in this study, the expression of cell division control protein 25 (CDC25) and Chitinase 1(CHI1) genes were used to further confirm the validated candidate reference genes. Our study presented the first systematic study of reference gene(s) selection for P. neoaphidis study and provided guidelines to obtain more accurate qPCR results for future developmental efforts.

  16. Molecular cloning of Pcc-dmrt1s and their specific expression patterns in Pengze crucian carp (Carassius auratus var. Pengze) affected by 17α-methyltestosterone.

    PubMed

    Zheng, Yao; Liang, Hongwei; Xu, Peng; Li, Meng; Wang, Zaizhao

    2014-08-01

    Dmrt1, an important transcription factor associated with testicular differentiation, is conserved among teleost, which could also be detected in ovaries. In the present study, three isoforms of Pcc-dmrt1s (Pcc-dmrt1a, Pcc-dmrt1b and Pcc-dmrt1c) resulting from alternative splicing of the dmrt1 gene were cloned and characterized in the triploid gynogenetic fish, the Pengze crucian carp. Their mRNA expression profiling was investigated in juvenile developmental stages, tissues of the adult fish, and the juveniles under 84.2 ng/L 17α-methyltestosterone (MT) treatments. Results showed that their putative proteins shared high identities to Dmrt1 in cyprinid fish species. Gene expression profiling in the developmental stages showed that all the three target genes had a highest/lowest expression at 56/40 days post-hatching (dph), respectively. The period of 40 dph appeared to be a key time during the process of the ovary development of Pengze crucian carp. The tissue distribution results indicated that Pcc-dmrt1s were predominantly expressed in hepatopancreas, brain, spleen and ovary of the female fish. MT significantly increased the mRNA expression of Pcc-dmrt1a (all 4-week exposures) and Pcc-dmrt1b (except for week 2), while repressed Pcc-dmrt1c transcripts at all exposure period except for week 2. MT extremely significant repressed cyp19a1a transcripts for 1 week. The present study indicated that MT could influence the ovary development of Pengze crucian carp by disturbing gene expressions of Pcc-dmrt1s and cyp19a1a. Furthermore, the present study will be of great significance to broaden the understanding of masculinizing pathway during ovary development in gynogenetic teleost.

  17. DNA methylation at differentially methylated regions of imprinted genes is resistant to developmental programming by maternal nutrition

    PubMed Central

    Ivanova, Elena; Chen, Jian-Hua; Segonds-Pichon, Anne; Ozanne, Susan E.; Kelsey, Gavin

    2012-01-01

    The nutritional environment in which the mammalian fetus or infant develop is recognized as influencing the risk of chronic diseases, such as type 2 diabetes and hypertension, in a phenomenon that has become known as developmental programming. The late onset of such diseases in response to earlier transient experiences has led to the suggestion that developmental programming may have an epigenetic component, because epigenetic marks such as DNA methylation or histone tail modifications could provide a persistent memory of earlier nutritional states. One class of genes that has been considered a potential target or mediator of programming events is imprinted genes, because these genes critically depend upon epigenetic modifications for correct expression and because many imprinted genes have roles in controlling fetal growth as well as neonatal and adult metabolism. In this study, we have used an established model of developmental programming—isocaloric protein restriction to female mice during gestation or lactation—to examine whether there are effects on expression and DNA methylation of imprinted genes in the offspring. We find that although expression of some imprinted genes in liver of offspring is robustly and sustainably changed, methylation of the differentially methylated regions (DMRs) that control their monoallelic expression remains largely unaltered. We conclude that deregulation of imprinting through a general effect on DMR methylation is unlikely to be a common factor in developmental programming. PMID:22968513

  18. Heart valve cardiomyocytes of mouse embryos express the serotonin transporter SERT

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pavone, Luigi Michele; Department of Biochemistry and Medical Biotechnologies, University of Naples Federico II, Naples; Spina, Anna

    2008-12-12

    Multiple evidence demonstrate a role for serotonin and its transporter SERT in heart valve development and disease. By utilizing a Cre/loxP system driven by SERT gene expression, we recently demonstrated a regionally restricted distribution of SERT-expressing cells in developing mouse heart. In order to characterize the cell types exhibiting SERT expression within the mouse heart valves at early developmental stages, in this study we performed immunohistochemistry for Islet1 (Isl1) and connexin-43 (Cx-43) on heart sections from SERT{sup Cre/+};ROSA26R embryos previously stained with X-gal. We observed the co-localization of LacZ staining with Isl1 labelling in the outflow tract, the right ventriclemore » and the conal region of E11.5 mouse heart. Cx-43 labelled cells co-localized with LacZ stained cells in the forming atrioventricular valves. These results demonstrate the cardiomyocyte phenotype of SERT-expressing cells in heart valves of the developing mouse heart, thus suggesting an active role of SERT in early heart valve development.« less

  19. Regulatory role of AINTEGUMENTA in organ initiation and growth

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Krizek, Beth Allyn; Lebioda, Lukasz

    2005-03-01

    Although several members of the plant-specific AP2/ERF family of transcription factors are important developmental regulators, many genes in this large protein family remain uncharacterized. Here, we present a phylogenetic analysis of the18 genes that make up the AP2 subgroup of this family. We report expression analyses of seven Arabidopsis genes most closely related to the floral development gene AINTEGUMENTA and show that all AINTEGUMENTA-like (AIL) genes are transcribed in multiple tissues during development. They are expressed primarily in young actively dividing tissues of a plant and not in mature leaves or stems. The spatial distribution of AIL5, AIL6, and AIL7more » mRNA in inflorescences was characterized by in situ hybridization. Each of these genes is expressed in a spatially and temporally distinct pattern within inflorescence meristems and flowers. Ectopic expression of AIL5 resulted in a larger floral organ phenotype, similar to that resulting from ectopic expression of ANT. Our results are consistent with AIL genes having roles in specification of meristematic or division-competent states.« less

  20. Interplay between the Localization and Kinetics of Phosphorylation in Flagellar Pole Development of the Bacterium Caulobacter crescentus

    PubMed Central

    Tropini, Carolina; Huang, Kerwyn Casey

    2012-01-01

    Bacterial cells maintain sophisticated levels of intracellular organization that allow for signal amplification, response to stimuli, cell division, and many other critical processes. The mechanisms underlying localization and their contribution to fitness have been difficult to uncover, due to the often challenging task of creating mutants with systematically perturbed localization but normal enzymatic activity, and the lack of quantitative models through which to interpret subtle phenotypic changes. Focusing on the model bacterium Caulobacter crescentus, which generates two different types of daughter cells from an underlying asymmetric distribution of protein phosphorylation, we use mathematical modeling to investigate the contribution of the localization of histidine kinases to the establishment of cellular asymmetry and subsequent developmental outcomes. We use existing mutant phenotypes and fluorescence data to parameterize a reaction-diffusion model of the kinases PleC and DivJ and their cognate response regulator DivK. We then present a systematic computational analysis of the effects of changes in protein localization and abundance to determine whether PleC localization is required for correct developmental timing in Caulobacter. Our model predicts the developmental phenotypes of several localization mutants, and suggests that a novel strain with co-localization of PleC and DivJ could provide quantitative insight into the signaling threshold required for flagellar pole development. Our analysis indicates that normal development can be maintained through a wide range of localization phenotypes, and that developmental defects due to changes in PleC localization can be rescued by increased PleC expression. We also show that the system is remarkably robust to perturbation of the kinetic parameters, and while the localization of either PleC or DivJ is required for asymmetric development, the delocalization of one of these two components does not prevent flagellar pole development. We further find that allosteric regulation of PleC observed in vitro does not affect the predicted in vivo developmental phenotypes. Taken together, our model suggests that cells can tolerate perturbations to localization phenotypes, whose evolutionary origins may be connected with reducing protein expression or with decoupling pre- and post-division phenotypes. PMID:22876167

  1. Brief report: Representational momentum for dynamic facial expressions in pervasive developmental disorder.

    PubMed

    Uono, Shota; Sato, Wataru; Toichi, Motomi

    2010-03-01

    Individuals with pervasive developmental disorder (PDD) have difficulty with social communication via emotional facial expressions, but behavioral studies involving static images have reported inconsistent findings about emotion recognition. We investigated whether dynamic presentation of facial expression would enhance subjective perception of expressed emotion in 13 individuals with PDD and 13 typically developing controls. We presented dynamic and static emotional (fearful and happy) expressions. Participants were asked to match a changeable emotional face display with the last presented image. The results showed that both groups perceived the last image of dynamic facial expression to be more emotionally exaggerated than the static facial expression. This finding suggests that individuals with PDD have an intact perceptual mechanism for processing dynamic information in another individual's face.

  2. Light-sheet fluorescence imaging to localize cardiac lineage and protein distribution

    PubMed Central

    Ding, Yichen; Lee, Juhyun; Ma, Jianguo; Sung, Kevin; Yokota, Tomohiro; Singh, Neha; Dooraghi, Mojdeh; Abiri, Parinaz; Wang, Yibin; Kulkarni, Rajan P.; Nakano, Atsushi; Nguyen, Thao P.; Fei, Peng; Hsiai, Tzung K.

    2017-01-01

    Light-sheet fluorescence microscopy (LSFM) serves to advance developmental research and regenerative medicine. Coupled with the paralleled advances in fluorescence-friendly tissue clearing technique, our cardiac LSFM enables dual-sided illumination to rapidly uncover the architecture of murine hearts over 10 by 10 by 10 mm3 in volume; thereby allowing for localizing progenitor differentiation to the cardiomyocyte lineage and AAV9-mediated expression of exogenous transmembrane potassium channels with high contrast and resolution. Without the steps of stitching image columns, pivoting the light-sheet and sectioning the heart mechanically, we establish a holistic strategy for 3-dimentional reconstruction of the “digital murine heart” to assess aberrant cardiac structures as well as the spatial distribution of the cardiac lineages in neonates and ion-channels in adults. PMID:28165052

  3. Medium-throughput processing of whole mount in situ hybridisation experiments into gene expression domains.

    PubMed

    Crombach, Anton; Cicin-Sain, Damjan; Wotton, Karl R; Jaeger, Johannes

    2012-01-01

    Understanding the function and evolution of developmental regulatory networks requires the characterisation and quantification of spatio-temporal gene expression patterns across a range of systems and species. However, most high-throughput methods to measure the dynamics of gene expression do not preserve the detailed spatial information needed in this context. For this reason, quantification methods based on image bioinformatics have become increasingly important over the past few years. Most available approaches in this field either focus on the detailed and accurate quantification of a small set of gene expression patterns, or attempt high-throughput analysis of spatial expression through binary pattern extraction and large-scale analysis of the resulting datasets. Here we present a robust, "medium-throughput" pipeline to process in situ hybridisation patterns from embryos of different species of flies. It bridges the gap between high-resolution, and high-throughput image processing methods, enabling us to quantify graded expression patterns along the antero-posterior axis of the embryo in an efficient and straightforward manner. Our method is based on a robust enzymatic (colorimetric) in situ hybridisation protocol and rapid data acquisition through wide-field microscopy. Data processing consists of image segmentation, profile extraction, and determination of expression domain boundary positions using a spline approximation. It results in sets of measured boundaries sorted by gene and developmental time point, which are analysed in terms of expression variability or spatio-temporal dynamics. Our method yields integrated time series of spatial gene expression, which can be used to reverse-engineer developmental gene regulatory networks across species. It is easily adaptable to other processes and species, enabling the in silico reconstitution of gene regulatory networks in a wide range of developmental contexts.

  4. Determination of male strobilus developmental stages by cytological and gene expression analyses in Japanese cedar (Cryptomeria japonica).

    PubMed

    Tsubomura, Miyoko; Kurita, Manabu; Watanabe, Atsushi

    2016-05-01

    The molecular mechanisms that control male strobilus development in conifers are largely unknown because the developmental stages and related genes have not yet been characterized. The determination of male strobilus developmental stages will contribute to genetic research and reproductive biology in conifers. Our objectives in this study were to determine the developmental stages of male strobili by cytological and transcriptome analysis, and to determine the stages at which aberrant morphology is observed in a male-sterile mutant of Cryptomeria japonica D. Don to better understand the molecular mechanisms that control male strobilus and pollen development. Male strobilus development was observed for 8 months, from initiation to pollen dispersal. A set of 19,209 expressed sequence tags (ESTs) collected from a male reproductive library and a pollen library was used for microarray analysis. We divided male strobilus development into 10 stages by cytological and transcriptome analysis. Eight clusters (7324 ESTs) exhibited major changes in transcriptome profiles during male strobili and pollen development in C. japonica Two clusters showed a gradual increase and decline in transcript abundance, respectively, while the other six clusters exhibited stage-specific changes. The stages at which the male sterility trait of Sosyun was expressed were identified using information on male strobilus and pollen developmental stages and gene expression profiles. Aberrant morphology was observed cytologically at Stage 6 (microspore stage), and differences in expression patterns compared with wild type were observed at Stage 4 (tetrad stage). © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  5. Distributional Learning in College Students with Developmental Language Disorder

    ERIC Educational Resources Information Center

    Hall, Jessica; Van Horne, Amanda Owen; McGregor, Karla K.; Farmer, Thomas

    2017-01-01

    Purpose: This study examined whether college students with developmental language disorder (DLD) could use distributional information in an artificial language to learn about grammatical category membership in a way similar to their typically developing (TD) peers. Method: Seventeen college students with DLD and 17 TD college students participated…

  6. Genome-wide identification and characterization of the NF-Y gene family in grape (vitis vinifera L.).

    PubMed

    Ren, Chong; Zhang, Zhan; Wang, Yi; Li, Shaohua; Liang, Zhenchang

    2016-08-11

    Nuclear factor Y (NF-Y) transcription factor is composed of three distinct subunits: NF-YA, NF-YB and NF-YC. Many members of NF-Y family have been reported to be key regulators in plant development, phytohormone signaling and drought tolerance. However, the function of the NF-Y family is less known in grape (Vitis vinifera L.). A total of 34 grape NF-Y genes that distributed unevenly on grape (V. vinifera) chromosomes were identified in this study. Phylogenetic analysis was performed to predict functional similarities between Arabidopsis thaliana and grape NF-Y genes. Comparison of the structures of grape NF-Y genes (VvNF-Ys) revealed their functional conservation and alteration. Furthermore, we investigated the expression profiles of VvNF-Ys in response to various stresses, phytohormone treatments, and in leaves and grape berries with various sugar contents at different developmental stages. The relationship between VvNF-Y transcript levels and sugar content was examined to select candidates for exogenous sugar treatments. Quantitative real-time PCR (qPCR) indicated that many VvNF-Ys responded to different sugar stimuli with variations in transcript abundance. qPCR and publicly available microarray data suggest that VvNF-Ys exhibit distinct expression patterns in different grape organs and developmental stages, and a number of VvNF-Ys may participate in responses to multiple abiotic and biotic stresses, phytohormone treatments and sugar accumulation or metabolism. In this study, we characterized 34 VvNF-Ys based on their distributions on chromosomes, gene structures, phylogenetic relationship with Arabidopsis NF-Y genes, and their expression patterns. The potential roles of VvNF-Ys in sugar accumulation or metabolism were also investigated. Altogether, the data provide significant insights on VvNF-Ys, and lay foundations for further functional studies of NF-Y genes in grape.

  7. Developmental Thyroid Hormone Insufficiency Reduces Expression of Brain-Derived Neurotrophic Factor (BDNF) in Adults But Not in Neonates

    EPA Science Inventory

    Brain-derived neurotrophic factor (BDNF) is a neurotrophin critical for many developmental and physiological aspects of CNS function. Severe hypothyroidism in the early neonatal period results in developmental and cognitive impairments and reductions in mRNA and protein expressio...

  8. Sexuality and Developmental Disability: Obstacles to Healthy Sexuality throughout the Lifespan

    ERIC Educational Resources Information Center

    Richards, Deborah; Miodrag, Nancy; Watson, Shelley L.

    2006-01-01

    This paper presents a lifespan perspective of sexuality issues for individuals with developmental disabilities. Individuals with developmental disabilities are human beings who have historically been denied the right to express their sexuality or engage in sexual relationships due to misconceptions or negative attitudes. Using a hypothetical case…

  9. Tissue Specificity and Dynamics of Sex-Biased Gene Expression in a Common Frog Population with Differentiated, Yet Homomorphic, Sex Chromosomes.

    PubMed

    Ma, Wen-Juan; Veltsos, Paris; Toups, Melissa A; Rodrigues, Nicolas; Sermier, Roberto; Jeffries, Daniel L; Perrin, Nicolas

    2018-06-12

    Sex-biased genes are central to the study of sexual selection, sexual antagonism, and sex chromosome evolution. We describe a comprehensive de novo assembled transcriptome in the common frog Rana temporaria based on five developmental stages and three adult tissues from both sexes, obtained from a population with karyotypically homomorphic but genetically differentiated sex chromosomes. This allows the study of sex-biased gene expression throughout development, and its effect on the rate of gene evolution while accounting for pleiotropic expression, which is known to negatively correlate with the evolutionary rate. Overall, sex-biased genes had little overlap among developmental stages and adult tissues. Late developmental stages and gonad tissues had the highest numbers of stage- or tissue-specific genes. We find that pleiotropic gene expression is a better predictor than sex bias for the evolutionary rate of genes, though it often interacts with sex bias. Although genetically differentiated, the sex chromosomes were not enriched in sex-biased genes, possibly due to a very recent arrest of XY recombination. These results extend our understanding of the developmental dynamics, tissue specificity, and genomic localization of sex-biased genes.

  10. Using the preschool language scale, fourth edition to characterize language in preschoolers with autism spectrum disorders.

    PubMed

    Volden, Joanne; Smith, Isabel M; Szatmari, Peter; Bryson, Susan; Fombonne, Eric; Mirenda, Pat; Roberts, Wendy; Vaillancourt, Tracy; Waddell, Charlotte; Zwaigenbaum, Lonnie; Georgiades, Stelios; Duku, Eric; Thompson, Ann

    2011-08-01

    The Preschool Language Scale, Fourth Edition (PLS-4; Zimmerman, Steiner, & Pond, 2002) was used to examine syntactic and semantic language skills in preschool children with autism spectrum disorders (ASD) to determine its suitability for use with this population. We expected that PLS-4 performance would be better in more intellectually able children and that receptive skills would be relatively more impaired than expressive abilities, consistent with previous findings in the area of vocabulary. Our sample consisted of 294 newly diagnosed preschool children with ASD. Children were assessed via a battery of developmental measures, including the PLS-4. As expected, PLS-4 scores were higher in more intellectually able children with ASD, and overall, expressive communication was higher than auditory comprehension. However, this overall advantage was not stable across nonverbal developmental levels. Expressive skills were significantly better than receptive skills at the youngest developmental levels, whereas the converse applied in children with more advanced development. The PLS-4 can be used to obtain a general index of early syntax and semantic skill in young children with ASD. Longitudinal data will be necessary to determine how the developmental relationship between receptive and expressive language skills unfolds in children with ASD.

  11. Understanding development and stem cells using single cell-based analyses of gene expression.

    PubMed

    Kumar, Pavithra; Tan, Yuqi; Cahan, Patrick

    2017-01-01

    In recent years, genome-wide profiling approaches have begun to uncover the molecular programs that drive developmental processes. In particular, technical advances that enable genome-wide profiling of thousands of individual cells have provided the tantalizing prospect of cataloging cell type diversity and developmental dynamics in a quantitative and comprehensive manner. Here, we review how single-cell RNA sequencing has provided key insights into mammalian developmental and stem cell biology, emphasizing the analytical approaches that are specific to studying gene expression in single cells. © 2017. Published by The Company of Biologists Ltd.

  12. Stability of the cytoskeleton of matured buffalo oocytes pretreated with cytochalasin B prior to vitrification.

    PubMed

    Wang, C L; Xu, H Y; Xie, L; Lu, Y Q; Yang, X G; Lu, S S; Lu, K H

    2016-06-01

    Stabilizing the cytoskeleton system during vitrification can improve the post-thaw survival and development of vitrified oocytes. The cytoskeleton stabilizer cytochalasin B (CB) has been used in cryopreservation to improve the developmental competence of vitrified oocytes. To assess the effect of pretreating matured buffalo oocytes with CB before vitrification, we applied 0, 4, 8, or 12 μg/mL CB for 30 min. The optimum concentration of CB treatment (8 μg/mL for 30 min) was then used to evaluate the distribution of microtubules and microfilaments, the expression of the cytoskeleton proteins actin and tubulin, and the developmental potential of matured oocytes that were vitrified-warmed by the Cryotop method. Western blotting demonstrated that vitrification significantly decreased tubulin expression, but that the decrease was attenuated for oocytes pretreated with 8 μg/mL CB before vitrification. After warming and intracytoplasmic sperm injection, oocytes that were pretreated with 8 μg/mL CB before vitrification yielded significantly higher 8-cell and blastocyst rates than those that were vitrified without CB pretreatment. The values for the vitrified groups in all experiments were significantly lower (P < 0.01) than those of the control groups. In conclusion, pretreatment with 8 μg/mL CB for 30 min significantly improves the cytoskeletal structure, expression of tubulin, and development capacity of vitrified matured buffalo oocytes. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Functional characterization of duplicated Suppressor of Overexpression of Constans 1-like genes in petunia.

    PubMed

    Preston, Jill C; Jorgensen, Stacy A; Jha, Suryatapa G

    2014-01-01

    Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae), many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1) in the short-lived perennial Petunia hybrida (petunia, Solanaceae). Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS) and Floral Binding Protein 21 (FBP21), but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.

  14. Functional Characterization of Duplicated SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1-Like Genes in Petunia

    PubMed Central

    Preston, Jill C.; Jorgensen, Stacy A.; Jha, Suryatapa G.

    2014-01-01

    Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae), many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (SOC1) in the short-lived perennial Petunia hybrida (petunia, Solanaceae). Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes UNSHAVEN (UNS) and FLORAL BINDING PROTEIN 21 (FBP21), but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods. PMID:24787903

  15. Developmental Expression of Kv Potassium Channels at the Axon Initial Segment of Cultured Hippocampal Neurons

    PubMed Central

    Sánchez-Ponce, Diana; DeFelipe, Javier; Garrido, Juan José; Muñoz, Alberto

    2012-01-01

    Axonal outgrowth and the formation of the axon initial segment (AIS) are early events in the acquisition of neuronal polarity. The AIS is characterized by a high concentration of voltage-dependent sodium and potassium channels. However, the specific ion channel subunits present and their precise localization in this axonal subdomain vary both during development and among the types of neurons, probably determining their firing characteristics in response to stimulation. Here, we characterize the developmental expression of different subfamilies of voltage-gated potassium channels in the AISs of cultured mouse hippocampal neurons, including subunits Kv1.2, Kv2.2 and Kv7.2. In contrast to the early appearance of voltage-gated sodium channels and the Kv7.2 subunit at the AIS, Kv1.2 and Kv2.2 subunits were tethered at the AIS only after 10 days in vitro. Interestingly, we observed different patterns of Kv1.2 and Kv2.2 subunit expression, with each confined to distinct neuronal populations. The accumulation of Kv1.2 and Kv2.2 subunits at the AIS was dependent on ankyrin G tethering, it was not affected by disruption of the actin cytoskeleton and it was resistant to detergent extraction, as described previously for other AIS proteins. This distribution of potassium channels in the AIS further emphasizes the heterogeneity of this structure in different neuronal populations, as proposed previously, and suggests corresponding differences in action potential regulation. PMID:23119056

  16. Commonly dysregulated genes in murine APL cells

    PubMed Central

    Yuan, Wenlin; Payton, Jacqueline E.; Holt, Matthew S.; Link, Daniel C.; Watson, Mark A.; DiPersio, John F.; Ley, Timothy J.

    2007-01-01

    To identify genes that are commonly dysregulated in a murine model of acute promyelocytic leukemia (APL), we first defined gene expression patterns during normal murine myeloid development; serial gene expression profiling studies were performed with primary murine hematopoietic progenitors that were induced to undergo myeloid maturation in vitro with G-CSF. Many genes were reproducibly expressed in restricted developmental “windows,” suggesting a structured hierarchy of expression that is relevant for the induction of developmental fates and/or differentiated cell functions. We compared the normal myeloid developmental transcriptome with that of APL cells derived from mice expressing PML-RARα under control of the murine cathepsin G locus. While many promyelocyte-specific genes were highly expressed in all APL samples, 116 genes were reproducibly dysregulated in many independent APL samples, including Fos, Jun, Egr1, Tnf, and Vcam1. However, this set of commonly dysregulated genes was expressed normally in preleukemic, early myeloid cells from the same mouse model, suggesting that dysregulation occurs as a “downstream” event during disease progression. These studies suggest that the genetic events that lead to APL progression may converge on common pathways that are important for leukemia pathogenesis. PMID:17008535

  17. H19, a marker of developmental transition, is reexpressed in human atherosclerotic plaques and is regulated by the insulin family of growth factors in cultured rabbit smooth muscle cells.

    PubMed

    Han, D K; Khaing, Z Z; Pollock, R A; Haudenschild, C C; Liau, G

    1996-03-01

    H19 is a developmentally regulated gene with putative tumor suppressor activity, and loss of H19 expression may be involved in Wilms' tumorigenesis. In this report, we have performed in situ hybridization analysis of H19 expression during normal rabbit development and in human atherosclerotic plaques. We have also used cultured smooth muscle cells to identify H19 regulatory factors. Our data indicate that H19 expression in the developing skeletal and smooth muscles correlated with specific differentiation events in these tissues. Expression of H19 in the skeletal muscle correlated with nonproliferative, actin-positive muscle cells. In the prenatal blood vessel, H19 expression was both temporally and spatially regulated with initial loss of expression in the inner smooth muscle layers adjacent to the lumen. We also identified H19-positive cells within the adult atherosclerotic lesion and we suggest that these cells may recapitulate earlier developmental events. These results, along with the identification of the insulin family of growth factors as potent regulatory molecules for H19 expression, provide additional clues toward understanding the physiological regulation and function of H19.

  18. H19, a marker of developmental transition, is reexpressed in human atherosclerotic plaques and is regulated by the insulin family of growth factors in cultured rabbit smooth muscle cells.

    PubMed Central

    Han, D K; Khaing, Z Z; Pollock, R A; Haudenschild, C C; Liau, G

    1996-01-01

    H19 is a developmentally regulated gene with putative tumor suppressor activity, and loss of H19 expression may be involved in Wilms' tumorigenesis. In this report, we have performed in situ hybridization analysis of H19 expression during normal rabbit development and in human atherosclerotic plaques. We have also used cultured smooth muscle cells to identify H19 regulatory factors. Our data indicate that H19 expression in the developing skeletal and smooth muscles correlated with specific differentiation events in these tissues. Expression of H19 in the skeletal muscle correlated with nonproliferative, actin-positive muscle cells. In the prenatal blood vessel, H19 expression was both temporally and spatially regulated with initial loss of expression in the inner smooth muscle layers adjacent to the lumen. We also identified H19-positive cells within the adult atherosclerotic lesion and we suggest that these cells may recapitulate earlier developmental events. These results, along with the identification of the insulin family of growth factors as potent regulatory molecules for H19 expression, provide additional clues toward understanding the physiological regulation and function of H19. PMID:8636440

  19. Impaired perception of facial emotion in developmental prosopagnosia.

    PubMed

    Biotti, Federica; Cook, Richard

    2016-08-01

    Developmental prosopagnosia (DP) is a neurodevelopmental condition characterised by difficulties recognising faces. Despite severe difficulties recognising facial identity, expression recognition is typically thought to be intact in DP; case studies have described individuals who are able to correctly label photographic displays of facial emotion, and no group differences have been reported. This pattern of deficits suggests a locus of impairment relatively late in the face processing stream, after the divergence of expression and identity analysis pathways. To date, however, there has been little attempt to investigate emotion recognition systematically in a large sample of developmental prosopagnosics using sensitive tests. In the present study, we describe three complementary experiments that examine emotion recognition in a sample of 17 developmental prosopagnosics. In Experiment 1, we investigated observers' ability to make binary classifications of whole-face expression stimuli drawn from morph continua. In Experiment 2, observers judged facial emotion using only the eye-region (the rest of the face was occluded). Analyses of both experiments revealed diminished ability to classify facial expressions in our sample of developmental prosopagnosics, relative to typical observers. Imprecise expression categorisation was particularly evident in those individuals exhibiting apperceptive profiles, associated with problems encoding facial shape accurately. Having split the sample of prosopagnosics into apperceptive and non-apperceptive subgroups, only the apperceptive prosopagnosics were impaired relative to typical observers. In our third experiment, we examined the ability of observers' to classify the emotion present within segments of vocal affect. Despite difficulties judging facial emotion, the prosopagnosics exhibited excellent recognition of vocal affect. Contrary to the prevailing view, our results suggest that many prosopagnosics do experience difficulties classifying expressions, particularly those with apperceptive profiles. These individuals may have difficulties forming view-invariant structural descriptions at an early stage in the face processing stream, before identity and expression pathways diverge. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. A novel galanin receptor 1a gene in zebrafish: tissue distribution, developmental expression roles in nutrition regulation.

    PubMed

    Li, Linfang; Wei, Shulei; Huang, Qiaoyan; Feng, Dong; Zhang, Shicui; Liu, Zhenhui

    2013-03-01

    Galanin (Gal), a 29 (30 in human) amino acid neuropeptide, exerts its biological activities through three different G protein-coupled receptors, namely GalR1, GalR2 and GalR3. However, we previously found that only GalR1 and GalR2 exist in fish, and fish GalR1 has two genes (GalR1a and GalR1b), with GalR1a possibly representing the primitive gene form during fish evolution. To uncover the functions of GalR1a in fish, here the tissue distribution, developmental expression and the role in nutrition regulation of GalR1a were investigated in zebrafish (Danio rerio). Interestingly, the expression of GalR1a mRNA was restricted to the intestine and brain in adult zebrafish, while GalR1b mRNA was present in all tissues tested. During embryogenesis, GalR1a mRNA was abundant at 1hpf (hour past fertilization) and decreased gradually in abundance from 3 hpf to 10 hpf; then a significant increase in the amount of GalR1a transcripts was observed at 35 hpf, and this high level was maintained until 5 dpf (day past fertilization). In situ hybridization of embryos and larvae, expression pattern of GalR1a was mainly restricted to the intestine, pectoral fin, branchial arches and head, indicating a role of GalR1a during zebrafish embryogenesis. Quantitative real-time PCR assay suggested that fasting, high fat feeding or linoleic acid (LA) all could significantly induce up-regulation of GalR1a both in vitro and in vivo, suggesting roles of GalR1a in control of nutrition intake, especially to fat. In addition, a potential role of zebrafish GalR1a in accumulation of lipid droplets in cells was also demonstrated. Our study lays a foundation for further investigation of GalR1a function and evolution in fish. Copyright © 2012 Elsevier Inc. All rights reserved.

  1. A study of the role of the FOXP2 and CNTNAP2 genes in persistent developmental stuttering.

    PubMed

    Han, Tae-Un; Park, John; Domingues, Carlos F; Moretti-Ferreira, Danilo; Paris, Emily; Sainz, Eduardo; Gutierrez, Joanne; Drayna, Dennis

    2014-09-01

    A number of speech disorders including stuttering have been shown to have important genetic contributions, as indicated by high heritability estimates from twin and other studies. We studied the potential contribution to stuttering from variants in the FOXP2 gene, which have previously been associated with developmental verbal dyspraxia, and from variants in the CNTNAP2 gene, which have been associated with specific language impairment (SLI). DNA sequence analysis of these two genes in a group of 602 unrelated cases, all with familial persistent developmental stuttering, revealed no excess of potentially deleterious coding sequence variants in the cases compared to a matched group of 487 well characterized neurologically normal controls. This was compared to the distribution of variants in the GNPTAB, GNPTG, and NAGPA genes which have previously been associated with persistent stuttering. Using an expanded subject data set, we again found that NAGPA showed significantly different mutation frequencies in North Americans of European descent (p=0.0091) and a significant difference existed in the mutation frequency of GNPTAB in Brazilians (p=0.00050). No significant differences in mutation frequency in the FOXP2 and CNTNAP2 genes were observed between cases and controls. To examine the pattern of expression of these five genes in the human brain, real time quantitative reverse transcription PCR was performed on RNA purified from 27 different human brain regions. The expression patterns of FOXP2 and CNTNAP2 were generally different from those of GNPTAB, GNPTG and NAPGA in terms of relatively lower expression in the cerebellum. This study provides an improved estimate of the contribution of mutations in GNPTAB, GNPTG and NAGPA to persistent stuttering, and suggests that variants in FOXP2 and CNTNAP2 are not involved in the genesis of familial persistent stuttering. This, together with the different brain expression patterns of GNPTAB, GNPTG, and NAGPA compared to that of FOXP2 and CNTNAP2, suggests that the genetic neuropathological origins of stuttering differ from those of verbal dyspraxia and SLI. Published by Elsevier Inc.

  2. On Expression Patterns and Developmental Origin of Human Brain Regions.

    PubMed

    Kirsch, Lior; Chechik, Gal

    2016-08-01

    Anatomical substructures of the human brain have characteristic cell-types, connectivity and local circuitry, which are reflected in area-specific transcriptome signatures, but the principles governing area-specific transcription and their relation to brain development are still being studied. In adult rodents, areal transcriptome patterns agree with the embryonic origin of brain regions, but the processes and genes that preserve an embryonic signature in regional expression profiles were not quantified. Furthermore, it is not clear how embryonic-origin signatures of adult-brain expression interplay with changes in expression patterns during development. Here we first quantify which genes have regional expression-patterns related to the developmental origin of brain regions, using genome-wide mRNA expression from post-mortem adult human brains. We find that almost all human genes (92%) exhibit an expression pattern that agrees with developmental brain-region ontology, but that this agreement changes at multiple phases during development. Agreement is particularly strong in neuron-specific genes, but also in genes that are not spatially correlated with neuron-specific or glia-specific markers. Surprisingly, agreement is also stronger in early-evolved genes. We further find that pairs of similar genes having high agreement to developmental region ontology tend to be more strongly correlated or anti-correlated, and that the strength of spatial correlation changes more strongly in gene pairs with stronger embryonic signatures. These results suggest that transcription regulation of most genes in the adult human brain is spatially tuned in a way that changes through life, but in agreement with development-determined brain regions.

  3. On Expression Patterns and Developmental Origin of Human Brain Regions

    PubMed Central

    Kirsch, Lior; Chechik, Gal

    2016-01-01

    Anatomical substructures of the human brain have characteristic cell-types, connectivity and local circuitry, which are reflected in area-specific transcriptome signatures, but the principles governing area-specific transcription and their relation to brain development are still being studied. In adult rodents, areal transcriptome patterns agree with the embryonic origin of brain regions, but the processes and genes that preserve an embryonic signature in regional expression profiles were not quantified. Furthermore, it is not clear how embryonic-origin signatures of adult-brain expression interplay with changes in expression patterns during development. Here we first quantify which genes have regional expression-patterns related to the developmental origin of brain regions, using genome-wide mRNA expression from post-mortem adult human brains. We find that almost all human genes (92%) exhibit an expression pattern that agrees with developmental brain-region ontology, but that this agreement changes at multiple phases during development. Agreement is particularly strong in neuron-specific genes, but also in genes that are not spatially correlated with neuron-specific or glia-specific markers. Surprisingly, agreement is also stronger in early-evolved genes. We further find that pairs of similar genes having high agreement to developmental region ontology tend to be more strongly correlated or anti-correlated, and that the strength of spatial correlation changes more strongly in gene pairs with stronger embryonic signatures. These results suggest that transcription regulation of most genes in the adult human brain is spatially tuned in a way that changes through life, but in agreement with development-determined brain regions. PMID:27564987

  4. Enhancer modularity and the evolution of new traits.

    PubMed

    Koshikawa, Shigeyuki

    2015-01-01

    Animals have modular cis-regulatory regions in their genomes, and expression of a single gene is often regulated by multiple enhancers residing in such a region. In the laboratory, and also in natural populations, loss of an enhancer can result in a loss of gene expression. Although only a few examples have been well characterized to date, some studies have suggested that an evolutionary gain of a new enhancer function can establish a new gene expression domain. Our recent study showed that Drosophila guttifera has more enhancers and additional expression domains of the wingless gene during the pupal stage, compared to D. melanogaster, and that these new features appear to have evolved in the ancestral lineage leading to D. guttifera. (1) Gain of a new expression domain of a developmental regulatory gene (toolkit gene), such as wingless, can cause co-option of the expression of its downstream genes to the new domain, resulting in duplication of a preexisting structure at this new body position. Recently, with the advancement of evo-devo studies, we have learned that the developmental regulatory systems are strikingly similar across various animal taxa, in spite of the great diversity of the animals' morphology. Even behind "new" traits, co-options of essential developmental genes from known systems are very common. We previously provided concrete evidence of gains of enhancer activities of a developmental regulatory gene underlying gains of new traits. (1) Broad occurrence of this scenario is testable and should be validated in the future.

  5. Reciprocal expression of integration host factor and HU in the developmental cycle and infectivity of Legionella pneumophila.

    PubMed

    Morash, Michael G; Brassinga, Ann Karen C; Warthan, Michelle; Gourabathini, Poornima; Garduño, Rafael A; Goodman, Steven D; Hoffman, Paul S

    2009-04-01

    Legionella pneumophila is an intracellular parasite of protozoa that differentiates late in infection into metabolically dormant cysts that are highly infectious. Regulation of this process is poorly understood. Here we report that the small DNA binding regulatory proteins integration host factor (IHF) and HU are reciprocally expressed over the developmental cycle, with HU expressed during exponential phase and IHF expressed postexponentially. To assess the role of these regulatory proteins in development, chromosomal deletions were constructed. Single (ihfA or ihfB) and double deletion (Deltaihf) IHF mutants failed to grow in Acanthamoeba castellanii unless complemented in trans when expressed temporally from the ihfA promoter but not under P(tac) (isopropyl-beta-d-thiogalactopyranoside). In contrast, IHF mutants were infectious for HeLa cells, though electron microscopic examination revealed defects in late-stage cyst morphogenesis (thickened cell wall, intracytoplasmic membranes, and inclusions of poly-beta-hydroxybutyrate), and were depressed for the developmental marker MagA. Green fluorescent protein promoter fusion assays indicated that IHF and the stationary-phase sigma factor RpoS were required for full postexponential expression of magA. Finally, defects in cyst morphogenesis noted for Deltaihf mutants in HeLa cells correlated with a loss of both detergent resistance and hyperinfectivity compared with results for wild-type cysts. These studies establish IHF and HU as markers of developmental stages and show that IHF function is required for both differentiation and full virulence of L. pneumophila in natural amoebic hosts.

  6. Desmin and nerve terminal expression during embryonic development of the lateral pterygoid muscle in mice.

    PubMed

    Yamamoto, Masahito; Shinomiya, Takashi; Kishi, Asuka; Yamane, Shigeki; Umezawa, Takashi; Ide, Yoshinobu; Abe, Shinichi

    2014-09-01

    In adults, the lateral pterygoid muscle (LPM) is usually divided into the upper and lower head, between which the buccal nerve passes. Recent investigations have demonstrated foetal developmental changes in the topographical relationship between the human LPM and buccal nerve. However, as few studies have investigated this issue, we clarified the expression of desmin and nerve terminal distribution during embryonic development of the LPM in mice. We utilized immunohistochemical staining and reverse transcription chain reaction (RT-PCR) to clarify the expression of desmin and nerve terminal distribution. We observed weak expression of desmin in the LPM at embryonic day (ED) 11, followed by an increase in expression from embryonic days 12-15. In addition, starting at ED 12, we observed preferential accumulation of desmin in the vicinity of the myotendinous junction, a trend that did not change up to ED 15. Nerve terminal first appeared at ED 13 and formed regularly spaced linear arrays at the centre of the muscle fibre by ED 15. The results of immunohistochemical staining agreed with those of RT-PCR analysis. We found that desmin accumulated in the vicinity of the myotendinous junction starting at ED 12, prior to the onset of jaw movement. We speculate that the accumulation of desmin is due to factors other than mechanical stress experienced during early muscle contraction. Meanwhile, the time point at which nerve terminals first appeared roughly coincided with the onset of jaw movement. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Developmental toxicity and alteration of gene expression in zebrafish embryos exposed to PFOS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shi Xiongjie; Graduate School of the Chinese Academy of Sciences, Beijing 100039; Du Yongbing

    2008-07-01

    Perfluorooctanesulfonate (PFOS) is a persistent organic pollutant, the potential toxicity of which is causing great concern. In the present study, we employed zebrafish embryos to investigate the developmental toxicity of this compound. Four-hour post-fertilization (hpf) zebrafish embryos were exposed to 0.1, 0.5, 1, 3 and 5 mg/L PFOS. Hatching was delayed and hatching rates as well as larval survivorship were significantly reduced after the embryos were exposed to 1, 3 and 5 mg/L PFOS until 132 hpf. The fry displayed gross developmental malformations, including epiboly deformities, hypopigmentation, yolk sac edema, tail and heart malformations and spinal curvature upon exposure tomore » PFOS concentrations of 1 mg/L or greater. Growth (body length) was significantly reduced in the 3 and 5 mg/L PFOS-treated groups. To test whether developmental malformation was mediated via apoptosis, flow cytometry analysis of DNA content, acridine orange staining and TUNEL assay was used. These techniques indicated that more apoptotic cells were present in the PFOS-treated embryos than in the control embryos. Certain genes related to cell apoptosis, p53 and Bax, were both significantly up-regulated upon exposure to all the concentrations tested. In addition, we investigated the effects of PFOS on marker genes related to early thyroid development (hhex and pax8) and genes regulating the balance of androgens and estrogens (cyp19a and cyp19b). For thyroid development, the expression of hhex was significantly up-regulated at all concentrations tested, whereas pax8 expression was significantly up-regulated only upon exposure to lower concentrations of PFOS (0.1, 0.5, 1 mg/L). The expression of cyp19a and of cyp19b was significantly down-regulated at all exposure concentrations. The overall results indicated that zebrafish embryos constitute a reliable model for testing the developmental toxicity of PFOS, and the gene expression patterns in the embryos were able to reveal some potential mechanisms of developmental toxicity.« less

  8. Regulatory mutations in TBX3 disrupt asymmetric hair pigmentation that underlies Dun camouflage color in horses

    PubMed Central

    Imsland, Freyja; McGowan, Kelly; Rubin, Carl-Johan; Henegar, Corneliu; Sundström, Elisabeth; Berglund, Jonas; Schwochow, Doreen; Gustafson, Ulla; Imsland, Páll; Lindblad-Toh, Kerstin; Lindgren, Gabriella; Mikko, Sofia; Millon, Lee; Wade, Claire; Schubert, Mikkel; Orlando, Ludovic; Penedo, Maria Cecilia T; Barsh, Gregory S; Andersson, Leif

    2016-01-01

    Dun is a wild-type coat color in horses characterized by pigment dilution with a striking pattern of dark areas termed primitive markings. Here we show that pigment dilution in Dun horses is due to radially asymmetric deposition of pigment in the growing hair caused by localized expression of the T-box 3 (TBX3) transcription factor in hair follicles, which in turn determines the distribution of hair follicle melanocytes. Most domestic horses are non-dun, a more intensely pigmented phenotype caused by regulatory mutations impairing TBX3 expression in the hair follicle, resulting in a more circumferential distribution of melanocytes and pigment granules in individual hairs. We identified two different alleles (non-dun1 and non-dun2) causing non-dun color. non-dun2 is a recently derived allele, whereas the Dun and non-dun1 alleles are found in ancient horse DNA, demonstrating that this polymorphism predates horse domestication. These findings uncover a new developmental role for T-box genes and new aspects of hair follicle biology and pigmentation. PMID:26691985

  9. Functional characterization of three MicroRNAs of the Asian Tiger Mosquito, Aedes albopictus

    PubMed Central

    2013-01-01

    Background Temporal and stage specific expression of microRNAs (miRNAs) in embryos, larvae, pupae and adults of Aedes albopictus showed differential expression levels across the four developmental stages, indicating their potential regulatory roles in mosquito development. The functional characterization of these miRNAs was not known. Accordingly our study evaluated the functional characterization of three miRNAs, which are temporally up-regulated in the various developmental stages of Ae. albopictus mosquitoes. Methods miRNA mimics, inhibitors and negative controls were designed and their knock-in and knock-down efficiency were analyzed by qRT-PCR after transfecting the mosquito cell lines C6/36, and also by injecting in their specific developmental stages. The functional role of each individual miRNA was analyzed with various parameters of development such as, hatching rate and hatching time in embryos, eclosion rate in larvae, longevity and fecundity in the adult mosquitoes. Results The knock-in with the specifically designed miRNA mimics showed increased levels of expression of miRNA compared with their normal controls. We confirmed these findings using qRT-PCR, both by in vitro expression in C6/36 mosquito cell lines after transfection as well as in in vivo expression in developmental stages of mosquitoes by microinjection. The knock-down of expression with the corresponding inhibitors showed a considerable decrease in the expression levels of these miRNAs and obvious functional effects in Ae. albopictus development, detected by a decrease in the hatching rate of embryos and eclosion rate in larvae and a marked reduction in longevity and fecundity in adults. Conclusion This study carried out by knock-in and knock-down of specifically and temporally expressed miRNAs in Ae. albopictus by microinjection is a novel study to delineate the importance of the miRNA expression in regulating mosquito development. The knock-down and loss of function of endogenously expressed miRNAs by the miRNA inhibitors in specific developmental stages had considerable effects on development, but enhancement of their gain of function was not observed on knock-in of these specific miRNAs. Hence, our study indicates that an optimal level of endogenous expression of miRNA is indispensable for the normal development and maintenance of the vectorial population density and pathogen transmissibility of this mosquito vector. PMID:23924583

  10. Genome-wide identification and characterization of auxin response factor (ARF) family genes related to flower and fruit development in papaya (Carica papaya L.).

    PubMed

    Liu, Kaidong; Yuan, Changchun; Li, Haili; Lin, Wanhuang; Yang, Yanjun; Shen, Chenjia; Zheng, Xiaolin

    2015-11-05

    Auxin and auxin signaling are involved in a series of developmental processes in plants. Auxin Response Factors (ARFs) is reported to modulate the expression of target genes by binding to auxin response elements (AuxREs) and influence the transcriptional activation of down-stream target genes. However, how ARF genes function in flower development and fruit ripening of papaya (Carica papaya L.) is largely unknown. In this study, a comprehensive characterization and expression profiling analysis of 11 C. papaya ARF (CpARF) genes was performed using the newly updated papaya reference genome data. We analyzed CpARF expression patterns at different developmental stages. CpARF1, CpARF2, CpARF4, CpARF5, and CpARF10 showed the highest expression at the initial stage of flower development, but decreased during the following developmental stages. CpARF6 expression increased during the developmental process and reached its peak level at the final stage of flower development. The expression of CpARF1 increased significantly during the fruit ripening stages. Many AuxREs were included in the promoters of two ethylene signaling genes (CpETR1 and CpETR2) and three ethylene-synthesis-related genes (CpACS1, CpACS2, and CpACO1), suggesting that CpARFs might be involved in fruit ripening via the regulation of ethylene signaling. Our study provided comprehensive information on ARF family in papaya, including gene structures, chromosome locations, phylogenetic relationships, and expression patterns. The involvement of CpARF gene expression changes in flower and fruit development allowed us to understand the role of ARF-mediated auxin signaling in the maturation of reproductive organs in papaya.

  11. Developmental transcriptome analysis of floral transition in Rosa odorata var. gigantea.

    PubMed

    Guo, Xuelian; Yu, Chao; Luo, Le; Wan, Huihua; Zhen, Ni; Li, Yushu; Cheng, Tangren; Wang, Jia; Pan, Huitang; Zhang, Qixiang

    2018-05-07

    Expression analyses revealed that floral transition of Rosa odorata var. gigantea is mainly regulated by VRN1, COLs, DELLA and KSN, with contributions by the effects of phytohormone and starch metabolism. Seasonal plants utilize changing environmental and developmental cues to control the transition from vegetative growth to flowering at the correct time of year. This study investigated global gene expression profiles at different developmental stages of Rosa odorata var. gigantea by RNA-sequencing, combined with phenotypic characterization and physiological changes. Gene ontology enrichment analysis of the differentially expressed genes (DEGs) between four different developmental stages (vegetative meristem, pre-floral meristem, floral meristem and secondary axillary buds) indicated that DNA methylation and the light reaction played a large role in inducing the rose floral transition. The expression of SUF and FLC, which are known to play a role in delaying flowering until vernalization, was down-regulated from the vegetative to the pre-floral meristem stage. In contrast, the expression of VRN1, which promotes flowering by repressing FLC expression, increased. The expression of DELLA proteins, which function as central nodes in hormone signaling pathways, and probably involve interactions between GA, auxin, and ABA to promote the floral transition, was well correlated with the expression of floral integrators, such as AGL24, COL4. We also identified DEGs associated with starch metabolism correlated with SOC1, AGL15, SPL3, AGL24, respectively. Taken together, our results suggest that vernalization and photoperiod are prominent cues to induce the rose floral transition, and that DELLA proteins also act as key regulators. The results summarized in the study on the floral transition of the seasonal rose lay a foundation for further functional demonstration, and have profound economic and ornamental values.

  12. Developmental expression of Toll‑like receptors in the guinea pig lung.

    PubMed

    Ma, Lingjie; Yang, Jiali; Yang, Li; Shi, Juan; Xue, Jing; Li, Yong; Liu, Xiaoming

    2017-03-01

    The guinea pig is a useful model for investigating infectious and non‑infectious lung diseases due to the sensitivity of its respiratory system and susceptibility to infectious agents. Toll‑like receptors (TLRs) are important components of the innate immune response and are critical for lung immune function. In the present study, the differentiation of epithelial cells in the guinea pig lung was examined during gestation by studying anatomic morphology and the major epithelial cell types using cell type‑specific markers. The developmental expression of all 9 TLRs and the TLR signaling adaptors myeloid differentiation factor 88 (MyD88) and tumor necrosis factor receptor associated factor 6 (TRAF‑6) were investigated by reverse transcription‑quantitative polymerase chain reaction and western blotting analysis. The formation of lung lobes in guinea pigs was observed at 45 days of gestation (dGA), along with the expression of the basal cell marker keratin 14 and the alveolar type II cell marker pro‑surfactant protein. However, the cube cell marker secretoglobin family1A member 1 and ciliated cell marker b‑tubulin IV were only detected in the lungs from 52 dGA onward. The expression levels of all TLRs, MyD88 and TRAF‑6 were determined in lung tissues harvested from embryos, newborn, postnatal and adult animals. The expression levels of all TLR signaling components displayed similar dynamic expression patterns with gestation age and postnatal maturation time, except for TLR‑4 and TLR‑7. mRNA expression levels of TLR components were significantly increased in the lungs at 45 and 52 dGA, compared with later developmental stages. These results suggest that TLR expression in the guinea pig lung is developmentally regulated, enhancing the understanding of lung biology in guinea pig models.

  13. Deep sequencing of small RNA libraries reveals dynamic expression patterns of microRNAs in multiple developmental stages of Bactrocera dorsalis.

    PubMed

    Huang, Y; Dou, W; Liu, B; Wei, D; Liao, C Y; Smagghe, G; Wang, J-J

    2014-10-01

    In eukaryotes, microRNAs (miRNAs) are small, conserved, noncoding RNAs that have emerged as critical regulators of gene expression. The oriental fruit fly Bactrocera dorsalis is one of the most economically important fruit fly pests in East Asia and the Pacific. Although transcriptome analyses have greatly enriched our knowledge of its structural genes, little is known about post-transcriptional regulation by miRNAs in this dipteran species. In this study, small RNA libraries corresponding to four B. dorsalis developmental stages (eggs, larvae, pupae and adults) were constructed and sequenced. Approximately 30.7 million reads of 18-30 nucleotides were obtained, with 123 known miRNAs and 60 novel miRNAs identified amongst these libraries. More than half of the miRNAs were stage-specific during the four developmental stages. A set of miRNAs was found to be up- or down-regulated during development by comparison of their reads at different developmental stages. Moreover, a small part of miRNAs owned both miR-#-3p and miR-#-5p types, with enormously variable miR-#-3p/miR-#-5p ratios in the same library and amongst different developmental stages for each miRNA. Taking these findings together, the current study has uncovered a number of miRNAs and provided insights into their possible involvement in developmental regulation by expression profiling of miRNAs. Further analyses of the expression and function of these miRNAs could increase our understanding of regulatory networks in this insect and lead to novel approaches for its control. © 2014 The Royal Entomological Society.

  14. Children's Expression and Control of Emotion-Related Behavior: Developmental and Gender Influences on Children's and Parents' Perceptions.

    ERIC Educational Resources Information Center

    Dorr, Aimee; And Others

    This study examined the developmental and gender influences on children's normative emotional expression and control. The study surveyed 307 pairs of middle-class European-American children who were 7, 11, and 15 years old, and one parent of each child. The results of the survey showed that children were closer to the norm in their expressive…

  15. From the Infant's Smile to Mastery of Anxiety: The Developmental Role of Humor.

    ERIC Educational Resources Information Center

    Levine, Jacob

    The smiles and laughter of an infant form the beginning of the developmental process of interpersonal interaction and socialization. The earliest smiles are automatic expressions of internal states, but soon infants' smiles are communications of pleasure. The developmental changes in smiling and laughing in early infancy reflect the rapidity with…

  16. Schizophrenia Risk Variation in the NRG1 gene Exerts Effects on NRG1-IV Splicing During Fetal and Early Postnatal Human Neocortical Development

    PubMed Central

    Paterson, Clare; Wang, Yanhong; Kleinman, Joel E.; Law, Amanda J.

    2015-01-01

    OBJECTIVE Neuregulin 1 (NRG1) is a multifunctional neurotrophin and a critical mediator of neurodevelopment and risk for schizophrenia. NRG1 undergoes extensive alternative splicing, and association of brain NRG1-IV isoform expression with the schizophrenia-risk polymorphism, rs6994992, is a potential molecular mechanism of risk. Novel splice variants of NRG1-IV (NRG1-IVNV), with predicted unique signaling capabilities, have been cloned in fetal brain. Because the developmental expression and genetic regulation of NRG1-IVNV in human brain and relationship to schizophrenia is unknown, the authors investigated the temporal dynamics of NRG1-IVNV transcription, compared to the major NRG1 isoforms (types I-IV), across human prenatal and postnatal prefrontal cortical development and examined the association of rs6994992 with NRG1-IVNV expression. METHOD NRG1, types I-IV and NRG1-IVNV isoform expression was evaluated using quantitative real-time PCR in prefrontal cortex during human fetal brain development (14-39 weeks gestation: N=41) and postnatally through aging (age range 0-83 years: N=195). The association of rs6994992 genotype with NRG1-IVNV expression was determined. In-vitro assays were performed to determine the subcellular distribution and proteolytic processing of NRG1-IVNV isoforms. RESULTS Expression of NRG1, types I, II, III was temporally regulated during human prenatal and postnatal neocortical development and the trajectory of NRG1-IVNV was unique, being expressed from 16 weeks gestation until 3 years of age, after which it was undetectable. NRG1-IVNVs expression was associated with rs6994992 genotype, whereby homozygosity for the schizophrenia-risk allele (T) conferred lower cortical NRG1-IVNV levels. Finally, in-vitro cellular assays demonstrate that NRG1-IVNV is a novel nuclear enriched, truncated NRG1 protein that is resistant to proteolytic processing. CONCLUSION This study provides the first quantitative map of NRG1 isoform expression during human neocortical development and aging and identifies a potential mechanism of early developmental risk for schizophrenia at the NRG1 locus, involving a novel class of NRG1 proteins. PMID:24935406

  17. Effects of perfluorooctanoic acid (PFOA) on expression of ...

    EPA Pesticide Factsheets

    PPARs regulate metabolism and can be activated by environmental contaminants such as perfluorooctanoic acid (PFOA). PFOA induces neonatal mortality, developmental delay, and growth deficits in mice. Studies in genetically altered mice showed that PPARa is required for PFOA-induced developmental toxicity. In this study, pregnant CD-1 mice were dosed orally from GD1-17 with water or 5 mg PFO/kg to examine PPARa, PPARß, and PPARy expression and profile the effects of PFOA on PPAR-regulated genes. Prenatal and postnatal liver, heart, adrenal, kidney, intestine, stomach, lung, spleen, and thymus were collected at various developmental ages. RNA and protein were examined using qPCR and Western blot analysis. PPAR expression varied with age in all tissues, and in liver PPARa and PPARy expression correlated with nutritional changes as the pups matured. As early as GD14, PFOA affected expression of genes involved in lipid and glucose homeostatic control. The metabolic disruption produced by PFOA may contribute to poor postnatal survival and persistent weight deficits of neonates This paper represents the continuing efforts at ORD, in response to the call for assistance from OPPTS, to investigate the potential developmental toxicities of perfluoroalkyl acids (PFAA). Perfluorooctanoic acid (PFOA) is a compound which persists and is found ubiquitously in the environment, wildlife and humans. Studies in our laboratory using an in vitro transfected cell model showed that PFO

  18. Role of the immune modulator programmed cell death-1 during development and apoptosis of mouse retinal ganglion cells

    PubMed Central

    Chen, Ling; Sham, Caroline W.; Chan, Ann M.; Francisco, Loise M.; Wu, Yin; Mareninov, Sergey; Sharpe, Arlene H.; Freeman, Gordon J.; Yang, Xian-Jie; Braun, Jonathan; Gordon, Lynn K.

    2011-01-01

    PURPOSE Mammalian programmed cell death-1 (PD-1) is a membrane-associated receptor regulating the balance between T cell activation, tolerance and immunopathology, however its role in neurons has not yet been defined. We investigate the hypothesis that PD-1 signaling actively promotes retinal ganglion cell (RGC) death within the developing mouse retina. METHODS Mature retinal cell types expressing PD-1 were identified by immunofluorescence staining of vertical retina sections; developmental expression was localized by immunostaining and quantified by Western analysis. PD-1 involvement in developmental RGC survival was assessed in vitro using retina explants and in vivo using PD-1 knockout mice. PD-1 ligand gene expression was detected by RT-PCR. RESULTS PD-1 is expressed in most adult RGCs, and undergoes dynamic upregulation during the early postnatal window of retinal cell maturation and physiological programmed cell death (PCD). In vitro blockade of PD-1 signaling during this time selectively increases survival of RGCs. Furthermore, PD-1 deficient mice show a selective increase in RGC number in the neonatal retina at the peak of developmental RGC death. Lastly, throughout postnatal retina maturation, we find gene expression of both immune PD-1 ligand genes, PD-L1 and PD-L2. CONCLUSIONS These findings collectively support a novel role for a PD-1-mediated signaling pathway in developmental PCD during postnatal RGC maturation. PMID:19420345

  19. A 3-dimensional human embryonic stem cell (hESC)-derived model to detect developmental neurotoxicity of nanoparticles.

    PubMed

    Hoelting, Lisa; Scheinhardt, Benjamin; Bondarenko, Olesja; Schildknecht, Stefan; Kapitza, Marion; Tanavde, Vivek; Tan, Betty; Lee, Qian Yi; Mecking, Stefan; Leist, Marcel; Kadereit, Suzanne

    2013-04-01

    Nanoparticles (NPs) have been shown to accumulate in organs, cross the blood-brain barrier and placenta, and have the potential to elicit developmental neurotoxicity (DNT). Here, we developed a human embryonic stem cell (hESC)-derived 3-dimensional (3-D) in vitro model that allows for testing of potential developmental neurotoxicants. Early central nervous system PAX6(+) precursor cells were generated from hESCs and differentiated further within 3-D structures. The 3-D model was characterized for neural marker expression revealing robust differentiation toward neuronal precursor cells, and gene expression profiling suggested a predominantly forebrain-like development. Altered neural gene expression due to exposure to non-cytotoxic concentrations of the known developmental neurotoxicant, methylmercury, indicated that the 3-D model could detect DNT. To test for specific toxicity of NPs, chemically inert polyethylene NPs (PE-NPs) were chosen. They penetrated deep into the 3-D structures and impacted gene expression at non-cytotoxic concentrations. NOTCH pathway genes such as HES5 and NOTCH1 were reduced in expression, as well as downstream neuronal precursor genes such as NEUROD1 and ASCL1. FOXG1, a patterning marker, was also reduced. As loss of function of these genes results in severe nervous system impairments in mice, our data suggest that the 3-D hESC-derived model could be used to test for Nano-DNT.

  20. Predictive computation of genomic logic processing functions in embryonic development

    PubMed Central

    Peter, Isabelle S.; Faure, Emmanuel; Davidson, Eric H.

    2012-01-01

    Gene regulatory networks (GRNs) control the dynamic spatial patterns of regulatory gene expression in development. Thus, in principle, GRN models may provide system-level, causal explanations of developmental process. To test this assertion, we have transformed a relatively well-established GRN model into a predictive, dynamic Boolean computational model. This Boolean model computes spatial and temporal gene expression according to the regulatory logic and gene interactions specified in a GRN model for embryonic development in the sea urchin. Additional information input into the model included the progressive embryonic geometry and gene expression kinetics. The resulting model predicted gene expression patterns for a large number of individual regulatory genes each hour up to gastrulation (30 h) in four different spatial domains of the embryo. Direct comparison with experimental observations showed that the model predictively computed these patterns with remarkable spatial and temporal accuracy. In addition, we used this model to carry out in silico perturbations of regulatory functions and of embryonic spatial organization. The model computationally reproduced the altered developmental functions observed experimentally. Two major conclusions are that the starting GRN model contains sufficiently complete regulatory information to permit explanation of a complex developmental process of gene expression solely in terms of genomic regulatory code, and that the Boolean model provides a tool with which to test in silico regulatory circuitry and developmental perturbations. PMID:22927416

  1. Region-Specific Slowing of Alpha Oscillations is Associated with Visual-Perceptual Abilities in Children Born Very Preterm

    PubMed Central

    Doesburg, Sam M.; Moiseev, Alexander; Herdman, Anthony T.; Ribary, Urs; Grunau, Ruth E.

    2013-01-01

    Children born very preterm (≤32 weeks gestational age) without major intellectual or neurological impairments often express selective deficits in visual-perceptual abilities. The alterations in neurophysiological development underlying these problems, however, remain poorly understood. Recent research has indicated that spontaneous alpha oscillations are slowed in children born very preterm, and that atypical alpha-mediated functional network connectivity may underlie selective developmental difficulties in visual-perceptual ability in this group. The present study provides the first source-resolved analysis of slowing of spontaneous alpha oscillations in very preterm children, indicating alterations in a distributed set of brain regions concentrated in areas of posterior parietal and inferior temporal regions associated with visual perception, as well as prefrontal cortical regions and thalamus. We also uniquely demonstrate that slowing of alpha oscillations is associated with selective difficulties in visual-perceptual ability in very preterm children. These results indicate that region-specific slowing of alpha oscillations contribute to selective developmental difficulties prevalent in this population. PMID:24298250

  2. Is Dyslexia a Brain Disorder?

    PubMed Central

    Parrila, Rauno

    2018-01-01

    Specific word reading difficulty, commonly termed ‘developmental dyslexia’, refers to the low end of the word reading skill distribution but is frequently considered to be a neurodevelopmental disorder. This term implies that brain development is thought to be disrupted, resulting in an abnormal and dysfunctional brain. We take issue with this view, pointing out that there is no evidence of any obvious neurological abnormality in the vast majority of cases of word reading difficulty cases. The available relevant evidence from neuroimaging studies consists almost entirely of correlational and group-differences studies. However, differences in brains are certain to exist whenever differences in behavior exist, including differences in ability and performance. Therefore, findings of brain differences do not constitute evidence for abnormality; rather, they simply document the neural substrate of the behavioral differences. We suggest that dyslexia is best viewed as one of many expressions of ordinary ubiquitous individual differences in normal developmental outcomes. Thus, terms such as “dysfunctional” or “abnormal” are not justified when referring to the brains of persons with dyslexia. PMID:29621138

  3. Mean of the typical decoding rates: a new translation efficiency index based on the analysis of ribosome profiling data.

    PubMed

    Dana, Alexandra; Tuller, Tamir

    2014-12-01

    Gene translation modeling and prediction is a fundamental problem that has numerous biomedical implementations. In this work we present a novel, user-friendly tool/index for calculating the mean of the typical decoding rates that enables predicting translation elongation efficiency of protein coding genes for different tissue types, developmental stages, and experimental conditions. The suggested translation efficiency index is based on the analysis of the organism's ribosome profiling data. This index could be used for example to predict changes in translation elongation efficiency of lowly expressed genes that usually have relatively low and/or biased ribosomal densities and protein levels measurements, or can be used for example for predicting translation efficiency of new genetically engineered genes. We demonstrate the usability of this index via the analysis of six organisms in different tissues and developmental stages. Distributable cross platform application and guideline are available for download at: http://www.cs.tau.ac.il/~tamirtul/MTDR/MTDR_Install.html. Copyright © 2015 Dana and Tuller.

  4. MOLECULAR AND MORPHOLOGICAL CHANGES IN ZEBRAFISH FOLLOWING TRANSIENT ETHANOL EXPOSURE DURING DEFINED DEVELOPMENTAL STAGES

    PubMed Central

    Zhang, Chengjin; Frazier, Jared M.; Chen, Hao; Liu, Yao; Lee, Ju-Ahng; Cole, Gregory J.

    2014-01-01

    Alcohol is a teratogen that has diverse effects on brain and craniofacial development, leading to a constellation of developmental disorders referred to as fetal alcohol spectrum disorder (FASD). The molecular basis of ethanol insult remains poorly understood, as does the relationship between molecular and behavioral changes as a consequence of prenatal ethanol exposure. Zebrafish embryos were exposed to a range of ethanol concentrations (0.5–5.0%) during defined developmental stages, and examined for morphological phenotypes characteristic of FASD. Embryos were also analyzed by in situ hybridization for changes in expression of defined cell markers for neural cell types that are sonic hedgehog-dependent. We show that transient binge-like ethanol exposures during defined developmental stages, such as early gastrulation and early neurulation, result in a range of phenotypes and changes in expression of Shh-dependent genes. The severity of fetal alcohol syndrome (FAS) morphological phenotypes, such as microphthalmia, depends on the embryonic stage and concentration of alcohol exposure, as does diminution of retinal Pax6a or forebrain and hindbrain GAD1 gene expression. We also show that changes in eye and brain morphology correlate with changes in Pax6a and GAD1 gene expression. Our results therefore show that transient binge-like ethanol exposures in zebrafish embryos produce the stereotypical morphological phenotypes of FAS, with the severity of phenotypes depending on the developmental stage and alcohol concentration of exposure. PMID:24929233

  5. Developmental constraints shape the evolution of the nematode mid-developmental transition.

    PubMed

    Zalts, Harel; Yanai, Itai

    2017-03-27

    Evolutionary theory assumes that genetic variation is uniform and gradual in nature, yet morphological and gene expression studies have revealed that different life-stages exhibit distinct levels of cross-species conservation. In particular, a stage in mid-embryogenesis is highly conserved across species of the same phylum, suggesting that this stage is subject to developmental constraints, either by increased purifying selection or by a strong mutational bias. An alternative explanation, however, holds that the same 'hourglass' pattern of variation may result from increased positive selection at the earlier and later stages of development. To distinguish between these scenarios, we examined gene expression variation in a population of the nematode Caenorhabditis elegans using an experimental design that eliminated the influence of positive selection. By measuring gene expression for all genes throughout development in 20 strains, we found that variations were highly uneven throughout development, with a significant depletion during mid-embryogenesis. In particular, the family of homeodomain transcription factors, whose expression generally coincides with mid-embryogenesis, evolved under high constraint. Our data further show that genes responsible for the integration of germ layers during morphogenesis are the most constrained class of genes. Together, these results provide strong evidence for developmental constraints as the mechanism underlying the hourglass model of animal evolution. Understanding the pattern and mechanism of developmental constraints provides a framework to understand how evolutionary processes have interacted with embryogenesis and led to the diversity of animal life on Earth.

  6. Molecular cloning and developmental expression of the catalytic and 65-kDa regulatory subunits of protein phosphatase 2A in Drosophila.

    PubMed Central

    Mayer-Jaekel, R E; Baumgartner, S; Bilbe, G; Ohkura, H; Glover, D M; Hemmings, B A

    1992-01-01

    cDNA clones encoding the catalytic subunit and the 65-kDa regulatory subunit of protein phosphatase 2A (PR65) from Drosophila melanogaster have been isolated by homology screening with the corresponding human cDNAs. The Drosophila clones were used to analyze the spatial and temporal expression of the transcripts encoding these two proteins. The Drosophila PR65 cDNA clones contained an open reading frame of 1773 nucleotides encoding a protein of 65.5 kDa. The predicted amino acid sequence showed 75 and 71% identity to the human PR65 alpha and beta isoforms, respectively. As previously reported for the mammalian PR65 isoforms, Drosophila PR65 is composed of 15 imperfect repeating units of approximately 39 amino acids. The residues contributing to this repeat structure show also the highest sequence conservation between species, indicating a functional importance for these repeats. The gene encoding Drosophila PR65 was located at 29B1,2 on the second chromosome. A major transcript of 2.8 kilobase (kb) encoding the PR65 subunit and two transcripts of 1.6 and 2.5 kb encoding the catalytic subunit could be detected throughout Drosophila development. All of these mRNAs were most abundant during early embryogenesis and were expressed at lower levels in larvae and adult flies. In situ hybridization of different developmental stages showed a colocalization of the PR65 and catalytic subunit transcripts. The mRNA expression is high in the nurse cells and oocytes, consistent with a high equally distributed expression in early embryos. In later embryonal development, the expression remains high in the nervous system and the gonads but the overall transcript levels decrease. In third instar larvae, high levels of mRNA could be observed in brain, imaginal discs, and in salivary glands. These results indicate that protein phosphatase 2A transcript levels change during development in a tissue and in a time-specific manner. Images PMID:1320961

  7. Developmental and Individual Differences in the Neural Processing of Dynamic Expressions of Pain and Anger

    PubMed Central

    Missana, Manuela; Grigutsch, Maren; Grossmann, Tobias

    2014-01-01

    We examined the processing of facial expressions of pain and anger in 8-month-old infants and adults by measuring event-related brain potentials (ERPs) and frontal EEG alpha asymmetry. The ERP results revealed that while adults showed a late positive potential (LPP) to emotional expressions that was enhanced to pain expressions, reflecting increased evaluation and emotional arousal to pain expressions, infants showed a negative component (Nc) to emotional expressions that was enhanced to angry expressions, reflecting increased allocation of attention to angry faces. Moreover, infants and adults showed opposite patterns in their frontal asymmetry responses to pain and anger, suggesting developmental differences in the motivational processes engendered by these facial expressions. These findings are discussed in the light of associated individual differences in infant temperament and adult dispositional empathy. PMID:24705497

  8. Sarcomeric Myosin Expression in the Tongue Body of Humans, Macaques and Rats

    PubMed Central

    Rahnert, Jill A.; Sokoloff, Alan J.; Burkholder, Thomas J.

    2010-01-01

    Expression of developmental and unconventional myosin heavy chain (MHC) isoforms in some adult head and neck muscles is thought to reflect specific contractile demands of muscle fibers active during kinematically complex movements. Mammalian tongue muscles are active during oromotor behaviors that encompass a wide range of tongue movement speeds and tongue shape changes (e.g. respiration, oral transport, swallowing, rejection), but the extent to which tongue muscles express developmental and unconventional MHC is not known. Quantitative PCR was used to determine the mRNA content of conventional MHC-beta, MHC-2a, MHC-2b and MHC-2x, the developmental isoforms embryonic MHC and neonatal MHC and the unconventional isoforms atrial/cardiac-α MHC (MHC-alpha), extraocular MHC, masseter MHC and slow tonic MHC in tongue body muscles of the rat, macaque and human. In all species, conventional MHC isoforms predominate. MHC-2b and MHC-2x account for 98% of total MHC mRNA in the rat. MHC-2a, MHC-2x and MHC-beta account for 94% of total MHC mRNA in humans and 96% of total MHC mRNA in macaque. With the exception of MHC-alpha in humans (5%), developmental and unconventional MHC mRNA represents less than 0.3% of total MHC mRNA. We conclude that in these species, there is limited expression of developmental and unconventional MHC and that diversity of tongue body muscle fiber contractile properties is achieved primarily by MHC-beta, MHC-2a, MHC-2x and MHC-2b. Whether expression of MHC-alpha mRNA in tongue is unique to humans or present in other hominoids awaits further investigation. PMID:19907142

  9. BDE-47 causes developmental retardation with down-regulated expression profiles of ecdysteroid signaling pathway-involved nuclear receptor (NR) genes in the copepod Tigriopus japonicus.

    PubMed

    Hwang, Dae-Sik; Han, Jeonghoon; Won, Eun-Ji; Kim, Duck-Hyun; Jeong, Chang-Bum; Hwang, Un-Ki; Zhou, Bingsheng; Choe, Joonho; Lee, Jae-Seong

    2016-08-01

    2,2',4,4'-Tetrabromodiphenyl ether (BDE-47) is a persistent organic pollutant (POP) in marine environments. Despite its adverse effects (e.g. developmental retardation) in ecdysozoa, the effects of BDE-47 on transcription of ecdysteroid signaling pathway-involved-nuclear receptor (NR) genes and metamorphosis-related genes have not been examined in copepods. To examine the deleterious effect of BDE-47 on copepod molting and metamorphosis, BDE-47 was exposed to the harpacticoid copepod Tigriopus japonicus, followed by monitoring developmental retardation and transcriptional alteration of NR genes. The developmental rate was significantly inhibited (P<0.05) in response to BDE-47 and the agricultural insecticide gamma-hexachlorocyclohexane. Conversely, the ecdysteroid agonist ponasterone A (PoA) led to decreased molting and metamorphosis time (P<0.05) from the nauplius stage to the adult stage. In particular, expression profiles of all NR genes were the highest at naupliar stages 5-6 except for SVP, FTZ-F1, and HR96 genes. Nuclear receptor USP, HR96, and FTZ-F1 genes also showed significant sex differences (P<0.05) in gene expression levels over different developmental stages, indicating that these genes may be involved in vitellogenesis. NR gene expression patterns showed significant decreases (P<0.05) in response to BDE-47 exposure, implying that molting and metamorphosis retardation is likely associated with NR gene expression. In summary, BDE-47 leads to molting and metamorphosis retardation and suppresses transcription of NR genes. This information will be helpful in understanding the molting and metamorphosis delay mechanism in response to BDE-47 exposure. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Characterization of transcriptome in the Indian meal moth Plodia interpunctella (Lepidoptera: Pyralidae) and gene expression analysis during developmental stages.

    PubMed

    Tang, Pei-An; Wu, Hai-Jing; Xue, Hao; Ju, Xing-Rong; Song, Wei; Zhang, Qi-Lin; Yuan, Ming-Long

    2017-07-30

    The Indian meal moth Plodia interpunctella (Lepidoptera: Pyralidae) is a worldwide pest that causes serious damage to stored foods. Although many efforts have been conducted on this species due to its economic importance, the study of genetic basis of development, behavior and insecticide resistance has been greatly hampered due to lack of genomic information. In this study, we used high throughput sequencing platform to perform a de novo transcriptome assembly and tag-based digital gene expression profiling (DGE) analyses across four different developmental stages of P. interpunctella (egg, third-instar larvae, pupae and adult). We obtained approximate 9gigabyte (GB) of clean data and recovered 84,938 unigenes, including 37,602 clusters and 47,336 singletons. These unigenes were annotated using BLAST against the non-redundant protein databases and then functionally classified based on Gene Ontology (GO), Clusters of Orthologous Groups (COG), and Kyoto Encyclopedia of Genes and Genomes databases (KEGG). A large number of differentially expressed genes were identified by pairwise comparisons among different developmental stages. Gene expression profiles dramatically changed between developmental stage transitions. Some of these differentially expressed genes were related to digestion and cuticularization. Quantitative real-time PCR results of six randomly selected genes conformed the findings in the DGEs. Furthermore, we identified over 8000 microsatellite markers and 97,648 single nucleotide polymorphisms which will be useful for population genetics studies of P. interpunctella. This transcriptomic information provided insight into the developmental basis of P. interpunctella and will be helpful for establishing integrated management strategies and developing new targets of insecticides for this serious pest. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. DNA methylation regulates gabrb2 mRNA expression: developmental variations and disruptions in l-methionine-induced zebrafish with schizophrenia-like symptoms.

    PubMed

    Wang, L; Jiang, W; Lin, Q; Zhang, Y; Zhao, C

    2016-11-01

    Single nucleotide polymorphisms (SNPs) in the human type A gamma-aminobutyric acid (GABA) receptor β 2 subunit gene (GABRB2) have been associated with schizophrenia and quantitatively correlated with mRNA expression in the postmortem brain tissue of patients with schizophrenia. l-Methionine (MET) administration has been reported to cause a recrudescence of psychotic symptoms in patients with schizophrenia, and similar symptoms have been generated in MET-induced mice. In this study, a zebrafish animal model was used to evaluate the relationship between the gabrb2 mRNA expression and its promoter DNA methylation in developmental and MET-induced schizophrenia-like zebrafish. The results indicated developmental increases in global DNA methylation and decreases in gabrb2 promoter methylation in zebrafish. A significant increase in gabrb2 mRNA levels was observed after GABA was synthesized. Additionally, the MET-triggered schizophrenia-like symptoms in adult zebrafish, involving social withdrawal and cognitive dysfunction analyzed with social interaction and T-maze behavioral tests, were accompanied by significantly increased DNA methylation levels in the global genome and the gabrb2 promoter. Furthermore, the significant correlation between gabrb2 mRNA expression and gabrb2 promoter methylation observed in the developmental stages became non-significant in MET-triggered adult zebrafish. These findings demonstrate that gabrb2 mRNA expression is associated with DNA methylation varies by developmental stage and show that these epigenetic association mechanisms are disrupted in MET-triggered adult zebrafish with schizophrenia-like symptoms. In conclusion, these results provide plausible epigenetic evidence of the GABA A receptor β 2 subunit involvement in the schizophrenia-like behaviors and demonstrate the potential use of zebrafish models in neuropsychiatric research. © 2016 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.

  12. Emotional Expression and Heart Rate in High-Risk Infants during the Face-To-Face/Still-Face

    PubMed Central

    Mattson, Whitney I.; Ekas, Naomi V.; Lambert, Brittany; Tronick, Ed; Lester, Barry M.; Messinger, Daniel S.

    2013-01-01

    In infants, eye constriction—the Duchenne marker—and mouth opening appear to index the intensity of both positive and negative facial expressions. We combined eye constriction and mouth opening that co-occurred with smiles and cry-faces (respectively, the prototypic expressions of infant joy and distress) to measure emotional expression intensity. Expression intensity and heart rate were measured throughout the Face-to-Face/Still Face (FFSF) in a sample of infants with prenatal cocaine exposure who were at risk for developmental difficulties. Smiles declined and cry-faces increased in the still-face episode, but the distribution of eye constriction and mouth opening in smiles and cry-faces did not differ across episodes of the FFSF. As time elapsed in the still face episode potential indices of intensity increased, cry-faces were more likely to be accompanied by eye constriction and mouth opening. During cry-faces there were also moderately stable individual differences in the quantity of eye constriction and mouth opening. Infant heart rate was higher during cry-faces and lower during smiles, but did not vary with intensity of expression or by episode. In sum, infants express more intense negative affect as the still-face progresses, but do not show clear differences in expressive intensity between episodes of the FFSF. PMID:24095807

  13. Mechanism of development of ionocytes rich in vacuolar-type H+-ATPase in the skin of zebrafish larvae

    PubMed Central

    Esaki, Masahiro; Hoshijima, Kazuyuki; Nakamura, Nobuhiro; Munakata, Keijiro; Tanaka, Mikiko; Ookata, Kayoko; Asakawa, Kazuhide; Kawakami, Koichi; Wang, Weiyi; Weinberg, Eric S.; Hirose, Shigehisa

    2009-01-01

    Mitochondrion-rich cells (MRCs), or ionocytes, play a central role in aquatic species, maintaining body fluid ionic homeostasis by actively taking up or excreting ions. Since their first description in 1932 in eel gills, extensive morphological and physiological analyses have yielded important insights into ionocyte structure and function, but understanding the developmental pathway specifying these cells remains an ongoing challenge. We previously succeeded in identifying a key transcription factor, Foxi3a, in zebrafish larvae by database mining. In the present study, we analyzed a zebrafish mutant, quadro (quo), deficient in foxi1 gene expression and found that foxi1 is essential for development of an MRC subpopulation rich in vacuolar-type H+-ATPase (vH-MRC). foxi1 acts upstream of Delta-Notch signaling that determines sporadic distribution of vH-MRC and regulates foxi3a expression. Through gain- and loss-of-function assays and cell transplantation experiments, we further clarified that (1) the expression level of foxi3a is maintained by a positive feedback loop between foxi3a and its downstream gene gcm2 and (2) Foxi3a functions cell-autonomously in the specification of vH-MRC. These observations provide a better understanding of the differentiation and distribution of the vH-MRC subtype. PMID:19268451

  14. Remodeling a tissue: subtraction adds insight.

    PubMed

    Axelrod, Jeffrey D

    2012-11-27

    Sculpting a body plan requires both patterning of gene expression and translating that pattern into morphogenesis. Developmental biologists have made remarkable strides in understanding gene expression patterning, but despite a long history of fascination with the mechanics of morphogenesis, knowledge of how patterned gene expression drives the emergence of even simple shapes and forms has grown at a slower pace. The successful merging of approaches from cell biology, developmental biology, imaging, engineering, and mathematical and computational sciences is now accelerating progress toward a fuller and better integrated understanding of the forces shaping morphogenesis.

  15. Quantitative GFP fluorescence as an indicator of arsenite developmental toxicity in mosaic heat shock protein 70 transgenic zebrafish

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Seok, Seung-Hyeok; Baek, Min-Won; Lee, Hui-Young

    2007-12-01

    In transgenic zebrafish (Danio rerio), green fluorescent protein (GFP) is a promising marker for environmental pollutants. In using GFP, one of the obstacles which we faced was how to compare toxicity among different toxicants or among a specific toxicant in different model species with the intensity of GFP expression. Using a fluorescence detection method, we first validated our method for estimating the amount of GFP fluorescence present in transgenic fish, which we used as an indicator of developmental toxicity caused by the well-known toxicant, arsenite. To this end, we developed mosaic transgenic zebrafish with the human heat shock response elementmore » (HSE) fused to the enhanced GFP (EGFP) reporter gene to indicate exposure to arsenite. We confirmed that EGFP expression sites correlate with gross morphological disruption caused by arsenite exposure. Arsenite (300.0 {mu}M) caused stronger EGFP fluorescence intensity and quantity than 50.0 {mu}M and 10.0 {mu}M arsenite in our transgenic zebrafish. Furthermore, arsenite-induced apoptosis was demonstrated by TUNEL assay. Apoptosis was inhibited by the antioxidant, N-acetyl-cystein (NAC) in this transgenic zebrafish. The distribution of TUNEL-positive cells in embryonic tissues was correlated with the sites of arsenite toxicity and EGFP expression. The EGFP values quantified using the standard curve equation from the known GFP quantity were consistent with the arsenite-induced EGFP expression pattern and arsenite concentration, indicating that this technique can be a reliable and applicable measurement. In conclusion, we propose that fluorescence-based EGFP quantification in transgenic fish containing the hsp70 promoter-EGFP reporter-gene construct is a useful indicator of development toxicity caused by arsenite.« less

  16. Diversity in genomic organisation, developmental regulation and distribution of the murine PR72/B" subunits of protein phosphatase 2A

    PubMed Central

    Zwaenepoel, Karen; Louis, Justin V; Goris, Jozef; Janssens, Veerle

    2008-01-01

    Background Protein phosphatase 2A (PP2A) is a serine/threonine-specific phosphatase displaying vital functions in growth and development through its role in various signalling pathways. PP2A holoenzymes comprise a core dimer composed of a catalytic C and a structural A subunit, which can associate with a variable B-type subunit. The importance of the B-type subunits for PP2A regulation cannot be overestimated as they determine holoenzyme localisation, activity and substrate specificity. Three B-type subunit families have been identified: PR55/B, PR61/B' and PR72/B", of which the latter is currently the least characterised. Results We deduced the sequences and genomic organisation of the different murine PR72/B" isoforms: three genes encode nine isoforms, five of which are abundantly expressed and give rise to genuine PP2A subunits. Thereby, one novel subunit was identified. Using Northern blotting, we examined the tissue-specific and developmental expression of these subunits. All subunits are highly expressed in heart, suggesting an important cardiac function. Immunohistochemical analysis revealed a striated expression pattern of PR72 and PR130 in heart and skeletal muscle, but not in bladder smooth muscle. The subcellular localisation and cell cycle regulatory ability of several PR72/B" isoforms were determined, demonstrating differences as well as similarities. Conclusion In contrast to PR55/B and PR61/B', the PR72/B" family seems evolutionary more divergent, as only two of the murine genes have a human orthologue. We have integrated these results in a more consistent nomenclature of both human and murine PR72/B" genes and their transcripts/proteins. Our results provide a platform for the future generation of PR72/B" knockout mice. PMID:18715506

  17. Molecular Characterization of abLIM, a Novel Actin-binding and Double Zinc Finger Protein

    PubMed Central

    Roof, Dorothy J.; Hayes, Annmarie; Adamian, Michael; Chishti, Athar H.; Li, Tiansen

    1997-01-01

    Molecules that couple the actin-based cytoskeleton to intracellular signaling pathways are central to the processes of cellular morphogenesis and differentiation. We have characterized a novel protein, the actin-binding LIM (abLIM) protein, which could mediate such interactions between actin filaments and cytoplasmic targets. abLIM protein consists of a COOH-terminal cytoskeletal domain that is fused to an NH2-terminal domain consisting of four double zinc finger motifs. The cytoskeletal domain is ∼50% identical to erythrocyte dematin, an actin-bundling protein of the red cell membrane skeleton, while the zinc finger domains conform to the LIM motif consensus sequence. In vitro expression studies demonstrate that abLIM protein can bind to F-actin through the dematin-like domain. Transcripts corresponding to three distinct isoforms have a widespread tissue distribution. However, a polypeptide corresponding to the full-length isoform is found exclusively in the retina and is enriched in biochemical extracts of retinal rod inner segments. abLIM protein also undergoes extensive phosphorylation in light-adapted retinas in vivo, and its developmental expression in the retina coincides with the elaboration of photoreceptor inner and outer segments. Based on the composite primary structure of abLIM protein, actin-binding capacity, potential regulation via phosphorylation, and isoform expression pattern, we speculate that abLIM may play a general role in bridging the actin-based cytoskeleton with an array of potential LIM protein-binding partners. The developmental time course of abLIM expression in the retina suggests that the retina-specific isoform may have a specialized role in the development or elaboration of photoreceptor inner and outer segments. PMID:9245787

  18. Molecular Characterisation of Transport Mechanisms at the Developing Mouse Blood–CSF Interface: A Transcriptome Approach

    PubMed Central

    Liddelow, Shane A.; Temple, Sally; Møllgård, Kjeld; Gehwolf, Renate; Wagner, Andrea; Bauer, Hannelore; Bauer, Hans-Christian; Phoenix, Timothy N.; Dziegielewska, Katarzyna M.; Saunders, Norman R.

    2012-01-01

    Exchange mechanisms across the blood–cerebrospinal fluid (CSF) barrier in the choroid plexuses within the cerebral ventricles control access of molecules to the central nervous system, especially in early development when the brain is poorly vascularised. However, little is known about their molecular or developmental characteristics. We examined the transcriptome of lateral ventricular choroid plexus in embryonic day 15 (E15) and adult mice. Numerous genes identified in the adult were expressed at similar levels at E15, indicating substantial plexus maturity early in development. Some genes coding for key functions (intercellular/tight junctions, influx/efflux transporters) changed expression during development and their expression patterns are discussed in the context of available physiological/permeability results in the developing brain. Three genes: Secreted protein acidic and rich in cysteine (Sparc), Glycophorin A (Gypa) and C (Gypc), were identified as those whose gene products are candidates to target plasma proteins to choroid plexus cells. These were investigated using quantitative- and single-cell-PCR on plexus epithelial cells that were albumin- or total plasma protein-immunopositive. Results showed a significant degree of concordance between plasma protein/albumin immunoreactivity and expression of the putative transporters. Immunohistochemistry identified SPARC and GYPA in choroid plexus epithelial cells in the embryo with a subcellular distribution that was consistent with transport of albumin from blood to cerebrospinal fluid. In adult plexus this pattern of immunostaining was absent. We propose a model of the cellular mechanism in which SPARC and GYPA, together with identified vesicle-associated membrane proteins (VAMPs) may act as receptors/transporters in developmentally regulated transfer of plasma proteins at the blood–CSF interface. PMID:22457777

  19. Regulation of the neurotensin NT1 receptor in the developing rat brain following chronic treatment with the antagonist SR 48692

    PubMed Central

    Lépée-Lorgeoux, Isabelle; Betancur, Catalina; Souazé, Frédérique; Rostène, William; Bérod, Anne; Pélaprat, Didier

    2000-01-01

    The aim of the present study was to investigate the role of neurotensin in the regulation of NT1 receptors during postnatal development in the rat brain. Characterization of the ontogeny of neurotensin concentration and [125I]neurotensin binding to NT1 receptors in the brain at different embryonic and postnatal stages showed that neurotensin was highly expressed at birth, reaching peak levels at postnatal day 5 (P5), and decreasing thereafter. The transient rise in neurotensin levels preceded the maximal expression of NT1 receptors, observed at P10, suggesting that neurotensin may influence the developmental profile of NT1 receptors. Using primary cultures of cerebral cortex neurons from fetal rats, we showed that exposure to the neurotensin agonist JMV 449 (1 nM) decreased (−43%) the amount of NT1 receptor mRNA measured by reverse transcription-PCR, an effect that was abolished by the non-peptide NT1 receptor antagonist SR 48692 (1 μM). However, daily injection of SR 48692 to rat pups from birth for 5, 9 or 15 days, did not modify [125I]neurotensin binding in brain membrane homogenates. Moreover, postnatal blockade of neurotensin transmission did not alter the density and distribution of NT1 receptors assessed by quantitative autoradiography nor NT1 receptor mRNA expression measured by in situ hybridization in the cerebral cortex, caudate-putamen and midbrain. These results suggest that although NT1 receptor expression can be regulated in vitro by the agonist at an early developmental stage, neurotensin is not a major factor in the establishment of the ontogenetic pattern of these receptors in the rat brain. PMID:10797539

  20. Small RNA profiling in two Brassica napus cultivars identifies microRNAs with oil production- and development-correlated expression and new small RNA classes.

    PubMed

    Zhao, Ying-Tao; Wang, Meng; Fu, San-Xiong; Yang, Wei-Cai; Qi, Cun-Kou; Wang, Xiu-Jie

    2012-02-01

    MicroRNAs (miRNAs) and small interfering RNAs are important regulators of plant development and seed formation, yet their population and abundance in the oil crop Brassica napus are still not well understood, especially at different developmental stages and among cultivars with varied seed oil contents. Here, we systematically analyzed the small RNA expression profiles of Brassica napus seeds at early embryonic developmental stages in high-oil-content and low-oil-content B. napus cultivars, both cultured in two environments. A total of 50 conserved miRNAs and 9 new miRNAs were identified, together with some new miRNA targets. Expression analysis revealed some miRNAs with varied expression levels in different seed oil content cultivars or at different embryonic developmental stages. A large number of 23-nucleotide small RNAs with specific nucleotide composition preferences were also identified, which may present new classes of functional small RNAs.

  1. Decoding the Regulatory Network for Blood Development from Single-Cell Gene Expression Measurements

    PubMed Central

    Haghverdi, Laleh; Lilly, Andrew J.; Tanaka, Yosuke; Wilkinson, Adam C.; Buettner, Florian; Macaulay, Iain C.; Jawaid, Wajid; Diamanti, Evangelia; Nishikawa, Shin-Ichi; Piterman, Nir; Kouskoff, Valerie; Theis, Fabian J.; Fisher, Jasmin; Göttgens, Berthold

    2015-01-01

    Here we report the use of diffusion maps and network synthesis from state transition graphs to better understand developmental pathways from single cell gene expression profiling. We map the progression of mesoderm towards blood in the mouse by single-cell expression analysis of 3,934 cells, capturing cells with blood-forming potential at four sequential developmental stages. By adapting the diffusion plot methodology for dimensionality reduction to single-cell data, we reconstruct the developmental journey to blood at single-cell resolution. Using transitions between individual cellular states as input, we develop a single-cell network synthesis toolkit to generate a computationally executable transcriptional regulatory network model that recapitulates blood development. Model predictions were validated by showing that Sox7 inhibits primitive erythropoiesis, and that Sox and Hox factors control early expression of Erg. We therefore demonstrate that single-cell analysis of a developing organ coupled with computational approaches can reveal the transcriptional programs that control organogenesis. PMID:25664528

  2. The moderating effects of intellectual development on core symptoms of autism and PDD-NOS in toddlers and infants.

    PubMed

    Matson, Johnny L; Dempsey, Timothy; LoVullo, Santino V; Fodstad, Jill C; Knight, Cheryl; Sevin, Jay A; Sharp, Brenda

    2013-01-01

    Little research has been conducted on whether deficits in developmental functioning affect the range of core symptoms for autism spectrum disorders (ASD). This study represents a first attempt to determine whether developmental level has an effect on the expression of ASD symptoms in infants and toddlers. Eight hundred and fifty-three infants were evaluated with respect to the nature and extent of their ASD symptoms and developmental functioning. Young children with autism displayed a higher number of symptoms than those with PDD-NOS on all three domains of impairment (social, communication, repetitive behaviors). As expected, children without an ASD evinced far fewer symptoms than both these groups. Developmental level was not found to be a moderator for expression of ASD symptoms for the entire sample, or individual diagnostic groups. Higher developmental level was associated with lower severity of evinced ASD symptoms in the sample. Copyright © 2012 Elsevier Ltd. All rights reserved.

  3. Developmental control of transcriptional and proliferative potency during the evolutionary emergence of animals

    PubMed Central

    Arenas-Mena, Cesar; Coffman, James A.

    2016-01-01

    Summary It is proposed that the evolution of complex animals required repressive genetic mechanisms for controlling the transcriptional and proliferative potency of cells. Unicellular organisms are transcriptionally potent, able to express their full genetic complement as the need arises through their life cycle, whereas differentiated cells of multicellular organisms can only express a fraction of their genomic potential. Likewise, whereas cell proliferation in unicellular organisms is primarily limited by nutrient availability, cell proliferation in multicellular organisms is developmentally regulated. Repressive genetic controls limiting the potency of cells at the end of ontogeny would have stabilized the gene expression states of differentiated cells and prevented disruptive proliferation, allowing the emergence of diverse cell types and functional shapes. We propose that distal cis-regulatory elements represent the primary innovations that set the stage for the evolution of developmental gene regulatory networks and the repressive control of key multipotency and cell-cycle control genes. The testable prediction of this model is that the genomes of extant animals, unlike those of our unicellular relatives, encode gene regulatory circuits dedicated to the developmental control of transcriptional and proliferative potency. PMID:26173445

  4. A Drosophila LexA Enhancer-Trap Resource for Developmental Biology and Neuroendocrine Research

    PubMed Central

    Kockel, Lutz; Huq, Lutfi M.; Ayyar, Anika; Herold, Emma; MacAlpine, Elle; Logan, Madeline; Savvides, Christina; Kim, Grace E. S.; Chen, Jiapei; Clark, Theresa; Duong, Trang; Fazel-Rezai, Vahid; Havey, Deanna; Han, Samuel; Jagadeesan, Ravi; Kim, Eun Soo Jackie; Lee, Diane; Lombardo, Kaelina; Piyale, Ida; Shi, Hansen; Stahr, Lydia; Tung, Dana; Tayvah, Uriel; Wang, Flora; Wang, Ja-Hon; Xiao, Sarah; Topper, Sydni M.; Park, Sangbin; Rotondo, Cheryl; Rankin, Anne E.; Chisholm, Townley W.; Kim, Seung K.

    2016-01-01

    Novel binary gene expression tools like the LexA-LexAop system could powerfully enhance studies of metabolism, development, and neurobiology in Drosophila. However, specific LexA drivers for neuroendocrine cells and many other developmentally relevant systems remain limited. In a unique high school biology course, we generated a LexA-based enhancer trap collection by transposon mobilization. The initial collection provides a source of novel LexA-based elements that permit targeted gene expression in the corpora cardiaca, cells central for metabolic homeostasis, and other neuroendocrine cell types. The collection further contains specific LexA drivers for stem cells and other enteric cells in the gut, and other developmentally relevant tissue types. We provide detailed analysis of nearly 100 new LexA lines, including molecular mapping of insertions, description of enhancer-driven reporter expression in larval tissues, and adult neuroendocrine cells, comparison with established enhancer trap collections and tissue specific RNAseq. Generation of this open-resource LexA collection facilitates neuroendocrine and developmental biology investigations, and shows how empowering secondary school science can achieve research and educational goals. PMID:27527793

  5. A Drosophila LexA Enhancer-Trap Resource for Developmental Biology and Neuroendocrine Research.

    PubMed

    Kockel, Lutz; Huq, Lutfi M; Ayyar, Anika; Herold, Emma; MacAlpine, Elle; Logan, Madeline; Savvides, Christina; Kim, Grace E S; Chen, Jiapei; Clark, Theresa; Duong, Trang; Fazel-Rezai, Vahid; Havey, Deanna; Han, Samuel; Jagadeesan, Ravi; Kim, Eun Soo Jackie; Lee, Diane; Lombardo, Kaelina; Piyale, Ida; Shi, Hansen; Stahr, Lydia; Tung, Dana; Tayvah, Uriel; Wang, Flora; Wang, Ja-Hon; Xiao, Sarah; Topper, Sydni M; Park, Sangbin; Rotondo, Cheryl; Rankin, Anne E; Chisholm, Townley W; Kim, Seung K

    2016-10-13

    Novel binary gene expression tools like the LexA-LexAop system could powerfully enhance studies of metabolism, development, and neurobiology in Drosophila However, specific LexA drivers for neuroendocrine cells and many other developmentally relevant systems remain limited. In a unique high school biology course, we generated a LexA-based enhancer trap collection by transposon mobilization. The initial collection provides a source of novel LexA-based elements that permit targeted gene expression in the corpora cardiaca, cells central for metabolic homeostasis, and other neuroendocrine cell types. The collection further contains specific LexA drivers for stem cells and other enteric cells in the gut, and other developmentally relevant tissue types. We provide detailed analysis of nearly 100 new LexA lines, including molecular mapping of insertions, description of enhancer-driven reporter expression in larval tissues, and adult neuroendocrine cells, comparison with established enhancer trap collections and tissue specific RNAseq. Generation of this open-resource LexA collection facilitates neuroendocrine and developmental biology investigations, and shows how empowering secondary school science can achieve research and educational goals. Copyright © 2016 Kockel et al.

  6. Calmodulin Gene Family in Potato: Developmental and Touch-Induced Expression of the mRNA Encoding a Novel Isoform

    NASA Technical Reports Server (NTRS)

    Takezawa, D.; Liu, Z. H.; An, G.; Poovaiah, B. W.

    1995-01-01

    Eight genomic clones of potato calmodulin (PCM1 to 8) were isolated and characterized. Sequence comparisons of different genes revealed that the deduced amino acid sequence of PCM1 had several unique substitutions, especially in the fourth Ca(2+)-binding area. The expression patterns of different genes were studied by northern analysis using the 3'-untranslated regions as probes. The expression of PCM1, 5, and 8 was highest in the stolon tip and it decreased during tuber development. The expression of PCM6 did not vary much in the tissues tested, except in the leaves, where the expression was lower; whereas, the expression of PCM4 was very low in all the tissues. The expression of PCM2 and PCM3 was not detected in any of the tissues tested. Among these genes, only PCM1 showed increased expression following touch stimulation. To study the regulation of PCM1, transgenic potato plants carrying the PCM1 promoter fused to the beta-glucuronidase (GUS) reporter gene were produced. GUS expression was found to be developmentally regulated and touch-responsive, indicating a positive correlation between the expression of PCM1 and GUS mRNAs. These results suggest that the 5'-flanking region of PCM1 controls developmental and touch-induced expression. X-Gluc staining patterns revealed that GUS localization is high in meristematic tissues such as the stem apex, stolon tip, and vascular regions.

  7. Bovine oocytes and early embryos express Staufen and ELAVL RNA-binding proteins.

    PubMed

    Calder, M D; Madan, P; Watson, A J

    2008-05-01

    RNA-binding proteins (RBP) influence RNA editing, localization, stability and translation and may contribute to oocyte developmental competence by regulating the stability and turnover of oogenetic mRNAs. The expression of Staufen 1 and 2 and ELAVL1, ELAVL2 RNA-binding proteins during cow early development was characterized. Cumulus-oocyte complexes were collected from slaughterhouse ovaries, matured, inseminated and subjected to embryo culture in vitro. Oocyte or preimplantation embryo pools were processed for RT-PCR and whole-mount immunofluorescence analysis of mRNA expression and protein distribution. STAU1 and STAU2 and ELAVL1 mRNAs and proteins were detected throughout cow preimplantation development from the germinal vesicle (GV) oocyte to the blastocyst stage. ELAVL2 mRNAs were detectable from the GV to the morula stage, whereas ELAVL2 protein was in all stages examined and localized to both cytoplasm and nuclei. The findings provide a foundation for investigating the role of RBPs during mammalian oocyte maturation and early embryogenesis.

  8. Sexual dimorphism in parental imprint ontogeny and contribution to embryonic development.

    PubMed

    Bourc'his, Déborah; Proudhon, Charlotte

    2008-01-30

    Genomic imprinting refers to the functional non-equivalence of parental genomes in mammals that results from the parent-of-origin allelic expression of a subset of genes. Parent-specific expression is dependent on the germ line acquisition of DNA methylation marks at imprinting control regions (ICRs), coordinated by the DNA-methyltransferase homolog DNMT3L. We discuss here how the gender-specific stages of DNMT3L expression may have influenced the various sexually dimorphic aspects of genomic imprinting: (1) the differential developmental timing of methylation establishment at paternally and maternally imprinted genes in each parental germ line, (2) the differential dependence on DNMT3L of parental methylation imprint establishment, (3) the unequal duration of paternal versus maternal methylation imprints during germ cell development, (4) the biased distribution of methylation-dependent ICRs towards the maternal genome, (5) the different genomic organization of paternal versus maternal ICRs, and finally (6) the overwhelming contribution of maternal germ line imprints to development compared to their paternal counterparts.

  9. Graded levels of FGF protein span the midbrain and can instruct graded induction and repression of neural mapping labels

    PubMed Central

    Chen, Yao; Mohammadi, Moosa; Flanagan, John G.

    2009-01-01

    Summary Graded guidance labels are widely used in neural map formation, but it is not well understood which potential strategy leads to their graded expression. In midbrain tectal map development, FGFs can induce an entire midbrain, but their protein distribution is unclear, nor is it known whether they may act instructively to produce graded gene expression. Using a receptor-alkaline phosphatase fusion probe, we find a long-range posterior>anterior FGF protein gradient spanning the midbrain. Heparan sulfate proteoglycan (HSPG) is required for this gradient. To test whether graded FGF concentrations can instruct graded gene expression, a quantitative tectal explant assay was developed. Engrailed-2 and ephrin-As, normally in posterior>anterior tectal gradients, showed graded upregulation. Moreover, EphAs, normally in anterior>posterior countergradients, showed coordinately graded downregulation. These results provide a mechanism to establish graded mapping labels, and more generally provide a developmental strategy to coordinately induce a structure and pattern its cell properties in gradients. PMID:19555646

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Garige, Mamatha; Walters, Eric, E-mail: ewalters@howard.edu

    The molecular basis for nutraceutical properties of the polyphenol curcumin (Curcuma longa, Turmeric) is complex, affecting multiple factors that regulate cell signaling and homeostasis. Here, we report the effect of curcumin on cellular and developmental mechanisms in the eukaryotic model, Dictyostelium discoideum. Dictyostelium proliferation was inhibited in the presence of curcumin, which also suppressed the prestarvation marker, discoidin I, members of the yakA-mediated developmental signaling pathway, and expression of the extracellular matrix/cell adhesion proteins (DdCAD and csA). This resulted in delayed chemotaxis, adhesion, and development of the organism. In contrast to the inhibitory effects on developmental genes, curcumin induced gstAmore » gene expression, overall GST activity, and generated production of reactive oxygen species. These studies expand our knowledge of developmental and biochemical signaling influenced by curcumin, and lends greater consideration of GST enzyme function in eukaryotic cell signaling, development, and differentiation.« less

  11. Integrating genetic and toxicogenomic information for determining underlying susceptibility to developmental disorders.

    PubMed

    Robinson, Joshua F; Port, Jesse A; Yu, Xiaozhong; Faustman, Elaine M

    2010-10-01

    To understand the complex etiology of developmental disorders, an understanding of both genetic and environmental risk factors is needed. Human and rodent genetic studies have identified a multitude of gene candidates for specific developmental disorders such as neural tube defects (NTDs). With the emergence of toxicogenomic-based assessments, scientists now also have the ability to compare and understand the expression of thousands of genes simultaneously across strain, time, and exposure in developmental models. Using a systems-based approach in which we are able to evaluate information from various parts and levels of the developing organism, we propose a framework for integrating genetic information with toxicogenomic-based studies to better understand gene-environmental interactions critical for developmental disorders. This approach has allowed us to characterize candidate genes in the context of variables critical for determining susceptibility such as strain, time, and exposure. Using a combination of toxicogenomic studies and complementary bioinformatic tools, we characterize NTD candidate genes during normal development by function (gene ontology), linked phenotype (disease outcome), location, and expression (temporally and strain-dependent). In addition, we show how environmental exposures (cadmium, methylmercury) can influence expression of these genes in a strain-dependent manner. Using NTDs as an example of developmental disorder, we show how simple integration of genetic information from previous studies into the standard microarray design can enhance analysis of gene-environment interactions to better define environmental exposure-disease pathways in sensitive and resistant mouse strains. © Wiley-Liss, Inc.

  12. Developmental toxicity in flounder embryos exposed to crude oils derived from different geographical regions.

    PubMed

    Jung, Jee-Hyun; Lee, Eun-Hee; Choi, Kwang-Min; Yim, Un Hyuk; Ha, Sung Yong; An, Joon Geon; Kim, Moonkoo

    2017-06-01

    Crude oils from distinct geographical regions have distinct chemical compositions, and, as a result, their toxicity may be different. However, developmental toxicity of crude oils derived from different geographical regions has not been extensively characterized. In this study, flounder embryos were separately exposed to effluents contaminated by three crude oils including: Basrah Light (BLO), Pyrenees (PCO), and Sakhalin Vityaz (SVO), in addition to a processed fuel oil (MFO-380), to measure developmental toxicity and for gene expressions. Each oil possessed a distinct chemical composition. Edema defect was highest in embryos exposed to PCO and MFO-380 that both have a greater fraction of three-ring PAHs (33% and 22%, respectively) compared to BLO and SVO. Observed caudal fin defects were higher in embryos exposed to SVO and MFO-380, which are both dominated by naphthalenes (81% and 52%, respectively). CYP1A gene expressions were also highest in embryos exposed to SVO and MFO-380. Higher incidence of cardiotoxicity and lower nkx 2.5 expression were detected in embryos exposed to PCO. Unique gene expression profiles were observed in embryos exposed to crude oils with distinct compositions. This study demonstrates that crude oils of different geographical origins with different compositional characteristics induce developmental toxicity to different degrees. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Family Life and Developmental Idealism in Yazd, Iran

    PubMed Central

    Abbasi-Shavazi, Mohammad Jalal; Askari-Nodoushan, Abbas

    2012-01-01

    BACKGROUND This paper is motivated by the theory that developmental idealism has been disseminated globally and has become an international force for family and demographic change. Developmental idealism is a set of cultural beliefs and values about development and how development relates to family and demographic behavior. It holds that modern societies are causal forces producing modern families, that modern families help to produce modern societies, and that modern family change is to be expected. OBJECTIVE We examine the extent to which developmental idealism has been disseminated in Iran. We also investigate predictors of the dissemination of developmental idealism. METHODS We use survey data collected in 2007 from a sample of women in Yazd, a city in Iran. We examine the distribution of developmental idealism in the sample and the multivariate predictors of developmental idealism. RESULTS We find considerable support for the expectation that many elements of developmental idealism have been widely disseminated. Statistically significant majorities associate development with particular family attributes, believe that development causes change in families, believe that fertility reductions and age-at-marriage increases help foster development, and perceive family trends in Iran headed toward modernity. As predicted, parental education, respondent education, and income affect adherence to developmental idealism. CONCLUSIONS Developmental idealism has been widely disseminated in Yazd, Iran and is related to social and demographic factors in predicted ways. COMMENTS Although our data come from only one city, we expect that developmental idealism has been widely distributed in Iran, with important implications for family and demographic behavior. PMID:22942772

  14. Regulation of Expressive Behavior as Reflecting Affect Socialization.

    ERIC Educational Resources Information Center

    Saarni, Carolyn

    Regulated expressiveness (the modification of expressive behavior) is a complex phenomenon. Accomplished basically in four ways, regulated expressiveness has developmental dimensions, motivational precursors, and cognitive antecedents, including perspective-taking ability and the growth of self-awareness. Ability to regulate expressiveness appears…

  15. Regulatory states in the developmental control of gene expression.

    PubMed

    Peter, Isabelle S

    2017-09-01

    A growing body of evidence shows that gene expression in multicellular organisms is controlled by the combinatorial function of multiple transcription factors. This indicates that not the individual transcription factors or signaling molecules, but the combination of expressed regulatory molecules, the regulatory state, should be viewed as the functional unit in gene regulation. Here, I discuss the concept of the regulatory state and its proposed role in the genome-wide control of gene expression. Recent analyses of regulatory gene expression in sea urchin embryos have been instrumental for solving the genomic control of cell fate specification in this system. Some of the approaches that were used to determine the expression of regulatory states during sea urchin embryogenesis are reviewed. Significant developmental changes in regulatory state expression leading to the distinct specification of cell fates are regulated by gene regulatory network circuits. How these regulatory state transitions are encoded in the genome is illuminated using the sea urchin endoderm-mesoderms cell fate decision circuit as an example. These observations highlight the importance of considering developmental gene regulation, and the function of individual transcription factors, in the context of regulatory states. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  16. Spatial localization of EGF family ligands and receptors in the zebrafish ovarian follicle and their expression profiles during folliculogenesis.

    PubMed

    Tse, Anna Chung-Kwan; Ge, Wei

    2010-07-01

    The roles of epidermal growth factor (EGF) family in the ovary have received increasing attention recently. Despite this, the production sites of EGF family members in the ovarian follicle still remain controversial. Using zebrafish as the model, the present study investigated spatial distribution of several EGF family ligands and receptors in the follicle as well as their temporal expression profiles during folliculogenesis. RT-PCR analysis on the somatic follicle layer and oocyte revealed that all EGF family ligands examined (egf, tgfa, btc and hbegf) were mostly or exclusively expressed in the oocyte. In contrast, their common receptor (egfr) was expressed exclusively in the follicle layer. By comparison, members of activin family showed an opposite pattern of distribution. Activin subunits (inhbaa and inhbb) were both expressed exclusively in the follicle layer whereas activin receptors and follistatin were abundantly present in the oocyte. During folliculogenesis, egf, tgfa and hbegf increased their expression together with egfr in the fast secondary growth phase. The developmental profiles of EGF family during embryogenesis appeared to argue for an important role for EGF family in folliculogenesis rather than embryogenesis as maternal molecules. The present study provided clear evidence for the existence of two paracrine pathways in the follicle, the oocyte-derived EGF family ligands and follicle cell-derived activins, which may mediate oocyte-to-follicle cell and follicle cell-to-oocyte communications, respectively. The functional relationship between these two signaling systems in the follicle is suggested by the observation that all four EGFR ligands examined significantly stimulated activin subunit expression in cultured follicle cells. (c) 2009 Elsevier Inc. All rights reserved.

  17. Development of intestinal ion-transporting mechanisms during smoltification and seawater acclimation in Atlantic salmon Salmo salar

    USGS Publications Warehouse

    Sundh, Henrik; Nilsen, Tom O.; Lindström, Jenny; Hasselberg-Frank, Linda; Stefansson, Sigurd O.; McCormick, Stephen D.; Sundell, K.

    2014-01-01

    This study investigated the expression of ion transporters involved in intestinal fluid absorption and presents evidence for developmental changes in abundance and tissue distribution of these transporters during smoltification and seawater (SW) acclimation of Atlantic salmonSalmo salar. Emphasis was placed on Na+, K+-ATPase (NKA) and Na+, K+, Cl− co-transporter (NKCC) isoforms, at both transcriptional and protein levels, together with transcription of chloride channel genes. The nka α1c was the dominant isoform at the transcript level in both proximal and distal intestines; also, it was the most abundant isoform expressed in the basolateral membrane of enterocytes in the proximal intestine. This isoform was also abundantly expressed in the distal intestine in the lower part of the mucosal folds. The protein expression of intestinal Nkaα1c increased during smoltification. Immunostaining was localized to the basal membrane of the enterocytes in freshwater (FW) fish, and re-distributed to a lateral position after SW entry. Two other Nka isoforms, α1a and α1b, were expressed in the intestine but were not regulated to the same extent during smoltification and subsequent SW transfer. Their localization in the intestinal wall indicates a house-keeping function in excitatory tissues. The absorptive form of the NKCC-like isoform (sub-apically located NKCC2 and/or Na+, Cl−co-transporter) increased during smoltification and further after SW transfer. The cellular distribution changed from a diffuse expression in the sub-apical regions during smoltification to clustering of the transporters closer to the apical membrane after entry to SW. Furthermore, transcript abundance indicates that the mechanisms necessary for exit of chloride ions across the basolateral membrane and into the lateral intercellular space are present in the form of one or more of three different chloride channels: cystic fibrosis transmembrane conductance regulator I and II and chloride channel 3.

  18. Regional distribution of calretinin and calbindin-D28k expression in the brain of the urodele amphibian Pleurodeles waltl during embryonic and larval development.

    PubMed

    Joven, Alberto; Morona, Ruth; Moreno, Nerea; González, Agustín

    2013-07-01

    The sequence of appearance of calretinin and calbindin-D28k immunoreactive (CRir and CBir, respectively) cells and fibers has been studied in the brain of the urodele amphibian Pleurodeles waltl. Embryonic, larval and juvenile stages were studied. The early expression and the dynamics of the distribution of CBir and CRir structures have been used as markers for developmental aspects of distinct neuronal populations, highlighting the accurate extent of many regions in the developing brain, not observed on the basis of cytoarchitecture alone. CR and, to a lesser extent, CB are expressed early in the central nervous system and show a progressively increasing expression from the embryonic stages throughout the larval life and, in general, the labeled structures in the developing brain retain their ability to express these proteins in the adult brain. The onset of CRir cells primarily served to follow the development of the olfactory bulbs, subpallium, thalamus, alar hypothalamus, mesencephalic tegmentum, and distinct cell populations in the rhombencephalic reticular formation. CBir cells highlighted the development of, among others, the pallidum, hypothalamus, dorsal habenula, midbrain tegmentum, cerebellum, and central gray of the rostral rhombencephalon. However, it was the relative and mostly segregated distribution of both proteins in distinct cell populations which evidenced the developing regionalization of the brain. The results have shown the usefulness in neuroanatomy of the analysis during development of the onset of CBir and CRir structures, but the comparison with previous data has shown extensive variability across vertebrate classes. Therefore, one should be cautious when comparing possible homologue structures across species only on the basis of the expression of these proteins, due to the variation of the content of calcium-binding proteins observed in well-established homologous regions in the brain of different vertebrates.

  19. Expression Patterns and Subcellular Localization of Carbonic Anhydrases Are Developmentally Regulated during Tooth Formation

    PubMed Central

    Reibring, Claes-Göran; El Shahawy, Maha; Hallberg, Kristina; Kannius-Janson, Marie; Nilsson, Jeanette; Parkkila, Seppo; Sly, William S.; Waheed, Abdul; Linde, Anders; Gritli-Linde, Amel

    2014-01-01

    Carbonic anhydrases (CAs) play fundamental roles in several physiological events, and emerging evidence points at their involvement in an array of disorders, including cancer. The expression of CAs in the different cells of teeth is unknown, let alone their expression patterns during odontogenesis. As a first step towards understanding the role of CAs during odontogenesis, we used immunohistochemistry, histochemistry and in situ hybridization to reveal hitherto unknown dynamic distribution patterns of eight CAs in mice. The most salient findings include expression of CAII/Car2 not only in maturation-stage ameloblasts (MA) but also in the papillary layer, dental papilla mesenchyme, odontoblasts and the epithelial rests of Malassez. We uncovered that the latter form lace-like networks around incisors; hitherto these have been known to occur only in molars. All CAs studied were produced by MA, however CAIV, CAIX and CARPXI proteins were distinctly enriched in the ruffled membrane of the ruffled MA but exhibited a homogeneous distribution in smooth-ended MA. While CAIV, CAVI/Car6, CAIX, CARPXI and CAXIV were produced by all odontoblasts, CAIII distribution displayed a striking asymmetry, in that it was virtually confined to odontoblasts in the root of molars and root analog of incisors. Remarkably, from initiation until near completion of odontogenesis and in several other tissues, CAXIII localized mainly in intracellular punctae/vesicles that we show to overlap with LAMP-1- and LAMP-2-positive vesicles, suggesting that CAXIII localizes within lysosomes. We showed that expression of CAs in developing teeth is not confined to cells involved in biomineralization, pointing at their participation in other biological events. Finally, we uncovered novel sites of CA expression, including the developing brain and eye, the olfactory epithelium, melanoblasts, tongue, notochord, nucleus pulposus and sebaceous glands. Our study provides important information for future single or multiple gene targeting strategies aiming at deciphering the function of CAs during odontogenesis. PMID:24789143

  20. Function and regulation of heat shock factor 2 during mouse embryogenesis

    PubMed Central

    Rallu, M.; Loones, Mt.; Lallemand, Y.; Morimoto, R.; Morange, M.; Mezger, V.

    1997-01-01

    The spontaneous expression of heat shock genes during development is well documented in many animal species, but the mechanisms responsible for this developmental regulation are only poorly understood. In vertebrates, additional heat shock transcription factors, distinct from the heat shock factor 1 (HSF1) involved in the stress response, were suggested to be involved in this developmental control. In particular, the mouse HSF2 has been found to be active in testis and during preimplantation development. However, the role of HSF2 and its mechanism of activation have remained elusive due to the paucity of data on its expression during development. In this study, we have examined HSF2 expression during the postimplantation phase of mouse development. Our data show a developmental regulation of HSF2, which is expressed at least until 15.5 days of embryogenesis. It becomes restricted to the central nervous system during the second half of gestation. It is expressed in the ventricular layer of the neural tube which contains mitotically active cells but not in postmitotic neurons. Parallel results were obtained for mRNA, protein, and activity levels, demonstrating that the main level of control was transcriptional. The detailed analysis of the activity of a luciferase reporter gene under the control of the hsp70.1 promoter, as well as the description of the protein expression patterns of the major heat shock proteins in the central nervous system, show that HSF2 and heat shock protein expression domains do not coincide. This result suggests that HFS2 might be involved in other regulatory developmental pathways and paves the way to new functional approaches. PMID:9122205

  1. MicroRNA-20a is essential for normal embryogenesis by targeting vsx1 mRNA in fish

    PubMed Central

    Sun, Lei; Li, Heng; Xu, Xiaofeng; Xiao, Guanxiu; Luo, Chen

    2015-01-01

    MicroRNAs are major post-transcriptional regulators of gene expression and have essential roles in diverse developmental processes. In vertebrates, some regulatory genes play different roles at different developmental stages. These genes are initially transcribed in a wide embryonic region but restricted within distinct cell types at subsequent stages during development. Therefore, post-transcriptional regulation is required for the transition from one developmental stage to the next and the establishment of different cell identities. However, the regulation of many multiple functional genes at post-transcription level during development remains unknown. Here we show that miR-20a can target the mRNA of vsx1, a multiple functional gene, at the 3′-UTR and inhibit protein expression in both goldfish and zebrafish. The expression of miR-20a is initiated ubiquitously at late gastrula stage and exhibits a tissue-specific pattern in the developing retina. Inhibition of vsx1 3′-UTR mediated protein expression occurs when and where miR-20a is expressed. Decoying miR-20a resulted in severely impaired head, eye and trunk formation in association with excessive generation of vsx1 marked neurons in the spinal cord and defects of somites in the mesoderm region. These results demonstrate that miR-20a is essential for normal embryogenesis by restricting Vsx1 expression in goldfish and zebrafish, and that post-transcriptional regulation is an essential mechanism for Vsx1 playing different roles in diverse developmental processes. PMID:25833418

  2. The Bicoid Class Homeodomain Factors ceh-36/OTX and unc-30/PITX Cooperate in C. elegans Embryonic Progenitor Cells to Regulate Robust Development

    PubMed Central

    Walton, Travis; Preston, Elicia; Nair, Gautham; Zacharias, Amanda L.; Raj, Arjun; Murray, John Isaac

    2015-01-01

    While many transcriptional regulators of pluripotent and terminally differentiated states have been identified, regulation of intermediate progenitor states is less well understood. Previous high throughput cellular resolution expression studies identified dozens of transcription factors with lineage-specific expression patterns in C. elegans embryos that could regulate progenitor identity. In this study we identified a broad embryonic role for the C. elegans OTX transcription factor ceh-36, which was previously shown to be required for the terminal specification of four neurons. ceh-36 is expressed in progenitors of over 30% of embryonic cells, yet is not required for embryonic viability. Quantitative phenotyping by computational analysis of time-lapse movies of ceh-36 mutant embryos identified cell cycle or cell migration defects in over 100 of these cells, but most defects were low-penetrance, suggesting redundancy. Expression of ceh-36 partially overlaps with that of the PITX transcription factor unc-30. unc-30 single mutants are viable but loss of both ceh-36 and unc-30 causes 100% lethality, and double mutants have significantly higher frequencies of cellular developmental defects in the cells where their expression normally overlaps. These factors are also required for robust expression of the downstream developmental regulator mls-2/HMX. This work provides the first example of genetic redundancy between the related yet evolutionarily distant OTX and PITX families of bicoid class homeodomain factors and demonstrates the power of quantitative developmental phenotyping in C. elegans to identify developmental regulators acting in progenitor cells. PMID:25738873

  3. Developmental profiles and mentality in preschool children with Prader-Willi syndrome: a preliminary study.

    PubMed

    Chen, Chien-Min; Chen, Chia-Ling; Hou, Jia-Woei; Hsu, Hung-Chih; Chung, Chia-Ying; Chou, Shih-Wei; Lin, Chu-Hsu; Chen, Kai-Hua

    2010-01-01

    A majority of the children with Prader-Willi syndrome (PWS) have global developmental delay and mental delay. The aim of this study was to investigate the developmental profiles and mental assessments among preschool children with PWS. Ten children with PWS between the ages of 15 months to 6 years, and 11 children with typical development were enrolled. Developmental profiles in terms of their developmental quotient (DQ) for the eight domains of the Chinese Children Developmental Inventory (CCDI) and mental assessments in terms of intelligence quotient (IQ) and developmental index (DI) were carried out for all children. The DQs of all eight domains, including gross motor, fine motor, expressive language, concept comprehension, situation comprehension, self help, personal- social and general development, in the PWS group were lower than the DQs of the children from the typical development group (p < 0.01). Children with PWS had better DQs in the fine motor domain than in the gross motor domain and in the receptive language domain than in the expressive language domain. Furthermore, their verbal IQ were better than their performance IQ and their mental DI was better than their psychomotor DI. These findings suggest that the children with PWS show an uneven global developmental delay together with an uneven mental delay. The results of this study should allow clinicians to better understand the developmental functioning of children with PWS and this will help with the planning of treatment strategies.

  4. Children's Representations of Facial Expression and Identity: Identity-Contingent Expression Aftereffects

    ERIC Educational Resources Information Center

    Vida, Mark D.; Mondloch, Catherine J.

    2009-01-01

    This investigation used adaptation aftereffects to examine developmental changes in the perception of facial expressions. Previous studies have shown that adults' perceptions of ambiguous facial expressions are biased following adaptation to intense expressions. These expression aftereffects are strong when the adapting and probe expressions share…

  5. Hepatic cytochrome P450 activity, abundance, and expression throughout human development

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sadler, Natalie C.; Nandhikonda, Premchendar; Webb-Robertson, Bobbie-Jo M.

    Cytochrome P450s are Phase I metabolic enzymes that play critical roles in the biotransformation of endogenous compounds and xenobiotics. The expression and activity of P450 enzymes can vary considerably throughout human development, especially when comparing fetal development to neonates, children, and adults. In an effort to develop a more comprehensive understanding of the ontogeny of P450 expression and activity we employed a multi-omic characterization of P450 transcript expression, protein abundance, and functional activity. To quantify the functional activity of individual P450s we employ activity-based protein profiling, which uses modified mechanism-based inhibitors of P450s as chemical probes, in tandem with proteomicmore » analyses to quantify activity. Our results reveal life-stage-dependent variability in P450 expression, abundance, and activity throughout human development and frequent discordant relationships between expression and activity. The results were used to distribute P450s into three general classes based upon developmental stage of expression and activity. We have significantly expanded the knowledge of P450 ontogeny, particularly at the level of individual P450 activity. We anticipate that our ontogeny results will be useful for enabling predictive therapeutic dosing, and for avoiding potentially adverse and harmful reactions during maturation from both therapeutic drugs and environmental xenobiotics.« less

  6. Gene expression as a sensitive endpoint to evaluate cell differentiation and maturation of the developing central nervous system in primary cultures of rat cerebellar granule cells (CGCs) exposed to pesticides

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hogberg, Helena T.; Department of Physiology, Wenner-Gren Institute, Stockholm University; Kinsner-Ovaskainen, Agnieszka

    The major advantage of primary neuronal cultures for developmental neurotoxicity (DNT) testing is their ability to replicate the crucial stages of neurodevelopment. In our studies using primary culture of cerebellar granule cells (CGCs) we have evaluated whether the gene expression relevant to the most critical developmental processes such as neuronal differentiation (NF-68 and NF-200) and functional maturation (NMDA and GABA{sub A} receptors), proliferation and differentiation of astrocytes (GFAP and S100{beta}) as well as the presence of neural precursor cells (nestin and Sox10) could be used as an endpoint for in vitro DNT. The expression of these genes was assessed aftermore » exposure to various pesticides (paraquat parathion, dichlorvos, pentachlorophenol and cycloheximide) that could induce developmental neurotoxicity through different mechanisms. All studied pesticides significantly modified the expression of selected genes, related to the different stages of neuronal and/or glial cell development and maturation. The most significant changes were observed after exposure to paraquat and parathion (i.e. down-regulation of mRNA expression of NF-68 and NF-200, NMDA and GABA{sub A} receptors). Similarly, dichlorvos affected mainly neurons (decreased mRNA expression of NF-68 and GABA{sub A} receptors) whereas cycloheximide had an effect on neurons and astrocytes, as significant decreases in the mRNA expression of both neurofilaments (NF-68 and NF-200) and the astrocyte marker (S100{beta}) were observed. Our results suggest that toxicity induced by pesticides that target multiple pathways of neurodevelopment can be identified by studying expression of genes that are involved in different stages of cell development and maturation, and that gene expression could be used as a sensitive endpoint for initial screening to identify the compounds with the potential to cause developmental neurotoxicity.« less

  7. Hepatic expression of transcription factors affecting developmental regulation of UGT1A1 in the Han Chinese population.

    PubMed

    Nie, Ya-Li; He, Hang; Li, Jiang-Feng; Meng, Xiang-Guang; Yan, Liang; Wang, Pei; Wang, Shu-Jie; Bi, Hong-Zheng; Zhang, Li-Rong; Kan, Quan-Cheng

    2017-01-01

    Complete or partial inactivity of UGT1A1, the unique enzyme responsible for bilirubin glucuronidation, is commonly associated with hyperbilirubinemia. We investigated the dynamic expression of UGT1A1, and that of the transcription factors (TFs) involved in its developmental regulation, during human hepatic growth in Han Chinese individuals. Eighty-eight prenatal, pediatric, and adult liver samples were obtained from Han Chinese individuals. Quantitative real-time polymerase chain reaction was used to evaluate mRNA expression of UGT1A1 and TFs including PXR, CAR, HNF1A, HNF4A, PPARA, etc. UGT1A1 protein levels and metabolic activity were determined by western blotting and high-performance liquid chromatography. Direct sequencing was employed to genotype UGT1A1*6 (211G˃A) and UGT1A1*28 (TA6˃TA7) polymorphisms. UGT1A1 expression was minimal in prenatal samples, but significantly elevated during pediatric and adult stages. mRNA and protein levels and metabolic activity were prominently increased (120-, 20-, and 10-fold, respectively) in pediatric and adult livers compared to prenatal samples. Furthermore, expression did not differ appreciably between pediatric and adult periods. Dynamic expression of TFs, including PXR, CAR, HNF1A, HNF4A, and PPARA, was consistent with UGT1A1 levels at each developmental stage. A pronounced correlation between expression of these TFs and that of UGT1A1 (P < 0.001) was observed. Moreover, UGT1A1*6 and UGT1A1*28 polymorphisms reduced levels of UGT1A1 by up to 40-60 %. Hepatic expression of transcription factors is associated with developmental regulation of UGT1A1 in the Han Chinese population. Moreover, UGT1A1 polymorphisms are associated with reduced expression of UGT1A1 mRNA and protein, as well as enzyme activity.

  8. Hypermethylation of Homeobox A10 by in Utero Diethylstilbestrol Exposure: An Epigenetic Mechanism for Altered Developmental Programming

    PubMed Central

    Bromer, Jason G.; Wu, Jie; Zhou, Yuping; Taylor, Hugh S.

    2009-01-01

    Diethylstilbestrol (DES) is a nonsteroidal estrogen that induces developmental anomalies of the female reproductive tract. The homeobox gene HOXA10 controls uterine organogenesis, and its expression is altered after in utero DES exposure. We hypothesized that an epigenetic mechanism underlies DES-mediated alterations in HOXA10 expression. We analyzed the expression pattern and methylation profile of HOXA10 after DES exposure. Expression of HOXA10 is increased in human endometrial cells after DES exposure, whereas Hoxa10 expression is repressed and shifted caudally from its normal location in mice exposed in utero. Cytosine guanine dinucleotide methylation frequency in the Hoxa10 intron was higher in DES-exposed offspring compared with controls (P = 0.017). The methylation level of Hoxa10 was also higher in the caudal portion of the uterus after DES exposure at the promoter and intron (P < 0.01). These changes were accompanied by increased expression of DNA methyltransferases 1 and 3b. No changes in methylation were observed after in vitro or adult DES exposure. DES has a dual mechanism of action as an endocrine disruptor; DES functions as a classical estrogen and directly stimulates HOXA10 expression with short-term exposure, however, in utero exposure results in hypermethylation of the HOXA10 gene and long-term altered HOXA10 expression. We identify hypermethylation as a novel mechanism of DES-induced altered developmental programming. PMID:19299448

  9. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    PubMed

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-12-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  10. Patterns of expression of position-dependent integrated transgenes in mouse embryo.

    PubMed Central

    Bonnerot, C; Grimber, G; Briand, P; Nicolas, J F

    1990-01-01

    The abilities to introduce foreign DNA into the genome of mice and to visualize gene expression at the single-cell level underlie a method for defining individual elements of a genetic program. We describe the use of an Escherichia coli lacZ reporter gene fused to the promoter of the gene for hypoxanthine phosphoribosyl transferase that is expressed in all tissues. Most transgenic mice (six of seven) obtained with this construct express the lacZ gene from the hypoxanthine phosphoribosyltransferase promoter. Unexpectedly, however, the expression is temporally and spatially regulated. Each transgenic line is characterized by a specific, highly reproducible pattern of lacZ expression. These results show that, for expression, the integrated construct must be complemented by elements of the genome. These elements exert dominant developmental control on the hypoxanthine phosphoribosyltransferase promoter. The expression patterns in some transgenic mice conform to a typological marker and in others to a subtle combination of typology and topography. These observations define discrete heterogeneities of cell types and of certain structures, particularly in the nervous system and in the mesoderm. This system opens opportunities for developmental studies by providing cellular, molecular, and genetic markers of cell types, cell states, and cells from developmental compartments. Finally this method illustrates that genes transduced or transposed to a different position in the genome acquire different spatiotemporal specificities, a result that has implications for evolution. Images PMID:1696727

  11. Developmental exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin alters DNA methyltransferase (dnmt) expression in zebrafish (Danio rerio)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aluru, Neelakanteswar, E-mail: naluru@whoi.edu; Kuo, Elaine; Stanford University, 450 Serra Mall, Stanford, CA 94305

    2015-04-15

    DNA methylation is one of the most important epigenetic modifications involved in the regulation of gene expression. The DNA methylation reaction is catalyzed by DNA methyltransferases (DNMTs). Recent studies have demonstrated that toxicants can affect normal development by altering DNA methylation patterns, but the mechanisms of action are poorly understood. Hence, we tested the hypothesis that developmental exposure to TCDD affects dnmt gene expression patterns. Zebrafish embryos were exposed to 5 nM TCDD for 1 h from 4 to 5 h post-fertilization (hpf) and sampled at 12, 24, 48, 72, and 96 hpf to determine dnmt gene expression and DNAmore » methylation patterns. We performed a detailed analysis of zebrafish dnmt gene expression during development and in adult tissues. Our results demonstrate that dnmt3b genes are highly expressed in early stages of development, and dnmt3a genes are more abundant in later stages. TCDD exposure upregulated dnmt1 and dnmt3b2 expression, whereas dnmt3a1, 3b1, and 3b4 are downregulated following exposure. We did not observe any TCDD-induced differences in global methylation or hydroxymethylation levels, but the promoter methylation of aryl hydrocarbon receptor (AHR) target genes was altered. In TCDD-exposed embryos, AHR repressor a (ahrra) and c-fos promoters were differentially methylated. To characterize the TCDD effects on DNMTs, we cloned the dnmt promoters with xenobiotic response elements and conducted AHR transactivation assays using a luciferase reporter system. Our results suggest that ahr2 can regulate dnmt3a1, dnmt3a2, and dnmt3b2 expression. Overall, we demonstrate that developmental exposure to TCDD alters dnmt expression and DNA methylation patterns. - Highlights: • TCDD altered the dnmt expression in a gene and developmental time-specific manner. • TCDD hypermethylated ahrra and hypomethylated c-fos proximal promoter regions. • Functional analysis suggests that ahr2 can regulate dnmt3a1, 3a2, and 3b2 expression. • Dnmt3b genes are expressed early whereas dnmt3a are abundant later in development.« less

  12. Developmentally sensitive markers of personality functioning in adolescents: Age-specific and age-neutral expressions.

    PubMed

    Debast, Inge; Rossi, Gina; Feenstra, Dineke; Hutsebaut, Joost

    2017-04-01

    Criterion D of the Diagnostic and Statistical Manual of Mental Disorders (5th ed.; DSM-5 ; American Psychiatric Association [APA], 2013) refers to a possible onset of personality disorders (PDs) in adolescence and in Section II the development/course in adolescence is described by some typical characteristics for several PDs. Yet, age-specific expressions of PDs are lacking in Section III. We urgently need a developmentally sensitive assessment instrument that differentiates developmental and contextual changes on the one hand from expressions of personality pathology on the other hand. Therefore we investigated which items of the Severity Indices for Personality Problems-118 (SIPP-118) were developmentally sensitive throughout adolescence and adulthood and which could be considered more age-specific markers requiring other content or thresholds over age groups. Applying item response theory (IRT) we detected differential item functioning (DIF) in 36% of the items in matched samples of 639 adolescents versus 639 adults. The DIF across age groups mainly reflected a different degree of symptom expressions for the same underlying level of functioning. The threshold for exhibiting symptoms given a certain degree of personality dysfunction was lower in adolescence for areas of personality functioning related to the Self and Interpersonal domains. Some items also measured a latent construct of personality functioning differently across adolescents and adults. This suggests that several facets of the SIPP-118 do not solely measure aspects of personality pathology in adolescents, but likely include more developmental issues. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  13. Developmental Changes is Expression of Beta-Adrenergic Receptors in Cultures of C2C12 Skeletal Muscle Cells

    NASA Technical Reports Server (NTRS)

    Young, Ronald B.; Bridge, K. Y.; Vaughn, J. R.

    2000-01-01

    beta-Adrenergic receptor (bAR) agonists have been reported to modulate growth in several mammalian and avian species, and bAR agonists presumably exert their physiological action on skeletal muscle cells through this receptor. Because of the importance of bAR regulation on muscle protein metabolism in muscle cells, the objectives of this study were to determine the developmental expression pattern of the bAR population in C2C12 skeletal muscle cells, and to analyze changes in both the quantity and isoform expression of the major muscle protein, myosin. The number of bAR in mononucleated C2C12 cells was approximately 8,000 bAR per cell, which is comparable with the population reported in several other nonmuscle cell types. However, the bar population increased after myoblast fusion to greater than 50,000 bAR per muscle cell equivalent. The reasons for this apparent over-expression of bAR in C2C12 cells is not known. The quantity of myosin also increased after C2C12 myoblast fusion, but the quantity of myosin was less than that reported in primary muscle cell cultures. Finally, at least five different isoforms of myosin heavy chain could be resolved in C2C12 cells, and three of these exhibited either increased or decreased developmental regulation relative to the others. Thus, C2C12 myoblasts undergo developmental regulation of bAR population and myosin heavy chain isoform expression.

  14. Platelet Serotonin Levels in Pervasive Developmental Disorders and Mental Retardation: Diagnostic Group Differences, Within-Group Distribution, and Behavioral Correlates.

    ERIC Educational Resources Information Center

    Mulder, Erik J.; Anderson, George M.; Kema, Ido P.; De Bildt, Annelies; Van Lang, Natasja D.J.; Den Boer, Johan A.; Minderaa Ruud B.

    2004-01-01

    Objective: To investigate group differences, the within-group distributions, and the clinical correlates of platelet serotonin (5-HT) levels in pervasive developmental disorders (PDD). Method: Platelet 5-HT levels were measured in Dutch children and young adults, recruited from 2001 through 2003, with PDD (autism, Asperger's and PDD-not otherwise…

  15. Computational Analysis of the Caenorhabditis elegans Germline to Study the Distribution of Nuclei, Proteins, and the Cytoskeleton.

    PubMed

    Gopal, Sandeep; Pocock, Roger

    2018-04-19

    The Caenorhabditis elegans (C. elegans) germline is used to study several biologically important processes including stem cell development, apoptosis, and chromosome dynamics. While the germline is an excellent model, the analysis is often two dimensional due to the time and labor required for three-dimensional analysis. Major readouts in such studies are the number/position of nuclei and protein distribution within the germline. Here, we present a method to perform automated analysis of the germline using confocal microscopy and computational approaches to determine the number and position of nuclei in each region of the germline. Our method also analyzes germline protein distribution that enables the three-dimensional examination of protein expression in different genetic backgrounds. Further, our study shows variations in cytoskeletal architecture in distinct regions of the germline that may accommodate specific spatial developmental requirements. Finally, our method enables automated counting of the sperm in the spermatheca of each germline. Taken together, our method enables rapid and reproducible phenotypic analysis of the C. elegans germline.

  16. Analyses of the NAC transcription factor gene family in Gossypium raimondii Ulbr.: chromosomal location, structure, phylogeny, and expression patterns.

    PubMed

    Shang, Haihong; Li, Wei; Zou, Changsong; Yuan, Youlu

    2013-07-01

    NAC domain proteins are plant-specific transcription factors known to play diverse roles in various plant developmental processes. In the present study, we performed the first comprehensive study of the NAC gene family in Gossypium raimondii Ulbr., incorporating phylogenetic, chromosomal location, gene structure, conserved motif, and expression profiling analyses. We identified 145 NAC transcription factor (NAC-TF) genes that were phylogenetically clustered into 18 distinct subfamilies. Of these, 127 NAC-TF genes were distributed across the 13 chromosomes, 80 (55%) were preferentially retained duplicates located in both duplicated regions and six were located in triplicated chromosomal regions. The majority of NAC-TF genes showed temporal-, spatial-, and tissue-specific expression patterns based on transcriptomic and qRT-PCR analyses. However, the expression patterns of several duplicate genes were partially redundant, suggesting the occurrence of sub-functionalization during their evolution. Based on their genomic organization, we concluded that genomic duplications contributed significantly to the expansion of the NAC-TF gene family in G. raimondii. Comprehensive analysis of their expression profiles could provide novel insights into the functional divergence among members of the NAC gene family in G. raimondii. © 2013 Institute of Botany, Chinese Academy of Sciences.

  17. Do convergent developmental mechanisms underlie convergent phenotypes?

    NASA Technical Reports Server (NTRS)

    Wray, Gregory A.

    2002-01-01

    Convergence is a pervasive evolutionary process, affecting many aspects of phenotype and even genotype. Relatively little is known about convergence in developmental processes, however, nor about the degree to which convergence in development underlies convergence in anatomy. A switch in the ecology of sea urchins from feeding to nonfeeding larvae illustrates how convergence in development can be associated with convergence in anatomy. Comparisons to more distantly related taxa, however, suggest that this association may be limited to relatively close phylogenetic comparisons. Similarities in gene expression during development provide another window into the association between convergence in developmental processes and convergence in anatomy. Several well-studied transcription factors exhibit likely cases of convergent gene expression in distantly related animal phyla. Convergence in regulatory gene expression domains is probably more common than generally acknowledged, and can arise for several different reasons. Copyright 2002 S. Karger AG, Basel.

  18. The Effects of a Developmental, Social-Pragmatic Language Intervention on Rate of Expressive Language Production in Young Children with Autistic Spectrum Disorders

    ERIC Educational Resources Information Center

    Ingersoll, Brooke; Dvortcsak, Anna; Whalen, Christina; Sikora, Darryn

    2005-01-01

    Developmental, social-pragmatic (DSP) interventions are based on the study of interactions between typically developing infants and their mothers. Despite the fact that DSP approaches are firmly grounded in developmental theory, there is limited research on the efficacy of these interventions for promoting social-communicative behavior in young…

  19. An epigenetic view of developmental diseases: new targets, new therapies.

    PubMed

    Xie, Pei; Zang, Li-Qun; Li, Xue-Kun; Shu, Qiang

    2016-08-01

    Function of epigenetic modifications is one of the most competitive fields in life science. Over the past several decades, it has been revealed that epigenetic modifications play essential roles in development and diseases including developmental diseases. In the present review, we summarize the recent progress about the function of epigenetic regulation, especially DNA and RNA modifications in developmental diseases. Original research articles and literature reviews published in PubMed-indexed journals. DNA modifications including methylation and demethylation can regulate gene expression, and are involved in development and multiple diseases including Rett syndrome, Autism spectrum disorders, congenital heart disease and cancer, etc. RNA methylation and demethylation play important roles in RNA processing, reprogramming, circadian, and neuronal activity, and then modulate development. DNA and RNA modifications play important roles in development and diseases through regulating gene expression. Epigenetic components could serve as novel targets for the treatment of developmental diseases.

  20. Delimiting regulatory sequences of the Drosophila melanogaster Ddc gene.

    PubMed Central

    Hirsh, J; Morgan, B A; Scholnick, S B

    1986-01-01

    We delimited sequences necessary for in vivo expression of the Drosophila melanogaster dopa decarboxylase gene Ddc. The expression of in vitro-altered genes was assayed following germ line integration via P-element vectors. Sequences between -209 and -24 were necessary for normally regulated expression, although genes lacking these sequences could be expressed at 10 to 50% of wild-type levels at specific developmental times. These genes showed components of normal developmental expression, which suggests that they retain some regulatory elements. All Ddc genes lacking the normal immediate 5'-flanking sequences were grossly deficient in larval central nervous system expression. Thus, this upstream region must contain at least one element necessary for this expression. A mutated Ddc gene without a normal TATA boxlike sequence used the normal RNA start points, indicating that this sequences is not required for start point specificity. Images PMID:3099170

  1. Loss of RNA expression and allele-specific expression associated with congenital heart disease

    PubMed Central

    McKean, David M.; Homsy, Jason; Wakimoto, Hiroko; Patel, Neil; Gorham, Joshua; DePalma, Steven R.; Ware, James S.; Zaidi, Samir; Ma, Wenji; Patel, Nihir; Lifton, Richard P.; Chung, Wendy K.; Kim, Richard; Shen, Yufeng; Brueckner, Martina; Goldmuntz, Elizabeth; Sharp, Andrew J.; Seidman, Christine E.; Gelb, Bruce D.; Seidman, J. G.

    2016-01-01

    Congenital heart disease (CHD), a prevalent birth defect occurring in 1% of newborns, likely results from aberrant expression of cardiac developmental genes. Mutations in a variety of cardiac transcription factors, developmental signalling molecules and molecules that modify chromatin cause at least 20% of disease, but most CHD remains unexplained. We employ RNAseq analyses to assess allele-specific expression (ASE) and biallelic loss-of-expression (LOE) in 172 tissue samples from 144 surgically repaired CHD subjects. Here we show that only 5% of known imprinted genes with paternal allele silencing are monoallelic versus 56% with paternal allele expression—this cardiac-specific phenomenon seems unrelated to CHD. Further, compared with control subjects, CHD subjects have a significant burden of both LOE genes and ASE events associated with altered gene expression. These studies identify FGFBP2, LBH, RBFOX2, SGSM1 and ZBTB16 as candidate CHD genes because of significantly altered transcriptional expression. PMID:27670201

  2. IGF-1 deficiency in a critical period early in life influences the vascular aging phenotype in mice by altering miRNA-mediated post-transcriptional gene regulation: implications for the developmental origins of health and disease hypothesis.

    PubMed

    Tarantini, Stefano; Giles, Cory B; Wren, Jonathan D; Ashpole, Nicole M; Valcarcel-Ares, M Noa; Wei, Jeanne Y; Sonntag, William E; Ungvari, Zoltan; Csiszar, Anna

    2016-08-01

    Epidemiological findings support the concept of Developmental Origins of Health and Disease, suggesting that early-life hormonal influences during a sensitive period of development have a fundamental impact on vascular health later in life. The endocrine changes that occur during development are highly conserved across mammalian species and include dramatic increases in circulating IGF-1 levels during adolescence. The present study was designed to characterize the effect of developmental IGF-1 deficiency on the vascular aging phenotype. To achieve that goal, early-onset endocrine IGF-1 deficiency was induced in mice by knockdown of IGF-1 in the liver using Cre-lox technology (Igf1 f/f mice crossed with mice expressing albumin-driven Cre recombinase). This model exhibits low-circulating IGF-1 levels during the peripubertal phase of development, which is critical for the biology of aging. Due to the emergence of miRNAs as important regulators of the vascular aging phenotype, the effect of early-life IGF-1 deficiency on miRNA expression profile in the aorta was examined in animals at 27 months of age. We found that developmental IGF-1 deficiency elicits persisting late-life changes in miRNA expression in the vasculature, which significantly differed from those in mice with adult-onset IGF-1 deficiency (TBG-Cre-AAV8-mediated knockdown of IGF-1 at 5 month of age in Igf1 f/f mice). Using a novel computational approach, we identified miRNA target genes that are co-expressed with IGF-1 and associate with aging and vascular pathophysiology. We found that among the predicted targets, the expression of multiple extracellular matrix-related genes, including collagen-encoding genes, were downregulated in mice with developmental IGF-1 deficiency. Collectively, IGF-1 deficiency during a critical period during early in life results in persistent changes in post-transcriptional miRNA-mediated control of genes critical targets for vascular health, which likely contribute to the deleterious late-life cardiovascular effects known to occur with developmental IGF-1 deficiency.

  3. Tissue-Specific Gain of RTK Signalling Uncovers Selective Cell Vulnerability during Embryogenesis

    PubMed Central

    Audebert, Stéphane; Helmbacher, Françoise; Dono, Rosanna; Maina, Flavio

    2015-01-01

    The successive events that cells experience throughout development shape their intrinsic capacity to respond and integrate RTK inputs. Cellular responses to RTKs rely on different mechanisms of regulation that establish proper levels of RTK activation, define duration of RTK action, and exert quantitative/qualitative signalling outcomes. The extent to which cells are competent to deal with fluctuations in RTK signalling is incompletely understood. Here, we employ a genetic system to enhance RTK signalling in a tissue-specific manner. The chosen RTK is the hepatocyte growth factor (HGF) receptor Met, an appropriate model due to its pleiotropic requirement in distinct developmental events. Ubiquitously enhanced Met in Cre/loxP-based Rosa26 stopMet knock-in context (Del-R26 Met) reveals that most tissues are capable of buffering enhanced Met-RTK signalling thus avoiding perturbation of developmental programs. Nevertheless, this ubiquitous increase of Met does compromise selected programs such as myoblast migration. Using cell-type specific Cre drivers, we genetically showed that altered myoblast migration results from ectopic Met expression in limb mesenchyme rather than in migrating myoblasts themselves. qRT-PCR analyses show that ectopic Met in limbs causes molecular changes such as downregulation in the expression levels of Notum and Syndecan4, two known regulators of morphogen gradients. Molecular and functional studies revealed that ectopic Met expression in limb mesenchyme does not alter HGF expression patterns and levels, but impairs HGF bioavailability. Together, our findings show that myoblasts, in which Met is endogenously expressed, are capable of buffering increased RTK levels, and identify mesenchymal cells as a cell type vulnerable to ectopic Met-RTK signalling. These results illustrate that embryonic cells are sensitive to alterations in the spatial distribution of RTK action, yet resilient to fluctuations in signalling levels of an RTK when occurring in its endogenous domain of activity. PMID:26393505

  4. Regulation of root hair initiation and expansin gene expression in Arabidopsis

    NASA Technical Reports Server (NTRS)

    Cho, Hyung-Taeg; Cosgrove, Daniel J.

    2002-01-01

    The expression of two Arabidopsis expansin genes (AtEXP7 and AtEXP18) is tightly linked to root hair initiation; thus, the regulation of these genes was studied to elucidate how developmental, hormonal, and environmental factors orchestrate root hair formation. Exogenous ethylene and auxin, as well as separation of the root from the medium, stimulated root hair formation and the expression of these expansin genes. The effects of exogenous auxin and root separation on root hair formation required the ethylene signaling pathway. By contrast, blocking the endogenous ethylene pathway, either by genetic mutations or by a chemical inhibitor, did not affect normal root hair formation and expansin gene expression. These results indicate that the normal developmental pathway for root hair formation (i.e., not induced by external stimuli) is independent of the ethylene pathway. Promoter analyses of the expansin genes show that the same promoter elements that determine cell specificity also determine inducibility by ethylene, auxin, and root separation. Our study suggests that two distinctive signaling pathways, one developmental and the other environmental/hormonal, converge to modulate the initiation of the root hair and the expression of its specific expansin gene set.

  5. Triazole induced concentration-related gene signatures in rat whole embryo culture.

    PubMed

    Robinson, Joshua F; Tonk, Elisa C M; Verhoef, Aart; Piersma, Aldert H

    2012-09-01

    Commonly used as antifungal agents in agriculture and medicine, triazoles have been shown to cause teratogenicity in a diverse set of animal models. Here, we evaluated the dose-dependent impacts of flusilazole, cyproconazole and triadimefon, on global gene expression in relation to effects on embryonic development using the rat whole embryo culture (WEC) model. After 4 h exposure, we identified changes in gene expression due to triazole exposure which preceded morphological alterations observed at 48 h. In general, across the three triazoles, we observed similar directionality of regulation in gene expression and the magnitude of effects on gene expression correlated with the degree of induced developmental toxicity. Significantly regulated genes included key members of steroid/cholesterol and retinoic acid metabolism and hindbrain developmental pathways. Direct comparisons with previous studies suggest that triazole-gene signatures identified in the WEC overlap with zebrafish and mouse, and furthermore, triazoles impact gene expression in a similar manner as retinoic acid exposures in rat embryos. In summary, we further differentiate pathways underlying triazole-developmental toxicity using WEC and demonstrate the conservation of these response-pathways across model systems. Copyright © 2012 Elsevier Inc. All rights reserved.

  6. Effects of perfluorooctanoic acid (PFOA) on expression of peroxisome proliferator-activated receptors (PPAR) and nuclear receptor-regulated genes in fetal and postnatal CD-1 mouse tissues.

    PubMed

    Abbott, Barbara D; Wood, Carmen R; Watkins, Andrew M; Tatum-Gibbs, Katoria; Das, Kaberi P; Lau, Christopher

    2012-07-01

    PPARs regulate metabolism and can be activated by environmental contaminants such as perfluorooctanoic acid (PFOA). PFOA induces neonatal mortality, developmental delay, and growth deficits in mice. Studies in genetically altered mice showed that PPARα is required for PFOA-induced developmental toxicity. In this study, pregnant CD-1 mice were dosed orally from GD1 to 17 with water or 5mg PFOA/kg to examine PPARα, PPARβ, and PPARγ expression and profile the effects of PFOA on PPAR-regulated genes. Prenatal and postnatal liver, heart, adrenal, kidney, intestine, stomach, lung, spleen, and thymus were collected at various developmental ages. RNA and protein were examined using qPCR and Western blot analysis. PPAR expression varied with age in all tissues, and in liver PPARα and PPARγ expression correlated with nutritional changes as the pups matured. As early as GD14, PFOA affected expression of genes involved in lipid and glucose homeostatic control. The metabolic disruption produced by PFOA may contribute to poor postnatal survival and persistent weight deficits of CD-1 mouse neonates. Published by Elsevier Inc.

  7. Characterization and Expression Patterns of microRNAs Involved in Rice Grain Filling

    PubMed Central

    Du, Yanxiu; Zhang, Jing; Li, Junzhou; Liu, Yanxia; Zhao, Yafan; Zhao, Quanzhi

    2013-01-01

    MicroRNAs (miRNAs) are upstream gene regulators of plant development and hormone homeostasis through their directed cleavage or translational repression of the target mRNAs, which may play crucial roles in rice grain filling and determining the final grain weight and yield. In this study, high-throughput sequencing was performed to survey the dynamic expressions of miRNAs and their corresponding target genes at five distinct developmental stages of grain filling. In total, 445 known miRNAs and 45 novel miRNAs were detected with most of them expressed in a developmental stage dependent manner, and the majority of known miRNAs, which increased gradually with rice grain filling, showed negatively related to the grain filling rate. Detailed expressional comparisons revealed a clear negative correlation between most miRNAs and their target genes. It was found that specific miRNA cohorts are expressed in a developmental stage dependent manner during grain filling and the known functions of these miRNAs are involved in plant hormone homeostasis and starch accumulation, indicating that the expression dynamics of these miRNAs might play key roles in regulating rice grain filling. PMID:23365650

  8. Developmental and seasonal expression of PtaHB1, a Populus gene encoding a class III HD-Zip protein, is closely associated with secondary growth and inversely correlated with the level of microRNA (miR166).

    PubMed

    Ko, Jae-Heung; Prassinos, Constantinos; Han, Kyung-Hwan

    2006-01-01

    In contrast to our knowledge of the shoot apical meristem, our understanding of cambium meristem differentiation and maintenance is limited. Class III homeodomain leucine-zipper (HD-Zip) proteins have been shown to play a regulatory role in vascular differentiation. The hybrid aspen (Populus tremulaxPopulus alba) class III HD-Zip transcription factor (PtaHB1) and microRNA 166 (Pta-miR166) family were cloned from hybrid aspen using a combination of in silico and polymerase chain reaction methods. Expression analyses of PtaHB1 and Pta-miR166 were performed by Northern blot analysis. The expression of PtaHB1 was closely associated with wood formation and regulated both developmentally and seasonally, with the highest expression during the active growing season. Also, its expression was inversely correlated with the level of Pta-miR166. Pta-miR166-directed cleavage of PtaHB1 in vivo was confirmed using modified 5'-rapid amplification of cDNA ends (RACE). The expression of Pta-miR166 was much higher in the winter than in the growing seasons, suggesting seasonal and developmental regulation of microRNA in this perennial plant species.

  9. Characterization of Adelphocoris suturalis (Hemiptera: Miridae) Transcriptome from Different Developmental Stages

    NASA Astrophysics Data System (ADS)

    Tian, Caihong; Tek Tay, Wee; Feng, Hongqiang; Wang, Ying; Hu, Yongmin; Li, Guoping

    2015-06-01

    Adelphocoris suturalis is one of the most serious pest insects of Bt cotton in China, however its molecular genetics, biochemistry and physiology are poorly understood. We used high throughput sequencing platform to perform de novo transcriptome assembly and gene expression analyses across different developmental stages (eggs, 2nd and 5th instar nymphs, female and male adults). We obtained 20 GB of clean data and revealed 88,614 unigenes, including 23,830 clusters and 64,784 singletons. These unigene sequences were annotated and classified by Gene Ontology, Clusters of Orthologous Groups, and Kyoto Encyclopedia of Genes and Genomes databases. A large number of differentially expressed genes were discovered through pairwise comparisons between these developmental stages. Gene expression profiles were dramatically different between life stage transitions, with some of these most differentially expressed genes being associated with sex difference, metabolism and development. Quantitative real-time PCR results confirm deep-sequencing findings based on relative expression levels of nine randomly selected genes. Furthermore, over 791,390 single nucleotide polymorphisms and 2,682 potential simple sequence repeats were identified. Our study provided comprehensive transcriptional gene expression information for A. suturalis that will form the basis to better understanding of development pathways, hormone biosynthesis, sex differences and wing formation in mirid bugs.

  10. Characterization of Adelphocoris suturalis (Hemiptera: Miridae) Transcriptome from Different Developmental Stages

    PubMed Central

    Tian, Caihong; Tek Tay, Wee; Feng, Hongqiang; Wang, Ying; Hu, Yongmin; Li, Guoping

    2015-01-01

    Adelphocoris suturalis is one of the most serious pest insects of Bt cotton in China, however its molecular genetics, biochemistry and physiology are poorly understood. We used high throughput sequencing platform to perform de novo transcriptome assembly and gene expression analyses across different developmental stages (eggs, 2nd and 5th instar nymphs, female and male adults). We obtained 20 GB of clean data and revealed 88,614 unigenes, including 23,830 clusters and 64,784 singletons. These unigene sequences were annotated and classified by Gene Ontology, Clusters of Orthologous Groups, and Kyoto Encyclopedia of Genes and Genomes databases. A large number of differentially expressed genes were discovered through pairwise comparisons between these developmental stages. Gene expression profiles were dramatically different between life stage transitions, with some of these most differentially expressed genes being associated with sex difference, metabolism and development. Quantitative real-time PCR results confirm deep-sequencing findings based on relative expression levels of nine randomly selected genes. Furthermore, over 791,390 single nucleotide polymorphisms and 2,682 potential simple sequence repeats were identified. Our study provided comprehensive transcriptional gene expression information for A. suturalis that will form the basis to better understanding of development pathways, hormone biosynthesis, sex differences and wing formation in mirid bugs. PMID:26047353

  11. RepSox improves viability and regulates gene expression in rhesus monkey-pig interspecies cloned embryos.

    PubMed

    Zhu, Hai-Ying; Jin, Long; Guo, Qing; Luo, Zhao-Bo; Li, Xiao-Chen; Zhang, Yu-Chen; Xing, Xiao-Xu; Xuan, Mei-Fu; Zhang, Guang-Lei; Luo, Qi-Rong; Wang, Jun-Xia; Cui, Cheng-Du; Li, Wen-Xue; Cui, Zheng-Yun; Yin, Xi-Jun; Kang, Jin-Dan

    2017-05-01

    To investigate the effect of the small molecule, RepSox, on the expression of developmentally important genes and the pre-implantation development of rhesus monkey-pig interspecies somatic cell nuclear transfer (iSCNT) embryos. Rhesus monkey cells expressing the monomeric red fluorescent protein 1 which have a normal (42) chromosome complement, were used as donor cells to generate iSCNT embryos. RepSox increased the expression levels of the pluripotency-related genes, Oct4 and Nanog (p < 0.05), but not of Sox2 compared with untreated embryos at the 2-4-cell stage. Expression of the anti-apoptotic gene, Bcl2, and the pro-apoptotic gene Bax was also affected at the 2-4-cell stage. RepSox treatment also increased the immunostaining intensity of Oct4 at the blastocyst stage (p < 0.05). Although the blastocyst developmental rate was higher in the group treated with 25 µM RepSox for 24 h than in the untreated control group (2.4 vs. 1.2%, p > 0.05), this was not significant. RepSox can improve the developmental potential of rhesus monkey-pig iSCNT embryos by regulating the expression of pluripotency-related genes.

  12. Effects of hypothyroidism on myosin heavy chain composition and fibre types of fast skeletal muscles in a small marsupial, Antechinus flavipes.

    PubMed

    Zhong, Wendy W H; Withers, Kerry W; Hoh, Joseph F Y

    2010-04-01

    Effects of drug-induced hypothyroidism on myosin heavy chain (MyHC) content and fibre types of fast skeletal muscles were studied in a small marsupial, Antechinus flavipes. SDS-PAGE of MyHCs from the tibialis anterior and gastrocnemius revealed four isoforms, 2B, 2X, 2A and slow, in that order of decreasing abundance. After 5 weeks treatment with methimazole, the functionally fastest 2B MyHC significantly decreased, while 2X, 2A and slow MyHCs increased. Immunohistochemistry using monospecific antibodies to each of the four MyHCs revealed decreased 2b and 2x fibres, and increased 2a and hybrid fibres co-expressing two or three MyHCs. In the normally homogeneously fast superficial regions of these muscles, evenly distributed slow-staining fibres appeared, resembling the distribution of slow primary myotubes in fast muscles during development. Hybrid fibres containing 2A and slow MyHCs were virtually absent. These results are more detailed but broadly similar to the earlier studies on eutherians. We hypothesize that hypothyroidism essentially reverses the effects of thyroid hormone on MyHC gene expression of muscle fibres during myogenesis, which differ according to the developmental origin of the fibre: it induces slow MyHC expression in 2b fibres derived from fast primary myotubes, and shifts fast MyHC expression in fibres of secondary origin towards 2A, but not slow, MyHC.

  13. Transcriptomic Profiling of Fruit Development in Black Raspberry Rubus coreanus

    PubMed Central

    Hu, Yaodong

    2018-01-01

    The wild Rubus species R. coreanus, which is widely distributed in southwest China, shows great promise as a genetic resource for breeding. One of its outstanding properties is adaptation to high temperature and humidity. To facilitate its use in selection and breeding programs, we assembled de novo 179,738,287 R. coreanus reads (125 bp in length) generated by RNA sequencing from fruits at three representative developmental stages. We also used the recently released draft genome of R. occidentalis to perform reference-guided assembly. We inferred a final 95,845-transcript reference for R. coreanus. Of these genetic resources, 66,597 (69.5%) were annotated. Based on these results, we carried out a comprehensive analysis of differentially expressed genes. Flavonoid biosynthesis, phenylpropanoid biosynthesis, plant hormone signal transduction, and cutin, suberin, and wax biosynthesis pathways were significantly enriched throughout the ripening process. We identified 23 transcripts involved in the flavonoid biosynthesis pathway whose expression perfectly paralleled changes in the metabolites. Additionally, we identified 119 nucleotide-binding site leucine-rich repeat (NBS-LRR) protein-coding genes, involved in pathogen resistance, of which 74 were in the completely conserved domain. These results provide, for the first time, genome-wide genetic information for understanding developmental regulation of R. coreanus fruits. They have the potential for use in breeding through functional genetic approaches in the near future. PMID:29805970

  14. Oocyte quality in mice is affected by a mycotoxin-contaminated diet.

    PubMed

    Hou, Yan-Jun; Xiong, Bo; Zheng, Wei-Jiang; Duan, Xing; Cui, Xiang-Shun; Kim, Nam-Hyung; Wang, Qiang; Xu, Yin-Xue; Sun, Shao-Chen

    2014-05-01

    Mycotoxins, such as deoxynivalenol (DON), zearalenone (ZEN), and aflatoxin (AF), are commonly found in many food commodities and may impair the growth and reproductive efficiency of animals and humans. We investigated the effects of a mycotoxin-contaminated diet on mouse oocyte quality. Maize contaminated with DON (3.875 mg/kg), ZEN (1,897 μg/kg), and AF (806 μg/kg) was incorporated into a mouse diet at three different levels (0, 15, and 30% w/w). After 4 weeks, ovarian and germinal vesicle oocyte indices decreased in mycotoxin-fed mice. Oocytes from these mice exhibited low developmental competence with reduced germinal vesicle breakdown and polar body extrusion rates. Embryo developmental competence also showed a similar pattern, and the majority of embryos could not develop to the morula stage. Actin expression was also reduced in both the oocyte cortex and cytoplasm, which was accompanied by decreased expression of the actin nucleation factors profilin-1 and mDia1. Moreover, a large percentage of oocytes derived from mice that were fed a mycotoxin-contaminated diet exhibited aberrant spindle morphology, a loss of the cortical granule-free domain, and abnormal mitochondrial distributions, which further supported the decreased oocyte quality. Thus, our results demonstrate that mycotoxins are toxic to the mouse reproductive system by affecting oocyte quality. Copyright © 2013 Wiley Periodicals, Inc.

  15. Developmental changes in facial expressions of emotions in the strange situation during the second year of life.

    PubMed

    Izard, Carroll E; Abe, Jo Ann A

    2004-09-01

    Infants' expressions of discrete emotions were coded during the more stressful episodes (4 through 8) of the Strange Situation at 13 and 18 months. The data showed a significant decrease in full-face expressions (more complex configurations of movements) and a significant increase in component expressions (simpler and more constrained patterns of movements). The authors interpreted this trend as a developmental change toward more regulated and less intense emotions. Consistent with this view, the aggregate index of infants' full-face negative emotion expressions, interpreted as reflecting relatively unregulated intense emotions, correlated significantly with maternal ratings of difficult temperament. The authors discuss alternative interpretations of the findings in terms of changes in reactivity/arousability and the emerging capacity for self-regulation. (c) 2004 APA, all rights reserved

  16. Neuronal expression of fibroblast growth factor receptors in zebrafish.

    PubMed

    Rohs, Patricia; Ebert, Alicia M; Zuba, Ania; McFarlane, Sarah

    2013-12-01

    Fibroblast growth factor (FGF) signaling is important for a host of developmental processes such as proliferation, differentiation, tissue patterning, and morphogenesis. In vertebrates, FGFs signal through a family of four fibroblast growth factor receptors (FGFR 1-4), one of which is duplicated in zebrafish (FGFR1). Here we report the mRNA expression of the five known zebrafish fibroblast growth factor receptors at five developmental time points (24, 36, 48, 60, and 72h postfertilization), focusing on expression within the central nervous system. We show that the receptors have distinct and dynamic expression in the developing zebrafish brain, eye, inner ear, lateral line, and pharynx. In many cases, the expression patterns are similar to those of homologous FGFRs in mouse, chicken, amphibians, and other teleosts. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. MicroRNA Profiling as Tool for In Vitro Developmental Neurotoxicity Testing: The Case of Sodium Valproate

    PubMed Central

    Smirnova, Lena; Block, Katharina; Sittka, Alexandra; Oelgeschläger, Michael; Seiler, Andrea E. M.; Luch, Andreas

    2014-01-01

    Studying chemical disturbances during neural differentiation of murine embryonic stem cells (mESCs) has been established as an alternative in vitro testing approach for the identification of developmental neurotoxicants. miRNAs represent a class of small non-coding RNA molecules involved in the regulation of neural development and ESC differentiation and specification. Thus, neural differentiation of mESCs in vitro allows investigating the role of miRNAs in chemical-mediated developmental toxicity. We analyzed changes in miRNome and transcriptome during neural differentiation of mESCs exposed to the developmental neurotoxicant sodium valproate (VPA). A total of 110 miRNAs and 377 mRNAs were identified differently expressed in neurally differentiating mESCs upon VPA treatment. Based on miRNA profiling we observed that VPA shifts the lineage specification from neural to myogenic differentiation (upregulation of muscle-abundant miRNAs, mir-206, mir-133a and mir-10a, and downregulation of neural-specific mir-124a, mir-128 and mir-137). These findings were confirmed on the mRNA level and via immunochemistry. Particularly, the expression of myogenic regulatory factors (MRFs) as well as muscle-specific genes (Actc1, calponin, myosin light chain, asporin, decorin) were found elevated, while genes involved in neurogenesis (e.g. Otx1, 2, and Zic3, 4, 5) were repressed. These results were specific for valproate treatment and―based on the following two observations―most likely due to the inhibition of histone deacetylase (HDAC) activity: (i) we did not observe any induction of muscle-specific miRNAs in neurally differentiating mESCs exposed to the unrelated developmental neurotoxicant sodium arsenite; and (ii) the expression of muscle-abundant mir-206 and mir-10a was similarly increased in cells exposed to the structurally different HDAC inhibitor trichostatin A (TSA). Based on our results we conclude that miRNA expression profiling is a suitable molecular endpoint for developmental neurotoxicity. The observed lineage shift into myogenesis, where miRNAs may play an important role, could be one of the developmental neurotoxic mechanisms of VPA. PMID:24896083

  18. Cloning of growth hormone, somatolactin, and their receptor mRNAs, their expression in organs, during development, and on salinity stress in the hermaphroditic fish, Kryptolebias marmoratus.

    PubMed

    Rhee, Jae-Sung; Kim, Bo-Mi; Seo, Jung Soo; Kim, Il-Chan; Lee, Young-Mi; Lee, Jae-Seong

    2012-04-01

    Salinity is an important parameter that affects survival and metabolism in fish. In fish, pituitary growth hormone (GH) regulates physiological functions including adaptation to different salinity as well as somatic growth. GH is stimulated by growth hormone-releasing hormone (GHRH) and exerts its function via binding to growth hormone receptor (GHR). As Kryptolebias marmoratus is a euryhaline fish, this species would be a useful model species for studying the adaptation to osmotic stress conditions. Here, we cloned GH, -GHR, somatolactin (SL), and somatolactin receptor (SLR) genes, and analyzed their expression patterns in different tissues and during early developmental stages by using real-time RT-PCR. We also further examined expression of them after acclimation to different salinity. Tissue distribution studies revealed that Km-GH and -SL mRNAs were remarkably expressed in brain and pituitary, whereas Km-GHR and -SLR mRNAs were predominantly expressed in liver, followed by gonad, muscle, pituitary, and brain. During embryonic developmental stages, the expression of their mRNA was increased at stage 3 (9 dpf). The Km-GH and -SL mRNA transcripts were constantly elevated until stage 5 (5h post hatch), whereas Km-GHR and -SLR mRNA levels decreased at this stage. After we transferred K. marmoratus from control (12 psu) to hyper-osmotic condition (hyperseawater, HSW; 33 psu), Km-GH, -SL, and GHR mRNA levels were enhanced. In hypo-osmotic conditions like freshwater (FW), Km-GH and -SL expressions were modulated 24 h after exposure, and Km-SLR transcripts were significantly upregulated. This finding suggests that Km-GH and -SL may be involved in the osmoregulatory mechanism under hyper-osmotic as well as hypo-osmotic stress. This is the first report on transcriptional modulation and relationship of GH, GHR, SL, and SLR during early development and after salinity stress. This study will be helpful to a better understanding on molecular mechanisms of adaptation response to salt stress in euryhaline fish. Copyright © 2012 Elsevier Inc. All rights reserved.

  19. Dysgraphia

    MedlinePlus

    Written expression disorder; Specific learning disorder with impairment in written expression ... can have dysgraphia only or along with other learning disabilities, such as: Developmental coordination disorder (includes poor handwriting) ...

  20. Function and Evolution of DNA Methylation in Nasonia vitripennis

    PubMed Central

    Wang, Xu; Wheeler, David; Avery, Amanda; Rago, Alfredo; Choi, Jeong-Hyeon; Colbourne, John K.; Clark, Andrew G.; Werren, John H.

    2013-01-01

    The parasitoid wasp Nasonia vitripennis is an emerging genetic model for functional analysis of DNA methylation. Here, we characterize genome-wide methylation at a base-pair resolution, and compare these results to gene expression across five developmental stages and to methylation patterns reported in other insects. An accurate assessment of DNA methylation across the genome is accomplished using bisulfite sequencing of adult females from a highly inbred line. One-third of genes show extensive methylation over the gene body, yet methylated DNA is not found in non-coding regions and rarely in transposons. Methylated genes occur in small clusters across the genome. Methylation demarcates exon-intron boundaries, with elevated levels over exons, primarily in the 5′ regions of genes. It is also elevated near the sites of translational initiation and termination, with reduced levels in 5′ and 3′ UTRs. Methylated genes have higher median expression levels and lower expression variation across development stages than non-methylated genes. There is no difference in frequency of differential splicing between methylated and non-methylated genes, and as yet no established role for methylation in regulating alternative splicing in Nasonia. Phylogenetic comparisons indicate that many genes maintain methylation status across long evolutionary time scales. Nasonia methylated genes are more likely to be conserved in insects, but even those that are not conserved show broader expression across development than comparable non-methylated genes. Finally, examination of duplicated genes shows that those paralogs that have lost methylation in the Nasonia lineage following gene duplication evolve more rapidly, show decreased median expression levels, and increased specialization in expression across development. Methylation of Nasonia genes signals constitutive transcription across developmental stages, whereas non-methylated genes show more dynamic developmental expression patterns. We speculate that loss of methylation may result in increased developmental specialization in evolution and acquisition of methylation may lead to broader constitutive expression. PMID:24130511

  1. BDNF Expression in Larval and Adult Zebrafish Brain: Distribution and Cell Identification

    PubMed Central

    Cacialli, Pietro; Gueguen, Marie-Madeleine; Coumailleau, Pascal; D’Angelo, Livia; Kah, Olivier; Lucini, Carla; Pellegrini, Elisabeth

    2016-01-01

    Brain-derived neurotrophic factor (BDNF), a member of the neurotrophin family, has emerged as an active mediator in many essential functions in the central nervous system of mammals. BDNF plays significant roles in neurogenesis, neuronal maturation and/or synaptic plasticity and is involved in cognitive functions such as learning and memory. Despite the vast literature present in mammals, studies devoted to BDNF in the brain of other animal models are scarse. Zebrafish is a teleost fish widely known for developmental genetic studies and is emerging as model for translational neuroscience research. In addition, its brain shows many sites of adult neurogenesis allowing higher regenerative properties after traumatic injuries. To add further knowledge on neurotrophic factors in vertebrate brain models, we decided to determine the distribution of bdnf mRNAs in the larval and adult zebrafish brain and to characterize the phenotype of cells expressing bdnf mRNAs by means of double staining studies. Our results showed that bdnf mRNAs were widely expressed in the brain of 7 days old larvae and throughout the whole brain of mature female and male zebrafish. In adults, bdnf mRNAs were mainly observed in the dorsal telencephalon, preoptic area, dorsal thalamus, posterior tuberculum, hypothalamus, synencephalon, optic tectum and medulla oblongata. By combining immunohistochemistry with in situ hybridization, we showed that bdnf mRNAs were never expressed by radial glial cells or proliferating cells. By contrast, bdnf transcripts were expressed in cells with neuronal phenotype in all brain regions investigated. Our results provide the first demonstration that the brain of zebrafish expresses bdnf mRNAs in neurons and open new fields of research on the role of the BDNF factor in brain mechanisms in normal and brain repairs situations. PMID:27336917

  2. GHF-1-promoter-targeted immortalization of a somatotropic progenitor cell results in dwarfism in transgenic mice.

    PubMed

    Lew, D; Brady, H; Klausing, K; Yaginuma, K; Theill, L E; Stauber, C; Karin, M; Mellon, P L

    1993-04-01

    During pituitary development, the homeo domain protein GHF-1 is required for generation of somatotropes and lactotropes and for growth hormone (GH) and prolactin (PRL) gene expression. GHF-1 mRNA is detectable several days before the emergence of GH- or PRL-expressing cells, suggesting the existence of a somatotropic progenitor cell in which GHF-1 transcription is first activated. We have immortalized this cell type by using the GHF-1 regulatory region to target SV40 T-antigen (Tag) tumorigenesis in transgenic mice. The GHF-Tag transgene caused developmental entrapment of somatotropic progenitor cells that express GHF-1 but not GH or PRL, resulting in dwarfism. Immortalized cell lines derived from a transgenic pituitary tumor maintain the characteristics of the somato/lactotropic progenitor in that they express GHF-1 mRNA and protein yet fail to activate GH or PRL transcription. Using these cells, we identified an enhancer that activates GHF-1 transcription at this early stage of development yet is inactive in cells representing later developmental stages of the somatotropic lineage or in other cell types. These experiments not only demonstrate the potential for immortalization of developmental progenitor cells using the regulatory regions from cell type-specific transcription factor genes but illustrate the power of such model systems in the study of developmental control.

  3. [An investigation of the imitation skills in children with autism spectrum disorder and their association with receptive-expressive language development].

    PubMed

    Turan, Figen; Ökçün Akçamuş, Meral Çilem

    2013-01-01

    This study aimed to compare imitation skills in children with autism spectrum disorder, and age-matched typically developing children and children with developmental delay, as well as to examine the association between imitation skills, and receptive and expressive language development in children with autism spectrum disorder. Imitation skills in children with autism spectrum disorder (n=18), and age-matched children with developmental delay (n=15) and typically developing children (n= 16) were assessed using the Motor Imitation Scale and Imitation Battery, and the differences in mean imitation scores between the groups were examined. Receptive language and expressive language development in the children with autism spectrum disorder were assessed using the Turkish Communicative Development Inventory (TCDI), and their association with imitation scores was explored. The children with autism spectrum disorder had significantly lower imitation scores than the children with developmental delay and typically developing children; however, there wasn't a significant difference in imitation scores between the children with developmental delay and typically developing children. A significant association between imitation scores, and receptive and expressive language development was observed in the children with autism spectrum disorder. The present findings indicate that deficient imitation skills are a distinctive feature of children with autism spectrum disorder and that imitation skills play a crucial role in children's language development.

  4. Comparative Transcriptome Analysis of Chinary, Assamica and Cambod tea (Camellia sinensis) Types during Development and Seasonal Variation using RNA-seq Technology

    NASA Astrophysics Data System (ADS)

    Kumar, Ajay; Chawla, Vandna; Sharma, Eshita; Mahajan, Pallavi; Shankar, Ravi; Yadav, Sudesh Kumar

    2016-11-01

    Tea quality and yield is influenced by various factors including developmental tissue, seasonal variation and cultivar type. Here, the molecular basis of these factors was investigated in three tea cultivars namely, Him Sphurti (H), TV23 (T), and UPASI-9 (U) using RNA-seq. Seasonal variation in these cultivars was studied during active (A), mid-dormant (MD), dormant (D) and mid-active (MA) stages in two developmental tissues viz. young and old leaf. Development appears to affect gene expression more than the seasonal variation and cultivar types. Further, detailed transcript and metabolite profiling has identified genes such as F3‧H, F3‧5‧H, FLS, DFR, LAR, ANR and ANS of catechin biosynthesis, while MXMT, SAMS, TCS and XDH of caffeine biosynthesis/catabolism as key regulators during development and seasonal variation among three different tea cultivars. In addition, expression analysis of genes related to phytohormones such as ABA, GA, ethylene and auxin has suggested their role in developmental tissues during seasonal variation in tea cultivars. Moreover, differential expression of genes involved in histone and DNA modification further suggests role of epigenetic mechanism in coordinating global gene expression during developmental and seasonal variation in tea. Our findings provide insights into global transcriptional reprogramming associated with development and seasonal variation in tea.

  5. Comparative Transcriptome Analysis of Chinary, Assamica and Cambod tea (Camellia sinensis) Types during Development and Seasonal Variation using RNA-seq Technology.

    PubMed

    Kumar, Ajay; Chawla, Vandna; Sharma, Eshita; Mahajan, Pallavi; Shankar, Ravi; Yadav, Sudesh Kumar

    2016-11-17

    Tea quality and yield is influenced by various factors including developmental tissue, seasonal variation and cultivar type. Here, the molecular basis of these factors was investigated in three tea cultivars namely, Him Sphurti (H), TV23 (T), and UPASI-9 (U) using RNA-seq. Seasonal variation in these cultivars was studied during active (A), mid-dormant (MD), dormant (D) and mid-active (MA) stages in two developmental tissues viz. young and old leaf. Development appears to affect gene expression more than the seasonal variation and cultivar types. Further, detailed transcript and metabolite profiling has identified genes such as F3'H, F3'5'H, FLS, DFR, LAR, ANR and ANS of catechin biosynthesis, while MXMT, SAMS, TCS and XDH of caffeine biosynthesis/catabolism as key regulators during development and seasonal variation among three different tea cultivars. In addition, expression analysis of genes related to phytohormones such as ABA, GA, ethylene and auxin has suggested their role in developmental tissues during seasonal variation in tea cultivars. Moreover, differential expression of genes involved in histone and DNA modification further suggests role of epigenetic mechanism in coordinating global gene expression during developmental and seasonal variation in tea. Our findings provide insights into global transcriptional reprogramming associated with development and seasonal variation in tea.

  6. Gene expression atlas of pigeonpea and its application to gain insights into genes associated with pollen fertility implicated in seed formation

    PubMed Central

    Pazhamala, Lekha T.; Purohit, Shilp; Saxena, Rachit K.; Garg, Vanika; Krishnamurthy, L.; Verdier, Jerome

    2017-01-01

    Abstract Pigeonpea (Cajanus cajan) is an important grain legume of the semi-arid tropics, mainly used for its protein rich seeds. To link the genome sequence information with agronomic traits resulting from specific developmental processes, a Cajanus cajan gene expression atlas (CcGEA) was developed using the Asha genotype. Thirty tissues/organs representing developmental stages from germination to senescence were used to generate 590.84 million paired-end RNA-Seq data. The CcGEA revealed a compendium of 28 793 genes with differential, specific, spatio-temporal and constitutive expression during various stages of development in different tissues. As an example to demonstrate the application of the CcGEA, a network of 28 flower-related genes analysed for cis-regulatory elements and splicing variants has been identified. In addition, expression analysis of these candidate genes in male sterile and male fertile genotypes suggested their critical role in normal pollen development leading to seed formation. Gene network analysis also identified two regulatory genes, a pollen-specific SF3 and a sucrose–proton symporter, that could have implications for improvement of agronomic traits such as seed production and yield. In conclusion, the CcGEA provides a valuable resource for pigeonpea to identify candidate genes involved in specific developmental processes and to understand the well-orchestrated growth and developmental process in this resilient crop. PMID:28338822

  7. A co-expression gene network associated with developmental regulation of apple fruit acidity.

    PubMed

    Bai, Yang; Dougherty, Laura; Cheng, Lailiang; Xu, Kenong

    2015-08-01

    Apple fruit acidity, which affects the fruit's overall taste and flavor to a large extent, is primarily determined by the concentration of malic acid. Previous studies demonstrated that the major QTL malic acid (Ma) on chromosome 16 is largely responsible for fruit acidity variations in apple. Recent advances suggested that a natural mutation that gives rise to a premature stop codon in one of the two aluminum-activated malate transporter (ALMT)-like genes (called Ma1) is the genetic causal element underlying Ma. However, the natural mutation does not explain the developmental changes of fruit malate levels in a given genotype. Using RNA-seq data from the fruit of 'Golden Delicious' taken at 14 developmental stages from 1 week after full-bloom (WAF01) to harvest (WAF20), we characterized their transcriptomes in groups of high (12.2 ± 1.6 mg/g fw, WAF03-WAF08), mid (7.4 ± 0.5 mg/g fw, WAF01-WAF02 and WAF10-WAF14) and low (5.4 ± 0.4 mg/g fw, WAF16-WAF20) malate concentrations. Detailed analyses showed that a set of 3,066 genes (including Ma1) were expressed not only differentially (P FDR < 0.05) between the high and low malate groups (or between the early and late developmental stages) but also in significant (P < 0.05) correlation with malate concentrations. The 3,066 genes fell in 648 MapMan (sub-) bins or functional classes, and 19 of them were significantly (P FDR < 0.05) co-enriched or co-suppressed in a malate dependent manner. Network inferring using the 363 genes encompassed in the 19 (sub-) bins, identified a major co-expression network of 239 genes. Since the 239 genes were also differentially expressed between the early (WAF03-WAF08) and late (WAF16-WAF20) developmental stages, the major network was considered to be associated with developmental regulation of apple fruit acidity in 'Golden Delicious'.

  8. The RNA-Seq-based high resolution gene expression atlas of chickpea (Cicer arietinum L.) reveals dynamic spatio-temporal changes associated with growth and development.

    PubMed

    Kudapa, Himabindu; Garg, Vanika; Chitikineni, Annapurna; Varshney, Rajeev K

    2018-04-10

    Chickpea is one of the world's largest cultivated food legumes and is an excellent source of high-quality protein to the human diet. Plant growth and development are controlled by programmed expression of a suite of genes at the given time, stage, and tissue. Understanding how the underlying genome sequence translates into specific plant phenotypes at key developmental stages, information on gene expression patterns is crucial. Here, we present a comprehensive Cicer arietinum Gene Expression Atlas (CaGEA) across different plant developmental stages and organs covering the entire life cycle of chickpea. One of the widely used drought tolerant cultivars, ICC 4958 has been used to generate RNA-Seq data from 27 samples at 5 major developmental stages of the plant. A total of 816 million raw reads were generated and of these, 794 million filtered reads after quality control (QC) were subjected to downstream analysis. A total of 15,947 unique number of differentially expressed genes across different pairwise tissue combinations were identified. Significant differences in gene expression patterns contributing in the process of flowering, nodulation, and seed and root development were inferred in this study. Furthermore, differentially expressed candidate genes from "QTL-hotspot" region associated with drought stress response in chickpea were validated. © 2018 The Authors. Plant, Cell & Environment Published by John Wiley & Sons Ltd.

  9. Large-scale gene expression profiling data for the model moss Physcomitrella patens aid understanding of developmental progression, culture and stress conditions.

    PubMed

    Hiss, Manuel; Laule, Oliver; Meskauskiene, Rasa M; Arif, Muhammad A; Decker, Eva L; Erxleben, Anika; Frank, Wolfgang; Hanke, Sebastian T; Lang, Daniel; Martin, Anja; Neu, Christina; Reski, Ralf; Richardt, Sandra; Schallenberg-Rüdinger, Mareike; Szövényi, Peter; Tiko, Theodhor; Wiedemann, Gertrud; Wolf, Luise; Zimmermann, Philip; Rensing, Stefan A

    2014-08-01

    The moss Physcomitrella patens is an important model organism for studying plant evolution, development, physiology and biotechnology. Here we have generated microarray gene expression data covering the principal developmental stages, culture forms and some environmental/stress conditions. Example analyses of developmental stages and growth conditions as well as abiotic stress treatments demonstrate that (i) growth stage is dominant over culture conditions, (ii) liquid culture is not stressful for the plant, (iii) low pH might aid protoplastation by reduced expression of cell wall structure genes, (iv) largely the same gene pool mediates response to dehydration and rehydration, and (v) AP2/EREBP transcription factors play important roles in stress response reactions. With regard to the AP2 gene family, phylogenetic analysis and comparison with Arabidopsis thaliana shows commonalities as well as uniquely expressed family members under drought, light perturbations and protoplastation. Gene expression profiles for P. patens are available for the scientific community via the easy-to-use tool at https://www.genevestigator.com. By providing large-scale expression profiles, the usability of this model organism is further enhanced, for example by enabling selection of control genes for quantitative real-time PCR. Now, gene expression levels across a broad range of conditions can be accessed online for P. patens. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

  10. Developmental defects in zebrafish for classification of EGF pathway inhibitors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pruvot, Benoist; Curé, Yoann; Djiotsa, Joachim

    2014-01-15

    One of the major challenges when testing drug candidates targeted at a specific pathway in whole animals is the discrimination between specific effects and unwanted, off-target effects. Here we used the zebrafish to define several developmental defects caused by impairment of Egf signaling, a major pathway of interest in tumor biology. We inactivated Egf signaling by genetically blocking Egf expression or using specific inhibitors of the Egf receptor function. We show that the combined occurrence of defects in cartilage formation, disturbance of blood flow in the trunk and a decrease of myelin basic protein expression represent good indicators for impairmentmore » of Egf signaling. Finally, we present a classification of known tyrosine kinase inhibitors according to their specificity for the Egf pathway. In conclusion, we show that developmental indicators can help to discriminate between specific effects on the target pathway from off-target effects in molecularly targeted drug screening experiments in whole animal systems. - Highlights: • We analyze the functions of Egf signaling on zebrafish development. • Genetic blocking of Egf expression causes cartilage, myelin and circulatory defects. • Chemical inhibition of Egf receptor function causes similar defects. • Developmental defects can reveal the specificity of Egf pathway inhibitors.« less

  11. Developmental Exposure to Diethylstilbestrol Alters Uterine Gene Expression That May Be Associated With Uterine Neoplasia Later in Life

    PubMed Central

    Newbold, Retha R.; Jefferson, Wendy N.; Grissom, Sherry F.; Padilla-Banks, Elizabeth; Snyder, Ryan J.; Lobenhofer, Edward K.

    2008-01-01

    Previously, we described a mouse model where the well-known reproductive carcinogen with estrogenic activity, diethylstilbestrol (DES), caused uterine adenocarcinoma following neonatal treatment. Tumor incidence was dose-dependent reaching >90% by 18 mo following neonatal treatment with 1000 μg/kg/d of DES. These tumors followed the initiation/promotion model of hormonal carcinogenesis with developmental exposure as initiator, and exposure to ovarian hormones at puberty as the promoter. To identify molecular pathways involved in DES-initiation events, uterine gene expression profiles were examined in prepubertal mice exposed to DES (1, 10, or 1000 μg/kg/d) on days 1–5 and compared to controls. Of more than 20 000 transcripts, approximately 3% were differentially expressed in at least one DES treatment group compared to controls; some transcripts demonstrated dose–responsiveness. Assessment of gene ontology annotation revealed alterations in genes associated with cell growth, differentiation, and adhesion. When expression profiles were compared to published studies of uteri from 5-d-old DES-treated mice, or adult mice treated with 17β estradiol, similarities were seen suggesting persistent differential expression of estrogen responsive genes following developmental DES exposure. Moreover, several altered genes were identified in human uterine adenocarcinomas. Four altered genes [lactotransferrin (Ltf), transforming growth factor beta inducible (Tgfb1), cyclin D1 (Ccnd1), and secreted frizzled-related protein 4 (Sfrp4)], selected for real-time RT-PCR analysis, correlated well with the directionality of the microarray data. These data suggested altered gene expression profiles observed 2 wk after treatment ceased, were established at the time of developmental exposure and maybe related to the initiation events resulting in carcinogenesis. PMID:17394237

  12. Developmental exposure to diethylstilbestrol alters uterine gene expression that may be associated with uterine neoplasia later in life.

    PubMed

    Newbold, Retha R; Jefferson, Wendy N; Grissom, Sherry F; Padilla-Banks, Elizabeth; Snyder, Ryan J; Lobenhofer, Edward K

    2007-09-01

    Previously, we described a mouse model where the well-known reproductive carcinogen with estrogenic activity, diethylstilbestrol (DES), caused uterine adenocarcinoma following neonatal treatment. Tumor incidence was dose-dependent reaching >90% by 18 mo following neonatal treatment with 1000 microg/kg/d of DES. These tumors followed the initiation/promotion model of hormonal carcinogenesis with developmental exposure as initiator, and exposure to ovarian hormones at puberty as the promoter. To identify molecular pathways involved in DES-initiation events, uterine gene expression profiles were examined in prepubertal mice exposed to DES (1, 10, or 1000 microg/kg/d) on days 1-5 and compared to controls. Of more than 20 000 transcripts, approximately 3% were differentially expressed in at least one DES treatment group compared to controls; some transcripts demonstrated dose-responsiveness. Assessment of gene ontology annotation revealed alterations in genes associated with cell growth, differentiation, and adhesion. When expression profiles were compared to published studies of uteri from 5-d-old DES-treated mice, or adult mice treated with 17beta estradiol, similarities were seen suggesting persistent differential expression of estrogen responsive genes following developmental DES exposure. Moreover, several altered genes were identified in human uterine adenocarcinomas. Four altered genes [lactotransferrin (Ltf), transforming growth factor beta inducible (Tgfb1), cyclin D1 (Ccnd1), and secreted frizzled-related protein 4 (Sfrp4)], selected for real-time RT-PCR analysis, correlated well with the directionality of the microarray data. These data suggested altered gene expression profiles observed 2 wk after treatment ceased, were established at the time of developmental exposure and maybe related to the initiation events resulting in carcinogenesis. (c) 2007 Wiley-Liss, Inc.

  13. THE EVOLUTION OF CANALIZATION AND THE BREAKING OF VON BAER'S LAWS: MODELING THE EVOLUTION OF DEVELOPMENT WITH EPISTASIS.

    PubMed

    Rice, Sean H

    1998-06-01

    Evolution can change the developmental processes underlying a character without changing the average expression of the character itself. This sort of change must occur in both the evolution of canalization, in which a character becomes increasingly buffered against genetic or developmental variation, and in the phenomenon of closely related species that show similar adult phenotypes but different underlying developmental patterns. To study such phenomena, I develop a model that follows evolution on a surface representing adult phenotype as a function of underlying developmental characters. A contour on such a "phenotype landscape" is a set of states of developmental characters that produce the same adult phenotype. Epistasis induces curvature of this surface, and degree of canalization is represented by the slope along a contour. I first discuss the geometric properties of phenotype landscapes, relating epistasis to canalization. I then impose a fitness function on the phenotype and model evolution of developmental characters as a function of the fitness function and the local geometry of the surface. This model shows how canalization evolves as a population approaches an optimum phenotype. It further shows that under some circumstances, "decanalization" can occur, in which the expression of adult phenotype becomes increasingly sensitive to developmental variation. This process can cause very similar populations to diverge from one another developmentally even when their adult phenotypes experience identical selection regimes. © 1998 The Society for the Study of Evolution.

  14. Functional analysis of CYP6ER1, a P450 gene associated with imidacloprid resistance in Nilaparvata lugens

    PubMed Central

    Pang, Rui; Chen, Meng; Liang, Zhikun; Yue, Xiangzhao; Ge, Hu; Zhang, Wenqing

    2016-01-01

    The cytochrome P450 CYP6ER1 has been reported to play an important role in imidacloprid resistance of the brown planthopper (BPH), Nilaparvata lugens, and is overexpressed in most resistant populations. In the present study, we confirmed that CYP6ER1 expression can be induced by certain levels of imidacloprid. Developmental expression analysis revealed that CYP6ER1 was expressed highly in the adult stage, and tissue distribution analysis showed that CYP6ER1 was expressed mainly in the fat body and midgut. RNA interference (RNAi) of CYP6ER1 and transgenic expression of CYP6ER1 in Drosophila melanogaster both suggested that the expression of CYP6ER1 is sufficient to confer imidacloprid resistance. Furthermore, we analyzed the interaction of imidacloprid and CYP6ER1 monooxygenase by using dynamic simulations and molecular docking. We found that Nitrogen atoms in the heterocycle of the imidacloprid molecule may bind to iron atoms in the center of the homology model of CYP6ER1 via 4,5-dihedro-1H-imidazole. This finding contributes to a better understanding of how CYP6ER1 takes part in the insecticide metabolism. PMID:27721443

  15. Functional analysis of CYP6ER1, a P450 gene associated with imidacloprid resistance in Nilaparvata lugens.

    PubMed

    Pang, Rui; Chen, Meng; Liang, Zhikun; Yue, Xiangzhao; Ge, Hu; Zhang, Wenqing

    2016-10-10

    The cytochrome P450 CYP6ER1 has been reported to play an important role in imidacloprid resistance of the brown planthopper (BPH), Nilaparvata lugens, and is overexpressed in most resistant populations. In the present study, we confirmed that CYP6ER1 expression can be induced by certain levels of imidacloprid. Developmental expression analysis revealed that CYP6ER1 was expressed highly in the adult stage, and tissue distribution analysis showed that CYP6ER1 was expressed mainly in the fat body and midgut. RNA interference (RNAi) of CYP6ER1 and transgenic expression of CYP6ER1 in Drosophila melanogaster both suggested that the expression of CYP6ER1 is sufficient to confer imidacloprid resistance. Furthermore, we analyzed the interaction of imidacloprid and CYP6ER1 monooxygenase by using dynamic simulations and molecular docking. We found that Nitrogen atoms in the heterocycle of the imidacloprid molecule may bind to iron atoms in the center of the homology model of CYP6ER1 via 4,5-dihedro-1H-imidazole. This finding contributes to a better understanding of how CYP6ER1 takes part in the insecticide metabolism.

  16. Chronic Stress Modulates Regional Cerebral Glucose Transporter Expression in an Age-Specific and Sexually-Dimorphic Manner

    PubMed Central

    Kelly, Sean D.; Harrell, Constance S.; Neigh, Gretchen N.

    2014-01-01

    Facilitative glucose transporters (GLUT) mediate glucose uptake across the blood-brain-barrier into neurons and glia. Deficits in specific cerebral GLUT isoforms are linked to developmental and neurological dysfunction, but less is known about the range of variation in cerebral GLUT expression in normal conditions and the effects of environmental influences on cerebral GLUT expression. Knowing that puberty is a time of increased cerebral plasticity, metabolic demand, and shifts in hormonal balance for males and females, we first assessed gene expression of five GLUT subtypes in four brain regions in male and female adolescent and adult Wistar rats. The data indicated that sex differences in GLUT expression were most profound in the hypothalamus, and the transition from adolescence to adulthood had the most profound effect on GLUT expression in the hippocampus. Next, given the substantial energetic demands during adolescence and prior demonstrations of the adverse effects of adolescent stress, we determined the extent to which chronic stress altered GLUT expression in males and females in both adolescence and adulthood. Chronic stress significantly altered cerebral GLUT expression in males and females throughout both developmental stages but in a sexually dimorphic and brain region-specific manner. Collectively, our data demonstrate that cerebral GLUTs are expressed differentially based on brain region, sex, age, and stress exposure. These results suggest that developmental and environmental factors influence GLUT expression in multiple brain regions. Given the importance of appropriate metabolic balance within the brain, further assessment of the functional implications of life stage and environmentally-induced changes in GLUTs are warranted. PMID:24382486

  17. Expressed Sequence Reference Standards for Evaluating Stage-specific Gene Expression in Southern Green Lacewings, Chrysoperla rufilabris

    USDA-ARS?s Scientific Manuscript database

    Five developmental stages of Chrysoperla rufilabris were tested using nine primer pairs. Three sequences were highly expressed at all life stages and six were differentially expressed. These primer pairs may be used as standards to quantitate functional gene expression associated with physiological ...

  18. PIK3CA-associated developmental disorders exhibit distinct classes of mutations with variable expression and tissue distribution

    PubMed Central

    Timms, Andrew E.; Conti, Valerio; Girisha, Katta M.; Martin, Beth; Olds, Carissa; Collins, Sarah; Park, Kaylee; Carter, Melissa; Krägeloh-Mann, Inge; Chitayat, David; Parikh, Aditi Shah; Bradshaw, Rachael; Torti, Erin; Braddock, Stephen; Burke, Leah; Ghedia, Sondhya; Stephan, Mark; Stewart, Fiona; Prasad, Chitra; Napier, Melanie; Saitta, Sulagna; Straussberg, Rachel; Gabbett, Michael; O’Connor, Bridget C.; Yin, Lim Jiin; Lai, Angeline Hwei Meeng; Martin, Nicole; McKinnon, Margaret; Addor, Marie-Claude; Schwartz, Charles E.; Lanoel, Agustina; Conway, Robert L.; Devriendt, Koenraad; Tatton-Brown, Katrina; Pierpont, Mary Ella; Painter, Michael; Worgan, Lisa; Reggin, James; Hennekam, Raoul; Pritchard, Colin C.; Aracena, Mariana; Gripp, Karen W.; Cordisco, Maria; Van Esch, Hilde; Garavelli, Livia; Curry, Cynthia; Goriely, Anne; Kayserilli, Hulya; Shendure, Jay; Graham, John; Guerrini, Renzo; Dobyns, William B.

    2016-01-01

    Mosaicism is increasingly recognized as a cause of developmental disorders with the advent of next-generation sequencing (NGS). Mosaic mutations of PIK3CA have been associated with the widest spectrum of phenotypes associated with overgrowth and vascular malformations. We performed targeted NGS using 2 independent deep-coverage methods that utilize molecular inversion probes and amplicon sequencing in a cohort of 241 samples from 181 individuals with brain and/or body overgrowth. We identified PIK3CA mutations in 60 individuals. Several other individuals (n = 12) were identified separately to have mutations in PIK3CA by clinical targeted-panel testing (n = 6), whole-exome sequencing (n = 5), or Sanger sequencing (n = 1). Based on the clinical and molecular features, this cohort segregated into three distinct groups: (a) severe focal overgrowth due to low-level but highly activating (hotspot) mutations, (b) predominantly brain overgrowth and less severe somatic overgrowth due to less-activating mutations, and (c) intermediate phenotypes (capillary malformations with overgrowth) with intermediately activating mutations. Sixteen of 29 PIK3CA mutations were novel. We also identified constitutional PIK3CA mutations in 10 patients. Our molecular data, combined with review of the literature, show that PIK3CA-related overgrowth disorders comprise a discontinuous spectrum of disorders that correlate with the severity and distribution of mutations. PMID:27631024

  19. Emotional expression and heart rate in high-risk infants during the face-to-face/still-face.

    PubMed

    Mattson, Whitney I; Ekas, Naomi V; Lambert, Brittany; Tronick, Ed; Lester, Barry M; Messinger, Daniel S

    2013-12-01

    In infants, eye constriction-the Duchenne marker-and mouth opening appear to index the intensity of both positive and negative facial expressions. We combined eye constriction and mouth opening that co-occurred with smiles and cry-faces (respectively, the prototypic expressions of infant joy and distress) to measure emotional expression intensity. Expression intensity and heart rate were measured throughout the face-to-face/still-face (FFSF) in a sample of infants with prenatal cocaine exposure who were at risk for developmental difficulties. Smiles declined and cry-faces increased in the still-face episode, but the distribution of eye constriction and mouth opening in smiles and cry-faces did not differ across episodes of the FFSF. As time elapsed in the still face episode potential indices of intensity increased, cry-faces were more likely to be accompanied by eye constriction and mouth opening. During cry-faces there were also moderately stable individual differences in the quantity of eye constriction and mouth opening. Infant heart rate was higher during cry-faces and lower during smiles, but did not vary with intensity of expression or by episode. In sum, infants express more intense negative affect as the still-face progresses, but do not show clear differences in expressive intensity between episodes of the FFSF. Copyright © 2013 Elsevier Inc. All rights reserved.

  20. Developmental Hypothyroidism Alters Brain-Derived Neurotrophic Factor (BDNF) Expression in Adulthood.

    EPA Science Inventory

    Severe developmental thyroid hormone (TH) insufficiency results in alterations in brain structure/function and lasting behavioral impairments. Environmental toxicants reduce circulating levels of TH, but the disruption is modest and the doseresponse relationships of TH and neuro...

  1. CELLULAR, BIOCHEMICAL, AND MOLECULAR TECHNIQUES IN DEVELOPMENTAL TOXICOLOGY

    EPA Science Inventory

    Cellular, molecular and biochemical approaches vastly expand the possibilities for revealing the underlying mechanisms of developmental toxicity. The increasing interest in embryonic development as a model system for the study of gene expression has resulted in a cornucopia of i...

  2. Biochemical and transcriptomic analyses reveal different metabolite biosynthesis profiles among three color and developmental stages in 'Anji Baicha' (Camellia sinensis).

    PubMed

    Li, Chun-Fang; Xu, Yan-Xia; Ma, Jian-Qiang; Jin, Ji-Qiang; Huang, Dan-Juan; Yao, Ming-Zhe; Ma, Chun-Lei; Chen, Liang

    2016-09-08

    The new shoots of the albino tea cultivar 'Anji Baicha' are yellow or white at low temperatures and turn green as the environmental temperatures increase during the early spring. 'Anji Baicha' metabolite profiles exhibit considerable variability over three color and developmental stages, especially regarding the carotenoid, chlorophyll, and theanine concentrations. Previous studies focused on physiological characteristics, gene expression differences, and variations in metabolite abundances in albino tea plant leaves at specific growth stages. However, the molecular mechanisms regulating metabolite biosynthesis in various color and developmental stages in albino tea leaves have not been fully characterized. We used RNA-sequencing to analyze 'Anji Baicha' leaves at the yellow-green, albescent, and re-greening stages. The leaf transcriptomes differed considerably among the three stages. Functional classifications based on Gene Ontology enrichment and Kyoto Encyclopedia of Genes and Genomes enrichment analyses revealed that differentially expressed unigenes were mainly related to metabolic pathways, biosynthesis of secondary metabolites, phenylpropanoid biosynthesis, and carbon fixation in photosynthetic organisms. Chemical analyses revealed higher β-carotene and theanine levels, but lower chlorophyll a levels, in the albescent stage than in the green stage. Furthermore, unigenes involved in carotenoid, chlorophyll, and theanine biosyntheses were identified, and the expression patterns of the differentially expressed unigenes in these biosynthesis pathways were characterized. Through co-expression analyses, we identified the key genes in these pathways. These genes may be responsible for the metabolite biosynthesis differences among the different leaf color and developmental stages of 'Anji Baicha' tea plants. Our study presents the results of transcriptomic and biochemical analyses of 'Anji Baicha' tea plants at various stages. The distinct transcriptome profiles for each color and developmental stage enabled us to identify changes to biosynthesis pathways and revealed the contributions of such variations to the albino phenotype of tea plants. Furthermore, comparisons of the transcriptomes and related metabolites helped clarify the molecular regulatory mechanisms underlying the secondary metabolic pathways in different stages.

  3. Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

    PubMed Central

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-01-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

  4. [Recombinant expression of Schistosoma japonicum fructose-1, 6-bisphos- phate aldolase and its expression in different developmental stages of S. japonicum].

    PubMed

    Yan, Ke; Zhong, Zheng-rong; Xu, Yun-xia; Ding, Shu-qin; Hu, Jian-guo; Xu, Yuan-hong; Luo, Qing-lie; Shen, Ji-long

    2015-06-01

    To clone, express and purify Schistosoma japonicum fructose-1, 6-bisphosphate aldolase (SjFBPA) in E. coli and observe its expression in different developmental stages of S. japonicum. FBPA gene was amplified from S. japonicum adult worm cDNA by using PCR. The amplified product was recombined into pET28a plasmid, and inducibly expressed with IPTG in E. coli BL21. SDS-PAGE and Western blotting were employed to analyze and identify the recombinant protein SjFBPA (rSjFBPA). Then, rSjFBPA was purified by chromatographic purification and its purity was analyzed by SDS- PAGE. The protein concentration of rSjFBPA purified was measured by the BCA method. Furthermore, SjFBPA mRNA was ana- lyzed in different developmental stages of S. japonicum by RT-PCR. SjFBPA was successfully amplified by using PCR and identified by restriction enzyme digestion and sequencing. The Western blotting analysis confirmed that the recombinant pro- tein could specifically reactive to the anti-His-tag monoclonal antibody. The concentration of the purified recombinant protein was about 4 mg/ml. The result of RT-PCR showed that SjFBPA mRNA was expressed in cercaria, schistosomulum, adult worm and egg of S. japonicum. SjFBPA is successfully recombined and expressed in a prokaryotic system, and SjFBPA mRNA is expressed in cercaria, schistosomulum, adult worm and egg of S. japonicum.

  5. Australian black field crickets show changes in neural gene expression associated with socially-induced morphological, life-history, and behavioral plasticity.

    PubMed

    Kasumovic, Michael M; Chen, Zhiliang; Wilkins, Marc R

    2016-10-24

    Ecological and evolutionary model organisms have provided extensive insight into the ecological triggers, adaptive benefits, and evolution of life-history driven developmental plasticity. Despite this, we still have a poor understanding of the underlying genetic changes that occur during shifts towards different developmental trajectories. The goal of this study is to determine whether we can identify underlying gene expression patterns that can describe the different life-history trajectories individuals follow in response to social cues of competition. To do this, we use the Australian black field cricket (Teleogryllus commodus), a species with sex-specific developmental trajectories moderated by the density and quality of calls heard during immaturity. In this study, we manipulated the social information males and females could hear by rearing individuals in either calling or silent treatments. We next used RNA-Seq to develop a reference transcriptome to study changes in brain gene expression at two points prior to sexual maturation. We show accelerated development in both sexes when exposed to calling; changes were also seen in growth, lifespan, and reproductive effort. Functional relationships between genes and phenotypes were apparent from ontological enrichment analysis. We demonstrate that increased investment towards traits such as growth and reproductive effort were often associated with the expression of a greater number of genes with similar effect, thus providing a suite of candidate genes for future research in this and other invertebrate organisms. Our results provide interesting insight into the genomic underpinnings of developmental plasticity and highlight the potential of a genomic exploration of other evolutionary theories such as condition dependence and sex-specific developmental strategies.

  6. Evolution-development congruence in pattern formation dynamics: Bifurcations in gene expression and regulation of networks structures.

    PubMed

    Kohsokabe, Takahiro; Kaneko, Kunihiko

    2016-01-01

    Search for possible relationships between phylogeny and ontogeny is important in evolutionary-developmental biology. Here we uncover such relationships by numerical evolution and unveil their origin in terms of dynamical systems theory. By representing developmental dynamics of spatially located cells with gene expression dynamics with cell-to-cell interaction under external morphogen gradient, gene regulation networks are evolved under mutation and selection with the fitness to approach a prescribed spatial pattern of expressed genes. For most numerical evolution experiments, evolution of pattern over generations and development of pattern by an evolved network exhibit remarkable congruence. Both in the evolution and development pattern changes consist of several epochs where stripes are formed in a short time, while for other temporal regimes, pattern hardly changes. In evolution, these quasi-stationary regimes are generations needed to hit relevant mutations, while in development, they are due to some gene expression that varies slowly and controls the pattern change. The morphogenesis is regulated by combinations of feedback or feedforward regulations, where the upstream feedforward network reads the external morphogen gradient, and generates a pattern used as a boundary condition for the later patterns. The ordering from up to downstream is common in evolution and development, while the successive epochal changes in development and evolution are represented as common bifurcations in dynamical-systems theory, which lead to the evolution-development congruence. Mechanism of exceptional violation of the congruence is also unveiled. Our results provide a new look on developmental stages, punctuated equilibrium, developmental bottlenecks, and evolutionary acquisition of novelty in morphogenesis. © 2015 The Authors. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution Published by Wiley Periodicals, Inc.

  7. Evolution‐development congruence in pattern formation dynamics: Bifurcations in gene expression and regulation of networks structures

    PubMed Central

    Kohsokabe, Takahiro

    2016-01-01

    ABSTRACT Search for possible relationships between phylogeny and ontogeny is important in evolutionary‐developmental biology. Here we uncover such relationships by numerical evolution and unveil their origin in terms of dynamical systems theory. By representing developmental dynamics of spatially located cells with gene expression dynamics with cell‐to‐cell interaction under external morphogen gradient, gene regulation networks are evolved under mutation and selection with the fitness to approach a prescribed spatial pattern of expressed genes. For most numerical evolution experiments, evolution of pattern over generations and development of pattern by an evolved network exhibit remarkable congruence. Both in the evolution and development pattern changes consist of several epochs where stripes are formed in a short time, while for other temporal regimes, pattern hardly changes. In evolution, these quasi‐stationary regimes are generations needed to hit relevant mutations, while in development, they are due to some gene expression that varies slowly and controls the pattern change. The morphogenesis is regulated by combinations of feedback or feedforward regulations, where the upstream feedforward network reads the external morphogen gradient, and generates a pattern used as a boundary condition for the later patterns. The ordering from up to downstream is common in evolution and development, while the successive epochal changes in development and evolution are represented as common bifurcations in dynamical‐systems theory, which lead to the evolution‐development congruence. Mechanism of exceptional violation of the congruence is also unveiled. Our results provide a new look on developmental stages, punctuated equilibrium, developmental bottlenecks, and evolutionary acquisition of novelty in morphogenesis. J. Exp. Zool. (Mol. Dev. Evol.) 326B:61–84, 2016. © 2015 The Authors. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution Published by Wiley Periodicals, Inc. PMID:26678220

  8. Molecular markers for X-ray-insensitive differentiated cells in the Inner and outer regions of the mesenchymal space in planarian Dugesia japonica.

    PubMed

    Teramoto, Machiko; Kudome-Takamatsu, Tomomi; Nishimura, Osamu; An, Yang; Kashima, Makoto; Shibata, Norito; Agata, Kiyokazu

    2016-09-01

    Planarian's strong regenerative ability is dependent on stem cells (called neoblasts) that are X-ray-sensitive and proliferative stem cells. In addition to neoblasts, another type of X-ray-sensitive cells was newly identified by recent research. Thus, planarian's X-ray-sensitive cells can be divided into at least two populations, Type 1 and Type 2, the latter corresponding to planarian's classically defined "neoblasts". Here, we show that Type 1 cells were distributed in the outer region (OR) immediately underneath the muscle layer at all axial levels from head to tail, while the Type 2 cells were distributed in a more internal region (IR) of the mesenchymal space at the axial levels from neck to tail. To elucidate the biological significance of these two regions, we searched for genes expressed in differentiated cells that were locate close to these X-ray-sensitive cell populations in the mesenchymal space, and identified six genes mainly expressed in the OR or IR, named OR1, OR2, OR3, IR1, IR2 and IR3. The predicted amino acid sequences of these genes suggested that differentiated cells expressing OR1, OR3, IR1, or IR2 provide Type 1 and Type 2 cells with specific extracellular matrix (ECM) environments. © 2016 Japanese Society of Developmental Biologists.

  9. Integration of tomato reproductive developmental landmarks and expression profiles, and the effect of SUN on fruit shape

    PubMed Central

    Xiao, Han; Radovich, Cheryll; Welty, Nicholas; Hsu, Jason; Li, Dongmei; Meulia, Tea; van der Knaap, Esther

    2009-01-01

    Background Universally accepted landmark stages are necessary to highlight key events in plant reproductive development and to facilitate comparisons among species. Domestication and selection of tomato resulted in many varieties that differ in fruit shape and size. This diversity is useful to unravel underlying molecular and developmental mechanisms that control organ morphology and patterning. The tomato fruit shape gene SUN controls fruit elongation. The most dramatic effect of SUN on fruit shape occurs after pollination and fertilization although a detailed investigation into the timing of the fruit shape change as well as gene expression profiles during critical developmental stages has not been conducted. Results We provide a description of floral and fruit development in a red-fruited closely related wild relative of tomato, Solanum pimpinellifolium accession LA1589. We use established and propose new floral and fruit landmarks to present a framework for tomato developmental studies. In addition, gene expression profiles of three key stages in floral and fruit development are presented, namely floral buds 10 days before anthesis (floral landmark 7), anthesis-stage flowers (floral landmark 10 and fruit landmark 1), and 5 days post anthesis fruit (fruit landmark 3). To demonstrate the utility of the landmarks, we characterize the tomato shape gene SUN in fruit development. SUN controls fruit shape predominantly after fertilization and its effect reaches a maximum at 8 days post-anthesis coinciding with fruit landmark 4 representing the globular embryo stage of seed development. The expression profiles of the NILs that differ at sun show that only 34 genes were differentially expressed and most of them at a less than 2-fold difference. Conclusion The landmarks for flower and fruit development in tomato were outlined and integrated with the effect of SUN on fruit shape. Although we did not identify many genes differentially expressed in the NILs that differ at the sun locus, higher or lower transcript levels for many genes involved in phytohormone biosynthesis or signaling as well as organ identity and patterning of tomato fruit were found between developmental time points. PMID:19422692

  10. The Silkworm (Bombyx mori) microRNAs and Their Expressions in Multiple Developmental Stages

    PubMed Central

    Luo, Qibin; Cai, Yimei; Lin, Wen-chang; Chen, Huan; Yang, Yue; Hu, Songnian; Yu, Jun

    2008-01-01

    Background MicroRNAs (miRNAs) play crucial roles in various physiological processes through post-transcriptional regulation of gene expressions and are involved in development, metabolism, and many other important molecular mechanisms and cellular processes. The Bombyx mori genome sequence provides opportunities for a thorough survey for miRNAs as well as comparative analyses with other sequenced insect species. Methodology/Principal Findings We identified 114 non-redundant conserved miRNAs and 148 novel putative miRNAs from the B. mori genome with an elaborate computational protocol. We also sequenced 6,720 clones from 14 developmental stage-specific small RNA libraries in which we identified 35 unique miRNAs containing 21 conserved miRNAs (including 17 predicted miRNAs) and 14 novel miRNAs (including 11 predicted novel miRNAs). Among the 114 conserved miRNAs, we found six pairs of clusters evolutionarily conserved cross insect lineages. Our observations on length heterogeneity at 5′ and/or 3′ ends of nine miRNAs between cloned and predicted sequences, and three mature forms deriving from the same arm of putative pre-miRNAs suggest a mechanism by which miRNAs gain new functions. Analyzing development-related miRNAs expression at 14 developmental stages based on clone-sampling and stem-loop RT PCR, we discovered an unusual abundance of 33 sequences representing 12 different miRNAs and sharply fluctuated expression of miRNAs at larva-molting stage. The potential functions of several stage-biased miRNAs were also analyzed in combination with predicted target genes and silkworm's phenotypic traits; our results indicated that miRNAs may play key regulatory roles in specific developmental stages in the silkworm, such as ecdysis. Conclusions/Significance Taking a combined approach, we identified 118 conserved miRNAs and 151 novel miRNA candidates from the B. mori genome sequence. Our expression analyses by sampling miRNAs and real-time PCR over multiple developmental stages allowed us to pinpoint molting stages as hotspots of miRNA expression both in sorts and quantities. Based on the analysis of target genes, we hypothesized that miRNAs regulate development through a particular emphasis on complex stages rather than general regulatory mechanisms. PMID:18714353

  11. A Drosophila model for fetal alcohol syndrome disorders: role for the insulin pathway

    PubMed Central

    McClure, Kimberly D.; French, Rachael L.; Heberlein, Ulrike

    2011-01-01

    SUMMARY Prenatal exposure to ethanol in humans results in a wide range of developmental abnormalities, including growth deficiency, developmental delay, reduced brain size, permanent neurobehavioral abnormalities and fetal death. Here we describe the use of Drosophila melanogaster as a model for exploring the effects of ethanol exposure on development and behavior. We show that developmental ethanol exposure causes reduced viability, developmental delay and reduced adult body size. We find that flies reared on ethanol-containing food have smaller brains and imaginal discs, which is due to reduced cell division rather than increased apoptosis. Additionally, we show that, as in mammals, flies reared on ethanol have altered responses to ethanol vapor exposure as adults, including increased locomotor activation, resistance to the sedating effects of the drug and reduced tolerance development upon repeated ethanol exposure. We have found that the developmental and behavioral defects are largely due to the effects of ethanol on insulin signaling; specifically, a reduction in Drosophila insulin-like peptide (Dilp) and insulin receptor expression. Transgenic expression of Dilp proteins in the larval brain suppressed both the developmental and behavioral abnormalities displayed by ethanol-reared adult flies. Our results thus establish Drosophila as a useful model system to uncover the complex etiology of fetal alcohol syndrome. PMID:21303840

  12. Play Therapy. ERIC Digest.

    ERIC Educational Resources Information Center

    Landreth, Garry; Bratton, Sue

    Play therapy is based on developmental principles and, thus, provides, through play, developmentally appropriate means of expression and communication for children. Therefore, skill in using play therapy is an essential tool for mental health professionals who work with children. Therapeutic play allows children the opportunity to express…

  13. Developmental transcriptional profiling reveals key insights into Triticeae reproductive development.

    PubMed

    Tran, Frances; Penniket, Carolyn; Patel, Rohan V; Provart, Nicholas J; Laroche, André; Rowland, Owen; Robert, Laurian S

    2013-06-01

    Despite their importance, there remains a paucity of large-scale gene expression-based studies of reproductive development in species belonging to the Triticeae. As a first step to address this deficiency, a gene expression atlas of triticale reproductive development was generated using the 55K Affymetrix GeneChip(®) wheat genome array. The global transcriptional profiles of the anther/pollen, ovary and stigma were analyzed at concurrent developmental stages, and co-expressed as well as preferentially expressed genes were identified. Data analysis revealed both novel and conserved regulatory factors underlying Triticeae floral development and function. This comprehensive resource rests upon detailed gene annotations, and the expression profiles are readily accessible via a web browser. © 2013 Her Majesty the Queen in Right of Canada as represented by the Minister of Agriculture and Agri-Food Canada.

  14. Role of PIN-mediated auxin efflux in apical hook development of Arabidopsis thaliana.

    PubMed

    Zádníková, Petra; Petrásek, Jan; Marhavy, Peter; Raz, Vered; Vandenbussche, Filip; Ding, Zhaojun; Schwarzerová, Katerina; Morita, Miyo T; Tasaka, Masao; Hejátko, Jan; Van Der Straeten, Dominique; Friml, Jirí; Benková, Eva

    2010-02-01

    The apical hook of dark-grown Arabidopsis seedlings is a simple structure that develops soon after germination to protect the meristem tissues during emergence through the soil and that opens upon exposure to light. Differential growth at the apical hook proceeds in three sequential steps that are regulated by multiple hormones, principally auxin and ethylene. We show that the progress of the apical hook through these developmental phases depends on the dynamic, asymmetric distribution of auxin, which is regulated by auxin efflux carriers of the PIN family. Several PIN proteins exhibited specific, partially overlapping spatial and temporal expression patterns, and their subcellular localization suggested auxin fluxes during hook development. Genetic manipulation of individual PIN activities interfered with different stages of hook development, implying that specific combinations of PIN genes are required for progress of the apical hook through the developmental phases. Furthermore, ethylene might modulate apical hook development by prolonging the formation phase and strongly suppressing the maintenance phase. This ethylene effect is in part mediated by regulation of PIN-dependent auxin efflux and auxin signaling.

  15. A morphological and electrophysiological study on the postnatal development of oligodendrocyte precursor cells in the rat brain.

    PubMed

    Chen, Peng-hui; Cai, Wen-qin; Wang, Li-yan; Deng, Qi-yue

    2008-12-03

    A widespread population of cells in CNS is identified by specific expression of the NG2 chondroitin sulphate proteoglycan and named as oligodendrocyte precursor cell (OPC). OPCs may possess stem cell-like characteristics, including multipotentiality in vitro and in vivo. It was proposed that OPCs in the CNS parenchyma comprise a unique population of glia, distinct from oligodendrocytes and astrocytes. This study confirmed that NG2 immunoreactive OPCs were continuously distributed in cerebral cortex and hippocampus during different postnatal developmental stages. These cells rapidly increased in number over the postnatal 7 days and migrate extensively to populate with abundant processes both in developing cortex and hippocampus. The morphology of OPCs exhibited extremely complex changes with the distribution of long distance primary process gradually increased from neonatal to adult CNS. Immunohistochemical studies showed that OPCs exhibited the morphological properties that can be distinguished from astrocytes. The electrophysiological properties showed that OPCs expressed a small amount of inward Na(+) currents which was distinguished from Na(+) currents in neurons owing to their lower Na-to-K conductance ratio and higher command voltage step depolarized maximum Na(+) current amplitude. These observations suggest that OPCs can be identified as the third type of macroglia because of their distribution in the CNS, the morphological development in process diversity and the electrophysiological difference from astrocyte.

  16. Gene expression studies of developing bovine longissimus muscle from two different beef cattle breeds

    PubMed Central

    Lehnert, Sigrid A; Reverter, Antonio; Byrne, Keren A; Wang, Yonghong; Nattrass, Greg S; Hudson, Nicholas J; Greenwood, Paul L

    2007-01-01

    Background The muscle fiber number and fiber composition of muscle is largely determined during prenatal development. In order to discover genes that are involved in determining adult muscle phenotypes, we studied the gene expression profile of developing fetal bovine longissimus muscle from animals with two different genetic backgrounds using a bovine cDNA microarray. Fetal longissimus muscle was sampled at 4 stages of myogenesis and muscle maturation: primary myogenesis (d 60), secondary myogenesis (d 135), as well as beginning (d 195) and final stages (birth) of functional differentiation of muscle fibers. All fetuses and newborns (total n = 24) were from Hereford dams and crossed with either Wagyu (high intramuscular fat) or Piedmontese (GDF8 mutant) sires, genotypes that vary markedly in muscle and compositional characteristics later in postnatal life. Results We obtained expression profiles of three individuals for each time point and genotype to allow comparisons across time and between sire breeds. Quantitative reverse transcription-PCR analysis of RNA from developing longissimus muscle was able to validate the differential expression patterns observed for a selection of differentially expressed genes, with one exception. We detected large-scale changes in temporal gene expression between the four developmental stages in genes coding for extracellular matrix and for muscle fiber structural and metabolic proteins. FSTL1 and IGFBP5 were two genes implicated in growth and differentiation that showed developmentally regulated expression levels in fetal muscle. An abundantly expressed gene with no functional annotation was found to be developmentally regulated in the same manner as muscle structural proteins. We also observed differences in gene expression profiles between the two different sire breeds. Wagyu-sired calves showed higher expression of fatty acid binding protein 5 (FABP5) RNA at birth. The developing longissimus muscle of fetuses carrying the Piedmontese mutation shows an emphasis on glycolytic muscle biochemistry and a large-scale up-regulation of the translational machinery at birth. We also document evidence for timing differences in differentiation events between the two breeds. Conclusion Taken together, these findings provide a detailed description of molecular events accompanying skeletal muscle differentiation in the bovine, as well as gene expression differences that may underpin the phenotype differences between the two breeds. In addition, this study has highlighted a non-coding RNA, which is abundantly expressed and developmentally regulated in bovine fetal muscle. PMID:17697390

  17. Glutathione S-transferase pi isoform (GSTP1) expression in murine retina increases with developmental maturity.

    PubMed

    Lee, Wen-Hsiang; Joshi, Pratibha; Wen, Rong

    2014-01-01

    Glutathione S-transferase pi isoform (GSTP1) is an intracellular detoxification enzyme that catalyzes reduction of chemically reactive electrophiles and is a zeaxanthin-binding protein in the human macula. We have previously demonstrated that GSTP1 levels are decreased in human age-related macular degeneration (AMD) retina compared to normal controls (Joshi et al., Invest Ophthalmol Vis Sci, e-abstract, 2009). We also showed that GSTP1 levels parallel survival of human retinal pigment epithelial (RPE) cells exposed to ultraviolet (UV) light, and GSTP1 over-expression protects them against UV light damage (Joshi et al., Invest Ophthalmol Vis Sci, e-abstract, 2010). In the present work, we determined the developmental time course of GSTP1 expression in murine retina and in response to light challenge. Eyes from BALB/c mice at postnatal day 20, 1 month, and 2 months of age were prepared for retinal protein extraction and cryo sectioning, and GSTP1 levels in the retina were analyzed by Western blot and immunohistochemistry (IHC). Another group of BALB/c mice with the same age ranges was exposed to 1000 lx of white fluorescent light for 24 h, and their retinas were analyzed for GSTP1 expression by Western blot and IHC in a similar manner. GSTP1 levels in the murine retina increased in ascending order from postnatal day 20, 1 month, and 2 months of age. Moreover, GSTP1 expression in murine retina at postnatal day 20, 1 month, and 2 months of age increased in response to brief light exposure compared to age-matched controls under normal condition. GSTP1 expression in retina increases with developmental age in mice and accompanies murine retinal maturation. Brief exposure to light induces GSTP1 expression in the murine retina across various developmental ages. GSTP1 induction may be a protective response to light-induced oxidative damage in the murine retina.

  18. Glutathione S-Transferase Pi Isoform (GSTP1) Expression in Murine Retina Increases with Developmental Maturity

    PubMed Central

    Lee, Wen-Hsiang; Joshi, Pratibha; Wen, Rong

    2014-01-01

    Background and Aims Glutathione S-transferase pi isoform (GSTP1) is an intracellular detoxification enzyme that catalyzes reduction of chemically reactive electrophiles and is a zeaxanthin-binding protein in the human macula. We have previously demonstrated that GSTP1 levels are decreased in human age-related macular degeneration (AMD) retina compared to normal controls [1]. We also showed that GSTP1 levels parallel survival of human retinal pigment epithelial (RPE) cells exposed to UV light, and GSTP1 over-expression protects them against UV light damage [2]. In the present work, we determined the developmental time course of GSTP1 expression in murine retina and in response to light challenge. Methods Eyes from BALB/c mice at post-natal day 20, 1 month, and 2 months of age were prepared for retinal protein extraction and cryo sectioning, and GSTP1 levels in the retina were analyzed by Western blot and immunohistochemistry (IHC). Another group of BALB/c mice with the same age ranges was exposed to 1000 lux of white fluorescent light for 24 hours, and their retinas were analyzed for GSTP1 expression by Western blot and IHC in a similar manner. Results GSTP1 levels in the murine retina increased in ascending order from post-natal day 20, 1 month, and 2 months of age. Moreover, GSTP1 expression in murine retina at post-natal day 20, 1 month, and 2 months of age increased in response to brief light exposure compared to age-matched controls under normal condition. Conclusions GSTP1 expression in retina increases with developmental age in mice and accompanies murine retinal maturation. Brief exposure to light induces GSTP1 expression in the murine retina across various developmental ages. GSTP1 induction may be a protective response to light-induced oxidative damage in the murine retina. PMID:24664677

  19. Developmental regulation of neuroligin genes in Japanese ricefish (Oryzias latipes) embryogenesis maintains the rhythm during ethanol-induced fetal alcohol spectrum disorder.

    PubMed

    Haron, Mona H; Khan, Ikhlas A; Dasmahapatra, Asok K

    2014-01-01

    Although prenatal alcohol exposure is the potential cause of fetal alcohol spectrum disorder (FASD) in humans, the molecular mechanism(s) of FASD is yet unknown. We have used Japanese ricefish (Oryzias latipes) embryogenesis as an animal model of FASD and reported that this model has effectively generated several phenotypic features in the cardiovasculature and neurocranial cartilages by developmental ethanol exposure which is analogous to human FASD phenotypes. As FASD is a neurobehavioral disorder, we are searching for a molecular target of ethanol that alters neurological functions. In this communication, we have focused on neuroligin genes (nlgn) which are known to be active at the postsynaptic side of both excitatory and inhibitory synapses of the central nervous system. There are six human NLGN homologs of Japanese ricefish reported in public data bases. We have partially cloned these genes and analyzed their expression pattern during normal development and also after exposing the embryos to ethanol. Our data indicate that the expression of all six nlgn genes in Japanese ricefish embryos is developmentally regulated. Although ethanol is able to induce developmental abnormalities in Japanese ricefish embryogenesis comparable to the FASD phenotypes, quantitative real-time PCR (qPCR) analysis of nlgn mRNAs indicate unresponsiveness of these genes to ethanol. We conclude that the disruption of the developmental rhythm of Japanese ricefish embryogenesis by ethanol that leads to FASD may not affect the nlgn gene expression at the message level. © 2013.

  20. Quantitation and histochemical localization of galectin-1 and galectin-1-reactive glycoconjugates in fetal development of bovine organs.

    PubMed

    Kaltner, H; Lips, K S; Reuter, G; Lippert, S; Sinowatz, F; Gabius, H J

    1997-10-01

    The display of cellular oligosaccharide chains is known to undergo marked developmental changes, as monitored histochemically with plant lectins. In conjunction with endogenous lectins respective ligand structures may have a functional role during fetal development. The assumption of a recognitive, functionally productive interplay prompts the study of the expression of a tissue lectin and of lectin-reactive glycoconjugates concomitantly. Focusing on common beta-galactosides as constituents of oligosaccharide chains and the predominant member of the family of galectins in mammals, namely galectin-1, the question therefore is addressed as to whether expression of lectin and lectin-reactive glycoconjugates exhibits alterations, assessed in three morphologically defined fetal stages and in adult bovine organs. Using a sandwich ELISA, the level of the rather ubiquitous galectin-1 is mostly increased in adult organs relative to respective fetal stages, except for the case of kidney. This developmental course is seen rather seldom, when the amounts of lectin-reactive glycoproteins or glycolipids are quantitated in solid-phase assays after tissue homogenization. Western blotting, combined with probing by labeled galectin-1, discloses primarily quantitative changes in the reactivity of individual glycoproteins. Performing the same assays on extract aliquots with a plant agglutinin, namely the galactoside-binding mistletoe lectin, whose fine specificity is different from galectin-1, its reduced extent of binding in solid-phase assays and the disparate profile of lectin-reactive glycoproteins reveal a non-uniform developmental alteration within the group of structural variants of beta-galactosides. Although sample preparation can affect ligand preservation and/or presentation and thus restricts the comparability of biochemical and histochemical results, especially for soluble reactants, the histochemical studies on frozen and paraffin-embedded sections of bovine heart, kidney and liver demonstrate that the localization of the galectin and of lectin-reactive epitopes can show a similar distribution, as seen in liver and heart, with organ-typical quantitative changes of a rather similar staining profile (heart, kidney) or notable changes in the spatial distribution (liver) in the course of development. This report emphasizes the potential value of combined monitoring of the lectin and its potential in vivo ligands to contribute to eventually unravel organ-related function(s) of a tissue lectin.

  1. Larval traits show temporally consistent constraints, but are decoupled from post-settlement juvenile growth, in an intertidal fish.

    PubMed

    Thia, Joshua A; Riginos, Cynthia; Liggins, Libby; Figueira, Will F; McGuigan, Katrina

    2018-05-05

    1.Complex life-cycles may evolve to dissociate distinct developmental phases in an organism's lifetime. However, genetic or environmental factors may restrict trait independence across life stages, constraining ontogenetic trajectories. Quantifying covariance across life-stages and their temporal variability is fundamental in understanding life-history phenotypes and potential distributions and consequences for selection. 2.We studied developmental constraints in an intertidal fish (Bathygobius cocosensis: Gobiidae) with a discrete pelagic larval phase and benthic juvenile phase. We tested whether traits occurring earlier in life affected those expressed later, and whether larval traits were decoupled from post-settlement juvenile traits. Sampling distinct cohorts from three annual breeding seasons afforded tests of temporally variability in trait covariance. 3.From otoliths (fish ear stones), we measured hatch size, larval duration, pelagic growth (larval traits) and early post-settlement growth (juvenile trait) in 124 juvenile B. cocoensis. We used path analyses to model trait relationships with respect to their chronological expression, comparing models among seasons. We also modelled the effect of season and hatch date on each individual trait to quantify their inherent variability. 4.Our path analyses demonstrated a decoupling of larval traits on juvenile growth. Within the larval phase, longer larval durations resulted in greater pelagic growth, and larger size-at-settlement. There was also evidence that larger hatch size might reduce larval durations, but this effect was only marginally significant. Although pelagic and post-settlement growth were decoupled, pelagic growth had post-settlement consequences: individuals with high pelagic growth were among the largest fish at settlement, and remained among the largest early post-settlement. We observed no evidence that trait relationships varied among breeding seasons, but larval duration differed among breeding seasons, and was shorter for larvae hatching later within each season. 5.Overall, we demonstrate mixed support for the expectation that traits in different life-stages are independent. While post-settlement growth was decoupled from larval traits, pelagic development had consequences for the size of newly settled juveniles. Temporal consistency in trait covariances implies that genetic and/or environmental factors influencing them were stable over our three-year study. Our work highlights the importance of individual developmental experiences and temporal variability in understanding population distributions of life-history traits. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  2. Structure and epitope distribution of heparan sulfate is disrupted in experimental lung hypoplasia: a glycobiological epigenetic cause for malformation?

    PubMed

    Thompson, Sophie M; Connell, Marilyn G; van Kuppevelt, Toin H; Xu, Ruoyan; Turnbull, Jeremy E; Losty, Paul D; Fernig, David G; Jesudason, Edwin C

    2011-06-14

    Heparan sulfate (HS) is present on the surface of virtually all mammalian cells and is a major component of the extracellular matrix (ECM), where it plays a pivotal role in cell-cell and cell-matrix cross-talk through its large interactome. Disruption of HS biosynthesis in mice results in neonatal death as a consequence of malformed lungs, indicating that HS is crucial for airway morphogenesis. Neonatal mortality (~50%) in newborns with congenital diaphragmatic hernia (CDH) is principally associated with lung hypoplasia and pulmonary hypertension. Given the importance of HS for lung morphogenesis, we investigated developmental changes in HS structure in normal and hypoplastic lungs using the nitrofen rat model of CDH and semi-synthetic bacteriophage ('phage) display antibodies, which identify distinct HS structures. The pulmonary pattern of elaborated HS structures is developmentally regulated. For example, the HS4E4V epitope is highly expressed in sub-epithelial mesenchyme of E15.5 - E17.5 lungs and at a lower level in more distal mesenchyme. However, by E19.5, this epitope is expressed similarly throughout the lung mesenchyme.We also reveal abnormalities in HS fine structure and spatiotemporal distribution of HS epitopes in hypoplastic CDH lungs. These changes involve structures recognised by key growth factors, FGF2 and FGF9. For example, the EV3C3V epitope, which was abnormally distributed in the mesenchyme of hypoplastic lungs, is recognised by FGF2. The observed spatiotemporal changes in HS structure during normal lung development will likely reflect altered activities of many HS-binding proteins regulating lung morphogenesis. Abnormalities in HS structure and distribution in hypoplastic lungs can be expected to perturb HS:protein interactions, ECM microenvironments and crucial epithelial-mesenchyme communication, which may contribute to lung dysmorphogenesis. Indeed, a number of epitopes correlate with structures recognised by FGFs, suggesting a functional consequence of the observed changes in HS in these lungs. These results identify a novel, significant molecular defect in hypoplastic lungs and reveals HS as a potential contributor to hypoplastic lung development in CDH. Finally, these results afford the prospect that HS-mimetic therapeutics could repair defective signalling in hypoplastic lungs, improve lung growth, and reduce CDH mortality.

  3. Structure and epitope distribution of heparan sulfate is disrupted in experimental lung hypoplasia: a glycobiological epigenetic cause for malformation?

    PubMed Central

    2011-01-01

    Background Heparan sulfate (HS) is present on the surface of virtually all mammalian cells and is a major component of the extracellular matrix (ECM), where it plays a pivotal role in cell-cell and cell-matrix cross-talk through its large interactome. Disruption of HS biosynthesis in mice results in neonatal death as a consequence of malformed lungs, indicating that HS is crucial for airway morphogenesis. Neonatal mortality (~50%) in newborns with congenital diaphragmatic hernia (CDH) is principally associated with lung hypoplasia and pulmonary hypertension. Given the importance of HS for lung morphogenesis, we investigated developmental changes in HS structure in normal and hypoplastic lungs using the nitrofen rat model of CDH and semi-synthetic bacteriophage ('phage) display antibodies, which identify distinct HS structures. Results The pulmonary pattern of elaborated HS structures is developmentally regulated. For example, the HS4E4V epitope is highly expressed in sub-epithelial mesenchyme of E15.5 - E17.5 lungs and at a lower level in more distal mesenchyme. However, by E19.5, this epitope is expressed similarly throughout the lung mesenchyme. We also reveal abnormalities in HS fine structure and spatiotemporal distribution of HS epitopes in hypoplastic CDH lungs. These changes involve structures recognised by key growth factors, FGF2 and FGF9. For example, the EV3C3V epitope, which was abnormally distributed in the mesenchyme of hypoplastic lungs, is recognised by FGF2. Conclusions The observed spatiotemporal changes in HS structure during normal lung development will likely reflect altered activities of many HS-binding proteins regulating lung morphogenesis. Abnormalities in HS structure and distribution in hypoplastic lungs can be expected to perturb HS:protein interactions, ECM microenvironments and crucial epithelial-mesenchyme communication, which may contribute to lung dysmorphogenesis. Indeed, a number of epitopes correlate with structures recognised by FGFs, suggesting a functional consequence of the observed changes in HS in these lungs. These results identify a novel, significant molecular defect in hypoplastic lungs and reveals HS as a potential contributor to hypoplastic lung development in CDH. Finally, these results afford the prospect that HS-mimetic therapeutics could repair defective signalling in hypoplastic lungs, improve lung growth, and reduce CDH mortality. PMID:21672206

  4. Discovering sparse transcription factor codes for cell states and state transitions during development

    PubMed Central

    Furchtgott, Leon A; Melton, Samuel; Menon, Vilas; Ramanathan, Sharad

    2017-01-01

    Computational analysis of gene expression to determine both the sequence of lineage choices made by multipotent cells and to identify the genes influencing these decisions is challenging. Here we discover a pattern in the expression levels of a sparse subset of genes among cell types in B- and T-cell developmental lineages that correlates with developmental topologies. We develop a statistical framework using this pattern to simultaneously infer lineage transitions and the genes that determine these relationships. We use this technique to reconstruct the early hematopoietic and intestinal developmental trees. We extend this framework to analyze single-cell RNA-seq data from early human cortical development, inferring a neocortical-hindbrain split in early progenitor cells and the key genes that could control this lineage decision. Our work allows us to simultaneously infer both the identity and lineage of cell types as well as a small set of key genes whose expression patterns reflect these relationships. DOI: http://dx.doi.org/10.7554/eLife.20488.001 PMID:28296636

  5. Developmental origin of lung macrophage diversity

    PubMed Central

    Tan, Serena Y. S.; Krasnow, Mark A.

    2016-01-01

    Macrophages are specialized phagocytic cells, present in all tissues, which engulf and digest pathogens, infected and dying cells, and debris, and can recruit and regulate other immune cells and the inflammatory response and aid in tissue repair. Macrophage subpopulations play distinct roles in these processes and in disease, and are typically recognized by differences in marker expression, immune function, or tissue of residency. Although macrophage subpopulations in the brain have been found to have distinct developmental origins, the extent to which development contributes to macrophage diversity between tissues and within tissues is not well understood. Here, we investigate the development and maintenance of mouse lung macrophages by marker expression patterns, genetic lineage tracing and parabiosis. We show that macrophages populate the lung in three developmental waves, each giving rise to a distinct lineage. These lineages express different markers, reside in different locations, renew in different ways, and show little or no interconversion. Thus, development contributes significantly to lung macrophage diversity and targets each lineage to a different anatomical domain. PMID:26952982

  6. Developmental Hypothyroidism Reduces the Expression of ...

    EPA Pesticide Factsheets

    Disruption of thyroid hormone (TH) is a known effect of environmental contaminants. Neurotrophins including brain-derived neurotrophic factor (BDNF) and nerve growth factor (NGF) have been implicated in brain dysfunction resulting from severe developmental TH insufficiency. Neurotrophins are also implicated in activity-dependent plasticity, a process critical for appropriate use-dependent connectivity in the developing brain and for memory formation in the adult. This study examined activity-induced expression of neurotrophin gene products in the hippocampus using the long-term potentiation (LTP) after developmental hypothyroidism induced by propylthiouracil (PTU). Pregnant rats were exposed to PTU (0 or I0ppm) via the drinking water from early gestation to weaning. Adult male offspring were anesthetized with urethane and implanted with electrodes in the dentate gyrus (00) and perforant path (PP). LTP was induced by PP stimulation and responses from 00 were monitored at 15m intervals until sacrifice of the animals 5 h later. The 00 was dissected from the stimulated and nonstimulated hemispheres for rtPCR analysis of the neurotrophins Bdnf, Ngf, Ntf3 and related genes Egrl, Arc, Klf9. We found no PTU-induced difference in basal levels of expression of any of these genes in the nonstimulated 00. LTP increased expression of Bdnf, Ngf, Arc and Klj9 in the control DG, and reduced expression of Ntf3. LTP in DG from PTU animals failed to increase expression of Bdnf,

  7. Molecular and Functional Characterization of Broccoli EMBRYONIC FLOWER 2 Genes

    PubMed Central

    Chen, Long-Fang O.; Lin, Chun-Hung; Lai, Ying-Mi; Huang, Jia-Yuan; Sung, Zinmay Renee

    2012-01-01

    Polycomb group (PcG) proteins regulate major developmental processes in Arabidopsis. EMBRYONIC FLOWER 2 (EMF2), the VEFS domain-containing PcG gene, regulates diverse genetic pathways and is required for vegetative development and plant survival. Despite widespread EMF2-like sequences in plants, little is known about their function other than in Arabidopsis and rice. To study the role of EMF2 in broccoli (Brassica oleracea var. italica cv. Elegance) development, we identified two broccoli EMF2 (BoEMF2) genes with sequence homology to and a similar gene expression pattern to that in Arabidopsis (AtEMF2). Reducing their expression in broccoli resulted in aberrant phenotypes and gene expression patterns. BoEMF2 regulates genes involved in diverse developmental and stress programs similar to AtEMF2 in Arabidopsis. However, BoEMF2 differs from AtEMF2 in the regulation of flower organ identity, cell proliferation and elongation, and death-related genes, which may explain the distinct phenotypes. The expression of BoEMF2.1 in the Arabidopsis emf2 mutant (Rescued emf2) partially rescued the mutant phenotype and restored the gene expression pattern to that of the wild type. Many EMF2-mediated molecular and developmental functions are conserved in broccoli and Arabidopsis. Furthermore, the restored gene expression pattern in Rescued emf2 provides insights into the molecular basis of PcG-mediated growth and development. PMID:22537758

  8. Monocarboxylate transporter 1 (MCT1) in the liver of pre-ruminant and adult bovines.

    PubMed

    Kirat, D; Inoue, H; Iwano, H; Yokota, H; Taniyama, H; Kato, S

    2007-01-01

    This study investigated the distribution and expression of monocarboxylate transporter 1 (MCT1) in the livers of pre-ruminant calves and adult bovines (bulls and cows), using different molecular biological techniques. Reverse transcription-polymerase chain reaction (RT-PCR) verified the presence of mRNA encoding for MCT1 in both pre-ruminant and adult bovine livers. Immunohistochemically, MCT1 was clearly demonstrated on the sinusoidal surfaces of bovine hepatocytes but its expression varied widely between pre-ruminants and adult bovines. In pre-ruminants, a faint hepatocellular expression of MCT1 was observed in a few hepatocytes, whereas an intense immunoreactive staining for MCT1 was shown in the majority of adult bovine hepatocytes. Western blot analysis also confirmed the results of the immunohistochemistry. Quantitative immunoblotting, as estimated by densitometric analysis, showed that the level of MCT1 in the liver of adult bovines was 8-9-fold greater (P<0.01) than that in pre-ruminant calf livers although no significant differences were detected between bulls and cows. The results demonstrated that MCT1 may play a crucial role in the transport of propionate in bovine liver, suggesting that MCT1 expression may be influenced by developmental and metabolic regulations.

  9. EXPRESS Rack Technology for Space Station

    NASA Technical Reports Server (NTRS)

    Davis, Ted B.; Adams, J. Brian; Fisher, Edward M., Jr.; Prickett, Guy B.; Smith, Timothy G.

    1999-01-01

    The EXPRESS rack provides accommodations for standard Mid-deck Locker and ISIS drawer payloads on the International Space Station. A design overview of the basic EXPRESS rack and two derivatives, the Human Research Facility and the Habitat Holding Rack, is given in Part I. In Part II, the design of the Solid State Power Control Module (SSPCM) is reviewed. The SSPCM is a programmable and remotely controllable power switching and voltage conversion unit which distributes and protects up to 3kW of 12OVDC and 28VDC power to payloads and rack subsystem components. Part III details the development and testing of a new data storage device, the BRP EXPRESS Memory Unit (BEMU). The BEMU is a conduction-cooled device which operates on 28VDC and is based on Boeing-modified 9GB commercial disk-drive technology. In Part IV results of a preliminary design effort for a rack Passive Damping System (PDS) are reported. The PDS is intended to isolate ISPR-based experiment racks from on-orbit vibration. System performance predictions based on component developmental testing indicate that such a system can provide effective isolation at frequencies of 1 Hz and above.

  10. Cloning, expression profiling, and acetylation identification of alpha-tubulin N-acetyltransferase 1 from Bombyx mori.

    PubMed

    Zhou, Huaixiang; Cheng, Xusheng; Xu, Xiaoyuan; Jiang, Tianlong; Zhou, Haimeng; Sheng, Qing; Nie, Zuoming

    2018-03-22

    Alpha-tubulin N-acetyltransferase 1 (ATAT1) is an acetyltransferase specific to α-tubulin and performs important functions in many cellular processes. Bombyx mori is an economic insect and also known as a model lepidoptera insect. In this study, we cloned a B. mori ATAT1 gene (BmATAT1) (Gen Bank accession number: XP_004932777.1). BmATAT1 contained an open reading frame (ORF) of 1,065 bp encoding 355 amino acids (aa). Expression profiling of BmATAT1 protein showed that the expression levels of BmATAT1 at different developmental stages and different tissues in fifth-instar larvae differ. BmATAT1 was highly expressed at the egg stage and in the head of the fifth-instar larvae. Subcellular localization showed that BmATAT1 was distributed in the cytoplasm and nucleus. Furthermore, BmATAT1 may lead to time-dependent induction of cell cycle arrest in the G2/M phase by flow cytometry analysis. Interestingly, using site-specific mutation, immunoprecipitation, and Western blotting, we further found a BmATAT1 acetylated site at K156, suggesting that this acetyltransferase could be regulated by acetylation itself. © 2018 Wiley Periodicals, Inc.

  11. Differential gene expression in notochord and nerve cord fate segregation in the Ciona intestinalis embryo.

    PubMed

    Kobayashi, Kenji; Yamada, Lixy; Satou, Yutaka; Satoh, Nori

    2013-09-01

    During early embryogenesis, embryonic cells gradually restrict their developmental potential and are eventually destined to give rise to one type of cells. Molecular mechanisms underlying developmental fate restriction are one of the major research subjects within developmental biology. In this article, this subject was addressed by combining blastomere isolation with microarray analysis. During the 6th cleavage of the Ciona intestinalis embryo, from the 32-cell to the 64-cell stage, four mother cells divide into daughter cells with two distinct fates, one giving rise to notochord precursor cells and the other to nerve cord precursors. Approximately 2,200 each of notochord and nerve cord precursor cells were isolated, and their mRNA expression profiles were compared by microarray. This analysis identified 106 and 68 genes, respectively, that are differentially expressed in notochord and nerve cord precursor cells. These included not only genes for transcription factors and signaling molecules but also those with generalized functions observed in many types of cells. In addition, whole-mount in situ hybridization showed dynamic spatial expression profiles of these genes during segregation of the two fates: partitioning of transcripts present in the mother cells into either type of daughter cells, and initiation of preferential gene expression in either type of cells. Copyright © 2013 Wiley Periodicals, Inc.

  12. Parasitization by Scleroderma guani influences expression of superoxide dismutase genes in Tenebrio molitor.

    PubMed

    Zhu, Jia-Ying; Ze, Sang-Zi; Stanley, David W; Yang, Bin

    2014-09-01

    Superoxide dismutase (SOD) is an antioxidant enzyme involved in detoxifying reactive oxygen species. In this study, we identified genes encoding the extracellular and intracellular copper-zinc SODs (ecCuZnSOD and icCuZnSOD) and a manganese SOD (MnSOD) in the yellow mealworm beetle, Tenebrio molitor. The cDNAs for ecCuZnSOD, icCuZnSOD, and MnSOD, respectively, encode 24.55, 15.81, and 23.14 kDa polypeptides, which possess structural features typical of other insect SODs. They showed 20-94% identity to other known SOD sequences from Bombyx mori, Musca domestica, Nasonia vitripennis, Pediculus humanus corporis, and Tribolium castaneum. Expression of these genes was analyzed in selected tissues and developmental stages, and following exposure to Escherichia coli and parasitization by Scleroderma guani. We recorded expression of all three SODs in cuticle, fat body, and hemocytes and in the major developmental stages. Relatively higher expressions were detected in late-instar larvae and pupae, compared to other developmental stages. Transcriptional levels were upregulated following bacterial infection. Analysis of pupae parasitized by S. guani revealed that expression of T. molitor SOD genes was significantly induced following parasitization. We infer that these genes act in immune response and in host-parasitoid interactions. © 2014 Wiley Periodicals, Inc.

  13. Developmental Effects of Acute, Chronic, and Withdrawal from Chronic Nicotine on Fear Conditioning

    PubMed Central

    Portugal, George S.; Wilkinson, Derek S.; Turner, Jill R.; Blendy, Julie A.; Gould, Thomas J.

    2012-01-01

    Pre-adolescence and adolescence are developmental periods associated with increased vulnerability for tobacco addiction, and exposure to tobacco during these periods may lead to long-lasting changes in behavioral and neuronal plasticity. The present study examined the short- and long-term effects of nicotine and nicotine withdrawal on fear conditioning in pre-adolescent, adolescent, and adult mice, and potential underlying substrates that may mediate the developmental effects of nicotine, such as changes in nicotinic acetylcholine receptor (nAChR) binding, CREB expression, and nicotine metabolism. Age-related differences existed in sensitivity to the effects of acute nicotine, chronic nicotine and nicotine withdrawal on contextual fear conditioning (no changes in cued fear conditioning were seen); younger mice were more sensitive to the acute effects and less sensitive to the effects of nicotine withdrawal 24 hours post treatment cessation. Developmental differences in nAChR binding were associated with the effects of nicotine withdrawal on contextual learning. Developmental differences in nicotine metabolism and CREB expression were also observed, but were not related to the effects of nicotine withdrawal on contextual learning 24 hours post treatment. Chronic nicotine exposure during pre-adolescence or adolescence, however, produced long-lasting impairments in contextual learning that were observed during adulthood, whereas adult chronic nicotine exposure did not. These developmental effects could be related to changes in CREB. Overall, there is a developmental shift in the effects of nicotine on hippocampus-dependent learning and developmental exposure to nicotine results in adult cognitive deficits; these changes in cognition may play an important role in the development and maintenance of nicotine addiction. PMID:22521799

  14. An Out-of-Math Experience: Einstein, Relativity, and the Developmental Mathematics Student.

    ERIC Educational Resources Information Center

    Fiore, Greg

    2000-01-01

    Discusses Einstein's special relativity theory and some of the developmental mathematics involved. Presents motivational classroom materials used in discussing relative-motion problems, evaluating a radical expression, graphing with asymptotes, interpreting a graph, studying variation, and solving literal and radical equations. (KHR)

  15. Gene Expression Changes in Developing Zebrafish as Potential Markers for Rapid Developmental Neurotoxicity Screening

    EPA Science Inventory

    Sparse information exists on many chemicals to guide developmental neurotoxicity (DNT) risk assessments. As DNT testing using rodents is laborious and expensive, alternative species such as zebrafish are being adapted for toxicity screening. Assessing the DNT potential of chem...

  16. Community Inclusion for Children and Youth with Developmental Disabilities.

    ERIC Educational Resources Information Center

    Fennick, Ellen; Royle, James

    2003-01-01

    Activity coaches from university teacher education and health education programs were trained to use individualized accommodations to help six children (ages 6-13) with developmental disabilities participate in community recreation activities. Children participated in swim classes or gymnastics at individualized levels, expressed enjoyment, and…

  17. Developmental cigarette smoke exposure II: Hepatic proteome profiles in 6 month old adult offspring.

    PubMed

    Neal, Rachel E; Chen, Jing; Webb, Cindy; Stocke, Kendall; Gambrell, Caitlin; Greene, Robert M; Pisano, M Michele

    2016-10-01

    Utilizing a mouse model of 'active' developmental cigarette smoke exposure (CSE) [gestational day (GD) 1 through postnatal day (PD) 21] characterized by offspring low birth weight, the impact of developmental CSE on liver proteome profiles of adult offspring at 6 months of age was determined. Liver tissue was collected from Sham- and CSE-offspring for 2D-SDS-PAGE based proteome analysis with Partial Least Squares-Discriminant Analysis (PLS-DA). A similar study conducted at the cessation of exposure to cigarette smoke documented decreased gluconeogenesis coupled to oxidative stress in weanling offspring. In the current study, exposure throughout development to cigarette smoke resulted in impaired hepatic carbohydrate metabolism, decreased serum glucose levels, and increased gluconeogenic regulatory enzyme abundances during the fed-state coupled to decreased expression of SIRT1 as well as increased PEPCK and PGC1α expression. Together these findings indicate inappropriately timed gluconeogenesis that may reflect impaired insulin signaling in mature offspring exposed to 'active' developmental CSE. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Gene expression atlas of pigeonpea and its application to gain insights into genes associated with pollen fertility implicated in seed formation.

    PubMed

    Pazhamala, Lekha T; Purohit, Shilp; Saxena, Rachit K; Garg, Vanika; Krishnamurthy, L; Verdier, Jerome; Varshney, Rajeev K

    2017-04-01

    Pigeonpea (Cajanus cajan) is an important grain legume of the semi-arid tropics, mainly used for its protein rich seeds. To link the genome sequence information with agronomic traits resulting from specific developmental processes, a Cajanus cajan gene expression atlas (CcGEA) was developed using the Asha genotype. Thirty tissues/organs representing developmental stages from germination to senescence were used to generate 590.84 million paired-end RNA-Seq data. The CcGEA revealed a compendium of 28 793 genes with differential, specific, spatio-temporal and constitutive expression during various stages of development in different tissues. As an example to demonstrate the application of the CcGEA, a network of 28 flower-related genes analysed for cis-regulatory elements and splicing variants has been identified. In addition, expression analysis of these candidate genes in male sterile and male fertile genotypes suggested their critical role in normal pollen development leading to seed formation. Gene network analysis also identified two regulatory genes, a pollen-specific SF3 and a sucrose-proton symporter, that could have implications for improvement of agronomic traits such as seed production and yield. In conclusion, the CcGEA provides a valuable resource for pigeonpea to identify candidate genes involved in specific developmental processes and to understand the well-orchestrated growth and developmental process in this resilient crop. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  19. RNA-sequencing analysis reveals abundant developmental stage-specific and immunity-related genes in the pollen beetle Meligethes aeneus.

    PubMed

    Vogel, H; Badapanda, C; Knorr, E; Vilcinskas, A

    2014-02-01

    The pollen beetle (Meligethes aeneus) is a major pest of oilseed rape (Brassica napus) and other cruciferous crops in Europe. Pesticide-resistant pollen beetle populations are emerging, increasing the economic impact of this species. We isolated total RNA from the larval and adult stages, the latter either naïve or immunized by injection with bacteria and yeast. High-throughput RNA sequencing (RNA-Seq) was carried out to establish a comprehensive transcriptome catalogue and to screen for developmental stage-specific and immunity-related transcripts. We assembled the transcriptome de novo by combining sequence tags from all developmental stages and treatments. Gene expression data based on normalized read counts revealed several functional gene categories that were differentially expressed between larvae and adults, particularly genes associated with digestion and detoxification that were induced in larvae, and genes associated with reproduction and environmental signalling that were induced in adults. We also identified many genes associated with microbe recognition, immunity-related signalling and defence effectors, such as antimicrobial peptides (AMPs) and lysozymes. Digital gene expression analysis revealed significant differences in the profile of AMPs expressed in larvae, naïve adults and immune-challenged adults, providing insight into the steady-state differences between developmental stages and the complex transcriptional remodelling that occurs following the induction of immunity. Our data provide insight into the adaptive mechanisms used by phytophagous insects and could lead to the development of more effective control strategies for insect pests. © 2013 The Royal Entomological Society.

  20. Endo-β-mannanase and β-tubulin gene expression during the final phases of coffee seed maturation.

    PubMed

    Santos, F C; Clemente, A C S; Caixeta, F; Rosa, S D V F

    2015-10-02

    Coffee seeds begin to develop shortly after fertilization and can take 6 to 8 months to complete their formation, a period during which all the characteristics of the mature seed are determined, directly influencing physiological quality. However, little is known about the molecular mechanisms that act during coffee seed maturation. The objective of the current study was to analyze expression of the β-tubulin (TUB) and endo-β-mannanase (MAN) genes during different phases at the end of development and in different tissues of Coffea arabica seeds. The transcription levels of the TUB and MAN genes were quantified in a relative manner using qRT-PCR in whole seeds, and dissected into embryos and endosperms at different developmental stages. Greater expression of MAN was observed in whole seeds and in endosperms during the green stage, and in the embryo during the over-ripe stage. High TUB gene expression was observed in whole seeds during the green stage and, in the embryos, there were peaks in expression during the over-ripe stage. In endosperms, the peak of expression occurred in both the green stage and in the cherry stage. These results suggest participation of endo-β-mannanase during the initial seed developmental stages, and in the stages of physiological maturity in the embryo tissues. TUB gene expression varied depending on the developmental stage and section of seed analyzed, indicating the participation of β-tubulin during organogenesis and coffee seed maturation.

  1. Laminar-specific and developmental expression of aquaporin-4 in the mouse hippocampus

    PubMed Central

    Hsu, Mike S.; Seldin, Marcus; Lee, Darrin J.; Seifert, Gerald; Steinhäuser, Christian; Binder, Devin K.

    2011-01-01

    Mice deficient in the water channel AQP4 demonstrate increased seizure duration in response to hippocampal stimulation as well as impaired extracellular K+ clearance. However, the expression of AQP4 in the hippocampus is not well described. In this study, we investigated i) the developmental, laminar and cell-type specificity of AQP4 expression in the hippocampus; ii) the effect of Kir4.1 deletion on AQP4 expression; and iii) performed Western blot and RT-PCR analyses. AQP4 immunohistochemistry on coronal sections from WT or Kir4.1-/- mice revealed a developmentally-regulated and laminar-specific pattern, with highest expression in the CA1 stratum lacunosummoleculare (SLM) and the molecular layer (ML) of the dentate gyrus (DG). AQP4 was colocalized with the glial markers GFAP and S100ß in the hippocampus, and was also ubiquitously expressed on astrocytic endfeet around blood vessels. No difference in AQP4 immunoreactivity was observed in Kir4.1-/- mice. Electrophysiological and postrecording RT-PCR analyses of individual cells revealed that AQP4 and Kir4.1 were co-expressed in nearly all CA1 astrocytes. In NG2 cells, AQP4 was also expressed at the transcript level. This study is the first to examine subregional AQP4 expression during development of the hippocampus. The strikingly high expression of AQP4 in the CA1 SLM and DG ML identifies these regions as potential sites of astrocytic K+ and H2O regulation. These results begin to delineate the functional capabilities of hippocampal subregions and cell types for K+ and H2O homeostasis, which is critical to excitability and serves as a potential target for modulation in diverse diseases. PMID:21256195

  2. Developmental pattern of diacylglycerol lipase-α (DAGLα) immunoreactivity in brain regions important for song learning and control in the zebra finch (Taeniopygia guttata).

    PubMed

    Soderstrom, Ken; Wilson, Ashley R

    2013-11-01

    Zebra finch song is a learned behavior dependent upon successful progress through a sensitive period of late-postnatal development. This learning is associated with maturation of distinct brain nuclei and the fiber tract interconnections between them. We have previously found remarkably distinct and dense CB1 cannabinoid receptor expression within many of these song control brain regions, implying a normal role for endocannabinoid signaling in vocal learning. Activation of CB1 receptors via daily treatments with exogenous agonist during sensorimotor stages of song learning (but not in adulthood) results in persistent alteration of song patterns. Now we are working to understand physiological changes responsible for this cannabinoid-altered vocal learning. We have found that song-altering developmental treatments are associated with changes in expression of endocannabinoid signaling elements, including CB1 receptors and the principal CNS endogenous agonist, 2-AG. Within CNS, 2-AG is produced largely through activity of the α isoform of the enzyme diacylglycerol lipase (DAGLα). To better appreciate the role of 2-AG production in normal vocal development we have determined the spatial distribution of DAGLα expression within zebra finch CNS during vocal development. Early during vocal development at 25 days, DAGLα staining is typically light and of fibroid processes. Staining peaks late in the sensorimotor stage of song learning at 75 days and is characterized by fiber, neuropil and some staining of both small and large cell somata. Results provide insight to the normal role for endocannabinoid signaling in the maturation of brain regions responsible for song learning and vocal-motor output, and suggest mechanisms by which exogenous cannabinoid exposure alters acquisition of this form of vocal communication. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. Distributional shift of urea production site from the extraembryonic yolk sac membrane to the embryonic liver during the development of cloudy catshark (Scyliorhinus torazame).

    PubMed

    Takagi, Wataru; Kajimura, Makiko; Tanaka, Hironori; Hasegawa, Kumi; Ogawa, Shuntaro; Hyodo, Susumu

    2017-09-01

    Urea is an essential osmolyte for marine cartilaginous fishes. Adult elasmobranchs and holocephalans are known to actively produce urea in the liver, muscle and other extrahepatic organs; however, osmoregulatory mechanisms in the developing cartilaginous fish embryo with an undeveloped urea-producing organ are poorly understood. We recently described the contribution of extraembryonic yolk sac membranes (YSM) to embryonic urea synthesis during the early developmental period of the oviparous holocephalan elephant fish (Callorhinchus milii). In the present study, to test whether urea production in the YSM is a general phenomenon among oviparous Chondrichthyes, we investigated gene expression and activities of ornithine urea cycle (OUC) enzymes together with urea concentrations in embryos of the elasmobranch cloudy catshark (Scyliorhinus torazame). The intracapsular fluid, in which the catshark embryo develops, had a similar osmolality to seawater, and embryos maintained a high concentration of urea at levels similar to that of adult plasma throughout development. Relative mRNA expressions and activities of catshark OUC enzymes were significantly higher in YSM than in embryos until stage 32. Concomitant with the development of the embryonic liver, the expression levels and activities of OUC enzymes were markedly increased in the embryo from stage 33, while those of the YSM decreased from stage 32. The present study provides further evidence that the YSM contributes to embryonic urea homeostasis until the liver and other extrahepatic organs become fully functional, and that urea-producing tissue shifts from the YSM to the embryonic liver in the late developmental period of oviparous marine cartilaginous fishes. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Diverse Developmental Disorders from The One Ring: Distinct Molecular Pathways Underlie the Cohesinopathies

    PubMed Central

    Horsfield, Julia A.; Print, Cristin G.; Mönnich, Maren

    2012-01-01

    The multi-subunit protein complex, cohesin, is responsible for sister chromatid cohesion during cell division. The interaction of cohesin with DNA is controlled by a number of additional regulatory proteins. Mutations in cohesin, or its regulators, cause a spectrum of human developmental syndromes known as the “cohesinopathies.” Cohesinopathy disorders include Cornelia de Lange Syndrome and Roberts Syndrome. The discovery of novel roles for chromatid cohesion proteins in regulating gene expression led to the idea that cohesinopathies are caused by dysregulation of multiple genes downstream of mutations in cohesion proteins. Consistent with this idea, Drosophila, mouse, and zebrafish cohesinopathy models all show altered expression of developmental genes. However, there appears to be incomplete overlap among dysregulated genes downstream of mutations in different components of the cohesion apparatus. This is surprising because mutations in all cohesion proteins would be predicted to affect cohesin’s roles in cell division and gene expression in similar ways. Here we review the differences and similarities between genetic pathways downstream of components of the cohesion apparatus, and discuss how such differences might arise, and contribute to the spectrum of cohesinopathy disorders. We propose that mutations in different elements of the cohesion apparatus have distinct developmental outcomes that can be explained by sometimes subtly different molecular effects. PMID:22988450

  5. Autism Symptomatology in Boys with Fragile X Syndrome: A Cross Sectional Developmental Trajectories Comparison with Nonsyndromic Autism Spectrum Disorder

    PubMed Central

    Thurman, Angela John; McDuffie, Andrea; Kover, Sara T.; Hagerman, Randi J.; Abbeduto, Leonard

    2015-01-01

    Although males with fragile X syndrome (FXS) are frequently described as demonstrating autism symptomatology, there is much debate regarding whether the behavioral symptoms representing the core domains of autism are the result of the same or different underlying neurological/psychological mechanisms. The present study used a cross-sectional developmental trajectories approach to compare the profiles of autism symptomatology relative to chronological age (CA), nonverbal IQ, and expressive vocabulary ability between individuals with FXS and individuals with nonsyndromic ASD. Results suggest that the onset of autism symptoms and their developmental trajectories in males with FXS differ in important ways as a function of chronological age, nonverbal cognitive ability, and expressive vocabulary relative to males with nonsyndromic ASD. Theoretical and clinical implications are discussed. PMID:25904201

  6. PM2.5-bound metal metabolic distribution and coupled lipid abnormality at different developmental windows.

    PubMed

    Ku, Tingting; Zhang, Yingying; Ji, Xiaotong; Li, Guangke; Sang, Nan

    2017-09-01

    Atmospheric fine particulate matter (PM 2.5 ) is a serious threat to human health. As a toxicant constituent, metal leads to significant health risks in a population, but exposure to PM 2.5 -bound metals and their biological impacts are not fully understood. In this study, we determined the metal contents of PM 2.5 samples collected from a typical coal-burning city and then investigated the metabolic distributions of six metals (Zn, Pb, Mn, As, Cu, and Cd) following PM 2.5 inhalation in mice in different developmental windows. The results indicate that fine particles were mainly deposited in the lung, but PM 2.5 -bound metals could reach and gather in secondary off-target tissues (the lung, liver, heart and brain) with a developmental window-dependent property. Furthermore, elevations in triglycerides and cholesterol levels in sensitive developmental windows (the young and elderly stages) occurred, and significant associations between metals (Pb, Mn, As and Cd) and cholesterol in the heart, brain, liver and lung were observed. These findings suggest that PM 2.5 inhalation caused selective metal metabolic distribution in tissues with a developmental window-dependent property and that the effects were associated with lipid alterations. This provides a foundation for the underlying systemic toxicity following PM 2.5 exposure based on metal components. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Detection of Patient Subgroups with Differential Expression in Omics Data: A Comprehensive Comparison of Univariate Measures

    PubMed Central

    Ahrens, Maike; Turewicz, Michael; Casjens, Swaantje; May, Caroline; Pesch, Beate; Stephan, Christian; Woitalla, Dirk; Gold, Ralf; Brüning, Thomas; Meyer, Helmut E.

    2013-01-01

    Detection of yet unknown subgroups showing differential gene or protein expression is a frequent goal in the analysis of modern molecular data. Applications range from cancer biology over developmental biology to toxicology. Often a control and an experimental group are compared, and subgroups can be characterized by differential expression for only a subgroup-specific set of genes or proteins. Finding such genes and corresponding patient subgroups can help in understanding pathological pathways, diagnosis and defining drug targets. The size of the subgroup and the type of differential expression determine the optimal strategy for subgroup identification. To date, commonly used software packages hardly provide statistical tests and methods for the detection of such subgroups. Different univariate methods for subgroup detection are characterized and compared, both on simulated and on real data. We present an advanced design for simulation studies: Data is simulated under different distributional assumptions for the expression of the subgroup, and performance results are compared against theoretical upper bounds. For each distribution, different degrees of deviation from the majority of observations are considered for the subgroup. We evaluate classical approaches as well as various new suggestions in the context of omics data, including outlier sum, PADGE, and kurtosis. We also propose the new FisherSum score. ROC curve analysis and AUC values are used to quantify the ability of the methods to distinguish between genes or proteins with and without certain subgroup patterns. In general, FisherSum for small subgroups and -test for large subgroups achieve best results. We apply each method to a case-control study on Parkinson's disease and underline the biological benefit of the new method. PMID:24278130

  8. CDKL5 expression is modulated during neuronal development and its subcellular distribution is tightly regulated by the C-terminal tail.

    PubMed

    Rusconi, Laura; Salvatoni, Lisa; Giudici, Laura; Bertani, Ilaria; Kilstrup-Nielsen, Charlotte; Broccoli, Vania; Landsberger, Nicoletta

    2008-10-31

    Mutations in the human X-linked cyclin-dependent kinase-like 5 (CDKL5) gene have been identified in patients with Rett syndrome (RTT), West syndrome, and X-linked infantile spasms, sharing the common feature of mental retardation and early seizures. CDKL5 is a rather uncharacterized kinase, but its involvement in RTT seems to be explained by the fact that it works upstream of MeCP2, the main cause of Rett syndrome. To understand the role of this kinase for nervous system functions and to address if molecular mechanisms are involved in regulating its distribution and activity, we studied the ontogeny of CDKL5 expression in developing mouse brains by immunostaining and Western blotting. The expression profile of CDKL5 was compared with that of MeCP2. The two proteins share a general expression profile in the adult mouse brain, but CDKL5 levels appear to be highly modulated at the regional level. Its expression is strongly induced in early postnatal stages, and in the adult brain CDKL5 is present in mature neurons, but not in astroglia. Interestingly, the presence of CDKL5 in the cell nucleus varies at the regional level of the adult brain and is developmentally regulated. CDKL5 shuttles between the cytoplasm and the nucleus and the C-terminal tail is involved in localizing the protein to the cytoplasm in a mechanism depending on active nuclear export. Accordingly, Rett derivatives containing disease-causing truncations of the C terminus are constitutively nuclear, suggesting that they might act as gain of function mutations in this cellular compartment.

  9. Sperm protection in the male reproductive tract by Toll-like receptors.

    PubMed

    Saeidi, S; Shapouri, F; Amirchaghmaghi, E; Hoseinifar, H; Sabbaghian, M; Sadighi Gilani, M A; Pacey, A A; Aflatoonian, R

    2014-09-01

    Sperm function can be affected by infection. Our understanding of innate immune system molecular mechanisms has been expanded, by the discovery of 'Toll-like receptors' (TLRs). It seems that these receptors could play a critical role in the protection of spermatozoa. This study seeks to examine the presence and distribution of TLRs in different parts of the human male reproductive tract and spermatozoa. So, TLR gene expression was examined by RT-PCR. Quantitative real-time PCR (Q-PCR) analysis used to compare the expression of TLRs in all sections of the male reproductive tract and TLRs 2, 3 and 4 in testicular sperm extraction (TESE) samples, which contained spermatozoa (TESE+) and those that did not (TESE-). Results showed that all TLR genes were expressed in different parts of the human male reproductive tract and spermatozoa. Moreover, Q-PCR indicated that the relative expression of TLRs did not significantly change in different parts of the male reproductive tract but this technique has shown only relative TLR2 expression in TESE- is lower than TESE+ samples. It could be concluded that TLRs may provide a broad spectrum of protection from infection in the male reproductive tract. Furthermore, TLRs may influence on the developmental process during spermatogenesis. © 2013 Blackwell Verlag GmbH.

  10. Genomic and transcriptomic insights into the cytochrome P450 monooxygenase gene repertoire in the rice pest brown planthopper, Nilaparvata lugens.

    PubMed

    Lao, Shu-Hua; Huang, Xiao-Hui; Huang, Hai-Jian; Liu, Cheng-Wen; Zhang, Chuan-Xi; Bao, Yan-Yuan

    2015-11-01

    The cytochrome P450 monooxygenase (P450) gene family is one of the most abundant eukaryotic gene families that encode detoxification enzymes. In this study, we identified an abundance of P450 gene repertoire through genome- and transcriptome-wide analysis in the brown planthopper (Nilaparvata lugens), the most destructive rice pest in Asia. Detailed gene information including the exon-intron organization, size, transcription orientation and distribution in the genome revealed that many P450 loci were closely situated on the same scaffold, indicating frequent occurrence of gene duplications. Insecticide-response expression profiling revealed that imidacloprid significantly increased NlCYP6CS1v2, NLCYP4CE1v2, NlCYP4DE1, NlCYP417A1v2 and NlCYP439A1 expression; while triazophos and deltamethrin notably enhanced NlCYP303A1 expression. Expression analysis at the developmental stage showed the egg-, nymph-, male- and female-specific expression patterns of N. lugens P450 genes. These novel findings will be helpful for clarifying the P450 functions in physiological processes including development, reproduction and insecticide resistance in this insect species. Copyright © 2015 Elsevier Inc. All rights reserved.

  11. Identification of appropriate reference genes for normalizing transcript expression by quantitative real-time PCR in Litsea cubeba.

    PubMed

    Lin, Liyuan; Han, Xiaojiao; Chen, Yicun; Wu, Qingke; Wang, Yangdong

    2013-12-01

    Quantitative real-time PCR has emerged as a highly sensitive and widely used method for detection of gene expression profiles, via which accurate detection depends on reliable normalization. Since no single control is appropriate for all experimental treatments, it is generally advocated to select suitable internal controls prior to use for normalization. This study reported the evaluation of the expression stability of twelve potential reference genes in different tissue/organs and six fruit developmental stages of Litsea cubeba in order to screen the superior internal reference genes for data normalization. Two softwares-geNorm, and NormFinder-were used to identify stability of these candidate genes. The cycle threshold difference and coefficient of variance were also calculated to evaluate the expression stability of candidate genes. F-BOX, EF1α, UBC, and TUA were selected as the most stable reference genes across 11 sample pools. F-BOX, EF1α, and EIF4α exhibited the highest expression stability in different tissue/organs and different fruit developmental stages. Besides, a combination of two stable reference genes would be sufficient for gene expression normalization in different fruit developmental stages. In addition, the relative expression profiles of DXS and DXR were evaluated by EF1α, UBC, and SAMDC. The results further validated the reliability of stable reference genes and also highlighted the importance of selecting suitable internal controls for L. cubeba. These reference genes will be of great importance for transcript normalization in future gene expression studies on L. cubeba.

  12. Analysis of global gene expression profiles to identify differentially expressed genes critical for embryo development in Brassica rapa.

    PubMed

    Zhang, Yu; Peng, Lifang; Wu, Ya; Shen, Yanyue; Wu, Xiaoming; Wang, Jianbo

    2014-11-01

    Embryo development represents a crucial developmental period in the life cycle of flowering plants. To gain insights into the genetic programs that control embryo development in Brassica rapa L., RNA sequencing technology was used to perform transcriptome profiling analysis of B. rapa developing embryos. The results generated 42,906,229 sequence reads aligned with 32,941 genes. In total, 27,760, 28,871, 28,384, and 25,653 genes were identified from embryos at globular, heart, early cotyledon, and mature developmental stages, respectively, and analysis between stages revealed a subset of stage-specific genes. We next investigated 9,884 differentially expressed genes with more than fivefold changes in expression and false discovery rate ≤ 0.001 from three adjacent-stage comparisons; 1,514, 3,831, and 6,633 genes were detected between globular and heart stage embryo libraries, heart stage and early cotyledon stage, and early cotyledon and mature stage, respectively. Large numbers of genes related to cellular process, metabolism process, response to stimulus, and biological process were expressed during the early and middle stages of embryo development. Fatty acid biosynthesis, biosynthesis of secondary metabolites, and photosynthesis-related genes were expressed predominantly in embryos at the middle stage. Genes for lipid metabolism and storage proteins were highly expressed in the middle and late stages of embryo development. We also identified 911 transcription factor genes that show differential expression across embryo developmental stages. These results increase our understanding of the complex molecular and cellular events during embryo development in B. rapa and provide a foundation for future studies on other oilseed crops.

  13. Similarities in temperature-dependent gene expression plasticity across timescales in threespine stickleback (Gasterosteus aculeatus).

    PubMed

    Metzger, David C H; Schulte, Patricia M

    2018-04-14

    Phenotypic plasticity occurs at a variety of timescales, but little is known about the degree to which plastic responses at different timescales are associated with similar underlying molecular processes, which is critical for assessing the effects of plasticity on evolutionary trajectories. To address this issue, we identified differential gene expression in response to developmental temperature in the muscle transcriptome of adult threespine stickleback (Gasterosteus aculeatus) exposed to 12, 18 and 24°C until hatch and then held at 18°C for 9 months and compared these results to differential gene expression in response to adult thermal acclimation in stickleback developed at 18°C and then acclimated to 5 and 25°C as adults. Adult thermal acclimation affected the expression of 7,940 and 7,015 genes in response to cold and warm acclimation, respectively, and 4,851 of these genes responded in both treatments. In contrast, the expression of only 33 and 29 genes was affected by cold and warm development, respectively. The majority of the genes affected by developmental temperature were also affected by adult acclimation temperature. Many genes that were differentially expressed as a result of adult acclimation were associated with previously identified temperature-dependent effects on DNA methylation patterns, suggesting a role of epigenetic mechanisms in regulating gene expression plasticity during acclimation. Taken together, these results demonstrate similarities between the persistent effects of developmental plasticity on gene expression and the effects of adult thermal acclimation, emphasizing the potential for mechanistic links between plasticity acting at these different life stages. © 2018 John Wiley & Sons Ltd.

  14. Newborn Mouse Lens Proteome and Its Alteration by Lysine 6 Mutant Ubiquitin

    PubMed Central

    2015-01-01

    Ubiquitin is a tag that often initiates degradation of proteins by the proteasome in the ubiquitin proteasome system. Targeted expression of K6W mutant ubiquitin (K6W-Ub) in the lens results in defects in lens development and cataract formation, suggesting critical functions for ubiquitin in lens. To study the developmental processes that require intact ubiquitin, we executed the most extensive characterization of the lens proteome to date. We quantified lens protein expression changes in multiple replicate pools of P1 wild-type and K6W-Ub-expressing mouse lenses. Lens proteins were digested with trypsin, peptides were separated using strong cation exchange and reversed-phase liquid chromatography, and tandem mass (MS/MS) spectra were collected with a linear ion trap. Transgenic mice that expressed low levels of K6W-Ub (low expressers) had normal, clear lenses at birth, whereas the lenses that expressed high levels of K6W-Ub (higher expressers) had abnormal lenses and cataracts at birth. A total of 2052 proteins were identified, of which 996 were reliably quantified and compared between wild-type and K6W-Ub transgenic mice. Consistent with a delayed developmental program, fiber-cell-specific proteins, such as γ-crystallins (γA, γB, γC, and γE), were down-regulated in K6W-Ub higher expressers. Up-regulated proteins were involved in energy metabolism, signal transduction, and proteolysis. The K6W-Ub low expressers exhibited delayed onset and milder cataract consistent with smaller changes in protein expression. Because lens protein expression changes occurred prior to lens morphological abnormalities and cataract formation in K6W-Ub low expressers, it appears that expression of K6W-Ub sets in motion a process of altered protein expression that results in developmental defects and cataract. PMID:24450463

  15. Transcriptional profiling of immune-related genes in Pacific white shrimp (Litopenaeus vannamei) during ontogenesis.

    PubMed

    Quispe, Ruth L; Justino, Emily B; Vieira, Felipe N; Jaramillo, Michael L; Rosa, Rafael D; Perazzolo, Luciane M

    2016-11-01

    We have performed here a gene expression analysis to determine the developmental stage at the main genes involved in crustacean immune response begin to be expressed and their changes in mRNA abundance during shrimp development. By using a quantitative PCR-based approach, we have measured the mRNA abundance of 24 immune-related genes from different functional categories in twelve developmental stages ranging from fertilized eggs to larval and postlarval stages and also in juveniles. We showed for the first time that the main genes from the RNAi-based post-transcriptional pathway involved in shrimp antiviral immunity are transcribed in all developmental stages, but exhibit a diverse pattern of gene expression during shrimp ontogenesis. On the other hand, hemocyte-expressed genes mainly involved in antimicrobial defenses appeared to be transcribed in larval stages, indicating that hematopoiesis initiates early in development. Moreover, transcript levels of some genes were early detected in fertilized eggs at 0-4 h post-spawning, suggesting a maternal contribution of immune-related transcripts to shrimp progeny. Altogether, our results provide important clues regarding the ontogenesis of hemocytes as well the establishment of antiviral and antimicrobial defenses in shrimp. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Serial analysis of gene expression in the silkworm, Bombyx mori.

    PubMed

    Huang, Jianhua; Miao, Xuexia; Jin, Weirong; Couble, Pierre; Mita, Kasuei; Zhang, Yong; Liu, Wenbin; Zhuang, Leijun; Shen, Yan; Keime, Celine; Gandrillon, Olivier; Brouilly, Patrick; Briolay, Jerome; Zhao, Guoping; Huang, Yongping

    2005-08-01

    The silkworm Bombyx mori is one of the most economically important insects and serves as a model for Lepidoptera insects. We used serial analysis of gene expression (SAGE) to derive profiles of expressed genes during the developmental life cycle of the silkworm and to create a reference for understanding silkworm metamorphosis. We generated four SAGE libraries, one from each of the four developmental stages of the silkworm. In total we obtained 257,964 SAGE tags, of which 39,485 were unique tags. Sorted by copy number, 14.1% of the unique tags were detected at a median to high level (five or more copies), 24.2% at lower levels (two to four copies), and 61.7% as single copies. Using a basic local alignment search tool on the EST database, 35% of the tags matched known silkworm expressed sequence tags. SAGE demonstrated that a number of the genes were up- or down-regulated during the four developmental phases of the egg, larva, pupa, and adult. Furthermore, we found that the generation of longer cDNA fragments from SAGE tags constituted the most efficient method of gene identification, which facilitated the analysis of a large number of unknown genes.

  17. Exposure to Parents' Negative Emotions as a Developmental Pathway to the Family Aggregation of Depression and Anxiety in the First Year of Life.

    PubMed

    Aktar, Evin; Bögels, Susan M

    2017-12-01

    Depression and anxiety load in families. In the present study, we focus on exposure to parental negative emotions in first postnatal year as a developmental pathway to early parent-to-child transmission of depression and anxiety. We provide an overview of the little research available on the links between infants' exposure to negative emotion and infants' emotional development in this developmentally sensitive period, and highlight priorities for future research. To address continuity between normative and maladaptive development, we discuss exposure to parental negative emotions in infants of parents with as well as without depression and/or anxiety diagnoses. We focus on infants' emotional expressions in everyday parent-infant interactions, and on infants' attention to negative facial expressions as early indices of emotional development. Available evidence suggests that infants' emotional expressions echo parents' expressions and reactions in everyday interactions. In turn, infants exposed more to negative emotions from the parent seem to attend less to negative emotions in others' facial expressions. The links between exposure to parental negative emotion and development hold similarly in infants of parents with and without depression and/or anxiety diagnoses. Given its potential links to infants' emotional development, and to later psychological outcomes in children of parents with depression and anxiety, we conclude that early exposure to parental negative emotions is an important developmental mechanism that awaits further research. Longitudinal designs that incorporate the study of early exposure to parents' negative emotion, socio-emotional development in infancy, and later psychological functioning while considering other genetic and biological vulnerabilities should be prioritized in future research.

  18. Dynamic Proteomic Characteristics and Network Integration Revealing Key Proteins for Two Kernel Tissue Developments in Popcorn.

    PubMed

    Dong, Yongbin; Wang, Qilei; Zhang, Long; Du, Chunguang; Xiong, Wenwei; Chen, Xinjian; Deng, Fei; Ma, Zhiyan; Qiao, Dahe; Hu, Chunhui; Ren, Yangliu; Li, Yuling

    2015-01-01

    The formation and development of maize kernel is a complex dynamic physiological and biochemical process that involves the temporal and spatial expression of many proteins and the regulation of metabolic pathways. In this study, the protein profiles of the endosperm and pericarp at three important developmental stages were analyzed by isobaric tags for relative and absolute quantification (iTRAQ) labeling coupled with LC-MS/MS in popcorn inbred N04. Comparative quantitative proteomic analyses among developmental stages and between tissues were performed, and the protein networks were integrated. A total of 6,876 proteins were identified, of which 1,396 were nonredundant. Specific proteins and different expression patterns were observed across developmental stages and tissues. The functional annotation of the identified proteins revealed the importance of metabolic and cellular processes, and binding and catalytic activities for the development of the tissues. The whole, endosperm-specific and pericarp-specific protein networks integrated 125, 9 and 77 proteins, respectively, which were involved in 54 KEGG pathways and reflected their complex metabolic interactions. Confirmation for the iTRAQ endosperm proteins by two-dimensional gel electrophoresis showed that 44.44% proteins were commonly found. However, the concordance between mRNA level and the protein abundance varied across different proteins, stages, tissues and inbred lines, according to the gene cloning and expression analyses of four relevant proteins with important functions and different expression levels. But the result by western blot showed their same expression tendency for the four proteins as by iTRAQ. These results could provide new insights into the developmental mechanisms of endosperm and pericarp, and grain formation in maize.

  19. Dynamic Proteomic Characteristics and Network Integration Revealing Key Proteins for Two Kernel Tissue Developments in Popcorn

    PubMed Central

    Du, Chunguang; Xiong, Wenwei; Chen, Xinjian; Deng, Fei; Ma, Zhiyan; Qiao, Dahe; Hu, Chunhui; Ren, Yangliu; Li, Yuling

    2015-01-01

    The formation and development of maize kernel is a complex dynamic physiological and biochemical process that involves the temporal and spatial expression of many proteins and the regulation of metabolic pathways. In this study, the protein profiles of the endosperm and pericarp at three important developmental stages were analyzed by isobaric tags for relative and absolute quantification (iTRAQ) labeling coupled with LC-MS/MS in popcorn inbred N04. Comparative quantitative proteomic analyses among developmental stages and between tissues were performed, and the protein networks were integrated. A total of 6,876 proteins were identified, of which 1,396 were nonredundant. Specific proteins and different expression patterns were observed across developmental stages and tissues. The functional annotation of the identified proteins revealed the importance of metabolic and cellular processes, and binding and catalytic activities for the development of the tissues. The whole, endosperm-specific and pericarp-specific protein networks integrated 125, 9 and 77 proteins, respectively, which were involved in 54 KEGG pathways and reflected their complex metabolic interactions. Confirmation for the iTRAQ endosperm proteins by two-dimensional gel electrophoresis showed that 44.44% proteins were commonly found. However, the concordance between mRNA level and the protein abundance varied across different proteins, stages, tissues and inbred lines, according to the gene cloning and expression analyses of four relevant proteins with important functions and different expression levels. But the result by western blot showed their same expression tendency for the four proteins as by iTRAQ. These results could provide new insights into the developmental mechanisms of endosperm and pericarp, and grain formation in maize. PMID:26587848

  20. Whole-Genome Analysis of the SHORT-ROOT Developmental Pathway in Arabidopsis

    PubMed Central

    Busch, Wolfgang; Cui, Hongchang; Wang, Jean Y; Blilou, Ikram; Hassan, Hala; Nakajima, Keiji; Matsumoto, Noritaka; Lohmann, Jan U; Scheres, Ben

    2006-01-01

    Stem cell function during organogenesis is a key issue in developmental biology. The transcription factor SHORT-ROOT (SHR) is a critical component in a developmental pathway regulating both the specification of the root stem cell niche and the differentiation potential of a subset of stem cells in the Arabidopsis root. To obtain a comprehensive view of the SHR pathway, we used a statistical method called meta-analysis to combine the results of several microarray experiments measuring the changes in global expression profiles after modulating SHR activity. Meta-analysis was first used to identify the direct targets of SHR by combining results from an inducible form of SHR driven by its endogenous promoter, ectopic expression, followed by cell sorting and comparisons of mutant to wild-type roots. Eight putative direct targets of SHR were identified, all with expression patterns encompassing subsets of the native SHR expression domain. Further evidence for direct regulation by SHR came from binding of SHR in vivo to the promoter regions of four of the eight putative targets. A new role for SHR in the vascular cylinder was predicted from the expression pattern of several direct targets and confirmed with independent markers. The meta-analysis approach was then used to perform a global survey of the SHR indirect targets. Our analysis suggests that the SHR pathway regulates root development not only through a large transcription regulatory network but also through hormonal pathways and signaling pathways using receptor-like kinases. Taken together, our results not only identify the first nodes in the SHR pathway and a new function for SHR in the development of the vascular tissue but also reveal the global architecture of this developmental pathway. PMID:16640459

  1. Reactivation of larval keratin gene (krt62.L) in blastema epithelium during Xenopus froglet limb regeneration.

    PubMed

    Satoh, Akira; Mitogawa, Kazumasa; Saito, Nanami; Suzuki, Miyuki; Suzuki, Ken-Ichi T; Ochi, Haruki; Makanae, Aki

    2017-12-15

    Limb regeneration is considered a form of limb redevelopment because of the molecular and morphological similarities. Forming a regeneration blastema is, in essence, creating a developing limb bud in an adult body. This reactivation of a developmental process in a mature body is worth studying. Xenopus laevis has a biphasic life cycle that involves distinct larval and adult stages. These distinct developmental stages are useful for investigating the reactivation of developmental processes in post-metamorphic frogs (froglets). In this study, we focused on the re-expression of a larval gene (krt62.L) during Xenopus froglet limb regeneration. Recently renamed krt62.L, this gene was known as the larval keratin (xlk) gene, which is specific to larval-tadpole stages. During limb regeneration in a froglet, krt62.L was re-expressed in a basal layer of blastema epithelium, where adult-specific keratin (Krt12.6.S) expression was also observable. Nerves produce important regulatory factors for amphibian limb regeneration, and also play a role in blastema formation and maintenance. The effect of nerve function on krt62.L expression could be seen in the maintenance of krt62.L expression, but not in its induction. When an epidermis-stripped limb bud was grafted in a froglet blastema, the grafted limb bud could reach the digit-forming stage. This suggests that krt62.L-positive froglet blastema epithelium is able to support the limb development process. These findings imply that the developmental process is locally reactivated in an postmetamorphic body during limb regeneration. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  2. Systems biology of embryonic development: Prospects for a complete understanding of the Caenorhabditis elegans embryo.

    PubMed

    Murray, John Isaac

    2018-05-01

    The convergence of developmental biology and modern genomics tools brings the potential for a comprehensive understanding of developmental systems. This is especially true for the Caenorhabditis elegans embryo because its small size, invariant developmental lineage, and powerful genetic and genomic tools provide the prospect of a cellular resolution understanding of messenger RNA (mRNA) expression and regulation across the organism. We describe here how a systems biology framework might allow large-scale determination of the embryonic regulatory relationships encoded in the C. elegans genome. This framework consists of two broad steps: (a) defining the "parts list"-all genes expressed in all cells at each time during development and (b) iterative steps of computational modeling and refinement of these models by experimental perturbation. Substantial progress has been made towards defining the parts list through imaging methods such as large-scale green fluorescent protein (GFP) reporter analysis. Imaging results are now being augmented by high-resolution transcriptome methods such as single-cell RNA sequencing, and it is likely the complete expression patterns of all genes across the embryo will be known within the next few years. In contrast, the modeling and perturbation experiments performed so far have focused largely on individual cell types or genes, and improved methods will be needed to expand them to the full genome and organism. This emerging comprehensive map of embryonic expression and regulatory function will provide a powerful resource for developmental biologists, and would also allow scientists to ask questions not accessible without a comprehensive picture. This article is categorized under: Invertebrate Organogenesis > Worms Technologies > Analysis of the Transcriptome Gene Expression and Transcriptional Hierarchies > Gene Networks and Genomics. © 2018 Wiley Periodicals, Inc.

  3. Serotonin Receptor 6 Mediates Defective Brain Development in Monoamine Oxidase A-deficient Mouse Embryos

    PubMed Central

    Wang, Chi Chiu; Man, Gene Chi Wai; Chu, Ching Yan; Borchert, Astrid; Ugun-Klusek, Aslihan; Billett, E. Ellen; Kühn, Hartmut; Ufer, Christoph

    2014-01-01

    Monoamine oxidases A and B (MAO-A and MAO-B) are enzymes of the outer mitochondrial membrane that metabolize biogenic amines. In the adult central nervous system, MAOs have important functions for neurotransmitter homeostasis. Expression of MAO isoforms has been detected in the developing embryo. However, suppression of MAO-B does not induce developmental alterations. In contrast, targeted inhibition and knockdown of MAO-A expression (E7.5–E10.5) caused structural abnormalities in the brain. Here we explored the molecular mechanisms underlying defective brain development induced by MAO-A knockdown during in vitro embryogenesis. The developmental alterations were paralleled by diminished apoptotic activity in the affected neuronal structures. Moreover, dysfunctional MAO-A expression led to elevated levels of embryonic serotonin (5-hydroxytryptamine (5-HT)), and we found that knockdown of serotonin receptor-6 (5-Htr6) expression or pharmacologic inhibition of 5-Htr6 activity rescued the MAO-A knockdown phenotype and restored apoptotic activity in the developing brain. Our data suggest that excessive 5-Htr6 activation reduces activation of caspase-3 and -9 of the intrinsic apoptotic pathway and enhances expression of antiapoptotic proteins Bcl-2 and Bcl-XL. Moreover, we found that elevated 5-HT levels in MAO-A knockdown embryos coincided with an enhanced activation of extracellular signal-regulated kinase 1/2 (ERK1/2) and a reduction of proliferating cell numbers. In summary, our findings suggest that excessive 5-HT in MAO-A-deficient mouse embryos triggers cellular signaling cascades via 5-Htr6, which suppresses developmental apoptosis in the brain and thus induces developmental retardations. PMID:24497636

  4. Gene expression profiles in the cerebellum and hippocampus following exposure to a neurotoxicant, Aroclor 1254: Developmental effects.

    EPA Science Inventory

    The developmental consequences of exposure to the polychlorinated biphenyls (PCBs) have been widely studied, making PCBs a unique model to understand issues related to environmental mixture of persistent chemicals. PCB exposure in humans adversely affects neurocognitive developm...

  5. Teaching Individuals with Developmental Delays: Basic Intervention Techniques.

    ERIC Educational Resources Information Center

    Lovaas, O. Ivar

    This teaching manual for treatment of children with developmental disabilities is divided into seven sections that address: (1) basic concepts; (2) transition into treatment; (3) early learning concepts; (4) expressive language; (5) strategies for visual learners; (6) programmatic considerations; and (7) organizational and legal issues. Among…

  6. Ascaroside expression in Caenorhabditis elegans is strongly dependent on diet and developmental stage

    USDA-ARS?s Scientific Manuscript database

    A group of small signaling molecules called ascarosides, associated with dauer formation, male attraction and social behavior in the nematode Caenorhabditis elegans, are shown to be regulated by developmental stage and environmental factors. The concentration of dauer-inducing ascaroside, ascr#2, i...

  7. Autistic Features in Young Children with Significant Cognitive Impairment: Autism or Mental Retardation?

    ERIC Educational Resources Information Center

    Vig, Susan; Jedrysek, Eleonora

    1999-01-01

    Examines issues in the differential diagnosis of autism in preschool children with significant cognitive impairment, including the use of traditional diagnostic guidelines for preschoolers with developmental delays, developmental changes in behavioral characteristics, involvement of cognitive factors in symptom expression, overlap between autism…

  8. Commentary.

    ERIC Educational Resources Information Center

    Scarr, Sandra

    1995-01-01

    Argues that Gottlieb rejects population sampling and statistical analyses of distributions as he proposes that his experimental brand of mechanistic science is the only legitimate approach to developmental research. Maintains that Gottlieb exaggerates developmental uncertainty, based on his own research with extreme environmental manipulations.…

  9. Developmental and Spatial Expression of sir2 Genes in the Cellular Slime Mold Dictyostelium discoideum.

    PubMed

    Katayama, Takahiro; Yasukawa, Hiro

    2008-01-01

    The cellular slime mold Dictyostelium discoideum grows as unicellular free-living amoebae in the presence of nutrients. Upon starvation, the amoebae aggregate and form multicellular structures that each consist of a stalk and spores. D. discoideum encodes at least four proteins (Sir2A, Sir2B, Sir2C, and Sir2D) homologous to human SIRT. RT-PCR and WISH analyses showed that the genes for Sir2A, Sir2C, and Sir2D were expressed at high levels in growing cells but at decreased levels in developing cells, whereas the gene encoding Sir2B was expressed in the prestalk-cell region in the developmental phase.

  10. Genome-Wide Classification and Evolutionary and Expression Analyses of Citrus MYB Transcription Factor Families in Sweet Orange

    PubMed Central

    Hou, Xiao-Jin; Li, Si-Bei; Liu, Sheng-Rui; Hu, Chun-Gen; Zhang, Jin-Zhi

    2014-01-01

    MYB family genes are widely distributed in plants and comprise one of the largest transcription factors involved in various developmental processes and defense responses of plants. To date, few MYB genes and little expression profiling have been reported for citrus. Here, we describe and classify 177 members of the sweet orange MYB gene (CsMYB) family in terms of their genomic gene structures and similarity to their putative Arabidopsis orthologs. According to these analyses, these CsMYBs were categorized into four groups (4R-MYB, 3R-MYB, 2R-MYB and 1R-MYB). Gene structure analysis revealed that 1R-MYB genes possess relatively more introns as compared with 2R-MYB genes. Investigation of their chromosomal localizations revealed that these CsMYBs are distributed across nine chromosomes. Sweet orange includes a relatively small number of MYB genes compared with the 198 members in Arabidopsis, presumably due to a paralog reduction related to repetitive sequence insertion into promoter and non-coding transcribed region of the genes. Comparative studies of CsMYBs and Arabidopsis showed that CsMYBs had fewer gene duplication events. Expression analysis revealed that the MYB gene family has a wide expression profile in sweet orange development and plays important roles in development and stress responses. In addition, 337 new putative microsatellites with flanking sequences sufficient for primer design were also identified from the 177 CsMYBs. These results provide a useful reference for the selection of candidate MYB genes for cloning and further functional analysis forcitrus. PMID:25375352

  11. A Rhodium(III) Complex as an Inhibitor of Neural Precursor Cell Expressed, Developmentally Down-Regulated 8-Activating Enzyme with in Vivo Activity against Inflammatory Bowel Disease.

    PubMed

    Zhong, Hai-Jing; Wang, Wanhe; Kang, Tian-Shu; Yan, Hui; Yang, Yali; Xu, Lipeng; Wang, Yuqiang; Ma, Dik-Lung; Leung, Chung-Hang

    2017-01-12

    We report herein the identification of the rhodium(III) complex [Rh(phq) 2 (MOPIP)] + (1) as a potent and selective ATP-competitive neural precursor cell expressed, developmentally down-regulated 8 (NEDD8)-activating enzyme (NAE) inhibitor. Structure-activity relationship analysis indicated that the overall organometallic design of complex 1 was important for anti-inflammatory activity. Complex 1 showed promising anti-inflammatory activity in vivo for the potential treatment of inflammatory bowel disease.

  12. Proteomic Analysis of Fetal Ovary Reveals That Ovarian Developmental Potential Is Greater in Meishan Pigs than in Yorkshire Pigs

    PubMed Central

    Che, Long; Wang, Dingyue; Yang, Zhenguo; Zhang, Pan; Lin, Yan; Fang, Zhengfeng; Che, Lianqiang; Li, Jian; Chen, Daiwen; Wu, De

    2015-01-01

    Time-dependent expression of functional proteins in fetal ovaries is important to understand the developmental process of the ovary. This study was carried out to enhance our understanding of the developmental process of porcine fetal ovaries and to better address the differences in fetal ovary development of local and foreign pigs. The objective of the present study is to test the expression of key proteins that regulate the growth and development of fetal ovaries in Meishan and Yorkshire porcine breeds by using proteomics technology. Six Meishan and 6 Yorkshire pregnant gilts were used in this experiment. Fetal ovaries were obtained from Yorkshire and Meishan gilts on days 55 and 90 of the gestation period. Using 2D-DIGE (two dimensional-difference in gel electrophoresis) analysis, the results showed that there are about 1551 and 1400 proteins in gilt fetal ovaries on days 55 and 90, respectively of the gestation. Using MALDI TOF-TOF MS analysis, 27 differentially expressed proteins were identified in the fetal ovaries of the 2 breeds on day 55 of gestation, and a total of 18 proteins were identified on day 90 of gestation. These differentially expressed proteins were involved in the regulation of biological processes (cell death, stress response, cytoskeletal proteins) and molecular functions (enzyme regulator activity). We also found that alpha-1-antitrypsin, actin, vimentin, and PP2A proteins promote the formation of primordial follicles in the ovaries of Yorkshire pigs on day 55 of gestation while low expression heat shock proteins and high expression alpha-fetoproteins (AFP) may promote Meishan fetal ovarian follicular development on day 90 of gestation. These findings provide a deeper understanding of how reduced expression of heat shock proteins and increased expression of AFP can significantly reduce the risk of reproductive disease in obese Meishan sows. Our study also shows how these proteins can increase the ovulation rate and may be responsible for the low reproductive efficiency reported in other obese breeds. The ovarian developmental potential was found to be greater in Meishan pigs than in Yorkshire pigs. PMID:26305539

  13. Role of paraoxonase (PON1) status in pesticide sensitivity: genetic and temporal determinants.

    PubMed

    Furlong, Clement E; Cole, Toby B; Jarvik, Gail P; Pettan-Brewer, Christina; Geiss, Gary K; Richter, Rebecca J; Shih, Diana M; Tward, Aaron D; Lusis, Aldons J; Costa, Lucio G

    2005-08-01

    Individual differences in detoxication capacities for specific organophosphorous (OP) compounds are due largely to differences in catalytic efficiency or abundance of the HDL-associated enzyme, paraoxonase (PON1). First, we provide evidence that children less than 2 years of age represent a particularly susceptible population for OP exposure due to low abundance of PON1 and variable onset of plasma PON1 activity. Second, we describe studies examining the neurotoxic effects of chronic, low-level OP pesticide exposure in mice. PON1 knockout (PON1(-/-)) and wild-type mice were exposed chronically (PN4 to PN21) to low levels of chlorpyrifos oxon (CPO). Endpoints included cholinesterase activity, histopathology, gene expression, and behavior. Even at PN4, when PON1 levels were low in wild-type mice, PON1(-/-) mice were more sensitive to inhibition of brain cholinesterase by CPO. At PN22, and persisting as long as 4 months, chronic developmental exposure to 0.18 mg/kg/d or 0.25 mg/kg/d CPO resulted in perinuclear vacuolization of cells in a discrete area of the neocortex and irregular distribution of neurons in the cortical plate, with an increase in the number of affected cells at 0.25mg/kg/d. Third, we describe a transgenic mouse model in which human transgenes encoding either hPON1Q192 or hPON1R192 were expressed at equal levels in place of mouse PON1. The developmental onset of expression followed the mouse time course and was identical for the two transgenes, allowing these mice to be used to assess the importance of the Q192R polymorphism during development. Adult mice expressing hPON1R192 were significantly more resistant than hPON1Q192 mice to CPO toxicity. Our studies indicate that children less than 2 years old, especially those homozygous for PON1Q192, would be predicted to be particularly susceptible to CPO toxicity.

  14. Comparative Study of Regulatory Circuits in Two Sea Urchin Species Reveals Tight Control of Timing and High Conservation of Expression Dynamics

    PubMed Central

    Gildor, Tsvia; Ben-Tabou de-Leon, Smadar

    2015-01-01

    Accurate temporal control of gene expression is essential for normal development and must be robust to natural genetic and environmental variation. Studying gene expression variation within and between related species can delineate the level of expression variability that development can tolerate. Here we exploit the comprehensive model of sea urchin gene regulatory networks and generate high-density expression profiles of key regulatory genes of the Mediterranean sea urchin, Paracentrotus lividus (Pl). The high resolution of our studies reveals highly reproducible gene initiation times that have lower variation than those of maximal mRNA levels between different individuals of the same species. This observation supports a threshold behavior of gene activation that is less sensitive to input concentrations. We then compare Mediterranean sea urchin gene expression profiles to those of its Pacific Ocean relative, Strongylocentrotus purpuratus (Sp). These species shared a common ancestor about 40 million years ago and show highly similar embryonic morphologies. Our comparative analyses of five regulatory circuits operating in different embryonic territories reveal a high conservation of the temporal order of gene activation but also some cases of divergence. A linear ratio of 1.3-fold between gene initiation times in Pl and Sp is partially explained by scaling of the developmental rates with temperature. Scaling the developmental rates according to the estimated Sp-Pl ratio and normalizing the expression levels reveals a striking conservation of relative dynamics of gene expression between the species. Overall, our findings demonstrate the ability of biological developmental systems to tightly control the timing of gene activation and relative dynamics and overcome expression noise induced by genetic variation and growth conditions. PMID:26230518

  15. Molecular and functional expression of cation-chloride cotransporters in dorsal root ganglion neurons during postnatal maturation

    PubMed Central

    Mao, Shihong; Garzon-Muvdi, Tomás; Di Fulvio, Mauricio; Chen, Yanfang; Delpire, Eric; Alvarez, Francisco J.

    2012-01-01

    GABA depolarizes and excites central neurons during early development, becoming inhibitory and hyperpolarizing with maturation. This “developmental shift” occurs abruptly, reflecting a decrease in intracellular Cl− concentration ([Cl−]i) and a hyperpolarizing shift in Cl− equilibrium potential due to upregulation of the K+-Cl− cotransporter KCC2b, a neuron-specific Cl− extruder. In contrast, primary afferent neurons (PANs) are depolarized by GABA throughout adulthood because of expression of NKCC1, a Na+-K+-2Cl− cotransporter that accumulates Cl− above equilibrium. The GABAA-mediated depolarization of PANs determines presynaptic inhibition in the spinal cord, a key mechanism gating somatosensory information. Little is known about developmental changes in Cl− transporter expression and Cl− homeostasis in PANs. Whether NKCC1 is expressed in PANs of all phenotypes or is restricted to subpopulations (e.g., nociceptors) is debatable. Likewise, whether PANs express KCC2s is controversial. We investigated NKCC1 and K+-Cl− cotransporter expression in rat and mouse dorsal root ganglion (DRG) neurons with molecular methods. Using fluorescence imaging microscopy, we measured [Cl−]i in acutely dissociated rat DRG neurons (P0–P21) loaded with N-(ethoxycarbonylmethyl)-6-methoxyquinolinium bromide and classified with phenotypic markers. DRG neurons of all sizes express two NKCC1 mRNAs, one full-length and a shorter splice variant lacking exon 21. Immunolabeling with validated antibodies revealed ubiquitous expression of NKCC1 in DRG neurons irrespective of postnatal age and phenotype. As maturation progresses [Cl−]i decreases gradually, persisting above equilibrium in >95% mature neurons. DRG neurons express mRNAs for KCC1, KCC3s, and KCC4, but not for KCC2s. Mechanisms underlying PANs' developmental changes in Cl− homeostasis are discussed and compared with those of central neurons. PMID:22457464

  16. Somitic disruption of GNAS in chick embryos mimics progressive osseous heteroplasia

    PubMed Central

    Cairns, Dana M.; Pignolo, Robert J.; Uchimura, Tomoya; Brennan, Tracy A.; Lindborg, Carter M.; Xu, Meiqi; Kaplan, Frederick S.; Shore, Eileen M.; Zeng, Li

    2013-01-01

    Progressive osseous heteroplasia (POH) is a rare developmental disorder of heterotopic ossification (HO) caused by heterozygous inactivating germline mutations in the paternal allele of the GNAS gene. Interestingly, POH lesions have a bewildering mosaic distribution. Using clinical, radiographic, and photographic documentation, we found that most of the 12 individuals studied had a lesional bias toward one side or the other, even showing exclusive sidedness. Most strikingly, all had a dermomyotomal distribution of HO lesions. We hypothesized that somatic mutations in a progenitor cell of somitic origin may act on a background of germline haploinsufficiency to cause loss of heterozygosity at the GNAS locus and lead to the unilateral distribution of POH lesions. Taking advantage of the chick system, we examined our hypothesis by mimicking loss of heterozygosity of GNAS expression using dominant-negative GNAS that was introduced into a subset of chick somites, the progenitors that give rise to dermis and muscle. We observed rapid ectopic cartilage and bone induction at the axial and lateral positions in a unilateral distribution corresponding to the injected somites, which suggests that blocking GNAS activity in a targeted population of progenitor cells can lead to mosaic ectopic ossification reminiscent of that seen in POH. PMID:23863715

  17. Leaps and lulls in the developmental transcriptome of Dictyostelium discoideum.

    PubMed

    Rosengarten, Rafael David; Santhanam, Balaji; Fuller, Danny; Katoh-Kurasawa, Mariko; Loomis, William F; Zupan, Blaz; Shaulsky, Gad

    2015-04-13

    Development of the soil amoeba Dictyostelium discoideum is triggered by starvation. When placed on a solid substrate, the starving solitary amoebae cease growth, communicate via extracellular cAMP, aggregate by tens of thousands and develop into multicellular organisms. Early phases of the developmental program are often studied in cells starved in suspension while cAMP is provided exogenously. Previous studies revealed massive shifts in the transcriptome under both developmental conditions and a close relationship between gene expression and morphogenesis, but were limited by the sampling frequency and the resolution of the methods. Here, we combine the superior depth and specificity of RNA-seq-based analysis of mRNA abundance with high frequency sampling during filter development and cAMP pulsing in suspension. We found that the developmental transcriptome exhibits mostly gradual changes interspersed by a few instances of large shifts. For each time point we treated the entire transcriptome as single phenotype, and were able to characterize development as groups of similar time points separated by gaps. The grouped time points represented gradual changes in mRNA abundance, or molecular phenotype, and the gaps represented times during which many genes are differentially expressed rapidly, and thus the phenotype changes dramatically. Comparing developmental experiments revealed that gene expression in filter developed cells lagged behind those treated with exogenous cAMP in suspension. The high sampling frequency revealed many genes whose regulation is reproducibly more complex than indicated by previous studies. Gene Ontology enrichment analysis suggested that the transition to multicellularity coincided with rapid accumulation of transcripts associated with DNA processes and mitosis. Later development included the up-regulation of organic signaling molecules and co-factor biosynthesis. Our analysis also demonstrated a high level of synchrony among the developing structures throughout development. Our data describe D. discoideum development as a series of coordinated cellular and multicellular activities. Coordination occurred within fields of aggregating cells and among multicellular bodies, such as mounds or migratory slugs that experience both cell-cell contact and various soluble signaling regimes. These time courses, sampled at the highest temporal resolution to date in this system, provide a comprehensive resource for studies of developmental gene expression.

  18. Genome-wide identification and analysis of the MADS-box gene family in apple.

    PubMed

    Tian, Yi; Dong, Qinglong; Ji, Zhirui; Chi, Fumei; Cong, Peihua; Zhou, Zongshan

    2015-01-25

    The MADS-box gene family is one of the most widely studied families in plants and has diverse developmental roles in flower pattern formation, gametophyte cell division and fruit differentiation. Although the genome-wide analysis of this family has been performed in some species, little is known regarding MADS-box genes in apple (Malus domestica). In this study, 146 MADS-box genes were identified in the apple genome and were phylogenetically clustered into six subgroups (MIKC(c), MIKC*, Mα, Mβ, Mγ and Mδ) with the MADS-box genes from Arabidopsis and rice. The predicted apple MADS-box genes were distributed across all 17 chromosomes at different densities. Additionally, the MADS-box domain, exon length, gene structure and motif compositions of the apple MADS-box genes were analysed. Moreover, the expression of all of the apple MADS-box genes was analysed in the root, stem, leaf, flower tissues and five stages of fruit development. All of the apple MADS-box genes, with the exception of some genes in each group, were expressed in at least one of the tissues tested, which indicates that the MADS-box genes are involved in various aspects of the physiological and developmental processes of the apple. To the best of our knowledge, this report describes the first genome-wide analysis of the apple MADS-box gene family, and the results should provide valuable information for understanding the classification, cloning and putative functions of this family. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Language, Thinking, and Communication: A Developmental Psycholinguistic Perspective.

    ERIC Educational Resources Information Center

    Schneider, Phyllis

    There are a number of views of the relationship between language and thinking. Two prominent figures in developmental psychology, Jean Piaget and Lev Vygotsky, proposed theories of language and thinking which also involve the notion of "communication." For Piaget, thinking develops first, and language comes along as an expression of…

  20. Simple Steps for Teaching Prepositions to Students with Autism and Other Developmental Disabilities

    ERIC Educational Resources Information Center

    Hicks, S. Christy; Rivera, Christopher J.; Patterson, Dawn R.

    2016-01-01

    The acquisition of receptive and expressive language skills by students with autism and developmental disabilities (DD) is often delayed, thus making the process of communicating with others challenging. Some students develop language skills incidentally through conversations with their families and peers, but others require instruction in…

  1. Beyond Polar Descriptions of Developmentally Appropriate Practice: A Reply to Bredekamp.

    ERIC Educational Resources Information Center

    Fowell, Nancy; Lawton, Joseph

    1993-01-01

    Addresses four concerns raised by Bredekamp in her commentary on an earlier article by Fowell and Lawton. The earlier article proposed an alternative view of developmentally appropriate practices to that expressed in a position paper of the National Association for the Education of Young Children. (BB)

  2. Massive shift in gene expression during transitions between developmental stages of the Gall Midge, Mayetiola destructor

    USDA-ARS?s Scientific Manuscript database

    The gall midge Mayetiola destructor is a destructive pest of wheat worldwide and a model organism for studying plant – insect interactions. The insect has six different developmental stages including eggs, three instars of larvae, pupae, and adults. Molecular mechanisms controlling the transition ...

  3. Incorporating "omics" in the study of reproduction and development: Virtual Tissue Models in Developmental Toxicity Research

    EPA Science Inventory

    In recent years, ground breaking research in genomic applications in the area of reproductive and developmental toxicology have been successful in linking changes in the expression of specific genes and their higher-level biological processes to effects induced by drugs or chemic...

  4. Auditory and Motor Rhythm Awareness in Adults with Dyslexia

    ERIC Educational Resources Information Center

    Thomson, Jennifer M.; Fryer, Ben; Maltby, James; Goswami, Usha

    2006-01-01

    Children with developmental dyslexia appear to be insensitive to basic auditory cues to speech rhythm and stress. For example, they experience difficulties in processing duration and amplitude envelope onset cues. Here we explored the sensitivity of adults with developmental dyslexia to the same cues. In addition, relations with expressive and…

  5. Overcoming Barriers to the Sexual Expression of Women with Developmental Disabilities.

    ERIC Educational Resources Information Center

    Stinson, Jennifer; Christian, LeeAnn; Dotson, Lori Ann

    2002-01-01

    This article discusses barriers to sexual fulfillment faced by women with developmental disabilities, including: access to gynecological healthcare, limited choices regarding reproductive issues, lack of sex education, and prevailing negative stereotypes that affect the way women are viewed by others and the way they view themselves.…

  6. Working through Children's Developmental and Existential Stress in Picture Books.

    ERIC Educational Resources Information Center

    Schwarcz, Joseph H.

    The aesthetic quality and psychological subtlety of contemporary picture books give genuine expression to a child's conscious and unconscious thoughts and emotions. Increasingly, themes of existential and developmental stress are appearing in picture books. Typical reactions aroused by such stress factors--and also by themes treated in picture…

  7. Developmental Hypothyroidism Reduces the Expression of Activity-Dependent Plasticity Genes in Denate Gyrus of the Adult Following Long Term Potentiation

    EPA Science Inventory

    Disruption of thyroid hormone (TH) is a known effect of environmental contaminants. Neurotrophins including brain-derived neurotrophic factor (BDNF) and nerve growth factor (NGF) have been implicated in brain dysfunction resulting from severe developmental TH insufficiency. Neuro...

  8. Maternally-Mediated Effects on Development*

    EPA Science Inventory

    In standard Segment II mammalian bioassays for developmental toxicity, it is the pregnant animal that is exposed to the test article, so in this sense, all in utero developmental toxicity is mediated by the mother. This will include absorption, distribution, metabolism and excret...

  9. Developmental Changes in Infants' Categorization of Anger and Disgust Facial Expressions

    ERIC Educational Resources Information Center

    Ruba, Ashley L.; Johnson, Kristin M.; Harris, Lasana T.; Wilbourn, Makeba Parramore

    2017-01-01

    For decades, scholars have examined how children first recognize emotional facial expressions. This research has found that infants younger than 10 months can discriminate negative, within-valence facial expressions in looking time tasks, and children older than 24 months struggle to categorize these expressions in labeling and free-sort tasks.…

  10. Molecular cloning and developmental expression of Tlx (Hox11) genes in zebrafish (Danio rerio).

    PubMed

    Langenau, D M; Palomero, T; Kanki, J P; Ferrando, A A; Zhou, Y; Zon, L I; Look, A T

    2002-09-01

    Tlx (Hox11) genes are orphan homeobox genes that play critical roles in the regulation of early developmental processes in vertebrates. Here, we report the identification and expression patterns of three members of the zebrafish Tlx family. These genes share similar, but not identical, expression patterns with other vertebrate Tlx-1 and Tlx-3 genes. Tlx-1 is expressed early in the developing hindbrain and pharyngeal arches, and later in the putative splenic primordium. However, unlike its orthologues, zebrafish Tlx-1 is not expressed in the cranial sensory ganglia or spinal cord. Two homologues of Tlx-3 were identified: Tlx-3a and Tlx-3b, which are both expressed in discrete regions of the developing nervous system, including the cranial sensory ganglia and Rohon-Beard neurons. However, only Tlx-3a is expressed in the statoacoustic cranial ganglia, enteric neurons and non-neural tissues such as the fin bud and pharyngeal arches and Tlx-3b is only expressed in the dorsal root ganglia. Copyright 2002 Elsevier Science Ireland Ltd.

  11. Temporal Control of Trichome Distribution by MicroRNA156-Targeted SPL Genes in Arabidopsis thaliana[W][OA

    PubMed Central

    Yu, Nan; Cai, Wen-Juan; Wang, Shucai; Shan, Chun-Min; Wang, Ling-Jian; Chen, Xiao-Ya

    2010-01-01

    The production and distribution of plant trichomes is temporally and spatially regulated. After entering into the flowering stage, Arabidopsis thaliana plants have progressively reduced numbers of trichomes on the inflorescence stem, and the floral organs are nearly glabrous. We show here that SQUAMOSA PROMOTER BINDING PROTEIN LIKE (SPL) genes, which define an endogenous flowering pathway and are targeted by microRNA 156 (miR156), temporally control the trichome distribution during flowering. Plants overexpressing miR156 developed ectopic trichomes on the stem and floral organs. By contrast, plants with elevated levels of SPLs produced fewer trichomes. During plant development, the increase in SPL transcript levels is coordinated with the gradual loss of trichome cells on the stem. The MYB transcription factor genes TRICHOMELESS1 (TCL1) and TRIPTYCHON (TRY) are negative regulators of trichome development. We show that SPL9 directly activates TCL1 and TRY expression through binding to their promoters and that this activation is independent of GLABROUS1 (GL1). The phytohormones cytokinin and gibberellin were reported to induce trichome formation on the stem and inflorescence via the C2H2 transcription factors GIS, GIS2, and ZFP8, which promote GL1 expression. We show that the GIS-dependent pathway does not affect the regulation of TCL1 and TRY by miR156-targeted SPLs, represented by SPL9. These results demonstrate that the miR156-regulated SPLs establish a direct link between developmental programming and trichome distribution. PMID:20622149

  12. Postnatal Expression of V2 Vasopressin Receptor Splice Variants in the Rat Cerebellum

    PubMed Central

    Vargas, Karina J.; Sarmiento, José M.; Ehrenfeld, Pamela; Añazco, Carolina C.; Villanueva, Carolina I.; Carmona, Pamela L.; Brenet, Marianne; Navarro, Javier; Müller-Esterl, Werner; Figueroa, Carlos D.; González, Carlos B.

    2010-01-01

    The V2 vasopressin receptor gene contains an alternative splice site in exon-3, which leads to the generation of two splice variants (V2a and V2b) first identified in the kidney. The open reading frame of the alternatively spliced V2b transcripten codes a truncated receptor, showing the same amino acid sequence as the canonical V2a receptor up to the 6th transmembrane segment, but displaying a distinct sequence to the corresponding 7th transmembrane segment and C-terminal domain relative to the V2a receptor. Here, we demonstrate the postnatal expression of V2a and V2b variants in the rat cerebellum. Most importantly, we showed by in situ hybridization and immunocytochemistry that both V2 splice variants were preferentially expressed in Purkinje cells, from early to late postnatal development. In addition, both variants were transiently expressed in the neuroblastic external granule cells and Bergmann fibers. These results indicate that the cellular distributions of both splice variants are developmentally regulated, and suggest that the transient expression of the V2 receptor is involved in the mechanisms of cerebellar cytodifferentiation by AVP. Finally, transfected CHO-K1 .expressing similar amounts of both V2 splice variants, as that found in the cerebellum, showed a significant reduction in the surface expression of V2a receptors, suggesting that the differential expression of the V2 splice variants regulate the vasopressin signaling in the cerebellum. PMID:19281786

  13. Epigenetic dysregulation of key developmental genes in radiation-induced rat mammary carcinomas.

    PubMed

    Daino, Kazuhiro; Nishimura, Mayumi; Imaoka, Tatsuhiko; Takabatake, Masaru; Morioka, Takamitsu; Nishimura, Yukiko; Shimada, Yoshiya; Kakinuma, Shizuko

    2018-02-13

    With the increase in the number of long-term cancer survivors worldwide, there is a growing concern about the risk of secondary cancers induced by radiotherapy. Epigenetic modifications of genes associated with carcinogenesis are attractive targets for the prevention of cancer owing to their reversible nature. To identify genes with possible changes in functionally relevant DNA methylation patterns in mammary carcinomas induced by radiation exposure, we performed microarray-based global DNA methylation and expression profiling in γ-ray-induced rat mammary carcinomas and normal mammary glands. The gene expression profiling identified dysregulation of developmentally related genes, including the downstream targets of polycomb repressive complex 2 (PRC2) and overexpression of enhancer of zeste homolog 2, a component of PRC2, in the carcinomas. By integrating expression and DNA methylation profiles, we identified ten hypermethylated and three hypomethylated genes that possibly act as tumor-suppressor genes and oncogenes dysregulated by aberrant DNA methylation; half of these genes encode developmental transcription factors. Bisulfite sequencing and quantitative PCR confirmed the dysregulation of the polycomb-regulated developmentally related transcription-factor genes Dmrt2, Hoxa7, Foxb1, Sox17, Lhx8, Gata3 and Runx1. Silencing of Hoxa7 was further verified by immunohistochemistry. These results suggest that, in radiation-induced mammary gland carcinomas, PRC2-mediated aberrant DNA methylation leads to dysregulation of developmentally related transcription-factor genes. Our findings provide clues to molecular mechanisms linking epigenetic regulation and radiation-induced breast carcinogenesis and underscore the potential of such epigenetic mechanisms as targets for cancer prevention. © 2018 UICC.

  14. Developmental studies of the lamprey and hierarchical evolutionary steps towards the acquisition of the jaw

    PubMed Central

    Kuratani, Shigeru

    2005-01-01

    The evolution of animal morphology can be understood as a series of changes in developmental programs. Among vertebrates, some developmental stages are conserved across species, representing particular developmental constraints. One of the most conserved stages is the vertebrate pharyngula, in which similar embryonic morphology is observed and the Hox code is clearly expressed. The oral developmental program also appears to be constrained to some extent, as both its morphology and the the Hox-code-default state of the oropharyngeal region are well conserved between the lamprey and gnathostome embryos. These features do not by themselves explain the evolution of jaws, but should be regarded as a prerequisite for evolutionary diversification of the mandibular arch. By comparing the pharyngula morphology of the lamprey and gnathostomes, it has become clear that the oral pattern is not entirely identical; in particular, the positional differentiation of the rostral ectomesenchyme is shifted between these animals. Therefore, the jaw seems to have arisen as an evolutionary novelty by overriding ancestral constraints, a process in which morphological homologies are partially lost. This change involves the heterotopic shift of tissue interaction, which appears to have been preceded by the transition from monorhiny to diplorhiny, as well as separation of the hypophysis. When gene expression patterns are compared between the lamprey and gnathostomes, cell-autonomously functioning genes tend to be associated with identical cell types or equivalent anatomical domains, whereas growth-factor-encoding genes have changed their expression domains during evolution. Thus, the heterotopic evolution may be based on changes in the regulation of signalling-molecule-encoding genes. PMID:16313390

  15. Methyl donor-deficient diet during development can affect fear and anxiety in adulthood in C57BL/6J mice.

    PubMed

    Ishii, Daisuke; Matsuzawa, Daisuke; Matsuda, Shingo; Tomizawa, Haruna; Sutoh, Chihiro; Shimizu, Eiji

    2014-01-01

    DNA methylation is one of the essential factors in the control of gene expression. Folic acid, methionine and choline (methyl donors)--all nutrients related to one-carbon metabolism--are known as important mediators of DNA methylation. A previous study has shown that long-term administration of a diet lacking in methyl donors caused global DNA hypermethylation in the brain (Pogribny et al., 2008). However, no study has investigated the effects of a diet lacking in methyl donors during the developmental period on emotional behaviors such as fear and anxiety-like behavior in association with gene expressions in the brain. In addition, it has not been elucidated whether a diet supplemented with methyl donors later in life can reverse these changes. Therefore, we examined the effects of methyl donor deficiency during the developmental period on fear memory acquisition/extinction and anxiety-like behavior, and the relevant gene expressions in the hippocampus in juvenile (6-wk) and adult (12-wk) mice. We found that juvenile mice fed a methyl-donor-deficient diet had impaired fear memory acquisition along with decreases in the gene expressions of Dnmt3a and Dnmt3b. In addition, reduced anxiety-like behavior with decreased gene expressions of Grin2b and Gabar2 was observed in both the methyl-donor-deficient group and the body-weight-matched food-restriction group. After being fed a diet supplemented with methyl donors ad libitum, adult mice reversed the alteration of gene expression of Dnmt3a, Dnmt3b, Grin2b and Gabar2, but anxiety-like behavior became elevated. In addition, impaired fear-memory formation was observed in the adult mice fed the methyl-donor-deficient diet during the developmental period. Our study suggested that developmental alterations in the one-carbon metabolic pathway in the brain could have effects on emotional behavior and memory formation that last into adulthood.

  16. Methyl Donor-Deficient Diet during Development Can Affect Fear and Anxiety in Adulthood in C57BL/6J Mice

    PubMed Central

    Ishii, Daisuke; Matsuzawa, Daisuke; Matsuda, Shingo; Tomizawa, Haruna; Sutoh, Chihiro; Shimizu, Eiji

    2014-01-01

    DNA methylation is one of the essential factors in the control of gene expression. Folic acid, methionine and choline (methyl donors)–all nutrients related to one-carbon metabolism–are known as important mediators of DNA methylation. A previous study has shown that long-term administration of a diet lacking in methyl donors caused global DNA hypermethylation in the brain (Pogribny et al., 2008). However, no study has investigated the effects of a diet lacking in methyl donors during the developmental period on emotional behaviors such as fear and anxiety-like behavior in association with gene expressions in the brain. In addition, it has not been elucidated whether a diet supplemented with methyl donors later in life can reverse these changes. Therefore, we examined the effects of methyl donor deficiency during the developmental period on fear memory acquisition/extinction and anxiety-like behavior, and the relevant gene expressions in the hippocampus in juvenile (6-wk) and adult (12-wk) mice. We found that juvenile mice fed a methyl-donor-deficient diet had impaired fear memory acquisition along with decreases in the gene expressions of Dnmt3a and Dnmt3b. In addition, reduced anxiety-like behavior with decreased gene expressions of Grin2b and Gabar2 was observed in both the methyl-donor-deficient group and the body-weight-matched food-restriction group. After being fed a diet supplemented with methyl donors ad libitum, adult mice reversed the alteration of gene expression of Dnmt3a, Dnmt3b, Grin2b and Gabar2, but anxiety-like behavior became elevated. In addition, impaired fear-memory formation was observed in the adult mice fed the methyl-donor-deficient diet during the developmental period. Our study suggested that developmental alterations in the one-carbon metabolic pathway in the brain could have effects on emotional behavior and memory formation that last into adulthood. PMID:25144567

  17. Overexpression of Three Heat Shock Proteins Protects Monochamus alternatus (Coleoptera: Cerambycidae) From Thermal Stress

    PubMed Central

    Cai, Ziling; Chen, Jingxiang; Cheng, Jie

    2017-01-01

    Abstract Ambient temperature is an important factor limiting the abundance and distribution of insects, and heat shock protein (Hsp) gene expression is sensitive to extremes of cold and heat. In order to explore the role of Hsps during thermal stress and development in Monochamus alternatus Hope (Coleoptera: Cerambycidae), we cloned and characterized full-length Hsp genes, including MaHsp60, MaHsp70, and MaHsp90. M. alternatus were exposed to different temperatures (−15, −5, 5, 15, 25, 35, and 40℃) for 1 h and was allowed to recover at 25℃ for 1 h. Following the treatments, we investigated the expression of the Hsps by quantitative real-time polymerase chain reaction. In third instar larvae, MaHsp60, MaHsp70, and MaHsp90 expression was upregulated in response to cold and heat, but the three Hsps were especially sensitive to heat, specifically at 35℃ and 40℃. After heating M. alternatus to 35℃, the expression of MaHsp60, MaHsp70, and MaHsp90 was higher than at 5℃ and 25℃ in nearly all developmental stages. MaHsp60, MaHsp70, and MaHsp90 expression was highest in later pupal, early adult, and early adult stages, respectively. These results suggest that compared with normal ambient temperatures, thermal stress could induce high expression of the three Hsps.

  18. Comparison of MeHg-induced toxicogenomic responses across in vivo and in vitro models used in developmental toxicology.

    PubMed

    Robinson, Joshua F; Theunissen, Peter T; van Dartel, Dorien A M; Pennings, Jeroen L; Faustman, Elaine M; Piersma, Aldert H

    2011-09-01

    Toxicogenomic evaluations may improve toxicity prediction of in vitro-based developmental models, such as whole embryo culture (WEC) and embryonic stem cells (ESC), by providing a robust mechanistic marker which can be linked with responses associated with developmental toxicity in vivo. While promising in theory, toxicogenomic comparisons between in vivo and in vitro models are complex due to inherent differences in model characteristics and experimental design. Determining factors which influence these global comparisons are critical in the identification of reliable mechanistic-based markers of developmental toxicity. In this study, we compared available toxicogenomic data assessing the impact of the known teratogen, methylmercury (MeHg) across a diverse set of in vitro and in vivo models to investigate the impact of experimental variables (i.e. model, dose, time) on our comparative assessments. We evaluated common and unique aspects at both the functional (Gene Ontology) and gene level of MeHg-induced response. At the functional level, we observed stronger similarity in MeHg-response between mouse embryos exposed in utero (2 studies), ESC, and WEC as compared to liver, brain and mouse embryonic fibroblast MeHg studies. These findings were strongly correlated to the presence of a MeHg-induced developmentally related gene signature. In addition, we identified specific MeHg-induced gene expression alterations associated with developmental signaling and heart development across WEC, ESC and in vivo systems. However, the significance of overlap between studies was highly dependent on traditional experimental variables (i.e. dose, time). In summary, we identify promising examples of unique gene expression responses which show in vitro-in vivo similarities supporting the relevance of in vitro developmental models for predicting in vivo developmental toxicity. Copyright © 2011 Elsevier Inc. All rights reserved.

  19. Inner ear development: building a spiral ganglion and an organ of Corti out of unspecified ectoderm.

    PubMed

    Fritzsch, Bernd; Pan, Ning; Jahan, Israt; Elliott, Karen L

    2015-07-01

    The mammalian inner ear develops from a placodal thickening into a complex labyrinth of ducts with five sensory organs specialized to detect position and movement in space. The mammalian ear also develops a spiraled cochlear duct containing the auditory organ, the organ of Corti (OC), specialized to translate sound into hearing. Development of the OC from a uniform sheet of ectoderm requires unparalleled precision in the topological developmental engineering of four different general cell types, namely sensory neurons, hair cells, supporting cells, and general otic epithelium, into a mosaic of ten distinctly recognizable cell types in and around the OC, each with a unique distribution. Moreover, the OC receives unique innervation by ear-derived spiral ganglion afferents and brainstem-derived motor neurons as efferents and requires neural-crest-derived Schwann cells to form myelin and neural-crest-derived cells to induce the stria vascularis. This transformation of a sheet of cells into a complicated interdigitating set of cells necessitates the orchestrated expression of multiple transcription factors that enable the cellular transformation from ectoderm into neurosensory cells forming the spiral ganglion neurons (SGNs), while simultaneously transforming the flat epithelium into a tube, the cochlear duct, housing the OC. In addition to the cellular and conformational changes forming the cochlear duct with the OC, changes in the surrounding periotic mesenchyme form passageways for sound to stimulate the OC. We review molecular developmental data, generated predominantly in mice, in order to integrate the well-described expression changes of transcription factors and their actions, as revealed in mutants, in the formation of SGNs and OC in the correct position and orientation with suitable innervation. Understanding the molecular basis of these developmental changes leading to the formation of the mammalian OC and highlighting the gaps in our knowledge might guide in vivo attempts to regenerate this most complicated cellular mosaic of the mammalian body for the reconstitution of hearing in a rapidly growing population of aging people suffering from hearing loss.

  20. A Genome-Wide Screen Indicates Correlation between Differentiation and Expression of Metabolism Related Genes

    PubMed Central

    Shende, Akhilesh; Singh, Anupama; Meena, Anil; Ghosal, Ritika; Ranganathan, Madhav; Bandyopadhyay, Amitabha

    2013-01-01

    Differentiated tissues may be considered as materials with distinct properties. The differentiation program of a given tissue ensures that it acquires material properties commensurate with its function. It may be hypothesized that some of these properties are acquired through production of tissue-specific metabolites synthesized by metabolic enzymes. To establish correlation between metabolism and organogenesis we have carried out a genome-wide expression study of metabolism related genes by RNA in-situ hybridization. 23% of the metabolism related genes studied are expressed in a tissue-restricted but not tissue-exclusive manner. We have conducted the screen on whole mount chicken (Gallus gallus) embryos from four distinct developmental stages to correlate dynamic changes in expression patterns of metabolic enzymes with spatio-temporally unique developmental events. Our data strongly suggests that unique combinations of metabolism related genes, and not specific metabolic pathways, are upregulated during differentiation. Further, expression of metabolism related genes in well established signaling centers that regulate different aspects of morphogenesis indicates developmental roles of some of the metabolism related genes. The database of tissue-restricted expression patterns of metabolism related genes, generated in this study, should serve as a resource for systematic identification of these genes with tissue-specific functions during development. Finally, comprehensive understanding of differentiation is not possible unless the downstream genes of a differentiation cascade are identified. We propose, metabolic enzymes constitute a significant portion of these downstream target genes. Thus our study should help elucidate different aspects of tissue differentiation. PMID:23717462

  1. A genome-wide screen indicates correlation between differentiation and expression of metabolism related genes.

    PubMed

    Roy, Priti; Kumar, Brijesh; Shende, Akhilesh; Singh, Anupama; Meena, Anil; Ghosal, Ritika; Ranganathan, Madhav; Bandyopadhyay, Amitabha

    2013-01-01

    Differentiated tissues may be considered as materials with distinct properties. The differentiation program of a given tissue ensures that it acquires material properties commensurate with its function. It may be hypothesized that some of these properties are acquired through production of tissue-specific metabolites synthesized by metabolic enzymes. To establish correlation between metabolism and organogenesis we have carried out a genome-wide expression study of metabolism related genes by RNA in-situ hybridization. 23% of the metabolism related genes studied are expressed in a tissue-restricted but not tissue-exclusive manner. We have conducted the screen on whole mount chicken (Gallus gallus) embryos from four distinct developmental stages to correlate dynamic changes in expression patterns of metabolic enzymes with spatio-temporally unique developmental events. Our data strongly suggests that unique combinations of metabolism related genes, and not specific metabolic pathways, are upregulated during differentiation. Further, expression of metabolism related genes in well established signaling centers that regulate different aspects of morphogenesis indicates developmental roles of some of the metabolism related genes. The database of tissue-restricted expression patterns of metabolism related genes, generated in this study, should serve as a resource for systematic identification of these genes with tissue-specific functions during development. Finally, comprehensive understanding of differentiation is not possible unless the downstream genes of a differentiation cascade are identified. We propose, metabolic enzymes constitute a significant portion of these downstream target genes. Thus our study should help elucidate different aspects of tissue differentiation.

  2. Sox genes in the coral Acropora millepora: divergent expression patterns reflect differences in developmental mechanisms within the Anthozoa

    PubMed Central

    2008-01-01

    Background Sox genes encode transcription factors that function in a wide range of developmental processes across the animal kingdom. To better understand both the evolution of the Sox family and the roles of these genes in cnidarians, we are studying the Sox gene complement of the coral, Acropora millepora (Class Anthozoa). Results Based on overall domain structures and HMG box sequences, the Acropora Sox genes considered here clearly fall into four of the five major Sox classes. AmSoxC is expressed in the ectoderm during development, in cells whose morphology is consistent with their assignment as sensory neurons. The expression pattern of the Nematostella ortholog of this gene is broadly similar to that of AmSoxC, but there are subtle differences – for example, expression begins significantly earlier in Acropora than in Nematostella. During gastrulation, AmSoxBb and AmSoxB1 transcripts are detected only in the presumptive ectoderm while AmSoxE1 transcription is restricted to the presumptive endoderm, suggesting that these Sox genes might play roles in germ layer specification. A third type B Sox gene, AmSoxBa, and a Sox F gene AmSoxF also have complex and specific expression patterns during early development. Each of these genes has a clear Nematostella ortholog, but in several cases the expression pattern observed in Acropora differs significantly from that reported in Nematostella. Conclusion These differences in expression patterns between Acropora and Nematostella largely reflect fundamental differences in developmental processes, underscoring the diversity of mechanisms within the anthozoan Sub-Class Hexacorallia (Zoantharia). PMID:19014479

  3. Control of asgE Expression during Growth and Development of Myxococcus xanthus

    PubMed Central

    Garza, Anthony G.; Harris, Baruch Z.; Greenberg, Brandon M.; Singer, Mitchell

    2000-01-01

    One of the earliest events in the Myxococcus xanthus developmental cycle is production of an extracellular cell density signal called A-signal (or A-factor). Previously, we showed that cells carrying an insertion in the asgE gene fail to produce normal levels of this cell-cell signal. In this study we found that expression of asgE is growth phase regulated and developmentally regulated. Several lines of evidence indicate that asgE is cotranscribed with an upstream gene during development. Using primer extension analyses, we identified two 5′ ends for this developmental transcript. The DNA sequence upstream of one 5′ end has similarity to the promoter regions of several genes that are A-signal dependent, whereas sequences located upstream of the second 5′ end show similarity to promoter elements identified for genes that are C-signal dependent. Consistent with this result is our finding that mutants failing to produce A-signal or C-signal are defective for developmental expression of asgE. In contrast to developing cells, the large majority of the asgE transcript found in vegetative cells appears to be monocistronic. This finding suggests that asgE uses different promoters for expression during vegetative growth and development. Growth phase regulation of asgE is abolished in a relA mutant, indicating that this vegetative promoter is induced by starvation. The data presented here, in combination with our previous results, indicate that the level of AsgE in vegetative cells is sufficient for this protein to carry out its function during development. PMID:11073904

  4. Transcription factors define the neuroanatomical organization of the medullary reticular formation

    PubMed Central

    Gray, Paul A.

    2013-01-01

    The medullary reticular formation contains large populations of inadequately described, excitatory interneurons that have been implicated in multiple homeostatic behaviors including breathing, viserosensory processing, vascular tone, and pain. Many hindbrain nuclei show a highly stereotyped pattern of localization across vertebrates suggesting a strong underlying genetic organization. Whether this is true for neurons within the reticular regions of hindbrain is unknown. Hindbrain neurons are derived from distinct developmental progenitor domains each of which expresses distinct patterns of transcription factors (TFs). These neuronal populations have distinct characteristics such as transmitter identity, migration, and connectivity suggesting developmentally expressed TFs might identify unique subpopulations of neurons within the reticular formation. A fate-mapping strategy using perinatal expression of reporter genes within Atoh1, Dbx1, Lmx1b, and Ptf1a transgenic mice coupled with immunohistochemistry (IHC) and in situ hybridization (ISH) were used to address the developmental organization of a large subset of reticular formation glutamatergic neurons. All hindbrain lineages have relatively large populations that extend the entire length of the hindbrain. Importantly, the location of neurons within each lineage was highly constrained. Lmx1b- and Dbx1- derived populations were both present in partially overlapping stripes within the reticular formation extending from dorsal to ventral brain. Within each lineage, distinct patterns of gene expression and organization were localized to specific hindbrain regions. Rostro-caudally sub-populations differ sequentially corresponding to proposed pseudo-rhombomereic boundaries. Dorsal-ventrally, sub-populations correspond to specific migratory positions. Together these data suggests the reticular formation is organized by a highly stereotyped developmental logic. PMID:23717265

  5. Transcription factors define the neuroanatomical organization of the medullary reticular formation.

    PubMed

    Gray, Paul A

    2013-01-01

    The medullary reticular formation contains large populations of inadequately described, excitatory interneurons that have been implicated in multiple homeostatic behaviors including breathing, viserosensory processing, vascular tone, and pain. Many hindbrain nuclei show a highly stereotyped pattern of localization across vertebrates suggesting a strong underlying genetic organization. Whether this is true for neurons within the reticular regions of hindbrain is unknown. Hindbrain neurons are derived from distinct developmental progenitor domains each of which expresses distinct patterns of transcription factors (TFs). These neuronal populations have distinct characteristics such as transmitter identity, migration, and connectivity suggesting developmentally expressed TFs might identify unique subpopulations of neurons within the reticular formation. A fate-mapping strategy using perinatal expression of reporter genes within Atoh1, Dbx1, Lmx1b, and Ptf1a transgenic mice coupled with immunohistochemistry (IHC) and in situ hybridization (ISH) were used to address the developmental organization of a large subset of reticular formation glutamatergic neurons. All hindbrain lineages have relatively large populations that extend the entire length of the hindbrain. Importantly, the location of neurons within each lineage was highly constrained. Lmx1b- and Dbx1- derived populations were both present in partially overlapping stripes within the reticular formation extending from dorsal to ventral brain. Within each lineage, distinct patterns of gene expression and organization were localized to specific hindbrain regions. Rostro-caudally sub-populations differ sequentially corresponding to proposed pseudo-rhombomereic boundaries. Dorsal-ventrally, sub-populations correspond to specific migratory positions. Together these data suggests the reticular formation is organized by a highly stereotyped developmental logic.

  6. Honey bee (Apis mellifera) transferrin-gene structure and the role of ecdysteroids in the developmental regulation of its expression.

    PubMed

    do Nascimento, Adriana Mendes; Cuvillier-Hot, Virginie; Barchuk, Angel Roberto; Simões, Zilá Luz Paulino; Hartfelder, Klaus

    2004-05-01

    Social life is prone to invasion by microorganisms, and binding of ferric ions by transferrin is an efficient strategy to restrict their access to iron. In this study, we isolated cDNA and genomic clones encoding an Apis mellifera transferrin (AmTRF) gene. It has an open reading frame (ORF) of 2136 bp spread over nine exons. The deduced protein sequence comprises 686 amino acid residues plus a 26 residues signal sequence, giving a predicted molecular mass of 76 kDa. Comparison of the deduced AmTRF amino acid sequence with known insect transferrins revealed significant similarity extending over the entire sequence. It clusters with monoferric transferrins, with which it shares putative iron-binding residues in the N-terminal lobe. In a functional analysis of AmTRF expression in honey bee development, we monitored its expression profile in the larval and pupal stages. The negative regulation of AmTRF by ecdysteroids deduced from the developmental expression profile was confirmed by experimental treatment of spinning-stage honey bee larvae with 20-hydroxyecdysone, and of fourth instar-larvae with juvenile hormone. A juvenile hormone application to spinning-stage larvae, in contrast, had only a minor effect on AmTRF transcript levels. This is the first study implicating ecdysteroids in the developmental regulation of transferrin expression in an insect species.

  7. Loss of Cation-Chloride Cotransporter Expression in Preterm Infants With White Matter Lesions: Implications for the Pathogenesis of Epilepsy

    PubMed Central

    Robinson, Shenandoah; Mikolaenko, Irina; Thompson, Ian; Cohen, Mark L.; Goyal, Monisha

    2011-01-01

    Epilepsy associated with preterm birth is often refractory to anticonvulsants. Children who are born preterm are also prone to cognitive delay and behavioral problems. Brains from these children often show diffuse abnormalities in cerebral circuitry that is likely caused by disrupted development during critical stages of cortical formation. To test the hypothesis that prenatal injury impairs the developmental switch of γ-amino butyric acid (GABA)ergic synapses from excitatory to inhibitory, thereby disrupting cortical circuit formation and predisposing to epilepsy, we used immunohistochemistry to compare the expression of cation-chloride transporters that developmentally regulate postsynaptic GABAergic discharges in postmortem cerebral samples from infants born preterm with known white matter injury (n = 11) with that of controls with minimal white matter gliosis (n = 7). Controls showed the expected developmental expression of cation-chloride transporters NKCC1 and KCC2 and of calretinin, a marker of a GABAergic neuronal subpopulation. Samples from infants with white matter damage showed a significant loss of expression of both NKCC1 and KCC2 in subplate and white matter. By contrast, there were no significant differences in total cell number or glutamate transporter VGLUT1 expression. Together, these novel findings suggest a molecular mechanism involved in the disruption of a critical stage of cerebral circuit development after brain injury from preterm birth that may predispose to epilepsy. PMID:20467335

  8. Neonatal manipulation of oxytocin prevents lipopolysaccharide-induced decrease in gene expression of growth factors in two developmental stages of the female rat.

    PubMed

    Bakos, Jan; Lestanova, Zuzana; Strbak, Vladimir; Havranek, Tomas; Bacova, Zuzana

    2014-10-01

    Oxytocin production and secretion is important for early development of the brain. Long-term consequences of manipulation of oxytocin system might include changes in markers of brain plasticity - cytoskeletal proteins and neurotrophins. The aim of the present study was (1) to determine whether neonatal oxytocin administration affects gene expression of nestin, microtubule-associated protein-2 (MAP-2), brain derived neurotrophic factor (BDNF) and nerve growth factor (NGF) in the brain of two developmental stages of rat and (2) to evaluate whether neonatal oxytocin administration protects against lipopolysaccharide (LPS) induced inflammation. Neonatal oxytocin did not prevent a decrease of body weight in the LPS treated animals. Oxytocin significantly increased gene expression of BDNF in the right hippocampus in 21-day and 2-month old rats of both sexes. Gene expression of NGF and MAP-2 significantly increased in males treated with oxytocin. Both, growth factors and intermediate filament-nestin mRNA levels, were reduced in females exposed to LPS. Oxytocin treatment prevented a decrease in the gene expression of only growth factors. In conclusion, neonatal manipulation of oxytocin has developmental and sex-dependent effect on markers of brain plasticity. These results also indicate, that oxytocin may be protective against inflammation particularly in females. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Enriched expression of the ciliopathy gene Ick in cell proliferating regions of adult mice.

    PubMed

    Tsutsumi, Ryotaro; Chaya, Taro; Furukawa, Takahisa

    2018-04-07

    Cilia are essential for sensory and motile functions across species. In humans, ciliary dysfunction causes "ciliopathies", which show severe developmental abnormalities in various tissues. Several missense mutations in intestinal cell kinase (ICK) gene lead to endocrine-cerebro-osteodysplasia syndrome or short rib-polydactyly syndrome, lethal recessive developmental ciliopathies. We and others previously reported that Ick-deficient mice exhibit neonatal lethality with developmental defects. Mechanistically, Ick regulates intraflagellar transport and cilia length at ciliary tips. Although Ick plays important roles during mammalian development, roles of Ick at the adult stage are poorly understood. In the current study, we investigated the Ick gene expression in adult mouse tissues. RT-PCR analysis showed that Ick is ubiquitously expressed, with enrichment in the retina, brain, lung, intestine, and reproductive system. In the adult brain, we found that Ick expression is enriched in the walls of the lateral ventricle, in the rostral migratory stream of the olfactory bulb, and in the subgranular zone of the hippocampal dentate gyrus by in situ hybridization analysis. We also observed that Ick staining pattern is similar to pachytene spermatocyte to spermatid markers in the mature testis and to an intestinal stem cell marker in the adult small intestine. These results suggest that Ick is expressed in proliferating regions in the adult mouse brain, testis, and intestine. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. Environmentally relevant levels of λ-cyhalothrin, fenvalerate, and permethrin cause developmental toxicity and disrupt endocrine system in zebrafish (Danio rerio) embryo.

    PubMed

    Zhang, Quan; Zhang, Yi; Du, Jie; Zhao, Meirong

    2017-10-01

    Synthetic pyrethroids (SPs) are one of the most widely used pesticides and frequently detected in the aquatic environment. Previous studies have shown that SPs posed high aquatic toxicity, but information on the developmental toxicity and endocrine disruption on zebrafish (Danio rerio) at environmentally relevant concentrations is limited. In this study, zebrafish embryos were employed to examine the adverse effects of λ-cyhalothrin (LCT), fenvalerate (FEN), and permethrin (PM) at 2.5, 10, 25, 125, 500 nM for 96 h. The results showed these 3 SPs caused dose-dependent mortality, malformation rate, and hatching rate. Thyroid hormone triiodothyronine (T 3 ) levels were significantly decreased after exposure to LCT and FEN. Quantitative real-time PCR analysis was then performed on a series of nuclear receptors (NRs) genes involved in the hypothalamic-pituitary-gonadal (HPG), hypothalamic-pituitary-thyroid (HPT), hypothalamic-pituitary-adrenocortical (HPA) axes, and oxidative-stress-related system. Our results showed that LCT, FEN, and PM downregulated AR expression while upregulated ER1 expression, and caused alteration to ER2a and ER2b expression. As for the expression of TRα and TRβ, they were both decreased following exposure to the 3 SPs. LCT and PM downregulated the MR expression and FEN induced MR expression. In addition, the expression of GR was increased after treating with LCT, while it was suppressed after exposure to FEN and PM. The 3 SPs also caused various alterations to the expression of genes including AhRs, PPARα, and PXR. These findings suggest that these 3 SPs may cause developmental toxicity to zebrafish larvae by disrupting endocrine signaling at environmentally relevant concentrations. Copyright © 2017. Published by Elsevier Ltd.

  11. Identification, Characterization, and Developmental Expression Pattern of Type III Interferon Receptor Gene in the Chinese Goose

    PubMed Central

    Zhou, Qin; Chen, Shun; Qi, Yulin; Zhou, Hao; Wang, Mingshu; Jia, Renyong; Zhu, Dekang; Liu, Mafeng; Liu, Fei; Chen, Xiaoyue; Zhou, Xue; Cheng, Anchun

    2015-01-01

    Interferons, as the first line of defense against the viral infection, play an important role in innate immune responses. Type III interferon (IFN-λ) was a newly identified member of IFN family, which plays IFN-like antiviral activity. Towards a better understanding of the type III interferon system in birds, type III interferon lambda receptor (IFNLR1) was first identified in the Chinese goose. In this paper, we had cloned 1952 bp for goose IFNLR1 (goIFNLR1), including an ORF of 1539 bp, encoding a 512-amino acid protein with a 20 aa predict signal peptide at its N terminal and a 23 aa transmembrane region. The predicted amino acid sequence of goIFNLR1 has 90%, 73%, and 34% identity with duck IFNLR1 (predicted sequence), chicken IFNLR1, and human IFNLR1, respectively. And the age-related tissue distribution of goIFNLR1 was identified by Real Time quantitative PCR (RT-qPCR), we found that the goIFNLR1 has a mainly expression in epithelium-rich tissues similar to other species', such as small intestinal, lung, liver, and stomach. Moreover, a relatively high expression of goIFNLR1 was also observed in the secondary immune tissues (harderian gland and cecal tonsil). The identification and tissue distribution of goIFNLR1 will facilitate further study of the role of IFN-λ in goose antiviral defense. PMID:26064884

  12. Enzymatic properties and localization of motopsin (PRSS12), a protease whose absence causes mental retardation.

    PubMed

    Mitsui, Shinichi; Yamaguchi, Nozomi; Osako, Yoji; Yuri, Kazunari

    2007-03-09

    Motopsin (PRSS12) is a mosaic protease expressed in the central nervous system. Truncation of the human motopsin gene causes nonsyndromic mental retardation. Understanding the enzymatic properties and localization of motopsin protein in the central nervous system will help identify the molecular mechanism by which the loss of motopsin function causes mental retardation. Recombinant motopsin showed amidolytic activity against the synthetic substrate benzyloxycarbonyl-l-phenylalanyl-l-arginine 4-methyl-coumaryl-7-amide. Motopsin activated the single-chain tissue plasminogen activator precursor and exhibited gelatinolytic activity. This enzymatic activity was inhibited by typical serine protease inhibitors such as aprotinin, leupeptin, and (4-amidinophenyl) methanesulfonyl fluoride. Immunocytochemistry using anti-motopsin IgG revealed that both human and mouse motopsin proteins were distributed in discrete puncta along the dendrites and soma as well as axons in cultured hippocampal neurons. In the limbic system, including the cingulate and hippocampal pyramidal neurons and piriform cortex, high level of motopsin protein was expressed at postnatal day 10, but a very low level at 10-week-old mice. Motopsin and tissue plasminogen activator were co-expressed in the cingulate pyramidal neurons at postnatal day 10 and were distributed along dendrites of cultured pyramidal neurons. In cranial nuclei, a moderate level of motopsin protein was detected independently on the developmental stage. Our results suggest that motopsin has multiple functions, such as axon outgrowth, arranging perineuronal environment, and maintaining neuronal plasticity, partly in coordination with other proteases including tissue plasminogen activator.

  13. Stage-Dependent Expression of Deltamethrin Toxicity and Resistance in Triatoma infestans (Hemiptera: Reduviidae) From Argentina.

    PubMed

    Germano, Mónica D; Picollo, María I

    2018-02-20

    Triatoma infestans Klug (Hemiptera: Reduviidae) is the main vector of Chagas disease in Latin America. This insect has been controlled with pyrethroids since the 1980s, although the emergence of resistance to deltamethrin has decreased control success in some areas of the Gran Chaco ecoregion. The response of T. infestans to deltamethrin was evaluated per developmental stage. In addition, we evaluated the possible stage-dependent expression of deltamethrin resistance. The bioassays were conducted by topical application of the insecticide in acetone. The drop size, age at the time of exposure, and mortality measuring time were standardized per stage. The lethal dose of deltamethrin moderately increased with the developmental stage. The resistance to deltamethrin was expressed in every instar, and was the highest in the fourth- and fifth-instar nymphs. While increasing, weight plays a relevant role in lethal dose stage dependency, a number of contributing factors such as degradative metabolism are probably involved in the variability of insecticide effect and resistance described for different T. infestans developmental stages. Possible explanations for these differences and their implications on resistance management and chemical control are discussed.

  14. A C. trachomatis Cloning Vector and the Generation of C. trachomatis Strains Expressing Fluorescent Proteins under the Control of a C. trachomatis Promoter

    PubMed Central

    Agaisse, Hervé; Derré, Isabelle

    2013-01-01

    Here we describe a versatile cloning vector for conducting genetic experiments in C. trachomatis. We successfully expressed various fluorescent proteins (i.e. GFP, mCherry and CFP) from C. trachomatis regulatory elements (i.e. the promoter and terminator of the incDEFG operon) and showed that the transformed strains produced wild type amounts of infectious particles and recapitulated major features of the C. trachomatis developmental cycle. C. trachomatis strains expressing fluorescent proteins are valuable tools for studying the C. trachomatis developmental cycle. For instance, we show the feasibility of investigating the dynamics of inclusion fusion and interaction with host proteins and organelles by time-lapse video microscopy. PMID:23441233

  15. Comparative immunochemical analyses of the developmental expression and distribution of ameloblastin and amelogenin in rat incisors.

    PubMed

    Nanci, A; Zalzal, S; Lavoie, P; Kunikata, M; Chen, W; Krebsbach, P H; Yamada, Y; Hammarström, L; Simmer, J P; Fincham, A G; Snead, M L; Smith, C E

    1998-08-01

    Mineralized tissues are unique in using proteins to attract and organize calcium and phosphate ions into a structured mineral phase. A precise knowledge of the expression and extracellular distribution of matrix proteins is therefore very important in understanding their function. The purpose of this investigation was to obtain comparative information on the expression, intracellular and extracellular distribution, and dynamics of proteins representative of the two main classes of enamel matrix proteins. Amelogenins were visualized using an antibody and an mRNA probe prepared against the major alternatively spliced isoform in rodents, and nonamelogenins by antibodies and mRNA probes specific to one enamel protein referred to by three names: ameloblastin, amelin, and sheathlin. Qualitative and quantitative immunocytochemistry, in combination with immunoblotting and in situ hybridization, indicated a correlation between mRNA signal and sites of protein secretion for amelogenin, but not for ameloblastin, during the early presecretory and mid- to late maturation stages, during which mRNA signals were detected but no proteins appeared to be secreted. Extracellular amelogenin immunoreactivity was generally weak near secretory surfaces, increasing over a distance of about 1.25 microm to reach a level slightly above an amount expected if the protein were being deposited evenly across the enamel layer. Immunolabeling for ameloblastin showed an inverse pattern, with relatively more gold particles near secretory surfaces and much fewer deeper into the enamel layer. Administration of brefeldin A and cycloheximide to stop protein secretion revealed that the immunoblotting pattern of amelogenin was relatively stable, whereas ameloblastin broke down rapidly into lower molecular weight fragments. The distance from the cell surface at which immunolabeling for amelogenin stabilized generally corresponded to the point at which that for ameloblastin started to show a net reduction. These data suggest a correlation between the distribution of amelogenin and ameloblastin and that intact ameloblastin has a transient role in promoting/stabilizing crystal elongation. (J Histochem Cytochem 46:911-934, 1998)

  16. Genome-wide DNA methylomes from discrete developmental stages reveal the predominance of non-CpG methylation in Tribolium castaneum

    PubMed Central

    Song, Xiaowen; Huang, Fei; Liu, Juanjuan; Li, Chengjun; Gao, Shanshan; Wu, Wei; Zhai, Mengfan; Yu, Xiaojuan; Xiong, Wenfeng; Xie, Jia

    2017-01-01

    Abstract Cytosine DNA methylation is a vital epigenetic regulator of eukaryotic development. Whether this epigenetic modification occurs in Tribolium castaneum has been controversial, its distribution pattern and functions have not been established. Here, using bisulphite sequencing (BS-Seq), we confirmed the existence of DNA methylation and described the methylation profiles of the four life stages of T. castaneum. In the T. castaneum genome, both symmetrical CpG and non-CpG methylcytosines were observed. Symmetrical CpG methylation, which was catalysed by DNMT1 and occupied a small part in T. castaneum methylome, was primarily enriched in gene bodies and was positively correlated with gene expression levels. Asymmetrical non-CpG methylation, which was predominant in the methylome, was strongly concentrated in intergenic regions and introns but absent from exons. Gene body methylation was negatively correlated with gene expression levels. The distribution pattern and functions of this type of methylation were similar only to the methylome of Drosophila melanogaster, which further supports the existence of a novel methyltransferase in the two species responsible for this type of methylation. This first life-cycle methylome of T. castaneum reveals a novel and unique methylation pattern, which will contribute to the further understanding of the variety and functions of DNA methylation in eukaryotes. PMID:28449092

  17. Sequence analysis and molecular characterization of Wnt4 gene in metacestodes of Taenia solium.

    PubMed

    Hou, Junling; Luo, Xuenong; Wang, Shuai; Yin, Cai; Zhang, Shaohua; Zhu, Xueliang; Dou, Yongxi; Cai, Xuepeng

    2014-04-01

    Wnt proteins are a family of secreted glycoproteins that are evolutionarily conserved and considered to be involved in extensive developmental processes in metazoan organisms. The characterization of wnt genes may improve understanding the parasite's development. In the present study, a wnt4 gene encoding 491amino acids was amplified from cDNA of metacestodes of Taenia solium using reverse transcription PCR (RT-PCR). Bioinformatics tools were used for sequence analysis. The conserved domain of the wnt gene family was predicted. The expression profile of Wnt4 was investigated using real-time PCR. Wnt4 expression was found to be dramatically increased in scolex evaginated cysticerci when compared to invaginated cysticerci. In situ hybridization showed that wnt4 gene was distributed in the posterior end of the worm along the primary body axis in evaginated cysticerci. These findings indicated that wnt4 may take part in the process of cysticerci evagination and play a role in scolex/bladder development of cysticerci of T. solium.

  18. Influence of Intensity on Children's Sensitivity to Happy, Sad, and Fearful Facial Expressions

    ERIC Educational Resources Information Center

    Gao, Xiaoqing; Maurer, Daphne

    2009-01-01

    Most previous studies investigating children's ability to recognize facial expressions used only intense exemplars. Here we compared the sensitivity of 5-, 7-, and 10-year-olds with that of adults (n = 24 per age group) for less intense expressions of happiness, sadness, and fear. The developmental patterns differed across expressions. For…

  19. Recognition of Immaturity and Emotional Expressions in Blended Faces by Children with Autism and Other Developmental Disabilities

    ERIC Educational Resources Information Center

    Gross, Thomas F.

    2008-01-01

    The recognition of facial immaturity and emotional expression by children with autism, language disorders, mental retardation, and non-disabled controls was studied in two experiments. Children identified immaturity and expression in upright and inverted faces. The autism group identified fewer immature faces and expressions than control (Exp. 1 &…

  20. Developmental Changes in the Primacy of Facial Cues for Emotion Recognition

    ERIC Educational Resources Information Center

    Leitzke, Brian T.; Pollak, Seth D.

    2016-01-01

    There have been long-standing differences of opinion regarding the influence of the face relative to that of contextual information on how individuals process and judge facial expressions of emotion. However, developmental changes in how individuals use such information have remained largely unexplored and could be informative in attempting to…

  1. Water Uptake along the Length of Grapevine Fine Roots: Developmental anatomy, tissue specific aquaporin expression, and pathways of water transport

    USDA-ARS?s Scientific Manuscript database

    To better understand water uptake patterns in root systems of woody perennial crops, we detailed the developmental anatomy and hydraulic physiology along the length of grapevine fine roots- from the tip to secondary growth zones. Our characterization included localization of suberized structures an...

  2. Clinical Decision Making and Preference Assessment for Individuals with Intellectual and Developmental Disabilities

    ERIC Educational Resources Information Center

    Virués-Ortega, Javier; Pritchard, Kristen; Grant, Robin L.; North, Sebastian; Hurtado-Parrado, Camilo; Lee, May S. H.; Temple, Bev; Julio, Flavia; Yu, C. T.

    2014-01-01

    Individuals with intellectual or developmental disabilities are able to reliably express their likes and dislikes through direct preference assessment. Preferred items tend to function as rewards and can therefore be used to facilitate the acquisition of new skills and promote task engagement. A number of preference assessment methods are…

  3. My Solar System: A Developmentally Adapted Eco-Mapping Technique for Children

    ERIC Educational Resources Information Center

    Curry, Jennifer R.; Fazio-Griffith, Laura J.; Rohr, Shannon N.

    2008-01-01

    Counseling children requires specific skills and techniques, such as play therapy and expressive arts, to address developmental manifestations and to facilitate the understanding of presenting problems. This article outlines an adapted eco-mapping activity that can be used as a creative counseling technique with children in order to promote…

  4. Positive Approaches: A Sexuality Guide for Teaching Developmentally Disabled Persons.

    ERIC Educational Resources Information Center

    Maurer, Lisa

    This guide is intended to assist caregivers of people with development disabilities in acquiring knowledge about sexuality and skill in expressing sexuality in a safe and appropriate manner. Section 1 provides an overview of the history of sexuality and developmentally disabled individuals. The second section provides exercises for the caregiver…

  5. Developmental Markers of Genetic Liability to Autism in Parents: A Longitudinal, Multigenerational Study

    ERIC Educational Resources Information Center

    Losh, Molly; Martin, Gary E.; Lee, Michelle; Klusek, Jessica; Sideris, John; Barron, Sheila; Wassink, Thomas

    2017-01-01

    Genetic liability to autism spectrum disorder (ASD) can be expressed in unaffected relatives through subclinical, genetically meaningful traits, or endophenotypes. This study aimed to identify developmental endophenotypes in parents of individuals with ASD by examining parents' childhood academic development over the school-age period. A cohort of…

  6. Carbamazepine- or Oxcarbazepine-Induced Hyponatraemia or Leucopenia, or Both, in Residents with a Developmental Disability.

    ERIC Educational Resources Information Center

    Heiskala, Hannu; Tokola, Ritta; Tammisto, Paavo; Kaski, Markus

    1997-01-01

    A study investigated the prevalence of carbamazepine- or oxcarbazepine-induced hyponatraemia and leucopenia in 334 Finnish individuals with developmental disabilities. Medication with these drugs resulted in significantly lower levels of serum sodium and counts of blood leucocytes. Because of difficulties in expressing their symptoms, this…

  7. What Counts as a Developmental Sequence? Exemplar-Based L2 Learning of English Questions

    ERIC Educational Resources Information Center

    Eskildsen, Søren W.

    2015-01-01

    Drawing on usage-based linguistics and its exemplar-based path of language learning, from recurring multiword expressions to increasingly abstract, schematized constructions, this article examines evidence for the exemplar-based developmental sequences for yes/no interrogatives and WH interrogatives in English as a second language (L2). The…

  8. The Effects of Psychopathology on the Pain Expression of Children and Youth with Intellectual and Developmental Disabilities

    ERIC Educational Resources Information Center

    Breau, Lynn M.; Camfield, Carol S.

    2011-01-01

    Behavioral pain assessment is possible for children and youth with intellectual and developmental disabilities (IDD). However, pain behavior is often misinterpreted as reflecting psychopathology. We examined whether psychopathology alters pain behavior. Caregivers of 123 children (56 girls ages 40 to 258 months) completed the Non-Communicating…

  9. MGOUN1 encodes an Arabidopsis type IB DNA topoisomerase required in stem cell regulation and to maintain developmentally regulated gene silencing.

    PubMed

    Graf, Philipp; Dolzblasz, Alicja; Würschum, Tobias; Lenhard, Michael; Pfreundt, Ulrike; Laux, Thomas

    2010-03-01

    Maintenance of stem cells in the Arabidopsis thaliana shoot meristem is regulated by signals from the underlying cells of the organizing center, provided through the transcription factor WUSCHEL (WUS). Here, we report the isolation of several independent mutants of MGOUN1 (MGO1) as genetic suppressors of ectopic WUS activity and enhancers of stem cell defects in hypomorphic wus alleles. mgo1 mutants have previously been reported to result in a delayed progression of meristem cells into differentiating organ primordia (Laufs et al., 1998). Genetic analyses indicate that MGO1 functions together with WUS in stem cell maintenance at all stages of shoot and floral meristems. Synergistic interactions of mgo1 with several chromatin mutants suggest that MGO1 affects gene expression together with chromatin remodeling pathways. In addition, the expression states of developmentally regulated genes are randomly switched in mgo1 in a mitotically inheritable way, indicating that MGO1 stabilizes epigenetic states against stochastically occurring changes. Positional cloning revealed that MGO1 encodes a putative type IB topoisomerase, which in animals and yeast has been shown to be required for regulation of DNA coiling during transcription and replication. The specific developmental defects in mgo1 mutants link topoisomerase IB function in Arabidopsis to stable propagation of developmentally regulated gene expression.

  10. Progranulin regulates neurogenesis in the developing vertebrate retina.

    PubMed

    Walsh, Caroline E; Hitchcock, Peter F

    2017-09-01

    We evaluated the expression and function of the microglia-specific growth factor, Progranulin-a (Pgrn-a) during developmental neurogenesis in the embryonic retina of zebrafish. At 24 hpf pgrn-a is expressed throughout the forebrain, but by 48 hpf pgrn-a is exclusively expressed by microglia and/or microglial precursors within the brain and retina. Knockdown of Pgrn-a does not alter the onset of neurogenic programs or increase cell death, however, in its absence, neurogenesis is significantly delayed-retinal progenitors fail to exit the cell cycle at the appropriate developmental time and postmitotic cells do not acquire markers of terminal differentiation, and microglial precursors do not colonize the retina. Given the link between Progranulin and cell cycle regulation in peripheral tissues and transformed cells, we analyzed cell cycle kinetics among retinal progenitors following Pgrn-a knockdown. Depleting Pgrn-a results in a significant lengthening of the cell cycle. These data suggest that Pgrn-a plays a dual role during nervous system development by governing the rate at which progenitors progress through the cell cycle and attracting microglial progenitors into the embryonic brain and retina. Collectively, these data show that Pgrn-a governs neurogenesis by regulating cell cycle kinetics and the transition from proliferation to cell cycle exit and differentiation. © 2017 The Authors. Developmental Neurobiology Published by Wiley Periodicals, Inc. Develop Neurobiol 77: 1114-1129, 2017. © 2017 The Authors. Developmental Neurobiology Published by Wiley Periodicals, Inc.

  11. Scriptaid and 5-aza-2'deoxycytidine enhanced expression of pluripotent genes and in vitro developmental competence in interspecies Black-footed cat cloned embryos

    USGS Publications Warehouse

    Gómez, M. C.; Biancardi, M.N.; Jenkins, J.A.; Dumas, C.; Galiguis, J.; Wang, G.; Earle Pope, C.

    2012-01-01

    Somatic cell nuclear transfer offers the possibility of preserving endangered species including the black-footed cat, which is threatened with extinction. The effectiveness and efficiency of somatic cell nuclear transfer (SCNT) depends on a variety of factors, but 'inappropriate epigenetic reprogramming of the transplanted nucleus is the primary cause of the developmental failure of cloned embryos. Abnormal epigenetic events such as DNA methylation and histone modifications during SCNT perturb the expression of imprinted and pluripotent-related genes that, consequently, may result in foetal and neonatal abnormalities. We have demonstrated that pregnancies can be established after transfer of black-footed cat cloned embryos into domestic cat recipients, but none of the implanted embryos developed to term and the foetal failure has been associated to aberrant reprogramming in cloned embryos. There is growing evidence that modifying the epigenetic pattern of the chromatin template of both donor cells and reconstructed embryos with a combination of inhibitors of histone deacetylases and DNA methyltransferases results in enhanced gene reactivation and improved in vitro and in vivo developmental competence. Epigenetic modifications of the chromatin template of black-footed cat donor cells and reconstructed embryos with epigenetic-modifying compounds enhanced in vitro development, and regulated the expression of pluripotent genes, but these epigenetic modifications did not improve in vivo developmental competence.

  12. Changes in cytokinins are sufficient to alter developmental patterns of defense metabolites in Nicotiana attenuata

    PubMed Central

    Brütting, Christoph; Schäfer, Martin; Vanková, Radomira; Gase, Klaus; Baldwin, Ian T.; Meldau, Stefan

    2016-01-01

    Plant defense metabolites are well-known to be regulated developmentally. The OD theory posits that a tissue’s fitness values and probability of attack should determine defense metabolite allocations. Young leaves are expected to provide a larger fitness-value to the plant and therefore their defense allocations should be higher when compared to older leaves. The mechanisms which coordinate development with defense remain unknown and frequently confound tests of the OD theory predictions. Here we demonstrate that cytokinins modulate ontogeny-dependent defenses in Nicotiana attenuata. We found that leaf cytokinin levels highly correlate with inducible defense expressions with high levels in young and low levels in older leaves. We genetically manipulated the developmental patterns of two different cytokinin classes by using senescence- and chemically-inducible expression of cytokinin biosynthesis genes. Genetically modifying the levels of different cytokinins in leaves was sufficient to alter ontogenic patterns of defense metabolites. We conclude that the developmental regulation of growth hormones that include cytokinins plays central roles in connecting development with defense and therefore in establishing optimal patterns of defense allocation in plants. PMID:27557345

  13. MicroRNAs: New Players in Anesthetic-Induced Developmental Neurotoxicity

    PubMed Central

    Twaroski, Danielle; Bosnjak, Zeljko J.; Bai, Xiaowen

    2015-01-01

    Growing evidence demonstrates that prolonged exposure to general anesthetics during brain development induces widespread neuronal cell death followed by long-term memory and learning disabilities in animal models. These studies have raised serious concerns about the safety of anesthetic use in pregnant women and young children. However, the underlying mechanisms of anesthetic-induced neurotoxicity are complex and are not well understood. MicroRNAs are endogenous, small, non-coding RNAs that have been implicated to play important roles in many different disease processes by negatively regulating target gene expression. A possible role for microRNAs in anesthetic-induced developmental neurotoxicity has recently been identified, suggesting that microRNA-based signaling might be a novel target for preventing the neurotoxicity. Here we provide an overview of anesthetic-induced developmental neurotoxicity and focus on the role of microRNAs in the neurotoxicity observed in both human stem cell-derived neuron and animal models. Aberrant expression of some microRNAs has been shown to be involved in anesthetic-induced developmental neurotoxicity, revealing the potential of microRNAs as therapeutic or preventive targets against the toxicity. PMID:26146587

  14. Predictive Models of Cognitive Outcomes of Developmental Insults

    NASA Astrophysics Data System (ADS)

    Chan, Yupo; Bouaynaya, Nidhal; Chowdhury, Parimal; Leszczynska, Danuta; Patterson, Tucker A.; Tarasenko, Olga

    2010-04-01

    Representatives of Arkansas medical, research and educational institutions have gathered over the past four years to discuss the relationship between functional developmental perturbations and their neurological consequences. We wish to track the effect on the nervous system by developmental perturbations over time and across species. Except for perturbations, the sequence of events that occur during neural development was found to be remarkably conserved across mammalian species. The tracking includes consequences on anatomical regions and behavioral changes. The ultimate goal is to develop a predictive model of long-term genotypic and phenotypic outcomes that includes developmental insults. Such a model can subsequently be fostered into an educated intervention for therapeutic purposes. Several datasets were identified to test plausible hypotheses, ranging from evoked potential datasets to sleep-disorder datasets. An initial model may be mathematical and conceptual. However, we expect to see rapid progress as large-scale gene expression studies in the mammalian brain permit genome-wide searches to discover genes that are uniquely expressed in brain circuits and regions. These genes ultimately control behavior. By using a validated model we endeavor to make useful predictions.

  15. 20-Hydroxyecdysone (20E) Primary Response Gene E75 Isoforms Mediate Steroidogenesis Autoregulation and Regulate Developmental Timing in Bombyx*

    PubMed Central

    Li, Kang; Tian, Ling; Guo, Zhongjian; Guo, Sanyou; Zhang, Jianzhen; Gu, Shi-Hong; Palli, Subba R.; Cao, Yang; Li, Sheng

    2016-01-01

    The temporal control mechanisms that precisely control animal development remain largely elusive. The timing of major developmental transitions in insects, including molting and metamorphosis, is coordinated by the steroid hormone 20-hydroxyecdysone (20E). 20E involves feedback loops to maintain pulses of ecdysteroid biosynthesis leading to its upsurge, whereas the underpinning molecular mechanisms are not well understood. Using the silkworm Bombyx mori as a model, we demonstrated that E75, the 20E primary response gene, mediates a regulatory loop between ecdysteroid biosynthesis and 20E signaling. E75 isoforms A and C directly bind to retinoic acid receptor-related response elements in Halloween gene promoter regions to induce gene expression thus promoting ecdysteroid biosynthesis and developmental transition, whereas isoform B antagonizes the transcriptional activity of isoform A/C through physical interaction. As the expression of E75 isoforms is differentially induced by 20E, the E75-mediated regulatory loop represents a fine autoregulation of steroidogenesis, which contributes to the precise control of developmental timing. PMID:27365399

  16. NCT and Culture-Conscious Developmental Science

    ERIC Educational Resources Information Center

    Downing-Wilson, Deborah; Pelaprat, Etienne; Rosero, Ivan; Vadeboncoeur, Jennifer; Packer, Martin; Cole, Michael

    2013-01-01

    The authors share the belief that there is great potential for developmental science in bringing the ideas of Niche Construction Theory (NCT), as developed in evolutionary biology, into conversation with Vygotskian-inspired theories such as cultural-historical and activity theories, distributed cognition, and embodied cognition, although from…

  17. A Transcriptome Atlas of Physcomitrella patens Provides Insights into the Evolution and Development of Land Plants.

    PubMed

    Ortiz-Ramírez, Carlos; Hernandez-Coronado, Marcela; Thamm, Anna; Catarino, Bruno; Wang, Mingyi; Dolan, Liam; Feijó, José A; Becker, Jörg D

    2016-02-01

    Identifying the genetic mechanisms that underpin the evolution of new organ and tissue systems is an aim of evolutionary developmental biology. Comparative functional genetic studies between angiosperms and bryophytes can define those genetic changes that were responsible for developmental innovations. Here, we report the generation of a transcriptome atlas covering most phases in the life cycle of the model bryophyte Physcomitrella patens, including detailed sporophyte developmental progression. We identified a comprehensive set of sporophyte-specific transcription factors, and found that many of these genes have homologs in angiosperms that function in developmental processes such as flowering and shoot branching. Deletion of the PpTCP5 transcription factor results in development of supernumerary sporangia attached to a single seta, suggesting that it negatively regulates branching in the moss sporophyte. Given that TCP genes repress branching in angiosperms, we suggest that this activity is ancient. Finally, comparison of P. patens and Arabidopsis thaliana transcriptomes led us to the identification of a conserved core of transcription factors expressed in tip-growing cells. We identified modifications in the expression patterns of these genes that could account for developmental differences between P. patens tip-growing cells and A. thaliana pollen tubes and root hairs. Copyright © 2016 The Author. Published by Elsevier Inc. All rights reserved.

  18. Effects of gamma radiation on the early developmental stages of Zebrafish (Danio rerio).

    PubMed

    Praveen Kumar, M K; Shyama, S K; Kashif, Shamim; Dubey, S K; Avelyno, D'costa; Sonaye, B H; Kadam Samit, B; Chaubey, R C

    2017-08-01

    The zebrafish is gaining importance as a popular vertebrate model organism and is widely employed in ecotoxicological studies, especially for the biomonitoring of pollution in water bodies. There is limited data on the genetic mechanisms governing the adverse health effects in regards to an early developmental exposure to gamma radiation. In the present study zebrafish (Danio rerio) embryos were exposed to 1, 2.5, 5, 7.5 and 10Gy of gamma radiation at 3h post fertilization (hpf). Different developmental toxicity endpoints were investigated. Further, expression of genes associated with the development and DNA damage i.e. (sox2 sox19a and p53) were evaluated using Quantitative PCR (qPCR). The significant changes in the expression of sox2 sox19a and p53 genes were observed. This data was supported the developmental defects observed in the zebrafish embryo exposed to gamma radiation such as i.e. increased DNA damage, decreased hatching rate, increase in median hatching time, decreased body length, increased mortality rate, increased morphological deformities. Further, study shows that the potential ecotoxicological threat of gamma radiation on the early developmental stages of zebrafish. Further, it revealed that the above parameters can be used as predictive biomarkers of gamma radiation exposure. Copyright © 2017. Published by Elsevier Inc.

  19. GATA simple sequence repeats function as enhancer blocker boundaries.

    PubMed

    Kumar, Ram P; Krishnan, Jaya; Pratap Singh, Narendra; Singh, Lalji; Mishra, Rakesh K

    2013-01-01

    Simple sequence repeats (SSRs) account for ~3% of the human genome, but their functional significance still remains unclear. One of the prominent SSRs the GATA tetranucleotide repeat has preferentially accumulated in complex organisms. GATA repeats are particularly enriched on the human Y chromosome, and their non-random distribution and exclusive association with genes expressed during early development indicate their role in coordinated gene regulation. Here we show that GATA repeats have enhancer blocker activity in Drosophila and human cells. This enhancer blocker activity is seen in transgenic as well as native context of the enhancers at various developmental stages. These findings ascribe functional significance to SSRs and offer an explanation as to why SSRs, especially GATA, may have accumulated in complex organisms.

  20. Ancient Eukaryotic Origin and Evolutionary Plasticity of Nuclear Lamina

    PubMed Central

    Field, Mark C.

    2016-01-01

    Abstract The emergence of the nucleus was a major event of eukaryogenesis. How the nuclear envelope (NE) arose and acquired functions governing chromatin organization and epigenetic control has direct bearing on origins of developmental/stage-specific expression programs. The configuration of the NE and the associated lamina in the last eukaryotic common ancestor (LECA) is of major significance and can provide insight into activities within the LECA nucleus. Subsequent lamina evolution, alterations, and adaptations inform on the variation and selection of distinct mechanisms that subtend gene expression in distinct taxa. Understanding lamina evolution has been difficult due to the diversity and limited taxonomic distributions of the three currently known highly distinct nuclear lamina. We rigorously searched available sequence data for an expanded view of the distribution of known lamina and lamina-associated proteins. While the lamina proteins of plants and trypanosomes are indeed taxonomically restricted, homologs of metazoan lamins and key lamin-binding proteins have significantly broader distributions, and a lamin gene tree supports vertical evolution from the LECA. Two protist lamins from highly divergent taxa target the nucleus in mammalian cells and polymerize into filamentous structures, suggesting functional conservation of distant lamin homologs. Significantly, a high level of divergence of lamin homologs within certain eukaryotic groups and the apparent absence of lamins and/or the presence of seemingly different lamina proteins in many eukaryotes suggests great evolutionary plasticity in structures at the NE, and hence mechanisms of chromatin tethering and epigenetic gene control. PMID:27189989

  1. Expressive Vocabulary in Young Children with Down Syndrome: From Research to Treatment.

    ERIC Educational Resources Information Center

    Kumin, Libby; Councill, Cheryl; Goodman, Mina

    1999-01-01

    Expressive vocabulary was studied in 130 children (ages 1 to 5 years) with Down syndrome. Although there was continuous growth in expressive referential vocabulary from birth through 5 years, age 5 was found to be an important developmental marker for multiword combinations and grammatical vocabulary. (Author/CR)

  2. Developmental and feedforward control of the expression of folate biosynthesis genes in tomato fruit

    USDA-ARS?s Scientific Manuscript database

    Little is known about how plants regulate their folate content, including whether the expression of folate biosynthesis genes is orchestrated during development or modulated by folate levels. Nor is much known about how folate levels impact the expression of other genes. These points were addressed ...

  3. Molecular cloning and expression analysis of Sox3 during gonad and embryonic development in Misgurnus anguillicaudatus.

    PubMed

    Xia, Xiaohua; Huo, Weiran; Wan, Ruyan; Zhang, Linxia; Xia, Xiaopei; Chang, Zhongjie

    2017-01-01

    Sox3 is a single-exon gene located on the X chromosome in most vertebrates. It belongs to the SoxB1 subfamily, which is part of the larger Sox family. Previous studies have revealed that Sox3 is expressed in many fish species. However, how Sox3 influences the development of Misgurnus anguillicaudatus remains unknown. In this study, a Sox3 homologue, termed MaSox3, was cloned from the brain of M. anguillicaudatus using homology-based cloning and the rapid amplification of cDNA ends method. Sequence analysis reveals that MaSox3 encodes a hydrophilic protein, which contains a characteristic HMG-box DNA-binding domain of 79 amino acids, and shares high homology with Sox3 in other species. Additionally, quantitative real-time reverse transcription PCR and in situ hybridization showed that MaSox3 is consistently expressed during embryogenesis, with peak expression during the neurula stage and broad expression in the central nervous system. Moreover, tissue distribution analyses have revealed that MaSox3 is abundant in the adult brain, the particle cell layer, and the gonad. Additionally, its expression is observed in primary spermatocyte cells, primary oocytes and previtellogenic oocyte cells. Taken together, all of these results suggest that the expression of the MaSox3 gene is highly conserved during vertebrate evolution and involved in a wide range of developmental processes including embryogenesis, neurogenesis and gonad development.

  4. Resource quality affects weapon and testis size and the ability of these traits to respond to selection in the leaf-footed cactus bug, Narnia femorata.

    PubMed

    Sasson, Daniel A; Munoz, Patricio R; Gezan, Salvador A; Miller, Christine W

    2016-04-01

    The size of weapons and testes can be central to male reproductive success. Yet, the expression of these traits is often extremely variable. Studies are needed that take a more complete organism perspective, investigating the sources of variation in both traits simultaneously and using developmental conditions that mimic those in nature. In this study, we investigated the components of variation in weapon and testis sizes using the leaf-footed cactus bug, Narnia femorata (Hemiptera: Coreidae) on three natural developmental diets. We show that the developmental diet has profound effects on both weapon and testis expression and scaling. Intriguingly, males in the medium-quality diet express large weapons but have relatively tiny testes, suggesting complex allocation decisions. We also find that heritability, evolvability, and additive genetic variation are highest in the high-quality diet for testis and body mass. This result suggests that these traits may have an enhanced ability to respond to selection during a small window of time each year when this diet is available. Taken together, these results illustrate that normal, seasonal fluctuations in the nutritional environment may play a large role in the expression of sexually selected traits and the ability of these traits to respond to selection.

  5. Prenatal ethanol exposure-induced adrenal developmental abnormality of male offspring rats and its possible intrauterine programming mechanisms

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Huang, Hegui; He, Zheng; Zhu, Chunyan

    Fetal adrenal developmental status is the major determinant of fetal tissue maturation and offspring growth. We have previously proposed that prenatal ethanol exposure (PEE) suppresses fetal adrenal corticosterone (CORT) synthesis. Here, we focused on PEE-induced adrenal developmental abnormalities of male offspring rats before and after birth, and aimed to explore its intrauterine programming mechanisms. A rat model of intrauterine growth retardation (IUGR) was established by PEE (4 g/kg·d). In PEE fetus, increased serum CORT concentration and decreased insulin-like growth factor 1 (IGF1) concentration, with lower bodyweight and structural abnormalities as well as a decreased Ki67 expression (proliferative marker), were observedmore » in the male fetal adrenal cortex. Adrenal glucocorticoid (GC)-metabolic activation system was enhanced while gene expression of IGF1 signaling pathway with steroidogenic acute regulatory protein (StAR), 3β-hydroxysteroid dehydrogenase (3β-HSD) was decreased. Furthermore, in the male adult offspring of PEE, serum CORT level was decreased but IGF1 was increased with partial catch-up growth, and Ki67 expression demonstrated no obvious change. Adrenal GC-metabolic activation system was inhibited, while IGF1 signaling pathway and 3β-HSD was enhanced with the steroidogenic factor 1 (SF1), and StAR was down-regulated in the adult adrenal. Based on these findings, we propose a “two-programming” mechanism for PEE-induced adrenal developmental toxicity: “the first programming” is a lower functional programming of adrenal steroidogenesis, and “the second programming” is GC-metabolic activation system-related GC-IGF1 axis programming. - Highlights: • Prenatal ethanol exposure induces adrenal developmental abnormality in offspring rats. • Prenatal ethanol exposure induces intrauterine programming of adrenal steroidogenesis. • Intrauterine GC-IGF1 axis programming might mediate adrenal developmental abnormality.« less

  6. A test for patterns of modularity in sequences of developmental events.

    PubMed

    Poe, Steven

    2004-08-01

    This study presents a statistical test for modularity in the context of relative timing of developmental events. The test assesses whether sets of developmental events show special phylogenetic conservation of rank order. The test statistic is the correlation coefficient of developmental ranks of the N events of the hypothesized module across taxa. The null distribution is obtained by taking correlation coefficients for randomly sampled sets of N events. This test was applied to two datasets, including one where phylogenetic information was taken into account. The events of limb development in two frog species were found to behave as a module.

  7. Porcine transcriptome analysis based on 97 non-normalized cDNA libraries and assembly of 1,021,891 expressed sequence tags

    PubMed Central

    Gorodkin, Jan; Cirera, Susanna; Hedegaard, Jakob; Gilchrist, Michael J; Panitz, Frank; Jørgensen, Claus; Scheibye-Knudsen, Karsten; Arvin, Troels; Lumholdt, Steen; Sawera, Milena; Green, Trine; Nielsen, Bente J; Havgaard, Jakob H; Rosenkilde, Carina; Wang, Jun; Li, Heng; Li, Ruiqiang; Liu, Bin; Hu, Songnian; Dong, Wei; Li, Wei; Yu, Jun; Wang, Jian; Stærfeldt, Hans-Henrik; Wernersson, Rasmus; Madsen, Lone B; Thomsen, Bo; Hornshøj, Henrik; Bujie, Zhan; Wang, Xuegang; Wang, Xuefei; Bolund, Lars; Brunak, Søren; Yang, Huanming; Bendixen, Christian; Fredholm, Merete

    2007-01-01

    Background Knowledge of the structure of gene expression is essential for mammalian transcriptomics research. We analyzed a collection of more than one million porcine expressed sequence tags (ESTs), of which two-thirds were generated in the Sino-Danish Pig Genome Project and one-third are from public databases. The Sino-Danish ESTs were generated from one normalized and 97 non-normalized cDNA libraries representing 35 different tissues and three developmental stages. Results Using the Distiller package, the ESTs were assembled to roughly 48,000 contigs and 73,000 singletons, of which approximately 25% have a high confidence match to UniProt. Approximately 6,000 new porcine gene clusters were identified. Expression analysis based on the non-normalized libraries resulted in the following findings. The distribution of cluster sizes is scaling invariant. Brain and testes are among the tissues with the greatest number of different expressed genes, whereas tissues with more specialized function, such as developing liver, have fewer expressed genes. There are at least 65 high confidence housekeeping gene candidates and 876 cDNA library-specific gene candidates. We identified differential expression of genes between different tissues, in particular brain/spinal cord, and found patterns of correlation between genes that share expression in pairs of libraries. Finally, there was remarkable agreement in expression between specialized tissues according to Gene Ontology categories. Conclusion This EST collection, the largest to date in pig, represents an essential resource for annotation, comparative genomics, assembly of the pig genome sequence, and further porcine transcription studies. PMID:17407547

  8. The mid-developmental transition and the evolution of animal body plans

    PubMed Central

    Cole, Alison G.; Winter, Eitan; Mostov, Natalia; Khair, Sally; Senderovich, Naftalie; Kovalev, Ekaterina; Silver, David H.; Feder, Martin; Fernandez-Valverde, Selene L.; Nakanishi, Nagayasu; Simmons, David; Simakov, Oleg; Larsson, Tomas; Liu, Shang-Yun; Jerafi-Vider, Ayelet; Yaniv, Karina; Ryan, Joseph F.; Martindale, Mark Q.; Rink, Jochen C.; Arendt, Detlev; Degnan, Sandie M.; Degnan, Bernard M.; Hashimshony, Tamar; Yanai, Itai

    2016-01-01

    Animals are grouped into ~35 ‘phyla’ based upon the notion of distinct body plans1–4. Morphological and molecular analyses have revealed that a stage in the middle of development—known as the phylotypic period—is conserved among species within some phyla5–9. Although these analyses provide evidence for their existence, phyla have also been criticized as lacking an objective definition, and consequently based on arbitrary groupings of animals10. Here we compare the developmental transcriptomes of ten species, each annotated to a different phylum, with a wide range of life histories and embryonic forms. We find that in all ten species, development comprises the coupling of early and late phases of conserved gene expression. These phases are linked by a divergent ‘mid-developmental transition’ that uses species-specific suites of signalling pathways and transcription factors. This mid-developmental transition overlaps with the phylotypic period that has been defined previously for three of the ten phyla, suggesting that transcriptional circuits and signalling mechanisms active during this transition are crucial for defining the phyletic body plan and that the mid-developmental transition may be used to define phylotypic periods in other phyla. Placing these observations alongside the reported conservation of mid-development within phyla, we propose that a phylum may be defined as a collection of species whose gene expression at the mid-developmental transition is both highly conserved among them, yet divergent relative to other species. PMID:26886793

  9. The Developmental Cognitive Neuroscience of Functional Connectivity

    ERIC Educational Resources Information Center

    Stevens, Michael C.

    2009-01-01

    Developmental cognitive neuroscience is a rapidly growing field that examines the relationships between biological development and cognitive ability. In the past decade, there has been ongoing refinement of concepts and methodology related to the study of "functional connectivity" among distributed brain regions believed to underlie cognition and…

  10. Expression of COUP-TFII Nuclear Receptor in Restricted GABAergic Neuronal Populations in the Adult Rat Hippocampus

    PubMed Central

    Fuentealba, Pablo; Klausberger, Thomas; Karayannis, Theofanis; Suen, Wai Yee; Huck, Jojanneke; Tomioka, Ryohei; Rockland, Kathleen; Capogna, Marco; Studer, Michèle; Morales, Marisela; Somogyi, Peter

    2015-01-01

    The COUP-TFII nuclear receptor, also known as NR2F2, is expressed in the developing ventral telencephalon and modulates the tangential migration of a set of subpallial neuronal progenitors during forebrain development. Little information is available about its expression patterns in the adult brain. We have identified the cell populations expressing COUP-TFII and the contribution of some of them to network activity in vivo. Expression of COUP-TFII by hippocampal pyramidal and dentate granule cells, as well as neurons in the neocortex, formed a gradient increasing from undetectable in the dorsal to very strong in the ventral sectors. In the dorsal hippocampal CA1 area, COUP-TFII was restricted to GABAergic interneurons and expressed in several, largely nonoverlapping neuronal populations. Immunoreactivity was present in calretinin-, neuronal nitric oxide synthase-, and reelin-expressing cells, as well as in subsets of cholecystokinin- or calbindin-expressing or radiatum-retrohippocampally projecting GABAergic cells, but not in parvalbumin-and/or somatostatin-expressing interneurons. In vivo recording and juxtacellular labeling of COUP-TFII-expressing cells revealed neurogliaform cells, basket cells in stratum radiatum and tachykinin-expressing radiatum dentate innervating interneurons, identified by their axodendritic distributions. They showed cell type-selective phase-locked firing to the theta rhythm but no activation during sharp wave/ripple oscillations. These basket cells in stratum radiatum and neurogliaform cells fired at the peak of theta oscillations detected extracellularly in stratum pyramidale, unlike previously reported ivy cells, which fired at the trough. The characterization of COUP-TFII-expressing neurons suggests that this developmentally important transcription factor plays cell type-specific role(s)in the adult hippocampus. PMID:20130170

  11. A Direct Comparison of Self-Injurious and Stereotyped Motor Behavior Between Preschool-Aged Children With and Without Developmental Delays

    PubMed Central

    Spofford, Lisa; Dimian, Adele; Tervo, Raymond; MacLean, William E.; Symons, Frank J.

    2016-01-01

    Objective To compare the prevalence of self-injurious behavior (SIB) and stereotyped motor behavior (STY) of preschool-aged children with developmental delays (DD group) and their peers without developmental delays (TD group) using a standardized caregiver report scale. Methods The Repetitive Behavior Scale-Revised was completed by caregivers of children with developmental delays and their peers without developmental delays. Frequency of occurrence and severity ratings for SIB and STY were compared between groups. Results SIB and STY were reported more often and at a greater level of severity in the DD group. Older chronological age was associated with more severe STY in the DD group but not the TD group. Gender was not related to STY or SIB for either group. Conclusions Differences in STY and SIB were evident between preschoolers with and without DD. Findings are discussed from developmental and behavioral psychology perspectives regarding the expression of repetitive behavior in developmentally at-risk pediatric populations. PMID:26514642

  12. Mobile microRNAs hit the target.

    PubMed

    Gursanscky, Nial R; Searle, Iain R; Carroll, Bernard J

    2011-11-01

    MicroRNAs (miRNAs) are negative regulators of gene expression in eukaryotic organisms, whereas small interfering RNAs (siRNAs) guide host-cell defence against viruses, transposons and transgenes. A key issue in plant biology is whether miRNAs act only in cells in which they are formed, or if, like siRNAs, they also function after passive diffusion or active transportation into other cells. Recent reports show that miRNAs are indeed able to move between plant cells to direct developmental programming of gene expression. In both leaf and root development, miRNAs establish intercellular gradients of gene expression that are essential for cell and tissue differentiation. Gradients in gene expression also play crucial roles in animal development, and there is strong evidence for intercellular movement of miRNAs in animals. Thus, intercellular movement of miRNAs may be crucial to animal developmental biology as well as plants. © 2011 John Wiley & Sons A/S.

  13. Definition of Drosophila hemocyte subsets by cell-type specific antigens.

    PubMed

    Kurucz, Eva; Váczi, B; Márkus, R; Laurinyecz, Barbara; Vilmos, P; Zsámboki, J; Csorba, Kinga; Gateff, Elisabeth; Hultmark, D; Andó, I

    2007-01-01

    We analyzed the heterogeneity of Drosophila hemocytes on the basis of the expression of cell-type specific antigens. The antigens characterize distinct subsets which partially overlap with those defined by morphological criteria. On the basis of the expression or the lack of expression of blood cell antigens the following hemocyte populations have been defined: crystal cells, plasmatocytes, lamellocytes and precursor cells. The expression of the antigens and thus the different cell types are developmentally regulated. The hemocytes are arranged in four main compartments: the circulating blood cells, the sessile tissue, the lymph glands and the posterior hematopoietic tissue. Each hemocyte compartment has a specific and characteristic composition of the various cell types. The described markers represent the first successful attempt to define hemocyte lineages by immunological markers in Drosophila and help to define morphologically, functionally, spatially and developmentally distinct subsets of hemocytes.

  14. Notch-dependent epithelial fold determines boundary formation between developmental fields in the Drosophila antenna.

    PubMed

    Ku, Hui-Yu; Sun, Y Henry

    2017-07-01

    Compartment boundary formation plays an important role in development by separating adjacent developmental fields. Drosophila imaginal discs have proven valuable for studying the mechanisms of boundary formation. We studied the boundary separating the proximal A1 segment and the distal segments, defined respectively by Lim1 and Dll expression in the eye-antenna disc. Sharp segregation of the Lim1 and Dll expression domains precedes activation of Notch at the Dll/Lim1 interface. By repressing bantam miRNA and elevating the actin regulator Enable, Notch signaling then induces actomyosin-dependent apical constriction and epithelial fold. Disruption of Notch signaling or the actomyosin network reduces apical constriction and epithelial fold, so that Dll and Lim1 cells become intermingled. Our results demonstrate a new mechanism of boundary formation by actomyosin-dependent tissue folding, which provides a physical barrier to prevent mixing of cells from adjacent developmental fields.

  15. Developmental language and speech disability.

    PubMed

    Spiel, G; Brunner, E; Allmayer, B; Pletz, A

    2001-09-01

    Speech disabilities (articulation deficits) and language disorders--expressive (vocabulary) receptive (language comprehension) are not uncommon in children. An overview of these along with a global description of the impairment of communication as well as clinical characteristics of language developmental disorders are presented in this article. The diagnostic tables, which are applied in the European and Anglo-American speech areas, ICD-10 and DSM-IV, have been explained and compared. Because of their strengths and weaknesses an alternative classification of language and speech developmental disorders is proposed, which allows a differentiation between expressive and receptive language capabilities with regard to the semantic and the morphological/syntax domains. Prevalence and comorbidity rates, psychosocial influences, biological factors and the biological social interaction have been discussed. The necessity of the use of standardized examinations is emphasised. General logopaedic treatment paradigms, specific therapy concepts and an overview of prognosis have been described.

  16. Longitudinal prediction of language emergence in infants at high and low risk for autism spectrum disorder.

    PubMed

    Edmunds, Sarah R; Ibañez, Lisa V; Warren, Zachary; Messinger, Daniel S; Stone, Wendy L

    2017-02-01

    This study used a prospective longitudinal design to examine the early developmental pathways that underlie language growth in infants at high risk (n = 50) and low risk (n = 34) for autism spectrum disorder in the first 18 months of life. While motor imitation and responding to joint attention (RJA) have both been found to predict expressive language in children with autism spectrum disorder and those with typical development, the longitudinal relation between these capacities has not yet been identified. As hypothesized, results revealed that 15-month RJA mediated the association between 12-month motor imitation and 18-month expressive vocabulary, even after controlling for earlier levels of RJA and vocabulary. These results provide new information about the developmental sequencing of skills relevant to language growth that may inform future intervention efforts for children at risk for language delay or other developmental challenges.

  17. Notch-dependent epithelial fold determines boundary formation between developmental fields in the Drosophila antenna

    PubMed Central

    2017-01-01

    Compartment boundary formation plays an important role in development by separating adjacent developmental fields. Drosophila imaginal discs have proven valuable for studying the mechanisms of boundary formation. We studied the boundary separating the proximal A1 segment and the distal segments, defined respectively by Lim1 and Dll expression in the eye-antenna disc. Sharp segregation of the Lim1 and Dll expression domains precedes activation of Notch at the Dll/Lim1 interface. By repressing bantam miRNA and elevating the actin regulator Enable, Notch signaling then induces actomyosin-dependent apical constriction and epithelial fold. Disruption of Notch signaling or the actomyosin network reduces apical constriction and epithelial fold, so that Dll and Lim1 cells become intermingled. Our results demonstrate a new mechanism of boundary formation by actomyosin-dependent tissue folding, which provides a physical barrier to prevent mixing of cells from adjacent developmental fields. PMID:28708823

  18. Gene Expression Data from the Moon Jelly, Aurelia, Provide Insights into the Evolution of the Combinatorial Code Controlling Animal Sense Organ Development.

    PubMed

    Nakanishi, Nagayasu; Camara, Anthony C; Yuan, David C; Gold, David A; Jacobs, David K

    2015-01-01

    In Bilateria, Pax6, Six, Eya and Dach families of transcription factors underlie the development and evolution of morphologically and phyletically distinct eyes, including the compound eyes in Drosophila and the camera-type eyes in vertebrates, indicating that bilaterian eyes evolved under the strong influence of ancestral developmental gene regulation. However the conservation in eye developmental genetics deeper in the Eumetazoa, and the origin of the conserved gene regulatory apparatus controlling eye development remain unclear due to limited comparative developmental data from Cnidaria. Here we show in the eye-bearing scyphozoan cnidarian Aurelia that the ectodermal photosensory domain of the developing medusa sensory structure known as the rhopalium expresses sine oculis (so)/six1/2 and eyes absent/eya, but not optix/six3/6 or pax (A&B). In addition, the so and eya co-expression domain encompasses the region of active cell proliferation, neurogenesis, and mechanoreceptor development in rhopalia. Consistent with the role of so and eya in rhopalial development, developmental transcriptome data across Aurelia life cycle stages show upregulation of so and eya, but not optix or pax (A&B), during medusa formation. Moreover, pax6 and dach are absent in the Aurelia genome, and thus are not required for eye development in Aurelia. Our data are consistent with so and eya, but not optix, pax or dach, having conserved functions in sensory structure specification across Eumetazoa. The lability of developmental components including Pax genes relative to so-eya is consistent with a model of sense organ development and evolution that involved the lineage specific modification of a combinatorial code that specifies animal sense organs.

  19. A heterologous hormone response element enhances expression of rat beta-casein promoter-driven chloramphenicol acetyltransferase fusion genes in the mammary gland of transgenic mice.

    PubMed

    Greenberg, N M; Reding, T V; Duffy, T; Rosen, J M

    1991-10-01

    Previous studies have demonstrated that the entire rat beta-casein (R beta C) gene and a -524/+490 R beta C fragment-chloramphenicol acetyltransferase (CAT) fusion gene are expressed preferentially in the mammary gland of transgenic mice in a developmentally regulated fashion. However, transgene expression was infrequent, less than 1% of that observed for the endogenous gene, and varied as much as 500-fold, presumably due to the site of chromosomal integration. To determine whether a heterologous hormone-responsive enhancer could be used to increase both the level and frequency of expression in the mammary gland, a fragment derived from the mouse mammary tumor virus long terminal repeat containing four hormone response elements (HREs) was inserted into the R beta C promoter at a site not known to contain transcriptional regulatory elements. Transgenic mice generated which carried HRE-enhanced R beta C-CAT fusion genes expressed CAT activity in the mammary glands of all founder lines examined at levels that were on average 13-fold greater than for lines generated with similar constructs not carrying HREs. In the highest expressing line, the level of HRE-enhanced transgene expression was found to be developmentally regulated, increasing 14-fold in the mammary gland from virgin to day 10 of lactation. In this line, expression was also observed in the thymus and spleen; however, the level of CAT activity was 4-fold lower than in the mammary gland and was not developmentally regulated. In adrenalectomized mice, the administration of dexamethasone stimulated CAT expression in the mammary gland but not in the thymus and spleen. These studies demonstrate that in the context of the R beta C promoter, the HRE functions in the mammary gland to increase both the frequency and level of transgene expression.

  20. Eye-Specific Gene Expression following Embryonic Ethanol Exposure in Zebrafish: Roles for Heat Shock Factor 1

    PubMed Central

    Kashyap, Bhavani; Pegorsch, Laurel; Frey, Ruth A.; Sun, Chi; Shelden, Eric A.; Stenkamp, Deborah L.

    2014-01-01

    The mechanisms through which ethanol exposure results in developmental defects remain unclear. We used the zebrafish model to elucidate eye-specific mechanisms that underlie ethanol-mediated microphthalmia (reduced eye size), through time-series microarray analysis of gene expression within eyes of embryos exposed to 1.5% ethanol. 62 genes were differentially expressed (DE) in ethanol-treated as compared to control eyes sampled during retinal neurogenesis (24-48 hours post-fertilization). The EDGE (extraction of differential gene expression) algorithm identified >3000 genes DE over developmental time in ethanol-exposed eyes as compared to controls. The DE lists included several genes indicating a mis-regulated cellular stress response due to ethanol exposure. Combined treatment with sub-threshold levels of ethanol and a morpholino targeting heat shock factor 1 mRNA resulted in microphthalmia, suggesting convergent molecular pathways. Thermal preconditioning partially prevented ethanol-mediated microphthalmia while maintaining Hsf-1 expression. These data suggest roles for reduced Hsf-1 in mediating microphthalmic effects of embryonic ethanol exposure. PMID:24355176

  1. The mouse F3/contactin glycoprotein

    PubMed Central

    Bizzoca, Antonella; Corsi, Patrizia

    2009-01-01

    F3/Contactin is an immunoglobulin superfamily component expressed in the nervous tissue of several species. Here we focus on the structural and functional properties of its mouse relative, on the mechanisms driving its regulated expression and on its developmental role. F3/Contactin is differentially expressed in distinct populations of central and peripheral neurons and in some non-neuronal cells. Accordingly, the regulatory region of the underlying gene includes promoter elements undergoing differential activation, associated with an intricate splicing profile, indicating that transcriptional and posttranscriptional mechanisms contribute to its expression. Transgenic models allowed to follow F3/Contactin promoter activation in vivo and to modify F3/Contactin gene expression under a heterologous promoter, which resulted in morphological and functional phenotypes. Besides axonal growth and pathfinding, these concerned earlier events, including precursor proliferation and commitment. This wide role in neural ontogenesis is consistent with the recognized interaction of F3/Contactin with developmental control genes belonging to the Notch pathway. PMID:19372728

  2. Molecular characterization and functional analysis of Eimeria tenella malate dehydrogenase.

    PubMed

    Chen, Ting; Huang, Bing; Zhao, Qiping; Dong, Hui; Zhu, Shunhai; Zhao, Zongping; Lv, Ling; Yan, Ming; Han, Hongyu

    2018-05-08

    Eimeria tenella is a serious intracellular parasite that actively invades cecal epithelial cells of chickens. The widespread use of drugs causes severe resistance to Eimeria tenella. We detected that malate dehydrogenase (MDH), one of the differentially expressed genes, was upregulated in diclazuril-resistant and maduramicin-resistant strains through transcriptome sequencing. In this study, we cloned and expressed MDH of E. tenella (EtMDH). Quantitative real-time polymerase chain reactions (qPCR) and Western blots were used to analyze the expression of EtMDH in resistant and sensitive strains, indicating EtMDH was upregulated in two resistant strains at the messenger RNA and protein levels. Enzyme activity was tested through absorbance measurement and the EtMDH activity increased in two resistant strains. Expression levels of EtMDH in four developmental stages of E. tenella were tested through qPCR and Western blot. Invasion inhibition assays explored if EtMDH was involved in invasion of DF-1 cells by E. tenella sporozoites. Indirect immunofluorescence assays investigated EtMDH distribution during parasite development in DF-1 cells invaded by E. tenella sporozoites. Experimental results showed that EtMDH may be related to drug resistance of E. tenella during its development and invasion. EtMDH may be an effective molecular marker for detection of E. tenella drug resistance.

  3. Differential cadherin expression in the developing postnatal telencephalon of a New World monkey.

    PubMed

    Matsunaga, Eiji; Nambu, Sanae; Oka, Mariko; Iriki, Atsushi

    2013-12-01

    Cadherins are cell adhesion molecules widely expressed in the nervous system, where they play various roles in neural patterning, nuclei formation, axon guidance, and synapse formation and function. Although many published articles have reported on cadherin expression in rodents and ferrets, there are limited data on their expression in primate brains. In this study, in situ hybridization analysis was performed for 10 cadherins [nine classic cadherins (Cdh4, -6, -7, -8, -9, -10, -11, -12, and -20) and T-cadherin (Cdh13)] in the developing postnatal telencephalon of the common marmoset (Callithrix jacchus). Each cadherin showed broad expression in the cerebral cortex, basal ganglia, amygdala, and hippocampus, as previously shown in the rodent brain. However, detailed expression patterns differed between rodents and marmosets. In contrast to rodents, cadherin expression was reduced overall and localized to restricted areas of the brain during the developmental process, suggesting that cadherins are more crucially involved in developmental or maturation processes rather than in neural functioning. These results also highlight the possibility that restricted/less redundant cadherin expression allows primate brains to generate functional diversity among neurons, allowing morphological and functional differences between rodents and primates. Copyright © 2013 Wiley Periodicals, Inc.

  4. Developmental programming: prenatal testosterone excess disrupts anti-Müllerian hormone expression in preantral and antral follicles.

    PubMed

    Veiga-Lopez, Almudena; Ye, Wen; Padmanabhan, Vasantha

    2012-03-01

    To investigate the impact of prenatal T excess on the expression of key ovarian regulators implicated in follicular recruitment and persistence using a large animal model of polycystic ovarian syndrome (PCOS). Interventional, animal model study. Academic research unit. A total of 25 female fetuses, 14 prepubertal female, and 24 adult female Suffolk sheep. Prenatal T treatment. Immunohistochemical determination of expression of anti-Müllerian hormone (AMH), kit ligand, and growth differentiation factor 9 (GDF9) in fetal, prepubertal, and adult ovarian tissues. Prenatal T treatment reduced the AMH protein expression in granulosa cells (GC) of preantral follicles and increased its expression in antral follicles compared with age-matched adult controls. These differences were not evident in prepubertal animals. Protein expression of GDF9 and kit ligand was not altered at any of the developmental time points studied. Prenatal T exposure is associated with changes in AMH expression in preantral and antral follicles in adult ovaries, similar to findings in women with PCOS. These findings indicate that abnormal folliculogenesis in PCOS may be at least in part mediated by changes in AMH expression. Copyright © 2012 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  5. Improving Social Understanding of Individuals of Intellectual and Developmental disabilities through a 3D-Facial Expression Intervention Program

    ERIC Educational Resources Information Center

    Cheng, Yufang; Chen, Shuhui

    2010-01-01

    Individuals with intellectual and developmental disabilities (IDD) have specific difficulties in cognitive social-emotional capability, which affect numerous aspects of social competence. This study evaluated the learning effects of using 3D-emotion system intervention program for individuals with IDD in learning socially based-emotions capability…

  6. Common and Unique Impairments in Facial-Expression Recognition in Pervasive Developmental Disorder-Not Otherwise Specified and Asperger's Disorder

    ERIC Educational Resources Information Center

    Uono, Shota; Sato, Wataru; Toichi, Motomi

    2013-01-01

    This study was designed to identify specific difficulties and associated features related to the problems with social interaction experienced by individuals with pervasive developmental disorder-not otherwise specified (PDD-NOS) using an emotion-recognition task. We compared individuals with PDD-NOS or Asperger's disorder (ASP) and typically…

  7. Perfluorooctanoic acid (PFOA)-induced developmental toxicity in the mouse is dependent on expression of peroxisome proliferator activated receptor-alpha (PPAR-α)

    EPA Science Inventory

    PFOA is a member of a family of perfluorinated chemicals that have a variety of applications. PFOA persists in the environment and is found in wildlife and humans. In mice, PFOA is developmentally toxic producing mortality, delayed eye opening, growth deficits, and altered puber...

  8. Interpretation of Anaphoric Dependencies in Russian-Speaking Children with and without Developmental Language Disorder

    ERIC Educational Resources Information Center

    Rakhlin, Natalia; Kornilov, Sergey A.; Reich, Jodi; Grigorenko, Elena L.

    2015-01-01

    We examined anaphora resolution in children with and without Developmental Language Disorder (DLD) to clarify whether (i) DLD is best understood as missing knowledge of certain linguistic operations/elements or as unreliable performance and (ii) if comprehension of sentences with anaphoric expressions as objects and exceptionally case marked (ECM)…

  9. Lasting Effects on Body Weight and Mammary Gland Gene Expression in Female Mice upon Early Life Exposure to n-3 but Not n-6 High-Fat Diets

    EPA Science Inventory

    Exposure to an imbalance of nutrients prior to conception and during critical developmental periods can have lasting consequences on physiological processes resulting in chronic diseases later in life. Developmental programming has been shown to involve structural and functional ...

  10. Factors Related to the Expression of Typical and Atypical Repetitive Movements of Young Children with Intellectual Disability.

    ERIC Educational Resources Information Center

    Wehmeyer, Michael L.

    1994-01-01

    This paper reviews research describing developmentally typical and atypical repetitive motor movements of children with and without disabilities. It then reports findings of a study of nine preschool-aged children with developmental delay and atypical stereotypies. Predictors of repetitive movements included level of functioning, age, ambulation,…

  11. Genome-wide identification of suitable zebrafish Danio rerio reference genes for normalization of gene expression data by RT-qPCR.

    PubMed

    Xu, H; Li, C; Zeng, Q; Agrawal, I; Zhu, X; Gong, Z

    2016-06-01

    In this study, to systematically identify the most stably expressed genes for internal reference in zebrafish Danio rerio investigations, 37 D. rerio transcriptomic datasets (both RNA sequencing and microarray data) were collected from gene expression omnibus (GEO) database and unpublished data, and gene expression variations were analysed under three experimental conditions: tissue types, developmental stages and chemical treatments. Forty-four putative candidate genes were identified with the c.v. <0·2 from all datasets. Following clustering into different functional groups, 21 genes, in addition to four conventional housekeeping genes (eef1a1l1, b2m, hrpt1l and actb1), were selected from different functional groups for further quantitative real-time (qrt-)PCR validation using 25 RNA samples from different adult tissues, developmental stages and chemical treatments. The qrt-PCR data were then analysed using the statistical algorithm refFinder for gene expression stability. Several new candidate genes showed better expression stability than the conventional housekeeping genes in all three categories. It was found that sep15 and metap1 were the top two stable genes for tissue types, ube2a and tmem50a the top two for different developmental stages, and rpl13a and rp1p0 the top two for chemical treatments. Thus, based on the extensive transcriptomic analyses and qrt-PCR validation, these new reference genes are recommended for normalization of D. rerio qrt-PCR data respectively for the three different experimental conditions. © 2016 The Fisheries Society of the British Isles.

  12. RNA Deep Sequencing Reveals Differential MicroRNA Expression during Development of Sea Urchin and Sea Star

    PubMed Central

    Kadri, Sabah; Hinman, Veronica F.; Benos, Panayiotis V.

    2011-01-01

    microRNAs (miRNAs) are small (20–23 nt), non-coding single stranded RNA molecules that act as post-transcriptional regulators of mRNA gene expression. They have been implicated in regulation of developmental processes in diverse organisms. The echinoderms, Strongylocentrotus purpuratus (sea urchin) and Patiria miniata (sea star) are excellent model organisms for studying development with well-characterized transcriptional networks. However, to date, nothing is known about the role of miRNAs during development in these organisms, except that the genes that are involved in the miRNA biogenesis pathway are expressed during their developmental stages. In this paper, we used Illumina Genome Analyzer (Illumina, Inc.) to sequence small RNA libraries in mixed stage population of embryos from one to three days after fertilization of sea urchin and sea star (total of 22,670,000 reads). Analysis of these data revealed the miRNA populations in these two species. We found that 47 and 38 known miRNAs are expressed in sea urchin and sea star, respectively, during early development (32 in common). We also found 13 potentially novel miRNAs in the sea urchin embryonic library. miRNA expression is generally conserved between the two species during development, but 7 miRNAs are highly expressed in only one species. We expect that our two datasets will be a valuable resource for everyone working in the field of developmental biology and the regulatory networks that affect it. The computational pipeline to analyze Illumina reads is available at http://www.benoslab.pitt.edu/services.html. PMID:22216218

  13. [Cloning and expression analysis of differentially expressed genes in Chinese fir stems treated by different concentrations of exogenous IAA].

    PubMed

    Yang, Li-Wei; Shi, Ji-Sen

    2012-04-01

    To reveal the potential genetic mechanisms of indole-3-acetic acid (IAA) that regulate Chinese fir wood formation, cloned the differentially expressed genes via suppress subtractive hybridization (SSH) using the truncated stems treated by 0 and 3 mg IAA/g lanolin as the driver and tester, respectively. A total of 332 unigenes that were involved in cell organization and biosynthesis, developmental processes control, electron transport, stress response, and signal transduction. To further test the results from SSH, we selected those unigenes, whose putative encoding proteins showed significantly homologous with HIRA, PGY1, SMP1, TCT, TRN2, and ARF4, and analyzed their expressed specificity in the wood formative tissues and their response to the secondary developmental changes of vascular cambium stimulated by 0, 1, and 3 mg.IAA/g.lanolin treatment. The results showed that ClHIRA, ClPGY1, and ClARF4, which were specifically expressed in the adaxial zone of stem, were positively response to the activities of cell division and tracheid differentiation stimulated by exogenous IAA treatment. However, ClSMP1, ClTCTP1, and ClTRN2, which were mainly expressed in the abaxial zones of stems, showed negative correlation with the treated levels of exogenous IAA and activities of vascular cambium secondary development at the transcriptional level. This result showed that the differential response of developmental regulatory genes located in different vascular tissues to the level changes of edogenous IAA in stems is likely to be an important molecular mechanism of auxin regulating wood formation.

  14. Sphingolipid Distribution, Content and Gene Expression during Olive-Fruit Development and Ripening

    PubMed Central

    Inês, Carla; Parra-Lobato, Maria C.; Paredes, Miguel A.; Labrador, Juana; Gallardo, Mercedes; Saucedo-García, Mariana; Gavilanes-Ruiz, Marina; Gomez-Jimenez, Maria C.

    2018-01-01

    Plant sphingolipids are involved in the building of the matrix of cell membranes and in signaling pathways of physiological processes and environmental responses. However, information regarding their role in fruit development and ripening, a plant-specific process, is unknown. The present study seeks to determine whether and, if so, how sphingolipids are involved in fleshy-fruit development and ripening in an oil-crop species such as olive (Olea europaea L. cv. Picual). Here, in the plasma-membranes of live protoplasts, we used fluorescence to examine various specific lipophilic stains in sphingolipid-enriched regions and investigated the composition of the sphingolipid long-chain bases (LCBs) as well as the expression patterns of sphingolipid-related genes, OeSPT, OeSPHK, OeACER, and OeGlcCerase, during olive-fruit development and ripening. The results demonstrate increased sphingolipid content and vesicle trafficking in olive-fruit protoplasts at the onset of ripening. Moreover, the concentration of LCB [t18:1(8Z), t18:1 (8E), t18:0, d18:2 (4E/8Z), d18:2 (4E/8E), d18:1(4E), and 1,4-anhydro-t18:1(8E)] increases during fruit development to reach a maximum at the onset of ripening, although these molecular species decreased during fruit ripening. On the other hand, OeSPT, OeSPHK, and OeGlcCerase were expressed differentially during fruit development and ripening, whereas OeACER gene expression was detected only at the fully ripe stage. The results provide novel data about sphingolipid distribution, content, and biosynthesis/turnover gene transcripts during fleshy-fruit ripening, indicating that all are highly regulated in a developmental manner. PMID:29434611

  15. Developmental Effects of Prenatal Exposure to Bisphenol A on the Uterus of Rat Offspring1

    PubMed Central

    Schönfelder, Gilbert; Friedrich, Karin; Paul, Martin; Chahoud, Ibrahim

    2004-01-01

    Abstract Exposure to estrogenic compounds during critical periods of fetal development could result in adverse effects on the development of reproductive organs that are not apparent until later in life. Bisphenol A (BPA), which is employed in the manufacture of a wide range of consumer products, is a prime candidate for endocrine disruption. We examined BPA to address the question of whether in utero exposure affects the uterus of the offspring and studied the expression and distribution of the estrogen receptors alpha (ERα) and beta (ERβ), because estrogens influence the development, growth, and function of the uterus through both receptors. Gravid Sprague-Dawley dams were administered by gavage either 0.1 or 50 mg/kg per day BPA or 0.2 mg/kg per day 17α-ethinyl estradiol (EE2) as reference dose on gestation days 6 through 21. Female offspring were killed in estrus. Uterine morphologic changes as well as ERα and ERβ distribution and expression were measured by immunohistochemistry and Western blot analysis. Striking morphologic changes were observed in the uterine epithelium of postpubertal offspring during estrus of the in utero BPA-treated animals (the thickness of the total epithelium was significantly reduced). ERα expression was increased in the 50-mg BPA and EE2-treated group. In contrast, we observed significantly decreased ERβ expression in all BPA- and EE2-treated animals when compared with the control. In summary, these results clearly indicate that in utero exposure of rats to BPA promotes uterine disruption in offspring. We hypothesize that the uterine disruption could possibly be provoked by a dysregulation of Erα and ERβ. PMID:15548368

  16. The dynamics of DNA methylation and hydroxymethylation during amelogenesis.

    PubMed

    Yoshioka, Hirotaka; Minamizaki, Tomoko; Yoshiko, Yuji

    2015-11-01

    Amelogenesis is a multistep process that relies on specific temporal and spatial signaling networks between the dental epithelium and mesenchymal tissues. Epigenetic modifications of key developmental genes in this process may be closely linked to a network of molecular events. However, the role of epigenetic regulation in amelogenesis remains unclear. Here, we have uncovered the spatial distributions of 5-methylcytosine (5-mC) and 5-hydroxymethylcytosine (5-hmC) to determine epigenetic events in the mandibular incisors of mice. Immunohistochemistry and dot blotting showed that 5-hmC in ameloblasts increased from the secretory stage to the later maturation stage. We also demonstrated the distribution of 5-mC-positive ameloblasts with punctate nuclear labeling from sometime after the initiation of the secretory stage to the later maturation stage; however, dot blotting failed to detect this change. No obvious alteration of 5-mC/5-hmC staining in odontoblasts and dental pulp cells was observed. Concomitant with quantitative expression data, immunohistochemistry showed that maintenance DNA methyltransferase DNMT1 was highly expressed in immature dental epithelial cells and subsequently decreased at later stages of development. Meanwhile, de novo DNA methyltransferase Dnmt3a and Dnmt3b and DNA demethylase Tet family genes were universally expressed, except Tet1 that was highly expressed in immature dental epithelial cells. Thus, DNMT1 may sustain the undifferentiated status of dental epithelial cells through the maintenance of DNA methylation, while the hydroxylation of 5-mC may occur through the whole differentiation process by TET activity. Taken together, these data indicate that the dynamic changes of 5-mC and 5-hmC may be critical for the regulation of amelogenesis.

  17. The aquaglyceroporin AQP9 contributes to the sex-specific effects of in utero arsenic exposure on placental gene expression.

    PubMed

    Winterbottom, Emily F; Koestler, Devin C; Fei, Dennis Liang; Wika, Eric; Capobianco, Anthony J; Marsit, Carmen J; Karagas, Margaret R; Robbins, David J

    2017-06-14

    Sex-specific factors play a major role in human health and disease, including responses to environmental stresses such as toxicant exposure. Increasing evidence suggests that such sex differences also exist during fetal development. In a previous report using the resources of the New Hampshire Birth Cohort Study (NHBCS), we found that low-to-moderate in utero exposure to arsenic, a highly toxic and widespread pollutant, was associated with altered expression of several key developmental genes in the fetal portion of the placenta. These associations were sex-dependent, suggesting that in utero arsenic exposure differentially impacts male and female fetuses. In the present study, we investigated the molecular basis for these sex-specific responses to arsenic. Using NanoString technology, we further analyzed the fetal placenta samples from the NHBCS for the expression of genes encoding arsenic transporters and metabolic enzymes. Multivariable linear regression analysis was used to examine their relationship with arsenic exposure and with key developmental genes, after stratification by fetal sex. We found that maternal arsenic exposure was strongly associated with expression of the AQP9 gene, encoding an aquaglyceroporin transporter, in female but not male fetal placenta. Moreover, AQP9 expression associated with that of a subset of female-specific arsenic-responsive genes. Our results suggest that AQP9 is upregulated in response to arsenic exposure in female, but not male, fetal placenta. Based on these results and prior studies, increased AQP9 expression may lead to increased arsenic transport in the female fetal placenta, which in turn may alter the expression patterns of key developmental genes that we have previously shown to be associated with arsenic exposure. Thus, this study suggests that AQP9 may play a role in the sex-specific effects of in utero arsenic exposure.

  18. FoxK1 splice variants show developmental stage-specific plasticity of expression with temperature in the tiger pufferfish.

    PubMed

    Fernandes, Jorge M O; MacKenzie, Matthew G; Kinghorn, James R; Johnston, Ian A

    2007-10-01

    FoxK1 is a member of the highly conserved forkhead/winged helix (Fox) family of transcription factors and it is known to play a key role in mammalian muscle development and myogenic stem cell function. The tiger pufferfish (Takifugu rubripes) orthologue of mammalian FoxK1 (TFoxK1) has seven exons and is located in a region of conserved synteny between pufferfish and mouse. TFoxK1 is expressed as three alternative transcripts: TFoxK1-alpha, TFoxK1-gamma and TFoxK1-delta. TFoxK1-alpha is the orthologue of mouse FoxK1-alpha, coding for a putative protein of 558 residues that contains the forkhead and forkhead-associated domains typical of Fox proteins and shares 53% global identity with its mammalian homologue. TFoxK1-gamma and TFoxK1-delta arise from intron retention events and these transcripts translate into the same 344-amino acid protein with a truncated forkhead domain. Neither are orthologues of mouse FoxK1-beta. In adult fish, the TFoxK1 splice variants were differentially expressed between fast and slow myotomal muscle, as well as other tissues, and the FoxK1-alpha protein was expressed in myogenic progenitor cells of fast myotomal muscle. During embryonic development, TFoxK1 was transiently expressed in the developing somites, heart, brain and eye. The relative expression of TFoxK1-alpha and the other two alternative transcripts varied with the incubation temperature regime for equivalent embryonic stages and the differences were particularly marked at later developmental stages. The developmental expression pattern of TFoxK1 and its localisation to mononuclear myogenic progenitor cells in adult fast muscle indicate that it may play an essential role in myogenesis in T. rubripes.

  19. Altered cortical expression of GABA-related genes in schizophrenia: illness progression vs developmental disturbance.

    PubMed

    Hoftman, Gil D; Volk, David W; Bazmi, H Holly; Li, Siyu; Sampson, Allan R; Lewis, David A

    2015-01-01

    Schizophrenia is a neurodevelopmental disorder with altered expression of GABA-related genes in the prefrontal cortex (PFC). However, whether these gene expression abnormalities reflect disturbances in postnatal developmental processes before clinical onset or arise as a consequence of clinical illness remains unclear. Expression levels for 7 GABA-related transcripts (vesicular GABA transporter [vGAT], GABA membrane transporter [GAT1], GABAA receptor subunit α1 [GABRA1] [novel in human and monkey cohorts], glutamic acid decarboxylase 67 [GAD67], parvalbumin, calretinin, and somatostatin [previously reported in human cohort, but not in monkey cohort]) were quantified in the PFC from 42 matched pairs of schizophrenia and comparison subjects and from 49 rhesus monkeys ranging in age from 1 week postnatal to adulthood. Levels of vGAT and GABRA1, but not of GAT1, messenger RNAs (mRNAs) were lower in the PFC of the schizophrenia subjects. As previously reported, levels of GAD67, parvalbumin, and somatostatin, but not of calretinin, mRNAs were also lower in these subjects. Neither illness duration nor age accounted for the levels of the transcripts with altered expression in schizophrenia. In monkey PFC, developmental changes in expression levels of many of these transcripts were in the opposite direction of the changes observed in schizophrenia. For example, mRNA levels for vGAT, GABRA1, GAD67, and parvalbumin all increased with age. Together with published reports, these findings support the interpretation that the altered expression of GABA-related transcripts in schizophrenia reflects a blunting of normal postnatal development changes, but they cannot exclude a decline during the early stages of clinical illness. © The Author 2013. Published by Oxford University Press on behalf of the Maryland Psychiatric Research Center. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  20. The DNA methylation status of MyoD and IGF-I genes are correlated with muscle growth during different developmental stages of Japanese flounder (Paralichthys olivaceus).

    PubMed

    Huang, Yajuan; Wen, Haishen; Zhang, Meizhao; Hu, Nan; Si, Yufeng; Li, Siping; He, Feng

    2018-05-01

    Many genes related to muscle growth modulate myoblast proliferation and differentiation and promote muscle hypertrophy. MyoD is a myogenic determinant that contributes to myoblast determination, and insulin-like growth factor 1 (IGF-I) interacts with MyoD to regulate muscle hypertrophy and muscle mass. In this study, we aimed to assess DNA methylation and mRNA expression patterns of MyoD and IGF-I during different developmental stages of Japanese flounder, and to examine the relationship between MyoD and IGF-I gene. DNA and RNA were extracted from muscles, and DNA methylation of MyoD and IGF-I promoter and exons was detected by bisulfite sequencing. The relative expression of MyoD and IGF-I was measured by quantitative polymerase chain reaction. IGF-I was measured by radioimmunoassay. Interestingly, the lowest expression of MyoD and IGF-I emerged at larva stage, and the mRNA expression was negatively associated with methylation. We hypothesized that many skeletal muscle were required to complete metamorphosis; thus, the expression levels of MyoD and IGF-I genes increased from larva stage and then decreased. The relative expression levels of MyoD and IGF-I exhibited similar patterns, suggesting that MyoD and IGF-I regulated muscle growth through combined effects. Changes in the concentrations of IGF-I hormone were similar to those of IGF-I gene expression. Our results the mechanism through which MyoD and IGF-I regulate muscle development and demonstrated that MyoD interacted with IGF-I to regulate muscle growth during different developmental stages. Copyright © 2018 Elsevier Inc. All rights reserved.

  1. A SNP uncoupling Mina expression from the TGFβ signaling pathway.

    PubMed

    Lian, Shang L; Mihi, Belgacem; Koyanagi, Madoka; Nakayama, Toshinori; Bix, Mark

    2018-03-01

    Mina is a JmjC family 2-oxoglutarate oxygenase with pleiotropic roles in cell proliferation, cancer, T cell differentiation, pulmonary inflammation, and intestinal parasite expulsion. Although Mina expression varies according to cell-type, developmental stage and activation state, its transcriptional regulation is poorly understood. Across inbred mouse strains, Mina protein level exhibits a bimodal distribution, correlating with inheritance of a biallelic haplotype block comprising 21 promoter/intron 1-region SNPs. We previously showed that heritable differences in Mina protein level are transcriptionally regulated. Accordingly, we decided to test the hypothesis that at least one of the promoter/intron 1-region SNPs perturbs a Mina cis-regulatory element (CRE). Here, we have comprehensively scanned for CREs across a Mina locus-spanning 26-kilobase genomic interval. We discovered 8 potential CREs and functionally validated 4 of these, the strongest of which (E2), residing in intron 1, contained a SNP whose BALB/c-but not C57Bl/6 allele-abolished both Smad3 binding and transforming growth factor beta (TGFβ) responsiveness. Our results demonstrate the TGFβ signaling pathway plays a critical role in regulating Mina expression and SNP rs4191790 controls heritable variation in Mina expression level, raising important questions regarding the evolution of an allele that uncouples Mina expression from the TGFβ signaling pathway. © 2017 The Authors. Immunity, Inflammation and Disease Published by John Wiley & Sons Ltd.

  2. A SNP uncoupling Mina expression from the TGFβ signaling pathway

    PubMed Central

    Lian, Shang L.; Mihi, Belgacem; Koyanagi, Madoka; Nakayama, Toshinori

    2017-01-01

    Abstract Introduction Mina is a JmjC family 2‐oxoglutarate oxygenase with pleiotropic roles in cell proliferation, cancer, T cell differentiation, pulmonary inflammation, and intestinal parasite expulsion. Although Mina expression varies according to cell‐type, developmental stage and activation state, its transcriptional regulation is poorly understood. Across inbred mouse strains, Mina protein level exhibits a bimodal distribution, correlating with inheritance of a biallelic haplotype block comprising 21 promoter/intron 1‐region SNPs. We previously showed that heritable differences in Mina protein level are transcriptionally regulated. Methods Accordingly, we decided to test the hypothesis that at least one of the promoter/intron 1‐region SNPs perturbs a Mina cis‐regulatory element (CRE). Here, we have comprehensively scanned for CREs across a Mina locus‐spanning 26‐kilobase genomic interval. Results We discovered 8 potential CREs and functionally validated 4 of these, the strongest of which (E2), residing in intron 1, contained a SNP whose BALB/c—but not C57Bl/6 allele—abolished both Smad3 binding and transforming growth factor beta (TGFβ) responsiveness. Conclusions Our results demonstrate the TGFβ signaling pathway plays a critical role in regulating Mina expression and SNP rs4191790 controls heritable variation in Mina expression level, raising important questions regarding the evolution of an allele that uncouples Mina expression from the TGFβ signaling pathway. PMID:28967702

  3. Intraspinal serotonergic neurons consist of two, temporally distinct populations in developing zebrafish

    PubMed Central

    Montgomery, Jacob E.; Wiggin, Timothy D.; Rivera-Perez, Luis M.; Lillesaar, Christina; Masino, Mark A.

    2015-01-01

    Zebrafish intraspinal serotonergic neuron (ISN) morphology and distribution have been examined in detail at different ages; however, some aspects of the development of these cells remain unclear. Although antibodies to serotonin (5-HT) have detected ISNs in the ventral spinal cord of embryos, larvae, and adults, the only tryptophan hydroxylase (tph) transcript that has been described in the spinal cord is tph1a. Paradoxically, spinal tph1a is expressed transiently in embryos, which brings the source of 5-HT in the ISNs of larvae and adults into question. Because the pet1 and tph2 promoters drive transgene expression in the spinal cord, we hypothesized that tph2 is expressed in spinal cords of zebrafish larvae. We confirmed this hypothesis through in situ hybridization. Next, we used 5-HT antibody labeling and transgenic markers of tph2-expressing neurons to identify a transient population of ISNs in embryos that was distinct from ISNs that appeared later in development. The existence of separate ISN populations may not have been recognized previously due to their shared location in the ventral spinal cord. Finally, we used transgenic markers and immunohistochemical labeling to identify the transient ISN population as GABAergic Kolmer-Agduhr double-prime (KA″) neurons. Altogether, this study revealed a novel developmental paradigm in which KA″ neurons are transiently serotonergic before the appearance of a stable population of tph2-expressing ISNs. PMID:26437856

  4. Developmental Disabilities Prevention and the Distribution of Risk among American Indians.

    ERIC Educational Resources Information Center

    Mendola, Pauline; And Others

    1994-01-01

    Compared to the U.S. general population, American Indian children experience a smaller proportion of genetic and congenital anomalies associated with developmental disabilities and greater risk associated with prenatal exposure to alcohol and tobacco, maternal diabetes, and disabling sequelae of accidents and otitis media. Prevention efforts…

  5. Differences in the Kinetic of the First Meiotic Division and in Active Mitochondrial Distribution between Prepubertal and Adult Oocytes Mirror Differences in their Developmental Competence in a Sheep Model

    PubMed Central

    Leoni, Giovanni Giuseppe; Palmerini, Maria Grazia; Satta, Valentina; Succu, Sara; Pasciu, Valeria; Zinellu, Angelo; Carru, Ciriaco; Macchiarelli, Guido; Nottola, Stefania Annarita; Naitana, Salvatore; Berlinguer, Fiammetta

    2015-01-01

    Our aim is to verify if oocyte developmental potential is related to the timing of meiotic progression and to mitochondrial distribution and activity using prepubertal and adult oocytes as models of low and high developmental capacity respectively. Prepubertal and adult oocytes were incorporated in an in vitro maturation system to determine meiotic and developmental competence and to assess at different time points kinetic of meiotic maturation, 2D protein electrophoresis patterns, ATP content and mitochondria distribution. Maturation and fertilization rates did not differ between prepubertal and adult oocytes (95.1% vs 96.7% and 66.73% vs 70.62% respectively for prepubertal and adult oocytes). Compared to adults, prepubertal oocytes showed higher parthenogenesis (17.38% vs 2.08% respectively in prepubertals and adults; P<0.01) and polispermy (14.30% vs 2.21% respectively in prepubertals and adults; P<0.01), lower cleavage rates (60.00% vs 67.08% respectively in prepubertals and adults; P<0.05) and blastocyst output (11.94% vs 34.% respectively in prepubertals and adults; P<0.01). Prepubertal oocytes reached MI stage 1 hr later than adults and this delay grows as the first meiotic division proceeds. Simultaneously, the protein pattern was altered since in prepubertal oocytes it fluctuates, dropping and rising to levels similar to adults only at 24 hrs. In prepubertal oocytes ATP rise is delayed and did not reach levels comparable to adult ones. CLSM observations revealed that at MII, in the majority of prepubertal oocytes, the active mitochondria are homogenously distributed, while in adults they are aggregated in big clusters. Our work demonstrates that mitochondria and their functional aggregation during maturation play an active role to provide energy in terms of ATP. The oocyte ATP content determines the timing of the meiotic cycle and the acquisition of developmental competence. Taken together our data suggest that oocytes with low developmental competence have a slowed down energetic metabolism which delays later development. PMID:25893245

  6. Early Mode of Life and Hatchling Size in Cephalopod Molluscs: Influence on the Species Distributional Ranges

    PubMed Central

    Vidal, Erica A. G.; Fernández-Álvarez, Fernando Á.; Nabhitabhata, Jaruwat

    2016-01-01

    Cephalopods (nautiluses, cuttlefishes, squids and octopuses) exhibit direct development and display two major developmental modes: planktonic and benthic. Planktonic hatchlings are small and go through some degree of morphological changes during the planktonic phase, which can last from days to months, with ocean currents enhancing their dispersal capacity. Benthic hatchlings are usually large, miniature-like adults and have comparatively reduced dispersal potential. We examined the relationship between early developmental mode, hatchling size and species latitudinal distribution range of 110 species hatched in the laboratory, which represent 13% of the total number of live cephalopod species described to date. Results showed that species with planktonic hatchlings reach broader distributional ranges in comparison with species with benthic hatchlings. In addition, squids and octopods follow an inverse relationship between hatchling size and species latitudinal distribution. In both groups, species with smaller hatchlings have broader latitudinal distribution ranges. Thus, squid and octopod species with larger hatchlings have latitudinal distributions of comparatively minor extension. This pattern also emerges when all species are grouped by genus (n = 41), but was not detected for cuttlefishes, a group composed mainly of species with large and benthic hatchlings. However, when hatchling size was compared to adult size, it was observed that the smaller the hatchlings, the broader the latitudinal distributional range of the species for cuttlefishes, squids and octopuses. This was also valid for all cephalopod species with benthic hatchlings pooled together. Hatchling size and associated developmental mode and dispersal potential seem to be main influential factors in determining the distributional range of cephalopods. PMID:27829039

  7. Ovary transcriptome profiling via artificial intelligence reveals a transcriptomic fingerprint predicting egg quality in striped bass, Morone saxatilis.

    PubMed

    Chapman, Robert W; Reading, Benjamin J; Sullivan, Craig V

    2014-01-01

    Inherited gene transcripts deposited in oocytes direct early embryonic development in all vertebrates, but transcript profiles indicative of embryo developmental competence have not previously been identified. We employed artificial intelligence to model profiles of maternal ovary gene expression and their relationship to egg quality, evaluated as production of viable mid-blastula stage embryos, in the striped bass (Morone saxatilis), a farmed species with serious egg quality problems. In models developed using artificial neural networks (ANNs) and supervised machine learning, collective changes in the expression of a limited suite of genes (233) representing <2% of the queried ovary transcriptome explained >90% of the eventual variance in embryo survival. Egg quality related to minor changes in gene expression (<0.2-fold), with most individual transcripts making a small contribution (<1%) to the overall prediction of egg quality. These findings indicate that the predictive power of the transcriptome as regards egg quality resides not in levels of individual genes, but rather in the collective, coordinated expression of a suite of transcripts constituting a transcriptomic "fingerprint". Correlation analyses of the corresponding candidate genes indicated that dysfunction of the ubiquitin-26S proteasome, COP9 signalosome, and subsequent control of the cell cycle engenders embryonic developmental incompetence. The affected gene networks are centrally involved in regulation of early development in all vertebrates, including humans. By assessing collective levels of the relevant ovarian transcripts via ANNs we were able, for the first time in any vertebrate, to accurately predict the subsequent embryo developmental potential of eggs from individual females. Our results show that the transcriptomic fingerprint evidencing developmental dysfunction is highly predictive of, and therefore likely to regulate, egg quality, a biologically complex trait crucial to reproductive fitness.

  8. Dynamic and Widespread lncRNA Expression in a Sponge and the Origin of Animal Complexity

    PubMed Central

    Gaiti, Federico; Fernandez-Valverde, Selene L.; Nakanishi, Nagayasu; Calcino, Andrew D.; Yanai, Itai; Tanurdzic, Milos; Degnan, Bernard M.

    2015-01-01

    Long noncoding RNAs (lncRNAs) are important developmental regulators in bilaterian animals. A correlation has been claimed between the lncRNA repertoire expansion and morphological complexity in vertebrate evolution. However, this claim has not been tested by examining morphologically simple animals. Here, we undertake a systematic investigation of lncRNAs in the demosponge Amphimedon queenslandica, a morphologically simple, early-branching metazoan. We combine RNA-Seq data across multiple developmental stages of Amphimedon with a filtering pipeline to conservatively predict 2,935 lncRNAs. These include intronic overlapping lncRNAs, exonic antisense overlapping lncRNAs, long intergenic nonprotein coding RNAs, and precursors for small RNAs. Sponge lncRNAs are remarkably similar to their bilaterian counterparts in being relatively short with few exons and having low primary sequence conservation relative to protein-coding genes. As in bilaterians, a majority of sponge lncRNAs exhibit typical hallmarks of regulatory molecules, including high temporal specificity and dynamic developmental expression. Specific lncRNA expression profiles correlate tightly with conserved protein-coding genes likely involved in a range of developmental and physiological processes, such as the Wnt signaling pathway. Although the majority of Amphimedon lncRNAs appears to be taxonomically restricted with no identifiable orthologs, we find a few cases of conservation between demosponges in lncRNAs that are antisense to coding sequences. Based on the high similarity in the structure, organization, and dynamic expression of sponge lncRNAs to their bilaterian counterparts, we propose that these noncoding RNAs are an ancient feature of the metazoan genome. These results are consistent with lncRNAs regulating the development of animals, regardless of their level of morphological complexity. PMID:25976353

  9. Ovary Transcriptome Profiling via Artificial Intelligence Reveals a Transcriptomic Fingerprint Predicting Egg Quality in Striped Bass, Morone saxatilis

    PubMed Central

    2014-01-01

    Inherited gene transcripts deposited in oocytes direct early embryonic development in all vertebrates, but transcript profiles indicative of embryo developmental competence have not previously been identified. We employed artificial intelligence to model profiles of maternal ovary gene expression and their relationship to egg quality, evaluated as production of viable mid-blastula stage embryos, in the striped bass (Morone saxatilis), a farmed species with serious egg quality problems. In models developed using artificial neural networks (ANNs) and supervised machine learning, collective changes in the expression of a limited suite of genes (233) representing <2% of the queried ovary transcriptome explained >90% of the eventual variance in embryo survival. Egg quality related to minor changes in gene expression (<0.2-fold), with most individual transcripts making a small contribution (<1%) to the overall prediction of egg quality. These findings indicate that the predictive power of the transcriptome as regards egg quality resides not in levels of individual genes, but rather in the collective, coordinated expression of a suite of transcripts constituting a transcriptomic “fingerprint”. Correlation analyses of the corresponding candidate genes indicated that dysfunction of the ubiquitin-26S proteasome, COP9 signalosome, and subsequent control of the cell cycle engenders embryonic developmental incompetence. The affected gene networks are centrally involved in regulation of early development in all vertebrates, including humans. By assessing collective levels of the relevant ovarian transcripts via ANNs we were able, for the first time in any vertebrate, to accurately predict the subsequent embryo developmental potential of eggs from individual females. Our results show that the transcriptomic fingerprint evidencing developmental dysfunction is highly predictive of, and therefore likely to regulate, egg quality, a biologically complex trait crucial to reproductive fitness. PMID:24820964

  10. Expression profiling of c-kit and its impact after esiRNA silencing during gonadal development in catfish.

    PubMed

    Laldinsangi, C; Senthilkumaran, B

    2018-04-03

    C-kit receptor is a member of a family of growth factor receptors that have tyrosine kinase activity, and are involved in the transduction of growth regulatory signals across plasma membrane by activation of its ligand, kitl/scf. The present study analysed mRNA and protein expression profiles of c-kit in the gonads of catfish, Clarias gariepinus, using real time PCR, in situ hybridization and immunohistochemistry. Tissue distribution analysis revealed higher expression mainly in the catfish gonads. Ontogeny studies showed minimal expression during early developmental stages and highest during 50-75 days post hatch, and the dimorphic expression in gonads decreased gradually till adulthood, which might suggest an important role for this gene around later stages of sex differentiation and gonadal development. Expression of C-kit was analysed at various phases of gonadal cycle in both male and female, which showed minimal expression during the resting phase, and higher expression in male compared to females during the pre-spawning phase. In vitro and in vivo induction using human chorionic gonadotropin elevated the expression of c-kit indicating the regulatory influence of hypothalamo-hypophyseal axis. In vivo transient gene silencing using c-kit-esiRNA in adult catfish during gonadal recrudescence showed a decrease in c-kit expression, which affected the expression level of germ cell meiotic marker sycp3, as well as several factors and steroidogenic enzyme genes involved in germ cell development. Decrease in the levels of serum 11-KT and T were also observed after esiRNA silencing. The findings of this study suggest that c-kit has an important role in the process of germ cell proliferation, development and maturation during gonadal development and recrudescence in catfish. Copyright © 2018. Published by Elsevier Inc.

  11. Expression Atlas: gene and protein expression across multiple studies and organisms

    PubMed Central

    Tang, Y Amy; Bazant, Wojciech; Burke, Melissa; Fuentes, Alfonso Muñoz-Pomer; George, Nancy; Koskinen, Satu; Mohammed, Suhaib; Geniza, Matthew; Preece, Justin; Jarnuczak, Andrew F; Huber, Wolfgang; Stegle, Oliver; Brazma, Alvis; Petryszak, Robert

    2018-01-01

    Abstract Expression Atlas (http://www.ebi.ac.uk/gxa) is an added value database that provides information about gene and protein expression in different species and contexts, such as tissue, developmental stage, disease or cell type. The available public and controlled access data sets from different sources are curated and re-analysed using standardized, open source pipelines and made available for queries, download and visualization. As of August 2017, Expression Atlas holds data from 3,126 studies across 33 different species, including 731 from plants. Data from large-scale RNA sequencing studies including Blueprint, PCAWG, ENCODE, GTEx and HipSci can be visualized next to each other. In Expression Atlas, users can query genes or gene-sets of interest and explore their expression across or within species, tissues, developmental stages in a constitutive or differential context, representing the effects of diseases, conditions or experimental interventions. All processed data matrices are available for direct download in tab-delimited format or as R-data. In addition to the web interface, data sets can now be searched and downloaded through the Expression Atlas R package. Novel features and visualizations include the on-the-fly analysis of gene set overlaps and the option to view gene co-expression in experiments investigating constitutive gene expression across tissues or other conditions. PMID:29165655

  12. Receptive Vocabulary in Boys with Autism Spectrum Disorder: Cross-Sectional Developmental Trajectories

    PubMed Central

    McDuffie, Andrea S.; Hagerman, Randi J.; Abbeduto, Leonard

    2013-01-01

    In light of evidence that receptive language may be a relative weakness for individuals with autism spectrum disorder (ASD), this study characterized receptive vocabulary profiles in boys with ASD using cross-sectional developmental trajectories relative to age, nonverbal cognition, and expressive vocabulary. Participants were 49 boys with ASD (4–11 years) and 80 typically developing boys (2–11 years). Receptive vocabulary, assessed with the Peabody Picture Vocabulary Test, was a weakness for boys with ASD relative to age and nonverbal cognition. Relative to expressive vocabulary, assessed with the Expressive Vocabulary Test, receptive vocabulary increased at a lower rate for boys with ASD. Vocabulary trajectories in ASD are distinguished from typical development; however, nonverbal cognition largely accounts for the patterns observed. PMID:23588510

  13. Phenotypic Checkpoints Regulate Neuronal Development

    PubMed Central

    Ben-Ari, Yehezkel; Spitzer, Nicholas C.

    2010-01-01

    Nervous system development proceeds by sequential gene expression mediated by cascades of transcription factors in parallel with sequences of patterned network activity driven by receptors and ion channels. These sequences are cell type- and developmental stage-dependent and modulated by paracrine actions of substances released by neurons and glia. How and to what extent these sequences interact to enable neuronal network development is not understood. Recent evidence demonstrates that CNS development requires intermediate stages of differentiation providing functional feedback that influences gene expression. We suggest that embryonic neuronal functions constitute a series of phenotypic checkpoint signatures; neurons failing to express these functions are delayed or developmentally arrested. Such checkpoints are likely to be a general feature of neuronal development and may constitute presymptomatic signatures of neurological disorders when they go awry. PMID:20864191

  14. Temporal and developmental requirements for the Prader–Willi imprinting center

    PubMed Central

    DuBose, Amanda J.; Smith, Emily Y.; Johnstone, Karen A.; Resnick, James L.

    2012-01-01

    Imprinted gene expression associated with Prader–Willi syndrome (PWS) and Angelman syndrome (AS) is controlled by two imprinting centers (ICs), the PWS-IC and the AS-IC. The PWS-IC operates in cis to activate transcription of genes that are expressed exclusively from the paternal allele. We have created a conditional allele of the PWS-IC to investigate its developmental activity. Deletion of the paternal PWS-IC in the embryo before implantation abolishes expression of the paternal-only genes in the neonatal brain. Surprisingly, deletion of the PWS-IC in early brain progenitors does not affect the subsequent imprinted status of PWS/AS genes in the newborn brain. These results indicate that the PWS-IC functions to protect the paternal epigenotype at the epiblast stage of development but is dispensable thereafter. PMID:22331910

  15. Detection of QTLs for seedling characteristics in barley (Hordeum vulgare L.) grown under hydroponic culture condition.

    PubMed

    Wang, Qifei; Sun, Genlou; Ren, Xifeng; Wang, Jibin; Du, Binbin; Li, Chengdao; Sun, Dongfa

    2017-11-07

    Seedling characteristics play significant roles in the growth and development of barley (Hordeum vulgare L.), including stable stand establishment, water and nutrients uptake, biotic resistance and abiotic stresses, and can influence yield and quality. However, the genetic mechanisms underlying seedling characteristics in barley are largely unknown and little research has been done. In the present work, 21 seedling-related characteristics are assessed in a barley double haploid (DH) population, grown under hydroponic conditions. Of them, leaf age (LAG), shoot height (SH), maximum root length (MRL), main root number (MRN) and seedling fresh weight (SFW) were investigated at the 13th, 20th, 27th, and 34th day after germination. The objectives were to identify quantitative trait loci (QTLs) underlying these seedling characteristics using a high-density linkage map and to reveal the QTL expression pattern by comparing the QTLs among four different seedling growth stages. A total of 70 QTLs were distributed over all chromosomes except 4H, and, individually, accounted for 5.01%-77.78% of phenotypic variation. Out of the 70 detected QTLs, 23 showed a major effect on 14 seedling-related characteristics. Ten co-localized chromosomal regions on 2H (five regions), 3H (two regions) and 7H (three regions) involved 39 QTLs (55.71%), each simultaneously influenced more than one trait. Meanwhile, 9 co-localized genomic regions involving 22 QTLs for five seedling characteristics (LAG, SH, MRL, MRN and SFW) at the 13th, 20th, 27th and 34th day-old seedling were common for two or more growth stages of seedling. QTL in the vicinity of Vrs1 locus on chromosome 2H with the favorable alleles from Huadamai 6 was found to have the largest main effects on multiple seedling-related traits. Six QTL cluster regions associated with 16 seedling-related characteristics were observed on chromosome 2H, 3H and 7H. The majority of the 29 regions identified for five seedling characteristics were selectively expressed at different developmental stages. The genetic effects of 9 consecutive expression regions displayed different developmental influences at different developmental stages. These findings enhanced our understanding of a genetic basis underlying seedling characteristics in barley. Some QTLs detected here could be used for marker-assisted selection (MAS) in barley breeding.

  16. Developmental outcomes of Down syndrome and Dandy-Walker malformation

    PubMed Central

    Love, Kaitlin; Huddleston, Lillie; Olney, Pat; Wrubel, David; Visootsak, Jeannie

    2012-01-01

    Dandy-Walker syndrome (DWS), or Dandy-Walker complex, is a congenital brain malformation of the posterior fossa, typically resulting in developmental delay and cognitive disability. The co-occurrence of Down syndrome (DS) and DWS is relatively uncommon; thus, its impact on developmental outcomes has not been fully elucidated. Herein, we report a case of a 37-month-old child with DS and DWS, who is functioning at the following age-equivalent: gross motor at a 9-mo level, fine motor 6 mo, expressive language 14 mo, receptive language 9 mo. As such, it is important to determine how the DWS influences developmental outcomes, and appreciate the importance of early interventional therapy. PMID:22866020

  17. Recognition of Facial Expressions of Emotion in Adults with Down Syndrome

    ERIC Educational Resources Information Center

    Virji-Babul, Naznin; Watt, Kimberley; Nathoo, Farouk; Johnson, Peter

    2012-01-01

    Research on facial expressions in individuals with Down syndrome (DS) has been conducted using photographs. Our goal was to examine the effect of motion on perception of emotional expressions. Adults with DS, adults with typical development matched for chronological age (CA), and children with typical development matched for developmental age (DA)…

  18. The Role of Facial Expressions in Attention-Orienting in Adults and Infants

    ERIC Educational Resources Information Center

    Rigato, Silvia; Menon, Enrica; Di Gangi, Valentina; George, Nathalie; Farroni, Teresa

    2013-01-01

    Faces convey many signals (i.e., gaze or expressions) essential for interpersonal interaction. We have previously shown that facial expressions of emotion and gaze direction are processed and integrated in specific combinations early in life. These findings open a number of developmental questions and specifically in this paper we address whether…

  19. mirEX: a platform for comparative exploration of plant pri-miRNA expression data.

    PubMed

    Bielewicz, Dawid; Dolata, Jakub; Zielezinski, Andrzej; Alaba, Sylwia; Szarzynska, Bogna; Szczesniak, Michal W; Jarmolowski, Artur; Szweykowska-Kulinska, Zofia; Karlowski, Wojciech M

    2012-01-01

    mirEX is a comprehensive platform for comparative analysis of primary microRNA expression data. RT-qPCR-based gene expression profiles are stored in a universal and expandable database scheme and wrapped by an intuitive user-friendly interface. A new way of accessing gene expression data in mirEX includes a simple mouse operated querying system and dynamic graphs for data mining analyses. In contrast to other publicly available databases, the mirEX interface allows a simultaneous comparison of expression levels between various microRNA genes in diverse organs and developmental stages. Currently, mirEX integrates information about the expression profile of 190 Arabidopsis thaliana pri-miRNAs in seven different developmental stages: seeds, seedlings and various organs of mature plants. Additionally, by providing RNA structural models, publicly available deep sequencing results, experimental procedure details and careful selection of auxiliary data in the form of web links, mirEX can function as a one-stop solution for Arabidopsis microRNA information. A web-based mirEX interface can be accessed at http://bioinfo.amu.edu.pl/mirex.

  20. The grapevine kinome: annotation, classification and expression patterns in developmental processes and stress responses.

    PubMed

    Zhu, Kaikai; Wang, Xiaolong; Liu, Jinyi; Tang, Jun; Cheng, Qunkang; Chen, Jin-Gui; Cheng, Zong-Ming Max

    2018-01-01

    Protein kinases (PKs) have evolved as the largest family of molecular switches that regulate protein activities associated with almost all essential cellular functions. Only a fraction of plant PKs, however, have been functionally characterized even in model plant species. In the present study, the entire grapevine kinome was identified and annotated using the most recent version of the grapevine genome. A total of 1168 PK-encoding genes were identified and classified into 20 groups and 121 families, with the RLK-Pelle group being the largest, with 872 members. The 1168 kinase genes were unevenly distributed over all 19 chromosomes, and both tandem and segmental duplications contributed to the expansion of the grapevine kinome, especially of the RLK-Pelle group. Ka/Ks values indicated that most of the tandem and segmental duplication events were under purifying selection. The grapevine kinome families exhibited different expression patterns during plant development and in response to various stress treatments, with many being coexpressed. The comprehensive annotation of grapevine kinase genes, their patterns of expression and coexpression, and the related information facilitate a more complete understanding of the roles of various grapevine kinases in growth and development, responses to abiotic stress, and evolutionary history.

  1. The expression of embryonic primary mesenchyme genes of the sea urchin, Strongylocentrotus purpuratus, in the adult skeletogenic tissues of this and other species of echinoderms.

    PubMed

    Drager, B J; Harkey, M A; Iwata, M; Whiteley, A H

    1989-05-01

    Adult tissues of the sea urchin, Strongylocentrotus purpuratus, were analyzed for the products of a set of genes whose expression, in the embryo, is restricted to the skeletogenic primary mesenchyme (PM). Three embryonic PM-specific mRNAs were found to be abundant in adult skeletal tissues (test and lantern), but not in a variety of soft tissues. Homologous mRNAs were also found in skeletal tissues of the congeneric sea urchin, S. droebachiensis, as well as a more distantly related echinoid, Dendraster excentricus, and an asteroid, Evasterias troschellii. The distributions of two of these RNAs were analyzed in regenerating spines of adult S. purpuratus using in situ hybridization. These gene products were localized primarily in the calcoblasts that accumulated at the regeneration site. In nonregenerating spines SpLM 18 RNAs, the most abundant of these gene products, were localized in a small population of noncalcoblast cells scattered through the spine shaft, and were absent from calcoblasts. These observations suggest that a program of gene expression associated with the process of calcification is conserved both developmentally through the period of metamorphosis and evolutionarily among the echinoderms.

  2. Postnatal choline supplementation selectively attenuates hippocampal microRNA alterations associated with developmental alcohol exposure

    PubMed Central

    Balaraman, Sridevi; Idrus, Nirelia M.; Miranda, Rajesh C.; Thomas, Jennifer D.

    2017-01-01

    Prenatal alcohol exposure can result in a range of physical, neuropathological, and behavioral alterations, collectively termed fetal alcohol spectrum disorders (FASD). We have shown that supplementation with the nutrient choline reduces the severity of developmental alcohol-associated deficits in hippocampal-dependent behaviors and normalizes some aspects of hippocampal cholinergic development and DNA methylation patterns. Alcohol’s developmental effects may also be mediated, in part, by altering microRNAs (miRNAs) that serve as negative regulators of gene translation. To determine whether choline supplementation alters ethanol’s long-lasting effects on miRNAs, Sprague-Dawley rats were exposed to 5.25 g/kg/day ethanol from postnatal days (PD) 4–9 via intubation; controls received sham intubations. Subjects were treated with choline chloride (100 mg/kg/day) or saline vehicle subcutaneously (s.c.) from PD 4–21. On PD 22, subjects were sacrificed, and RNA isolated from the hippocampus. MiRNA expression was assessed with TaqMan Human MicroRNA Panel Low-Density Arrays. Ethanol significantly increased miRNA expression variance, an effect that was normalized with choline supplementation. Cluster analysis of stably expressed miRNAs that exceeded an ANOVA p<0.05 criterion indicated that for both male and female offspring, control and ethanol-exposed groups were most dissimilar from each other, with choline-supplemented groups in between. MiRNAs that expressed an average 2-fold change due to ethanol exposure were further analyzed to identify which ethanol-sensitive miRNAs were protected by choline supplementation. We found that at a false discovery rate (FDR)-adjusted criterion of p<0.05, miR-200c was induced by ethanol exposure and that choline prevented this effect. Collectively, our data show that choline supplementation can normalize disturbances in miRNA expression following developmental alcohol exposure and can protect specific miRNAs from induction by ethanol. These findings have important implications for the mechanisms by which choline may serve as a potential treatment for FASD. PMID:28433422

  3. Lamellar pro-inflammatory cytokine expression patterns in laminitis at the developmental stage and at the onset of lameness: innate vs. adaptive immune response.

    PubMed

    Belknap, J K; Giguère, S; Pettigrew, A; Cochran, A M; Van Eps, A W; Pollitt, C C

    2007-01-01

    Recent research has indicated that inflammation plays a role in the early stages of laminitis and that, similar to organ failure in human sepsis, early inflammatory mechanisms may lead to downstream events resulting in lamellar failure. Characterisation of the type of immune response (i.e. innate vs. adaptive) is essential in order to develop therapeutic strategies to counteract these deleterious events. To quantitate gene expression of pro-inflammatory cytokines known to be important in the innate and adaptive immune response during the early stages of laminitis, using both the black walnut extract (BWE) and oligofructose (OF) models of laminitis. Real-time qPCR was used to assess lamellar mRNA expression of interleukins-1beta, 2, 4, 6, 8, 10, 12 and 18, and tumour necrosis factor alpha and interferon gamma at the developmental stage and at the onset of lameness. Significantly increased lamellar mRNA expression of cytokines important in the innate immune response were present at the developmental stage of the BWE model, and at the onset of acute lameness in both the BWE model and OF model. Of the cytokines characteristic of the Th1 and Th2 arms of the adaptive immune response, a mixed response was noted at the onset of acute lameness in the BWE model, whereas the response was skewed towards a Th1 response at the onset of lameness in the OF model. Lamellar inflammation is characterised by strong innate immune response in the developmental stages of laminitis; and a mixture of innate and adaptive immune responses at the onset of lameness. These results indicate that anti-inflammatory treatment of early stage laminitis (and the horse at risk of laminitis) should include not only therapeutic drugs that address prostanoid activity, but should also address the marked increases in lamellar cytokine expression.

  4. Developmental up-regulation of vesicular glutamate transporter-1 promotes neocortical presynaptic terminal development.

    PubMed

    Berry, Corbett T; Sceniak, Michael P; Zhou, Louie; Sabo, Shasta L

    2012-01-01

    Presynaptic terminal formation is a complex process that requires assembly of proteins responsible for synaptic transmission at sites of axo-dendritic contact. Accumulation of presynaptic proteins at developing terminals is facilitated by glutamate receptor activation. Glutamate is loaded into synaptic vesicles for release via the vesicular glutamate transporters VGLUT1 and VGLUT2. During postnatal development there is a switch from predominantly VGLUT2 expression to high VGLUT1 and low VGLUT2, raising the question of whether the developmental increase in VGLUT1 is important for presynaptic development. Here, we addressed this question using confocal microscopy and quantitative immunocytochemistry in primary cultures of rat neocortical neurons. First, in order to understand the extent to which the developmental switch from VGLUT2 to VGLUT1 occurs through an increase in VGLUT1 at individual presynaptic terminals or through addition of VGLUT1-positive presynaptic terminals, we examined the spatio-temporal dynamics of VGLUT1 and VGLUT2 expression. Between 5 and 12 days in culture, the percentage of presynaptic terminals that expressed VGLUT1 increased during synapse formation, as did expression of VGLUT1 at individual terminals. A subset of VGLUT1-positive terminals also expressed VGLUT2, which decreased at these terminals. At individual terminals, the increase in VGLUT1 correlated with greater accumulation of other synaptic vesicle proteins, such as synapsin and synaptophysin. When the developmental increase in VGLUT1 was prevented using VGLUT1-shRNA, the density of presynaptic terminals and accumulation of synapsin and synaptophysin at terminals were decreased. Since VGLUT1 knock-down was limited to a small number of neurons, the observed effects were cell-autonomous and independent of changes in overall network activity. These results demonstrate that up-regulation of VGLUT1 is important for development of presynaptic terminals in the cortex.

  5. Developmental Up-Regulation of Vesicular Glutamate Transporter-1 Promotes Neocortical Presynaptic Terminal Development

    PubMed Central

    Berry, Corbett T.; Sceniak, Michael P.; Zhou, Louie; Sabo, Shasta L.

    2012-01-01

    Presynaptic terminal formation is a complex process that requires assembly of proteins responsible for synaptic transmission at sites of axo-dendritic contact. Accumulation of presynaptic proteins at developing terminals is facilitated by glutamate receptor activation. Glutamate is loaded into synaptic vesicles for release via the vesicular glutamate transporters VGLUT1 and VGLUT2. During postnatal development there is a switch from predominantly VGLUT2 expression to high VGLUT1 and low VGLUT2, raising the question of whether the developmental increase in VGLUT1 is important for presynaptic development. Here, we addressed this question using confocal microscopy and quantitative immunocytochemistry in primary cultures of rat neocortical neurons. First, in order to understand the extent to which the developmental switch from VGLUT2 to VGLUT1 occurs through an increase in VGLUT1 at individual presynaptic terminals or through addition of VGLUT1-positive presynaptic terminals, we examined the spatio-temporal dynamics of VGLUT1 and VGLUT2 expression. Between 5 and 12 days in culture, the percentage of presynaptic terminals that expressed VGLUT1 increased during synapse formation, as did expression of VGLUT1 at individual terminals. A subset of VGLUT1-positive terminals also expressed VGLUT2, which decreased at these terminals. At individual terminals, the increase in VGLUT1 correlated with greater accumulation of other synaptic vesicle proteins, such as synapsin and synaptophysin. When the developmental increase in VGLUT1 was prevented using VGLUT1-shRNA, the density of presynaptic terminals and accumulation of synapsin and synaptophysin at terminals were decreased. Since VGLUT1 knock-down was limited to a small number of neurons, the observed effects were cell-autonomous and independent of changes in overall network activity. These results demonstrate that up-regulation of VGLUT1 is important for development of presynaptic terminals in the cortex. PMID:23226425

  6. Modulation of organic acids and sugar content in tomato fruits by an abscisic acid-regulated transcription factor.

    PubMed

    Bastías, Adriana; López-Climent, María; Valcárcel, Mercedes; Rosello, Salvador; Gómez-Cadenas, Aurelio; Casaretto, José A

    2011-03-01

    Growing evidence suggests that the phytohormone abscisic acid (ABA) plays a role in fruit development. ABA signaling components of developmental programs and responses to stress conditions include the group of basic leucine zipper transcriptional activators known as ABA-response element binding factors (AREBs/ABFs). AREB transcription factors mediate ABA-regulated gene expression involved in desiccation tolerance and are expressed mainly in seeds and in vegetative tissues under stress; however, they are also expressed in some fruits such as tomato. In order to get an insight into the role of ABA signaling in fruit development, the expression of two AREB-like factors were investigated during different developmental stages. In addition, tomato transgenic lines that overexpress and downregulate one AREB-like transcription factor, SlAREB1, were used to determine its effect on the levels of some metabolites determining fruit quality. Higher levels of citric acid, malic acid, glutamic acid, glucose and fructose were observed in SlAREB1-overexpressing lines compared with those in antisense suppression lines in red mature fruit pericarp. The higher hexose concentration correlated with increased expression of genes encoding a vacuolar invertase (EC 3.2.1.26) and a sucrose synthase (EC 2.4.1.13). No significant changes were found in ethylene content which agrees with the normal ripening phenotype observed in transgenic fruits. These results suggest that an AREB-mediated ABA signal affects the metabolism of these compounds during the fruit developmental program. Copyright © Physiologia Plantarum 2010.

  7. RNA-sequencing of the sturgeon Acipenser baeri provides insights into expression dynamics of morphogenic differentiation and developmental regulatory genes in early versus late developmental stages.

    PubMed

    Song, Wei; Jiang, Keji; Zhang, Fengying; Lin, Yu; Ma, Lingbo

    2016-08-08

    Acipenser baeri, one of the critically endangered animals on the verge of extinction, is a key species for evolutionary, developmental, physiology and conservation studies and a standout amongst the most important food products worldwide. Though the transcriptome of the early development of A. baeri has been published recently, the transcriptome changes occurring in the transition from embryonic to late stages are still unknown. The aim of this work was to analyze the transcriptomes of embryonic and post-embryonic stages of A. baeri and identify differentially expressed genes (DEGs) and their expression patterns using mRNA collected from specimens at big yolk plug, wide neural plate and 64 day old sturgeon developmental stages for RNA-Seq. The paired-end sequencing of the transcriptome of samples of A. baeri collected at two early (big yolk plug (T1, 32 h after fertilization) and wide neural plate formation (T2, 45 h after fertilization)) and one late (T22, 64 day old sturgeon) developmental stages using Illumina Hiseq2000 platform generated 64039846, 64635214 and 75293762 clean paired-end reads for T1, T2 and T22, respectively. After quality control, the sequencing reads were de novo assembled to generate a set of 149,265 unigenes with N50 value of 1277 bp. Functional annotation indicated that a substantial number of these unigenes had significant similarity with proteins in public databases. Differential expression profiling allowed the identification of 2789, 12,819 and 10,824 DEGs from the respective T1 vs. T2, T1 vs. T22 and T2 vs. T22 comparisons. High correlation of DEGs' features was recorded among early stages while significant divergences were observed when comparing the late stage with early stages. GO and KEGG enrichment analyses revealed the biological processes, cellular component, molecular functions and metabolic pathways associated with identified DEGs. The qRT-PCR performed for candidate genes in specimens confirmed the validity of the RNA-seq data. This study presents, for the first time, an extensive overview of RNA-Seq based characterization of the early and post-embryonic developmental transcriptomes of A. baeri and provided 149,265 gene sequences that will be potentially valuable for future molecular and genetic studies in A. baeri.

  8. Aspects of embryonic and larval development in bighead carp Hypophthalmichthys nobilis and silver carp Hypophthalmichthys molitrix

    USGS Publications Warehouse

    George, Amy E.; Chapman, Duane C.

    2013-01-01

    As bighead carp Hypophthalmichthys nobilis and silver carp H. molitrix (the bigheaded carps) are poised to enter the Laurentian Great Lakes and potentially damage the region’s economically important fishery, information on developmental rates and behaviors of carps is critical to assessing their ability to establish sustainable populations within the Great Lakes basin. In laboratory experiments, the embryonic and larval developmental rates, size, and behaviors of bigheaded carp were tracked at two temperature treatments, one “cold” and one “warm”. Developmental rates were computed using previously described stages of development and the cumulative thermal unit method. Both species have similar thermal requirements, with a minimum developmental temperature for embryonic stages of 12.1° C for silver carp and 12.9° C for bighead carp, and 13.3° C for silver carp larval stages and 13.4° C for bighead carp larval stages. Egg size differed among species and temperature treatments, as egg size was larger in bighead carp, and “warm" temperature treatments. The larvae started robust upwards vertical swimming immediately after hatching, interspersed with intervals of sinking. Vertical swimming tubes were used to measure water column distribution, and ascent and descent rates of vertically swimming fish. Water column distribution and ascent and descent rates changed with ontogeny. Water column distribution also showed some diel periodicity. Developmental rates, size, and behaviors contribute to the drift distance needed to fulfill the early life history requirements of bigheaded carps and can be used in conjunction with transport information to assess invasibility of a river.

  9. In Silico Analysis of Expression Data for Identification of Genes Involved in Spatial Accumulation of Calcium in Developing Seeds of Rice

    PubMed Central

    Goel, Anshita; Gaur, Vikram S.; Arora, Sandeep; Gupta, Sanjay

    2012-01-01

    Abstract The calcium (Ca2+) transporters, like Ca2+ channels, Ca2+ ATPases, and Ca2+ exchangers, are instrumental for signaling and transport. However, the mechanism by which they orchestrate the accumulation of Ca2+ in grain filling has not yet been investigated. Hence the present study was designed to identify the potential calcium transporter genes that may be responsible for the spatial accumulation of calcium during grain filling. In silico expression analyses were performed to identify Ca2+ transporters that predominantly express during the different developmental stages of Oryza sativa. A total of 13 unique calcium transporters (7 from massively parallel signature sequencing [MPSS] data analysis, and 9 from microarray analysis) were identified. Analysis of variance (ANOVA) revealed differential expression of the transporters across tissues, and principal component analysis (PCA) exhibited their seed-specific distinctive expression profile. Interestingly, Ca2+ exchanger genes are highly expressed in the initial stages, whereas some Ca2+ ATPase genes are highly expressed throughout seed development. Furthermore, analysis of the cis-elements located in the promoter region of the subset of 13 genes suggested that Dof proteins play essential roles in regulating the expression of Ca2+ transporter genes during rice seed development. Based on these results, we developed a hypothetical model explaining the transport and tissue specific distribution of calcium in developing cereal seeds. The model may be extrapolated to understand the mechanism behind the exceptionally high level of calcium accumulation seen in grains like finger millet. PMID:22734689

  10. Mutation of the murC and murB Genes Impairs Heterocyst Differentiation in Anabaena sp. Strain PCC 7120

    PubMed Central

    Videau, Patrick; Rivers, Orion S.; Ushijima, Blake; Oshiro, Reid T.; Kim, Min Joo; Philmus, Benjamin

    2016-01-01

    ABSTRACT To stabilize cellular integrity in the face of environmental perturbations, most bacteria, including cyanobacteria, synthesize and maintain a strong, flexible, three-dimensional peptidoglycan lattice. Anabaena sp. strain PCC 7120 is a filamentous cyanobacterium capable of differentiating morphologically distinct nitrogen-fixing heterocyst cells in a periodic pattern. While heterocyst development has been shown to require proper peptidoglycan remodeling, the role of peptidoglycan synthesis has remained unclear. Here we report the identification of two peptidoglycan synthesis genes, murC (alr5065) and murB (alr5066), as required for heterocyst development. The murC and murB genes are predicted to encode a UDP-N-acetylmuramate:l-alanine ligase and a UDP-N-acetylenolpyruvoylglucosamine reductase, respectively, and we confirm enzymatic function through complementation of Escherichia coli strains deficient for these enzymes. Cells depleted of either murC or murB expression failed to differentiate heterocysts under normally inducing conditions and displayed decreased filament integrity. To identify the stage(s) of development affected by murC or murB depletion, the spatial distribution of expression of the patterning marker gene, patS, was examined. Whereas murB depletion did not affect the pattern of patS expression, murC depletion led to aberrant expression of patS in all cells of the filament. Finally, expression of gfp controlled by the region of DNA immediately upstream of murC was enriched in differentiating cells and was repressed by the transcription factor NtcA. Collectively, the data in this work provide evidence for a direct link between peptidoglycan synthesis and the maintenance of a biological pattern in a multicellular organism. IMPORTANCE Multicellular organisms that differentiate specialized cells must regulate morphological changes such that both cellular integrity and the dissemination of developmental signals are preserved. Here we show that the multicellular bacterium Anabaena, which differentiates a periodic pattern of specialized heterocyst cells, requires peptidoglycan synthesis by the murine ligase genes murC (alr5065) and murB (alr5066) for maintenance of patterned gene expression, filament integrity, and overall development. This work highlights the significant influence that intracellular structure and intercellular connections can have on the execution of a developmental program. PMID:26811320

  11. Mutation of the murC and murB Genes Impairs Heterocyst Differentiation in Anabaena sp. Strain PCC 7120.

    PubMed

    Videau, Patrick; Rivers, Orion S; Ushijima, Blake; Oshiro, Reid T; Kim, Min Joo; Philmus, Benjamin; Cozy, Loralyn M

    2016-04-01

    To stabilize cellular integrity in the face of environmental perturbations, most bacteria, including cyanobacteria, synthesize and maintain a strong, flexible, three-dimensional peptidoglycan lattice. Anabaena sp. strain PCC 7120 is a filamentous cyanobacterium capable of differentiating morphologically distinct nitrogen-fixing heterocyst cells in a periodic pattern. While heterocyst development has been shown to require proper peptidoglycan remodeling, the role of peptidoglycan synthesis has remained unclear. Here we report the identification of two peptidoglycan synthesis genes, murC (alr5065) and murB (alr5066), as required for heterocyst development. The murC and murB genes are predicted to encode a UDP-N-acetylmuramate:L-alanine ligase and a UDP-N-acetylenolpyruvoylglucosamine reductase, respectively, and we confirm enzymatic function through complementation of Escherichia coli strains deficient for these enzymes. Cells depleted of either murC or murB expression failed to differentiate heterocysts under normally inducing conditions and displayed decreased filament integrity. To identify the stage(s) of development affected by murC or murB depletion, the spatial distribution of expression of the patterning marker gene, patS, was examined. Whereas murB depletion did not affect the pattern of patS expression, murC depletion led to aberrant expression of patS in all cells of the filament. Finally, expression of gfp controlled by the region of DNA immediately upstream of murC was enriched in differentiating cells and was repressed by the transcription factor NtcA. Collectively, the data in this work provide evidence for a direct link between peptidoglycan synthesis and the maintenance of a biological pattern in a multicellular organism. Multicellular organisms that differentiate specialized cells must regulate morphological changes such that both cellular integrity and the dissemination of developmental signals are preserved. Here we show that the multicellular bacterium Anabaena, which differentiates a periodic pattern of specialized heterocyst cells, requires peptidoglycan synthesis by the murine ligase genes murC (alr5065) and murB (alr5066) for maintenance of patterned gene expression, filament integrity, and overall development. This work highlights the significant influence that intracellular structure and intercellular connections can have on the execution of a developmental program. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  12. Developmental gene regulation during tomato fruit ripening and in-vitro sepal morphogenesis

    PubMed Central

    Bartley, Glenn E; Ishida, Betty K

    2003-01-01

    Background Red ripe tomatoes are the result of numerous physiological changes controlled by hormonal and developmental signals, causing maturation or differentiation of various fruit tissues simultaneously. These physiological changes affect visual, textural, flavor, and aroma characteristics, making the fruit more appealing to potential consumers for seed dispersal. Developmental regulation of tomato fruit ripening has, until recently, been lacking in rigorous investigation. We previously indicated the presence of up-regulated transcription factors in ripening tomato fruit by data mining in TIGR Tomato Gene Index. In our in-vitro system, green tomato sepals cultured at 16 to 22°C turn red and swell like ripening tomato fruit while those at 28°C remain green. Results Here, we have further examined regulation of putative developmental genes possibly involved in tomato fruit ripening and development. Using molecular biological methods, we have determined the relative abundance of various transcripts of genes during in vitro sepal ripening and in tomato fruit pericarp at three stages of development. A number of transcripts show similar expression in fruits to RIN and PSY1, ripening-associated genes, and others show quite different expression. Conclusions Our investigation has resulted in confirmation of some of our previous database mining results and has revealed differences in gene expression that may be important for tomato cultivar variation. We present new and intriguing information on genes that should now be studied in a more focused fashion. PMID:12906715

  13. Developmental programming: impact of prenatal testosterone excess on pre- and postnatal gonadotropin regulation in sheep.

    PubMed

    Manikkam, Mohan; Thompson, Robert C; Herkimer, Carol; Welch, Kathleen B; Flak, Jonathan; Karsch, Fred J; Padmanabhan, Vasantha

    2008-04-01

    The goal of this study was to explore mechanisms that mediate hypersecretion of LH and progressive loss of cyclicity in female sheep exposed during fetal life to excess testosterone. Our working hypothesis was that prenatal testosterone excess, by its androgenic action, amplifies GnRH-induced LH (but not FSH) secretion and, thus, hypersecretion of LH in adulthood, and that this results from altered developmental gene expression of GnRH and estradiol (E2) receptors, gonadotropin subunits, and paracrine factors that differentially regulate LH and FSH synthesis. We observed that, relative to controls, females exposed during fetal life to excess testosterone, as well as the nor-aromatizable androgen dihydrotestosterone, exhibited enhanced LH but not FSH responses to intermittent delivery of GnRH boluses under conditions in which endogenous LH (GnRH) pulses were suppressed. Luteinizing hormone hypersecretion was more evident in adults than in prepubertal females, and it was associated with development of acyclicity. Measurement of pituitary mRNA concentrations revealed that prenatal testosterone excess induced developmental changes in gene expression of pituitary GnRH and E2 receptors and paracrine modulators of LH and FSH synthesis in a manner consistent with subsequent amplification of LH release. Together, this series of studies suggests that prenatal testosterone excess, by its androgenic action, amplifies GnRH-induced LH response, leading to LH hypersecretion and acyclicity in adulthood, and that this programming involves developmental changes in expression of pituitary genes involved in LH and FSH release.

  14. Developmental estrogen exposures and disruptions to maternal behavior and brain: Effects of ethinyl estradiol, a common positive control.

    PubMed

    Catanese, Mary C; Vandenberg, Laura N

    2017-11-07

    Due of its structural similarity to the endogenous estrogen 17β-estradiol (E2), the synthetic estrogen 17α-ethinyl estradiol (EE2) is widely used to study the effects of estrogenic substances on sensitive organs at multiple stages of development. Here, we investigated the effects of EE2 on maternal behavior and the maternal brain in females exposed during gestation and the perinatal period. We assessed several components of maternal behavior including nesting behavior and pup retrieval; characterized the expression of estrogen receptor (ER)α in the medial preoptic area (MPOA), a brain region critical for the display of maternal behavior; and measured expression of tyrosine hydroxylase, a marker for dopaminergic cells, in the ventral tegmental area (VTA), a brain region important in maternal motivation. We found that developmental exposure to EE2 induces subtle effects on several aspects of maternal behavior including time building the nest and time spent engaged in self-care. Developmental exposure to EE2 also altered ERα expression in the central MPOA during both early and late lactation and led to significantly reduced tyrosine hydroxylase immunoreactivity in the VTA. Our results demonstrate both dose- and postpartum stage-related effects of developmental exposure to EE2 on behavior and brain that manifest later in adulthood, during the maternal period. These findings provide further evidence for effects of exposure to exogenous estrogenic compounds during the critical periods of fetal and perinatal development. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Expression of APG-2 protein, a member of the heat shock protein 110 family, in developing rat brain.

    PubMed

    Okui, M; Ito, F; Ogita, K; Kuramoto, N; Kudoh, J; Shimizu, N; Ide, T

    2000-01-01

    APG-2 protein is a member of the heat shock protein 110 family, and it is thought to play an important role in the maintenance of neuronal functions under physiological and stress conditions. However, neither the tissue-distribution of APG-2 protein nor developmental change of its expression has been studied at the protein level. Therefore, we generated an antiserum against APG-2 protein and studied expression of this protein in rat brain and other tissues by use of the Western blot method. The results showed a high expression of APG-2 protein in various regions of the central nervous system (cerebral cortex, hippocampus, striatum, midbrain, hypothalamus, cerebellum, medulla pons, and spinal cord) throughout the entire postnatal stage. Similarly, a high level of APG-2 protein was detected in the whole brain of rat embryos and in adult rat tissues such as liver, lung, spleen, and kidney. In contrast, its expression in heart was high at postnatal days 1 and 3, but thereafter drastically decreased to a low level. Furthermore, APG-2 protein was detected in neuronal primary cultures prepared from rat cerebral cortex, and its level did not change notably during neuronal differentiation. These results show that APG-2 protein is constitutively expressed in various tissues and also in neuronal cells throughout the entire embryonic and postnatal period. suggesting that it might play an important role in these tissues under non-stress conditions.

  16. Cerebellins are differentially expressed in selective subsets of neurons throughout the brain.

    PubMed

    Seigneur, Erica; Südhof, Thomas C

    2017-10-15

    Cerebellins are secreted hexameric proteins that form tripartite complexes with the presynaptic cell-adhesion molecules neurexins or 'deleted-in-colorectal-cancer', and the postsynaptic glutamate-receptor-related proteins GluD1 and GluD2. These tripartite complexes are thought to regulate synapses. However, cerebellins are expressed in multiple isoforms whose relative distributions and overall functions are not understood. Three of the four cerebellins, Cbln1, Cbln2, and Cbln4, autonomously assemble into homohexamers, whereas the Cbln3 requires Cbln1 for assembly and secretion. Here, we show that Cbln1, Cbln2, and Cbln4 are abundantly expressed in nearly all brain regions, but exhibit strikingly different expression patterns and developmental dynamics. Using newly generated knockin reporter mice for Cbln2 and Cbln4, we find that Cbln2 and Cbln4 are not universally expressed in all neurons, but only in specific subsets of neurons. For example, Cbln2 and Cbln4 are broadly expressed in largely non-overlapping subpopulations of excitatory cortical neurons, but only sparse expression was observed in excitatory hippocampal neurons of the CA1- or CA3-region. Similarly, Cbln2 and Cbln4 are selectively expressed, respectively, in inhibitory interneurons and excitatory mitral projection neurons of the main olfactory bulb; here, these two classes of neurons form dendrodendritic reciprocal synapses with each other. A few brain regions, such as the nucleus of the lateral olfactory tract, exhibit astoundingly high Cbln2 expression levels. Viewed together, our data show that cerebellins are abundantly expressed in relatively small subsets of neurons, suggesting specific roles restricted to subsets of synapses. © 2017 Wiley Periodicals, Inc.

  17. Distribution of cellular HSV-1 receptor expression in human brain.

    PubMed

    Lathe, Richard; Haas, Juergen G

    2017-06-01

    Herpes simplex virus type 1 (HSV-1) is a neurotropic virus linked to a range of acute and chronic neurological disorders affecting distinct regions of the brain. Unusually, HSV-1 entry into cells requires the interaction of viral proteins glycoprotein D (gD) and glycoprotein B (gB) with distinct cellular receptor proteins. Several different gD and gB receptors have been identified, including TNFRSF14/HVEM and PVRL1/nectin 1 as gD receptors and PILRA, MAG, and MYH9 as gB receptors. We investigated the expression of these receptor molecules in different areas of the adult and developing human brain using online transcriptome databases. Whereas all HSV-1 receptors showed distinct expression patterns in different brain areas, the Allan Brain Atlas (ABA) reported increased expression of both gD and gB receptors in the hippocampus. Specifically, for PVRL1, TNFRFS14, and MYH9, the differential z scores for hippocampal expression, a measure of relative levels of increased expression, rose to 2.9, 2.9, and 2.5, respectively, comparable to the z score for the archetypical hippocampus-enriched mineralocorticoid receptor (NR3C2, z = 3.1). These data were confirmed at the Human Brain Transcriptome (HBT) database, but HBT data indicate that MAG expression is also enriched in hippocampus. The HBT database allowed the developmental pattern of expression to be investigated; we report that all HSV1 receptors markedly increase in expression levels between gestation and the postnatal/adult periods. These results suggest that differential receptor expression levels of several HSV-1 gD and gB receptors in the adult hippocampus are likely to underlie the susceptibility of this brain region to HSV-1 infection.

  18. Aroclor 1254, a developmental neurotoxicant, alters energy metabolism- and intracellular signaling-associated protein networks in rat cerebellum and hippocampus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kodavanti, Prasada Rao S., E-mail: kodavanti.prasada@epa.gov; Osorio, Cristina; Program on Molecular Biology and Biotechnology, University of North Carolina at Chapel Hill, North Carolina

    2011-11-15

    The vast literature on the mode of action of polychlorinated biphenyls (PCBs) indicates that PCBs are a unique model for understanding the mechanisms of toxicity of environmental mixtures of persistent chemicals. PCBs have been shown to adversely affect psychomotor function and learning and memory in humans. Although the molecular mechanisms for PCB effects are unclear, several studies indicate that the disruption of Ca{sup 2+}-mediated signal transduction plays significant roles in PCB-induced developmental neurotoxicity. Culminating events in signal transduction pathways include the regulation of gene and protein expression, which affects the growth and function of the nervous system. Our previous studiesmore » showed changes in gene expression related to signal transduction and neuronal growth. In this study, protein expression following developmental exposure to PCB is examined. Pregnant rats (Long Evans) were dosed with 0.0 or 6.0 mg/kg/day of Aroclor-1254 from gestation day 6 through postnatal day (PND) 21, and the cerebellum and hippocampus from PND14 animals were analyzed to determine Aroclor 1254-induced differential protein expression. Two proteins were found to be differentially expressed in the cerebellum following PCB exposure while 18 proteins were differentially expressed in the hippocampus. These proteins are related to energy metabolism in mitochondria (ATP synthase, sub unit {beta} (ATP5B), creatine kinase, and malate dehydrogenase), calcium signaling (voltage-dependent anion-selective channel protein 1 (VDAC1) and ryanodine receptor type II (RyR2)), and growth of the nervous system (dihydropyrimidinase-related protein 4 (DPYSL4), valosin-containing protein (VCP)). Results suggest that Aroclor 1254-like persistent chemicals may alter energy metabolism and intracellular signaling, which might result in developmental neurotoxicity. -- Highlights: Black-Right-Pointing-Pointer We performed brain proteomic analysis of rats exposed to the neurotoxicant, Aroclor 1254. Black-Right-Pointing-Pointer Cerebellum and hippocampus were analyzed by 2D DIGE and Mass spectrometry. Black-Right-Pointing-Pointer Proteins affected participate in Energy metabolism, calcium signaling and nervous system growth.« less

  19. Genome-wide analysis of coordinated transcript abundance during seed development in different Brassica rapa morphotypes.

    PubMed

    Basnet, Ram Kumar; Moreno-Pachon, Natalia; Lin, Ke; Bucher, Johan; Visser, Richard G F; Maliepaard, Chris; Bonnema, Guusje

    2013-12-01

    Brassica seeds are important as basic units of plant growth and sources of vegetable oil. Seed development is regulated by many dynamic metabolic processes controlled by complex networks of spatially and temporally expressed genes. We conducted a global microarray gene co-expression analysis by measuring transcript abundance of developing seeds from two diverse B. rapa morphotypes: a pak choi (leafy-type) and a yellow sarson (oil-type), and two of their doubled haploid (DH) progenies, (1) to study the timing of metabolic processes in developing seeds, (2) to explore the major transcriptional differences in developing seeds of the two morphotypes, and (3) to identify the optimum stage for a genetical genomics study in B. rapa seed. Seed developmental stages were similar in developing seeds of pak choi and yellow sarson of B. rapa; however, the colour of embryo and seed coat differed among these two morphotypes. In this study, most transcriptional changes occurred between 25 and 35 DAP, which shows that the timing of seed developmental processes in B. rapa is at later developmental stages than in the related species B. napus. Using a Weighted Gene Co-expression Network Analysis (WGCNA), we identified 47 "gene modules", of which 27 showed a significant association with temporal and/or genotypic variation. An additional hierarchical cluster analysis identified broad spectra of gene expression patterns during seed development. The predominant variation in gene expression was according to developmental stages rather than morphotype differences. Since lipids are the major storage compounds of Brassica seeds, we investigated in more detail the regulation of lipid metabolism. Four co-regulated gene clusters were identified with 17 putative cis-regulatory elements predicted in their 1000 bp upstream region, either specific or common to different lipid metabolic pathways. This is the first study of genome-wide profiling of transcript abundance during seed development in B. rapa. The identification of key physiological events, major expression patterns, and putative cis-regulatory elements provides useful information to construct gene regulatory networks in B. rapa developing seeds and provides a starting point for a genetical genomics study of seed quality traits.

  20. Conserved Gene Expression Programs in Developing Roots from Diverse Plants.

    PubMed

    Huang, Ling; Schiefelbein, John

    2015-08-01

    The molecular basis for the origin and diversification of morphological adaptations is a central issue in evolutionary developmental biology. Here, we defined temporal transcript accumulation in developing roots from seven vascular plants, permitting a genome-wide comparative analysis of the molecular programs used by a single organ across diverse species. The resulting gene expression maps uncover significant similarity in the genes employed in roots and their developmental expression profiles. The detailed analysis of a subset of 133 genes known to be associated with root development in Arabidopsis thaliana indicates that most of these are used in all plant species. Strikingly, this was also true for root development in a lycophyte (Selaginella moellendorffii), which forms morphologically different roots and is thought to have evolved roots independently. Thus, despite vast differences in size and anatomy of roots from diverse plants, the basic molecular mechanisms employed during root formation appear to be conserved. This suggests that roots evolved in the two major vascular plant lineages either by parallel recruitment of largely the same developmental program or by elaboration of an existing root program in the common ancestor of vascular plants. © 2015 American Society of Plant Biologists. All rights reserved.

Top