A Novel SERRS Sandwich-Hybridization Assay to Detect Specific DNA Target

PubMed Central

Gillet, Benjamin; Montagnac, Gilles; Daniel, Isabelle; Hänni, Catherine

2011-01-01

In this study, we have applied Surface Enhanced Resonance Raman Scattering (SERRS) technology to the specific detection of DNA. We present an innovative SERRS sandwich-hybridization assay that allows specific DNA detection without any enzymatic amplification, such as is the case with Polymerase Chain Reaction (PCR). In some substrates, such as ancient or processed remains, enzymatic amplification fails due to DNA alteration (degradation, chemical modification) or to the presence of inhibitors. Consequently, the development of a non-enzymatic method, allowing specific DNA detection, could avoid long, expensive and inconclusive amplification trials. Here, we report the proof of concept of a SERRS sandwich-hybridization assay that leads to the detection of a specific chamois DNA. This SERRS assay reveals its potential as a non-enzymatic alternative technology to DNA amplification methods (particularly the PCR method) with several applications for species detection. As the amount and type of damage highly depend on the preservation conditions, the present SERRS assay would enlarge the range of samples suitable for DNA analysis and ultimately would provide exciting new opportunities for the investigation of ancient DNA in the fields of evolutionary biology and molecular ecology, and of altered DNA in food frauds detection and forensics. PMID:21655320

Detection of genetically modified organisms in foods by DNA amplification techniques.

PubMed

García-Cañas, Virginia; Cifuentes, Alejandro; González, Ramón

2004-01-01

In this article, the different DNA amplification techniques that are being used for detecting genetically modified organisms (GMOs) in foods are examined. This study intends to provide an updated overview (including works published till June 2002) on the principal applications of such techniques together with their main advantages and drawbacks in GMO detection in foods. Some relevant facts on sampling, DNA isolation, and DNA amplification methods are discussed. Moreover; these analytical protocols are discuissed from a quantitative point of view, including the newest investigations on multiplex detection of GMOs in foods and validation of methods.

Use of Multiple Displacement Amplification as Pre-polymerase Chain Reaction (Pre-PCR) to amplify genomic DNA of siphonapterids preserved for long periods in scientific collections.

PubMed

Avelar, Daniel M; Linardi, Pedro M

2010-09-15

The recently developed Multiple Displacement Amplification technique (MDA) allows for the production of a large quantity of high quality genomic DNA from low amounts of the original DNA. The goal of this study was to evaluate the performance of the MDA technique to amplify genomic DNA of siphonapterids that have been stored for long periods in 70% ethanol at room temperature. We subjected each DNA sample to two different methodologies: (1) amplification of mitochondrial 16S sequences without MDA; (2) amplification of 16S after MDA. All the samples obtained from these procedures were then sequenced. Only 4 samples (15.4%) subjected to method 1 showed amplification. In contrast, the application of MDA (method 2) improved the performance substantially, with 24 samples (92.3%) showing amplification, with significant difference. Interestingly, one of the samples successfully amplified with this method was originally collected in 1909. All of the sequenced samples displayed satisfactory results in quality evaluations (Phred ≥ 20) and good similarities, as identified with the BLASTn tool. Our results demonstrate that the use of MDA may be an effective tool in molecular studies involving specimens of fleas that have traditionally been considered inadequately preserved for such purposes.

Use of Multiple Displacement Amplification as Pre-polymerase Chain Reaction (Pre-PCR) to amplify genomic DNA of siphonapterids preserved for long periods in scientific collections

PubMed Central

2010-01-01

The recently developed Multiple Displacement Amplification technique (MDA) allows for the production of a large quantity of high quality genomic DNA from low amounts of the original DNA. The goal of this study was to evaluate the performance of the MDA technique to amplify genomic DNA of siphonapterids that have been stored for long periods in 70% ethanol at room temperature. We subjected each DNA sample to two different methodologies: (1) amplification of mitochondrial 16S sequences without MDA; (2) amplification of 16S after MDA. All the samples obtained from these procedures were then sequenced. Only 4 samples (15.4%) subjected to method 1 showed amplification. In contrast, the application of MDA (method 2) improved the performance substantially, with 24 samples (92.3%) showing amplification, with significant difference. Interestingly, one of the samples successfully amplified with this method was originally collected in 1909. All of the sequenced samples displayed satisfactory results in quality evaluations (Phred ≥ 20) and good similarities, as identified with the BLASTn tool. Our results demonstrate that the use of MDA may be an effective tool in molecular studies involving specimens of fleas that have traditionally been considered inadequately preserved for such purposes. PMID:20840790

Digital droplet multiple displacement amplification (ddMDA) for whole genome sequencing of limited DNA samples

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rhee, Minsoung; Light, Yooli K.; Meagher, Robert J.

Here, multiple displacement amplification (MDA) is a widely used technique for amplification of DNA from samples containing limited amounts of DNA (e.g., uncultivable microbes or clinical samples) before whole genome sequencing. Despite its advantages of high yield and fidelity, it suffers from high amplification bias and non-specific amplification when amplifying sub-nanogram of template DNA. Here, we present a microfluidic digital droplet MDA (ddMDA) technique where partitioning of the template DNA into thousands of sub-nanoliter droplets, each containing a small number of DNA fragments, greatly reduces the competition among DNA fragments for primers and polymerase thereby greatly reducing amplification bias. Consequently,more » the ddMDA approach enabled a more uniform coverage of amplification over the entire length of the genome, with significantly lower bias and non-specific amplification than conventional MDA. For a sample containing 0.1 pg/μL of E. coli DNA (equivalent of ~3/1000 of an E. coli genome per droplet), ddMDA achieves a 65-fold increase in coverage in de novo assembly, and more than 20-fold increase in specificity (percentage of reads mapping to E. coli) compared to the conventional tube MDA. ddMDA offers a powerful method useful for many applications including medical diagnostics, forensics, and environmental microbiology.« less

Digital droplet multiple displacement amplification (ddMDA) for whole genome sequencing of limited DNA samples

DOE PAGES

Rhee, Minsoung; Light, Yooli K.; Meagher, Robert J.; ...

2016-05-04

Here, multiple displacement amplification (MDA) is a widely used technique for amplification of DNA from samples containing limited amounts of DNA (e.g., uncultivable microbes or clinical samples) before whole genome sequencing. Despite its advantages of high yield and fidelity, it suffers from high amplification bias and non-specific amplification when amplifying sub-nanogram of template DNA. Here, we present a microfluidic digital droplet MDA (ddMDA) technique where partitioning of the template DNA into thousands of sub-nanoliter droplets, each containing a small number of DNA fragments, greatly reduces the competition among DNA fragments for primers and polymerase thereby greatly reducing amplification bias. Consequently,more » the ddMDA approach enabled a more uniform coverage of amplification over the entire length of the genome, with significantly lower bias and non-specific amplification than conventional MDA. For a sample containing 0.1 pg/μL of E. coli DNA (equivalent of ~3/1000 of an E. coli genome per droplet), ddMDA achieves a 65-fold increase in coverage in de novo assembly, and more than 20-fold increase in specificity (percentage of reads mapping to E. coli) compared to the conventional tube MDA. ddMDA offers a powerful method useful for many applications including medical diagnostics, forensics, and environmental microbiology.« less

Detection of DNA Sequences Refractory to PCR Amplification Using a Biophysical SERRS Assay (Surface Enhanced Resonant Raman Spectroscopy)

PubMed Central

Feuillie, Cécile; Merheb, Maxime M.; Gillet, Benjamin; Montagnac, Gilles; Daniel, Isabelle; Hänni, Catherine

2014-01-01

The analysis of ancient or processed DNA samples is often a great challenge, because traditional Polymerase Chain Reaction – based amplification is impeded by DNA damage. Blocking lesions such as abasic sites are known to block the bypass of DNA polymerases, thus stopping primer elongation. In the present work, we applied the SERRS-hybridization assay, a fully non-enzymatic method, to the detection of DNA refractory to PCR amplification. This method combines specific hybridization with detection by Surface Enhanced Resonant Raman Scattering (SERRS). It allows the detection of a series of double-stranded DNA molecules containing a varying number of abasic sites on both strands, when PCR failed to detect the most degraded sequences. Our SERRS approach can quickly detect DNA molecules without any need for DNA repair. This assay could be applied as a pre-requisite analysis prior to enzymatic reparation or amplification. A whole new set of samples, both forensic and archaeological, could then deliver information that was not yet available due to a high degree of DNA damage. PMID:25502338

Detection of DNA sequences refractory to PCR amplification using a biophysical SERRS assay (Surface Enhanced Resonant Raman Spectroscopy).

PubMed

Feuillie, Cécile; Merheb, Maxime M; Gillet, Benjamin; Montagnac, Gilles; Daniel, Isabelle; Hänni, Catherine

2014-01-01

The analysis of ancient or processed DNA samples is often a great challenge, because traditional Polymerase Chain Reaction - based amplification is impeded by DNA damage. Blocking lesions such as abasic sites are known to block the bypass of DNA polymerases, thus stopping primer elongation. In the present work, we applied the SERRS-hybridization assay, a fully non-enzymatic method, to the detection of DNA refractory to PCR amplification. This method combines specific hybridization with detection by Surface Enhanced Resonant Raman Scattering (SERRS). It allows the detection of a series of double-stranded DNA molecules containing a varying number of abasic sites on both strands, when PCR failed to detect the most degraded sequences. Our SERRS approach can quickly detect DNA molecules without any need for DNA repair. This assay could be applied as a pre-requisite analysis prior to enzymatic reparation or amplification. A whole new set of samples, both forensic and archaeological, could then deliver information that was not yet available due to a high degree of DNA damage.

Improved Method for Direct Detection of Environmental Microorganisms Using an Amplification of 16S rDNA Region

NASA Astrophysics Data System (ADS)

Tsujimura, M.; Akutsu, J.; Zhang, Z.; Sasaki, M.; Tajima, H.; Kawarabayasi, Y.

2004-12-01

The thermostable proteins or enzymes were expected to be capable to be utilized in many areas of industries. Many thermophilic microorganisms, which possess the thermostable proteins or enzymes, were identified from the extreme environment. However, many unidentified and uncultivable microorganisms are still remaining in the environment on the earth. It is generally said that the cultivable microorganisms are less than 1% of entire microorganisms living in the earth, remaining over 99% are still uncultivable. As an approach to the uncultivable microorganisms, the PCR amplification of 16S rDNA region using primer sets designed from the conserved region has been generally utilized for detection and community analysis of microorganism in the environment. However, the facts, that PCR amplification introduces the mutation in the amplified DNA fragment and efficiency of PCR amplification is depend on the sequences of primer sets, indicated that the improving of PCR analysis was necessary for more correct detection of microorganisms. As the result of evaluation for the quality of DNA polymerases, sequences of primers used for amplification and conditions of PCR amplification, the DNA polymerase, the primer set and the conditions for amplification, which did not amplify the DNA fragment from the DNA contaminated within the DNA polymerase itself, were successfully selected. Also the rate of mutation in the DNA fragment amplified was evaluated using this conditions and the genomic DNA from cultivable microbes as a template. The result indicated the rate of mutation introduced by PCR was approximately 0.1% to 0.125%. The improved method using these conditions and error rate calculated was applied for the analysis of microorganisms in the geothermal environment. The result indicated that four kinds of dominant microorganisms, including both of bacteria and archaea, were alive within soil in the hot spring in Tohoku Area. We would like to apply this improved method to detection of microorganisms with important genes from more other environments.

Comparison of four DNA extraction methods for the detection of Mycobacterium leprae from Ziehl-Neelsen-stained microscopic slides.

PubMed

Ruiz-Fuentes, Jenny Laura; Díaz, Alexis; Entenza, Anayma Elena; Frión, Yahima; Suárez, Odelaisy; Torres, Pedro; de Armas, Yaxsier; Acosta, Lucrecia

2015-12-01

The diagnosis of leprosy has been a challenge due to the low sensibility of the conventional methods and the impossibility of culturing the causative organism. In this study, four methods for Mycobacterium leprae nucleic-acid extraction from Ziehl-Neelsen-stained slides (ZNS slides) were compared: Phenol/chloroform, Chelex 100 resin, and two commercial kits (Wizard Genomic DNA Purification Kit and QIAamp DNA Mini Kit). DNA was extracted from four groups of slides: a high-codification-slide group (bacteriological index [BI]⩾4), a low-codification-slide group (BI=1), a negative-slide group (BI=0), and a negative-control-slide group (BI=0). Quality DNA was evidenced by the amplification of specific repetitive element present in M. leprae genomic DNA (RLEP) using a nested polymerase chain reaction. This is the first report comparing four different extraction methods for obtaining M. leprae DNA from ZNS slides in Cuban patients, and applied in molecular diagnosis. Good-quality DNA and positive amplification were detected in the high-codification-slide group with the four methods, while from the low-codification-slide group only the QIAGEN and phenol-chloroform methods obtained amplification of M. leprae. In the negative-slide group, only the QIAGEN method was able to obtain DNA with sufficient quality for positive amplification of the RLEP region. No amplification was observed in the negative-control-slide group by any method. Patients with ZNS negative slides can still transmit the infection, and molecular methods can help identify and treat them, interrupting the chain of transmission and preventing the onset of disabilities. The ZNS slides can be sent easily to reference laboratories for later molecular analysis that can be useful not only to improve the diagnosis, but also for the application of other molecular techniques. Copyright © 2015 Asian-African Society for Mycobacteriology. Published by Elsevier Ltd. All rights reserved.

Detection of genetically modified organisms (GMOs) using isothermal amplification of target DNA sequences.

PubMed

Lee, David; La Mura, Maurizio; Allnutt, Theo R; Powell, Wayne

2009-02-02

The most common method of GMO detection is based upon the amplification of GMO-specific DNA amplicons using the polymerase chain reaction (PCR). Here we have applied the loop-mediated isothermal amplification (LAMP) method to amplify GMO-related DNA sequences, 'internal' commonly-used motifs for controlling transgene expression and event-specific (plant-transgene) junctions. We have tested the specificity and sensitivity of the technique for use in GMO studies. Results show that detection of 0.01% GMO in equivalent background DNA was possible and dilutions of template suggest that detection from single copies of the template may be possible using LAMP. This work shows that GMO detection can be carried out using LAMP for routine screening as well as for specific events detection. Moreover, the sensitivity and ability to amplify targets, even with a high background of DNA, here demonstrated, highlights the advantages of this isothermal amplification when applied for GMO detection.

Systematic evaluation of bias in microbial community profiles induced by whole genome amplification.

PubMed

Direito, Susana O L; Zaura, Egija; Little, Miranda; Ehrenfreund, Pascale; Röling, Wilfred F M

2014-03-01

Whole genome amplification methods facilitate the detection and characterization of microbial communities in low biomass environments. We examined the extent to which the actual community structure is reliably revealed and factors contributing to bias. One widely used [multiple displacement amplification (MDA)] and one new primer-free method [primase-based whole genome amplification (pWGA)] were compared using a polymerase chain reaction (PCR)-based method as control. Pyrosequencing of an environmental sample and principal component analysis revealed that MDA impacted community profiles more strongly than pWGA and indicated that this related to species GC content, although an influence of DNA integrity could not be excluded. Subsequently, biases by species GC content, DNA integrity and fragment size were separately analysed using defined mixtures of DNA from various species. We found significantly less amplification of species with the highest GC content for MDA-based templates and, to a lesser extent, for pWGA. DNA fragmentation also interfered severely: species with more fragmented DNA were less amplified with MDA and pWGA. pWGA was unable to amplify low molecular weight DNA (< 1.5 kb), whereas MDA was inefficient. We conclude that pWGA is the most promising method for characterization of microbial communities in low-biomass environments and for currently planned astrobiological missions to Mars. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.

Monodisperse Picoliter Droplets for Low-Bias and Contamination-Free Reactions in Single-Cell Whole Genome Amplification

PubMed Central

Maruyama, Toru; Yamagishi, Keisuke; Mori, Tetsushi; Takeyama, Haruko

2015-01-01

Whole genome amplification (WGA) is essential for obtaining genome sequences from single bacterial cells because the quantity of template DNA contained in a single cell is very low. Multiple displacement amplification (MDA), using Phi29 DNA polymerase and random primers, is the most widely used method for single-cell WGA. However, single-cell MDA usually results in uneven genome coverage because of amplification bias, background amplification of contaminating DNA, and formation of chimeras by linking of non-contiguous chromosomal regions. Here, we present a novel MDA method, termed droplet MDA, that minimizes amplification bias and amplification of contaminants by using picoliter-sized droplets for compartmentalized WGA reactions. Extracted DNA fragments from a lysed cell in MDA mixture are divided into 105 droplets (67 pL) within minutes via flow through simple microfluidic channels. Compartmentalized genome fragments can be individually amplified in these droplets without the risk of encounter with reagent-borne or environmental contaminants. Following quality assessment of WGA products from single Escherichia coli cells, we showed that droplet MDA minimized unexpected amplification and improved the percentage of genome recovery from 59% to 89%. Our results demonstrate that microfluidic-generated droplets show potential as an efficient tool for effective amplification of low-input DNA for single-cell genomics and greatly reduce the cost and labor investment required for determination of nearly complete genome sequences of uncultured bacteria from environmental samples. PMID:26389587

Differential impact of ionic and coordinate covalent chromium (Cr)-DNA binding on DNA replication.

PubMed

Fornsaglio, Jamie L; O'Brien, Travis J; Patierno, Steven R

2005-11-01

The reactive species produced by the reduction of Cr(VI), particularly Cr(III), can form both ionic and coordinate covalent complexes with DNA. These Cr(III)-DNA interactions consist of Cr-DNA monoadducts, Cr-DNA ternary adducts, and Cr-DNA interstrand cross-links (Cr-ICLs), the latter of which are DNA polymerase arresting lesions (PALs). We sought to determine the impact of Cr-DNA interactions on the formation of replication blocking lesions in S. cerevisiae using a PCR-based method. We found that target sequence (TS) amplification using DNA isolated from Cr(VI)-treated yeast actually increased as a function of Cr(VI) concentration. Moreover, the enhanced TS amplification was reproduced in vitro using Cr(III)-treated DNA. In contrast, PCR amplification of TS from DNA isolated from yeast exposed to equitoxic doses of the inorganic DNA cross-linking agent cisplatin (CDDP), was decreased in a concentration-dependent manner. This paradox suggested that a specific Cr-DNA interaction, such as an ionic Cr-DNA complex, was responsible for the enhanced TS amplification, thereby masking the replication-blocking effect of certain ternary Cr-DNA adducts (i.e. interstrand cross-links). To test this possibility, we removed ionically associated Cr from the DNA using salt extraction prior to PCR analysis. This procedure obviated the increased amplification and revealed a dose-dependent decrease in TS amplification and an increase in Cr-PALs. These data from DNA analyzed ex vivo after treatment of intact cells indicate that ionic interactions of Cr with DNA result in increased DNA amplification whereas coordinate-covalent Cr-DNA complexes lead to formation of Cr-PALs. Thus, these results suggest that treatment of living cells with Cr(VI) leads to two modes of Cr-binding, which may have conflicting effects on DNA replication.

Reverse transcription strand invasion based amplification (RT-SIBA): a method for rapid detection of influenza A and B.

PubMed

Eboigbodin, Kevin; Filén, Sanna; Ojalehto, Tuomas; Brummer, Mirko; Elf, Sonja; Pousi, Kirsi; Hoser, Mark

2016-06-01

Rapid and accurate diagnosis of influenza viruses plays an important role in infection control, as well as in preventing the misuse of antibiotics. Isothermal nucleic acid amplification methods offer significant advantages over the polymerase chain reaction (PCR), since they are more rapid and do not require the sophisticated instruments needed for thermal cycling. We previously described a novel isothermal nucleic acid amplification method, 'Strand Invasion Based Amplification' (SIBA®), with high analytical sensitivity and specificity, for the detection of DNA. In this study, we describe the development of a variant of the SIBA method, namely, reverse transcription SIBA (RT-SIBA), for the rapid detection of viral RNA targets. The RT-SIBA method includes a reverse transcriptase enzyme that allows one-step reverse transcription of RNA to complementary DNA (cDNA) and simultaneous amplification and detection of the cDNA by SIBA under isothermal reaction conditions. The RT-SIBA method was found to be more sensitive than PCR for the detection of influenza A and B and could detect 100 copies of influenza RNA within 15 min. The development of RT-SIBA will enable rapid and accurate diagnosis of viral RNA targets within point-of-care or central laboratory settings.

Molecular barcodes detect redundancy and contamination in hairpin-bisulfite PCR

PubMed Central

Miner, Brooks E.; Stöger, Reinhard J.; Burden, Alice F.; Laird, Charles D.; Hansen, R. Scott

2004-01-01

PCR amplification of limited amounts of DNA template carries an increased risk of product redundancy and contamination. We use molecular barcoding to label each genomic DNA template with an individual sequence tag prior to PCR amplification. In addition, we include molecular ‘batch-stamps’ that effectively label each genomic template with a sample ID and analysis date. This highly sensitive method identifies redundant and contaminant sequences and serves as a reliable method for positive identification of desired sequences; we can therefore capture accurately the genomic template diversity in the sample analyzed. Although our application described here involves the use of hairpin-bisulfite PCR for amplification of double-stranded DNA, the method can readily be adapted to single-strand PCR. Useful applications will include analyses of limited template DNA for biomedical, ancient DNA and forensic purposes. PMID:15459281

The Effect of Storage and Extraction Methods on Amplification of Plasmodium falciparum DNA from Dried Blood Spots.

PubMed

Schwartz, Alanna; Baidjoe, Amrish; Rosenthal, Philip J; Dorsey, Grant; Bousema, Teun; Greenhouse, Bryan

2015-05-01

Extraction and amplification of DNA from dried blood spots (DBS) collected in field studies is commonly used for detection of Plasmodium falciparum. However, there have been few systematic efforts to determine the effects of storage and extraction methods on the sensitivity of DNA amplification. We investigated the effects of storage conditions, length of storage, and DNA extraction methods on amplification via three PCR-based assays using field samples and laboratory controls. Samples stored as DBS for 2 or more years at ambient temperature showed a significant loss of sensitivity that increased with time; after 10 years only 10% samples with parasite densities > 1,000 parasites/μL were detectable by nested polymerase chain reaction (PCR). Conversely, DBS and extracted DNA stored at -20°C showed no loss of sensitivity with time. Samples with low parasite densities amplified more successfully with saponin/Chelex compared with spin-column-based extraction, though the latter method performed better on samples with higher parasite densities stored for 2 years at ambient temperature. DNA extracted via both methods was stable after 20 freeze-thaw cycles. Our results suggest that DBS should be stored at -20°C or extracted immediately, especially if anticipating 2 or more years of storage. © The American Society of Tropical Medicine and Hygiene.

The Effect of Storage and Extraction Methods on Amplification of Plasmodium falciparum DNA from Dried Blood Spots

PubMed Central

Schwartz, Alanna; Baidjoe, Amrish; Rosenthal, Philip J.; Dorsey, Grant; Bousema, Teun; Greenhouse, Bryan

2015-01-01

Extraction and amplification of DNA from dried blood spots (DBS) collected in field studies is commonly used for detection of Plasmodium falciparum. However, there have been few systematic efforts to determine the effects of storage and extraction methods on the sensitivity of DNA amplification. We investigated the effects of storage conditions, length of storage, and DNA extraction methods on amplification via three PCR-based assays using field samples and laboratory controls. Samples stored as DBS for 2 or more years at ambient temperature showed a significant loss of sensitivity that increased with time; after 10 years only 10% samples with parasite densities > 1,000 parasites/μL were detectable by nested polymerase chain reaction (PCR). Conversely, DBS and extracted DNA stored at −20°C showed no loss of sensitivity with time. Samples with low parasite densities amplified more successfully with saponin/Chelex compared with spin-column-based extraction, though the latter method performed better on samples with higher parasite densities stored for 2 years at ambient temperature. DNA extracted via both methods was stable after 20 freeze-thaw cycles. Our results suggest that DBS should be stored at −20°C or extracted immediately, especially if anticipating 2 or more years of storage. PMID:25758652

Rapid screening method for male DNA by using the loop-mediated isothermal amplification assay.

PubMed

Kitamura, Masashi; Kubo, Seiji; Tanaka, Jin; Adachi, Tatsushi

2017-08-12

Screening for male-derived biological material from collected samples plays an important role in criminal investigations, especially those involving sexual assaults. We have developed a loop-mediated isothermal amplification (LAMP) assay targeting multi-repeat sequences of the Y chromosome for detecting male DNA. Successful amplification occurred with 0.5 ng of male DNA under isothermal conditions of 61 to 67 °C, but no amplification occurred with up to 10 ng of female DNA. Under the optimized conditions, the LAMP reaction initiated amplification within 10 min and amplified for 20 min. The LAMP reaction was sensitive at levels as low as 1-pg male DNA, and a quantitative LAMP assay could be developed because of the strong correlation between the reaction time and the amount of template DNA in the range of 10 pg to 10 ng. Furthermore, to apply the LAMP assay to on-site screening for male-derived samples, we evaluated a protocol using a simple DNA extraction method and a colorimetric intercalating dye that allows detection of the LAMP reaction by evaluating the change in color of the solution. Using this protocol, samples of male-derived blood and saliva stains were processed in approximately 30 min from DNA extraction to detection. Because our protocol does not require much hands-on time or special equipment, this LAMP assay promises to become a rapid and simple screening method for male-derived samples in forensic investigations.

Development of fluorescent methods for DNA methyltransferase assay

NASA Astrophysics Data System (ADS)

Li, Yueying; Zou, Xiaoran; Ma, Fei; Tang, Bo; Zhang, Chun-yang

2017-03-01

DNA methylation modified by DNA methyltransferase (MTase) plays an important role in regulating gene transcription, cell growth and proliferation. The aberrant DNA MTase activity may lead to a variety of human diseases including cancers. Therefore, accurate and sensitive detection of DNA MTase activity is crucial to biomedical research, clinical diagnostics and therapy. However, conventional DNA MTase assays often suffer from labor-intensive operations and time-consuming procedures. Alternatively, fluorescent methods have significant advantages of simplicity and high sensitivity, and have been widely applied for DNA MTase assay. In this review, we summarize the recent advances in the development of fluorescent methods for DNA MTase assay. These emerging methods include amplification-free and the amplification-assisted assays. Moreover, we discuss the challenges and future directions of this area.

[Investigation of RNA viral genome amplification by multiple displacement amplification technique].

PubMed

Pang, Zheng; Li, Jian-Dong; Li, Chuan; Liang, Mi-Fang; Li, De-Xin

2013-06-01

In order to facilitate the detection of newly emerging or rare viral infectious diseases, a negative-strand RNA virus-severe fever with thrombocytopenia syndrome bunyavirus, and a positive-strand RNA virus-dengue virus, were used to investigate RNA viral genome unspecific amplification by multiple displacement amplification technique from clinical samples. Series of 10-fold diluted purified viral RNA were utilized as analog samples with different pathogen loads, after a series of reactions were sequentially processed, single-strand cDNA, double-strand cDNA, double-strand cDNA treated with ligation without or with supplemental RNA were generated, then a Phi29 DNA polymerase depended isothermal amplification was employed, and finally the target gene copies were detected by real time PCR assays to evaluate the amplification efficiencies of various methods. The results showed that multiple displacement amplification effects of single-strand or double-strand cDNA templates were limited, while the fold increases of double-strand cDNA templates treated with ligation could be up to 6 X 10(3), even 2 X 10(5) when supplemental RNA existed, and better results were obtained when viral RNA loads were lower. A RNA viral genome amplification system using multiple displacement amplification technique was established in this study and effective amplification of RNA viral genome with low load was achieved, which could provide a tool to synthesize adequate viral genome for multiplex pathogens detection.

A method for release and multiple strand amplification of small quantities of DNA from endospores of the fastidious bacterium Pasteuria penetrans.

PubMed

Mauchline, T H; Mohan, S; Davies, K G; Schaff, J E; Opperman, C H; Kerry, B R; Hirsch, P R

2010-05-01

To establish a reliable protocol to extract DNA from Pasteuria penetrans endospores for use as template in multiple strand amplification, thus providing sufficient material for genetic analyses. To develop a highly sensitive PCR-based diagnostic tool for P. penetrans. An optimized method to decontaminate endospores, release and purify DNA enabled multiple strand amplification. DNA purity was assessed by cloning and sequencing gyrB and 16S rRNA gene fragments obtained from PCR using generic primers. Samples indicated to be 100%P. penetrans by the gyrB assay were estimated at 46% using the 16S rRNA gene. No bias was detected on cloning and sequencing 12 housekeeping and sporulation gene fragments from amplified DNA. The detection limit by PCR with Pasteuria-specific 16S rRNA gene primers following multiple strand amplification of DNA extracted using the method was a single endospore. Generation of large quantities DNA will facilitate genomic sequencing of P. penetrans. Apparent differences in sample purity are explained by variations in 16S rRNA gene copy number in Eubacteria leading to exaggerated estimations of sample contamination. Detection of single endospores will facilitate investigations of P. penetrans molecular ecology. These methods will advance studies on P. penetrans and facilitate research on other obligate and fastidious micro-organisms where it is currently impractical to obtain DNA in sufficient quantity and quality.

Nondestructive DNA extraction from blackflies (Diptera: Simuliidae): retaining voucher specimens for DNA barcoding projects.

PubMed

Hunter, Stephanie J; Goodall, Tim I; Walsh, Kerry A; Owen, Richard; Day, John C

2008-01-01

A nondestructive, chemical-free method is presented for the extraction of DNA from small insects. Blackflies were submerged in sterile, distilled water and sonicated for varying lengths of time to provide DNA which was assessed in terms of quantity, purity and amplification efficiency. A verified DNA barcode was produced from DNA extracted from blackfly larvae, pupae and adult specimens. A 60-second sonication period was found to release the highest quality and quantity of DNA although the amplification efficiency was found to be similar regardless of sonication time. Overall, a 66% amplification efficiency was observed. Examination of post-sonicated material confirmed retention of morphological characters. Sonication was found to be a reliable DNA extraction approach for barcoding, providing sufficient quality template for polymerase chain reaction amplification as well as retaining the voucher specimen for post-barcoding morphological evaluation. © 2007 The Authors.

Sequencing of the large dsDNA genome of Oryctes rhinoceros nudivirus using multiple displacement amplification of nanogram amounts of virus DNA.

PubMed

Wang, Yongjie; Kleespies, Regina G; Ramle, Moslim B; Jehle, Johannes A

2008-09-01

The genomic sequence analysis of many large dsDNA viruses is hampered by the lack of enough sample materials. Here, we report a whole genome amplification of the Oryctes rhinoceros nudivirus (OrNV) isolate Ma07 starting from as few as about 10 ng of purified viral DNA by application of phi29 DNA polymerase- and exonuclease-resistant random hexamer-based multiple displacement amplification (MDA) method. About 60 microg of high molecular weight DNA with fragment sizes of up to 25 kbp was amplified. A genomic DNA clone library was generated using the product DNA. After 8-fold sequencing coverage, the 127,615 bp of OrNV whole genome was sequenced successfully. The results demonstrate that the MDA-based whole genome amplification enables rapid access to genomic information from exiguous virus samples.

Sequence independent amplification of DNA

DOEpatents

Bohlander, S.K.

1998-03-24

The present invention is a rapid sequence-independent amplification procedure (SIA). Even minute amounts of DNA from various sources can be amplified independent of any sequence requirements of the DNA or any a priori knowledge of any sequence characteristics of the DNA to be amplified. This method allows, for example, the sequence independent amplification of microdissected chromosomal material and the reliable construction of high quality fluorescent in situ hybridization (FISH) probes from YACs or from other sources. These probes can be used to localize YACs on metaphase chromosomes but also--with high efficiency--in interphase nuclei. 25 figs.

Sequence independent amplification of DNA

DOEpatents

Bohlander, Stefan K.

1998-01-01

The present invention is a rapid sequence-independent amplification procedure (SIA). Even minute amounts of DNA from various sources can be amplified independent of any sequence requirements of the DNA or any a priori knowledge of any sequence characteristics of the DNA to be amplified. This method allows, for example the sequence independent amplification of microdissected chromosomal material and the reliable construction of high quality fluorescent in situ hybridization (FISH) probes from YACs or from other sources. These probes can be used to localize YACs on metaphase chromosomes but also--with high efficiency--in interphase nuclei.

A Simple Method for the Extraction, PCR-amplification, Cloning, and Sequencing of Pasteuria 16S rDNA from Small Numbers of Endospores.

PubMed

Atibalentja, N; Noel, G R; Ciancio, A

2004-03-01

For many years the taxonomy of the genus Pasteuria has been marred with confusion because the bacterium could not be cultured in vitro and, therefore, descriptions were based solely on morphological, developmental, and pathological characteristics. The current study sought to devise a simple method for PCR-amplification, cloning, and sequencing of Pasteuria 16S rDNA from small numbers of endospores, with no need for prior DNA purification. Results show that DNA extracts from plain glass bead-beating of crude suspensions containing 10,000 endospores at 0.2 x 10 endospores ml(-1) were sufficient for PCR-amplification of Pasteuria 16S rDNA, when used in conjunction with specific primers. These results imply that for P. penetrans and P. nishizawae only one parasitized female of Meloidogyne spp. and Heterodera glycines, respectively, should be sufficient, and as few as eight cadavers of Belonolaimus longicaudatus with an average number of 1,250 endospores of "Candidatus Pasteuria usgae" are needed for PCR-amplification of Pasteuria 16S rDNA. The method described in this paper should facilitate the sequencing of the 16S rDNA of the many Pasteuria isolates that have been reported on nematodes and, consequently, expedite the classification of those isolates through comparative sequence analysis.

Target-triggering multiple-cycle signal amplification strategy for ultrasensitive detection of DNA based on QCM and SPR.

PubMed

Song, Weiling; Yin, Wenshuo; Sun, Wenbo; Guo, Xiaoyan; He, Peng; Yang, Xiaoyan; Zhang, Xiaoru

2018-04-24

Detection of ultralow concentrations of nucleic acid sequences is a central challenge in the early diagnosis of genetic diseases. Herein, we developed a target-triggering cascade multiple cycle amplification for ultrasensitive DNA detection using quartz crystal microbalance (QCM) and surface plasmon resonance (SPR). It was based on the exonuclease Ⅲ (Exo Ⅲ)-assisted signal amplification and the hybridization chain reaction (HCR). The streptavidin-coated Au-NPs (Au-NPs-SA) were assembled on the HCR products as recognition element. Upon sensing of target DNA, the duplex DNA probe triggered the Exo Ⅲ cleavage process, accompanied by generating a new secondary target DNA and releasing target DNA. The released target DNA and the secondary target DNA were recycled. Simultaneously, numerous single strands were liberated and acted as the trigger of HCR to generate further signal amplification, resulting in the immobilization of abundant Au-NPs-SA on the gold substrate. The QCM sensor results were found to be comparable to that achieved using a SPR sensor platform. This method exhibited a high sensitivity toward target DNA with a detection limit of 0.70 fM. The high sensitivity and specificity make this method a great potential for detecting DNA with trace amounts in bioanalysis and clinical biomedicine. Copyright © 2018 Elsevier Inc. All rights reserved.

The effect of main urine inhibitors on the activity of different DNA polymerases in loop-mediated isothermal amplification.

PubMed

Jevtuševskaja, Jekaterina; Krõlov, Katrin; Tulp, Indrek; Langel, Ülo

2017-04-01

The use of rapid amplification methods to detect pathogens in biological samples is mainly limited by the amount of pathogens present in the sample and the presence of inhibiting substances. Inhibitors can affect the amplification efficiency by either binding to the polymerase, interacting with the DNA, or interacting with the polymerase during primer extension. Amplification is performed using DNA polymerase enzymes and even small changes in their activity can influence the sensitivity and robustness of molecular assays Methods: The main purpose of this research was to examine which compounds present in urine inhibit polymerases with strand displacement activity. To quantify the inhibition, we employed quantitative loop-mediated isothermal amplification Results: The authors found that the presence of BSA, Mg 2+, and urea at physiologically relevant concentrations, as well as acidic or alkaline conditions did not affect the activity of any of the tested polymerases. However, addition of salt significantly affected the activity of the tested polymerases. These findings may aid in the development of more sensitive, robust, cost effective isothermal amplification based molecular assays suitable for both point-of-care testing and on-site screening of pathogens directly from unprocessed urine which avoid the need for long and tedious DNA purification steps prior to amplification.

Embryo Sexing and Sex Chromosomal Chimerism Analysis by Loop-Mediated Isothermal Amplification in Cattle and Water Buffaloes

PubMed Central

HIRAYAMA, Hiroki; KAGEYAMA, Soichi; MORIYASU, Satoru; SAWAI, Ken; MINAMIHASHI, Akira

2013-01-01

Abstract In domestic animals of the family Bovidae, sex preselection of offspring has been demanded for convenience of milk/beef production and animal breeding. Development of the nonsurgical embryo transfer technique and sexing methods of preimplantation embryos made it possible. Sexing based on detection of Y chromosome-specific DNA sequences is considered the most reliable method to date. PCR enables amplification of a target sequence from a small number of blastomeres. However, it requires technical skill and is time consuming. Furthermore, PCR has the risk of false positives because of DNA contamination during handling of the PCR products in duplicate PCR procedures and/or electrophoresis. Therefore, for embryo sexing to become widely used in the cattle embryo transfer industry, a simple, rapid and precise sexing method needs to be developed. Loop-mediated isothermal amplification (LAMP) is a novel DNA amplification method, and the reaction is carried out under isothermal conditions (range, 60 to 65 C) using DNA polymerase with strand displacement activity. When the target DNA is amplified by LAMP, a white precipitate derived from magnesium pyrophosphate (a by-product of the LAMP reaction) is observed. It is noteworthy that LAMP does not need special reagents or electrophoresis to detect the amplified DNA. This review describes the development and application of an embryo sexing method using LAMP in cattle and water buffaloes. PMID:23965599

Diagnostic application of polymerase chain reaction for detection of Ehrlichia risticii in equine monocytic ehrlichiosis (Potomac horse fever).

PubMed

Biswas, B; Mukherjee, D; Mattingly-Napier, B L; Dutta, S K

1991-10-01

Genomic amplification by the polymerase chain reaction (PCR) was used to identify a unique genomic sequence of Ehrlichia risticii directly in DNA isolated from peripheral-blood buffy coat cells of E. risticii-infected horses (Potomac horse fever) and from infected cell cultures. A specific primer pair, selected from a cloned, species-specific, 1-kb DNA fragment of the E. risticii genome as a template, was used for the amplification of the target DNA of 247 bp. The optimal number of 40 PCR cycles, determined by analyzing an amplification profile obtained with a constant Taq polymerase concentration, was used to achieve maximum amplification of the E. risticii DNA segment. Efficient amplification of target DNA was achieved with specimens processed by either the phenol extraction or rapid lysis method. The specificity of the amplified DNA product was confirmed by the proper size (247 bp) and appropriate restriction enzyme cleavage pattern of the amplified target DNA, as well as by the specific hybridization signal obtained by using a PCR-amplified 185-bp internal DNA probe. A 10(5)- to 10(6)-fold amplification of target DNA, which allowed detection of E. risticii from as few as two to three infected cells in culture and from a very small volume of buffy coat cells from infected horses, was achieved. This PCR amplification procedure was found to be highly specific and sensitive for the detection of E. risticii for the study of Potomac horse fever.

Clustered Regularly Interspaced Short Palindromic Repeats/Cas9 Triggered Isothermal Amplification for Site-Specific Nucleic Acid Detection.

PubMed

Huang, Mengqi; Zhou, Xiaoming; Wang, Huiying; Xing, Da

2018-02-06

A novel CRISPR/Cas9 triggered isothermal exponential amplification reaction (CAS-EXPAR) strategy based on CRISPR/Cas9 cleavage and nicking endonuclease (NEase) mediated nucleic acids amplification was developed for rapid and site-specific nucleic acid detection. CAS-EXPAR was primed by the target DNA fragment produced by cleavage of CRISPR/Cas9, and the amplification reaction performed cyclically to generate a large number of DNA replicates which were detected using a real-time fluorescence monitoring method. This strategy that combines the advantages of CRISPR/Cas9 and exponential amplification showed high specificity as well as rapid amplification kinetics. Unlike conventional nucleic acids amplification reactions, CAS-EXPAR does not require exogenous primers, which often cause target-independent amplification. Instead, primers are first generated by Cas9/sgRNA directed site-specific cleavage of target and accumulated during the reaction. It was demonstrated this strategy gave a detection limit of 0.82 amol and showed excellent specificity in discriminating single-base mismatch. Moreover, the applicability of this method to detect DNA methylation and L. monocytogenes total RNA was also verified. Therefore, CAS-EXPAR may provide a new paradigm for efficient nucleic acid amplification and hold the potential for molecular diagnostic applications.

Single-Cell-Based Platform for Copy Number Variation Profiling through Digital Counting of Amplified Genomic DNA Fragments.

PubMed

Li, Chunmei; Yu, Zhilong; Fu, Yusi; Pang, Yuhong; Huang, Yanyi

2017-04-26

We develop a novel single-cell-based platform through digital counting of amplified genomic DNA fragments, named multifraction amplification (mfA), to detect the copy number variations (CNVs) in a single cell. Amplification is required to acquire genomic information from a single cell, while introducing unavoidable bias. Unlike prevalent methods that directly infer CNV profiles from the pattern of sequencing depth, our mfA platform denatures and separates the DNA molecules from a single cell into multiple fractions of a reaction mix before amplification. By examining the sequencing result of each fraction for a specific fragment and applying a segment-merge maximum likelihood algorithm to the calculation of copy number, we digitize the sequencing-depth-based CNV identification and thus provide a method that is less sensitive to the amplification bias. In this paper, we demonstrate a mfA platform through multiple displacement amplification (MDA) chemistry. When performing the mfA platform, the noise of MDA is reduced; therefore, the resolution of single-cell CNV identification can be improved to 100 kb. We can also determine the genomic region free of allelic drop-out with mfA platform, which is impossible for conventional single-cell amplification methods.

Highly efficient nuclear DNA typing of the World War II skeletal remains using three new autosomal short tandem repeat amplification kits with the extended European Standard Set of loci

PubMed Central

Zupanič Pajnič, Irena; Gornjak Pogorelc, Barbara; Balažic, Jože; Zupanc, Tomaž; Štefanič, Borut

2012-01-01

Aim To perform an efficiency study of three new amplification kits with the extended European Standard Set (ESS) of loci for autosomal short tandem repeat (STR) typing of skeletal remains excavated from the World War II mass graves in Slovenia. Methods In the beginning of the 2011, we analyzed 102 bones and teeth using the PowerPlex ESX 17 System (Promega), AmpFiSTR NGM PCR Amplification Kit (Applied Biosystems), and Investigator ESSplex Kit (Qiagen). We cleaned the bones and teeth, removed surface contamination, and ground them into a powder using liquid nitrogen. Prior to DNA isolation with Biorobot EZ1 (Qiagen), 0.5 g bone or tooth powder was decalcified. Nuclear DNA of the samples was quantified using real-time polymerase chain reaction. All three kits used the same extract with the amplification conditions recommended by the manufacturers. Results We extracted up to 131 ng DNA/g of powder from the bones and teeth. All three amplification kits showed very similar efficiency, since DNA typing was successful with all amplification kits in 101 out of 102 bones and teeth, which represents a 99% success rate. Conclusion The commercially available ESX 17, ESSplex, and NGM kits are highly reliable for STR typing of World War II skeletal remains with the DNA extraction method optimized in our laboratory. PMID:22351574

Enhanced sequencing coverage with digital droplet multiple displacement amplification

PubMed Central

Sidore, Angus M.; Lan, Freeman; Lim, Shaun W.; Abate, Adam R.

2016-01-01

Sequencing small quantities of DNA is important for applications ranging from the assembly of uncultivable microbial genomes to the identification of cancer-associated mutations. To obtain sufficient quantities of DNA for sequencing, the small amount of starting material must be amplified significantly. However, existing methods often yield errors or non-uniform coverage, reducing sequencing data quality. Here, we describe digital droplet multiple displacement amplification, a method that enables massive amplification of low-input material while maintaining sequence accuracy and uniformity. The low-input material is compartmentalized as single molecules in millions of picoliter droplets. Because the molecules are isolated in compartments, they amplify to saturation without competing for resources; this yields uniform representation of all sequences in the final product and, in turn, enhances the quality of the sequence data. We demonstrate the ability to uniformly amplify the genomes of single Escherichia coli cells, comprising just 4.7 fg of starting DNA, and obtain sequencing coverage distributions that rival that of unamplified material. Digital droplet multiple displacement amplification provides a simple and effective method for amplifying minute amounts of DNA for accurate and uniform sequencing. PMID:26704978

Molecular analysis of single oocyst of Eimeria by whole genome amplification (WGA) based nested PCR.

PubMed

Wang, Yunzhou; Tao, Geru; Cui, Yujuan; Lv, Qiyao; Xie, Li; Li, Yuan; Suo, Xun; Qin, Yinghe; Xiao, Lihua; Liu, Xianyong

2014-09-01

PCR-based molecular tools are widely used for the identification and characterization of protozoa. Here we report the molecular analysis of Eimeria species using combined methods of whole genome amplification (WGA) and nested PCR. Single oocyst of Eimeria stiedai or Eimeriamedia was directly used for random amplification of the genomic DNA with either primer extension preamplification (PEP) or multiple displacement amplification (MDA), and then the WGA product was used as template in nested PCR with species-specific primers for ITS-1, 18S rDNA and 23S rDNA of E. stiedai and E. media. WGA-based PCR was successful for the amplification of these genes from single oocyst. For the species identification of single oocyst isolated from mixed E. stiedai or E. media, the results from WGA-based PCR were exactly in accordance with those from morphological identification, suggesting the availability of this method in molecular analysis of eimerian parasites at the single oocyst level. WGA-based PCR method can also be applied for the identification and genetic characterization of other protists. Copyright © 2014 Elsevier Inc. All rights reserved.

Formation of template-switching artifacts by linear amplification.

PubMed

Chakravarti, Dhrubajyoti; Mailander, Paula C

2008-07-01

Linear amplification is a method of synthesizing single-stranded DNA from either a single-stranded DNA or one strand of a double-stranded DNA. In this protocol, molecules of a single primer DNA are extended by multiple rounds of DNA synthesis at high temperature using thermostable DNA polymerases. Although linear amplification generates the intended full-length single-stranded product, it is more efficient over single-stranded templates than double-stranded templates. We analyzed linear amplification over single- or double-stranded mouse H-ras DNA (exon 1-2 region). The single-stranded H-ras template yielded only the intended product. However, when the double-stranded template was used, additional artifact products were observed. Increasing the concentration of the double-stranded template produced relatively higher amounts of these artifact products. One of the artifact DNA bands could be mapped and analyzed by sequencing. It contained three template-switching products. These DNAs were formed by incomplete DNA strand extension over the template strand, followed by switching to the complementary strand at a specific Ade nucleotide within a putative hairpin sequence, from which DNA synthesis continued over the complementary strand.

A surface-confined DNA assembly amplification strategy on DNA nanostructural scaffold for electrochemiluminescence biosensing.

PubMed

Feng, Qiu-Mei; Guo, Yue-Hua; Xu, Jing-Juan; Chen, Hong-Yuan

2018-02-15

A critical challenge in surface-based DNA assembly amplification is the reduced accessibility of DNA strands arranged on a heterogeneous surface compared to that in homogeneous solution. Here, a novel in situ surface-confined DNA assembly amplification electrochemiluminescence (ECL) biosensor based on DNA nanostructural scaffold was presented. In this design, a stem-loop structural DNA segment (Hairpin 1) was constructed on the vertex of DNA nanostructural scaffold as recognition probe. In the present of target DNA, the hairpin structure changed to rod-like through complementary hybridization with target DNA, resulting in the formation of Hairpin 1:target DNA. When the obtained Hairpin 1:target DNA met Hairpin 2 labeled with glucose oxidase (GOD), the DNA cyclic amplification was activated, releasing target DNA into homogeneous solution for the next recycling. Thus, the ECL signal of Ru(bpy) 3 2+ -TPrA system was quenched by H 2 O 2 , the product of GOD catalyzing glucose. As a result, this proposed method achieved a linear range response from 50 aM to 10 pM with lower detection limit of 20 aM. Copyright © 2017 Elsevier B.V. All rights reserved.

Graphene Nanoprobes for Real-Time Monitoring of Isothermal Nucleic Acid Amplification.

PubMed

Li, Fan; Liu, Xiaoguo; Zhao, Bin; Yan, Juan; Li, Qian; Aldalbahi, Ali; Shi, Jiye; Song, Shiping; Fan, Chunhai; Wang, Lihua

2017-05-10

Isothermal amplification is an efficient way to amplify DNA with high accuracy; however, the real-time monitoring for quantification analysis mostly relied on expensive and precisely designed probes. In the present study, a graphene oxide (GO)-based nanoprobe was used to real-time monitor the isothermal amplification process. The interaction between GO and different DNA structures was systematically investigated, including single-stranded DNA (ssDNA), double-stranded DNA (dsDNA), DNA 3-helix, and long rolling circle amplification (RCA) and hybridization chain reaction (HCR) products, which existed in one-, two-, and three-dimensional structures. It was found that the high rigid structures exhibited much lower affinity with GO than soft ssDNA, and generally the rigidity was dependent on the length of targets and the hybridization position with probe DNA. On the basis of these results, we successfully monitored HCR amplification process, RCA process, and the enzyme restriction of RCA products with GO nanoprobe; other applications including the detection of the assembly/disassembly of DNA 3-helix structures were also performed. Compared to the widely used end-point detection methods, the GO-based sensing platform is simple, sensitive, cost-effective, and especially in a real-time monitoring mode. We believe such studies can provide comprehensive understandings and evocation on design of GO-based biosensors for broad application in various fields.

Advanced DNA-Based Point-of-Care Diagnostic Methods for Plant Diseases Detection.

PubMed

Lau, Han Yih; Botella, Jose R

2017-01-01

Diagnostic technologies for the detection of plant pathogens with point-of-care capability and high multiplexing ability are an essential tool in the fight to reduce the large agricultural production losses caused by plant diseases. The main desirable characteristics for such diagnostic assays are high specificity, sensitivity, reproducibility, quickness, cost efficiency and high-throughput multiplex detection capability. This article describes and discusses various DNA-based point-of care diagnostic methods for applications in plant disease detection. Polymerase chain reaction (PCR) is the most common DNA amplification technology used for detecting various plant and animal pathogens. However, subsequent to PCR based assays, several types of nucleic acid amplification technologies have been developed to achieve higher sensitivity, rapid detection as well as suitable for field applications such as loop-mediated isothermal amplification, helicase-dependent amplification, rolling circle amplification, recombinase polymerase amplification, and molecular inversion probe. The principle behind these technologies has been thoroughly discussed in several review papers; herein we emphasize the application of these technologies to detect plant pathogens by outlining the advantages and disadvantages of each technology in detail.

Advanced DNA-Based Point-of-Care Diagnostic Methods for Plant Diseases Detection

PubMed Central

Lau, Han Yih; Botella, Jose R.

2017-01-01

Diagnostic technologies for the detection of plant pathogens with point-of-care capability and high multiplexing ability are an essential tool in the fight to reduce the large agricultural production losses caused by plant diseases. The main desirable characteristics for such diagnostic assays are high specificity, sensitivity, reproducibility, quickness, cost efficiency and high-throughput multiplex detection capability. This article describes and discusses various DNA-based point-of care diagnostic methods for applications in plant disease detection. Polymerase chain reaction (PCR) is the most common DNA amplification technology used for detecting various plant and animal pathogens. However, subsequent to PCR based assays, several types of nucleic acid amplification technologies have been developed to achieve higher sensitivity, rapid detection as well as suitable for field applications such as loop-mediated isothermal amplification, helicase-dependent amplification, rolling circle amplification, recombinase polymerase amplification, and molecular inversion probe. The principle behind these technologies has been thoroughly discussed in several review papers; herein we emphasize the application of these technologies to detect plant pathogens by outlining the advantages and disadvantages of each technology in detail. PMID:29375588

DNA extraction from formalin-fixed, paraffin-embedded tissues: protein digestion as a limiting step for retrieval of high-quality DNA.

PubMed

Díaz-Cano, S J; Brady, S P

1997-12-01

Several DNA extraction methods have been used for formalin-fixed, paraffin-embedded tissues, with variable results being reported regarding the suitability of DNA obtained from such sources to serve as template in polymerase chain reaction (PCR)-based genetic analyses. We present a method routinely used for archival material in our laboratory that reliably yields DNA of sufficient quality for PCR studies. This method is based on extended proteinase K digestion (250 micrograms/ml in an EDTA-free calcium-containing buffer supplemented with mussel glycogen) followed by phenol-chloroform extraction. Agarose gel electrophoresis of both digestion buffer aliquots and PCR amplification of the beta-globin gene tested the suitability of the retrieved DNA for PCR amplification.

Unusual isothermal multimerization and amplification by the strand-displacing DNA polymerases with reverse transcription activities.

PubMed

Wang, Guoping; Ding, Xiong; Hu, Jiumei; Wu, Wenshuai; Sun, Jingjing; Mu, Ying

2017-10-24

Existing isothermal nucleic acid amplification (INAA) relying on the strand displacement activity of DNA polymerase usually requires at least two primers. However, in this paper, we report an unusual isothermal multimerization and amplification (UIMA) which only needs one primer and is efficiently initiated by the strand-displacing DNA polymerases with reverse transcription activities. On electrophoresis, the products of UIMA present a cascade-shape band and they are confirmed to be multimeric DNAs with repeated target sequences. In contrast to current methods, UIMA is simple to product multimeric DNA, due to the independent of multiple primers and rolling circle structures. Through assaying the synthesized single-stranded DNA targets, UIMA performs high sensitivity and specificity, as well as the universality. In addition, a plausible mechanism of UIMA is proposed, involving short DNA bending, mismatch extension, and template slippage. UIMA is a good explanation for why nonspecific amplification easily happens in existing INAAs. As the simplest INAA till now, UIMA provides a new insight for deeply understanding INAA and opens a new avenue for thoroughly addressing nonspecific amplification.

Fluorescent Quantification of DNA Based on Core-Shell Fe3O4@SiO2@Au Nanocomposites and Multiplex Ligation-Dependent Probe Amplification.

PubMed

Fan, Jing; Yang, Haowen; Liu, Ming; Wu, Dan; Jiang, Hongrong; Zeng, Xin; Elingarami, Sauli; Ll, Zhiyang; Li, Song; Liu, Hongna; He, Nongyue

2015-02-01

In this research, a novel method for relative fluorescent quantification of DNA based on Fe3O4@SiO2@Au gold-coated magnetic nanocomposites (GMNPs) and multiplex ligation- dependent probe amplification (MLPA) has been developed. With the help of self-assembly, seed-mediated growth and chemical reduction method, core-shell Fe3O4@SiO2@Au GMNPs were synthesized. Through modified streptavidin on the GMNPs surface, we obtained a bead chip which can capture the biotinylated probes. Then we designed MLPA probes which were tagged with biotin or Cy3 and target DNA on the basis of human APP gene sequence. The products from the thermostable DNA ligase induced ligation reactions and PCR amplifications were incubated with SA-GMNPs. After washing, magnetic separation, spotting, the fluorescent scanning results showed our method can be used for the relative quantitative analysis of the target DNA in the concentration range of 03004~0.5 µM.

Nanoliter reactors improve multiple displacement amplification of genomes from single cells.

PubMed

Marcy, Yann; Ishoey, Thomas; Lasken, Roger S; Stockwell, Timothy B; Walenz, Brian P; Halpern, Aaron L; Beeson, Karen Y; Goldberg, Susanne M D; Quake, Stephen R

2007-09-01

Since only a small fraction of environmental bacteria are amenable to laboratory culture, there is great interest in genomic sequencing directly from single cells. Sufficient DNA for sequencing can be obtained from one cell by the Multiple Displacement Amplification (MDA) method, thereby eliminating the need to develop culture methods. Here we used a microfluidic device to isolate individual Escherichia coli and amplify genomic DNA by MDA in 60-nl reactions. Our results confirm a report that reduced MDA reaction volume lowers nonspecific synthesis that can result from contaminant DNA templates and unfavourable interaction between primers. The quality of the genome amplification was assessed by qPCR and compared favourably to single-cell amplifications performed in standard 50-microl volumes. Amplification bias was greatly reduced in nanoliter volumes, thereby providing a more even representation of all sequences. Single-cell amplicons from both microliter and nanoliter volumes provided high-quality sequence data by high-throughput pyrosequencing, thereby demonstrating a straightforward route to sequencing genomes from single cells.

Direct PCR amplification of forensic touch and other challenging DNA samples: A review.

PubMed

Cavanaugh, Sarah E; Bathrick, Abigail S

2018-01-01

DNA evidence sample processing typically involves DNA extraction, quantification, and STR amplification; however, DNA loss can occur at both the DNA extraction and quantification steps, which is not ideal for forensic evidence containing low levels of DNA. Direct PCR amplification of forensic unknown samples has been suggested as a means to circumvent extraction and quantification, thereby retaining the DNA typically lost during those procedures. Direct PCR amplification is a method in which a sample is added directly to an amplification reaction without being subjected to prior DNA extraction, purification, or quantification. It allows for maximum quantities of DNA to be targeted, minimizes opportunities for error and contamination, and reduces the time and monetary resources required to process samples, although data analysis may take longer as the increased DNA detection sensitivity of direct PCR may lead to more instances of complex mixtures. ISO 17025 accredited laboratories have successfully implemented direct PCR for limited purposes (e.g., high-throughput databanking analysis), and recent studies indicate that direct PCR can be an effective method for processing low-yield evidence samples. Despite its benefits, direct PCR has yet to be widely implemented across laboratories for the processing of evidentiary items. While forensic DNA laboratories are always interested in new methods that will maximize the quantity and quality of genetic information obtained from evidentiary items, there is often a lag between the advent of useful methodologies and their integration into laboratories. Delayed implementation of direct PCR of evidentiary items can be attributed to a variety of factors, including regulatory guidelines that prevent laboratories from omitting the quantification step when processing forensic unknown samples, as is the case in the United States, and, more broadly, a reluctance to validate a technique that is not widely used for evidence samples. The advantages of direct PCR of forensic evidentiary samples justify a re-examination of the factors that have delayed widespread implementation of this method and of the evidence supporting its use. In this review, the current and potential future uses of direct PCR in forensic DNA laboratories are summarized. Copyright © 2017 Elsevier B.V. All rights reserved.

Dual phase multiplex polymerase chain reaction

DOEpatents

Pemov, Alexander [Charlottesville, VA; Bavykin, Sergei [Darien, IL

2008-10-07

Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.

Study Unveils New Method for Universal Extraction and PCR Amplification of Fungal DNA

DTIC Science & Technology

2014-06-12

Wickes noted that there are methods to extract fungi from soil , for example, and "once you get down to pure DNA, everything else is the same," he said...rare or hard to identify fungal infections. The new extraction and amplification method can be universally applied to fungi , according to the...best treatments. In addition, rare fungi , or species with phenotypic doppelgangers, can stump medical mycologists, so molecular methods are critical

Photocleavable DNA barcode-antibody conjugates allow sensitive and multiplexed protein analysis in single cells.

PubMed

Agasti, Sarit S; Liong, Monty; Peterson, Vanessa M; Lee, Hakho; Weissleder, Ralph

2012-11-14

DNA barcoding is an attractive technology, as it allows sensitive and multiplexed target analysis. However, DNA barcoding of cellular proteins remains challenging, primarily because barcode amplification and readout techniques are often incompatible with the cellular microenvironment. Here we describe the development and validation of a photocleavable DNA barcode-antibody conjugate method for rapid, quantitative, and multiplexed detection of proteins in single live cells. Following target binding, this method allows DNA barcodes to be photoreleased in solution, enabling easy isolation, amplification, and readout. As a proof of principle, we demonstrate sensitive and multiplexed detection of protein biomarkers in a variety of cancer cells.

Whole genome amplification of Chelex-extracted DNA from a single mite: a method for studying genetics of the predatory mite Phytoseiulus persimilis.

PubMed

Konakandla, Bhanu; Park, Yoonseong; Margolies, David

2006-01-01

We developed and optimized a method using Chelex DNA extraction followed by whole genome amplification (WGA) to overcome problems conducting molecular genetic studies due to the limited amount of DNA obtainable from individual small organisms such as predatory mites. The DNA from a single mite, Phytoseiulus persimilis Athias-Henrot (Acari: Phytoseiidae), isolated in Chelex suspension was subjected to WGA. More than 1000-fold amplification of the DNA was achieved using as little as 0.03 ng genomic DNA template. The DNA obtained by the WGA was used for polymerase chain reaction followed by direct sequencing. From WGA DNA, nuclear DNA intergenic spacers ITS1 and ITS2 and a mitochondrial DNA 12S marker were tested in three different geographical populations of the predatory mite: California, the Netherlands, and Sicily. We found a total of four different alleles of the 12S in the Sicilian population, but no polymorphism was identified in the ITS marker. The combination of Chelex DNA extraction and WGA is thus shown to be a simple and robust technique for examining molecular markers for multiple loci by using individual mites. We conclude that the methods, Chelex extraction of DNA followed by WGA, provide a large quantity of DNA template that can be used for multiple PCR reactions useful for genetic studies requiring the genotypes of individual mites.

Inhibition of recombinase polymerase amplification by background DNA: a lateral flow-based method for enriching target DNA.

PubMed

Rohrman, Brittany; Richards-Kortum, Rebecca

2015-02-03

Recombinase polymerase amplification (RPA) may be used to detect a variety of pathogens, often after minimal sample preparation. However, previous work has shown that whole blood inhibits RPA. In this paper, we show that the concentrations of background DNA found in whole blood prevent the amplification of target DNA by RPA. First, using an HIV-1 RPA assay with known concentrations of nonspecific background DNA, we show that RPA tolerates more background DNA when higher HIV-1 target concentrations are present. Then, using three additional assays, we demonstrate that the maximum amount of background DNA that may be tolerated in RPA reactions depends on the DNA sequences used in the assay. We also show that changing the RPA reaction conditions, such as incubation time and primer concentration, has little effect on the ability of RPA to function when high concentrations of background DNA are present. Finally, we develop and characterize a lateral flow-based method for enriching the target DNA concentration relative to the background DNA concentration. This sample processing method enables RPA of 10(4) copies of HIV-1 DNA in a background of 0-14 μg of background DNA. Without lateral flow sample enrichment, the maximum amount of background DNA tolerated is 2 μg when 10(6) copies of HIV-1 DNA are present. This method requires no heating or other external equipment, may be integrated with upstream DNA extraction and purification processes, is compatible with the components of lysed blood, and has the potential to detect HIV-1 DNA in infant whole blood with high proviral loads.

One-step random mutagenesis by error-prone rolling circle amplification

PubMed Central

Fujii, Ryota; Kitaoka, Motomitsu; Hayashi, Kiyoshi

2004-01-01

In vitro random mutagenesis is a powerful tool for altering properties of enzymes. We describe here a novel random mutagenesis method using rolling circle amplification, named error-prone RCA. This method consists of only one DNA amplification step followed by transformation of the host strain, without treatment with any restriction enzymes or DNA ligases, and results in a randomly mutated plasmid library with 3–4 mutations per kilobase. Specific primers or special equipment, such as a thermal-cycler, are not required. This method permits rapid preparation of randomly mutated plasmid libraries, enabling random mutagenesis to become a more commonly used technique. PMID:15507684

Diagnostic testing for Giardia infections.

PubMed

Heyworth, Martin F

2014-03-01

The traditional method for diagnosing Giardia infections involves microscopic examination of faecal specimens for Giardia cysts. This method is subjective and relies on observer experience. From the 1980s onwards, objective techniques have been developed for diagnosing Giardia infections, and are superseding diagnostic techniques reliant on microscopy. Detection of Giardia antigen(s) by immunoassay is the basis of commercially available diagnostic kits. Various nucleic acid amplification techniques (NAATs) can demonstrate DNA of Giardia intestinalis, and have the potential to become standard approaches for diagnosing Giardia infections. Of such techniques, methods involving either fluorescent microspheres (Luminex) or isothermal amplification of DNA (loop-mediated isothermal amplification; LAMP) are especially promising.

An evaluation of direct PCR amplification

PubMed Central

Hall, Daniel E.; Roy, Reena

2014-01-01

Aim To generate complete DNA profiles from blood and saliva samples deposited on FTA® and non-FTA® paper substrates following a direct amplification protocol. Methods Saliva samples from living donors and blood samples from deceased individuals were deposited on ten different FTA® and non-FTA® substrates. These ten paper substrates containing body fluids were kept at room temperature for varying lengths of time ranging from one day to approximately one year. For all assays in this research, 1.2 mm punches were collected from each substrate containing one type of body fluid and amplified with reagents provided in the nine commercial polymerase chain reaction (PCR) amplification kits. The substrates were not subjected to purification reagent or extraction buffer prior to amplification. Results Success rates were calculated for all nine amplification kits and all ten substrates based on their ability to yield complete DNA profiles following a direct amplification protocol. Six out of the nine amplification kits, and four out of the ten paper substrates had the highest success rates overall. Conclusion The data show that it is possible to generate complete DNA profiles following a direct amplification protocol using both standard (non-direct) and direct PCR amplification kits. The generation of complete DNA profiles appears to depend more on the success of the amplification kit rather than the than the FTA®- or non-FTA®-based substrates. PMID:25559837

Digital LAMP in a sample self-digitization (SD) chip

PubMed Central

Herrick, Alison M.; Dimov, Ivan K.; Lee, Luke P.; Chiu, Daniel T.

2012-01-01

This paper describes the realization of digital loop-mediated DNA amplification (dLAMP) in a sample self-digitization (SD) chip. Digital DNA amplification has become an attractive technique to quantify absolute concentrations of DNA in a sample. While digital polymerase chain reaction is still the most widespread implementation, its use in resource—limited settings is impeded by the need for thermal cycling and robust temperature control. In such situations, isothermal protocols that can amplify DNA or RNA without thermal cycling are of great interest. Here, we showed the successful amplification of single DNA molecules in a stationary droplet array using isothermal digital loop-mediated DNA amplification. Unlike most (if not all) existing methods for sample discretization, our design allows for automated, loss-less digitization of sample volumes on-chip. We demonstrated accurate quantification of relative and absolute DNA concentrations with sample volumes of less than 2 μl. We assessed the homogeneity of droplet size during sample self-digitization in our device, and verified that the size variation was small enough such that straightforward counting of LAMP-active droplets sufficed for data analysis. We anticipate that the simplicity and robustness of our SD chip make it attractive as an inexpensive and easy-to-operate device for DNA amplification, for example in point-of-care settings. PMID:22399016

Rapid ABO genotyping by high-speed droplet allele-specific PCR using crude samples.

PubMed

Taira, Chiaki; Matsuda, Kazuyuki; Takeichi, Naoya; Furukawa, Satomi; Sugano, Mitsutoshi; Uehara, Takeshi; Okumura, Nobuo; Honda, Takayuki

2018-01-01

ABO genotyping has common tools for personal identification of forensic and transplantation field. We developed a new method based on a droplet allele-specific PCR (droplet-AS-PCR) that enabled rapid PCR amplification. We attempted rapid ABO genotyping using crude DNA isolated from dried blood and buccal cells. We designed allele-specific primers for three SNPs (at nucleotides 261, 526, and 803) in exons 6 and 7 of the ABO gene. We pretreated dried blood and buccal cells with proteinase K, and obtained crude DNAs without DNA purification. Droplet-AS-PCR allowed specific amplification of the SNPs at the three loci using crude DNA, with results similar to those for DNA extracted from fresh peripheral blood. The sensitivity of the methods was 5%-10%. The genotyping of extracted DNA and crude DNA were completed within 8 and 9 minutes, respectively. The genotypes determined by the droplet-AS-PCR method were always consistent with those obtained by direct sequencing. The droplet-AS-PCR method enabled rapid and specific amplification of three SNPs of the ABO gene from crude DNA treated with proteinase K. ABO genotyping by the droplet-AS-PCR has the potential to be applied to various fields including a forensic medicine and transplantation medical care. © 2017 Wiley Periodicals, Inc.

Comparative analysis of protocols for DNA extraction from soybean caterpillars.

PubMed

Palma, J; Valmorbida, I; da Costa, I F D; Guedes, J V C

2016-04-07

Genomic DNA extraction is crucial for molecular research, including diagnostic and genome characterization of different organisms. The aim of this study was to comparatively analyze protocols of DNA extraction based on cell lysis by sarcosyl, cetyltrimethylammonium bromide, and sodium dodecyl sulfate, and to determine the most efficient method applicable to soybean caterpillars. DNA was extracted from specimens of Chrysodeixis includens and Spodoptera eridania using the aforementioned three methods. DNA quantification was performed using spectrophotometry and high molecular weight DNA ladders. The purity of the extracted DNA was determined by calculating the A260/A280 ratio. Cost and time for each DNA extraction method were estimated and analyzed statistically. The amount of DNA extracted by these three methods was sufficient for PCR amplification. The sarcosyl method yielded DNA of higher purity, because it generated a clearer pellet without viscosity, and yielded high quality amplification products of the COI gene I. The sarcosyl method showed lower cost per extraction and did not differ from the other methods with respect to preparation times. Cell lysis by sarcosyl represents the best method for DNA extraction in terms of yield, quality, and cost effectiveness.

NAIMA: target amplification strategy allowing quantitative on-chip detection of GMOs.

PubMed

Morisset, Dany; Dobnik, David; Hamels, Sandrine; Zel, Jana; Gruden, Kristina

2008-10-01

We have developed a novel multiplex quantitative DNA-based target amplification method suitable for sensitive, specific and quantitative detection on microarray. This new method named NASBA Implemented Microarray Analysis (NAIMA) was applied to GMO detection in food and feed, but its application can be extended to all fields of biology requiring simultaneous detection of low copy number DNA targets. In a first step, the use of tailed primers allows the multiplex synthesis of template DNAs in a primer extension reaction. A second step of the procedure consists of transcription-based amplification using universal primers. The cRNA product is further on directly ligated to fluorescent dyes labelled 3DNA dendrimers allowing signal amplification and hybridized without further purification on an oligonucleotide probe-based microarray for multiplex detection. Two triplex systems have been applied to test maize samples containing several transgenic lines, and NAIMA has shown to be sensitive down to two target copies and to provide quantitative data on the transgenic contents in a range of 0.1-25%. Performances of NAIMA are comparable to singleplex quantitative real-time PCR. In addition, NAIMA amplification is faster since 20 min are sufficient to achieve full amplification.

NAIMA: target amplification strategy allowing quantitative on-chip detection of GMOs

PubMed Central

Morisset, Dany; Dobnik, David; Hamels, Sandrine; Žel, Jana; Gruden, Kristina

2008-01-01

We have developed a novel multiplex quantitative DNA-based target amplification method suitable for sensitive, specific and quantitative detection on microarray. This new method named NASBA Implemented Microarray Analysis (NAIMA) was applied to GMO detection in food and feed, but its application can be extended to all fields of biology requiring simultaneous detection of low copy number DNA targets. In a first step, the use of tailed primers allows the multiplex synthesis of template DNAs in a primer extension reaction. A second step of the procedure consists of transcription-based amplification using universal primers. The cRNA product is further on directly ligated to fluorescent dyes labelled 3DNA dendrimers allowing signal amplification and hybridized without further purification on an oligonucleotide probe-based microarray for multiplex detection. Two triplex systems have been applied to test maize samples containing several transgenic lines, and NAIMA has shown to be sensitive down to two target copies and to provide quantitative data on the transgenic contents in a range of 0.1–25%. Performances of NAIMA are comparable to singleplex quantitative real-time PCR. In addition, NAIMA amplification is faster since 20 min are sufficient to achieve full amplification. PMID:18710880

Label-free and ultrasensitive fluorescence detection of cocaine based on a strategy that utilizes DNA-templated silver nanoclusters and the nicking endonuclease-assisted signal amplification method.

PubMed

Zhang, Kai; Wang, Ke; Zhu, Xue; Zhang, Jue; Xu, Lan; Huang, Biao; Xie, Minhao

2014-01-07

A general and reliable strategy for the detection of cocaine was proposed utilizing DNA-templated silver nanoclusters as signal indicators and the nicking endonuclease-assisted signal amplification method. This strategy can detect cocaine specifically with a detection limit as low as 2 nM by using a small volume of 5 μL.

Attomolar quantitation of Mycobacterium tuberculosis by asymmetric helicase-dependent isothermal DNA-amplification and electrochemical detection.

PubMed

Barreda-García, Susana; González-Álvarez, María José; de-Los-Santos-Álvarez, Noemí; Palacios-Gutiérrez, Juan José; Miranda-Ordieres, Arturo J; Lobo-Castañón, María Jesús

2015-06-15

A highly sensitive and robust method for the quantification of specific DNA sequences based on coupling asymmetric helicase-dependent DNA amplification to electrochemical detection is described. This method relies on the entrapment of the amplified ssDNA sequences on magnetic beads followed by a post-amplification hybridization assay to provide an added degree of specificity. As a proof-of-concept a 84-bases long sequence specific of Mycobacterium tuberculosis is amplified at 65°C, providing 3×10(6) amplification after 90 min. Using this system 0.5 aM, corresponding to 15 copies of the target gene in 50 µL of sample, can be successfully detected and reliably quantified under isothermal conditions in less than 4h. The assay has been applied to the detection of M. tuberculosis in sputum, pleural fluid and urine samples. Besides this application, the proposed assays is a powerful and general tool for molecular diagnostic that can be applied to the detection of other specific DNA sequences, taking full advantage of the plethora of genomic information now available. Copyright © 2014 Elsevier B.V. All rights reserved.

Isothermal multiple displacement amplification: a methodical approach enhancing molecular routine diagnostics of microcarcinomas and small biopsies.

PubMed

Mairinger, Fabian D; Walter, Robert Fh; Vollbrecht, Claudia; Hager, Thomas; Worm, Karl; Ting, Saskia; Wohlschläger, Jeremias; Zarogoulidis, Paul; Zarogoulidis, Konstantinos; Schmid, Kurt W

2014-01-01

Isothermal multiple displacement amplification (IMDA) can be a powerful tool in molecular routine diagnostics for homogeneous and sequence-independent whole-genome amplification of notably small tumor samples, eg, microcarcinomas and biopsies containing a small amount of tumor. Currently, this method is not well established in pathology laboratories. We designed a study to confirm the feasibility and convenience of this method for routine diagnostics with formalin-fixed, paraffin-embedded samples prepared by laser-capture microdissection. A total of 250 μg DNA (concentration 5 μg/μL) was generated by amplification over a period of 8 hours with a material input of approximately 25 cells, approximately equivalent to 175 pg of genomic DNA. In the generated DNA, a representation of all chromosomes could be shown and the presence of elected genes relevant for diagnosis in clinical samples could be proven. Mutational analysis of clinical samples could be performed without any difficulty and showed concordance with earlier diagnostic findings. We established the feasibility and convenience of IMDA for routine diagnostics. We also showed that small amounts of DNA, which were not analyzable with current molecular methods, could be sufficient for a wide field of applications in molecular routine diagnostics when they are preamplified with IMDA.

An electrochemical biosensor for double-stranded Wnt7B gene detection based on enzymatic isothermal amplification.

PubMed

Li, Junlong; Chen, Zhongping; Xiang, Yu; Zhou, Lili; Wang, Ting; Zhang, Zhang; Sun, Kexin; Yin, Dan; Li, Yi; Xie, Guoming

2016-12-15

Wnt7B gene plays an important role in the development and progression of breast cancer, gastric cancer, esophageal cancer and pancreatic cancer. While, the natural state of DNA is double stranded, which makes it difficult to be directly detected. Here, we develop an electrochemical biosensor method for Wnt7B gene detection without the need to denature the target. This method firstly used nicking enzyme for exploiting in the double-stranded DNA (dsDNA). Then, long single-stranded DNA (ssDNA) was generated from the cutting site through polymerase extension reaction. Whereafter, the long ssDNA triggered a hairpin self-assembly recycling reaction, which gave rise to another isothermal amplification reaction. Last, short ssDNA was formed after the this amplification process, which could hybridize with the capture probe immobilized on Au electrode and result in signal variation. This method showed excellent analytical performance for dsDNA, of which the linear range was 2fM to 500pM and the detection limit was 1.6fM (S/N=3). It also showed an good results when applied to the real sample of Wnt7B gene detection. Copyright © 2016 Elsevier B.V. All rights reserved.

Label-Free Sensitive Detection of DNA Methyltransferase by Target-Induced Hyperbranched Amplification with Zero Background Signal.

PubMed

Zhang, Yan; Wang, Xin-Yan; Zhang, Qianyi; Zhang, Chun-Yang

2017-11-21

DNA methyltransferases (MTases) may specifically recognize the short palindromic sequences and transfer a methyl group from S-adenosyl-l-methionine to target cytosine/adenine. The aberrant DNA methylation is linked to the abnormal DNA MTase activity, and some DNA MTases have become promising targets of anticancer/antimicrobial drugs. However, the reported DNA MTase assays often involve laborious operation, expensive instruments, and radio-labeled substrates. Here, we develop a simple and label-free fluorescent method to sensitively detect DNA adenine methyltransferase (Dam) on the basis of terminal deoxynucleotidyl transferase (TdT)-activated Endonuclease IV (Endo IV)-assisted hyperbranched amplification. We design a hairpin probe with a palindromic sequence in the stem as the substrate and a NH 2 -modified 3' end for the prevention of nonspecific amplification. The substrate may be methylated by Dam and subsequently cleaved by DpnI, producing three single-stranded DNAs, two of which with 3'-OH termini may be amplified by hyperbranched amplification to generate a distinct fluorescence signal. Because high exactitude of TdT enables the amplification only in the presence of free 3'-OH termini and Endo IV only hydrolyzes the intact apurinic/apyrimidinic sites in double-stranded DNAs, zero background signal can be achieved. This method exhibits excellent selectivity and high sensitivity with a limit of detection of 0.003 U/mL for pure Dam and 9.61 × 10 -6 mg/mL for Dam in E. coli cells. Moreover, it can be used to screen the Dam inhibitors, holding great potentials in disease diagnosis and drug development.

Optimal DNA Isolation Method for Detection of Nontuberculous Mycobacteria by Polymerase Chain Reaction.

PubMed

Mohammadi, Samira; Esfahani, Bahram Nasr; Moghim, Sharareh; Mirhendi, Hossein; Zaniani, Fatemeh Riyahi; Safaei, Hajieh Ghasemian; Fazeli, Hossein; Salehi, Mahshid

2017-01-01

Nontuberculous mycobacteria (NTM) are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA ® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR) amplification of the heat-shock protein 65 gene with serially diluted DNA samples. The CTAB method showed more positive results at 1:10-1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.

[PCR-based evaluation of sequence specificity of DNA fragmentation by ultrasound].

PubMed

Garafutdinov, R R; Galimova, A A; Sakhabutdinova, A R; Chemeris, A V

2016-01-01

Ultrasonic fragmentation, which is a simple and convenient method for the mechanical degradation of DNA, is widely used in modern genome studies as one of the sample preparation steps. It has been recently found that the DNA breaks occur more often in the regions containing 5'-CG-3' dinucleotides. We studied the influence of the 5'-CG-3' dinucleotides on the efficiency of the 28S rRNA gene amplification during PCR with sonicated DNA of Mantis religiosa. It was shown that the amplification rate depends on the template length and the number of 5'-CG-3' dinucleotides. Amplification of the DNA regions with a higher 5'-CG-3' density is less efficient because of their higher sensitivity to ultrasound. The amount of the amplified DNA templates is inversely proportional to the 5'-CG-3'number.

Development of loop-mediated isothermal amplification (LAMP) assay for the rapid detection of Penicillium nordicum in dry-cured meat products.

PubMed

Ferrara, M; Perrone, G; Gallo, A; Epifani, F; Visconti, A; Susca, A

2015-06-02

The need of powerful diagnostic tools for rapid, simple, and cost-effective detection of food-borne fungi has become very important in the area of food safety. Currently, several isothermal nucleic acid amplification methods have been developed as an alternative to PCR-based analyses. Loop-mediated isothermal amplification (LAMP) is one of these innovative methods; it requires neither gel electrophoresis to separate and visualize the products nor expensive laboratory equipment and it has been applied already for detection of pathogenic organisms. In the current study, we developed a LAMP assay for the specific detection of Penicillium nordicum, the major causative agent of ochratoxin A contamination in protein-rich food, especially dry-cured meat products. The assay was based on targeting otapksPN gene, a key gene in the biosynthesis of ochratoxin A (OTA) in P. nordicum. Amplification of DNA during the reaction was detected directly in-tube by color transition of hydroxynaphthol blue from violet to sky blue, visible to the naked eye, avoiding further post amplification analyses. Only DNAs isolated from several P. nordicum strains led to positive results and no amplification was observed from non-target OTA and non OTA-producing strains. The assay was able to detect down to 100 fg of purified targeted genomic DNA or 10(2) conidia/reaction within 60 min. The LAMP assay for detection and identification of P. nordicum was combined with a rapid DNA extraction method set up on serially diluted conidia, providing an alternative rapid, specific and sensitive DNA-based method suitable for application directly "on-site", notably in key steps of dry-cured meat production. Copyright © 2015 Elsevier B.V. All rights reserved.

The Development and Use of Internal Amplification Controls (IACs) with DNA Profiling Kits for Forensic DNA Analysis.

PubMed

Zahra, Nathalie; Goodwin, William

2016-01-01

Biological samples recovered for forensic investigations are often degraded and/or have low amounts of DNA; in addition, in some instances the samples may be contaminated with chemicals that can act as PCR inhibitors. As a consequence this can make interpretation of the results challenging with the possibility of having partial profiles and false negative results. Because of the impact of DNA analysis on forensic investigations, it is important to monitor the process of DNA profiling, in particular the amplification reaction. In this chapter we describe a method for the in-house generation and use of internal amplification controls (IACs) with DNA profiling kits to monitor the success of the PCR proces. In the example we show the use of the SGM Plus® kit. These controls can also be used to aid the interpretation of the DNA profile.

Calibrating genomic and allelic coverage bias in single-cell sequencing.

PubMed

Zhang, Cheng-Zhong; Adalsteinsson, Viktor A; Francis, Joshua; Cornils, Hauke; Jung, Joonil; Maire, Cecile; Ligon, Keith L; Meyerson, Matthew; Love, J Christopher

2015-04-16

Artifacts introduced in whole-genome amplification (WGA) make it difficult to derive accurate genomic information from single-cell genomes and require different analytical strategies from bulk genome analysis. Here, we describe statistical methods to quantitatively assess the amplification bias resulting from whole-genome amplification of single-cell genomic DNA. Analysis of single-cell DNA libraries generated by different technologies revealed universal features of the genome coverage bias predominantly generated at the amplicon level (1-10 kb). The magnitude of coverage bias can be accurately calibrated from low-pass sequencing (∼0.1 × ) to predict the depth-of-coverage yield of single-cell DNA libraries sequenced at arbitrary depths. We further provide a benchmark comparison of single-cell libraries generated by multi-strand displacement amplification (MDA) and multiple annealing and looping-based amplification cycles (MALBAC). Finally, we develop statistical models to calibrate allelic bias in single-cell whole-genome amplification and demonstrate a census-based strategy for efficient and accurate variant detection from low-input biopsy samples.

Calibrating genomic and allelic coverage bias in single-cell sequencing

PubMed Central

Francis, Joshua; Cornils, Hauke; Jung, Joonil; Maire, Cecile; Ligon, Keith L.; Meyerson, Matthew; Love, J. Christopher

2016-01-01

Artifacts introduced in whole-genome amplification (WGA) make it difficult to derive accurate genomic information from single-cell genomes and require different analytical strategies from bulk genome analysis. Here, we describe statistical methods to quantitatively assess the amplification bias resulting from whole-genome amplification of single-cell genomic DNA. Analysis of single-cell DNA libraries generated by different technologies revealed universal features of the genome coverage bias predominantly generated at the amplicon level (1–10 kb). The magnitude of coverage bias can be accurately calibrated from low-pass sequencing (~0.1 ×) to predict the depth-of-coverage yield of single-cell DNA libraries sequenced at arbitrary depths. We further provide a benchmark comparison of single-cell libraries generated by multi-strand displacement amplification (MDA) and multiple annealing and looping-based amplification cycles (MALBAC). Finally, we develop statistical models to calibrate allelic bias in single-cell whole-genome amplification and demonstrate a census-based strategy for efficient and accurate variant detection from low-input biopsy samples. PMID:25879913

Ultrasensitive electrochemical aptasensor for ochratoxin A based on two-level cascaded signal amplification strategy.

PubMed

Yang, Xingwang; Qian, Jing; Jiang, Ling; Yan, Yuting; Wang, Kan; Liu, Qian; Wang, Kun

2014-04-01

Ochratoxin A (OTA) has a number of toxic effects to both humans and animals, so developing sensitive detection method is of great importance. Herein, we describe an ultrasensitive electrochemical aptasensor for OTA based on the two-level cascaded signal amplification strategy with methylene blue (MB) as a redox indicator. In this method, capture DNA, aptamers, and reporter DNA functionalized-gold nanoparticles (GNPs) were immobilized on the electrode accordingly, where GNPs were used as the first-level signal enhancer. To receive the more sensitive response, a larger number of guanine (G)-rich DNA was bound to the GNPs' surface to provide abundant anchoring sites for MB to achieve the second-level signal amplification. By employing this novel strategy, an ~8.5 (±0.3) fold amplification in signal intensity was obtained. Afterward, OTA was added to force partial GNPs/G-rich DNA to release from the sensing interface and thus decreased the electrochemical response. An effective sensing range from 2.5pM to 2.5nM was received with an extremely low detection limit of 0.75 (±0.12) pM. This amplification strategy has the potential to be the main technology for aptamer-based electrochemical biosensor in a variety of fields. Copyright © 2013 Elsevier B.V. All rights reserved.

Maintenance of host DNA integrity in field-preserved mosquito (Diptera: Culicidae) blood meals for identification by DNA barcoding.

PubMed

Reeves, Lawrence E; Holderman, Chris J; Gillett-Kaufman, Jennifer L; Kawahara, Akito Y; Kaufman, Phillip E

2016-09-15

Determination of the interactions between hematophagous arthropods and their hosts is a necessary component to understanding the transmission dynamics of arthropod-vectored pathogens. Current molecular methods to identify hosts of blood-fed arthropods require the preservation of host DNA to serve as an amplification template. During transportation to the laboratory and storage prior to molecular analysis, genetic samples need to be protected from nucleases, and the degradation effects of hydrolysis, oxidation and radiation. Preservation of host DNA contained in field-collected blood-fed specimens has an additional caveat: suspension of the degradative effects of arthropod digestion on host DNA. Unless effective preservation methods are implemented promptly after blood-fed specimens are collected, host DNA will continue to degrade. Preservation methods vary in their efficacy, and need to be selected based on the logistical constraints of the research program. We compared four preservation methods (cold storage at -20 °C, desiccation, ethanol storage of intact mosquito specimens and crushed specimens on filter paper) for field storage of host DNA from blood-fed mosquitoes across a range of storage and post-feeding time periods. The efficacy of these techniques in maintaining host DNA integrity was evaluated using a polymerase chain reaction (PCR) to detect the presence of a sufficient concentration of intact host DNA templates for blood meal analysis. We applied a logistic regression model to assess the effects of preservation method, storage time and post-feeding time on the binomial response variable, amplification success. Preservation method, storage time and post-feeding time all significantly impacted PCR amplification success. Filter papers and, to a lesser extent, 95 % ethanol, were the most effective methods for the maintenance of host DNA templates. Amplification success of host DNA preserved in cold storage at -20 °C and desiccation was poor. Our data suggest that, of the methods tested, host DNA template integrity was most stable when blood meals were preserved using filter papers. Filter paper preservation is effective over short- and long-term storage, while ethanol preservation is only suitable for short-term storage. Cold storage at -20 °C, and desiccation of blood meal specimens, even for short time periods, should be avoided.

[Research status and prospects of DNA test on difficult specimens].

PubMed

Dang, Hua-Wei; Mao, Jiong; Wang, Hui; Huang, Jiang-Ping; Bai, Xiao-Gang

2012-02-01

This paper reviews the advances of DNA detection on three types of difficult biological specimens including degraded samples, trace evidences and mixed samples. The source of different samples, processing methods and announcements were analyzed. New methods such as mitochondrial test system, changing the original experimental conditions, low-volume PCR amplification and new technologies such as whole genome amplification techniques, laser capture micro-dissection, and mini-STR technology in recent years are introduced.

Comparison of the DNA extraction methods for polymerase chain reaction amplification from formalin-fixed and paraffin-embedded tissues.

PubMed

Sato, Y; Sugie, R; Tsuchiya, B; Kameya, T; Natori, M; Mukai, K

2001-12-01

To obtain an adequate quality and quantity of DNA from formalin-fixed and paraffin-embedded tissue, six different DNA extraction methods were compared. Four methods used deparaffinization by xylene followed by proteinase K digestion and phenol-chloroform extraction. The temperature of the different steps was changed to obtain higher yields and improved quality of extracted DNA. The remaining two methods used microwave heating for deparaffinization. The best DNA extraction method consisted of deparaffinization by microwave irradiation, protein digestion with proteinase K at 48 degrees C overnight, and no further purification steps. By this method, the highest DNA yield was obtained and the amplification of a 989-base pair beta-globin gene fragment was achieved. Furthermore, DNA extracted by means of this procedure from five gastric carcinomas was successfully used for single strand conformation polymorphism and direct sequencing assays of the beta-catenin gene. Because the microwave-based DNA extraction method presented here is simple, has a lower contamination risk, and results in a higher yield of DNA compared with the ordinary organic chemical reagent-based extraction method, it is considered applicable to various clinical and basic fields.

Adaptation of a visualized loop-mediated isothermal amplification technique for field detection of Plasmodium vivax infection.

PubMed

Tao, Zhi-Yong; Zhou, Hua-Yun; Xia, Hui; Xu, Sui; Zhu, Han-Wu; Culleton, Richard L; Han, Eun-Taek; Lu, Feng; Fang, Qiang; Gu, Ya-Ping; Liu, Yao-Bao; Zhu, Guo-Ding; Wang, Wei-Ming; Li, Ju-Lin; Cao, Jun; Gao, Qi

2011-06-21

Loop-mediated isothermal amplification (LAMP) is a high performance method for detecting DNA and holds promise for use in the molecular detection of infectious pathogens, including Plasmodium spp. However, in most malaria-endemic areas, which are often resource-limited, current LAMP methods are not feasible for diagnosis due to difficulties in accurately interpreting results with problems of sensitive visualization of amplified products, and the risk of contamination resulting from the high quantity of amplified DNA produced. In this study, we establish a novel visualized LAMP method in a closed-tube system, and validate it for the diagnosis of malaria under simulated field conditions. A visualized LAMP method was established by the addition of a microcrystalline wax-dye capsule containing the highly sensitive DNA fluorescence dye SYBR Green I to a normal LAMP reaction prior to the initiation of the reaction. A total of 89 blood samples were collected on filter paper and processed using a simple boiling method for DNA extraction, and then tested by the visualized LAMP method for Plasmodium vivax infection. The wax capsule remained intact during isothermal amplification, and released the DNA dye to the reaction mixture only when the temperature was raised to the melting point following amplification. Soon after cooling down, the solidified wax sealed the reaction mix at the bottom of the tube, thus minimizing the risk of aerosol contamination. Compared to microscopy, the sensitivity and specificity of LAMP were 98.3% (95% confidence interval (CI): 91.1-99.7%) and 100% (95% CI: 88.3-100%), and were in close agreement with a nested polymerase chain reaction method. This novel, cheap and quick visualized LAMP method is feasible for malaria diagnosis in resource-limited field settings.

NASBA: A detection and amplification system uniquely suited for RNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sooknanan, R.; Malek, L.T.

1995-06-01

The invention of PCR (polymerase chain reaction) has revolutionized our ability to amplify and manipulate a nucleic acid sequence in vitro. The commercial rewards of this revolution have driven the development of other nuclei acid amplification and detection methodologies. This has created an alphabet soup of technologies that use different amplification methods, including NASBA (nucleic acid sequence-based amplification), LCR (ligase chain reaction), SDA (strand displacement amplification), QBR (Q-beta replicase), CPR (cycling probe reaction), and bDNA (branched DNA). Despite the differences in their processes, these amplification systems can be separated into two broad categories based on how they achieve their goal:more » sequence-based amplification systems, such as PCR, NASBA, and SDA, amplify a target nucleic acid sequence. Signal-based amplification systems, such as LCR, QBR, CPR and bDNA, amplify or alter a signal from a detection reaction that is target-dependent. While the various methods have relative strengths and weaknesses, only NASBA offers the unique ability to homogeneously amplify an RNA analyte in the presence of homologous genomic DNA under isothermal conditions. Since the detection of RNA sequences almost invariably measures biological activity, it is an excellent prognostic indicator of activities as diverse as virus production, gene expression, and cell viability. The isothermal nature of the reaction makes NASBA especially suitable for large-scale manual screening. These features extend NASBA`s application range from research to commercial diagnostic applications. Field test kits are presently under development for human diagnostics as well as the burgeoning fields of food and environmental diagnostic testing. These developments suggest future integration of NASBA into robotic workstations for high-throughput screening as well. 17 refs., 1 tab.« less

Improved multiple displacement amplification (iMDA) and ultraclean reagents.

PubMed

Motley, S Timothy; Picuri, John M; Crowder, Chris D; Minich, Jeremiah J; Hofstadler, Steven A; Eshoo, Mark W

2014-06-06

Next-generation sequencing sample preparation requires nanogram to microgram quantities of DNA; however, many relevant samples are comprised of only a few cells. Genomic analysis of these samples requires a whole genome amplification method that is unbiased and free of exogenous DNA contamination. To address these challenges we have developed protocols for the production of DNA-free consumables including reagents and have improved upon multiple displacement amplification (iMDA). A specialized ethylene oxide treatment was developed that renders free DNA and DNA present within Gram positive bacterial cells undetectable by qPCR. To reduce DNA contamination in amplification reagents, a combination of ion exchange chromatography, filtration, and lot testing protocols were developed. Our multiple displacement amplification protocol employs a second strand-displacing DNA polymerase, improved buffers, improved reaction conditions and DNA free reagents. The iMDA protocol, when used in combination with DNA-free laboratory consumables and reagents, significantly improved efficiency and accuracy of amplification and sequencing of specimens with moderate to low levels of DNA. The sensitivity and specificity of sequencing of amplified DNA prepared using iMDA was compared to that of DNA obtained with two commercial whole genome amplification kits using 10 fg (~1-2 bacterial cells worth) of bacterial genomic DNA as a template. Analysis showed >99% of the iMDA reads mapped to the template organism whereas only 0.02% of the reads from the commercial kits mapped to the template. To assess the ability of iMDA to achieve balanced genomic coverage, a non-stochastic amount of bacterial genomic DNA (1 pg) was amplified and sequenced, and data obtained were compared to sequencing data obtained directly from genomic DNA. The iMDA DNA and genomic DNA sequencing had comparable coverage 99.98% of the reference genome at ≥1X coverage and 99.9% at ≥5X coverage while maintaining both balance and representation of the genome. The iMDA protocol in combination with DNA-free laboratory consumables, significantly improved the ability to sequence specimens with low levels of DNA. iMDA has broad utility in metagenomics, diagnostics, ancient DNA analysis, pre-implantation embryo screening, single-cell genomics, whole genome sequencing of unculturable organisms, and forensic applications for both human and microbial targets.

A pure DNA hydrogel with stable catalytic ability produced by one-step rolling circle amplification.

PubMed

Huang, Yishun; Xu, Wanlin; Liu, Guoyuan; Tian, Leilei

2017-03-09

A rolling-circle-amplification method was developed to produce DNA hydrogels with horseradish-peroxidase-like catalytic capability. The catalytic hydrogel exhibits highly improved stability at elevated temperatures or during a long-term storage. Integrated with glucose oxidase, the complex hydrogel can be applied to the sensitive and reliable detection of glucose.

Detection and differentiation of Fusarium oxysporum f. sp. lycopersici race 1 using loop-mediated isothermal amplification with three primer sets.

PubMed

Ayukawa, Y; Komatsu, K; Kashiwa, T; Akai, K; Yamada, M; Teraoka, T; Arie, T

2016-09-01

Fusarium oxysporum f. sp. lycopersici (Fol) causes tomato wilt. Based on the difference in pathogenicity towards tomato cultivars, Fol is classified into three races. In this study, a rapid method is developed for the detection and discrimination of Fol race 1 using a loop-mediated isothermal amplification (LAMP) assay with two primer sets targeting a region of the nucleotide sequence of the SIX4 gene specific for race 1 and a primer set targeting the SIX5 gene, conserved in all known Fol isolates. Upon LAMP reaction, amplification using all three primer sets was observed only when DNA of Fol race 1 was used as a template, and not when DNA of other Fol races or other fungal species was used. This method could detect 300 fg of Fol race 1 DNA, a 100-fold higher sensitivity than that obtained by conventional PCR. The method can also detect DNA extracted from soil artificially infested with Fol race 1. It is now possible to detect Fol race 1 in colonies and infected tomato stems without DNA isolation. This method is a rapid and simple tool for discrimination of Fol race 1. This study developed a loop-mediated isothermal amplification (LAMP) assay for detection and differentiation of Fusarium oxysporum f. sp. lycopersici (Fol) race 1 by using three primer sets targeting for the SIX4 and SIX5 genes. These genes are present together only in Fol race 1. This method can detect Fol race 1 in infected tomato stems without DNA extraction, affording an efficient diagnosis of Fusarium wilt on tomatoes in the field. © 2016 The Society for Applied Microbiology.

Detection of HIV-1 p24 Gag in plasma by a nanoparticle-based bio-barcode-amplification method.

PubMed

Kim, Eun-Young; Stanton, Jennifer; Korber, Bette T M; Krebs, Kendall; Bogdan, Derek; Kunstman, Kevin; Wu, Samuel; Phair, John P; Mirkin, Chad A; Wolinsky, Steven M

2008-06-01

Detection of HIV-1 in patients is limited by the sensitivity and selectivity of available tests. The nanotechnology-based bio-barcode-amplification method offers an innovative approach to detect specific HIV-1 antigens from diverse HIV-1 subtypes. We evaluated the efficacy of this protein-detection method in detecting HIV-1 in men enrolled in the Chicago component of the Multicenter AIDS Cohort Study (MACS). The method relies on magnetic microparticles with antibodies that specifically bind the HIV-1 p24 Gag protein and nanoparticles that are encoded with DNA and antibodies that can sandwich the target protein captured by the microparticle-bound antibodies. The aggregate sandwich structures are magnetically separated from solution, and treated to remove the conjugated barcode DNA. The DNA barcodes (hundreds per target) were identified by a nanoparticle-based detection method that does not rely on PCR. Of 112 plasma samples from HIV-1-infected subjects, 111 were positive for HIV-1 p24 Gag protein (range: 0.11-71.5 ng/ml of plasma) by the bio-barcode-amplification method. HIV-1 p24 Gag protein was detected in only 23 out of 112 men by the conventional ELISA. A total of 34 uninfected subjects were negative by both tests. Thus, the specificity of the bio-barcode-amplification method was 100% and the sensitivity 99%. The bio-barcode-amplification method detected HIV-1 p24 Gag protein in plasma from all study subjects with less than 200 CD4(+) T cells/microl of plasma (100%) and 19 out of 20 (95%) HIV-1-infected men who had less than 50 copies/ml of plasma of HIV-1 RNA. In a separate group of 60 diverse international isolates, representative of clades A, B, C and D and circulating recombinant forms CRF01_AE and CRF02_AG, the bio-barcode-amplification method identified the presence of virus correctly. The bio-barcode-amplification method was superior to the conventional ELISA assay for the detection of HIV-1 p24 Gag protein in plasma with a breadth of coverage for diverse HIV-1 subtypes. Because the bio-barcode-amplification method does not require enzymatic amplification, this method could be translated into a robust point-of-care test.

[Assessment of two DNA extraction methods to amplify the pneumolysin gene (PLY) from blood culture samples of Streptococcus pneumoniae].

PubMed

Hernández, Carolina; Durán, Claudia; Ulloa, María Teresa; Prado, Valeria

2004-05-01

Streptococcus pneumoniae is a common etiologic agent of invasive respiratory infections among children under 5 years of age and older adults. Isolation rates of S. pneumoniae by traditional culture techniques are low. To study the sensitivity and specificity of two different DNA extraction methods to amplify the ply gene, applied to three different types of blood culture broths, experimentally inoculated with S. pneumoniae. DNA was extracted from the cultures using an organic method or a technique that consists in dilution, washing with NaOH and concentration of the sample. This was followed by PCR amplification of a 355 pb fragment of the pneumolysin gene (ply). The organic DNA extraction method inhibited the PCR reaction at all concentrations studied (0.6 to 10(6) colony forming units/mL). Using the NaOH extraction, ply gene amplification was positive in all three blood culture broths, but only at concentrations of 10(3) colony forming units/mL, or higher. Using the same DNA extraction method, PCR was negative when the broths were inoculated with seven other related bacterial species, which results in a 100% specificity. Detection of S. pneumoniae by amplification of ply gene from blood cultures using the protocol of NaOH for DNA extraction is specific and provides results in a short lapse. However, the diagnostic sensitivity is not optimal, which limits its clinical use.

Modular development of a prototype point of care molecular diagnostic platform for sexually transmitted infections.

PubMed

Branavan, Manoharanehru; Mackay, Ruth E; Craw, Pascal; Naveenathayalan, Angel; Ahern, Jeremy C; Sivanesan, Tulasi; Hudson, Chris; Stead, Thomas; Kremer, Jessica; Garg, Neha; Baker, Mark; Sadiq, Syed T; Balachandran, Wamadeva

2016-08-01

This paper presents the design of a modular point of care test platform that integrates a proprietary sample collection device directly with a microfluidic cartridge. Cell lysis, within the cartridge, is conducted using a chemical method and nucleic acid purification is done on an activated cellulose membrane. The microfluidic device incorporates passive mixing of the lysis-binding buffers and sample using a serpentine channel. Results have shown extraction efficiencies for this new membrane of 69% and 57% compared to the commercial Qiagen extraction method of 85% and 59.4% for 0.1ng/µL and 100ng/µL salmon sperm DNA respectively spiked in phosphate buffered solution. Extraction experiments using the serpentine passive mixer cartridges incorporating lysis and nucleic acid purification showed extraction efficiency around 80% of the commercial Qiagen kit. Isothermal amplification was conducted using thermophillic helicase dependant amplification and recombinase polymerase amplification. A low cost benchtop real-time isothermal amplification platform has been developed capable of running six amplifications simultaneously. Results show that the platform is capable of detecting 1.32×10(6) of sample DNA through thermophillic helicase dependant amplification and 1×10(5) copy numbers Chlamydia trachomatis genomic DNA within 10min through recombinase polymerase nucleic acid amplification tests. Copyright © 2016 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Mechanism of chimera formation during the Multiple Displacement Amplification reaction.

PubMed

Lasken, Roger S; Stockwell, Timothy B

2007-04-12

Multiple Displacement Amplification (MDA) is a method used for amplifying limiting DNA sources. The high molecular weight amplified DNA is ideal for DNA library construction. While this has enabled genomic sequencing from one or a few cells of unculturable microorganisms, the process is complicated by the tendency of MDA to generate chimeric DNA rearrangements in the amplified DNA. Determining the source of the DNA rearrangements would be an important step towards reducing or eliminating them. Here, we characterize the major types of chimeras formed by carrying out an MDA whole genome amplification from a single E. coli cell and sequencing by the 454 Life Sciences method. Analysis of 475 chimeras revealed the predominant reaction mechanisms that create the DNA rearrangements. The highly branched DNA synthesized in MDA can assume many alternative secondary structures. DNA strands extended on an initial template can be displaced becoming available to prime on a second template creating the chimeras. Evidence supports a model in which branch migration can displace 3'-ends freeing them to prime on the new templates. More than 85% of the resulting DNA rearrangements were inverted sequences with intervening deletions that the model predicts. Intramolecular rearrangements were favored, with displaced 3'-ends reannealing to single stranded 5'-strands contained within the same branched DNA molecule. In over 70% of the chimeric junctions, the 3' termini had initiated priming at complimentary sequences of 2-21 nucleotides (nts) in the new templates. Formation of chimeras is an important limitation to the MDA method, particularly for whole genome sequencing. Identification of the mechanism for chimera formation provides new insight into the MDA reaction and suggests methods to reduce chimeras. The 454 sequencing approach used here will provide a rapid method to assess the utility of reaction modifications.

Mechanism of chimera formation during the Multiple Displacement Amplification reaction

PubMed Central

Lasken, Roger S; Stockwell, Timothy B

2007-01-01

Background Multiple Displacement Amplification (MDA) is a method used for amplifying limiting DNA sources. The high molecular weight amplified DNA is ideal for DNA library construction. While this has enabled genomic sequencing from one or a few cells of unculturable microorganisms, the process is complicated by the tendency of MDA to generate chimeric DNA rearrangements in the amplified DNA. Determining the source of the DNA rearrangements would be an important step towards reducing or eliminating them. Results Here, we characterize the major types of chimeras formed by carrying out an MDA whole genome amplification from a single E. coli cell and sequencing by the 454 Life Sciences method. Analysis of 475 chimeras revealed the predominant reaction mechanisms that create the DNA rearrangements. The highly branched DNA synthesized in MDA can assume many alternative secondary structures. DNA strands extended on an initial template can be displaced becoming available to prime on a second template creating the chimeras. Evidence supports a model in which branch migration can displace 3'-ends freeing them to prime on the new templates. More than 85% of the resulting DNA rearrangements were inverted sequences with intervening deletions that the model predicts. Intramolecular rearrangements were favored, with displaced 3'-ends reannealing to single stranded 5'-strands contained within the same branched DNA molecule. In over 70% of the chimeric junctions, the 3' termini had initiated priming at complimentary sequences of 2–21 nucleotides (nts) in the new templates. Conclusion Formation of chimeras is an important limitation to the MDA method, particularly for whole genome sequencing. Identification of the mechanism for chimera formation provides new insight into the MDA reaction and suggests methods to reduce chimeras. The 454 sequencing approach used here will provide a rapid method to assess the utility of reaction modifications. PMID:17430586

Optimal DNA Isolation Method for Detection of Nontuberculous Mycobacteria by Polymerase Chain Reaction

PubMed Central

Mohammadi, Samira; Esfahani, Bahram Nasr; Moghim, Sharareh; Mirhendi, Hossein; Zaniani, Fatemeh Riyahi; Safaei, Hajieh Ghasemian; Fazeli, Hossein; Salehi, Mahshid

2017-01-01

Background: Nontuberculous mycobacteria (NTM) are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. Materials and Methods: The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR) amplification of the heat-shock protein 65 gene with serially diluted DNA samples. Results: The CTAB method showed more positive results at 1:10–1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. Conclusions: According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor. PMID:29279831

Developmental validation of a Cannabis sativa STR multiplex system for forensic analysis.

PubMed

Howard, Christopher; Gilmore, Simon; Robertson, James; Peakall, Rod

2008-09-01

A developmental validation study based on recommendations of the Scientific Working Group on DNA Analysis Methods (SWGDAM) was conducted on a multiplex system of 10 Cannabis sativa short tandem repeat loci. Amplification of the loci in four multiplex reactions was tested across DNA from dried root, stem, and leaf sources, and DNA from fresh, frozen, and dried leaf tissue with a template DNA range of 10.0-0.01 ng. The loci were amplified and scored consistently for all DNA sources when DNA template was in the range of 10.0-1.0 ng. Some allelic dropout and PCR failure occurred in reactions with lower template DNA amounts. Overall, amplification was best using 10.0 ng of template DNA from dried leaf tissue indicating that this is the optimal source material. Cross species amplification was observed in Humulus lupulus for three loci but there was no allelic overlap. This is the first study following SWGDAM validation guidelines to validate short tandem repeat markers for forensic use in plants.

Development of a quantitative fluorescence single primer isothermal amplification-based method for the detection of Salmonella.

PubMed

Wang, Jianchang; Li, Rui; Hu, Lianxia; Sun, Xiaoxia; Wang, Jinfeng; Li, Jing

2016-02-16

Food-borne disease caused by Salmonella has long been, and continues to be, an important global public health problem, necessitating rapid and accurate detection of Salmonella in food. Real time PCR is the most recently developed approach for Salmonella detection. Single primer isothermal amplification (SPIA), a novel gene amplification technique, has emerged as an attractive microbiological testing method. SPIA is performed under a constant temperature, eliminating the need for an expensive thermo-cycler. In addition, SPIA reactions can be accomplished in 30 min, faster than real time PCR that usually takes over 2h. We developed a quantitative fluorescence SPIA-based method for the detection of Salmonella. Using Salmonella Typhimurium genomic DNA as template and a primer targeting Salmonella invA gene, we showed the detection limit of SPIA was 2.0 × 10(1)fg DNA. Its successful amplification of different serotypic Salmonella genomic DNA but not non-Salmonella bacterial DNA demonstrated the specificity of SPIA. Furthermore, this method was validated with artificially contaminated beef. In conclusion, we showed high sensitivity and specificity of SPIA in the detection of Salmonella, comparable to real time PCR. In addition, SPIA is faster and more cost-effective (non-use of expensive cyclers), making it a potential alternative for field detection of Salmonella in resource-limited settings that are commonly encountered in developing countries. Copyright © 2015 Elsevier B.V. All rights reserved.

Compaction of rolling circle amplification products increases signal integrity and signal-to-noise ratio

PubMed Central

Clausson, Carl-Magnus; Arngården, Linda; Ishaq, Omer; Klaesson, Axel; Kühnemund, Malte; Grannas, Karin; Koos, Björn; Qian, Xiaoyan; Ranefall, Petter; Krzywkowski, Tomasz; Brismar, Hjalmar; Nilsson, Mats; Wählby, Carolina; Söderberg, Ola

2015-01-01

Rolling circle amplification (RCA) for generation of distinct fluorescent signals in situ relies upon the self-collapsing properties of single-stranded DNA in commonly used RCA-based methods. By introducing a cross-hybridizing DNA oligonucleotide during rolling circle amplification, we demonstrate that the fluorophore-labeled RCA products (RCPs) become smaller. The reduced size of RCPs increases the local concentration of fluorophores and as a result, the signal intensity increases together with the signal-to-noise ratio. Furthermore, we have found that RCPs sometimes tend to disintegrate and may be recorded as several RCPs, a trait that is prevented with our cross-hybridizing DNA oligonucleotide. These effects generated by compaction of RCPs improve accuracy of visual as well as automated in situ analysis for RCA based methods, such as proximity ligation assays (PLA) and padlock probes. PMID:26202090

Primer Extension Mutagenesis Powered by Selective Rolling Circle Amplification

PubMed Central

Huovinen, Tuomas; Brockmann, Eeva-Christine; Akter, Sultana; Perez-Gamarra, Susan; Ylä-Pelto, Jani; Liu, Yuan; Lamminmäki, Urpo

2012-01-01

Primer extension mutagenesis is a popular tool to create libraries for in vitro evolution experiments. Here we describe a further improvement of the method described by T.A. Kunkel using uracil-containing single-stranded DNA as the template for the primer extension by additional uracil-DNA glycosylase treatment and rolling circle amplification (RCA) steps. It is shown that removal of uracil bases from the template leads to selective amplification of the nascently synthesized circular DNA strand carrying the desired mutations by phi29 DNA polymerase. Selective RCA (sRCA) of the DNA heteroduplex formed in Kunkel's mutagenesis increases the mutagenesis efficiency from 50% close to 100% and the number of transformants 300-fold without notable diversity bias. We also observed that both the mutated and the wild-type DNA were present in at least one third of the cells transformed directly with Kunkel's heteroduplex. In contrast, the cells transformed with sRCA product contained only mutated DNA. In sRCA, the complex cell-based selection for the mutant strand is replaced with the more controllable enzyme-based selection and less DNA is needed for library creation. Construction of a gene library of ten billion members is demonstrated with the described method with 240 nanograms of DNA as starting material. PMID:22355397

Genome amplification of single sperm using multiple displacement amplification.

PubMed

Jiang, Zhengwen; Zhang, Xingqi; Deka, Ranjan; Jin, Li

2005-06-07

Sperm typing is an effective way to study recombination rate on a fine scale in regions of interest. There are two strategies for the amplification of single meiotic recombinants: repulsion-phase allele-specific PCR and whole genome amplification (WGA). The former can selectively amplify single recombinant molecules from a batch of sperm but is not scalable for high-throughput operation. Currently, primer extension pre-amplification is the only method used in WGA of single sperm, whereas it has limited capacity to produce high-coverage products enough for the analysis of local recombination rate in multiple large regions. Here, we applied for the first time a recently developed WGA method, multiple displacement amplification (MDA), to amplify single sperm DNA, and demonstrated its great potential for producing high-yield and high-coverage products. In a 50 mul reaction, 76 or 93% of loci can be amplified at least 2500- or 250-fold, respectively, from single sperm DNA, and second-round MDA can further offer >200-fold amplification. The MDA products are usable for a variety of genetic applications, including sequencing and microsatellite marker and single nucleotide polymorphism (SNP) analysis. The use of MDA in single sperm amplification may open a new era for studies on local recombination rates.

Real-time fluorescence loop mediated isothermal amplification for the diagnosis of malaria.

PubMed

Lucchi, Naomi W; Demas, Allison; Narayanan, Jothikumar; Sumari, Deborah; Kabanywanyi, Abdunoor; Kachur, S Patrick; Barnwell, John W; Udhayakumar, Venkatachalam

2010-10-29

Molecular diagnostic methods can complement existing tools to improve the diagnosis of malaria. However, they require good laboratory infrastructure thereby restricting their use to reference laboratories and research studies. Therefore, adopting molecular tools for routine use in malaria endemic countries will require simpler molecular platforms. The recently developed loop-mediated isothermal amplification (LAMP) method is relatively simple and can be improved for better use in endemic countries. In this study, we attempted to improve this method for malaria diagnosis by using a simple and portable device capable of performing both the amplification and detection (by fluorescence) of LAMP in one platform. We refer to this as the RealAmp method. Published genus-specific primers were used to test the utility of this method. DNA derived from different species of malaria parasites was used for the initial characterization. Clinical samples of P. falciparum were used to determine the sensitivity and specificity of this system compared to microscopy and a nested PCR method. Additionally, directly boiled parasite preparations were compared with a conventional DNA isolation method. The RealAmp method was found to be simple and allowed real-time detection of DNA amplification. The time to amplification varied but was generally less than 60 minutes. All human-infecting Plasmodium species were detected. The sensitivity and specificity of RealAmp in detecting P. falciparum was 96.7% and 91.7% respectively, compared to microscopy and 98.9% and 100% respectively, compared to a standard nested PCR method. In addition, this method consistently detected P. falciparum from directly boiled blood samples. This RealAmp method has great potential as a field usable molecular tool for diagnosis of malaria. This tool can provide an alternative to conventional PCR based diagnostic methods for field use in clinical and operational programs.

Real-time PCR detection of Plasmodium directly from whole blood and filter paper samples

PubMed Central

2011-01-01

Background Real-time PCR is a sensitive and specific method for the analysis of Plasmodium DNA. However, prior purification of genomic DNA from blood is necessary since PCR inhibitors and quenching of fluorophores from blood prevent efficient amplification and detection of PCR products. Methods Reagents designed to specifically overcome PCR inhibition and quenching of fluorescence were evaluated for real-time PCR amplification of Plasmodium DNA directly from blood. Whole blood from clinical samples and dried blood spots collected in the field in Colombia were tested. Results Amplification and fluorescence detection by real-time PCR were optimal with 40× SYBR® Green dye and 5% blood volume in the PCR reaction. Plasmodium DNA was detected directly from both whole blood and dried blood spots from clinical samples. The sensitivity and specificity ranged from 93-100% compared with PCR performed on purified Plasmodium DNA. Conclusions The methodology described facilitates high-throughput testing of blood samples collected in the field by fluorescence-based real-time PCR. This method can be applied to a broad range of clinical studies with the advantages of immediate sample testing, lower experimental costs and time-savings. PMID:21851640

[Evaluation of 3 methods of DNA extraction from paraffin-embedded material for the amplification of genomic DNA using PCR].

PubMed

Mesquita, R A; Anzai, E K; Oliveira, R N; Nunes, F D

2001-01-01

There are several protocols reported in the literature for the extraction of genomic DNA from formalin-fixed paraffin-embedded samples. Genomic DNA is utilized in molecular analyses, including PCR. This study compares three different methods for the extraction of genomic DNA from formalin-fixed paraffin-embedded (inflammatory fibrous hyperplasia) and non-formalin-fixed (normal oral mucosa) samples: phenol with enzymatic digestion, and silica with and without enzymatic digestion. The amplification of DNA by means of the PCR technique was carried out with primers for the exon 7 of human keratin type 14. Amplicons were analyzed by means of electrophoresis in an 8% polyacrylamide gel with 5% glycerol, followed by silver-staining visualization. The phenol/enzymatic digestion and the silica/enzymatic digestion methods provided amplicons from both tissue samples. The method described is a potential aid in the establishment of the histopathologic diagnosis and in retrospective studies with archival paraffin-embedded samples.

Qualitative and quantitative assessment of single fingerprints in forensic DNA analysis.

PubMed

Ostojic, Lana; Klempner, Stacey A; Patel, Rosni A; Mitchell, Adele A; Axler-DiPerte, Grace L; Wurmbach, Elisa

2014-11-01

Fingerprints and touched items are important sources of DNA for STR profiling, since this evidence can be recovered in a wide variety of criminal offenses. However, there are some fundamental difficulties in working with these samples, including variability in quantity and quality of extracted DNA. In this study, we collected and analyzed over 700 fingerprints. We compared a commercially available extraction protocol (Zygem) to two methods developed in our laboratory, a simple one-tube protocol and a high sensitivity protocol (HighSens) that includes additional steps to concentrate and purify the DNA. The amplification protocols tested were AmpFLSTR® Identifiler® using either 28 or 31 amplification cycles, and Identifiler® Plus using 32 amplification cycles. We found that the HighSens and Zygem extraction methods were significantly better in their DNA yields than the one-tube method. Identifiler® Plus increased the quality of the STR profiles for the one-tube extraction significantly. However, this effect could not be verified for the other extraction methods. Furthermore, microscopic analysis of single fingerprints revealed that some individuals tended to shed more material than others onto glass slides. However, a dense deposition of skin flakes did not strongly correlate with a high quality STR profile. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Emergence of a replicating species from an in vitro RNA evolution reaction

NASA Technical Reports Server (NTRS)

Breaker, R. R.; Joyce, G. F.

1994-01-01

The technique of self-sustained sequence replication allows isothermal amplification of DNA and RNA molecules in vitro. This method relies on the activities of a reverse transcriptase and a DNA-dependent RNA polymerase to amplify specific nucleic acid sequences. We have modified this protocol to allow selective amplification of RNAs that catalyze a particular chemical reaction. During an in vitro RNA evolution experiment employing this modified system, a unique class of "selfish" RNAs emerged and replicated to the exclusion of the intended RNAs. Members of this class of selfish molecules, termed RNA Z, amplify efficiently despite their inability to catalyze the target chemical reaction. Their amplification requires the action of both reverse transcriptase and RNA polymerase and involves the synthesis of both DNA and RNA replication intermediates. The proposed amplification mechanism for RNA Z involves the formation of a DNA hairpin that functions as a template for transcription by RNA polymerase. This arrangement links the two strands of the DNA, resulting in the production of RNA transcripts that contain an embedded RNA polymerase promoter sequence.

A Sequence-Independent Strategy for Detection and Cloning of Circular DNA Virus Genomes by Using Multiply Primed Rolling-Circle Amplification

PubMed Central

Rector, Annabel; Tachezy, Ruth; Van Ranst, Marc

2004-01-01

The discovery of novel viruses has often been accomplished by using hybridization-based methods that necessitate the availability of a previously characterized virus genome probe or knowledge of the viral nucleotide sequence to construct consensus or degenerate PCR primers. In their natural replication cycle, certain viruses employ a rolling-circle mechanism to propagate their circular genomes, and multiply primed rolling-circle amplification (RCA) with φ29 DNA polymerase has recently been applied in the amplification of circular plasmid vectors used in cloning. We employed an isothermal RCA protocol that uses random hexamer primers to amplify the complete genomes of papillomaviruses without the need for prior knowledge of their DNA sequences. We optimized this RCA technique with extracted human papillomavirus type 16 (HPV-16) DNA from W12 cells, using a real-time quantitative PCR assay to determine amplification efficiency, and obtained a 2.4 × 104-fold increase in HPV-16 DNA concentration. We were able to clone the complete HPV-16 genome from this multiply primed RCA product. The optimized protocol was subsequently applied to a bovine fibropapillomatous wart tissue sample. Whereas no papillomavirus DNA could be detected by restriction enzyme digestion of the original sample, multiply primed RCA enabled us to obtain a sufficient amount of papillomavirus DNA for restriction enzyme analysis, cloning, and subsequent sequencing of a novel variant of bovine papillomavirus type 1. The multiply primed RCA method allows the discovery of previously unknown papillomaviruses, and possibly also other circular DNA viruses, without a priori sequence information. PMID:15113879

DNA Hydrogel with Tunable pH-Responsive Properties Produced by Rolling Circle Amplification.

PubMed

Xu, Wanlin; Huang, Yishun; Zhao, Haoran; Li, Pan; Liu, Guoyuan; Li, Jing; Zhu, Chengshen; Tian, Leilei

2017-12-22

Recently, smart DNA hydrogels, which are generally formed by the self-assembly of oligonucleotides or through the cross-linking of oligonucleotide-polymer hybrids, have attracted tremendous attention. However, the difficulties of fabricating DNA hydrogels limit their practical applications. We report herein a novel method for producing pH-responsive hydrogels by rolling circle amplification (RCA). In this method, pH-sensitive cross-linking sites were introduced into the polymeric DNA chains during DNA synthesis. As the DNA sequence can be precisely defined by its template, the properties of such hydrogels can be finely tuned in a very facile way through template design. We have investigated the process of hydrogel formation and pH-responsiveness to provide rationales for functional hydrogel design based on the RCA reaction. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Signal-on fluorescence biosensor for microRNA-21 detection based on DNA strand displacement reaction and Mg2+-dependent DNAzyme cleavage.

PubMed

Yin, Huan-Shun; Li, Bing-Chen; Zhou, Yun-Lei; Wang, Hai-Yan; Wang, Ming-Hui; Ai, Shi-Yun

2017-10-15

MicroRNAs have been involved into many biological processes and are regarded as disease biomarkers. Simple, rapid, sensitive and selective method for microRNA detection is crucial for early diagnosis and therapy of diseases. In this work, sensitive fluorescence assay was developed for microRNA-21 detection based on DNA polymerase induced strand displacement amplification reaction, Mg 2+ -dependent DNAzyme catalysis reaction, and magnetic separation. In the presence of target microRNA-21, amounts of trigger DNA could be produced with DNA polymerase induced strand displacement amplification reaction, and the trigger DNA could be further hybridized with signal DNA, which was labeled with biotin and AMCA dye. After introduction of Mg 2+ , trigger DNA could form DNAzyme to cleave signal DNA. After magnetic separation, the DNA fragment with AMCA dye could give fluorescence signal, which was related to microRNA-21 concentration. Based on the two efficient signal amplifications, the developed method showed high detection sensitivity with low detection limit of 0.27fM (3σ). In addition, this fluorescence strategy also possessed excellent detection specificity, and could be applied to analyze microRNA-21 expression level in serum of cancer patient. According to the obtained results, the developed fluorescence method might be a promising detection platform for microRNA-21 quantitative analysis in biomedical research and clinical diagnosis. Copyright © 2017 Elsevier B.V. All rights reserved.

Protocol for the use of a rapid real-time PCR method for the detection of HIV-1 proviral DNA using double-stranded primer.

PubMed

Pau, Chou-Pong; Wells, Susan K; Granade, Timothy C

2012-01-01

This chapter describes a real-time PCR method for the detection of HIV-1 proviral DNA in whole blood samples using a novel double-stranded primer system. The assay utilizes a simple commercially available DNA extraction method and a rapid and easy-to-perform real-time PCR protocol to consistently detect a minimum of four copies of HIV-1 group M proviral DNA in as little as 90 min after sample (whole blood) collection. Co-amplification of the human RNase P gene serves as an internal control to monitor the efficiency of both the DNA extraction and amplification. Once the assay is validated properly, it may be suitable as an alternative confirmation test for HIV-1 infections in a variety of HIV testing venues including the mother-to-child transmission testing sites, clinics, and diagnostic testing centers.

Detection of Giardia in environmental waters by immuno-PCR amplification methods.

PubMed

Mahbubani, M H; Schaefer, F W; Jones, D D; Bej, A K

1998-02-01

Genomic DNA was extracted either directly from Giardia muris cysts seeded into environmental surface waters or from cysts isolated by immunomagnetic beads (IMB). A 0.171-kbp segment of the giardin gene was PCR-amplified following "direct extraction" of Giardia DNA from seeded Cahaba river water concentrate with moderate turbidity (780 JTU's), but DNA purified from seeded Colorado river water concentrates with high turbidity (2 x 10(5) JTUs) failed to amplify. However, if the cysts were first separated by the IMB approach from seeded Cahaba or Colorado river waters, and the DNA released by a freeze-boil Chelex(R)100 treatment, detection of G. muris by PCR amplification could be achieved at a sensitivity of 3 x 10(0) or 3 x 10(1) cysts/ml, respectively. If, however, the G. muris cysts used to seed even moderately turbid river waters (780 JTUs) were formalin treated (which is conventionally used for microscopic examination), neither direct extraction nor IMB purification methods yielded amplifiable DNA. Use of immunomagnetic beads to separate Giardia cysts from complex matrices of environmental surface waters followed by DNA release and PCR amplification of the target giardin gene improved the reliability of detection of this pathogen with the required sensitivity.

The DNA isolation method has effect on allele drop-out and on the results of fluorescent PCR and DNA fragment analysis.

PubMed

Nagy, Bálint; Bán, Zoltán; Papp, Zoltán

2005-10-01

The quality and the quantity of isolated DNA have an effect on PCR amplifications. The authors studied three DNA isolation protocols (resin binding method using fresh and frozen amniotic fluid samples, and silica adsorption method using fresh samples) on the quantity and on the quality of the isolated DNA. Amniotic fluid samples were obtained from 20 pregnant women. The isolated DNA concentrations were determined by real-time fluorimeter using SYBRGreen I method. Each sample was studied for the presence of 8 STR markers. The authors compared the number of the detected alleles, electrophoretograms and peak areas. There was a significant difference between the concentration of the obtained DNA and in the peak areas between the three isolation protocols. The numbers of detected alleles were different, we observed the most allele drop outs in the resin type DNA isolation protocol from the fresh sample (detected allele numbers 182), followed by resin binding protocol from the frozen samples (detected allele number 243) and by the silica adsorption method (detected allele number 264). The authors demonstrated that the DNA isolation method has an effect on the quantity and quality of the isolated DNA, and on further PCR amplifications.

DNA-based identification of spices: DNA isolation, whole genome amplification, and polymerase chain reaction.

PubMed

Focke, Felix; Haase, Ilka; Fischer, Markus

2011-01-26

Usually spices are identified morphologically using simple methods like magnifying glasses or microscopic instruments. On the other hand, molecular biological methods like the polymerase chain reaction (PCR) enable an accurate and specific detection also in complex matrices. Generally, the origins of spices are plants with diverse genetic backgrounds and relationships. The processing methods used for the production of spices are complex and individual. Consequently, the development of a reliable DNA-based method for spice analysis is a challenging intention. However, once established, this method will be easily adapted to less difficult food matrices. In the current study, several alternative methods for the isolation of DNA from spices have been developed and evaluated in detail with regard to (i) its purity (photometric), (ii) yield (fluorimetric methods), and (iii) its amplifiability (PCR). Whole genome amplification methods were used to preamplify isolates to improve the ratio between amplifiable DNA and inhibiting substances. Specific primer sets were designed, and the PCR conditions were optimized to detect 18 spices selectively. Assays of self-made spice mixtures were performed to proof the applicability of the developed methods.

Novel One-Tube-One-Step Real-Time Methodology for Rapid Transcriptomic Biomarker Detection: Signal Amplification by Ternary Initiation Complexes.

PubMed

Fujita, Hiroto; Kataoka, Yuka; Tobita, Seiji; Kuwahara, Masayasu; Sugimoto, Naoki

2016-07-19

We have developed a novel RNA detection method, termed signal amplification by ternary initiation complexes (SATIC), in which an analyte sample is simply mixed with the relevant reagents and allowed to stand for a short time under isothermal conditions (37 °C). The advantage of the technique is that there is no requirement for (i) heat annealing, (ii) thermal cycling during the reaction, (iii) a reverse transcription step, or (iv) enzymatic or mechanical fragmentation of the target RNA. SATIC involves the formation of a ternary initiation complex between the target RNA, a circular DNA template, and a DNA primer, followed by rolling circle amplification (RCA) to generate multiple copies of G-quadruplex (G4) on a long DNA strand like beads on a string. The G4s can be specifically fluorescence-stained with N(3)-hydroxyethyl thioflavin T (ThT-HE), which emits weakly with single- and double-stranded RNA/DNA but strongly with parallel G4s. An improved dual SATIC system, which involves the formation of two different ternary initiation complexes in the RCA process, exhibited a wide quantitative detection range of 1-5000 pM. Furthermore, this enabled visual observation-based RNA detection, which is more rapid and convenient than conventional isothermal methods, such as reverse transcription-loop-mediated isothermal amplification, signal mediated amplification of RNA technology, and RNA-primed rolling circle amplification. Thus, SATIC methodology may serve as an on-site and real-time measurement technique for transcriptomic biomarkers for various diseases.

Single-cell genomic sequencing using Multiple Displacement Amplification.

PubMed

Lasken, Roger S

2007-10-01

Single microbial cells can now be sequenced using DNA amplified by the Multiple Displacement Amplification (MDA) reaction. The few femtograms of DNA in a bacterium are amplified into micrograms of high molecular weight DNA suitable for DNA library construction and Sanger sequencing. The MDA-generated DNA also performs well when used directly as template for pyrosequencing by the 454 Life Sciences method. While MDA from single cells loses some of the genomic sequence, this approach will greatly accelerate the pace of sequencing from uncultured microbes. The genetically linked sequences from single cells are also a powerful tool to be used in guiding genomic assembly of shotgun sequences of multiple organisms from environmental DNA extracts (metagenomic sequences).

Dual-primer self-generation SERS signal amplification assay for PDGF-BB using label-free aptamer.

PubMed

Ye, SuJuan; Zhai, XiaoMo; Wu, YanYing; Kuang, ShaoPing

2016-05-15

Highly sensitive detection of proteins, especially those associated with cancers, is essential to biomedical research as well as clinical diagnosis. In this work, a simple and novel one-two-three signal amplification surface-enhanced Raman scattering (SERS) method for the detection of protein is fabricated by using label-free aptamer and dual-primer self-generation. Platelet-derived growth factor B-chain (PDGF-BB) is selected as the model protein. The one-two-three cascade DNA amplification means one target-aptamer binding event, two hairpin DNA switches and three DNA amplification reactions. This strategy possesses some remarkable features compared to conventional signal amplification methods: (i) A smart probe including a label-free aptamer is fabricated, for suitable hybridization without hindering the affinity of the aptamer toward its target. (ii) Using the unique structure switch of the aptamer and cooperator, a one-two-three working mode is developed to amplify the SERS signal. The amplification efficiency is enhanced. Given the unique and attractive characteristics, a simple and universal strategy is designed to accomplish ultrasensitive detection of proteins. The detection limit of PDGF-BB via SERS detection is 0.42 pM, with the linear range from 1.0×10(-12)M to 10(-8)M. It is potentially universal because the aptamer can be easily designed for biomolecules whose aptamers undergo similar conformational changes. Copyright © 2015 Elsevier B.V. All rights reserved.

Development of an Ammonium Sulfate DNA Extraction Method for Obtaining Amplifiable DNA in a Small Number of Cells and Its Application to Clinical Specimens

PubMed Central

Oh, Seo Young; Kim, Wook Youn; Hwang, Tae Sook; Han, Hye Seung; Lim, So Dug; Kim, Wan Seop

2013-01-01

DNA extraction from microdissected cells has become essential for handling clinical specimens with advances in molecular pathology. Conventional methods have limitations for extracting amplifiable DNA from specimens containing a small number of cells. We developed an ammonium sulfate DNA extraction method (A) and compared it with two other methods (B and C). DNA quality and quantity, β-globin amplification, and detectability of two cancer associated gene mutations were evaluated. Method A showed the best DNA yield, particularly when the cell number was very low. Amplification of the β-globin gene using DNA from the SNU 790 cell line and papillary thyroid carcinoma (PTC) cells extracted with Method A demonstrated the strongest band. BRAF V600E mutation analysis using ethanol-fixed PTC cells from a patient demonstrated both a “T” peak increase and an adjacent “A” peak decrease when 25 and 50 cells were extracted, whereas mutant peaks were too low to be analyzed using the other two methods. EGFR mutation analysis using formalin-fixed paraffin-embedded lung cancer tissues demonstrated a mutant peak with Method A, whereas the mutant peak was undetectable with Methods B or C. Method A yielded the best DNA quantity and quality with outstanding efficiency, particularly when paucicellular specimens were used. PMID:23691506

Method of artificial DNA splicing by directed ligation (SDL).

PubMed Central

Lebedenko, E N; Birikh, K R; Plutalov, O V; Berlin YuA

1991-01-01

An approach to directed genetic recombination in vitro has been devised, which allows for joining together, in a predetermined way, a series of DNA segments to give a precisely spliced polynucleotide sequence (DNA splicing by directed ligation, SDL). The approach makes use of amplification, by means of several polymerase chain reactions (PCR), of a chosen set of DNA segments. Primers for the amplifications contain recognition sites of the class IIS restriction endonucleases, which transform blunt ends of the amplification products into protruding ends of unique primary structures, the ends to be used for joining segments together being mutually complementary. Ligation of the mixture of the segments so synthesized gives the desired sequence in an unambiguous way. The suggested approach has been exemplified by the synthesis of a totally processed (intronless) gene encoding human mature interleukin-1 alpha. Images PMID:1662363

Effect of food processing on plant DNA degradation and PCR-based GMO analysis: a review.

PubMed

Gryson, Nicolas

2010-03-01

The applicability of a DNA-based method for GMO detection and quantification depends on the quality and quantity of the DNA. Important food-processing conditions, for example temperature and pH, may lead to degradation of the DNA, rendering PCR analysis impossible or GMO quantification unreliable. This review discusses the effect of several food processes on DNA degradation and subsequent GMO detection and quantification. The data show that, although many of these processes do indeed lead to the fragmentation of DNA, amplification of the DNA may still be possible. Length and composition of the amplicon may, however, affect the result, as also may the method of extraction used. Also, many techniques are used to describe the behaviour of DNA in food processing, which occasionally makes it difficult to compare research results. Further research should be aimed at defining ingredients in terms of their DNA quality and PCR amplification ability, and elaboration of matrix-specific certified reference materials.

Comparison of three methods of DNA extraction from peripheral blood mononuclear cells and lung fragments of equines.

PubMed

Santos, E M; Paula, J F R; Motta, P M C; Heinemann, M B; Leite, R C; Haddad, J P A; Del Puerto, H L; Reis, J K P

2010-08-17

We compared three different protocols for DNA extraction from horse peripheral blood mononuclear cells (PBMC) and lung fragments, determining average final DNA concentration, purity, percentage of PCR amplification using beta-actin, and cost. Thirty-four samples from PBMC, and 33 samples from lung fragments were submitted to DNA extraction by three different protocols. Protocol A consisted of a phenol-chloroform and isoamylic alcohol extraction, Protocol B used alkaline extraction with NaOH, and Protocol C used the DNAzol((R)) reagent kit. Protocol A was the best option for DNA extraction from lung fragments, producing high DNA concentrations, with high sensitivity in PCR amplification (100%), followed by Protocols C and B. On the other hand, for PBMC samples, Protocol B gave the highest sensitivity in PCR amplification (100%), followed by Protocols C and A. We conclude that Protocol A should be used for PCR diagnosis from lung fragment samples, while Protocol B should be used for PBMC.

Enrichment of methylated molecules using enhanced-ice-co-amplification at lower denaturation temperature-PCR (E-ice-COLD-PCR) for the sensitive detection of disease-related hypermethylation.

PubMed

Mauger, Florence; Kernaleguen, Magali; Lallemand, Céline; Kristensen, Vessela N; Deleuze, Jean-François; Tost, Jörg

2018-05-01

The detection of specific DNA methylation patterns bears great promise as biomarker for personalized management of cancer patients. Co-amplification at lower denaturation temperature-PCR (COLD-PCR) assays are sensitive methods, but have previously only been able to analyze loss of DNA methylation. Enhanced (E)-ice-COLD-PCR reactions starting from 2 ng of bisulfite-converted DNA were developed to analyze methylation patterns in two promoters with locked nucleic acid (LNA) probes blocking amplification of unmethylated CpGs. The enrichment of methylated molecules was compared to quantitative (q)PCR and quantified using serial dilutions. E-ice-COLD-PCR allowed the multiplexed enrichment and quantification of methylated DNA. Assays were validated in primary breast cancer specimens and circulating cell-free DNA from cancer patients. E-ice-COLD-PCR could prove a useful tool in the context of DNA methylation analysis for personalized medicine.

Linear nicking endonuclease-mediated strand-displacement DNA amplification.

PubMed

Joneja, Aric; Huang, Xiaohua

2011-07-01

We describe a method for linear isothermal DNA amplification using nicking endonuclease-mediated strand displacement by a DNA polymerase. The nicking of one strand of a DNA target by the endonuclease produces a primer for the polymerase to initiate synthesis. As the polymerization proceeds, the downstream strand is displaced into a single-stranded form while the nicking site is also regenerated. The combined continuous repetitive action of nicking by the endonuclease and strand-displacement synthesis by the polymerase results in linear amplification of one strand of the DNA molecule. We demonstrate that DNA templates up to 5000 nucleotides can be linearly amplified using a nicking endonuclease with 7-bp recognition sequence and Sequenase version 2.0 in the presence of single-stranded DNA binding proteins. We also show that a mixture of three templates of 500, 1000, and 5000 nucleotides in length is linearly amplified with the original molar ratios of the templates preserved. Moreover, we demonstrate that a complex library of hydrodynamically sheared genomic DNA from bacteriophage lambda can be amplified linearly. Copyright © 2011 Elsevier Inc. All rights reserved.

In-gel multiple displacement amplification of long DNA fragments diluted to the single molecule level.

PubMed

Michikawa, Yuichi; Sugahara, Keisuke; Suga, Tomo; Ohtsuka, Yoshimi; Ishikawa, Kenichi; Ishikawa, Atsuko; Shiomi, Naoko; Shiomi, Tadahiro; Iwakawa, Mayumi; Imai, Takashi

2008-12-15

The isolation and multiple genotyping of long individual DNA fragments are needed to obtain haplotype information for diploid organisms. Limiting dilution of sample DNA followed by multiple displacement amplification is a useful technique but is restricted to short (<5 kb) DNA fragments. In the current study, a novel modification was applied to overcome these problems. A limited amount of cellular DNA was carefully released from intact cells into a mildly heated alkaline agarose solution and mixed thoroughly. The solution was then gently aliquoted and allowed to solidify while maintaining the integrity of the diluted DNA. Exogenously provided Phi29 DNA polymerase was used to perform consistent genomic amplification with random hexameric oligonucleotides within the agarose gels. Simple heat melting of the gel allowed recovery of the amplified materials in a solution of the polymerase chain reaction (PCR)-ready form. The haplotypes of seven SNPs spanning 240 kb of the DNA surrounding the human ATM gene region on chromosome 11 were determined for 10 individuals, demonstrating the feasibility of this new method.

Linear nicking endonuclease-mediated strand displacement DNA amplification

PubMed Central

Joneja, Aric; Huang, Xiaohua

2011-01-01

We describe a method for linear isothermal DNA amplification using nicking endonuclease-mediated strand displacement by a DNA polymerase. The nicking of one strand of a DNA target by the endonuclease produces a primer for the polymerase to initiate synthesis. As the polymerization proceeds, the downstream strand is displaced into a single-stranded form while the nicking site is also regenerated. The combined continuous repetitive action of nicking by the endonuclease and strand displacement synthesis by the polymerase results in linear amplification of one strand of the DNA molecule. We demonstrate that DNA templates up to five thousand nucleotides can be linearly amplified using a nicking endonuclease with seven base-pair recognition sequence and Sequenase version 2.0 in the presence of single-stranded DNA binding proteins. We also show that a mixture of three templates of 500, 1000, and 5000 nucleotides in length are linearly amplified with the original molar ratios of the templates preserved. Moreover, we demonstrate that a complex library of hydrodynamically sheared genomic DNA from bacteriophage lambda can be amplified linearly. PMID:21342654

Scalable amplification of strand subsets from chip-synthesized oligonucleotide libraries

PubMed Central

Schmidt, Thorsten L.; Beliveau, Brian J.; Uca, Yavuz O.; Theilmann, Mark; Da Cruz, Felipe; Wu, Chao-Ting; Shih, William M.

2015-01-01

Synthetic oligonucleotides are the main cost factor for studies in DNA nanotechnology, genetics and synthetic biology, which all require thousands of these at high quality. Inexpensive chip-synthesized oligonucleotide libraries can contain hundreds of thousands of distinct sequences, however only at sub-femtomole quantities per strand. Here we present a selective oligonucleotide amplification method, based on three rounds of rolling-circle amplification, that produces nanomole amounts of single-stranded oligonucleotides per millilitre reaction. In a multistep one-pot procedure, subsets of hundreds or thousands of single-stranded DNAs with different lengths can selectively be amplified and purified together. These oligonucleotides are used to fold several DNA nanostructures and as primary fluorescence in situ hybridization probes. The amplification cost is lower than other reported methods (typically around US$ 20 per nanomole total oligonucleotides produced) and is dominated by the use of commercial enzymes. PMID:26567534

Non-Enzymatic Detection of Bacterial Genomic DNA Using the Bio-Barcode Assay

PubMed Central

Hill, Haley D.; Vega, Rafael A.; Mirkin, Chad A.

2011-01-01

The detection of bacterial genomic DNA through a non-enzymatic nanomaterials based amplification method, the bio-barcode assay, is reported. The assay utilizes oligonucleotide functionalized magnetic microparticles to capture the target of interest from the sample. A critical step in the new assay involves the use of blocking oligonucleotides during heat denaturation of the double stranded DNA. These blockers bind to specific regions of the target DNA upon cooling, and prevent the duplex DNA from re-hybridizing, which allows the particle probes to bind. Following target isolation using the magnetic particles, oligonucleotide functionalized gold nanoparticles act as target recognition agents. The oligonucleotides on the nanoparticle (barcodes) act as amplification surrogates. The barcodes are then detected using the Scanometric method. The limit of detection for this assay was determined to be 2.5 femtomolar, and this is the first demonstration of a barcode type assay for the detection of double stranded, genomic DNA. PMID:17927207

Enzymatic Production of Monoclonal Stoichiometric Single-Stranded DNA Oligonucleotides

PubMed Central

Ducani, Cosimo; Kaul, Corinna; Moche, Martin; Shih, William M.; Högberg, Björn

2013-01-01

Single-stranded oligonucleotides are important as research tools as probes for diagnostics and gene therapy. Today, production of oligonucleotides is done via solid-phase synthesis. However, the capabilities of current polymer chemistry are limited in comparison to what can be produced in biological systems. The errors in synthetic DNA increases with oligonucleotide length, and sequence diversity can often be a problem. Here, we present the Monoclonal Stoichiometric (MOSIC) method for enzymatic DNA oligonucleotide production. Using this method, we amplify oligonucleotides from clonal templates followed by digestion of a cutter-hairpin, resulting in pools of monoclonal oligonucleotides with precisely controlled relative stoichiometric ratios. We present data where MOSIC oligonucleotides, 14–378 nt long, were prepared either by in vitro rolling-circle amplification, or by amplification in Escherichia coli in the form of phagemid DNA. The formation of a DNA crystal and folding of DNA nanostructures confirmed the scalability, purity and stoichiometry of the produced oligonucleotides. PMID:23727986

Use of FTA elute card impregnated with cervicovaginal sample directly into the amplification reaction increases the detection of human papillomavirus DNA.

PubMed

Santos, Carla R; Franciscatto, Laura G; Barcellos, Regina B; Almeida, Sabrina E M; Rossetti, Maria Lucia R

2012-01-01

This study aimed to evaluate the use of the FTA elute card(TM) impregnated with cervicovaginal sample directly in the PCR amplification for detection of HPV-DNA. The results were compared to a reference technique. This method was more efficient than the protocol indicated by the manufacturer, identifying 91.7% against 54.2% of the positive samples.

A BAYESIAN METHOD FOR CALCULATING REAL-TIME QUANTITATIVE PCR CALIBRATION CURVES USING ABSOLUTE PLASMID DNA STANDARDS

EPA Science Inventory

In real-time quantitative PCR studies using absolute plasmid DNA standards, a calibration curve is developed to estimate an unknown DNA concentration. However, potential differences in the amplification performance of plasmid DNA compared to genomic DNA standards are often ignore...

Methylation Sensitive Amplification Polymorphism Sequencing (MSAP-Seq)-A Method for High-Throughput Analysis of Differentially Methylated CCGG Sites in Plants with Large Genomes.

PubMed

Chwialkowska, Karolina; Korotko, Urszula; Kosinska, Joanna; Szarejko, Iwona; Kwasniewski, Miroslaw

2017-01-01

Epigenetic mechanisms, including histone modifications and DNA methylation, mutually regulate chromatin structure, maintain genome integrity, and affect gene expression and transposon mobility. Variations in DNA methylation within plant populations, as well as methylation in response to internal and external factors, are of increasing interest, especially in the crop research field. Methylation Sensitive Amplification Polymorphism (MSAP) is one of the most commonly used methods for assessing DNA methylation changes in plants. This method involves gel-based visualization of PCR fragments from selectively amplified DNA that are cleaved using methylation-sensitive restriction enzymes. In this study, we developed and validated a new method based on the conventional MSAP approach called Methylation Sensitive Amplification Polymorphism Sequencing (MSAP-Seq). We improved the MSAP-based approach by replacing the conventional separation of amplicons on polyacrylamide gels with direct, high-throughput sequencing using Next Generation Sequencing (NGS) and automated data analysis. MSAP-Seq allows for global sequence-based identification of changes in DNA methylation. This technique was validated in Hordeum vulgare . However, MSAP-Seq can be straightforwardly implemented in different plant species, including crops with large, complex and highly repetitive genomes. The incorporation of high-throughput sequencing into MSAP-Seq enables parallel and direct analysis of DNA methylation in hundreds of thousands of sites across the genome. MSAP-Seq provides direct genomic localization of changes and enables quantitative evaluation. We have shown that the MSAP-Seq method specifically targets gene-containing regions and that a single analysis can cover three-quarters of all genes in large genomes. Moreover, MSAP-Seq's simplicity, cost effectiveness, and high-multiplexing capability make this method highly affordable. Therefore, MSAP-Seq can be used for DNA methylation analysis in crop plants with large and complex genomes.

Methylation Sensitive Amplification Polymorphism Sequencing (MSAP-Seq)—A Method for High-Throughput Analysis of Differentially Methylated CCGG Sites in Plants with Large Genomes

PubMed Central

Chwialkowska, Karolina; Korotko, Urszula; Kosinska, Joanna; Szarejko, Iwona; Kwasniewski, Miroslaw

2017-01-01

Epigenetic mechanisms, including histone modifications and DNA methylation, mutually regulate chromatin structure, maintain genome integrity, and affect gene expression and transposon mobility. Variations in DNA methylation within plant populations, as well as methylation in response to internal and external factors, are of increasing interest, especially in the crop research field. Methylation Sensitive Amplification Polymorphism (MSAP) is one of the most commonly used methods for assessing DNA methylation changes in plants. This method involves gel-based visualization of PCR fragments from selectively amplified DNA that are cleaved using methylation-sensitive restriction enzymes. In this study, we developed and validated a new method based on the conventional MSAP approach called Methylation Sensitive Amplification Polymorphism Sequencing (MSAP-Seq). We improved the MSAP-based approach by replacing the conventional separation of amplicons on polyacrylamide gels with direct, high-throughput sequencing using Next Generation Sequencing (NGS) and automated data analysis. MSAP-Seq allows for global sequence-based identification of changes in DNA methylation. This technique was validated in Hordeum vulgare. However, MSAP-Seq can be straightforwardly implemented in different plant species, including crops with large, complex and highly repetitive genomes. The incorporation of high-throughput sequencing into MSAP-Seq enables parallel and direct analysis of DNA methylation in hundreds of thousands of sites across the genome. MSAP-Seq provides direct genomic localization of changes and enables quantitative evaluation. We have shown that the MSAP-Seq method specifically targets gene-containing regions and that a single analysis can cover three-quarters of all genes in large genomes. Moreover, MSAP-Seq's simplicity, cost effectiveness, and high-multiplexing capability make this method highly affordable. Therefore, MSAP-Seq can be used for DNA methylation analysis in crop plants with large and complex genomes. PMID:29250096

Excision Repair-Initiated Enzyme-Assisted Bicyclic Cascade Signal Amplification for Ultrasensitive Detection of Uracil-DNA Glycosylase.

PubMed

Wang, Li-Juan; Ren, Ming; Zhang, Qianyi; Tang, Bo; Zhang, Chun-Yang

2017-04-18

Uracil-DNA glycosylase (UDG) is an important base excision repair (BER) enzyme responsible for the repair of uracil-induced DNA lesion and the maintenance of genomic integrity, while the aberrant expression of UDG is associated with a variety of cancers. Thus, the accurate detection of UDG activity is essential to biomedical research and clinical diagnosis. Here, we develop a fluorescent method for ultrasensitive detection of UDG activity using excision repair-initiated enzyme-assisted bicyclic cascade signal amplification. This assay involves (1) UDG-actuated uracil-excision repair, (2) excision repair-initiated nicking enzyme-mediated isothermal exponential amplification, (3) ribonuclease H (RNase H)-induced hydrolysis of signal probes for generating fluorescence signal. The presence of UDG enables the removal of uracil from U·A pairs and generates an apurinic/apyrimidinic (AP) site. Endonuclease IV (Endo IV) subsequently cleaves the AP site, resulting in the break of DNA substrate. The cleaved DNA substrate functions as both a primer and a template to initiate isothermal exponential amplification, producing a large number of triggers. The resultant trigger may selectively hybridize with the signal probe which is modified with FAM and BHQ1, forming a RNA-DNA heterogeneous duplex. The subsequent hydrolysis of RNA-DNA duplex by RNase H leads to the generation of fluorescence signal. This assay exhibits ultrahigh sensitivity with a detection limit of 0.0001 U/mL, and it can even measure UDG activity at the single-cell level. Moreover, this method can be applied for the measurement of kinetic parameters and the screening of inhibitors, thereby providing a powerful tool for DNA repair enzyme-related biomedical research and clinical diagnosis.

Comparison of manual and semi-automatic DNA extraction protocols for the barcoding characterization of hematophagous louse flies (Diptera: Hippoboscidae).

PubMed

Gutiérrez-López, Rafael; Martínez-de la Puente, Josué; Gangoso, Laura; Soriguer, Ramón C; Figuerola, Jordi

2015-06-01

The barcoding of life initiative provides a universal molecular tool to distinguish animal species based on the amplification and sequencing of a fragment of the subunit 1 of the cytochrome oxidase (COI) gene. Obtaining good quality DNA for barcoding purposes is a limiting factor, especially in studies conducted on small-sized samples or those requiring the maintenance of the organism as a voucher. In this study, we compared the number of positive amplifications and the quality of the sequences obtained using DNA extraction methods that also differ in their economic costs and time requirements and we applied them for the genetic characterization of louse flies. Four DNA extraction methods were studied: chloroform/isoamyl alcohol, HotShot procedure, Qiagen DNeasy(®) Tissue and Blood Kit and DNA Kit Maxwell(®) 16LEV. All the louse flies were morphologically identified as Ornithophila gestroi and a single COI-based haplotype was identified. The number of positive amplifications did not differ significantly among DNA extraction procedures. However, the quality of the sequences was significantly lower for the case of the chloroform/isoamyl alcohol procedure with respect to the rest of methods tested here. These results may be useful for the genetic characterization of louse flies, leaving most of the remaining insect as a voucher. © 2015 The Society for Vector Ecology.

A novel, sensitive and label-free loop-mediated isothermal amplification detection method for nucleic acids using luminophore dyes.

PubMed

Roy, Sharmili; Wei, Sim Xiao; Ying, Jean Liew Zhi; Safavieh, Mohammadali; Ahmed, Minhaz Uddin

2016-12-15

Electrochemiluminescence (ECL) has been widely rendered for nucleic acid testing. Here, we integrate loop-mediated isothermal amplification (LAMP) with ECL technique for DNA detection and quantification. The target LAMP DNA bound electrostatically with [Ru(bpy)3](+2) on the carbon electrode surface, and an ECL reaction was triggered by tripropylamine (TPrA) to yield luminescence. We illustrated this method as a new and highly sensitive strategy for the detection of sequence-specific DNA from different meat species at picogram levels. The proposed strategy renders the signal amplification capacities of TPrA and combines LAMP with inherently high sensitivity of the ECL technique, to facilitate the detection of low quantities of DNA. By leveraging this technique, target DNA of Sus scrofa (pork) meat was detected as low as 1pg/µL (3.43×10(-1)copies/µL). In addition, the proposed technique was applied for detection of Bacillus subtilis DNA samples and detection limit of 10pg/µL (2.2×10(3)copies/µL) was achieved. The advantages of being isothermal, sensitive and robust with ability for multiplex detection of bio-analytes makes this method a facile and appealing sensing modality in hand-held devices to be used at the point-of-care (POC). Copyright © 2016 Elsevier B.V. All rights reserved.

Ultrasensitive electrochemical detection of DNA based on Zn²⁺ assistant DNA recycling followed with hybridization chain reaction dual amplification.

PubMed

Qian, Yong; Wang, Chunyan; Gao, Fenglei

2015-01-15

A new strategy to combine Zn(2+) assistant DNA recycling followed with hybridization chain reaction dual amplification was designed for highly sensitive electrochemical detection of target DNA. A gold electrode was used to immobilize molecular beacon (MB) as the recognition probe and perform the amplification procedure. In the presence of the target DNA, the hairpin probe 1 was opened, and the DNAzyme was liberated from the caged structure. The activated DNAzyme hybridized with the MB and catalyzed its cleavage in the presence of Zn(2+) cofactor and resulting in a free DNAzyme strand. Finally, each target-induced activated DNAzyme underwent many cycles triggering the cleavage of MB, thus forming numerous MB fragments. The MB fragments triggered the HCR and formed a long double-helix DNA structure. Because both H1 and H2 were labeled by biotin, a lot of SA-ALP was captured on the electrode surface, thus catalyzing a silver deposition process for electrochemical stripping analysis. This novel cascade signal amplification strategy can detect target DNA down to the attomolar level with a dynamic range spanning 6 orders of magnitude. This highly sensitive and specific assay has a great potential to become a promising DNA quantification method in biomedical research and clinical diagnosis. Copyright © 2014 Elsevier B.V. All rights reserved.

A novel, integrated forensic microdevice on a rotation-driven platform: Buccal swab to STR product in less than 2 h.

PubMed

Cox, Jordan O; DeCarmen, Teresa Sikes; Ouyang, Yiwen; Strachan, Briony; Sloane, Hillary; Connon, Cathey; Gibson, Kemper; Jackson, Kimberly; Landers, James P; Cruz, Tracey Dawson

2016-12-01

This work describes the development of a novel microdevice for forensic DNA processing of reference swabs. This microdevice incorporates an enzyme-based assay for DNA preparation, which allows for faster processing times and reduced sample handling. Infrared-mediated PCR (IR-PCR) is used for STR amplification using a custom reaction mixture, allowing for amplification of STR loci in 45 min while circumventing the limitations of traditional block thermocyclers. Uniquely positioned valves coupled with a simple rotational platform are used to exert fluidic control, eliminating the need for bulky external equipment. All microdevices were fabricated using laser ablation and thermal bonding of PMMA layers. Using this microdevice, the enzyme-mediated DNA liberation module produced DNA yields similar to or higher than those produced using the traditional (tube-based) protocol. Initial microdevice IR-PCR experiments to test the amplification module and reaction (using Phusion Flash/SpeedSTAR) generated near-full profiles that suffered from interlocus peak imbalance and poor adenylation (significant -A). However, subsequent attempts using KAPA 2G and Pfu Ultra polymerases generated full STR profiles with improved interlocus balance and the expected adenylated product. A fully integrated run designed to test microfluidic control successfully generated CE-ready STR amplicons in less than 2 h (<1 h of hands-on time). Using this approach, high-quality STR profiles were developed that were consistent with those produced using conventional DNA purification and STR amplification methods. This method is a smaller, more elegant solution than current microdevice methods and offers a cheaper, hands-free, closed-system alternative to traditional forensic methods. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

SMA Diagnosis: Detection of SMN1 Deletion with Real-Time mCOP-PCR System Using Fresh Blood DNA.

PubMed

Niba, Emma Tabe Eko; Ar Rochmah, Mawaddah; Harahap, Nur Imma Fatimah; Awano, Hiroyuki; Morioka, Ichiro; Iijima, Kazumoto; Saito, Toshio; Saito, Kayoko; Takeuchi, Atsuko; Lai, Poh San; Bouike, Yoshihiro; Nishio, Hisahide; Shinohara, Masakazu

2017-12-18

Spinal muscular atrophy (SMA) is one of the most common autosomal recessive disorders. The symptoms are caused by defects of lower motor neurons in the spinal cord. More than 95% of SMA patients are homozygous for survival motor neuron 1 (SMN1) deletion. We previously developed a screening system for SMN1 deletion based on a modified competitive oligonucleotide priming-PCR (mCOP-PCR) technique using dried blood spot (DBS) on filter paper. This system is convenient for mass screening in the large population and/or first-tier diagnostic method of the patients in the remote areas. However, this system was still time-consuming and effort-taking, because it required pre-amplification procedure to avoid non-specific amplification and gel-electrophoresis to detect the presence or absence of SMN1 deletion. When the fresh blood samples are used instead of DBS, or when the gel-electrophoresis is replaced by real-time PCR, we may have a simpler and more rapid diagnostic method for SMA. To establish a simpler and more rapid diagnostic method of SMN1 deletion using fresh blood DNA. DNA samples extracted from fresh blood and stored at 4 ℃ for 1 month. The samples were assayed using a real-time mCOP-PCR system without pre-amplification procedures. DNA samples had already been genotyped by PCR-restriction fragment length polymorphism (PCR-RFLP), showing the presence or absence of SMN1 exon 7. The DNA samples were directly subjected to the mCOP-PCR step. The amplification of mCOP-PCR was monitored in a real-time PCR apparatus. The genotyping results of the real-time mCOP-PCR system using fresh blood DNA were completely matched with those of PCR-RFLP. In this real-time mCOP-PCR system using fresh blood-DNA, it took only four hours from extraction of DNA to detection of the presence or absence of SMN1 deletion, while it took more than 12 hours in PCR-RFLP. Our real-time mCOP-PCR system using fresh blood DNA was rapid and accurate, suggesting it may be useful for the first-tier diagnostic method of SMA.

Linear and exponential TAIL-PCR: a method for efficient and quick amplification of flanking sequences adjacent to Tn5 transposon insertion sites.

PubMed

Jia, Xianbo; Lin, Xinjian; Chen, Jichen

2017-11-02

Current genome walking methods are very time consuming, and many produce non-specific amplification products. To amplify the flanking sequences that are adjacent to Tn5 transposon insertion sites in Serratia marcescens FZSF02, we developed a genome walking method based on TAIL-PCR. This PCR method added a 20-cycle linear amplification step before the exponential amplification step to increase the concentration of the target sequences. Products of the linear amplification and the exponential amplification were diluted 100-fold to decrease the concentration of the templates that cause non-specific amplification. Fast DNA polymerase with a high extension speed was used in this method, and an amplification program was used to rapidly amplify long specific sequences. With this linear and exponential TAIL-PCR (LETAIL-PCR), we successfully obtained products larger than 2 kb from Tn5 transposon insertion mutant strains within 3 h. This method can be widely used in genome walking studies to amplify unknown sequences that are adjacent to known sequences.

Nucleic acid detection system and method for detecting influenza

DOEpatents

Cai, Hong; Song, Jian

2015-03-17

The invention provides a rapid, sensitive and specific nucleic acid detection system which utilizes isothermal nucleic acid amplification in combination with a lateral flow chromatographic device, or DNA dipstick, for DNA-hybridization detection. The system of the invention requires no complex instrumentation or electronic hardware, and provides a low cost nucleic acid detection system suitable for highly sensitive pathogen detection. Hybridization to single-stranded DNA amplification products using the system of the invention provides a sensitive and specific means by which assays can be multiplexed for the detection of multiple target sequences.

Comparison of Different Drying Methods for Recovery of Mushroom DNA.

PubMed

Wang, Shouxian; Liu, Yu; Xu, Jianping

2017-06-07

Several methods have been reported for drying mushroom specimens for population genetic, taxonomic, and phylogenetic studies. However, most methods have not been directly compared for their effectiveness in preserving mushroom DNA. In this study, we compared silica gel drying at ambient temperature and oven drying at seven different temperatures. Two mushroom species representing two types of fruiting bodies were examined: the fleshy button mushroom Agaricus bisporus and the leathery shelf fungus Trametes versicolor. For each species dried with the eight methods, we assessed the mushroom water loss rate, the quality and quantity of extracted DNA, and the effectiveness of using the extracted DNA as a template for PCR amplification of two DNA fragments (ITS and a single copy gene). Dried specimens from all tested methods yielded sufficient DNA for PCR amplification of the two genes in both species. However, differences among the methods for the two species were found in: (i) the time required by different drying methods for the fresh mushroom tissue to reach a stable weight; and (ii) the relative quality and quantity of the extracted genomic DNA. Among these methods, oven drying at 70 °C for 3-4 h seemed the most efficient for preserving field mushroom samples for subsequent molecular work.

Quantitative analysis of DNA methylation in the promoter region of the methylguanine-O(6) -DNA-methyltransferase gene by COBRA and subsequent native capillary gel electrophoresis.

PubMed

Goedecke, Simon; Mühlisch, Jörg; Hempel, Georg; Frühwald, Michael C; Wünsch, Bernhard

2015-12-01

Along with histone modifications, RNA interference and delayed replication timing, DNA methylation belongs to the key processes in epigenetic regulation of gene expression. Therefore, reliable information about the methylation level of particular DNA fragments is of major interest. Herein the methylation level at two positions of the promoter region of the gene methylguanine-O(6) -DNA-Methyltransferase (MGMT) was investigated. Previously, it was demonstrated that the epigenetic status of this DNA region correlates with response to alkylating anticancer agents. An automated CGE method with LIF detection was established to separate the six DNA fragments resulting from combined bisulfite restriction analysis of the methylated and non-methylated MGMT promoter. In COBRA, the DNA was treated with bisulfite converting cytosine into uracil. During PCR uracil pairs with adenine, which changes the original recognition site of the restriction enzyme Taql. Artificial probes generated by mixing appropriate amounts of DNA after bisulfite treatment and PCR amplification were used for validation of the method. The methylation levels of these samples could be determined with high accuracy and precision. DNA samples prepared by mixing the corresponding clones first and then performing PCR amplification led to non-linear correlation between the corrected peak areas and the methylation levels. This effect is explained by slightly different PCR amplification of DNA with different sequences present in the mixture. The superiority of CGE over PAGE was clearly demonstrated. Finally, the established method was used to analyze the methylation levels of human brain tumor tissue samples. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Integrating DNA strand displacement circuitry to the nonlinear hybridization chain reaction.

PubMed

Zhang, Zhuo; Fan, Tsz Wing; Hsing, I-Ming

2017-02-23

Programmable and modular attributes of DNA molecules allow one to develop versatile sensing platforms that can be operated isothermally and enzyme-free. In this work, we present an approach to integrate upstream DNA strand displacement circuits that can be turned on by a sequence-specific microRNA analyte with a downstream nonlinear hybridization chain reaction for a cascading hyperbranched nucleic acid assembly. This system provides a two-step amplification strategy for highly sensitive detection of the miRNA analyte, conducive for multiplexed detection. Multiple miRNA analytes were tested with our integrated circuitry using the same downstream signal amplification setting, showing the decoupling of nonlinear self-assembly with the analyte sequence. Compared with the reported methods, our signal amplification approach provides an additional control module for higher-order DNA self-assembly and could be developed into a promising platform for the detection of critical nucleic-acid based biomarkers.

Genome-wide single-nucleotide polymorphism arrays demonstrate high fidelity of multiple displacement-based whole-genome amplification.

PubMed

Tzvetkov, Mladen V; Becker, Christian; Kulle, Bettina; Nürnberg, Peter; Brockmöller, Jürgen; Wojnowski, Leszek

2005-02-01

Whole-genome DNA amplification by multiple displacement (MD-WGA) is a promising tool to obtain sufficient DNA amounts from samples of limited quantity. Using Affymetrix' GeneChip Human Mapping 10K Arrays, we investigated the accuracy and allele amplification bias in DNA samples subjected to MD-WGA. We observed an excellent concordance (99.95%) between single-nucleotide polymorphisms (SNPs) called both in the nonamplified and the corresponding amplified DNA. This concordance was only 0.01% lower than the intra-assay reproducibility of the genotyping technique used. However, MD-WGA failed to amplify an estimated 7% of polymorphic loci. Due to the algorithm used to call genotypes, this was detected only for heterozygous loci. We achieved a 4.3-fold reduction of noncalled SNPs by combining the results from two independent MD-WGA reactions. This indicated that inter-reaction variations rather than specific chromosomal loci reduced the efficiency of MD-WGA. Consistently, we detected no regions of reduced amplification, with the exception of several SNPs located near chromosomal ends. Altogether, despite a substantial loss of polymorphic sites, MD-WGA appears to be the current method of choice to amplify genomic DNA for array-based SNP analyses. The number of nonamplified loci can be substantially reduced by amplifying each DNA sample in duplicate.

Novel Degenerate PCR Method for Whole-Genome Amplification Applied to Peru Margin (ODP Leg 201) Subsurface Samples

PubMed Central

Martino, Amanda J.; Rhodes, Matthew E.; Biddle, Jennifer F.; Brandt, Leah D.; Tomsho, Lynn P.; House, Christopher H.

2011-01-01

A degenerate polymerase chain reaction (PCR)-based method of whole-genome amplification, designed to work fluidly with 454 sequencing technology, was developed and tested for use on deep marine subsurface DNA samples. While optimized here for use with Roche 454 technology, the general framework presented may be applicable to other next generation sequencing systems as well (e.g., Illumina, Ion Torrent). The method, which we have called random amplification metagenomic PCR (RAMP), involves the use of specific primers from Roche 454 amplicon sequencing, modified by the addition of a degenerate region at the 3′ end. It utilizes a PCR reaction, which resulted in no amplification from blanks, even after 50 cycles of PCR. After efforts to optimize experimental conditions, the method was tested with DNA extracted from cultured E. coli cells, and genome coverage was estimated after sequencing on three different occasions. Coverage did not vary greatly with the different experimental conditions tested, and was around 62% with a sequencing effort equivalent to a theoretical genome coverage of 14.10×. The GC content of the sequenced amplification product was within 2% of the predicted values for this strain of E. coli. The method was also applied to DNA extracted from marine subsurface samples from ODP Leg 201 site 1229 (Peru Margin), and results of a taxonomic analysis revealed microbial communities dominated by Proteobacteria, Chloroflexi, Firmicutes, Euryarchaeota, and Crenarchaeota, among others. These results were similar to those obtained previously for those samples; however, variations in the proportions of taxa identified illustrates well the generally accepted view that community analysis is sensitive to both the amplification technique used and the method of assigning sequences to taxonomic groups. Overall, we find that RAMP represents a valid methodology for amplifying metagenomes from low-biomass samples. PMID:22319519

Development of a Quantitative Recombinase Polymerase Amplification Assay with an Internal Positive Control

PubMed Central

Richards-Kortum, Rebecca

2015-01-01

It was recently demonstrated that recombinase polymerase amplification (RPA), an isothermal amplification platform for pathogen detection, may be used to quantify DNA sample concentration using a standard curve. In this manuscript, a detailed protocol for developing and implementing a real-time quantitative recombinase polymerase amplification assay (qRPA assay) is provided. Using HIV-1 DNA quantification as an example, the assembly of real-time RPA reactions, the design of an internal positive control (IPC) sequence, and co-amplification of the IPC and target of interest are all described. Instructions and data processing scripts for the construction of a standard curve using data from multiple experiments are provided, which may be used to predict the concentration of unknown samples or assess the performance of the assay. Finally, an alternative method for collecting real-time fluorescence data with a microscope and a stage heater as a step towards developing a point-of-care qRPA assay is described. The protocol and scripts provided may be used for the development of a qRPA assay for any DNA target of interest. PMID:25867513

Development of a quantitative recombinase polymerase amplification assay with an internal positive control.

PubMed

Crannell, Zachary A; Rohrman, Brittany; Richards-Kortum, Rebecca

2015-03-30

It was recently demonstrated that recombinase polymerase amplification (RPA), an isothermal amplification platform for pathogen detection, may be used to quantify DNA sample concentration using a standard curve. In this manuscript, a detailed protocol for developing and implementing a real-time quantitative recombinase polymerase amplification assay (qRPA assay) is provided. Using HIV-1 DNA quantification as an example, the assembly of real-time RPA reactions, the design of an internal positive control (IPC) sequence, and co-amplification of the IPC and target of interest are all described. Instructions and data processing scripts for the construction of a standard curve using data from multiple experiments are provided, which may be used to predict the concentration of unknown samples or assess the performance of the assay. Finally, an alternative method for collecting real-time fluorescence data with a microscope and a stage heater as a step towards developing a point-of-care qRPA assay is described. The protocol and scripts provided may be used for the development of a qRPA assay for any DNA target of interest.

[Quantitative PCR in the diagnosis of Leishmania].

PubMed

Mortarino, M; Franceschi, A; Mancianti, F; Bazzocchi, C; Genchi, C; Bandi, C

2004-06-01

Polymerase chain reaction (PCR) is a sensitive and rapid method for the diagnosis of canine Leishmania infection and can be performed on a variety of biological samples, including peripheral blood, lymph node, bone marrow and skin. Standard PCR requires electrophoretic analysis of the amplification products and is usually not suitable for quantification of the template DNA (unless competitor-based or other methods are developed), being of reduced usefulness when accurate monitoring of target DNA is required. Quantitative real-time PCR allows the continuous monitoring of the accumulation of PCR products during the amplification reaction. This allows the identification of the cycle of near-logarithmic PCR product generation (threshold cycle) and, by inference, the relative quantification of the template DNA present at the start of the reaction. Since the amplification product are monitored in "real-time" as they form cycle-by-cycle, no post-amplification handling is required. The absolute quantification is performed according either to an internal standard co-amplified with the sample DNA, or to an external standard curve obtained by parallel amplification of serial known concentrations of a reference DNA sequence. From the quantification of the template DNA, an estimation of the relative load of parasites in the different samples can be obtained. The advantages compared to standard and semi-quantitative PCR techniques are reduction of the assay's time and contamination risks, and improved sensitivity. As for standard PCR, the minimal components of the quantitative PCR reaction mixture are the DNA target of the amplification, an oligonucleotide primer pair flanking the target sequence, a suitable DNA polymerase, deoxynucleotides, buffer and salts. Different technologies have been set up for the monitoring of amplification products, generally based on the use of fluorescent probes. For instance, SYBR Green technology is a non-specific detection system based on a fluorescent dsDNA intercalator and it is applicable to all potential targets. TaqMan technology is more specific since performs the direct assessment of the amount of amplified DNA using a fluorescent probe specific for the target sequence flanked by the primer pair. This probe is an oligonucleotide labelled with a reporter dye (fluorescent) and a quencher (which absorbs the fluorescent signal generated by the reporter). The thermic protocol of amplification allows the binding of the fluorescent probe to the target sequence before the binding of the primers and the starting of the polymerization by Taq polymerase. During polymerization, 5'-3' exonuclease activity of Taq polymerase digests the probe and in this way the reporter dye is released from the probe and a fluorescent signal is detected. The intensity of the signal accumulates at the end of each cycle and is related to the amount of the amplification product. In recent years, quantitative PCR methods based either on SYBR Green or TaqMan technology have been set up for the quantification of Leishmania in mouse liver, mouse skin and human peripheral blood, targeting either single-copy chromosomal or multi-copy minicircle sequences with high sensitivity and reproducibility. In particular, real-time PCR seems to be a reliable, rapid and noninvasive method for the diagnosis and follow up of visceral leishmaniasis in humans. At present, the application of real-time PCR for research and clinical diagnosis of Leishmania infection in dogs is still foreseable. As for standard PCR, the high sensitivity of real-time PCR could allow the use of blood sampling that is less invasive and easily performed for monitoring the status of the dogs. The development of a real-time PCR assay for Leishmania infantum infection in dogs could support the standard and optimized serological and PCR methods currenly in use for the diagnosis and follow-up of canine leishmaniasis, and perhaps prediction of recurrences associated with tissue loads of residual pathogens after treatment. At this regard, a TaqMan Real Time PCR method developed for the quantification of Leishmania infantum minicircle DNA in peripheral blood of naturally infected dogs sampled before and at different time points after the beginning of a standard antileishmanial therapy will be illustrated.

Loop-mediated isothermal amplification (LAMP) based detection of Colletotrichum falcatum causing red rot in sugarcane.

PubMed

Chandra, Amaresh; Keizerweerd, Amber T; Que, Youxiong; Grisham, Michael P

2015-08-01

Red rot, caused by Colletotrichum falcatum, is a destructive disease prevalent in most sugarcane-producing countries. Disease-free sugarcane planting materials (setts) are essential as the pathogen spreads primarily through infected setts. The present study was undertaken to develop a loop-mediated isothermal amplification (LAMP) assay for the detection of C. falcatum. C. falcatum genomic DNA was isolated from pure mycelium culture and infected tissues. Four sets of primers corresponding to a unique DNA sequence specific to C. falcatum were designed. Specificity of the LAMP test was checked with DNA of another fungal pathogen of sugarcane, Puccinia melanocephala, as well as two closely-related species, Colletotrichum fructivorum and Colletotrichum acutatum. No reaction was found with the three pathogens. When C. falcatum DNA from pure culture was used in a detection limit analysis, sensitivity of the LAMP method was observed to be ten times higher than that of conventional PCR; however, sensitivity was only 5 times higher when DNA from C. falcatum-infected tissues was used. Using the LAMP assay, C. falcatum DNA is amplified with high specificity, efficiency, and rapidity under isothermal conditions. Moreover, visual judgment of color change in <1 h without further post-amplification processing makes the LAMP method convenient, economical, and useful in diagnostic laboratories and the field.

Use of FTA elute card impregnated with cervicovaginal sample directly into the amplification reaction increases the detection of human papillomavirus DNA

PubMed Central

Santos, Carla R.; Franciscatto, Laura G.; Barcellos, Regina B.; Almeida, Sabrina E. M.; Rossetti, Maria Lucia R.

2012-01-01

This study aimed to evaluate the use of the FTA elute cardTM impregnated with cervicovaginal sample directly in the PCR amplification for detection of HPV-DNA. The results were compared to a reference technique. This method was more efficient than the protocol indicated by the manufacturer, identifying 91.7% against 54.2% of the positive samples. PMID:24031844

Integrated microfluidic systems for cell lysis, mixing/pumping and DNA amplification

NASA Astrophysics Data System (ADS)

Lee, Chia-Yen; Lee, Gwo-Bin; Lin, Jr-Lung; Huang, Fu-Chun; Liao, Chia-Sheng

2005-06-01

The present paper reports a fully automated microfluidic system for the DNA amplification process by integrating an electroosmotic pump, an active micromixer and an on-chip temperature control system. In this DNA amplification process, the cell lysis is initially performed in a micro cell lysis reactor. Extracted DNA samples, primers and reagents are then driven electroosmotically into a mixing region where they are mixed by the active micromixer. The homogeneous mixture is then thermally cycled in a micro-PCR (polymerase chain reaction) chamber to perform DNA amplification. Experimental results show that the proposed device can successfully automate the sample pretreatment operation for DNA amplification, thereby delivering significant time and effort savings. The new microfluidic system, which facilitates cell lysis, sample driving/mixing and DNA amplification, could provide a significant contribution to ongoing efforts to miniaturize bio-analysis systems by utilizing a simple fabrication process and cheap materials.

Error baseline rates of five sample preparation methods used to characterize RNA virus populations.

PubMed

Kugelman, Jeffrey R; Wiley, Michael R; Nagle, Elyse R; Reyes, Daniel; Pfeffer, Brad P; Kuhn, Jens H; Sanchez-Lockhart, Mariano; Palacios, Gustavo F

2017-01-01

Individual RNA viruses typically occur as populations of genomes that differ slightly from each other due to mutations introduced by the error-prone viral polymerase. Understanding the variability of RNA virus genome populations is critical for understanding virus evolution because individual mutant genomes may gain evolutionary selective advantages and give rise to dominant subpopulations, possibly even leading to the emergence of viruses resistant to medical countermeasures. Reverse transcription of virus genome populations followed by next-generation sequencing is the only available method to characterize variation for RNA viruses. However, both steps may lead to the introduction of artificial mutations, thereby skewing the data. To better understand how such errors are introduced during sample preparation, we determined and compared error baseline rates of five different sample preparation methods by analyzing in vitro transcribed Ebola virus RNA from an artificial plasmid-based system. These methods included: shotgun sequencing from plasmid DNA or in vitro transcribed RNA as a basic "no amplification" method, amplicon sequencing from the plasmid DNA or in vitro transcribed RNA as a "targeted" amplification method, sequence-independent single-primer amplification (SISPA) as a "random" amplification method, rolling circle reverse transcription sequencing (CirSeq) as an advanced "no amplification" method, and Illumina TruSeq RNA Access as a "targeted" enrichment method. The measured error frequencies indicate that RNA Access offers the best tradeoff between sensitivity and sample preparation error (1.4-5) of all compared methods.

Paternity testing in case of brother-sister incest.

PubMed

Macan, Marijana; Uvodić, Petra; Botica, Vladimir

2003-06-01

We performed a paternity test in a case of incest between brother and sister. DNA from blood samples of the alleged parents and their two children was obtained with Chelex DNA extraction method and quantified with Applied Biosystems QuantiBlot quantitation kit. Polymerase chain reaction (PCR) amplification of DNA samples was performed with AmpFlSTR SGM Plus PCR amplification kit and GenePrint PowerPlex PCR amplification kit. The amplified products were separated and detected by using the Perkin Elmer's ABI PRISM trade mark 310 Genetic Analyser. DNA and data analysis of 17 loci and Amelogenin confirmed the suspicion of brother-sister incest. Since both children had inherited all of the obligate alleles from the alleged father, we could confirm with certainty of 99.999999% that the oldest brother in the family was the biological father of both children. Calculated data showed that even in a case of brother-sister incest, paternity could be proved by the analysis of Amelogenin and 17 DNA loci.

Amplified DNAs in laboratory stocks of Leishmania tarentolae: extrachromosomal circles structurally and functionally similar to the inverted-H-region amplification of methotrexate-resistant Leishmania major

DOE Office of Scientific and Technical Information (OSTI.GOV)

Petrillo-Peixoto, M.L.; Beverley, S.M.

1988-12-01

We describe the structure of amplified DNA that was discovered in two laboratory stocks of the protozoan parasite Leishmania tarentolae. Restriction mapping and molecular cloning revealed that a region of 42 kilobases was amplified 8- to 30-fold in these lines. Southern blot analyses of digested DNAs or chromosomes separated by pulsed-field electrophoresis showed that the amplified DNA corresponded to the H region, a locus defined originally by its amplification in methotrexate-resistant Leishmania major. Similarities between the amplified DNA of the two species included (i) extensive cross-hybridization; (ii) approximate conservation of sequence order; (iii) extrachromosomal localization; (iv) an overall inverted, head-to-headmore » configuration as a circular 140-kilobase tetrameric molecule; (v) two regions of DNA sequence rearrangement, each of which was closely associated with the two centers of the inverted repeats; (vi) association with methotrexate resistance; and (vii) phenotypically conservative amplification, in which the wild-type chromosomal arrangement was retained without apparent modification. Our data showed that amplified DNA mediating drug resistance arose in unselected L. tarentolae, although the pressures leading to apparently spontaneous amplification and maintenance of the H region are not known. The simple structure and limited extent of DNA amplified in these and other Leishmania lines suggests that the study of gene amplification in Leishmania spp. offers an attractive model system for the study of amplification in cultured mammalian cells and tumors. We also introduced a method for measuring the size of large circular DNAs, using gamma-irradiation to introduce limited double-strand breaks followed by sizing of the linear DNAs by pulsed-field electrophoresis.« less

Droplet digital polymerase chain reaction (PCR) outperforms real-time PCR in the detection of environmental DNA from an invasive fish species.

PubMed

Doi, Hideyuki; Takahara, Teruhiko; Minamoto, Toshifumi; Matsuhashi, Saeko; Uchii, Kimiko; Yamanaka, Hiroki

2015-05-05

Environmental DNA (eDNA) has been used to investigate species distributions in aquatic ecosystems. Most of these studies use real-time polymerase chain reaction (PCR) to detect eDNA in water; however, PCR amplification is often inhibited by the presence of organic and inorganic matter. In droplet digital PCR (ddPCR), the sample is partitioned into thousands of nanoliter droplets, and PCR inhibition may be reduced by the detection of the end-point of PCR amplification in each droplet, independent of the amplification efficiency. In addition, real-time PCR reagents can affect PCR amplification and consequently alter detection rates. We compared the effectiveness of ddPCR and real-time PCR using two different PCR reagents for the detection of the eDNA from invasive bluegill sunfish, Lepomis macrochirus, in ponds. We found that ddPCR had higher detection rates of bluegill eDNA in pond water than real-time PCR with either of the PCR reagents, especially at low DNA concentrations. Limits of DNA detection, which were tested by spiking the bluegill DNA to DNA extracts from the ponds containing natural inhibitors, found that ddPCR had higher detection rate than real-time PCR. Our results suggest that ddPCR is more resistant to the presence of PCR inhibitors in field samples than real-time PCR. Thus, ddPCR outperforms real-time PCR methods for detecting eDNA to document species distributions in natural habitats, especially in habitats with high concentrations of PCR inhibitors.

Direct PCR amplification of DNA from human bloodstains, saliva, and touch samples collected with microFLOQ® swabs.

PubMed

Ambers, Angie; Wiley, Rachel; Novroski, Nicole; Budowle, Bruce

2018-01-01

Previous studies have shown that nylon flocked swabs outperform traditional fiber swabs in DNA recovery due to their innovative design and lack of internal absorbent core to entrap cellular materials. The microFLOQ ® Direct swab, a miniaturized version of the 4N6 FLOQSwab ® , has a small swab head that is treated with a lysing agent which allows for direct amplification and DNA profiling from sample collection to final result in less than two hours. Additionally, the microFLOQ ® system subsamples only a minute portion of a stain and preserves the vast majority of the sample for subsequent testing or re-analysis, if desired. The efficacy of direct amplification of DNA from dilute bloodstains, saliva stains, and touch samples was evaluated using microFLOQ ® Direct swabs and the GlobalFiler™ Express system. Comparisons were made to traditional methods to assess the robustness of this alternate workflow. Controlled studies with 1:19 and 1:99 dilutions of bloodstains and saliva stains consistently yielded higher STR peak heights than standard methods with 1ng input DNA from the same samples. Touch samples from common items yielded single source and mixed profiles that were consistent with primary users of the objects. With this novel methodology/workflow, no sample loss occurs and therefore more template DNA is available during amplification. This approach may have important implications for analysis of low quantity and/or degraded samples that plague forensic casework. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

The influence of diet on faecal DNA amplification and sex identification in brown bears (Ursus arctos)

USGS Publications Warehouse

Murphy, M.A.; Waits, L.P.; Kendall, K.C.

2003-01-01

To evaluate the influence of diet on faecal DNA amplification, 11 captive brown bears (Ursus arctos) were placed on six restricted diets: grass (Trifolium spp., Haplopappus hirtus and Poa pratensis), alfalfa (Lupinus spp.), carrots (Daucus spp.), white-tailed deer (Odocoileus virginianus), blueberries (Vaccinium spp.) and salmon (Salmo spp.). DNA was extracted from 50 faecal samples of each restricted diet, and amplification of brown bear DNA was attempted for a mitochondrial DNA (mtDNA) locus and nuclear DNA (nDNA) locus. For mtDNA, no significant differences were observed in amplification success rates across diets. For nDNA, amplification success rates for salmon diet extracts were significantly lower than all other diet extracts (P < 0.001). To evaluate the accuracy of faecal DNA sex identification when female carnivores consume male mammalian prey, female bears were fed male white-tailed deer. Four of 10 extracts amplified, and all extracts were incorrectly scored as male due to amplification of X and Y-chromosome fragments. The potential biases highlighted in this study have broad implications for researchers using faecal DNA for individual and sex identification, and should be evaluated in other species.

Amplification of bovine papillomavirus DNA by N-methyl-N'-nitro-N-nitrosoguanidine, ultraviolet irradiation, or infection with herpes simplex virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schmitt, J.; Schlehofer, J.R.; Mergener, K.

1989-09-01

Treatment with N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) or irradiation with ultraviolet light (uv254 nm) induces amplification of integrated as well as episomal sequences of bovine papillomavirus (BPV) type 1 DNA in BPV-1-transformed mouse C127 cells (i.e., ID13 cells). This is shown by filter in situ hybridization and Southern blot analysis of cellular DNA. Similarly, infection of ID13 cells with herpes simplex virus (HSV) type 1 which has been shown to be mutagenic for host cell DNA leads to amplification of BPV DNA sequences. In contrast to this induction of DNA amplification by initiators, treatment of ID13 cells with the tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA)more » does not result in increased synthesis of BPV DNA nor does TPA treatment modulate the initiator-induced DNA amplification. Similar to other cell systems infection with adeno-associated virus (AAV) type 2 inhibits BPV-1 DNA amplification irrespective of the inducing agent. In contrast to initiator-induced DNA amplification, treatment with carcinogen (MNNG) or tumor promoters or combination of MNNG and promoter of C127 cells prior to transformation by BPV-1 does not lead to an increase in the number of transformed foci. The induction of amplification of papillomavirus DNA by initiating agents possibly represents one of the mechanisms by which the observed synergism between papillomavirus infection and initiators in tumorigenesis might occur.« less

Loop-mediated isothermal amplification (LAMP) assay-A rapid detection tool for identifying red fox (Vulpes vulpes) DNA in the carcasses of harbour porpoises (Phocoena phocoena).

PubMed

Heers, Teresa; van Neer, Abbo; Becker, André; Grilo, Miguel Luca; Siebert, Ursula; Abdulmawjood, Amir

2017-01-01

Carcasses of wild animals are often visited by different scavengers. However, determining which scavenger caused certain types of bite marks is particularly difficult and knowledge thereof is lacking. Therefore, a loop-mediated isothermal amplification (LAMP) assay (target sequence cytochrome b) was developed to detect red fox DNA in carcasses of harbour porpoises. The MSwab™ method for direct testing without prior DNA isolation was validated. As a detection device, the portable real-time fluorometer Genie® II was used, which yields rapid results and can be used in field studies without huge laboratory equipment. In addition to in vitro evaluation and validation, a stranded and scavenged harbour porpoise carcass was successfully examined for red fox DNA residues. The developed LAMP method is a valuable diagnostic tool for confirming presumable red fox bite wounds in harbour porpoises without further DNA isolation steps.

A novel method of genomic DNA extraction for Cactaceae1

PubMed Central

Fehlberg, Shannon D.; Allen, Jessica M.; Church, Kathleen

2013-01-01

• Premise of the study: Genetic studies of Cactaceae can at times be impeded by difficult sampling logistics and/or high mucilage content in tissues. Simplifying sampling and DNA isolation through the use of cactus spines has not previously been investigated. • Methods and Results: Several protocols for extracting DNA from spines were tested and modified to maximize yield, amplification, and sequencing. Sampling of and extraction from spines resulted in a simplified protocol overall and complete avoidance of mucilage as compared to typical tissue extractions. Sequences from one nuclear and three plastid regions were obtained across eight genera and 20 species of cacti using DNA extracted from spines. • Conclusions: Genomic DNA useful for amplification and sequencing can be obtained from cactus spines. The protocols described here are valuable for any cactus species, but are particularly useful for investigators interested in sampling living collections, extensive field sampling, and/or conservation genetic studies. PMID:25202521

Something from (almost) nothing: the impact of multiple displacement amplification on microbial ecology.

PubMed

Binga, Erik K; Lasken, Roger S; Neufeld, Josh D

2008-03-01

Microbial ecology is a field that applies molecular techniques to analyze genes and communities associated with a plethora of unique environments on this planet. In the past, low biomass and the predominance of a few abundant community members have impeded the application of techniques such as PCR, microarray analysis and metagenomics to complex microbial populations. In the absence of suitable cultivation methods, it was not possible to obtain DNA samples from individual microorganisms. Recently, a method called multiple displacement amplification (MDA) has been used to circumvent these limitations by amplifying DNA from microbial communities in low-biomass environments, individual cells from uncultivated microbial species and active organisms obtained through stable isotope probing incubations. This review describes the development and applications of MDA, discusses its strengths and limitations and highlights the impact of MDA on the field of microbial ecology. Whole genome amplification via MDA has increased access to the genomic DNA of uncultivated microorganisms and low-biomass environments and represents a 'power tool' in the molecular toolbox of microbial ecologists.

DNA extraction and amplification from contemporary Polynesian bark-cloth.

PubMed

Moncada, Ximena; Payacán, Claudia; Arriaza, Francisco; Lobos, Sergio; Seelenfreund, Daniela; Seelenfreund, Andrea

2013-01-01

Paper mulberry has been used for thousands of years in Asia and Oceania for making paper and bark-cloth, respectively. Museums around the world hold valuable collections of Polynesian bark-cloth. Genetic analysis of the plant fibers from which the textiles were made may answer a number of questions of interest related to provenance, authenticity or species used in the manufacture of these textiles. Recovery of nucleic acids from paper mulberry bark-cloth has not been reported before. We describe a simple method for the extraction of PCR-amplifiable DNA from small samples of contemporary Polynesian bark-cloth (tapa) using two types of nuclear markers. We report the amplification of about 300 bp sequences of the ITS1 region and of a microsatellite marker. Sufficient DNA was retrieved from all bark-cloth samples to permit successful PCR amplification. This method shows a means of obtaining useful genetic information from modern bark-cloth samples and opens perspectives for the analyses of small fragments derived from ethnographic materials.

DNA Extraction and Amplification from Contemporary Polynesian Bark-Cloth

PubMed Central

Moncada, Ximena; Payacán, Claudia; Arriaza, Francisco; Lobos, Sergio; Seelenfreund, Daniela; Seelenfreund, Andrea

2013-01-01

Background Paper mulberry has been used for thousands of years in Asia and Oceania for making paper and bark-cloth, respectively. Museums around the world hold valuable collections of Polynesian bark-cloth. Genetic analysis of the plant fibers from which the textiles were made may answer a number of questions of interest related to provenance, authenticity or species used in the manufacture of these textiles. Recovery of nucleic acids from paper mulberry bark-cloth has not been reported before. Methodology We describe a simple method for the extraction of PCR-amplifiable DNA from small samples of contemporary Polynesian bark-cloth (tapa) using two types of nuclear markers. We report the amplification of about 300 bp sequences of the ITS1 region and of a microsatellite marker. Conclusions Sufficient DNA was retrieved from all bark-cloth samples to permit successful PCR amplification. This method shows a means of obtaining useful genetic information from modern bark-cloth samples and opens perspectives for the analyses of small fragments derived from ethnographic materials. PMID:23437166

Optimization and evaluation of single-cell whole-genome multiple displacement amplification.

PubMed

Spits, C; Le Caignec, C; De Rycke, M; Van Haute, L; Van Steirteghem, A; Liebaers, I; Sermon, K

2006-05-01

The scarcity of genomic DNA can be a limiting factor in some fields of genetic research. One of the methods developed to overcome this difficulty is whole genome amplification (WGA). Recently, multiple displacement amplification (MDA) has proved very efficient in the WGA of small DNA samples and pools of cells, the reaction being catalyzed by the phi29 or the Bst DNA polymerases. The aim of the present study was to develop a reliable, efficient, and fast protocol for MDA at the single-cell level. We first compared the efficiency of phi29 and Bst polymerases on DNA samples and single cells. The phi29 polymerase generated accurately, in a short time and from a single cell, sufficient DNA for a large set of tests, whereas the Bst enzyme showed a low efficiency and a high error rate. A single-cell protocol was optimized using the phi29 polymerase and was evaluated on 60 single cells; the DNA obtained DNA was assessed by 22 locus-specific PCRs. This new protocol can be useful for many applications involving minute quantities of starting material, such as forensic DNA analysis, prenatal and preimplantation genetic diagnosis, or cancer research. (c) 2006 Wiley-Liss, Inc.

Highly sensitive DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization

PubMed Central

Yu, Xu; Zhang, Zhi-Ling; Zheng, Si-Yang

2014-01-01

A novel highly sensitive colorimetric assay for DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization was established. The DNA modified superparamagnetic beads were demonstrated to capture and enrich the target DNA in the hybridization buffer or human plasma. The hybridization chain reaction and enzyme-induced silver metallization on the gold nanoparticles were used as cascade signal amplification for the detection of target DNA. The metalization of silver on the gold nanoparticles induced a significant colour change from red to yellow until black depending on the concentration of the target DNA, which could be recognized by naked eyes. This method showed a good specificity for the target DNA detection, with the capabilty to discriminate single-base-pair mismatched DNA mutation (single nucleotide polymorphism). Meanwhile, this approach exhibited an excellent anti-interference capability with the convenience of the magentic seperation and washing, which enabled its usage in complex biological systems such as human blood plasma. As an added benefit, the utilization of hybridization chain reaction and enzyme-induced metallization improved detection sensitivity down to 10 pM, which is about 100-fold lower than that of traditional unamplified homogeneous assays. PMID:25500528

Helicase-dependent amplification of nucleic acids.

PubMed

Cao, Yun; Kim, Hyun-Jin; Li, Ying; Kong, Huimin; Lemieux, Bertrand

2013-10-11

Helicase-dependent amplification (HDA) is a novel method for the isothermal in vitro amplification of nucleic acids. The HDA reaction selectively amplifies a target sequence by extension of two oligonucleotide primers. Unlike the polymerase chain reaction (PCR), HDA uses a helicase enzyme to separate the deoxyribonucleic acid (DNA) strands, rather than heat denaturation. This allows DNA amplification without the need for thermal cycling. The helicase used in HDA is a helicase super family II protein obtained from a thermophilic organism, Thermoanaerobacter tengcongensis (TteUvrD). This thermostable helicase is capable of unwinding blunt-end nucleic acid substrates at elevated temperatures (60° to 65°C). The HDA reaction can also be coupled with reverse transcription for ribonucleic acid (RNA) amplification. The products of this reaction can be detected during the reaction using fluorescent probes when incubations are conducted in a fluorimeter. Alternatively, products can be detected after amplification using a disposable amplicon containment device that contains an embedded lateral flow strip. Copyright © 2013 John Wiley & Sons, Inc.

Highly sensitive detection of DNA methylation levels by using a quantum dot-based FRET method

NASA Astrophysics Data System (ADS)

Ma, Yunfei; Zhang, Honglian; Liu, Fangming; Wu, Zhenhua; Lu, Shaohua; Jin, Qinghui; Zhao, Jianlong; Zhong, Xinhua; Mao, Hongju

2015-10-01

DNA methylation is the most frequently studied epigenetic modification that is strongly involved in genomic stability and cellular plasticity. Aberrant changes in DNA methylation status are ubiquitous in human cancer and the detection of these changes can be informative for cancer diagnosis. Herein, we reported a facile quantum dot-based (QD-based) fluorescence resonance energy transfer (FRET) technique for the detection of DNA methylation. The method relies on methylation-sensitive restriction enzymes for the differential digestion of genomic DNA based on its methylation status. Digested DNA is then subjected to PCR amplification for the incorporation of Alexa Fluor-647 (A647) fluorophores. DNA methylation levels can be detected qualitatively through gel analysis and quantitatively by the signal amplification from QDs to A647 during FRET. Furthermore, the methylation levels of three tumor suppressor genes, PCDHGB6, HOXA9 and RASSF1A, in 20 lung adenocarcinoma and 20 corresponding adjacent nontumorous tissue (NT) samples were measured to verify the feasibility of the QD-based FRET method and a high sensitivity for cancer detection (up to 90%) was achieved. Our QD-based FRET method is a convenient, continuous and high-throughput method, and is expected to be an alternative for detecting DNA methylation as a biomarker for certain human cancers.DNA methylation is the most frequently studied epigenetic modification that is strongly involved in genomic stability and cellular plasticity. Aberrant changes in DNA methylation status are ubiquitous in human cancer and the detection of these changes can be informative for cancer diagnosis. Herein, we reported a facile quantum dot-based (QD-based) fluorescence resonance energy transfer (FRET) technique for the detection of DNA methylation. The method relies on methylation-sensitive restriction enzymes for the differential digestion of genomic DNA based on its methylation status. Digested DNA is then subjected to PCR amplification for the incorporation of Alexa Fluor-647 (A647) fluorophores. DNA methylation levels can be detected qualitatively through gel analysis and quantitatively by the signal amplification from QDs to A647 during FRET. Furthermore, the methylation levels of three tumor suppressor genes, PCDHGB6, HOXA9 and RASSF1A, in 20 lung adenocarcinoma and 20 corresponding adjacent nontumorous tissue (NT) samples were measured to verify the feasibility of the QD-based FRET method and a high sensitivity for cancer detection (up to 90%) was achieved. Our QD-based FRET method is a convenient, continuous and high-throughput method, and is expected to be an alternative for detecting DNA methylation as a biomarker for certain human cancers. Electronic supplementary information (ESI) available: Synthesis of CdSe/CdS/ZnS core/shell/shell QDs. Sequences of primers used for amplifying the promoter regions in bisulfate-modified DNA. Comparison of detected methylation levels in different gene promoters using the QD-based FRET method versus bisulfite pyrosequencing. Methylation levels of the RASSF1A gene in one pair of NT and cancer samples as indicated by pyrosequencing. Theoretical calculation of the Förster distance R0. See DOI: 10.1039/c5nr04956c

"Signal-on" photoelectrochemical biosensor for sensitive detection of human T-Cell lymphotropic virus type II DNA: dual signal amplification strategy integrating enzymatic amplification with terminal deoxynucleotidyl transferase-mediated extension.

PubMed

Shen, Qingming; Han, Li; Fan, Gaochao; Zhang, Jian-Rong; Jiang, Liping; Zhu, Jun-Jie

2015-01-01

A novel "signal-on" photoelectrochemical (PEC) biosensor for sensitive detection of human T-cell lymphotropic virus type II (HTLV-II) DNA was developed on the basis of enzymatic amplification coupled with terminal deoxynucleotidyl transferase (TdT)-mediated extension strategy. The intensity of the photocurrent signal was proportional to the concentration of the HTLV-II DNA-target DNA (tDNA) by dual signal amplification. In this protocol, GR-CdS:Mn/ZnS nanocomposites were used as photoelectric conversion material, while pDNA was used as the tDNA recognizing unit. Moreover, the TdT-mediated extension and the enzymatic signal amplification technique were used to enhance the sensitivity of detection. Using this novel dual signal amplification strategy, the prototype of PEC DNA sensor can detect as low as ∼0.033 fM of HTLV-II DNA with a linear range of 0.1-5000 fM, with excellent differentiation ability even for single-base mismatches. This PEC DNA assay opens a promising platform to detect various DNA targets at ultralow levels for early diagnoses of different diseases.

Detection of viral infection and gene expression in clinical tissue specimens using branched DNA (bDNA) in situ hybridization.

PubMed

Kenny, Daryn; Shen, Lu-Ping; Kolberg, Janice A

2002-09-01

In situ hybridization (ISH) methods for detection of nucleic acid sequences have proved especially powerful for revealing genetic markers and gene expression in a morphological context. Although target and signal amplification technologies have enabled researchers to detect relatively low-abundance molecules in cell extracts, the sensitive detection of nucleic acid sequences in tissue specimens has proved more challenging. We recently reported the development of a branched DNA (bDNA) ISH method for detection of DNA and mRNA in whole cells. Based on bDNA signal amplification technology, bDNA ISH is highly sensitive and can detect one or two copies of DNA per cell. In this study we evaluated bDNA ISH for detection of nucleic acid sequences in tissue specimens. Using normal and human papillomavirus (HPV)-infected cervical biopsy specimens, we explored the cell type-specific distribution of HPV DNA and mRNA by bDNA ISH. We found that bDNA ISH allowed rapid, sensitive detection of nucleic acids with high specificity while preserving tissue morphology. As an adjunct to conventional histopathology, bDNA ISH may improve diagnostic accuracy and prognosis for viral and neoplastic diseases.

Sensitive SERS detection of DNA methyltransferase by target triggering primer generation-based multiple signal amplification strategy.

PubMed

Li, Ying; Yu, Chuanfeng; Han, Huixia; Zhao, Caisheng; Zhang, Xiaoru

2016-07-15

A novel and sensitive surface-enhanced Raman scattering (SERS) method is proposed for the assay of DNA methyltransferase (MTase) activity and evaluation of inhibitors by developing a target triggering primer generation-based multiple signal amplification strategy. By using of a duplex substrate for Dam MTase, two hairpin templates and a Raman probe, multiple signal amplification mode is achieved. Once recognized by Dam MTase, the duplex substrate can be cleaved by Dpn I endonuclease and two primers are released for triggering the multiple signal amplification reaction. Consequently, a wide dynamic range and remarkably high sensitivity are obtained under isothermal conditions. The detection limit is 2.57×10(-4)UmL(-1). This assay exhibits an excellent selectivity and is successfully applied in the screening of inhibitors for Dam MTase. In addition, this novel sensing system is potentially universal as the recognition element can be conveniently designed for other target analytes by changing the substrate of DNA MTase. Copyright © 2016 Elsevier B.V. All rights reserved.

DNA recovery from soils of diverse composition.

PubMed

Zhou, J; Bruns, M A; Tiedje, J M

1996-02-01

A simple, rapid method for bacterial lysis and direct extraction of DNA from soils with minimal shearing was developed to address the risk of chimera formation from small template DNA during subsequent PCR. The method was based on lysis with a high-salt extraction buffer (1.5 M NaCl) and extended heating (2 to 3 h) of the soil suspension in the presence of sodium dodecyl sulfate (SDS), hexadecyltrimethylammonium bromide, and proteinase K. The extraction method required 6 h and was tested on eight soils differing in organic carbon, clay content, and pH, including ones from which DNA extraction is difficult. The DNA fragment size in crude extracts from all soils was > 23 kb. Preliminary trials indicated that DNA recovery from two soils seeded with gram-negative bacteria was 92 to 99%. When the method was tested on all eight unseeded soils, microscopic examination of indigenous bacteria in soil pellets before and after extraction showed variable cell lysis efficiency (26 to 92%). Crude DNA yields from the eight soils ranged from 2.5 to 26.9 micrograms of DNA g-1, and these were positively correlated with the organic carbon content in the soil (r = 0.73). DNA yields from gram-positive bacteria from pure cultures were two to six times higher when the high-salt-SDS-heat method was combined with mortar-and-pestle grinding and freeze-thawing, and most DNA recovered was of high molecular weight. Four methods for purifying crude DNA were also evaluated for percent recovery, fragment size, speed, enzyme restriction, PCR amplification, and DNA-DNA hybridization. In general, all methods produced DNA pure enough for PCR amplification. Since soil type and microbial community characteristics will influence DNA recovery, this study provides guidance for choosing appropriate extraction and purification methods on the basis of experimental goals.

A Simple Method for Amplifying RNA Targets (SMART)

PubMed Central

McCalla, Stephanie E.; Ong, Carmichael; Sarma, Aartik; Opal, Steven M.; Artenstein, Andrew W.; Tripathi, Anubhav

2012-01-01

We present a novel and simple method for amplifying RNA targets (named by its acronym, SMART), and for detection, using engineered amplification probes that overcome existing limitations of current RNA-based technologies. This system amplifies and detects optimal engineered ssDNA probes that hybridize to target RNA. The amplifiable probe-target RNA complex is captured on magnetic beads using a sequence-specific capture probe and is separated from unbound probe using a novel microfluidic technique. Hybridization sequences are not constrained as they are in conventional target-amplification reactions such as nucleic acid sequence amplification (NASBA). Our engineered ssDNA probe was amplified both off-chip and in a microchip reservoir at the end of the separation microchannel using isothermal NASBA. Optimal solution conditions for ssDNA amplification were investigated. Although KCl and MgCl2 are typically found in NASBA reactions, replacing 70 mmol/L of the 82 mmol/L total chloride ions with acetate resulted in optimal reaction conditions, particularly for low but clinically relevant probe concentrations (≤100 fmol/L). With the optimal probe design and solution conditions, we also successfully removed the initial heating step of NASBA, thus achieving a true isothermal reaction. The SMART assay using a synthetic model influenza DNA target sequence served as a fundamental demonstration of the efficacy of the capture and microfluidic separation system, thus bridging our system to a clinically relevant detection problem. PMID:22691910

Direct LAMP Assay without Prior DNA Purification for Sex Determination of Papaya.

PubMed

Tsai, Chi-Chu; Shih, Huei-Chuan; Ko, Ya-Zhu; Wang, Ren-Huang; Li, Shu-Ju; Chiang, Yu-Chung

2016-09-24

Papaya (Carica papaya L.) is an economically important tropical fruit tree with hermaphrodite, male and female sex types. Hermaphroditic plants are the major type used for papaya production because their fruits have more commercial advantages than those of female plants. Sex determination of the seedlings, or during the early growth stages, is very important for the papaya seedling industry. Thus far, the only method for determining the sex type of a papaya at the seedling stage has been DNA analysis. In this study, a molecular technique-based on DNA analysis-was developed for detecting male-hermaphrodite-specific markers to examine the papaya's sex type. This method is based on the loop-mediated isothermal amplification (LAMP) and does not require prior DNA purification. The results show that the method is an easy, efficient, and inexpensive way to determine a papaya's sex. This is the first report on the LAMP assay, using intact plant materials-without DNA purification-as samples for the analysis of sex determination of papaya. We found that using high-efficiency DNA polymerase was essential for successful DNA amplification, using trace intact plant material as a template DNA source.

Direct LAMP Assay without Prior DNA Purification for Sex Determination of Papaya

PubMed Central

Tsai, Chi-Chu; Shih, Huei-Chuan; Ko, Ya-Zhu; Wang, Ren-Huang; Li, Shu-Ju; Chiang, Yu-Chung

2016-01-01

Papaya (Carica papaya L.) is an economically important tropical fruit tree with hermaphrodite, male and female sex types. Hermaphroditic plants are the major type used for papaya production because their fruits have more commercial advantages than those of female plants. Sex determination of the seedlings, or during the early growth stages, is very important for the papaya seedling industry. Thus far, the only method for determining the sex type of a papaya at the seedling stage has been DNA analysis. In this study, a molecular technique—based on DNA analysis—was developed for detecting male-hermaphrodite-specific markers to examine the papaya’s sex type. This method is based on the loop-mediated isothermal amplification (LAMP) and does not require prior DNA purification. The results show that the method is an easy, efficient, and inexpensive way to determine a papaya’s sex. This is the first report on the LAMP assay, using intact plant materials-without DNA purification-as samples for the analysis of sex determination of papaya. We found that using high-efficiency DNA polymerase was essential for successful DNA amplification, using trace intact plant material as a template DNA source. PMID:27669237

Development and evaluation of an in-house single step loop-mediated isothermal amplification (SS-LAMP) assay for the detection of Mycobacterium tuberculosis complex in sputum samples from Moroccan patients.

PubMed

Bentaleb, El Mehdi; Abid, Mohammed; El Messaoudi, My Driss; Lakssir, Brahim; Ressami, El Mostafa; Amzazi, Saaïd; Sefrioui, Hassan; Ait Benhassou, Hassan

2016-09-27

Tuberculosis (TB) is a major global health problem and remains the leading cause of morbidity and mortality in developing countries. Routinely used TB diagnostic methods, in most endemic areas, are time-consuming, often less-sensitive, expensive and inaccessible to most patients. Therefore, there is an urgent need for the development of early, easy to use and effective diagnosis tools of TB, which can be effectively integrated into resource limited settings, to anticipate the early treatment and limit further spread of the disease. Over the last decade, Loop-mediated isothermal amplification (LAMP) assays have become a powerful tool for rapid diagnosis of infectious diseases because of the simplicity of device requirements. Indeed, LAMP is a simple, quick and cost effective Isothermal Nucleic Acid Amplification diagnostic test (INAAT) that has the potential to be used in TB endemic settings of resource-poor countries. In the present study, we have developed a simple and rapid TB molecular diagnostic test using a Single-Step Loop-mediated isothermal DNA amplification (SS-LAMP) method for the detection of Mycobacterium tuberculosis complex (MTBC) strains, with a simplified sample preparation procedure, eliminating DNA extraction prior to LAMP amplification, DNA initial denaturation and enzymatic inactivation steps during the amplification process. To perform our in-house SS-LAMP assay, a set of six specific primers was specifically designed to recognize eight distinct regions on the MTBC species-specific repetitive insertion sequence 6110 (IS6110). The amplification of the targeted DNA was carried out under isothermal conditions at 65 °C within 1 h. Our protocol was firstly optimized using 60 of confirmed MTBC isolates and a recombinant pGEMeasy-IS6110 vector for sensitivity testing. Thereafter, the assay was evaluated on liquefied sputum specimens collected from 157 Moroccan patients suspected of having TB. Our SS-LAMP developed assay was able to detect MTBC DNA directly from liquefied sputum samples without any prior DNA extraction, denaturation nor the final enzymatic inactivation step. When compared to routinely used Löwenstein Jensen (LJ) Culture method, our SS-LAMP assay is rapid and showed specificity and sensitivity of 99.14 % and 82.93 % respectively which are within the international standards. In addition, the limit of detection of our assay was found to be as little as 10 copies of bacterial DNA. To our knowledge, this is the first study using a single step LAMP (SS-LAMP) procedure as a rapid, easy to perform and cost effective testing for TB early detection. This innovative assay could be suitable for low-income countries with restricted health equipment facilities.

A dual amplification strategy for DNA detection combining bio-barcode assay and metal-enhanced fluorescence modality.

PubMed

Zhou, Zhenpeng; Li, Tian; Huang, Hongduan; Chen, Yang; Liu, Feng; Huang, Chengzhi; Li, Na

2014-11-11

Silver-enhanced fluorescence was coupled with a bio-barcode assay to facilitate a dual amplification assay to demonstrate a non-enzymatic approach for simple and sensitive detection of DNA. In the assay design, magnetic nanoparticles seeded with silver nanoparticles were modified with the capture DNA, and silver nanoparticles were modified with the binding of ssDNA and the fluorescently labeled barcode dsDNA. Upon introduction of the target DNA, a sandwich structure was formed because of the hybridization reaction. By simple magnetic separation, silver-enhanced fluorescence of barcode DNAs could be readily measured without the need of a further step to liberate barcode DNAs from silver nanoparticles, endowing the method with simplicity and high sensitivity with a detection limit of 1 pM.

Optimization of PMA-PCR Protocol for Viability Detection of Pathogens

NASA Technical Reports Server (NTRS)

Mikkelson, Brian J.; Lee, Christine M.; Ponce, Adrian

2011-01-01

This presented study demonstrates the need that PMA-PCR can be used to capture the loss of viability of a sample that is much more specific and time-efficient than alternative methods. This protocol is particularly useful in scenarios in which sterilization treatments may inactivate organisms but not degrade their DNA. The use of a PCR-based method of pathogen detection without first inactivating the DNA of nonviable cells will potentially lead to false positives. The loss of culturability, by heat-killing, did not prevent amplified PCR products, which supports the use of PMA to prevent amplification and differentiate between viable and dead cells. PMA was shown to inhibit the amplification of DNA by PCR in vegetative cells that had been heat-killed.

Visual and highly sensitive detection of cancer cells by a colorimetric aptasensor based on cell-triggered cyclic enzymatic signal amplification.

PubMed

Zhang, Xianxia; Xiao, Kunyi; Cheng, Liwei; Chen, Hui; Liu, Baohong; Zhang, Song; Kong, Jilie

2014-06-03

Rapid and efficient detection of cancer cells at their earliest stages is one of the central challenges in cancer diagnostics. We developed a simple, cost-effective, and highly sensitive colorimetric method for visually detecting rare cancer cells based on cell-triggered cyclic enzymatic signal amplification (CTCESA). In the absence of target cells, hairpin aptamer probes (HAPs) and linker DNAs stably coexist in solution, and the linker DNA assembles DNA-AuNPs, producing a purple solution. In the presence of target cells, the specific binding of HAPs to the target cells triggers a conformational switch that results in linker DNA hybridization and cleavage by nicking endonuclease-strand scission cycles. Consequently, the cleaved fragments of linker DNA can no longer assemble into DNA-AuNPs, resulting in a red color. UV-vis spectrometry and photograph analyses demonstrated that this CTCESA-based method exhibited selective and sensitive colorimetric responses to the presence of target CCRF-CEM cells, which could be detected by the naked eye. The linear response for CCRF-CEM cells in a concentration range from 10(2) to 10(4) cells was obtained with a detection limit of 40 cells, which is approximately 20 times lower than the detection limit of normal AuNP-based methods without amplification. Given the high specificity and sensitivity of CTCESA, this colorimetric method provides a sensitive, label-free, and cost-effective approach for early cancer diagnosis and point-to-care applications.

Voltammetric determination of attomolar levels of a sequence derived from the genom of hepatitis B virus by using molecular beacon mediated circular strand displacement and rolling circle amplification.

PubMed

Huang, Shan; Feng, Mengmeng; Li, Jiawen; Liu, Yi; Xiao, Qi

2018-03-03

The authors describe an electrochemical method for the determination of the single-stranded DNA (ssDNA) oligonucleotide with a sequence derived from the genom of hepatitis B virus (HBV). It is making use of circular strand displacement (CSD) and rolling circle amplification (RCA) strategies mediated by a molecular beacon (MB). This ssDNA hybridizes with the loop portion of the MB immobilized on the surface of a gold electrode, while primer DNA also hybridizes with the rest of partial DNA sequences of MB. This triggers the MB-mediated CSD. The RCA is then initiated to produce a long DNA strand with multiple tandem-repeat sequences, and this results in a significant increase of the differential pulse voltammetric response of the electrochemical probe Methylene Blue at a rather low working potential of -0.24 V (vs. Ag/AgCl). Under optimal experimental conditions, the assay displays an ultrahigh sensitivity (with a 2.6 aM detection limit) and excellent selectivity. Response is linear in the 10 to 700 aM DNA concentration range. Graphical abstract Schematic of a voltammetric method for the determination of attomolar levels of target DNA. It is based on molecular beacon mediated circular strand displacement and rolling circle amplification strategies. Under optimal experimental conditions, the assay displays an ultrahigh sensitivity with a 2.6 aM detection limit and excellent selectivity.

Rapid and sensitive detection of Citrus Bacterial Canker by loop-mediated isothermal amplification combined with simple visual evaluation methods

PubMed Central

2010-01-01

Background Citrus Bacterial Canker (CBC) is a major, highly contagious disease of citrus plants present in many countries in Asia, Africa and America, but not in the Mediterranean area. There are three types of Citrus Bacterial Canker, named A, B, and C that have different genotypes and posses variation in host range within citrus species. The causative agent for type A CBC is Xanthomonas citri subsp. citri, while Xanthomonas fuscans subsp. aurantifolii, strain B causes type B CBC and Xanthomonas fuscans subsp. aurantifolii strain C causes CBC type C. The early and accurate identification of those bacteria is essential for the protection of the citrus industry. Detection methods based on bacterial isolation, antibodies or polymerase chain reaction (PCR) have been developed previously; however, these approaches may be time consuming, laborious and, in the case of PCR, it requires expensive laboratory equipment. Loop-mediated isothermal amplification (LAMP), which is a novel isothermal DNA amplification technique, is sensitive, specific, fast and requires no specialized laboratory equipment. Results A loop-mediated isothermal amplification assay for the diagnosis of Citrus Bacterial Canker (CBC-LAMP) was developed and evaluated. DNA samples were obtained from infected plants or cultured bacteria. A typical ladder-like pattern on gel electrophoresis was observed in all positive samples in contrast to the negative controls. In addition, amplification products were detected by visual inspection using SYBRGreen and using a lateral flow dipstick, eliminating the need for gel electrophoresis. The sensitivity and specificity of the assay were evaluated in different conditions and using several sample sources which included purified DNA, bacterium culture and infected plant tissue. The sensitivity of the CBC-LAMP was 10 fg of pure Xcc DNA, 5 CFU in culture samples and 18 CFU in samples of infected plant tissue. No cross reaction was observed with DNA of other phytopathogenic bacteria. The assay was capable of detecting CBC-causing strains from several geographical origins and pathotypes. Conclusions The CBC-LAMP technique is a simple, fast, sensitive and specific method for the diagnosis of Citrus Bacterial Canker. This method can be useful in the phytosanitary programs of the citrus industry worldwide. PMID:20565886

Amplification of chromosomal DNA in situ

DOEpatents

Christian, Allen T.; Coleman, Matthew A.; Tucker, James D.

2002-01-01

Amplification of chromosomal DNA in situ to increase the amount of DNA associated with a chromosome or chromosome region is described. The amplification of chromosomal DNA in situ provides for the synthesis of Fluorescence in situ Hybridization (FISH) painting probes from single dissected chromosome fragments, the production of cDNA libraries from low copy mRNAs and improved in Comparative Genomic Hybridization (CGH) procedures.

Whole genome amplification of DNA extracted from FFPE tissues.

PubMed

Bosso, Mira; Al-Mulla, Fahd

2011-01-01

Whole genome amplification systems were developed to meet the increasing research demands on DNA resources and to avoid DNA shortage. The technology enables amplification of nanogram amounts of DNA into microgram quantities and is increasingly used in the amplification of DNA from multiple origins such as blood, fresh frozen tissue, formalin-fixed paraffin-embedded tissues, saliva, buccal swabs, bacteria, and plant and animal sources. This chapter focuses on the use of GenomePlex(®) tissue Whole Genome Amplification Kit, to amplify DNA directly from archived tissue. In addition, this chapter documents our unique experience with the utilization of GenomePlex(®) amplified DNA using several molecular techniques including metaphase Comparative Genomic Hybridization, array Comparative Genomic Hybridization, and real-time quantitative polymerase chain reaction assays. GenomePlex(®) is a registered trademark of Rubicon Genomics Incorporation.

Indel analysis by droplet digital PCR: a sensitive method for DNA mixture detection and chimerism analysis.

PubMed

Santurtún, Ana; Riancho, José A; Arozamena, Jana; López-Duarte, Mónica; Zarrabeitia, María T

2017-01-01

Several methods have been developed to determinate genetic profiles from a mixed samples and chimerism analysis in transplanted patients. The aim of this study was to explore the effectiveness of using the droplet digital PCR (ddPCR) for mixed chimerism detection (a mixture of genetic profiles resulting after allogeneic hematopoietic stem cell transplantation (HSCT)). We analyzed 25 DNA samples from patients who had undergone HSCT and compared the performance of ddPCR and two established methods for chimerism detection, based upon the Indel and STRs analysis, respectively. Additionally, eight artificial mixture DNA samples were created to evaluate the sensibility of ddPCR. Our results show that the chimerism percentages estimated by the analysis of a single Indel using ddPCR were very similar to those calculated by the amplification of 15 STRs (r 2  = 0.970) and with the results obtained by the amplification of 38 Indels (r 2  = 0.975). Moreover, the amplification of a single Indel by ddPCR was sensitive enough to detect a minor DNA contributor comprising down to 0.5 % of the sample. We conclude that ddPCR can be a powerful tool for the determination of a genetic profile of forensic mixtures and clinical chimerism analysis when traditional techniques are not sensitive enough.

Optimization of whole-transcriptome amplification from low cell density deep-sea microbial samples for metatranscriptomic analysis.

PubMed

Wu, Jieying; Gao, Weimin; Zhang, Weiwen; Meldrum, Deirdre R

2011-01-01

Limitation in sample quality and quantity is one of the big obstacles for applying metatranscriptomic technologies to explore gene expression and functionality of microbial communities in natural environments. In this study, several amplification methods were evaluated for whole-transcriptome amplification of deep-sea microbial samples, which are of low cell density and high impurity. The best amplification method was identified and incorporated into a complete protocol to isolate and amplify deep-sea microbial samples. In the protocol, total RNA was first isolated by a modified method combining Trizol (Invitrogen, CA) and RNeasy (QIAGEN, CA) method, amplified with a WT-Ovation™ Pico RNA Amplification System (NuGEN, CA), and then converted to double-strand DNA from single-strand cDNA with a WT-Ovation™ Exon Module (NuGEN, CA). The products from the whole-transcriptome amplification of deep-sea microbial samples were assessed first through random clone library sequencing. The BLAST search results showed that marine-based sequences are dominant in the libraries, consistent with the ecological source of the samples. The products were then used for next-generation Roche GS FLX Titanium sequencing to obtain metatranscriptome data. Preliminary analysis of the metatranscriptomic data showed good sequencing quality. Although the protocol was designed and demonstrated to be effective for deep-sea microbial samples, it should be applicable to similar samples from other extreme environments in exploring community structure and functionality of microbial communities. Copyright © 2010 Elsevier B.V. All rights reserved.

Loop-mediated isothermal amplification (LAMP) shield for Arduino DNA detection.

PubMed

Velders, Aldrik H; Schoen, Cor; Saggiomo, Vittorio

2018-02-01

Loop-mediated isothermal amplification (LAMP) of DNA is gaining relevance as a method to detect nucleic acids, as it is easier, faster, and more powerful than conventional Polymerase Chain Reaction. However, LAMP is still mostly used in laboratory settings, because of the lack of a cheap and easy, one-button device that can perform LAMP experiments. Here we show how to build and program an Arduino shield for a LAMP and detection of DNA. The here described Arduino Shield is cheap, easy to assemble, to program and use, it is battery operated and the detection of DNA is done by naked-eye so that it can be used in field.

Enhanced DNA Profiling of the Semen Donor in Late Reported Sexual Assaults: Use of Y-Chromosome-Targeted Pre-amplification and Next Generation Y-STR Amplification Systems.

PubMed

Hanson, Erin K; Ballantyne, Jack

2016-01-01

In some cases of sexual assault the victim may not report the assault for several days after the incident due to various factors. The ability to obtain an autosomal STR profile of the semen donor from a living victim rapidly diminishes as the post-coital interval is extended due to the presence of only a small amount of male DNA amidst an overwhelming amount of female DNA. Previously, we have utilized various technological tools to overcome the limitations of male DNA profiling in extended interval post-coital samples including the use of Y-chromosome STR profiling, cervical sample, and post-PCR purification permitting the recovery of Y-STR profiles of the male DNA from samples collected 5-6 days after intercourse. Despite this success, the reproductive biology literature reports the presence of spermatozoa in the human cervix up to 7-10 days post-coitus. Therefore, novel and improved methods for recovery of male profiles in extended interval post-coital samples were required. Here, we describe enhanced strategies, including Y-chromosome-targeted pre-amplification and next generation Y-STR amplification kits, that have resulted in the ability to obtain probative male profiles from samples collected 6-9 days after intercourse.

A Paper and Plastic Device for Performing Recombinase Polymerase Amplification of HIV DNA

PubMed Central

Rohrman, Brittany A.; Richards-Kortum, Rebecca R.

2013-01-01

Despite the importance of early diagnosis and treatment of HIV, only a small fraction of HIV-exposed infants in low- and middle-income countries are tested for the disease. The gold standard for early infant diagnosis, DNA PCR, requires resources that are unavailable in poor settings, and no point-of-care HIV DNA test is currently available. We have developed a device constructed of layers of paper, glass fiber, and plastic that is capable of performing isothermal, enzymatic amplification of HIV DNA. The device is inexpensive, small, light-weight, and easy to assemble. The device stores lyophilized enzymes, facilitates mixing of reaction components, and supports recombinase polymerase amplification in five steps of operation. Using commercially available lateral flow strips as a detection method, we demonstrate the ability of our device to amplify 10 copies of HIV DNA to detectable levels in 15 minutes. Our results suggest that our device, which is designed to be used after DNA extraction from dried-blood spots, may serve in conjunction with lateral flow strips as part of a point-of-care HIV DNA test to be used in low resource settings. PMID:22733333

A paper and plastic device for performing recombinase polymerase amplification of HIV DNA.

PubMed

Rohrman, Brittany A; Richards-Kortum, Rebecca R

2012-09-07

Despite the importance of early diagnosis and treatment of HIV, only a small fraction of HIV-exposed infants in low- and middle-income countries are tested for the disease. The gold standard for early infant diagnosis, DNA PCR, requires resources that are unavailable in poor settings, and no point-of-care HIV DNA test is currently available. We have developed a device constructed of layers of paper, glass fiber, and plastic that is capable of performing isothermal, enzymatic amplification of HIV DNA. The device is inexpensive, small, light-weight, and easy to assemble. The device stores lyophilized enzymes, facilitates mixing of reaction components, and supports recombinase polymerase amplification in five steps of operation. Using commercially available lateral flow strips as a detection method, we demonstrate the ability of our device to amplify 10 copies of HIV DNA to detectable levels in 15 min. Our results suggest that our device, which is designed to be used after DNA extraction from dried-blood spots, may serve in conjunction with lateral flow strips as part of a point-of-care HIV DNA test to be used in low resource settings.

Highly sensitive electrochemical detection of human telomerase activity based on bio-barcode method.

PubMed

Li, Ying; Liu, Bangwei; Li, Xia; Wei, Qingli

2010-07-15

In the present study, an electrochemical method for highly sensitive detection of human telomerase activity was developed based on bio-barcode amplification assay. Telomerase was extracted from HeLa cells, then the extract was mixed with telomerase substrate (TS) primer to perform extension reaction. The extension product was hybridized with the capture DNA immobilized on the Au electrode and then reacted with the signal DNA on Au nanoparticles to form a sandwich hybridization mode. Electrochemical signals were generated by chronocoulometric interrogation of [Ru(NH(3))(6)](3+) that quantitatively binds to the DNA on Au nanoparticles via electrostatic interaction. This method can detect the telomerase activity from as little as 10 cultured cancer cells without the polymerase chain reaction (PCR) amplification of telomerase extension product. Copyright (c) 2010 Elsevier B.V. All rights reserved.

Global DNA methylation analysis using methyl-sensitive amplification polymorphism (MSAP).

PubMed

Yaish, Mahmoud W; Peng, Mingsheng; Rothstein, Steven J

2014-01-01

DNA methylation is a crucial epigenetic process which helps control gene transcription activity in eukaryotes. Information regarding the methylation status of a regulatory sequence of a particular gene provides important knowledge of this transcriptional control. DNA methylation can be detected using several methods, including sodium bisulfite sequencing and restriction digestion using methylation-sensitive endonucleases. Methyl-Sensitive Amplification Polymorphism (MSAP) is a technique used to study the global DNA methylation status of an organism and hence to distinguish between two individuals based on the DNA methylation status determined by the differential digestion pattern. Therefore, this technique is a useful method for DNA methylation mapping and positional cloning of differentially methylated genes. In this technique, genomic DNA is first digested with a methylation-sensitive restriction enzyme such as HpaII, and then the DNA fragments are ligated to adaptors in order to facilitate their amplification. Digestion using a methylation-insensitive isoschizomer of HpaII, MspI is used in a parallel digestion reaction as a loading control in the experiment. Subsequently, these fragments are selectively amplified by fluorescently labeled primers. PCR products from different individuals are compared, and once an interesting polymorphic locus is recognized, the desired DNA fragment can be isolated from a denaturing polyacrylamide gel, sequenced and identified based on DNA sequence similarity to other sequences available in the database. We will use analysis of met1, ddm1, and atmbd9 mutants and wild-type plants treated with a cytidine analogue, 5-azaC, or zebularine to demonstrate how to assess the genetic modulation of DNA methylation in Arabidopsis. It should be noted that despite the fact that MSAP is a reliable technique used to fish for polymorphic methylated loci, its power is limited to the restriction recognition sites of the enzymes used in the genomic DNA digestion.

Unknown sequence amplification: Application to in vitro genome walking in Chlamydia trachomatis L2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Copley, C.G.; Boot, C.; Bundell, K.

1991-01-01

A recently described technique, Chemical Genetics' unknown sequence amplification method, which requires only one specific oligonucleotide, has broadened the applicability of the polymerase chain reaction to DNA of unknown sequence. The authors have adapted this technique to the study of the genome of Chlamydia trachomatis, an obligate intracellular bacterium, and describe modifications that significantly improve the utility of this approach. These techniques allow for rapid genomic analysis entirely in vitro, using DNA of limited quantity of purity.

Enzyme-free and label-free ultra-sensitive colorimetric detection of Pb(2+) using molecular beacon and DNAzyme based amplification strategy.

PubMed

Yun, Wen; Cai, Dingzhou; Jiang, JiaoLai; Zhao, Pengxiang; Huang, Yu; Sang, Ge

2016-06-15

An enzyme-free and label-free colorimetric Pb(2+) sensor based on DNAzyme and molecular beacon (MB) has been developed and demonstrated by recycle using enzyme strand for signal amplification. The substrate strand DNA (S-DNA) of DNAzyme could be converted into MB structure with base pairs of stem part at the both ends. The MB could hybridize with enzyme strand DNA (E-DNA) to form DNAzyme, and be activated and cleaved in the presence of Pb(2+). The cleaved MB is much less stable, releasing from the DNAzyme as two product pieces. The product pieces of MB are flexible and could bind to unmodified AuNPs to effectively stabilize them against salt-induced aggregation. Then, the E-DNA is liberated to catalyze the next reaction and amplify the response signal. By taking advantage of repeated using of E-DNA, our proposed method exhibited high sensitive for Pb(2+) detection in a linear range from 0.05 to 5 nM with detection limit of 20 pM by UV-vis spectrometer. Moreover, this method was also used for determination of Pb(2+) in river water samples with satisfying results. Importantly, this strategy could reach high sensitivity without any modification and complex enzymatic or hairpins based amplification procedures. Copyright © 2016 Elsevier B.V. All rights reserved.

Research Advances

ERIC Educational Resources Information Center

King, Angela G.

2004-01-01

Nanotechnology are employed by researchers at Northwestern University to develop a method of labeling disease markers present in blood with unique DNA tags they have dubbed "bio-bar-codes". The preparation of nanoparticle and magnetic microparticle probes and a nanoparticle-based PSR-less DNA amplification scheme are involved by the DNA-BCA assay.

Colorimetric Detection of Ehrlichia Canis via Nucleic Acid Hybridization in Gold Nano-Colloids

PubMed Central

Muangchuen, Ajima; Chaumpluk, Piyasak; Suriyasomboon, Annop; Ekgasit, Sanong

2014-01-01

Canine monocytic ehrlichiosis (CME) is a major thick-bone disease of dog caused by Ehrlichia canis. Detection of this causal agent outside the laboratory using conventional methods is not effective enough. Thus an assay for E. canis detection based on the p30 outer membrane protein gene was developed. It was based on the p30 gene amplification using loop-mediated isothermal DNA amplification (LAMP). The primer set specific to six areas within the target gene were designed and tested for their sensitivity and specificity. Detection of DNA signals was based on modulation of gold nanoparticles' surface properties and performing DNA/DNA hybridization using an oligonucleotide probe. Presence of target DNA affected the gold colloid nanoparticles in terms of particle aggregation with a plasmonic color change of the gold colloids from ruby red to purple, visible by the naked eye. All the assay steps were completed within 90 min including DNA extraction without relying on standard laboratory facilities. This method was very specific to target bacteria. Its sensitivity with probe hybridization was sufficient to detect 50 copies of target DNA. This method should provide an alternative choice for point of care control and management of the disease. PMID:25111239

Colorimetric detection of Ehrlichia canis via nucleic acid hybridization in gold nano-colloids.

PubMed

Muangchuen, Ajima; Chaumpluk, Piyasak; Suriyasomboon, Annop; Ekgasit, Sanong

2014-08-08

Canine monocytic ehrlichiosis (CME) is a major thick-bone disease of dog caused by Ehrlichia canis. Detection of this causal agent outside the laboratory using conventional methods is not effective enough. Thus an assay for E. canis detection based on the p30 outer membrane protein gene was developed. It was based on the p30 gene amplification using loop-mediated isothermal DNA amplification (LAMP). The primer set specific to six areas within the target gene were designed and tested for their sensitivity and specificity. Detection of DNA signals was based on modulation of gold nanoparticles' surface properties and performing DNA/DNA hybridization using an oligonucleotide probe. Presence of target DNA affected the gold colloid nanoparticles in terms of particle aggregation with a plasmonic color change of the gold colloids from ruby red to purple, visible by the naked eye. All the assay steps were completed within 90 min including DNA extraction without relying on standard laboratory facilities. This method was very specific to target bacteria. Its sensitivity with probe hybridization was sufficient to detect 50 copies of target DNA. This method should provide an alternative choice for point of care control and management of the disease.

Agarose droplet microfluidics for highly parallel and efficient single molecule emulsion PCR.

PubMed

Leng, Xuefei; Zhang, Wenhua; Wang, Chunming; Cui, Liang; Yang, Chaoyong James

2010-11-07

An agarose droplet method was developed for highly parallel and efficient single molecule emulsion PCR. The method capitalizes on the unique thermoresponsive sol-gel switching property of agarose for highly efficient DNA amplification and amplicon trapping. Uniform agarose solution droplets generated via a microfluidic chip serve as robust and inert nanolitre PCR reactors for single copy DNA molecule amplification. After PCR, agarose droplets are gelated to form agarose beads, trapping all amplicons in each reactor to maintain the monoclonality of each droplet. This method does not require cocapsulation of primer labeled microbeads, allows high throughput generation of uniform droplets and enables high PCR efficiency, making it a promising platform for many single copy genetic studies.

Rapid and sensitive detection of canine parvovirus type 2 by recombinase polymerase amplification.

PubMed

Wang, Jianchang; Liu, Libing; Li, Ruiwen; Wang, Jinfeng; Fu, Qi; Yuan, Wanzhe

2016-04-01

A novel recombinase polymerase amplification (RPA)-based method for detection of canine parvovirus type 2 (CPV-2) was developed. Sensitivity analysis showed that the detection limit of RPA was 10 copies of CPV-2 genomic DNA. RPA amplified both CPV-2a and -2b DNA but did not amplify the template of other important dog viruses (CCoV, PRV or CDV), demonstrating high specificity. The method was further validated with 57 canine fecal samples. An outstanding advantage of RPA is that it is an isothermal reaction and can be performed in a water bath, making RPA a potential alternative method for CPV-2 detection in resource-limited settings.

RNase H-assisted RNA-primed rolling circle amplification for targeted RNA sequence detection.

PubMed

Takahashi, Hirokazu; Ohkawachi, Masahiko; Horio, Kyohei; Kobori, Toshiro; Aki, Tsunehiro; Matsumura, Yukihiko; Nakashimada, Yutaka; Okamura, Yoshiko

2018-05-17

RNA-primed rolling circle amplification (RPRCA) is a useful laboratory method for RNA detection; however, the detection of RNA is limited by the lack of information on 3'-terminal sequences. We uncovered that conventional RPRCA using pre-circularized probes could potentially detect the internal sequence of target RNA molecules in combination with RNase H. However, the specificity for mRNA detection was low, presumably due to non-specific hybridization of non-target RNA with the circular probe. To overcome this technical problem, we developed a method for detecting a sequence of interest in target RNA molecules via RNase H-assisted RPRCA using padlocked probes. When padlock probes are hybridized to the target RNA molecule, they are converted to the circular form by SplintR ligase. Subsequently, RNase H creates nick sites only in the hybridized RNA sequence, and single-stranded DNA is finally synthesized from the nick site by phi29 DNA polymerase. This method could specifically detect at least 10 fmol of the target RNA molecule without reverse transcription. Moreover, this method detected GFP mRNA present in 10 ng of total RNA isolated from Escherichia coli without background DNA amplification. Therefore, this method can potentially detect almost all types of RNA molecules without reverse transcription and reveal full-length sequence information.

Evaluation of fluorescence in situ hybridization techniques to study long non-coding RNA expression in cultured cells

PubMed Central

Soares, Ricardo J; Maglieri, Giulia; Gutschner, Tony; Lund, Anders H; Nielsen, Boye S

2018-01-01

Abstract Deciphering the functions of long non-coding RNAs (lncRNAs) is facilitated by visualization of their subcellular localization using in situ hybridization (ISH) techniques. We evaluated four different ISH methods for detection of MALAT1 and CYTOR in cultured cells: a multiple probe detection approach with or without enzymatic signal amplification, a branched-DNA (bDNA) probe and an LNA-modified probe with enzymatic signal amplification. All four methods adequately stained MALAT1 in the nucleus in all of three cell lines investigated, HeLa, NHDF and T47D, and three of the methods detected the less expressed CYTOR. The sensitivity of the four ISH methods was evaluated by image analysis. In all three cell lines, the two methods involving enzymatic amplification gave the most intense MALAT1 signal, but the signal-to-background ratios were not different. CYTOR was best detected using the bDNA method. All four ISH methods showed significantly reduced MALAT1 signal in knock-out cells, and siRNA-induced knock-down of CYTOR resulted in significantly reduced CYTOR ISH signal, indicating good specificity of the probe designs and detection systems. Our data suggest that the ISH methods allow detection of both abundant and less abundantly expressed lncRNAs, although the latter required the use of the most specific and sensitive probe detection system. PMID:29059327

Low template STR typing: effect of replicate number and consensus method on genotyping reliability and DNA database search results.

PubMed

Benschop, Corina C G; van der Beek, Cornelis P; Meiland, Hugo C; van Gorp, Ankie G M; Westen, Antoinette A; Sijen, Titia

2011-08-01

To analyze DNA samples with very low DNA concentrations, various methods have been developed that sensitize short tandem repeat (STR) typing. Sensitized DNA typing is accompanied by stochastic amplification effects, such as allele drop-outs and drop-ins. Therefore low template (LT) DNA profiles are interpreted with care. One can either try to infer the genotype by a consensus method that uses alleles confirmed in replicate analyses, or one can use a statistical model to evaluate the strength of the evidence in a direct comparison with a known DNA profile. In this study we focused on the first strategy and we show that the procedure by which the consensus profile is assembled will affect genotyping reliability. In order to gain insight in the roles of replicate number and requested level of reproducibility, we generated six independent amplifications of samples of known donors. The LT methods included both increased cycling and enhanced capillary electrophoresis (CE) injection [1]. Consensus profiles were assembled from two to six of the replications using four methods: composite (include all alleles), n-1 (include alleles detected in all but one replicate), n/2 (include alleles detected in at least half of the replicates) and 2× (include alleles detected twice). We compared the consensus DNA profiles with the DNA profile of the known donor, studied the stochastic amplification effects and examined the effect of the consensus procedure on DNA database search results. From all these analyses we conclude that the accuracy of LT DNA typing and the efficiency of database searching improve when the number of replicates is increased and the consensus method is n/2. The most functional number of replicates within this n/2 method is four (although a replicate number of three suffices for samples showing >25% of the alleles in standard STR typing). This approach was also the optimal strategy for the analysis of 2-person mixtures, although modified search strategies may be needed to retrieve the minor component in database searches. From the database searches follows the recommendation to specifically mark LT DNA profiles when entering them into the DNA database. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

Recombinase Polymerase Amplification Combined with Lateral Flow Strip for Listeria monocytogenes Detection in Food.

PubMed

Du, Xin-Jun; Zang, Yu-Xuan; Liu, Hai-Bin; Li, Ping; Wang, Shuo

2018-04-01

Listeria monocytogenes is an important food-borne pathogenic bacterium that causes human disease, resulting in economic losses worldwide. The current detection methods for L. monocytogenes are not well suited for direct field testing because they involve complicated, time-consuming operations. A simple, efficient method is vital for L. monocytogenes detection. In this study, we combined isothermal recombinase polymerase amplification (RPA) with a lateral flow (LF) strip to rapidly and reliably detect L. monocytogenes. In the presence of biotin- and digoxin-modified primers, RPA produced numerous digoxin- and biotin-attached duplex DNA products. These products were detected on an LF strip via dual immunoreactions (digoxin on the duplex DNA reacted with the anti-digoxin antibody on the gold nanoparticle (Au-NP) and the biotin on the duplex DNA captured by the streptavidin on the LF test zone). The accumulation of Au-NPs produced characteristic bands, enabling the visual detection of L. monocytogenes without instrumentation. This assay could be used to detect L. monocytogenes within 15 min, including DNA amplification with RPA for 10 min at 39 °C and visualization of the amplicons by LF strips for 5 min. Experiments confirmed a detection limit as low as 300 fg of DNA and 1.5 × 10 1 CFU in pure cultures. Furthermore, RPA-LF exhibited no cross-reactions with pathogens. Evaluation of the method with food samples indicated that the detection limit was substantially improved to 1.5 × 10° CFU for the original bacterial content in 25 g/mL samples after enrichment for 6 hr. RPA-LF can be used as a sensitive and rapid detection technique for L. monocytogenes. Recombinase polymerase amplification (RPA) can amplify target DNA at 37 to 42 °C without a thermal cycler. Lateral flow (LF) strips are portable, cheap and easy to operate. RPA combined with LF strips to detect Listeria monocytogenes can be widely used in remote areas. © 2018 Institute of Food Technologists®.

A cascade signal amplification strategy for surface enhanced Raman spectroscopy detection of thrombin based on DNAzyme assistant DNA recycling and rolling circle amplification.

PubMed

Gao, Fenglei; Du, Lili; Tang, Daoquan; Lu, Yao; Zhang, Yanzhuo; Zhang, Lixian

2015-04-15

A sensitive protocol for surface enhanced Raman spectroscopy (SERS) detection of thrombin is designed with R6G-Ag NPs as a signal tag by combining DNAzyme assistant DNA recycling and rolling circle amplification (RCA). Molecular beacon (MB) as recognition probe immobilizes on the glass slides and performs the amplification procedure. After thrombin-induced structure-switching DNA hairpins of probe 1, the DNAzyme is liberated from the caged structure, which hybridizes with the MB for cleavage of the MB in the presence of cofactor Zn(2+) and initiates the DNA recycling process, leading to the cleavage of a large number of MB and the generation of numerous primers for triggering RCA reaction. The long amplified RCA product which contained hundreds of tandem-repeat sequences, which can bind with oligonucleotide functionalized Ag NPs reporters. The attached signal tags can be easily read out by SERS. Because of the cascade signal amplification, these newly designed protocols provides a sensitive SERS detection of thrombin down to the femolar level (2.3fM) with a linear range of 5 orders of magnitude (from 10(-14) to 10(-9)M) and have high selectivity toward its target protein. The proposed method is expected to be a good clinical tool for the diagnosis of a thrombotic disease. Copyright © 2014 Elsevier B.V. All rights reserved.

The Interplay Between Estrogen and Replication Origins in Breast Cancer DNA Amplification

DTIC Science & Technology

2013-09-01

Replication Origins in Breast Cancer DNA Amplification PRINCIPAL INVESTIGATOR: Cinzia Casella CONTRACTING ORGANIZATION: Brown...Interplay Between Estrogen and Replication Origins in Breast Cancer DNA Amplification 5b. GRANT NUMBER W81XWH-11-1-0599 5c. PROGRAM ELEMENT NUMBER 6... amplification and oncogenes activation in breast cancer cells? This project aims to understand the role of estrogen in inducing re-replication, thus

INTERNAL AMPLIFICATION CONTROL FOR USE IN QUANTITATIVE POLYMERASE CHAIN REACTION FECAL INDICATOR BACTERIA ASSAYS

EPA Science Inventory

Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...

IDLN-MSP: Idiolocal normalization of real-time methylation-specific PCR for genetic imbalanced DNA specimens.

PubMed

Santourlidis, Simeon; Ghanjati, Foued; Beermann, Agnes; Hermanns, Thomas; Poyet, Cédric

2016-02-01

Sensitive, accurate, and reliable measurements of tumor cell-specific DNA methylation changes are of fundamental importance in cancer diagnosis, prognosis, and monitoring. Real-time methylation-specific PCR (MSP) using intercalating dyes is an established method of choice for this purpose. Here we present a simple but crucial adaptation of this widely applied method that overcomes a major obstacle: genetic abnormalities in the DNA samples, such as aneuploidy or copy number variations, that could result in inaccurate results due to improper normalization if the copy numbers of the target and reference sequences are not the same. In our idiolocal normalization (IDLN) method, the locus for the normalizing, methylation-independent reference amplification is chosen close to the locus of the methylation-dependent target amplification. This ensures that the copy numbers of both the target and reference sequences will be identical in most cases if they are close enough to each other, resulting in accurate normalization and reliable comparative measurements of DNA methylation in clinical samples when using real-time MSP.

Enzymatic production of 'monoclonal stoichiometric' single-stranded DNA oligonucleotides.

PubMed

Ducani, Cosimo; Kaul, Corinna; Moche, Martin; Shih, William M; Högberg, Björn

2013-07-01

Single-stranded oligonucleotides are important as research tools, as diagnostic probes, in gene therapy and in DNA nanotechnology. Oligonucleotides are typically produced via solid-phase synthesis, using polymer chemistries that are limited relative to what biological systems produce. The number of errors in synthetic DNA increases with oligonucleotide length, and the resulting diversity of sequences can be a problem. Here we present the 'monoclonal stoichiometric' (MOSIC) method for enzyme-mediated production of DNA oligonucleotides. We amplified oligonucleotides from clonal templates derived from single bacterial colonies and then digested cutter hairpins in the products, which released pools of oligonucleotides with precisely controlled relative stoichiometric ratios. We prepared 14-378-nucleotide MOSIC oligonucleotides either by in vitro rolling-circle amplification or by amplification of phagemid DNA in Escherichia coli. Analyses of the formation of a DNA crystal and folding of DNA nanostructures confirmed the scalability, purity and stoichiometry of the produced oligonucleotides.

Homogenous assay for protein detection based on proximity DNA hybridization and isothermal circular strand displacement amplification reaction.

PubMed

Zhang, Manjun; Li, Ruimin; Ling, Liansheng

2017-06-01

This work proposed a homogenous fluorescence assay for proteins, based on the target-triggered proximity DNA hybridization in combination with strand displacement amplification (SDA). It benefited from target-triggered proximity DNA hybridization to specifically recognize the target and SDA making recycling signal amplification. The system included a molecular beacon (MB), an extended probe (EP), and an assistant probe (AP), which were not self-assembly in the absence of target proteins, due to the short length of the designed complementary sequence among MB, EP, and AP. Upon addition of the target proteins, EP and AP are bound to the target proteins, which induced the occurrence of proximity hybridization between MB, EP, and AP and followed by strand displacement amplification. Through the primer extension, a tripartite complex of probes and target was displaced and recycled to hybridize with another MB, and the more opened MB enabled the detection signal to amplify. Under optimum conditions, it was used for the detection of streptavidin and thrombin. Fluorescence intensity was proportional to the concentration of streptavidin and thrombin in the range of 0.2-30 and 0.2-35 nmol/L, respectively. Furthermore, this fluorescent method has a good selectivity, in which the fluorescence intensity of thrombin was ~37-fold or even larger than that of the other proteins at the same concentration. It is a new and simple method for SDA-involved target protein detection and possesses a great potential for other protein detection in the future. Graphical abstract A homogenous assay for protein detection is based on proximity DNA hybridization and strand displacement amplification reaction.

Isothermal Amplification Methods for the Detection of Nucleic Acids in Microfluidic Devices

PubMed Central

Zanoli, Laura Maria; Spoto, Giuseppe

2012-01-01

Diagnostic tools for biomolecular detection need to fulfill specific requirements in terms of sensitivity, selectivity and high-throughput in order to widen their applicability and to minimize the cost of the assay. The nucleic acid amplification is a key step in DNA detection assays. It contributes to improving the assay sensitivity by enabling the detection of a limited number of target molecules. The use of microfluidic devices to miniaturize amplification protocols reduces the required sample volume and the analysis times and offers new possibilities for the process automation and integration in one single device. The vast majority of miniaturized systems for nucleic acid analysis exploit the polymerase chain reaction (PCR) amplification method, which requires repeated cycles of three or two temperature-dependent steps during the amplification of the nucleic acid target sequence. In contrast, low temperature isothermal amplification methods have no need for thermal cycling thus requiring simplified microfluidic device features. Here, the use of miniaturized analysis systems using isothermal amplification reactions for the nucleic acid amplification will be discussed. PMID:25587397

Method to detect the end-point for PCR DNA amplification using an ionically labeled probe and measuring impedance change

DOEpatents

Miles, Robin R [Danville, CA; Belgrader, Phillip [Severna Park, MD; Fuller, Christopher D [Oakland, CA

2007-01-02

Impedance measurements are used to detect the end-point for PCR DNA amplification. A pair of spaced electrodes are located on a surface of a microfluidic channel and an AC or DC voltage is applied across the electrodes to produce an electric field. An ionically labeled probe will attach to a complementary DNA segment, and a polymerase enzyme will release the ionic label. This causes the conductivity of the solution in the area of the electrode to change. This change in conductivity is measured as a change in the impedance been the two electrodes.

Frequency-encoded laser-induced fluorescence for multiplexed detection in infrared-mediated quantitative PCR

PubMed Central

Schrell, Adrian M.; Roper, Michael G.

2014-01-01

A frequency-modulated fluorescence encoding method was used as a means to increase the number of fluorophores monitored during infrared-mediated polymerase chain reaction. Laser lines at 488-nm and 561-nm were modulated at 73- and 137-Hz, respectively, exciting fluorescence from the dsDNA intercalating dye, EvaGreen, and the temperature insensitive dye, ROX. Emission was collected in a color-blind manner using a single photomultiplier tube for detection and demodulated by frequency analysis. The resulting frequency domain signal resolved the contribution from the two fluorophores as well as the background from the IR lamp. The detection method was successfully used to measure amplification of DNA samples containing 104 – 107 starting copies of template producing an amplification efficiency of 96%. The utility of this methodology was further demonstrated by simultaneous amplification of two genes from human genomic DNA using different color TaqMan probes. This method of multiplexing fluorescence detection with IR-qPCR is ideally suited as it allowed isolation of the signals of interest from the background in the frequency domain and is expected to further reduce the complexity of multiplexed microfluidic IR-qPCR instrumentation. PMID:24448431

Development and application of loop-mediated isothermal amplification for detection of the F167Y mutation of carbendazim-resistant isolates in Fusarium graminearum

PubMed Central

Duan, Yabing; Zhang, Xiaoke; Ge, Changyan; Wang, Yong; Cao, Junhong; Jia, Xiaojing; Wang, Jianxin; Zhou, Mingguo

2014-01-01

Resistance of Fusarium graminearum to carbendazim is caused by point mutations in the β2-tubulin gene. The point mutation at codon 167 (TTT → TAT, F167Y) occurs in more than 90% of field resistant isolates in China. To establish a suitable method for rapid detection of the F167Y mutation in F. graminearum, an efficient and simple method with high specificity was developed based on loop-mediated isothermal amplification (LAMP). A set of four primers was designed and optimized to specially distinguish the F167Y mutation genotype. The LAMP reaction was optimal at 63°C for 60 min. When hydroxynaphthol blue dye (HNB) was added prior to amplification, samples with DNA of the F167Y mutation developed a characteristic sky blue color after the reaction but those without DNA or with different DNA did not. Results of HNB staining method were reconfirmed by gel electrophoresis. The developed LAMP had good specificity, stability and repeatability and was suitable for monitoring carbendazim-resistance populations of F. graminearum in agricultural production. PMID:25403277

A novel nonenzymatic cascade amplification for ultrasensitive photoelectrochemical DNA sensing based on target driven to initiate cyclic assembly of hairpins.

PubMed

Wen, Guangming; Dong, Wenxia; Liu, Bin; Li, Zhongping; Fan, Lifang

2018-05-29

A novel cascade photoelectrochemical (PEC) signal amplification biosensing tactics was developed for DNA detection based on a target-driven DNA association to induce cyclic hairpin assembly. In the circulatory system there are two ssDNA (A and B) and two hairpins (C and D). The hybridization of these ssDNA led to the formation of an A-target-B structure. The close proximity of their toehold and branch-migration regions was able to induce the cyclic hairpin assembly. Afterwards, the assembly result further causes the separation of a double-stranded probe DNA (Q:F) to switch the PEC signal via toehold-mediated strand replacement. As such, the signal stranded DNA-CdS QDs (F) as the signal tag was released in the presence of the target DNA. The signal DNA-CdS QDs was then coated to F-doped tin oxide (FTO) electrode leading to the "signal-on" PEC signal. The designed biosensing strategy showed a low detection limit of 21.3 pM for target DNA and a broad linear range from 50 pM to 100 nM. This signal amplification PEC sensing method exhibited a potential application to detect protein molecules, RNA or metal ions via changing the sequence of A and B recognition. Copyright © 2018 Elsevier B.V. All rights reserved.

Influence of sequence and size of DNA on packaging efficiency of parvovirus MVM-based vectors.

PubMed

Brandenburger, A; Coessens, E; El Bakkouri, K; Velu, T

1999-05-01

We have derived a vector from the autonomous parvovirus MVM(p), which expresses human IL-2 specifically in transformed cells (Russell et al., J. Virol 1992;66:2821-2828). Testing the therapeutic potential of these vectors in vivo requires high-titer stocks. Stocks with a titer of 10(9) can be obtained after concentration and purification (Avalosse et al., J. Virol. Methods 1996;62:179-183), but this method requires large culture volumes and cannot easily be scaled up. We wanted to increase the production of recombinant virus at the initial transfection step. Poor vector titers could be due to inadequate genome amplification or to inefficient packaging. Here we show that intracellular amplification of MVM vector genomes is not the limiting factor for vector production. Several vector genomes of different size and/or structure were amplified to an equal extent. Their amplification was also equivalent to that of a cotransfected wild-type genome. We did not observe any interference between vector and wild-type genomes at the level of DNA amplification. Despite equivalent genome amplification, vector titers varied greatly between the different genomes, presumably owing to differences in packaging efficiency. Genomes with a size close to 100% that of wild type were packaged most efficiently with loss of efficiency at lower and higher sizes. However, certain genomes of identical size showed different packaging efficiencies, illustrating the importance of the DNA sequence, and probably its structure.

Application of a Loop-Mediated Isothermal Amplification Assay for Rapid Detection of Cow Components Adulterated in Buffalo Milk/Meat.

PubMed

Deb, Rajib; Sengar, Gyanendra Singh; Singh, Umesh; Kumar, Sushil; Alyethodi, R R; Alex, Rani; Raja, T V; Das, A K; Prakash, B

2016-12-01

Loop-mediated isothermal amplification (LAMP) is a diagnostic method for amplification of DNA with rapid and minimal equipment requirement. In the present study, we applied the LAMP assay for rapid detection of cow components adulteration in buffalo milk/meat samples. The test can be completed within around 1 h 40 min starting from DNA extraction and can be performed in water bath without requirement of thermocycler. The cow DNA in buffalo samples were identified in the developed LAMP assay by either visualizing with SYBR Green I/HNB dyes or observing the typical ladder pattern on gel electrophoresis. The test can detect up to 5 % level of cow milk/meat mixed in buffalo counterparts. Due to the simplicity and specificity, the developed LAMP test can be easily adapted in any laboratory for rapid detection of cow species identification in livestock by products.

Multiple Cross Displacement Amplification Combined with Gold Nanoparticle-Based Lateral Flow Biosensor for Detection of Vibrio parahaemolyticus

PubMed Central

Wang, Yi; Li, Hui; Li, Dongxun; Li, Kewei; Wang, Yan; Xu, Jianguo; Ye, Changyun

2016-01-01

Vibrio parahaemolyticus (V. parahaemolyticus) is a marine seafood-borne pathogen causing severe illnesses in humans and aquatic animals. In the present study, multiple cross displacement amplification was combined with a lateral flow biosensor (MCDA-LFB) to detect the toxR gene of V. parahaemolyticus in DNA extracts from pure cultures and spiked oyster homogenates. Amplification was carried out at a constant temperature (62°C) for only 30 min, and amplification products were directly applied to the biosensor. The entire process, including oyster homogenate processing (30 min), isothermal amplification (30 min) and results indicating (∼2 min), could be completed within 65 min. Amplification product was detectable from as little as 10 fg of pure V. parahaemolyticus DNA and from approximately 4.2 × 102 CFU in 1 mL of oyster homogenate. No cross-reaction with other Vibrio species and with non-Vibrio species was observed. Therefore, the MCDA-LFB method established in the current report is suitable for the rapid screening of V. parahaemolyticus in clinical, food, and environmental samples. PMID:28066368

Real-time DNA Amplification and Detection System Based on a CMOS Image Sensor.

PubMed

Wang, Tiantian; Devadhasan, Jasmine Pramila; Lee, Do Young; Kim, Sanghyo

2016-01-01

In the present study, we developed a polypropylene well-integrated complementary metal oxide semiconductor (CMOS) platform to perform the loop mediated isothermal amplification (LAMP) technique for real-time DNA amplification and detection simultaneously. An amplification-coupled detection system directly measures the photon number changes based on the generation of magnesium pyrophosphate and color changes. The photon number decreases during the amplification process. The CMOS image sensor observes the photons and converts into digital units with the aid of an analog-to-digital converter (ADC). In addition, UV-spectral studies, optical color intensity detection, pH analysis, and electrophoresis detection were carried out to prove the efficiency of the CMOS sensor based the LAMP system. Moreover, Clostridium perfringens was utilized as proof-of-concept detection for the new system. We anticipate that this CMOS image sensor-based LAMP method will enable the creation of cost-effective, label-free, optical, real-time and portable molecular diagnostic devices.

Development of internal amplification controls for DNA profiling with the AmpFℓSTR(®) SGM Plus(®) kit.

PubMed

Zahra, Nathalie; Hadi, Sibte; Smith, Judith A; Iyengar, Arati; Goodwin, William

2011-06-01

DNA extracted from forensic samples can be degraded and also contain co-extracted contaminants that inhibit PCR. The effects of DNA degradation and PCR inhibition are often indistinguishable when examining a DNA profile. Two internal amplification controls (IACs) were developed to improve quality control of PCR using the AmpFℓSTR® SGM Plus® kit. The co-amplification of these controls with DNA samples was used to monitor amplification efficiency and detect PCR inhibitors. IAC fragments of 90 and 410 bp (IAC₉₀ and IAC₄₁₀) were generated from the plasmid pBR322 using tailed primers and then amplified with ROX-labelled primers. Co-amplification of IAC₉₀ and IAC₄₁₀ was performed with varying amounts of template DNA, degraded DNA and DNA contaminated with humic acid, heme and indigo dye. Both IAC₉₀ and IAC₄₁₀ were successfully amplified with human DNA without significantly affecting the quality of the DNA profile, even with DNA amounts lower than 0.5 ng. In the presence of inhibitors, the IAC₉₀ signal was still present after all human DNA loci fail to amplify; in contrast, the IAC₄₁₀ signal was reduced or absent at low levels of inhibition. Amplification of the two IACs provided an internal PCR control and allowed partial profiles caused by inhibition to be distinguished from degraded DNA profiles. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Real-time monitoring of rolling-circle amplification using a modified molecular beacon design

PubMed Central

Nilsson, Mats; Gullberg, Mats; Dahl, Fredrik; Szuhai, Karoly; Raap, Anton K.

2002-01-01

We describe a method to monitor rolling-circle replication of circular oligonucleotides in dual-color and in real-time using molecular beacons. The method can be used to study the kinetics of the polymerization reaction and to amplify and quantify circularized oligonucleotide probes in a rolling-circle amplification (RCA) reaction. Modified molecular beacons were made of 2′-O-Me-RNA to prevent 3′ exonucleolytic degradation by the polymerase used. Moreover, the complement of one of the stem sequences of the molecular beacon was included in the RCA products to avoid fluorescence quenching due to inter-molecular hybridization of neighboring molecular beacons hybridizing to the concatemeric polymerization product. The method allows highly accurate quantification of circularized DNA over a broad concentration range by relating the signal from the test DNA circle to an internal reference DNA circle reporting in a distinct fluorescence color. PMID:12136114

Comparison of STR profiling from low template DNA extracts with and without the consensus profiling method

PubMed Central

2012-01-01

Background The consensus profiling method was introduced to overcome the exaggerated stochastic effects associated with low copy number DNA typing. However, little empirical evidence has been provided which shows that a consensus profile, derived from dividing a sample into separate aliquots and including only alleles seen at least twice, gives the most informative profile, compared to a profile obtained by amplifying the entire low template DNA extract in one reaction. Therefore, this study aimed to investigate the quality of consensus profiles compared to profiles obtained using the whole low template extract for amplification. Methods A total of 100 pg and 25 pg DNA samples were amplified with the PowerPlex® ESI 16 Kits using 30 or 34 PCR cycles. A total of 100 pg and 25 pg DNA samples were then divided into three aliquots for a 34-cycle PCR and a consensus profile derived that included alleles that appeared in at least two of the replicates. Profiles from the non-split samples were compared to the consensus profiles focusing on peak heights, allele drop out, locus drop out and allele drop in. Results Performing DNA profiling on non-split extracts produced profiles with a higher percentage of correct loci compared to the consensus profiling technique. Consensus profiling did eliminate any spurious alleles from the final profile. However, there was a notable increase in allele and locus drop out when a LTDNA sample was divided prior to amplification. Conclusions The loss of information that occurs when a sample is split for amplification indicates that consensus profiling may not be producing the most informative DNA profile for samples where the template amount is limited. PMID:22748106

Development of a fast PCR protocol enabling rapid generation of AmpFℓSTR® Identifiler® profiles for genotyping of human DNA

PubMed Central

2012-01-01

Background Traditional PCR methods for forensic STR genotyping require approximately 2.5 to 4 hours to complete, contributing a significant portion of the time required to process forensic DNA samples. The purpose of this study was to develop and validate a fast PCR protocol that enabled amplification of the 16 loci targeted by the AmpFℓSTR® Identifiler® primer set, allowing decreased cycling times. Methods Fast PCR conditions were achieved by substituting the traditional Taq polymerase for SpeedSTAR™ HS DNA polymerase which is designed for fast PCR, by upgrading to a thermal cycler with faster temperature ramping rates and by modifying cycling parameters (less time at each temperature) and adopting a two-step PCR approach. Results The total time required for the optimized protocol is 26 min. A total of 147 forensically relevant DNA samples were amplified using the fast PCR protocol for Identifiler. Heterozygote peak height ratios were not affected by fast PCR conditions, and full profiles were generated for single-source DNA amounts between 0.125 ng and 2.0 ng. Individual loci in profiles produced with the fast PCR protocol exhibited average n-4 stutter percentages ranging from 2.5 ± 0.9% (THO1) to 9.9 ± 2.7% (D2S1338). No increase in non-adenylation or other amplification artefacts was observed. Minor contributor alleles in two-person DNA mixtures were reliably discerned. Low level cross-reactivity (monomorphic peaks) was observed with some domestic animal DNA. Conclusions The fast PCR protocol presented offers a feasible alternative to current amplification methods and could aid in reducing the overall time in STR profile production or could be incorporated into a fast STR genotyping procedure for time-sensitive situations. PMID:22394458

Evaluation of the efficacy of constitutional array-based comparative genomic hybridization in the diagnosis of aneuploidy using genomic and amplified DNA.

PubMed

Tan, Niap H; Palmer, Rodger; Wang, Rubin

2010-02-01

Array-based comparative genomic hybridization (array CGH) is a new molecular technique that has the potential to revolutionize cytogenetics. However, use of high resolution array CGH in the clinical setting is plagued by the problem of widespread copy number variations (CNV) in the human genome. Constitutional microarray, containing only clones that interrogate regions of known constitutional syndromes, may circumvent the dilemma of detecting CNV of unknown clinical significance. The present study investigated the efficacy of constitutional microarray in the diagnosis of trisomy. Test samples included genomic DNA from trisomic cell lines, amplification products of 50 ng of genomic DNA and whole genome amplification products of single cells. DNA amplification was achieved by means of multiple displacement amplification (MDA) over 16 h. The trisomic and sex chromosomes copy number imbalances in the genomic DNA were correctly identified by the constitutional microarrays. However, there was a failure to detect the trisomy in the amplification products of 50 ng of genomic DNA and whole genome amplification products of single cells. Using carefully selected clones, Spectral Genomics constitutional microarray was able to detect the chromosomal copy number imbalances in genomic DNA without the confounding effects of CNV. The diagnostic failure in amplified DNA samples could be attributed to the amplification process. The MDA duration of 16 h generated excessive amount of biases and shortening the duration might minimize the problem.

Colony-PCR Is a Rapid Method for DNA Amplification of Hyphomycetes

PubMed Central

Walch, Georg; Knapp, Maria; Rainer, Georg; Peintner, Ursula

2016-01-01

Fungal pure cultures identified with both classical morphological methods and through barcoding sequences are a basic requirement for reliable reference sequences in public databases. Improved techniques for an accelerated DNA barcode reference library construction will result in considerably improved sequence databases covering a wider taxonomic range. Fast, cheap, and reliable methods for obtaining DNA sequences from fungal isolates are, therefore, a valuable tool for the scientific community. Direct colony PCR was already successfully established for yeasts, but has not been evaluated for a wide range of anamorphic soil fungi up to now, and a direct amplification protocol for hyphomycetes without tissue pre-treatment has not been published so far. Here, we present a colony PCR technique directly from fungal hyphae without previous DNA extraction or other prior manipulation. Seven hundred eighty-eight fungal strains from 48 genera were tested with a success rate of 86%. PCR success varied considerably: DNA of fungi belonging to the genera Cladosporium, Geomyces, Fusarium, and Mortierella could be amplified with high success. DNA of soil-borne yeasts was always successfully amplified. Absidia, Mucor, Trichoderma, and Penicillium isolates had noticeably lower PCR success. PMID:29376929

Field Detection of Citrus Huanglongbing Associated with ' Candidatus Liberibacter Asiaticus' by Recombinese Polymerase Amplification within 15 min.

PubMed

Qian, Wenjuan; Lu, Ying; Meng, Youqing; Ye, Zunzhong; Wang, Liu; Wang, Rui; Zheng, Qiqi; Wu, Hui; Wu, Jian

2018-06-06

' Candidatus Liberibacter asiaticus' (Las) is the most prevalent bacterium associated with huanglongbing, which is one of the most destructive diseases of citrus. In this paper, an extremely rapid and simple method for field detection of Las from leaf samples, based on recombinase polymerase amplification (RPA), is described. Three RPA primer pairs were designed and evaluated. RPA amplification was optimized so that it could be accomplished within 10 min. In combination with DNA crude extraction by a 50-fold dilution after 1 min of grinding in 0.5 M sodium hydroxide and visual detection via fluorescent DNA dye (positive samples display obvious green fluorescence while negative samples remain colorless), the whole detection process can be accomplished within 15 min. The sensitivity and specificity of this RPA-based method were evaluated and were proven to be equal to those of real-time PCR. The reliability of this method was also verified by analyzing field samples.

A signal-on electrochemical aptasensor for ultrasensitive detection of endotoxin using three-way DNA junction-aided enzymatic recycling and graphene nanohybrid for amplification

NASA Astrophysics Data System (ADS)

Bai, Lijuan; Chai, Yaqin; Pu, Xiaoyun; Yuan, Ruo

2014-02-01

Endotoxin, also known as lipopolysaccharide (LPS), is able to induce a strong immune response on its internalization into mammalian cells. To date, aptamer-based biosensors for LPS detection have been rarely reported. This work describes a new signal-on electrochemical aptasensor for the ultrasensitive detection of LPS by combining the three-way DNA hybridization process and nanotechnology-based amplification. With the help of DNA1 (associated with the concentration of target LPS), the capture probe hybridizes with DNA1 and the assistant probe to open its hairpin structure and form a ternary ``Y'' junction structure. The DNA1 can be released from the structure in the presence of nicking endonuclease to initiate the next hybridization process. Then a great deal of cleaved capture probe produced in the cyclic process can bind with DNA2-nanocomposite, which contains the electroactive toluidine blue (Tb) with the amplification materials graphene (Gra) and gold nanoparticles (AuNPs). Thus, an enhanced electrochemical signal can be easily read out. With the cascade signal amplification, this newly designed protocol provides an ultrasensitive electrochemical detection of LPS down to the femtogram level (8.7 fg mL-1) with a linear range of 6 orders of magnitude (from 10 fg mL-1 to 50 ng mL-1). Moreover, the high sensitivity and specificity make this method versatile for the detection of other biomolecules by changing the corresponding sequences of the capture probe and the assistant probe.

Evaluation of mailed pediatric buccal cytobrushes for use in a case-control study of birth defects.

PubMed

Gallagher, Margaret L; Sturchio, Cynthia; Smith, Ashley; Koontz, Deborah; Jenkins, Mary M; Honein, Margaret A; Rasmussen, Sonja A

2011-07-01

Buccal cell collection is a convenient DNA collection method; however, little attention has been given to the quality of DNA obtained from pediatric populations. The purpose of this study was to determine the effect of a modified cytobrush collection method on the yield and quality of infant buccal DNA collected as part of a population-based case-control study of birth defects. METHODS Cytobrushes were collected from infants, mothers, and fathers using a standard collection method in 1997 to 2003 and a modified protocol that allows air-drying of the cytobrushes after collection from 2003 to the present. Yield and quality of DNA from 1057 cytobrushes was assessed by quantitative PCR and short tandem repeat (STR) genotyping, respectively. RESULTS Air-dried cytobrushes from infants had higher median DNA yields (1300 ng) and STR completion rates (99.5%) than standard collection method cytobrushes (60 ng and 59.5%, respectively). A subset of DNA aliquots was genotyped for six single nucleotide polymorphisms (SNPs). Aliquots from both collection methods that passed the quality protocol (DNA concentration >1 ng/μl, and successful amplification of ≥1 STR) had high genotype completion rates (99-100%). The median DNA yield following whole genome amplification was more than twofold higher for air-dried than standard collection specimens (p < 0.001). CONCLUSION Yield and quality of buccal DNA collected from infants are improved by using a method that incorporates air-drying; however, DNA collected by both methods is suitable for genotyping if stringent quality control procedures are instituted. These findings may be helpful for future epidemiologic studies of birth defects and other adverse pediatric outcomes. Copyright © 2011 Wiley-Liss, Inc.

Label-free detection of real-time DNA amplification using a nanofluidic diffraction grating

NASA Astrophysics Data System (ADS)

Yasui, Takao; Ogawa, Kensuke; Kaji, Noritada; Nilsson, Mats; Ajiri, Taiga; Tokeshi, Manabu; Horiike, Yasuhiro; Baba, Yoshinobu

2016-08-01

Quantitative DNA amplification using fluorescence labeling has played an important role in the recent, rapid progress of basic medical and molecular biological research. Here we report a label-free detection of real-time DNA amplification using a nanofluidic diffraction grating. Our detection system observed intensity changes during DNA amplification of diffracted light derived from the passage of a laser beam through nanochannels embedded in a microchannel. Numerical simulations revealed that the diffracted light intensity change in the nanofluidic diffraction grating was attributed to the change of refractive index. We showed the first case reported to date for label-free detection of real-time DNA amplification, such as specific DNA sequences from tubercle bacilli (TB) and human papillomavirus (HPV). Since our developed system allows quantification of the initial concentration of amplified DNA molecules ranging from 1 fM to 1 pM, we expect that it will offer a new strategy for developing fundamental techniques of medical applications.

Flow cytometric detection method for DNA samples

DOEpatents

Nasarabadi, Shanavaz [Livermore, CA; Langlois, Richard G [Livermore, CA; Venkateswaran, Kodumudi S [Round Rock, TX

2011-07-05

Disclosed herein are two methods for rapid multiplex analysis to determine the presence and identity of target DNA sequences within a DNA sample. Both methods use reporting DNA sequences, e.g., modified conventional Taqman.RTM. probes, to combine multiplex PCR amplification with microsphere-based hybridization using flow cytometry means of detection. Real-time PCR detection can also be incorporated. The first method uses a cyanine dye, such as, Cy3.TM., as the reporter linked to the 5' end of a reporting DNA sequence. The second method positions a reporter dye, e.g., FAM.TM. on the 3' end of the reporting DNA sequence and a quencher dye, e.g., TAMRA.TM., on the 5' end.

Flow cytometric detection method for DNA samples

DOEpatents

Nasarabadi, Shanavaz [Livermore, CA; Langlois, Richard G [Livermore, CA; Venkateswaran, Kodumudi S [Livermore, CA

2006-08-01

Disclosed herein are two methods for rapid multiplex analysis to determine the presence and identity of target DNA sequences within a DNA sample. Both methods use reporting DNA sequences, e.g., modified conventional Taqman.RTM. probes, to combine multiplex PCR amplification with microsphere-based hybridization using flow cytometry means of detection. Real-time PCR detection can also be incorporated. The first method uses a cyanine dye, such as, Cy3.TM., as the reporter linked to the 5' end of a reporting DNA sequence. The second method positions a reporter dye, e.g., FAM, on the 3' end of the reporting DNA sequence and a quencher dye, e.g., TAMRA, on the 5' end.

Successful isolation and PCR amplification of DNA from National Institute of Standards and Technology herbal dietary supplement standard reference material powders and extracts.

PubMed

Cimino, Matthew T

2010-03-01

Twenty-four herbal dietary supplement powder and extract reference standards provided by the National Institute of Standards and Technology (NIST) were investigated using three different commercially available DNA extraction kits to evaluate DNA availability for downstream nucleotide-based applications. The material included samples of Camellia, Citrus, Ephedra, Ginkgo, Hypericum, Serenoa, And Vaccinium. Protocols from Qiagen, MoBio, and Phytopure were used to isolate and purify DNA from the NIST standards. The resulting DNA concentration was quantified using SYBR Green fluorometry. Each of the 24 samples yielded DNA, though the concentration of DNA from each approach was notably different. The Phytopure method consistently yielded more DNA. The average yield ratio was 22 : 3 : 1 (ng/microL; Phytopure : Qiagen : MoBio). Amplification of the internal transcribed spacer II region using PCR was ultimately successful in 22 of the 24 samples. Direct sequencing chromatograms of the amplified material suggested that most of the samples were comprised of mixtures. However, the sequencing chromatograms of 12 of the 24 samples were sufficient to confirm the identity of the target material. The successful extraction, amplification, and sequencing of DNA from these herbal dietary supplement extracts and powders supports a continued effort to explore nucleotide sequence-based tools for the authentication and identification of plants in dietary supplements. (c) Georg Thieme Verlag KG Stuttgart . New York.

Loop-mediated isothermal amplification for detection of the tomato and potato late blight pathogen, Phytophthora infestans

USDA-ARS?s Scientific Manuscript database

Aims: To design and validate a colorimetric loop-mediated isothermal amplification assay for rapid detection of P. infestans DNA. Methods and Results: Two sets of LAMP primers were designed and evaluated for their sensitivity and specificity for P. infestans. ITSII primers targeted a portion of the ...

Sponge-associated actinobacterial diversity: validation of the methods of actinobacterial DNA extraction and optimization of 16S rRNA gene amplification.

PubMed

Yang, Qi; Franco, Christopher M M; Zhang, Wei

2015-10-01

Experiments were designed to validate the two common DNA extraction protocols (CTAB-based method and DNeasy Blood & Tissue Kit) used to effectively recover actinobacterial DNA from sponge samples in order to study the sponge-associated actinobacterial diversity. This was done by artificially spiking sponge samples with actinobacteria (spores, mycelia and a combination of the two). Our results demonstrated that both DNA extraction methods were effective in obtaining DNA from the sponge samples as well as the sponge samples spiked with different amounts of actinobacteria. However, it was noted that in the presence of the sponge, the bacterial 16S rRNA gene could not be amplified unless the combined DNA template was diluted. To test the hypothesis that the extracted sponge DNA contained inhibitors, dilutions of the DNA extracts were tested for six sponge species representing five orders. The results suggested that the inhibitors were co-extracted with the sponge DNA, and a high dilution of this DNA was required for the successful PCR amplification for most of the samples. The optimized PCR conditions, including primer selection, PCR reaction system and program optimization, further improved the PCR performance. However, no single PCR condition was found to be suitable for the diverse sponge samples using various primer sets. These results highlight for the first time that the DNA extraction methods used are effective in obtaining actinobacterial DNA and that the presence of inhibitors in the sponge DNA requires high dilution coupled with fine tuning of the PCR conditions to achieve success in the study of sponge-associated actinobacterial diversity.

Selective whole genome amplification for resequencing target microbial species from complex natural samples.

PubMed

Leichty, Aaron R; Brisson, Dustin

2014-10-01

Population genomic analyses have demonstrated power to address major questions in evolutionary and molecular microbiology. Collecting populations of genomes is hindered in many microbial species by the absence of a cost effective and practical method to collect ample quantities of sufficiently pure genomic DNA for next-generation sequencing. Here we present a simple method to amplify genomes of a target microbial species present in a complex, natural sample. The selective whole genome amplification (SWGA) technique amplifies target genomes using nucleotide sequence motifs that are common in the target microbe genome, but rare in the background genomes, to prime the highly processive phi29 polymerase. SWGA thus selectively amplifies the target genome from samples in which it originally represented a minor fraction of the total DNA. The post-SWGA samples are enriched in target genomic DNA, which are ideal for population resequencing. We demonstrate the efficacy of SWGA using both laboratory-prepared mixtures of cultured microbes as well as a natural host-microbe association. Targeted amplification of Borrelia burgdorferi mixed with Escherichia coli at genome ratios of 1:2000 resulted in >10(5)-fold amplification of the target genomes with <6.7-fold amplification of the background. SWGA-treated genomic extracts from Wolbachia pipientis-infected Drosophila melanogaster resulted in up to 70% of high-throughput resequencing reads mapping to the W. pipientis genome. By contrast, 2-9% of sequencing reads were derived from W. pipientis without prior amplification. The SWGA technique results in high sequencing coverage at a fraction of the sequencing effort, thus allowing population genomic studies at affordable costs. Copyright © 2014 by the Genetics Society of America.

Ultrasensitive electrochemical detection of nucleic acids by template enhanced hybridization followed with rolling circle amplification.

PubMed

Ji, Hanxu; Yan, Feng; Lei, Jianping; Ju, Huangxian

2012-08-21

An ultrasensitive protocol for electrochemical detection of DNA is designed with quantum dots (QDs) as a signal tag by combining the template enhanced hybridization process (TEHP) and rolling circle amplification (RCA). Upon the recognition of the molecular beacon (MB) to target DNA, the MB hybridizes with assistants and target DNA to form a ternary ''Y-junction''. The target DNA can be dissociated from the structure under the reaction of nicking endonuclease to initiate the next hybridization process. The template enhanced MB fragments further act as the primers of the RCA reaction to produce thousands of repeated oligonucleotide sequences, which can bind with oligonucleotide functionalized QDs. The attached signal tags can be easily read out by square-wave voltammetry after dissolving with acid. Because of the cascade signal amplification and the specific TEHP and RCA reaction, this newly designed protocol provides an ultrasensitive electrochemical detection of DNA down to the attomolar level (11 aM) with a linear range of 6 orders of magnitude (from 1 × 10(-17) to 1 × 10(-11) M) and can discriminate mismatched DNA from perfect matched target DNA with high selectivity. The high sensitivity and specificity make this method a great potential for early diagnosis in gene-related diseases.

Theory and applications of the polymerase chain reaction.

PubMed

Remick, D G; Kunkel, S L; Holbrook, E A; Hanson, C A

1990-04-01

The polymerase chain reaction (PCR) is a newly developed molecular biology technique that can significantly amplify DNA or RNA. The process consists of repetitive cycles of specific DNA synthesis, defined by short stretches of preselected DNA. With each cycle, there is a doubling of the final, desired DNA product such that a million-fold amplification is possible. This powerful method has numerous applications in diagnostic pathology, especially in the fields of microbiology, forensic science, and hematology. The PCR may be used to directly detect viral DNA, which may facilitate the diagnosis of acquired immune deficiency syndrome (AIDS) or other viral diseases. PCR amplification of DNA allows detection of specific sequences from extremely small samples, such as with forensic material. In hematology, PCR may help in the diagnosis of hemoglobinopathies or of neoplastic disorders by documenting chromosomal translocations. The new PCR opens exciting new avenues for diagnostic pathology using this new technology.

DNA recovery from microhymenoptera using six non-destructive methodologies with considerations for subsequent preparation of museum slides.

PubMed

Guzmán-Larralde, Adriana J; Suaste-Dzul, Alba P; Gallou, Adrien; Peña-Carrillo, Kenzy I

2017-01-01

Because of the tiny size of microhymenoptera, successful morphological identification typically requires specific mounting protocols that require time, skills, and experience. Molecular taxonomic identification is an alternative, but many DNA extraction protocols call for maceration of the whole specimen, which is not compatible with preserving museum vouchers. Thus, non-destructive DNA isolation methods are attractive alternatives for obtaining DNA without damaging sample individuals. However, their performance needs to be assessed in microhymenopterans. We evaluated six non-destructive methods: (A) DNeasy® Blood & Tissue Kit; (B) DNeasy® Blood & Tissue Kit, modified; (C) Protocol with CaCl 2 buffer; (D) Protocol with CaCl 2 buffer, modified; (E) HotSHOT; and (F) Direct PCR. The performance of each DNA extraction method was tested across several microhymenopteran species by attempting to amplify the mitochondrial gene COI from insect specimens of varying ages: 1 day, 4 months, 3 years, 12 years, and 23 years. Methods B and D allowed COI amplification in all insects, while methods A, C, and E were successful in DNA amplification from insects up to 12 years old. Method F, the fastest, was useful in insects up to 4 months old. Finally, we adapted permanent slide preparation in Canada balsam for every technique. The results reported allow for combining morphological and molecular methodologies for taxonomic studies.

Hairpin DNA Switch for Ultrasensitive Spectrophotometric Detection of DNA Hybridization Based on Gold Nanoparticles and Enzyme Signal Amplification

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Youyu; Tang, Zhiwen; Wang, Jun

2010-08-01

A novel DNA detection platform based on a hairpin-DNA switch, nanoparticles, and enzyme signal amplification for ultrasensitive detection of DNA hybridization has been developed in this work. In this DNA assay, a “stem-loop” DNA probe dually labeled with a thiol at its 5’ end and a biotin at its 3’ end, respectively, was used. This probe was immobilized on the gold nanoparticles (AuNPs) anchored by a protein, globulin, on a 96-well microplate. In the absence of target DNA, the immobilized probe with the stem-loop structure shields the biotin from being approached by a bulky horseradish peroxidase linked-avidin (avidin-HRP) conjugate duemore » to the steric hindrance. However, in the presence of target DNA, the hybridization between the hairpin DNA probe and the target DNA causes significant conformational change of the probe, which forces biotin away from the surface of AuNPs. As a result, the biotin becomes accessible by the avidin-HRP, and the target hybridization event can be sensitively detected via the HRP catalyzed substrate 3, 3', 5, 5'-tetramethylbenzidine using spectrophometric method. Some experimental parameters governing the performance of the assay have been optimized. At optimal conditions, this DNA assay can detect DNA at the concentration of femtomolar level by means of a signal amplification strategy based on the combination of enzymes and nanoparticles. This approach also has shown excellent specificity to distinguish single-base mismatches of DNA targets because of the intrinsic high selectivity of the hairpin DNA probe.« less

Isothermal circular-strand-displacement polymerization of DNA and microRNA in digital microfluidic devices.

PubMed

Giuffrida, Maria Chiara; Zanoli, Laura Maria; D'Agata, Roberta; Finotti, Alessia; Gambari, Roberto; Spoto, Giuseppe

2015-02-01

Nucleic-acid amplification is a crucial step in nucleic-acid-sequence-detection assays. The use of digital microfluidic devices to miniaturize amplification techniques reduces the required sample volume and the analysis time and offers new possibilities for process automation and integration in a single device. The recently introduced droplet polymerase-chain-reaction (PCR) amplification methods require repeated cycles of two or three temperature-dependent steps during the amplification of the nucleic-acid target sequence. In contrast, low-temperature isothermal-amplification methods have no need for thermal cycling, thus requiring simplified microfluidic-device features. Here, the combined use of digital microfluidics and molecular-beacon (MB)-assisted isothermal circular-strand-displacement polymerization (ICSDP) to detect microRNA-210 sequences is described. MicroRNA-210 has been described as the most consistently and predominantly upregulated hypoxia-inducible factor. The nmol L(-1)-pmol L(-1) detection capabilities of the method were first tested by targeting single-stranded DNA sequences from the genetically modified Roundup Ready soybean. The ability of the droplet-ICSDP method to discriminate between full-matched, single-mismatched, and unrelated sequences was also investigated. The detection of a range of nmol L(-1)-pmol L(-1) microRNA-210 solutions compartmentalized in nanoliter-sized droplets was performed, establishing the ability of the method to detect as little as 10(-18) mol of microRNA target sequences compartmentalized in 20 nL droplets. The suitability of the method for biological samples was tested by detecting microRNA-210 from transfected K562 cells.

Deconstructing the Polymerase Chain Reaction: Understanding and Correcting Bias Associated with Primer Degeneracies and Primer-Template Mismatches

PubMed Central

Green, Stefan J.; Venkatramanan, Raghavee; Naqib, Ankur

2015-01-01

The polymerase chain reaction (PCR) is sensitive to mismatches between primer and template, and mismatches can lead to inefficient amplification of targeted regions of DNA template. In PCRs in which a degenerate primer pool is employed, each primer can behave differently. Therefore, inefficiencies due to different primer melting temperatures within a degenerate primer pool, in addition to mismatches between primer binding sites and primers, can lead to a distortion of the true relative abundance of targets in the original DNA pool. A theoretical analysis indicated that a combination of primer-template and primer-amplicon interactions during PCR cycles 3–12 is potentially responsible for this distortion. To test this hypothesis, we developed a novel amplification strategy, entitled “Polymerase-exonuclease (PEX) PCR”, in which primer-template interactions and primer-amplicon interactions are separated. The PEX PCR method substantially and significantly improved the evenness of recovery of sequences from a mock community of known composition, and allowed for amplification of templates with introduced mismatches near the 3’ end of the primer annealing sites. When the PEX PCR method was applied to genomic DNA extracted from complex environmental samples, a significant shift in the observed microbial community was detected. Furthermore, the PEX PCR method provides a mechanism to identify which primers in a primer pool are annealing to target gDNA. Primer utilization patterns revealed that at high annealing temperatures in the PEX PCR method, perfect match annealing predominates, while at lower annealing temperatures, primers with up to four mismatches with templates can contribute substantially to amplification. The PEX PCR method is simple to perform, is limited to PCR mixes and a single exonuclease step which can be performed without reaction cleanup, and is recommended for reactions in which degenerate primer pools are used or when mismatches between primers and template are possible. PMID:25996930

Improving enrichment of circulating fetal DNA for genetic testing: size fractionation followed by whole gene amplification.

PubMed

Jorgez, Carolina J; Bischoff, Farideh Z

2009-01-01

Among the pitfalls of using cell-free fetal DNA in plasma for prenatal diagnosis is quality of the recovered DNA fragments and concomitant presence of maternal DNA (>95%). Our objective is to provide alternative methods for achieving enrichment and high-quality fetal DNA from plasma. Cell-free DNA from 31 pregnant women and 18 controls (10 males and 8 females) were size separated using agarose gel electrophoresis. DNA fragments of 100-300, 500-700 and 1,500-2,000 bp were excised and extracted, followed by whole genome amplification (WGA) of recovered fragments. Levels of beta-globin and DYS1 were measured. Distribution of beta-globin size fragments was similar among pregnant women and controls. Among control male cases, distribution of size fragments was the same for both beta-globin and DYS1. Among maternal cases confirmed to be male, the smallest size fragment (100-300 bp) accounted for nearly 50% (39.76 +/- 17.55%) of the recovered DYS1-DNA (fetal) and only 10% (10.40 +/- 6.49%) of beta-globin (total) DNA. After WGA of plasma fragments from pregnant women, DYS1 sequence amplification was best observed when using the 100-300 bp fragments as template. Combination of electrophoresis for size separation and WGA led to enriched fetal DNA from plasma. This novel combination of strategies is more likely to permit universal clinical applications of cell-free fetal DNA. Copyright 2009 S. Karger AG, Basel.

[Application of recombinase polymerase amplification in the detection of Pseudomonas aeruginosa].

PubMed

Jin, X J; Gong, Y L; Yang, L; Mo, B H; Peng, Y Z; He, P; Zhao, J N; Li, X L

2018-04-20

Objective: To establish an optimized method of recombinase polymerase amplification (RPA) to rapidly detect Pseudomonas aeruginosa in clinic. Methods: (1) The DNA templates of one standard Pseudomonas aeruginosa strain was extracted and detected by polymerase chain reaction (PCR), real-time fluorescence quantitative PCR and RPA. Time of sample loading, time of amplification, and time of detection of the three methods were recorded. (2) One standard Pseudomonas aeruginosa strain was diluted in 7 concentrations of 1×10(7,) 1×10(6,) 1×10(5,) 1×10(4,) 1×10(3,) 1×10(2,) and 1×10(1) colony forming unit (CFU)/mL after recovery and cultivation. The DNA templates of Pseudomonas aeruginosa and negative control strain Pseudomonas putida were extracted and detected by PCR, real-time fluorescence quantitative PCR, and RPA separately. The sensitivity of the three methods in detecting Pseudomonas aeruginosa was analyzed. (3) The DNA templates of one standard Pseudomonas aeruginosa strain and four negative control strains ( Staphylococcus aureus, Acinetobacter baumanii, Candida albicans, and Pseudomonas putida ) were extracted separately, and then they were detected by PCR, real-time fluorescence quantitative PCR, and RPA. The specificity of the three methods in detecting Pseudomonas aeruginosa was analyzed. (4) The DNA templates of 28 clinical strains of Pseudomonas aeruginosa preserved in glycerin, 1 clinical strain of which was taken by cotton swab, and negative control strain Pseudomonas putida were extracted separately, and then they were detected by RPA. Positive amplification signals of the clinical strains were observed, and the detection rate was calculated. All experiments were repeated for 3 times. Sensitivity results were analyzed by GraphPad Prism 5.01 statistical software. Results: (1) The loading time of RPA, PCR, and real-time fluorescence quantitative PCR for detecting Pseudomonas aeruginosa were all 20 minutes. In PCR, time of amplification was 98 minutes, time of gel detection was 20 minutes, and the total time was 138 minutes. In real-time fluorescence quantitative PCR, amplification and detection could be completed simultaneously, which took 90 minutes, and the total time was 110 minutes. In RPA, amplification and detection could also be completed simultaneously, which took 15 minutes, and the total time was 35 minutes. (2) Pseudomonas putida did not show positive amplification signals or gel positive results in any of the three detection methods. The detection limit of Pseudomonas aeruginosa in real-time fluorescence quantitative PCR and PCR was 1×10(1) CFU/mL, and that of Pseudomonas aeruginosa in RPA was 1×10(2) CFU/mL. In RPA and real-time fluorescence quantitative PCR, the higher the concentration of Pseudomonas aeruginosa, the shorter threshold time and smaller the number of cycles, namely shorter time for detecting the positive amplified signal. In real-time fluorescence quantitative PCR, all positive amplification signal could be detected when the concentration of Pseudomonas aeruginosa was 1×10(1)-1×10(7) CFU/mL. In RPA, the detection rate of positive amplification signal was 0 when the concentration of Pseudomonas aeruginosa was 1×10(1) CFU/mL, while the detection rate of positive amplification signal was 67% when the concentration of Pseudomonas aeruginosa was 1×10(2) CFU/mL, and the detection rate of positive amplification signal was 100% when the concentration of Pseudomonas aeruginosa was 1×10(3)-1×10(7) CFU/mL. (3) In RPA, PCR, and real-time fluorescence quantitative PCR, Pseudomonas aeruginosa showed positive amplification signals and gel positive results, but there were no positive amplification signals or gel positive results in four negative control strains of Acinetobacter baumannii, Staphylococcus aureus, Candida albicans, and Pseudomonas putida . (4) In RPA, 28 clinical strains of Pseudomonas aeruginosa preserved in glycerin and 1 clinical strain of Pseudomonas aeruginosa taken by cotton swab showed positive amplification signals, while Pseudomonas putida did not show positive amplification signal. The detection rate of positive amplification signal of 29 clinical strains of Pseudomonas aeruginosa in RPA was 100%. Conclusions: The established optimized RPA technology for fast detection of Pseudomonas aeruginosa requires shorter time, with high sensitivity and specificity. It was of great value in fast detection of Pseudomonas aeruginosa infection in clinic.

New Fpg probe chemistry for direct detection of recombinase polymerase amplification on lateral flow strips.

PubMed

Powell, Michael L; Bowler, Frank R; Martinez, Aurore J; Greenwood, Catherine J; Armes, Niall; Piepenburg, Olaf

2018-02-15

Rapid, cost-effective and sensitive detection of nucleic acids has the ability to improve upon current practices employed for pathogen detection in diagnosis of infectious disease and food testing. Furthermore, if assay complexity can be reduced, nucleic acid amplification tests could be deployed in resource-limited and home use scenarios. In this study, we developed a novel Fpg (Formamidopyrimidine DNA glycosylase) probe chemistry, which allows lateral flow detection of amplification in undiluted recombinase polymerase amplification (RPA) reactions. The prototype nucleic acid lateral flow chemistry was applied to a human genomic target (rs1207445), Campylobacter jejuni 16S rDNA and two genetic markers of the important food pathogen E. coli O157:H7. All four assays have an analytical sensitivity between 10 and 100 copies DNA per amplification. Furthermore, the assay is performed with fewer hands-on steps than using the current RPA Nfo lateral flow method as dilution of amplicon is not required for lateral flow analysis. Due to the simplicity of the workflow, we believe that the lateral flow chemistry for direct detection could be readily adapted to a cost-effective single-use consumable, ideal for use in non-laboratory settings. Copyright © 2017. Published by Elsevier Inc.

Specific and Sensitive Isothermal Electrochemical Biosensor for Plant Pathogen DNA Detection with Colloidal Gold Nanoparticles as Probes

NASA Astrophysics Data System (ADS)

Lau, Han Yih; Wu, Haoqi; Wee, Eugene J. H.; Trau, Matt; Wang, Yuling; Botella, Jose R.

2017-01-01

Developing quick and sensitive molecular diagnostics for plant pathogen detection is challenging. Herein, a nanoparticle based electrochemical biosensor was developed for rapid and sensitive detection of plant pathogen DNA on disposable screen-printed carbon electrodes. This 60 min assay relied on the rapid isothermal amplification of target pathogen DNA sequences by recombinase polymerase amplification (RPA) followed by gold nanoparticle-based electrochemical assessment with differential pulse voltammetry (DPV). Our method was 10,000 times more sensitive than conventional polymerase chain reaction (PCR)/gel electrophoresis and could readily identify P. syringae infected plant samples even before the disease symptoms were visible. On the basis of the speed, sensitivity, simplicity and portability of the approach, we believe the method has potential as a rapid disease management solution for applications in agriculture diagnostics.

Specific and Sensitive Isothermal Electrochemical Biosensor for Plant Pathogen DNA Detection with Colloidal Gold Nanoparticles as Probes.

PubMed

Lau, Han Yih; Wu, Haoqi; Wee, Eugene J H; Trau, Matt; Wang, Yuling; Botella, Jose R

2017-01-17

Developing quick and sensitive molecular diagnostics for plant pathogen detection is challenging. Herein, a nanoparticle based electrochemical biosensor was developed for rapid and sensitive detection of plant pathogen DNA on disposable screen-printed carbon electrodes. This 60 min assay relied on the rapid isothermal amplification of target pathogen DNA sequences by recombinase polymerase amplification (RPA) followed by gold nanoparticle-based electrochemical assessment with differential pulse voltammetry (DPV). Our method was 10,000 times more sensitive than conventional polymerase chain reaction (PCR)/gel electrophoresis and could readily identify P. syringae infected plant samples even before the disease symptoms were visible. On the basis of the speed, sensitivity, simplicity and portability of the approach, we believe the method has potential as a rapid disease management solution for applications in agriculture diagnostics.

Detection of Puccinia kuehnii Causing Sugarcane Orange Rust with a Loop-Mediated Isothermal Amplification-Based Assay.

PubMed

Chandra, Amaresh; Keizerweerd, Amber T; Grisham, Michael P

2016-03-01

Puccinia kuehnii is a fungal pathogen that causes orange rust in sugarcane, which is now prevalent in many countries. At the early stage of disease, it is almost indistinguishable from brown rust, which is caused by Puccinia melanocephala. Although several PCR assays are available to detect these diseases, the loop-mediated isothermal amplification (LAMP)-based assay has been reported to be more economical and easier to perform. Under isothermal conditions, DNA is amplified with high specificity and rapidity. Moreover, visual judgment of color change without further post-amplification processing makes the method convenient. The present study was undertaken to detect P. kuehnii genomic DNA using four primers corresponding to a unique DNA sequence of P. kuehnii. The LAMP assay was found to be optimal when 8 mM MgSO4 was used and the reaction was incubated at 63 °C for 90 min. Positive samples showed a color change from orange to green upon SYBR Green I dye addition. Specificity of the LAMP test was checked with DNA of P. melanocephala, which showed no reaction. Sensitivity of the LAMP method was observed to be the same as real-time PCR at 0.1 ng, thus providing a rapid and more affordable option for early disease detection.

Digital quantification of DNA via isothermal amplification on a self-driven microfluidic chip featuring hydrophilic film-coated polydimethylsiloxane.

PubMed

Ma, Yu-Dong; Chang, Wen-Hsin; Luo, Kang; Wang, Chih-Hung; Liu, Shih-Yuan; Yen, Wen-Hsiang; Lee, Gwo-Bin

2018-01-15

Loop-mediated isothermal amplification (LAMP) is a DNA amplification approach characterized by high sensitivity and specificity. In "digital LAMP", small quantities of both template DNA and reagents are encapsulated within a droplet or microwell, allowing for analysis of precious nucleic acid samples in shorter amounts of time relative to traditional DNA amplification protocols (e.g., PCR) with an improved limit of detection. In this study, an integrated, self-driven microfluidic chip was designed to carry out digital LAMP. The entire quantification process could be automatically performed on this chip via capillary forces enabled through microwells comprised of polydimethylsiloxane (PDMS) surfaces coated with a hydrophilic film; no external pumps were required. Moreover, digitized droplets could be separated from each other by normally-closed microvalves. The contact angle of the hydrophilic film-coated PDMS surface was only 14.3°. This is the first time that a rapid (30min) and simple method has been used to create hydrophilic PDMS surfaces that allow for digital LAMP to be performed in a self-driven microfluidic device. As a proof of concept, amplification of a gene specific to a vancomycin-resistant Enterococcus strain was performed on the developed microfluidic chip within 30min, and the limit of detection was only 11 copies with a volume of 30μL. This device may therefore become a promising tool for clinical diagnosis and point-of-care applications. Copyright © 2017 Elsevier B.V. All rights reserved.

Magnetic nanobeads present during enzymatic amplification and labeling for a simplified DNA detection protocol based on AC susceptometry

NASA Astrophysics Data System (ADS)

Bejhed, Rebecca S.; Strømme, Maria; Svedlindh, Peter; Ahlford, Annika; Strömberg, Mattias

2015-12-01

Magnetic biosensors are promising candidates for low-cost point-of-care biodiagnostic devices. For optimal efficiency it is crucial to minimize the time and complexity of the assay protocol including target recognition, amplification, labeling and read-out. In this work, possibilities for protocol simplifications for a DNA biodetection principle relying on hybridization of magnetic nanobeads to rolling circle amplification (RCA) products are investigated. The target DNA is recognized through a padlock ligation assay resulting in DNA circles serving as templates for the RCA process. It is found that beads can be present during amplification without noticeably interfering with the enzyme used for RCA (phi29 polymerase). As a result, the bead-coil hybridization can be performed immediately after amplification in a one-step manner at elevated temperature within a few minutes prior to read-out in an AC susceptometer setup, i.e. a combined protocol approach. Moreover, by recording the phase angle ξ = arctan(χ″/χ'), where χ and χ″ are the in-phase and out-of-phase components of the AC susceptibility, respectively, at one single frequency the total assay time for the optimized combined protocol would be no more than 1.5 hours, often a relevant time frame for diagnosis of cancer and infectious disease. Also, applying the phase angle method normalization of AC susceptibility data is not needed. These findings are useful for the development of point-of-care biodiagnostic devices relying on bead-coil binding and magnetic AC susceptometry.

Detection of bovine mastitis pathogens by loop-mediated isothermal amplification and an electrochemical DNA chip.

PubMed

Kawai, Kazuhiro; Inada, Mika; Ito, Keiko; Hashimoto, Koji; Nikaido, Masaru; Hata, Eiji; Katsuda, Ken; Kiku, Yoshio; Tagawa, Yuichi; Hayashi, Tomohito

2017-12-22

Bovine mastitis causes significant economic losses in the dairy industry. Effective prevention of bovine mastitis requires an understanding of the infection status of a pathogenic microorganism in a herd that has not yet shown clinical signs of mastitis and appropriate treatment specific for the pathogenic microorganism. However, bacterial identification by culture has drawbacks in that the sensitivity may be low and the procedure can be complex. In this study, we developed a genetic detection method to identify mastitis pathogens using a simple and highly sensitive electrochemical DNA chip which can specifically detect bacterial DNA in milk specimens. First, we selected microorganisms belonging to 12 families and/or genera associated with mastitis for which testing should be performed. Next, we optimized the conditions for amplifying microorganism DNA by loop-mediated isothermal amplification (LAMP) using 32 primers and the use of a DNA chip capable of measuring all pathogens simultaneously. Sample detection could be completed in just a few hours using this method. Comparison of the results obtained with our DNA chip method and those obtained by bacterial culture verified that when the culture method was set to 100%, the total positive concordance rate of the DNA chip was 85.0% and the total negative concordance rate was 86.9%. Furthermore, the proposed method allows both rapid and highly sensitive detection of mastitis pathogens. We believe that this method will contribute to the development of an effective mastitis control program.

Detection of bovine mastitis pathogens by loop-mediated isothermal amplification and an electrochemical DNA chip

PubMed Central

KAWAI, Kazuhiro; INADA, Mika; ITO, Keiko; HASHIMOTO, Koji; NIKAIDO, Masaru; HATA, Eiji; KATSUDA, Ken; KIKU, Yoshio; TAGAWA, Yuichi; HAYASHI, Tomohito

2017-01-01

Bovine mastitis causes significant economic losses in the dairy industry. Effective prevention of bovine mastitis requires an understanding of the infection status of a pathogenic microorganism in a herd that has not yet shown clinical signs of mastitis and appropriate treatment specific for the pathogenic microorganism. However, bacterial identification by culture has drawbacks in that the sensitivity may be low and the procedure can be complex. In this study, we developed a genetic detection method to identify mastitis pathogens using a simple and highly sensitive electrochemical DNA chip which can specifically detect bacterial DNA in milk specimens. First, we selected microorganisms belonging to 12 families and/or genera associated with mastitis for which testing should be performed. Next, we optimized the conditions for amplifying microorganism DNA by loop-mediated isothermal amplification (LAMP) using 32 primers and the use of a DNA chip capable of measuring all pathogens simultaneously. Sample detection could be completed in just a few hours using this method. Comparison of the results obtained with our DNA chip method and those obtained by bacterial culture verified that when the culture method was set to 100%, the total positive concordance rate of the DNA chip was 85.0% and the total negative concordance rate was 86.9%. Furthermore, the proposed method allows both rapid and highly sensitive detection of mastitis pathogens. We believe that this method will contribute to the development of an effective mastitis control program. PMID:29093278

A powerless on-the-spot detection protocol for transgenic crops within 30 min, from leaf sampling up to results.

PubMed

Wang, Liu; Wang, Rui; Yu, Yonghua; Zhang, Fang; Wang, Xiaofu; Ying, Yibin; Wu, Jian; Xu, Junfeng

2016-01-01

The requirement of power-dependent instruments or excessive operation time usually restricts current nucleic acid amplification methods from being used for detection of transgenic crops in the field. In this paper, an easy and rapid detection method which requires no electricity supply has been developed. The time-consuming process of nucleic acid purification is omitted in this method. DNA solution obtained from leaves with 0.5 M sodium hydroxide (NaOH) can be used for loop-mediated isothermal amplification (LAMP) only after simple dilution. Traditional instruments like a polymerase chain reaction (PCR) amplifier and water bath used for DNA amplification are abandoned. Three kinds of dewar flasks were tested and it turned out that the common dewar flask was the best. Combined with visual detection of LAMP amplicons by phosphate (Pi)-induced coloration reaction, the whole process of detection of transgenic crops via genetically pure material (leaf material of one plant) could be accomplished within 30 min. The feasibility of this method was also verified by analysis of practical samples.

Development of a rapid assay to detect the jellyfish Cyanea nozakii using a loop-mediated isothermal amplification method.

PubMed

Liu, Zhongyuan; Dong, Zhijun; Liu, Dongyan

2016-07-01

Blooms of the harmful jellyfish Cyanea nozakii, which are a severe nuisance to fisheries and tourisms, frequently occur in the northern East China Sea, Yellow Sea, and Bohai Sea. To provide early warning of this species, a simple and effective molecular method for identifying C. nozakii was developed using the loop-mediated isothermal amplification method (LAMP). The LAMP assay is highly specific and uses a set of four primers that target six different regions on the mitochondrial cytochrome c oxidase subunit I (COI) gene of C. nozakii. The amplification conditions, including the dNTP and betaine concentrations, the inner primer to outer primer concentration ratio, reaction time and temperature, were optimized. The LAMP assay amplified DNA extracted from tissue samples of C. nozakii but did not amplify DNA from other common scyphozoans and hydrozoans collected in the same region. In addition, the LAMP assay was more sensitive than conventional PCR. Therefore, the established LAMP assay is a sensitive, specific, fast, and easily performed method for detection of C. nozakii at different stages in their life cycle.

Recombinase polymerase amplification (RPA) combined with lateral flow (LF) strip for equipment-free detection of Cryptosporidium spp. oocysts in dairy cattle feces.

PubMed

Wu, Yao-Dong; Zhou, Dong-Hui; Zhang, Long-Xian; Zheng, Wen-Bin; Ma, Jian-Gang; Wang, Meng; Zhu, Xing-Quan; Xu, Min-Jun

2016-09-01

Cryptosporidium is a widespread protozoan parasite that infects a large number of vertebrate animals, resulting in varying degrees of diarrhea or even death. As dairy cattle feces is an important source of Cryptosporidium spp. infection, development of a handy and accurate detection method via its oocysts in dairy cattle feces would be interesting and necessary. We herein developed a quick detecting method using recombinase polymerase amplification (RPA) combined with lateral flow (LF) strip to detect DNA of Cryptosporidium oocysts in dairy cattle feces. The DNA was released by boiled water with 0.1 % N-lauroylsarcosine sodium salt (LSS). The established method was proven to be of higher sensitivity than normal polymerase chain reaction (PCR) amplification with the lowest detection of 0.5 oocyst per reaction, and specificity with no cross reactivity to other common protozoan species in the intestine of dairy cattle. The diagnostic method established herein is simple, rapid, and cost-effective, and has potential for further development as a diagnostic kit for the diagnosis of cryptosporidiosis of dairy cattle.

3' rapid amplification of cDNA ends (RACE) walking for rapid structural analysis of large transcripts.

PubMed

Ozawa, Tatsuhiko; Kondo, Masato; Isobe, Masaharu

2004-01-01

The 3' rapid amplification of cDNA ends (3' RACE) is widely used to isolate the cDNA of unknown 3' flanking sequences. However, the conventional 3' RACE often fails to amplify cDNA from a large transcript if there is a long distance between the 5' gene-specific primer and poly(A) stretch, since the conventional 3' RACE utilizes 3' oligo-dT-containing primer complementary to the poly(A) tail of mRNA at the first strand cDNA synthesis. To overcome this problem, we have developed an improved 3' RACE method suitable for the isolation of cDNA derived from very large transcripts. By using the oligonucleotide-containing random 9mer together with the GC-rich sequence for the suppression PCR technology at the first strand of cDNA synthesis, we have been able to amplify the cDNA from a very large transcript, such as the microtubule-actin crosslinking factor 1 (MACF1) gene, which codes a transcript of 20 kb in size. When there is no splicing variant, our highly specific amplification allows us to perform the direct sequencing of 3' RACE products without requiring cloning in bacterial hosts. Thus, this stepwise 3' RACE walking will help rapid characterization of the 3' structure of a gene, even when it encodes a very large transcript.

Chemical synthesis and characterization of branched oligodeoxyribonucleotides (bDNA) for use as signal amplifiers in nucleic acid quantification assays.

PubMed

Horn, T; Chang, C A; Urdea, M S

1997-12-01

The divergent synthesis of bDNA structures is described. This new type of branched DNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branching network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb molecules were assembled on a solid support using parameters optimized for bDNA synthesis. The chemistry was used to synthesize bDNA comb molecules containing 15 secondary sequences. The bDNA comb molecules were elaborated by enzymatic ligation into branched amplification multimers, large bDNA molecules (a total of 1068 nt) containing an average of 36 repeated DNA oligomer sequences, each capable of hybridizing specifically to an alkaline phosphatase-labeled oligonucleotide. The bDNA comb molecules were characterized by electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The branched amplification multimers have been used as signal amplifiers in nucleic acid quantification assays for detection of viral infection. It is possible to detect as few as 50 molecules with bDNA technology.

Chemical synthesis and characterization of branched oligodeoxyribonucleotides (bDNA) for use as signal amplifiers in nucleic acid quantification assays.

PubMed Central

Horn, T; Chang, C A; Urdea, M S

1997-01-01

The divergent synthesis of bDNA structures is described. This new type of branched DNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branching network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb molecules were assembled on a solid support using parameters optimized for bDNA synthesis. The chemistry was used to synthesize bDNA comb molecules containing 15 secondary sequences. The bDNA comb molecules were elaborated by enzymatic ligation into branched amplification multimers, large bDNA molecules (a total of 1068 nt) containing an average of 36 repeated DNA oligomer sequences, each capable of hybridizing specifically to an alkaline phosphatase-labeled oligonucleotide. The bDNA comb molecules were characterized by electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The branched amplification multimers have been used as signal amplifiers in nucleic acid quantification assays for detection of viral infection. It is possible to detect as few as 50 molecules with bDNA technology. PMID:9365266

THE USE OF MULTIPLE DISPLACEMENT AMPLIFICATION TO INCREASE THE DETECTION AND GENOTYPING OF TRYPANOSOMA SPECIES SAMPLES IMMOBILISED ON FTA FILTERS

PubMed Central

MORRISON, LIAM J.; McCORMACK, GILLIAN; SWEENEY, LINDSAY; LIKEUFACK, ANNE C. L.; TRUC, PHILIPPE; TURNER, C. MICHAEL; TAIT, ANDY; MacLEOD, ANNETTE

2007-01-01

Whole genome amplification methods are a recently developed tool for amplifying DNA from limited template. We report its application in trypanosome infections, characterised by low parasitaemias. Multiple Displacement Amplification (MDA) amplifies DNA with a simple in vitro step, and was evaluated on mouse blood samples on FTA filter cards with known numbers of Trypanosoma brucei parasites. The data showed a twenty-fold increase in the number of PCRs possible per sample, using primers diagnostic for the multi-copy ribosomal ITS region or 177 bp repeats, and a twenty-fold increase in sensitivity over nested PCR against a single copy microsatellite. Using MDA for microsatellite genotyping caused allele dropout at low DNA concentrations, which was overcome by pooling multiple MDA reactions. The validity of using MDA was established with samples from Human African Trypanosomiasis patients. The use of MDA allows maximal use of finite DNA samples and may prove a valuable tool in studies where multiple reactions are necessary, such as population genetic analyses. PMID:17556624

Ultrasensitive detection of nucleic acids and proteins using quartz crystal microbalance and surface plasmon resonance sensors based on target-triggering multiple signal amplification strategy.

PubMed

Sun, Wenbo; Song, Weiling; Guo, Xiaoyan; Wang, Zonghua

2017-07-25

In this study, quartz crystal microbalance (QCM) and surface plasmon resonance (SPR) sensors were combined with template enhanced hybridization processes (TEHP), rolling circle amplification (RCA) and biocatalytic precipitation (BCP) for ultrasensitive detection of DNA and protein. The DNA complementary to the aptamer was released by the specific binding of the aptamer to the target protein and then hybridized with the capture probe and the assistant DNA to form a ternary "Y" junction structure. The initiation chain was generated by the template-enhanced hybridization process which leaded to the rolling circle amplification reaction, and a large number of repeating unit sequences were formed. Hybridized with the enzyme-labeled probes, the biocatalytic precipitation reaction was further carried out, resulting in a large amount of insoluble precipitates and amplifying the detection signal. Under the optimum conditions, detection limits as low as 43 aM for target DNA and 53 aM for lysozyme were achieved. In addition, this method also showed good selectivity and sensitivity in human serum. Copyright © 2017 Elsevier B.V. All rights reserved.

Microfluidic electrochemical assay for rapid detection and quantification of Escherichia coli.

PubMed

Safavieh, Mohammadali; Ahmed, Minhaz Uddin; Tolba, Mona; Zourob, Mohammed

2012-01-15

Microfluidic electrochemical biosensor for performing Loop-mediated isothermal amplification (LAMP) was developed for the detection and quantification of Escherichia coli. The electrochemical detection for detecting the DNA amplification was achieved using Hoechst 33258 redox molecule and linear sweep voltametry (LSV). The DNA aggregation and minor groove binding with redox molecule cause a significant drop in the anodic oxidation of LSV. Unlike other electrochemical techniques, this method does not require the probe immobilization and the detection of the bacteria can be accomplished in a single chamber without DNA extraction and purification steps. The isothermal amplification time has a major role in the quantification of the bacteria. We have shown that we could detect and quantify 24 CFU/ml of bacteria and 8.6 fg/μl DNA in 60 min and 48 CFU/ml of bacteria in 35 min in LB media and urine samples. We believe that this microfluidic chip has great potential to be used as a point of care diagnostic (POC) device in the clinical/hospital application. Copyright © 2011 Elsevier B.V. All rights reserved.

Development of NIST standard reference material 2373: Genomic DNA standards for HER2 measurements.

PubMed

He, Hua-Jun; Almeida, Jamie L; Lund, Steve P; Steffen, Carolyn R; Choquette, Steve; Cole, Kenneth D

2016-06-01

NIST standard reference material (SRM) 2373 was developed to improve the measurements of the HER2 gene amplification in DNA samples. SRM 2373 consists of genomic DNA extracted from five breast cancer cell lines with different amounts of amplification of the HER2 gene. The five components are derived from the human cell lines SK-BR-3, MDA-MB-231, MDA-MB-361, MDA-MB-453, and BT-474. The certified values are the ratios of the HER2 gene copy numbers to the copy numbers of selected reference genes DCK, EIF5B, RPS27A, and PMM1. The ratios were measured using quantitative polymerase chain reaction and digital PCR, methods that gave similar ratios. The five components of SRM 2373 have certified HER2 amplification ratios that range from 1.3 to 17.7. The stability and homogeneity of the reference materials were shown by repeated measurements over a period of several years. SRM 2373 is a well characterized genomic DNA reference material that can be used to improve the confidence of the measurements of HER2 gene copy number.

Optimization and evaluation of T7 based RNA linear amplification protocols for cDNA microarray analysis

PubMed Central

Zhao, Hongjuan; Hastie, Trevor; Whitfield, Michael L; Børresen-Dale, Anne-Lise; Jeffrey, Stefanie S

2002-01-01

Background T7 based linear amplification of RNA is used to obtain sufficient antisense RNA for microarray expression profiling. We optimized and systematically evaluated the fidelity and reproducibility of different amplification protocols using total RNA obtained from primary human breast carcinomas and high-density cDNA microarrays. Results Using an optimized protocol, the average correlation coefficient of gene expression of 11,123 cDNA clones between amplified and unamplified samples is 0.82 (0.85 when a virtual array was created using repeatedly amplified samples to minimize experimental variation). Less than 4% of genes show changes in expression level by 2-fold or greater after amplification compared to unamplified samples. Most changes due to amplification are not systematic both within one tumor sample and between different tumors. Amplification appears to dampen the variation of gene expression for some genes when compared to unamplified poly(A)+ RNA. The reproducibility between repeatedly amplified samples is 0.97 when performed on the same day, but drops to 0.90 when performed weeks apart. The fidelity and reproducibility of amplification is not affected by decreasing the amount of input total RNA in the 0.3–3 micrograms range. Adding template-switching primer, DNA ligase, or column purification of double-stranded cDNA does not improve the fidelity of amplification. The correlation coefficient between amplified and unamplified samples is higher when total RNA is used as template for both experimental and reference RNA amplification. Conclusion T7 based linear amplification reproducibly generates amplified RNA that closely approximates original sample for gene expression profiling using cDNA microarrays. PMID:12445333

Evaluation of whole genome amplified DNA to decrease material expenditure and increase quality.

PubMed

Bækvad-Hansen, Marie; Bybjerg-Grauholm, Jonas; Poulsen, Jesper B; Hansen, Christine S; Hougaard, David M; Hollegaard, Mads V

2017-06-01

The overall aim of this study is to evaluate whole genome amplification of DNA extracted from dried blood spot samples. We wish to explore ways of optimizing the amplification process, while decreasing the amount of input material and inherently the cost. Our primary focus of optimization is on the amount of input material, the amplification reaction volume, the number of replicates and amplification time and temperature. Increasing the quality of the amplified DNA and the subsequent results of array genotyping is a secondary aim of this project. This study is based on DNA extracted from dried blood spot samples. The extracted DNA was subsequently whole genome amplified using the REPLIg kit and genotyped on the PsychArray BeadChip (assessing > 570,000 SNPs genome wide). We used Genome Studio to evaluate the quality of the genotype data by call rates and log R ratios. The whole genome amplification process is robust and does not vary between replicates. Altering amplification time, temperature or number of replicates did not affect our results. We found that spot size i.e. amount of input material could be reduced without compromising the quality of the array genotyping data. We also showed that whole genome amplification reaction volumes can be reduced by a factor of 4, without compromising the DNA quality. Whole genome amplified DNA samples from dried blood spots is well suited for array genotyping and produces robust and reliable genotype data. However, the amplification process introduces additional noise to the data, making detection of structural variants such as copy number variants difficult. With this study, we explore ways of optimizing the amplification protocol in order to reduce noise and increase data quality. We found, that the amplification process was very robust, and that changes in amplification time or temperature did not alter the genotyping calls or quality of the array data. Adding additional replicates of each sample also lead to insignificant changes in the array data. Thus, the amount of noise introduced by the amplification process was consistent regardless of changes made to the amplification protocol. We also explored ways of decreasing material expenditure by reducing the spot size or the amplification reaction volume. The reduction did not affect the quality of the genotyping data.

PCR-based detection of a rare linear DNA in cell culture.

PubMed

Saveliev, Sergei V.

2002-11-11

The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 10(7) or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.

PCR-based detection of a rare linear DNA in cell culture

PubMed Central

2002-01-01

The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 107 or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials. PMID:12734566

Loop-mediated isothermal amplification (LAMP): a versatile technique for detection of micro-organisms.

PubMed

Wong, Y-P; Othman, S; Lau, Y-L; Radu, S; Chee, H-Y

2018-03-01

Loop-mediated isothermal amplification (LAMP) amplifies DNA with high specificity, efficiency and rapidity under isothermal conditions by using a DNA polymerase with high displacement strand activity and a set of specifically designed primers to amplify targeted DNA strands. Following its first discovery by Notomi et al. ( Nucleic Acids Res 28: E63), LAMP was further developed over the years which involved the combination of this technique with other molecular approaches, such as reverse transcription and multiplex amplification for the detection of infectious diseases caused by micro-organisms in humans, livestock and plants. In this review, available types of LAMP techniques will be discussed together with their applications in detection of various micro-organisms. Up to date, there are varieties of LAMP detection methods available including colorimetric and fluorescent detection, real-time monitoring using turbidity metre and detection using lateral flow device which will also be highlighted in this review. Apart from that, commercialization of LAMP technique had also been reported such as lyophilized form of LAMP reagents kit and LAMP primer sets for detection of pathogenic micro-organisms. On top of that, advantages and limitations of this molecular detection method are also described together with its future potential as a diagnostic method for infectious disease. © 2017 The Society for Applied Microbiology.

Development and application of loop-mediated isothermal amplification (LAMP) for detection of Plasmopara viticola

PubMed Central

Kong, Xiangjiu; Qin, Wentao; Huang, Xiaoqing; Kong, Fanfang; Schoen, Cor D.; Feng, Jie; Wang, Zhongyue; Zhang, Hao

2016-01-01

A rapid LAMP (loop-mediated isothermal amplification) detection method was developed on the basis of the ITS sequence of P. viticola, the major causal agent of grape downy mildew. Among the 38 fungal and oomycete species tested, DNA isolated exclusively from P. viticola resulted in a specific product after LAMP amplification. This assay had high sensitivity and was able to detect the presence of less than 33 fg of genomic DNA per 25-μL reaction within 30 min. The infected leaves may produce sporangia that serve as a secondary inoculum. The developed LAMP assay is efficient for estimating the latent infection of grape leaves by P. viticola. When combined with the rapid and simple DNA extraction method, this assay’s total detection time is shortened to approximately one hour; therefore it is suitable for on-site detection of latent infection in the field. The sporangia levels in the air are strongly associated with disease severity. The LAMP method was also demonstrated to be able to estimate the level of sporangia released in the air in a certain period. This assay should make disease forecasting more accurate and rapid and should be helpful in decision-making regarding the control of grape downy mildew. PMID:27363943

An evaluation of tyramide signal amplification and archived fixed and frozen tissue in microarray gene expression analysis

PubMed Central

Karsten, Stanislav L.; Van Deerlin, Vivianna M. D.; Sabatti, Chiara; Gill, Lisa H.; Geschwind, Daniel H.

2002-01-01

Archival formalin-fixed, paraffin-embedded and ethanol-fixed tissues represent a potentially invaluable resource for gene expression analysis, as they are the most widely available material for studies of human disease. Little data are available evaluating whether RNA obtained from fixed (archival) tissues could produce reliable and reproducible microarray expression data. Here we compare the use of RNA isolated from human archival tissues fixed in ethanol and formalin to frozen tissue in cDNA microarray experiments. Since an additional factor that can limit the utility of archival tissue is the often small quantities available, we also evaluate the use of the tyramide signal amplification method (TSA), which allows the use of small amounts of RNA. Detailed analysis indicates that TSA provides a consistent and reproducible signal amplification method for cDNA microarray analysis, across both arrays and the genes tested. Analysis of this method also highlights the importance of performing non-linear channel normalization and dye switching. Furthermore, archived, fixed specimens can perform well, but not surprisingly, produce more variable results than frozen tissues. Consistent results are more easily obtainable using ethanol-fixed tissues, whereas formalin-fixed tissue does not typically provide a useful substrate for cDNA synthesis and labeling. PMID:11788730

DNase I enzyme-aided fluorescence signal amplification based on graphene oxide-DNA aptamer interactions for colorectal cancer exosome detection.

PubMed

Wang, Hui; Chen, Hui; Huang, Zhipeng; Li, Tengda; Deng, Anmei; Kong, Jilie

2018-07-01

Exosomes have proved to be an effective cancer biomarker with significant potential, and several cell-specific molecules have been found in colorectal cancer (CRC) exosomes. Nevertheless, it is challenging to use exosomes in clinical lab diagnostics due to their nanoscale and the lack of a convenient and effective detection platform. Here, we developed a DNase I enzyme-aided fluorescence amplification method for CRC exosome detection, based on graphene oxide (GO)-DNA aptamer (CD63 and EpCAM aptamers) interactions. The fluorescence of fluorophore-labeled aptamers quenched by GO, recovered after incubation with samples containing CRC exosomes. The DNase I enzyme digested the single-stranded DNA aptamers on the exosome surface and the exosomes were able to interact with more fluorescent aptamer probes, resulting in an increase of signal amplification. The limit of detection for CRC exosomes is 2.1 × 10 4 particles/μl. Consequently, a rapid and effective method with high sensitivity was established. The method was verified in 19 clinical blood serum samples to distinguish healthy and CRC patients, showing significant diagnostic power. Moreover, it can be expanded to other kinds of cancer exosomes, in addition to CRC. Copyright © 2018 Elsevier B.V. All rights reserved.

A cascade amplification strategy based on rolling circle amplification and hydroxylamine amplified gold nanoparticles enables chemiluminescence detection of adenosine triphosphate.

PubMed

Wang, Ping; Zhang, Tonghuan; Yang, Taoyi; Jin, Nan; Zhao, Yanjun; Fan, Aiping

2014-08-07

A highly sensitive and selective chemiluminescent (CL) biosensor for adenosine triphosphate (ATP) was developed by taking advantage of the ATP-dependent enzymatic reaction (ATP-DER), the powerful signal amplification capability of rolling circle amplification (RCA), and hydroxylamine-amplified gold nanoparticles (Au NPs). The strategy relies on the ability of ATP, a cofactor of T4 DNA ligase, to trigger the ligation-RCA reaction. In the presence of ATP, the T4 DNA ligase catalyzes the ligation reaction between the two ends of the padlock probe, producing a closed circular DNA template that initiates the RCA reaction with phi29 DNA polymerase and dNTP. Therein, many complementary copies of the circular template can be generated. The ATP-DER is eventually converted into a detectable CL signal after a series of processes, including gold probe hybridization, hydroxylamine amplification, and oxidative gold metal dissolution coupled with a simple and sensitive luminol CL reaction. The CL signal is directly proportional to the ATP level. The results showed that the detection limit of the assay is 100 pM of ATP, which compares favorably with those of other ATP detection techniques. In addition, by taking advantage of ATP-DER, the proposed CL sensing system exhibits extraordinary specificity towards ATP and could distinguish the target molecule ATP from its analogues. The proposed method provides a new and versatile platform for the design of novel DNA ligation reaction-based CL sensing systems for other cofactors. This novel ATP-DER based CL sensing system may find wide applications in clinical diagnosis as well as in environmental and biomedical fields.

Improved technique that allows the performance of large-scale SNP genotyping on DNA immobilized by FTA technology.

PubMed

He, Hongbin; Argiro, Laurent; Dessein, Helia; Chevillard, Christophe

2007-01-01

FTA technology is a novel method designed to simplify the collection, shipment, archiving and purification of nucleic acids from a wide variety of biological sources. The number of punches that can normally be obtained from a single specimen card are often however, insufficient for the testing of the large numbers of loci required to identify genetic factors that control human susceptibility or resistance to multifactorial diseases. In this study, we propose an improved technique to perform large-scale SNP genotyping. We applied a whole genome amplification method to amplify DNA from buccal cell samples stabilized using FTA technology. The results show that using the improved technique it is possible to perform up to 15,000 genotypes from one buccal cell sample. Furthermore, the procedure is simple. We consider this improved technique to be a promising methods for performing large-scale SNP genotyping because the FTA technology simplifies the collection, shipment, archiving and purification of DNA, while whole genome amplification of FTA card bound DNA produces sufficient material for the determination of thousands of SNP genotypes.

A mass spectrometry-based multiplex SNP genotyping by utilizing allele-specific ligation and strand displacement amplification.

PubMed

Park, Jung Hun; Jang, Hyowon; Jung, Yun Kyung; Jung, Ye Lim; Shin, Inkyung; Cho, Dae-Yeon; Park, Hyun Gyu

2017-05-15

We herein describe a new mass spectrometry-based method for multiplex SNP genotyping by utilizing allele-specific ligation and strand displacement amplification (SDA) reaction. In this method, allele-specific ligation is first performed to discriminate base sequence variations at the SNP site within the PCR-amplified target DNA. The primary ligation probe is extended by a universal primer annealing site while the secondary ligation probe has base sequences as an overhang with a nicking enzyme recognition site and complementary mass marker sequence. The ligation probe pairs are ligated by DNA ligase only at specific allele in the target DNA and the resulting ligated product serves as a template to promote the SDA reaction using a universal primer. This process isothermally amplifies short DNA fragments, called mass markers, to be analyzed by mass spectrometry. By varying the sizes of the mass markers, we successfully demonstrated the multiplex SNP genotyping capability of this method by reliably identifying several BRCA mutations in a multiplex manner with mass spectrometry. Copyright © 2016 Elsevier B.V. All rights reserved.

Direct amplification of DNA from fresh and preserved ectomycorrhizal root tips

Treesearch

Elizabeth Bent; D. Lee Taylor

2009-01-01

Methods are described by which DNA can be amplified directly from ectomycorrhizal root tip homogenates of a variety of plant species (Picea mariana (black spruce), Betula papyrifera (paper birch), Populus tremuloides (trembling aspen) and Alnus sp.(alder)), including root tips that have...

Development and evaluation of probe based real time loop mediated isothermal amplification for Salmonella: A new tool for DNA quantification.

PubMed

Mashooq, Mohmad; Kumar, Deepak; Niranjan, Ankush Kiran; Agarwal, Rajesh Kumar; Rathore, Rajesh

2016-07-01

A one step, single tube, accelerated probe based real time loop mediated isothermal amplification (RT LAMP) assay was developed for detecting the invasion gene (InvA) of Salmonella. The probe based RT LAMP is a novel method of gene amplification that amplifies nucleic acid with high specificity and rapidity under isothermal conditions with a set of six primers. The whole procedure is very simple and rapid, and amplification can be obtained in 20min. Detection of gene amplification was accomplished by amplification curve, turbidity and addition of DNA binding dye at the end of the reaction results in colour difference and can be visualized under normal day light and in UV. The sensitivity of developed assay was found 10 fold higher than taqman based qPCR. The specificity of the RT LAMP assay was validated by the absence of any cross reaction with other members of enterobacteriaceae family and other gram negative bacteria. These results indicate that the probe based RT LAMP assay is extremely rapid, cost effective, highly specific and sensitivity and has potential usefulness for rapid Salmonella surveillance. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.

Ultrasensitive electrochemical biosensor for detection of DNA from Bacillus subtilis by coupling target-induced strand displacement and nicking endonuclease signal amplification.

PubMed

Hu, Yuhua; Xu, Xueqin; Liu, Qionghua; Wang, Ling; Lin, Zhenyu; Chen, Guonan

2014-09-02

A simple, ultrasensitive, and specific electrochemical biosensor was designed to determine the given DNA sequence of Bacillus subtilis by coupling target-induced strand displacement and nicking endonuclease signal amplification. The target DNA (TD, the DNA sequence from the hypervarient region of 16S rDNA of Bacillus subtilis) could be detected by the differential pulse voltammetry (DPV) in a range from 0.1 fM to 20 fM with the detection limit down to 0.08 fM at the 3s(blank) level. This electrochemical biosensor exhibits high distinction ability to single-base mismatch, double-bases mismatch, and noncomplementary DNA sequence, which may be expected to detect single-base mismatch and single nucleotide polymorphisms (SNPs). Moreover, the applicability of the designed biosensor for detecting the given DNA sequence from Bacillus subtilis was investigated. The result obtained by electrochemical method is approximately consistent with that by a real-time quantitative polymerase chain reaction detecting system (QPCR) with SYBR Green.

Construction Strategy for an Internal Amplification Control for Real-Time Diagnostic Assays Using Nucleic Acid Sequence-Based Amplification: Development and Clinical Application

PubMed Central

Rodríguez-Lázaro, David; D'Agostino, Martin; Pla, Maria; Cook, Nigel

2004-01-01

An important analytical control in molecular amplification-based methods is an internal amplification control (IAC), which should be included in each reaction mixture. An IAC is a nontarget nucleic acid sequence which is coamplified simultaneously with the target sequence. With negative results for the target nucleic acid, the absence of an IAC signal indicates that amplification has failed. A general strategy for the construction of an IAC for inclusion in molecular beacon-based real-time nucleic acid sequence-based amplification (NASBA) assays is presented. Construction proceeds in two phases. In the first phase, a double-stranded DNA molecule that contains nontarget sequences flanked by target sequences complementary to the NASBA primers is produced. At the 5′ end of this DNA molecule is a T7 RNA polymerase binding sequence. In the second phase of construction, RNA transcripts are produced from the DNA by T7 RNA polymerase. This RNA is the IAC; it is amplified by the target NASBA primers and is detected by a molecular beacon probe complementary to the internal nontarget sequences. As a practical example, an IAC for use in an assay for the detection of Mycobacterium avium subsp. paratuberculosis is described, its incorporation and optimization within the assay are detailed, and its application to spiked and natural clinical samples is shown to illustrate the correct interpretation of the diagnostic results. PMID:15583319

Preparation of metagenomic libraries from naturally occurring marine viruses.

PubMed

Solonenko, Sergei A; Sullivan, Matthew B

2013-01-01

Microbes are now well recognized as major drivers of the biogeochemical cycling that fuels the Earth, and their viruses (phages) are known to be abundant and important in microbial mortality, horizontal gene transfer, and modulating microbial metabolic output. Investigation of environmental phages has been frustrated by an inability to culture the vast majority of naturally occurring diversity coupled with the lack of robust, quantitative, culture-independent methods for studying this uncultured majority. However, for double-stranded DNA phages, a quantitative viral metagenomic sample-to-sequence workflow now exists. Here, we review these advances with special emphasis on the technical details of preparing DNA sequencing libraries for metagenomic sequencing from environmentally relevant low-input DNA samples. Library preparation steps broadly involve manipulating the sample DNA by fragmentation, end repair and adaptor ligation, size fractionation, and amplification. One critical area of future research and development is parallel advances for alternate nucleic acid types such as single-stranded DNA and RNA viruses that are also abundant in nature. Combinations of recent advances in fragmentation (e.g., acoustic shearing and tagmentation), ligation reactions (adaptor-to-template ratio reference table availability), size fractionation (non-gel-sizing), and amplification (linear amplification for deep sequencing and linker amplification protocols) enhance our ability to generate quantitatively representative metagenomic datasets from low-input DNA samples. Such datasets are already providing new insights into the role of viruses in marine systems and will continue to do so as new environments are explored and synergies and paradigms emerge from large-scale comparative analyses. © 2013 Elsevier Inc. All rights reserved.

A method suitable for DNA extraction from humus-rich soil.

PubMed

Miao, Tianjin; Gao, Song; Jiang, Shengwei; Kan, Guoshi; Liu, Pengju; Wu, Xianming; An, Yingfeng; Yao, Shuo

2014-11-01

A rapid and convenient method for extracting DNA from soil is presented. Soil DNA is extracted by direct cell lysis in the presence of EDTA, SDS, phenol, chloroform and isoamyl alcohol (3-methyl-1-butanol) followed by precipitation with 2-propanol. The extracted DNA is purified by modified DNA purification kit and DNA gel extraction kit. With this method, DNA extracted from humus-rich dark brown forest soil was free from humic substances and, therefore, could be used for efficient PCR amplification and restriction digestion. In contrast, DNA sample extracted with the traditional CTAB-based method had lower yield and purity, and no DNA could be extracted from the same soil sample with a commonly-used commercial soil DNA isolation kit. In addition, this method is time-saving and convenient, providing an efficient choice especially for DNA extraction from humus-rich soils.

Multiplex Allele-Specific Amplification from Whole Blood for Detecting Multiple Polymorphisms Simultaneously

PubMed Central

Zhu, Jianjie; Chen, Lanxin; Mao, Yong; Zhou, Huan

2013-01-01

Allele-specific amplification on the basis of polymerase chain reaction (PCR) has been widely used for single-nucleotide polymorphism (SNP) genotyping. However, the extraction of PCR-compatible genomic DNA from whole blood is usually required. This process is complicated and tedious, and is prone to cause cross-contamination between samples. To facilitate direct PCR amplification from whole blood without the extraction of genomic DNA, we optimized the pH value of PCR solution and the concentrations of magnesium ions and facilitator glycerol. Then, we developed multiplex allele-specific amplifications from whole blood and applied them to a case–control study. In this study, we successfully established triplex, five-plex, and eight-plex allele-specific amplifications from whole blood for determining the distribution of genotypes and alleles of 14 polymorphisms in 97 gastric cancer patients and 141 healthy controls. Statistical analysis results showed significant association of SNPs rs9344, rs1799931, and rs1800629 with the risk of gastric cancer. This method is accurate, time-saving, cost-effective, and easy-to-do, especially suitable for clinical prediction of disease susceptibility. PMID:23072573

Target-regulated proximity hybridization with three-way DNA junction for in situ enhanced electronic detection of marine biotoxin based on isothermal cycling signal amplification strategy.

PubMed

Liu, Bingqian; Chen, Jinfeng; Wei, Qiaohua; Zhang, Bing; Zhang, Lan; Tang, Dianping

2015-07-15

A new signal amplification strategy based on target-regulated DNA proximity hybridization (TRPH) reaction accompanying formation of three-way DNA junction was designed for electronic detection of Microcystin-LR (MC-LR used in this case), coupling with junction-induced isothermal cycling signal amplification. Initially, a sandwiched-type immunoreaction was carried out in a low-cost PCR tube between anti-MC-LR mAb1 antibody-labeled DNA1 (mAb1-DNA1) and anti-MC-LR mAb2-labeled DNA2 (mAb2-DNA2) in the presence of target to form a three-way DNA junction. Then, the junction could undergo an unbiased strand displacement reaction on an h-like DNA nanostructure-modified electrode (labeled with methylene blue redox tag on the short DNA strand), thereby resulting in the dissociation of methylene blue-labeled signal DNA from the electrode. The newly formed double-stranded DNA could be cleaved again by exonuclease III, and the released three-way DNA junction retriggered the strand-displacement reaction with h-like DNA nanostructures for junction recycling. During the strand-displacement reaction, numerous methylene blue-labeled DNA strands were far away from the electrode, thus decreasing the detectable electrochemical signal within the applied potentials. Under optimal conditions, the TRPH-based immunosensing system exhibited good electrochemical responses for detecting target MC-LR at a concentration as low as 1.0ngkg(-1) (1.0ppt). Additionally, the precision, reproducibility, specificity and method accuracy were also investigated with acceptable results. Copyright © 2015 Elsevier B.V. All rights reserved.

Comparison of whole-genome bisulfite sequencing library preparation strategies identifies sources of biases affecting DNA methylation data.

PubMed

Olova, Nelly; Krueger, Felix; Andrews, Simon; Oxley, David; Berrens, Rebecca V; Branco, Miguel R; Reik, Wolf

2018-03-15

Whole-genome bisulfite sequencing (WGBS) is becoming an increasingly accessible technique, used widely for both fundamental and disease-oriented research. Library preparation methods benefit from a variety of available kits, polymerases and bisulfite conversion protocols. Although some steps in the procedure, such as PCR amplification, are known to introduce biases, a systematic evaluation of biases in WGBS strategies is missing. We perform a comparative analysis of several commonly used pre- and post-bisulfite WGBS library preparation protocols for their performance and quality of sequencing outputs. Our results show that bisulfite conversion per se is the main trigger of pronounced sequencing biases, and PCR amplification builds on these underlying artefacts. The majority of standard library preparation methods yield a significantly biased sequence output and overestimate global methylation. Importantly, both absolute and relative methylation levels at specific genomic regions vary substantially between methods, with clear implications for DNA methylation studies. We show that amplification-free library preparation is the least biased approach for WGBS. In protocols with amplification, the choice of bisulfite conversion protocol or polymerase can significantly minimize artefacts. To aid with the quality assessment of existing WGBS datasets, we have integrated a bias diagnostic tool in the Bismark package and offer several approaches for consideration during the preparation and analysis of WGBS datasets.

A quantitative evaluation of two methods for preserving hair samples

USGS Publications Warehouse

Roon, David A.; Waits, L.P.; Kendall, K.C.

2003-01-01

Hair samples are an increasingly important DNA source for wildlife studies, yet optimal storage methods and DNA degradation rates have not been rigorously evaluated. We tested amplification success rates over a one-year storage period for DNA extracted from brown bear (Ursus arctos) hair samples preserved using silica desiccation and -20C freezing. For three nuclear DNA microsatellites, success rates decreased significantly after a six-month time point, regardless of storage method. For a 1000 bp mitochondrial fragment, a similar decrease occurred after a two-week time point. Minimizing delays between collection and DNA extraction will maximize success rates for hair-based noninvasive genetic sampling projects.

Novel approach for deriving genome wide SNP analysis data from archived blood spots

PubMed Central

2012-01-01

Background The ability to transport and store DNA at room temperature in low volumes has the advantage of optimising cost, time and storage space. Blood spots on adapted filter papers are popular for this, with FTA (Flinders Technology Associates) Whatman™TM technology being one of the most recent. Plant material, plasmids, viral particles, bacteria and animal blood have been stored and transported successfully using this technology, however the method of porcine DNA extraction from FTA Whatman™TM cards is a relatively new approach, allowing nucleic acids to be ready for downstream applications such as PCR, whole genome amplification, sequencing and subsequent application to single nucleotide polymorphism microarrays has hitherto been under-explored. Findings DNA was extracted from FTA Whatman™TM cards (following adaptations of the manufacturer’s instructions), whole genome amplified and subsequently analysed to validate the integrity of the DNA for downstream SNP analysis. DNA was successfully extracted from 288/288 samples and amplified by WGA. Allele dropout post WGA, was observed in less than 2% of samples and there was no clear evidence of amplification bias nor contamination. Acceptable call rates on porcine SNP chips were also achieved using DNA extracted and amplified in this way. Conclusions DNA extracted from FTA Whatman cards is of a high enough quality and quantity following whole genomic amplification to perform meaningful SNP chip studies. PMID:22974252

Electrochemical biosensor based on functional composite nanofibers for detection of K-ras gene via multiple signal amplification strategy.

PubMed

Wang, Xiaoying; Shu, Guofang; Gao, Chanchan; Yang, Yu; Xu, Qian; Tang, Meng

2014-12-01

An electrochemical biosensor based on functional composite nanofibers for hybridization detection of specific K-ras gene that is highly associated with colorectal cancer via multiple signal amplification strategy has been developed. The carboxylated multiwalled carbon nanotubes (MWCNTs) doped nylon 6 (PA6) composite nanofibers (MWCNTs-PA6) was prepared using electrospinning, which served as the nanosized backbone for thionine (TH) electropolymerization. The functional composite nanofibers [MWCNTs-PA6-PTH, where PTH is poly(thionine)] used as supporting scaffolds for single-stranded DNA1 (ssDNA1) immobilization can dramatically increase the amount of DNA attachment and the hybridization sensitivity. Through the hybridization reaction, a sandwich format of ssDNA1/K-ras gene/gold nanoparticle-labeled ssDNA2 (AuNPs-ssDNA2) was fabricated, and the AuNPs offered excellent electrochemical signal transduction. The signal amplification was further implemented by forming network-like thiocyanuric acid/gold nanoparticles (TA/AuNPs). A significant sensitivity enhancement was obtained; the detection limit was down to 30fM, and the discriminations were up to 54.3 and 51.9% between the K-ras gene and the one-base mismatched sequences including G/C and A/T mismatched bases, respectively. The amenability of this method to the analyses of K-ras gene from the SW480 colorectal cancer cell lysates was demonstrated. The results are basically consistent with those of the K-ras Kit (HRM: high-resolution melt). The method holds promise for the diagnosis and management of cancer. Copyright © 2014 Elsevier Inc. All rights reserved.

DETECTION OF GIARDIA IN ENVIRONMENTAL WATERS BY IMMUNO-PCR AMPLIFICATION METHODS

EPA Science Inventory

Genomic DNA was extracted either directly from Giardia muris cysts seeded into environmental surface waters or from cysts isolated by immunomagnetic beads (IMB).A 0.171-kbp segment of the giardin gene was PCR-amplified following "direct extraction" of Giardia DNA from seeded Caha...

DETECTION OF GIARDIA IN ENVIRONMENTAL WATERS BY IMMUNO-PCR AMPLIFICATION METHODS

EPA Science Inventory

Genomic DNA was extracted either directly from Giardia muris cysts seeded into environmental surface waters or from cysts isolated by immunomagnetic beads (IMB}. A 0.171-kbp segment of the giardin gene was PCR-amplified following "direct extraction" of Giardia DNA from seeded Cah...

Enhanced genetic analysis of single human bioparticles recovered by simplified micromanipulation from forensic 'touch DNA' evidence.

PubMed

Farash, Katherine; Hanson, Erin K; Ballantyne, Jack

2015-03-09

DNA profiles can be obtained from 'touch DNA' evidence, which comprises microscopic traces of human biological material. Current methods for the recovery of trace DNA employ cotton swabs or adhesive tape to sample an area of interest. However, such a 'blind-swabbing' approach will co-sample cellular material from the different individuals, even if the individuals' cells are located in geographically distinct locations on the item. Thus, some of the DNA mixtures encountered in touch DNA samples are artificially created by the swabbing itself. In some instances, a victim's DNA may be found in significant excess thus masking any potential perpetrator's DNA. In order to circumvent the challenges with standard recovery and analysis methods, we have developed a lower cost, 'smart analysis' method that results in enhanced genetic analysis of touch DNA evidence. We describe an optimized and efficient micromanipulation recovery strategy for the collection of bio-particles present in touch DNA samples, as well as an enhanced amplification strategy involving a one-step 5 µl microvolume lysis/STR amplification to permit the recovery of STR profiles from the bio-particle donor(s). The use of individual or few (i.e., "clumps") bioparticles results in the ability to obtain single source profiles. These procedures represent alternative enhanced techniques for the isolation and analysis of single bioparticles from forensic touch DNA evidence. While not necessary in every forensic investigation, the method could be highly beneficial for the recovery of a single source perpetrator DNA profile in cases involving physical assault (e.g., strangulation) that may not be possible using standard analysis techniques. Additionally, the strategies developed here offer an opportunity to obtain genetic information at the single cell level from a variety of other non-forensic trace biological material.

Population diversity of ammonium oxidizers investigated by specific PCR amplification

USGS Publications Warehouse

Ward, B.B.; Voytek, M.A.; Witzel, K.-P.

1997-01-01

The species composition of ammonia-oxidizing bacteria in aquatic environments was investigated using PCR primers for 16S rRNA genes to amplify specific subsets of the total ammonia-oxidizer population. The specificity of the amplification reactions was determined using total genomic DNA from known nitrifying strains and non-nitrifying strains identified as having similar rDNA sequences. Specificity of amplification was determined both for direct amplification, using the nitrifier specific primers, and with nested amplification, in which the nitrifier primers were used to reamplify a fragment obtained from direct amplification with Eubacterial universal primers. The present level of specificity allows the distinction between Nitrosomonas europaea, Nitrosomonas sp. (marine) and the other known ammonia-oxidizers in the beta subclass of the Proteobacteria. Using total DNA extracted from natural samples, we used direct amplification to determine presence/absence of different species groups. Species composition was found to differ among depths in vertical profiles of lake samples and among samples and enrichments from various other aquatic environments. Nested PCR yielded several more positive reactions, which implies that nitrifier DNA was present in most samples, but often at very low levels.

Rapid amplification of 5' complementary DNA ends (5' RACE).

PubMed

2005-08-01

This method is used to extend partial cDNA clones by amplifying the 5' sequences of the corresponding mRNAs 1-3. The technique requires knowledge of only a small region of sequence within the partial cDNA clone. During PCR, the thermostable DNA polymerase is directed to the appropriate target RNA by a single primer derived from the region of known sequence; the second primer required for PCR is complementary to a general feature of the target-in the case of 5' RACE, to a homopolymeric tail added (via terminal transferase) to the 3' termini of cDNAs transcribed from a preparation of mRNA. This synthetic tail provides a primer-binding site upstream of the unknown 5' sequence of the target mRNA. The products of the amplification reaction are cloned into a plasmid vector for sequencing and subsequent manipulation.

A factorial design experiment as a pilot study for noninvasive genetic sampling.

PubMed

Renan, Sharon; Speyer, Edith; Shahar, Naama; Gueta, Tomer; Templeton, Alan R; Bar-David, Shirli

2012-11-01

Noninvasive genetic sampling has increasingly been used in ecological and conservation studies during the last decade. A major part of the noninvasive genetic literature is dedicated to the search for optimal protocols, by comparing different methods of collection, preservation and extraction of DNA from noninvasive materials. However, the lack of quantitative comparisons among these studies and the possibility that different methods are optimal for different systems make it difficult to decide which protocol to use. Moreover, most studies that have compared different methods focused on a single factor - collection, preservation or extraction - while there could be interactions between these factors. We designed a factorial experiment, as a pilot study, aimed at exploring the effect of several collection, preservation and extraction methods, and the interactions between them, on the quality and amplification success of DNA obtained from Asiatic wild ass (Equus hemionus) faeces in Israel. The amplification success rates of one mitochondrial DNA and four microsatellite markers differed substantially as a function of collection, preservation and extraction methods and their interactions. The most efficient combination for our system integrated the use of swabs as a collection method with preservation at -20 °C and with the Qiagen DNA Stool Kit with modifications as the DNA extraction method. The significant interaction found between the collection, preservation methods and the extraction methods reinforces the importance of conducting a factorial design experiment, rather than examining each factor separately, as a pilot study before initiating a full-scale noninvasive research project. © 2012 Blackwell Publishing Ltd.

Development of a fast PCR protocol enabling rapid generation of AmpFℓSTR® Identifiler® profiles for genotyping of human DNA.

PubMed

Foster, Amanda; Laurin, Nancy

2012-03-06

Traditional PCR methods for forensic STR genotyping require approximately 2.5 to 4 hours to complete, contributing a significant portion of the time required to process forensic DNA samples. The purpose of this study was to develop and validate a fast PCR protocol that enabled amplification of the 16 loci targeted by the AmpFℓSTR® Identifiler® primer set, allowing decreased cycling times. Fast PCR conditions were achieved by substituting the traditional Taq polymerase for SpeedSTAR™ HS DNA polymerase which is designed for fast PCR, by upgrading to a thermal cycler with faster temperature ramping rates and by modifying cycling parameters (less time at each temperature) and adopting a two-step PCR approach. The total time required for the optimized protocol is 26 min. A total of 147 forensically relevant DNA samples were amplified using the fast PCR protocol for Identifiler. Heterozygote peak height ratios were not affected by fast PCR conditions, and full profiles were generated for single-source DNA amounts between 0.125 ng and 2.0 ng. Individual loci in profiles produced with the fast PCR protocol exhibited average n-4 stutter percentages ranging from 2.5 ± 0.9% (THO1) to 9.9 ± 2.7% (D2S1338). No increase in non-adenylation or other amplification artefacts was observed. Minor contributor alleles in two-person DNA mixtures were reliably discerned. Low level cross-reactivity (monomorphic peaks) was observed with some domestic animal DNA. The fast PCR protocol presented offers a feasible alternative to current amplification methods and could aid in reducing the overall time in STR profile production or could be incorporated into a fast STR genotyping procedure for time-sensitive situations.

ERG Oncoprotein Expression in Prostate Cancer: Clonal Progression of ERG-Positive Tumor Cells and Potential for ERG-Based Stratification

DTIC Science & Technology

2010-01-01

staining results as ERG positive or negative. Analysis of ERG mRNA by branched-chain DNA ( bDNA ) signal amplification One 4-mm thick section was selected...patients treated with radical prostatectomy by using bDNA assay as described in Materials and Methods. Consecutive tissue slides from whole-mounted FFPE

Fitting new technologies into the safety paradigm: use of microarrays in transfusion.

PubMed

Fournier-Wirth, C; Coste, J

2007-01-01

Until the late 1990s, mandatory blood screening for transmissible infectious agents depended entirely on antigen/antibody-based detection assays. The recent emergence of Nucleic acid Amplification Technologies (NAT) has revolutionised viral diagnosis, not only by increasing the level of sensitivity but also by facilitating the detection of several viruses in parallel by multiplexing specific primers. In more complex biological situations, when a broad spectrum of pathogens must be screened, the limitations of these first generation technologies became apparent. High throughput systems, such as DNA Arrays, permit a conceptually new approach. These miniaturised micro systems allow the detection of hundreds of different targets simultaneously, inducing a dramatic decrease in reagent consumption, a reduction in the number of confirmation tests and a simplification of data interpretation. However, the systems currently available require additional instrumentation and reagents for sample preparation and target amplification prior to detection on the DNA array. A major challenge in the area of DNA detection is the development of methods that do not rely on target amplification systems. Likewise, the advances of protein microarrays have lagged because of poor stability of proteins, complex coupling chemistry and weak detection signals. Emerging technologies like Biosensors and nano-particle based DNA or Protein Bio-Barcode Amplification Assays are promising diagnostic tools for a wide range of clinical applications, including blood donation screening.

Dual signal amplification for highly sensitive electrochemical detection of uropathogens via enzyme-based catalytic target recycling.

PubMed

Su, Jiao; Zhang, Haijie; Jiang, Bingying; Zheng, Huzhi; Chai, Yaqin; Yuan, Ruo; Xiang, Yun

2011-11-15

We report an ultrasensitive electrochemical approach for the detection of uropathogen sequence-specific DNA target. The sensing strategy involves a dual signal amplification process, which combines the signal enhancement by the enzymatic target recycling technique with the sensitivity improvement by the quantum dot (QD) layer-by-layer (LBL) assembled labels. The enzyme-based catalytic target DNA recycling process results in the use of each target DNA sequence for multiple times and leads to direct amplification of the analytical signal. Moreover, the LBL assembled QD labels can further enhance the sensitivity of the sensing system. The coupling of these two effective signal amplification strategies thus leads to low femtomolar (5fM) detection of the target DNA sequences. The proposed strategy also shows excellent discrimination between the target DNA and the single-base mismatch sequences. The advantageous intrinsic sequence-independent property of exonuclease III over other sequence-dependent enzymes makes our new dual signal amplification system a general sensing platform for monitoring ultralow level of various types of target DNA sequences. Copyright © 2011 Elsevier B.V. All rights reserved.

Rapid visual detection of cyprinid herpesvirus 2 by recombinase polymerase amplification combined with a lateral flow dipstick.

PubMed

Wang, H; Sun, M; Xu, D; Podok, P; Xie, J; Jiang, Ys; Lu, Lq

2018-05-28

Herpesviral haematopoietic necrosis (HVHN), caused by cyprinid herpesvirus 2 (CyHV-2), causes significant losses in crucian carp (Carassius carassius) aquaculture. Rapid and convenient DNA assay detection of CyHV-2 is useful for field diagnosis. Recombinase polymerase amplification (RPA) is a novel isothermal DNA amplification and detection technology that can amplify DNA within 30 min at ~37°C by simulating in vivo DNA recombination. Herein, a rapid and convenient detection assay based on RPA with a lateral flow dipstick (LFD) was developed for detecting CyHV-2. The highly conserved ORF72 of CyHV-2 was targeted by specific and sensitive primers and probes. The optimized assay takes only 15 min at 38°C using a water bath, with analysis of products by 2% agarose gel electrophoresis within 30 min. A simple lateral flow strip based on the unique probe in reaction buffer was developed for visualization. The entire RPA-LFD assay takes 50 min less than the routine PCR method, is 100 times more sensitive and displays no cross-reaction with other aquatic viruses. The combined isothermal RPA and lateral flow assay (RPA-LFD) provides a simple, rapid, reliable method that could improve field diagnosis of CyHV-2 when resources are limited. © 2018 John Wiley & Sons Ltd.

Rolling-circle amplification under topological constraints

PubMed Central

Kuhn, Heiko; Demidov, Vadim V.; Frank-Kamenetskii, Maxim D.

2002-01-01

We have performed rolling-circle amplification (RCA) reactions on three DNA templates that differ distinctly in their topology: an unlinked DNA circle, a linked DNA circle within a pseudorotaxane-type structure and a linked DNA circle within a catenane. In the linked templates, the single-stranded circle (dubbed earring probe) is threaded, with the aid of two peptide nucleic acid openers, between the two strands of double-stranded DNA (dsDNA). We have found that the RCA efficiency of amplification was essentially unaffected when the linked templates were employed. By showing that the DNA catenane remains intact after RCA reactions, we prove that certain DNA polymerases can carry out the replicative synthesis under topological constraints allowing detection of several hundred copies of a dsDNA marker without DNA denaturation. Our finding may have practical implications in the area of DNA diagnostics. PMID:11788721

An Electrochemical DNA Sensing System Using Modified Nanoparticle Probes for Detecting Methicillin-Resistant Staphylococcus aureus.

PubMed

Sakamoto, Hiroaki; Amano, Yoshihisa; Satomura, Takenori; Suye, Shin-Ichiro

2017-01-01

We have developed a novel, highly sensitive, biosensing system for detecting methicillin-resistant Staphylococcus aureus (MRSA). The system employs gold nanoparticles (AuNPs), magnetic nanoparticles (mNPs), and an electrochemical detection method. We have designed and synthesized ferrocene- and single-stranded DNA-conjugated nanoparticles that hybridize to MRSA DNA. Hybridized complexes are easily separated by taking advantage of mNPs. A current response could be obtained through the oxidation of ferrocene on the AuNP surface when a constant potential of +250 mV vs. Ag/AgCl is applied. The enzymatic reaction of L-proline dehydrogenase provides high signal amplification. This sensing system, using a nanoparticle-modified probe, has the ability to detect 10 pM of genomic DNA from MRSA without amplification by the polymerase chain reaction. Current responses are linearly related to the amount of genomic DNA in the range of 10-166 pM. Selectivity is confirmed by demonstrating that this sensing system could distinguish MRSA from Staphylococcus aureus (SA) DNA.

Vaccinia virus, herpes simplex virus, and carcinogens induce DNA amplification in a human cell line and support replication of a helpervirus dependent parvovirus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schlehofer, J.R.; Ehrbar, M.; zur Hausen, H.

1986-07-15

The SV40-transformed human kidney cell line, NB-E, amplifies integrated as well as episomal SV40 DNA upon treatment with chemical (DMBA) or physical (uv irradiation) carcinogens (initiators) as well as after infection with herpes simplex virus (HSV) type 1 or with vaccinia virus. In addition it is shown that vaccinia virus induces SV40 DNA amplification also in the SV40-transformed Chinese hamster embryo cell line, CO631. These findings demonstrate that human cells similar to Chinese hamster cells amplify integrated DNA sequences after treatment with carcinogens or infection with specific viruses. Furthermore, a poxvirus--vaccinia virus--similar to herpes group viruses induces DNA amplification. Asmore » reported for other systems, the vaccinia virus-induced DNA amplification in NB-E cells is inhibited by coinfection with adeno-associated virus (AAV) type 5. This is in line with previous studies on inhibition of carcinogen- or HSV-induced DNA amplification in CO631 cells. The experiments also demonstrate that vaccinia virus, in addition to herpes and adenoviruses acts as a helper virus for replication and structural antigen synthesis of AAV-5 in NB-E cells.« less

DNA sequence responsible for the amplification of adjacent genes.

PubMed

Pasion, S G; Hartigan, J A; Kumar, V; Biswas, D K

1987-10-01

A 10.3-kb DNA fragment in the 5'-flanking region of the rat prolactin (rPRL) gene was isolated from F1BGH(1)2C1, a strain of rat pituitary tumor cells (GH cells) that produces prolactin in response to 5-bromodeoxyuridine (BrdU). Following transfection and integration into genomic DNA of recipient mouse L cells, this DNA induced amplification of the adjacent thymidine kinase gene from Herpes simplex virus type 1 (HSV1TK). We confirmed the ability of this "Amplicon" sequence to induce amplification of other linked or unlinked genes in DNA-mediated gene transfer studies. When transferred into the mouse L cells with the 10.3-5'rPRL gene sequence of BrdU-responsive cells, both the human growth hormone and the HSV1TK genes are amplified in response to 5-bromodeoxyuridine. This observation is substantiated by BrdU-induced amplification of the cotransferred bacterial Neo gene. Cotransfection studies reveal that the BrdU-induced amplification capability is associated with a 4-kb DNA sequence in the 5'-flanking region of the rPRL gene of BrdU-responsive cells. These results demonstrate that genes of heterologous origin, linked or unlinked, and selected or unselected, can be coamplified when located within the amplification boundary of the Amplicon sequence.

Development of a highly sensitive loop-mediated isothermal amplification (LAMP) method for the detection of Loa loa.

PubMed

Fernández-Soto, Pedro; Mvoulouga, Prosper Obolo; Akue, Jean Paul; Abán, Julio López; Santiago, Belén Vicente; Sánchez, Miguel Cordero; Muro, Antonio

2014-01-01

The filarial parasite Loa loa, the causative agent of loiasis, is endemic in Central and Western Africa infecting 3-13 million people. L. loa has been associated with fatal encephalopathic reactions in high Loa-infected individuals receiving ivermectin during mass drug administration programs for the control of onchocerciasis and lymphatic filariasis. In endemic areas, the only diagnostic method routinely used is the microscopic examination of mid-day blood samples by thick blood film. Improved methods for detection of L. loa are needed in endemic regions with limited resources, where delayed diagnosis results in high mortality. We have investigated the use of a loop-mediated isothermal amplification (LAMP) assay to facilitate rapid, inexpensive, molecular diagnosis of loiasis. Primers for LAMP were designed from a species-specific repetitive DNA sequence from L. loa retrieved from GenBank. Genomic DNA of a L. loa adult worm was used to optimize the LAMP conditions using a thermocycler or a conventional heating block. Amplification of DNA in the LAMP mixture was visually inspected for turbidity as well as addition of fluorescent dye. LAMP specificity was evaluated using DNA from other parasites; sensitivity was evaluated using DNA from L. loa 10-fold serially diluted. Simulated human blood samples spiked with DNA from L. loa were also tested for sensitivity. Upon addition of fluorescent dye, all positive reactions turned green while the negative controls remained orange under ambient light. After electrophoresis on agarose gels, a ladder of multiple bands of different sizes could be observed in positive samples. The detection limit of the assay was found to be as little as 0.5 ag of L. loa genomic DNA when using a heating block. We have designed, for the first time, a highly sensitive LAMP assay for the detection of L. loa which is potentially adaptable for field diagnosis and disease surveillance in loiasis-endemic areas.

Development of a Highly Sensitive Loop-Mediated Isothermal Amplification (LAMP) Method for the Detection of Loa loa

PubMed Central

Fernández-Soto, Pedro; Mvoulouga, Prosper Obolo; Akue, Jean Paul; Abán, Julio López; Santiago, Belén Vicente; Sánchez, Miguel Cordero; Muro, Antonio

2014-01-01

The filarial parasite Loa loa, the causative agent of loiasis, is endemic in Central and Western Africa infecting 3–13 million people. L. loa has been associated with fatal encephalopathic reactions in high Loa-infected individuals receiving ivermectin during mass drug administration programs for the control of onchocerciasis and lymphatic filariasis. In endemic areas, the only diagnostic method routinely used is the microscopic examination of mid-day blood samples by thick blood film. Improved methods for detection of L. loa are needed in endemic regions with limited resources, where delayed diagnosis results in high mortality. We have investigated the use of a loop-mediated isothermal amplification (LAMP) assay to facilitate rapid, inexpensive, molecular diagnosis of loiasis. Primers for LAMP were designed from a species-specific repetitive DNA sequence from L. loa retrieved from GenBank. Genomic DNA of a L. loa adult worm was used to optimize the LAMP conditions using a thermocycler or a conventional heating block. Amplification of DNA in the LAMP mixture was visually inspected for turbidity as well as addition of fluorescent dye. LAMP specificity was evaluated using DNA from other parasites; sensitivity was evaluated using DNA from L. loa 10-fold serially diluted. Simulated human blood samples spiked with DNA from L. loa were also tested for sensitivity. Upon addition of fluorescent dye, all positive reactions turned green while the negative controls remained orange under ambient light. After electrophoresis on agarose gels, a ladder of multiple bands of different sizes could be observed in positive samples. The detection limit of the assay was found to be as little as 0.5 ag of L. loa genomic DNA when using a heating block. We have designed, for the first time, a highly sensitive LAMP assay for the detection of L. loa which is potentially adaptable for field diagnosis and disease surveillance in loiasis-endemic areas. PMID:24722638

Miniaturized isothermal nucleic acid amplification, a review.

PubMed

Asiello, Peter J; Baeumner, Antje J

2011-04-21

Micro-Total Analysis Systems (µTAS) for use in on-site rapid detection of DNA or RNA are increasingly being developed. Here, amplification of the target sequence is key to increasing sensitivity, enabling single-cell and few-copy nucleic acid detection. The several advantages to miniaturizing amplification reactions and coupling them with sample preparation and detection on the same chip are well known and include fewer manual steps, preventing contamination, and significantly reducing the volume of expensive reagents. To-date, the majority of miniaturized systems for nucleic acid analysis have used the polymerase chain reaction (PCR) for amplification and those systems are covered in previous reviews. This review provides a thorough overview of miniaturized analysis systems using alternatives to PCR, specifically isothermal amplification reactions. With no need for thermal cycling, isothermal microsystems can be designed to be simple and low-energy consuming and therefore may outperform PCR in portable, battery-operated detection systems in the future. The main isothermal methods as miniaturized systems reviewed here include nucleic acid sequence-based amplification (NASBA), loop-mediated isothermal amplification (LAMP), helicase-dependent amplification (HDA), rolling circle amplification (RCA), and strand displacement amplification (SDA). Also, important design criteria for the miniaturized devices are discussed. Finally, the potential of miniaturization of some new isothermal methods such as the exponential amplification reaction (EXPAR), isothermal and chimeric primer-initiated amplification of nucleic acids (ICANs), signal-mediated amplification of RNA technology (SMART) and others is presented.

Novel rolling circle amplification and DNA origami-based DNA belt-involved signal amplification assay for highly sensitive detection of prostate-specific antigen (PSA).

PubMed

Yan, Juan; Hu, Chongya; Wang, Ping; Liu, Rui; Zuo, Xiaolei; Liu, Xunwei; Song, Shiping; Fan, Chunhai; He, Dannong; Sun, Gang

2014-11-26

Prostate-specific antigen (PSA) is one of the most important biomarkers for the early diagnosis and prognosis of prostate cancer. Although many efforts have been made to achieve significant progress for the detection of PSA, challenges including relative low sensitivity, complicated operation, sophisticated instruments, and high cost remain unsolved. Here, we have developed a strategy combining rolling circle amplification (RCA)-based DNA belts and magnetic bead-based enzyme-linked immunosorbent assay (ELISA) for the highly sensitive and specific detection of PSA. At first, a 96-base circular DNA template was designed and prepared for the following RCA. Single stranded DNA (ssDNA) products from RCA were used as scaffold strand for DNA origami, which was hybridized with three staple strands of DNA. The resulting DNA belts were conjugated with multiple enzymes for signal amplification and then employed to magnetic bead based ELISA for PSA detection. Through our strategy, as low as 50 aM of PSA can be detected with excellent specificity.

Microfluidic Chip-Based Detection and Intraspecies Strain Discrimination of Salmonella Serovars Derived from Whole Blood of Septic Mice

PubMed Central

Patterson, Adriana S.; Heithoff, Douglas M.; Ferguson, Brian S.; Soh, H. Tom; Mahan, Michael J.

2013-01-01

Salmonella is a zoonotic pathogen that poses a considerable public health and economic burden in the United States and worldwide. Resultant human diseases range from enterocolitis to bacteremia to sepsis and are acutely dependent on the particular serovar of Salmonella enterica subsp. enterica, which comprises over 99% of human-pathogenic S. enterica isolates. Point-of-care methods for detection and strain discrimination of Salmonella serovars would thus have considerable benefit to medical, veterinary, and field applications that safeguard public health and reduce industry-associated losses. Here we describe a single, disposable microfluidic chip that supports isothermal amplification and sequence-specific detection and discrimination of Salmonella serovars derived from whole blood of septic mice. The integrated microfluidic electrochemical DNA (IMED) chip consists of an amplification chamber that supports loop-mediated isothermal amplification (LAMP), a rapid, single-temperature amplification method as an alternative to PCR that offers advantages in terms of sensitivity, reaction speed, and amplicon yield. The amplification chamber is connected via a microchannel to a detection chamber containing a reagentless, multiplexed (here biplex) sensing array for sequence-specific electrochemical DNA (E-DNA) detection of the LAMP products. Validation of the IMED device was assessed by the detection and discrimination of S. enterica subsp. enterica serovars Typhimurium and Choleraesuis, the causative agents of enterocolitis and sepsis in humans, respectively. IMED chips conferred rapid (under 2 h) detection and discrimination of these strains at clinically relevant levels (<1,000 CFU/ml) from whole, unprocessed blood collected from septic animals. The IMED-based chip assay shows considerable promise as a rapid, inexpensive, and portable point-of-care diagnostic platform for the detection and strain-specific discrimination of microbial pathogens. PMID:23354710

Automated PCR setup for forensic casework samples using the Normalization Wizard and PCR Setup robotic methods.

PubMed

Greenspoon, S A; Sykes, K L V; Ban, J D; Pollard, A; Baisden, M; Farr, M; Graham, N; Collins, B L; Green, M M; Christenson, C C

2006-12-20

Human genome, pharmaceutical and research laboratories have long enjoyed the application of robotics to performing repetitive laboratory tasks. However, the utilization of robotics in forensic laboratories for processing casework samples is relatively new and poses particular challenges. Since the quantity and quality (a mixture versus a single source sample, the level of degradation, the presence of PCR inhibitors) of the DNA contained within a casework sample is unknown, particular attention must be paid to procedural susceptibility to contamination, as well as DNA yield, especially as it pertains to samples with little biological material. The Virginia Department of Forensic Science (VDFS) has successfully automated forensic casework DNA extraction utilizing the DNA IQ(trade mark) System in conjunction with the Biomek 2000 Automation Workstation. Human DNA quantitation is also performed in a near complete automated fashion utilizing the AluQuant Human DNA Quantitation System and the Biomek 2000 Automation Workstation. Recently, the PCR setup for casework samples has been automated, employing the Biomek 2000 Automation Workstation and Normalization Wizard, Genetic Identity version, which utilizes the quantitation data, imported into the software, to create a customized automated method for DNA dilution, unique to that plate of DNA samples. The PCR Setup software method, used in conjunction with the Normalization Wizard method and written for the Biomek 2000, functions to mix the diluted DNA samples, transfer the PCR master mix, and transfer the diluted DNA samples to PCR amplification tubes. Once the process is complete, the DNA extracts, still on the deck of the robot in PCR amplification strip tubes, are transferred to pre-labeled 1.5 mL tubes for long-term storage using an automated method. The automation of these steps in the process of forensic DNA casework analysis has been accomplished by performing extensive optimization, validation and testing of the software methods.

Simple method for production of internal control DNA for Mycobacterium tuberculosis polymerase chain reaction assays.

PubMed Central

deWit, D; Wootton, M; Allan, B; Steyn, L

1993-01-01

A simple method for the production of internal control DNA for two well-established Mycobacterium tuberculosis polymerase chain reaction assays is described. The internal controls were produced from Mycobacterium kansasii DNA with the same primers but at a lower annealing temperature than that used in the standard assays. In both assays, therefore, the internal control DNA has the same primer-binding sequences at the target DNA. One-microgram quantities of internal control DNA which was not contaminated with target DNA could easily be produced by this method. The inclusion of the internal control in the reaction mixture did not affect the efficiency of amplification of the target DNA. The method is simple and rapid and should be adaptable to most M. tuberculosis polymerase chain reaction assays. Images PMID:8370752

Point of care diagnosis of multiple schistosome parasites: Species-specific DNA detection in urine by loop-mediated isothermal amplification (LAMP).

PubMed

Lodh, Nilanjan; Mikita, Kei; Bosompem, Kwabena M; Anyan, William K; Quartey, Joseph K; Otchere, Joseph; Shiff, Clive J

2017-09-01

Schistosomes are easily transmitted and high chance of repeat infection, so if control strategies based on targeted mass drug administration (MDA) are to succeed it is essential to have a test that is sensitive, accurate and simple to use. It is known and regularly demonstrated that praziquantel does not always eliminate an infection so in spite of the successes of control programs a residual of the reservoir survives to re-infect snails. The issue of diagnostic sensitivity becomes more critical in the assessment of program effectiveness. While serology, such as antigen capture tests might improve sensitivity, it has been shown that the presence of species-specific DNA fragments will indicate, most effectively, the presence of active parasites. Polymerase chain reaction (PCR) can amplify and detect DNA from urine residue captured on Whatman No. 3 filter paper that is dried after filtration. Previously we have detected S. mansoni and S. haematobium parasite-specific small repeat DNA fragment from filtered urine on filter paper by PCR. In the current study, we assessed the efficacy of detection of 86 urine samples for either or both schistosome parasites by PCR and loop-mediated isothermal amplification (LAMP) that were collected from a low to moderate transmission area in Ghana. Two different DNA extraction methods, standard extraction kit and field usable LAMP-PURE kit were also evaluated by PCR and LAMP amplification. With S. haematobium LAMP amplification for both extractions showed similar sensitivity and specificity when compared with PCR amplification (100%) verified by gel electrophoresis. For S. mansoni sensitivity was highest for LAMP amplification (100%) for standard extraction than PCR and LAMP with LAMP-PURE (99% and 94%). The LAMP-PURE extraction produced false negatives, which require further investigation for this field usable extraction kit. Overall high positive and negative predictive values (90% - 100%) for both species demonstrated a highly robust approach. The LAMP approach is close to point of care use and equally sensitive and specific to detection of species-specific DNA by PCR. LAMP can be an effective means to detect low intensity infection due to its simplicity and minimal DNA extraction requirement. This will enhance the effectiveness of surveillance and MDA control programs of schistosomiasis. Copyright © 2017 Elsevier B.V. All rights reserved.

Evaluation of a manual DNA extraction protocol and an isothermal amplification assay for detecting HIV-1 DNA from dried blood spots for use in resource-limited settings.

PubMed

Jordan, Jeanne A; Ibe, Christine O; Moore, Miranda S; Host, Christel; Simon, Gary L

2012-05-01

In resource-limited settings (RLS) dried blood spots (DBS) are collected on infants and transported through provincial laboratories to a central facility where HIV-1 DNA PCR testing is performed using specialized equipment. Implementing a simpler approach not requiring such equipment or skilled personnel could allow the more numerous provincial laboratories to offer testing, improving turn-around-time to identify and treat infected infants sooner. Assess performances of a manual DNA extraction method and helicase-dependent amplification (HDA) assay for detecting HIV-1 DNA from DBS. 60 HIV-1 infected adults were enrolled, blood samples taken and DBS made. DBS extracts were assessed for DNA concentration and beta globin amplification using PCR and melt-curve analysis. These same extracts were then tested for HIV-1 DNA using HDA and compared to results generated by PCR and pyrosequencing. Finally, HDA limit of detection (LOD) studies were performed using DBS extracts prepared with known numbers of 8E5 cells. The manual extraction protocol consistently yielded high concentrations of amplifiable DNA from DBS. LOD assessment demonstrated HDA detected ∼470 copies/ml of HIV-1 DNA extracts in 4/4 replicates. No statistical difference was found using the McNemar's test when comparing HDA to PCR for detecting HIV-1 DNA from DBS. Using just a magnet, heat block and pipettes, the manual extraction protocol and HDA assay detected HIV-1 DNA from DBS at levels that would be useful for early infant diagnosis. Next steps will include assessing HDA for non-B HIV-1 subtypes recognition and comparison to Roche HIV-1 DNA v1.5 PCR assay. Copyright © 2012 Elsevier B.V. All rights reserved.

Identification of ochratoxin A producing Aspergillus carbonarius and A. niger clade isolated from grapes using the loop-mediated isothermal amplification (LAMP) reaction.

PubMed

Storari, M; von Rohr, R; Pertot, I; Gessler, C; Broggini, G A L

2013-04-01

To develop two assays based on the loop-mediated isothermal amplification (LAMP) of DNA for the quick and specific identification of Aspergillus carbonarius and ochratoxigenic strains of the Aspergillus niger clade isolated from grapes. Two sets of primers were designed based on the polyketide synthase genes involved or putatively involved in ochratoxin A (OTA) biosynthesis in A. carbonarius and A. niger clade. Hydroxynaphthol blue was used as indirect method to indicate DNA amplification. The limit of detection of both assays was comparable to that of a PCR reaction. Specificities of the reactions were tested using DNA from different black aspergilli isolated from grapes. The two LAMP assays were then used to identify A. carbonarius and ochratoxigenic A. niger and A. awamori grown in pure cultures without a prior DNA extraction. The two LAMP assays permitted to quickly and specifically identify DNA from OTA-producing black aspergilli, as well as isolates grown in pure culture. Monitoring vineyards for the presence of OTA-producing strains is part of the measures to minimize the occurrence of OTA in grape products. The two LAMP assays developed here could be potentially used to speed the screening process of vineyards for the presence of OTA-producing black aspergilli. © 2013 The Society for Applied Microbiology.

Ligation-mediated PCR with a back-to-back adapter reduces amplification bias resulting from variations in GC content.

PubMed

Ishihara, Satoru; Kotomura, Naoe; Yamamoto, Naoki; Ochiai, Hiroshi

2017-08-15

Ligation-mediated polymerase chain reaction (LM-PCR) is a common technique for amplification of a pool of DNA fragments. Here, a double-stranded oligonucleotide consisting of two primer sequences in back-to-back orientation was designed as an adapter for LM-PCR. When DNA fragments were ligated with this adapter, the fragments were sandwiched between two adapters in random orientations. In the ensuing PCR, ligation products linked at each end to an opposite side of the adapter, i.e. to a distinct primer sequence, were preferentially amplified compared with products linked at each end to an identical primer sequence. The use of this adapter in LM-PCR reduced the impairment of PCR by substrate DNA with a high GC content, compared with the use of traditional LM-PCR adapters. This result suggested that our method has the potential to contribute to reduction of the amplification bias that is caused by an intrinsic property of the sequence context in substrate DNA. A DNA preparation obtained from a chromatin immunoprecipitation assay using pulldown of a specific form of histone H3 was successfully amplified using the modified LM-PCR, and the amplified products could be used as probes in a fluorescence in situ hybridization analysis. Copyright © 2017 Elsevier Inc. All rights reserved.

Development of a Novel Loop-Mediated Isothermal Amplification (LAMP) Assay for the Detection of Rickettsia spp.

PubMed

Hanaoka, Nozomu; Matsutani, Minenosuke; Satoh, Masaaki; Ogawa, Motohiko; Shirai, Mutsunori; Ando, Shuji

2017-01-24

We developed a novel loop-mediated isothermal amplification (LAMP) method to detect Rickettsia spp., including Rickettsia prowazekii and R. typhi. Species-specific LAMP primers were developed for orthologous genes conserved among Rickettsia spp. The selected modified primers could detect all the Rickettsia spp. tested. The LAMP method was successfully used to detect 100 DNA copies of Rickettsia spp. within approximately 60 min at 63℃. Therefore, this method may be an excellent tool for the early diagnosis of rickettsiosis in a laboratory or in the field.

An isothermal based recombinase polymerase amplification assay for rapid, sensitive and robust indexing of citrus yellow mosaic virus.

PubMed

Kumar, P V; Sharma, S K; Rishi, N; Ghosh, D K; Baranwal, V K

Management of viral diseases relies on definite and sensitive detection methods. Citrus yellow mosaic virus (CYMV), a double stranded DNA virus of the genus Badnavirus, causes yellow mosaic disease in citrus plants. CYMV is transmitted through budwood and requires a robust and simplified indexing protocol for budwood certification programme. The present study reports development and standardization of an isothermal based recombinase polymerase amplification (RPA) assay for a sensitive, rapid, easy, and cost-effective method for detection and diagnosis of CYMV. Two different oligonucleotide primer sets were designed from ORF III (coding for polyprotein) and ORF II (coding for virion associated protein) regions of CYMV to perform amplification assays. Comparative evaluation of RPA, PCR and immuno-capture recombinase polymerase amplification (IC-RPA) based assays were done using purified DNA and plant crude sap. CYMV infection was efficiently detected from the crude sap in RPA and IC-RPA assays. The primer set used in RPA was specific and did not show any cross-amplification with banana streak MY virus (BSMYV), another Badnavirus species. The results from the present study indicated that RPA assay can be used easily in routine indexing of citrus planting material. To the best of our knowledge, this is the first report on development of a rapid and simplified isothermal detection assay for CYMV and can be utilized as an effective technique in quarantine and budwood certification process.

Self-Assembled DNA Tetrahedral Scaffolds for the Construction of Electrochemiluminescence Biosensor with Programmable DNA Cyclic Amplification.

PubMed

Feng, Qiu-Mei; Guo, Yue-Hua; Xu, Jing-Juan; Chen, Hong-Yuan

2017-05-24

A novel DNA tetrahedron-structured electrochemiluminescence (ECL) platform for bioanalysis with programmable DNA cyclic amplification was developed. In this work, glucose oxidase (GOD) was labeled to a DNA sequence (S) as functional conjugation (GOD-S), which could hybridize with other DNA sequences (L and P) to form GOD-S:L:P probe. In the presence of target DNA and a help DNA (A), the programmable DNA cyclic amplification was activated and released GOD-S via toehold-mediated strand displacement. Then, the obtained GOD-S was further immobilized on the DNA tetrahedral scaffolds with a pendant capture DNA and Ru(bpy) 3 2+ -conjugated silica nanoparticles (RuSi NPs) decorated on the electrode surface. Thus, the amount of GOD-S assembled on the electrode surface depended on the concentration of target DNA and GOD could catalyze glucose to generate H 2 O 2 in situ. The ECL signal of Ru(bpy) 3 2+ -TPrA system was quenched by the presence of H 2 O 2 . By integrating the programmable DNA cyclic amplification and in situ generating H 2 O 2 as Ru(bpy) 3 2+ ECL quencher, a sensitive DNA tetrahedron-structured ECL sensing platform was proposed for DNA detection. Under optimized conditions, this biosensor showed a wide linear range from 100 aM to 10 pM with a detection limit of 40 aM, indicating a promising application in DNA analysis. Furthermore, by labeling GOD to different recognition elements, the proposed strategy could be used for the detection of various targets. Thus, this programmable cascade amplification strategy not only retains the high selectivity and good capturing efficiency of tetrahedral-decorated electrode surface but also provides potential applications in the construction of ECL biosensor.

Detection of Fungi from an Indoor Environment using Loop-mediated Isothermal Amplification (LAMP) Method.

PubMed

Nakayama, Takako; Yamazaki, Takashi; Yo, Ayaka; Tone, Kazuya; Mahdi Alshahni, Mohamed; Fujisaki, Ryuichi; Makimura, Koichi

2017-01-01

　Loop-mediated isothermal amplification (LAMP) is a useful DNA detection method with high specificity and sensitivity. The LAMP reaction is carried out within a short time at a constant temperature without the need for thermal cycling. We developed a LAMP primer set for detecting a wide range of fungi by aligning the sequences of the large subunit ribosomal RNA gene of Candida albicans (Ascomycota), Cryptococcus neoformans (Basidiomycota), and Mucor racemosus (Mucorales). The threshold of C. albicans rDNA as template with our LAMP primer set was in the range of 10-100 copies per a reaction. In this study, we evaluated the correlation between colony forming units (CFU) and LAMP detection rate using the LAMP method for environmental fungi. The LAMP method should be a useful means of detecting fungi in indoor environments, disaster areas, or even in confined manned spacecraft to prevent allergies or infections caused by fungi.

Simultaneous use of multiplex ligation-dependent probe amplification assay and flow cytometric DNA ploidy analysis in patients with acute leukemia.

PubMed

Reyes-Núñez, Virginia; Galo-Hooker, Evelyn; Pérez-Romano, Beatriz; Duque, Ricardo E; Ruiz-Arguelles, Alejandro; Garcés-Eisele, Javier

2018-01-01

The aim of this work was to simultaneously use multiplex ligation-dependent probe amplification (MLPA) assay and flow cytometric DNA ploidy analysis (FPA) to detect aneuploidy in patients with newly diagnosed acute leukemia. MLPA assay and propidium iodide FPA were used to test samples from 53 consecutive patients with newly diagnosed acute leukemia referred to our laboratory for immunophenotyping. Results were compared by nonparametric statistics. The combined use of both methods significantly increased the rate of detection of aneuploidy as compared to that obtained by each method alone. The limitations of one method are somehow countervailed by the other and vice versa. MPLA and FPA yield different yet complementary information concerning aneuploidy in acute leukemia. The simultaneous use of both methods might be recommended in the clinical setting. © 2017 International Clinical Cytometry Society. © 2017 International Clinical Cytometry Society.

Effect of dactyloscopic powders on DNA profiling from enhanced fingerprints: results from an experimental study.

PubMed

Tozzo, Pamela; Giuliodori, Alice; Rodriguez, Daniele; Caenazzo, Luciana

2014-03-01

We conducted a study on the effect of fingerprint enhancement methods on subsequent short tandem repeat profiling. First, we performed a study typing blood traces deposited on 5 different surfaces, treated with 8 types of dactyloscopic powders. Three different DNA extraction methods were used. Subsequently, we analyzed latent fingerprints on the same 5 surfaces enhanced with the 8 different powders used in the first part of the study. This study has demonstrated that DNA profiling can be performed on fingerprints left on different substrates, and the substrate will affect the amount of DNA that can be recovered for DNA typing. In the first phase of the study, a profile was obtained in 92% of the 120 samples analyzed; in the second part, in 55% of the 80 samples analyzed, we obtained a profile complete in 32.5% of the cases. From the results obtained, it seems that the powders used in latent fingerprints enhancement, rather than having a direct inhibitory effect on extraction and amplification of DNA, may cause partial degradation of DNA, reducing the efficiency of amplification reaction. It should not be forgotten that these results were obtained under laboratory conditions, and in real caseworks, there may still be different problems involved.

Identification of aster yellows phytoplasma in garlic and green onion by PCR-based methods.

PubMed

Khadhair, A H; Evans, I R; Choban, B

2002-01-01

In the summer of 1999, typical yellows-type symptoms were observed on garlic and green onion plants in a number of gardens and plots around Edmonton, Alberta, Canada. DNA was extracted from leaf tissues of evidently healthy and infected plants. DNA amplifications were conducted on these samples, using two primer pairs, R16F2n/R2 and R16(1)F1/R1, derived from phytoplasma rDNA sequences. DNA samples of aster yellows (AY), lime witches'-broom (LWB) and potato witches'-broom (PWB) phytoplasmas served as controls and were used to determine group relatedness. In a direct polymerase chain reaction (PCR) assay, DNA amplification with universal primer pair R16F2n/R2 gave the expected amplified products of 1.2 kb. Dilution (1/40) of each of the latter products were used as template and nested with specific primer pair R16(1)F1/R1. An expected PCR product of 1.1 kb was obtained from each phytoplasma-infected garlic and green onion samples, LWB and AY phytoplasmas but not from PWB phytoplasma. An aliquot from each amplification product (1.2 kb) with universal primers was subjected to PCR-based restriction fragment length polymorphism (RFLP) to identify phytoplasma isolates, using four restriction endonucleases (AluI, KpnI, MseI and RsaI). DNA amplification with specific primer pair R16(1)F1/R1 and RFLP analysis indicated the presence of AY phytoplasma in the infected garlic and green onion samples. These results suggest that AY phytoplasma in garlic and green onion samples belong to the subgroup 16Sr1-A.

Comparison of Three Different Sensitive Assays for Hepatitis B Virus DNA in Monitoring of Responses to Antiviral Therapy

PubMed Central

Chan, Henry L. Y.; Leung, Nancy W. Y.; Lau, Tracy C. M.; Wong, May L.; Sung, Joseph J. Y.

2000-01-01

The aim of our study was to compare the performances of two new hepatitis B virus (HBV) DNA assays, a cross-linking assay (NAXCOR) and a hybrid-capture amplification assay (Digene), versus the widely used branched-DNA (bDNA) assay (Chiron) in the monitoring of HBV DNA levels during antiviral treatment. Serial serum samples from 12 chronically HBV infected patients undergoing a phase II trial of an antiviral drug, 2′,3′-dideoxy-5-fluoro-3′-thiacytidine (FTC), were studied. A total of 96 serum samples were tested for HBV DNA using the cross-linking, hybrid-capture amplification, and bDNA assays. In the comparison of the cross-linking and bDNA assays, concordant results were found in 77 (80.3%) samples, no significant difference was found between the median log10 HBV DNA levels (6.66 versus 7.17 meq/ml), and the results of the two assays were closely correlated (r = 0.95). In the comparison of the hybrid-capture amplification and bDNA assays, concordant results were found in 79 (82.3%) samples, no significant difference was found between the median log10 HBV DNA levels (6.98 versus 6.99 meq/ml), and the results of the two assays were closely correlated (r = 0.99). Six (6.3%) samples by the cross-linking assay and 10 (10.4%) samples by the bDNA assay required retesting because of unacceptably high within-run coefficients of variance. No sample required retesting in the hybrid-capture amplification assay according to the internal validation. In conclusion, the cross-linking and hybrid-capture amplification assays were as sensitive as the bDNA assay for HBV DNA detection and can be recommended for monitoring of HBV DNA levels during antiviral treatment. PMID:10970358

Isolation of DNA from small amounts of elephant ivory: Sampling the cementum with total demineralization extraction.

PubMed

Winters, M; Torkelson, A; Booth, R; Mailand, C; Hoareau, Y; Tucker, S; Wasser, S K

2018-07-01

Genotyping ivory samples can determine the geographic origin of poached ivory as well as the legality of ivory being sold in ivory markets. We conducted a series of experiments to determine where the DNA is most concentrated in ivory samples and how best to increase DNA yield from groups of samples likely to vary in DNA concentration. We examined variation in DNA amplification success from: the layer(s) of the tusk (cementum and/or dentine) being extracted, demineralization temperature and time, and the concentration of eluates. Since demineralization of the pulverized sample produces a pellet and supernatant, we also assessed DNA amplification success from the pellet, the supernatant, their combination, as well as variation in the respective amounts used for extraction. Our results show that the outer cementum layer of the tusk contains the highest concentration of DNA and should be separated and used exclusively as the source material of ivory processed for extraction, when available. Utilizing the combined demineralized lysate improves extraction efficiency, as does increasing demineralization time to 3 or more days, conducted at 4°C. The most significant improvements occurred for low template DNA ivory samples followed by medium quality samples. Amplification success of high quality samples was not affected by these changes. Application of this optimized method to 3068 ivory samples resulted in 81.2% of samples being confirmed for both alleles at a minimum of 10 out of 16 microsatellite loci, which is our threshold for inclusion in DNA assignment analyses. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

[Study on a collagenase protocol to extract DNA from remnant feathers in edible bird's nest].

PubMed

Wang, Ling-Li; Chen, Nian; Zhang, Wei-Wei; Wu, Guo-Hong; Lai, Xiao-Ping

2013-08-01

To establish a method for extracting genomic DNA from rudimental bird feather from the precious edible bird's nest (EBN) harvested from the swiftlet cave. Observed the EBN using endoscopic and studied the influence of adding collagenase on the extracting yield of DNA. PCR amplification and sequencing for the extraction was also conducted. Collagenase was used in addition to protease K which could substantively increase the DNA yield. The DNA extracted by this method could be used for PCR and other molecular biology analyses. This method can be applied to identify the species types in biological products, especially for animal tissue materials that rich in collagen.

Novel selection methods for DNA-encoded chemical libraries

PubMed Central

Chan, Alix I.; McGregor, Lynn M.; Liu, David R.

2015-01-01

Driven by the need for new compounds to serve as biological probes and leads for therapeutic development and the growing accessibility of DNA technologies including high-throughput sequencing, many academic and industrial groups have begun to use DNA-encoded chemical libraries as a source of bioactive small molecules. In this review, we describe the technologies that have enabled the selection of compounds with desired activities from these libraries. These methods exploit the sensitivity of in vitro selection coupled with DNA amplification to overcome some of the limitations and costs associated with conventional screening methods. In addition, we highlight newer techniques with the potential to be applied to the high-throughput evaluation of DNA-encoded chemical libraries. PMID:25723146

Identification of Prostate Cancer-Specific microDNAs

DTIC Science & Technology

2014-12-01

displacement amplification (MDA). 2 adopted multiple displacement amplification (MDA) with random primers for enriched circular DNA by rolling circle ... amplification (RCA) (Fig. 1) and then amplified DNA fragments were subject to deep sequencing. Sequence NO of Reads seq 1 184 seq 2 133 seq 3 2407 seq...prostate cancer cells through multiple displacement amplification .  Clone #7 is the top candidate which has been cloned in an expression vector and it

Toehold-mediated strand displacement reaction triggered isothermal DNA amplification for highly sensitive and selective fluorescent detection of single-base mutation.

PubMed

Zhu, Jing; Ding, Yongshun; Liu, Xingti; Wang, Lei; Jiang, Wei

2014-09-15

Highly sensitive and selective detection strategy for single-base mutations is essential for risk assessment of malignancy and disease prognosis. In this work, a fluorescent detection method for single-base mutation was proposed based on high selectivity of toehold-mediated strand displacement reaction (TSDR) and powerful signal amplification capability of isothermal DNA amplification. A discrimination probe was specially designed with a stem-loop structure and an overhanging toehold domain. Hybridization between the toehold domain and the perfect matched target initiated the TSDR along with the unfolding of the discrimination probe. Subsequently, the target sequence acted as a primer to initiate the polymerization and nicking reactions, which released a great abundant of short sequences. Finally, the released strands were annealed with the reporter probe, launching another polymerization and nicking reaction to produce lots of G-quadruplex DNA, which could bind the N-methyl mesoporphyrin IX to yield an enhanced fluorescence response. However, when there was even a single base mismatch in the target DNA, the TSDR was suppressed and so subsequent isothermal DNA amplification and fluorescence response process could not occur. The proposed approach has been successfully implemented for the identification of the single-base mutant sequences in the human KRAS gene with a detection limit of 1.8 pM. Furthermore, a recovery of 90% was obtained when detecting the target sequence in spiked HeLa cells lysate, demonstrating the feasibility of this detection strategy for single-base mutations in biological samples. Copyright © 2014 Elsevier B.V. All rights reserved.

Microarray-Based Analysis of Subnanogram Quantities of Microbial Community DNAs by Using Whole-Community Genome Amplification†

PubMed Central

Wu, Liyou; Liu, Xueduan; Schadt, Christopher W.; Zhou, Jizhong

2006-01-01

Microarray technology provides the opportunity to identify thousands of microbial genes or populations simultaneously, but low microbial biomass often prevents application of this technology to many natural microbial communities. We developed a whole-community genome amplification-assisted microarray detection approach based on multiple displacement amplification. The representativeness of amplification was evaluated using several types of microarrays and quantitative indexes. Representative detection of individual genes or genomes was obtained with 1 to 100 ng DNA from individual or mixed genomes, in equal or unequal abundance, and with 1 to 500 ng community DNAs from groundwater. Lower concentrations of DNA (as low as 10 fg) could be detected, but the lower template concentrations affected the representativeness of amplification. Robust quantitative detection was also observed by significant linear relationships between signal intensities and initial DNA concentrations ranging from (i) 0.04 to 125 ng (r2 = 0.65 to 0.99) for DNA from pure cultures as detected by whole-genome open reading frame arrays, (ii) 0.1 to 1,000 ng (r2 = 0.91) for genomic DNA using community genome arrays, and (iii) 0.01 to 250 ng (r2 = 0.96 to 0.98) for community DNAs from ethanol-amended groundwater using 50-mer functional gene arrays. This method allowed us to investigate the oligotrophic microbial communities in groundwater contaminated with uranium and other metals. The results indicated that microorganisms containing genes involved in contaminant degradation and immobilization are present in these communities, that their spatial distribution is heterogeneous, and that microbial diversity is greatly reduced in the highly contaminated environment. PMID:16820490

New, Improved Version of the mCOP-PCR Screening System for Detection of Spinal Muscular Atrophy Gene (SMN1) Deletion.

PubMed

Shinohara, Masakazu; Ar Rochmah, Mawaddah; Nakanishi, Kenta; Harahap, Nur Imma Fatimah; Niba, Emma Tabe Eko; Saito, Toshio; Saito, Kayoko; Takeuchi, Atsuko; Bouike, Yoshihiro; Nishio, Hisahide

2017-09-07

Spinal muscular atrophy (SMA) is a frequent autosomal recessive disorder, characterized by lower motor neuron loss in the spinal cord. More than 95% of SMA patients show homozygous survival motor neuron 1 (SMN1) deletion. We previously developed a screening system for SMN1 deletion based on a modified competitive oligonucleotide priming-PCR (mCOP-PCR) technique. However, non-specific amplification products were observed with mCOP-PCR, which might lead to erroneous interpretation of the screening results. To establish an improved version of the mCOP-PCR screening system without non-specific amplification. DNA samples were assayed using a new version of the mCOP-PCR screening system. DNA samples had already been genotyped by PCR-restriction fragment length polymorphism (PCR-RFLP), showing the presence or absence of SMN1 exon 7. The new mCOP-PCR method contained a targeted pre-amplification step of the region, including an SMN1-specific nucleotide, prior to the mCOP-PCR step. mCOP-PCR products were electrophoresed on agarose gels. No non-specific amplification products were detected in electrophoresis gels with the new mCOP-PCR screening system. An additional targeted pre-amplification step eliminated non-specific amplification from mCOP-PCR screening.

Relative quantification of 40 nucleic acid sequences by multiplex ligation-dependent probe amplification

PubMed Central

Schouten, Jan P.; McElgunn, Cathal J.; Waaijer, Raymond; Zwijnenburg, Danny; Diepvens, Filip; Pals, Gerard

2002-01-01

We describe a new method for relative quantification of 40 different DNA sequences in an easy to perform reaction requiring only 20 ng of human DNA. Applications shown of this multiplex ligation-dependent probe amplification (MLPA) technique include the detection of exon deletions and duplications in the human BRCA1, MSH2 and MLH1 genes, detection of trisomies such as Down’s syndrome, characterisation of chromosomal aberrations in cell lines and tumour samples and SNP/mutation detection. Relative quantification of mRNAs by MLPA will be described elsewhere. In MLPA, not sample nucleic acids but probes added to the samples are amplified and quantified. Amplification of probes by PCR depends on the presence of probe target sequences in the sample. Each probe consists of two oligonucleotides, one synthetic and one M13 derived, that hybridise to adjacent sites of the target sequence. Such hybridised probe oligonucleotides are ligated, permitting subsequent amplification. All ligated probes have identical end sequences, permitting simultaneous PCR amplification using only one primer pair. Each probe gives rise to an amplification product of unique size between 130 and 480 bp. Probe target sequences are small (50–70 nt). The prerequisite of a ligation reaction provides the opportunity to discriminate single nucleotide differences. PMID:12060695

Relative quantification of 40 nucleic acid sequences by multiplex ligation-dependent probe amplification.

PubMed

Schouten, Jan P; McElgunn, Cathal J; Waaijer, Raymond; Zwijnenburg, Danny; Diepvens, Filip; Pals, Gerard

2002-06-15

We describe a new method for relative quantification of 40 different DNA sequences in an easy to perform reaction requiring only 20 ng of human DNA. Applications shown of this multiplex ligation-dependent probe amplification (MLPA) technique include the detection of exon deletions and duplications in the human BRCA1, MSH2 and MLH1 genes, detection of trisomies such as Down's syndrome, characterisation of chromosomal aberrations in cell lines and tumour samples and SNP/mutation detection. Relative quantification of mRNAs by MLPA will be described elsewhere. In MLPA, not sample nucleic acids but probes added to the samples are amplified and quantified. Amplification of probes by PCR depends on the presence of probe target sequences in the sample. Each probe consists of two oligonucleotides, one synthetic and one M13 derived, that hybridise to adjacent sites of the target sequence. Such hybridised probe oligonucleotides are ligated, permitting subsequent amplification. All ligated probes have identical end sequences, permitting simultaneous PCR amplification using only one primer pair. Each probe gives rise to an amplification product of unique size between 130 and 480 bp. Probe target sequences are small (50-70 nt). The prerequisite of a ligation reaction provides the opportunity to discriminate single nucleotide differences.

The thermal history of human fossils and the likelihood of successful DNA amplification.

PubMed

Smith, Colin I; Chamberlain, Andrew T; Riley, Michael S; Stringer, Chris; Collins, Matthew J

2003-09-01

Recent success in the amplification of ancient DNA (aDNA) from fossil humans has led to calls for further tests to be carried out on similar material. However, there has been little systematic research on the survival of DNA in the fossil record, even though the environment of the fossil is known to be of paramount importance for the survival of biomolecules over archaeological and geological timescales. A better understanding of aDNA survival would enable research to focus on material with greater chances of successful amplification, thus preventing the unnecessary loss of material and valuable researcher time. We argue that the thermal history of a fossil is a key parameter for the survival of biomolecules. The thermal history of a number of northwest European Neanderthal cave sites is reconstructed here and they are ranked in terms of the relative likelihood of aDNA survival at the sites, under the assumption that DNA depurination is the principal mechanism of degradation. The claims of aDNA amplification from material found at Lake Mungo, Australia, are also considered in the light of the thermal history of this site.

Following basal stem rot in young oil palm plantings.

PubMed

Panchal, G; Bridge, P D

2005-01-01

The PCR primer GanET has previously been shown to be suitable for the specific amplification of DNA from Ganoderma boninense. A DNA extraction and PCR method has been developed that allows for the amplification of the G. boninense DNA from environmental samples of oil palm tissue. The GanET primer reaction was used in conjunction with a palm-sampling programme to investigate the possible infection of young palms through cut frond base surfaces. Ganoderma DNA was detected in frond base material at a greater frequency than would be expected by comparison with current infection levels. Comparisons are made between the height of the frond base infected, the number of frond bases infected, and subsequent development of basal stem rot. The preliminary results suggest that the development of basal stem rot may be more likely to occur when young lower frond bases are infected.

Signal amplification by rolling circle amplification on DNA microarrays

PubMed Central

Nallur, Girish; Luo, Chenghua; Fang, Linhua; Cooley, Stephanie; Dave, Varshal; Lambert, Jeremy; Kukanskis, Kari; Kingsmore, Stephen; Lasken, Roger; Schweitzer, Barry

2001-01-01

While microarrays hold considerable promise in large-scale biology on account of their massively parallel analytical nature, there is a need for compatible signal amplification procedures to increase sensitivity without loss of multiplexing. Rolling circle amplification (RCA) is a molecular amplification method with the unique property of product localization. This report describes the application of RCA signal amplification for multiplexed, direct detection and quantitation of nucleic acid targets on planar glass and gel-coated microarrays. As few as 150 molecules bound to the surface of microarrays can be detected using RCA. Because of the linear kinetics of RCA, nucleic acid target molecules may be measured with a dynamic range of four orders of magnitude. Consequently, RCA is a promising technology for the direct measurement of nucleic acids on microarrays without the need for a potentially biasing preamplification step. PMID:11726701

Extraction of High Quality DNA from Seized Moroccan Cannabis Resin (Hashish)

PubMed Central

El Alaoui, Moulay Abdelaziz; Melloul, Marouane; Alaoui Amine, Sanaâ; Stambouli, Hamid; El Bouri, Aziz; Soulaymani, Abdelmajid; El Fahime, Elmostafa

2013-01-01

The extraction and purification of nucleic acids is the first step in most molecular biology analysis techniques. The objective of this work is to obtain highly purified nucleic acids derived from Cannabis sativa resin seizure in order to conduct a DNA typing method for the individualization of cannabis resin samples. To obtain highly purified nucleic acids from cannabis resin (Hashish) free from contaminants that cause inhibition of PCR reaction, we have tested two protocols: the CTAB protocol of Wagner and a CTAB protocol described by Somma (2004) adapted for difficult matrix. We obtained high quality genomic DNA from 8 cannabis resin seizures using the adapted protocol. DNA extracted by the Wagner CTAB protocol failed to give polymerase chain reaction (PCR) amplification of tetrahydrocannabinolic acid (THCA) synthase coding gene. However, the extracted DNA by the second protocol permits amplification of THCA synthase coding gene using different sets of primers as assessed by PCR. We describe here for the first time the possibility of DNA extraction from (Hashish) resin derived from Cannabis sativa. This allows the use of DNA molecular tests under special forensic circumstances. PMID:24124454

Colorimetric detection of genetically modified organisms based on exonuclease III-assisted target recycling and hemin/G-quadruplex DNAzyme amplification.

PubMed

Zhang, Decai; Wang, Weijia; Dong, Qian; Huang, Yunxiu; Wen, Dongmei; Mu, Yuejing; Yuan, Yong

2017-12-21

An isothermal colorimetric method is described for amplified detection of the CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on (a) target DNA-triggered unlabeled molecular beacon (UMB) termini binding, and (b) exonuclease III (Exo III)-assisted target recycling, and (c) hemin/G-quadruplex (DNAzyme) based signal amplification. The specific binding of target to the G-quadruplex sequence-locked UMB triggers the digestion of Exo III. This, in turn, releases an active G-quadruplex segment and target DNA for successive hybridization and cleavage. The Exo III impellent recycling of targets produces numerous G-quadruplex sequences. These further associate with hemin to form DNAzymes and hence will catalyze H 2 O 2 -mediated oxidation of the chromogenic enzyme substrate ABTS 2- causing the formation of a green colored product. This finding enables a sensitive colorimetric determination of GMO DNA (at an analytical wavelength of 420 nm) at concentrations as low as 0.23 nM. By taking advantage of isothermal incubation, this method does not require sophisticated equipment or complicated syntheses. Analyses can be performed within 90 min. The method also discriminates single base mismatches. In our perception, it has a wide scope in that it may be applied to the detection of many other GMOs. Graphical abstract An isothermal and sensitive colorimetric method is described for amplified detection of CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on target DNA-triggered molecular beacon (UMB) termini-binding and exonuclease III assisted target recycling, and on hemin/G-quadruplex (DNAzyme) signal amplification.

Mapping DNA methylation by transverse current sequencing: Reduction of noise from neighboring nucleotides

NASA Astrophysics Data System (ADS)

Alvarez, Jose; Massey, Steven; Kalitsov, Alan; Velev, Julian

Nanopore sequencing via transverse current has emerged as a competitive candidate for mapping DNA methylation without needed bisulfite-treatment, fluorescent tag, or PCR amplification. By eliminating the error producing amplification step, long read lengths become feasible, which greatly simplifies the assembly process and reduces the time and the cost inherent in current technologies. However, due to the large error rates of nanopore sequencing, single base resolution has not been reached. A very important source of noise is the intrinsic structural noise in the electric signature of the nucleotide arising from the influence of neighboring nucleotides. In this work we perform calculations of the tunneling current through DNA molecules in nanopores using the non-equilibrium electron transport method within an effective multi-orbital tight-binding model derived from first-principles calculations. We develop a base-calling algorithm accounting for the correlations of the current through neighboring bases, which in principle can reduce the error rate below any desired precision. Using this method we show that we can clearly distinguish DNA methylation and other base modifications based on the reading of the tunneling current.

Rapid detection of Porcine circovirus 2 by recombinase polymerase amplification.

PubMed

Wang, Jianchang; Wang, Jinfeng; Liu, Libing; Li, Ruiwen; Yuan, Wanzhe

2016-09-01

Porcine circovirus-associated disease, caused primarily by Porcine circovirus 2 (PCV-2), has become endemic in many pig-producing countries and has resulted in significant economic losses to the swine industry worldwide. Tests for PCV-2 infection include PCR, nested PCR, competitive PCR, and real-time PCR (rtPCR). Recombinase polymerase amplification (RPA) has emerged as an isothermal gene amplification technology for the molecular detection of infectious disease agents. RPA is performed at a constant temperature and therefore can be carried out in a water bath. In addition, RPA is completed in ~30 min, much faster than PCR, which usually takes >60 min. We developed a RPA-based method for the detection of PCV-2. The detection limit of RPA was 10(2) copies of PCV-2 genomic DNA. RPA showed the same sensitivity as rtPCR but was 10 times more sensitive than conventional PCR. Successful amplification of PCV-2 DNA, but not other viral templates, demonstrated high specificity of the RPA assay. This method was also validated using clinical samples. The results showed that the RPA assay had a diagnostic agreement rate of 93.7% with conventional PCR and 100% with rtPCR. These findings suggest that the RPA assay is a simple, rapid, and cost-effective method for PCV-2 detection, which could be potentially applied in clinical diagnosis and field surveillance of PCV-2 infection. © 2016 The Author(s).

Isothermal Recombinase Polymerase amplification (RPA) of Schistosoma haematobium DNA and oligochromatographic lateral flow detection.

PubMed

Rosser, A; Rollinson, D; Forrest, M; Webster, B L

2015-09-04

Accurate diagnosis of urogenital schistosomiasis is vital for surveillance/control programs. Amplification of schistosome DNA in urine by PCR is sensitive and specific but requires infrastructure, financial resources and skilled personnel, often not available in endemic areas. Recombinase Polymerase Amplification (RPA) is an isothermal DNA amplification/detection technology that is simple, rapid, portable and needs few resources. Here a Schistosoma haematobium RPA assay was developed and adapted so that DNA amplicons could be detected using oligochromatographic Lateral Flow (LF) strips. The assay successfully amplified S. haematobium DNA at 30-45 °C in 10 mins and was sensitive to a lower limit of 100 fg of DNA. The assay was also successful with the addition of crude urine, up to 5% of the total reaction volume. Cross amplification occurred with other schistosome species but not with other common urine microorganisms. The LF-RPA assay developed here can amplify and detect low levels of S. haematobium DNA. Reactions are rapid, require low temperatures and positive reactions are interpreted using lateral flow strips, reducing the need for infrastructure and resources. This together with an ability to withstand inhibitors within urine makes RPA a promising technology for further development as a molecular diagnostic tool for urogenital schistosomiasis.

Methods for applying accurate digital PCR analysis on low copy DNA samples.

PubMed

Whale, Alexandra S; Cowen, Simon; Foy, Carole A; Huggett, Jim F

2013-01-01

Digital PCR (dPCR) is a highly accurate molecular approach, capable of precise measurements, offering a number of unique opportunities. However, in its current format dPCR can be limited by the amount of sample that can be analysed and consequently additional considerations such as performing multiplex reactions or pre-amplification can be considered. This study investigated the impact of duplexing and pre-amplification on dPCR analysis by using three different assays targeting a model template (a portion of the Arabidopsis thaliana alcohol dehydrogenase gene). We also investigated the impact of different template types (linearised plasmid clone and more complex genomic DNA) on measurement precision using dPCR. We were able to demonstrate that duplex dPCR can provide a more precise measurement than uniplex dPCR, while applying pre-amplification or varying template type can significantly decrease the precision of dPCR. Furthermore, we also demonstrate that the pre-amplification step can introduce measurement bias that is not consistent between experiments for a sample or assay and so could not be compensated for during the analysis of this data set. We also describe a model for estimating the prevalence of molecular dropout and identify this as a source of dPCR imprecision. Our data have demonstrated that the precision afforded by dPCR at low sample concentration can exceed that of the same template post pre-amplification thereby negating the need for this additional step. Our findings also highlight the technical differences between different templates types containing the same sequence that must be considered if plasmid DNA is to be used to assess or control for more complex templates like genomic DNA.

Methods for Applying Accurate Digital PCR Analysis on Low Copy DNA Samples

PubMed Central

Whale, Alexandra S.; Cowen, Simon; Foy, Carole A.; Huggett, Jim F.

2013-01-01

Digital PCR (dPCR) is a highly accurate molecular approach, capable of precise measurements, offering a number of unique opportunities. However, in its current format dPCR can be limited by the amount of sample that can be analysed and consequently additional considerations such as performing multiplex reactions or pre-amplification can be considered. This study investigated the impact of duplexing and pre-amplification on dPCR analysis by using three different assays targeting a model template (a portion of the Arabidopsis thaliana alcohol dehydrogenase gene). We also investigated the impact of different template types (linearised plasmid clone and more complex genomic DNA) on measurement precision using dPCR. We were able to demonstrate that duplex dPCR can provide a more precise measurement than uniplex dPCR, while applying pre-amplification or varying template type can significantly decrease the precision of dPCR. Furthermore, we also demonstrate that the pre-amplification step can introduce measurement bias that is not consistent between experiments for a sample or assay and so could not be compensated for during the analysis of this data set. We also describe a model for estimating the prevalence of molecular dropout and identify this as a source of dPCR imprecision. Our data have demonstrated that the precision afforded by dPCR at low sample concentration can exceed that of the same template post pre-amplification thereby negating the need for this additional step. Our findings also highlight the technical differences between different templates types containing the same sequence that must be considered if plasmid DNA is to be used to assess or control for more complex templates like genomic DNA. PMID:23472156

Highly Sensitive Colorimetric Cancer Cell Detection Based on Dual Signal Amplification.

PubMed

Yu, Tao; Dai, Pan-Pan; Xu, Jing-Juan; Chen, Hong-Yuan

2016-02-01

Facile and efficient detection of cancer cells at their preclinical stages is one of the central challenges in cancer diagnostics. A direct, rapid, highly sensitive and specific biosensor for detection of cancer biomarkers is desirable in early diagnosis and prognosis of cancer. In this work, we developed, for the first time, an easy and intuitive dispersion-dominated colorimetric strategy for cancer cell detection based on combining multi-DNA released from an aptamer scaffold with cyclic enzymatic amplification, which was triggered by aptamer DNA conformational switch and demonstrated by non-cross-linking gold nanoparticles (Au NPs) aggregation. First, five kinds of messenger DNAs (mDNAs) were aligned on the cancer cell aptamers modified on magnetic beads (MBs) to form mDNAs-Apt-MBs biocompatible nanosensors. In the presence of target cells, the aptamer would bind to the receptors on the cell membranes, and mDNAs would be released, resulting in the first amplification that one biological binding event would cause the release of multiple kinds of mDNAs simultaneously. After magnetic separation, the released mDNAs were introduced into the cyclic enzymatic amplification to cleave more single strand DNA (ssDNA) fragments. Instead of modification of Au NPs, these fragments and mDNAs could be adsorbed on the surface of Au NPs to prevent particle aggregation and ensure the stability and color of solution in high salt environments. The linear response for HL-60 cells in a concentration range from 10 to 10(4) cells was obtained with a detection limit of four cells in buffer solution. Moreover, the feasibility of the proposed strategy was demonstrated in a diluted serum sample. This dual signal amplification method can be extended to other types of cancer cells, which has potential application in point-of-care cancer diagnosis.

Identification of salivary Lactobacillus rhamnosus species by DNA profiling and a specific probe.

PubMed

Richard, B; Groisillier, A; Badet, C; Dorignac, G; Lonvaud-Funel, A

2001-03-01

The Lactobacillus genus has been shown to be associated with the dental carious process, but little is known about the species related to the decay, although Lactobacillus rhamnosus is suspected to be the most implicated species. Conventional identification methods based on biochemical criteria lead to ambiguous results, since the Lactobacillus species found in saliva are phenotypically close. To clarify the role of this genus in the evolution of carious disease, this work aimed to find a rapid and reliable method for identifying the L. rhamnosus species. Methods based on hybridization with DNA probes and DNA amplification by PCR were used. The dominant salivary Lactobacillus species (reference strains from the ATCC) were selected for this purpose as well as some wild strains isolated from children's saliva. DNA profiling using semirandom polymorphic DNA amplification (semi-RAPD) generated specific patterns for L. rhamnosus ATCC 7469. The profiles of all L. rhamnosus strains tested were similar and could be grouped; these strains shared four common fragments. Wild strains first identified with classic methods shared common patterns with the L. rhamnosus species and could be reclassified. One fragment of the profile was purified, cloned, used as a probe and found to be specific to the L. rhamnosus species. These results may help to localize this species within its ecological niche and to elucidate the progression of the carious process.

Single-cell paired-end genome sequencing reveals structural variation per cell cycle

PubMed Central

Voet, Thierry; Kumar, Parveen; Van Loo, Peter; Cooke, Susanna L.; Marshall, John; Lin, Meng-Lay; Zamani Esteki, Masoud; Van der Aa, Niels; Mateiu, Ligia; McBride, David J.; Bignell, Graham R.; McLaren, Stuart; Teague, Jon; Butler, Adam; Raine, Keiran; Stebbings, Lucy A.; Quail, Michael A.; D’Hooghe, Thomas; Moreau, Yves; Futreal, P. Andrew; Stratton, Michael R.; Vermeesch, Joris R.; Campbell, Peter J.

2013-01-01

The nature and pace of genome mutation is largely unknown. Because standard methods sequence DNA from populations of cells, the genetic composition of individual cells is lost, de novo mutations in cells are concealed within the bulk signal and per cell cycle mutation rates and mechanisms remain elusive. Although single-cell genome analyses could resolve these problems, such analyses are error-prone because of whole-genome amplification (WGA) artefacts and are limited in the types of DNA mutation that can be discerned. We developed methods for paired-end sequence analysis of single-cell WGA products that enable (i) detecting multiple classes of DNA mutation, (ii) distinguishing DNA copy number changes from allelic WGA-amplification artefacts by the discovery of matching aberrantly mapping read pairs among the surfeit of paired-end WGA and mapping artefacts and (iii) delineating the break points and architecture of structural variants. By applying the methods, we capture DNA copy number changes acquired over one cell cycle in breast cancer cells and in blastomeres derived from a human zygote after in vitro fertilization. Furthermore, we were able to discover and fine-map a heritable inter-chromosomal rearrangement t(1;16)(p36;p12) by sequencing a single blastomere. The methods will expedite applications in basic genome research and provide a stepping stone to novel approaches for clinical genetic diagnosis. PMID:23630320

Real-time quantitative PCR detection of circulating tumor cells using tag DNA mediated signal amplification strategy.

PubMed

Mei, Ting; Lu, Xuewen; Sun, Ning; Li, Xiaomei; Chen, Jitao; Liang, Min; Zhou, Xinke; Fang, Zhiyuan

2018-06-05

The level of circulating tumor cell (CTCs) is a reliable marker for tumor burden and malignant progression. Quantification of CTCs remains technically challenging due to the rarity of these cells in peripheral blood. In the present study, we established a real-time quantitative PCR (Q-PCR) based method for sensitive detection of CTCs without DNA extraction. Blood sample was first turned to erythrocyte lyses and then incubated with two antibodies, tag-DNA modified CK-19 antibody and magnetic beads conjugated EpCAM antibody. Tumor cells were further enriched by magnetic separation. Tag-DNA that immobilized on tumor cells through CK-19 antibodies were also retrieved, which was further quantified by Q-PCR. This assay was able to detect single tumor cell in a 5 mL blood sample. The detection rate of clinical tumor blood sample was 92.3%. Furthermore, CTC count in patient was correlated with tumor stage and tumor status. The signal amplification was based on tag DNA rather than tumor gene, which was independent of nucleic acid extraction. With high sensitivity and convenience, this method can be a good alternative for the determination of cancer progress. Copyright © 2018 Elsevier B.V. All rights reserved.

DNA analysis of molluscs from a museum wet collection: a comparison of different extraction methods.

PubMed

Jaksch, Katharina; Eschner, Anita; Rintelen, Thomas V; Haring, Elisabeth

2016-07-18

DNA isolation and PCR amplification from molluscan taxa is considered as problematic because polysaccharides in tissue and mucus presumably co-precipitate with the DNA and inhibit the activity of DNA polymerase. In the present study we tested two common extraction methods on specimens from the mollusc collection of the Natural History Museum Vienna (NHMW). We analysed a broad variety of taxa covering a large temporal span (acquisition years 1877 to 1999), which distinguishes our study from previous ones where mostly fresh material was used. We also took other factors into account: effects of sample age, effects of formaldehyde treatment and taxon-specific problems. We used several primer combinations to amplify amplicons of different lengths of two mitochondrial genes: cytochrome c oxidase subunit 1 (COI) and 16S rRNA gene (16S). Overall PCR success was 43 % in the 576 extractions (including all primer combinations). The smallest amplicon (~240 bp) showed the best results (49 % positive reactions), followed by the 400 bp amplicon (40.5 %). Both short sections yielded significantly better results than the 700 bp long amplicon (27 %). Comparatively, the Gen-ial-First, All-tissue DNA-Kit-extraction method performed significantly better than Promega-Tissue and Hair Extraction Kit. Generally, PCR success is age-dependent. Nonetheless, we were able to obtain the longest amplicon even from 137-year-old material. Importantly, formaldehyde traces did not totally inhibit amplification success, although very high concentrations did. Museum material has gained importance for DNA analysis in recent years, especially for DNA barcoding projects. In some cases, however, the amplification of the standard barcoding region (partial sequence of the COI) is problematic with old material. Our study clearly shows that the COI barcoding region could be amplified in up to 49 % of PCRs (varying with amplicon length), which is, for museum samples, quite a high percentage. The difference between extraction methods was minimal and we recommend using an established kit for a first attempt because experience and routine in handling might be more important than slight performance differences of the various kits. Finally, we identify fixation, storage, sample conservation and documentation of the specimens' history rather than the DNA extraction method to be the most crucial factors for PCR success.

Detection of Babesia bovis carrier cattle by using polymerase chain reaction amplification of parasite DNA.

PubMed Central

Fahrimal, Y; Goff, W L; Jasmer, D P

1992-01-01

Carrier cattle infected with Babesia bovis are difficult to detect because of the low numbers of parasites that occur in peripheral blood. However, diagnosis of low-level infections with the parasite is important for evaluating the efficacies of vaccines and in transmission and epidemiological studies. We used the polymerase chain reaction (PCR) to amplify a portion of the apocytochrome b gene from the parasite and tested the ability of this method to detect carrier cattle. The target sequence is associated with a 7.4-kb DNA element in undigested B. bovis genomic DNA (as shown previously), and the amplified product was detected by Southern and dot blot hybridization. The assay was specific for B. bovis, since no amplification was detected with Babesia bigemina, Trypanosoma brucei, Anaplasma marginale, or leukocyte DNA. The target sequence was amplified in DNA from B. bovis Mexico, Texas, and Australia S and L strains, demonstrating the applicability of the method to strains from different geographic regions. The sensitivity of the method ranged from 1 to 10 infected erythrocytes extracted from 0.5 ml of blood. This sensitivity was about 1,000 times greater than that from the use of unamplified parasite DNA. By the PCR method, six B. bovis carrier cattle were detected 86% of the time (range, 66 to 100%) when they were tested 11 times, while with microscopic examination of thick blood smears, the same carrier cattle were detected only 36% of the time (range, 17 to 66%). The method provides a useful diagnostic tool for detecting B. bovis carrier cattle, and the sensitivity is significantly improved over that of current methods. The results also suggest that characteristics of the apocytchrome b gene may make this a valuable target DNA for PCR-based detection of other hemoparasites. Images PMID:1624551

Amplification of the entire kanamycin biosynthetic gene cluster during empirical strain improvement of Streptomyces kanamyceticus.

PubMed

Yanai, Koji; Murakami, Takeshi; Bibb, Mervyn

2006-06-20

Streptomyces kanamyceticus 12-6 is a derivative of the wild-type strain developed for industrial kanamycin (Km) production. Southern analysis and DNA sequencing revealed amplification of a large genomic segment including the entire Km biosynthetic gene cluster in the chromosome of strain 12-6. At 145 kb, the amplifiable unit of DNA (AUD) is the largest AUD reported in Streptomyces. Striking repetitive DNA sequences belonging to the clustered regularly interspaced short palindromic repeats family were found in the AUD and may play a role in its amplification. Strain 12-6 contains a mixture of different chromosomes with varying numbers of AUDs, sometimes exceeding 36 copies and producing an amplified region >5.7 Mb. The level of Km production depended on the copy number of the Km biosynthetic gene cluster, suggesting that DNA amplification occurred during strain improvement as a consequence of selection for increased Km resistance. Amplification of DNA segments including entire antibiotic biosynthetic gene clusters might be a common mechanism leading to increased antibiotic production in industrial strains.

Integration of single-molecule detection with magnetic separation for multiplexed detection of DNA glycosylases.

PubMed

Li, Chen-Chen; Zhang, Yan; Tang, Bo; Zhang, Chun-Yang

2018-06-05

We combine single-molecule detection with magnetic separation for simultaneous measurement of human 8-oxoG DNA glycosylase 1 (hOGG1) and uracil DNA glycosylase (UDG) based on excision repair-initiated endonuclease IV (Endo IV)-assisted signal amplification. This method can sensitively detect multiple DNA glycosylases, and it can be further applied for the simultaneous measurement of enzyme kinetic parameters and screening of both hOGG1 and UDG inhibitors.

Origins of DNA Replication and Amplification in the Breast Cancer Genome

DTIC Science & Technology

2011-09-01

AD_________________ Award Number: W81XWH-10-1-0463 TITLE: Origins of DNA Replication and...hypothesis we need to map origins of DNA replication in the genome and ask which of these coincide with sites of DNA amplification and with ER...Spring Harbor DNA Replication meetings this summer/earlyfall. Figures from the posters and also the abstracts are attached. The samples have been

Development of a multiplex polymerase chain reaction-sequence-specific primer method for NKG2D and NKG2F single-nucleotide polymorphism typing using isothermal multiple displacement amplification products.

PubMed

Kaewmanee, M; Phoksawat, W; Romphruk, A; Romphruk, A V; Jumnainsong, A; Leelayuwat, C

2013-06-01

Natural killer group 2 member D (NKG2D) on immune effector cells recognizes multiple stress-inducible ligands. NKG2D single-nucleotide polymorphism (SNP) haplotypes were related to the levels of cytotoxic activity of peripheral blood mononuclear cells. Indeed, these polymorphisms were also located in NKG2F. Isothermal multiple displacement amplification (IMDA) is used for whole genome amplification (WGA) that can amplify very small genomic DNA templates into microgram with whole genome coverage. This is particularly useful in the cases of limited amount of valuable DNA samples requiring multi-locus genotyping. In this study, we evaluated the quality and applicability of IMDA to genetic studies in terms of sensitivity, efficiency of IMDA re-amplification and stability of IMDA products. The smallest amount of DNA to be effectively amplified by IMDA was 200 pg yielding final DNA of approximately 16 µg within 1.5 h. IMDA could be re-amplified only once (second round of amplification), and could be kept for 5 months at 4°C and more than a year at -20°C without loosing genome coverage. The amplified products were used successfully to setup a multiplex polymerase chain reaction-sequence-specific primer for SNP typing of the NKG2D/F genes. The NKG2D/F multiplex polymerase chain reaction (PCR) contained six PCR mixtures for detecting 10 selected SNPs, including 8 NKG2D/F SNP haplotypes and 2 additional NKG2D coding SNPs. This typing procedure will be applicable in both clinical and research laboratories. Thus, our data provide useful information and limitations for utilization of genome-wide amplification using IMDA and its application for multiplex NKG2D/F typing. © 2013 John Wiley & Sons Ltd.

Development and application of loop-mediated isothermal amplification methods targeting the seM gene for detection of Streptococcus equi subsp. equi.

PubMed

Hobo, Seiji; Niwa, Hidekazu; Oku, Kazuomi

2012-03-01

Loop-mediated isothermal amplification (LAMP) constitutes a potentially valuable diagnostic tool for rapid diagnosis of contagious diseases. In this study, we developed a novel LAMP method (seM-LAMP) to detect the seM gene of Streptococcus equi subsp. equi (S. equi), the causative agent of strangles in equids. The seM-LAMP successfully amplified the target sequence of the seM gene at 63°C within 60 min. The sensitivity of the seM-LAMP was slightly lower than the 2nd reaction of the seM semi-nested PCR. To evaluate the species specificity of the seM-LAMP, we tested 100 S. equi and 189 non-S. equi strains. Significant amplification of the DNA originating from S. equi was observed within 60 min incubation, but no amplification of non-S. equi DNA occurred. The results were identical to those of seM semi-nested PCR. To investigate the clinical usefulness of the methods, the seM-LAMP and the seM semi-nested PCR were used to screen 590 nasal swabs obtained during an outbreak of strangles. Both methods showed that 79 and 511 swabs were S. equi positive and negative, respectively, and the results were identical to those of the culture examination. These results indicate that the seM-LAMP is potentially useful for the reliable routine diagnosis of Streptococcus equi subsp. equi infections.

DNAzymes in DNA Nanomachines and DNA Analysis

NASA Astrophysics Data System (ADS)

He, Yu; Tian, Ye; Chen, Yi; Mao, Chengde

This chapter discusses our efforts in using DNAzymes in DNA nano-machines and DNA analysis systems. 10-23 DNAzymes can cleave specific phos-phodiester bonds in RNA. We use them to construct an autonomous DNA-RNA chimera nanomotor, which constantly extracts chemical energy from RNA substrates and transduces the energy into a mechanical motion: cycles of contraction and extension. The motor's motion can be reversibly turned on and off by a DNA analogue (brake) of the RNA substrate. Addition and removal of the brake stops and restarts, respectively, the motor's motion. Furthermore, when the RNA substrates are preorganized into a one-dimensional track, a DNAzyme can continuously move along the track so long as there are substrates available ahead. Based on a similar mechanism, a novel DNA detection system has been developed. A target DNA activates a DNAzyme to cleave RNA-containing molecular beacons (MB), which generates an enhanced fluorescence signal. A following work integrates two steps of signal amplifications: a rolling-circle amplification (RCA) to synthesize multiple copies of DNAzymes, and the DNAzymes catalyze a chemical reaction to generate a colorimetric signal. This method allows detection of DNA analytes whose concentration is as low as 1 pM.

Fluorometric determination of nucleic acids based on the use of polydopamine nanotubes and target-induced strand displacement amplification.

PubMed

Ge, Jia; Bai, Dong-Mei; -Geng, Xin; Hu, Ya-Lei; Cai, Qi-Yong; Xing, Ke; Zhang, Lin; Li, Zhao-Hui

2018-01-10

The authors describe a fluorometric method for the quantitation of nucleic acids by combining (a) cycled strand displacement amplification, (b) the unique features of the DNA probe SYBR Green, and (c) polydopamine nanotubes. SYBR Green undergoes strong fluorescence enhancement upon intercalation into double-stranded DNA (dsDNA). The polydopamine nanotubes selectively adsorb single-stranded DNA (ssDNA) and molecular beacons. In the absence of target DNA, the molecular beacon, primer and SYBR Green are adsorbed on the surface of polydopamine nanotubes. This results in quenching of the fluorescence of SYBR Green, typically measured at excitation/emission wavelengths of 488/518 nm. Upon addition of analyte (target DNA) and polymerase, the stem of the molecular beacon is opened so that it can bind to the primer. This triggers target strand displacement polymerization, during which dsDNA is synthesized. The hybridized target is then displaced due to the strand displacement activity of the polymerase. The displaced target hybridizes with another molecular beacon. This triggers the next round of polymerization. Consequently, a large amount of dsDNA is formed which is detected by addition of SYBR Green. Thus, sensitive and selective fluorometric detection is realized. The fluorescent sensing strategy shows very good analytical performances towards DNA detection, such as a wide linear range from 0.05 to 25 nM with a low limit of detection of 20 pM. Graphical abstract Schematic of a fluorometric strategy for highly sensitive and selective determination of nucleic acids by combining strand displacement amplification and the unique features of SYBR Green I (SG) and polydopamine nanotubes.

Tip-enhanced fluorescence with radially polarized illumination for monitoring loop-mediated isothermal amplification on Hepatitis C virus cDNA

NASA Astrophysics Data System (ADS)

Wei, Shih-Chung; Chuang, Tsung-Liang; Wang, Da-Shin; Lu, Hui-Hsin; Gu, Frank X.; Sung, Kung-Bin; Lin, Chii-Wann

2015-02-01

A tip nanobiosensor for monitoring DNA replication was presented. The effects of excitation power and polarization on tip-enhanced fluorescence (TEF) were assessed with the tip immersed in fluorescein isothiocyanate solution first. The photon count rose on average fivefold with radially polarized illumination at 50 mW. We then used polymerase-functionalized tips for monitoring loop-mediated isothermal amplification on Hepatitis C virus cDNA. The amplicon-SYBR Green I complex was detected and compared to real-time loop-mediated isothermal amplification. The signals of the reaction using 4 and 0.004 ng/μl templates were detected 10 and 30 min earlier, respectively. The results showed the potential of TEF in developing a nanobiosensor for real-time DNA amplification.

Interlaboratory comparison of real-time pcr protocols for quantification of general fecal indicator bacteria

USGS Publications Warehouse

Shanks, O.C.; Sivaganesan, M.; Peed, L.; Kelty, C.A.; Blackwood, A.D.; Greene, M.R.; Noble, R.T.; Bushon, R.N.; Stelzer, E.A.; Kinzelman, J.; Anan'Eva, T.; Sinigalliano, C.; Wanless, D.; Griffith, J.; Cao, Y.; Weisberg, S.; Harwood, V.J.; Staley, C.; Oshima, K.H.; Varma, M.; Haugland, R.A.

2012-01-01

The application of quantitative real-time PCR (qPCR) technologies for the rapid identification of fecal bacteria in environmental waters is being considered for use as a national water quality metric in the United States. The transition from research tool to a standardized protocol requires information on the reproducibility and sources of variation associated with qPCR methodology across laboratories. This study examines interlaboratory variability in the measurement of enterococci and Bacteroidales concentrations from standardized, spiked, and environmental sources of DNA using the Entero1a and GenBac3 qPCR methods, respectively. Comparisons are based on data generated from eight different research facilities. Special attention was placed on the influence of the DNA isolation step and effect of simplex and multiplex amplification approaches on interlaboratory variability. Results suggest that a crude lysate is sufficient for DNA isolation unless environmental samples contain substances that can inhibit qPCR amplification. No appreciable difference was observed between simplex and multiplex amplification approaches. Overall, interlaboratory variability levels remained low (<10% coefficient of variation) regardless of qPCR protocol. ?? 2011 American Chemical Society.

Digital RNA sequencing minimizes sequence-dependent bias and amplification noise with optimized single-molecule barcodes

PubMed Central

Shiroguchi, Katsuyuki; Jia, Tony Z.; Sims, Peter A.; Xie, X. Sunney

2012-01-01

RNA sequencing (RNA-Seq) is a powerful tool for transcriptome profiling, but is hampered by sequence-dependent bias and inaccuracy at low copy numbers intrinsic to exponential PCR amplification. We developed a simple strategy for mitigating these complications, allowing truly digital RNA-Seq. Following reverse transcription, a large set of barcode sequences is added in excess, and nearly every cDNA molecule is uniquely labeled by random attachment of barcode sequences to both ends. After PCR, we applied paired-end deep sequencing to read the two barcodes and cDNA sequences. Rather than counting the number of reads, RNA abundance is measured based on the number of unique barcode sequences observed for a given cDNA sequence. We optimized the barcodes to be unambiguously identifiable, even in the presence of multiple sequencing errors. This method allows counting with single-copy resolution despite sequence-dependent bias and PCR-amplification noise, and is analogous to digital PCR but amendable to quantifying a whole transcriptome. We demonstrated transcriptome profiling of Escherichia coli with more accurate and reproducible quantification than conventional RNA-Seq. PMID:22232676

High-fidelity target sequencing of individual molecules identified using barcode sequences: de novo detection and absolute quantitation of mutations in plasma cell-free DNA from cancer patients.

PubMed

Kukita, Yoji; Matoba, Ryo; Uchida, Junji; Hamakawa, Takuya; Doki, Yuichiro; Imamura, Fumio; Kato, Kikuya

2015-08-01

Circulating tumour DNA (ctDNA) is an emerging field of cancer research. However, current ctDNA analysis is usually restricted to one or a few mutation sites due to technical limitations. In the case of massively parallel DNA sequencers, the number of false positives caused by a high read error rate is a major problem. In addition, the final sequence reads do not represent the original DNA population due to the global amplification step during the template preparation. We established a high-fidelity target sequencing system of individual molecules identified in plasma cell-free DNA using barcode sequences; this system consists of the following two steps. (i) A novel target sequencing method that adds barcode sequences by adaptor ligation. This method uses linear amplification to eliminate the errors introduced during the early cycles of polymerase chain reaction. (ii) The monitoring and removal of erroneous barcode tags. This process involves the identification of individual molecules that have been sequenced and for which the number of mutations have been absolute quantitated. Using plasma cell-free DNA from patients with gastric or lung cancer, we demonstrated that the system achieved near complete elimination of false positives and enabled de novo detection and absolute quantitation of mutations in plasma cell-free DNA. © The Author 2015. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Comparative evaluation of hepatitis C virus RNA quantitation by branched DNA, NASBA, and monitor assays.

PubMed

Lunel, F; Cresta, P; Vitour, D; Payan, C; Dumont, B; Frangeul, L; Reboul, D; Brault, C; Piette, J C; Huraux, J M

1999-02-01

Several studies have shown a relationship between pretreatment hepatitis C virus (HCV) viral load and the response to interferon (IFN) therapy, creating a need for quantitative HCV-RNA assays. Here, we compared three commercial methods: nucleic acid sequence-based amplification NASBA (Organon), branched DNA 2.0 (bDNA) (Chiron), and Monitor (Roche), with reverse-transcription polymerase chain reaction (RT-PCR) as the reference. We assessed sensitivity and reproducibility on a well-characterized panel of sera (EUROHEP), a Chimp Rodney plasma pool, and samples from IFN-treated and -untreated patients with chronic hepatitis C caused by different HCV genotypes. The reproducibility of the NASBA and bDNA methods was slightly better than that of Monitor, especially for genotypes 2 and 4. NASBA had the highest sensitivity (99% vs. 94% and 88% with Monitor and bDNA, respectively), especially for the follow-up of patients on IFN. NASBA gave the highest HCV-RNA concentrations, which were approximately 10-fold more than with the bDNA assay and 100-fold more than with the Monitor kit. The linearity, tested on the chimp Rodney plasma pool, was better with bDNA for high viral load than with NASBA and Monitor, although for low concentration of HCV RNA, bDNA was negative. Pretreatment viral load was lower in patients who had a sustained virological response to IFN, although the bDNA method was not sensitive enough to quantify all pretreatment samples. This study indicates that gene amplification methods (NASBA or Monitor) have better sensitivity than bDNA assays for quantification of HCV RNA in patients with chronic HCV infection, although the bDNA and NASBA methods are more likely to quantify all genotypes. Prospective studies are needed to demonstrate the usefulness of quantitative assays for the follow-up of patients with chronic hepatitis C.

Long-range barcode labeling-sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Feng; Zhang, Tao; Singh, Kanwar K.

Methods for sequencing single large DNA molecules by clonal multiple displacement amplification using barcoded primers. Sequences are binned based on barcode sequences and sequenced using a microdroplet-based method for sequencing large polynucleotide templates to enable assembly of haplotype-resolved complex genomes and metagenomes.

swga: a primer design toolkit for selective whole genome amplification.

PubMed

Clarke, Erik L; Sundararaman, Sesh A; Seifert, Stephanie N; Bushman, Frederic D; Hahn, Beatrice H; Brisson, Dustin

2017-07-15

Population genomic analyses are often hindered by difficulties in obtaining sufficient numbers of genomes for analysis by DNA sequencing. Selective whole-genome amplification (SWGA) provides an efficient approach to amplify microbial genomes from complex backgrounds for sequence acquisition. However, the process of designing sets of primers for this method has many degrees of freedom and would benefit from an automated process to evaluate the vast number of potential primer sets. Here, we present swga , a program that identifies primer sets for SWGA and evaluates them for efficiency and selectivity. We used swga to design and test primer sets for the selective amplification of Wolbachia pipientis genomic DNA from infected Drosophila melanogaster and Mycobacterium tuberculosis from human blood. We identify primer sets that successfully amplify each against their backgrounds and describe a general method for using swga for arbitrary targets. In addition, we describe characteristics of primer sets that correlate with successful amplification, and present guidelines for implementation of SWGA to detect new targets. Source code and documentation are freely available on https://www.github.com/eclarke/swga . The program is implemented in Python and C and licensed under the GNU Public License. ecl@mail.med.upenn.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

Highly sensitive fluorescence assay of DNA methyltransferase activity by methylation-sensitive cleavage-based primer generation exponential isothermal amplification-induced G-quadruplex formation.

PubMed

Xue, Qingwang; Lv, Yanqin; Xu, Shuling; Zhang, Yuanfu; Wang, Lei; Li, Rui; Yue, Qiaoli; Li, Haibo; Gu, Xiaohong; Zhang, Shuqiu; Liu, Jifeng

2015-04-15

Site-specific identification of DNA methylation and assay of MTase activity are imperative for determining specific cancer types, provide insights into the mechanism of gene repression, and develop novel drugs to treat methylation-related diseases. Herein, we developed a highly sensitive fluorescence assay of DNA methyltransferase by methylation-sensitive cleavage-based primer generation exponential isothermal amplification (PG-EXPA) coupled with supramolecular fluorescent Zinc(II)-protoporphyrin IX (ZnPPIX)/G-quadruplex. In the presence of DNA adenine methylation (Dam) MTase, the methylation-responsive sequence of hairpin probe is methylated and cleaved by the methylation-sensitive restriction endonuclease Dpn I. The cleaved hairpin probe then functions as a signal primer to initiate the exponential isothermal amplification reaction (EXPAR) by hybridizing with a unimolecular DNA containing three functional domains as the amplification template, producing a large number of G-quadruplex nanostructures by utilizing polymerases and nicking enzymes as mechanical activators. The G-quadruplex nanostructures act as host for ZnPPIX that lead to supramolecular complexes ZnPPIX/G-quadruplex, which provides optical labels for amplified fluorescence detection of Dam MTase. While in the absence of Dam MTase, neither methylation/cleavage nor PG-EXPA reaction can be initiated and no fluorescence signal is observed. The proposed method exhibits a wide dynamic range from 0.0002 to 20U/mL and an extremely low detection limit of 8.6×10(-5)U/mL, which is superior to most conventional approaches for the MTase assay. Owing to the specific site recognition of MTase toward its substrate, the proposed sensing system was able to readily discriminate Dam MTase from other MTase such as M.SssI and even detect the target in a complex biological matrix. Furthermore, the application of the proposed sensing strategy for screening Dam MTase inhibitors was also demonstrated with satisfactory results. This novel method not only provides a promising platform for monitoring activity and inhibition of DNA MTases, but also shows great potentials in biological process researches, drugs discovery and clinical diagnostics. Copyright © 2014 Elsevier B.V. All rights reserved.

Detection of Pseudomonas savastanoi pv. savastanoi in olive plants by enrichment and PCR.

PubMed

Penyalver, R; García, A; Ferrer, A; Bertolini, E; López, M M

2000-06-01

The sequence of the gene iaaL of Pseudomonas savastanoi EW2009 was used to design primers for PCR amplification. The iaaL-derived primers directed the amplification of a 454-bp fragment from genomic DNA isolated from 70 strains of P. savastanoi, whereas genomic DNA from 93 non-P. savastanoi isolates did not yield this amplified product. A previous bacterial enrichment in the semiselective liquid medium PVF-1 improved the PCR sensitivity level, allowing detection of 10 to 100 CFU/ml of plant extract. P. savastanoi was detected by the developed enrichment-PCR method in knots from different varieties of inoculated and naturally infected olive trees. Moreover, P. savastanoi was detected in symptomless stem tissues from naturally infected olive plants. This enrichment-PCR method is more sensitive and less cumbersome than the conventional isolation methods for detection of P. savastanoi.

Co-amplification at lower denaturation temperature-PCR: methodology and applications.

PubMed

Liang, Hui; Chen, Guo-Jie; Yu, Yan; Xiong, Li-Kuan

2018-03-20

Co-amplification at lower denaturation temperature-polymerase chain reaction (COLD-PCR) is a novel form of PCR that selectively denatures and amplifies low-abundance mutations from mixtures of wild-type and mutation-containing sequences, enriching the mutation 10 to 100 folds. Due to the slightly altered melting temperature (Tm) of the double-stranded DNA and the formation of the mutation/wild-type heteroduplex DNA, COLD-PCR methods are sensitive, specific, accurate, cost-effective and easy to maneuver, and can enrich mutations of any type and at any position, even unknown mutations within amplicons. COLD-PCR and its improved methods are now applied in cancer, microorganisms, prenatal screening, animals and plants. They are extremely useful for early diagnosis, monitoring the prognosis of disease and the efficiency of the treatment, drug selection, prediction of prognosis, plant breeding and etc. In this review, we introduce the principles, key techniques, derived methods and applications of COLD-PCR.

Ultrasensitive Electrochemical Detection of mRNA Using Branched DNA Amplifiers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mao, Xun; Liu, Guodong; Wang, Shengfu

2008-11-01

We describe here an ultrasensitive electrochemical detection of m RNA protocol without RNA purification and PCR amplification. The new m RNA electrical detection capability is coupled to the amplification feature of branched DNA (bDNA) technology and with the nagnetic beads based electrochemical bioassay.

Highly Sensitive Detection of Low-Abundance White Spot Syndrome Virus by a Pre-Amplification PCR Method.

PubMed

Pan, Xiaoming; Zhang, Yanfang; Sha, Xuejiao; Wang, Jing; Li, Jing; Dong, Ping; Liang, Xingguo

2017-03-28

White spot syndrome virus (WSSV) is a major threat to the shrimp farming industry and so far there is no effective therapy for it, and thus early diagnostic of WSSV is of great importance. However, at the early stage of infection, the extremely low-abundance of WSSV DNA challenges the detection sensitivity and accuracy of PCR. To effectively detect low-abundance WSSV, here we developed a pre-amplification PCR (pre-amp PCR) method to amplify trace amounts of WSSV DNA from massive background genomic DNA. Combining with normal specific PCR, 10 copies of target WSSV genes were detected from ~10 10 magnitude of backgrounds. In particular, multiple target genes were able to be balanced amplified with similar efficiency due to the usage of the universal primer. The efficiency of the pre-amp PCR was validated by nested-PCR and quantitative PCR, and pre-amp PCR showed higher efficiency than nested-PCR when multiple targets were detected. The developed method is particularly suitable for the super early diagnosis of WSSV, and has potential to be applied in other low-abundance sample detection cases.

Invasive reaction assisted strand-displacement signal amplification for sensitive DNA detection.

PubMed

Zou, Bingjie; Song, Qinxin; Wang, Jianping; Liu, Yunlong; Zhou, Guohua

2014-11-18

A novel DNA detection assay was proposed by invasive reaction coupled with molecular beacon assisted strand-displacement signal amplification (IRASA). Target DNAs are firstly hybridized to two probes to initiate invasive reaction to produce amplified flaps. Then these flaps are further amplified by strand-displacement signal amplification. The detection limit was around 0.2 pM.

Microdissection and molecular manipulation of single chromosomes in woody fruit trees with small chromosomes using pomelo (Citrus grandis) as a model. II. Cloning of resistance gene analogs from single chromosomes.

PubMed

Huang, D; Wu, W; Lu, L

2004-05-01

Amplification of resistance gene analogs (RGAs) is both a useful method for acquiring DNA markers closely linked to disease resistance (R) genes and a potential approach for the rapid cloning of R genes in plants. However, the screening of target sequences from among the numerous amplified RGAs can be very laborious. The amplification of RGAs from specific chromosomes could greatly reduce the number of RGAs to be screened and, consequently, speed up the identification of target RGAs. We have developed two methods for amplifying RGAs from single chromosomes. Method 1 uses products of Sau3A linker adaptor-mediated PCR (LAM-PCR) from a single chromosome as the templates for RGA amplification, while Method 2 directly uses a single chromosomal DNA molecule as the template. Using a pair of degenerate primers designed on the basis of the conserved nucleotide-binding-site motifs in many R genes, RGAs were successfully amplified from single chromosomes of pomelo using both these methods. Sequencing and cluster analysis of RGA clones obtained from single chromosomes revealed the number, type and organization of R-gene clusters on the chromosomes. We suggest that Method 1 is suitable for analyzing chromosomes that are unidentifiable under a microscope, while Method 2 is more appropriate when chromosomes can be clearly identified.

Rapid and efficient method to extract metagenomic DNA from estuarine sediments.

PubMed

Shamim, Kashif; Sharma, Jaya; Dubey, Santosh Kumar

2017-07-01

Metagenomic DNA from sediments of selective estuaries of Goa, India was extracted using a simple, fast, efficient and environment friendly method. The recovery of pure metagenomic DNA from our method was significantly high as compared to other well-known methods since the concentration of recovered metagenomic DNA ranged from 1185.1 to 4579.7 µg/g of sediment. The purity of metagenomic DNA was also considerably high as the ratio of absorbance at 260 and 280 nm ranged from 1.88 to 1.94. Therefore, the recovered metagenomic DNA was directly used to perform various molecular biology experiments viz. restriction digestion, PCR amplification, cloning and metagenomic library construction. This clearly proved that our protocol for metagenomic DNA extraction using silica gel efficiently removed the contaminants and prevented shearing of the metagenomic DNA. Thus, this modified method can be used to recover pure metagenomic DNA from various estuarine sediments in a rapid, efficient and eco-friendly manner.

Development of Reverse Transcription Thermostable Helicase-Dependent DNA Amplification for the Detection of Tomato Spotted Wilt Virus.

PubMed

Wu, Xinghai; Chen, Chanfa; Xiao, Xizhi; Deng, Ming Jun

2016-11-01

A protocol for the reverse transcription-helicase-dependent amplification (RT-HDA) of isothermal DNA was developed for the detection of tomato spotted wilt virus (TSWV). Specific primers, which were based on the highly conserved region of the N gene sequence in TSWV, were used for the amplification of virus's RNA. The LOD of RT-HDA, reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP), and reverse transcriptase-polymerase chain reaction (RT-PCR) assays were conducted using 10-fold serial dilution of RNA eluates. TSWV sensitivity in RT-HDA and RT-LAMP was 4 pg RNA compared with 40 pg RNA in RT-PCR. The specificity of RT-HDA for TSWV was high, showing no cross-reactivity with other tomato and Tospovirus viruses including cucumber mosaic virus (CMV), tomato black ring virus (TBRV), tomato mosaic virus (ToMV), or impatiens necrotic spot virus (INSV). The RT-HDA method is effective for the detection of TSWV in plant samples and is a potential tool for early and rapid detection of TSWV.

Recombinase-based isothermal amplification of nucleic acids with self-avoiding molecular recognition systems (SAMRS).

PubMed

Sharma, Nidhi; Hoshika, Shuichi; Hutter, Daniel; Bradley, Kevin M; Benner, Steven A

2014-10-13

Recombinase polymerase amplification (RPA) is an isothermal method to amplify nucleic acid sequences without the temperature cycling that classical PCR uses. Instead of using heat to denature the DNA duplex, RPA uses recombination enzymes to swap single-stranded primers into the duplex DNA product; these are then extended using a strand-displacing polymerase to complete the cycle. Because RPA runs at low temperatures, it never forces the system to recreate base-pairs following Watson-Crick rules, and therefore it produces undesired products that impede the amplification of the desired product, complicating downstream analysis. Herein, we show that most of these undesired side products can be avoided if the primers contain components of a self-avoiding molecular recognition system (SAMRS). Given the precision that is necessary in the recombination systems for them to function biologically, it is surprising that they accept SAMRS. SAMRS-RPA is expected to be a powerful tool within the range of amplification techniques available to scientists. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Novel selection methods for DNA-encoded chemical libraries.

PubMed

Chan, Alix I; McGregor, Lynn M; Liu, David R

2015-06-01

Driven by the need for new compounds to serve as biological probes and leads for therapeutic development and the growing accessibility of DNA technologies including high-throughput sequencing, many academic and industrial groups have begun to use DNA-encoded chemical libraries as a source of bioactive small molecules. In this review, we describe the technologies that have enabled the selection of compounds with desired activities from these libraries. These methods exploit the sensitivity of in vitro selection coupled with DNA amplification to overcome some of the limitations and costs associated with conventional screening methods. In addition, we highlight newer techniques with the potential to be applied to the high-throughput evaluation of DNA-encoded chemical libraries. Copyright © 2015 Elsevier Ltd. All rights reserved.

Mitochondrial DNA mutations in single human blood cells.

PubMed

Yao, Yong-Gang; Kajigaya, Sachiko; Young, Neal S

2015-09-01

Determination mitochondrial DNA (mtDNA) sequences from extremely small amounts of DNA extracted from tissue of limited amounts and/or degraded samples is frequently employed in medical, forensic, and anthropologic studies. Polymerase chain reaction (PCR) amplification followed by DNA cloning is a routine method, especially to examine heteroplasmy of mtDNA mutations. In this review, we compare the mtDNA mutation patterns detected by three different sequencing strategies. Cloning and sequencing methods that are based on PCR amplification of DNA extracted from either single cells or pooled cells yield a high frequency of mutations, partly due to the artifacts introduced by PCR and/or the DNA cloning process. Direct sequencing of PCR product which has been amplified from DNA in individual cells is able to detect the low levels of mtDNA mutations present within a cell. We further summarize the findings in our recent studies that utilized this single cell method to assay mtDNA mutation patterns in different human blood cells. Our data show that many somatic mutations observed in the end-stage differentiated cells are found in hematopoietic stem cells (HSCs) and progenitors within the CD34(+) cell compartment. Accumulation of mtDNA variations in the individual CD34+ cells is affected by both aging and family genetic background. Granulocytes harbor higher numbers of mutations compared with the other cells, such as CD34(+) cells and lymphocytes. Serial assessment of mtDNA mutations in a population of single CD34(+) cells obtained from the same donor over time suggests stability of some somatic mutations. CD34(+) cell clones from a donor marked by specific mtDNA somatic mutations can be found in the recipient after transplantation. The significance of these findings is discussed in terms of the lineage tracing of HSCs, aging effect on accumulation of mtDNA mutations and the usage of mtDNA sequence in forensic identification. Copyright © 2015 Elsevier B.V. All rights reserved.

Highly sensitive and selective microRNA detection based on DNA-bio-bar-code and enzyme-assisted strand cycle exponential signal amplification.

PubMed

Dong, Haifeng; Meng, Xiangdan; Dai, Wenhao; Cao, Yu; Lu, Huiting; Zhou, Shufeng; Zhang, Xueji

2015-04-21

Herein, a highly sensitive and selective microRNA (miRNA) detection strategy using DNA-bio-bar-code amplification (BCA) and Nb·BbvCI nicking enzyme-assisted strand cycle for exponential signal amplification was designed. The DNA-BCA system contains a locked nucleic acid (LNA) modified DNA probe for improving hybridization efficiency, while a signal reported molecular beacon (MB) with an endonuclease recognition site was designed for strand cycle amplification. In the presence of target miRNA, the oligonucleotides functionalized magnetic nanoprobe (MNP-DNA) and gold nanoprobe (AuNP-DNA) with numerous reported probes (RP) can hybridize with target miRNA, respectively, to form a sandwich structure. After sandwich structures were separated from the solution by the magnetic field, the RP were released under high temperature to recognize the MB and cleaved the hairpin DNA to induce the dissociation of RP. The dissociated RP then triggered the next strand cycle to produce exponential fluorescent signal amplification for miRNA detection. Under optimized conditions, the exponential signal amplification system shows a good linear range of 6 orders of magnitude (from 0.3 pM to 3 aM) with limit of detection (LOD) down to 52.5 zM, while the sandwich structure renders the system with high selectivity. Meanwhile, the feasibility of the proposed strategy for cell miRNA detection was confirmed by analyzing miRNA-21 in HeLa lysates. Given the high-performance for miRNA analysis, the strategy has a promising application in biological detection and in clinical diagnosis.

De novo amplification within a silent human cholinesterase gene in a family subjected to prolonged exposure to organophosphorus insecticides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prody, C.A.; Dreyfus, P.; Soreq, H.

1989-01-01

A 100-fold DNA amplification in the CHE gene, coding for serum butyrylcholinesterase (BtChoEase), was found in a farmer expressing silent CHE phenotype. Individuals homozygous for this gene display a defective serum BtChoEase and are particularly vulnerable to poisoning by agricultural organophosphorus insecticides, to which all members of this family had long been exposed. DNA blot hybridization with regional BtChoEase cDNA probes suggested that the amplification was most intense in regions encoding central sequences within BtChoEase cDNA, whereas distal sequences were amplified to a much lower extent. This is in agreement with the onion skin model, based on amplification of genesmore » in cultured cells and primary tumors. The amplification was absent in the grandparents but present at the same extent in one of their sons and in a grandson, with similar DNA blot hybridization patterns. In situ hybridization experiments localized the amplified sequences to the long arm of chromosome 3, close to the site where the authors previously mapped the CHE gene. Altogether, these observations suggest that the initial amplification event occurred early in embryogenesis, spermatogenesis, or oogenesis, where the CHE gene is intensely active and where cholinergic functioning was indicated to be physiologically necessary. These findings demonstrate a de novo amplification in apparently healthy individuals within an autosomal gene producing a target protein to an inhibitor.« less

Detection of periodontal pathogen Porphyromonas gingivalis by loop-mediated isothermal amplification method.

PubMed

Maeda, Hiroshi; Kokeguchi, Susumu; Fujimoto, Chiyo; Tanimoto, Ichiro; Yoshizumi, Wakako; Nishimura, Fusanori; Takashiba, Shogo

2005-02-01

A method for nucleic acid amplification, loop-mediated isothermal amplification (LAMP) was employed to develop a rapid and simple detection system for periodontal pathogen, Porphyromonas gingivalis. A set of six primers was designed by targeting the 16S ribosomal RNA gene. By the detection system, target DNA was amplified and visualized on agarose gel within 30 min under isothermal condition at 64 degrees C with a detection limit of 20 cells of P. gingivalis. Without gel electrophoresis, the LAMP amplicon was directly visualized in the reaction tube by addition of SYBR Green I for a naked-eye inspection. The LAMP reaction was also assessed by white turbidity of magnesium pyrophosphate (a by-product of LAMP) in the tube. Detection limits of these naked-eye inspections were 20 cells and 200 cells, respectively. Although false-positive DNA amplification was observed from more than 10(7) cells of Porphyromonas endodontalis, no amplification was observed in other five related oral pathogens. Further, quantitative detection of P. gingivalis was accomplished by a real-time monitoring of the LAMP reaction using SYBR Green I with linearity over a range of 10(2)-10(6) cells. The real-time LAMP was then applied to clinical samples of dental plaque and demonstrated almost identical results to the conventional real-time PCR with an advantage of rapidity. These findings indicate the potential usefulness of LAMP for detecting and quantifying P. gingivalis, especially in its rapidity and simplicity.

Hetero-enzyme-based two-round signal amplification strategy for trace detection of aflatoxin B1 using an electrochemical aptasensor.

PubMed

Zheng, Wanli; Teng, Jun; Cheng, Lin; Ye, Yingwang; Pan, Daodong; Wu, Jingjing; Xue, Feng; Liu, Guodong; Chen, Wei

2016-06-15

An electrochemical aptasensor for trace detection of aflatoxin B1 (AFB1) was developed by using an aptamer as the recognition unit while adopting the telomerase and EXO III based two-round signal amplification strategy as the signal enhancement units. The telomerase amplification was used to elongate the ssDNA probes on the surface of gold nanoparticles, by which the signal response range of the signal-off model electrochemical aptasensor could be correspondingly enlarged. Then, the EXO III amplification was used to hydrolyze the 3'-end of the dsDNA after the recognition of target AFB1, which caused the release of bounded AFB1 into the sensing system, where it participated in the next recognition-sensing cycle. With this two-round signal amplified electrochemical aptasensor, target AFB1 was successfully measured at trace concentrations with excellent detection limit of 0.6*10(-4)ppt and satisfied specificity due to the excellent affinity of the aptamer against AFB1. Based on this designed two-round signal amplification strategy, both the sensing range and detection limit were greatly improved. This proposed ultrasensitive electrochemical aptasensor method was also validated by comparison with the classic instrumental methods. Importantly, this hetero-enzyme based two-round signal amplified electrochemical aptasensor offers a great promising protocol for ultrasensitive detection of AFB1 and other mycotoxins by replacing the core recognition sequence of the aptamer. Copyright © 2016 Elsevier B.V. All rights reserved.

Micropreparative capillary gel electrophoresis of DNA: rapid expressed sequence tag library construction.

PubMed

Shi, Liang; Khandurina, Julia; Ronai, Zsolt; Li, Bi-Yu; Kwan, Wai King; Wang, Xun; Guttman, András

2003-01-01

A capillary gel electrophoresis based automated DNA fraction collection technique was developed to support a novel DNA fragment-pooling strategy for expressed sequence tag (EST) library construction. The cDNA population is first cleaved by BsaJ I and EcoR I restriction enzymes, and then subpooled by selective ligation with specific adapters followed by polymerase chain reaction (PCR) amplification and labeling. Combination of this cDNA fingerprinting method with high-resolution capillary gel electrophoresis separation and precise fractionation of individual cDNA transcript representatives avoids redundant fragment selection and concomitant repetitive sequencing of abundant transcripts. Using a computer-controlled capillary electrophoresis device the transcript representatives were separated by their size and fractions were automatically collected in every 30 s into 96-well plates. The high resolving power of the sieving matrix ensured sequencing grade separation of the DNA fragments (i.e., single-base resolution) and successful fraction collection. Performance and precision of the fraction collection procedure was validated by PCR amplification of the collected DNA fragments followed by capillary electrophoresis analysis for size and purity verification. The collected and PCR-amplified transcript representatives, ranging up to several hundred base pairs, were then sequenced to create an EST library.

Development of a molecular method for testing the effectiveness of UV systems on-site.

PubMed

Nizri, Limor; Vaizel-Ohayon, Dalit; Ben-Amram, Hila; Sharaby, Yehonatan; Halpern, Malka; Mamane, Hadas

2017-12-15

We established a molecular method for quantifying ultraviolet (UV) disinfection efficacy using total bacterial DNA in a water sample. To evaluate UV damage to the DNA, we developed the "DNA damage" factor, which is a novel cultivation-independent approach that reveals UV-exposure efficiency by applying a simple PCR amplification method. The study's goal was to prove the feasibility of this method for demonstrating the efficiency of UV systems in the field using flow-through UV reactors. In laboratory-based experiments using seeded bacteria, the DNA damage tests demonstrated a good correlation between PCR products and UV dose. In the field, natural groundwater sampled before and after being subjected to the full-scale UV reactors was filtered, and the DNA extracted from the filtrate was subjected to PCR amplification for a 900-bp fragment of the 16S rRNA gene with initial DNA concentrations of 0.1 and 1 ng/μL. In both cases, the UV dose predicted and explained a significant proportion of the variance in the log inactivation ratio and DNA damage factor. Log inactivation ratio was very low, as expected in groundwater due to low initial bacterial counts, whereas the DNA damage factor was within the range of values obtained in the laboratory-based experiments. Consequently, the DNA damage factor reflected the true performance of the full-scale UV system during operational water flow by using the indigenous bacterial array present in a water sample. By applying this method, we were able to predict with high confidence, the UV reactor inactivation potential. For method validation, laboratory and field iterations are required to create a practical field calibration curve that can be used to determine the expected efficiency of the full-scale UV system in the field under actual operation. Copyright © 2017 Elsevier Ltd. All rights reserved.

A comparison of DNA fragmentation methods - Applications for the biochip technology.

PubMed

Sapojnikova, Nelly; Asatiani, Nino; Kartvelishvili, Tamar; Asanishvili, Lali; Zinkevich, Vitaly; Bogdarina, Irina; Mitchell, Julian; Al-Humam, Abdulmohsen

2017-08-20

The efficiency of hybridization signal detection in a biochip is affected by the method used for test DNA preparation, such as fragmentation, amplification and fluorescent labelling. DNA fragmentation is the commonest methods used and it is recognised as a critical step in biochip analysis. Currently methods used for DNA fragmentation are based either on sonication or on the enzymatic digestion. In this study, we compared the effect of different types of enzymatic DNA fragmentations, using DNase I to generate ssDNA breaks, NEBNext dsDNA fragmentase and SaqAI restrictase, on DNA labelling. DNA from different Desulfovibrio species was used as a substrate for these enzymes. Of the methods used, DNA fragmented by NEBNext dsDNA Fragmentase digestion was subsequently labelled with the greatest efficiency. As a result of this, the use of this enzyme to fragment target DNA increases the sensitivity of biochip-based detection significantly, and this is an important consideration when determining the presence of targeted DNA in ecological and medical samples. Copyright © 2017 Elsevier B.V. All rights reserved.

An Efficient Multistrategy DNA Decontamination Procedure of PCR Reagents for Hypersensitive PCR Applications

PubMed Central

Pruvost, Mélanie; Bennett, E. Andrew; Grange, Thierry; Geigl, Eva-Maria

2010-01-01

Background PCR amplification of minute quantities of degraded DNA for ancient DNA research, forensic analyses, wildlife studies and ultrasensitive diagnostics is often hampered by contamination problems. The extent of these problems is inversely related to DNA concentration and target fragment size and concern (i) sample contamination, (ii) laboratory surface contamination, (iii) carry-over contamination, and (iv) contamination of reagents. Methodology/Principal Findings Here we performed a quantitative evaluation of current decontamination methods for these last three sources of contamination, and developed a new procedure to eliminate contaminating DNA contained in PCR reagents. We observed that most current decontamination methods are either not efficient enough to degrade short contaminating DNA molecules, rendered inefficient by the reagents themselves, or interfere with the PCR when used at doses high enough to eliminate these molecules. We also show that efficient reagent decontamination can be achieved by using a combination of treatments adapted to different reagent categories. Our procedure involves γ- and UV-irradiation and treatment with a mutant recombinant heat-labile double-strand specific DNase from the Antarctic shrimp Pandalus borealis. Optimal performance of these treatments is achieved in narrow experimental conditions that have been precisely analyzed and defined herein. Conclusions/Significance There is not a single decontamination method valid for all possible contamination sources occurring in PCR reagents and in the molecular biology laboratory and most common decontamination methods are not efficient enough to decontaminate short DNA fragments of low concentration. We developed a versatile multistrategy decontamination procedure for PCR reagents. We demonstrate that this procedure allows efficient reagent decontamination while preserving the efficiency of PCR amplification of minute quantities of DNA. PMID:20927390

Shake and stew: a non-destructive PCR-ready DNA isolation method from a single preserved fish larva.

PubMed

Alvarado Bremer, J R; Smith, B L; Moulton, D L; Lu, C-P; Cornic, M

2014-01-01

A rapid non-destructive alternative to isolate DNA from an individual fish larva is presented, based on the suspension of epithelial cells through vortex forces, and the release of DNA in a heated alkaline solution. DNA from >6056 fish larvae isolated using this protocol has yielded a high PCR amplification success rate (>93%), suggesting its applicability to other taxonomic groups or sources when tissue amount is the limiting factor. © 2014 The Fisheries Society of the British Isles.

One simple DNA extraction device and its combination with modified visual loop-mediated isothermal amplification for rapid on-field detection of genetically modified organisms.

PubMed

Zhang, Miao; Liu, Yinan; Chen, Lili; Quan, Sheng; Jiang, Shimeng; Zhang, Dabing; Yang, Litao

2013-01-02

Quickness, simplicity, and effectiveness are the three major criteria for establishing a good molecular diagnosis method in many fields. Herein we report a novel detection system for genetically modified organisms (GMOs), which can be utilized to perform both on-field quick screening and routine laboratory diagnosis. In this system, a newly designed inexpensive DNA extraction device was used in combination with a modified visual loop-mediated isothermal amplification (vLAMP) assay. The main parts of the DNA extraction device included a silica gel membrane filtration column and a modified syringe. The DNA extraction device could be easily operated without using other laboratory instruments, making it applicable to an on-field GMO test. High-quality genomic DNA (gDNA) suitable for polymerase chain reaction (PCR) and isothermal amplification could be quickly isolated from plant tissues using this device within 15 min. In the modified vLAMP assay, a microcrystalline wax encapsulated detection bead containing SYBR green fluorescent dye was introduced to avoid dye inhibition and cross-contaminations from post-LAMP operation. The system was successfully applied and validated in screening and identification of GM rice, soybean, and maize samples collected from both field testing and the Grain Inspection, Packers, and Stockyards Administration (GIPSA) proficiency test program, which demonstrated that it was well-adapted to both on-field testing and/or routine laboratory analysis of GMOs.

Quencher-free fluorescence strategy for detection of DNA methyltransferase activity based on exonuclease III-assisted signal amplification.

PubMed

Liu, Haisheng; Ma, Changbei; Zhou, Meijuan; Chen, Hanchun; He, Hailun; Wang, Kemin

2016-11-01

This work demonstrates a novel method for DNA methyltransferase (MTase) activity detection with a quencher-free molecular beacon (MB) probe based on exonuclease (Exo) III-assisted signal amplification. In the presence of Dam MTase and DpnI endonuclease, the elaborately designed hairpin substrate (MB1) was cleaved into two parts (part A and part B). Exo III can then digest part A and release a single-stranded target of the 2-aminopurine-labeled MB (MB2). Subsequently, the MB2 can hybridize with its target to form a double-stranded structure with a protruding 3'-terminus and then trigger the digestion of MB2 by Exo III. During the digestion of MB2, the 2-aminopurine is separated from the DNA strands and released free in solution, inducing an increase of the fluorescent signal. Owing to the presence of a recessed 3'-terminus in the formed double-stranded DNA, Exo III-assisted recyclable cleavage of MB2 was achieved. Therefore, an amplified fluorescence signal was observed. Under the optimized conditions, Dam MTase can be detected in the range of 0.2-40 units/mL with a limit of detection of 0.2 units/mL and good selectivity. Furthermore, the present assay can be used for screening potential DNA MTase inhibitors. Graphical Abstract A quencher-free fluorescence assay for sensitive detection of DNA methyltransferase activity based on exonuclease III-assisted signal amplification is reported.

Amplification and chromosomal dispersion of human endogenous retroviral sequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Steele, P.E.; Martin, M.A.; Rabson, A.B.

1986-09-01

Endogenous retroviral sequences have undergone amplification events involving both viral and flanking cellular sequences. The authors cloned members of an amplified family of full-length endogenous retroviral sequences. Genomic blotting, employing a flanking cellular DNA probe derived from a member of this family, revealed a similar array of reactive bands in both humans and chimpanzees, indicating that an amplification event involving retroviral and associated cellular DNA sequences occurred before the evolutionary separation of these two primates. Southern analyses of restricted somatic cell hybrid DNA preparations suggested that endogenous retroviral segments are widely dispersed in the human genome and that amplification andmore » dispersion events may be linked.« less

Sequencing intractable DNA to close microbial genomes.

PubMed

Hurt, Richard A; Brown, Steven D; Podar, Mircea; Palumbo, Anthony V; Elias, Dwayne A

2012-01-01

Advancement in high throughput DNA sequencing technologies has supported a rapid proliferation of microbial genome sequencing projects, providing the genetic blueprint for in-depth studies. Oftentimes, difficult to sequence regions in microbial genomes are ruled "intractable" resulting in a growing number of genomes with sequence gaps deposited in databases. A procedure was developed to sequence such problematic regions in the "non-contiguous finished" Desulfovibrio desulfuricans ND132 genome (6 intractable gaps) and the Desulfovibrio africanus genome (1 intractable gap). The polynucleotides surrounding each gap formed GC rich secondary structures making the regions refractory to amplification and sequencing. Strand-displacing DNA polymerases used in concert with a novel ramped PCR extension cycle supported amplification and closure of all gap regions in both genomes. The developed procedures support accurate gene annotation, and provide a step-wise method that reduces the effort required for genome finishing.

Development of a loop-mediated isothermal amplification method for rapid mass-screening of sand flies for Leishmania infection.

PubMed

Nzelu, Chukwunonso O; Gomez, Eduardo A; Cáceres, Abraham G; Sakurai, Tatsuya; Martini-Robles, Luiggi; Uezato, Hiroshi; Mimori, Tatsuyuki; Katakura, Ken; Hashiguchi, Yoshihisa; Kato, Hirotomo

2014-04-01

Entomological monitoring of Leishmania infection in leishmaniasis endemic areas offers epidemiologic advantages for predicting the risk and expansion of the disease, as well as evaluation of the effectiveness of control programs. In this study, we developed a highly sensitive loop-mediated isothermal amplification (LAMP) method for the mass screening of sand flies for Leishmania infection based on the 18S rRNA gene. The LAMP technique could detect 0.01 parasites, which was more sensitive than classical PCR. The method was robust and could amplify the target DNA within 1h from a crude sand fly template without DNA purification. Amplicon detection could be accomplished by the newly developed colorimetric malachite green (MG)--mediated naked eye visualization. Pre-addition of MG to the LAMP reaction solution did not inhibit amplification efficiency. The field applicability of the colorimetric MG-based LAMP assay was demonstrated with 397 field-caught samples from the endemic areas of Ecuador and eight positive sand flies were detected. The robustness, superior sensitivity, and ability to produce better visual discriminatory reaction products than existing LAMP fluorescence and turbidity assays indicated the field potential usefulness of this new method for surveillance and epidemiological studies of leishmaniasis in developing countries. Copyright © 2013 Elsevier B.V. All rights reserved.

Droplet Microfluidic Device Fabrication and Use for Isothermal Amplification and Detection of MicroRNA.

PubMed

Giuffrida, Maria Chiara; D'Agata, Roberta; Spoto, Giuseppe

2017-01-01

Droplet microfluidics combined with the isothermal circular strand displacement polymerization (ICSDP) represents a powerful new technique to detect both single-stranded DNA and microRNA sequences. The method here described helps in overcoming some drawbacks of the lately introduced droplet polymerase chain reaction (PCR) amplification when implemented in microfluidic devices. The method also allows the detection of nanoliter droplets of nucleic acids sequences solutions, with a particular attention to microRNA sequences that are detected at the picomolar level. The integration of the ICSDP amplification protocol in droplet microfluidic devices reduces the time of analysis and the amount of sample required. In addition, there is also the possibility to design parallel analyses to be integrated in portable devices.

Parvovirus B19 is a bystander in adult myocarditis.

PubMed

Koepsell, Scott A; Anderson, Daniel R; Radio, Stanley J

2012-01-01

The genomic DNA of parvovirus B19, a small single-stranded DNA virus of the genus Erythrovirus, has been shown to persist in solid tissues of constitutionally healthy, immunocompetent individuals. Despite these data, many case reports and series have linked the presence of parvovirus B19 genomic DNA, detected through nucleic acid amplification testing, with myocarditis and cardiomyopathy. Herein, we use multiple tools to better assess the relationship between parvovirus B19 and myocarditis and cardiomyopathy. Nucleic acid amplification testing, immunohistochemistry, in situ hybridization, and electron microscopy were used to assess the location and activity of parvovirus B19 in cases of myocarditis and in cases with no significant cardiac disease. Nucleic acid amplification testing for parvovirus B19 genomic DNA was positive in 73% of patients with myocarditis/cardiomyopathy and in 26% of patients with no significant disease. In situ hybridization and immunohistochemistry showed that, in cases with amplifiable parvovirus B19 DNA, parvovirus B19 genomic DNA and viral protein production were present in rare mononuclear cells. In a majority of cases of myocarditis and a significant number of otherwise normal hearts, nucleic acid amplification testing detected persistent parvovirus B19 genomic DNA that did not play a significant pathogenic role. The source of parvovirus B19 DNA appeared to be interstitial mononuclear inflammatory cells and not myocardial or endothelial cells. Therefore, nucleic acid amplification testing alone is not diagnostically helpful for determining the etiology of adult myocarditis. Copyright © 2012 Elsevier Inc. All rights reserved.

Internal validation of the GlobalFiler™ Express PCR Amplification Kit for the direct amplification of reference DNA samples on a high-throughput automated workflow.

PubMed

Flores, Shahida; Sun, Jie; King, Jonathan; Budowle, Bruce

2014-05-01

The GlobalFiler™ Express PCR Amplification Kit uses 6-dye fluorescent chemistry to enable multiplexing of 21 autosomal STRs, 1 Y-STR, 1 Y-indel and the sex-determining marker amelogenin. The kit is specifically designed for processing reference DNA samples in a high throughput manner. Validation studies were conducted to assess the performance and define the limitations of this direct amplification kit for typing blood and buccal reference DNA samples on various punchable collection media. Studies included thermal cycling sensitivity, reproducibility, precision, sensitivity of detection, minimum detection threshold, system contamination, stochastic threshold and concordance. Results showed that optimal amplification and injection parameters for a 1.2mm punch from blood and buccal samples were 27 and 28 cycles, respectively, combined with a 12s injection on an ABI 3500xL Genetic Analyzer. Minimum detection thresholds were set at 100 and 120RFUs for 27 and 28 cycles, respectively, and it was suggested that data from positive amplification controls provided a better threshold representation. Stochastic thresholds were set at 250 and 400RFUs for 27 and 28 cycles, respectively, as stochastic effects increased with cycle number. The minimum amount of input DNA resulting in a full profile was 0.5ng, however, the optimum range determined was 2.5-10ng. Profile quality from the GlobalFiler™ Express Kit and the previously validated AmpFlSTR(®) Identifiler(®) Direct Kit was comparable. The validation data support that reliable DNA typing results from reference DNA samples can be obtained using the GlobalFiler™ Express PCR Amplification Kit. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Method for analyzing microbial communities

DOEpatents

Zhou, Jizhong [Oak Ridge, TN; Wu, Liyou [Oak Ridge, TN

2010-07-20

The present invention provides a method for quantitatively analyzing microbial genes, species, or strains in a sample that contains at least two species or strains of microorganisms. The method involves using an isothermal DNA polymerase to randomly and representatively amplify genomic DNA of the microorganisms in the sample, hybridizing the resultant polynucleotide amplification product to a polynucleotide microarray that can differentiate different genes, species, or strains of microorganisms of interest, and measuring hybridization signals on the microarray to quantify the genes, species, or strains of interest.

Single palindromic molecular beacon-based amplification for genetic analysis of cancers.

PubMed

Li, Feng; Zhao, Hui; Wang, Zheng-Yong; Wu, Zai-Sheng; Yang, Zhe; Li, Cong-Cong; Xu, Huo; Lyu, Jian-Xin; Shen, Zhi-Fa

2017-05-15

The detection of biomarkers is of crucial importance in reducing the morbidity and mortality of complex diseases. Thus, there is a great desire to develop highly efficient and simple sensing methods to fulfill the different diagnostic and therapeutic purposes. Herein, using tumor suppressor p53 gene as model target DNA, we developed a novel palindromic fragment-incorporated molecular beacon (P-MB) that can perform multiple functions, including recognition element, signal reporter, polymerization template and primer. Upon specific hybridization with target DNA, P-MBs can interact with each other and are extended by polymerase without any additional probes. As a result, hybridized targets are peeled off from P-MBs and initiate the next round of reactions, leading to the unique strand displacement amplification (SDA). The newly-proposed enzymatic amplification displays the detection limit as low as 100pM and excellent selectivity in distinguishing single-base mutation with the linear response range from 100pM to 75nM. This is the simplest SDA sensing system so far because of only involving one type of DNA probe. This impressive sensing paradigm is expected to provide new insight into developing new-type of DNA probes that hold tremendous potential with important applications in molecular biology research and clinical diagnosis. Copyright © 2017 Elsevier B.V. All rights reserved.

Sub-attomole oligonucleotide and p53 cDNA determinations via a high-resolution surface plasmon resonance combined with oligonucleotide-capped gold nanoparticle signal amplification.

PubMed

Yao, Xin; Li, Xin; Toledo, Freddy; Zurita-Lopez, Cecilia; Gutova, Margarita; Momand, Jamil; Zhou, Feimeng

2006-07-15

Oligonucleotide (ODN)-capped gold nanoparticles (Au-NPs) were used in a sandwich assay of ODN or polynucleotide by a flow injection surface plasmon resonance (SPR). A carboxylated dextran film was immobilized onto the SPR sensor surface to eliminate nonspecific adsorption of ODN-capped Au-NPs. The tandem use of signal amplification via the adlayer of the ODN-capped Au-NPs and the differential signal detection by the bicell detector on the SPR resulted in a remarkable DNA detection level. A 39-mer target at a quantity as low as 2.1 x 10(-20)mol, corresponding to 1.38 fM in a 15 microl solution, can be measured. To our knowledge, both the concentration and quantity detection levels are the lowest among all the gene analyses conducted with SPR to this point. The method is shown to be reproducible (relative standard deviation values <16%) and to possess high sequence specificity. It is also demonstrated to be viable for sequence-specific p53 cDNA analysis. The successful elimination of nonspecific adsorption of, and the signal amplification by, ODN-capped Au-NPs renders the SPR attractive for cases where the DNA concentration is extremely low and the sample availability is severely limited.

Error baseline rates of five sample preparation methods used to characterize RNA virus populations

PubMed Central

Kugelman, Jeffrey R.; Wiley, Michael R.; Nagle, Elyse R.; Reyes, Daniel; Pfeffer, Brad P.; Kuhn, Jens H.; Sanchez-Lockhart, Mariano; Palacios, Gustavo F.

2017-01-01

Individual RNA viruses typically occur as populations of genomes that differ slightly from each other due to mutations introduced by the error-prone viral polymerase. Understanding the variability of RNA virus genome populations is critical for understanding virus evolution because individual mutant genomes may gain evolutionary selective advantages and give rise to dominant subpopulations, possibly even leading to the emergence of viruses resistant to medical countermeasures. Reverse transcription of virus genome populations followed by next-generation sequencing is the only available method to characterize variation for RNA viruses. However, both steps may lead to the introduction of artificial mutations, thereby skewing the data. To better understand how such errors are introduced during sample preparation, we determined and compared error baseline rates of five different sample preparation methods by analyzing in vitro transcribed Ebola virus RNA from an artificial plasmid-based system. These methods included: shotgun sequencing from plasmid DNA or in vitro transcribed RNA as a basic “no amplification” method, amplicon sequencing from the plasmid DNA or in vitro transcribed RNA as a “targeted” amplification method, sequence-independent single-primer amplification (SISPA) as a “random” amplification method, rolling circle reverse transcription sequencing (CirSeq) as an advanced “no amplification” method, and Illumina TruSeq RNA Access as a “targeted” enrichment method. The measured error frequencies indicate that RNA Access offers the best tradeoff between sensitivity and sample preparation error (1.4−5) of all compared methods. PMID:28182717

Copy number variants calling for single cell sequencing data by multi-constrained optimization.

PubMed

Xu, Bo; Cai, Hongmin; Zhang, Changsheng; Yang, Xi; Han, Guoqiang

2016-08-01

Variations in DNA copy number carry important information on genome evolution and regulation of DNA replication in cancer cells. The rapid development of single-cell sequencing technology allows one to explore gene expression heterogeneity among single-cells, thus providing important cancer cell evolution information. Single-cell DNA/RNA sequencing data usually have low genome coverage, which requires an extra step of amplification to accumulate enough samples. However, such amplification will introduce large bias and makes bioinformatics analysis challenging. Accurately modeling the distribution of sequencing data and effectively suppressing the bias influence is the key to success variations analysis. Recent advances demonstrate the technical noises by amplification are more likely to follow negative binomial distribution, a special case of Poisson distribution. Thus, we tackle the problem CNV detection by formulating it into a quadratic optimization problem involving two constraints, in which the underling signals are corrupted by Poisson distributed noises. By imposing the constraints of sparsity and smoothness, the reconstructed read depth signals from single-cell sequencing data are anticipated to fit the CNVs patterns more accurately. An efficient numerical solution based on the classical alternating direction minimization method (ADMM) is tailored to solve the proposed model. We demonstrate the advantages of the proposed method using both synthetic and empirical single-cell sequencing data. Our experimental results demonstrate that the proposed method achieves excellent performance and high promise of success with single-cell sequencing data. Crown Copyright © 2016. Published by Elsevier Ltd. All rights reserved.

A highly sensitive SPRi biosensing strategy for simultaneous detection of multiplex miRNAs based on strand displacement amplification and AuNP signal enhancement.

PubMed

Wei, Xiaotong; Duan, Xiaolei; Zhou, Xiaoyan; Wu, Jiangling; Xu, Hongbing; Min, Xun; Ding, Shijia

2018-06-07

Herein, a dual channel surface plasmon resonance imaging (SPRi) biosensor has been developed for the simultaneous and highly sensitive detection of multiplex miRNAs based on strand displacement amplification (SDA) and DNA-functionalized AuNP signal enhancement. In the presence of target miRNAs (miR-21 or miR-192), the miRNAs could specifically hybridize with the corresponding hairpin probes (H) and initiate the SDA, resulting in massive triggers. Subsequently, the two parts of the released triggers could hybridize with capture probes (CP) and DNA-functionalized AuNPs, assembling DNA sandwiches with great mass on the chip surface. A significantly amplified SPR signal readout was achieved. This established biosensing method was capable of simultaneously detecting multiplex miRNAs with a limit of detection down to 0.15 pM for miR-21 and 0.22 pM for miR-192. This method exhibited good specificity and acceptable reproducibility. Moreover, the developed method was applied to the determination of target miRNAs in a complex matrix. Thus, this developed SPRi biosensing method may present a potential alternative tool for miRNA detection in biomedical research and clinical diagnosis.

Binding-induced DNA walker for signal amplification in highly selective electrochemical detection of protein.

PubMed

Ji, Yuhang; Zhang, Lei; Zhu, Longyi; Lei, Jianping; Wu, Jie; Ju, Huangxian

2017-10-15

A binding-induced DNA walker-assisted signal amplification was developed for highly selective electrochemical detection of protein. Firstly, the track of DNA walker was constructed by self-assembly of the high density ferrocene (Fc)-labeled anchor DNA and aptamer 1 on the gold electrode surface. Sequentially, a long swing-arm chain containing aptamer 2 and walking strand DNA was introduced onto gold electrode through aptamers-target specific recognition, and thus initiated walker strand sequences to hybridize with anchor DNA. Then, the DNA walker was activated by the stepwise cleavage of the hybridized anchor DNA by nicking endonuclease to release multiple Fc molecules for signal amplification. Taking thrombin as the model target, the Fc-generated electrochemical signal decreased linearly with logarithm value of thrombin concentration ranging from 10pM to 100nM with a detection limit of 2.5pM under the optimal conditions. By integrating the specific recognition of aptamers to target with the enzymatic cleavage of nicking endonuclease, the aptasensor showed the high selectivity. The binding-induced DNA walker provides a promising strategy for signal amplification in electrochemical biosensor, and has the extensive applications in sensitive and selective detection of the various targets. Copyright © 2017 Elsevier B.V. All rights reserved.

Expanded Genetic Codes in Next Generation Sequencing Enable Decontamination and Mitochondrial Enrichment

PubMed Central

McKernan, Kevin J.; Spangler, Jessica; Zhang, Lei; Tadigotla, Vasisht; McLaughlin, Stephen; Warner, Jason; Zare, Amir; Boles, Richard G.

2014-01-01

We have developed a PCR method, coined Déjà vu PCR, that utilizes six nucleotides in PCR with two methyl specific restriction enzymes that respectively digest these additional nucleotides. Use of this enzyme-and-nucleotide combination enables what we term a “DNA diode”, where DNA can advance in a laboratory in only one direction and cannot feedback into upstream assays. Here we describe aspects of this method that enable consecutive amplification with the introduction of a 5th and 6th base while simultaneously providing methylation dependent mitochondrial DNA enrichment. These additional nucleotides enable a novel DNA decontamination technique that generates ephemeral and easy to decontaminate DNA. PMID:24788618

[Definition of appropriate temperature and storage conditions in the detection of Leishmania DNA with PCR in phlebotomine flies].

PubMed

Cabrera, Olga L; Munsterman, Leonard E; Cárdenas, Rocío; Gutiérrez, Reynaldo; Ferro, Cristina

2002-09-01

For epidemiological studies and control programs of leishmaniasis, taxonomic identification of the etiologic agent of the disease in the insect vector is of critical importance. The implementation of molecular techniques such as the polymerase chain reaction (PCR) has permitted great advances in the efficacy and sensitivity of parasite identification. Previously, these investigations involved labor-intensive dissections and required expert personnel. The present work evaluates the effects of storage methods of phlebotomine samples in the optimization of PCR identification of Leishmania. Females of Lutzomyia longipalpis, from the colony of the Instituto Nacional de Salud, were experimentally infected with Leishmania chagasi (= L. infantum), from the upper Magdalena Valley (Quipile, Cundinamarca, Colombia). The infected insects were preserved in three solutions: 100% ethanol, 70% ethanol, and TE; subsamples of each class were stored at -80 degrees C, -20 degrees C and room temperature. To determine infection rates, samples were dissected and screened microscopically. Chelex 100 was used for extraction of total Leishmania DNA. For PCR amplification, the kinetoplastic minicircle DNA primers OL1 and OL2 of Leishmania were used, and the products were visualized by electrophoresis in 1% agarose gels. For each of the 3 storage conditions, amplifications were successful, producing a approximately 120 base pair product unique to Leishmania. The results demonstrated the advantage of PCR as a routine screening method for detecting infected flies in endemic foci of visceral leishmaniasis. Since storage method did not affect PCR amplification success, the most cost effective method -70% ethanol at room temperature--is the option recommended for storing entomological samples in vector incrimination studies.

A novel electrochemical biosensor for ultrasensitive and specific detection of DNA based on molecular beacon mediated circular strand displacement and rolling circle amplification.

PubMed

Cheng, Wei; Zhang, Wei; Yan, Yurong; Shen, Bo; Zhu, Dan; Lei, Pinhua; Ding, Shijia

2014-12-15

A novel electrochemical biosensing strategy was developed for ultrasensitive and specific detection of target DNA using a cascade signal amplification based on molecular beacon (MB) mediated circular strand displacement (CSD), rolling circle amplification (RCA), biotin-strepavidin system, and enzymatic amplification. The target DNA hybridized with the loop portion of MB probe immobilized on the gold electrode and triggered the CSD, leading to multiple biotin-tagged DNA duplex. Furthermore, via biotin-streptavidin interaction, the RCA was implemented, producing long massive tandem-repeat DNA sequences for binding numerous biotinylated detection probes. This enabled an ultrasensitive electrochemical readout by further employing the streptavidin-alkaline phosphatase. The proposed biosensor showed very high sensitivity and selectivity with a dynamic response range from 1 fM to 100 pM. The proposed strategy could have the potential for applying in clinical molecular diagnostics and environmental monitoring. Copyright © 2014 Elsevier B.V. All rights reserved.

'Mitominis': multiplex PCR analysis of reduced size amplicons for compound sequence analysis of the entire mtDNA control region in highly degraded samples.

PubMed

Eichmann, Cordula; Parson, Walther

2008-09-01

The traditional protocol for forensic mitochondrial DNA (mtDNA) analyses involves the amplification and sequencing of the two hypervariable segments HVS-I and HVS-II of the mtDNA control region. The primers usually span fragment sizes of 300-400 bp each region, which may result in weak or failed amplification in highly degraded samples. Here we introduce an improved and more stable approach using shortened amplicons in the fragment range between 144 and 237 bp. Ten such amplicons were required to produce overlapping fragments that cover the entire human mtDNA control region. These were co-amplified in two multiplex polymerase chain reactions and sequenced with the individual amplification primers. The primers were carefully selected to minimize binding on homoplasic and haplogroup-specific sites that would otherwise result in loss of amplification due to mis-priming. The multiplexes have successfully been applied to ancient and forensic samples such as bones and teeth that showed a high degree of degradation.

Nuclease-resistant double-stranded DNA controls or standards for hepatitis B virus nucleic acid amplification assays

PubMed Central

2009-01-01

Background Identical blood samples tested using different kits can give markedly different hepatitis B virus (HBV) DNA levels, which can cause difficulty in the interpretation of viral load. A universal double-stranded DNA control or standard that can be used in all commercial HBV DNA nucleic acid amplification assay kits is urgently needed. By aligning all HBV genotypes (A-H), we found that the surface antigen gene and precore-core gene regions of HBV are the most conserved regions among the different HBV genotypes. We constructed a chimeric fragment by overlapping extension polymerase chain reaction and obtained a 1,349-bp HBVC+S fragment. We then packaged the fragment into lambda phages using a traditional lambda phage cloning procedure. Results The obtained armored DNA was resistant to DNase I digestion and was stable, noninfectious to humans, and could be easily extracted using commercial kits. More importantly, the armored DNA may be used with all HBV DNA nucleic acid amplification assay kits. Conclusions The lambda phage packaging system can be used as an excellent expression platform for armored DNA. The obtained armored DNA possessed all characteristics of an excellent positive control or standard. In addition, this armored DNA is likely to be appropriate for all commercial HBV DNA nucleic acid amplification detection kits. Thus, the constructed armored DNA can probably be used as a universal positive control or standard in HBV DNA assays. PMID:20025781

DNA polymerase preference determines PCR priming efficiency.

PubMed

Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian

2014-01-30

Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially available DNA polymerases. The results suggest that the interaction of the DNA polymerase with the primer:template junction during the initiation of DNA polymerization is very important in terms of overall amplification bias and has broader implications for both the primer design process and multiplex PCR.

Single Cell Total RNA Sequencing through Isothermal Amplification in Picoliter-Droplet Emulsion.

PubMed

Fu, Yusi; Chen, He; Liu, Lu; Huang, Yanyi

2016-11-15

Prevalent single cell RNA amplification and sequencing chemistries mainly focus on polyadenylated RNAs in eukaryotic cells by using oligo(dT) primers for reverse transcription. We develop a new RNA amplification method, "easier-seq", to reverse transcribe and amplify the total RNAs, both with and without polyadenylate tails, from a single cell for transcriptome sequencing with high efficiency, reproducibility, and accuracy. By distributing the reverse transcribed cDNA molecules into 1.5 × 10 5 aqueous droplets in oil, the cDNAs are isothermally amplified using random primers in each of these 65-pL reactors separately. This new method greatly improves the ease of single-cell RNA sequencing by reducing the experimental steps. Meanwhile, with less chance to induce errors, this method can easily maintain the quality of single-cell sequencing. In addition, this polyadenylate-tail-independent method can be seamlessly applied to prokaryotic cell RNA sequencing.

Targeting helicase-dependent amplification products with an electrochemical genosensor for reliable and sensitive screening of genetically modified organisms.

PubMed

Moura-Melo, Suely; Miranda-Castro, Rebeca; de-Los-Santos-Álvarez, Noemí; Miranda-Ordieres, Arturo J; Dos Santos Junior, J Ribeiro; da Silva Fonseca, Rosana A; Lobo-Castañón, Maria Jesús

2015-08-18

Cultivation of genetically modified organisms (GMOs) and their use in food and feed is constantly expanding; thus, the question of informing consumers about their presence in food has proven of significant interest. The development of sensitive, rapid, robust, and reliable methods for the detection of GMOs is crucial for proper food labeling. In response, we have experimentally characterized the helicase-dependent isothermal amplification (HDA) and sequence-specific detection of a transgene from the Cauliflower Mosaic Virus 35S Promoter (CaMV35S), inserted into most transgenic plants. HDA is one of the simplest approaches for DNA amplification, emulating the bacterial replication machinery, and resembling PCR but under isothermal conditions. However, it usually suffers from a lack of selectivity, which is due to the accumulation of spurious amplification products. To improve the selectivity of HDA, which makes the detection of amplification products more reliable, we have developed an electrochemical platform targeting the central sequence of HDA copies of the transgene. A binary monolayer architecture is built onto a thin gold film where, upon the formation of perfect nucleic acid duplexes with the amplification products, these are enzyme-labeled and electrochemically transduced. The resulting combined system increases genosensor detectability up to 10(6)-fold, allowing Yes/No detection of GMOs with a limit of detection of ∼30 copies of the CaMV35S genomic DNA. A set of general utility rules in the design of genosensors for detection of HDA amplicons, which may assist in the development of point-of-care tests, is also included. The method provides a versatile tool for detecting nucleic acids with extremely low abundance not only for food safety control but also in the diagnostics and environmental control areas.

Colocalization recognition-activated cascade signal amplification strategy for ultrasensitive detection of transcription factors.

PubMed

Zhu, Desong; Wang, Lei; Xu, Xiaowen; Jiang, Wei

2017-03-15

Transcription factors (TFs) bind to specific double-stranded DNA (dsDNA) sequences in the regulatory regions of genes to regulate the process of gene transcription. Their expression levels sensitively reflect cell developmental situation and disease state. TFs have become potential diagnostic markers and therapeutic targets of cancers and some other diseases. Hence, high sensitive detection of TFs is of vital importance for early diagnosis of diseases and drugs development. The traditional exonucleases-assisted signal amplification methods suffered from the false positives caused by incomplete digestion of excess recognition probes. Herein, based on a new recognition way-colocalization recognition (CR)-activated dual signal amplification, an ultrasensitive fluorescent detection strategy for TFs was developed. TFs-induced the colocalization of three split recognition components resulted in noticeable increases of local effective concentrations and hybridization of three split components, which activated the subsequent cascade signal amplification including strand displacement amplification (SDA) and exponential rolling circle amplification (ERCA). This strategy eliminated the false positive influence and achieved ultra-high sensitivity towards the purified NF-κB p50 with detection limit of 2.0×10 -13 M. Moreover, NF-κB p50 can be detected in as low as 0.21ngμL -1 HeLa cell nuclear extracts. In addition, this proposed strategy could be used for the screening of NF-κB p50 activity inhibitors and potential anti-NF-κB p50 drugs. Finally, our proposed strategy offered a potential method for reliable detection of TFs in medical diagnosis and treatment research of cancers and other related diseases. Copyright © 2016 Elsevier B.V. All rights reserved.

Pre-amplification in the context of high-throughput qPCR gene expression experiment.

PubMed

Korenková, Vlasta; Scott, Justin; Novosadová, Vendula; Jindřichová, Marie; Langerová, Lucie; Švec, David; Šídová, Monika; Sjöback, Robert

2015-03-11

With the introduction of the first high-throughput qPCR instrument on the market it became possible to perform thousands of reactions in a single run compared to the previous hundreds. In the high-throughput reaction, only limited volumes of highly concentrated cDNA or DNA samples can be added. This necessity can be solved by pre-amplification, which became a part of the high-throughput experimental workflow. Here, we focused our attention on the limits of the specific target pre-amplification reaction and propose the optimal, general setup for gene expression experiment using BioMark instrument (Fluidigm). For evaluating different pre-amplification factors following conditions were combined: four human blood samples from healthy donors and five transcripts having high to low expression levels; each cDNA sample was pre-amplified at four cycles (15, 18, 21, and 24) and five concentrations (equivalent to 0.078 ng, 0.32 ng, 1.25 ng, 5 ng, and 20 ng of total RNA). Factors identified as critical for a success of cDNA pre-amplification were cycle of pre-amplification, total RNA concentration, and type of gene. The selected pre-amplification reactions were further tested for optimal Cq distribution in a BioMark Array. The following concentrations combined with pre-amplification cycles were optimal for good quality samples: 20 ng of total RNA with 15 cycles of pre-amplification, 20x and 40x diluted; and 5 ng and 20 ng of total RNA with 18 cycles of pre-amplification, both 20x and 40x diluted. We set up upper limits for the bulk gene expression experiment using gene expression Dynamic Array and provided an easy-to-obtain tool for measuring of pre-amplification success. We also showed that variability of the pre-amplification, introduced into the experimental workflow of reverse transcription-qPCR, is lower than variability caused by the reverse transcription step.

Ultrasensitive photoelectrochemical biosensor for the detection of HTLV-I DNA: A cascade signal amplification strategy integrating λ-exonuclease aided target recycling with hybridization chain reaction and enzyme catalysis.

PubMed

Shi, Xiao-Mei; Fan, Gao-Chao; Tang, Xueying; Shen, Qingming; Zhu, Jun-Jie

2018-06-30

Sensitive and specific detection of DNA is of great significance for clinical diagnosis. In this paper, an effective cascade signal amplification strategy was introduced into photoelectrochemical (PEC) biosensor for ultrasensitive detection of human T-cell lymphotropic virus type I (HTLV-I) DNA. This proposed signal amplification strategy integrates λ-exonuclease (λ-Exo) aided target recycling with hybridization chain reaction (HCR) and enzyme catalysis. In the presence of target DNA (tDNA) of HTLV-I, the designed hairpin DNA (h 1 DNA) hybridized with tDNA, subsequently recognized and cleaved by λ-Exo to set free tDNA. With the λ-Exo aided tDNA recycling, an increasing number of DNA fragments (output DNA, oDNA) were released from the digestion of h 1 DNA. Then, triggered by the hybridization of oDNA with capture DNA (cDNA), numerous biotin-labeled hairpin DNAs (h 2 DNA and h 3 DNA) could be loaded onto the photoelectrode via the HCR. Finally, avidin-labeled alkaline phosphatase (avidin-ALP) could be introduced onto the electrode by specific interaction between biotin and avidin. The ALP could catalyze dephosphorylation of phospho-L-ascorbic acid trisodium salt (AAP) to generate an efficient electron donor of ascorbic acid (AA), and thereby greatly increasing the photocurrent signal. By utilizing the proposed cascade signal amplification strategy, the fabricated PEC biosensor exhibited an ultrasensitive and specific detection of HTLV-I DNA down to 11.3 aM, and it also offered an effective strategy to detect other DNAs at ultralow levels. Copyright © 2018 Elsevier B.V. All rights reserved.

Biobar-coded gold nanoparticles and DNAzyme-based dual signal amplification strategy for ultrasensitive detection of protein by electrochemiluminescence.

PubMed

Xia, Hui; Li, Lingling; Yin, Zhouyang; Hou, Xiandeng; Zhu, Jun-Jie

2015-01-14

A dual signal amplification strategy for electrochemiluminescence (ECL) aptasensor was designed based on biobar-coded gold nanoparticles (Au NPs) and DNAzyme. CdSeTe@ZnS quantum dots (QDs) were chosen as the ECL signal probes. To verify the proposed ultrasensitive ECL aptasensor for biomolecules, we detected thrombin (Tb) as a proof-of-principle analyte. The hairpin DNA designed for the recognition of protein consists of two parts: the sequences of catalytical 8-17 DNAzyme and thrombin aptamer. Only in the presence of thrombin could the hairpin DNA be opened, followed by a recycling cleavage of excess substrates by catalytic core of the DNAzyme to induce the first-step amplification. One part of the fragments was captured to open the capture DNA modified on the Au electrode, which further connected with the prepared biobar-coded Au NPs-CdSeTe@ZnS QDs to get the final dual-amplified ECL signal. The limit of detection for Tb was 0.28 fM with excellent selectivity, and this proposed method possessed good performance in real sample analysis. This design introduces the new concept of dual-signal amplification by a biobar-coded system and DNAzyme recycling into ECL determination, and it is promising to be extended to provide a highly sensitive platform for various target biomolecules.

Genotyping of 25 leukemia-associated genes in a single work flow by next-generation sequencing technology with low amounts of input template DNA.

PubMed

Rinke, Jenny; Schäfer, Vivien; Schmidt, Mathias; Ziermann, Janine; Kohlmann, Alexander; Hochhaus, Andreas; Ernst, Thomas

2013-08-01

We sought to establish a convenient, sensitive next-generation sequencing (NGS) method for genotyping the 26 most commonly mutated leukemia-associated genes in a single work flow and to optimize this method for low amounts of input template DNA. We designed 184 PCR amplicons that cover all of the candidate genes. NGS was performed with genomic DNA (gDNA) from a cohort of 10 individuals with chronic myelomonocytic leukemia. The results were compared with NGS data obtained from sequencing of DNA generated by whole-genome amplification (WGA) of 20 ng template gDNA. Differences between gDNA and WGA samples in variant frequencies were determined for 2 different WGA kits. For gDNA samples, 25 of 26 genes were successfully sequenced with a sensitivity of 5%, which was achieved by a median coverage of 492 reads (range, 308-636 reads) per amplicon. We identified 24 distinct mutations in 11 genes. With WGA samples, we reliably detected all mutations above 5% sensitivity with a median coverage of 506 reads (range, 256-653 reads) per amplicon. With all variants included in the analysis, WGA amplification by the 2 kits tested yielded differences in variant frequencies that ranged from -28.19% to +9.94% [mean (SD) difference, -0.2% (4.08%)] and from -35.03% to +18.67% [mean difference, -0.75% (5.12%)]. Our method permits simultaneous analysis of a wide range of leukemia-associated target genes in a single sequencing run. NGS can be performed after WGA of template DNA for reliable detection of variants without introducing appreciable bias.

DNA Quantity and Quality in Remnants of Traffic-Killed Specimens of an Endangered Longhorn Beetle: A Comparison of Different Methods.

PubMed

Rusterholz, Hans-Peter; Ursenbacher, Sylvain; Coray, Armin; Weibel, Urs; Baur, Bruno

2015-01-01

The sampling of living insects should be avoided in highly endangered species when the sampling would further increase the risk of population extinction. Nonlethal sampling (wing clips or leg removals) can be an alternative to obtain DNA of individuals for population genetic studies. However, nonlethal sampling may not be possible for all insect species. We examined whether remnants of traffic-killed specimens of the endangered and protected flightless longhorn beetle Iberodorcadion fuliginator (L., 1758) can be used as a resource for population genetic analyses. Using insect fragments of traffic-killed specimens collected over 15 yr, we determined the most efficient DNA extraction method in relation to the state of the specimens (crushed, fragment, or intact), preservation (dried, airtight, or in ethanol), storage duration, and weight of the sample by assessing the quantity and quality of genomic DNA. A modified cetyltrimethyl ammonium bromide method provided the highest recovery rate of genomic DNA and the largest yield and highest quality of DNA. We further used traffic-killed specimens to evaluate two DNA amplification techniques (quantitative polymerase chain reaction [qPCR] and microsatellites). Both qPCR and microsatellites revealed successful DNA amplification in all degraded specimens or beetle fragments examined. However, relative qPCR concentration and peak height of microsatellites were affected by the state of specimen and storage duration but not by specimen weight. Our investigation demonstrates that degraded remnants of traffic-killed beetle specimens can serve as a source of high-quality genomic DNA, which allows to address conservation genetic issues. © The Author 2015. Published by Oxford University Press on behalf of the Entomological Society of America.

Development of cross-priming amplification for direct detection of the African Swine Fever Virus, in pig and wild boar blood and sera samples.

PubMed

Frączyk, M; Woźniakowski, G; Kowalczyk, A; Niemczuk, K; Pejsak, Z

2016-05-01

African swine fever (ASF) is considered a major threat to the production of pigs worldwide. The ASF aetiological agent, ASFV, is the sole member of the Asfivirus genus, belonging to the Asfarviridae family. An effective ASF vaccine is not currently available, thus the only measures of ASF spread control include, reliable and fast diagnosis. Officially approved, diagnostic methods include, virus isolation, serological assays, including enzyme-linked immunosorbent assay and immunoperoxidase assay (IPT) and different modifications of the polymerase chain reaction (PCR). This paper describes the first development and application of a cross-priming amplification method (CPA) for the direct detection of genetic ASFV material, in blood and sera from pigs and wild boars. This method is specific only to ASFV DNA. The study showed that CPA had equal sensitivity, in comparison to the official, universal probe library (UPL) real-time PCR and reached 7·2 copies of standard plasmid DNA, containing a p72 gene fragment. This method was capable of detecting ASFV DNA in all examined blood samples, originating from pigs; n = 10 and wild boars; n = 76. The obtained results were also confirmed by the officially approved, real-time PCR. The developed CPA might be further used by local and county veterinary officers, hunters or pig farmers, for preliminary ASF diagnosis. The spread of the African swine fever virus (ASFV) among infected pigs and wild boars, is currently one of the most important facets of virus transmission in eastern Europe. Cross-priming amplification (CPA) has been developed, for fast and direct development of genetic ASFV material in the blood and sera of infected pigs and wild boars. It has been shown that CPA is a rapid, sensitive and specific isothermal method for the detection of ASFV DNA, in directly collected blood or sera from pigs and wild boars. © 2016 The Society for Applied Microbiology.

Rapid and Sensitive Isothermal Detection of Nucleic-acid Sequence by Multiple Cross Displacement Amplification.

PubMed

Wang, Yi; Wang, Yan; Ma, Ai-Jing; Li, Dong-Xun; Luo, Li-Juan; Liu, Dong-Xin; Jin, Dong; Liu, Kai; Ye, Chang-Yun

2015-07-08

We have devised a novel amplification strategy based on isothermal strand-displacement polymerization reaction, which was termed multiple cross displacement amplification (MCDA). The approach employed a set of ten specially designed primers spanning ten distinct regions of target sequence and was preceded at a constant temperature (61-65 °C). At the assay temperature, the double-stranded DNAs were at dynamic reaction environment of primer-template hybrid, thus the high concentration of primers annealed to the template strands without a denaturing step to initiate the synthesis. For the subsequent isothermal amplification step, a series of primer binding and extension events yielded several single-stranded DNAs and single-stranded single stem-loop DNA structures. Then, these DNA products enabled the strand-displacement reaction to enter into the exponential amplification. Three mainstream methods, including colorimetric indicators, agarose gel electrophoresis and real-time turbidity, were selected for monitoring the MCDA reaction. Moreover, the practical application of the MCDA assay was successfully evaluated by detecting the target pathogen nucleic acid in pork samples, which offered advantages on quick results, modest equipment requirements, easiness in operation, and high specificity and sensitivity. Here we expounded the basic MCDA mechanism and also provided details on an alternative (Single-MCDA assay, S-MCDA) to MCDA technique.

Enhanced solid-phase recombinase polymerase amplification and electrochemical detection.

PubMed

Del Río, Jonathan Sabaté; Lobato, Ivan Magriñà; Mayboroda, Olena; Katakis, Ioanis; O'Sullivan, Ciara K

2017-05-01

Recombinase polymerase amplification (RPA) is an elegant method for the rapid, isothermal amplification of nucleic acids. Here, we elucidate the optimal surface chemistry for rapid and efficient solid-phase RPA, which was fine-tuned in order to obtain a maximum signal-to-noise ratio, defining the optimal DNA probe density, probe-to-lateral spacer ratio (1:0, 1:1, 1:10 and 1:100) and length of a vertical spacer of the probe as well as investigating the effect of different types of lateral spacers. The use of different labelling strategies was also examined in order to reduce the number of steps required for the analysis, using biotin or horseradish peroxidase-labelled reverse primers. Optimisation of the amplification temperature used and the use of surface blocking agents were also pursued. The combination of these changes facilitated a significantly more rapid amplification and detection protocol, with a lowered limit of detection (LOD) of 1 · 10 -15 M. The optimised protocol was applied to the detection of Francisella tularensis in real samples from hares and a clear correlation with PCR and qPCR results observed and the solid-phase RPA demonstrated to be capable of detecting 500 fM target DNA in real samples. Graphical abstract Relative size of thiolated lateral spacers tested versus the primer and the uvsx recombinase protein.

Surface invasive cleavage assay on a maskless light-directed diamond DNA microarray for genome-wide human SNP mapping.

PubMed

Nie, Bei; Yang, Min; Fu, Weiling; Liang, Zhiqing

2015-07-07

The surface invasive cleavage assay, because of its innate accuracy and ability for self-signal amplification, provides a potential route for the mapping of hundreds of thousands of human SNP sites. However, its performance on a high density DNA array has not yet been established, due to the unusual "hairpin" probe design on the microarray and the lack of chemical stability of commercially available substrates. Here we present an applicable method to implement a nanocrystalline diamond thin film as an alternative substrate for fabricating an addressable DNA array using maskless light-directed photochemistry, producing the most chemically stable and biocompatible system for genetic analysis and enzymatic reactions. The surface invasive cleavage reaction, followed by degenerated primer ligation and post-rolling circle amplification is consecutively performed on the addressable diamond DNA array, accurately mapping SNP sites from PCR-amplified human genomic target DNA. Furthermore, a specially-designed DNA array containing dual probes in the same pixel is fabricated by following a reverse light-directed DNA synthesis protocol. This essentially enables us to decipher thousands of SNP alleles in a single-pot reaction by the simple addition of enzyme, target and reaction buffers.

SERS assay of telomerase activity at single-cell level and colon cancer tissues via quadratic signal amplification.

PubMed

Shi, Muling; Zheng, Jing; Liu, Changhui; Tan, Guixiang; Qing, Zhihe; Yang, Sheng; Yang, Jinfeng; Tan, Yongjun; Yang, Ronghua

2016-03-15

As an important biomarker and therapeutic target, telomerase has attracted extensive attention concerning its detection and monitoring. Recently, enzyme-assisted amplification approaches have provided useful platforms for the telomerase activity detection, however, further improvement in sensitivity is still hindered by the single-step signal amplification. Herein, we develop a quadratic signal amplification strategy for ultrasensitive surface-enhanced Raman scattering (SERS) detection of telomerase activity. The central idea of our design is using telomerase-induced silver nanoparticles (AgNPs) assembly and silver ions (Ag(+))-mediated cascade amplification. In our approach, each telomerase-aided DNA sequence extension could trigger the formation of a long double-stranded DNA (dsDNA), making numerous AgNPs assembling along with this long strand through specific Ag-S bond, to form a primary amplification element. For secondary amplification, each conjugated AgNP was dissolved into Ag(+), which can effectively induce the 4-aminobenzenethiol (4-ABT) modified gold nanoparticles (AuNPs@4-ABT) to undergo aggregation to form numerous "hot-spots". Through quadratic amplifications, a limit of detection down to single HeLa cell was achieved. More importantly, this method demonstrated good performance when applied to tissues from colon cancer patients, which exhibits great potential in the practical application of telomerase-based cancer diagnosis in early stages. To demonstrate the potential in screening the telomerase inhibitors and telomerase-targeted drugs, the proposed design is successfully employed to measure the inhibition of telomerase activity by 3'-azido-3'-deoxythymidine. Copyright © 2015 Elsevier B.V. All rights reserved.

ITS1: a DNA barcode better than ITS2 in eukaryotes?

PubMed

Wang, Xin-Cun; Liu, Chang; Huang, Liang; Bengtsson-Palme, Johan; Chen, Haimei; Zhang, Jian-Hui; Cai, Dayong; Li, Jian-Qin

2015-05-01

A DNA barcode is a short piece of DNA sequence used for species determination and discovery. The internal transcribed spacer (ITS/ITS2) region has been proposed as the standard DNA barcode for fungi and seed plants and has been widely used in DNA barcoding analyses for other biological groups, for example algae, protists and animals. The ITS region consists of both ITS1 and ITS2 regions. Here, a large-scale meta-analysis was carried out to compare ITS1 and ITS2 from three aspects: PCR amplification, DNA sequencing and species discrimination, in terms of the presence of DNA barcoding gaps, species discrimination efficiency, sequence length distribution, GC content distribution and primer universality. In total, 85 345 sequence pairs in 10 major groups of eukaryotes, including ascomycetes, basidiomycetes, liverworts, mosses, ferns, gymnosperms, monocotyledons, eudicotyledons, insects and fishes, covering 611 families, 3694 genera, and 19 060 species, were analysed. Using similarity-based methods, we calculated species discrimination efficiencies for ITS1 and ITS2 in all major groups, families and genera. Using Fisher's exact test, we found that ITS1 has significantly higher efficiencies than ITS2 in 17 of the 47 families and 20 of the 49 genera, which are sample-rich. By in silico PCR amplification evaluation, primer universality of the extensively applied ITS1 primers was found superior to that of ITS2 primers. Additionally, shorter length of amplification product and lower GC content was discovered to be two other advantages of ITS1 for sequencing. In summary, ITS1 represents a better DNA barcode than ITS2 for eukaryotic species. © 2014 John Wiley & Sons Ltd.

A DNA logic gate based on strand displacement reaction and rolling circle amplification, responding to multiple low-abundance DNA fragment input signals, and its application in detecting miRNAs.

PubMed

Chen, Yuqi; Song, Yanyan; Wu, Fan; Liu, Wenting; Fu, Boshi; Feng, Bingkun; Zhou, Xiang

2015-04-25

A conveniently amplified DNA AND logic gate platform was designed for the highly sensitive detection of low-abundance DNA fragment inputs based on strand displacement reaction and rolling circle amplification strategy. Compared with others, this system can detect miRNAs in biological samples. The success of this strategy demonstrates the potential of DNA logic gates in disease diagnosis.

Confirmed detection of Cyclospora cayetanesis, Encephalitozoon intestinalis and Cryptosporidium parvum in water used for drinking.

PubMed

Dowd, Scot E; John, David; Eliopolus, James; Gerba, Charles P; Naranjo, Jaime; Klein, Robert; López, Beatriz; de Mejía, Maricruz; Mendoza, Carlos E; Pepper, Ian L

2003-09-01

Human enteropathogenic microsporidia (HEM), Cryptosporidium parvum, Cyclospora cayetanesis, and Giardia lamblia are associated with gastrointestinal disease in humans. To date, the mode of transmission and environmental occurrence of HEM (Encephalitozoon intestinalis and Enterocytozoon bieneusi) and Cyclospora cayetanesis have not been fully elucidated due to lack of sensitive and specific environmental screening methods. The present study was undertaken with recently developed methods, to screen various water sources used for public consumption in rural areas around the city of Guatemala. Water concentrates collected in these areas were subjected to community DNA extraction followed by PCR amplification, PCR sequencing and computer database homology comparison (CDHC). All water samples screened in this study had been previously confirmed positive for Giardia spp. by immunofluorescent assay (IFA). Of the 12 water concentrates screened, 6 showed amplification of microsporidial SSU-rDNA and were subsequently confirmed to be Encephalitozoon intestinalis. Five of the samples allowed for amplification of Cyclospora 18S-rDNA; three of these were confirmed to be Cyclospora cayetanesis while two could not be identified because of inadequate sequence information. Thus, this study represents the first confirmed identification of Cyclospora cayetanesis and Encephalitozoon intestinalis in source water used for consumption. The fact that the waters tested may be used for human consumption indicates that these emerging protozoa may be transmitted by ingestion of contaminated water.

Development of real-time recombinase polymerase amplification assay for rapid and sensitive detection of canine parvovirus 2.

PubMed

Geng, Yunyun; Wang, Jianchang; Liu, Libing; Lu, Yan; Tan, Ke; Chang, Yan-Zhong

2017-11-06

Canine parvovirus 2, a linear single-stranded DNA virus belonging to the genus Parvovirus within the family Parvoviridae, is a highly contagious pathogen of domestic dogs and several wild canidae species. Early detection of canine parvovirus (CPV-2) is crucial to initiating appropriate outbreak control strategies. Recombinase polymerase amplification (RPA), a novel isothermal gene amplification technique, has been developed for the molecular detection of diverse pathogens. In this study, a real-time RPA assay was developed for the detection of CPV-2 using primers and an exo probe targeting the CPV-2 nucleocapsid protein gene. The real-time RPA assay was performed successfully at 38 °C, and the results were obtained within 4-12 min for 10 5 -10 1 molecules of template DNA. The assay only detected CPV-2, and did not show cross-detection of other viral pathogens, demonstrating a high level of specificity. The analytical sensitivity of the real-time RPA was 10 1 copies/reaction of a standard DNA template, which was 10 times more sensitive than the common RPA method. The clinical sensitivity of the real-time RPA assay matched 100% (n = 91) to the real-time PCR results. The real-time RPA assay is a simple, rapid, reliable and affordable method that can potentially be applied for the detection of CPV-2 in the research laboratory and point-of-care diagnosis.

Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

DOEpatents

Cruz-Perez, Patricia; Buttner, Mark P.

2004-05-11

A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

Identification of Prostate Cancer-Specific microDNAs

DTIC Science & Technology

2016-02-01

circular DNA by rolling circle amplification (RCA) and then amplified DNA fragments were subject to deep sequencing. Deep sequencing of the...demonstrate the existence of microDNAs in prostate cancer. We adopted multiple displacement amplification (MDA) with random 2 primers for enriched...prostate cancer cells through multiple displacement amplification and next generation sequencing. R e la ti v e c e ll g ro w th ( % ) 0 20

Two-dimensional MoS2 as a nano-binder for ssDNA: Ultrasensitive aptamer based amperometric detection of Ochratoxin A.

PubMed

Tang, Juan; Huang, Yapei; Cheng, Yu; Huang, Lulu; Zhuang, Junyang; Tang, Dianping

2018-02-07

Two-dimensional (2D) MoS 2 is found to possess different affinities for ssDNA and dsDNA. This finding is exploited in an amperometric aptamer-based method for the determination of the mycotoxin ochratoxin A (OTA). Initially, a dsDNA probe (formatted through the hybridization of OTA-aptamer with an auxiliary DNA) is self-assembled on a gold electrode. Upon introduction of OTA, it will bind to the aptamer and cause the unwinding of dsDNA, while the auxiliary DNA (with single-stranded structure) remains on the electrode. Since the affinity of 2D MoS 2 for ssDNA is considerably larger than that for dsDNA, it will be adsorbed on the electrode by binding to the auxiliary DNA. Notably, 2D MoS 2 possesses peroxidase-like activity. Hence, it can catalyze the amplification of electrochemical signal of the hydroquinone/benzoquinone redox system. Under optimal conditions, the amperometric signal (best measured at -0.2 V vs. SCE) increases with increasing OTA concentration in the range from 0.5 pg·mL -1 to 1.0 ng·mL -1 , with a lower detection limit of 0.23 pg·mL -1 . The method was applied to the determination of OTA in spiked red wine. Graphical abstract Herein we construct a convenient electrochemical aptasensor for sensitive monitor of ochratoxin A by using 2D MoS 2 as a nano-binder to catalyze the amplification of electrochemical signal from hydroquinone/benzoquinone system.

Comparison of methods for the extraction of DNA from formalin-fixed, paraffin-embedded archival tissues.

PubMed

Sengüven, Burcu; Baris, Emre; Oygur, Tulin; Berktas, Mehmet

2014-01-01

Discussing a protocol involving xylene-ethanol deparaffinization on slides followed by a kit-based extraction that allows for the extraction of high quality DNA from FFPE tissues. DNA was extracted from the FFPE tissues of 16 randomly selected blocks. Methods involving deparaffinization on slides or tubes, enzyme digestion overnight or for 72 hours and isolation using phenol chloroform method or a silica-based commercial kit were compared in terms of yields, concentrations and the amplifiability. The highest yield of DNA was produced from the samples that were deparaffinized on slides, digested for 72 hours and isolated with a commercial kit. Samples isolated with the phenol-chloroform method produced DNA of lower purity than the samples that were purified with kit. The samples isolated with the commercial kit resulted in better PCR amplification. Silica-based commercial kits and deparaffinized on slides should be considered for DNA extraction from FFPE.

Detection of dopamine in dopaminergic cell using nanoparticles-based barcode DNA analysis.

PubMed

An, Jeung Hee; Kim, Tae-Hyung; Oh, Byung-Keun; Choi, Jeong Woo

2012-01-01

Nanotechnology-based bio-barcode-amplification analysis may be an innovative approach to dopamine detection. In this study, we evaluated the efficacy of this bio-barcode DNA method in detecting dopamine from dopaminergic cells. Herein, a combination DNA barcode and bead-based immunoassay for neurotransmitter detection with PCR-like sensitivity is described. This method relies on magnetic nanoparticles with antibodies and nanoparticles that are encoded with DNA, and antibodies that can sandwich the target protein captured by the nanoparticle-bound antibodies. The aggregate sandwich structures are magnetically separated from solution, and treated in order to remove the conjugated barcode DNA. The DNA barcodes were then identified via PCR analysis. The dopamine concentration in dopaminergic cells can be readily and rapidly detected via the bio-barcode assay method. The bio-barcode assay method is, therefore, a rapid and high-throughput screening tool for the detection of neurotransmitters such as dopamine.

Use of Sequenom Sample ID Plus® SNP Genotyping in Identification of FFPE Tumor Samples

PubMed Central

Miller, Jessica K.; Buchner, Nicholas; Timms, Lee; Tam, Shirley; Luo, Xuemei; Brown, Andrew M. K.; Pasternack, Danielle; Bristow, Robert G.; Fraser, Michael; Boutros, Paul C.; McPherson, John D.

2014-01-01

Short tandem repeat (STR) analysis, such as the AmpFlSTR® Identifiler® Plus kit, is a standard, PCR-based human genotyping method used in the field of forensics. Misidentification of cell line and tissue DNA can be costly if not detected early; therefore it is necessary to have quality control measures such as STR profiling in place. A major issue in large-scale research studies involving archival formalin-fixed paraffin embedded (FFPE) tissues is that varying levels of DNA degradation can result in failure to correctly identify samples using STR genotyping. PCR amplification of STRs of several hundred base pairs is not always possible when DNA is degraded. The Sample ID Plus® panel from Sequenom allows for human DNA identification and authentication using SNP genotyping. In comparison to lengthy STR amplicons, this multiplexing PCR assay requires amplification of only 76–139 base pairs, and utilizes 47 SNPs to discriminate between individual samples. In this study, we evaluated both STR and SNP genotyping methods of sample identification, with a focus on paired FFPE tumor/normal DNA samples intended for next-generation sequencing (NGS). The ability to successfully validate the identity of FFPE samples can enable cost savings by reducing rework. PMID:24551080

Use of Sequenom sample ID Plus® SNP genotyping in identification of FFPE tumor samples.

PubMed

Miller, Jessica K; Buchner, Nicholas; Timms, Lee; Tam, Shirley; Luo, Xuemei; Brown, Andrew M K; Pasternack, Danielle; Bristow, Robert G; Fraser, Michael; Boutros, Paul C; McPherson, John D

2014-01-01

Short tandem repeat (STR) analysis, such as the AmpFlSTR® Identifiler® Plus kit, is a standard, PCR-based human genotyping method used in the field of forensics. Misidentification of cell line and tissue DNA can be costly if not detected early; therefore it is necessary to have quality control measures such as STR profiling in place. A major issue in large-scale research studies involving archival formalin-fixed paraffin embedded (FFPE) tissues is that varying levels of DNA degradation can result in failure to correctly identify samples using STR genotyping. PCR amplification of STRs of several hundred base pairs is not always possible when DNA is degraded. The Sample ID Plus® panel from Sequenom allows for human DNA identification and authentication using SNP genotyping. In comparison to lengthy STR amplicons, this multiplexing PCR assay requires amplification of only 76-139 base pairs, and utilizes 47 SNPs to discriminate between individual samples. In this study, we evaluated both STR and SNP genotyping methods of sample identification, with a focus on paired FFPE tumor/normal DNA samples intended for next-generation sequencing (NGS). The ability to successfully validate the identity of FFPE samples can enable cost savings by reducing rework.

Separation and parallel sequencing of the genomes and transcriptomes of single cells using G&T-seq.

PubMed

Macaulay, Iain C; Teng, Mabel J; Haerty, Wilfried; Kumar, Parveen; Ponting, Chris P; Voet, Thierry

2016-11-01

Parallel sequencing of a single cell's genome and transcriptome provides a powerful tool for dissecting genetic variation and its relationship with gene expression. Here we present a detailed protocol for G&T-seq, a method for separation and parallel sequencing of genomic DNA and full-length polyA(+) mRNA from single cells. We provide step-by-step instructions for the isolation and lysis of single cells; the physical separation of polyA(+) mRNA from genomic DNA using a modified oligo-dT bead capture and the respective whole-transcriptome and whole-genome amplifications; and library preparation and sequence analyses of these amplification products. The method allows the detection of thousands of transcripts in parallel with the genetic variants captured by the DNA-seq data from the same single cell. G&T-seq differs from other currently available methods for parallel DNA and RNA sequencing from single cells, as it involves physical separation of the DNA and RNA and does not require bespoke microfluidics platforms. The process can be implemented manually or through automation. When performed manually, paired genome and transcriptome sequencing libraries from eight single cells can be produced in ∼3 d by researchers experienced in molecular laboratory work. For users with experience in the programming and operation of liquid-handling robots, paired DNA and RNA libraries from 96 single cells can be produced in the same time frame. Sequence analysis and integration of single-cell G&T-seq DNA and RNA data requires a high level of bioinformatics expertise and familiarity with a wide range of informatics tools.

An improved protocol for DNA extraction from alkaline soil and sediment samples for constructing metagenomic libraries.

PubMed

Verma, Digvijay; Satyanarayana, T

2011-09-01

An improved single-step protocol has been developed for extracting pure community humic substance-free DNA from alkaline soils and sediments. The method is based on direct cell lysis in the presence of powdered activated charcoal and polyvinylpolypyrrolidone followed by precipitation with polyethyleneglycol and isopropanol. The strategy allows simultaneous isolation and purification of DNA while minimizing the loss of DNA with respect to other available protocols for metagenomic DNA extraction. Moreover, the purity levels are significant, which are difficult to attain with any of the methods reported in the literature for DNA extraction from soils. The DNA thus extracted was free from humic substances and, therefore, could be processed for restriction digestion, PCR amplification as well as for the construction of metagenomic libraries.

A paper and plastic device for the combined isothermal amplification and lateral flow detection of Plasmodium DNA.

PubMed

Cordray, Michael S; Richards-Kortum, Rebecca R

2015-11-26

Isothermal amplification techniques are emerging as a promising method for malaria diagnosis since they are capable of detecting extremely low concentrations of parasite target while mitigating the need for infrastructure and training required by other nucleic acid based tests. Recombinase polymerase amplification (RPA) is promising for further development since it operates in a short time frame (<30 min) and produces a product that can be visually detected on a lateral flow dipstick. A self-sealing paper and plastic system that performs both the amplification and detection of a malaria DNA sequence is presented. Primers were designed using the NCBI nBLAST tools and screened using gel electrophoresis. Paper and plastic devices were prototyped using commercial design software and parts were cut using a laser cutter and assembled by hand. Synthetic copies of the Plasmodium 18S gene were spiked into solution and used as targets for the RPA reaction. To test the performance of the device the same samples spiked with synthetic target were run in parallel both in the paper and plastic devices and using conventional bench top methods. Novel RPA primers were developed that bind to sequences present in the four species of Plasmodium which infect humans. The paper and plastic devices were found to be capable of detecting as few as 5 copies/µL of synthetic Plasmodium DNA (50 copies total), comparable to the same reaction run on the bench top. The devices produce visual results in an hour, cost approximately $1, and are self-contained once the device is sealed. The device was capable of carrying out the RPA reaction and detecting meaningful amounts of synthetic Plasmodium DNA in a self-sealing and self-contained device. This device may be a step towards making nucleic acid tests more accessible for malaria detection.

Data Acceptance Criteria for Standardized Human-Associated Fecal Source Identification Quantitative Real-Time PCR Methods.

PubMed

Shanks, Orin C; Kelty, Catherine A; Oshiro, Robin; Haugland, Richard A; Madi, Tania; Brooks, Lauren; Field, Katharine G; Sivaganesan, Mano

2016-05-01

There is growing interest in the application of human-associated fecal source identification quantitative real-time PCR (qPCR) technologies for water quality management. The transition from a research tool to a standardized protocol requires a high degree of confidence in data quality across laboratories. Data quality is typically determined through a series of specifications that ensure good experimental practice and the absence of bias in the results due to DNA isolation and amplification interferences. However, there is currently a lack of consensus on how best to evaluate and interpret human fecal source identification qPCR experiments. This is, in part, due to the lack of standardized protocols and information on interlaboratory variability under conditions for data acceptance. The aim of this study is to provide users and reviewers with a complete series of conditions for data acceptance derived from a multiple laboratory data set using standardized procedures. To establish these benchmarks, data from HF183/BacR287 and HumM2 human-associated qPCR methods were generated across 14 laboratories. Each laboratory followed a standardized protocol utilizing the same lot of reference DNA materials, DNA isolation kits, amplification reagents, and test samples to generate comparable data. After removal of outliers, a nested analysis of variance (ANOVA) was used to establish proficiency metrics that include lab-to-lab, replicate testing within a lab, and random error for amplification inhibition and sample processing controls. Other data acceptance measurements included extraneous DNA contamination assessments (no-template and extraction blank controls) and calibration model performance (correlation coefficient, amplification efficiency, and lower limit of quantification). To demonstrate the implementation of the proposed standardized protocols and data acceptance criteria, comparable data from two additional laboratories were reviewed. The data acceptance criteria proposed in this study should help scientists, managers, reviewers, and the public evaluate the technical quality of future findings against an established benchmark. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

A simple and efficient method for agroinfection of Vernonia cinerea with infectious clones of Vernonia yellow vein virus.

PubMed

Packialakshmi, R M; Usha, R

2011-12-01

Vernonia yellow vein virus (VeYVV) is a distinct monopartite begomovirus associated with a satellite DNA β. After constructing dimers of both DNA A and DNA β in binary vectors, a number of infection methods were attempted. However, only a modified stem-prick method produced up to 83% infection in the natural host Vernonia cinerea, thus, fulfilling the Koch's postulate. The presence of the viral DNA in the agroinfected plants was confirmed by rolling circle amplification (RCA), followed by Southern hybridization. DNA β induces typical symptoms of Vernonia yellow vein disease (VeYVD) when co-agroinoculated with the begomovirus to Vernonia and also leads to the accumulation of DNA A systemically. VeYVV represents a new member of the emerging group of monopartite begomoviruses requiring a satellite component for symptom induction.

Extended PCR conditions to reduce drop-out frequencies in low template STR typing including unequal mixtures.

PubMed

Weiler, Natalie E C; Matai, Anuska S; Sijen, Titia

2012-01-01

Forensic laboratories employ various approaches to obtain short tandem repeat (STR) profiles from minimal traces (<100 pg DNA input). Most approaches aim to sensitize DNA profiling by increasing the amplification level by a higher cycle number or enlarging the amount of PCR products analyzed during capillary electrophoresis. These methods have limitations when unequal mixtures are genotyped, since the major component will be over-amplified or over-loaded. This study explores an alternative strategy for improved detection of the minor components in low template (LT) DNA typing that may be better suited for the detection of the minor component in mixtures. The strategy increases the PCR amplification efficiency by extending the primer annealing time several folds. When the AmpFℓSTR(®) Identifiler(®) amplification parameters are changed to an annealing time of 20 min during all 28 cycles, the drop-out frequency is reduced for both pristine DNA and single or multiple donor mock case work samples. In addition, increased peak heights and slightly more drop-ins are observed while the heterozygous peak balance remains similar as with the conventional Identifiler protocol. By this extended protocol, full DNA profiles were obtained from only 12 sperm heads (which corresponds to 36 pg of DNA) that were collected by laser micro dissection. Notwithstanding the improved detection, allele drop-outs do persist, albeit in lower frequencies. Thus a LT interpretation strategy such as deducing consensus profiles from multiple independent amplifications is appropriate. The use of extended PCR conditions represents a general approach to improve detection of unequal mixtures as shown using four commercially available kits (AmpFℓSTR(®) Identifiler, SEfiler Plus, NGM and Yfiler). The extended PCR protocol seems to amplify more of the molecules in LT samples during PCR, which results in a lower drop-out frequency. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

Development of Rapid Isothermal Amplification Assays for Detection of Phytophthora spp. in Plant Tissue.

PubMed

Miles, Timothy D; Martin, Frank N; Coffey, Michael D

2015-02-01

Several isothermal amplification techniques recently have been developed that are tolerant of inhibitors present in many plant extracts, which can reduce the need for obtaining purified DNA for running diagnostic assays. One such commercially available technique that has similarities with real-time polymerase chain reaction (PCR) for designing primers and a labeled probe is recombinase polymerase amplification (RPA). This technology was used to develop two simple and rapid approaches for detection of Phytophthora spp.: one genus-specific assay multiplexed with a plant internal control and the other species-specific assays for Phytophthora ramorum and P. kernoviae. All assays were tested for sensitivity (ranging from 3 ng to 1 fg of DNA) and specificity using DNA extracted from more than 136 Phytophthora taxa, 21 Pythium spp., 1 Phytopythium sp., and a wide range of plant species. The lower limit of linear detection using purified DNA was 200 to 300 fg of DNA in all pathogen RPA assays. Six different extraction buffers were tested for use during plant tissue maceration and the assays were validated in the field by collecting 222 symptomatic plant samples from over 50 different hosts. Only 56 samples were culture positive for Phytophthora spp. whereas 91 were positive using the Phytophthora genus-specific RPA test and a TaqMan real-time PCR assay. A technique for the generation of sequencing templates from positive RPA amplifications to confirm species identification was also developed. These RPA assays have added benefits over traditional technologies because they are rapid (results can be obtained in as little as 15 min), do not require DNA extraction or extensive training to complete, use less expensive portable equipment than PCR-based assays, and are significantly more specific than current immunologically based methods. This should provide a rapid, field-deployable capability for pathogen detection that will facilitate point-of-sample collection processing, thereby reducing the time necessary for accurate diagnostics and making management decisions.

Combined subtraction hybridization and polymerase chain reaction amplification procedure for isolation of strain-specific Rhizobium DNA sequences.

PubMed Central

Bjourson, A J; Stone, C E; Cooper, J E

1992-01-01

A novel subtraction hybridization procedure, incorporating a combination of four separation strategies, was developed to isolate unique DNA sequences from a strain of Rhizobium leguminosarum bv. trifolii. Sau3A-digested DNA from this strain, i.e., the probe strain, was ligated to a linker and hybridized in solution with an excess of pooled subtracter DNA from seven other strains of the same biovar which had been restricted, ligated to a different, biotinylated, subtracter-specific linker, and amplified by polymerase chain reaction to incorporate dUTP. Subtracter DNA and subtracter-probe hybrids were removed by phenol-chloroform extraction of a streptavidin-biotin-DNA complex. NENSORB chromatography of the sequences remaining in the aqueous layer captured biotinylated subtracter DNA which may have escaped removal by phenol-chloroform treatment. Any traces of contaminating subtracter DNA were removed by digestion with uracil DNA glycosylase. Finally, remaining sequences were amplified by polymerase chain reaction with a probe strain-specific primer, labelled with 32P, and tested for specificity in dot blot hybridizations against total genomic target DNA from each strain in the subtracter pool. Two rounds of subtraction-amplification were sufficient to remove cross-hybridizing sequences and to give a probe which hybridized only with homologous target DNA. The method is applicable to the isolation of DNA and RNA sequences from both procaryotic and eucaryotic cells. Images PMID:1637166

Loop-mediated isothermal amplification assay for detection and discrimination of Toxocara canis and Toxocara cati eggs directly from sand samples.

PubMed

Macuhova, K; Kumagai, T; Akao, N; Ohta, N

2010-12-01

We developed a novel and simple method, using loop-mediated isothermal amplification (LAMP), for the detection and discrimination of Toxocara canis and Toxocara cati eggs. The new method employs 4 steps: (1) concentration of Toxocara eggs in a small amount of sand; (2) dissolution of the proteinaceous membrane of eggs and simultaneously separation of them from the sand using NaClO treatment; (3) extraction of DNA using NaOH treatment; and (4) detection of T. canis / T. cati DNA using a LAMP assay. All these steps are fast, easy to perform, and do not require expensive equipment or reagents. The novel method was tested both experimentally and in a field study. In the laboratory, we could reliably detect as few as 3 T. canis eggs in artificially contaminated sand, if the experiment was repeated twice. In the field trial, we were able to detect T. cati DNA from 4 natural sandpits having moderate to heavy contamination, although not in a single lightly contaminated sandpit. All of the examined sandpits were found to be contaminated with eggs of T. cati, but none appeared to contain T. canis. Our new method could extract DNA from T. canis and T. cati eggs directly from sand samples as well as detect and distinguish these 2 species in a few easy steps, with markedly reduced time and expense.

DNA barcoding of vouchered xylarium wood specimens of nine endangered Dalbergia species.

PubMed

Yu, Min; Jiao, Lichao; Guo, Juan; Wiedenhoeft, Alex C; He, Tuo; Jiang, Xiaomei; Yin, Yafang

2017-12-01

ITS2+ trnH - psbA was the best combination of DNA barcode to resolve the Dalbergia wood species studied. We demonstrate the feasibility of building a DNA barcode reference database using xylarium wood specimens. The increase in illegal logging and timber trade of CITES-listed tropical species necessitates the development of unambiguous identification methods at the species level. For these methods to be fully functional and deployable for law enforcement, they must work using wood or wood products. DNA barcoding of wood has been promoted as a promising tool for species identification; however, the main barrier to extensive application of DNA barcoding to wood is the lack of a comprehensive and reliable DNA reference library of barcodes from wood. In this study, xylarium wood specimens of nine Dalbergia species were selected from the Wood Collection of the Chinese Academy of Forestry and DNA was then extracted from them for further PCR amplification of eight potential DNA barcode sequences (ITS2, matK, trnL, trnH-psbA, trnV-trnM1, trnV-trnM2, trnC-petN, and trnS-trnG). The barcodes were tested singly and in combination for species-level discrimination ability by tree-based [neighbor-joining (NJ)] and distance-based (TaxonDNA) methods. We found that the discrimination ability of DNA barcodes in combination was higher than any single DNA marker among the Dalbergia species studied, with the best two-marker combination of ITS2+trnH-psbA analyzed with NJ trees performing the best (100% accuracy). These barcodes are relatively short regions (<350 bp) and amplification reactions were performed with high success (≥90%) using wood as the source material, a necessary factor to apply DNA barcoding to timber trade. The present results demonstrate the feasibility of using vouchered xylarium specimens to build DNA barcoding reference databases.

Enhanced Genetic Analysis of Single Human Bioparticles Recovered by Simplified Micromanipulation from Forensic ‘Touch DNA’ Evidence

PubMed Central

Farash, Katherine; Hanson, Erin K.; Ballantyne, Jack

2015-01-01

DNA profiles can be obtained from ‘touch DNA’ evidence, which comprises microscopic traces of human biological material. Current methods for the recovery of trace DNA employ cotton swabs or adhesive tape to sample an area of interest. However, such a ‘blind-swabbing’ approach will co-sample cellular material from the different individuals, even if the individuals’ cells are located in geographically distinct locations on the item. Thus, some of the DNA mixtures encountered in touch DNA samples are artificially created by the swabbing itself. In some instances, a victim’s DNA may be found in significant excess thus masking any potential perpetrator’s DNA. In order to circumvent the challenges with standard recovery and analysis methods, we have developed a lower cost, ‘smart analysis’ method that results in enhanced genetic analysis of touch DNA evidence. We describe an optimized and efficient micromanipulation recovery strategy for the collection of bio-particles present in touch DNA samples, as well as an enhanced amplification strategy involving a one-step 5 µl microvolume lysis/STR amplification to permit the recovery of STR profiles from the bio-particle donor(s). The use of individual or few (i.e., “clumps”) bioparticles results in the ability to obtain single source profiles. These procedures represent alternative enhanced techniques for the isolation and analysis of single bioparticles from forensic touch DNA evidence. While not necessary in every forensic investigation, the method could be highly beneficial for the recovery of a single source perpetrator DNA profile in cases involving physical assault (e.g., strangulation) that may not be possible using standard analysis techniques. Additionally, the strategies developed here offer an opportunity to obtain genetic information at the single cell level from a variety of other non-forensic trace biological material. PMID:25867046

Diagnostic devices for isothermal nucleic acid amplification.

PubMed

Chang, Chia-Chen; Chen, Chien-Cheng; Wei, Shih-Chung; Lu, Hui-Hsin; Liang, Yang-Hung; Lin, Chii-Wann

2012-01-01

Since the development of the polymerase chain reaction (PCR) technique, genomic information has been retrievable from lesser amounts of DNA than previously possible. PCR-based amplifications require high-precision instruments to perform temperature cycling reactions; further, they are cumbersome for routine clinical use. However, the use of isothermal approaches can eliminate many complications associated with thermocycling. The application of diagnostic devices for isothermal DNA amplification has recently been studied extensively. In this paper, we describe the basic concepts of several isothermal amplification approaches and review recent progress in diagnostic device development.

Diagnostic Devices for Isothermal Nucleic Acid Amplification

PubMed Central

Chang, Chia-Chen; Chen, Chien-Cheng; Wei, Shih-Chung; Lu, Hui-Hsin; Liang, Yang-Hung; Lin, Chii-Wann

2012-01-01

Since the development of the polymerase chain reaction (PCR) technique, genomic information has been retrievable from lesser amounts of DNA than previously possible. PCR-based amplifications require high-precision instruments to perform temperature cycling reactions; further, they are cumbersome for routine clinical use. However, the use of isothermal approaches can eliminate many complications associated with thermocycling. The application of diagnostic devices for isothermal DNA amplification has recently been studied extensively. In this paper, we describe the basic concepts of several isothermal amplification approaches and review recent progress in diagnostic device development. PMID:22969402

Aptamer/Au nanoparticles/cobalt sulfide nanosheets biosensor for 17β-estradiol detection using a guanine-rich complementary DNA sequence for signal amplification.

PubMed

Huang, Ke-Jing; Liu, Yu-Jie; Zhang, Ji-Zong; Cao, Jun-Tao; Liu, Yan-Ming

2015-05-15

We have developed a sensitive sensing platform for 17β-estradiol by combining the aptamer probe and hybridization reaction. In this assay, 2-dimensional cobalt sulfide nanosheet (CoS) was synthesized by a simple hydrothermal method with L-cysteine as sulfur donor. An electrochemical aptamer biosensor was constructed by assembling a thiol group tagged 17β-estradiol aptamer on CoS and gold nanoparticles (AuNPs) modified electrode. Methylene blue was applied as a tracer and a guanine-rich complementary DNA sequence was designed to bind with the unbound 17β-estradiol aptamer for signal amplification. The binding of guanine-rich DNA to the aptamer was inhibited when the aptamer captured 17β-estradiol. Using guanine-rich DNA in the assay greatly amplified the redox signal of methylene blue bound to the detection probe. The CoS/AuNPs film formed on the biosensor surface appeared to be a good conductor for accelerating the electron transfer. The method demonstrated a high sensitivity of detection with the dynamic concentration range spanning from 1.0×10(-9) to 1.0×10(-12) M and a detection limit of 7.0×10(-13) M. Besides, the fabricated biosensor exhibited good selectivity toward 17β-estradiol even when interferents were presented at 100-fold concentrations. Our attempt will extend the application of the CoS nanosheet and this signal amplification assay to biosensing areas. Copyright © 2014 Elsevier B.V. All rights reserved.

Two methods for construction of internal amplification controls for the detection of Escherichia coli O157 by polymerase chain reaction.

PubMed

Abdulmawjood, A; Roth, S; Bülte, M

2002-10-01

For the detection of food born bacteria by polymerase chain reaction (PCR) in food products, an internal amplification control (IAC) is required in order to prevent false negative results that might be caused by PCR inhibitors. In the present study, two IACs were constructed using two different methods. These IACs were designed in a way that the same primer pair can be used to amplify the target DNA and coamplify the IAC. The first IAC with a size of approximately 200 bp was constructed by deleting a part of the amplicon of the original target DNA (500 bp) between the two primer sites to produce an IAC smaller than the target DNA. The second IAC with a size of approximately 600 bp was synthesized in a one step PCR reaction. The primers used in this reaction possessed 5' over-hanging ends, which were identical to the primers used in the diagnostic reaction, whereas their 3' ends were complementary to the (pUC19) predetermined DNA sequence of defined length and sequence. The concentration of IACs appeared to be critical. Too much IAC DNA template would out-compete the target DNA template, thus giving a false negative result. However the use of an optimal IAC concentration increased the reliability of the PCR assays and appeared to be useful for food diagnostics.

[Development and validation of event-specific quantitative PCR method for genetically modified maize LY038].

PubMed

Mano, Junichi; Masubuchi, Tomoko; Hatano, Shuko; Futo, Satoshi; Koiwa, Tomohiro; Minegishi, Yasutaka; Noguchi, Akio; Kondo, Kazunari; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Takabatake, Reona; Kitta, Kazumi

2013-01-01

In this article, we report a novel real-time PCR-based analytical method for quantitation of the GM maize event LY038. We designed LY038-specific and maize endogenous reference DNA-specific PCR amplifications. After confirming the specificity and linearity of the LY038-specific PCR amplification, we determined the conversion factor required to calculate the weight-based content of GM organism (GMO) in a multilaboratory evaluation. Finally, in order to validate the developed method, an interlaboratory collaborative trial according to the internationally harmonized guidelines was performed with blind DNA samples containing LY038 at the mixing levels of 0, 0.5, 1.0, 5.0 and 10.0%. The precision of the method was evaluated as the RSD of reproducibility (RSDR), and the values obtained were all less than 25%. The limit of quantitation of the method was judged to be 0.5% based on the definition of ISO 24276 guideline. The results from the collaborative trial suggested that the developed quantitative method would be suitable for practical testing of LY038 maize.

PMS2 gene mutational analysis: direct cDNA sequencing to circumvent pseudogene interference.

PubMed

Wimmer, Katharina; Wernstedt, Annekatrin

2014-01-01

The presence of highly homologous pseudocopies can compromise the mutation analysis of a gene of interest. In particular, when using PCR-based strategies, pseudogene co-amplification has to be effectively prevented. This is often achieved by using primers designed to be parental gene specific according to the reference sequence and by applying stringent PCR conditions. However, there are cases in which this approach is of limited utility. For example, it has been shown that the PMS2 gene exchanges sequences with one of its pseudogenes, named PMS2CL. This results in functional PMS2 alleles containing pseudogene-derived sequences at their 3'-end and in nonfunctional PMS2CL pseudogene alleles that contain gene-derived sequences. Hence, the paralogues cannot be distinguished according to the reference sequence. This shortcoming can be effectively circumvented by using direct cDNA sequencing. This approach is based on the selective amplification of PMS2 transcripts in two overlapping 1.6-kb RT-PCR products. In addition to avoiding pseudogene co-amplification and allele dropout, this method has also the advantage that it allows to effectively identify deletions, splice mutations, and de novo retrotransposon insertions that escape the detection of most DNA-based mutation analysis protocols.

A Novel Isothermal Assay of Borrelia burgdorferi by Recombinase Polymerase Amplification with Lateral Flow Detection.

PubMed

Liu, Wei; Liu, Hui-Xin; Zhang, Lin; Hou, Xue-Xia; Wan, Kang-Lin; Hao, Qin

2016-08-03

A novel isothermal detection for recombinase polymerase amplification with lateral flow (LF-RPA) was established for Borrelia burgdorferi (B. burgdorferi) detection in this study. This assay with high sensitivity and specificity can get a visible result without any additional equipment in 30 min. We designed a pair of primers according to recA gene of B. burgdorferi strains and a methodology evaluation was performed. The results showed that the RPA assay based on the recA gene was successfully applied in B. burgdorferi detection, and its specific amplification was only achieved from the genomic DNA of B. burgdorferi. The detection limit of the new assay was about 25 copies of the B. burgdorferi genomic DNA. Twenty Lyme borreliosis patients' serum samples were detected by LF-RPA assay, real-time qPCR and nested-PCR. Results showed the LF-RPA assay is more effective than nested-PCR for its shorter reaction time and considerably higher detection rate. This method is of great value in clinical rapid detection for Lyme borreliosis. Using the RPA assay might be a megatrend for DNA detection in clinics and endemic regions.

Electrochemical detection of Piscirickettsia salmonis genomic DNA from salmon samples using solid-phase recombinase polymerase amplification.

PubMed

Del Río, Jonathan Sabaté; Svobodova, Marketa; Bustos, Paulina; Conejeros, Pablo; O'Sullivan, Ciara K

2016-12-01

Electrochemical detection of solid-phase isothermal recombinase polymerase amplification (RPA) of Piscirickettsia salmonis in salmon genomic DNA is reported. The electrochemical biosensor was constructed by surface functionalization of gold electrodes with a thiolated forward primer specific to the genomic region of interest. Solid-phase RPA and primer elongation were achieved in the presence of the specific target sequence and biotinylated reverse primers. The formation of the subsequent surface-tethered duplex amplicons was electrochemically monitored via addition of streptavidin-linked HRP upon completion of solid-phase RPA. Successful quantitative amplification and detection were achieved in less than 1 h at 37 °C, calibrating with PCR-amplified genomic DNA standards and achieving a limit of detection of 5 · 10 -8  μg ml -1 (3 · 10 3 copies in 10 μl). The presented system was applied to the analysis of eight real salmon samples, and the method was also compared to qPCR analysis, observing an excellent degree of correlation. Graphical abstract Schematic of use of electrochemical RPA for detection of Psiricketessia salmonis in salmon liver.

Novel approach to quantitative polymerase chain reaction using real-time detection: application to the detection of gene amplification in breast cancer.

PubMed

Bièche, I; Olivi, M; Champème, M H; Vidaud, D; Lidereau, R; Vidaud, M

1998-11-23

Gene amplification is a common event in the progression of human cancers, and amplified oncogenes have been shown to have diagnostic, prognostic and therapeutic relevance. A kinetic quantitative polymerase-chain-reaction (PCR) method, based on fluorescent TaqMan methodology and a new instrument (ABI Prism 7700 Sequence Detection System) capable of measuring fluorescence in real-time, was used to quantify gene amplification in tumor DNA. Reactions are characterized by the point during cycling when PCR amplification is still in the exponential phase, rather than the amount of PCR product accumulated after a fixed number of cycles. None of the reaction components is limited during the exponential phase, meaning that values are highly reproducible in reactions starting with the same copy number. This greatly improves the precision of DNA quantification. Moreover, real-time PCR does not require post-PCR sample handling, thereby preventing potential PCR-product carry-over contamination; it possesses a wide dynamic range of quantification and results in much faster and higher sample throughput. The real-time PCR method, was used to develop and validate a simple and rapid assay for the detection and quantification of the 3 most frequently amplified genes (myc, ccndl and erbB2) in breast tumors. Extra copies of myc, ccndl and erbB2 were observed in 10, 23 and 15%, respectively, of 108 breast-tumor DNA; the largest observed numbers of gene copies were 4.6, 18.6 and 15.1, respectively. These results correlated well with those of Southern blotting. The use of this new semi-automated technique will make molecular analysis of human cancers simpler and more reliable, and should find broad applications in clinical and research settings.

Removal of inhibitor(s) of the polymerase chain reaction from formalin fixed, paraffin wax embedded tissues.

PubMed

An, S F; Fleming, K A

1991-11-01

A problem associated with use of the polymerase chain reaction to amplify specific DNA fragments from formalin fixed, paraffin wax embedded tissues is the not infrequent failure of amplification. One possible reason for this could be the presence of inhibitor(s), which interfere with the activity of the reaction. It has been shown that such inhibitor(s) exist when amplifying the human beta globin gene (which exists in human genomic DNA as a single copy gene) from routine clinical samples. A variety of methods to remove such inhibitor(s) were investigated. The results indicate that inhibitor(s) are removed by proteinase K digestion, followed by purification with phenol/chloroform, and centrifugation through a Centricon-30 membrane (30,000 molecular weight cut off). Other factors, including the length and concentration of the DNA sequence to be amplified, can also affect amplification.

Label-free and sensitive detection of T4 polynucleotide kinase activity via coupling DNA strand displacement reaction with enzymatic-aided amplification.

PubMed

Cheng, Rui; Tao, Mangjuan; Shi, Zhilu; Zhang, Xiafei; Jin, Yan; Li, Baoxin

2015-11-15

Several fluorescence signal amplification strategies have been developed for sensitive detection of T4 polynucleotide kinase (T4 PNK) activity, but they need fluorescence dye labeled DNA probe. We have addressed the limitation and report here a label-free strategy for sensitive detection of PNK activity by coupling DNA strand displacement reaction with enzymatic-aided amplification. A hairpin oligonucleotide (hpDNA) with blunt ends was used as the substrate for T4 PNK phosphorylation. In the presence of T4 PNK, the stem of hpDNA was phosphorylated and further degraded by lambda exonuclease (λ exo) from 5' to 3' direction to release a single-stranded DNA as a trigger of DNA strand displacement reaction (SDR). The trigger DNA can continuously displace DNA P2 from P1/P2 hybrid with the help of specific cleavage of nicking endonuclease (Nt.BbvCI). Then, DNA P2 can form G-quadruplex in the presence of potassium ions and quadruplex-selective fluorphore, N-methyl mesoporphyrin IX (NMM), resulting in a significant increase in fluorescence intensity of NMM. Thus, the accumulative release of DNA P2 led to fluorescence signal amplification for determining T4 PNK activity with a detection limit of 6.6×10(-4) U/mL, which is superior or comparative with established approaches. By ingeniously utilizing T4 PNK-triggered DNA SDR, T4 PNK activity can be specifically and facilely studied in homogeneous solution containing complex matrix without any external fluorescence labeling. Moreover, the influence of different inhibitors on the T4 PNK activity revealed that it also can be explored to screen T4 PNK inhibitors. Therefore, this label-free amplification strategy presents a facile and cost-effective approach for nucleic acid phosphorylation related research. Copyright © 2015 Elsevier B.V. All rights reserved.

Visualization of DNA in highly processed botanical materials.

PubMed

Lu, Zhengfei; Rubinsky, Maria; Babajanian, Silva; Zhang, Yanjun; Chang, Peter; Swanson, Gary

2018-04-15

DNA-based methods have been gaining recognition as a tool for botanical authentication in herbal medicine; however, their application in processed botanical materials is challenging due to the low quality and quantity of DNA left after extensive manufacturing processes. The low amount of DNA recovered from processed materials, especially extracts, is "invisible" by current technology, which has casted doubt on the presence of amplifiable botanical DNA. A method using adapter-ligation and PCR amplification was successfully applied to visualize the "invisible" DNA in botanical extracts. The size of the "invisible" DNA fragments in botanical extracts was around 20-220 bp compared to fragments of around 600 bp for the more easily visualized DNA in botanical powders. This technique is the first to allow characterization and visualization of small fragments of DNA in processed botanical materials and will provide key information to guide the development of appropriate DNA-based botanical authentication methods in the future. Copyright © 2017 Elsevier Ltd. All rights reserved.

Yoctomole electrochemical genosensing of Ebola virus cDNA by rolling circle and circle to circle amplification.

PubMed

Carinelli, S; Kühnemund, M; Nilsson, M; Pividori, M I

2017-07-15

This work addresses the design of an Ebola diagnostic test involving a simple, rapid, specific and highly sensitive procedure based on isothermal amplification on magnetic particles with electrochemical readout. Ebola padlock probes were designed to detect a specific L-gene sequence present in the five most common Ebola species. Ebola cDNA was amplified by rolling circle amplification (RCA) on magnetic particles. Further re-amplification was performed by circle-to-circle amplification (C2CA) and the products were detected in a double-tagging approach using a biotinylated capture probe for immobilization on magnetic particles and a readout probe for electrochemical detection by square-wave voltammetry on commercial screen-printed electrodes. The electrochemical genosensor was able to detect as low as 200 ymol, corresponding to 120 cDNA molecules of L-gene Ebola virus with a limit of detection of 33 cDNA molecules. The isothermal double-amplification procedure by C2CA combined with the electrochemical readout and the magnetic actuation enables the high sensitivity, resulting in a rapid, inexpensive, robust and user-friendly sensing strategy that offers a promising approach for the primary care in low resource settings, especially in less developed countries. Copyright © 2016 Elsevier B.V. All rights reserved.

Buccal DNA collection: comparison of buccal swabs with FTA cards.

PubMed

Milne, Elizabeth; van Bockxmeer, Frank M; Robertson, Laila; Brisbane, Joanna M; Ashton, Lesley J; Scott, Rodney J; Armstrong, Bruce K

2006-04-01

Collection and analysis of DNA, most commonly from blood or buccal cells, is becoming more common in epidemiologic studies. Buccal samples, which are painless to take and relatively easily collected, are often the preferred source. There are several buccal cell collection methods: swabs, brushes, mouthwash, and treated cards, such as FTA or IsoCode cards. Few studies have systematically compared methods of buccal cell collection with respect to DNA yield and amplification success under similar conditions. We compared buccal DNA collection and amplification using buccal swabs and FTA cards in 122 control subjects from our Australian case-control study of childhood acute lymphoblastic leukaemia. Buccal DNA was quantified using a real-time PCR for beta-actin and genotyped at the loci of three polymorphisms (MTHFR 677C>T, ACE I/D, and XPD 1012G>A). PCR was successful with DNA from buccal swabs for 62% to 89% of subjects and from FTA cards for 83% to 100% of subjects, depending on the locus. The matched pair odds ratios (95% confidence interval) comparing success of FTA cards with buccal swabs are as follows: MTHFR 677C>T using PCR-RFLP, 12.5 (11.6-13.5) and using real-time PCR, 130.0 (113.1-152.8); ACE I/D using PCR-amplified fragment length polymorphism, 3.36 (3.2-3.5); XPD 1012G>A using real-time PCR, 150.0 (132.7-172.3). FTA cards are a robust DNA collection method and generally produce DNA suitable for PCR more reliably than buccal swabs. There are, however, technical challenges in handling discs punched from FTA cards that intending users should be aware of.

Back to basics: an evaluation of NaOH and alternative rapid DNA extraction protocols for DNA barcoding, genotyping, and disease diagnostics from fungal and oomycete samples.

PubMed

Osmundson, Todd W; Eyre, Catherine A; Hayden, Katherine M; Dhillon, Jaskirn; Garbelotto, Matteo M

2013-01-01

The ubiquity, high diversity and often-cryptic manifestations of fungi and oomycetes frequently necessitate molecular tools for detecting and identifying them in the environment. In applications including DNA barcoding, pathogen detection from plant samples, and genotyping for population genetics and epidemiology, rapid and dependable DNA extraction methods scalable from one to hundreds of samples are desirable. We evaluated several rapid extraction methods (NaOH, Rapid one-step extraction (ROSE), Chelex 100, proteinase K) for their ability to obtain DNA of quantity and quality suitable for the following applications: PCR amplification of the multicopy barcoding locus ITS1/5.8S/ITS2 from various fungal cultures and sporocarps; single-copy microsatellite amplification from cultures of the phytopathogenic oomycete Phytophthora ramorum; probe-based P. ramorum detection from leaves. Several methods were effective for most of the applications, with NaOH extraction favored in terms of success rate, cost, speed and simplicity. Frozen dilutions of ROSE and NaOH extracts maintained PCR viability for over 32 months. DNA from rapid extractions performed poorly compared to CTAB/phenol-chloroform extracts for TaqMan diagnostics from tanoak leaves, suggesting that incomplete removal of PCR inhibitors is an issue for sensitive diagnostic procedures, especially from plants with recalcitrant leaf chemistry. NaOH extracts exhibited lower yield and size than CTAB/phenol-chloroform extracts; however, NaOH extraction facilitated obtaining clean sequence data from sporocarps contaminated by other fungi, perhaps due to dilution resulting from low DNA yield. We conclude that conventional extractions are often unnecessary for routine DNA sequencing or genotyping of fungi and oomycetes, and recommend simpler strategies where source materials and intended applications warrant such use. © 2012 Blackwell Publishing Ltd.

No recombination of mtDNA after heteroplasmy for 50 generations in the mouse maternal germline

PubMed Central

Hagström, Erik; Freyer, Christoph; Battersby, Brendan J.; Stewart, James B.; Larsson, Nils-Göran

2014-01-01

Variants of mitochondrial DNA (mtDNA) are commonly used as markers to track human evolution because of the high sequence divergence and exclusive maternal inheritance. It is assumed that the inheritance is clonal, i.e. that mtDNA is transmitted between generations without germline recombination. In contrast to this assumption, a number of studies have reported the presence of recombinant mtDNA molecules in cell lines and animal tissues, including humans. If germline recombination of mtDNA is frequent, it would strongly impact phylogenetic and population studies by altering estimates of coalescent time and branch lengths in phylogenetic trees. Unfortunately, this whole area is controversial and the experimental approaches have been widely criticized as they often depend on polymerase chain reaction (PCR) amplification of mtDNA and/or involve studies of transformed cell lines. In this study, we used an in vivo mouse model that has had germline heteroplasmy for a defined set of mtDNA mutations for more than 50 generations. To assess recombination, we adapted and validated a method based on cloning of single mtDNA molecules in the λ phage, without prior PCR amplification, followed by subsequent mutation analysis. We screened 2922 mtDNA molecules and found no germline recombination after transmission of mtDNA under genetically and evolutionary relevant conditions in mammals. PMID:24163253

Whole genome amplification and real-time PCR in forensic casework

PubMed Central

Giardina, Emiliano; Pietrangeli, Ilenia; Martone, Claudia; Zampatti, Stefania; Marsala, Patrizio; Gabriele, Luciano; Ricci, Omero; Solla, Gianluca; Asili, Paola; Arcudi, Giovanni; Spinella, Aldo; Novelli, Giuseppe

2009-01-01

Background WGA (Whole Genome Amplification) in forensic genetics can eliminate the technical limitations arising from low amounts of genomic DNA (gDNA). However, it has not been used to date because any amplification bias generated may complicate the interpretation of results. Our aim in this paper was to assess the applicability of MDA to forensic SNP genotyping by performing a comparative analysis of genomic and amplified DNA samples. A 26-SNPs TaqMan panel specifically designed for low copy number (LCN) and/or severely degraded genomic DNA was typed on 100 genomic as well as amplified DNA samples. Results Aliquots containing 1, 0.1 and 0.01 ng each of 100 DNA samples were typed for a 26-SNPs panel. Similar aliquots of the same DNA samples underwent multiple displacement amplification (MDA) before being typed for the same panel. Genomic DNA samples showed 0% PCR failure rate for all three dilutions, whilst the PCR failure rate of the amplified DNA samples was 0% for the 1 ng and 0.1 ng dilutions and 0.077% for the 0.01 ng dilution. The genotyping results of both the amplified and genomic DNA samples were also compared with reference genotypes of the same samples obtained by direct sequencing. The genomic DNA samples showed genotype concordance rates of 100% for all three dilutions while the concordance rates of the amplified DNA samples were 100% for the 1 ng and 0.1 ng dilutions and 99.923% for the 0.01 ng dilution. Moreover, ten artificially-degraded DNA samples, which gave no results when analyzed by current forensic methods, were also amplified by MDA and genotyped with 100% concordance. Conclusion We investigated the suitability of MDA material for forensic SNP typing. Comparative analysis of amplified and genomic DNA samples showed that a large number of SNPs could be accurately typed starting from just 0.01 ng of template. We found that the MDA genotyping call and accuracy rates were only slightly lower than those for genomic DNA. Indeed, when 10 pg of input DNA was used in MDA, we obtained 99.923% concordance, indicating a genotyping error rate of 1/1299 (7.7 × 10-4). This is quite similar to the genotyping error rate of STRs used in current forensic analysis. Such efficiency and accuracy of SNP typing of amplified DNA suggest that MDA can also generate large amounts of genome-equivalent DNA from a minimal amount of input DNA. These results show for the first time that MDA material is suitable for SNP-based forensic protocols and in general when samples fail to give interpretable STR results. PMID:19366436

[Identification of Clonorchis sinensis metacercariae based on PCR targeting ribosomal DNA ITS regions and COX1 gene].

PubMed

Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong

2014-06-01

To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.

A novel electrochemiluminescence strategy for ultrasensitive DNA assay using luminol functionalized gold nanoparticles multi-labeling and amplification of gold nanoparticles and biotin-streptavidin system.

PubMed

Chai, Ying; Tian, Dayong; Wang, Wei; Cui, Hua

2010-10-28

Luminol functionalized gold nanoparticles were used as labels for electrochemiluminescence signal amplification and an ultrasensitive, highly selective, convenient, low cost DNA detection strategy was developed.

Amplification of Mitochondrial DNA for detection of Plasmodiumvivax in Balochistan.

PubMed

Shahwani, Muhammad Naeem; Nisar, Samia; Aleem, Abdul; Panezai, Marina; Afridi, Sarwat; Malik, Shaukat Iqbal

2017-05-01

To access a new step using PCR to amplify the targeted mtDNA sequence for detecting specifically Plasmodium vivax and its co-infections, false positive and false negative results with Plasmodium falciparum. In this study we have standardized a new technical approach in which the target mitochondrial DNA sequence (mtDNA) was amplified by using a PCR technique as a tool to detect Plasmodium spp. Species specific primers were designed to hybridize with cytochrome c oxidase gene of P. vivax (cox I) and P. falciparum (cox III). Two hundred blood samples were collected on the basis of clinical symptoms which were initially examined through microscopic analysis after preparing Giemsa stained thick and thin blood smears. Afterwards genomic DNA was extracted from all samples and was then subjected to PCR amplification by using species specific primers and amplified segments were sequenced for confirmation of results. One-hundred and thirty-two blood samples were detected as positive for malaria by PCR, out of which 64 were found to be positive by PCR and 53 by both microscopy and PCR for P.vivax infection. Nine samples were found to be false negative, one P.vivax mono infection was declared as co infection by PCR and 3 samples identified as having P.falciparum gametes were confirmed as P.vivax by PCR amplification. Sensitivity and specificity were found to be 85% and 92% respectively. Results obtained through PCR method were comparatively better and reliable than microscopy.

Simple System for Isothermal DNA Amplification Coupled to Lateral Flow Detection

PubMed Central

Roskos, Kristina; Hickerson, Anna I.; Lu, Hsiang-Wei; Ferguson, Tanya M.; Shinde, Deepali N.; Klaue, Yvonne; Niemz, Angelika

2013-01-01

Infectious disease diagnosis in point-of-care settings can be greatly improved through integrated, automated nucleic acid testing devices. We have developed an early prototype for a low-cost system which executes isothermal DNA amplification coupled to nucleic acid lateral flow (NALF) detection in a mesofluidic cartridge attached to a portable instrument. Fluid handling inside the cartridge is facilitated through one-way passive valves, flexible pouches, and electrolysis-driven pumps, which promotes a compact and inexpensive instrument design. The closed-system disposable prevents workspace amplicon contamination. The cartridge design is based on standard scalable manufacturing techniques such as injection molding. Nucleic acid amplification occurs in a two-layer pouch that enables efficient heat transfer. We have demonstrated as proof of principle the amplification and detection of Mycobacterium tuberculosis (M.tb) genomic DNA in the cartridge, using either Loop Mediated Amplification (LAMP) or the Exponential Amplification Reaction (EXPAR), both coupled to NALF detection. We envision that a refined version of this cartridge, including upstream sample preparation coupled to amplification and detection, will enable fully-automated sample-in to answer-out infectious disease diagnosis in primary care settings of low-resource countries with high disease burden. PMID:23922706

Origins of DNA Replication and Amplification in the Breast Cancer Genome

DTIC Science & Technology

2012-09-01

W81XWH-10-1-0463 TITLE: Origins of DNA Replication and Amplification in the...2. REPORT TYPE Final 3. DATES COVERED 1 Sep 2010 – 31 Aug 2012 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Origins of DNA Replication and...described in the DOD funded parent grant, to test our hypothesis we need to map origins of DNA replication in the genome and ask which of these

Protein Detection via Direct Enzymatic Amplification of Short DNA Aptamers

PubMed Central

Fischer, Nicholas O.; Tarasow, Theodore M.; Tok, Jeffrey B.-H.

2008-01-01

Aptamers are single-stranded nucleic acids that fold into defined tertiary structures to bind target molecules with high specificities and affinities. DNA aptamers have garnered much interest as recognition elements for biodetection and diagnostic applications due to their small size, ease of discovery and synthesis, and chemical and thermal stability. Herein, we describe the design and application of a short DNA molecule capable of both protein target binding and amplifiable bioreadout processes. As both recognition and readout capabilities are incorporated into a single DNA molecule, tedious conjugation procedures required for protein-DNA hybrids can be omitted. The DNA aptamer is designed to be amplified directly by either the polymerase chain reaction (PCR) or rolling circle amplification (RCA) processes, taking advantage of real-time amplification monitoring techniques for target detection. A combination of both RCA and PCR provides a wide protein target dynamic range (1 μM to 10 pM). PMID:17980857

Product differentiation by analysis of DNA melting curves during the polymerase chain reaction.

PubMed

Ririe, K M; Rasmussen, R P; Wittwer, C T

1997-02-15

A microvolume fluorometer integrated with a thermal cycler was used to acquire DNA melting curves during polymerase chain reaction by fluorescence monitoring of the double-stranded DNA specific dye SYBR Green I. Plotting fluorescence as a function of temperature as the thermal cycler heats through the dissociation temperature of the product gives a DNA melting curve. The shape and position of this DNA melting curve are functions of the GC/AT ratio, length, and sequence and can be used to differentiate amplification products separated by less than 2 degrees C in melting temperature. Desired products can be distinguished from undesirable products, in many cases eliminating the need for gel electrophoresis. Analysis of melting curves can extend the dynamic range of initial template quantification when amplification is monitored with double-stranded DNA specific dyes. Complete amplification and analysis of products can be performed in less than 15 min.

Double-probe signal enhancing strategy for toxin aptasensing based on rolling circle amplification.

PubMed

Tong, Ping; Zhao, Wei-Wei; Zhang, Lan; Xu, Jing-Juan; Chen, Hong-Yuan

2012-03-15

On the basis of aptamer-based rolling circle amplification (RCA) and magnetic beads (MBs), a highly sensitive electrochemical method was developed for the determination of Ochratoxin A (OTA). Initially, an amino-modified capture DNA was immobilized onto MBs for the following hybridization with an OTA aptamer and a phosphate labeled padlock DNA. In the presence of OTA, the aptamer would dissociate from the bioconjugate, and the padlock DNA would subsequently hybridize with the capture DNA to form a circular template with the aid of the T4 ligase. Next, capture DNA would act as primer to initiate a linear RCA reaction and hence generate a long tandem repeated sequences by phi29 DNA polymerase and dNTPs. Then, two quantum dots (QDs) labeled DNA probes were tagged on the resulted RCA product to indicate the OTA recognition event by electrochemical readout. This strategy, based on the novel design of OTA-mediated DNA circularization, the combination of RCA and double signal probes introduction, could detect OTA down to the level of 0.2 pg mL(-1) with a dynamic range spanning more than 4 orders of magnitude. The proposed approach is tested to determine OTA in red wines and shows good application potential in real samples. Copyright © 2011 Elsevier B.V. All rights reserved.

Deep Diversity: Novel Approach to Overcoming the PCR Bias Encountered During Environmental Analysis of Microbial Populations for Alpha-Diversity

NASA Technical Reports Server (NTRS)

Ramirez, Gustavo A; Vaishampayan, Parag A.

2011-01-01

Alpha-diversity studies are of crucial importance to environmental microbiologists. The polymerase chain reaction (PCR) method has been paramount for studies interrogating microbial environmental samples for taxon richness. Phylogenetic studies using this technique are based on the amplification and comparison of the 16S rRNA coding regions. PCR, due disproportionate distribution of microbial species in the environment, increasingly favors the amplification of the most predominant phylotypes with every subsequent reaction cycle. The genetic and chemical complexity of environmental samples are intrinsic factors that exacerbate an inherit bias in PCR-based quantitative and qualitative studies of microbial communities. We report that treatment of a genetically complex total genomic environmental DNA extract with Propidium Monoazide (PMA), a DNA intercalating molecule capable of forming a covalent cross-linkage to organic moieties upon light exposure, disproportionally inactivates predominant phylotypes and results in the exponential amplification of previously shadowed microbial ?-diversity quantified as a 19.5% increase in OUTs reported via phylogenetic screening using PhyloChip.

Post-Fragmentation Whole Genome Amplification-Based Method

NASA Technical Reports Server (NTRS)

Benardini, James; LaDuc, Myron T.; Langmore, John

2011-01-01

This innovation is derived from a proprietary amplification scheme that is based upon random fragmentation of the genome into a series of short, overlapping templates. The resulting shorter DNA strands (<400 bp) constitute a library of DNA fragments with defined 3 and 5 termini. Specific primers to these termini are then used to isothermally amplify this library into potentially unlimited quantities that can be used immediately for multiple downstream applications including gel eletrophoresis, quantitative polymerase chain reaction (QPCR), comparative genomic hybridization microarray, SNP analysis, and sequencing. The standard reaction can be performed with minimal hands-on time, and can produce amplified DNA in as little as three hours. Post-fragmentation whole genome amplification-based technology provides a robust and accurate method of amplifying femtogram levels of starting material into microgram yields with no detectable allele bias. The amplified DNA also facilitates the preservation of samples (spacecraft samples) by amplifying scarce amounts of template DNA into microgram concentrations in just a few hours. Based on further optimization of this technology, this could be a feasible technology to use in sample preservation for potential future sample return missions. The research and technology development described here can be pivotal in dealing with backward/forward biological contamination from planetary missions. Such efforts rely heavily on an increasing understanding of the burden and diversity of microorganisms present on spacecraft surfaces throughout assembly and testing. The development and implementation of these technologies could significantly improve the comprehensiveness and resolving power of spacecraft-associated microbial population censuses, and are important to the continued evolution and advancement of planetary protection capabilities. Current molecular procedures for assaying spacecraft-associated microbial burden and diversity have inherent sample loss issues at practically every step, particularly nucleic acid extraction. In engineering a molecular means of amplifying nucleic acids directly from single cells in their native state within the sample matrix, this innovation has circumvented entirely the need for DNA extraction regimes in the sample processing scheme.

Bacteriophage Amplification-Coupled Detection and Identification of Bacterial Pathogens

NASA Astrophysics Data System (ADS)

Cox, Christopher R.; Voorhees, Kent J.

Current methods of species-specific bacterial detection and identification are complex, time-consuming, and often require expensive specialized equipment and highly trained personnel. Numerous biochemical and genotypic identification methods have been applied to bacterial characterization, but all rely on tedious microbiological culturing practices and/or costly sequencing protocols which render them impractical for deployment as rapid, cost-effective point-of-care or field detection and identification methods. With a view towards addressing these shortcomings, we have exploited the evolutionarily conserved interactions between a bacteriophage (phage) and its bacterial host to develop species-specific detection methods. Phage amplification-coupled matrix assisted laser desorption time-of-flight mass spectrometry (MALDI-TOF-MS) was utilized to rapidly detect phage propagation resulting from species-specific in vitro bacterial infection. This novel signal amplification method allowed for bacterial detection and identification in as little as 2 h, and when combined with disulfide bond reduction methods developed in our laboratory to enhance MALDI-TOF-MS resolution, was observed to lower the limit of detection by several orders of magnitude over conventional spectroscopy and phage typing methods. Phage amplification has been combined with lateral flow immunochromatography (LFI) to develop rapid, easy-to-operate, portable, species-specific point-of-care (POC) detection devices. Prototype LFI detectors have been developed and characterized for Yersinia pestis and Bacillus anthracis, the etiologic agents of plague and anthrax, respectively. Comparable sensitivity and rapidity was observed when phage amplification was adapted to a species-specific handheld LFI detector, thus allowing for rapid, simple, POC bacterial detection and identification while eliminating the need for bacterial culturing or DNA isolation and amplification techniques.

High-sensitivity stable-isotope probing by a quantitative terminal restriction fragment length polymorphism protocol.

PubMed

Andeer, Peter; Strand, Stuart E; Stahl, David A

2012-01-01

Stable-isotope probing (SIP) has proved a valuable cultivation-independent tool for linking specific microbial populations to selected functions in various natural and engineered systems. However, application of SIP to microbial populations with relatively minor buoyant density increases, such as populations that utilize compounds as a nitrogen source, results in reduced resolution of labeled populations. We therefore developed a tandem quantitative PCR (qPCR)-TRFLP (terminal restriction fragment length polymorphism) protocol that improves resolution of detection by quantifying specific taxonomic groups in gradient fractions. This method combines well-controlled amplification with TRFLP analysis to quantify relative taxon abundance in amplicon pools of FAM-labeled PCR products, using the intercalating dye EvaGreen to monitor amplification. Method accuracy was evaluated using mixtures of cloned 16S rRNA genes, DNA extracted from low- and high-G+C bacterial isolates (Escherichia coli, Rhodococcus, Variovorax, and Microbacterium), and DNA from soil microcosms amended with known amounts of genomic DNA from bacterial isolates. Improved resolution of minor shifts in buoyant density relative to TRFLP analysis alone was confirmed using well-controlled SIP analyses.

Efficient preparation of shuffled DNA libraries through recombination (Gateway) cloning.

PubMed

Lehtonen, Soili I; Taskinen, Barbara; Ojala, Elina; Kukkurainen, Sampo; Rahikainen, Rolle; Riihimäki, Tiina A; Laitinen, Olli H; Kulomaa, Markku S; Hytönen, Vesa P

2015-01-01

Efficient and robust subcloning is essential for the construction of high-diversity DNA libraries in the field of directed evolution. We have developed a more efficient method for the subcloning of DNA-shuffled libraries by employing recombination cloning (Gateway). The Gateway cloning procedure was performed directly after the gene reassembly reaction, without additional purification and amplification steps, thus simplifying the conventional DNA shuffling protocols. Recombination-based cloning, directly from the heterologous reassembly reaction, conserved the high quality of the library and reduced the time required for the library construction. The described method is generally compatible for the construction of DNA-shuffled gene libraries. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Highly sensitive chemiluminescent point mutation detection by circular strand-displacement amplification reaction.

PubMed

Shi, Chao; Ge, Yujie; Gu, Hongxi; Ma, Cuiping

2011-08-15

Single nucleotide polymorphism (SNP) genotyping is attracting extensive attentions owing to its direct connections with human diseases including cancers. Here, we have developed a highly sensitive chemiluminescence biosensor based on circular strand-displacement amplification and the separation by magnetic beads reducing the background signal for point mutation detection at room temperature. This method took advantage of both the T4 DNA ligase recognizing single-base mismatch with high selectivity and the strand-displacement reaction of polymerase to perform signal amplification. The detection limit of this method was 1.3 × 10(-16)M, which showed better sensitivity than that of most of those reported detection methods of SNP. Additionally, the magnetic beads as carrier of immobility was not only to reduce the background signal, but also may have potential apply in high through-put screening of SNP detection in human genome. Copyright © 2011 Elsevier B.V. All rights reserved.

Autoclave sterilization of instruments used on women with cervical neoplasia is an effective method of eradicating residual human papillomavirus DNA: a polymerase chain reaction-based evaluation.

PubMed

Estes, Jacob M; Kirby, Tyler O; Huh, Warner K

2007-01-01

To determine whether autoclave sterilization eradicates human papillomavirus (HPV) DNA on specula and instruments used to treat women with cervical neoplasia. Specula and instruments used in two referral colposcopy clinics were evaluated to determine the PGMY9/11 primer system's ability to amplify residual HPV DNA. Each speculum and instrument was sampled with a Dacron swab and stored in PreservCyt solution (Cytyc Corporation, Marlborough, MA) at 4 degrees C. DNA amplification was performed under standard conditions with appropriate controls followed by HPV typing using the reverse line blot test (Roche Molecular Systems, Alameda, CA). Once validated, the same polymerase chain reaction method was used on autoclave-sterilized specula and biopsy instruments and heated glass bead- and Cidex bath (Johnson & Johnson, New Brunswick, NJ)-sterilized instruments. All results, with appropriate positive and negative controls, were confirmed in triplicate. A total of 140 instruments (70 used and 70 autoclaved) were sampled for residual HPV DNA. Five samples in the contaminated specula arm were excluded from analysis secondary to insufficient sampling. Of the remaining samples, 52.3% (34/65) of contaminated instruments-both specula and biopsy instruments-had detectable HPV DNA. Fifty-five percent of contaminated biopsy instruments (11/20) were positive and 51.1% of contaminated specula (23/45) were positive. All 70 autoclaved samples (50 specula and 20 biopsy instruments) were negative for residual HPV DNA or beta-globin. One instrument in the glass bead and Cidex group that was presumed sterile was positive for HPV 16 DNA. The PGMY9/11 primer system is an effective method to detect residual HPV DNA. Autoclave sterilization appears to eradicate HPV DNA to levels undetectable with this sensitive assay, whereas heated glass beads followed by Cidex bath appears to be inadequate methods. These results suggest that autoclave sterilization is effective when using nondisposable instruments and should be the method of choice in studies using polymerase chain reaction-based amplification of HPV DNA.

Highly sensitive detection of human IgG using a novel bio-barcode assay combined with DNA chip technology

NASA Astrophysics Data System (ADS)

Liu, Zhenbao; Zhou, Bo; Wang, Haiqing; Lu, Feng; Liu, Tianjun; Song, Cunxian; Leng, Xigang

2013-09-01

A simple and ultrasensitive detection of human IgG based on signal amplification using a novel bio-barcode assay and DNA chip technology was developed. The sensing platform was a sandwich system made up of antibody-modified magnetic microparticles (Ab-MMPs)/human IgG/Cy3-labeled single-stranded DNA and antibody-modified gold nanoparticles (Cy3-ssDNA-Ab-AuNPs). The MMPs (2.5 μm in diameter) modified with mouse anti-human IgG monoclonal-antibodies could capture human IgG and further be separated and enriched via a magnetic field. The AuNPs (13 nm in diameter) conjugated with goat anti-human IgG polyclonal-antibodies and Cy3-ssDNA could further combine with the human IgG/Ab-MMP complex. The Cy3-ssDNA on AuNPs was then released by TCEP to hybridize with the DNA chip, thus generating a detectable signal by the fluorescence intensity of Cy3. In order to improve detection sensitivity, a three-level cascaded signal amplification was developed: (1) The MMP enrichment as the first-level; (2) Large quantities of Cy3-ssDNA on AuNPs as the second-level; (3) The Cy3-ssDNA conjugate with DNA chip as the third-level. The highly sensitive technique showed an increased response of the fluorescence intensity to the increased concentration of human IgG through a detection range from 1 pg mL-1 to 10 ng mL-1. This sensing technique could not only improve the detection sensitivity for the low concentration of human IgG but also present a robust and efficient signal amplification model. The detection method has good stability, specificity, and reproducibility and could be applied in the detection of human IgG in the real samples.

Twin target self-amplification-based DNA machine for highly sensitive detection of cancer-related gene.

PubMed

Xu, Huo; Jiang, Yifan; Liu, Dengyou; Liu, Kai; Zhang, Yafeng; Yu, Suhong; Shen, Zhifa; Wu, Zai-Sheng

2018-06-29

The sensitive detection of cancer-related genes is of great significance for early diagnosis and treatment of human cancers, and previous isothermal amplification sensing systems were often based on the reuse of target DNA, the amplification of enzymatic products and the accumulation of reporting probes. However, no reporting probes are able to be transformed into target species and in turn initiate the signal of other probes. Herein we reported a simple, isothermal and highly sensitive homogeneous assay system for tumor suppressor p53 gene detection based on a new autonomous DNA machine, where the signaling probe, molecular beacon (MB), was able to execute the function similar to target DNA besides providing the common signal. In the presence of target p53 gene, the operation of DNA machine can be initiated, and cyclical nucleic acid strand-displacement polymerization (CNDP) and nicking/polymerization cyclical amplification (NPCA) occur, during which the MB was opened by target species and cleaved by restriction endonuclease. In turn, the cleaved fragments could activate the next signaling process as target DNA did. According to the functional similarity, the cleaved fragment was called twin target, and the corresponding fashion to amplify the signal was named twin target self-amplification. Utilizing this newly-proposed DNA machine, the target DNA could be detected down to 0.1 pM with a wide dynamic range (6 orders of magnitude) and single-base mismatched targets were discriminated, indicating a very high assay sensitivity and good specificity. In addition, the DNA machine was not only used to screen the p53 gene in complex biological matrix but also was capable of practically detecting genomic DNA p53 extracted from A549 cell line. This indicates that the proposed DNA machine holds the potential application in biomedical research and early clinical diagnosis. Copyright © 2018 Elsevier B.V. All rights reserved.

Development of a real-world direct interface for integrated DNA extraction and amplification in a microfluidic device.

PubMed

Shaw, Kirsty J; Joyce, Domino A; Docker, Peter T; Dyer, Charlotte E; Greenway, Gillian M; Greenman, John; Haswell, Stephen J

2011-02-07

Integrated DNA extraction and amplification have been carried out in a microfluidic device using electro-osmotic pumping (EOP) for fluidic control. All the necessary reagents for performing both DNA extraction and polymerase chain reaction (PCR) amplification were pre-loaded into the microfluidic device following encapsulation in agarose gel. Buccal cells were collected using OmniSwabs [Whatman™, UK] and manually added to a chaotropic binding/lysis solution pre-loaded into the microfluidic device. The released DNA was then adsorbed onto a silica monolith contained within the DNA extraction chamber and the microfluidic device sealed using polymer electrodes. The washing and elution steps for DNA extraction were carried out using EOP, resulting in transfer of the eluted DNA into the PCR chamber. Thermal cycling, achieved using a Peltier element, resulted in amplification of the Amelogenin locus as confirmed using conventional capillary gel electrophoresis. It was demonstrated that the PCR reagents could be stored in the microfluidic device for at least 8 weeks at 4 °C with no significant loss of activity. Such methodology lends itself to the production of 'ready-to-use' microfluidic devices containing all the necessary reagents for sample processing, with many obvious applications in forensics and clinical medicine.

SPERM RNA AMPLIFICATION FOR GENE EXPRESSION PROFILING BY DNA MICROARRAY TECHNOLOGY

EPA Science Inventory

Sperm RNA Amplification for Gene Expression Profiling by DNA Microarray Technology
Hongzu Ren, Kary E. Thompson, Judith E. Schmid and David J. Dix, Reproductive Toxicology Division, NHEERL, Office of Research and Development, US Environmental Protection Agency, Research Triang...

Rapid Detection and Identification of a Pathogen's DNA Using Phi29 DNA Polymerase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, Y.; Dunn, J.; Gao, S.

2008-10-31

Zoonotic pathogens including those transmitted by insect vectors are some of the most deadly of all infectious diseases known to mankind. A number of these agents have been further weaponized and are widely recognized as being potentially significant biothreat agents. We describe a novel method based on multiply-primed rolling circle in vitro amplification for profiling genomic DNAs to permit rapid, cultivation-free differential detection and identification of circular plasmids in infectious agents. Using Phi29 DNA polymerase and a two-step priming reaction we could reproducibly detect and characterize by DNA sequencing circular DNA from Borrelia burgdorferi B31 in DNA samples containing asmore » little as 25 pg of Borrelia DNA amongst a vast excess of human DNA. This simple technology can ultimately be adapted as a sensitive method to detect specific DNA from both known and unknown pathogens in a wide variety of complex environments.« less

Typeability of DNA in Touch Traces Deposited on Paper and Optical Data Discs.

PubMed

Sołtyszewski, Ireneusz; Szeremeta, Michał; Skawrońska, Małgorzata; Niemcunowicz-Janica, Anna; Pepiński, Witold

2015-01-01

Nucleated epithelial cells that are transferred by casual touching and handling of objects are the primary source of biological evidence that is found in high-volume crimes. Cellular material associated with touch traces usually contains low levels of DNA template making it challenging to acquire an informative profile. The main purpose of this study was to examine the efficacy of DNA typing in fingerprints deposited on optical data discs and the office paper. Latent fingerprints were made by 60 subjects of both sexes (30 males and 30 females). A highly effective DNA extraction method with QIAamp DNA Mini Kit (Qiagen) and an increased sensitivity PCR by AmpFlSTR® NGM™ Amplification Kit (Applied Biosystems) carried out at standard 30 cycles and at increased 34 cycles were used. The mean value of total DNA recovery was 0.4 ng from CDs/DVDs and 0.3 ng from the office paper. Amplification of Low Template DNA (LT-DNA) resulted in improved analytical success by increasing the number of PCR cycles from standard 30 to 34. On the other hand, the increased PCR cycles resulted in allele drop-ins showing additional peaks, the majority of which were outside the stutter positions. Rigorous procedures and interpretation guidelines are required during LT-DNA for producing reliable and reproducible DNA profiles for forensic purposes.

Development and testing of an optimized method for DNA-based identification of jaguar (Panthera onca) and puma (Puma concolor) faecal samples for use in ecological and genetic studies.

PubMed

Haag, Taiana; Santos, Anelisie S; De Angelo, Carlos; Srbek-Araujo, Ana Carolina; Sana, Dênis A; Morato, Ronaldo G; Salzano, Francisco M; Eizirik, Eduardo

2009-07-01

The elusive nature and endangered status of most carnivore species imply that efficient approaches for their non-invasive sampling are required to allow for genetic and ecological studies. Faecal samples are a major potential source of information, and reliable approaches are needed to foster their application in this field, particularly in areas where few studies have been conducted. A major obstacle to the reliable use of faecal samples is their uncertain species-level identification in the field, an issue that can be addressed with DNA-based assays. In this study we describe a sequence-based approach that efficiently distinguishes jaguar versus puma scats, and that presents several desirable properties: (1) considerably high amplification and sequencing rates; (2) multiple diagnostic sites reliably differentiating the two focal species; (3) high information content that allows for future application in other carnivores; (4) no evidence of amplification of prey DNA; and (5) no evidence of amplification of a nuclear mitochondrial DNA insertion known to occur in the jaguar. We demonstrate the reliability and usefulness of this approach by evaluating 55 field-collected samples from four locations in the highly fragmented Atlantic Forest biome of Brazil and Argentina, and document the presence of one or both of these endangered felids in each of these areas.

Sensitive and inexpensive molecular test for falciparum malaria: detecting Plasmodium falciparum DNA directly from heat-treated blood by loop-mediated isothermal amplification.

PubMed

Poon, Leo L M; Wong, Bonnie W Y; Ma, Edmund H T; Chan, Kwok H; Chow, Larry M C; Abeyewickreme, Wimal; Tangpukdee, Noppadon; Yuen, Kwok Y; Guan, Yi; Looareesuwan, Sornchai; Peiris, J S Malik

2006-02-01

Malaria is one of the most important parasitic infections in humans. A sensitive diagnostic test for malaria that could be applied at the community level could be useful in programs to control the disease. The aim of the present work was to develop a simple, inexpensive molecular test for Plasmodium falciparum. Blood was collected from controls (n = 100) and from patients diagnosed with falciparum malaria infection (n = 102), who were recruited to the study. Heat-treated blood samples were tested by a loop-mediated isothermal amplification (LAMP) assay for P. falciparum. Results were interpreted by a turbidity meter in real time or visually at the end of the assay. To evaluate the assay, DNA from these samples was purified and tested by PCR. Results from the LAMP and PCR assays were compared. The LAMP assay detected P. falciparum directly from heat-treated blood. The quantitative data from the assay correlated to the parasite counts obtained by blood-film microscopic analyses. When we used the PCR assay as the comparison method, the sensitivity and specificity of the LAMP assay were 95% and 99%, respectively. Unlike PCR, the LAMP assay does not require purified DNA for efficient DNA amplification, thereby reducing the cost and turnaround time for P. falciparum diagnosis. The assay requires only basic instruments, and assay positivity can be verified by visual inspection.

Subtraction of cap-trapped full-length cDNA libraries to select rare transcripts.

PubMed

Hirozane-Kishikawa, Tomoko; Shiraki, Toshiyuki; Waki, Kazunori; Nakamura, Mari; Arakawa, Takahiro; Kawai, Jun; Fagiolini, Michela; Hensch, Takao K; Hayashizaki, Yoshihide; Carninci, Piero

2003-09-01

The normalization and subtraction of highly expressed cDNAs from relatively large tissues before cloning dramatically enhanced the gene discovery by sequencing for the mouse full-length cDNA encyclopedia, but these methods have not been suitable for limited RNA materials. To normalize and subtract full-length cDNA libraries derived from limited quantities of total RNA, here we report a method to subtract plasmid libraries excised from size-unbiased amplified lambda phage cDNA libraries that avoids heavily biasing steps such as PCR and plasmid library amplification. The proportion of full-length cDNAs and the gene discovery rate are high, and library diversity can be validated by in silico randomization.

Rolling Circle Amplification of Complete Nematode Mitochondrial Genomes

PubMed Central

Tang, Sha; Hyman, Bradley C.

2005-01-01

To enable investigation of nematode mitochondrial DNA evolution, methodology has been developed to amplify intact nematode mitochondrial genomes in preparative yields using a rolling circle replication strategy. Successful reactions were generated from whole cell template DNA prepared by alkaline lysis of the rhabditid nematode Caenorhabditis elegans and a mermithid nematode, Thaumamermis cosgrovei. These taxa, representing the two major nematode classes Chromodorea and Enoplea, maintain mitochondrial genomes of 13.8 kb and 20.0 kb, respectively. Efficient amplifications were conducted on template DNA isolated from individual or pooled nematodes that were alive or stored at -80°C. Unexpectedly, these experiments revealed that multiple T. cosgrovei mitochondrial DNA haplotypes are maintained in our local population. Rolling circle amplification products can be used as templates for standard PCR reactions with specific primers that target mitochondrial genes or for direct DNA sequencing. PMID:19262866

Nanoparticles Affect PCR Primarily via Surface Interactions with PCR Components: Using Amino-Modified Silica-Coated Magnetic Nanoparticles as a Main Model.

PubMed

Bai, Yalong; Cui, Yan; Paoli, George C; Shi, Chunlei; Wang, Dapeng; Shi, Xianming

2015-06-24

Nanomaterials have been widely reported to affect the polymerase chain reaction (PCR). However, many studies in which these effects were observed were not comprehensive, and many of the proposed mechanisms have been primarily speculative. In this work, we used amino-modified silica-coated magnetic nanoparticles (ASMNPs, which can be collected very easily using an external magnetic field) as a model and compared them with gold nanoparticles (AuNPs, which have been studied extensively) to reveal the mechanisms by which nanoparticles affect PCR. We found that nanoparticles affect PCR primarily by binding to PCR components: (1) inhibition, (2) specifity, and (3) efficiency and yield of PCR are impacted. (1) Excess nanomaterials inhibit PCR by adsorbing to DNA polymerase, Mg(2+), oligonucleotide primers, or DNA templates. Nanoparticle surface-active groups are particularly important to this effect. (2, a) Nanomaterials do not inhibit nonspecific amplification products caused by false priming as previously surmised. It was shown that relatively low concentrations of nanoparticles inhibited the amplification of long amplicons, and increasing the amount of nanoparticles inhibited the amplification of short amplicons. This concentration phenomenon appears to be the result of the formation of "joints" upon the adsorption of ASMNPs to DNA templates. (b) Nanomaterials are able to inhibit nonspecific amplification products due to incomplete amplification by preferably adsorbing single-stranded incomplete amplification products. (3) Some types of nanomaterials, such as AuNPs, enhance the efficiency and yield of PCR because these types of nanoparticles can adsorb to single-stranded DNA more strongly than to double-stranded DNA. This behavior assists in the rapid and thorough denaturation of double-stranded DNA templates. Therefore, the interaction between the surface of nanoparticles and PCR components is sufficient to explain most of the effects of nanoparticles on PCR.

Comparison of methods of DNA extraction for real-time PCR in a model of pleural tuberculosis.

PubMed

Santos, Ana; Cremades, Rosa; Rodríguez, Juan Carlos; García-Pachón, Eduardo; Ruiz, Montserrat; Royo, Gloria

2010-01-01

Molecular methods have been reported to have different sensitivities in the diagnosis of pleural tuberculosis and this may in part be caused by the use of different methods of DNA extraction. Our study compares nine DNA extraction systems in an experimental model of pleural tuberculosis. An inoculum of Mycobacterium tuberculosis was added to 23 pleural liquid samples with different characteristics. DNA was subsequently extracted using nine different methods (seven manual and two automatic) for analysis with real-time PCR. Only two methods were able to detect the presence of M. tuberculosis DNA in all the samples: extraction using columns (Qiagen) and automated extraction with the TNAI system (Roche). The automatic method is more expensive, but requires less time. Almost all the false negatives were because of the difficulty involved in extracting M. tuberculosis DNA, as in general, all the methods studied are capable of eliminating inhibitory substances that block the amplification reaction. The method of M. tuberculosis DNA extraction used affects the results of the diagnosis of pleural tuberculosis by molecular methods. DNA extraction systems that have been shown to be effective in pleural liquid should be used.

Comparison of Methods for the Extraction of DNA from Formalin-Fixed, Paraffin-Embedded Archival Tissues

PubMed Central

Sengüven, Burcu; Baris, Emre; Oygur, Tulin; Berktas, Mehmet

2014-01-01

Aim: Discussing a protocol involving xylene-ethanol deparaffinization on slides followed by a kit-based extraction that allows for the extraction of high quality DNA from FFPE tissues. Methods: DNA was extracted from the FFPE tissues of 16 randomly selected blocks. Methods involving deparaffinization on slides or tubes, enzyme digestion overnight or for 72 hours and isolation using phenol chloroform method or a silica-based commercial kit were compared in terms of yields, concentrations and the amplifiability. Results: The highest yield of DNA was produced from the samples that were deparaffinized on slides, digested for 72 hours and isolated with a commercial kit. Samples isolated with the phenol-chloroform method produced DNA of lower purity than the samples that were purified with kit. The samples isolated with the commercial kit resulted in better PCR amplification. Conclusion: Silica-based commercial kits and deparaffinized on slides should be considered for DNA extraction from FFPE. PMID:24688314

One-step selection of Vaccinia virus-binding DNA aptamers by MonoLEX

PubMed Central

Nitsche, Andreas; Kurth, Andreas; Dunkhorst, Anna; Pänke, Oliver; Sielaff, Hendrik; Junge, Wolfgang; Muth, Doreen; Scheller, Frieder; Stöcklein, Walter; Dahmen, Claudia; Pauli, Georg; Kage, Andreas

2007-01-01

Background As a new class of therapeutic and diagnostic reagents, more than fifteen years ago RNA and DNA aptamers were identified as binding molecules to numerous small compounds, proteins and rarely even to complete pathogen particles. Most aptamers were isolated from complex libraries of synthetic nucleic acids by a process termed SELEX based on several selection and amplification steps. Here we report the application of a new one-step selection method (MonoLEX) to acquire high-affinity DNA aptamers binding Vaccinia virus used as a model organism for complex target structures. Results The selection against complete Vaccinia virus particles resulted in a 64-base DNA aptamer specifically binding to orthopoxviruses as validated by dot blot analysis, Surface Plasmon Resonance, Fluorescence Correlation Spectroscopy and real-time PCR, following an aptamer blotting assay. The same oligonucleotide showed the ability to inhibit in vitro infection of Vaccinia virus and other orthopoxviruses in a concentration-dependent manner. Conclusion The MonoLEX method is a straightforward procedure as demonstrated here for the identification of a high-affinity DNA aptamer binding Vaccinia virus. MonoLEX comprises a single affinity chromatography step, followed by subsequent physical segmentation of the affinity resin and a single final PCR amplification step of bound aptamers. Therefore, this procedure improves the selection of high affinity aptamers by reducing the competition between aptamers of different affinities during the PCR step, indicating an advantage for the single-round MonoLEX method. PMID:17697378

Low Cost Extraction and Isothermal Amplification of DNA for Infectious Diarrhea Diagnosis

PubMed Central

Huang, Shichu; Do, Jaephil; Mahalanabis, Madhumita; Fan, Andy; Zhao, Lei; Jepeal, Lisa; Singh, Satish K.; Klapperich, Catherine M.

2013-01-01

In order to counter the common perception that molecular diagnostics are too complicated to work in low resource settings, we have performed a difficult sample preparation and DNA amplification protocol using instrumentation designed to be operated without wall or battery power. In this work we have combined a nearly electricity-free nucleic acid extraction process with an electricity-free isothermal amplification assay to detect the presence of Clostridium difficile (C. difficile) DNA in the stool of infected patients. We used helicase-dependent isothermal amplification (HDA) to amplify the DNA in a low-cost, thermoplastic reaction chip heated with a pair of commercially available toe warmers, while using a simple Styrofoam insulator. DNA was extracted from known positive and negative stool samples. The DNA extraction protocol utilized an air pressure driven solid phase extraction device run using a standard bicycle pump. The simple heater setup required no electricity or battery and was capable of maintaining the temperature at 65°C±2°C for 55 min, suitable for repeatable HDA amplification. Experiments were performed to explore the adaptability of the system for use in a range of ambient conditions. When compared to a traditional centrifuge extraction protocol and a laboratory thermocycler, this disposable, no power platform achieved approximately the same lower limit of detection (1.25×10−2 pg of C. difficile DNA) while requiring much less raw material and a fraction of the lab infrastructure and cost. This proof of concept study could greatly impact the accessibility of molecular assays for applications in global health. PMID:23555883

Sensitive Visual Detection of AHPND Bacteria Using Loop-Mediated Isothermal Amplification Combined with DNA-Functionalized Gold Nanoparticles as Probes

PubMed Central

Arunrut, Narong; Kampeera, Jantana; Sirithammajak, Sarawut; Sanguanrut, Piyachat; Proespraiwong, Porranee; Suebsing, Rungkarn; Kiatpathomchai, Wansika

2016-01-01

Acute hepatopancreatic necrosis disease (AHPND) is a component cause of early mortality syndrome (EMS) of shrimp. In 2013, the causative agent was found to be unique isolates of Vibrio parahaemolyticus (VPAHPND) that contained a 69 kbp plasmid (pAP1) carrying binary Pir-like toxin genes PirvpA and PirvpB. In Thailand, AHPND was first recognized in 2012, prior to knowledge of the causative agent, and it subsequently led to a precipitous drop in shrimp production. After VPAHPND was characterized, a major focus of the AHPND control strategy was to monitor broodstock shrimp and post larvae for freedom from VPAHPND by nucleic acid amplification methods, most of which required use of expensive and sophisticated equipment not readily available in a shrimp farm setting. Here, we describe a simpler but equally sensitive approach for detection of VPAHPND based on loop-mediated isothermal amplification (LAMP) combined with unaided visual reading of positive amplification products using a DNA-functionalized, ssDNA-labled nanogold probe (AuNP). The target for the special set of six LAMP primers used was the VPAHPND PirvpA gene. The LAMP reaction was carried out at 65°C for 45 min followed by addition of the red AuNP solution and further incubation at 65°C for 5 min, allowing any PirvpA gene amplicons present to hybridize with the probe. Hybridization protected the AuNP against aggregation, so that the solution color remained red upon subsequent salt addition (positive test result) while unprotected AuNP aggregated and underwent a color change from red to blue and eventually precipitated (negative result). The total assay time was approximately 50 min. The detection limit (100 CFU) was comparable to that of other commonly-used methods for nested PCR detection of VPAHPND and 100-times more sensitive than 1-step PCR detection methods (104 CFU) that used amplicon detection by electrophoresis or spectrophotometry. There was no cross reaction with DNA templates derived from non-AHPND bacteria commonly found in shrimp ponds (including other Vibrio species). The new method significantly reduced the time, difficulty and cost for molecular detection of VPAHPND in shrimp hatchery and farm settings. PMID:27003504

Simulated rRNA/DNA Ratios Show Potential To Misclassify Active Populations as Dormant

DOE Office of Scientific and Technical Information (OSTI.GOV)

Steven, Blaire; Hesse, Cedar; Soghigian, John

The use of rRNA/DNA ratios derived from surveys of rRNA sequences in RNA and DNA extracts is an appealing but poorly validated approach to infer the activity status of environmental microbes. To improve the interpretation of rRNA/DNA ratios, we performed simulations to investigate the effects of community structure, rRNA amplification, and sampling depth on the accuracy of rRNA/DNA ratios in classifying bacterial populations as “active” or “dormant.” Community structure was an insignificant factor. In contrast, the extent of rRNA amplification that occurs as cells transition from dormant to growing had a significant effect (P < 0.0001) on classification accuracy, withmore » misclassification errors ranging from 16 to 28%, depending on the rRNA amplification model. The error rate increased to 47% when communities included a mixture of rRNA amplification models, but most of the inflated error was false negatives (i.e., active populations misclassified as dormant). Sampling depth also affected error rates (P < 0.001). Inadequate sampling depth produced various artifacts that are characteristic of rRNA/DNA ratios generated from real communities. These data show important constraints on the use of rRNA/DNA ratios to infer activity status. Whereas classification of populations as active based on rRNA/DNA ratios appears generally valid, classification of populations as dormant is potentially far less accurate.« less

Simulated rRNA/DNA Ratios Show Potential To Misclassify Active Populations as Dormant

DOE PAGES

Steven, Blaire; Hesse, Cedar; Soghigian, John; ...

2017-03-31

The use of rRNA/DNA ratios derived from surveys of rRNA sequences in RNA and DNA extracts is an appealing but poorly validated approach to infer the activity status of environmental microbes. To improve the interpretation of rRNA/DNA ratios, we performed simulations to investigate the effects of community structure, rRNA amplification, and sampling depth on the accuracy of rRNA/DNA ratios in classifying bacterial populations as “active” or “dormant.” Community structure was an insignificant factor. In contrast, the extent of rRNA amplification that occurs as cells transition from dormant to growing had a significant effect (P < 0.0001) on classification accuracy, withmore » misclassification errors ranging from 16 to 28%, depending on the rRNA amplification model. The error rate increased to 47% when communities included a mixture of rRNA amplification models, but most of the inflated error was false negatives (i.e., active populations misclassified as dormant). Sampling depth also affected error rates (P < 0.001). Inadequate sampling depth produced various artifacts that are characteristic of rRNA/DNA ratios generated from real communities. These data show important constraints on the use of rRNA/DNA ratios to infer activity status. Whereas classification of populations as active based on rRNA/DNA ratios appears generally valid, classification of populations as dormant is potentially far less accurate.« less

Enzymatic repair of selected cross-linked homoduplex molecules enhances nuclear gene rescue from Pompeii and Herculaneum remains.

PubMed

Di Bernardo, Giovanni; Del Gaudio, Stefania; Cammarota, Marcella; Galderisi, Umberto; Cascino, Antonino; Cipollaro, Marilena

2002-02-15

Ancient DNA (aDNA) samples extracted from the bone remains of six equids buried by the Vesuvius eruption in 79 AD were investigated to test pre-amplification and enzymatic repair procedures designed to enhance the rescue of nuclear genes. The extracts, which proved all positive for Equidae mtDNA amplification, proved positive only four times out of 18 when tested for single-copy Equidae nuclear genes (epsilon globin, p53 and gamma interferon). Pre-amplification did not change the number of retrieved aDNA sequences but 10 times out of 14 enzymatic repair restored the amplifiability of the genes analysed, proving that repair increases the rate of successful rescue from 22 to alpha(lambda)mu(omicron)sigma(tau) 80%. These findings support the hypothesis that some of these cross-linked aDNA molecules, which are not completely separated when DNA is extracted under denaturing conditions, become homoduplex substrates for Pol I and/or T4 ligase action upon renaturation. aDNA authenticity is proved by the homology of the nucleotide sequences of loci tested to the corresponding modern Equidae sequences. Data also indicate that cross-linked homoduplex molecules selected by denaturation of the extract are repaired without any chimera formation. The general features of aDNA amplification with and without denaturation and enzymatic repair are discussed.

Enzymatic repair of selected cross-linked homoduplex molecules enhances nuclear gene rescue from Pompeii and Herculaneum remains

PubMed Central

Di Bernardo, Giovanni; Del Gaudio, Stefania; Cammarota, Marcella; Galderisi, Umberto; Cascino, Antonino; Cipollaro, Marilena

2002-01-01

Ancient DNA (aDNA) samples extracted from the bone remains of six equids buried by the Vesuvius eruption in 79 AD were investigated to test pre-amplification and enzymatic repair procedures designed to enhance the rescue of nuclear genes. The extracts, which proved all positive for Equidae mtDNA amplification, proved positive only four times out of 18 when tested for single-copy Equidae nuclear genes (ɛ globin, p53 and γ interferon). Pre-amplification did not change the number of retrieved aDNA sequences but 10 times out of 14 enzymatic repair restored the amplifiability of the genes analysed, proving that repair increases the rate of successful rescue from 22 to αλµοστ 80%. These findings support the hypothesis that some of these cross-linked aDNA molecules, which are not completely separated when DNA is extracted under denaturing conditions, become homoduplex substrates for Pol I and/or T4 ligase action upon renaturation. aDNA authenticity is proved by the homology of the nucleotide sequences of loci tested to the corresponding modern Equidae sequences. Data also indicate that cross-linked homoduplex molecules selected by denaturation of the extract are repaired without any chimera formation. The general features of aDNA amplification with and without denaturation and enzymatic repair are discussed. PMID:11842122

Rapid and Specific Detection of Salmonella spp. in Animal Feed Samples by PCR after Culture Enrichment

PubMed Central

Löfström, Charlotta; Knutsson, Rickard; Axelsson, Charlotta Engdahl; Rådström, Peter

2004-01-01

A PCR procedure has been developed for routine analysis of viable Salmonella spp. in feed samples. The objective was to develop a simple PCR-compatible enrichment procedure to enable DNA amplification without any sample pretreatment such as DNA extraction or cell lysis. PCR inhibition by 14 different feed samples and natural background flora was circumvented by the use of the DNA polymerase Tth. This DNA polymerase was found to exhibit a high level of resistance to PCR inhibitors present in these feed samples compared to DyNAzyme II, FastStart Taq, Platinum Taq, Pwo, rTth, Taq, and Tfl. The specificity of the Tth assay was confirmed by testing 101 Salmonella and 43 non-Salmonella strains isolated from feed and food samples. A sample preparation method based on culture enrichment in buffered peptone water and DNA amplification with Tth DNA polymerase was developed. The probability of detecting small numbers of salmonellae in feed, in the presence of natural background flora, was accurately determined and found to follow a logistic regression model. From this model, the probability of detecting 1 CFU per 25 g of feed in artificially contaminated soy samples was calculated and found to be 0.81. The PCR protocol was evaluated on 155 naturally contaminated feed samples and compared to an established culture-based method, NMKL-71. Eight percent of the samples were positive by PCR, compared with 3% with the conventional method. The reasons for the differences in sensitivity are discussed. Use of this method in the routine analysis of animal feed samples would improve safety in the food chain. PMID:14711627

Detection of human papillomavirus DNA in urine. A review of the literature.

PubMed

Vorsters, A; Micalessi, I; Bilcke, J; Ieven, M; Bogers, J; Van Damme, P

2012-05-01

The detection of human papillomavirus (HPV) DNA in urine, a specimen easily obtained by a non-invasive self-sampling method, has been the subject of a considerable number of studies. This review provides an overview of 41 published studies; assesses how different methods and settings may contribute to the sometimes contradictory outcomes; and discusses the potential relevance of using urine samples in vaccine trials, disease surveillance, epidemiological studies, and specific settings of cervical cancer screening. Urine sampling, storage conditions, sample preparation, DNA extraction, and DNA amplification may all have an important impact on HPV DNA detection and the form of viral DNA that is detected. Possible trends in HPV DNA prevalence in urine could be inferred from the presence of risk factors or the diagnosis of cervical lesions. HPV DNA detection in urine is feasible and may become a useful tool but necessitates further improvement and standardization.

Extraction of genomic DNA from yeasts for PCR-based applications.

PubMed

Lõoke, Marko; Kristjuhan, Kersti; Kristjuhan, Arnold

2011-05-01

We have developed a quick and low-cost genomic DNA extraction protocol from yeast cells for PCR-based applications. This method does not require any enzymes, hazardous chemicals, or extreme temperatures, and is especially powerful for simultaneous analysis of a large number of samples. DNA can be efficiently extracted from different yeast species (Kluyveromyces lactis, Hansenula polymorpha, Schizosaccharomyces pombe, Candida albicans, Pichia pastoris, and Saccharomyces cerevisiae). The protocol involves lysis of yeast colonies or cells from liquid culture in a lithium acetate (LiOAc)-SDS solution and subsequent precipitation of DNA with ethanol. Approximately 100 nanograms of total genomic DNA can be extracted from 1 × 10(7) cells. DNA extracted by this method is suitable for a variety of PCR-based applications (including colony PCR, real-time qPCR, and DNA sequencing) for amplification of DNA fragments of ≤ 3500 bp.

Isolation from genomic DNA of sequences binding specific regulatory proteins by the acceleration of protein electrophoretic mobility upon DNA binding.

PubMed

Subrahmanyam, S; Cronan, J E

1999-01-21

We report an efficient and flexible in vitro method for the isolation of genomic DNA sequences that are the binding targets of a given DNA binding protein. This method takes advantage of the fact that binding of a protein to a DNA molecule generally increases the rate of migration of the protein in nondenaturing gel electrophoresis. By the use of a radioactively labeled DNA-binding protein and nonradioactive DNA coupled with PCR amplification from gel slices, we show that specific binding sites can be isolated from Escherichia coli genomic DNA. We have applied this method to isolate a binding site for FadR, a global regulator of fatty acid metabolism in E. coli. We have also isolated a second binding site for BirA, the biotin operon repressor/biotin ligase, from the E. coli genome that has a very low binding efficiency compared with the bio operator region.

Establishment and Application of a Loop-Mediated Isothermal Amplification Method for Simple, Specific, Sensitive and Rapid Detection of Toxoplasma gondii

PubMed Central

CAO, Lili; CHENG, Ronghua; YAO, Lin; YUAN, Shuxian; YAO, Xinhua

2013-01-01

ABSTRACT The Loop-mediated isothermal amplification (LAMP) method amplifies DNA with high simply, specificity, sensitivity and rapidity. In this study, A LAMP assay with 6 primers targeting a highly conserved region of the GRA1 gene was developed to diagnose Toxoplasma gondii. The reaction time of the LAMP assay was shortened to 30 min after optimizing the reaction system. The LAMP assay was found to be highly specific and stable. The detection limit of the LAMP assay was 10 copies, the same as that of the conventional PCR. We used the LAMP assay to develop a real-time fluorogenic protocol to quantitate T. gondii DNA and generated a log-linear regression plot by plotting the time-to-threshold values against genomic equivalent copies. Furthermore, the LAMP assay was applied to detect T. gondii DNA in 423 blood samples and 380 lymph node samples from 10 pig farms, and positive results were obtained for 7.8% and 8.2% of samples, respectively. The results showed that the LAMP method is slightly more sensitive than conventional PCR (6.1% and 7.6%). Positive samples obtained from 6 pig farms. The LAMP assay established in this study resulted in simple, specific, sensitive and rapid detection of T. gondii DNA and is expected to play an important role in clinical detection of T. gondii. PMID:23965849

Real-time fluorescence loop-mediated isothermal amplification assay for direct detection of egg drop syndrome virus.

PubMed

Zheney, Makay; Kaziyev, Zhambul; Kassenova, Gulmira; Zhao, Lingna; Liu, Wei; Liang, Lin; Li, Gang

2018-02-13

Egg drop syndrome (EDS), caused by the adenovirus "egg drop syndrome virus" (EDSV) causes severe economic losses through reduced egg production in breeder and layer flocks. The diagnosis of EDSV has been done by molecular tools since its complete genome sequence was identified. In order to enhance the capabilities of the real-time fluorescence loop-mediated isothermal amplification (RealAmp) assay, we aimed to apply the method for direct detection of the EDSV without viral DNA extraction. In order to detect the presence of the EDSV DNA, three pairs of primers were designed, from the conserved region of fiber gene of the EDSV. For our assay, test and control samples were directly used in the reaction mixture in 10-fold serial dilution. The target DNA was amplified at 65 °C, which yield positive results in a relatively short period of 40-45 min. The method reported in this study is highly sensitive as compared to polymerase chain reaction (PCR) and showed no sign of cross-reactivity or false positive results. The RealAmp accomplished specific identification of EDSV among a variety of poultry disease viruses. The direct RealAmp can be used to detect the presence of EDSV. As our result showed, the RealAmp method could be suitable for the direct detection of other DNA viruses.

Periodic Assembly of Nanospecies on Repetitive DNA Sequences Generated on Gold Nanoparticles by Rolling Circle Amplification

NASA Astrophysics Data System (ADS)

Zhao, Weian; Brook, Michael A.; Li, Yingfu

Periodical assembly of nanospecies is desirable for the construction of nanodevices. We provide a protocol for the preparation of a gold nanoparticle (AuNP)/DNA scaffold on which nanospecies can be assembled in a periodical manner. AuNP/DNA scaffold is prepared by growing long single-stranded DNA (ssDNA) molecules (typically hundreds of nanometers to a few microns in length) on AuNPs via rolling circle amplification (RCA). Since these long ssDNA molecules contain many repetitive sequence units, complementary DNA-attached nanospecies can be assembled through specific hybridization in a controllable and periodical manner.

Theoretical underpinning of the single-molecule-dilution (SMD) method of direct haplotype resolution.

PubMed Central

Stephens, J C; Rogers, J; Ruano, G

1990-01-01

In a recent paper we have shown that DNA haplotypes of multiply heterozygous individuals can be resolved directly by polymerase-chain-reaction (PCR) amplification of a single molecule of genomic template. Our method (the single-molecule-dilution [SMD] method) relies on the stochastic separation of maternal and paternal alleles at high dilution. The stochasticity of separation and the potential for DNA shearing (which could separate the loci of interest) are two factors that can compromise the results of the experiment. This paper explores the consequences of these two factors and shows that the SMD method can be expected to work very reliably even in the presence of a moderate amount of DNA shearing. PMID:2339707

Development of a Tandem Repeat-Based Polymerase Chain Displacement Reaction Method for Highly Sensitive Detection of 'Candidatus Liberibacter asiaticus'.

PubMed

Lou, Binghai; Song, Yaqin; RoyChowdhury, Moytri; Deng, Chongling; Niu, Ying; Fan, Qijun; Tang, Yan; Zhou, Changyong

2018-02-01

Huanglongbing (HLB) is one of the most destructive diseases in citrus production worldwide. Early detection of HLB pathogens can facilitate timely removal of infected citrus trees in the field. However, low titer and uneven distribution of HLB pathogens in host plants make reliable detection challenging. Therefore, the development of effective detection methods with high sensitivity is imperative. This study reports the development of a novel method, tandem repeat-based polymerase chain displacement reaction (TR-PCDR), for the detection of 'Candidatus Liberibacter asiaticus', a widely distributed HLB-associated bacterium. A uniquely designed primer set (TR2-PCDR-F/TR2-PCDR-1R) and a thermostable Taq DNA polymerase mutant with strand displacement activity were used for TR-PCDR amplification. Performed in a regular thermal cycler, TR-PCDR could produce more than two amplicons after each amplification cycle. Sensitivity of the developed TR-PCDR was 10 copies of target DNA fragment. The sensitive level was proven to be 100× higher than conventional PCR and similar to real-time PCR. Data from the detection of 'Ca. L. asiaticus' with filed samples using the above three methods also showed similar results. No false-positive TR-PCDR amplification was observed from healthy citrus samples and water controls. These results thereby illustrated that the developed TR-PCDR method can be applied to the reliable, highly sensitive, and cost-effective detection of 'Ca. L. asiaticus'.