DNA barcoding reveals a cryptic nemertean invasion in Atlantic and Mediterranean waters
NASA Astrophysics Data System (ADS)
Fernández-Álvarez, Fernando Ángel; Machordom, Annie
2013-09-01
For several groups, like nemerteans, morphology-based identification is a hard discipline, but DNA barcoding may help non-experts in the identification process. In this study, DNA barcoding is used to reveal the cryptic invasion of Pacific Cephalothrix cf. simula into Atlantic and Mediterranean coasts. Although DNA barcoding is a promising method for the identification of Nemertea, only 6 % of the known number of nemertean species is currently associated with a correct DNA barcode. Therefore, additional morphological and molecular studies are necessary to advance the utility of DNA barcoding in the characterisation of possible nemertean alien invasions.
Wilson, John-James; Sing, Kong-Wah; Sofian-Azirun, Mohd
2013-01-01
The objective of this study was to build a DNA barcode reference library for the true butterflies of Peninsula Malaysia and assess the value of attaching subspecies names to DNA barcode records. A new DNA barcode library was constructed with butterflies from the Museum of Zoology, University of Malaya collection. The library was analysed in conjunction with publicly available DNA barcodes from other Asia-Pacific localities to test the ability of the DNA barcodes to discriminate species and subspecies. Analyses confirmed the capacity of the new DNA barcode reference library to distinguish the vast majority of species (92%) and revealed that most subspecies possessed unique DNA barcodes (84%). In some cases conspecific subspecies exhibited genetic distances between their DNA barcodes that are typically seen between species, and these were often taxa that have previously been regarded as full species. Subspecies designations as shorthand for geographically and morphologically differentiated groups provide a useful heuristic for assessing how such groups correlate with clustering patterns of DNA barcodes, especially as the number of DNA barcodes per species in reference libraries increases. Our study demonstrates the value in attaching subspecies names to DNA barcode records as they can reveal a history of taxonomic concepts and expose important units of biodiversity.
Wilson, John-James; Sing, Kong-Wah; Sofian-Azirun, Mohd
2013-01-01
The objective of this study was to build a DNA barcode reference library for the true butterflies of Peninsula Malaysia and assess the value of attaching subspecies names to DNA barcode records. A new DNA barcode library was constructed with butterflies from the Museum of Zoology, University of Malaya collection. The library was analysed in conjunction with publicly available DNA barcodes from other Asia-Pacific localities to test the ability of the DNA barcodes to discriminate species and subspecies. Analyses confirmed the capacity of the new DNA barcode reference library to distinguish the vast majority of species (92%) and revealed that most subspecies possessed unique DNA barcodes (84%). In some cases conspecific subspecies exhibited genetic distances between their DNA barcodes that are typically seen between species, and these were often taxa that have previously been regarded as full species. Subspecies designations as shorthand for geographically and morphologically differentiated groups provide a useful heuristic for assessing how such groups correlate with clustering patterns of DNA barcodes, especially as the number of DNA barcodes per species in reference libraries increases. Our study demonstrates the value in attaching subspecies names to DNA barcode records as they can reveal a history of taxonomic concepts and expose important units of biodiversity. PMID:24282514
USDA-ARS?s Scientific Manuscript database
DNA barcoding revealed the presence of the polyphagous leafminer pest Liriomyza sativae Blanchard in Bangladesh. DNA barcode sequences for mitochondrial COI were generated for Agromyzidae larvae, pupae and adults collected from field populations across Bangladesh. BLAST sequence similarity searches ...
Revealing the Hyperdiverse Mite Fauna of Subarctic Canada through DNA Barcoding
Young, Monica R.; Behan-Pelletier, Valerie M.; Hebert, Paul D. N.
2012-01-01
Although mites are one of the most abundant and diverse groups of arthropods, they are rarely targeted for detailed biodiversity surveys due to taxonomic constraints. We address this gap through DNA barcoding, evaluating acarine diversity at Churchill, Manitoba, a site on the tundra-taiga transition. Barcode analysis of 6279 specimens revealed nearly 900 presumptive species of mites with high species turnover between substrates and between forested and non-forested sites. Accumulation curves have not reached an asymptote for any of the three mite orders investigated, and estimates suggest that more than 1200 species of Acari occur at this locality. The coupling of DNA barcode results with taxonomic assignments revealed that Trombidiformes compose 49% of the fauna, a larger fraction than expected based on prior studies. This investigation demonstrates the efficacy of DNA barcoding in facilitating biodiversity assessments of hyperdiverse taxa. PMID:23133656
DNA barcoding the floras of biodiversity hotspots.
Lahaye, Renaud; van der Bank, Michelle; Bogarin, Diego; Warner, Jorge; Pupulin, Franco; Gigot, Guillaume; Maurin, Olivier; Duthoit, Sylvie; Barraclough, Timothy G; Savolainen, Vincent
2008-02-26
DNA barcoding is a technique in which species identification is performed by using DNA sequences from a small fragment of the genome, with the aim of contributing to a wide range of ecological and conservation studies in which traditional taxonomic identification is not practical. DNA barcoding is well established in animals, but there is not yet any universally accepted barcode for plants. Here, we undertook intensive field collections in two biodiversity hotspots (Mesoamerica and southern Africa). Using >1,600 samples, we compared eight potential barcodes. Going beyond previous plant studies, we assessed to what extent a "DNA barcoding gap" is present between intra- and interspecific variations, using multiple accessions per species. Given its adequate rate of variation, easy amplification, and alignment, we identified a portion of the plastid matK gene as a universal DNA barcode for flowering plants. Critically, we further demonstrate the applicability of DNA barcoding for biodiversity inventories. In addition, analyzing >1,000 species of Mesoamerican orchids, DNA barcoding with matK alone reveals cryptic species and proves useful in identifying species listed in Convention on International Trade of Endangered Species (CITES) appendixes.
DNA barcoding the floras of biodiversity hotspots
Lahaye, Renaud; van der Bank, Michelle; Bogarin, Diego; Warner, Jorge; Pupulin, Franco; Gigot, Guillaume; Maurin, Olivier; Duthoit, Sylvie; Barraclough, Timothy G.; Savolainen, Vincent
2008-01-01
DNA barcoding is a technique in which species identification is performed by using DNA sequences from a small fragment of the genome, with the aim of contributing to a wide range of ecological and conservation studies in which traditional taxonomic identification is not practical. DNA barcoding is well established in animals, but there is not yet any universally accepted barcode for plants. Here, we undertook intensive field collections in two biodiversity hotspots (Mesoamerica and southern Africa). Using >1,600 samples, we compared eight potential barcodes. Going beyond previous plant studies, we assessed to what extent a “DNA barcoding gap” is present between intra- and interspecific variations, using multiple accessions per species. Given its adequate rate of variation, easy amplification, and alignment, we identified a portion of the plastid matK gene as a universal DNA barcode for flowering plants. Critically, we further demonstrate the applicability of DNA barcoding for biodiversity inventories. In addition, analyzing >1,000 species of Mesoamerican orchids, DNA barcoding with matK alone reveals cryptic species and proves useful in identifying species listed in Convention on International Trade of Endangered Species (CITES) appendixes. PMID:18258745
Chambers, E Anne; Hebert, Paul D N
2016-01-01
High rates of species discovery and loss have led to the urgent need for more rapid assessment of species diversity in the herpetofauna. DNA barcoding allows for the preliminary identification of species based on sequence divergence. Prior DNA barcoding work on reptiles and amphibians has revealed higher biodiversity counts than previously estimated due to cases of cryptic and undiscovered species. Past studies have provided DNA barcodes for just 14% of the North American herpetofauna, revealing the need for expanded coverage. This study extends the DNA barcode reference library for North American herpetofauna, assesses the utility of this approach in aiding species delimitation, and examines the correspondence between current species boundaries and sequence clusters designated by the BIN system. Sequences were obtained from 730 specimens, representing 274 species (43%) from the North American herpetofauna. Mean intraspecific divergences were 1% and 3%, while average congeneric sequence divergences were 16% and 14% in amphibians and reptiles, respectively. BIN assignments corresponded with current species boundaries in 79% of amphibians, 100% of turtles, and 60% of squamates. Deep divergences (>2%) were noted in 35% of squamate and 16% of amphibian species, and low divergences (<2%) occurred in 12% of reptiles and 23% of amphibians, patterns reflected in BIN assignments. Sequence recovery declined with specimen age, and variation in recovery success was noted among collections. Within collections, barcodes effectively flagged seven mislabeled tissues, and barcode fragments were recovered from five formalin-fixed specimens. This study demonstrates that DNA barcodes can effectively flag errors in museum collections, while BIN splits and merges reveal taxa belonging to deeply diverged or hybridizing lineages. This study is the first effort to compile a reference library of DNA barcodes for herpetofauna on a continental scale.
Chambers, E. Anne; Hebert, Paul D. N.
2016-01-01
Background High rates of species discovery and loss have led to the urgent need for more rapid assessment of species diversity in the herpetofauna. DNA barcoding allows for the preliminary identification of species based on sequence divergence. Prior DNA barcoding work on reptiles and amphibians has revealed higher biodiversity counts than previously estimated due to cases of cryptic and undiscovered species. Past studies have provided DNA barcodes for just 14% of the North American herpetofauna, revealing the need for expanded coverage. Methodology/Principal Findings This study extends the DNA barcode reference library for North American herpetofauna, assesses the utility of this approach in aiding species delimitation, and examines the correspondence between current species boundaries and sequence clusters designated by the BIN system. Sequences were obtained from 730 specimens, representing 274 species (43%) from the North American herpetofauna. Mean intraspecific divergences were 1% and 3%, while average congeneric sequence divergences were 16% and 14% in amphibians and reptiles, respectively. BIN assignments corresponded with current species boundaries in 79% of amphibians, 100% of turtles, and 60% of squamates. Deep divergences (>2%) were noted in 35% of squamate and 16% of amphibian species, and low divergences (<2%) occurred in 12% of reptiles and 23% of amphibians, patterns reflected in BIN assignments. Sequence recovery declined with specimen age, and variation in recovery success was noted among collections. Within collections, barcodes effectively flagged seven mislabeled tissues, and barcode fragments were recovered from five formalin-fixed specimens. Conclusions/Significance This study demonstrates that DNA barcodes can effectively flag errors in museum collections, while BIN splits and merges reveal taxa belonging to deeply diverged or hybridizing lineages. This study is the first effort to compile a reference library of DNA barcodes for herpetofauna on a continental scale. PMID:27116180
Song, Chao; Wang, Qian; Zhang, Ruilei; Sun, Bingjiao; Wang, Xinhua
2016-02-16
In this study, we tested the utility of the mitochondrial gene cytochrome c oxidase subunit 1 (CO1) as the barcode region to deal with taxonomical problems of Polypedilum (Tripodura) non-biting midges (Diptera: Chironomidae). The 114 DNA barcodes representing 27 morphospecies are divided into 33 well separated clusters based on both Neighbor Joining and Maximum Likelihood methods. DNA barcodes revealed an 82% success rate in matching with morphospecies. The selected DNA barcode data support 37-64 operational taxonomic units (OTUs) based on the methods of Automatic Barcode Gap Discovery (ABGD) and Poisson Tree Process (PTP). Furthermore, a priori species based on consistent phenotypic variations were attested by molecular analysis, and a taxonomical misidentification of barcode sequences from GenBank was found. We could not observe a distinct barcode gap but an overlap ranged from 9-12%. Our results supported DNA barcoding as an ideal method to detect cryptic species, delimit sibling species, and associate different life stages in non-biting midges.
DNA barcodes for bio-surveillance: regulated and economically important arthropod plant pests.
Ashfaq, Muhammad; Hebert, Paul D N
2016-11-01
Many of the arthropod species that are important pests of agriculture and forestry are impossible to discriminate morphologically throughout all of their life stages. Some cannot be differentiated at any life stage. Over the past decade, DNA barcoding has gained increasing adoption as a tool to both identify known species and to reveal cryptic taxa. Although there has not been a focused effort to develop a barcode library for them, reference sequences are now available for 77% of the 409 species of arthropods documented on major pest databases. Aside from developing the reference library needed to guide specimen identifications, past barcode studies have revealed that a significant fraction of arthropod pests are a complex of allied taxa. Because of their importance as pests and disease vectors impacting global agriculture and forestry, DNA barcode results on these arthropods have significant implications for quarantine detection, regulation, and management. The current review discusses these implications in light of the presence of cryptic species in plant pests exposed by DNA barcoding.
Guo, Hui-Fang; Guan, Bei; Shi, Fu-Ming; Zhou, Zhi-Jun
2016-01-01
DNA barcoding has been proved successful to provide resolution beyond the boundaries of morphological information. Hence, a study was undertaken to establish DNA barcodes for all morphologically determined Hexacentrus species in China collections. In total, 83 specimens of five Hexacentrus species were barcoded using standard mitochondrial cytochrome c oxidase subunit I (COI) gene. Except for Hexacentrus japonicus, barcode gaps were present in the remaining Hexacentrus species. Taxon ID tree generated seven BOLD's barcode index numbers (BINs), four of which were in agreement with the morphological species. For Hexacentrus japonicus, the maximum intraspecific divergence (4.43%) produced a minimal overlap (0.64%), and 19 specimens were divided into three different BINs. There may be cryptic species within the current Hexacentrus japonicus. This study adds to a growing body of DNA barcodes that have become available for katydids, and shows that a DNA barcoding approach enables the identification of known Hexacentrus species with a very high resolution.
Guo, Hui-Fang; Guan, Bei; Shi, Fu-Ming; Zhou, Zhi-Jun
2016-01-01
Abstract DNA barcoding has been proved successful to provide resolution beyond the boundaries of morphological information. Hence, a study was undertaken to establish DNA barcodes for all morphologically determined Hexacentrus species in China collections. In total, 83 specimens of five Hexacentrus species were barcoded using standard mitochondrial cytochrome c oxidase subunit I (COI) gene. Except for Hexacentrus japonicus, barcode gaps were present in the remaining Hexacentrus species. Taxon ID tree generated seven BOLD’s barcode index numbers (BINs), four of which were in agreement with the morphological species. For Hexacentrus japonicus, the maximum intraspecific divergence (4.43%) produced a minimal overlap (0.64%), and 19 specimens were divided into three different BINs. There may be cryptic species within the current Hexacentrus japonicus. This study adds to a growing body of DNA barcodes that have become available for katydids, and shows that a DNA barcoding approach enables the identification of known Hexacentrus species with a very high resolution. PMID:27408576
Paz, Andrea; Crawford, Andrew J
2012-11-01
Molecular markers offer a universal source of data for quantifying biodiversity. DNA barcoding uses a standardized genetic marker and a curated reference database to identify known species and to reveal cryptic diversity within wellsampled clades. Rapid biological inventories, e.g. rapid assessment programs (RAPs), unlike most barcoding campaigns, are focused on particular geographic localities rather than on clades. Because of the potentially sparse phylogenetic sampling, the addition of DNA barcoding to RAPs may present a greater challenge for the identification of named species or for revealing cryptic diversity. In this article we evaluate the use of DNA barcoding for quantifying lineage diversity within a single sampling site as compared to clade-based sampling, and present examples from amphibians. We compared algorithms for identifying DNA barcode clusters (e.g. species, cryptic species or Evolutionary Significant Units) using previously published DNA barcode data obtained from geography-based sampling at a site in Central Panama, and from clade-based sampling in Madagascar. We found that clustering algorithms based on genetic distance performed similarly on sympatric as well as clade-based barcode data, while a promising coalescent-based method performed poorly on sympatric data. The various clustering algorithms were also compared in terms of speed and software implementation. Although each method has its shortcomings in certain contexts, we recommend the use of the ABGD method, which not only performs fairly well under either sampling method, but does so in a few seconds and with a user-friendly Web interface.
Vargas, Sergio; Kelly, Michelle; Schnabel, Kareen; Mills, Sadie; Bowden, David; Wörheide, Gert
2015-01-01
The approximately 350 demosponge species that have been described from Antarctica represent a faunistic component distinct from that of neighboring regions. Sponges provide structure to the Antarctic benthos and refuge to other invertebrates, and can be dominant in some communities. Despite the importance of sponges in the Antarctic subtidal environment, sponge DNA barcodes are scarce but can provide insight into the evolutionary relationships of this unique biogeographic province. We sequenced the standard barcoding COI region for a comprehensive selection of sponges collected during expeditions to the Ross Sea region in 2004 and 2008, and produced DNA-barcodes for 53 demosponge species covering about 60% of the species collected. The Antarctic sponge communities are phylogenetically diverse, matching the diversity of well-sampled sponge communities in the Lusitanic and Mediterranean marine provinces in the Temperate Northern Atlantic for which molecular data are readily available. Additionally, DNA-barcoding revealed levels of in situ molecular evolution comparable to those present among Caribbean sponges. DNA-barcoding using the Segregating Sites Algorithm correctly assigned approximately 54% of the barcoded species to the morphologically determined species. A barcode library for Antarctic sponges was assembled and used to advance the systematic and evolutionary research of Antarctic sponges. We provide insights on the evolutionary forces shaping Antarctica's diverse sponge communities, and a barcode library against which future sequence data from other regions or depth strata of Antarctica can be compared. The opportunity for rapid taxonomic identification of sponge collections for ecological research is now at the horizon.
Kim, W J; Ji, Y; Choi, G; Kang, Y M; Yang, S; Moon, B C
2016-08-05
This study was performed to identify and analyze the phylogenetic relationship among four herbaceous species of the genus Paeonia, P. lactiflora, P. japonica, P. veitchii, and P. suffruticosa, using DNA barcodes. These four species, which are commonly used in traditional medicine as Paeoniae Radix and Moutan Radicis Cortex, are pharmaceutically defined in different ways in the national pharmacopoeias in Korea, Japan, and China. To authenticate the different species used in these medicines, we evaluated rDNA-internal transcribed spacers (ITS), matK and rbcL regions, which provide information capable of effectively distinguishing each species from one another. Seventeen samples were collected from different geographic regions in Korea and China, and DNA barcode regions were amplified using universal primers. Comparative analyses of these DNA barcode sequences revealed species-specific nucleotide sequences capable of discriminating the four Paeonia species. Among the entire sequences of three barcodes, marker nucleotides were identified at three positions in P. lactiflora, eleven in P. japonica, five in P. veitchii, and 25 in P. suffruticosa. Phylogenetic analyses also revealed four distinct clusters showing homogeneous clades with high resolution at the species level. The results demonstrate that the analysis of these three DNA barcode sequences is a reliable method for identifying the four Paeonia species and can be used to authenticate Paeoniae Radix and Moutan Radicis Cortex at the species level. Furthermore, based on the assessment of amplicon sizes, inter/intra-specific distances, marker nucleotides, and phylogenetic analysis, rDNA-ITS was the most suitable DNA barcode for identification of these species.
Increasing global participation in genetics research through DNA barcoding.
Adamowicz, Sarah J; Steinke, Dirk
2015-12-01
DNA barcoding--the sequencing of short, standardized DNA regions for specimen identification and species discovery--has promised to facilitate rapid access to biodiversity knowledge by diverse users. Here, we advance our opinion that increased global participation in genetics research is beneficial, both to scientists and for science, and explore the premise that DNA barcoding can help to democratize participation in genetics research. We examine publication patterns (2003-2014) in the DNA barcoding literature and compare trends with those in the broader, related domain of genomics. While genomics is the older and much larger field, the number of nations contributing to the published literature is similar between disciplines. Meanwhile, DNA barcoding exhibits a higher pace of growth in the number of publications as well as greater evenness among nations in their proportional contribution to total authorships. This exploration revealed DNA barcoding to be a highly international discipline, with growing participation by researchers in especially biodiverse nations. We briefly consider several of the challenges that may hinder further participation in genetics research, including access to training and molecular facilities as well as policy relating to the movement of genetic resources.
DNA barcodes of the native ray-finned fishes in Taiwan.
Chang, Chia-Hao; Shao, Kwang-Tsao; Lin, Han-Yang; Chiu, Yung-Chieh; Lee, Mao-Ying; Liu, Shih-Hui; Lin, Pai-Lei
2017-07-01
Species identification based on the DNA sequence of a fragment of the cytochrome c oxidase subunit I gene in the mitochondrial genome, DNA barcoding, is widely applied to assist in sustainable exploitation of fish resources and the protection of fish biodiversity. The aim of this study was to establish a reliable barcoding reference database of the native ray-finned fishes in Taiwan. A total of 2993 individuals, belonging to 1245 species within 637 genera, 184 families and 29 orders of ray-finned fishes and representing approximately 40% of the recorded ray-finned fishes in Taiwan, were PCR amplified at the barcode region and bidirectionally sequenced. The mean length of the 2993 barcodes is 549 bp. Mean congeneric K2P distance (15.24%) is approximately 10-fold higher than the mean conspecific one (1.51%), but approximately 1.4-fold less than the mean genetic distance between families (20.80%). The Barcode Index Number (BIN) discordance report shows that 2993 specimens represent 1275 BINs and, among them, 86 BINs are singletons, 570 BINs are taxonomically concordant, and the other 619 BINs are taxonomically discordant. Barcode gap analysis also revealed that more than 90% of the collected fishes in this study can be discriminated by DNA barcoding. Overall, the barcoding reference database established by this study reveals the need for taxonomic revisions and voucher specimen rechecks, in addition to assisting in the management of Taiwan's fish resources and diversity. © 2016 John Wiley & Sons Ltd.
Zou, Shanmei; Li, Qi
2016-06-01
With the global biodiversity crisis, DNA barcoding aims for fast species identification and cryptic species diversity revelation. For more than 10 years, large amounts of DNA barcode data have been accumulating in publicly available databases, most of which were conducted by distance or tree-building methods that have often been argued, especially for cryptic species revelation. In this context, overlooked cryptic diversity may exist in the available barcoding data. The character-based DNA barcoding, however, has a good chance for detecting the overlooked cryptic diversity. In this study, marine mollusk was as the ideal case for detecting the overlooked potential cryptic species from existing cytochrome c oxidase I (COI) sequences with character-based DNA barcode. A total of 1081 COI sequences of mollusks, belonging to 176 species of 25 families of Gastropoda, Cephalopoda, and Lamellibranchia, were conducted by character analysis. As a whole, the character-based barcoding results were consistent with previous distance and tree-building analysis for species discrimination. More importantly, quite a number of species analyzed were divided into distinct clades with unique diagnostical characters. Based on the concept of cryptic species revelation of character-based barcoding, these species divided into separate taxonomic groups might be potential cryptic species. The detection of the overlooked potential cryptic diversity proves that the character-based barcoding mode possesses more advantages of revealing cryptic biodiversity. With the development of DNA barcoding, making the best use of barcoding data is worthy of our attention for species conservation.
Use of mitochondrial COI gene for the identification of family Salticidae and Lycosidae of spiders.
Naseem, Sajida; Tahir, Hafiz Muhammad
2018-01-01
In recent years, DNA barcoding has become quite popular for molecular identification of species because it is simple, quick and an affordable method. Present study was conducted to identify spiders of most abundant families, i.e. Salticidae and Lycosidae from citrus orchards in Sargodha district using DNA barcoding. A total of 160 specimens were subjected to DNA barcoding but, sequences up to 600 bp were recovered for 156 specimens. This molecular approach proved helpful to assign the exact taxon to those specimens which were misidentified through morphological characters in the study. We were succeeded to discriminate six species of Lycosidae and nine species of Salticidae through DNA barcoding. Results revealed the presence of clear barcode gap (discontinuity in intra- and inter-specific divergences) for members of both families. Furthermore, the maximum intra-specific divergence was less than NN (nearest neighbour) distance for all species. This suggested the reliability of DNA barcoding for spider's identification up to species level. We got 98% success in our study. It is concluded from present study that DNA barcoding is more reliable tool especially for immature spiders, when morphological characters are ambiguous.
Dincă, Vlad; Zakharov, Evgeny V.; Hebert, Paul D. N.; Vila, Roger
2011-01-01
DNA barcoding aims to accelerate species identification and discovery, but performance tests have shown marked differences in identification success. As a consequence, there remains a great need for comprehensive studies which objectively test the method in groups with a solid taxonomic framework. This study focuses on the 180 species of butterflies in Romania, accounting for about one third of the European butterfly fauna. This country includes five eco-regions, the highest of any in the European Union, and is a good representative for temperate areas. Morphology and DNA barcodes of more than 1300 specimens were carefully studied and compared. Our results indicate that 90 per cent of the species form barcode clusters allowing their reliable identification. The remaining cases involve nine closely related species pairs, some whose taxonomic status is controversial or that hybridize regularly. Interestingly, DNA barcoding was found to be the most effective identification tool, outperforming external morphology, and being slightly better than male genitalia. Romania is now the first country to have a comprehensive DNA barcode reference database for butterflies. Similar barcoding efforts based on comprehensive sampling of specific geographical regions can act as functional modules that will foster the early application of DNA barcoding while a global system is under development. PMID:20702462
Becker, R A; Sales, N G; Santos, G M; Santos, G B; Carvalho, D C
2015-07-01
The identification of fish larvae from two neotropical hydrographic basins using traditional morphological taxonomy and DNA barcoding revealed no conflicting results between the morphological and barcode identification of larvae. A lower rate (25%) of correct morphological identification of eggs as belonging to migratory or non-migratory species was achieved. Accurate identification of ichthyoplankton by DNA barcoding is an important tool for fish reproductive behaviour studies, correct estimation of biodiversity by detecting eggs from rare species, as well as defining environmental and management strategies for fish conservation in the neotropics. © 2015 The Fisheries Society of the British Isles.
Raupach, Michael J.; Hannig, Karsten; Morinière, Jérome; Hendrich, Lars
2016-01-01
Abstract As molecular identification method, DNA barcoding based on partial cytochrome c oxidase subunit 1 (COI) sequences has been proven to be a useful tool for species determination in many insect taxa including ground beetles. In this study we tested the effectiveness of DNA barcodes to discriminate species of the ground beetle genus Bembidion and some closely related taxa of Germany. DNA barcodes were obtained from 819 individuals and 78 species, including sequences from previous studies as well as more than 300 new generated DNA barcodes. We found a 1:1 correspondence between BIN and traditionally recognized species for 69 species (89%). Low interspecific distances with maximum pairwise K2P values below 2.2% were found for three species pairs, including two species pairs with haplotype sharing (Bembidion atrocaeruleum/Bembidion varicolor and Bembidion guttula/Bembidion mannerheimii). In contrast to this, deep intraspecific sequence divergences with distinct lineages were revealed for two species (Bembidion geniculatum/Ocys harpaloides). Our study emphasizes the use of DNA barcodes for the identification of the analyzed ground beetles species and represents an important step in building-up a comprehensive barcode library for the Carabidae in Germany and Central Europe as well. PMID:27408547
Raupach, Michael J.; Hannig, Karsten; Moriniére, Jérôme; Hendrich, Lars
2018-01-01
Abstract The genus Amara Bonelli, 1810 is a very speciose and taxonomically difficult genus of the Carabidae. The identification of many of the species is accomplished with considerable difficulty, in particular for females and immature stages. In this study the effectiveness of DNA barcoding, the most popular method for molecular species identification, was examined to discriminate various species of this genus from Central Europe. DNA barcodes from 690 individuals and 47 species were analysed, including sequences from previous studies and more than 350 newly generated DNA barcodes. Our analysis revealed unique BINs for 38 species (81%). Interspecific K2P distances below 2.2% were found for three species pairs and one species trio, including haplotype sharing between Amara alpina/Amara torrida and Amara communis/Amara convexior/Amara makolskii. This study represents another step in generating an extensive reference library of DNA barcodes for carabids, highly valuable bioindicators for characterizing disturbances in various habitats. PMID:29853775
[Hydrophidae identification through analysis on Cyt b gene barcode].
Liao, Li-xi; Zeng, Ke-wu; Tu, Peng-fei
2015-08-01
Hydrophidae, one of the precious traditional Chinese medicines, is generally drily preserved to prevent corruption, but it is hard to identify the species of Hydrophidae through the appearance because of the change due to the drying process. The identification through analysis on gene barcode, a new technique in species identification, can avoid the problem. The gene barcodes of the 6 species of Hydrophidae like Lapemis hardwickii were aquired through DNA extraction and gene sequencing. These barcodes were then in sequence alignment and test the identification efficency by BLAST. Our results revealed that the barcode sequences performed high identification efficiency, and had obvious difference between intra- and inter-species. These all indicated that Cyt b DNA barcoding can confirm the Hydrophidae identification.
DNA barcodes reveal microevolutionary signals in fire response trait in two legume genera
Bello, Abubakar; Daru, Barnabas H.; Stirton, Charles H.; Chimphango, Samson B. M.; van der Bank, Michelle; Maurin, Olivier; Muasya, A. Muthama
2015-01-01
Large-scale DNA barcoding provides a new technique for species identification and evaluation of relationships across various levels (populations and species) and may reveal fundamental processes in recently diverged species. Here, we analysed DNA sequence variation in the recently diverged legumes from the Psoraleeae (Fabaceae) occurring in the Cape Floristic Region (CFR) of southern Africa to test the utility of DNA barcodes in species identification and discrimination. We further explored the phylogenetic signal on fire response trait (reseeding and resprouting) at species and generic levels. We showed that Psoraleoid legumes of the CFR exhibit a barcoding gap yielding the combination of matK and rbcLa (matK + rbcLa) data set as a better barcode than single regions. We found a high score (100 %) of correct identification of individuals to their respective genera but a very low score (<50 %) in identifying them to species. We found a considerable match (54 %) between genetic species and morphologically delimited species. We also found that different lineages showed a weak but significant phylogenetic conservatism in their response to fire as reseeders or resprouters, with more clustering of resprouters than would be expected by chance. These novel microevolutionary patterns might be acting continuously over time to produce multi-scale regularities of biodiversity. This study provides the first insight into the DNA barcoding campaign of land plants in species identification and detection of the phylogenetic signal in recently diverged lineages of the CFR. PMID:26507570
DNA Barcoding of Marine Metazoa
NASA Astrophysics Data System (ADS)
Bucklin, Ann; Steinke, Dirk; Blanco-Bercial, Leocadio
2011-01-01
More than 230,000 known species representing 31 metazoan phyla populate the world's oceans. Perhaps another 1,000,000 or more species remain to be discovered. There is reason for concern that species extinctions may outpace discovery, especially in diverse and endangered marine habitats such as coral reefs. DNA barcodes (i.e., short DNA sequences for species recognition and discrimination) are useful tools to accelerate species-level analysis of marine biodiversity and to facilitate conservation efforts. This review focuses on the usual barcode region for metazoans: a ˜648 base-pair region of the mitochondrial cytochrome c oxidase subunit I (COI) gene. Barcodes have also been used for population genetic and phylogeographic analysis, identification of prey in gut contents, detection of invasive species, forensics, and seafood safety. More controversially, barcodes have been used to delimit species boundaries, reveal cryptic species, and discover new species. Emerging frontiers are the use of barcodes for rapid and increasingly automated biodiversity assessment by high-throughput sequencing, including environmental barcoding and the use of barcodes to detect species for which formal identification or scientific naming may never be possible.
Vassou, Sophie Lorraine; Nithaniyal, Stalin; Raju, Balaji; Parani, Madasamy
2016-07-18
Ayurveda is a system of traditional medicine that originated in ancient India, and it is still in practice. Medicinal plants are the backbone of Ayurveda, which heavily relies on the plant-derived therapeutics. While Ayurveda is becoming more popular in several countries throughout the World, lack of authenticated medicinal plant raw drugs is a growing concern. Our aim was to DNA barcode the medicinal plants that are listed in the Ayurvedic Pharmacopoeia of India (API) to create a reference DNA barcode library, and to use the same to authenticate the raw drugs that are sold in markets. We have DNA barcoded 347 medicinal plants using rbcL marker, and curated rbcL DNA barcodes for 27 medicinal plants from public databases. These sequences were used to create Ayurvedic Pharmacopoeia of India - Reference DNA Barcode Library (API-RDBL). This library was used to authenticate 100 medicinal plant raw drugs, which were in the form of powders (82) and seeds (18). Ayurvedic Pharmacopoeia of India - Reference DNA Barcode Library (API-RDBL) was created with high quality and authentic rbcL barcodes for 374 out of the 395 medicinal plants that are included in the API. The rbcL DNA barcode differentiated 319 species (85 %) with the pairwise divergence ranging between 0.2 and 29.9 %. PCR amplification and DNA sequencing success rate of rbcL marker was 100 % even for the poorly preserved medicinal plant raw drugs that were collected from local markets. DNA barcoding revealed that only 79 % raw drugs were authentic, and the remaining 21 % samples were adulterated. Further, adulteration was found to be much higher with powders (ca. 25 %) when compared to seeds (ca. 5 %). The present study demonstrated the utility of DNA barcoding in authenticating medicinal plant raw drugs, and found that approximately one fifth of the market samples were adulterated. Powdered raw drugs, which are very difficult to be identified by taxonomists as well as common people, seem to be the easy target for adulteration. Developing a quality control protocol for medicinal plant raw drugs by incorporating DNA barcoding as a component is essential to ensure safety to the consumers.
DNA barcodes for Nearctic Auchenorrhyncha (Insecta: Hemiptera).
Foottit, Robert G; Maw, Eric; Hebert, P D N
2014-01-01
Many studies have shown the suitability of sequence variation in the 5' region of the mitochondrial cytochrome c oxidase I (COI) gene as a DNA barcode for the identification of species in a wide range of animal groups. We examined 471 species in 147 genera of Hemiptera: Auchenorrhyncha drawn from specimens in the Canadian National Collection of Insects to assess the effectiveness of DNA barcoding in this group. Analysis of the COI gene revealed less than 2% intra-specific divergence in 93% of the taxa examined, while minimum interspecific distances exceeded 2% in 70% of congeneric species pairs. Although most species are characterized by a distinct sequence cluster, sequences for members of many groups of closely related species either shared sequences or showed close similarity, with 25% of species separated from their nearest neighbor by less than 1%. This study, although preliminary, provides DNA barcodes for about 8% of the species of this hemipteran suborder found in North America north of Mexico. Barcodes can enable the identification of many species of Auchenorrhyncha, but members of some species groups cannot be discriminated. Future use of DNA barcodes in regulatory, pest management, and environmental applications will be possible as the barcode library for Auchenorrhyncha expands to include more species and broader geographic coverage.
DNA Barcodes for Nearctic Auchenorrhyncha (Insecta: Hemiptera)
Foottit, Robert G.; Maw, Eric; Hebert, P. D. N.
2014-01-01
Background Many studies have shown the suitability of sequence variation in the 5′ region of the mitochondrial cytochrome c oxidase I (COI) gene as a DNA barcode for the identification of species in a wide range of animal groups. We examined 471 species in 147 genera of Hemiptera: Auchenorrhyncha drawn from specimens in the Canadian National Collection of Insects to assess the effectiveness of DNA barcoding in this group. Methodology/Principal Findings Analysis of the COI gene revealed less than 2% intra-specific divergence in 93% of the taxa examined, while minimum interspecific distances exceeded 2% in 70% of congeneric species pairs. Although most species are characterized by a distinct sequence cluster, sequences for members of many groups of closely related species either shared sequences or showed close similarity, with 25% of species separated from their nearest neighbor by less than 1%. Conclusions/Significance This study, although preliminary, provides DNA barcodes for about 8% of the species of this hemipteran suborder found in North America north of Mexico. Barcodes can enable the identification of many species of Auchenorrhyncha, but members of some species groups cannot be discriminated. Future use of DNA barcodes in regulatory, pest management, and environmental applications will be possible as the barcode library for Auchenorrhyncha expands to include more species and broader geographic coverage. PMID:25004106
Wilson, J-J; Sing, K-W; Halim, M R A; Ramli, R; Hashim, R; Sofian-Azirun, M
2014-02-19
Bats are important flagship species for biodiversity research; however, diversity in Southeast Asia is considerably underestimated in the current checklists and field guides. Incorporation of DNA barcoding into surveys has revealed numerous species-level taxa overlooked by conventional methods. Inclusion of these taxa in inventories provides a more informative record of diversity, but is problematic as these species lack formal description. We investigated how frequently documented, but undescribed, bat taxa are encountered in Peninsular Malaysia. We discuss whether a barcode library provides a means of recognizing and recording these taxa across biodiversity inventories. Tissue was sampled from bats trapped at Pasir Raja, Dungun Terengganu, Peninsular Malaysia. The DNA was extracted and the COI barcode region amplified and sequenced. We identified 9 species-level taxa within our samples, based on analysis of the DNA barcodes. Six specimens matched to four previously documented taxa considered candidate species but currently lacking formal taxonomic status. This study confirms the high diversity of bats within Peninsular Malaysia (9 species in 13 samples) and demonstrates how DNA barcoding allows for inventory and documentation of known taxa lacking formal taxonomic status.
Role of DNA barcoding in marine biodiversity assessment and conservation: An update
Trivedi, Subrata; Aloufi, Abdulhadi A.; Ansari, Abid A.; Ghosh, Sankar K.
2015-01-01
More than two third area of our planet is covered by oceans and assessment of marine biodiversity is a challenging task. With the increasing global population, there is a tendency to exploit marine resources for food, energy and other requirements. This puts pressure on the fragile marine environment and necessitates sustainable conservation efforts. Marine species identification using traditional taxonomical methods is often burdened with taxonomic controversies. Here we discuss the comparatively new concept of DNA barcoding and its significance in marine perspective. This molecular technique can be useful in the assessment of cryptic species which is widespread in marine environment and linking the different life cycle stages to the adult which is difficult to accomplish in the marine ecosystem. Other advantages of DNA barcoding include authentication and safety assessment of seafood, wildlife forensics, conservation genetics and detection of invasive alien species (IAS). Global DNA barcoding efforts in the marine habitat include MarBOL, CeDAMar, CMarZ, SHARK-BOL, etc. An overview on DNA barcoding of different marine groups ranging from the microbes to mammals is revealed. In conjugation with newer and faster techniques like high-throughput sequencing, DNA barcoding can serve as an effective modern tool in marine biodiversity assessment and conservation. PMID:26980996
DNA barcoding and the identification of tree frogs (Amphibia: Anura: Rhacophoridae).
Dang, Ning-Xin; Sun, Feng-Hui; Lv, Yun-Yun; Zhao, Bo-Han; Wang, Ji-Chao; Murphy, Robert W; Wang, Wen-Zhi; Li, Jia-Tang
2016-07-01
The DNA barcoding gene COI (cytochrome c oxidase subunit I) effectively identifies many species. Herein, we barcoded 172 individuals from 37 species belonging to nine genera in Rhacophoridae to test if the gene serves equally well to identify species of tree frogs. Phenetic neighbor joining and phylogenetic Bayesian inference were used to construct phylogenetic trees, which resolved all nine genera as monophyletic taxa except for Rhacophorus, two new matrilines for Liuixalus, and Polypedates leucomystax species complex. Intraspecific genetic distances ranged from 0.000 to 0.119 and interspecific genetic distances ranged from 0.015 to 0.334. Within Rhacophorus and Kurixalus, the intra- and interspecific genetic distances did not reveal an obvious barcode gap. Notwithstanding, we found that COI sequences unambiguously identified rhacophorid species and helped to discover likely new cryptic species via the synthesis of genealogical relationships and divergence patterns. Our results supported that COI is an effective DNA barcoding marker for Rhacophoridae.
Hassold, Sonja; Lowry, Porter P; Bauert, Martin R; Razafintsalama, Annick; Ramamonjisoa, Lolona; Widmer, Alex
2016-01-01
Illegal selective logging of tropical timber is of increasing concern worldwide. Madagascar is a biodiversity hotspot and home to some of the world's most sought after tropical timber species. Malagasy rosewoods belong to the genus Dalbergia (Fabaceae), which is highly diverse and has a pantropical distribution, but these timber species are among the most threatened as a consequence of intensive illegal selective logging and deforestation. Reliable identification of Dalbergia species from Madagascar is important for law enforcement but is almost impossible without fertile plant material, which is often unavailable during forest inventories or when attempting to identify logged trees of cut wood. DNA barcoding has been promoted as a promising tool for species identification in such cases. In this study we tested whether DNA barcoding with partial sequences of three plastid markers (matK, rbcL and trnL (UAA)) can distinguish between Dalbergia from Madagascar and from other areas of its distributional range, and whether Malagasy species can be distinguished from one another. Phylogenetic analyses revealed that the Malagasy Dalbergia species studied form two monophyletic groups, each containing two subgroups, only one of which corresponds to a single species. We characterized diagnostic polymorphisms in the three DNA barcoding markers that allow rapid discrimination between Dalbergia from Madagascar and from other areas of its distribution range. Species identification success based on individual barcoding markers or combinations was poor, whereas subgroup identification success was much higher (up to 98%), revealing both the value and limitations of a DNA barcoding approach for the identification of closely related Malagasy rosewoods.
Analyzing Mosquito (Diptera: Culicidae) Diversity in Pakistan by DNA Barcoding
Ashfaq, Muhammad; Hebert, Paul D. N.; Mirza, Jawwad H.; Khan, Arif M.; Zafar, Yusuf; Mirza, M. Sajjad
2014-01-01
Background Although they are important disease vectors mosquito biodiversity in Pakistan is poorly known. Recent epidemics of dengue fever have revealed the need for more detailed understanding of the diversity and distributions of mosquito species in this region. DNA barcoding improves the accuracy of mosquito inventories because morphological differences between many species are subtle, leading to misidentifications. Methodology/Principal Findings Sequence variation in the barcode region of the mitochondrial COI gene was used to identify mosquito species, reveal genetic diversity, and map the distribution of the dengue-vector species in Pakistan. Analysis of 1684 mosquitoes from 491 sites in Punjab and Khyber Pakhtunkhwa during 2010–2013 revealed 32 species with the assemblage dominated by Culex quinquefasciatus (61% of the collection). The genus Aedes (Stegomyia) comprised 15% of the specimens, and was represented by six taxa with the two dengue vector species, Ae. albopictus and Ae. aegypti, dominant and broadly distributed. Anopheles made up another 6% of the catch with An. subpictus dominating. Barcode sequence divergence in conspecific specimens ranged from 0–2.4%, while congeneric species showed from 2.3–17.8% divergence. A global haplotype analysis of disease-vectors showed the presence of multiple haplotypes, although a single haplotype of each dengue-vector species was dominant in most countries. Geographic distribution of Ae. aegypti and Ae. albopictus showed the later species was dominant and found in both rural and urban environments. Conclusions As the first DNA-based analysis of mosquitoes in Pakistan, this study has begun the construction of a barcode reference library for the mosquitoes of this region. Levels of genetic diversity varied among species. Because of its capacity to differentiate species, even those with subtle morphological differences, DNA barcoding aids accurate tracking of vector populations. PMID:24827460
Analyzing mosquito (Diptera: culicidae) diversity in Pakistan by DNA barcoding.
Ashfaq, Muhammad; Hebert, Paul D N; Mirza, Jawwad H; Khan, Arif M; Zafar, Yusuf; Mirza, M Sajjad
2014-01-01
Although they are important disease vectors mosquito biodiversity in Pakistan is poorly known. Recent epidemics of dengue fever have revealed the need for more detailed understanding of the diversity and distributions of mosquito species in this region. DNA barcoding improves the accuracy of mosquito inventories because morphological differences between many species are subtle, leading to misidentifications. Sequence variation in the barcode region of the mitochondrial COI gene was used to identify mosquito species, reveal genetic diversity, and map the distribution of the dengue-vector species in Pakistan. Analysis of 1684 mosquitoes from 491 sites in Punjab and Khyber Pakhtunkhwa during 2010-2013 revealed 32 species with the assemblage dominated by Culex quinquefasciatus (61% of the collection). The genus Aedes (Stegomyia) comprised 15% of the specimens, and was represented by six taxa with the two dengue vector species, Ae. albopictus and Ae. aegypti, dominant and broadly distributed. Anopheles made up another 6% of the catch with An. subpictus dominating. Barcode sequence divergence in conspecific specimens ranged from 0-2.4%, while congeneric species showed from 2.3-17.8% divergence. A global haplotype analysis of disease-vectors showed the presence of multiple haplotypes, although a single haplotype of each dengue-vector species was dominant in most countries. Geographic distribution of Ae. aegypti and Ae. albopictus showed the later species was dominant and found in both rural and urban environments. As the first DNA-based analysis of mosquitoes in Pakistan, this study has begun the construction of a barcode reference library for the mosquitoes of this region. Levels of genetic diversity varied among species. Because of its capacity to differentiate species, even those with subtle morphological differences, DNA barcoding aids accurate tracking of vector populations.
DNA Barcoding the Geometrid Fauna of Bavaria (Lepidoptera): Successes, Surprises, and Questions
Hausmann, Axel; Haszprunar, Gerhard; Hebert, Paul D. N.
2011-01-01
Background The State of Bavaria is involved in a research program that will lead to the construction of a DNA barcode library for all animal species within its territorial boundaries. The present study provides a comprehensive DNA barcode library for the Geometridae, one of the most diverse of insect families. Methodology/Principal Findings This study reports DNA barcodes for 400 Bavarian geometrid species, 98 per cent of the known fauna, and approximately one per cent of all Bavarian animal species. Although 98.5% of these species possess diagnostic barcode sequences in Bavaria, records from neighbouring countries suggest that species-level resolution may be compromised in up to 3.5% of cases. All taxa which apparently share barcodes are discussed in detail. One case of modest divergence (1.4%) revealed a species overlooked by the current taxonomic system: Eupithecia goossensiata Mabille, 1869 stat.n. is raised from synonymy with Eupithecia absinthiata (Clerck, 1759) to species rank. Deep intraspecific sequence divergences (>2%) were detected in 20 traditionally recognized species. Conclusions/Significance The study emphasizes the effectiveness of DNA barcoding as a tool for monitoring biodiversity. Open access is provided to a data set that includes records for 1,395 geometrid specimens (331 species) from Bavaria, with 69 additional species from neighbouring regions. Taxa with deep intraspecific sequence divergences are undergoing more detailed analysis to ascertain if they represent cases of cryptic diversity. PMID:21423340
Chen, Weitao; Ma, Xiuhui; Shen, Yanjun; Mao, Yuntao; He, Shunping
2015-11-30
Nujiang River (NR), an essential component of the biodiversity hotspot of the Mountains of Southwest China, possesses a characteristic fish fauna and contains endemic species. Although previous studies on fish diversity in the NR have primarily consisted of listings of the fish species observed during field collections, in our study, we DNA-barcoded 1139 specimens belonging to 46 morphologically distinct fish species distributed throughout the NR basin by employing multiple analytical approaches. According to our analyses, DNA barcoding is an efficient method for the identification of fish by the presence of barcode gaps. However, three invasive species are characterized by deep conspecific divergences, generating multiple lineages and Operational Taxonomic Units (OTUs), implying the possibility of cryptic species. At the other end of the spectrum, ten species (from three genera) that are characterized by an overlap between their intra- and interspecific genetic distances form a single genetic cluster and share haplotypes. The neighbor-joining phenogram, Barcode Index Numbers (BINs) and Automatic Barcode Gap Discovery (ABGD) identified 43 putative species, while the General Mixed Yule-coalescence (GMYC) identified five more OTUs. Thus, our study established a reliable DNA barcode reference library for the fish in the NR and sheds new light on the local fish diversity.
Mankga, Ledile T.; Yessoufou, Kowiyou; Moteetee, Annah M.; Daru, Barnabas H.; van der Bank, Michelle
2013-01-01
Abstract Medicinal plants cover a broad range of taxa, which may be phylogenetically less related but morphologically very similar. Such morphological similarity between species may lead to misidentification and inappropriate use. Also the substitution of a medicinal plant by a cheaper alternative (e.g. other non-medicinal plant species), either due to misidentification, or deliberately to cheat consumers, is an issue of growing concern. In this study, we used DNA barcoding to identify commonly used medicinal plants in South Africa. Using the core plant barcodes, matK and rbcLa, obtained from processed and poorly conserved materials sold at the muthi traditional medicine market, we tested efficacy of the barcodes in species discrimination. Based on genetic divergence, PCR amplification efficiency and BLAST algorithm, we revealed varied discriminatory potentials for the DNA barcodes. In general, the barcodes exhibited high discriminatory power, indicating their effectiveness in verifying the identity of the most common plant species traded in South African medicinal markets. BLAST algorithm successfully matched 61% of the queries against a reference database, suggesting that most of the information supplied by sellers at traditional medicinal markets in South Africa is correct. Our findings reinforce the utility of DNA barcoding technique in limiting false identification that can harm public health. PMID:24453559
Chen, Weitao; Ma, Xiuhui; Shen, Yanjun; Mao, Yuntao; He, Shunping
2015-01-01
Nujiang River (NR), an essential component of the biodiversity hotspot of the Mountains of Southwest China, possesses a characteristic fish fauna and contains endemic species. Although previous studies on fish diversity in the NR have primarily consisted of listings of the fish species observed during field collections, in our study, we DNA-barcoded 1139 specimens belonging to 46 morphologically distinct fish species distributed throughout the NR basin by employing multiple analytical approaches. According to our analyses, DNA barcoding is an efficient method for the identification of fish by the presence of barcode gaps. However, three invasive species are characterized by deep conspecific divergences, generating multiple lineages and Operational Taxonomic Units (OTUs), implying the possibility of cryptic species. At the other end of the spectrum, ten species (from three genera) that are characterized by an overlap between their intra- and interspecific genetic distances form a single genetic cluster and share haplotypes. The neighbor-joining phenogram, Barcode Index Numbers (BINs) and Automatic Barcode Gap Discovery (ABGD) identified 43 putative species, while the General Mixed Yule-coalescence (GMYC) identified five more OTUs. Thus, our study established a reliable DNA barcode reference library for the fish in the NR and sheds new light on the local fish diversity. PMID:26616046
Nuclear genomes distinguish cryptic species suggested by their DNA barcodes and ecology
Janzen, Daniel H.; Burns, John M.; Cong, Qian; Hallwachs, Winnie; Dapkey, Tanya; Manjunath, Ramya; Hajibabaei, Mehrdad; Hebert, Paul D. N.; Grishin, Nick V.
2017-01-01
DNA sequencing brings another dimension to exploration of biodiversity, and large-scale mitochondrial DNA cytochrome oxidase I barcoding has exposed many potential new cryptic species. Here, we add complete nuclear genome sequencing to DNA barcoding, ecological distribution, natural history, and subtleties of adult color pattern and size to show that a widespread neotropical skipper butterfly known as Udranomia kikkawai (Weeks) comprises three different species in Costa Rica. Full-length barcodes obtained from all three century-old Venezuelan syntypes of U. kikkawai show that it is a rainforest species occurring from Costa Rica to Brazil. The two new species are Udranomia sallydaleyae Burns, a dry forest denizen occurring from Costa Rica to Mexico, and Udranomia tomdaleyi Burns, which occupies the junction between the rainforest and dry forest and currently is known only from Costa Rica. Whereas the three species are cryptic, differing but slightly in appearance, their complete nuclear genomes totaling 15 million aligned positions reveal significant differences consistent with their 0.00065-Mbp (million base pair) mitochondrial barcodes and their ecological diversification. DNA barcoding of tropical insects reared by a massive inventory suggests that the presence of cryptic species is a widespread phenomenon and that further studies will substantially increase current estimates of insect species richness. PMID:28716927
Fang Chen; Youqing Luo; Melody A. Keena; Ying Wu; Peng Wu; Juan Shi
2015-01-01
The gypsy moth from Asia (two subspecies) is considered a greater threat to North America than European gypsy moth, because of a broader host range and females being capable of flight. Variation within and among gypsy moths from China (nine locations), one of the native countries of Asian gypsy moth, were compared using DNA barcode sequences (658 bp of mtDNA cytochrome...
NASA Astrophysics Data System (ADS)
Bucklin, Ann; Ortman, Brian D.; Jennings, Robert M.; Nigro, Lisa M.; Sweetman, Christopher J.; Copley, Nancy J.; Sutton, Tracey; Wiebe, Peter H.
2010-12-01
Species diversity of the metazoan holozooplankton assemblage of the Sargasso Sea, Northwest Atlantic Ocean, was examined through coordinated morphological taxonomic identification of species and DNA sequencing of a ˜650 base-pair region of mitochondrial cytochrome oxidase I (mtCOI) as a DNA barcode (i.e., short sequence for species recognition and discrimination). Zooplankton collections were made from the surface to 5,000 meters during April, 2006 on the R/V R.H. Brown. Samples were examined by a ship-board team of morphological taxonomists; DNA barcoding was carried out in both ship-board and land-based DNA sequencing laboratories. DNA barcodes were determined for a total of 297 individuals of 175 holozooplankton species in four phyla, including: Cnidaria (Hydromedusae, 4 species; Siphonophora, 47); Arthropoda (Amphipoda, 10; Copepoda, 34; Decapoda, 9; Euphausiacea, 10; Mysidacea, 1; Ostracoda, 27); and Mollusca (Cephalopoda, 8; Heteropoda, 6; Pteropoda, 15); and Chaetognatha (4). Thirty species of fish (Teleostei) were also barcoded. For all seven zooplankton groups for which sufficient data were available, Kimura-2-Parameter genetic distances were significantly lower between individuals of the same species (mean=0.0114; S.D. 0.0117) than between individuals of different species within the same group (mean=0.3166; S.D. 0.0378). This difference, known as the barcode gap, ensures that mtCOI sequences are reliable characters for species identification for the oceanic holozooplankton assemblage. In addition, DNA barcodes allow recognition of new or undescribed species, reveal cryptic species within known taxa, and inform phylogeographic and population genetic studies of geographic variation. The growing database of "gold standard" DNA barcodes serves as a Rosetta Stone for marine zooplankton, providing the key for decoding species diversity by linking species names, morphology, and DNA sequence variation. In light of the pivotal position of zooplankton in ocean food webs, their usefulness as rapid responders to environmental change, and the increasing scarcity of taxonomists, the use of DNA barcodes is an important and useful approach for rapid analysis of species diversity and distribution in the pelagic community.
DNA barcode analysis of butterfly species from Pakistan points towards regional endemism
Ashfaq, Muhammad; Akhtar, Saleem; Khan, Arif M; Adamowicz, Sarah J; Hebert, Paul D N
2013-01-01
DNA barcodes were obtained for 81 butterfly species belonging to 52 genera from sites in north-central Pakistan to test the utility of barcoding for their identification and to gain a better understanding of regional barcode variation. These species represent 25% of the butterfly fauna of Pakistan and belong to five families, although the Nymphalidae were dominant, comprising 38% of the total specimens. Barcode analysis showed that maximum conspecific divergence was 1.6%, while there was 1.7–14.3% divergence from the nearest neighbour species. Barcode records for 55 species showed <2% sequence divergence to records in the Barcode of Life Data Systems (BOLD), but only 26 of these cases involved specimens from neighbouring India and Central Asia. Analysis revealed that most species showed little incremental sequence variation when specimens from other regions were considered, but a threefold increase was noted in a few cases. There was a clear gap between maximum intraspecific and minimum nearest neighbour distance for all 81 species. Neighbour-joining cluster analysis showed that members of each species formed a monophyletic cluster with strong bootstrap support. The barcode results revealed two provisional species that could not be clearly linked to known taxa, while 24 other species gained their first coverage. Future work should extend the barcode reference library to include all butterfly species from Pakistan as well as neighbouring countries to gain a better understanding of regional variation in barcode sequences in this topographically and climatically complex region. PMID:23789612
A DNA 'barcode blitz': rapid digitization and sequencing of a natural history collection.
Hebert, Paul D N; Dewaard, Jeremy R; Zakharov, Evgeny V; Prosser, Sean W J; Sones, Jayme E; McKeown, Jaclyn T A; Mantle, Beth; La Salle, John
2013-01-01
DNA barcoding protocols require the linkage of each sequence record to a voucher specimen that has, whenever possible, been authoritatively identified. Natural history collections would seem an ideal resource for barcode library construction, but they have never seen large-scale analysis because of concerns linked to DNA degradation. The present study examines the strength of this barrier, carrying out a comprehensive analysis of moth and butterfly (Lepidoptera) species in the Australian National Insect Collection. Protocols were developed that enabled tissue samples, specimen data, and images to be assembled rapidly. Using these methods, a five-person team processed 41,650 specimens representing 12,699 species in 14 weeks. Subsequent molecular analysis took about six months, reflecting the need for multiple rounds of PCR as sequence recovery was impacted by age, body size, and collection protocols. Despite these variables and the fact that specimens averaged 30.4 years old, barcode records were obtained from 86% of the species. In fact, one or more barcode compliant sequences (>487 bp) were recovered from virtually all species represented by five or more individuals, even when the youngest was 50 years old. By assembling specimen images, distributional data, and DNA barcode sequences on a web-accessible informatics platform, this study has greatly advanced accessibility to information on thousands of species. Moreover, much of the specimen data became publically accessible within days of its acquisition, while most sequence results saw release within three months. As such, this study reveals the speed with which DNA barcode workflows can mobilize biodiversity data, often providing the first web-accessible information for a species. These results further suggest that existing collections can enable the rapid development of a comprehensive DNA barcode library for the most diverse compartment of terrestrial biodiversity - insects.
Patterns of DNA barcode variation in Canadian marine molluscs.
Layton, Kara K S; Martel, André L; Hebert, Paul D N
2014-01-01
Molluscs are the most diverse marine phylum and this high diversity has resulted in considerable taxonomic problems. Because the number of species in Canadian oceans remains uncertain, there is a need to incorporate molecular methods into species identifications. A 648 base pair segment of the cytochrome c oxidase subunit I gene has proven useful for the identification and discovery of species in many animal lineages. While the utility of DNA barcoding in molluscs has been demonstrated in other studies, this is the first effort to construct a DNA barcode registry for marine molluscs across such a large geographic area. This study examines patterns of DNA barcode variation in 227 species of Canadian marine molluscs. Intraspecific sequence divergences ranged from 0-26.4% and a barcode gap existed for most taxa. Eleven cases of relatively deep (>2%) intraspecific divergence were detected, suggesting the possible presence of overlooked species. Structural variation was detected in COI with indels found in 37 species, mostly bivalves. Some indels were present in divergent lineages, primarily in the region of the first external loop, suggesting certain areas are hotspots for change. Lastly, mean GC content varied substantially among orders (24.5%-46.5%), and showed a significant positive correlation with nearest neighbour distances. DNA barcoding is an effective tool for the identification of Canadian marine molluscs and for revealing possible cases of overlooked species. Some species with deep intraspecific divergence showed a biogeographic partition between lineages on the Atlantic, Arctic and Pacific coasts, suggesting the role of Pleistocene glaciations in the subdivision of their populations. Indels were prevalent in the barcode region of the COI gene in bivalves and gastropods. This study highlights the efficacy of DNA barcoding for providing insights into sequence variation across a broad taxonomic group on a large geographic scale.
Hernández-Triana, Luis M; Montes De Oca, Fernanda; Prosser, Sean W J; Hebert, Paul D N; Gregory, T Ryan; McMurtrie, Shelley
2017-04-01
In this paper, the utility of a partial sequence of the COI gene, the DNA barcoding region, for the identification of species of black flies in the austral region was assessed. Twenty-eight morphospecies were analyzed: eight of the genus Austrosimulium (four species in the subgenus Austrosimulium s. str., three species in the subgenus Novaustrosimulium, and one species unassigned to subgenus), two of the genus Cnesia, eight of Gigantodax, three of Paracnephia, one of Paraustrosimulium, and six of Simulium (subgenera Morops, Nevermannia, and Pternaspatha). The neighbour-joining tree derived from the DNA barcode sequences grouped most specimens according to species or species groups recognized by morphotaxonomic studies. Intraspecific sequence divergences within morphologically distinct species ranged from 0% to 1.8%, while higher divergences (2%-4.2%) in certain species suggested the presence of cryptic diversity. The existence of well-defined groups within S. simile revealed the likely inclusion of cryptic diversity. DNA barcodes also showed that specimens identified as C. dissimilis, C. nr. pussilla, and C. ornata might be conspecific, suggesting possible synonymy. DNA barcoding combined with a sound morphotaxonomic framework would provide an effective approach for the identification of black flies in the region.
DNA barcoding for biosecurity: case studies from the UK plant protection program.
Hodgetts, Jennifer; Ostojá-Starzewski, Jozef C; Prior, Thomas; Lawson, Rebecca; Hall, Jayne; Boonham, Neil
2016-11-01
Since its conception, DNA barcoding has seen a rapid uptake within the research community. Nevertheless, as with many new scientific tools, progression towards the point of routine deployment within diagnostic laboratories has been slow. In this paper, we discuss the application of DNA barcoding in the Defra plant health diagnostic laboratories, where DNA barcoding is used primarily for the identification of invertebrate pests. We present a series of case studies that demonstrate the successful application of DNA barcoding but also reveal some potential limitations to expanded use. The regulated plant pest, Bursephalenchus xylophilus, and one of its vectors, Monochamus alternatus, were found in dining chairs. Some traded wood products are potentially high risk, allowing the movement of longhorn beetles; Trichoferus campestris, Leptura quadrifasciata, and Trichoferus holosericeus were found in a wooden cutlery tray, a railway sleeper, and a dining chair, respectively. An outbreak of Meloidogyne fallax was identified in Allium ampeloprasum and in three weed species. Reference sequences for UK native psyllids were generated to enable the development of rapid diagnostics to be used for monitoring following the release of Aphalara itadori as a biological control agent for Fallopia japonica.
Raupach, Michael J; Barco, Andrea; Steinke, Dirk; Beermann, Jan; Laakmann, Silke; Mohrbeck, Inga; Neumann, Hermann; Kihara, Terue C; Pointner, Karin; Radulovici, Adriana; Segelken-Voigt, Alexandra; Wesse, Christina; Knebelsberger, Thomas
2015-01-01
During the last years DNA barcoding has become a popular method of choice for molecular specimen identification. Here we present a comprehensive DNA barcode library of various crustacean taxa found in the North Sea, one of the most extensively studied marine regions of the world. Our data set includes 1,332 barcodes covering 205 species, including taxa of the Amphipoda, Copepoda, Decapoda, Isopoda, Thecostraca, and others. This dataset represents the most extensive DNA barcode library of the Crustacea in terms of species number to date. By using the Barcode of Life Data Systems (BOLD), unique BINs were identified for 198 (96.6%) of the analyzed species. Six species were characterized by two BINs (2.9%), and three BINs were found for the amphipod species Gammarus salinus Spooner, 1947 (0.4%). Intraspecific distances with values higher than 2.2% were revealed for 13 species (6.3%). Exceptionally high distances of up to 14.87% between two distinct but monophyletic clusters were found for the parasitic copepod Caligus elongatus Nordmann, 1832, supporting the results of previous studies that indicated the existence of an overlooked sea louse species. In contrast to these high distances, haplotype-sharing was observed for two decapod spider crab species, Macropodia parva Van Noort & Adema, 1985 and Macropodia rostrata (Linnaeus, 1761), underlining the need for a taxonomic revision of both species. Summarizing the results, our study confirms the application of DNA barcodes as highly effective identification system for the analyzed marine crustaceans of the North Sea and represents an important milestone for modern biodiversity assessment studies using barcode sequences.
Establishing a community-wide DNA barcode library as a new tool for arctic research.
Wirta, H; Várkonyi, G; Rasmussen, C; Kaartinen, R; Schmidt, N M; Hebert, P D N; Barták, M; Blagoev, G; Disney, H; Ertl, S; Gjelstrup, P; Gwiazdowicz, D J; Huldén, L; Ilmonen, J; Jakovlev, J; Jaschhof, M; Kahanpää, J; Kankaanpää, T; Krogh, P H; Labbee, R; Lettner, C; Michelsen, V; Nielsen, S A; Nielsen, T R; Paasivirta, L; Pedersen, S; Pohjoismäki, J; Salmela, J; Vilkamaa, P; Väre, H; von Tschirnhaus, M; Roslin, T
2016-05-01
DNA sequences offer powerful tools for describing the members and interactions of natural communities. In this study, we establish the to-date most comprehensive library of DNA barcodes for a terrestrial site, including all known macroscopic animals and vascular plants of an intensively studied area of the High Arctic, the Zackenberg Valley in Northeast Greenland. To demonstrate its utility, we apply the library to identify nearly 20 000 arthropod individuals from two Malaise traps, each operated for two summers. Drawing on this material, we estimate the coverage of previous morphology-based species inventories, derive a snapshot of faunal turnover in space and time and describe the abundance and phenology of species in the rapidly changing arctic environment. Overall, 403 terrestrial animal and 160 vascular plant species were recorded by morphology-based techniques. DNA barcodes (CO1) offered high resolution in discriminating among the local animal taxa, with 92% of morphologically distinguishable taxa assigned to unique Barcode Index Numbers (BINs) and 93% to monophyletic clusters. For vascular plants, resolution was lower, with 54% of species forming monophyletic clusters based on barcode regions rbcLa and ITS2. Malaise catches revealed 122 BINs not detected by previous sampling and DNA barcoding. The insect community was dominated by a few highly abundant taxa. Even closely related taxa differed in phenology, emphasizing the need for species-level resolution when describing ongoing shifts in arctic communities and ecosystems. The DNA barcode library now established for Zackenberg offers new scope for such explorations, and for the detailed dissection of interspecific interactions throughout the community. © 2015 John Wiley & Sons Ltd.
DNA barcode analysis of butterfly species from Pakistan points towards regional endemism.
Ashfaq, Muhammad; Akhtar, Saleem; Khan, Arif M; Adamowicz, Sarah J; Hebert, Paul D N
2013-09-01
DNA barcodes were obtained for 81 butterfly species belonging to 52 genera from sites in north-central Pakistan to test the utility of barcoding for their identification and to gain a better understanding of regional barcode variation. These species represent 25% of the butterfly fauna of Pakistan and belong to five families, although the Nymphalidae were dominant, comprising 38% of the total specimens. Barcode analysis showed that maximum conspecific divergence was 1.6%, while there was 1.7-14.3% divergence from the nearest neighbour species. Barcode records for 55 species showed <2% sequence divergence to records in the Barcode of Life Data Systems (BOLD), but only 26 of these cases involved specimens from neighbouring India and Central Asia. Analysis revealed that most species showed little incremental sequence variation when specimens from other regions were considered, but a threefold increase was noted in a few cases. There was a clear gap between maximum intraspecific and minimum nearest neighbour distance for all 81 species. Neighbour-joining cluster analysis showed that members of each species formed a monophyletic cluster with strong bootstrap support. The barcode results revealed two provisional species that could not be clearly linked to known taxa, while 24 other species gained their first coverage. Future work should extend the barcode reference library to include all butterfly species from Pakistan as well as neighbouring countries to gain a better understanding of regional variation in barcode sequences in this topographically and climatically complex region. © 2013 The Authors. Molecular Ecology Resources published by John Wiley & Sons Ltd.
Makarova, Olga; Contaldo, Nicoletta; Paltrinieri, Samanta; Kawube, Geofrey; Bertaccini, Assunta; Nicolaisen, Mogens
2012-01-01
Background Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf) gene for phytoplasma identification is reported. Methodology/Principal Findings We designed a new set of primers and amplified a 420–444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX). Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed that the tuf tree is highly congruent with the 16S rRNA tree and had higher inter- and intra- group sequence divergence. Mean K2P inter−/intra- group divergences of the tuf barcode did not overlap and had approximately one order of magnitude difference for most groups, suggesting the presence of a DNA barcoding gap. The use of the tuf barcode allowed separation of main ribosomal groups and most of their subgroups. Phytoplasma tuf barcodes were deposited in the NCBI GenBank and Q-bank databases. Conclusions/Significance This study demonstrates that DNA barcoding principles can be applied for identification of phytoplasmas. Our findings suggest that the tuf barcode performs as well or better than a 1.2 kbp fragment of the 16S rRNA gene and thus provides an easy procedure for phytoplasma identification. The obtained sequences were used to create a publicly available reference database that can be used by plant health services and researchers for online phytoplasma identification. PMID:23272216
Constructing DNA Barcode Sets Based on Particle Swarm Optimization.
Wang, Bin; Zheng, Xuedong; Zhou, Shihua; Zhou, Changjun; Wei, Xiaopeng; Zhang, Qiang; Wei, Ziqi
2018-01-01
Following the completion of the human genome project, a large amount of high-throughput bio-data was generated. To analyze these data, massively parallel sequencing, namely next-generation sequencing, was rapidly developed. DNA barcodes are used to identify the ownership between sequences and samples when they are attached at the beginning or end of sequencing reads. Constructing DNA barcode sets provides the candidate DNA barcodes for this application. To increase the accuracy of DNA barcode sets, a particle swarm optimization (PSO) algorithm has been modified and used to construct the DNA barcode sets in this paper. Compared with the extant results, some lower bounds of DNA barcode sets are improved. The results show that the proposed algorithm is effective in constructing DNA barcode sets.
Integrative taxonomy detects cryptic and overlooked fish species in a neotropical river basin.
Gomes, Laís Carvalho; Pessali, Tiago Casarim; Sales, Naiara Guimarães; Pompeu, Paulo Santos; Carvalho, Daniel Cardoso
2015-10-01
The great freshwater fish diversity found in the neotropical region makes management and conservation actions challenging. Due to shortage of taxonomists and insufficient infrastructure to deal with such great biodiversity (i.e. taxonomic impediment), proposed remedies to accelerate species identification and descriptions include techniques that combine DNA-based identification and concise morphological description. The building of a DNA barcode reference database correlating meristic and genetic data was developed for 75 % of the Mucuri River basin's freshwater fish. We obtained a total of 141 DNA barcode sequences from 37 species belonging to 30 genera, 19 families, and 5 orders. Genetic distances within species, genera, and families were 0.74, 9.5, and 18.86 %, respectively. All species could be clearly identified by the DNA barcodes. Divergences between meristic morphological characteristics and DNA barcodes revealed two cryptic species among the Cyphocharax gilbert and Astyanax gr. bimaculatus specimens, and helped to identify two overlooked species within the Gymnotus and Astyanax taxa. Therefore, using a simplified model of neotropical biodiversity, we tested the efficiency of an integrative taxonomy approach for species discovery, identification of cryptic diversity, and accelerating biodiversity descriptions.
Raupach, Michael J.; Barco, Andrea; Steinke, Dirk; Beermann, Jan; Laakmann, Silke; Mohrbeck, Inga; Neumann, Hermann; Kihara, Terue C.; Pointner, Karin; Radulovici, Adriana; Segelken-Voigt, Alexandra; Wesse, Christina; Knebelsberger, Thomas
2015-01-01
During the last years DNA barcoding has become a popular method of choice for molecular specimen identification. Here we present a comprehensive DNA barcode library of various crustacean taxa found in the North Sea, one of the most extensively studied marine regions of the world. Our data set includes 1,332 barcodes covering 205 species, including taxa of the Amphipoda, Copepoda, Decapoda, Isopoda, Thecostraca, and others. This dataset represents the most extensive DNA barcode library of the Crustacea in terms of species number to date. By using the Barcode of Life Data Systems (BOLD), unique BINs were identified for 198 (96.6%) of the analyzed species. Six species were characterized by two BINs (2.9%), and three BINs were found for the amphipod species Gammarus salinus Spooner, 1947 (0.4%). Intraspecific distances with values higher than 2.2% were revealed for 13 species (6.3%). Exceptionally high distances of up to 14.87% between two distinct but monophyletic clusters were found for the parasitic copepod Caligus elongatus Nordmann, 1832, supporting the results of previous studies that indicated the existence of an overlooked sea louse species. In contrast to these high distances, haplotype-sharing was observed for two decapod spider crab species, Macropodia parva Van Noort & Adema, 1985 and Macropodia rostrata (Linnaeus, 1761), underlining the need for a taxonomic revision of both species. Summarizing the results, our study confirms the application of DNA barcodes as highly effective identification system for the analyzed marine crustaceans of the North Sea and represents an important milestone for modern biodiversity assessment studies using barcode sequences. PMID:26417993
Raupach, Michael J; Hendrich, Lars; Küchler, Stefan M; Deister, Fabian; Morinière, Jérome; Gossner, Martin M
2014-01-01
During the last few years, DNA barcoding has become an efficient method for the identification of species. In the case of insects, most published DNA barcoding studies focus on species of the Ephemeroptera, Trichoptera, Hymenoptera and especially Lepidoptera. In this study we test the efficiency of DNA barcoding for true bugs (Hemiptera: Heteroptera), an ecological and economical highly important as well as morphologically diverse insect taxon. As part of our study we analyzed DNA barcodes for 1742 specimens of 457 species, comprising 39 families of the Heteroptera. We found low nucleotide distances with a minimum pairwise K2P distance <2.2% within 21 species pairs (39 species). For ten of these species pairs (18 species), minimum pairwise distances were zero. In contrast to this, deep intraspecific sequence divergences with maximum pairwise distances >2.2% were detected for 16 traditionally recognized and valid species. With a successful identification rate of 91.5% (418 species) our study emphasizes the use of DNA barcodes for the identification of true bugs and represents an important step in building-up a comprehensive barcode library for true bugs in Germany and Central Europe as well. Our study also highlights the urgent necessity of taxonomic revisions for various taxa of the Heteroptera, with a special focus on various species of the Miridae. In this context we found evidence for on-going hybridization events within various taxonomically challenging genera (e.g. Nabis Latreille, 1802 (Nabidae), Lygus Hahn, 1833 (Miridae), Phytocoris Fallén, 1814 (Miridae)) as well as the putative existence of cryptic species (e.g. Aneurus avenius (Duffour, 1833) (Aradidae) or Orius niger (Wolff, 1811) (Anthocoridae)).
Raupach, Michael J.; Hendrich, Lars; Küchler, Stefan M.; Deister, Fabian; Morinière, Jérome; Gossner, Martin M.
2014-01-01
During the last few years, DNA barcoding has become an efficient method for the identification of species. In the case of insects, most published DNA barcoding studies focus on species of the Ephemeroptera, Trichoptera, Hymenoptera and especially Lepidoptera. In this study we test the efficiency of DNA barcoding for true bugs (Hemiptera: Heteroptera), an ecological and economical highly important as well as morphologically diverse insect taxon. As part of our study we analyzed DNA barcodes for 1742 specimens of 457 species, comprising 39 families of the Heteroptera. We found low nucleotide distances with a minimum pairwise K2P distance <2.2% within 21 species pairs (39 species). For ten of these species pairs (18 species), minimum pairwise distances were zero. In contrast to this, deep intraspecific sequence divergences with maximum pairwise distances >2.2% were detected for 16 traditionally recognized and valid species. With a successful identification rate of 91.5% (418 species) our study emphasizes the use of DNA barcodes for the identification of true bugs and represents an important step in building-up a comprehensive barcode library for true bugs in Germany and Central Europe as well. Our study also highlights the urgent necessity of taxonomic revisions for various taxa of the Heteroptera, with a special focus on various species of the Miridae. In this context we found evidence for on-going hybridization events within various taxonomically challenging genera (e.g. Nabis Latreille, 1802 (Nabidae), Lygus Hahn, 1833 (Miridae), Phytocoris Fallén, 1814 (Miridae)) as well as the putative existence of cryptic species (e.g. Aneurus avenius (Duffour, 1833) (Aradidae) or Orius niger (Wolff, 1811) (Anthocoridae)). PMID:25203616
Hawlitschek, Oliver; Porch, Nick; Hendrich, Lars; Balke, Michael
2011-02-09
DNA sequencing techniques used to estimate biodiversity, such as DNA barcoding, may reveal cryptic species. However, disagreements between barcoding and morphological data have already led to controversy. Species delimitation should therefore not be based on mtDNA alone. Here, we explore the use of nDNA and bioclimatic modelling in a new species of aquatic beetle revealed by mtDNA sequence data. The aquatic beetle fauna of Australia is characterised by high degrees of endemism, including local radiations such as the genus Antiporus. Antiporus femoralis was previously considered to exist in two disjunct, but morphologically indistinguishable populations in south-western and south-eastern Australia. We constructed a phylogeny of Antiporus and detected a deep split between these populations. Diagnostic characters from the highly variable nuclear protein encoding arginine kinase gene confirmed the presence of two isolated populations. We then used ecological niche modelling to examine the climatic niche characteristics of the two populations. All results support the status of the two populations as distinct species. We describe the south-western species as Antiporus occidentalis sp.n. In addition to nDNA sequence data and extended use of mitochondrial sequences, ecological niche modelling has great potential for delineating morphologically cryptic species.
Hawlitschek, Oliver; Porch, Nick; Hendrich, Lars; Balke, Michael
2011-01-01
Background DNA sequencing techniques used to estimate biodiversity, such as DNA barcoding, may reveal cryptic species. However, disagreements between barcoding and morphological data have already led to controversy. Species delimitation should therefore not be based on mtDNA alone. Here, we explore the use of nDNA and bioclimatic modelling in a new species of aquatic beetle revealed by mtDNA sequence data. Methodology/Principal Findings The aquatic beetle fauna of Australia is characterised by high degrees of endemism, including local radiations such as the genus Antiporus. Antiporus femoralis was previously considered to exist in two disjunct, but morphologically indistinguishable populations in south-western and south-eastern Australia. We constructed a phylogeny of Antiporus and detected a deep split between these populations. Diagnostic characters from the highly variable nuclear protein encoding arginine kinase gene confirmed the presence of two isolated populations. We then used ecological niche modelling to examine the climatic niche characteristics of the two populations. All results support the status of the two populations as distinct species. We describe the south-western species as Antiporus occidentalis sp.n. Conclusion/Significance In addition to nDNA sequence data and extended use of mitochondrial sequences, ecological niche modelling has great potential for delineating morphologically cryptic species. PMID:21347370
NASA Astrophysics Data System (ADS)
von Beeren, Christoph; Stoeckle, Mark Y.; Xia, Joyce; Burke, Griffin; Kronauer, Daniel J. C.
2015-02-01
DNA barcoding promises to be a useful tool to identify pest species assuming adequate representation of genetic variants in a reference library. Here we examined mitochondrial DNA barcodes in a global urban pest, the American cockroach (Periplaneta americana). Our sampling effort generated 284 cockroach specimens, most from New York City, plus 15 additional U.S. states and six other countries, enabling the first large-scale survey of P. americana barcode variation. Periplaneta americana barcode sequences (n = 247, including 24 GenBank records) formed a monophyletic lineage separate from other Periplaneta species. We found three distinct P. americana haplogroups with relatively small differences within (<=0.6%) and larger differences among groups (2.4%-4.7%). This could be interpreted as indicative of multiple cryptic species. However, nuclear DNA sequences (n = 77 specimens) revealed extensive gene flow among mitochondrial haplogroups, confirming a single species. This unusual genetic pattern likely reflects multiple introductions from genetically divergent source populations, followed by interbreeding in the invasive range. Our findings highlight the need for comprehensive reference databases in DNA barcoding studies, especially when dealing with invasive populations that might be derived from multiple genetically distinct source populations.
Assembling and auditing a comprehensive DNA barcode reference library for European marine fishes.
Oliveira, L M; Knebelsberger, T; Landi, M; Soares, P; Raupach, M J; Costa, F O
2016-12-01
A large-scale comprehensive reference library of DNA barcodes for European marine fishes was assembled, allowing the evaluation of taxonomic uncertainties and species genetic diversity that were otherwise hidden in geographically restricted studies. A total of 4118 DNA barcodes were assigned to 358 species generating 366 Barcode Index Numbers (BIN). Initial examination revealed as much as 141 BIN discordances (more than one species in each BIN). After implementing an auditing and five-grade (A-E) annotation protocol, the number of discordant species BINs was reduced to 44 (13% grade E), while concordant species BINs amounted to 271 (78% grades A and B) and 14 other had insufficient data (grade D). Fifteen species displayed comparatively high intraspecific divergences ranging from 2·6 to 18·5% (grade C), which is biologically paramount information to be considered in fish species monitoring and stock assessment. On balance, this compilation contributed to the detection of 59 European fish species probably in need of taxonomic clarification or re-evaluation. The generalized implementation of an auditing and annotation protocol for reference libraries of DNA barcodes is recommended. © 2016 The Fisheries Society of the British Isles.
Lyons, Eli; Sheridan, Paul; Tremmel, Georg; Miyano, Satoru; Sugano, Sumio
2017-10-24
High-throughput screens allow for the identification of specific biomolecules with characteristics of interest. In barcoded screens, DNA barcodes are linked to target biomolecules in a manner allowing for the target molecules making up a library to be identified by sequencing the DNA barcodes using Next Generation Sequencing. To be useful in experimental settings, the DNA barcodes in a library must satisfy certain constraints related to GC content, homopolymer length, Hamming distance, and blacklisted subsequences. Here we report a novel framework to quickly generate large-scale libraries of DNA barcodes for use in high-throughput screens. We show that our framework dramatically reduces the computation time required to generate large-scale DNA barcode libraries, compared with a naїve approach to DNA barcode library generation. As a proof of concept, we demonstrate that our framework is able to generate a library consisting of one million DNA barcodes for use in a fragment antibody phage display screening experiment. We also report generating a general purpose one billion DNA barcode library, the largest such library yet reported in literature. Our results demonstrate the value of our novel large-scale DNA barcode library generation framework for use in high-throughput screening applications.
Nascimento, M H S; Almeida, M S; Veira, M N S; Limeira Filho, D; Lima, R C; Barros, M C; Fraga, E C
2016-08-29
DNA barcoding is a useful complementary tool for use in traditional taxonomic studies due to its ability to detect cryptic species, and may be particularly efficient in the identification of fish species. The fish fauna of the Itapecuru River represents an important fishery resource in the Brazilian State of Maranhão, although it is currently suffering increasing degradation as a result of anthropogenic impacts. Therefore, DNA barcoding was used in the present study to identify fish species and establish a database of the rich freshwater fish fauna of Maranhão. A total of 440 specimens were analyzed, corresponding to 64 species belonging to 59 genera, 31 families, and 10 orders. Overall, 92.19% of these species could be identified by DNA barcoding, and were characterized by low levels (average 0.80%) of intra-specific divergence. However, five species (Anableps anableps, Gymnotus carapo, Sciades couma, Pseudauchenipterus nodosus, and Leporinus piau) presented values of mean genetic divergence above 3%, indicating the existence of cryptic diversity in these fishes. The DNA barcoding approach permitted the analysis of a large number of specimens and facilitated the discrimination and identification of closely related fish species in the Itapecuru Basin.
Dentinger, Bryn T M; Margaritescu, Simona; Moncalvo, Jean-Marc
2010-07-01
We present two methods for DNA extraction from fresh and dried mushrooms that are adaptable to high-throughput sequencing initiatives, such as DNA barcoding. Our results show that these protocols yield ∼85% sequencing success from recently collected materials. Tests with both recent (<2 year) and older (>100 years) specimens reveal that older collections have low success rates and may be an inefficient resource for populating a barcode database. However, our method of extracting DNA from herbarium samples using small amount of tissue is reliable and could be used for important historical specimens. The application of these protocols greatly reduces time, and therefore cost, of generating DNA sequences from mushrooms and other fungi vs. traditional extraction methods. The efficiency of these methods illustrates that standardization and streamlining of sample processing should be shifted from the laboratory to the field. © 2009 Blackwell Publishing Ltd.
DNA barcodes for 1/1000 of the animal kingdom.
Hebert, Paul D N; Dewaard, Jeremy R; Landry, Jean-François
2010-06-23
This study reports DNA barcodes for more than 1300 Lepidoptera species from the eastern half of North America, establishing that 99.3 per cent of these species possess diagnostic barcode sequences. Intraspecific divergences averaged just 0.43 per cent among this assemblage, but most values were lower. The mean was elevated by deep barcode divergences (greater than 2%) in 5.1 per cent of the species, often involving the sympatric occurrence of two barcode clusters. A few of these cases have been analysed in detail, revealing species overlooked by the current taxonomic system. This study also provided a large-scale test of the extent of regional divergence in barcode sequences, indicating that geographical differentiation in the Lepidoptera of eastern North America is small, even when comparisons involve populations as much as 2800 km apart. The present results affirm that a highly effective system for the identification of Lepidoptera in this region can be built with few records per species because of the limited intra-specific variation. As most terrestrial and marine taxa are likely to possess a similar pattern of population structure, an effective DNA-based identification system can be developed with modest effort.
Ebihara, Atsushi; Nitta, Joel H; Ito, Motomi
2010-12-08
DNA barcoding is expected to be an effective identification tool for organisms with heteromorphic generations such as pteridophytes, which possess a morphologically simple gametophyte generation. Although a reference data set including complete coverage of the target local flora/fauna is necessary for accurate identification, DNA barcode studies including such rich taxonomic sampling on a countrywide scale are lacking. The Japanese pteridophyte flora (733 taxa including subspecies and varieties) was used to test the utility of two plastid DNA barcode regions (rbcL and trnH-psbA) with the intention of developing an identification system for native gametophytes. DNA sequences were obtained from each of 689 (94.0%) taxa for rbcL and 617 (84.2%) taxa for trnH-psbA. Mean interspecific divergence values across all taxon pairs (K2P genetic distances) did not reveal a significant difference in rate between trnH-psbA and rbcL, but mean K2P distances of each genus showed significant heterogeneity according to systematic position. The minimum fail rate of taxon discrimination in an identification test using BLAST (12.52%) was obtained when rbcL and trnH-psbA were combined, and became lower in datasets excluding infraspecific taxa or apogamous taxa, or including sexual diploids only. This study demonstrates the overall effectiveness of DNA barcodes for species identification in the Japanese pteridophyte flora. Although this flora is characterized by a high occurrence of apogamous taxa that pose a serious challenge to identification using DNA barcodes, such taxa are limited to a small number of genera, and only minimally detract from the overall success rate. In the case that a query sequence is matched to a known apogamous genus, routine species identification may not be possible. Otherwise, DNA barcoding is a practical tool for identification of most Japanese pteridophytes, and is especially anticipated to be helpful for identification of non-hybridizing gametophytes.
Hou, Gang; Chen, Wei-Tao; Lu, Huo-Sheng; Cheng, Fei; Xie, Song-Guang
2018-01-01
DNA barcodes were studied for 1,353 specimens representing 272 morphological species belonging to 149 genera and 55 families of Perciformes from the South China Sea (SCS). The average Kimura 2-parameter (K2P) distances within species, genera and families were 0.31%, 8.71% and 14.52%, respectively. A neighbour-joining (NJ) tree, Bayesian inference (BI) and maximum-likelihood (ML) trees and Automatic Barcode Gap Discovery (ABGD) revealed 260, 253 and 259 single-species-representing clusters, respectively. Barcoding gap analysis (BGA) demonstrated that barcode gaps were present for 178 of 187 species analysed with multiple specimens (95.2%), with the minimum interspecific distance to the nearest neighbour larger than the maximum intraspecific distance. A group of three Thunnus species (T. albacares, T. obesus and T. tonggol), a pair of Gerres species (G. oyena and G. japonicus), a pair of Istiblennius species (I. edentulous and I. lineatus) and a pair of Uranoscopus species (U. oligolepis and U. kaianus) were observed with low interspecific distances and overlaps between intra- and interspecific genetic distances. Three species (Apogon ellioti, Naucrates ductor and Psenopsis anomala) showed deep intraspecific divergences and generated two lineages each, suggesting the possibility of cryptic species. Our results demonstrated that DNA barcodes are highly reliable for delineating species of Perciformes in the SCS. The DNA barcode library established in this study will shed light on further research on the diversity of Perciformes in the SCS. © 2017 John Wiley & Sons Ltd.
Masunaga, Nanae; Kagara, Naofumi; Motooka, Daisuke; Nakamura, Shota; Miyake, Tomohiro; Tanei, Tomonori; Naoi, Yasuto; Shimoda, Masafumi; Shimazu, Kenzo; Kim, Seung Jin; Noguchi, Shinzaburo
2018-01-01
We aimed to develop a highly sensitive method to detect ESR1 mutations in cell-free DNA (cfDNA) using next-generation sequencing with molecular barcode (MB-NGS) targeting the hotspot segment (c.1600-1713). The sensitivity of MB-NGS was tested using serially diluted ESR1 mutant DNA and then cfDNA samples from 34 patients with metastatic breast cancer were analyzed with MB-NGS. The results of MB-NGS were validated in comparison with conventional NGS and droplet digital PCR (ddPCR). MB-NGS showed a higher sensitivity (0.1%) than NGS without barcode (1%) by reducing background errors. Of the cfDNA samples from 34 patients with metastatic breast cancer, NGS without barcode revealed seven mutations in six patients (17.6%) and MB-NGS revealed six additional mutations including three mutations not reported in the COSMIC database of breast cancer, resulting in total 13 ESR1 mutations in ten patients (29.4%). Regarding the three hotspot mutations, all the patients with mutations detected by MB-NGS had identical mutations detected by droplet digital PCR (ddPCR), and mutant allele frequency correlated very well between both (r = 0.850, p < 0.01). Moreover, all the patients without these mutations by MB-NGS were found to have no mutations by ddPCR. In conclusion, MB-NGS could successfully detect ESR1 mutations in cfDNA with a higher sensitivity of 0.1% than conventional NGS and was considered as clinically useful as ddPCR.
A DNA Mini-Barcoding System for Authentication of Processed Fish Products.
Shokralla, Shadi; Hellberg, Rosalee S; Handy, Sara M; King, Ian; Hajibabaei, Mehrdad
2015-10-30
Species substitution is a form of seafood fraud for the purpose of economic gain. DNA barcoding utilizes species-specific DNA sequence information for specimen identification. Previous work has established the usability of short DNA sequences-mini-barcodes-for identification of specimens harboring degraded DNA. This study aims at establishing a DNA mini-barcoding system for all fish species commonly used in processed fish products in North America. Six mini-barcode primer pairs targeting short (127-314 bp) fragments of the cytochrome c oxidase I (CO1) DNA barcode region were developed by examining over 8,000 DNA barcodes from species in the U.S. Food and Drug Administration (FDA) Seafood List. The mini-barcode primer pairs were then tested against 44 processed fish products representing a range of species and product types. Of the 44 products, 41 (93.2%) could be identified at the species or genus level. The greatest mini-barcoding success rate found with an individual primer pair was 88.6% compared to 20.5% success rate achieved by the full-length DNA barcode primers. Overall, this study presents a mini-barcoding system that can be used to identify a wide range of fish species in commercial products and may be utilized in high throughput DNA sequencing for authentication of heavily processed fish products.
A checklist of the bats of Peninsular Malaysia and progress towards a DNA barcode reference library.
Lim, Voon-Ching; Ramli, Rosli; Bhassu, Subha; Wilson, John-James
2017-01-01
Several published checklists of bat species have covered Peninsular Malaysia as part of a broader region and/or in combination with other mammal groups. Other researchers have produced comprehensive checklists for specific localities within the peninsula. To our knowledge, a comprehensive checklist of bats specifically for the entire geopolitical region of Peninsular Malaysia has never been published, yet knowing which species are present in Peninsular Malaysia and their distributions across the region are crucial in developing suitable conservation plans. Our literature search revealed that 110 bat species have been documented in Peninsular Malaysia; 105 species have precise locality records while five species lack recent and/or precise locality records. We retrieved 18 species from records dated before the year 2000 and seven species have only ever been recorded once. Our search of Barcode of Life Datasystems (BOLD) found that 86 (of the 110) species have public records of which 48 species have public DNA barcodes available from bats sampled in Peninsular Malaysia. Based on Neighbour-Joining tree analyses and the allocation of DNA barcodes to Barcode Index Number system (BINs) by BOLD, several DNA barcodes recorded under the same species name are likely to represent distinct taxa. We discuss these cases in detail and highlight the importance of further surveys to determine the occurences and resolve the taxonomy of particular bat species in Peninsular Malaysia, with implications for conservation priorities.
Zou, Shanmei; Fei, Cong; Wang, Chun; Gao, Zhan; Bao, Yachao; He, Meilin; Wang, Changhai
2016-01-01
Microalgae identification is extremely difficult. The efficiency of DNA barcoding in microalgae identification involves ideal gene markers and approaches employed, which however, is still under the way. Although Scenedesmus has obtained much research in producing lipids its identification is difficult. Here we present a comprehensive coalescent, distance and character-based DNA barcoding for 118 Scenedesmus strains based on rbcL, tufA, ITS and 16S. The four genes, and their combined data rbcL + tufA + ITS + 16S, rbcL + tufA and ITS + 16S were analyzed by all of GMYC, P ID, PTP, ABGD, and character-based barcoding respectively. It was apparent that the three combined gene data showed a higher proportion of resolution success than the single gene. In comparison, the GMYC and PTP analysis produced more taxonomic lineages. The ABGD generated various resolution in discrimination among the single and combined data. The character-based barcoding was proved to be the most effective approach for species discrimination in both single and combined data which produced consistent species identification. All the integrated results recovered 11 species, five out of which were revealed as potential cryptic species. We suggest that the character-based DNA barcoding together with other approaches based on multiple genes and their combined data could be more effective in microalgae diversity revelation. PMID:27827440
Zou, Shanmei; Fei, Cong; Wang, Chun; Gao, Zhan; Bao, Yachao; He, Meilin; Wang, Changhai
2016-11-09
Microalgae identification is extremely difficult. The efficiency of DNA barcoding in microalgae identification involves ideal gene markers and approaches employed, which however, is still under the way. Although Scenedesmus has obtained much research in producing lipids its identification is difficult. Here we present a comprehensive coalescent, distance and character-based DNA barcoding for 118 Scenedesmus strains based on rbcL, tufA, ITS and 16S. The four genes, and their combined data rbcL + tufA + ITS + 16S, rbcL + tufA and ITS + 16S were analyzed by all of GMYC, P ID, PTP, ABGD, and character-based barcoding respectively. It was apparent that the three combined gene data showed a higher proportion of resolution success than the single gene. In comparison, the GMYC and PTP analysis produced more taxonomic lineages. The ABGD generated various resolution in discrimination among the single and combined data. The character-based barcoding was proved to be the most effective approach for species discrimination in both single and combined data which produced consistent species identification. All the integrated results recovered 11 species, five out of which were revealed as potential cryptic species. We suggest that the character-based DNA barcoding together with other approaches based on multiple genes and their combined data could be more effective in microalgae diversity revelation.
Pramual, Pairot; Simwisat, Kusumart; Martin, Jon
2016-01-28
Chironomidae are a highly diverse group of insects. Members of this family are often included in programs monitoring the health of freshwater ecosystems. However, a difficulty in morphological identification, particularly of larval stages is the major obstacle to this application. In this study, we tested the efficiency of mitochondrial cytochrome c oxidase I (COI) sequences as the DNA barcoding region for species identification of Chironomidae in Thailand. The results revealed 14 species with a high success rate (>90%) for the correct species identification, which suggests the potential usefulness of the technique. However, some morphological species possess high (>3%) intraspecific genetic divergence that suggests these species could be species complexes and need further morphological or cytological examination. Sequence-based species delimitation analyses indicated that most specimens identified as Chironomus kiiensis, Tokunaga 1936, in Japan are conspecific with C. striatipennis, Kieffer 1912, although a small number form a separate cluster. A review of the descriptions of Kiefferulus tainanus (Kieffer 1912) and its junior synonym, K. biroi (Kieffer 1918), following our results, suggests that this synonymy is probably not correct and that K. tainanus occurs in Japan, China and Singapore, while K. biroi occurs in India and Thailand. Our results therefore revealed the usefulness of DNA barcoding for correct species identification of Chironomidae, particularly the immature stages. In addition, DNA barcodes could also uncover hidden diversity that can guide further taxonomic study, and offer a more efficient way to identify species than morphological analysis where large numbers of specimens are involved, provided the identifications of DNA barcodes in the databases are correct. Our studies indicate that this is not the case, and we identify cases of misidentifications for C. flaviplumus, Tokunaga 1940 and K. tainanus.
Bergmame, Laura; Huffman, Jane; Cole, Rebecca; Dayanandan, Selvadurai; Tkach, Vasyl; McLaughlin, J. Daniel
2011-01-01
Flukes belonging to Sphaeridiotrema are important parasites of waterfowl, and 2 morphologically similar species Sphaeridiotrema globulus and Sphaeridiotrema pseudoglobulus, have been implicated in waterfowl mortality in North America. Cytochrome oxidase I (barcode region) and partial LSU-rDNA sequences from specimens of S. globulus and S. pseudoglobulus, obtained from naturally and experimentally infected hosts from New Jersey and Quebec, respectively, confirmed that these species were distinct. Barcode sequences of the 2 species differed at 92 of 590 nucleotide positions (15.6%) and the translated sequences differed by 13 amino acid residues. Partial LSU-rDNA sequences differed at 29 of 1,208 nucleotide positions (2.4%). Additional barcode sequences from specimens collected from waterfowl in Wisconsin and Minnesota and morphometric data obtained from specimens acquired along the north shore of Lake Superior revealed the presence of S. pseudoglobulus in these areas. Although morphometric data suggested the presence of S. globulus in the Lake Superior sample, it was not found among the specimens sequenced from Wisconsin or Minnesota.
Bergmame, L.; Huffman, J.; Cole, R.; Dayanandan, S.; Tkach, V.; McLaughlin, J.D.
2011-01-01
Flukes belonging to Sphaeridiotrema are important parasites of waterfowl, and 2 morphologically similar species Sphaeridiotrema globulus and Sphaeridiotrema pseudoglobulus, have been implicated in waterfowl mortality in North America. Cytochrome oxidase I (barcode region) and partial LSU-rDNA sequences from specimens of S. globulus and S. pseudoglobulus, obtained from naturally and experimentally infected hosts from New Jersey and Quebec, respectively, confirmed that these species were distinct. Barcode sequences of the 2 species differed at 92 of 590 nucleotide positions (15.6%) and the translated sequences differed by 13 amino acid residues. Partial LSU-rDNA sequences differed at 29 of 1,208 nucleotide positions (2.4%). Additional barcode sequences from specimens collected from waterfowl in Wisconsin and Minnesota and morphometric data obtained from specimens acquired along the north shore of Lake Superior revealed the presence of S. pseudoglobulus in these areas. Although morphometric data suggested the presence of S. globulus in the Lake Superior sample, it was not found among the specimens sequenced from Wisconsin or Minnesota. ?? 2011 American Society of Parasitologists.
YUAN, QING-JUN; ZHANG, BIN; JIANG, DAN; ZHANG, WEN-JING; LIN, TSAI-YUN; WANG, NIAN-HE; CHIOU, SHU-JIAU; HUANG, LU-QI
2015-01-01
DNA barcodes have been increasingly used in authentication of medicinal plants, while their wide application in materia medica is limited in their accuracy due to incomplete sampling of species and absence of identification for materia medica. In this study, 95 leaf accessions of 23 species (including one variety) and materia medica of three Pharmacopoeia-recorded species of Angelica in China were collected to evaluate the effectiveness of four DNA barcodes (rbcL, matK, trnH-psbA and ITS). Our results showed that ITS provided the best discriminatory power by resolving 17 species as monophyletic lineages without shared alleles and exhibited the largest barcoding gap among the four single barcodes. The phylogenetic analysis of ITS showed that Levisticum officinale and Angelica sinensis were sister taxa, which indicates that L. officinale should be considered as a species of Angelica. The combination of ITS + rbcL + matK + trnH-psbA performed slight better discriminatory power than ITS, recovering 23 species without shared alleles and 19 species as monophyletic clades in ML tree. Authentication of materia medica using ITS revealed that the decoction pieces of A. sinensis and A. biserrata were partially adulterated with those of L. officinale, and the temperature around 80 °C processing A. dahurica decoction pieces obviously reduced the efficiency of PCR and sequencing. The examination of two cultivated varieties of A. dahurica from different localities indicated that the four DNA barcodes are inefficient for discriminating geographical authenticity of conspecific materia medica. This study provides an empirical paradigm in identification of medicinal plants and their materia medica using DNA barcodes. PMID:24961287
Yuan, Qing-Jun; Zhang, Bin; Jiang, Dan; Zhang, Wen-Jing; Lin, Tsai-Yun; Wang, Nian-He; Chiou, Shu-Jiau; Huang, Lu-Qi
2015-03-01
DNA barcodes have been increasingly used in authentication of medicinal plants, while their wide application in materia medica is limited in their accuracy due to incomplete sampling of species and absence of identification for materia medica. In this study, 95 leaf accessions of 23 species (including one variety) and materia medica of three Pharmacopoeia-recorded species of Angelica in China were collected to evaluate the effectiveness of four DNA barcodes (rbcL, matK, trnH-psbA and ITS). Our results showed that ITS provided the best discriminatory power by resolving 17 species as monophyletic lineages without shared alleles and exhibited the largest barcoding gap among the four single barcodes. The phylogenetic analysis of ITS showed that Levisticum officinale and Angelica sinensis were sister taxa, which indicates that L. officinale should be considered as a species of Angelica. The combination of ITS + rbcL + matK + trnH-psbA performed slight better discriminatory power than ITS, recovering 23 species without shared alleles and 19 species as monophyletic clades in ML tree. Authentication of materia medica using ITS revealed that the decoction pieces of A. sinensis and A. biserrata were partially adulterated with those of L. officinale, and the temperature around 80 °C processing A. dahurica decoction pieces obviously reduced the efficiency of PCR and sequencing. The examination of two cultivated varieties of A. dahurica from different localities indicated that the four DNA barcodes are inefficient for discriminating geographical authenticity of conspecific materia medica. This study provides an empirical paradigm in identification of medicinal plants and their materia medica using DNA barcodes. © 2014 The Authors. Molecular Ecology Resources Published by John Wiley & Sons Ltd.
DNA barcode goes two-dimensions: DNA QR code web server.
Liu, Chang; Shi, Linchun; Xu, Xiaolan; Li, Huan; Xing, Hang; Liang, Dong; Jiang, Kun; Pang, Xiaohui; Song, Jingyuan; Chen, Shilin
2012-01-01
The DNA barcoding technology uses a standard region of DNA sequence for species identification and discovery. At present, "DNA barcode" actually refers to DNA sequences, which are not amenable to information storage, recognition, and retrieval. Our aim is to identify the best symbology that can represent DNA barcode sequences in practical applications. A comprehensive set of sequences for five DNA barcode markers ITS2, rbcL, matK, psbA-trnH, and CO1 was used as the test data. Fifty-three different types of one-dimensional and ten two-dimensional barcode symbologies were compared based on different criteria, such as coding capacity, compression efficiency, and error detection ability. The quick response (QR) code was found to have the largest coding capacity and relatively high compression ratio. To facilitate the further usage of QR code-based DNA barcodes, a web server was developed and is accessible at http://qrfordna.dnsalias.org. The web server allows users to retrieve the QR code for a species of interests, convert a DNA sequence to and from a QR code, and perform species identification based on local and global sequence similarities. In summary, the first comprehensive evaluation of various barcode symbologies has been carried out. The QR code has been found to be the most appropriate symbology for DNA barcode sequences. A web server has also been constructed to allow biologists to utilize QR codes in practical DNA barcoding applications.
Prado, Blanca R.; Pozo, Carmen; Valdez-Moreno, Martha; Hebert, Paul D. N.
2011-01-01
Background Recent studies have demonstrated the utility of DNA barcoding in the discovery of overlooked species and in the connection of immature and adult stages. In this study, we use DNA barcoding to examine diversity patterns in 121 species of Nymphalidae from the Yucatan Peninsula in Mexico. Our results suggest the presence of cryptic species in 8 of these 121 taxa. As well, the reference database derived from the analysis of adult specimens allowed the identification of nymphalid caterpillars providing new details on host plant use. Methodology/Principal Findings We gathered DNA barcode sequences from 857 adult Nymphalidae representing 121 different species. This total includes four species (Adelpha iphiclus, Adelpha malea, Hamadryas iphtime and Taygetis laches) that were initially overlooked because of their close morphological similarity to other species. The barcode results showed that each of the 121 species possessed a diagnostic array of barcode sequences. In addition, there was evidence of cryptic taxa; seven species included two barcode clusters showing more than 2% sequence divergence while one species included three clusters. All 71 nymphalid caterpillars were identified to a species level by their sequence congruence to adult sequences. These caterpillars represented 16 species, and included Hamadryas julitta, an endemic species from the Yucatan Peninsula whose larval stages and host plant (Dalechampia schottii, also endemic to the Yucatan Peninsula) were previously unknown. Conclusions/Significance This investigation has revealed overlooked species in a well-studied museum collection of nymphalid butterflies and suggests that there is a substantial incidence of cryptic species that await full characterization. The utility of barcoding in the rapid identification of caterpillars also promises to accelerate the assembly of information on life histories, a particularly important advance for hyperdiverse tropical insect assemblages. PMID:22132140
Kang, Tae Hwa; Lee, Kwang-Su; Lee, Heung-Sik
2015-08-01
DNA barcoding and morphological analyses of Korean Lymantria (Erebidae, Lepidoptera) were conducted for quarantine inspection. In DNA barcoding, Lymantria dispar identified through quarantine inspection was distinguished as three species, L. dispar asiatica, L. albescens, and L. xylina. Lymantria monacha, which is known as a single species in Korea, is revealed as containing three species, L. monacha, L. minomonis, and L. sugii. At the subspecies level, L. dispar dispar formed a single cluster, whereas L. d. asiatica and L. d. japonica formed a cluster containing both subspecies. In morphological re-examination on DNA barcoding results, L. dispar was distinguished from L. albescens by wing pattern, and from L. xylina by papillae anale. L. monacha and the related species were hard to be distinct from each other by using wing pattern, but it was easily distinct through comparison of genitalia. Therefore, DNA barcoding led to accurate identification in species level, but in subspecies level, only a taxon showing geographically far distance was discriminated from the others. These results may provide a taxonomic outline of the Korean Lymantria fauna and may be used as an identification reference for Lymantria species during quarantine inspection. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Identification of species adulteration in traded medicinal plant raw drugs using DNA barcoding.
Nithaniyal, Stalin; Vassou, Sophie Lorraine; Poovitha, Sundar; Raju, Balaji; Parani, Madasamy
2017-02-01
Plants are the major source of therapeutic ingredients in complementary and alternative medicine (CAM). However, species adulteration in traded medicinal plant raw drugs threatens the reliability and safety of CAM. Since morphological features of medicinal plants are often not intact in the raw drugs, DNA barcoding was employed for species identification. Adulteration in 112 traded raw drugs was tested after creating a reference DNA barcode library consisting of 1452 rbcL and matK barcodes from 521 medicinal plant species. Species resolution of this library was 74.4%, 90.2%, and 93.0% for rbcL, matK, and rbcL + matK, respectively. DNA barcoding revealed adulteration in about 20% of the raw drugs, and at least 6% of them were derived from plants with completely different medicinal or toxic properties. Raw drugs in the form of dried roots, powders, and whole plants were found to be more prone to adulteration than rhizomes, fruits, and seeds. Morphological resemblance, co-occurrence, mislabeling, confusing vernacular names, and unauthorized or fraudulent substitutions might have contributed to species adulteration in the raw drugs. Therefore, this library can be routinely used to authenticate traded raw drugs for the benefit of all stakeholders: traders, consumers, and regulatory agencies.
BioBarcode: a general DNA barcoding database and server platform for Asian biodiversity resources.
Lim, Jeongheui; Kim, Sang-Yoon; Kim, Sungmin; Eo, Hae-Seok; Kim, Chang-Bae; Paek, Woon Kee; Kim, Won; Bhak, Jong
2009-12-03
DNA barcoding provides a rapid, accurate, and standardized method for species-level identification using short DNA sequences. Such a standardized identification method is useful for mapping all the species on Earth, particularly when DNA sequencing technology is cheaply available. There are many nations in Asia with many biodiversity resources that need to be mapped and registered in databases. We have built a general DNA barcode data processing system, BioBarcode, with open source software - which is a general purpose database and server. It uses mySQL RDBMS 5.0, BLAST2, and Apache httpd server. An exemplary database of BioBarcode has around 11,300 specimen entries (including GenBank data) and registers the biological species to map their genetic relationships. The BioBarcode database contains a chromatogram viewer which improves the performance in DNA sequence analyses. Asia has a very high degree of biodiversity and the BioBarcode database server system aims to provide an efficient bioinformatics protocol that can be freely used by Asian researchers and research organizations interested in DNA barcoding. The BioBarcode promotes the rapid acquisition of biological species DNA sequence data that meet global standards by providing specialized services, and provides useful tools that will make barcoding cheaper and faster in the biodiversity community such as standardization, depository, management, and analysis of DNA barcode data. The system can be downloaded upon request, and an exemplary server has been constructed with which to build an Asian biodiversity system http://www.asianbarcode.org.
Ten years of barcoding at the African Centre for DNA Barcoding.
Bezeng, B S; Davies, T J; Daru, B H; Kabongo, R M; Maurin, O; Yessoufou, K; van der Bank, H; van der Bank, M
2017-07-01
The African Centre for DNA Barcoding (ACDB) was established in 2005 as part of a global initiative to accurately and rapidly survey biodiversity using short DNA sequences. The mitochondrial cytochrome c oxidase 1 gene (CO1) was rapidly adopted as the de facto barcode for animals. Following the evaluation of several candidate loci for plants, the Plant Working Group of the Consortium for the Barcoding of Life in 2009 recommended that two plastid genes, rbcLa and matK, be adopted as core DNA barcodes for terrestrial plants. To date, numerous studies continue to test the discriminatory power of these markers across various plant lineages. Over the past decade, we at the ACDB have used these core DNA barcodes to generate a barcode library for southern Africa. To date, the ACDB has contributed more than 21 000 plant barcodes and over 3000 CO1 barcodes for animals to the Barcode of Life Database (BOLD). Building upon this effort, we at the ACDB have addressed questions related to community assembly, biogeography, phylogenetic diversification, and invasion biology. Collectively, our work demonstrates the diverse applications of DNA barcoding in ecology, systematics, evolutionary biology, and conservation.
Building a DNA barcode library of Alaska's non-marine arthropods.
Sikes, Derek S; Bowser, Matthew; Morton, John M; Bickford, Casey; Meierotto, Sarah; Hildebrandt, Kyndall
2017-03-01
Climate change may result in ecological futures with novel species assemblages, trophic mismatch, and mass extinction. Alaska has a limited taxonomic workforce to address these changes. We are building a DNA barcode library to facilitate a metabarcoding approach to monitoring non-marine arthropods. Working with the Canadian Centre for DNA Barcoding, we obtained DNA barcodes from recently collected and authoritatively identified specimens in the University of Alaska Museum (UAM) Insect Collection and the Kenai National Wildlife Refuge collection. We submitted tissues from 4776 specimens, of which 81% yielded DNA barcodes representing 1662 species and 1788 Barcode Index Numbers (BINs), of primarily terrestrial, large-bodied arthropods. This represents 84% of the species available for DNA barcoding in the UAM Insect Collection. There are now 4020 Alaskan arthropod species represented by DNA barcodes, after including all records in Barcode of Life Data Systems (BOLD) of species that occur in Alaska - i.e., 48.5% of the 8277 Alaskan, non-marine-arthropod, named species have associated DNA barcodes. An assessment of the identification power of the library in its current state yielded fewer species-level identifications than expected, but the results were not discouraging. We believe we are the first to deliberately begin development of a DNA barcode library of the entire arthropod fauna for a North American state or province. Although far from complete, this library will become increasingly valuable as more species are added and costs to obtain DNA sequences fall.
Zhou, Changqing; Kandemir, Irfan; Walsh, Douglas B; Zalom, Frank G; Lavine, Laura Corley
2012-01-01
The western tarnished plant bug Lygus hesperus is an economically important pest that belongs to a complex of morphologically similar species that makes identification problematic. The present study provides evidence for the use of DNA barcodes from populations of L. hesperus from the western United States of America for accurate identification. This study reports DNA barcodes for 134 individuals of the western tarnished plant bug from alfalfa and strawberry agricultural fields in the western United States of America. Sequence divergence estimates of <3% reveal that morphologically variable individuals presumed to be L. hesperus were accurately identified. Paired estimates of F(st) and subsequent estimates of gene flow show that geographically distinct populations of L. hesperus are genetically similar. Therefore, our results support and reinforce the relatively recent (<100 years) migration of the western tarnished plant bug into agricultural habitats across the western United States. This study reveals that despite wide host plant usage and phenotypically plastic morphological traits, the commonly recognized western tarnished plant bug belongs to a single species, Lygus hesperus. In addition, no significant genetic structure was found for the geographically diverse populations of western tarnished plant bug used in this study.
Chen, Rui; Jiang, Li-Yun; Chen, Jing; Qiao, Ge-Xia
2016-01-01
The mountains of southwest China are one of the hot spots of biodiversity in the world. However, the high-altitude fauna that inhabit these mountains remain a mystery. In this study, the species diversity of the aphids of the genus Cinara from the high-altitude coniferous forests was first assessed, and then the processes and the mechanisms of speciation were discussed. Three hundreds and four aphid samples that contained 3040 individuals were collected during fourteen field surveys. The molecular clusters derived from the DNA barcodes were used to explore the species diversity. Notably, the aphid alpha-diversity was high, with as many as 94 candidate species, and furthermore, 86.2% of the species collected had not been previously recorded. The centers of aphid species richness corresponded to the distributional pattern of the diversity of the host conifer plant species. The divergence time revealed that following the uplift of the Qinghai-Tibetan Plateau during the Pleistocene, the changes in the climate, ecology and host habitats were likely the most important factors that drove the rapid process of evolutionary radiation in the aphids. Our findings revealed the high species diversity of the aphids with DNA barcoding. PMID:26838797
A checklist of the bats of Peninsular Malaysia and progress towards a DNA barcode reference library
Ramli, Rosli; Bhassu, Subha
2017-01-01
Several published checklists of bat species have covered Peninsular Malaysia as part of a broader region and/or in combination with other mammal groups. Other researchers have produced comprehensive checklists for specific localities within the peninsula. To our knowledge, a comprehensive checklist of bats specifically for the entire geopolitical region of Peninsular Malaysia has never been published, yet knowing which species are present in Peninsular Malaysia and their distributions across the region are crucial in developing suitable conservation plans. Our literature search revealed that 110 bat species have been documented in Peninsular Malaysia; 105 species have precise locality records while five species lack recent and/or precise locality records. We retrieved 18 species from records dated before the year 2000 and seven species have only ever been recorded once. Our search of Barcode of Life Datasystems (BOLD) found that 86 (of the 110) species have public records of which 48 species have public DNA barcodes available from bats sampled in Peninsular Malaysia. Based on Neighbour-Joining tree analyses and the allocation of DNA barcodes to Barcode Index Number system (BINs) by BOLD, several DNA barcodes recorded under the same species name are likely to represent distinct taxa. We discuss these cases in detail and highlight the importance of further surveys to determine the occurences and resolve the taxonomy of particular bat species in Peninsular Malaysia, with implications for conservation priorities. PMID:28742835
Huemer, Peter; Mutanen, Marko; Sefc, Kristina M; Hebert, Paul D N
2014-01-01
This study examines the performance of DNA barcodes (mt cytochrome c oxidase 1 gene) in the identification of 1004 species of Lepidoptera shared by two localities (Finland, Austria) that are 1600 km apart. Maximum intraspecific distances for the pooled data were less than 2% for 880 species (87.6%), while deeper divergence was detected in 124 species. Despite such variation, the overall DNA barcode library possessed diagnostic COI sequences for 98.8% of the taxa. Because a reference library based on Finnish specimens was highly effective in identifying specimens from Austria, we conclude that barcode libraries based on regional sampling can often be effective for a much larger area. Moreover, dispersal ability (poor, good) and distribution patterns (disjunct, fragmented, continuous, migratory) had little impact on levels of intraspecific geographic divergence. Furthermore, the present study revealed that, despite the intensity of past taxonomic work on European Lepidoptera, nearly 20% of the species shared by Austria and Finland require further work to clarify their status. Particularly discordant BIN (Barcode Index Number) cases should be checked to ascertain possible explanatory factors such as incorrect taxonomy, hybridization, introgression, and Wolbachia infections.
Olivar, Jay Edneil C; Alaba, Joanner Paulus Erik P; Atienza, Jose Francisco M; Tan, Jerick Jeffrey S; Umali, Maximo T; Alejandro, Grecebio Jonathan D
2016-05-01
The majority of the population in the Philippines relies on herbal products as their primary source for their healthcare needs. After the recognition of Vitex negundo L. (lagundi) as an important and effective alternative medicine for cough, sore throat, asthma and fever by the Philippine Department of Health (DOH), there was an increase in the production of lagundi-based herbal products in the form of teas, capsules and syrups. The efficiency of these products is greatly reliant on the use of authentic plant material, and to this day no standard protocol has been established to authenticate plant materials. DNA barcoding offers a quick and reliable species authentication tool, but its application to plant material has been less successful due to (1) lack of a standard DNA barcoding loci in plants and (2) poor DNA yield from powderised plant products. This study reports the successful application of DNA barcoding in the authentication of five V. negundo herbal products sold in the Philippines. Also, the first standard reference material (SRM) herbal library for the recognition of authentic V. negundo samples was established using 42 gene accessions of ITS, psbA-trnH and matK barcoding loci. Authentication of the herbal products utilised the SRM following the BLASTn and maximum-likelihood (ML) tree construction criterion. Barcode sequences were retrieved for ITS and psbA-trnH of all products tested and the results of the study revealed that only one out of five herbal products satisfied both BLASTn and ML criterion and was considered to contain authentic V. negundo. The results prompt the urgent need to utilise DNA barcoding in authenticating herbal products available in the Philippine market. Authentication of these products will secure consumer health by preventing the negative effects of adulteration, substitution and contamination.
Detection of dopamine in dopaminergic cell using nanoparticles-based barcode DNA analysis.
An, Jeung Hee; Kim, Tae-Hyung; Oh, Byung-Keun; Choi, Jeong Woo
2012-01-01
Nanotechnology-based bio-barcode-amplification analysis may be an innovative approach to dopamine detection. In this study, we evaluated the efficacy of this bio-barcode DNA method in detecting dopamine from dopaminergic cells. Herein, a combination DNA barcode and bead-based immunoassay for neurotransmitter detection with PCR-like sensitivity is described. This method relies on magnetic nanoparticles with antibodies and nanoparticles that are encoded with DNA, and antibodies that can sandwich the target protein captured by the nanoparticle-bound antibodies. The aggregate sandwich structures are magnetically separated from solution, and treated in order to remove the conjugated barcode DNA. The DNA barcodes were then identified via PCR analysis. The dopamine concentration in dopaminergic cells can be readily and rapidly detected via the bio-barcode assay method. The bio-barcode assay method is, therefore, a rapid and high-throughput screening tool for the detection of neurotransmitters such as dopamine.
DNA barcoding in the media: does coverage of cool science reflect its social context?
Geary, Janis; Camicioli, Emma; Bubela, Tania
2016-09-01
Paul Hebert and colleagues first described DNA barcoding in 2003, which led to international efforts to promote and coordinate its use. Since its inception, DNA barcoding has generated considerable media coverage. We analysed whether this coverage reflected both the scientific and social mandates of international barcoding organizations. We searched newspaper databases to identify 900 English-language articles from 2003 to 2013. Coverage of the science of DNA barcoding was highly positive but lacked context for key topics. Coverage omissions pose challenges for public understanding of the science and applications of DNA barcoding; these included coverage of governance structures and issues related to the sharing of genetic resources across national borders. Our analysis provided insight into how barcoding communication efforts have translated into media coverage; more targeted communication efforts may focus media attention on previously omitted, but important topics. Our analysis is timely as the DNA barcoding community works to establish the International Society for the Barcode of Life.
BioBarcode: a general DNA barcoding database and server platform for Asian biodiversity resources
2009-01-01
Background DNA barcoding provides a rapid, accurate, and standardized method for species-level identification using short DNA sequences. Such a standardized identification method is useful for mapping all the species on Earth, particularly when DNA sequencing technology is cheaply available. There are many nations in Asia with many biodiversity resources that need to be mapped and registered in databases. Results We have built a general DNA barcode data processing system, BioBarcode, with open source software - which is a general purpose database and server. It uses mySQL RDBMS 5.0, BLAST2, and Apache httpd server. An exemplary database of BioBarcode has around 11,300 specimen entries (including GenBank data) and registers the biological species to map their genetic relationships. The BioBarcode database contains a chromatogram viewer which improves the performance in DNA sequence analyses. Conclusion Asia has a very high degree of biodiversity and the BioBarcode database server system aims to provide an efficient bioinformatics protocol that can be freely used by Asian researchers and research organizations interested in DNA barcoding. The BioBarcode promotes the rapid acquisition of biological species DNA sequence data that meet global standards by providing specialized services, and provides useful tools that will make barcoding cheaper and faster in the biodiversity community such as standardization, depository, management, and analysis of DNA barcode data. The system can be downloaded upon request, and an exemplary server has been constructed with which to build an Asian biodiversity system http://www.asianbarcode.org. PMID:19958506
DNA barcoding of vouchered xylarium wood specimens of nine endangered Dalbergia species.
Yu, Min; Jiao, Lichao; Guo, Juan; Wiedenhoeft, Alex C; He, Tuo; Jiang, Xiaomei; Yin, Yafang
2017-12-01
ITS2+ trnH - psbA was the best combination of DNA barcode to resolve the Dalbergia wood species studied. We demonstrate the feasibility of building a DNA barcode reference database using xylarium wood specimens. The increase in illegal logging and timber trade of CITES-listed tropical species necessitates the development of unambiguous identification methods at the species level. For these methods to be fully functional and deployable for law enforcement, they must work using wood or wood products. DNA barcoding of wood has been promoted as a promising tool for species identification; however, the main barrier to extensive application of DNA barcoding to wood is the lack of a comprehensive and reliable DNA reference library of barcodes from wood. In this study, xylarium wood specimens of nine Dalbergia species were selected from the Wood Collection of the Chinese Academy of Forestry and DNA was then extracted from them for further PCR amplification of eight potential DNA barcode sequences (ITS2, matK, trnL, trnH-psbA, trnV-trnM1, trnV-trnM2, trnC-petN, and trnS-trnG). The barcodes were tested singly and in combination for species-level discrimination ability by tree-based [neighbor-joining (NJ)] and distance-based (TaxonDNA) methods. We found that the discrimination ability of DNA barcodes in combination was higher than any single DNA marker among the Dalbergia species studied, with the best two-marker combination of ITS2+trnH-psbA analyzed with NJ trees performing the best (100% accuracy). These barcodes are relatively short regions (<350 bp) and amplification reactions were performed with high success (≥90%) using wood as the source material, a necessary factor to apply DNA barcoding to timber trade. The present results demonstrate the feasibility of using vouchered xylarium specimens to build DNA barcoding reference databases.
Ashfaq, Muhammad; Hebert, Paul D N; Mirza, M Sajjad; Khan, Arif M; Mansoor, Shahid; Shah, Ghulam S; Zafar, Yusuf
2014-01-01
Although whiteflies (Bemisia tabaci complex) are an important pest of cotton in Pakistan, its taxonomic diversity is poorly understood. As DNA barcoding is an effective tool for resolving species complexes and analyzing species distributions, we used this approach to analyze genetic diversity in the B. tabaci complex and map the distribution of B. tabaci lineages in cotton growing areas of Pakistan. Sequence diversity in the DNA barcode region (mtCOI-5') was examined in 593 whiteflies from Pakistan to determine the number of whitefly species and their distributions in the cotton-growing areas of Punjab and Sindh provinces. These new records were integrated with another 173 barcode sequences for B. tabaci, most from India, to better understand regional whitefly diversity. The Barcode Index Number (BIN) System assigned the 766 sequences to 15 BINs, including nine from Pakistan. Representative specimens of each Pakistan BIN were analyzed for mtCOI-3' to allow their assignment to one of the putative species in the B. tabaci complex recognized on the basis of sequence variation in this gene region. This analysis revealed the presence of Asia II 1, Middle East-Asia Minor 1, Asia 1, Asia II 5, Asia II 7, and a new lineage "Pakistan". The first two taxa were found in both Punjab and Sindh, but Asia 1 was only detected in Sindh, while Asia II 5, Asia II 7 and "Pakistan" were only present in Punjab. The haplotype networks showed that most haplotypes of Asia II 1, a species implicated in transmission of the cotton leaf curl virus, occurred in both India and Pakistan. DNA barcodes successfully discriminated cryptic species in B. tabaci complex. The dominant haplotypes in the B. tabaci complex were shared by India and Pakistan. Asia II 1 was previously restricted to Punjab, but is now the dominant lineage in southern Sindh; its southward spread may have serious implications for cotton plantations in this region.
Agasti, Sarit S; Liong, Monty; Peterson, Vanessa M; Lee, Hakho; Weissleder, Ralph
2012-11-14
DNA barcoding is an attractive technology, as it allows sensitive and multiplexed target analysis. However, DNA barcoding of cellular proteins remains challenging, primarily because barcode amplification and readout techniques are often incompatible with the cellular microenvironment. Here we describe the development and validation of a photocleavable DNA barcode-antibody conjugate method for rapid, quantitative, and multiplexed detection of proteins in single live cells. Following target binding, this method allows DNA barcodes to be photoreleased in solution, enabling easy isolation, amplification, and readout. As a proof of principle, we demonstrate sensitive and multiplexed detection of protein biomarkers in a variety of cancer cells.
Choosing and Using a Plant DNA Barcode
Hollingsworth, Peter M.; Graham, Sean W.; Little, Damon P.
2011-01-01
The main aim of DNA barcoding is to establish a shared community resource of DNA sequences that can be used for organismal identification and taxonomic clarification. This approach was successfully pioneered in animals using a portion of the cytochrome oxidase 1 (CO1) mitochondrial gene. In plants, establishing a standardized DNA barcoding system has been more challenging. In this paper, we review the process of selecting and refining a plant barcode; evaluate the factors which influence the discriminatory power of the approach; describe some early applications of plant barcoding and summarise major emerging projects; and outline tool development that will be necessary for plant DNA barcoding to advance. PMID:21637336
Ramirez, Jorge L.; Birindelli, Jose L.; Carvalho, Daniel C.; Affonso, Paulo R. A. M.; Venere, Paulo C.; Ortega, Hernán; Carrillo-Avila, Mauricio; Rodríguez-Pulido, José A.; Galetti, Pedro M.
2017-01-01
Molecular studies have improved our knowledge on the neotropical ichthyofauna. DNA barcoding has successfully been used in fish species identification and in detecting cryptic diversity. Megaleporinus (Anostomidae) is a recently described freshwater fish genus within which taxonomic uncertainties remain. Here we assessed all nominal species of this genus using a DNA barcode approach (Cytochrome Oxidase subunit I) with a broad sampling to generate a reference library, characterize new molecular lineages, and test the hypothesis that some of the nominal species represent species complexes. The analyses identified 16 (ABGD and BIN) to 18 (ABGD, GMYC, and PTP) different molecular operational taxonomic units (MOTUs) within the 10 studied nominal species, indicating cryptic biodiversity and potential candidate species. Only Megaleporinus brinco, Megaleporinus garmani, and Megaleporinus elongatus showed correspondence between nominal species and MOTUs. Within six nominal species, a subdivision in two MOTUs was found, while Megaleporinus obtusidens was divided in three MOTUs, suggesting that DNA barcode is a very useful approach to identify the molecular lineages of Megaleporinus, even in the case of recent divergence (< 0.5 Ma). Our results thus provided molecular findings that can be used along with morphological traits to better define each species, including candidate new species. This is the most complete analysis of DNA barcode in this recently described genus, and considering its economic value, a precise species identification is quite desirable and fundamental for conservation of the whole biodiversity of this fish. PMID:29075287
International Barcode of Life: Focus on big biodiversity in South Africa.
Adamowicz, Sarah J; Hollingsworth, Peter M; Ratnasingham, Sujeevan; van der Bank, Michelle
2017-11-01
Participants in the 7th International Barcode of Life Conference (Kruger National Park, South Africa, 20-24 November 2017) share the latest findings in DNA barcoding research and its increasingly diversified applications. Here, we review prevailing trends synthesized from among 429 invited and contributed abstracts, which are collated in this open-access special issue of Genome. Hosted for the first time on the African continent, the 7th Conference places special emphasis on the evolutionary origins, biogeography, and conservation of African flora and fauna. Within Africa and elsewhere, DNA barcoding and related techniques are being increasingly used for wildlife forensics and for the validation of commercial products, such as medicinal plants and seafood species. A striking trend of the conference is the dramatic rise of studies on environmental DNA (eDNA) and on diverse uses of high-throughput sequencing techniques. Emerging techniques in these areas are opening new avenues for environmental biomonitoring, managing species-at-risk and invasive species, and revealing species interaction networks in unprecedented detail. Contributors call for the development of validated community standards for high-throughput sequence data generation and analysis, to enable the full potential of these methods to be realized for understanding and managing biodiversity on a global scale.
DNA Barcode Goes Two-Dimensions: DNA QR Code Web Server
Li, Huan; Xing, Hang; Liang, Dong; Jiang, Kun; Pang, Xiaohui; Song, Jingyuan; Chen, Shilin
2012-01-01
The DNA barcoding technology uses a standard region of DNA sequence for species identification and discovery. At present, “DNA barcode” actually refers to DNA sequences, which are not amenable to information storage, recognition, and retrieval. Our aim is to identify the best symbology that can represent DNA barcode sequences in practical applications. A comprehensive set of sequences for five DNA barcode markers ITS2, rbcL, matK, psbA-trnH, and CO1 was used as the test data. Fifty-three different types of one-dimensional and ten two-dimensional barcode symbologies were compared based on different criteria, such as coding capacity, compression efficiency, and error detection ability. The quick response (QR) code was found to have the largest coding capacity and relatively high compression ratio. To facilitate the further usage of QR code-based DNA barcodes, a web server was developed and is accessible at http://qrfordna.dnsalias.org. The web server allows users to retrieve the QR code for a species of interests, convert a DNA sequence to and from a QR code, and perform species identification based on local and global sequence similarities. In summary, the first comprehensive evaluation of various barcode symbologies has been carried out. The QR code has been found to be the most appropriate symbology for DNA barcode sequences. A web server has also been constructed to allow biologists to utilize QR codes in practical DNA barcoding applications. PMID:22574113
Zenker, Mauricio M.; Rougerie, Rodolphe; Teston, José A.; Laguerre, Michel; Pie, Marcio R.; Freitas, André V. L.
2016-01-01
The morphological species delimitations (i.e. morphospecies) have long been the best way to avoid the taxonomic impediment and compare insect taxa biodiversity in highly diverse tropical and subtropical regions. The development of DNA barcoding, however, has shown great potential to replace (or at least complement) the morphospecies approach, with the advantage of relying on automated methods implemented in computer programs or even online rather than in often subjective morphological features. We sampled moths extensively for two years using light traps in a patch of the highly endangered Atlantic Forest of Brazil to produce a nearly complete census of arctiines (Noctuoidea: Erebidae), whose species richness was compared using different morphological and molecular approaches (DNA barcoding). A total of 1,075 barcode sequences of 286 morphospecies were analyzed. Based on the clustering method Barcode Index Number (BIN) we found a taxonomic bias of approximately 30% in our initial morphological assessment. However, a morphological reassessment revealed that the correspondence between morphospecies and molecular operational taxonomic units (MOTUs) can be up to 94% if differences in genitalia morphology are evaluated in individuals of different MOTUs originated from the same morphospecies (putative cases of cryptic species), and by recording if individuals of different genders in different morphospecies merge together in the same MOTU (putative cases of sexual dimorphism). The results of two other clustering methods (i.e. Automatic Barcode Gap Discovery and 2% threshold) were very similar to those of the BIN approach. Using empirical data we have shown that DNA barcoding performed substantially better than the morphospecies approach, based on superficial morphology, to delimit species of a highly diverse moth taxon, and thus should be used in species inventories. PMID:26859488
Zenker, Mauricio M; Rougerie, Rodolphe; Teston, José A; Laguerre, Michel; Pie, Marcio R; Freitas, André V L
2016-01-01
The morphological species delimitations (i.e. morphospecies) have long been the best way to avoid the taxonomic impediment and compare insect taxa biodiversity in highly diverse tropical and subtropical regions. The development of DNA barcoding, however, has shown great potential to replace (or at least complement) the morphospecies approach, with the advantage of relying on automated methods implemented in computer programs or even online rather than in often subjective morphological features. We sampled moths extensively for two years using light traps in a patch of the highly endangered Atlantic Forest of Brazil to produce a nearly complete census of arctiines (Noctuoidea: Erebidae), whose species richness was compared using different morphological and molecular approaches (DNA barcoding). A total of 1,075 barcode sequences of 286 morphospecies were analyzed. Based on the clustering method Barcode Index Number (BIN) we found a taxonomic bias of approximately 30% in our initial morphological assessment. However, a morphological reassessment revealed that the correspondence between morphospecies and molecular operational taxonomic units (MOTUs) can be up to 94% if differences in genitalia morphology are evaluated in individuals of different MOTUs originated from the same morphospecies (putative cases of cryptic species), and by recording if individuals of different genders in different morphospecies merge together in the same MOTU (putative cases of sexual dimorphism). The results of two other clustering methods (i.e. Automatic Barcode Gap Discovery and 2% threshold) were very similar to those of the BIN approach. Using empirical data we have shown that DNA barcoding performed substantially better than the morphospecies approach, based on superficial morphology, to delimit species of a highly diverse moth taxon, and thus should be used in species inventories.
Laopichienpong, Nararat; Muangmai, Narongrit; Supikamolseni, Arrjaree; Twilprawat, Panupon; Chanhome, Lawan; Suntrarachun, Sunutcha; Peyachoknagul, Surin; Srikulnath, Kornsorn
2016-12-15
DNA barcodes of mitochondrial cytochrome c oxidase I (COI), cytochrome b (Cytb) genes, and their combined data sets were constructed from 35 snake species in Thailand. No barcoding gap was detected in either of the two genes from the observed intra- and interspecific sequence divergences. Intra- and interspecific sequence divergences of the COI gene differed 14 times, with barcode cut-off scores ranging over 2%-4% for threshold values differentiated among most of the different species; the Cytb gene differed 6 times with cut-off scores ranging over 2%-6%. Thirty-five specific nucleotide mutations were also found at interspecific level in the COI gene, identifying 18 snake species, but no specific nucleotide mutation was observed for Cytb in any single species. This suggests that COI barcoding was a better marker than Cytb. Phylogenetic clustering analysis indicated that most species were represented by monophyletic clusters, suggesting that these snake species could be clearly differentiated using COI barcodes. However, the two-marker combination of both COI and Cytb was more effective, differentiating snake species by over 2%-4%, and reducing species numbers in the overlap value between intra- and interspecific divergences. Three species delimitation algorithms (general mixed Yule-coalescent, automatic barcoding gap detection, and statistical parsimony network analysis) were extensively applied to a wide range of snakes based on both barcodes. This revealed cryptic diversity for eleven snake species in Thailand. In addition, eleven accessions from the database previously grouped under the same species were represented at different species level, suggesting either high genetic diversity, or the misidentification of these sequences in the database as a consequence of cryptic species. Copyright © 2016 Elsevier B.V. All rights reserved.
Four years of DNA barcoding: current advances and prospects.
Frézal, Lise; Leblois, Raphael
2008-09-01
Research using cytochrome c oxidase barcoding techniques on zoological specimens was initiated by Hebert et al. [Hebert, P.D.N., Ratnasingham, S., deWaard, J.R., 2003. Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proc. R. Soc. Lond. B 270, S96-S99]. By March 2004, the Consortium for the Barcode of Life started to promote the use of a standardized DNA barcoding approach, consisting of identifying a specimen as belonging to a certain animal species based on a single universal marker: the DNA barcode sequence. Over the last 4 years, this approach has become increasingly popular and advances as well as limitations have clearly emerged as increasing amounts of organisms have been studied. Our purpose is to briefly expose DNA Barcode of Life principles, pros and cons, relevance and universality. The initially proposed Barcode of life framework has greatly evolved, giving rise to a flexible description of DNA barcoding and a larger range of applications.
Barcode DNA length polymorphisms vs fatty acid profiling for adulteration detection in olive oil.
Uncu, Ali Tevfik; Uncu, Ayse Ozgur; Frary, Anne; Doganlar, Sami
2017-04-15
The aim of this study was to compare the performance of a DNA-barcode assay with fatty acid profile analysis to authenticate the botanical origin of olive oil. To achieve this aim, we performed a PCR-capillary electrophoresis (PCR-CE) approach on olive oil: seed oil blends using the plastid trnL (UAA) intron barcode. In parallel to genomic analysis, we subjected the samples to gas chromatography analysis of fatty acid composition. While the PCR-CE assay proved equally efficient as gas chromatography analysis in detecting adulteration with soybean, palm, rapeseed, sunflower, sesame, cottonseed and peanut oils, it was superior to the widely utilized analytical chemistry approach in revealing the adulterant species and detecting small quantities of corn and safflower oils in olive oil. Moreover, the DNA-based test correctly identified all tested olive oil: hazelnut oil blends whereas it was not feasible to detect hazelnut oil adulteration through fatty acid profile analysis. Thus, the present research has shown the feasibility of a PCR-CE barcode assay to detect adulteration in olive oil. Copyright © 2016 Elsevier Ltd. All rights reserved.
Probing planetary biodiversity with DNA barcodes: The Noctuoidea of North America
Lafontaine, J. Donald; Schmidt, B. Christian; deWaard, Jeremy R.; Zakharov, Evgeny V.; Hebert, Paul D. N.
2017-01-01
This study reports the assembly of a DNA barcode reference library for species in the lepidopteran superfamily Noctuoidea from Canada and the USA. Based on the analysis of 69,378 specimens, the library provides coverage for 97.3% of the noctuoid fauna (3565 of 3664 species). In addition to verifying the strong performance of DNA barcodes in the discrimination of these species, the results indicate close congruence between the number of species analyzed (3565) and the number of sequence clusters (3816) recognized by the Barcode Index Number (BIN) system. Distributional patterns across 12 North American ecoregions are examined for the 3251 species that have GPS data while BIN analysis is used to quantify overlap between the noctuoid faunas of North America and other zoogeographic regions. This analysis reveals that 90% of North American noctuoids are endemic and that just 7.5% and 1.8% of BINs are shared with the Neotropics and with the Palearctic, respectively. One third (29) of the latter species are recent introductions and, as expected, they possess low intraspecific divergences. PMID:28570635
Costion, Craig M; Kress, W John; Crayn, Darren M
2016-01-01
The taxonomic status of a single island, narrow range endemic plant species from Palau, Micronesia (Timonius salsedoi) was assessed using DNA barcode markers, additional plastid loci, and morphology in order to verify its conservation status. DNA barcode loci distinguished T. salsedoi from all other Timonius species sampled from Palau, and were supported by sequence data from the atpB-rbcL intergenic spacer region. Timonius salsedoi was only known from two mature individual trees in 2012. Due to its extremely narrow range and population size, it had previously been recommended to be listed as Critically Endangered Status under three separate IUCN Criteria. In 2014 a second survey of the population following a typhoon revealed that the only two known trees had died suggesting that this species may now be extinct. Comprehensive follow up surveys of suitable habitat for this species are urgently required.
Pinto, Israel de Souza; Chagas, Bruna Dias das; Rodrigues, Andressa Alencastre Fuzari; Ferreira, Adelson Luiz; Rezende, Helder Ricas; Bruno, Rafaela Vieira; Falqueto, Aloisio; Andrade-Filho, José Dilermando; Galati, Eunice Aparecida Bianchi; Shimabukuro, Paloma Helena Fernandes; Brazil, Reginaldo Peçanha
2015-01-01
DNA barcoding has been an effective tool for species identification in several animal groups. Here, we used DNA barcoding to discriminate between 47 morphologically distinct species of Brazilian sand flies. DNA barcodes correctly identified approximately 90% of the sampled taxa (42 morphologically distinct species) using clustering based on neighbor-joining distance, of which four species showed comparatively higher maximum values of divergence (range 4.23–19.04%), indicating cryptic diversity. The DNA barcodes also corroborated the resurrection of two species within the shannoni complex and provided an efficient tool to differentiate between morphologically indistinguishable females of closely related species. Taken together, our results validate the effectiveness of DNA barcoding for species identification and the discovery of cryptic diversity in sand flies from Brazil. PMID:26506007
Pinto, Israel de Souza; Chagas, Bruna Dias das; Rodrigues, Andressa Alencastre Fuzari; Ferreira, Adelson Luiz; Rezende, Helder Ricas; Bruno, Rafaela Vieira; Falqueto, Aloisio; Andrade-Filho, José Dilermando; Galati, Eunice Aparecida Bianchi; Shimabukuro, Paloma Helena Fernandes; Brazil, Reginaldo Peçanha; Peixoto, Alexandre Afranio
2015-01-01
DNA barcoding has been an effective tool for species identification in several animal groups. Here, we used DNA barcoding to discriminate between 47 morphologically distinct species of Brazilian sand flies. DNA barcodes correctly identified approximately 90% of the sampled taxa (42 morphologically distinct species) using clustering based on neighbor-joining distance, of which four species showed comparatively higher maximum values of divergence (range 4.23-19.04%), indicating cryptic diversity. The DNA barcodes also corroborated the resurrection of two species within the shannoni complex and provided an efficient tool to differentiate between morphologically indistinguishable females of closely related species. Taken together, our results validate the effectiveness of DNA barcoding for species identification and the discovery of cryptic diversity in sand flies from Brazil.
Zhou, X.; Robinson, J.L.; Geraci, C.J.; Parker, C.R.; Flint, O.S.; Etnier, D.A.; Ruiter, D.; DeWalt, R.E.; Jacobus, L.M.; Hebert, P.D.N.
2011-01-01
Deoxyribonucleic acid (DNA) barcoding is an effective tool for species identification and lifestage association in a wide range of animal taxa. We developed a strategy for rapid construction of a regional DNA-barcode reference library and used the caddisflies (Trichoptera) of the Great Smoky Mountains National Park (GSMNP) as a model. Nearly 1000 cytochrome c oxidase subunit I (COI) sequences, representing 209 caddisfly species previously recorded from GSMNP, were obtained from the global Trichoptera Barcode of Life campaign. Most of these sequences were collected from outside the GSMNP area. Another 645 COI sequences, representing 80 species, were obtained from specimens collected in a 3-d bioblitz (short-term, intense sampling program) in GSMNP. The joint collections provided barcode coverage for 212 species, 91% of the GSMNP fauna. Inclusion of samples from other localities greatly expedited construction of the regional DNA-barcode reference library. This strategy increased intraspecific divergence and decreased average distances to nearest neighboring species, but the DNA-barcode library was able to differentiate 93% of the GSMNP Trichoptera species examined. Global barcoding projects will aid construction of regional DNA-barcode libraries, but local surveys make crucial contributions to progress by contributing rare or endemic species and full-length barcodes generated from high-quality DNA. DNA taxonomy is not a goal of our present work, but the investigation of COI divergence patterns in caddisflies is providing new insights into broader biodiversity patterns in this group and has directed attention to various issues, ranging from the need to re-evaluate species taxonomy with integrated morphological and molecular evidence to the necessity of an appropriate interpretation of barcode analyses and its implications in understanding species diversity (in contrast to a simple claim for barcoding failure).
Iftikhar, Romana; Ashfaq, Muhammad; Rasool, Akhtar; Hebert, Paul D N
2016-01-01
Although thrips are globally important crop pests and vectors of viral disease, species identifications are difficult because of their small size and inconspicuous morphological differences. Sequence variation in the mitochondrial COI-5' (DNA barcode) region has proven effective for the identification of species in many groups of insect pests. We analyzed barcode sequence variation among 471 thrips from various plant hosts in north-central Pakistan. The Barcode Index Number (BIN) system assigned these sequences to 55 BINs, while the Automatic Barcode Gap Discovery detected 56 partitions, a count that coincided with the number of monophyletic lineages recognized by Neighbor-Joining analysis and Bayesian inference. Congeneric species showed an average of 19% sequence divergence (range = 5.6% - 27%) at COI, while intraspecific distances averaged 0.6% (range = 0.0% - 7.6%). BIN analysis suggested that all intraspecific divergence >3.0% actually involved a species complex. In fact, sequences for three major pest species (Haplothrips reuteri, Thrips palmi, Thrips tabaci), and one predatory thrips (Aeolothrips intermedius) showed deep intraspecific divergences, providing evidence that each is a cryptic species complex. The study compiles the first barcode reference library for the thrips of Pakistan, and examines global haplotype diversity in four important pest thrips.
DNA barcoding a nightmare taxon: assessing barcode index numbers and barcode gaps for sweat bees.
Gibbs, Jason
2018-01-01
There is an ongoing campaign to DNA barcode the world's >20 000 bee species. Recent revisions of Lasioglossum (Dialictus) (Hymenoptera: Halictidae) for Canada and the eastern United States were completed using integrative taxonomy. DNA barcode data from 110 species of L. (Dialictus) are examined for their value in identification and discovering additional taxonomic diversity. Specimen identification success was estimated using the best close match method. Error rates were 20% relative to current taxonomic understanding. Barcode Index Numbers (BINs) assigned using Refined Single Linkage Analysis (RESL) and barcode gaps using the Automatic Barcode Gap Discovery (ABGD) method were also assessed. RESL was incongruent for 44.5% of species, although some cryptic diversity may exist. Forty-three of 110 species were part of merged BINs with multiple species. The barcode gap is non-existent for the data set as a whole and ABGD showed levels of discordance similar to the RESL. The viridatum species-group is particularly problematic, so that DNA barcodes alone would be misleading for species delimitation and specimen identification. Character-based methods using fixed nucleotide substitutions could improve specimen identification success in some cases. The use of DNA barcoding for species discovery for standard taxonomic practice in the absence of a well-defined barcode gap is discussed.
Tan, Ji; Lim, Phaik-Eem; Phang, Siew-Moi; Hong, Dang Diem; Sunarpi, H.; Hurtado, Anicia Q.
2012-01-01
DNA barcoding has been a major advancement in the field of taxonomy, seeing much effort put into the barcoding of wide taxa of organisms, macro and microalgae included. The mitochondrial-encoded cox1 and plastid-encoded rbcL has been proposed as potential DNA barcodes for rhodophytes, but are yet to be tested on the commercially important carrageenophytes Kappaphycus and Eucheuma. This study gauges the effectiveness of four markers, namely the mitochondrial cox1, cox2, cox2-3 spacer and the plastid rbcL in DNA barcoding on selected Kappaphycus and Eucheuma from Southeast Asia. Marker assessments were performed using established distance and tree-based identification criteria from earlier studies. Barcoding patterns on a larger scale were simulated by empirically testing on the commonly used cox2-3 spacer. The phylogeny of these rhodophytes was also briefly described. In this study, the cox2 marker which satisfies the prerequisites of DNA barcodes was found to exhibit moderately high interspecific divergences with no intraspecific variations, thus a promising marker for the DNA barcoding of Kappaphycus and Eucheuma. However, the already extensively used cox2-3 spacer was deemed to be in overall more appropriate as a DNA barcode for these two genera. On a wider scale, cox1 and rbcL were still better DNA barcodes across the rhodophyte taxa when practicality and cost-efficiency were taken into account. The phylogeny of Kappaphycus and Eucheuma were generally similar to those earlier reported. Still, the application of DNA barcoding has demonstrated our relatively poor taxonomic comprehension of these seaweeds, thus suggesting more in-depth efforts in taxonomic restructuring as well as establishment. PMID:23285223
Delineating Species with DNA Barcodes: A Case of Taxon Dependent Method Performance in Moths
Kekkonen, Mari; Mutanen, Marko; Kaila, Lauri; Nieminen, Marko; Hebert, Paul D. N.
2015-01-01
The accelerating loss of biodiversity has created a need for more effective ways to discover species. Novel algorithmic approaches for analyzing sequence data combined with rapidly expanding DNA barcode libraries provide a potential solution. While several analytical methods are available for the delineation of operational taxonomic units (OTUs), few studies have compared their performance. This study compares the performance of one morphology-based and four DNA-based (BIN, parsimony networks, ABGD, GMYC) methods on two groups of gelechioid moths. It examines 92 species of Finnish Gelechiinae and 103 species of Australian Elachistinae which were delineated by traditional taxonomy. The results reveal a striking difference in performance between the two taxa with all four DNA-based methods. OTU counts in the Elachistinae showed a wider range and a relatively low (ca. 65%) OTU match with reference species while OTU counts were more congruent and performance was higher (ca. 90%) in the Gelechiinae. Performance rose when only monophyletic species were compared, but the taxon-dependence remained. None of the DNA-based methods produced a correct match with non-monophyletic species, but singletons were handled well. A simulated test of morphospecies-grouping performed very poorly in revealing taxon diversity in these small, dull-colored moths. Despite the strong performance of analyses based on DNA barcodes, species delineated using single-locus mtDNA data are best viewed as OTUs that require validation by subsequent integrative taxonomic work. PMID:25849083
DNA Barcoding of Freshwater Fishes of Indo-Myanmar Biodiversity Hotspot.
Barman, Anindya Sundar; Singh, Mamta; Singh, Soibam Khogen; Saha, Himadri; Singh, Yumlembam Jackie; Laishram, Martina; Pandey, Pramod Kumar
2018-06-05
To develop an effective conservation and management strategy, it is required to assess the biodiversity status of an ecosystem, especially when we deal with Indo-Myanmar biodiversity hotspot. Importance of this reaches to an entirely different level as the hotspot represents the area of high endemism which is under continuous threat. Therefore, the need of the present study was conceptualized, dealing with molecular assessment of the fish fauna of Indo-Myanmar region, which covers the Indian states namely, Manipur, Meghalaya, Mizoram, and Nagaland. A total of 363 specimens, representing 109 species were collected and barcoded from the different rivers and their tributaries of the region. The analyses performed in the present study, i.e. Kimura 2-Parameter genetic divergence, Neighbor-Joining, Automated Barcode Gap Discovery and Bayesian Poisson Tree Processes suggest that DNA barcoding is an efficient and reliable tool for species identification. Most of the species were clearly delineated. However, presence of intra-specific and inter-specific genetic distance overlap in few species, revealed the existence of putative cryptic species. A reliable DNA barcode reference library, established in our study provides an adequate knowledge base to the groups of non-taxonomists, researchers, biodiversity managers and policy makers in sketching effective conservation measures for this ecosystem.
Jisming-See, Shi-Wei; Sing, Kong-Wah; Wilson, John-James
2016-10-01
The "rings" belonging to the genus Ypthima are amongst the most common butterflies in Peninsular Malaysia. However, the species can be difficult to tell apart, with keys relying on minor and often non-discrete ring characters found on the hindwing. Seven species have been reported from Peninsular Malaysia, but this is thought to be an underestimate of diversity. DNA barcodes of 165 individuals, and wing and genital morphology, were examined to reappraise species diversity of this genus in Peninsular Malaysia. DNA barcodes collected during citizen science projects-School Butterfly Project and Peninsular Malaysia Butterfly Count-recently conducted in Peninsular Malaysia were included. The new DNA barcodes formed six groups with different Barcode Index Numbers (BINs) representing four species reported in Peninsular Malaysia. When combined with public DNA barcodes from the Barcode Of Life Datasystems, several taxonomic issues arose. We consider the taxon Y. newboldi, formerly treated as a subspecies of Y. baldus, as a distinct species. DNA barcodes also supported an earlier suggestion that Y. nebulosa is a synonym under Y. horsfieldii humei. Two BINs of the genus Ypthima comprising DNA barcodes collected during citizen science projects did not correspond to any species previously reported in Peninsular Malaysia.
Potential of DNA barcoding for detecting quarantine fungi.
Gao, Ruifang; Zhang, Guiming
2013-11-01
The detection of live quarantine pathogenic fungi plays an important role in guaranteeing regional biological safety. DNA barcoding, an emerging species identification technology, holds promise for the reliable, quick, and accurate detection of quarantine fungi. International standards for phytosanitary guidelines are urgently needed. The varieties of quarantine fungi listed for seven countries/regions, the currently applied detection methods, and the status of DNA barcoding for detecting quarantine fungi are summarized in this study. Two approaches have been proposed to apply DNA barcoding to fungal quarantine procedures: (i) to verify the reliability of known internal transcribed spacer (ITS)/cytochrome c oxidase subunit I (COI) data for use as barcodes, and (ii) to determine other barcodes for species that cannot be identified by ITS/COI. As a unique, standardizable, and universal species identification tool, DNA barcoding offers great potential for integrating detection methods used in various countries/regions and establishing international detection standards based on accepted DNA barcodes. Through international collaboration, interstate disputes can be eased and many problems related to routine quarantine detection methods can be solved for global trade.
Identifying Canadian Freshwater Fishes through DNA Barcodes
Hubert, Nicolas; Hanner, Robert; Holm, Erling; Mandrak, Nicholas E.; Taylor, Eric; Burridge, Mary; Watkinson, Douglas; Dumont, Pierre; Curry, Allen; Bentzen, Paul; Zhang, Junbin; April, Julien; Bernatchez, Louis
2008-01-01
Background DNA barcoding aims to provide an efficient method for species-level identifications using an array of species specific molecular tags derived from the 5′ region of the mitochondrial cytochrome c oxidase I (COI) gene. The efficiency of the method hinges on the degree of sequence divergence among species and species-level identifications are relatively straightforward when the average genetic distance among individuals within a species does not exceed the average genetic distance between sister species. Fishes constitute a highly diverse group of vertebrates that exhibit deep phenotypic changes during development. In this context, the identification of fish species is challenging and DNA barcoding provide new perspectives in ecology and systematics of fishes. Here we examined the degree to which DNA barcoding discriminate freshwater fish species from the well-known Canadian fauna, which currently encompasses nearly 200 species, some which are of high economic value like salmons and sturgeons. Methodology/Principal Findings We bi-directionally sequenced the standard 652 bp “barcode” region of COI for 1360 individuals belonging to 190 of the 203 Canadian freshwater fish species (95%). Most species were represented by multiple individuals (7.6 on average), the majority of which were retained as voucher specimens. The average genetic distance was 27 fold higher between species than within species, as K2P distance estimates averaged 8.3% among congeners and only 0.3% among concpecifics. However, shared polymorphism between sister-species was detected in 15 species (8% of the cases). The distribution of K2P distance between individuals and species overlapped and identifications were only possible to species group using DNA barcodes in these cases. Conversely, deep hidden genetic divergence was revealed within two species, suggesting the presence of cryptic species. Conclusions/Significance The present study evidenced that freshwater fish species can be efficiently identified through the use of DNA barcoding, especially the species complex of small-sized species, and that the present COI library can be used for subsequent applications in ecology and systematics. PMID:22423312
[Integrated DNA barcoding database for identifying Chinese animal medicine].
Shi, Lin-Chun; Yao, Hui; Xie, Li-Fang; Zhu, Ying-Jie; Song, Jing-Yuan; Zhang, Hui; Chen, Shi-Lin
2014-06-01
In order to construct an integrated DNA barcoding database for identifying Chinese animal medicine, the authors and their cooperators have completed a lot of researches for identifying Chinese animal medicines using DNA barcoding technology. Sequences from GenBank have been analyzed simultaneously. Three different methods, BLAST, barcoding gap and Tree building, have been used to confirm the reliabilities of barcode records in the database. The integrated DNA barcoding database for identifying Chinese animal medicine has been constructed using three different parts: specimen, sequence and literature information. This database contained about 800 animal medicines and the adulterants and closely related species. Unknown specimens can be identified by pasting their sequence record into the window on the ID page of species identification system for traditional Chinese medicine (www. tcmbarcode. cn). The integrated DNA barcoding database for identifying Chinese animal medicine is significantly important for animal species identification, rare and endangered species conservation and sustainable utilization of animal resources.
BOLDMirror: a global mirror system of DNA barcode data.
Liu, D; Liu, L; Guo, G; Wang, W; Sun, Q; Parani, M; Ma, J
2013-11-01
DNA barcoding is a novel concept for taxonomic identification using short, specific genetic markers and has been applied to study a large number of eukaryotes. The huge amount of data output generated by DNA barcoding requires well-organized information systems. Besides the Barcode of Life Data system (BOLD) established in Canada, the mirror system is also important for the international barcode of life project (iBOL). For this purpose, we developed the BOLDMirror, a global mirror system of DNA barcode data. It is open-sourced and can run on the LAMP (Linux + Apache + MySQL + PHP) environment. BOLDMirror has data synchronization, data representation and statistics modules, and also provides spaces to store user operation history. BOLDMirror can be accessed at http://www.boldmirror.net and several countries have used it to setup their site of DNA barcoding. © 2012 John Wiley & Sons Ltd.
DNA barcoding Indian freshwater fishes.
Lakra, Wazir Singh; Singh, M; Goswami, Mukunda; Gopalakrishnan, A; Lal, K K; Mohindra, V; Sarkar, U K; Punia, P P; Singh, K V; Bhatt, J P; Ayyappan, S
2016-11-01
DNA barcoding is a promising technique for species identification using a short mitochondrial DNA sequence of cytochrome c oxidase I (COI) gene. In the present study, DNA barcodes were generated from 72 species of freshwater fish covering the Orders Cypriniformes, Siluriformes, Perciformes, Synbranchiformes, and Osteoglossiformes representing 50 genera and 19 families. All the samples were collected from diverse sites except the species endemic to a particular location. Species were represented by multiple specimens in the great majority of the barcoded species. A total of 284 COI sequences were generated. After amplification and sequencing of 700 base pair fragment of COI, primers were trimmed which invariably generated a 655 base pair barcode sequence. The average Kimura two-parameter (K2P) distances within-species, genera, families, and orders were 0.40%, 9.60%, 13.10%, and 17.16%, respectively. DNA barcode discriminated congeneric species without any confusion. The study strongly validated the efficiency of COI as an ideal marker for DNA barcoding of Indian freshwater fishes.
Trebitz, Anett S; Hoffman, Joel C; Grant, George W; Billehus, Tyler M; Pilgrim, Erik M
2015-07-22
DNA-based identification of mixed-organism samples offers the potential to greatly reduce the need for resource-intensive morphological identification, which would be of value both to bioassessment and non-native species monitoring. The ability to assign species identities to DNA sequences found depends on the availability of comprehensive DNA reference libraries. Here, we compile inventories for aquatic metazoans extant in or threatening to invade the Laurentian Great Lakes and examine the availability of reference mitochondrial COI DNA sequences (barcodes) in the Barcode of Life Data System for them. We found barcode libraries largely complete for extant and threatening-to-invade vertebrates (100% of reptile, 99% of fish, and 92% of amphibian species had barcodes). In contrast, barcode libraries remain poorly developed for precisely those organisms where morphological identification is most challenging; 46% of extant invertebrates lacked reference barcodes with rates especially high among rotifers, oligochaetes, and mites. Lack of species-level identification for many aquatic invertebrates also is a barrier to matching DNA sequences with physical specimens. Attaining the potential for DNA-based identification of mixed-organism samples covering the breadth of aquatic fauna requires a concerted effort to build supporting barcode libraries and voucher collections.
NASA Astrophysics Data System (ADS)
Trebitz, Anett S.; Hoffman, Joel C.; Grant, George W.; Billehus, Tyler M.; Pilgrim, Erik M.
2015-07-01
DNA-based identification of mixed-organism samples offers the potential to greatly reduce the need for resource-intensive morphological identification, which would be of value both to bioassessment and non-native species monitoring. The ability to assign species identities to DNA sequences found depends on the availability of comprehensive DNA reference libraries. Here, we compile inventories for aquatic metazoans extant in or threatening to invade the Laurentian Great Lakes and examine the availability of reference mitochondrial COI DNA sequences (barcodes) in the Barcode of Life Data System for them. We found barcode libraries largely complete for extant and threatening-to-invade vertebrates (100% of reptile, 99% of fish, and 92% of amphibian species had barcodes). In contrast, barcode libraries remain poorly developed for precisely those organisms where morphological identification is most challenging; 46% of extant invertebrates lacked reference barcodes with rates especially high among rotifers, oligochaetes, and mites. Lack of species-level identification for many aquatic invertebrates also is a barrier to matching DNA sequences with physical specimens. Attaining the potential for DNA-based identification of mixed-organism samples covering the breadth of aquatic fauna requires a concerted effort to build supporting barcode libraries and voucher collections.
Supervised DNA Barcodes species classification: analysis, comparisons and results
2014-01-01
Background Specific fragments, coming from short portions of DNA (e.g., mitochondrial, nuclear, and plastid sequences), have been defined as DNA Barcode and can be used as markers for organisms of the main life kingdoms. Species classification with DNA Barcode sequences has been proven effective on different organisms. Indeed, specific gene regions have been identified as Barcode: COI in animals, rbcL and matK in plants, and ITS in fungi. The classification problem assigns an unknown specimen to a known species by analyzing its Barcode. This task has to be supported with reliable methods and algorithms. Methods In this work the efficacy of supervised machine learning methods to classify species with DNA Barcode sequences is shown. The Weka software suite, which includes a collection of supervised classification methods, is adopted to address the task of DNA Barcode analysis. Classifier families are tested on synthetic and empirical datasets belonging to the animal, fungus, and plant kingdoms. In particular, the function-based method Support Vector Machines (SVM), the rule-based RIPPER, the decision tree C4.5, and the Naïve Bayes method are considered. Additionally, the classification results are compared with respect to ad-hoc and well-established DNA Barcode classification methods. Results A software that converts the DNA Barcode FASTA sequences to the Weka format is released, to adapt different input formats and to allow the execution of the classification procedure. The analysis of results on synthetic and real datasets shows that SVM and Naïve Bayes outperform on average the other considered classifiers, although they do not provide a human interpretable classification model. Rule-based methods have slightly inferior classification performances, but deliver the species specific positions and nucleotide assignments. On synthetic data the supervised machine learning methods obtain superior classification performances with respect to the traditional DNA Barcode classification methods. On empirical data their classification performances are at a comparable level to the other methods. Conclusions The classification analysis shows that supervised machine learning methods are promising candidates for handling with success the DNA Barcoding species classification problem, obtaining excellent performances. To conclude, a powerful tool to perform species identification is now available to the DNA Barcoding community. PMID:24721333
Jiao, Lichao; Yu, Min; Wiedenhoeft, Alex C; He, Tuo; Li, Jianing; Liu, Bo; Jiang, Xiaomei; Yin, Yafang
2018-01-31
DNA barcoding has been proposed as a useful tool for forensic wood identification and development of a reliable DNA reference library is an essential first step. Xylaria (wood collections) are potentially enormous data repositories if DNA information could be extracted from wood specimens. In this study, 31 xylarium wood specimens and 8 leaf specimens of six important commercial species of Pterocarpus were selected to investigate the reliability of DNA barcodes for authentication at the species level and to determine the feasibility of building wood DNA barcode reference libraries from xylarium specimens. Four DNA barcodes (ITS2, matK, ndhF-rpl32 and rbcL) and their combination were tested to evaluate their discrimination ability for Pterocarpus species with both TaxonDNA and tree-based analytical methods. The results indicated that the combination barcode of matK + ndhF-rpl32 + ITS2 yielded the best discrimination for the Pterocarpus species studied. The mini-barcode ndhF-rpl32 (167-173 bps) performed well distinguishing P. santalinus from its wood anatomically inseparable species P. tinctorius. Results from this study verified not only the feasibility of building DNA barcode libraries using xylarium wood specimens, but the importance of using wood rather than leaves as the source tissue, when wood is the botanical material to be identified.
DNA barcoding gap: reliable species identification over morphological and geographical scales.
Čandek, Klemen; Kuntner, Matjaž
2015-03-01
The philosophical basis and utility of DNA barcoding have been a subject of numerous debates. While most literature embraces it, some studies continue to question its use in dipterans, butterflies and marine gastropods. Here, we explore the utility of DNA barcoding in identifying spider species that vary in taxonomic affiliation, morphological diagnosibility and geographic distribution. Our first test searched for a 'barcoding gap' by comparing intra- and interspecific means, medians and overlap in more than 75,000 computed Kimura 2-parameter (K2P) genetic distances in three families. Our second test compared K2P distances of congeneric species with high vs. low morphological distinctness in 20 genera of 11 families. Our third test explored the effect of enlarging geographical sampling area at a continental scale on genetic variability in DNA barcodes within 20 species of nine families. Our results generally point towards a high utility of DNA barcodes in identifying spider species. However, the size of the barcoding gap strongly depends on taxonomic groups and practices. It is becoming critical to define the barcoding gap statistically more consistently and to document its variation over taxonomic scales. Our results support models of independent patterns of morphological and molecular evolution by showing that DNA barcodes are effective in species identification regardless of their morphological diagnosibility. We also show that DNA barcodes represent an effective tool for identifying spider species over geographic scales, yet their variation contains useful biogeographic information. © 2014 John Wiley & Sons Ltd.
Highlighting Astyanax Species Diversity through DNA Barcoding
Oliveira, Carlos Alexandre Miranda; de Melo, Filipe Augusto Gonçalves; Bertaco, Vinicius de Araújo; de Astarloa, Juan M. Díaz; Rosso, Juan J.; Foresti, Fausto; Oliveira, Claudio
2016-01-01
DNA barcoding has been used extensively to solve taxonomic questions and identify new species. Neotropical fishes are found in a wide variety of shapes and sizes, with a large number of species yet to be described, many of which are very difficult to identify. Characidae is the most species-rich family of the Characiformes, and many of its genera are affected by taxonomic uncertainties, including the widely-distributed, species-rich genus Astyanax. In this study, we present an extensive analysis of Astyanax covering almost its entire area of occurrence, based on DNA barcoding. The use of different approaches (ABGD, GMYC and BIN) to the clustering of the sequences revealed ample consistency in the results obtained by the initial cutoff value of 2% divergence for putative species in the Neighbor-Joining analysis using the Kimura-2-parameter model. The results indicate the existence of five Astyanax lineages. Some groups, such as that composed by the trans-Andean forms, are mostly composed of well-defined species, and in others a number of nominal species are clustered together, hampering the delimitation of species, which in many cases proved impossible. The results confirm the extreme complexity of the systematics of the genus Astyanax and show that DNA barcoding can be an useful tool to address these complexes questions. PMID:27992537
Chee, S Y
2015-05-25
The mitochondrial DNA (mtDNA) cytochrome oxidase I (COI) gene has been universally and successfully utilized as a barcoding gene, mainly because it can be amplified easily, applied across a wide range of taxa, and results can be obtained cheaply and quickly. However, in rare cases, the gene can fail to distinguish between species, particularly when exposed to highly sensitive methods of data analysis, such as the Bayesian method, or when taxa have undergone introgressive hybridization, over-splitting, or incomplete lineage sorting. Such cases require the use of alternative markers, and nuclear DNA markers are commonly used. In this study, a dendrogram produced by Bayesian analysis of an mtDNA COI dataset was compared with that of a nuclear DNA ATPS-α dataset, in order to evaluate the efficiency of COI in barcoding Malaysian nerites (Neritidae). In the COI dendrogram, most of the species were in individual clusters, except for two species: Nerita chamaeleon and N. histrio. These two species were placed in the same subcluster, whereas in the ATPS-α dendrogram they were in their own subclusters. Analysis of the ATPS-α gene also placed the two genera of nerites (Nerita and Neritina) in separate clusters, whereas COI gene analysis placed both genera in the same cluster. Therefore, in the case of the Neritidae, the ATPS-α gene is a better barcoding gene than the COI gene.
Zhang, Wei; Fan, Xiaohong; Zhu, Shuifang; Zhao, Hong; Fu, Lianzhong
2013-01-01
Comprehensive sampling is crucial to DNA barcoding, but it is rarely performed because materials are usually unavailable. In practice, only a few rather than all species of a genus are required to be identified. Thus identification of a given species using a limited sample is of great importance in current application of DNA barcodes. Here, we selected 70 individuals representing 48 species from each major lineage of Solanum, one of the most species-rich genera of seed plants, to explore whether DNA barcodes can provide reliable specific-species discrimination in the context of incomplete sampling. Chloroplast genes ndhF and trnS-trnG and the nuclear gene waxy, the commonly used markers in Solanum phylogeny, were selected as the supplementary barcodes. The tree-building and modified barcode gap methods were employed to assess species resolution. The results showed that four Solanum species of quarantine concern could be successfully identified through the two-step barcoding sampling strategy. In addition, discrepancies between nuclear and cpDNA barcodes in some samples demonstrated the ability to discriminate hybrid species, and highlights the necessity of using barcode regions with different modes of inheritance. We conclude that efficient phylogenetic markers are good candidates as the supplementary barcodes in a given taxonomic group. Critically, we hypothesized that a specific-species could be identified from a phylogenetic framework using incomplete sampling-through this, DNA barcoding will greatly benefit the current fields of its application.
Moftah, Marie; Abdel Aziz, Sayeda H.; Elramah, Sara; Favereaux, Alexandre
2011-01-01
The identification of species constitutes the first basic step in phylogenetic studies, biodiversity monitoring and conservation. DNA barcoding, i.e. the sequencing of a short standardized region of DNA, has been proposed as a new tool for animal species identification. The present study provides an update on the composition of shark in the Egyptian Mediterranean waters off Alexandria, since the latest study to date was performed 30 years ago, DNA barcoding was used in addition to classical taxonomical methodologies. Thus, 51 specimen were DNA barcoded for a 667 bp region of the mitochondrial COI gene. Although DNA barcoding aims at developing species identification systems, some phylogenetic signals were apparent in the data. In the neighbor-joining tree, 8 major clusters were apparent, each of them containing individuals belonging to the same species, and most with 100% bootstrap value. This study is the first to our knowledge to use DNA barcoding of the mitochondrial COI gene in order to confirm the presence of species Squalus acanthias, Oxynotus centrina, Squatina squatina, Scyliorhinus canicula, Scyliorhinus stellaris, Mustelus mustelus, Mustelus punctulatus and Carcharhinus altimus in the Egyptian Mediterranean waters. Finally, our study is the starting point of a new barcoding database concerning shark composition in the Egyptian Mediterranean waters (Barcoding of Egyptian Mediterranean Sharks [BEMS], http://www.boldsystems.org/views/projectlist.php?Barcoding%20Fish%20%28FishBOL%29). PMID:22087242
Critical factors for assembling a high volume of DNA barcodes
Hajibabaei, Mehrdad; deWaard, Jeremy R; Ivanova, Natalia V; Ratnasingham, Sujeevan; Dooh, Robert T; Kirk, Stephanie L; Mackie, Paula M; Hebert, Paul D.N
2005-01-01
Large-scale DNA barcoding projects are now moving toward activation while the creation of a comprehensive barcode library for eukaryotes will ultimately require the acquisition of some 100 million barcodes. To satisfy this need, analytical facilities must adopt protocols that can support the rapid, cost-effective assembly of barcodes. In this paper we discuss the prospects for establishing high volume DNA barcoding facilities by evaluating key steps in the analytical chain from specimens to barcodes. Alliances with members of the taxonomic community represent the most effective strategy for provisioning the analytical chain with specimens. The optimal protocols for DNA extraction and subsequent PCR amplification of the barcode region depend strongly on their condition, but production targets of 100K barcode records per year are now feasible for facilities working with compliant specimens. The analysis of museum collections is currently challenging, but PCR cocktails that combine polymerases with repair enzyme(s) promise future success. Barcode analysis is already a cost-effective option for species identification in some situations and this will increasingly be the case as reference libraries are assembled and analytical protocols are simplified. PMID:16214753
Determining Plant – Leaf Miner – Parasitoid Interactions: A DNA Barcoding Approach
Derocles, Stéphane A. P.; Evans, Darren M.; Nichols, Paul C.; Evans, S. Aifionn; Lunt, David H.
2015-01-01
A major challenge in network ecology is to describe the full-range of species interactions in a community to create highly-resolved food-webs. We developed a molecular approach based on DNA full barcoding and mini-barcoding to describe difficult to observe plant – leaf miner – parasitoid interactions, consisting of animals commonly regarded as agricultural pests and their natural enemies. We tested the ability of universal primers to amplify the remaining DNA inside leaf miner mines after the emergence of the insect. We compared the results of a) morphological identification of adult specimens; b) identification based on the shape of the mines; c) the COI Mini-barcode (130 bp) and d) the COI full barcode (658 bp) fragments to accurately identify the leaf-miner species. We used the molecular approach to build and analyse a tri-partite ecological network of plant – leaf miner – parasitoid interactions. We were able to detect the DNA of leaf-mining insects within their feeding mines on a range of host plants using mini-barcoding primers: 6% for the leaves collected empty and 33% success after we observed the emergence of the leaf miner. We suggest that the low amplification success of leaf mines collected empty was mainly due to the time since the adult emerged and discuss methodological improvements. Nevertheless our approach provided new species-interaction data for the ecological network. We found that the 130 bp fragment is variable enough to identify all the species included in this study. Both COI fragments reveal that some leaf miner species could be composed of cryptic species. The network built using the molecular approach was more accurate in describing tri-partite interactions compared with traditional approaches based on morphological criteria. PMID:25710377
DNA Barcoding of Sigmodontine Rodents: Identifying Wildlife Reservoirs of Zoonoses
Müller, Lívia; Gonçalves, Gislene L.; Cordeiro-Estrela, Pedro; Marinho, Jorge R.; Althoff, Sérgio L.; Testoni, André. F.; González, Enrique M.; Freitas, Thales R. O.
2013-01-01
Species identification through DNA barcoding is a tool to be added to taxonomic procedures, once it has been validated. Applying barcoding techniques in public health would aid in the identification and correct delimitation of the distribution of rodents from the subfamily Sigmodontinae. These rodents are reservoirs of etiological agents of zoonoses including arenaviruses, hantaviruses, Chagas disease and leishmaniasis. In this study we compared distance-based and probabilistic phylogenetic inference methods to evaluate the performance of cytochrome c oxidase subunit I (COI) in sigmodontine identification. A total of 130 sequences from 21 field-trapped species (13 genera), mainly from southern Brazil, were generated and analyzed, together with 58 GenBank sequences (24 species; 10 genera). Preliminary analysis revealed a 9.5% rate of misidentifications in the field, mainly of juveniles, which were reclassified after examination of external morphological characters and chromosome numbers. Distance and model-based methods of tree reconstruction retrieved similar topologies and monophyly for most species. Kernel density estimation of the distance distribution showed a clear barcoding gap with overlapping of intraspecific and interspecific densities < 1% and 21 species with mean intraspecific distance < 2%. Five species that are reservoirs of hantaviruses could be identified through DNA barcodes. Additionally, we provide information for the description of a putative new species, as well as the first COI sequence of the recently described genus Drymoreomys. The data also indicated an expansion of the distribution of Calomys tener. We emphasize that DNA barcoding should be used in combination with other taxonomic and systematic procedures in an integrative framework and based on properly identified museum collections, to improve identification procedures, especially in epidemiological surveillance and ecological assessments. PMID:24244670
Park, D-S; Suh, S-J; Hebert, P D N; Oh, H-W; Hong, K-J
2011-08-01
Although DNA barcode coverage has grown rapidly for many insect orders, there are some groups, such as scale insects, where sequence recovery has been difficult. However, using a recently developed primer set, we recovered barcode records from 373 specimens, providing coverage for 75 species from 31 genera in two families. Overall success was >90% for mealybugs and >80% for armored scale species. The G·C content was very low in most species, averaging just 16.3%. Sequence divergences (K2P) between congeneric species averaged 10.7%, while intra-specific divergences averaged 0.97%. However, the latter value was inflated by high intra-specific divergence in nine taxa, cases that may indicate species overlooked by current taxonomic treatments. Our study establishes the feasibility of developing a comprehensive barcode library for scale insects and indicates that its construction will both create an effective system for identifying scale insects and reveal taxonomic situations worthy of deeper analysis.
Application of DNA barcodes in wildlife conservation in Tropical East Asia.
Wilson, John-James; Sing, Kong-Wah; Lee, Ping-Shin; Wee, Alison K S
2016-10-01
Over the past 50 years, Tropical East Asia has lost more biodiversity than any tropical region. Tropical East Asia is a megadiverse region with an acute taxonomic impediment. DNA barcodes are short standardized DNA sequences used for taxonomic purposes and have the potential to lessen the challenges of biodiversity inventory and assessments in regions where they are most needed. We reviewed DNA barcoding efforts in Tropical East Asia relative to other tropical regions. We suggest DNA barcodes (or metabarcodes from next-generation sequencers) may be especially useful for characterizing and connecting species-level biodiversity units in inventories encompassing taxa lacking formal description (particularly arthropods) and in large-scale, minimal-impact approaches to vertebrate monitoring and population assessments through secondary sources of DNA (invertebrate derived DNA and environmental DNA). We suggest interest and capacity for DNA barcoding are slowly growing in Tropical East Asia, particularly among the younger generation of researchers who can connect with the barcoding analogy and understand the need for new approaches to the conservation challenges being faced. © 2016 Society for Conservation Biology.
Molecular methods, such as DNA barcoding, have the potential in enhance biomonitoring programs worldwide. Altering routinely used sample preservation methods to protect DNA from degradation may pose a potential impediment to application of DNA barcoding and metagenomics for biom...
DNA barcoding of vouchered xylarium wood specimens of nine endangered Dalbergia species
Min Yu; Lichao Jiao; Juan Guo; Alex C. Wiedenhoeft; Tuo He; Xiaomei Jiang; Yafang Yin
2017-01-01
ITS2+trnH-psbA was the best combination of DNA barcode to resolve the Dalbergia wood species studied. We demonstrate the feasibility of building a DNA barcode reference database using xylarium wood specimens.
Diversity of Marine-Derived Fungal Cultures Exposed by DNA Barcodes: The Algorithm Matters
Andreakis, Nikos; Høj, Lone; Kearns, Philip; Hall, Michael R.; Ericson, Gavin; Cobb, Rose E.; Gordon, Benjamin R.; Evans-Illidge, Elizabeth
2015-01-01
Marine fungi are an understudied group of eukaryotic microorganisms characterized by unresolved genealogies and unstable classification. Whereas DNA barcoding via the nuclear ribosomal internal transcribed spacer (ITS) provides a robust and rapid tool for fungal species delineation, accurate classification of fungi is often arduous given the large number of partial or unknown barcodes and misidentified isolates deposited in public databases. This situation is perpetuated by a paucity of cultivable fungal strains available for phylogenetic research linked to these data sets. We analyze ITS barcodes produced from a subsample (290) of 1781 cultured isolates of marine-derived fungi in the Bioresources Library located at the Australian Institute of Marine Science (AIMS). Our analysis revealed high levels of under-explored fungal diversity. The majority of isolates were ascomycetes including representatives of the subclasses Eurotiomycetidae, Hypocreomycetidae, Sordariomycetidae, Pleosporomycetidae, Dothideomycetidae, Xylariomycetidae and Saccharomycetidae. The phylum Basidiomycota was represented by isolates affiliated with the genera Tritirachium and Tilletiopsis. BLAST searches revealed 26 unknown OTUs and 50 isolates corresponding to previously uncultured, unidentified fungal clones. This study makes a significant addition to the availability of barcoded, culturable marine-derived fungi for detailed future genomic and physiological studies. We also demonstrate the influence of commonly used alignment algorithms and genetic distance measures on the accuracy and comparability of estimating Operational Taxonomic Units (OTUs) by the automatic barcode gap finder (ABGD) method. Large scale biodiversity screening programs that combine datasets using algorithmic OTU delineation pipelines need to ensure compatible algorithms have been used because the algorithm matters. PMID:26308620
Ashfaq, Muhammad; Hebert, Paul D. N.; Mirza, M. Sajjad; Khan, Arif M.; Mansoor, Shahid; Shah, Ghulam S.; Zafar, Yusuf
2014-01-01
Background Although whiteflies (Bemisia tabaci complex) are an important pest of cotton in Pakistan, its taxonomic diversity is poorly understood. As DNA barcoding is an effective tool for resolving species complexes and analyzing species distributions, we used this approach to analyze genetic diversity in the B. tabaci complex and map the distribution of B. tabaci lineages in cotton growing areas of Pakistan. Methods/Principal Findings Sequence diversity in the DNA barcode region (mtCOI-5′) was examined in 593 whiteflies from Pakistan to determine the number of whitefly species and their distributions in the cotton-growing areas of Punjab and Sindh provinces. These new records were integrated with another 173 barcode sequences for B. tabaci, most from India, to better understand regional whitefly diversity. The Barcode Index Number (BIN) System assigned the 766 sequences to 15 BINs, including nine from Pakistan. Representative specimens of each Pakistan BIN were analyzed for mtCOI-3′ to allow their assignment to one of the putative species in the B. tabaci complex recognized on the basis of sequence variation in this gene region. This analysis revealed the presence of Asia II 1, Middle East-Asia Minor 1, Asia 1, Asia II 5, Asia II 7, and a new lineage “Pakistan”. The first two taxa were found in both Punjab and Sindh, but Asia 1 was only detected in Sindh, while Asia II 5, Asia II 7 and “Pakistan” were only present in Punjab. The haplotype networks showed that most haplotypes of Asia II 1, a species implicated in transmission of the cotton leaf curl virus, occurred in both India and Pakistan. Conclusions DNA barcodes successfully discriminated cryptic species in B. tabaci complex. The dominant haplotypes in the B. tabaci complex were shared by India and Pakistan. Asia II 1 was previously restricted to Punjab, but is now the dominant lineage in southern Sindh; its southward spread may have serious implications for cotton plantations in this region. PMID:25099936
Evaluation of the DNA barcodes in Dendrobium (Orchidaceae) from mainland Asia.
Xu, Songzhi; Li, Dezhu; Li, Jianwu; Xiang, Xiaoguo; Jin, Weitao; Huang, Weichang; Jin, Xiaohua; Huang, Luqi
2015-01-01
DNA barcoding has been proposed to be one of the most promising tools for accurate and rapid identification of taxa. However, few publications have evaluated the efficiency of DNA barcoding for the large genera of flowering plants. Dendrobium, one of the largest genera of flowering plants, contains many species that are important in horticulture, medicine and biodiversity conservation. Besides, Dendrobium is a notoriously difficult group to identify. DNA barcoding was expected to be a supplementary means for species identification, conservation and future studies in Dendrobium. We assessed the power of 11 candidate barcodes on the basis of 1,698 accessions of 184 Dendrobium species obtained primarily from mainland Asia. Our results indicated that five single barcodes, i.e., ITS, ITS2, matK, rbcL and trnH-psbA, can be easily amplified and sequenced with the currently established primers. Four barcodes, ITS, ITS2, ITS+matK, and ITS2+matK, have distinct barcoding gaps. ITS+matK was the optimal barcode based on all evaluation methods. Furthermore, the efficiency of ITS+matK was verified in four other large genera including Ficus, Lysimachia, Paphiopedilum, and Pedicularis in this study. Therefore, we tentatively recommend the combination of ITS+matK as a core DNA barcode for large flowering plant genera.
Evaluation of the DNA Barcodes in Dendrobium (Orchidaceae) from Mainland Asia
Xu, Songzhi; Li, Dezhu; Li, Jianwu; Xiang, Xiaoguo; Jin, Weitao; Huang, Weichang; Jin, Xiaohua; Huang, Luqi
2015-01-01
DNA barcoding has been proposed to be one of the most promising tools for accurate and rapid identification of taxa. However, few publications have evaluated the efficiency of DNA barcoding for the large genera of flowering plants. Dendrobium, one of the largest genera of flowering plants, contains many species that are important in horticulture, medicine and biodiversity conservation. Besides, Dendrobium is a notoriously difficult group to identify. DNA barcoding was expected to be a supplementary means for species identification, conservation and future studies in Dendrobium. We assessed the power of 11 candidate barcodes on the basis of 1,698 accessions of 184 Dendrobium species obtained primarily from mainland Asia. Our results indicated that five single barcodes, i.e., ITS, ITS2, matK, rbcL and trnH-psbA, can be easily amplified and sequenced with the currently established primers. Four barcodes, ITS, ITS2, ITS+matK, and ITS2+matK, have distinct barcoding gaps. ITS+matK was the optimal barcode based on all evaluation methods. Furthermore, the efficiency of ITS+matK was verified in four other large genera including Ficus, Lysimachia, Paphiopedilum, and Pedicularis in this study. Therefore, we tentatively recommend the combination of ITS+matK as a core DNA barcode for large flowering plant genera. PMID:25602282
A DNA barcode for land plants.
2009-08-04
DNA barcoding involves sequencing a standard region of DNA as a tool for species identification. However, there has been no agreement on which region(s) should be used for barcoding land plants. To provide a community recommendation on a standard plant barcode, we have compared the performance of 7 leading candidate plastid DNA regions (atpF-atpH spacer, matK gene, rbcL gene, rpoB gene, rpoC1 gene, psbK-psbI spacer, and trnH-psbA spacer). Based on assessments of recoverability, sequence quality, and levels of species discrimination, we recommend the 2-locus combination of rbcL+matK as the plant barcode. This core 2-locus barcode will provide a universal framework for the routine use of DNA sequence data to identify specimens and contribute toward the discovery of overlooked species of land plants.
Hollingsworth, Peter M.; Forrest, Laura L.; Spouge, John L.; Hajibabaei, Mehrdad; Ratnasingham, Sujeevan; van der Bank, Michelle; Chase, Mark W.; Cowan, Robyn S.; Erickson, David L.; Fazekas, Aron J.; Graham, Sean W.; James, Karen E.; Kim, Ki-Joong; Kress, W. John; Schneider, Harald; van AlphenStahl, Jonathan; Barrett, Spencer C.H.; van den Berg, Cassio; Bogarin, Diego; Burgess, Kevin S.; Cameron, Kenneth M.; Carine, Mark; Chacón, Juliana; Clark, Alexandra; Clarkson, James J.; Conrad, Ferozah; Devey, Dion S.; Ford, Caroline S.; Hedderson, Terry A.J.; Hollingsworth, Michelle L.; Husband, Brian C.; Kelly, Laura J.; Kesanakurti, Prasad R.; Kim, Jung Sung; Kim, Young-Dong; Lahaye, Renaud; Lee, Hae-Lim; Long, David G.; Madriñán, Santiago; Maurin, Olivier; Meusnier, Isabelle; Newmaster, Steven G.; Park, Chong-Wook; Percy, Diana M.; Petersen, Gitte; Richardson, James E.; Salazar, Gerardo A.; Savolainen, Vincent; Seberg, Ole; Wilkinson, Michael J.; Yi, Dong-Keun; Little, Damon P.
2009-01-01
DNA barcoding involves sequencing a standard region of DNA as a tool for species identification. However, there has been no agreement on which region(s) should be used for barcoding land plants. To provide a community recommendation on a standard plant barcode, we have compared the performance of 7 leading candidate plastid DNA regions (atpF–atpH spacer, matK gene, rbcL gene, rpoB gene, rpoC1 gene, psbK–psbI spacer, and trnH–psbA spacer). Based on assessments of recoverability, sequence quality, and levels of species discrimination, we recommend the 2-locus combination of rbcL+matK as the plant barcode. This core 2-locus barcode will provide a universal framework for the routine use of DNA sequence data to identify specimens and contribute toward the discovery of overlooked species of land plants. PMID:19666622
Nzelu, Chukwunonso O; Cáceres, Abraham G; Arrunátegui-Jiménez, Martín J; Lañas-Rosas, Máximo F; Yañez-Trujillano, Henrry H; Luna-Caipo, Deysi V; Holguín-Mauricci, Carlos E; Katakura, Ken; Hashiguchi, Yoshihisa; Kato, Hirotomo
2015-05-01
Phlebotomine sand flies are the only proven vectors of leishmaniases, a group of human and animal diseases. Accurate knowledge of sand fly species identification is essential in understanding the epidemiology of leishmaniasis and vector control in endemic areas. Classical identification of sand fly species based on morphological characteristics often remains difficult and requires taxonomic expertise. Here, we generated DNA barcodes of the cytochrome c oxidase subunit 1 (COI) gene using 159 adult specimens morphologically identified to be 19 species of sand flies, belonging to 6 subgenera/species groups circulating in Peru, including the vector species. Neighbor-joining (NJ) analysis based on Kimura 2-Parameter genetic distances formed non-overlapping clusters for all species. The levels of intraspecific genetic divergence ranged from 0 to 5.96%, whereas interspecific genetic divergence among different species ranged from 8.39 to 19.08%. The generated COI barcodes could discriminate between all the sand fly taxa. Besides its success in separating known species, we found that DNA barcoding is useful in revealing population differentiation and cryptic diversity, and thus promises to be a valuable tool for epidemiological studies of leishmaniasis. Copyright © 2015 Elsevier B.V. All rights reserved.
The unholy trinity: taxonomy, species delimitation and DNA barcoding
DeSalle, Rob; Egan, Mary G; Siddall, Mark
2005-01-01
Recent excitement over the development of an initiative to generate DNA sequences for all named species on the planet has in our opinion generated two major areas of contention as to how this ‘DNA barcoding’ initiative should proceed. It is critical that these two issues are clarified and resolved, before the use of DNA as a tool for taxonomy and species delimitation can be universalized. The first issue concerns how DNA data are to be used in the context of this initiative; this is the DNA barcode reader problem (or barcoder problem). Currently, many of the published studies under this initiative have used tree building methods and more precisely distance approaches to the construction of the trees that are used to place certain DNA sequences into a taxonomic context. The second problem involves the reaction of the taxonomic community to the directives of the ‘DNA barcoding’ initiative. This issue is extremely important in that the classical taxonomic approach and the DNA approach will need to be reconciled in order for the ‘DNA barcoding’ initiative to proceed with any kind of community acceptance. In fact, we feel that DNA barcoding is a misnomer. Our preference is for the title of the London meetings—Barcoding Life. In this paper we discuss these two concerns generated around the DNA barcoding initiative and attempt to present a phylogenetic systematic framework for an improved barcoder as well as a taxonomic framework for interweaving classical taxonomy with the goals of ‘DNA barcoding’. PMID:16214748
[Principles for molecular identification of traditional Chinese materia medica using DNA barcoding].
Chen, Shi-Lin; Yao, Hui; Han, Jian-Ping; Xin, Tian-Yi; Pang, Xiao-Hui; Shi, Lin-Chun; Luo, Kun; Song, Jing-Yuan; Hou, Dian-Yun; Shi, Shang-Mei; Qian, Zhong-Zhi
2013-01-01
Since the research of molecular identification of Chinese Materia Medica (CMM) using DNA barcode is rapidly developing and popularizing, the principle of this method is approved to be listed in the Supplement of the Pharmacopoeia of the People's Republic of China. Based on the study on comprehensive samples, the DNA barcoding systems have been established to identify CMM, i.e. ITS2 as a core barcode and psbA-trnH as a complementary locus for identification of planta medica, and COI as a core barcode and ITS2 as a complementary locus for identification of animal medica. This article introduced the principle of molecular identification of CMM using DNA barcoding and its drafting instructions. Furthermore, its application perspective was discussed.
Hawlitschek, Oliver; Nagy, Zoltán T.; Berger, Johannes; Glaw, Frank
2013-01-01
In the past decade, DNA barcoding became increasingly common as a method for species identification in biodiversity inventories and related studies. However, mainly due to technical obstacles, squamate reptiles have been the target of few barcoding studies. In this article, we present the results of a DNA barcoding study of squamates of the Comoros archipelago, a poorly studied group of oceanic islands close to and mostly colonized from Madagascar. The barcoding dataset presented here includes 27 of the 29 currently recognized squamate species of the Comoros, including 17 of the 18 endemic species. Some species considered endemic to the Comoros according to current taxonomy were found to cluster with non-Comoran lineages, probably due to poorly resolved taxonomy. All other species for which more than one barcode was obtained corresponded to distinct clusters useful for species identification by barcoding. In most species, even island populations could be distinguished using barcoding. Two cryptic species were identified using the DNA barcoding approach. The obtained barcoding topology, a Bayesian tree based on COI sequences of 5 genera, was compared with available multigene topologies, and in 3 cases, major incongruences between the two topologies became evident. Three of the multigene studies were initiated after initial screening of a preliminary version of the barcoding dataset presented here. We conclude that in the case of the squamates of the Comoros Islands, DNA barcoding has proven a very useful and efficient way of detecting isolated populations and promising starting points for subsequent research. PMID:24069192
DNA barcoding reveal patterns of species diversity among northwestern Pacific molluscs
Sun, Shao’e; Li, Qi; Kong, Lingfeng; Yu, Hong; Zheng, Xiaodong; Yu, Ruihai; Dai, Lina; Sun, Yan; Chen, Jun; Liu, Jun; Ni, Lehai; Feng, Yanwei; Yu, Zhenzhen; Zou, Shanmei; Lin, Jiping
2016-01-01
This study represents the first comprehensive molecular assessment of northwestern Pacific molluscs. In total, 2801 DNA barcodes belonging to 569 species from China, Japan and Korea were analyzed. An overlap between intra- and interspecific genetic distances was present in 71 species. We tested the efficacy of this library by simulating a sequence-based specimen identification scenario using Best Match (BM), Best Close Match (BCM) and All Species Barcode (ASB) criteria with three threshold values. BM approach returned 89.15% true identifications (95.27% when excluding singletons). The highest success rate of congruent identifications was obtained with BCM at 0.053 threshold. The analysis of our barcode library together with public data resulted in 582 Barcode Index Numbers (BINs), 72.2% of which was found to be concordantly with morphology-based identifications. The discrepancies were divided in two groups: sequences from different species clustered in a single BIN and conspecific sequences divided in one more BINs. In Neighbour-Joining phenogram, 2,320 (83.0%) queries fromed 355 (62.4%) species-specific barcode clusters allowing their successful identification. 33 species showed paraphyletic and haplotype sharing. 62 cases are represented by deeply diverged lineages. This study suggest an increased species diversity in this region, highlighting taxonomic revision and conservation strategy for the cryptic complexes. PMID:27640675
A DNA mini-barcode for land plants.
Little, Damon P
2014-05-01
Small portions of the barcode region - mini-barcodes - may be used in place of full-length barcodes to overcome DNA degradation for samples with poor DNA preservation. 591,491,286 rbcL mini-barcode primer combinations were electronically evaluated for PCR universality, and two novel highly universal sets of priming sites were identified. Novel and published rbcL mini-barcode primers were evaluated for PCR amplification [determined with a validated electronic simulation (n = 2765) and empirically (n = 188)], Sanger sequence quality [determined empirically (n = 188)], and taxonomic discrimination [determined empirically (n = 30,472)]. PCR amplification for all mini-barcodes, as estimated by validated electronic simulation, was successful for 90.2-99.8% of species. Overall Sanger sequence quality for mini-barcodes was very low - the best mini-barcode tested produced sequences of adequate quality (B20 ≥ 0.5) for 74.5% of samples. The majority of mini-barcodes provide correct identifications of families in excess of 70.1% of the time. Discriminatory power noticeably decreased at lower taxonomic levels. At the species level, the discriminatory power of the best mini-barcode was less than 38.2%. For samples believed to contain DNA from only one species, an investigator should attempt to sequence, in decreasing order of utility and probability of success, mini-barcodes F (rbcL1/rbcLB), D (F52/R193) and K (F517/R604). For samples believed to contain DNA from more than one species, an investigator should amplify and sequence mini-barcode D (F52/R193). © 2013 John Wiley & Sons Ltd.
Zhou, Zhenpeng; Li, Tian; Huang, Hongduan; Chen, Yang; Liu, Feng; Huang, Chengzhi; Li, Na
2014-11-11
Silver-enhanced fluorescence was coupled with a bio-barcode assay to facilitate a dual amplification assay to demonstrate a non-enzymatic approach for simple and sensitive detection of DNA. In the assay design, magnetic nanoparticles seeded with silver nanoparticles were modified with the capture DNA, and silver nanoparticles were modified with the binding of ssDNA and the fluorescently labeled barcode dsDNA. Upon introduction of the target DNA, a sandwich structure was formed because of the hybridization reaction. By simple magnetic separation, silver-enhanced fluorescence of barcode DNAs could be readily measured without the need of a further step to liberate barcode DNAs from silver nanoparticles, endowing the method with simplicity and high sensitivity with a detection limit of 1 pM.
NASA Astrophysics Data System (ADS)
Zhou, Hong; Zhang, Zhinan; Chen, Haiyan; Sun, Renhua; Wang, Hui; Guo, Lei; Pan, Haijian
2010-07-01
In this study, we integrated a DNA barcoding project with an ecological survey on intertidal polychaete communities and investigated the utility of CO1 gene sequence as a DNA barcode for the classification of the intertidal polychaetes. Using 16S rDNA as a complementary marker and combining morphological and ecological characterization, some of dominant and common polychaete species from Chinese coasts were assessed for their taxonomic status. We obtained 22 haplotype gene sequences of 13 taxa, including 10 CO1 sequences and 12 16S rDNA sequences. Based on intra- and inter-specific distances, we built phylogenetic trees using the neighbor-joining method. Our study suggested that the mitochondrial CO1 gene was a valid DNA barcoding marker for species identification in polychaetes, but other genes, such as 16S rDNA, could be used as a complementary genetic marker. For more accurate species identification and effective testing of species hypothesis, DNA barcoding should be incorporated with morphological, ecological, biogeographical, and phylogenetic information. The application of DNA barcoding and molecular identification in the ecological survey on the intertidal polychaete communities demonstrated the feasibility of integrating DNA taxonomy and ecology.
Schäffer, Sylvia; Zachos, Frank E.
2017-01-01
DNA-barcoding is a rapidly developing method for efficiently identifying samples to species level by means of short standard DNA sequences. However, reliable species assignment requires the availability of a comprehensive DNA barcode reference library, and hence numerous initiatives aim at generating such barcode databases for particular taxa or geographic regions. Historical museum collections represent a potentially invaluable source for the DNA-barcoding of many taxa. This is particularly true for birds and mammals, for which collecting fresh (voucher) material is often very difficult to (nearly) impossible due to the special animal welfare and conservation regulations that apply to vertebrates in general, and birds and mammals in particular. Moreover, even great efforts might not guarantee sufficiently complete sampling of fresh material in a short period of time. DNA extracted from historical samples is usually degraded, such that only short fragments can be amplified, rendering the recovery of the barcoding region as a single fragment impossible. Here, we present a new set of primers that allows the efficient amplification and sequencing of the entire barcoding region in most higher taxa of Central European birds and mammals in six overlapping fragments, thus greatly increasing the value of historical museum collections for generating DNA barcode reference libraries. Applying our new primer set in recently established NGS protocols promises to further increase the efficiency of barcoding old bird and mammal specimens. PMID:28358863
Schäffer, Sylvia; Zachos, Frank E; Koblmüller, Stephan
2017-01-01
DNA-barcoding is a rapidly developing method for efficiently identifying samples to species level by means of short standard DNA sequences. However, reliable species assignment requires the availability of a comprehensive DNA barcode reference library, and hence numerous initiatives aim at generating such barcode databases for particular taxa or geographic regions. Historical museum collections represent a potentially invaluable source for the DNA-barcoding of many taxa. This is particularly true for birds and mammals, for which collecting fresh (voucher) material is often very difficult to (nearly) impossible due to the special animal welfare and conservation regulations that apply to vertebrates in general, and birds and mammals in particular. Moreover, even great efforts might not guarantee sufficiently complete sampling of fresh material in a short period of time. DNA extracted from historical samples is usually degraded, such that only short fragments can be amplified, rendering the recovery of the barcoding region as a single fragment impossible. Here, we present a new set of primers that allows the efficient amplification and sequencing of the entire barcoding region in most higher taxa of Central European birds and mammals in six overlapping fragments, thus greatly increasing the value of historical museum collections for generating DNA barcode reference libraries. Applying our new primer set in recently established NGS protocols promises to further increase the efficiency of barcoding old bird and mammal specimens.
Efficient alignment-free DNA barcode analytics.
Kuksa, Pavel; Pavlovic, Vladimir
2009-11-10
In this work we consider barcode DNA analysis problems and address them using alternative, alignment-free methods and representations which model sequences as collections of short sequence fragments (features). The methods use fixed-length representations (spectrum) for barcode sequences to measure similarities or dissimilarities between sequences coming from the same or different species. The spectrum-based representation not only allows for accurate and computationally efficient species classification, but also opens possibility for accurate clustering analysis of putative species barcodes and identification of critical within-barcode loci distinguishing barcodes of different sample groups. New alignment-free methods provide highly accurate and fast DNA barcode-based identification and classification of species with substantial improvements in accuracy and speed over state-of-the-art barcode analysis methods. We evaluate our methods on problems of species classification and identification using barcodes, important and relevant analytical tasks in many practical applications (adverse species movement monitoring, sampling surveys for unknown or pathogenic species identification, biodiversity assessment, etc.) On several benchmark barcode datasets, including ACG, Astraptes, Hesperiidae, Fish larvae, and Birds of North America, proposed alignment-free methods considerably improve prediction accuracy compared to prior results. We also observe significant running time improvements over the state-of-the-art methods. Our results show that newly developed alignment-free methods for DNA barcoding can efficiently and with high accuracy identify specimens by examining only few barcode features, resulting in increased scalability and interpretability of current computational approaches to barcoding.
Blagoev, Gergin A; Nikolova, Nadya I; Sobel, Crystal N; Hebert, Paul D N; Adamowicz, Sarah J
2013-11-26
Arctic ecosystems, especially those near transition zones, are expected to be strongly impacted by climate change. Because it is positioned on the ecotone between tundra and boreal forest, the Churchill area is a strategic locality for the analysis of shifts in faunal composition. This fact has motivated the effort to develop a comprehensive biodiversity inventory for the Churchill region by coupling DNA barcoding with morphological studies. The present study represents one element of this effort; it focuses on analysis of the spider fauna at Churchill. 198 species were detected among 2704 spiders analyzed, tripling the count for the Churchill region. Estimates of overall diversity suggest that another 10-20 species await detection. Most species displayed little intraspecific sequence variation (maximum <1%) in the barcode region of the cytochrome c oxidase subunit I (COI) gene, but four species showed considerably higher values (maximum = 4.1-6.2%), suggesting cryptic species. All recognized species possessed a distinct haplotype array at COI with nearest-neighbour interspecific distances averaging 8.57%. Three species new to Canada were detected: Robertus lyrifer (Theridiidae), Baryphyma trifrons (Linyphiidae), and Satilatlas monticola (Linyphiidae). The first two species may represent human-mediated introductions linked to the port in Churchill, but the other species represents a range extension from the USA. The first description of the female of S. monticola was also presented. As well, one probable new species of Alopecosa (Lycosidae) was recognized. This study provides the first comprehensive DNA barcode reference library for the spider fauna of any region. Few cryptic species of spiders were detected, a result contrasting with the prevalence of undescribed species in several other terrestrial arthropod groups at Churchill. Because most (97.5%) sequence clusters at COI corresponded with a named taxon, DNA barcoding reliably identifies spiders in the Churchill fauna. The capacity of DNA barcoding to enable the identification of otherwise taxonomically ambiguous specimens (juveniles, females) also represents a major advance for future monitoring efforts on this group.
Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V
2015-12-01
The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.
Validation of the ITS2 region as a novel DNA barcode for identifying medicinal plant species.
Chen, Shilin; Yao, Hui; Han, Jianping; Liu, Chang; Song, Jingyuan; Shi, Linchun; Zhu, Yingjie; Ma, Xinye; Gao, Ting; Pang, Xiaohui; Luo, Kun; Li, Ying; Li, Xiwen; Jia, Xiaocheng; Lin, Yulin; Leon, Christine
2010-01-07
The plant working group of the Consortium for the Barcode of Life recommended the two-locus combination of rbcL+matK as the plant barcode, yet the combination was shown to successfully discriminate among 907 samples from 550 species at the species level with a probability of 72%. The group admits that the two-locus barcode is far from perfect due to the low identification rate, and the search is not over. Here, we compared seven candidate DNA barcodes (psbA-trnH, matK, rbcL, rpoC1, ycf5, ITS2, and ITS) from medicinal plant species. Our ranking criteria included PCR amplification efficiency, differential intra- and inter-specific divergences, and the DNA barcoding gap. Our data suggest that the second internal transcribed spacer (ITS2) of nuclear ribosomal DNA represents the most suitable region for DNA barcoding applications. Furthermore, we tested the discrimination ability of ITS2 in more than 6600 plant samples belonging to 4800 species from 753 distinct genera and found that the rate of successful identification with the ITS2 was 92.7% at the species level. The ITS2 region can be potentially used as a standard DNA barcode to identify medicinal plants and their closely related species. We also propose that ITS2 can serve as a novel universal barcode for the identification of a broader range of plant taxa.
Zhou, Chengran
2017-01-01
Abstract Over the past decade, biodiversity researchers have dedicated tremendous efforts to constructing DNA reference barcodes for rapid species registration and identification. Although analytical cost for standard DNA barcoding has been significantly reduced since early 2000, further dramatic reduction in barcoding costs is unlikely because Sanger sequencing is approaching its limits in throughput and chemistry cost. Constraints in barcoding cost not only led to unbalanced barcoding efforts around the globe, but also prevented high-throughput sequencing (HTS)–based taxonomic identification from applying binomial species names, which provide crucial linkages to biological knowledge. We developed an Illumina-based pipeline, HIFI-Barcode, to produce full-length Cytochrome c oxidase subunit I (COI) barcodes from pooled polymerase chain reaction amplicons generated by individual specimens. The new pipeline generated accurate barcode sequences that were comparable to Sanger standards, even for different haplotypes of the same species that were only a few nucleotides different from each other. Additionally, the new pipeline was much more sensitive in recovering amplicons at low quantity. The HIFI-Barcode pipeline successfully recovered barcodes from more than 78% of the polymerase chain reactions that didn’t show clear bands on the electrophoresis gel. Moreover, sequencing results based on the single molecular sequencing platform Pacbio confirmed the accuracy of the HIFI-Barcode results. Altogether, the new pipeline can provide an improved solution to produce full-length reference barcodes at about one-tenth of the current cost, enabling construction of comprehensive barcode libraries for local fauna, leading to a feasible direction for DNA barcoding global biomes. PMID:29077841
Liu, Shanlin; Yang, Chentao; Zhou, Chengran; Zhou, Xin
2017-12-01
Over the past decade, biodiversity researchers have dedicated tremendous efforts to constructing DNA reference barcodes for rapid species registration and identification. Although analytical cost for standard DNA barcoding has been significantly reduced since early 2000, further dramatic reduction in barcoding costs is unlikely because Sanger sequencing is approaching its limits in throughput and chemistry cost. Constraints in barcoding cost not only led to unbalanced barcoding efforts around the globe, but also prevented high-throughput sequencing (HTS)-based taxonomic identification from applying binomial species names, which provide crucial linkages to biological knowledge. We developed an Illumina-based pipeline, HIFI-Barcode, to produce full-length Cytochrome c oxidase subunit I (COI) barcodes from pooled polymerase chain reaction amplicons generated by individual specimens. The new pipeline generated accurate barcode sequences that were comparable to Sanger standards, even for different haplotypes of the same species that were only a few nucleotides different from each other. Additionally, the new pipeline was much more sensitive in recovering amplicons at low quantity. The HIFI-Barcode pipeline successfully recovered barcodes from more than 78% of the polymerase chain reactions that didn't show clear bands on the electrophoresis gel. Moreover, sequencing results based on the single molecular sequencing platform Pacbio confirmed the accuracy of the HIFI-Barcode results. Altogether, the new pipeline can provide an improved solution to produce full-length reference barcodes at about one-tenth of the current cost, enabling construction of comprehensive barcode libraries for local fauna, leading to a feasible direction for DNA barcoding global biomes. © The Authors 2017. Published by Oxford University Press.
DNA Barcodes for Forensically Important Fly Species in Brazil.
Koroiva, Ricardo; de Souza, Mirian S; Roque, Fabio de Oliveira; Pepinelli, Mateus
2018-04-07
Here, we analyze 248 DNA barcode sequences of 35 fly species of forensic importance in Brazil. DNA barcoding can be effectively used for specimen identification of these species, allowing the unambiguous identification of 31 species, an overall success rate of 88%. Our results show a high rate of success for molecular identification using DNA barcoding sequences and open new perspectives for immature species identification, a subject on which limited forensic investigations exist in Tropical regions. We also address the implications of building a robust forensic DNA barcode database. A geographic bias is recognized for the COI dataset available for forensically important fly species in Brazil, with concentration of sequences from specimens collected mainly in sites located in the Cerrado, Mata Atlântica, and Pampa biomes.
Efficacy of DNA barcoding for the species identification of spiders from Western Ghats of India.
Gaikwad, Swapnil; Warudkar, Ashwin; Shouche, Yogesh
2017-09-01
DNA barcoding has emerged as an additional tool for taxonomy and as an aid to taxonomic impediments. Due to their extensive morphological variation, spiders are taxonomically challenging. Therefore, all over the world, attempts are being made to DNA barcode species of spiders. Till now no attempts were made to DNA barcode Indian spiders despite their rich diversity. We have generated DNA barcodes for 60 species (n = 112) of spiders for the first time from India. Although only 17 species were correctly identified at the species level, DNA barcoding correctly discriminated 99% of the species studied here. We have also found high intraspecies nucleotide divergence in Plexippus paykulli suggesting cryptic diversity that needs to be studied in detail. Our study also showed non-specific amplification of the Cytochrome Oxidase I (COI) gene of endosymbiont bacteria Wolbachia. However, these cases are very rare and could be resolved by the use of modified or group specific primers.
Zúñiga, Jose D.; Gostel, Morgan R.; Mulcahy, Daniel G.; Barker, Katharine; Asia Hill; Sedaghatpour, Maryam; Vo, Samantha Q.; Funk, Vicki A.; Coddington, Jonathan A.
2017-01-01
Abstract The Global Genome Initiative has sequenced and released 1961 DNA barcodes for genetic samples obtained as part of the Global Genome Initiative for Gardens Program. The dataset includes barcodes for 29 plant families and 309 genera that did not have sequences flagged as barcodes in GenBank and sequences from officially recognized barcoding genetic markers meet the data standard of the Consortium for the Barcode of Life. The genetic samples were deposited in the Smithsonian Institution’s National Museum of Natural History Biorepository and their records were made public through the Global Genome Biodiversity Network’s portal. The DNA barcodes are now available on GenBank. PMID:29118648
Defining operational taxonomic units using DNA barcode data.
Blaxter, Mark; Mann, Jenna; Chapman, Tom; Thomas, Fran; Whitton, Claire; Floyd, Robin; Abebe, Eyualem
2005-10-29
The scale of diversity of life on this planet is a significant challenge for any scientific programme hoping to produce a complete catalogue, whatever means is used. For DNA barcoding studies, this difficulty is compounded by the realization that any chosen barcode sequence is not the gene 'for' speciation and that taxa have evolutionary histories. How are we to disentangle the confounding effects of reticulate population genetic processes? Using the DNA barcode data from meiofaunal surveys, here we discuss the benefits of treating the taxa defined by barcodes without reference to their correspondence to 'species', and suggest that using this non-idealist approach facilitates access to taxon groups that are not accessible to other methods of enumeration and classification. Major issues remain, in particular the methodologies for taxon discrimination in DNA barcode data.
Thaler, David S; Stoeckle, Mark Y
2016-10-01
DNA barcodes for species identification and the analysis of human mitochondrial variation have developed as independent fields even though both are based on sequences from animal mitochondria. This study finds questions within each field that can be addressed by reference to the other. DNA barcodes are based on a 648-bp segment of the mitochondrially encoded cytochrome oxidase I. From most species, this segment is the only sequence available. It is impossible to know whether it fairly represents overall mitochondrial variation. For modern humans, the entire mitochondrial genome is available from thousands of healthy individuals. SNPs in the human mitochondrial genome are evenly distributed across all protein-encoding regions arguing that COI DNA barcode is representative. Barcode variation among related species is largely based on synonymous codons. Data on human mitochondrial variation support the interpretation that most - possibly all - synonymous substitutions in mitochondria are selectively neutral. DNA barcodes confirm reports of a low variance in modern humans compared to nonhuman primates. In addition, DNA barcodes allow the comparison of modern human variance to many other extant animal species. Birds are a well-curated group in which DNA barcodes are coupled with census and geographic data. Putting modern human variation in the context of intraspecies variation among birds shows humans to be a single breeding population of average variance.
Decru, Eva; Moelants, Tuur; De Gelas, Koen; Vreven, Emmanuel; Verheyen, Erik; Snoeks, Jos
2016-01-01
This study evaluates the utility of DNA barcoding to traditional morphology-based species identifications for the fish fauna of the north-eastern Congo basin. We compared DNA sequences (COI) of 821 samples from 206 morphologically identified species. Best match, best close match and all species barcoding analyses resulted in a rather low identification success of 87.5%, 84.5% and 64.1%, respectively. The ratio 'nearest-neighbour distance/maximum intraspecific divergence' was lower than 1 for 26.1% of the samples, indicating possible taxonomic problems. In ten genera, belonging to six families, the number of species inferred from mtDNA data exceeded the number of species identified using morphological features; and in four cases indications of possible synonymy were detected. Finally, the DNA barcodes confirmed previously known identification problems within certain genera of the Clariidae, Cyprinidae and Mormyridae. Our results underscore the large number of taxonomic problems lingering in the taxonomy of the fish fauna of the Congo basin and illustrate why DNA barcodes will contribute to future efforts to compile a reliable taxonomic inventory of the Congo basin fish fauna. Therefore, the obtained barcodes were deposited in the reference barcode library of the Barcode of Life Initiative. © 2015 John Wiley & Sons Ltd.
Noise reduction in single time frame optical DNA maps
Müller, Vilhelm; Westerlund, Fredrik
2017-01-01
In optical DNA mapping technologies sequence-specific intensity variations (DNA barcodes) along stretched and stained DNA molecules are produced. These “fingerprints” of the underlying DNA sequence have a resolution of the order one kilobasepairs and the stretching of the DNA molecules are performed by surface adsorption or nano-channel setups. A post-processing challenge for nano-channel based methods, due to local and global random movement of the DNA molecule during imaging, is how to align different time frames in order to produce reproducible time-averaged DNA barcodes. The current solutions to this challenge are computationally rather slow. With high-throughput applications in mind, we here introduce a parameter-free method for filtering a single time frame noisy barcode (snap-shot optical map), measured in a fraction of a second. By using only a single time frame barcode we circumvent the need for post-processing alignment. We demonstrate that our method is successful at providing filtered barcodes which are less noisy and more similar to time averaged barcodes. The method is based on the application of a low-pass filter on a single noisy barcode using the width of the Point Spread Function of the system as a unique, and known, filtering parameter. We find that after applying our method, the Pearson correlation coefficient (a real number in the range from -1 to 1) between the single time-frame barcode and the time average of the aligned kymograph increases significantly, roughly by 0.2 on average. By comparing to a database of more than 3000 theoretical plasmid barcodes we show that the capabilities to identify plasmids is improved by filtering single time-frame barcodes compared to the unfiltered analogues. Since snap-shot experiments and computational time using our method both are less than a second, this study opens up for high throughput optical DNA mapping with improved reproducibility. PMID:28640821
Zhang, Dequan; Jiang, Bei; Duan, Lizhen; Zhou, Nong
2016-01-01
DNA barcoding is a technique used to identify species based on species-specific differences in short regions of their DNA. It is widely used in species discrimination of medicinal plants and traditional medicines. In the present study, four potential DNA barcodes, namely rbcL , matK , trnH-psbA and ITS (nuclear ribosomal internal transcribed spacer) were adopted for species discrimination in Crawfurdia Wall (Genetiaceae). Identification ability of these DNA barcodes and combinations were evaluated using three classic methods (Distance, Blast and Tree-Building). As a result, ITS, trnH-psbA and rbcL regions showed great universality for a success rate of 100%; whereas matK was disappointing for which only 65% samples gained useful DNA sequences. ITS region, which could clearly and effectively identify the five species in Crawfurdia , performed very well in this study. On the contrary, trnH-psbA and rbcL performed poorly in discrimination among these species. ITS marker was an ideal DNA barcode in Crawfurdia and it should be incorporated into one of the core barcodes for seed plants.
Integration of DNA barcoding into an ongoing inventory of complex tropical biodiversity
USDA-ARS?s Scientific Manuscript database
The extensive use of DNA barcoding technology in a large inventory of Macrolepidoptera and their parasitoids is documented. The methodology used and its practical applications are summarized, and numerous examples of how DNA barcoding has untangled complexes of cryptic species of butterflies, moths...
Fan, Long; Hui, Jerome H L; Yu, Zu Guo; Chu, Ka Hou
2014-07-01
Species identification based on short sequences of DNA markers, that is, DNA barcoding, has emerged as an integral part of modern taxonomy. However, software for the analysis of large and multilocus barcoding data sets is scarce. The Basic Local Alignment Search Tool (BLAST) is currently the fastest tool capable of handling large databases (e.g. >5000 sequences), but its accuracy is a concern and has been criticized for its local optimization. However, current more accurate software requires sequence alignment or complex calculations, which are time-consuming when dealing with large data sets during data preprocessing or during the search stage. Therefore, it is imperative to develop a practical program for both accurate and scalable species identification for DNA barcoding. In this context, we present VIP Barcoding: a user-friendly software in graphical user interface for rapid DNA barcoding. It adopts a hybrid, two-stage algorithm. First, an alignment-free composition vector (CV) method is utilized to reduce searching space by screening a reference database. The alignment-based K2P distance nearest-neighbour method is then employed to analyse the smaller data set generated in the first stage. In comparison with other software, we demonstrate that VIP Barcoding has (i) higher accuracy than Blastn and several alignment-free methods and (ii) higher scalability than alignment-based distance methods and character-based methods. These results suggest that this platform is able to deal with both large-scale and multilocus barcoding data with accuracy and can contribute to DNA barcoding for modern taxonomy. VIP Barcoding is free and available at http://msl.sls.cuhk.edu.hk/vipbarcoding/. © 2014 John Wiley & Sons Ltd.
Luo, Arong; Zhang, Aibing; Ho, Simon Yw; Xu, Weijun; Zhang, Yanzhou; Shi, Weifeng; Cameron, Stephen L; Zhu, Chaodong
2011-01-28
A well-informed choice of genetic locus is central to the efficacy of DNA barcoding. Current DNA barcoding in animals involves the use of the 5' half of the mitochondrial cytochrome oxidase 1 gene (CO1) to diagnose and delimit species. However, there is no compelling a priori reason for the exclusive focus on this region, and it has been shown that it performs poorly for certain animal groups. To explore alternative mitochondrial barcoding regions, we compared the efficacy of the universal CO1 barcoding region with the other mitochondrial protein-coding genes in eutherian mammals. Four criteria were used for this comparison: the number of recovered species, sequence variability within and between species, resolution to taxonomic levels above that of species, and the degree of mutational saturation. Based on 1,179 mitochondrial genomes of eutherians, we found that the universal CO1 barcoding region is a good representative of mitochondrial genes as a whole because the high species-recovery rate (> 90%) was similar to that of other mitochondrial genes, and there were no significant differences in intra- or interspecific variability among genes. However, an overlap between intra- and interspecific variability was still problematic for all mitochondrial genes. Our results also demonstrated that any choice of mitochondrial gene for DNA barcoding failed to offer significant resolution at higher taxonomic levels. We suggest that the CO1 barcoding region, the universal DNA barcode, is preferred among the mitochondrial protein-coding genes as a molecular diagnostic at least for eutherian species identification. Nevertheless, DNA barcoding with this marker may still be problematic for certain eutherian taxa and our approach can be used to test potential barcoding loci for such groups.
2011-01-01
Background A well-informed choice of genetic locus is central to the efficacy of DNA barcoding. Current DNA barcoding in animals involves the use of the 5' half of the mitochondrial cytochrome oxidase 1 gene (CO1) to diagnose and delimit species. However, there is no compelling a priori reason for the exclusive focus on this region, and it has been shown that it performs poorly for certain animal groups. To explore alternative mitochondrial barcoding regions, we compared the efficacy of the universal CO1 barcoding region with the other mitochondrial protein-coding genes in eutherian mammals. Four criteria were used for this comparison: the number of recovered species, sequence variability within and between species, resolution to taxonomic levels above that of species, and the degree of mutational saturation. Results Based on 1,179 mitochondrial genomes of eutherians, we found that the universal CO1 barcoding region is a good representative of mitochondrial genes as a whole because the high species-recovery rate (> 90%) was similar to that of other mitochondrial genes, and there were no significant differences in intra- or interspecific variability among genes. However, an overlap between intra- and interspecific variability was still problematic for all mitochondrial genes. Our results also demonstrated that any choice of mitochondrial gene for DNA barcoding failed to offer significant resolution at higher taxonomic levels. Conclusions We suggest that the CO1 barcoding region, the universal DNA barcode, is preferred among the mitochondrial protein-coding genes as a molecular diagnostic at least for eutherian species identification. Nevertheless, DNA barcoding with this marker may still be problematic for certain eutherian taxa and our approach can be used to test potential barcoding loci for such groups. PMID:21276253
Comprehensive DNA barcoding of the herpetofauna of Germany.
Hawlitschek, O; Morinière, J; Dunz, A; Franzen, M; Rödder, D; Glaw, F; Haszprunar, G
2016-01-01
We present the first comprehensive DNA barcoding study of German reptiles and amphibians representing likewise the first on the European herpetofauna. A total of 248 barcodes for all native species and subspecies in the country and a few additional taxa were obtained in the framework of the projects 'Barcoding Fauna Bavarica' (BFB) and 'German Barcode of Life' (GBOL). In contrast to many invertebrate groups, the success rate of the identification of mitochondrial lineages representing species via DNA barcode was almost 100% because no cases of Barcode Index Number (BIN) sharing were detected within German native reptiles and amphibians. However, as expected, a reliable identification of the hybridogenetic species complex in the frog genus Pelophylax was not possible. Deep conspecific lineages resulting in the identification of more than one BIN were found in Lissotriton vulgaris, Natrix natrix and the hybridogenetic Pelophylax complex. A high variety of lineages with different BINs was also found in the barcodes of wall lizards (Podarcis muralis), confirming the existence of many introduced lineages and the frequent occurrence of multiple introductions. Besides the reliable species identification of all life stages and even of tissue remains, our study highlights other potential applications of DNA barcoding concerning German amphibians and reptiles, such as the detection of allochthonous lineages, monitoring of gene flow and also noninvasive sampling via environmental DNA. DNA barcoding based on COI has now proven to be a reliable and efficient tool for studying most amphibians and reptiles as it is already for many other organism groups in zoology. © 2015 John Wiley & Sons Ltd.
DNA barcoding commercially important fish species of Turkey.
Keskın, Emre; Atar, Hasan H
2013-09-01
DNA barcoding was used in the identification of 89 commercially important freshwater and marine fish species found in Turkish ichthyofauna. A total of 1765 DNA barcodes using a 654-bp-long fragment of the mitochondrial cytochrome c oxidase subunit I gene were generated for 89 commercially important freshwater and marine fish species found in Turkish ichthyofauna. These species belong to 70 genera, 40 families and 19 orders from class Actinopterygii, and all were associated with a distinct DNA barcode. Nine and 12 of the COI barcode clusters represent the first species records submitted to the BOLD and GenBank databases, respectively. All COI barcodes (except sequences of first species records) were matched with reference sequences of expected species, according to morphological identification. Average nucleotide frequencies of the data set were calculated as T = 29.7%, C = 28.2%, A = 23.6% and G = 18.6%. Average pairwise genetic distance among individuals were estimated as 0.32%, 9.62%, 17,90% and 22.40% for conspecific, congeneric, confamilial and within order, respectively. Kimura 2-parameter genetic distance values were found to increase with taxonomic level. For most of the species analysed in our data set, there is a barcoding gap, and an overlap in the barcoding gap exists for only two genera. Neighbour-joining trees were drawn based on DNA barcodes and all the specimens clustered in agreement with their taxonomic classification at species level. Results of this study supported DNA barcoding as an efficient molecular tool for a better monitoring, conservation and management of fisheries. © 2013 John Wiley & Sons Ltd.
DNA barcoding: an efficient tool to overcome authentication challenges in the herbal market.
Mishra, Priyanka; Kumar, Amit; Nagireddy, Akshitha; Mani, Daya N; Shukla, Ashutosh K; Tiwari, Rakesh; Sundaresan, Velusamy
2016-01-01
The past couple of decades have witnessed global resurgence of herbal-based health care. As a result, the trade of raw drugs has surged globally. Accurate and fast scientific identification of the plant(s) is the key to success for the herbal drug industry. The conventional approach is to engage an expert taxonomist, who uses a mix of traditional and modern techniques for precise plant identification. However, for bulk identification at industrial scale, the process is protracted and time-consuming. DNA barcoding, on the other hand, offers an alternative and feasible taxonomic tool box for rapid and robust species identification. For the success of DNA barcode, the barcode loci must have sufficient information to differentiate unambiguously between closely related plant species and discover new cryptic species. For herbal plant identification, matK, rbcL, trnH-psbA, ITS, trnL-F, 5S-rRNA and 18S-rRNA have been used as successful DNA barcodes. Emerging advances in DNA barcoding coupled with next-generation sequencing and high-resolution melting curve analysis have paved the way for successful species-level resolution recovered from finished herbal products. Further, development of multilocus strategy and its application has provided new vistas to the DNA barcode-based plant identification for herbal drug industry. For successful and acceptable identification of herbal ingredients and a holistic quality control of the drug, DNA barcoding needs to work harmoniously with other components of the systems biology approach. We suggest that for effectively resolving authentication challenges associated with the herbal market, DNA barcoding must be used in conjunction with metabolomics along with need-based transcriptomics and proteomics. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
Efficient alignment-free DNA barcode analytics
Kuksa, Pavel; Pavlovic, Vladimir
2009-01-01
Background In this work we consider barcode DNA analysis problems and address them using alternative, alignment-free methods and representations which model sequences as collections of short sequence fragments (features). The methods use fixed-length representations (spectrum) for barcode sequences to measure similarities or dissimilarities between sequences coming from the same or different species. The spectrum-based representation not only allows for accurate and computationally efficient species classification, but also opens possibility for accurate clustering analysis of putative species barcodes and identification of critical within-barcode loci distinguishing barcodes of different sample groups. Results New alignment-free methods provide highly accurate and fast DNA barcode-based identification and classification of species with substantial improvements in accuracy and speed over state-of-the-art barcode analysis methods. We evaluate our methods on problems of species classification and identification using barcodes, important and relevant analytical tasks in many practical applications (adverse species movement monitoring, sampling surveys for unknown or pathogenic species identification, biodiversity assessment, etc.) On several benchmark barcode datasets, including ACG, Astraptes, Hesperiidae, Fish larvae, and Birds of North America, proposed alignment-free methods considerably improve prediction accuracy compared to prior results. We also observe significant running time improvements over the state-of-the-art methods. Conclusion Our results show that newly developed alignment-free methods for DNA barcoding can efficiently and with high accuracy identify specimens by examining only few barcode features, resulting in increased scalability and interpretability of current computational approaches to barcoding. PMID:19900305
Applying plant DNA barcodes to identify species of Parnassia (Parnassiaceae).
Yang, Jun-Bo; Wang, Yi-Ping; Möller, Michael; Gao, Lian-Ming; Wu, Ding
2012-03-01
DNA barcoding is a technique to identify species by using standardized DNA sequences. In this study, a total of 105 samples, representing 30 Parnassia species, were collected to test the effectiveness of four proposed DNA barcodes (rbcL, matK, trnH-psbA and ITS) for species identification. Our results demonstrated that all four candidate DNA markers have a maximum level of primer universality and sequencing success. As a single DNA marker, the ITS region provided the highest species resolution with 86.7%, followed by trnH-psbA with 73.3%. The combination of the core barcode regions, matK+rbcL, gave the lowest species identification success (63.3%) among any combination of multiple markers and was found unsuitable as DNA barcode for Parnassia. The combination of ITS+trnH-psbA achieved the highest species discrimination with 90.0% resolution (27 of 30 sampled species), equal to the four-marker combination and higher than any two or three marker combination including rbcL or matK. Therefore, matK and rbcL should not be used as DNA barcodes for the species identification of Parnassia. Based on the overall performance, the combination of ITS+trnH-psbA is proposed as the most suitable DNA barcode for identifying Parnassia species. DNA barcoding is a useful technique and provides a reliable and effective mean for the discrimination of Parnassia species, and in combination with morphology-based taxonomy, will be a robust approach for tackling taxonomically complex groups. In the light of our findings, we found among the three species not identified a possible cryptic speciation event in Parnassia. © 2011 Blackwell Publishing Ltd.
Arshed, Muhammad Jefte C; Valdez, Marcos B; Alejandro, Grecebio Jonathan D
2017-01-01
The pantropical genus Lasianthus Jack is identified for high phenotypic plasticity making traditional taxonomic identification difficult. Having some members with important medicinal properties, a precise complimentary identification through DNA barcoding is needed for species delineation. In this study, 12 samples representing six Philippine Lasianthus species were used to determine the most efficient barcoding loci among the cpDNA markers ( mat K, rbc L, rps 16, and trn T-F) and nrDNA (ITS) based on the criteria of universality, discriminatory power, and resolution of species. The results revealed that ITS has the recommended primer universality, greatest interspecific divergences, and average resolution of species. Among the cpDNA markers, mat K and rbc L are recommended but with minimal resolution of species. While trn T-F showed moderate interspecific variations and resolution of Lasianthus species, rps 16 has the lowest interspecific divergence and resolution of species. Consequently, ITS is the potential ideal DNA barcode for Lasianthus species. ITS, mat K, and rps 16 markers have the excellent amplification and sequence qualityITS marker has the highest interspecific divergence with the maximum values, followed by mat K, rbc L, trn T-F, and rps 16, respectivelyAll markers except rps 16 yielded average resolution to Lasianthus speciesITS marker is the most ideal locus in terms of excellent universality, high interspecific discriminatory ability, and average species resolution. Abbreviations used: ITS: Internal Transcribe Spacer, mat K: maturase K, rbc L: ribulose-1,5-biphospahte-carboxylase, rps 16: ribosomal protein 16 small subunit gene.
Guo, Shaokun; He, Jia; Zhao, Zihua; Liu, Lijun; Gao, Liyuan; Wei, Shuhua; Guo, Xiaoyu; Zhang, Rong; Li, Zhihong
2017-12-12
Neoceratitis asiatica (Becker), which especially infests wolfberry (Lycium barbarum L.), could cause serious economic losses every year in China, especially to organic wolfberry production. In some important wolfberry plantings, it is difficult and time-consuming to rear the larvae or pupae to adults for morphological identification. Molecular identification based on DNA barcode is a solution to the problem. In this study, 15 samples were collected from Ningxia, China. Among them, five adults were identified according to their morphological characteristics. The utility of mitochondrial DNA (mtDNA) cytochrome c oxidase I (COI) gene sequence as DNA barcode in distinguishing N. asiatica was evaluated by analysing Kimura 2-parameter distances and phylogenetic trees. There were significant differences between intra-specific and inter-specific genetic distances according to the barcoding gap analysis. The uncertain larval and pupal samples were within the same cluster as N. asiatica adults and formed sister cluster to N. cyanescens. A combination of morphological and molecular methods enabled accurate identification of N. asiatica. This is the first study using DNA barcode to identify N. asiatica and the obtained DNA sequences will be added to the DNA barcode database.
Design of 240,000 orthogonal 25mer DNA barcode probes.
Xu, Qikai; Schlabach, Michael R; Hannon, Gregory J; Elledge, Stephen J
2009-02-17
DNA barcodes linked to genetic features greatly facilitate screening these features in pooled formats using microarray hybridization, and new tools are needed to design large sets of barcodes to allow construction of large barcoded mammalian libraries such as shRNA libraries. Here we report a framework for designing large sets of orthogonal barcode probes. We demonstrate the utility of this framework by designing 240,000 barcode probes and testing their performance by hybridization. From the test hybridizations, we also discovered new probe design rules that significantly reduce cross-hybridization after their introduction into the framework of the algorithm. These rules should improve the performance of DNA microarray probe designs for many applications.
Design of 240,000 orthogonal 25mer DNA barcode probes
Xu, Qikai; Schlabach, Michael R.; Hannon, Gregory J.; Elledge, Stephen J.
2009-01-01
DNA barcodes linked to genetic features greatly facilitate screening these features in pooled formats using microarray hybridization, and new tools are needed to design large sets of barcodes to allow construction of large barcoded mammalian libraries such as shRNA libraries. Here we report a framework for designing large sets of orthogonal barcode probes. We demonstrate the utility of this framework by designing 240,000 barcode probes and testing their performance by hybridization. From the test hybridizations, we also discovered new probe design rules that significantly reduce cross-hybridization after their introduction into the framework of the algorithm. These rules should improve the performance of DNA microarray probe designs for many applications. PMID:19171886
Defining operational taxonomic units using DNA barcode data
Blaxter, Mark; Mann, Jenna; Chapman, Tom; Thomas, Fran; Whitton, Claire; Floyd, Robin; Abebe, Eyualem
2005-01-01
Abstract The scale of diversity of life on this planet is a significant challenge for any scientific programme hoping to produce a complete catalogue, whatever means is used. For DNA barcoding studies, this difficulty is compounded by the realization that any chosen barcode sequence is not the gene ‘for’ speciation and that taxa have evolutionary histories. How are we to disentangle the confounding effects of reticulate population genetic processes? Using the DNA barcode data from meiofaunal surveys, here we discuss the benefits of treating the taxa defined by barcodes without reference to their correspondence to ‘species’, and suggest that using this non-idealist approach facilitates access to taxon groups that are not accessible to other methods of enumeration and classification. Major issues remain, in particular the methodologies for taxon discrimination in DNA barcode data. PMID:16214751
Validation of the ITS2 Region as a Novel DNA Barcode for Identifying Medicinal Plant Species
Chen, Shilin; Yao, Hui; Han, Jianping; Liu, Chang; Song, Jingyuan; Shi, Linchun; Zhu, Yingjie; Ma, Xinye; Gao, Ting; Pang, Xiaohui; Luo, Kun; Li, Ying; Li, Xiwen; Jia, Xiaocheng; Lin, Yulin; Leon, Christine
2010-01-01
Background The plant working group of the Consortium for the Barcode of Life recommended the two-locus combination of rbcL + matK as the plant barcode, yet the combination was shown to successfully discriminate among 907 samples from 550 species at the species level with a probability of 72%. The group admits that the two-locus barcode is far from perfect due to the low identification rate, and the search is not over. Methodology/Principal Findings Here, we compared seven candidate DNA barcodes (psbA-trnH, matK, rbcL, rpoC1, ycf5, ITS2, and ITS) from medicinal plant species. Our ranking criteria included PCR amplification efficiency, differential intra- and inter-specific divergences, and the DNA barcoding gap. Our data suggest that the second internal transcribed spacer (ITS2) of nuclear ribosomal DNA represents the most suitable region for DNA barcoding applications. Furthermore, we tested the discrimination ability of ITS2 in more than 6600 plant samples belonging to 4800 species from 753 distinct genera and found that the rate of successful identification with the ITS2 was 92.7% at the species level. Conclusions The ITS2 region can be potentially used as a standard DNA barcode to identify medicinal plants and their closely related species. We also propose that ITS2 can serve as a novel universal barcode for the identification of a broader range of plant taxa. PMID:20062805
Mulcahy, Daniel G; Lee, Justin L; Miller, Aryeh H; Chand, Mia; Thura, Myint Kyaw; Zug, George R
2018-01-01
Despite threats of species extinctions, taxonomic crises, and technological advances in genomics and natural history database informatics, we are still distant from cataloguing all of the species of life on earth. Amphibians and reptiles are no exceptions; in fact new species are described nearly every day and many species face possible extinction. The number of described species continues to climb as new areas of the world are explored and as species complexes are examined more thoroughly. The use of DNA barcoding provides a mechanism for rapidly estimating the number of species at a given site and has the potential to record all of the species of life on Earth. Though DNA barcoding has its caveats, it can be useful to estimate the number of species in a more systematic and efficient manner, to be followed in combination with more traditional, morphology-based identifications and species descriptions. Herein, we report the results of a voucher-based herpetological expedition to the Tanintharyi (Tenasserim) Region of Myanmar, enhanced with DNA barcode data. Our main surveys took place in the currently proposed Tanintharyi National Park. We combine our results with photographs and observational data from the Chaung-nauk-pyan forest reserve. Additionally, we provide the first checklist of amphibians and reptiles of the region, with species based on the literature and museum. Amphibians, anurans in particular, are one of the most poorly known groups of vertebrates in terms of taxonomy and the number of known species, particularly in Southeast Asia. Our rapid-assessment program combined with DNA barcoding and use of Barcode Index Numbers (BINs) of voucher specimens reveals the depth of taxonomic diversity in the southern Tanintharyi herpetofauna even though only a third of the potential amphibians and reptiles were seen. A total of 51 putative species (one caecilian, 25 frogs, 13 lizards, 10 snakes, and two turtles) were detected, several of which represent potentially undescribed species. Several of these species were detected by DNA barcode data alone. Furthermore, five species were recorded for the first time in Myanmar, two amphibians (Ichthyophis cf. kohtaoensis and Chalcorana eschatia ) and three snakes ( Ahaetulla mycterizans , Boiga dendrophila , and Boiga drapiezii ).
Mulcahy, Daniel G.; Lee, Justin L.; Miller, Aryeh H.; Chand, Mia; Thura, Myint Kyaw; Zug, George R.
2018-01-01
Abstract Despite threats of species extinctions, taxonomic crises, and technological advances in genomics and natural history database informatics, we are still distant from cataloguing all of the species of life on earth. Amphibians and reptiles are no exceptions; in fact new species are described nearly every day and many species face possible extinction. The number of described species continues to climb as new areas of the world are explored and as species complexes are examined more thoroughly. The use of DNA barcoding provides a mechanism for rapidly estimating the number of species at a given site and has the potential to record all of the species of life on Earth. Though DNA barcoding has its caveats, it can be useful to estimate the number of species in a more systematic and efficient manner, to be followed in combination with more traditional, morphology-based identifications and species descriptions. Herein, we report the results of a voucher-based herpetological expedition to the Tanintharyi (Tenasserim) Region of Myanmar, enhanced with DNA barcode data. Our main surveys took place in the currently proposed Tanintharyi National Park. We combine our results with photographs and observational data from the Chaung-nauk-pyan forest reserve. Additionally, we provide the first checklist of amphibians and reptiles of the region, with species based on the literature and museum. Amphibians, anurans in particular, are one of the most poorly known groups of vertebrates in terms of taxonomy and the number of known species, particularly in Southeast Asia. Our rapid-assessment program combined with DNA barcoding and use of Barcode Index Numbers (BINs) of voucher specimens reveals the depth of taxonomic diversity in the southern Tanintharyi herpetofauna even though only a third of the potential amphibians and reptiles were seen. A total of 51 putative species (one caecilian, 25 frogs, 13 lizards, 10 snakes, and two turtles) were detected, several of which represent potentially undescribed species. Several of these species were detected by DNA barcode data alone. Furthermore, five species were recorded for the first time in Myanmar, two amphibians (Ichthyophis cf. kohtaoensis and Chalcorana eschatia) and three snakes (Ahaetulla mycterizans, Boiga dendrophila, and Boiga drapiezii). PMID:29780268
Non-Enzymatic Detection of Bacterial Genomic DNA Using the Bio-Barcode Assay
Hill, Haley D.; Vega, Rafael A.; Mirkin, Chad A.
2011-01-01
The detection of bacterial genomic DNA through a non-enzymatic nanomaterials based amplification method, the bio-barcode assay, is reported. The assay utilizes oligonucleotide functionalized magnetic microparticles to capture the target of interest from the sample. A critical step in the new assay involves the use of blocking oligonucleotides during heat denaturation of the double stranded DNA. These blockers bind to specific regions of the target DNA upon cooling, and prevent the duplex DNA from re-hybridizing, which allows the particle probes to bind. Following target isolation using the magnetic particles, oligonucleotide functionalized gold nanoparticles act as target recognition agents. The oligonucleotides on the nanoparticle (barcodes) act as amplification surrogates. The barcodes are then detected using the Scanometric method. The limit of detection for this assay was determined to be 2.5 femtomolar, and this is the first demonstration of a barcode type assay for the detection of double stranded, genomic DNA. PMID:17927207
Bishoyi, Ashok Kumar; Kavane, Aarti; Sharma, Anjali; Geetha, K A
2017-02-01
CYMBOPOGON: is an important member of grass family Poaceae, cultivated for essential oils which have greater medicinal and industrial value. Taxonomic identification of Cymbopogon species is determined mainly by morphological markers, odour of essential oils and concentration of bioactive compounds present in the oil matrices which are highly influenced by environment. Authenticated molecular marker based taxonomical identification is also lacking in the genus; hence effort was made to evaluate potential DNA barcode loci in six commercially important Cymbopogon species for their individual discrimination and authentication at the species level. Four widely used DNA barcoding regions viz., ITS 1 & ITS 2 spacers, matK, psbA-trnH and rbcL were taken for the study. Gene sequences of the same or related genera of the concerned loci were mined from NCBI domain and primers were designed and validated for barcode loci amplification. Out of the four loci studied, sequences from matK and ITS spacer loci revealed 0.46% and 5.64% nucleotide sequence diversity, respectively whereas the other two loci i.e., psbA-trnH and rbcL showed 100% sequence homology. The newly developed primers can be used for barcode loci amplification in the genus Cymbopogon. The identified Single Nucleotide Polymorphisms from the studied sequences may be used as barcodes for the six Cymbopogon species. The information generated can also be utilized for barcode development of the genus by including more number of Cymbopgon species in future.
Application of DNA Machineries for the Barcode Patterned Detection of Genes or Proteins.
Zhou, Zhixin; Luo, Guofeng; Wulf, Verena; Willner, Itamar
2018-06-05
The study introduces an analytical platform for the detection of genes or aptamer-ligand complexes by nucleic acid barcode patterns generated by DNA machineries. The DNA machineries consist of nucleic acid scaffolds that include specific recognition sites for the different genes or aptamer-ligand analytes. The binding of the analytes to the scaffolds initiate, in the presence of the nucleotide mixture, a cyclic polymerization/nicking machinery that yields displaced strands of variable lengths. The electrophoretic separation of the resulting strands provides barcode patterns for the specific detection of the different analytes. Mixtures of DNA machineries that yield, upon sensing of different genes (or aptamer ligands), one-, two-, or three-band barcode patterns are described. The combination of nucleic acid scaffolds acting, in the presence of polymerase/nicking enzyme and nucleotide mixture, as DNA machineries, that generate multiband barcode patterns provide an analytical platform for the detection of an individual gene out of many possible genes. The diversity of genes (or other analytes) that can be analyzed by the DNA machineries and the barcode patterned imaging is given by the Pascal's triangle. As a proof-of-concept, the detection of one of six genes, that is, TP53, Werner syndrome, Tay-Sachs normal gene, BRCA1, Tay-Sachs mutant gene, and cystic fibrosis disorder gene by six two-band barcode patterns is demonstrated. The advantages and limitations of the detection of analytes by polymerase/nicking DNA machineries that yield barcode patterns as imaging readout signals are discussed.
Does a global DNA barcoding gap exist in Annelida?
Kvist, Sebastian
2016-05-01
Accurate identification of unknown specimens by means of DNA barcoding is contingent on the presence of a DNA barcoding gap, among other factors, as its absence may result in dubious specimen identifications - false negatives or positives. Whereas the utility of DNA barcoding would be greatly reduced in the absence of a distinct and sufficiently sized barcoding gap, the limits of intraspecific and interspecific distances are seldom thoroughly inspected across comprehensive sampling. The present study aims to illuminate this aspect of barcoding in a comprehensive manner for the animal phylum Annelida. All cytochrome c oxidase subunit I sequences (cox1 gene; the chosen region for zoological DNA barcoding) present in GenBank for Annelida, as well as for "Polychaeta", "Oligochaeta", and Hirudinea separately, were downloaded and curated for length, coverage and potential contaminations. The final datasets consisted of 9782 (Annelida), 5545 ("Polychaeta"), 3639 ("Oligochaeta"), and 598 (Hirudinea) cox1 sequences and these were either (i) used as is in an automated global barcoding gap detection analysis or (ii) further analyzed for genetic distances, separated into bins containing intraspecific and interspecific comparisons and plotted in a graph to visualize any potential global barcoding gap. Over 70 million pairwise genetic comparisons were made and results suggest that although there is a tendency towards separation, no distinct or sufficiently sized global barcoding gap exists in either of the datasets rendering future barcoding efforts at risk of erroneous specimen identifications (but local barcoding gaps may still exist allowing for the identification of specimens at lower taxonomic ranks). This seems to be especially true for earthworm taxa, which account for fully 35% of the total number of interspecific comparisons that show 0% divergence.
The Barcode of Life Data Portal: Bridging the Biodiversity Informatics Divide for DNA Barcoding
Sarkar, Indra Neil; Trizna, Michael
2011-01-01
With the volume of molecular sequence data that is systematically being generated globally, there is a need for centralized resources for data exploration and analytics. DNA Barcode initiatives are on track to generate a compendium of molecular sequence–based signatures for identifying animals and plants. To date, the range of available data exploration and analytic tools to explore these data have only been available in a boutique form—often representing a frustrating hurdle for many researchers that may not necessarily have resources to install or implement algorithms described by the analytic community. The Barcode of Life Data Portal (BDP) is a first step towards integrating the latest biodiversity informatics innovations with molecular sequence data from DNA barcoding. Through establishment of community driven standards, based on discussion with the Data Analysis Working Group (DAWG) of the Consortium for the Barcode of Life (CBOL), the BDP provides an infrastructure for incorporation of existing and next-generation DNA barcode analytic applications in an open forum. PMID:21818249
Mat Jaafar, Tun Nurul Aimi; Taylor, Martin I.; Mohd Nor, Siti Azizah; de Bruyn, Mark; Carvalho, Gary R.
2012-01-01
Background DNA barcodes, typically focusing on the cytochrome oxidase I gene (COI) in many animals, have been used widely as a species-identification tool. The ability of DNA barcoding to distinguish species from a range of taxa and to reveal cryptic species has been well documented. Despite the wealth of DNA barcode data for fish from many temperate regions, there are relatively few available from the Southeast Asian region. Here, we target the marine fish Family Carangidae, one of the most commercially-important families from the Indo-Malay Archipelago (IMA), to produce an initial reference DNA barcode library. Methodology/Principal Findings Here, a 652 bp region of COI was sequenced for 723 individuals from 36 putative species of Family Carangidae distributed within IMA waters. Within the newly-generated dataset, three described species exhibited conspecific divergences up to ten times greater (4.32–4.82%) than mean estimates (0.24–0.39%), indicating a discrepancy with assigned morphological taxonomic identification, and the existence of cryptic species. Variability of the mitochondrial DNA COI region was compared within and among species to evaluate the COI region's suitability for species identification. The trend in range of mean K2P distances observed was generally in accordance with expectations based on taxonomic hierarchy: 0% to 4.82% between individuals within species, 0% to 16.4% between species within genera, and 8.64% to 25.39% between genera within families. The average Kimura 2-parameter (K2P) distance between individuals, between species within genera, and between genera within family were 0.37%, 10.53% and 16.56%, respectively. All described species formed monophyletic clusters in the Neighbour-joining phylogenetic tree, although three species representing complexes of six potential cryptic species were detected in Indo-Malay Carangidae; Atule mate, Selar crumenophthalmus and Seriolina nigrofasciata. Conclusion/Significance This study confirms that COI is an effective tool for species identification of Carangidae from the IMA. There were moderate levels of cryptic diversity among putative species within the central IMA. However, to explain the hypothesis of species richness in the IMA, it is necessary to sample the whole family across their broad geographic range. Such insights are helpful not only to document mechanisms driving diversification and recruitment in Carangidae, but also to provide a scientific framework for management strategies and conservation of commercially-important fisheries resources. PMID:23209586
An, Jeung Hee; Oh, Byung-Keun; Choi, Jeong Woo
2013-04-01
Tyrosine hydroxylase, the rate-limiting enzyme of catecholamine biosysthesis, is predominantly expressed in several cell groups within the brain, including the dopaminergic neurons of the substantia nigra and ventral tegmental area. We evaluated the efficacy of this protein-detection method in detecting tyrosine hydroxylase in normal and oxidative stress damaged dopaminergic cells. In this study, a coupling of DNA barcode and bead-based immnunoassay for detecting tyrosine hydroxylaser with PCR-like sensitivity is reported. The method relies on magnetic nanoparticles with antibodies and nanoparticles that are encoded with DNA and antibodies that can sandwich the target protein captured by the nanoparticle-bound antibodies. The aggregate sandwich structures are magnetically separated from solution, and treated to remove the conjugated barcode DNA. The DNA barcodes were identified by PCR analysis. The concentration of tyrosine hydroxylase in dopaminergic cell can be easily and rapidly detected using bio-barcode assay. The bio-barcode assay is a rapid and high-throughput screening tool to detect of neurotransmitter such as dopamine.
Detection of proteins using a colorimetric bio-barcode assay.
Nam, Jwa-Min; Jang, Kyung-Jin; Groves, Jay T
2007-01-01
The colorimetric bio-barcode assay is a red-to-blue color change-based protein detection method with ultrahigh sensitivity. This assay is based on both the bio-barcode amplification method that allows for detecting miniscule amount of targets with attomolar sensitivity and gold nanoparticle-based colorimetric DNA detection method that allows for a simple and straightforward detection of biomolecules of interest (here we detect interleukin-2, an important biomarker (cytokine) for many immunodeficiency-related diseases and cancers). The protocol is composed of the following steps: (i) conjugation of target capture molecules and barcode DNA strands onto silica microparticles, (ii) target capture with probes, (iii) separation and release of barcode DNA strands from the separated probes, (iv) detection of released barcode DNA using DNA-modified gold nanoparticle probes and (v) red-to-blue color change analysis with a graphic software. Actual target detection and quantification steps with premade probes take approximately 3 h (whole protocol including probe preparations takes approximately 3 days).
Buschmann, Tilo; Zhang, Rong; Brash, Douglas E; Bystrykh, Leonid V
2014-08-07
DNA barcodes are short unique sequences used to label DNA or RNA-derived samples in multiplexed deep sequencing experiments. During the demultiplexing step, barcodes must be detected and their position identified. In some cases (e.g., with PacBio SMRT), the position of the barcode and DNA context is not well defined. Many reads start inside the genomic insert so that adjacent primers might be missed. The matter is further complicated by coincidental similarities between barcode sequences and reference DNA. Therefore, a robust strategy is required in order to detect barcoded reads and avoid a large number of false positives or negatives.For mass inference problems such as this one, false discovery rate (FDR) methods are powerful and balanced solutions. Since existing FDR methods cannot be applied to this particular problem, we present an adapted FDR method that is suitable for the detection of barcoded reads as well as suggest possible improvements. In our analysis, barcode sequences showed high rates of coincidental similarities with the Mus musculus reference DNA. This problem became more acute when the length of the barcode sequence decreased and the number of barcodes in the set increased. The method presented in this paper controls the tail area-based false discovery rate to distinguish between barcoded and unbarcoded reads. This method helps to establish the highest acceptable minimal distance between reads and barcode sequences. In a proof of concept experiment we correctly detected barcodes in 83% of the reads with a precision of 89%. Sensitivity improved to 99% at 99% precision when the adjacent primer sequence was incorporated in the analysis. The analysis was further improved using a paired end strategy. Following an analysis of the data for sequence variants induced in the Atp1a1 gene of C57BL/6 murine melanocytes by ultraviolet light and conferring resistance to ouabain, we found no evidence of cross-contamination of DNA material between samples. Our method offers a proper quantitative treatment of the problem of detecting barcoded reads in a noisy sequencing environment. It is based on the false discovery rate statistics that allows a proper trade-off between sensitivity and precision to be chosen.
DNA Barcoding Investigations Bring Biology to Life
ERIC Educational Resources Information Center
Musante, Susan
2010-01-01
This article describes how DNA barcoding investigations bring biology to life. Biologists recognize the power of DNA barcoding not just to teach biology through connections to the real world but also to immerse students in the exciting process of science. As an investigator in the Program for the Human Environment at Rockefeller University in New…
DNA Barcoding and PBL in an Australian Postsecondary College
ERIC Educational Resources Information Center
Cross, Joseph; Garard, Helen; Currie, Tina
2018-01-01
DNA barcoding is increasingly being introduced into biological science educational curricula worldwide. The technique has a number of features that make it ideal for science curricula and particularly for Project-Based Learning (PBL). This report outlines the development of a DNA barcoding project in an Australian TAFE college, which also combined…
USDA-ARS?s Scientific Manuscript database
Six DNA regions were evaluated in a multi-national, multi-laboratory consortium as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it...
Services of DNA barcoding in different fields.
Muhammad Tahir, Hafiz; Akhtar, Samreen
2016-11-01
DNA barcoding is a new master key for species identification and has greatly accelerated the pace of species discovery. In this novel and cost-effective technique, a short DNA sequence from a standard region of mitochondrial "CO1" gene called "barcode" is used. At present, researchers all over the world are utilizing this powerful tool for investigating biodiversity, differentiating cryptic species, testing food authenticity, identifying parasites, vectors, insect pests, and predators, monitoring of illegal trade of animals and their products, and identifying forensically important insects. In addition, this technique can potentially be used to monitor quality of drinking water, quickly identify the indicator species of lakes, rivers, and streams, identify species with harmful attributes or medicinal properties, monitor smuggling of endangered plants and animals and their products, and disease investigations. Despite non-favorable criticism from a few researchers, DNA barcoding has achieved immense popularity in the scientific community, especially among biologists. The present review provides an overview of DNA barcoding and its practical applications. The limitation, future prospective and main informative platforms for DNA barcoding have also been discussed.
DNA Barcoding analysis of seafood accuracy in Washington, D.C. restaurants
Stern, David B.; Castro Nallar, Eduardo; Rathod, Jason
2017-01-01
In Washington D.C., recent legislation authorizes citizens to test if products are properly represented and, if they are not, to bring a lawsuit for the benefit of the general public. Recent studies revealing the widespread phenomenon of seafood substitution across the United States make it a fertile area for consumer protection testing. DNA barcoding provides an accurate and cost-effective way to perform these tests, especially when tissue alone is available making species identification based on morphology impossible. In this study, we sequenced the 5′ barcoding region of the Cytochrome Oxidase I gene for 12 samples of vertebrate and invertebrate food items across six restaurants in Washington, D.C. and used multiple analytical methods to make identifications. These samples included several ambiguous menu listings, sequences with little genetic variation among closely related species and one sequence with no available reference sequence. Despite these challenges, we were able to make identifications for all samples and found that 33% were potentially mislabeled. While we found a high degree of mislabeling, the errors involved closely related species and we did not identify egregious substitutions as have been found in other cities. This study highlights the efficacy of DNA barcoding and robust analyses in identifying seafood items for consumer protection. PMID:28462038
DNA barcoding the native flowering plants and conifers of Wales.
de Vere, Natasha; Rich, Tim C G; Ford, Col R; Trinder, Sarah A; Long, Charlotte; Moore, Chris W; Satterthwaite, Danielle; Davies, Helena; Allainguillaume, Joel; Ronca, Sandra; Tatarinova, Tatiana; Garbett, Hannah; Walker, Kevin; Wilkinson, Mike J
2012-01-01
We present the first national DNA barcode resource that covers the native flowering plants and conifers for the nation of Wales (1143 species). Using the plant DNA barcode markers rbcL and matK, we have assembled 97.7% coverage for rbcL, 90.2% for matK, and a dual-locus barcode for 89.7% of the native Welsh flora. We have sampled multiple individuals for each species, resulting in 3304 rbcL and 2419 matK sequences. The majority of our samples (85%) are from DNA extracted from herbarium specimens. Recoverability of DNA barcodes is lower using herbarium specimens, compared to freshly collected material, mostly due to lower amplification success, but this is balanced by the increased efficiency of sampling species that have already been collected, identified, and verified by taxonomic experts. The effectiveness of the DNA barcodes for identification (level of discrimination) is assessed using four approaches: the presence of a barcode gap (using pairwise and multiple alignments), formation of monophyletic groups using Neighbour-Joining trees, and sequence similarity in BLASTn searches. These approaches yield similar results, providing relative discrimination levels of 69.4 to 74.9% of all species and 98.6 to 99.8% of genera using both markers. Species discrimination can be further improved using spatially explicit sampling. Mean species discrimination using barcode gap analysis (with a multiple alignment) is 81.6% within 10×10 km squares and 93.3% for 2×2 km squares. Our database of DNA barcodes for Welsh native flowering plants and conifers represents the most complete coverage of any national flora, and offers a valuable platform for a wide range of applications that require accurate species identification.
Stein, Eric D; White, Bryan P; Mazor, Raphael D; Miller, Peter E; Pilgrim, Erik M
2013-01-01
Molecular methods, such as DNA barcoding, have the potential to enhance biomonitoring programs worldwide. Altering routinely used sample preservation methods to protect DNA from degradation may pose a potential impediment to application of DNA barcoding and metagenomics for biomonitoring using benthic macroinvertebrates. Using higher volumes or concentrations of ethanol, requirements for shorter holding times, or the need to include additional filtering may increase cost and logistical constraints to existing biomonitoring programs. To address this issue we evaluated the efficacy of various ethanol-based sample preservation methods at maintaining DNA integrity. We evaluated a series of methods that were minimally modified from typical field protocols in order to identify an approach that can be readily incorporated into existing monitoring programs. Benthic macroinvertebrates were collected from a minimally disturbed stream in southern California, USA and subjected to one of six preservation treatments. Ten individuals from five taxa were selected from each treatment and processed to produce DNA barcodes from the mitochondrial gene cytochrome c oxidase I (COI). On average, we obtained successful COI sequences (i.e. either full or partial barcodes) for between 93-99% of all specimens across all six treatments. As long as samples were initially preserved in 95% ethanol, successful sequencing of COI barcodes was not affected by a low dilution ratio of 2∶1, transfer to 70% ethanol, presence of abundant organic matter, or holding times of up to six months. Barcoding success varied by taxa, with Leptohyphidae (Ephemeroptera) producing the lowest barcode success rate, most likely due to poor PCR primer efficiency. Differential barcoding success rates have the potential to introduce spurious results. However, routine preservation methods can largely be used without adverse effects on DNA integrity.
Stein, Eric D.; White, Bryan P.; Mazor, Raphael D.; Miller, Peter E.; Pilgrim, Erik M.
2013-01-01
Molecular methods, such as DNA barcoding, have the potential to enhance biomonitoring programs worldwide. Altering routinely used sample preservation methods to protect DNA from degradation may pose a potential impediment to application of DNA barcoding and metagenomics for biomonitoring using benthic macroinvertebrates. Using higher volumes or concentrations of ethanol, requirements for shorter holding times, or the need to include additional filtering may increase cost and logistical constraints to existing biomonitoring programs. To address this issue we evaluated the efficacy of various ethanol-based sample preservation methods at maintaining DNA integrity. We evaluated a series of methods that were minimally modified from typical field protocols in order to identify an approach that can be readily incorporated into existing monitoring programs. Benthic macroinvertebrates were collected from a minimally disturbed stream in southern California, USA and subjected to one of six preservation treatments. Ten individuals from five taxa were selected from each treatment and processed to produce DNA barcodes from the mitochondrial gene cytochrome c oxidase I (COI). On average, we obtained successful COI sequences (i.e. either full or partial barcodes) for between 93–99% of all specimens across all six treatments. As long as samples were initially preserved in 95% ethanol, successful sequencing of COI barcodes was not affected by a low dilution ratio of 2∶1, transfer to 70% ethanol, presence of abundant organic matter, or holding times of up to six months. Barcoding success varied by taxa, with Leptohyphidae (Ephemeroptera) producing the lowest barcode success rate, most likely due to poor PCR primer efficiency. Differential barcoding success rates have the potential to introduce spurious results. However, routine preservation methods can largely be used without adverse effects on DNA integrity. PMID:23308097
DNA Barcoding the Native Flowering Plants and Conifers of Wales
de Vere, Natasha; Rich, Tim C. G.; Ford, Col R.; Trinder, Sarah A.; Long, Charlotte; Moore, Chris W.; Satterthwaite, Danielle; Davies, Helena; Allainguillaume, Joel; Ronca, Sandra; Tatarinova, Tatiana; Garbett, Hannah; Walker, Kevin; Wilkinson, Mike J.
2012-01-01
We present the first national DNA barcode resource that covers the native flowering plants and conifers for the nation of Wales (1143 species). Using the plant DNA barcode markers rbcL and matK, we have assembled 97.7% coverage for rbcL, 90.2% for matK, and a dual-locus barcode for 89.7% of the native Welsh flora. We have sampled multiple individuals for each species, resulting in 3304 rbcL and 2419 matK sequences. The majority of our samples (85%) are from DNA extracted from herbarium specimens. Recoverability of DNA barcodes is lower using herbarium specimens, compared to freshly collected material, mostly due to lower amplification success, but this is balanced by the increased efficiency of sampling species that have already been collected, identified, and verified by taxonomic experts. The effectiveness of the DNA barcodes for identification (level of discrimination) is assessed using four approaches: the presence of a barcode gap (using pairwise and multiple alignments), formation of monophyletic groups using Neighbour-Joining trees, and sequence similarity in BLASTn searches. These approaches yield similar results, providing relative discrimination levels of 69.4 to 74.9% of all species and 98.6 to 99.8% of genera using both markers. Species discrimination can be further improved using spatially explicit sampling. Mean species discrimination using barcode gap analysis (with a multiple alignment) is 81.6% within 10×10 km squares and 93.3% for 2×2 km squares. Our database of DNA barcodes for Welsh native flowering plants and conifers represents the most complete coverage of any national flora, and offers a valuable platform for a wide range of applications that require accurate species identification. PMID:22701588
Koroiva, Ricardo; Pepinelli, Mateus; Rodrigues, Marciel Elio; Roque, Fabio de Oliveira; Lorenz-Lemke, Aline Pedroso; Kvist, Sebastian
2017-01-01
We present a DNA barcoding study of Neotropical odonates from the Upper Plata basin, Brazil. A total of 38 species were collected in a transition region of "Cerrado" and Atlantic Forest, both regarded as biological hotspots, and 130 cytochrome c oxidase subunit I (COI) barcodes were generated for the collected specimens. The distinct gap between intraspecific (0-2%) and interspecific variation (15% and above) in COI, and resulting separation of Barcode Index Numbers (BIN), allowed for successful identification of specimens in 94% of cases. The 6% fail rate was due to a shared BIN between two separate nominal species. DNA barcoding, based on COI, thus seems to be a reliable and efficient tool for identifying Neotropical odonate specimens down to the species level. These results underscore the utility of DNA barcoding to aid specimen identification in diverse biological hotspots, areas that require urgent action regarding taxonomic surveys and biodiversity conservation.
Gold Nanoparticles-Based Barcode Analysis for Detection of Norepinephrine.
An, Jeung Hee; Lee, Kwon-Jai; Choi, Jeong-Woo
2016-02-01
Nanotechnology-based bio-barcode amplification analysis offers an innovative approach for detecting neurotransmitters. We evaluated the efficacy of this method for detecting norepinephrine in normal and oxidative-stress damaged dopaminergic cells. Our approach use a combination of DNA barcodes and bead-based immunoassays for detecting neurotransmitters with surface-enhanced Raman spectroscopy (SERS), and provides polymerase chain reaction (PCR)-like sensitivity. This method relies on magnetic Dynabeads containing antibodies and nanoparticles that are loaded both with DNA barcords and with antibodies that can sandwich the target protein captured by the Dynabead-bound antibodies. The aggregate sandwich structures are magnetically separated from the solution and treated to remove the conjugated barcode DNA. The DNA barcodes are then identified by SERS and PCR analysis. The concentration of norepinephrine in dopaminergic cells can be readily detected using the bio-barcode assay, which is a rapid, high-throughput screening tool for detecting neurotransmitters.
Jung, Jae Hwan; Kim, Gha-Young; Seo, Tae Seok
2011-10-21
Here we report an integrated microdevice consisting of an efficient passive mixer, a magnetic separation chamber, and a capillary electrophoretic microchannel in which DNA barcode assay, target pathogen separation, and barcode DNA capillary electrophoretic analysis were performed sequentially within 30 min for multiplex pathogen detection at the single-cell level. The intestine-shaped serpentine 3D micromixer provides a high mixing rate to generate magnetic particle-pathogenic bacteria-DNA barcode labelled AuNP complexes quantitatively. After magnetic separation and purification of those complexes, the barcode DNA strands were released and analyzed by the microfluidic capillary electrophoresis within 5 min. The size of the barcode DNA strand was controlled depending on the target bacteria (Staphylococcus aureus, Escherichia coli O157:H7, and Salmonella typhimurium), and the different elution time of the barcode DNA peak in the electropherogram allows us to recognize the target pathogen with ease in the monoplex as well as in the multiplex analysis. In addition, the quantity of the DNA barcode strand (∼10(4)) per AuNP is enough to be observed in the laser-induced confocal fluorescence detector, thereby making single-cell analysis possible. This novel integrated microdevice enables us to perform rapid, sensitive, and multiplex pathogen detection with sample-in-answer-out capability to be applied for biosafety testing, environmental screening, and clinical trials.
Using DNA barcodes for assessing diversity in the family Hybotidae (Diptera, Empidoidea)
Nagy, Zoltán T.; Sonet, Gontran; Mortelmans, Jonas; Vandewynkel, Camille; Grootaert, Patrick
2013-01-01
Abstract Empidoidea is one of the largest extant lineages of flies, but phylogenetic relationships among species of this group are poorly investigated and global diversity remains scarcely assessed. In this context, one of the most enigmatic empidoid families is Hybotidae. Within the framework of a pilot study, we barcoded 339 specimens of Old World hybotids belonging to 164 species and 22 genera (plus two Empis as outgroups) and attempted to evaluate whether patterns of intra- and interspecific divergences match the current taxonomy. We used a large sampling of diverse Hybotidae. The material came from the Palaearctic (Belgium, France, Portugal and Russian Caucasus), the Afrotropic (Democratic Republic of the Congo) and the Oriental realms (Singapore and Thailand). Thereby, we optimized lab protocols for barcoding hybotids. Although DNA barcodes generally well distinguished recognized taxa, the study also revealed a number of unexpected phenomena: e.g., undescribed taxa found within morphologically very similar or identical specimens, especially when geographic distance was large; some morphologically distinct species showed no genetic divergence; or different pattern of intraspecific divergence between populations or closely related species. Using COI sequences and simple Neighbour-Joining tree reconstructions, the monophyly of many species- and genus-level taxa was well supported, but more inclusive taxonomical levels did not receive significant bootstrap support. We conclude that in hybotids DNA barcoding might be well used to identify species, when two main constraints are considered. First, incomplete barcoding libraries hinder efficient (correct) identification. Therefore, extra efforts are needed to increase the representation of hybotids in these databases. Second, the spatial scale of sampling has to be taken into account, and especially for widespread species or species complexes with unclear taxonomy, an integrative approach has to be used to clarify species boundaries and identities. PMID:24453562
Jennings, W Bryan; Wogel, Henrique; Bilate, Marcos; Salles, Rodrigo de O L; Buckup, Paulo A
2016-09-01
The microhylid frogs belonging to the genus Arcovomer have been reported from lowland Atlantic Rainforest in the Brazilian states of Espírito Santo, Rio de Janeiro, and São Paulo. Here, we use DNA barcoding to assess levels of genetic divergence between apparently isolated populations in Espírito Santo and Rio de Janeiro. Our mtDNA data consisting of cytochrome oxidase subunit I (COI) nucleotide sequences reveals 13.2% uncorrected and 30.4% TIM2 + I + Γ corrected genetic divergences between these two populations. This level of divergence exceeds the suggested 10% uncorrected divergence threshold for elevating amphibian populations to candidate species using this marker, which implies that the Espírito Santo population is a species distinct from Arcovomer passarellii. Calibration of our model-corrected sequence divergence estimates suggests that the time of population divergence falls between 12 and 29 million years ago.
Wolbachia and DNA barcoding insects: patterns, potential, and problems.
Smith, M Alex; Bertrand, Claudia; Crosby, Kate; Eveleigh, Eldon S; Fernandez-Triana, Jose; Fisher, Brian L; Gibbs, Jason; Hajibabaei, Mehrdad; Hallwachs, Winnie; Hind, Katharine; Hrcek, Jan; Huang, Da-Wei; Janda, Milan; Janzen, Daniel H; Li, Yanwei; Miller, Scott E; Packer, Laurence; Quicke, Donald; Ratnasingham, Sujeevan; Rodriguez, Josephine; Rougerie, Rodolphe; Shaw, Mark R; Sheffield, Cory; Stahlhut, Julie K; Steinke, Dirk; Whitfield, James; Wood, Monty; Zhou, Xin
2012-01-01
Wolbachia is a genus of bacterial endosymbionts that impacts the breeding systems of their hosts. Wolbachia can confuse the patterns of mitochondrial variation, including DNA barcodes, because it influences the pathways through which mitochondria are inherited. We examined the extent to which these endosymbionts are detected in routine DNA barcoding, assessed their impact upon the insect sequence divergence and identification accuracy, and considered the variation present in Wolbachia COI. Using both standard PCR assays (Wolbachia surface coding protein--wsp), and bacterial COI fragments we found evidence of Wolbachia in insect total genomic extracts created for DNA barcoding library construction. When >2 million insect COI trace files were examined on the Barcode of Life Datasystem (BOLD) Wolbachia COI was present in 0.16% of the cases. It is possible to generate Wolbachia COI using standard insect primers; however, that amplicon was never confused with the COI of the host. Wolbachia alleles recovered were predominantly Supergroup A and were broadly distributed geographically and phylogenetically. We conclude that the presence of the Wolbachia DNA in total genomic extracts made from insects is unlikely to compromise the accuracy of the DNA barcode library; in fact, the ability to query this DNA library (the database and the extracts) for endosymbionts is one of the ancillary benefits of such a large scale endeavor--which we provide several examples. It is our conclusion that regular assays for Wolbachia presence and type can, and should, be adopted by large scale insect barcoding initiatives. While COI is one of the five multi-locus sequence typing (MLST) genes used for categorizing Wolbachia, there is limited overlap with the eukaryotic DNA barcode region.
Heinrichs, Guido; de Hoog, G. Sybren
2012-01-01
Herpotrichiellaceous black yeasts and relatives comprise severe pathogens flanked by nonpathogenic environmental siblings. Reliable identification by conventional methods is notoriously difficult. Molecular identification is hampered by the sequence variability in the internal transcribed spacer (ITS) domain caused by difficult-to-sequence homopolymeric regions and by poor taxonomic attribution of sequences deposited in GenBank. Here, we present a potential solution using short barcode identifiers (27 to 50 bp) based on ITS2 ribosomal DNA (rDNA), which allows unambiguous definition of species-specific fragments. Starting from proven sequences of ex-type and authentic strains, we were able to describe 103 identifiers. Multiple BLAST searches of these proposed barcode identifiers in GenBank revealed uniqueness for 100 taxonomic entities, whereas the three remaining identifiers each matched with two entities, but the species of these identifiers could easily be discriminated by differences in the remaining ITS regions. Using the proposed barcode identifiers, a 4.1-fold increase of 100% matches in GenBank was achieved in comparison to the classical approach using the complete ITS sequences. The proposed barcode identifiers will be made accessible for the diagnostic laboratory in a permanently updated online database, thereby providing a highly practical, reliable, and cost-effective tool for identification of clinically important black yeasts and relatives. PMID:22785187
Status and prospects of DNA barcoding in medically important parasites and vectors.
Ondrejicka, Danielle A; Locke, Sean A; Morey, Kevin; Borisenko, Alex V; Hanner, Robert H
2014-12-01
For over 10 years, DNA barcoding has been used to identify specimens and discern species. Its potential benefits in parasitology were recognized early, but its utility and uptake remain unclear. Here we review studies using DNA barcoding in parasites and vectors affecting humans and find that the technique is accurate (accords with author identifications based on morphology or other markers) in 94-95% of cases, although aspects of DNA barcoding (vouchering, marker implicated) have often been misunderstood. In a newly compiled checklist of parasites, vectors, and hazards, barcodes are available for 43% of all 1403 species and for more than half of 429 species of greater medical importance. This is encouraging coverage that would improve with an active campaign targeting parasites and vectors. Copyright © 2014 Elsevier Ltd. All rights reserved.
Daniel L. Lindner; Tor Carlsen; Henrik Nilsson; Marie Davey; Trond Schumacher; Havard. Kauserud
2013-01-01
The rDNA internal transcribed spacer (ITS) region has been accepted as a DNA barcoding marker for fungi and is widely used in phylogenetic studies; however, intragenomic ITS variability has been observed in a broad range of taxa, including prokaryotes, plants, animals, and fungi, and this variability has the potential to inflate species richness estimates in molecular...
Wang, Y J; Li, Z H; Zhang, S F; Varadínová, Z; Jiang, F; Kučerová, Z; Stejskal, V; Opit, G; Cao, Y; Li, F J
2014-10-01
Several species of the genus Cryptolestes Ganglbauer, 1899 (Coleoptera: Laemophloeidae) are commonly found in stored products. In this study, five species of Cryptolestes, with almost worldwide distribution, were obtained from laboratories in China, Czech Republic and the USA: Cryptolestes ferrugineus (Stephens, 1831), Cryptolestes pusillus (Schönherr, 1817), Cryptolestes turcicus (Grouvelle, 1876), Cryptolestes pusilloides (Steel & Howe, 1952) and Cryptolestes capensis (Waltl, 1834). Molecular identification based on a 658 bp fragment from the mitochondrial DNA cytochrome c oxidase subunit I (COI) was adopted to overcome some problems of morphological identification of Cryptolestes species. The utility of COI sequences as DNA barcodes in discriminating the five Cryptolestes species was evaluated on adults and larvae by analysing Kimura 2-parameter distances, phylogenetic tree and haplotype networks. The results showed that molecular approaches based on DNA barcodes were able to accurately identify these species. This is the first study using DNA barcoding to identify Cryptolestes species and the gathered DNA sequences will complement the biological barcode database.
20 years since the introduction of DNA barcoding: from theory to application.
Fišer Pečnikar, Živa; Buzan, Elena V
2014-02-01
Traditionally, taxonomic identification has relied upon morphological characters. In the last two decades, molecular tools based on DNA sequences of short standardised gene fragments, termed DNA barcodes, have been developed for species discrimination. The most common DNA barcode used in animals is a fragment of the cytochrome c oxidase (COI) mitochondrial gene, while for plants, two chloroplast gene fragments from the RuBisCo large subunit (rbcL) and maturase K (matK) genes are widely used. Information gathered from DNA barcodes can be used beyond taxonomic studies and will have far-reaching implications across many fields of biology, including ecology (rapid biodiversity assessment and food chain analysis), conservation biology (monitoring of protected species), biosecurity (early identification of invasive pest species), medicine (identification of medically important pathogens and their vectors) and pharmacology (identification of active compounds). However, it is important that the limitations of DNA barcoding are understood and techniques continually adapted and improved as this young science matures.
Integrating DNA barcode data and taxonomic practice: determination, discovery, and description.
Goldstein, Paul Z; DeSalle, Rob
2011-02-01
DNA barcodes, like traditional sources of taxonomic information, are potentially powerful heuristics in the identification of described species but require mindful analytical interpretation. The role of DNA barcoding in generating hypotheses of new taxa in need of formal taxonomic treatment is discussed, and it is emphasized that the recursive process of character evaluation is both necessary and best served by understanding the empirical mechanics of the discovery process. These undertakings carry enormous ramifications not only for the translation of DNA sequence data into taxonomic information but also for our comprehension of the magnitude of species diversity and its disappearance. This paper examines the potential strengths and pitfalls of integrating DNA sequence data, specifically in the form of DNA barcodes as they are currently generated and analyzed, with taxonomic practice.
2013-01-01
Background Arctic ecosystems, especially those near transition zones, are expected to be strongly impacted by climate change. Because it is positioned on the ecotone between tundra and boreal forest, the Churchill area is a strategic locality for the analysis of shifts in faunal composition. This fact has motivated the effort to develop a comprehensive biodiversity inventory for the Churchill region by coupling DNA barcoding with morphological studies. The present study represents one element of this effort; it focuses on analysis of the spider fauna at Churchill. Results 198 species were detected among 2704 spiders analyzed, tripling the count for the Churchill region. Estimates of overall diversity suggest that another 10–20 species await detection. Most species displayed little intraspecific sequence variation (maximum <1%) in the barcode region of the cytochrome c oxidase subunit I (COI) gene, but four species showed considerably higher values (maximum = 4.1-6.2%), suggesting cryptic species. All recognized species possessed a distinct haplotype array at COI with nearest-neighbour interspecific distances averaging 8.57%. Three species new to Canada were detected: Robertus lyrifer (Theridiidae), Baryphyma trifrons (Linyphiidae), and Satilatlas monticola (Linyphiidae). The first two species may represent human-mediated introductions linked to the port in Churchill, but the other species represents a range extension from the USA. The first description of the female of S. monticola was also presented. As well, one probable new species of Alopecosa (Lycosidae) was recognized. Conclusions This study provides the first comprehensive DNA barcode reference library for the spider fauna of any region. Few cryptic species of spiders were detected, a result contrasting with the prevalence of undescribed species in several other terrestrial arthropod groups at Churchill. Because most (97.5%) sequence clusters at COI corresponded with a named taxon, DNA barcoding reliably identifies spiders in the Churchill fauna. The capacity of DNA barcoding to enable the identification of otherwise taxonomically ambiguous specimens (juveniles, females) also represents a major advance for future monitoring efforts on this group. PMID:24279427
Prospects and Problems for Identification of Poisonous Plants in China using DNA Barcodes.
Xie, Lei; Wang, Ying Wei; Guan, Shan Yue; Xie, Li Jing; Long, Xin; Sun, Cheng Ye
2014-10-01
Poisonous plants are a deadly threat to public health in China. The traditional clinical diagnosis of the toxic plants is inefficient, fallible, and dependent upon experts. In this study, we tested the performance of DNA barcodes for identification of the most threatening poisonous plants in China. Seventy-four accessions of 27 toxic plant species in 22 genera and 17 families were sampled and three DNA barcodes (matK, rbcL, and ITS) were amplified, sequenced and tested. Three methods, Blast, pairwise global alignment (PWG) distance, and Tree-Building were tested for discrimination power. The primer universality of all the three markers was high. Except in the case of ITS for Hemerocallis minor, the three barcodes were successfully generated from all the selected species. Among the three methods applied, Blast showed the lowest discrimination rate, whereas PWG Distance and Tree-Building methods were equally effective. The ITS barcode showed highest discrimination rates using the PWG Distance and Tree-Building methods. When the barcodes were combined, discrimination rates were increased for the Blast method. DNA barcoding technique provides us a fast tool for clinical identification of poisonous plants in China. We suggest matK, rbcL, ITS used in combination as DNA barcodes for authentication of poisonous plants. Copyright © 2014 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.
Hunter, Stephanie J; Goodall, Tim I; Walsh, Kerry A; Owen, Richard; Day, John C
2008-01-01
A nondestructive, chemical-free method is presented for the extraction of DNA from small insects. Blackflies were submerged in sterile, distilled water and sonicated for varying lengths of time to provide DNA which was assessed in terms of quantity, purity and amplification efficiency. A verified DNA barcode was produced from DNA extracted from blackfly larvae, pupae and adult specimens. A 60-second sonication period was found to release the highest quality and quantity of DNA although the amplification efficiency was found to be similar regardless of sonication time. Overall, a 66% amplification efficiency was observed. Examination of post-sonicated material confirmed retention of morphological characters. Sonication was found to be a reliable DNA extraction approach for barcoding, providing sufficient quality template for polymerase chain reaction amplification as well as retaining the voucher specimen for post-barcoding morphological evaluation. © 2007 The Authors.
deWaard, Jeremy R; Mitchell, Andrew; Keena, Melody A; Gopurenko, David; Boykin, Laura M; Armstrong, Karen F; Pogue, Michael G; Lima, Joao; Floyd, Robin; Hanner, Robert H; Humble, Leland M
2010-12-09
Detecting and controlling the movements of invasive species, such as insect pests, relies upon rapid and accurate species identification in order to initiate containment procedures by the appropriate authorities. Many species in the tussock moth genus Lymantria are significant forestry pests, including the gypsy moth Lymantria dispar L., and consequently have been a focus for the development of molecular diagnostic tools to assist in identifying species and source populations. In this study we expand the taxonomic and geographic coverage of the DNA barcode reference library, and further test the utility of this diagnostic method, both for species/subspecies assignment and for determination of geographic provenance of populations. Cytochrome oxidase I (COI) barcodes were obtained from 518 individuals and 36 species of Lymantria, including sequences assembled and generated from previous studies, vouchered material in public collections, and intercepted specimens obtained from surveillance programs in Canada. A maximum likelihood tree was constructed, revealing high bootstrap support for 90% of species clusters. Bayesian species assignment was also tested, and resulted in correct assignment to species and subspecies in all instances. The performance of barcoding was also compared against the commonly employed NB restriction digest system (also based on COI); while the latter is informative for discriminating gypsy moth subspecies, COI barcode sequences provide greater resolution and generality by encompassing a greater number of haplotypes across all Lymantria species, none shared between species. This study demonstrates the efficacy of DNA barcodes for diagnosing species of Lymantria and reinforces the view that the approach is an under-utilized resource with substantial potential for biosecurity and surveillance. Biomonitoring agencies currently employing the NB restriction digest system would gather more information by transitioning to the use of DNA barcoding, a change which could be made relatively seamlessly as the same gene region underlies both protocols.
Crawford, Andrew J; Cruz, Catalina; Griffith, Edgardo; Ross, Heidi; Ibáñez, Roberto; Lips, Karen R; Driskell, Amy C; Bermingham, Eldredge; Crump, Paul
2013-11-01
Amphibians constitute a diverse yet still incompletely characterized clade of vertebrates, in which new species are still being discovered and described at a high rate. Amphibians are also increasingly endangered, due in part to disease-driven threats of extinctions. As an emergency response, conservationists have begun ex situ assurance colonies for priority species. The abundance of cryptic amphibian diversity, however, may cause problems for ex situ conservation. In this study we used a DNA barcoding approach to survey mitochondrial DNA (mtDNA) variation in captive populations of 10 species of Neotropical amphibians maintained in an ex situ assurance programme at El Valle Amphibian Conservation Center (EVACC) in the Republic of Panama. We combined these mtDNA sequences with genetic data from presumably conspecific wild populations sampled from across Panama, and applied genetic distance-based and character-based analyses to identify cryptic lineages. We found that three of ten species harboured substantial cryptic genetic diversity within EVACC, and an additional three species harboured cryptic diversity among wild populations, but not in captivity. Ex situ conservation efforts focused on amphibians are therefore vulnerable to an incomplete taxonomy leading to misidentification among cryptic species. DNA barcoding may therefore provide a simple, standardized protocol to identify cryptic diversity readily applicable to any amphibian community. © 2012 John Wiley & Sons Ltd.
Efficiency of ITS Sequences for DNA Barcoding in Passiflora (Passifloraceae)
Giudicelli, Giovanna Câmara; Mäder, Geraldo; de Freitas, Loreta Brandão
2015-01-01
DNA barcoding is a technique for discriminating and identifying species using short, variable, and standardized DNA regions. Here, we tested for the first time the performance of plastid and nuclear regions as DNA barcodes in Passiflora. This genus is a largely variable, with more than 900 species of high ecological, commercial, and ornamental importance. We analyzed 1034 accessions of 222 species representing the four subgenera of Passiflora and evaluated the effectiveness of five plastid regions and three nuclear datasets currently employed as DNA barcodes in plants using barcoding gap, applied similarity-, and tree-based methods. The plastid regions were able to identify less than 45% of species, whereas the nuclear datasets were efficient for more than 50% using “best match” and “best close match” methods of TaxonDNA software. All subgenera presented higher interspecific pairwise distances and did not fully overlap with the intraspecific distance, and similarity-based methods showed better results than tree-based methods. The nuclear ribosomal internal transcribed spacer 1 (ITS1) region presented a higher discrimination power than the other datasets and also showed other desirable characteristics as a DNA barcode for this genus. Therefore, we suggest that this region should be used as a starting point to identify Passiflora species. PMID:25837628
BOKP: A DNA Barcode Reference Library for Monitoring Herbal Drugs in the Korean Pharmacopeia
Liu, Jinxin; Shi, Linchun; Song, Jingyuan; Sun, Wei; Han, Jianping; Liu, Xia; Hou, Dianyun; Yao, Hui; Li, Mingyue; Chen, Shilin
2017-01-01
Herbal drug authentication is an important task in traditional medicine; however, it is challenged by the limitations of traditional authentication methods and the lack of trained experts. DNA barcoding is conspicuous in almost all areas of the biological sciences and has already been added to the British pharmacopeia and Chinese pharmacopeia for routine herbal drug authentication. However, DNA barcoding for the Korean pharmacopeia still requires significant improvements. Here, we present a DNA barcode reference library for herbal drugs in the Korean pharmacopeia and developed a species identification engine named KP-IDE to facilitate the adoption of this DNA reference library for the herbal drug authentication. Using taxonomy records, specimen records, sequence records, and reference records, KP-IDE can identify an unknown specimen. Currently, there are 6,777 taxonomy records, 1,054 specimen records, 30,744 sequence records (ITS2 and psbA-trnH) and 285 reference records. Moreover, 27 herbal drug materials were collected from the Seoul Yangnyeongsi herbal medicine market to give an example for real herbal drugs authentications. Our study demonstrates the prospects of the DNA barcode reference library for the Korean pharmacopeia and provides future directions for the use of DNA barcoding for authenticating herbal drugs listed in other modern pharmacopeias. PMID:29326593
Photocleavable DNA Barcoding Antibodies for Multiplexed Protein Analysis in Single Cells.
Ullal, Adeeti V; Weissleder, Ralph
2015-01-01
We describe a DNA-barcoded antibody sensing technique for single cell protein analysis in which the barcodes are photocleaved and digitally detected without amplification steps (Ullal et al., Sci Transl Med 6:219, 2014). After photocleaving the unique ~70 mer DNA barcodes we use a fluorescent hybridization technology for detection, similar to what is commonly done for nucleic acid readouts. This protocol offers a simple method for multiplexed protein detection using 100+ antibodies and can be performed on clinical samples as well as single cells.
Lowenstein, Jacob H.; Burger, Joanna; Jeitner, Christian W.; Amato, George; Kolokotronis, Sergios-Orestis; Gochfeld, Michael
2010-01-01
Excessive ingestion of mercury—a health hazard associated with consuming predatory fishes—damages neurological, sensory-motor and cardiovascular functioning. The mercury levels found in Bigeye Tuna (Thunnus obesus) and bluefin tuna species (Thunnus maccoyii, Thunnus orientalis, and Thunnus thynnus), exceed or approach levels permissible by Canada, the European Union, Japan, the US, and the World Health Organization. We used DNA barcodes to identify tuna sushi samples analysed for mercury and demonstrate that the ability to identify cryptic samples in the market place allows regulatory agencies to more accurately measure the risk faced by fish consumers and enact policies that better safeguard their health. PMID:20410032
Directed nucleation assembly of DNA tile complexes for barcode-patterned lattices
NASA Astrophysics Data System (ADS)
Yan, Hao; Labean, Thomas H.; Feng, Liping; Reif, John H.
2003-07-01
The programmed self-assembly of patterned aperiodic molecular structures is a major challenge in nanotechnology and has numerous potential applications for nanofabrication of complex structures and useful devices. Here we report the construction of an aperiodic patterned DNA lattice (barcode lattice) by a self-assembly process of directed nucleation of DNA tiles around a scaffold DNA strand. The input DNA scaffold strand, constructed by ligation of shorter synthetic oligonucleotides, provides layers of the DNA lattice with barcode patterning information represented by the presence or absence of DNA hairpin loops protruding out of the lattice plane. Self-assembly of multiple DNA tiles around the scaffold strand was shown to result in a patterned lattice containing barcode information of 01101. We have also demonstrated the reprogramming of the system to another patterning. An inverted barcode pattern of 10010 was achieved by modifying the scaffold strands and one of the strands composing each tile. A ribbon lattice, consisting of repetitions of the barcode pattern with expected periodicity, was also constructed by the addition of sticky ends. The patterning of both classes of lattices was clearly observable via atomic force microscopy. These results represent a step toward implementation of a visual readout system capable of converting information encoded on a 1D DNA strand into a 2D form readable by advanced microscopic techniques. A functioning visual output method would not only increase the readout speed of DNA-based computers, but may also find use in other sequence identification techniques such as mutation or allele mapping.
Directed nucleation assembly of DNA tile complexes for barcode-patterned lattices.
Yan, Hao; LaBean, Thomas H; Feng, Liping; Reif, John H
2003-07-08
The programmed self-assembly of patterned aperiodic molecular structures is a major challenge in nanotechnology and has numerous potential applications for nanofabrication of complex structures and useful devices. Here we report the construction of an aperiodic patterned DNA lattice (barcode lattice) by a self-assembly process of directed nucleation of DNA tiles around a scaffold DNA strand. The input DNA scaffold strand, constructed by ligation of shorter synthetic oligonucleotides, provides layers of the DNA lattice with barcode patterning information represented by the presence or absence of DNA hairpin loops protruding out of the lattice plane. Self-assembly of multiple DNA tiles around the scaffold strand was shown to result in a patterned lattice containing barcode information of 01101. We have also demonstrated the reprogramming of the system to another patterning. An inverted barcode pattern of 10010 was achieved by modifying the scaffold strands and one of the strands composing each tile. A ribbon lattice, consisting of repetitions of the barcode pattern with expected periodicity, was also constructed by the addition of sticky ends. The patterning of both classes of lattices was clearly observable via atomic force microscopy. These results represent a step toward implementation of a visual readout system capable of converting information encoded on a 1D DNA strand into a 2D form readable by advanced microscopic techniques. A functioning visual output method would not only increase the readout speed of DNA-based computers, but may also find use in other sequence identification techniques such as mutation or allele mapping.
The campaign to DNA barcode all fishes, FISH-BOL.
Ward, R D; Hanner, R; Hebert, P D N
2009-02-01
FISH-BOL, the Fish Barcode of Life campaign, is an international research collaboration that is assembling a standardized reference DNA sequence library for all fishes. Analysis is targeting a 648 base pair region of the mitochondrial cytochrome c oxidase I (COI) gene. More than 5000 species have already been DNA barcoded, with an average of five specimens per species, typically vouchers with authoritative identifications. The barcode sequence from any fish, fillet, fin, egg or larva can be matched against these reference sequences using BOLD; the Barcode of Life Data System (http://www.barcodinglife.org). The benefits of barcoding fishes include facilitating species identification, highlighting cases of range expansion for known species, flagging previously overlooked species and enabling identifications where traditional methods cannot be applied. Results thus far indicate that barcodes separate c. 98 and 93% of already described marine and freshwater fish species, respectively. Several specimens with divergent barcode sequences have been confirmed by integrative taxonomic analysis as new species. Past concerns in relation to the use of fish barcoding for species discrimination are discussed. These include hybridization, recent radiations, regional differentiation in barcode sequences and nuclear copies of the barcode region. However, current results indicate these issues are of little concern for the great majority of specimens.
Identification of the vascular plants of Churchill, Manitoba, using a DNA barcode library
2012-01-01
Background Because arctic plant communities are highly vulnerable to climate change, shifts in their composition require rapid, accurate identifications, often for specimens that lack diagnostic floral characters. The present study examines the role that DNA barcoding can play in aiding floristic evaluations in the arctic by testing the effectiveness of the core plant barcode regions (rbcL, matK) and a supplemental ribosomal DNA (ITS2) marker for a well-studied flora near Churchill, Manitoba. Results This investigation examined 900 specimens representing 312 of the 354 species of vascular plants known from Churchill. Sequencing success was high for rbcL: 95% for fresh specimens and 85% for herbarium samples (mean age 20 years). ITS2 worked equally well for the fresh and herbarium material (89% and 88%). However, sequencing success was lower for matK, despite two rounds of PCR amplification, which reflected less effective primer binding and sensitivity to the DNA degradation (76% of fresh, 45% of herbaria samples). A species was considered as taxonomically resolved if its members showed at least one diagnostic difference from any other taxon in the study and formed a monophyletic clade. The highest species resolution (69%) was obtained by combining information from all three genes. The joint sequence information for rbcL and matK distinguished 54% of 286 species, while rbcL and ITS2 distinguished 63% of 285 species. Discrimination of species within Salix, which constituted 8% of the flora, was particularly problematic. Despite incomplete resolution, the barcode results revealed 22 misidentified herbarium specimens, and enabled the identification of field specimens which were otherwise too immature to identify. Although seven cases of ITS2 paralogy were noted in the families Cyperaceae, Juncaceae and Juncaginaceae, this intergenic spacer played an important role in resolving congeneric plant species at Churchill. Conclusions Our results provided fast and cost-effective solution to create a comprehensive, effective DNA barcode reference library for a local flora. PMID:23190419
Identification of the vascular plants of Churchill, Manitoba, using a DNA barcode library.
Kuzmina, Maria L; Johnson, Karen L; Barron, Hannah R; Hebert, Paul Dn
2012-11-28
Because arctic plant communities are highly vulnerable to climate change, shifts in their composition require rapid, accurate identifications, often for specimens that lack diagnostic floral characters. The present study examines the role that DNA barcoding can play in aiding floristic evaluations in the arctic by testing the effectiveness of the core plant barcode regions (rbcL, matK) and a supplemental ribosomal DNA (ITS2) marker for a well-studied flora near Churchill, Manitoba. This investigation examined 900 specimens representing 312 of the 354 species of vascular plants known from Churchill. Sequencing success was high for rbcL: 95% for fresh specimens and 85% for herbarium samples (mean age 20 years). ITS2 worked equally well for the fresh and herbarium material (89% and 88%). However, sequencing success was lower for matK, despite two rounds of PCR amplification, which reflected less effective primer binding and sensitivity to the DNA degradation (76% of fresh, 45% of herbaria samples). A species was considered as taxonomically resolved if its members showed at least one diagnostic difference from any other taxon in the study and formed a monophyletic clade. The highest species resolution (69%) was obtained by combining information from all three genes. The joint sequence information for rbcL and matK distinguished 54% of 286 species, while rbcL and ITS2 distinguished 63% of 285 species. Discrimination of species within Salix, which constituted 8% of the flora, was particularly problematic. Despite incomplete resolution, the barcode results revealed 22 misidentified herbarium specimens, and enabled the identification of field specimens which were otherwise too immature to identify. Although seven cases of ITS2 paralogy were noted in the families Cyperaceae, Juncaceae and Juncaginaceae, this intergenic spacer played an important role in resolving congeneric plant species at Churchill. Our results provided fast and cost-effective solution to create a comprehensive, effective DNA barcode reference library for a local flora.
Highlights of DNA Barcoding in identification of salient microorganisms like fungi.
Dulla, E L; Kathera, C; Gurijala, H K; Mallakuntla, T R; Srinivasan, P; Prasad, V; Mopati, R D; Jasti, P K
2016-12-01
Fungi, the second largest kingdom of eukaryotic life, are diverse and widespread. Fungi play a distinctive role in the production of different products on industrial scale, like fungal enzymes, antibiotics, fermented foods, etc., to give storage stability and improved health to meet major global challenges. To utilize algae perfectly for human needs, and to pave the way for getting a healthy relationship with fungi, it is important to identify them in a quick and robust manner with molecular-based identification system. So, there is a technique that aims to provide a well-organized method for species level identifications and to contribute powerfully to taxonomic and biodiversity research is DNA Barcoding. DNA Barcoding is generally achieved by the retrieval of a short DNA sequence - the 'barcode' - from a standard part of the genome and that barcode is then compared with a library of reference barcode sequences derived from individuals of known identity for identification. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Pepinelli, Mateus; Rodrigues, Marciel Elio; Roque, Fabio de Oliveira; Lorenz-Lemke, Aline Pedroso; Kvist, Sebastian
2017-01-01
We present a DNA barcoding study of Neotropical odonates from the Upper Plata basin, Brazil. A total of 38 species were collected in a transition region of “Cerrado” and Atlantic Forest, both regarded as biological hotspots, and 130 cytochrome c oxidase subunit I (COI) barcodes were generated for the collected specimens. The distinct gap between intraspecific (0–2%) and interspecific variation (15% and above) in COI, and resulting separation of Barcode Index Numbers (BIN), allowed for successful identification of specimens in 94% of cases. The 6% fail rate was due to a shared BIN between two separate nominal species. DNA barcoding, based on COI, thus seems to be a reliable and efficient tool for identifying Neotropical odonate specimens down to the species level. These results underscore the utility of DNA barcoding to aid specimen identification in diverse biological hotspots, areas that require urgent action regarding taxonomic surveys and biodiversity conservation. PMID:28763495
Hajibabaei, Mehrdad; Shokralla, Shadi; Zhou, Xin; Singer, Gregory A. C.; Baird, Donald J.
2011-01-01
Timely and accurate biodiversity analysis poses an ongoing challenge for the success of biomonitoring programs. Morphology-based identification of bioindicator taxa is time consuming, and rarely supports species-level resolution especially for immature life stages. Much work has been done in the past decade to develop alternative approaches for biodiversity analysis using DNA sequence-based approaches such as molecular phylogenetics and DNA barcoding. On-going assembly of DNA barcode reference libraries will provide the basis for a DNA-based identification system. The use of recently introduced next-generation sequencing (NGS) approaches in biodiversity science has the potential to further extend the application of DNA information for routine biomonitoring applications to an unprecedented scale. Here we demonstrate the feasibility of using 454 massively parallel pyrosequencing for species-level analysis of freshwater benthic macroinvertebrate taxa commonly used for biomonitoring. We designed our experiments in order to directly compare morphology-based, Sanger sequencing DNA barcoding, and next-generation environmental barcoding approaches. Our results show the ability of 454 pyrosequencing of mini-barcodes to accurately identify all species with more than 1% abundance in the pooled mixture. Although the approach failed to identify 6 rare species in the mixture, the presence of sequences from 9 species that were not represented by individuals in the mixture provides evidence that DNA based analysis may yet provide a valuable approach in finding rare species in bulk environmental samples. We further demonstrate the application of the environmental barcoding approach by comparing benthic macroinvertebrates from an urban region to those obtained from a conservation area. Although considerable effort will be required to robustly optimize NGS tools to identify species from bulk environmental samples, our results indicate the potential of an environmental barcoding approach for biomonitoring programs. PMID:21533287
Zainal Abidin, Muchlisin; Pulungan, Chaidir Parlindungan
2016-01-01
DNA barcoding of the cytochrome oxidase subunit I (COI) gene was utilized to assess the species diversity of the freshwater halfbeak genus Hemirhamphodon. A total of 201 individuals from 46 locations in Peninsular Malaysia, north Borneo (Sarawak) and Sumatra were successfully amplified for 616 base pairs of the COI gene revealing 231 variable and 213 parsimony informative sites. COI gene trees showed that most recognized species form monophyletic clades with high bootstrap support. Pairwise within species comparisons exhibited a wide range of intraspecific diversity from 0.0% to 14.8%, suggesting presence of cryptic diversity. This finding was further supported by barcode gap analysis, ABGD and the constructed COI gene trees. In particular, H. pogonognathus from Kelantan (northeast Peninsular Malaysia) diverged from the other H. pogonognathus groups with distances ranging from 7.8 to 11.8%, exceeding the nearest neighbor taxon. High intraspecific diversity was also observed in H. byssus and H. kuekanthali, but of a lower magnitude. This study also provides insights into endemism and phylogeographic structuring, and limited support for the Paleo-drainage divergence hypothesis as a driver of speciation in the genus Hemirhamphodon. PMID:27657915
Lee, Shiou Yih; Ng, Wei Lun; Mahat, Mohd Noor; Nazre, Mohd; Mohamed, Rozi
2016-01-01
The identification of Aquilaria species from their resinous non-wood product, the agarwood, is challenging as conventional techniques alone are unable to ascertain the species origin. Aquilaria is a highly protected species due to the excessive exploitation of its precious agarwood. Here, we applied the DNA barcoding technique to generate barcode sequences for Aquilaria species and later applied the barcodes to identify the source species of agarwood found in the market. We developed a reference DNA barcode library using eight candidate barcode loci (matK, rbcL, rpoB, rpoC1, psbA-trnH, trnL-trnF, ITS, and ITS2) amplified from 24 leaf accessions of seven Aquilaria species obtained from living trees. Our results indicated that all single barcodes can be easily amplified and sequenced with the selected primers. The combination of trnL-trnF+ITS and trnL-trnF+ITS2 yielded the greatest species resolution using the least number of loci combination, while matK+trnL-trnF+ITS showed potential in detecting the geographical origins of Aquilaria species. We propose trnL-trnF+ITS2 as the best candidate barcode for Aquilaria as ITS2 has a shorter sequence length compared to ITS, which eases PCR amplification especially when using degraded DNA samples such as those extracted from processed agarwood products. A blind test conducted on eight agarwood samples in different forms using the proposed barcode combination proved successful in their identification up to the species level. Such potential of DNA barcoding in identifying the source species of agarwood will contribute to the international timber trade control, by providing an effective method for species identification and product authentication. PMID:27128309
Untangling taxonomy: a DNA barcode reference library for Canadian spiders.
Blagoev, Gergin A; deWaard, Jeremy R; Ratnasingham, Sujeevan; deWaard, Stephanie L; Lu, Liuqiong; Robertson, James; Telfer, Angela C; Hebert, Paul D N
2016-01-01
Approximately 1460 species of spiders have been reported from Canada, 3% of the global fauna. This study provides a DNA barcode reference library for 1018 of these species based upon the analysis of more than 30,000 specimens. The sequence results show a clear barcode gap in most cases with a mean intraspecific divergence of 0.78% vs. a minimum nearest-neighbour (NN) distance averaging 7.85%. The sequences were assigned to 1359 Barcode index numbers (BINs) with 1344 of these BINs composed of specimens belonging to a single currently recognized species. There was a perfect correspondence between BIN membership and a known species in 795 cases, while another 197 species were assigned to two or more BINs (556 in total). A few other species (26) were involved in BIN merges or in a combination of merges and splits. There was only a weak relationship between the number of specimens analysed for a species and its BIN count. However, three species were clear outliers with their specimens being placed in 11-22 BINs. Although all BIN splits need further study to clarify the taxonomic status of the entities involved, DNA barcodes discriminated 98% of the 1018 species. The present survey conservatively revealed 16 species new to science, 52 species new to Canada and major range extensions for 426 species. However, if most BIN splits detected in this study reflect cryptic taxa, the true species count for Canadian spiders could be 30-50% higher than currently recognized. © 2015 The Authors. Molecular Ecology Resources Published by John Wiley & Sons Ltd.
Chen, Rui; Jiang, Li-Yun; Qiao, Ge-Xia
2012-01-01
The mitochondrial gene COI has been widely used by taxonomists as a standard DNA barcode sequence for the identification of many animal species. However, the COI region is of limited use for identifying certain species and is not efficiently amplified by PCR in all animal taxa. To evaluate the utility of COI as a DNA barcode and to identify other barcode genes, we chose the aphid subfamily Lachninae (Hemiptera: Aphididae) as the focus of our study. We compared the results obtained using COI with two other mitochondrial genes, COII and Cytb. In addition, we propose a new method to improve the efficiency of species identification using DNA barcoding. Three mitochondrial genes (COI, COII and Cytb) were sequenced and were used in the identification of over 80 species of Lachninae. The COI and COII genes demonstrated a greater PCR amplification efficiency than Cytb. Species identification using COII sequences had a higher frequency of success (96.9% in "best match" and 90.8% in "best close match") and yielded lower intra- and higher interspecific genetic divergence values than the other two markers. The use of "tag barcodes" is a new approach that involves attaching a species-specific tag to the standard DNA barcode. With this method, the "barcoding overlap" can be nearly eliminated. As a result, we were able to increase the identification success rate from 83.9% to 95.2% by using COI and the "best close match" technique. A COII-based identification system should be more effective in identifying lachnine species than COI or Cytb. However, the Cytb gene is an effective marker for the study of aphid population genetics due to its high sequence diversity. Furthermore, the use of "tag barcodes" can improve the accuracy of DNA barcoding identification by reducing or removing the overlap between intra- and inter-specific genetic divergence values.
Nagy, Zoltán T; Sonet, Gontran; Glaw, Frank; Vences, Miguel
2012-01-01
DNA barcoding of non-avian reptiles based on the cytochrome oxidase subunit I (COI) gene is still in a very early stage, mainly due to technical problems. Using a newly developed set of reptile-specific primers for COI we present the first comprehensive study targeting the entire reptile fauna of the fourth-largest island in the world, the biodiversity hotspot of Madagascar. Representatives of the majority of Madagascan non-avian reptile species (including Squamata and Testudines) were sampled and successfully DNA barcoded. The new primer pair achieved a constantly high success rate (72.7-100%) for most squamates. More than 250 species of reptiles (out of the 393 described ones; representing around 64% of the known diversity of species) were barcoded. The average interspecific genetic distance within families ranged from a low of 13.4% in the Boidae to a high of 29.8% in the Gekkonidae. Using the average genetic divergence between sister species as a threshold, 41-48 new candidate (undescribed) species were identified. Simulations were used to evaluate the performance of DNA barcoding as a function of completeness of taxon sampling and fragment length. Compared with available multi-gene phylogenies, DNA barcoding correctly assigned most samples to species, genus and family with high confidence and the analysis of fewer taxa resulted in an increased number of well supported lineages. Shorter marker-lengths generally decreased the number of well supported nodes, but even mini-barcodes of 100 bp correctly assigned many samples to genus and family. The new protocols might help to promote DNA barcoding of reptiles and the established library of reference DNA barcodes will facilitate the molecular identification of Madagascan reptiles. Our results might be useful to easily recognize undescribed diversity (i.e. novel taxa), to resolve taxonomic problems, and to monitor the international pet trade without specialized expert knowledge.
Nagy, Zoltán T.; Sonet, Gontran; Glaw, Frank; Vences, Miguel
2012-01-01
Background DNA barcoding of non-avian reptiles based on the cytochrome oxidase subunit I (COI) gene is still in a very early stage, mainly due to technical problems. Using a newly developed set of reptile-specific primers for COI we present the first comprehensive study targeting the entire reptile fauna of the fourth-largest island in the world, the biodiversity hotspot of Madagascar. Methodology/Principal Findings Representatives of the majority of Madagascan non-avian reptile species (including Squamata and Testudines) were sampled and successfully DNA barcoded. The new primer pair achieved a constantly high success rate (72.7–100%) for most squamates. More than 250 species of reptiles (out of the 393 described ones; representing around 64% of the known diversity of species) were barcoded. The average interspecific genetic distance within families ranged from a low of 13.4% in the Boidae to a high of 29.8% in the Gekkonidae. Using the average genetic divergence between sister species as a threshold, 41–48 new candidate (undescribed) species were identified. Simulations were used to evaluate the performance of DNA barcoding as a function of completeness of taxon sampling and fragment length. Compared with available multi-gene phylogenies, DNA barcoding correctly assigned most samples to species, genus and family with high confidence and the analysis of fewer taxa resulted in an increased number of well supported lineages. Shorter marker-lengths generally decreased the number of well supported nodes, but even mini-barcodes of 100 bp correctly assigned many samples to genus and family. Conclusions/Significance The new protocols might help to promote DNA barcoding of reptiles and the established library of reference DNA barcodes will facilitate the molecular identification of Madagascan reptiles. Our results might be useful to easily recognize undescribed diversity (i.e. novel taxa), to resolve taxonomic problems, and to monitor the international pet trade without specialized expert knowledge. PMID:22479636
Standley, C J; Stothard, J R
2012-10-01
While Schistosoma rodhaini is typically considered a parasite of small mammals and is very scantly distributed in the Lake Victoria basin, it is known to hybridize with the more widespread Schistosoma mansoni, the causative agent of intestinal schistosomiasis. As part of broader parasitological and malacological surveys for S. mansoni across Lake Victoria, schistosome cercariae were harvested from a field-caught Biomphalaria choanomphala taken on Ngamba Island Chimpanzee Sanctuary, Uganda. Upon DNA barcoding, these cercariae were found to be a mixture of both S. rodhaini and S. mansoni, with further phylogenetic analysis revealing a hitherto unknown sub-lineage within S. rodhaini. Despite repeated sampling for eggs and miracidia from both chimpanzees and staff on Ngamba Island Sanctuary, detection of S. rodhaini within local definitive hosts awaits additional efforts, which should be mindful of a potential host role of spotted-necked otters.
"Crown of thorns" of Daphnia: an exceptional inducible defense discovered by DNA barcoding.
Laforsch, Christian; Haas, Andreas; Jung, Nina; Schwenk, Klaus; Tollrian, Ralph; Petrusek, Adam
2009-09-01
DNA barcoding has emerged as valuable tool to document global biodiversity. Mitochondrial cytochrome oxidase I (COI) sequences serve as genetic markers to catalogue species richness in the animal kingdom and to identify cryptic and polymorphic animal species. Furthermore, DNA barcoding data serve as a fuel for ecological studies, as they provide the opportunity to unravel species interactions among hosts and parasites, predators and prey, and among competitors in unprecedented detail. In a recent paper we described how DNA barcoding in combination with morphological and ecological data unravelled a striking predator-prey interaction of organisms from temporary aquatic habitats, the predatory notostracan Triops and its prey, cladocerans of the Daphnia atkinsoni complex.
DNA barcodes for ecology, evolution, and conservation.
Kress, W John; García-Robledo, Carlos; Uriarte, Maria; Erickson, David L
2015-01-01
The use of DNA barcodes, which are short gene sequences taken from a standardized portion of the genome and used to identify species, is entering a new phase of application as more and more investigations employ these genetic markers to address questions relating to the ecology and evolution of natural systems. The suite of DNA barcode markers now applied to specific taxonomic groups of organisms are proving invaluable for understanding species boundaries, community ecology, functional trait evolution, trophic interactions, and the conservation of biodiversity. The application of next-generation sequencing (NGS) technology will greatly expand the versatility of DNA barcodes across the Tree of Life, habitats, and geographies as new methodologies are explored and developed. Published by Elsevier Ltd.
Santos, Angélica Rossotti Dos; Usso, Mariana Campaner; Gouveia, Juceli Gonzalez; Araya-Jaime, Cristian; Frantine-Silva, Wilson; Giuliano-Caetano, Lucia; Foresti, Fausto; Dias, Ana Lúcia
2017-06-01
The mapping of repetitive DNA sites by fluorescence in situ hybridization has been widely used for karyotype studies in different species of fish, especially when dealing with related species or even genera presenting high chromosome variability. This study analyzed three populations of Bryconamericus, with diploid number preserved, but with different karyotype formulae. Bryconamericus ecai, from the Forquetinha river/RS, presented three new cytotypes, increasing the number of karyotype forms to seven in this population. Other two populations of Bryconamericus sp. from the Vermelho stream/PR and Cambuta river/PR exhibited interpopulation variation. The chromosome mapping of rDNA sites revealed unique markings among the three populations, showing inter- and intrapopulation variability located in the terminal region. The molecular analysis using DNA barcoding complementing the cytogenetic analysis also showed differentiation among the three populations. The U2 small nuclear DNA repetitive sequence exhibited conserved features, being located in the interstitial region of a single chromosome pair. This is the first report on its occurrence in the genus Bryconamericus. Data obtained revealed a karyotype variability already assigned to the genus, along with polymorphism of ribosomal sites, demonstrating that this group of fish can be undergoing a divergent evolutionary process, constituting a substantive model for studies of chromosomal evolution.
DNA barcode-based molecular identification system for fish species.
Kim, Sungmin; Eo, Hae-Seok; Koo, Hyeyoung; Choi, Jun-Kil; Kim, Won
2010-12-01
In this study, we applied DNA barcoding to identify species using short DNA sequence analysis. We examined the utility of DNA barcoding by identifying 53 Korean freshwater fish species, 233 other freshwater fish species, and 1339 saltwater fish species. We successfully developed a web-based molecular identification system for fish (MISF) using a profile hidden Markov model. MISF facilitates efficient and reliable species identification, overcoming the limitations of conventional taxonomic approaches. MISF is freely accessible at http://bioinfosys.snu.ac.kr:8080/MISF/misf.jsp .
Towards writing the encyclopaedia of life: an introduction to DNA barcoding
Savolainen, Vincent; Cowan, Robyn S; Vogler, Alfried P; Roderick, George K; Lane, Richard
2005-01-01
An international consortium of major natural history museums, herbaria and other organizations has launched an ambitious project, the ‘Barcode of Life Initiative’, to promote a process enabling the rapid and inexpensive identification of the estimated 10 million species on Earth. DNA barcoding is a diagnostic technique in which short DNA sequence(s) can be used for species identification. The first international scientific conference on Barcoding of Life was held at the Natural History Museum in London in February 2005, and here we review the scientific challenges discussed during this conference and in previous publications. Although still controversial, the scientific benefits of DNA barcoding include: (i) enabling species identification, including any life stage or fragment, (ii) facilitating species discoveries based on cluster analyses of gene sequences (e.g. cox1=CO1, in animals), (iii) promoting development of handheld DNA sequencing technology that can be applied in the field for biodiversity inventories and (iv) providing insight into the diversity of life. PMID:16214739
The Hemiptera (Insecta) of Canada: Constructing a Reference Library of DNA Barcodes
Gwiazdowski, Rodger A.; Foottit, Robert G.; Maw, H. Eric L.; Hebert, Paul D. N.
2015-01-01
DNA barcode reference libraries linked to voucher specimens create new opportunities for high-throughput identification and taxonomic re-evaluations. This study provides a DNA barcode library for about 45% of the recognized species of Canadian Hemiptera, and the publically available R workflow used for its generation. The current library is based on the analysis of 20,851 specimens including 1849 species belonging to 628 genera and 64 families. These individuals were assigned to 1867 Barcode Index Numbers (BINs), sequence clusters that often coincide with species recognized through prior taxonomy. Museum collections were a key source for identified specimens, but we also employed high-throughput collection methods that generated large numbers of unidentified specimens. Many of these specimens represented novel BINs that were subsequently identified by taxonomists, adding barcode coverage for additional species. Our analyses based on both approaches includes 94 species not listed in the most recent Canadian checklist, representing a potential 3% increase in the fauna. We discuss the development of our workflow in the context of prior DNA barcode library construction projects, emphasizing the importance of delineating a set of reference specimens to aid investigations in cases of nomenclatural and DNA barcode discordance. The identification for each specimen in the reference set can be annotated on the Barcode of Life Data System (BOLD), allowing experts to highlight questionable identifications; annotations can be added by any registered user of BOLD, and instructions for this are provided. PMID:25923328
A comparative study of COI and 16 S rRNA genes for DNA barcoding of cultivable carps in India.
Mohanty, Mausumee; Jayasankar, Pallipuram; Sahoo, Lakshman; Das, Paramananda
2015-02-01
The 5' region of the mitochondrial DNA gene cytochrome c oxidase subunit I (COI) is the standard marker for DNA barcoding. However, 16 S rRNA has also been advocated for DNA barcoding in many animal species. Herein, we directly compare the usefulness of COI and 16 S rRNA in discriminating six cultivable carp species: Labeo rohita, Catla catla, Cirrhinus mrigala, Labeo fimbriatus, Labeo bata and Cirrhinus reba from India. Analysis of partial sequences of these two gene fragments from 171 individuals indicated close genetic relationship between Catla catla and Labeo rohita. The results of the present study indicated COI to be more useful than 16 S rRNA for DNA barcoding of Indian carps.
A laboratory information management system for DNA barcoding workflows.
Vu, Thuy Duong; Eberhardt, Ursula; Szöke, Szániszló; Groenewald, Marizeth; Robert, Vincent
2012-07-01
This paper presents a laboratory information management system for DNA sequences (LIMS) created and based on the needs of a DNA barcoding project at the CBS-KNAW Fungal Biodiversity Centre (Utrecht, the Netherlands). DNA barcoding is a global initiative for species identification through simple DNA sequence markers. We aim at generating barcode data for all strains (or specimens) included in the collection (currently ca. 80 k). The LIMS has been developed to better manage large amounts of sequence data and to keep track of the whole experimental procedure. The system has allowed us to classify strains more efficiently as the quality of sequence data has improved, and as a result, up-to-date taxonomic names have been given to strains and more accurate correlation analyses have been carried out.
Arif, I A; Khan, H A; Al Sadoon, M; Shobrak, M
2011-10-31
In recent years, DNA barcoding has emerged as a powerful tool for species identification. We report an extended validation of a universal DNA mini-barcode for amplification of 130-bp COI segments from 23 specimens collected from a desert environment, including 11 reptiles, five mammals and seven birds. Besides the standard double-annealing protocol, we also tested a more stringent single-annealing protocol. The PCR success rate for the amplification of the mini-barcode region was: mammals (4/5), reptiles (5/11) and birds (4/7). These findings demonstrate the limited utility of universal primers for mini-barcoding, at least for these vertebrate taxa that we collected from the Saudi Arabian desert.
Identification of Fabaceae plants using the DNA barcode matK.
Gao, Ting; Sun, Zhiying; Yao, Hui; Song, Jingyuan; Zhu, Yingjie; Ma, Xinye; Chen, Shilin
2011-01-01
In this study, we tested the applicability of the core DNA barcode MATK for identifying species within the Fabaceae family. Based on an evaluation of genetic variation, DNA barcoding gaps, and species discrimination power, MATK is a useful barcode for Fabaceae species. Of 1355 plant samples collected from 1079 species belonging to 409 diverse genera, MATK precisely identified approximately 80 % and 96 % of them at the species and genus levels, respectively. Therefore, our research indicates that the MATK region is a valuable marker for plant species within Fabaceae. © Georg Thieme Verlag KG Stuttgart · New York.
Liu, Jun; Li, Qi; Kong, Lingfeng; Yu, Hong; Zheng, Xiaodong
2011-09-01
Oysters (family Ostreidae), with high levels of phenotypic plasticity and wide geographic distribution, are a challenging group for taxonomists and phylogenetics. As a useful tool for molecular species identification, DNA barcoding might offer significant potential for oyster identification and taxonomy. This study used two mitochondrial fragments, cytochrome c oxidase I (COI) and the large ribosomal subunit (16S rDNA), to assess whether oyster species could be identified by phylogeny and distance-based DNA barcoding techniques. Relationships among species were estimated by the phylogenetic analyses of both genes, and then pairwise inter- and intraspecific genetic divergences were assessed. Species forming well-differentiated clades in the molecular phylogenies were identical for both genes even when the closely related species were included. Intraspecific variability of 16S rDNA overlapped with interspecific divergence. However, average intra- and interspecific genetic divergences for COI were 0-1.4% (maximum 2.2%) and 2.6-32.2% (minimum 2.2%), respectively, indicating the existence of a barcoding gap. These results confirm the efficacy of species identification in oysters via DNA barcodes and phylogenetic analysis. © 2011 Blackwell Publishing Ltd.
DNA Barcode Authentication of Saw Palmetto Herbal Dietary Supplements
Little, Damon P.; Jeanson, Marc L.
2013-01-01
Herbal dietary supplements made from saw palmetto (Serenoa repens; Arecaceae) fruit are commonly consumed to ameliorate benign prostate hyperplasia. A novel DNA mini–barcode assay to accurately identify [specificity = 1.00 (95% confidence interval = 0.74–1.00); sensitivity = 1.00 (95% confidence interval = 0.66–1.00); n = 31] saw palmetto dietary supplements was designed from a DNA barcode reference library created for this purpose. The mini–barcodes were used to estimate the frequency of mislabeled saw palmetto herbal dietary supplements on the market in the United States of America. Of the 37 supplements examined, amplifiable DNA could be extracted from 34 (92%). Mini–barcode analysis of these supplements demonstrated that 29 (85%) contain saw palmetto and that 2 (6%) supplements contain related species that cannot be legally sold as herbal dietary supplements in the United States of America. The identity of 3 (9%) supplements could not be conclusively determined. PMID:24343362
DNA barcodes for dragonflies and damselflies (Odonata) of Mindanao, Philippines.
Casas, Princess Angelie S; Sing, Kong-Wah; Lee, Ping-Shin; Nuñeza, Olga M; Villanueva, Reagan Joseph T; Wilson, John-James
2018-03-01
Reliable species identification provides a sounder basis for use of species in the order Odonata as biological indicators and for their conservation, an urgent concern as many species are threatened with imminent extinction. We generated 134 COI barcodes from 36 morphologically identified species of Odonata collected from Mindanao Island, representing 10 families and 19 genera. Intraspecific sequence divergences ranged from 0 to 6.7% with four species showing more than 2%, while interspecific sequence divergences ranged from 0.5 to 23.3% with seven species showing less than 2%. Consequently, no distinct gap was observed between intraspecific and interspecific DNA barcode divergences. The numerous islands of the Philippine archipelago may have facilitated rapid speciation in the Odonata and resulted in low interspecific sequence divergences among closely related groups of species. This study contributes DNA barcodes for 36 morphologically identified species of Odonata reported from Mindanao including 31 species with no previous DNA barcode records.
DNA barcode authentication of saw palmetto herbal dietary supplements.
Little, Damon P; Jeanson, Marc L
2013-12-17
Herbal dietary supplements made from saw palmetto (Serenoa repens; Arecaceae) fruit are commonly consumed to ameliorate benign prostate hyperplasia. A novel DNA mini-barcode assay to accurately identify [specificity = 1.00 (95% confidence interval = 0.74-1.00); sensitivity = 1.00 (95% confidence interval = 0.66-1.00); n = 31] saw palmetto dietary supplements was designed from a DNA barcode reference library created for this purpose. The mini-barcodes were used to estimate the frequency of mislabeled saw palmetto herbal dietary supplements on the market in the United States of America. Of the 37 supplements examined, amplifiable DNA could be extracted from 34 (92%). Mini-barcode analysis of these supplements demonstrated that 29 (85%) contain saw palmetto and that 2 (6%) supplements contain related species that cannot be legally sold as herbal dietary supplements in the United States of America. The identity of 3 (9%) supplements could not be conclusively determined.
Directed nucleation assembly of DNA tile complexes for barcode-patterned lattices
Yan, Hao; LaBean, Thomas H.; Feng, Liping; Reif, John H.
2003-01-01
The programmed self-assembly of patterned aperiodic molecular structures is a major challenge in nanotechnology and has numerous potential applications for nanofabrication of complex structures and useful devices. Here we report the construction of an aperiodic patterned DNA lattice (barcode lattice) by a self-assembly process of directed nucleation of DNA tiles around a scaffold DNA strand. The input DNA scaffold strand, constructed by ligation of shorter synthetic oligonucleotides, provides layers of the DNA lattice with barcode patterning information represented by the presence or absence of DNA hairpin loops protruding out of the lattice plane. Self-assembly of multiple DNA tiles around the scaffold strand was shown to result in a patterned lattice containing barcode information of 01101. We have also demonstrated the reprogramming of the system to another patterning. An inverted barcode pattern of 10010 was achieved by modifying the scaffold strands and one of the strands composing each tile. A ribbon lattice, consisting of repetitions of the barcode pattern with expected periodicity, was also constructed by the addition of sticky ends. The patterning of both classes of lattices was clearly observable via atomic force microscopy. These results represent a step toward implementation of a visual readout system capable of converting information encoded on a 1D DNA strand into a 2D form readable by advanced microscopic techniques. A functioning visual output method would not only increase the readout speed of DNA-based computers, but may also find use in other sequence identification techniques such as mutation or allele mapping. PMID:12821776
The changing epitome of species identification – DNA barcoding
Ajmal Ali, M.; Gyulai, Gábor; Hidvégi, Norbert; Kerti, Balázs; Al Hemaid, Fahad M.A.; Pandey, Arun K.; Lee, Joongku
2014-01-01
The discipline taxonomy (the science of naming and classifying organisms, the original bioinformatics and a basis for all biology) is fundamentally important in ensuring the quality of life of future human generation on the earth; yet over the past few decades, the teaching and research funding in taxonomy have declined because of its classical way of practice which lead the discipline many a times to a subject of opinion, and this ultimately gave birth to several problems and challenges, and therefore the taxonomist became an endangered race in the era of genomics. Now taxonomy suddenly became fashionable again due to revolutionary approaches in taxonomy called DNA barcoding (a novel technology to provide rapid, accurate, and automated species identifications using short orthologous DNA sequences). In DNA barcoding, complete data set can be obtained from a single specimen irrespective to morphological or life stage characters. The core idea of DNA barcoding is based on the fact that the highly conserved stretches of DNA, either coding or non coding regions, vary at very minor degree during the evolution within the species. Sequences suggested to be useful in DNA barcoding include cytoplasmic mitochondrial DNA (e.g. cox1) and chloroplast DNA (e.g. rbcL, trnL-F, matK, ndhF, and atpB rbcL), and nuclear DNA (ITS, and house keeping genes e.g. gapdh). The plant DNA barcoding is now transitioning the epitome of species identification; and thus, ultimately helping in the molecularization of taxonomy, a need of the hour. The ‘DNA barcodes’ show promise in providing a practical, standardized, species-level identification tool that can be used for biodiversity assessment, life history and ecological studies, forensic analysis, and many more. PMID:24955007
FBIS: A regional DNA barcode archival & analysis system for Indian fishes.
Nagpure, Naresh Sahebrao; Rashid, Iliyas; Pathak, Ajey Kumar; Singh, Mahender; Singh, Shri Prakash; Sarkar, Uttam Kumar
2012-01-01
DNA barcode is a new tool for taxon recognition and classification of biological organisms based on sequence of a fragment of mitochondrial gene, cytochrome c oxidase I (COI). In view of the growing importance of the fish DNA barcoding for species identification, molecular taxonomy and fish diversity conservation, we developed a Fish Barcode Information System (FBIS) for Indian fishes, which will serve as a regional DNA barcode archival and analysis system. The database presently contains 2334 sequence records of COI gene for 472 aquatic species belonging to 39 orders and 136 families, collected from available published data sources. Additionally, it contains information on phenotype, distribution and IUCN Red List status of fishes. The web version of FBIS was designed using MySQL, Perl and PHP under Linux operating platform to (a) store and manage the acquisition (b) analyze and explore DNA barcode records (c) identify species and estimate genetic divergence. FBIS has also been integrated with appropriate tools for retrieving and viewing information about the database statistics and taxonomy. It is expected that FBIS would be useful as a potent information system in fish molecular taxonomy, phylogeny and genomics. The database is available for free at http://mail.nbfgr.res.in/fbis/
2009-01-01
Background This study reports progress in assembling a DNA barcode reference library for Ephemeroptera, Plecoptera, and Trichoptera ("EPTs") from a Canadian subarctic site, which is the focus of a comprehensive biodiversity inventory using DNA barcoding. These three groups of aquatic insects exhibit a moderate level of species diversity, making them ideal for testing the feasibility of DNA barcoding for routine biotic surveys. We explore the correlation between the morphological species delineations, DNA barcode-based haplotype clusters delimited by a sequence threshold (2%), and a threshold-free approach to biodiversity quantification--phylogenetic diversity. Results A DNA barcode reference library is built for 112 EPT species for the focal region, consisting of 2277 COI sequences. Close correspondence was found between EPT morphospecies and haplotype clusters as designated using a standard threshold value. Similarly, the shapes of taxon accumulation curves based upon haplotype clusters were very similar to those generated using phylogenetic diversity accumulation curves, but were much more computationally efficient. Conclusion The results of this study will facilitate other lines of research on northern EPTs and also bode well for rapidly conducting initial biodiversity assessments in unknown EPT faunas. PMID:20003245
Hanner, Robert; Becker, Sven; Ivanova, Natalia V; Steinke, Dirk
2011-10-01
The Fish Barcode of Life campaign involves a broad international collaboration among scientists working to advance the identification of fishes using DNA barcodes. With over 25% of the world's known ichthyofauna currently profiled, forensic identification of seafood products is now feasible and is becoming routine. Driven by growing consumer interest in the food supply, investigative reporters from five different media establishments procured seafood samples (n = 254) from numerous retail establishments located among five Canadian metropolitan areas between 2008 and 2010. The specimens were sent to the Canadian Centre for DNA Barcoding for analysis. By integrating the results from these individual case studies in a summary analysis, we provide a broad perspective on seafood substitution across Canada. Barcodes were recovered from 93% of the samples (n = 236), and identified using the Barcode of Life Data Systems "species identification" engine ( www.barcodinglife.org ). A 99% sequence similarity threshold was employed as a conservative matching criterion for specimen identification to the species level. Comparing these results against the Canadian Food Inspection Agency's "Fish List" a guideline to interpreting "false, misleading or deceptive" names (as per s 27 of the Fish Inspection regulations) demonstrated that 41% of the samples were mislabeled. Most samples were readily identified; however, this was not true in all cases because some samples had no close match. Others were ambiguous due to limited barcode resolution (or imperfect taxonomy) observed within a few closely related species complexes. The latter cases did not significantly impact the results because even the partial resolution achieved was sufficient to demonstrate mislabeling. This work highlights the functional utility of barcoding for the identification of diverse market samples. It also demonstrates how barcoding serves as a bridge linking scientific nomenclature with approved market names, potentially empowering regulatory bodies to enforce labeling standards. By synchronizing taxonomic effort with sequencing effort and database curation, barcoding provides a molecular identification resource of service to applied forensics.
Submicrometre geometrically encoded fluorescent barcodes self-assembled from DNA
NASA Astrophysics Data System (ADS)
Lin, Chenxiang; Jungmann, Ralf; Leifer, Andrew M.; Li, Chao; Levner, Daniel; Church, George M.; Shih, William M.; Yin, Peng
2012-10-01
The identification and differentiation of a large number of distinct molecular species with high temporal and spatial resolution is a major challenge in biomedical science. Fluorescence microscopy is a powerful tool, but its multiplexing ability is limited by the number of spectrally distinguishable fluorophores. Here, we used (deoxy)ribonucleic acid (DNA)-origami technology to construct submicrometre nanorods that act as fluorescent barcodes. We demonstrate that spatial control over the positioning of fluorophores on the surface of a stiff DNA nanorod can produce 216 distinct barcodes that can be decoded unambiguously using epifluorescence or total internal reflection fluorescence microscopy. Barcodes with higher spatial information density were demonstrated via the construction of super-resolution barcodes with features spaced by ˜40 nm. One species of the barcodes was used to tag yeast surface receptors, which suggests their potential applications as in situ imaging probes for diverse biomolecular and cellular entities in their native environments.
Sub-micrometer Geometrically Encoded Fluorescent Barcodes Self-Assembled from DNA
Lin, Chenxiang; Jungmann, Ralf; Leifer, Andrew M.; Li, Chao; Levner, Daniel; Church, George M.; Shih, William M.; Yin, Peng
2012-01-01
The identification and differentiation of a large number of distinct molecular species with high temporal and spatial resolution is a major challenge in biomedical science. Fluorescence microscopy is a powerful tool, but its multiplexing ability is limited by the number of spectrally distinguishable fluorophores. Here we use DNA-origami technology to construct sub-micrometer nanorods that act as fluorescent barcodes. We demonstrate that spatial control over the positioning of fluorophores on the surface of a stiff DNA nanorod can produce 216 distinct barcodes that can be unambiguously decoded using epifluorescence or total internal reflection fluorescence (TIRF) microscopy. Barcodes with higher spatial information density were demonstrated via the construction of super-resolution barcodes with features spaced by ~40 nm. One species of the barcodes was used to tag yeast surface receptors, suggesting their potential applications as in situ imaging probes for diverse biomolecular and cellular entities in their native environments. PMID:23000997
Díaz-Mejía, J Javier; Celaj, Albi; Mellor, Joseph C; Coté, Atina; Balint, Attila; Ho, Brandon; Bansal, Pritpal; Shaeri, Fatemeh; Gebbia, Marinella; Weile, Jochen; Verby, Marta; Karkhanina, Anna; Zhang, YiFan; Wong, Cassandra; Rich, Justin; Prendergast, D'Arcy; Gupta, Gaurav; Öztürk, Sedide; Durocher, Daniel; Brown, Grant W; Roth, Frederick P
2018-05-28
Condition-dependent genetic interactions can reveal functional relationships between genes that are not evident under standard culture conditions. State-of-the-art yeast genetic interaction mapping, which relies on robotic manipulation of arrays of double-mutant strains, does not scale readily to multi-condition studies. Here, we describe barcode fusion genetics to map genetic interactions (BFG-GI), by which double-mutant strains generated via en masse "party" mating can also be monitored en masse for growth to detect genetic interactions. By using site-specific recombination to fuse two DNA barcodes, each representing a specific gene deletion, BFG-GI enables multiplexed quantitative tracking of double mutants via next-generation sequencing. We applied BFG-GI to a matrix of DNA repair genes under nine different conditions, including methyl methanesulfonate (MMS), 4-nitroquinoline 1-oxide (4NQO), bleomycin, zeocin, and three other DNA-damaging environments. BFG-GI recapitulated known genetic interactions and yielded new condition-dependent genetic interactions. We validated and further explored a subnetwork of condition-dependent genetic interactions involving MAG1 , SLX4, and genes encoding the Shu complex, and inferred that loss of the Shu complex leads to an increase in the activation of the checkpoint protein kinase Rad53. © 2018 The Authors. Published under the terms of the CC BY 4.0 license.
López-Quintero, Carlos A; Atanasova, Lea; Franco-Molano, A Esperanza; Gams, Walter; Komon-Zelazowska, Monika; Theelen, Bart; Müller, Wally H; Boekhout, Teun; Druzhinina, Irina
2013-11-01
The diversity of Trichoderma (Hypocreales, Ascomycota) colonizing leaf litter as well as the rhizosphere of Garcinia macrophylla (Clusiaceae) was investigated in primary and secondary rain forests in Colombian Amazonia. DNA barcoding of 107 strains based on the internal transcribed spacers 1 and 2 (ITS1 and 2) of the ribosomal RNA gene cluster and the partial sequence of the translation elongation factor 1 alpha (tef1) gene revealed that the diversity of Trichoderma was dominated (71 %) by three common cosmopolitan species, namely Trichoderma harzianum sensu lato (41 %), Trichoderma spirale (17 %) and Trichoderma koningiopsis (13 %). Four ITS 1 and 2 phylotypes (13 strains) could not be identified with certainty. Multigene phylogenetic analysis and phenotype profiling of four strains with an ITS1 and 2 phylotype similar to Trichoderma strigosum revealed a new sister species of the latter that is described here as Trichoderma strigosellum sp. nov. Sequence similarity searches revealed that this species also occurs in soils of Malaysia and Cameroon, suggesting a pantropical distribution.
Renoux, Lance P; Dolan, Maureen C; Cook, Courtney A; Smit, Nico J; Sikkel, Paul C
2017-08-01
Apicomplexan parasites are obligate parasites of many species of vertebrates. To date, there is very limited understanding of these parasites in the most-diverse group of vertebrates, actinopterygian fishes. While DNA barcoding targeting the eukaryotic 18S small subunit rRNA gene sequence has been useful in identifying apicomplexans in tetrapods, identification of apicomplexans infecting fishes has relied solely on morphological identification by microscopy. In this study, a DNA barcoding method was developed that targets the 18S rRNA gene primers for identifying apicomplexans parasitizing certain actinopterygian fishes. A lead primer set was selected showing no cross-reactivity to the overwhelming abundant host DNA and successfully confirmed 37 of the 41 (90.2%) microscopically verified parasitized fish blood samples analyzed in this study. Furthermore, this DNA barcoding method identified 4 additional samples that screened negative for parasitemia, suggesting this molecular method may provide improved sensitivity over morphological characterization by microscopy. In addition, this PCR screening method for fish apicomplexans, using Whatman FTA preserved DNA, was tested in efforts leading to a more simplified field collection, transport, and sample storage method as well as a streamlining sample processing important for DNA barcoding of large sample sets.
DNA barcode reference data for the Korean herpetofauna and their applications.
Jeong, Tae Jin; Jun, Jumin; Han, Sanghoon; Kim, Hyun Tae; Oh, Kyunghee; Kwak, Myounghai
2013-11-01
Recently, amphibians and reptiles have drawn attention because of declines in species and populations caused mainly by habitat loss, overexploitation and climate change. This study constructed a DNA barcode database for the Korean herpetofauna, including all the recorded amphibians and 68% of the recorded reptiles, to provide a useful, standardized tool for species identification in monitoring and management. A total of 103 individuals from 18 amphibian and 17 reptile species were used to generate barcode sequences using partial sequences of the mitochondrial cytochrome c oxidase subunit I (COI) gene and to compare it with other suggested barcode loci. Comparing 16S rRNA, cytochrome b (Cytb) and COI for amphibians and 12S rRNA, Cytb and COI for reptiles, our results revealed that COI is better than the other markers in terms of a high level of sequence variation without length variation and moderate amplification success. Although the COI marker had no clear barcoding gap because of the high level of intraspecific variation, all of the analysed individuals from the same species clustered together in a neighbour-joining tree. High intraspecific variation suggests the possibility of cryptic species. Finally, using this database, confiscated snakes were identified as Elaphe schrenckii, designated as endangered in Korea and a food contaminant was identified as the lizard Takydromus amurensis. © 2013 John Wiley & Sons Ltd.
Exploring Genetic Divergence in a Species-Rich Insect Genus Using 2790 DNA Barcodes
Lin, Xiaolong; Stur, Elisabeth; Ekrem, Torbjørn
2015-01-01
DNA barcoding using a fragment of the mitochondrial cytochrome c oxidase subunit 1 gene (COI) has proven to be successful for species-level identification in many animal groups. However, most studies have been focused on relatively small datasets or on large datasets of taxonomically high-ranked groups. We explore the quality of DNA barcodes to delimit species in the diverse chironomid genus Tanytarsus (Diptera: Chironomidae) by using different analytical tools. The genus Tanytarsus is the most species-rich taxon of tribe Tanytarsini (Diptera: Chironomidae) with more than 400 species worldwide, some of which can be notoriously difficult to identify to species-level using morphology. Our dataset, based on sequences generated from own material and publicly available data in BOLD, consist of 2790 DNA barcodes with a fragment length of at least 500 base pairs. A neighbor joining tree of this dataset comprises 131 well separated clusters representing 121 morphological species of Tanytarsus: 77 named, 16 unnamed and 28 unidentified theoretical species. For our geographically widespread dataset, DNA barcodes unambiguously discriminate 94.6% of the Tanytarsus species recognized through prior morphological study. Deep intraspecific divergences exist in some species complexes, and need further taxonomic studies using appropriate nuclear markers as well as morphological and ecological data to be resolved. The DNA barcodes cluster into 120–242 molecular operational taxonomic units (OTUs) depending on whether Objective Clustering, Automatic Barcode Gap Discovery (ABGD), Generalized Mixed Yule Coalescent model (GMYC), Poisson Tree Process (PTP), subjective evaluation of the neighbor joining tree or Barcode Index Numbers (BINs) are used. We suggest that a 4–5% threshold is appropriate to delineate species of Tanytarsus non-biting midges. PMID:26406595
Nevill, Paul G; Wallace, Mark J; Miller, Joseph T; Krauss, Siegfried L
2013-11-01
We used DNA barcoding to address an important conservation issue in the Midwest of Western Australia, working on Australia's largest genus of flowering plant. We tested whether or not currently recommended plant DNA barcoding regions (matK and rbcL) were able to discriminate Acacia taxa of varying phylogenetic distances, and ultimately identify an ambiguously labelled seed collection from a mine-site restoration project. Although matK successfully identified the unknown seed as the rare and conservation priority listed A. karina, and was able to resolve six of the eleven study species, this region was difficult to amplify and sequence. In contrast, rbcL was straightforward to recover and align, but could not determine the origin of the seed and only resolved 3 of the 11 species. Other chloroplast regions (rpl32-trnL, psbA-trnH, trnL-F and trnK) had mixed success resolving the studied taxa. In general, species were better resolved in multilocus data sets compared to single-locus data sets. We recommend using the formal barcoding regions supplemented with data from other plastid regions, particularly rpl32-trnL, for barcoding in Acacia. Our study demonstrates the novel use of DNA barcoding for seed identification and illustrates the practical potential of DNA barcoding for the growing discipline of restoration ecology. © 2013 John Wiley & Sons Ltd.
Applications of three DNA barcodes in assorting intertidal red macroalgal flora in Qingdao, China
NASA Astrophysics Data System (ADS)
Zhao, Xiaobo; Pang, Shaojun; Shan, Tifeng; Liu, Feng
2013-03-01
This study is part of the endeavor to construct a comprehensive DNA barcoding database for common seaweeds in China. Identifications of red seaweeds, which have simple morphology and anatomy, are sometimes difficult solely depending on morphological characteristics. In recent years, DNA barcode technique has become a more and more effective tool to help solve some of the taxonomic difficulties. Some DNA markers such as COI (cytochrome oxidase subunit I) are proposed as standardized DNA barcodes for all seaweed species. In this study, COI, UPA (universal plastid amplicon, domain V of 23S rRNA), and ITS (nuclear internal transcribed spacer) were employed to analyze common species of intertidal red seaweeds in Qingdao (119.3°-121°E, 35.35°-37.09°N). The applicability of using one or a few combined barcodes to identify red seaweed species was tested. The results indicated that COI is a sensitive marker at species level. However, not all the tested species gave PCR amplification products due to lack of the universal primers. The second barcode UPA had effective universal primers but needed to be tested for the effectiveness of resolving closely related species. More than one ITS sequence types were found in some species in this investigation, which might lead to confusion in further analysis. Therefore ITS sequence is not recommended as a universal barcode for seaweeds identification.
USDA-ARS?s Scientific Manuscript database
A type barcode is a DNA barcode unequivocally tied to an authoritatively identified specimen, preferably the primary type specimen. Type barcodes are analogous, albeit subordinate, to type specimens, providing a stable reference to which other barcodes can be compared. We here designate and describe...
Palhares, Rafael Melo; Gonçalves Drummond, Marcela; dos Santos Alves Figueiredo Brasil, Bruno; Pereira Cosenza, Gustavo; das Graças Lins Brandão, Maria; Oliveira, Guilherme
2015-01-01
Medicinal plants are used throughout the world, and the regulations defining their proper use, such as identification of the correct species and verification of the presence, purity and concentration of the required chemical compounds, are widely recognized. Herbal medicines are made from vegetal drugs, the processed products of medicinal species. These processed materials present a number of challenges in terms of botanical identification, and according to the World Health Organization (WHO), the use of incorrect species is a threat to consumer safety. The samples used in this study consisted of the dried leaves, flowers and roots of 257 samples from 8 distinct species approved by the WHO for the production of medicinal herbs and sold in Brazilian markets. Identification of the samples in this study using DNA barcoding (matK, rbcL and ITS2 regions) revealed that the level of substitutions may be as high as 71%. Using qualitative and quantitative chemical analyses, this study identified situations in which the correct species was being sold, but the chemical compounds were not present. Even more troubling, some samples identified as substitutions using DNA barcoding contained the chemical compounds from the correct species at the minimum required concentration. This last situation may lead to the use of unknown species or species whose safety for human consumption remains unknown. This study concludes that DNA barcoding should be used in a complementary manner for species identification with chemical analyses to detect and quantify the required chemical compounds, thus improving the quality of this class of medicines. PMID:25978064
Yang, Cheng-Hong; Wu, Kuo-Chuan; Chuang, Li-Yeh; Chang, Hsueh-Wei
2018-01-01
DNA barcode sequences are accumulating in large data sets. A barcode is generally a sequence larger than 1000 base pairs and generates a computational burden. Although the DNA barcode was originally envisioned as straightforward species tags, the identification usage of barcode sequences is rarely emphasized currently. Single-nucleotide polymorphism (SNP) association studies provide us an idea that the SNPs may be the ideal target of feature selection to discriminate between different species. We hypothesize that SNP-based barcodes may be more effective than the full length of DNA barcode sequences for species discrimination. To address this issue, we tested a r ibulose diphosphate carboxylase ( rbcL ) S NP b arcoding (RSB) strategy using a decision tree algorithm. After alignment and trimming, 31 SNPs were discovered in the rbcL sequences from 38 Brassicaceae plant species. In the decision tree construction, these SNPs were computed to set up the decision rule to assign the sequences into 2 groups level by level. After algorithm processing, 37 nodes and 31 loci were required for discriminating 38 species. Finally, the sequence tags consisting of 31 rbcL SNP barcodes were identified for discriminating 38 Brassicaceae species based on the decision tree-selected SNP pattern using RSB method. Taken together, this study provides the rational that the SNP aspect of DNA barcode for rbcL gene is a useful and effective sequence for tagging 38 Brassicaceae species.
DNA record of some traditional small millet landraces in India and Nepal.
Ragupathy, Subramanyam; Dhivya, Shanmughanandhan; Patel, Kirit; Sritharan, Abiran; Sambandan, Kathirvelu; Gartaula, Hom; Sathishkumar, Ramalingam; Khadka, Kamal; Nirmala, Balasubramanian C; Kumari, A Nirmala; Newmaster, Steven G
2016-12-01
Despite the extensive use of small millet landraces as an important source of nutrition for people living in semi-arid regions, they are presently marginalized and their diversity and distribution are threatened at a global scale. Local farmers have developed ancient breeding programs entrenched in traditional knowledge (TK) that has sustained rural cultures for thousands of years. The convention on biological diversity seeks fair and equitable sharing of genetic resources arising from local knowledge and requires signatory nations to provide appropriate policy and legal framework to farmers' rights over plant genetic resources and associated TK. DNA barcoding employed in this study is proposed as a model for conservation of genetic diversity and an essential step towards documenting and protecting farmers' rights and TK. Our study focuses on 32 landraces of small millets that are still used by indigenous farmers located in the rain fed areas of rural India and Nepal. Traditional knowledge of traits and utility was gathered using participatory methods and semi-structured interviews with key informants. DNA was extracted and sequenced (rbcL, trnH-psbA and ITS2) from 160 samples. Both multivariate analysis of traits and phylogenetic analyses were used to assess diversity among small millet landraces. Our research revealed considerable variation in traits and DNA sequences among the 32 small millet landraces. We utilized a tiered approach using ITS2 DNA barcode to make 100 % accurate landrace (32 landraces) and species (six species) assignments for all 160 blind samples in our study. We have also recorded precious TK of nutritional value, ecological and agricultural traits used by local farmers for each of these traditional landraces. This research demonstrates the potential of DNA barcoding as a reliable identification tool and for use in evaluating and conserving genetic diversity of small millets. We suggest ways in which DNA barcodes could be used in the Protection of Plant Varieties and Farmers' Rights in India and Nepal.
Sonet, Gontran; Jordaens, Kurt; Braet, Yves; Bourguignon, Luc; Dupont, Eréna; Backeljau, Thierry; De Meyer, Marc; Desmyter, Stijn
2013-01-01
Abstract Fly larvae living on dead corpses can be used to estimate post-mortem intervals. The identification of these flies is decisive in forensic casework and can be facilitated by using DNA barcodes provided that a representative and comprehensive reference library of DNA barcodes is available. We constructed a local (Belgium and France) reference library of 85 sequences of the COI DNA barcode fragment (mitochondrial cytochrome c oxidase subunit I gene), from 16 fly species of forensic interest (Calliphoridae, Muscidae, Fanniidae). This library was then used to evaluate the ability of two public libraries (GenBank and the Barcode of Life Data Systems – BOLD) to identify specimens from Belgian and French forensic cases. The public libraries indeed allow a correct identification of most specimens. Yet, some of the identifications remain ambiguous and some forensically important fly species are not, or insufficiently, represented in the reference libraries. Several search options offered by GenBank and BOLD can be used to further improve the identifications obtained from both libraries using DNA barcodes. PMID:24453564
Rapidly evolving homing CRISPR barcodes
Kalhor, Reza; Mali, Prashant; Church, George M.
2017-01-01
We present here an approach for engineering evolving DNA barcodes in living cells. The methodology entails using a homing guide RNA (hgRNA) scaffold that directs the Cas9-hgRNA complex to target the DNA locus of the hgRNA itself. We show that this homing CRISPR-Cas9 system acts as an expressed genetic barcode that diversifies its sequence and that the rate of diversification can be controlled in cultured cells. We further evaluate these barcodes in cell populations and show the barcode RNAs can be assayed as single molecules in situ . This integrated approach will have wide ranging applications, such as in deep lineage tracing, cellular barcoding, molecular recording, dissecting cancer biology, and connectome mapping. PMID:27918539
Ismail, Noor Zafirah; Arsad, Hasni; Samian, Mohammed Razip; Hamdan, Mohammad Razak; Othman, Ahmad Sofiman
2018-01-01
This study was conducted to determine the feasibility of using three plastid DNA regions ( matK , trnH - psbA , and rbcL ) as DNA barcodes to identify the medicinal plant Clinacanthus nutans . In this study, C. nutans was collected at several different locations. Total genomic DNA was extracted, amplified by polymerase chain reaction (PCR), and sequenced using matK , trnH - psbA , and rbcL , primers. DNA sequences generated from PCR were submitted to the National Center for Biotechnology Information's (NCBI) GenBank. Identification of C. nutans was carried out using NCBI's Basic Local Alignment Search Tool (BLAST). The rbcL and trnH - psbA regions successfully identified C. nutans with sequencing rates of 100% through BLAST identification. Molecular Evolutionary Genetics Analysis (MEGA) 6.0 was used to analyze interspecific and intraspecific divergence of plastid DNA sequences. rbcL and matK exhibited the lowest average interspecific distance (0.0487 and 0.0963, respectively), whereas trnH - psbA exhibited the highest average interspecific distance (0.2029). The R package Spider revealed that trnH - psbA correctly identified Barcode of Life Data System (BOLD) 96%, best close match 79%, and near neighbor 100% of the species, compared to matK (BOLD 72%; best close match 64%; near neighbor 78%) and rbcL (BOLD 77%; best close match 62%; near neighbor 88%). These results indicate that trnH - psbA is very effective at identifying C. nutans , as it performed well in discriminating species in Acanthaceae.
Sass, Chodon; Little, Damon P.; Stevenson, Dennis Wm.; Specht, Chelsea D.
2007-01-01
Barcodes are short segments of DNA that can be used to uniquely identify an unknown specimen to species, particularly when diagnostic morphological features are absent. These sequences could offer a new forensic tool in plant and animal conservation—especially for endangered species such as members of the Cycadales. Ideally, barcodes could be used to positively identify illegally obtained material even in cases where diagnostic features have been purposefully removed or to release confiscated organisms into the proper breeding population. In order to be useful, a DNA barcode sequence must not only easily PCR amplify with universal or near-universal reaction conditions and primers, but also contain enough variation to generate unique identifiers at either the species or population levels. Chloroplast regions suggested by the Plant Working Group of the Consortium for the Barcode of Life (CBoL), and two alternatives, the chloroplast psbA-trnH intergenic spacer and the nuclear ribosomal internal transcribed spacer (nrITS), were tested for their utility in generating unique identifiers for members of the Cycadales. Ease of amplification and sequence generation with universal primers and reaction conditions was determined for each of the seven proposed markers. While none of the proposed markers provided unique identifiers for all species tested, nrITS showed the most promise in terms of variability, although sequencing difficulties remain a drawback. We suggest a workflow for DNA barcoding, including database generation and management, which will ultimately be necessary if we are to succeed in establishing a universal DNA barcode for plants. PMID:17987130
DNA fingerprinting, DNA barcoding, and next generation sequencing technology in plants.
Sucher, Nikolaus J; Hennell, James R; Carles, Maria C
2012-01-01
DNA fingerprinting of plants has become an invaluable tool in forensic, scientific, and industrial laboratories all over the world. PCR has become part of virtually every variation of the plethora of approaches used for DNA fingerprinting today. DNA sequencing is increasingly used either in combination with or as a replacement for traditional DNA fingerprinting techniques. A prime example is the use of short, standardized regions of the genome as taxon barcodes for biological identification of plants. Rapid advances in "next generation sequencing" (NGS) technology are driving down the cost of sequencing and bringing large-scale sequencing projects into the reach of individual investigators. We present an overview of recent publications that demonstrate the use of "NGS" technology for DNA fingerprinting and DNA barcoding applications.
DNA Barcoding in Fragaria L. (Strawberry) Species
USDA-ARS?s Scientific Manuscript database
DNA barcoding for species identification using a short DNA sequence has been successful in animals due to rapid mutation rates of the mitochondrial genome where the animal DNA barocode, cytochrome c oxidase 1 gene is located. The chloroplast PsbA-trnH spacer and the nuclear ribosomal internal transc...
Benefits and Limitations of DNA Barcoding and Metabarcoding in Herbal Product Authentication.
Raclariu, Ancuta Cristina; Heinrich, Michael; Ichim, Mihael Cristin; de Boer, Hugo
2018-03-01
Herbal medicines play an important role globally in the health care sector and in industrialised countries they are often considered as an alternative to mono-substance medicines. Current quality and authentication assessment methods rely mainly on morphology and analytical phytochemistry-based methods detailed in pharmacopoeias. Herbal products however are often highly processed with numerous ingredients, and even if these analytical methods are accurate for quality control of specific lead or marker compounds, they are of limited suitability for the authentication of biological ingredients. To review the benefits and limitations of DNA barcoding and metabarcoding in complementing current herbal product authentication. Recent literature relating to DNA based authentication of medicinal plants, herbal medicines and products are summarised to provide a basic understanding of how DNA barcoding and metabarcoding can be applied to this field. Different methods of quality control and authentication have varying resolution and usefulness along the value chain of these products. DNA barcoding can be used for authenticating products based on single herbal ingredients and DNA metabarcoding for assessment of species diversity in processed products, and both methods should be used in combination with appropriate hyphenated chemical methods for quality control. DNA barcoding and metabarcoding have potential in the context of quality control of both well and poorly regulated supply systems. Standardisation of protocols for DNA barcoding and DNA sequence-based identification are necessary before DNA-based biological methods can be implemented as routine analytical approaches and approved by the competent authorities for use in regulated procedures. © 2017 The Authors. Phytochemical Analysis Published by John Wiley & Sons Ltd. © 2017 The Authors. Phytochemical Analysis Published by John Wiley & Sons Ltd.
Pitfalls of Establishing DNA Barcoding Systems in Protists: The Cryptophyceae as a Test Case
Hoef-Emden, Kerstin
2012-01-01
A DNA barcode is a preferrably short and highly variable region of DNA supposed to facilitate a rapid identification of species. In many protistan lineages, a lack of species-specific morphological characters hampers an identification of species by light or electron microscopy, and difficulties to perform mating experiments in laboratory cultures also do not allow for an identification of biological species. Thus, testing candidate barcode markers as well as establishment of accurately working species identification systems are more challenging than in multicellular organisms. In cryptic species complexes the performance of a potential barcode marker can not be monitored using morphological characters as a feedback, but an inappropriate choice of DNA region may result in artifactual species trees for several reasons. Therefore a priori knowledge of the systematics of a group is required. In addition to identification of known species, methods for an automatic delimitation of species with DNA barcodes have been proposed. The Cryptophyceae provide a mixture of systematically well characterized as well as badly characterized groups and are used in this study to test the suitability of some of the methods for protists. As species identification method the performance of blast in searches against badly to well-sampled reference databases has been tested with COI-5P and 5′-partial LSU rDNA (domains A to D of the nuclear LSU rRNA gene). In addition the performance of two different methods for automatic species delimitation, fixed thresholds of genetic divergence and the general mixed Yule-coalescent model (GMYC), have been examined. The study demonstrates some pitfalls of barcoding methods that have to be taken care of. Also a best-practice approach towards establishing a DNA barcode system in protists is proposed. PMID:22970104
Pitfalls of establishing DNA barcoding systems in protists: the cryptophyceae as a test case.
Hoef-Emden, Kerstin
2012-01-01
A DNA barcode is a preferrably short and highly variable region of DNA supposed to facilitate a rapid identification of species. In many protistan lineages, a lack of species-specific morphological characters hampers an identification of species by light or electron microscopy, and difficulties to perform mating experiments in laboratory cultures also do not allow for an identification of biological species. Thus, testing candidate barcode markers as well as establishment of accurately working species identification systems are more challenging than in multicellular organisms. In cryptic species complexes the performance of a potential barcode marker can not be monitored using morphological characters as a feedback, but an inappropriate choice of DNA region may result in artifactual species trees for several reasons. Therefore a priori knowledge of the systematics of a group is required. In addition to identification of known species, methods for an automatic delimitation of species with DNA barcodes have been proposed. The Cryptophyceae provide a mixture of systematically well characterized as well as badly characterized groups and are used in this study to test the suitability of some of the methods for protists. As species identification method the performance of blast in searches against badly to well-sampled reference databases has been tested with COI-5P and 5'-partial LSU rDNA (domains A to D of the nuclear LSU rRNA gene). In addition the performance of two different methods for automatic species delimitation, fixed thresholds of genetic divergence and the general mixed Yule-coalescent model (GMYC), have been examined. The study demonstrates some pitfalls of barcoding methods that have to be taken care of. Also a best-practice approach towards establishing a DNA barcode system in protists is proposed.
DNA Barcoding of Recently Diverged Species: Relative Performance of Matching Methods
van Velzen, Robin; Weitschek, Emanuel; Felici, Giovanni; Bakker, Freek T.
2012-01-01
Recently diverged species are challenging for identification, yet they are frequently of special interest scientifically as well as from a regulatory perspective. DNA barcoding has proven instrumental in species identification, especially in insects and vertebrates, but for the identification of recently diverged species it has been reported to be problematic in some cases. Problems are mostly due to incomplete lineage sorting or simply lack of a ‘barcode gap’ and probably related to large effective population size and/or low mutation rate. Our objective was to compare six methods in their ability to correctly identify recently diverged species with DNA barcodes: neighbor joining and parsimony (both tree-based), nearest neighbor and BLAST (similarity-based), and the diagnostic methods DNA-BAR, and BLOG. We analyzed simulated data assuming three different effective population sizes as well as three selected empirical data sets from published studies. Results show, as expected, that success rates are significantly lower for recently diverged species (∼75%) than for older species (∼97%) (P<0.00001). Similarity-based and diagnostic methods significantly outperform tree-based methods, when applied to simulated DNA barcode data (P<0.00001). The diagnostic method BLOG had highest correct query identification rate based on simulated (86.2%) as well as empirical data (93.1%), indicating that it is a consistently better method overall. Another advantage of BLOG is that it offers species-level information that can be used outside the realm of DNA barcoding, for instance in species description or molecular detection assays. Even though we can confirm that identification success based on DNA barcoding is generally high in our data, recently diverged species remain difficult to identify. Nevertheless, our results contribute to improved solutions for their accurate identification. PMID:22272356
DNA barcoding of recently diverged species: relative performance of matching methods.
van Velzen, Robin; Weitschek, Emanuel; Felici, Giovanni; Bakker, Freek T
2012-01-01
Recently diverged species are challenging for identification, yet they are frequently of special interest scientifically as well as from a regulatory perspective. DNA barcoding has proven instrumental in species identification, especially in insects and vertebrates, but for the identification of recently diverged species it has been reported to be problematic in some cases. Problems are mostly due to incomplete lineage sorting or simply lack of a 'barcode gap' and probably related to large effective population size and/or low mutation rate. Our objective was to compare six methods in their ability to correctly identify recently diverged species with DNA barcodes: neighbor joining and parsimony (both tree-based), nearest neighbor and BLAST (similarity-based), and the diagnostic methods DNA-BAR, and BLOG. We analyzed simulated data assuming three different effective population sizes as well as three selected empirical data sets from published studies. Results show, as expected, that success rates are significantly lower for recently diverged species (∼75%) than for older species (∼97%) (P<0.00001). Similarity-based and diagnostic methods significantly outperform tree-based methods, when applied to simulated DNA barcode data (P<0.00001). The diagnostic method BLOG had highest correct query identification rate based on simulated (86.2%) as well as empirical data (93.1%), indicating that it is a consistently better method overall. Another advantage of BLOG is that it offers species-level information that can be used outside the realm of DNA barcoding, for instance in species description or molecular detection assays. Even though we can confirm that identification success based on DNA barcoding is generally high in our data, recently diverged species remain difficult to identify. Nevertheless, our results contribute to improved solutions for their accurate identification.
Multiplexing clonality: combining RGB marking and genetic barcoding
Cornils, Kerstin; Thielecke, Lars; Hüser, Svenja; Forgber, Michael; Thomaschewski, Michael; Kleist, Nadja; Hussein, Kais; Riecken, Kristoffer; Volz, Tassilo; Gerdes, Sebastian; Glauche, Ingmar; Dahl, Andreas; Dandri, Maura; Roeder, Ingo; Fehse, Boris
2014-01-01
RGB marking and DNA barcoding are two cutting-edge technologies in the field of clonal cell marking. To combine the virtues of both approaches, we equipped LeGO vectors encoding red, green or blue fluorescent proteins with complex DNA barcodes carrying color-specific signatures. For these vectors, we generated highly complex plasmid libraries that were used for the production of barcoded lentiviral vector particles. In proof-of-principle experiments, we used barcoded vectors for RGB marking of cell lines and primary murine hepatocytes. We applied single-cell polymerase chain reaction to decipher barcode signatures of individual RGB-marked cells expressing defined color hues. This enabled us to prove clonal identity of cells with one and the same RGB color. Also, we made use of barcoded vectors to investigate clonal development of leukemia induced by ectopic oncogene expression in murine hematopoietic cells. In conclusion, by combining RGB marking and DNA barcoding, we have established a novel technique for the unambiguous genetic marking of individual cells in the context of normal regeneration as well as malignant outgrowth. Moreover, the introduction of color-specific signatures in barcodes will facilitate studies on the impact of different variables (e.g. vector type, transgenes, culture conditions) in the context of competitive repopulation studies. PMID:24476916
Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.
Françoso, E; Arias, M C
2013-09-01
Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.
Borges, Luísa M. S.; Hollatz, Claudia; Lobo, Jorge; Cunha, Ana M.; Vilela, Ana P.; Calado, Gonçalo; Coelho, Rita; Costa, Ana C.; Ferreira, Maria S. G.; Costa, Maria H.; Costa, Filipe O.
2016-01-01
The Gastropoda is one of the best studied classes of marine invertebrates. Yet, most species have been delimited based on morphology only. The application of DNA barcodes has shown to be greatly useful to help delimiting species. Therefore, sequences of the cytochrome c oxidase I gene from 108 specimens of 34 morpho-species were used to investigate the molecular diversity within the gastropods from the Portuguese coast. To the above dataset, we added available COI-5P sequences of taxonomically close species, in a total of 58 morpho-species examined. There was a good match between ours and sequences from independent studies, in public repositories. We found 32 concordant (91.4%) out of the 35 Barcode Index Numbers (BINs) generated from our sequences. The application of a ranking system to the barcodes yield over 70% with top taxonomic congruence, while 14.2% of the species barcodes had insufficient data. In the majority of the cases, there was a good concordance between morphological identification and DNA barcodes. Nonetheless, the discordance between morphological and molecular data is a reminder that even the comparatively well-known European marine gastropods can benefit from being probed using the DNA barcode approach. Discordant cases should be reviewed with more integrative studies. PMID:26876495
Borges, Luísa M S; Hollatz, Claudia; Lobo, Jorge; Cunha, Ana M; Vilela, Ana P; Calado, Gonçalo; Coelho, Rita; Costa, Ana C; Ferreira, Maria S G; Costa, Maria H; Costa, Filipe O
2016-02-15
The Gastropoda is one of the best studied classes of marine invertebrates. Yet, most species have been delimited based on morphology only. The application of DNA barcodes has shown to be greatly useful to help delimiting species. Therefore, sequences of the cytochrome c oxidase I gene from 108 specimens of 34 morpho-species were used to investigate the molecular diversity within the gastropods from the Portuguese coast. To the above dataset, we added available COI-5P sequences of taxonomically close species, in a total of 58 morpho-species examined. There was a good match between ours and sequences from independent studies, in public repositories. We found 32 concordant (91.4%) out of the 35 Barcode Index Numbers (BINs) generated from our sequences. The application of a ranking system to the barcodes yield over 70% with top taxonomic congruence, while 14.2% of the species barcodes had insufficient data. In the majority of the cases, there was a good concordance between morphological identification and DNA barcodes. Nonetheless, the discordance between morphological and molecular data is a reminder that even the comparatively well-known European marine gastropods can benefit from being probed using the DNA barcode approach. Discordant cases should be reviewed with more integrative studies.
Ekrem, Torbjørn; Stur, Elisabeth
2017-01-01
Abstract Chironomidae (Diptera) pupal exuviae samples are commonly used for biological monitoring of aquatic habitats. DNA barcoding has proved useful for species identification of chironomid life stages containing cellular tissue, but the barcoding success of chironomid pupal exuviae is unknown. We assessed whether standard DNA barcoding could be efficiently used for species identification of chironomid pupal exuviae when compared with morphological techniques and if there were differences in performance between temperate and tropical ecosystems, subfamilies, and tribes. PCR, sequence, and identification success differed significantly between geographic regions and taxonomic groups. For Norway, 27 out of 190 (14.2%) of pupal exuviae resulted in high-quality chironomid sequences that match species. For Costa Rica, 69 out of 190 (36.3%) Costa Rican pupal exuviae resulted in high-quality sequences, but none matched known species. Standard DNA barcoding of chironomid pupal exuviae had limited success in species identification of unknown specimens due to contaminations and lack of matching references in available barcode libraries, especially from Costa Rica. Therefore, we recommend future biodiversity studies that focus their efforts on understudied regions, to simultaneously use morphological and molecular identification techniques to identify all life stages of chironomids and populate the barcode reference library with identified sequences.
Lee, Ping-Shin; Sing, Kong-Wah; Wilson, John-James
2015-01-01
Most tropical mammal species are threatened or data-deficient. Data collection is impeded by the traditional monitoring approaches which can be laborious, expensive and struggle to detect cryptic diversity. Monitoring approaches using mammal DNA derived from invertebrates are emerging as cost- and time-effective alternatives. As a step towards development of blowfly-derived DNA as an effective method for mammal monitoring in the biodiversity hotspot of Peninsular Malaysia, our objectives were (i) to determine the persistence period of amplifiable mammal mtDNA in blowfly guts through a laboratory feeding experiment (ii) to design and test primers that can selectively amplify mammal COI DNA mini-barcodes in the presence of high concentrations of blowfly DNA. The persistence period of amplifiable mammal mtDNA in blowfly guts was 24 h to 96 h post-feeding indicating the need for collecting flies within 24 h of capture to detect mammal mtDNA of sufficient quantity and quality. We designed a new primer combination for a COI DNA mini-barcode that did not amplify blowfly DNA and showed 89% amplification success for a dataset of mammals from Peninsular Malaysia. The short (205 bp) DNA mini-barcode could distinguish most mammal species (including separating dark taxa) and is of suitable length for high-throughput sequencing. Our new DNA mini-barcode target and a standardized trapping protocol with retrieval of blowflies every 24 h could point the way forward in the development of blowfly-derived DNA as an effective method for mammal monitoring.
Lee, Ping-Shin; Sing, Kong-Wah; Wilson, John-James
2015-01-01
Most tropical mammal species are threatened or data-deficient. Data collection is impeded by the traditional monitoring approaches which can be laborious, expensive and struggle to detect cryptic diversity. Monitoring approaches using mammal DNA derived from invertebrates are emerging as cost- and time-effective alternatives. As a step towards development of blowfly-derived DNA as an effective method for mammal monitoring in the biodiversity hotspot of Peninsular Malaysia, our objectives were (i) to determine the persistence period of amplifiable mammal mtDNA in blowfly guts through a laboratory feeding experiment (ii) to design and test primers that can selectively amplify mammal COI DNA mini-barcodes in the presence of high concentrations of blowfly DNA. The persistence period of amplifiable mammal mtDNA in blowfly guts was 24 h to 96 h post-feeding indicating the need for collecting flies within 24 h of capture to detect mammal mtDNA of sufficient quantity and quality. We designed a new primer combination for a COI DNA mini-barcode that did not amplify blowfly DNA and showed 89% amplification success for a dataset of mammals from Peninsular Malaysia. The short (205 bp) DNA mini-barcode could distinguish most mammal species (including separating dark taxa) and is of suitable length for high-throughput sequencing. Our new DNA mini-barcode target and a standardized trapping protocol with retrieval of blowflies every 24 h could point the way forward in the development of blowfly-derived DNA as an effective method for mammal monitoring. PMID:25898278
Kim, Sungmin; Song, Kyo-Hong; Ree, Han-Il; Kim, Won
2012-01-01
Non-biting midges (Diptera: Chironomidae) are a diverse population that commonly causes respiratory allergies in humans. Chironomid larvae can be used to indicate freshwater pollution, but accurate identification on the basis of morphological characteristics is difficult. In this study, we constructed a mitochondrial cytochrome c oxidase subunit I (COI)-based DNA barcode library for Korean chironomids. This library consists of 211 specimens from 49 species, including adults and unidentified larvae. The interspecies and intraspecies COI sequence variations were analyzed. Sophisticated indexes were developed in order to properly evaluate indistinct barcode gaps that are created by insufficient sampling on both the interspecies and intraspecies levels and by variable mutation rates across taxa. In a variety of insect datasets, these indexes were useful for re-evaluating large barcode datasets and for defining COI barcode gaps. The COI-based DNA barcode library will provide a rapid and reliable tool for the molecular identification of Korean chironomid species. Furthermore, this reverse-taxonomic approach will be improved by the continuous addition of other speceis’ sequences to the library. PMID:22138764
Land plants and DNA barcodes: short-term and long-term goals.
Chase, Mark W; Salamin, Nicolas; Wilkinson, Mike; Dunwell, James M; Kesanakurthi, Rao Prasad; Haider, Nadia; Haidar, Nadia; Savolainen, Vincent
2005-10-29
Land plants have had the reputation of being problematic for DNA barcoding for two general reasons: (i) the standard DNA regions used in algae, animals and fungi have exceedingly low levels of variability and (ii) the typically used land plant plastid phylogenetic markers (e.g. rbcL, trnL-F, etc.) appear to have too little variation. However, no one has assessed how well current phylogenetic resources might work in the context of identification (versus phylogeny reconstruction). In this paper, we make such an assessment, particularly with two of the markers commonly sequenced in land plant phylogenetic studies, plastid rbcL and internal transcribed spacers of the large subunits of nuclear ribosomal DNA (ITS), and find that both of these DNA regions perform well even though the data currently available in GenBank/EBI were not produced to be used as barcodes and BLAST searches are not an ideal tool for this purpose. These results bode well for the use of even more variable regions of plastid DNA (such as, for example, psbA-trnH) as barcodes, once they have been widely sequenced. In the short term, efforts to bring land plant barcoding up to the standards being used now in other organisms should make swift progress. There are two categories of DNA barcode users, scientists in fields other than taxonomy and taxonomists. For the former, the use of mitochondrial and plastid DNA, the two most easily assessed genomes, is at least in the short term a useful tool that permits them to get on with their studies, which depend on knowing roughly which species or species groups they are dealing with, but these same DNA regions have important drawbacks for use in taxonomic studies (i.e. studies designed to elucidate species limits). For these purposes, DNA markers from uniparentally (usually maternally) inherited genomes can only provide half of the story required to improve taxonomic standards being used in DNA barcoding. In the long term, we will need to develop more sophisticated barcoding tools, which would be multiple, low-copy nuclear markers with sufficient genetic variability and PCR-reliability; these would permit the detection of hybrids and permit researchers to identify the 'genetic gaps' that are useful in assessing species limits.
Land plants and DNA barcodes: short-term and long-term goals
Chase, Mark W; Salamin, Nicolas; Wilkinson, Mike; Dunwell, James M; Kesanakurthi, Rao Prasad; Haidar, Nadia; Savolainen, Vincent
2005-01-01
Land plants have had the reputation of being problematic for DNA barcoding for two general reasons: (i) the standard DNA regions used in algae, animals and fungi have exceedingly low levels of variability and (ii) the typically used land plant plastid phylogenetic markers (e.g. rbcL, trnL-F, etc.) appear to have too little variation. However, no one has assessed how well current phylogenetic resources might work in the context of identification (versus phylogeny reconstruction). In this paper, we make such an assessment, particularly with two of the markers commonly sequenced in land plant phylogenetic studies, plastid rbcL and internal transcribed spacers of the large subunits of nuclear ribosomal DNA (ITS), and find that both of these DNA regions perform well even though the data currently available in GenBank/EBI were not produced to be used as barcodes and BLAST searches are not an ideal tool for this purpose. These results bode well for the use of even more variable regions of plastid DNA (such as, for example, psbA-trnH) as barcodes, once they have been widely sequenced. In the short term, efforts to bring land plant barcoding up to the standards being used now in other organisms should make swift progress. There are two categories of DNA barcode users, scientists in fields other than taxonomy and taxonomists. For the former, the use of mitochondrial and plastid DNA, the two most easily assessed genomes, is at least in the short term a useful tool that permits them to get on with their studies, which depend on knowing roughly which species or species groups they are dealing with, but these same DNA regions have important drawbacks for use in taxonomic studies (i.e. studies designed to elucidate species limits). For these purposes, DNA markers from uniparentally (usually maternally) inherited genomes can only provide half of the story required to improve taxonomic standards being used in DNA barcoding. In the long term, we will need to develop more sophisticated barcoding tools, which would be multiple, low-copy nuclear markers with sufficient genetic variability and PCR-reliability; these would permit the detection of hybrids and permit researchers to identify the ‘genetic gaps’ that are useful in assessing species limits. PMID:16214746
Kuzmina, Maria L; Braukmann, Thomas W A; Fazekas, Aron J; Graham, Sean W; Dewaard, Stephanie L; Rodrigues, Anuar; Bennett, Bruce A; Dickinson, Timothy A; Saarela, Jeffery M; Catling, Paul M; Newmaster, Steven G; Percy, Diana M; Fenneman, Erin; Lauron-Moreau, Aurélien; Ford, Bruce; Gillespie, Lynn; Subramanyam, Ragupathy; Whitton, Jeannette; Jennings, Linda; Metsger, Deborah; Warne, Connor P; Brown, Allison; Sears, Elizabeth; Dewaard, Jeremy R; Zakharov, Evgeny V; Hebert, Paul D N
2017-12-01
Constructing complete, accurate plant DNA barcode reference libraries can be logistically challenging for large-scale floras. Here we demonstrate the promise and challenges of using herbarium collections for building a DNA barcode reference library for the vascular plant flora of Canada. Our study examined 20,816 specimens representing 5076 of 5190 vascular plant species in Canada (98%). For 98% of the specimens, at least one of the DNA barcode regions was recovered from the plastid loci rbcL and matK and from the nuclear ITS2 region. We used beta regression to quantify the effects of age, type of preservation, and taxonomic affiliation (family) on DNA sequence recovery. Specimen age and method of preservation had significant effects on sequence recovery for all markers, but influenced some families more (e.g., Boraginaceae) than others (e.g., Asteraceae). Our DNA barcode library represents an unparalleled resource for metagenomic and ecological genetic research working on temperate and arctic biomes. An observed decline in sequence recovery with specimen age may be associated with poor primer matches, intragenomic variation (for ITS2), or inhibitory secondary compounds in some taxa.
Kuzmina, Maria L.; Braukmann, Thomas W. A.; Fazekas, Aron J.; Graham, Sean W.; Dewaard, Stephanie L.; Rodrigues, Anuar; Bennett, Bruce A.; Dickinson, Timothy A.; Saarela, Jeffery M.; Catling, Paul M.; Newmaster, Steven G.; Percy, Diana M.; Fenneman, Erin; Lauron-Moreau, Aurélien; Ford, Bruce; Gillespie, Lynn; Subramanyam, Ragupathy; Whitton, Jeannette; Jennings, Linda; Metsger, Deborah; Warne, Connor P.; Brown, Allison; Sears, Elizabeth; Dewaard, Jeremy R.; Zakharov, Evgeny V.; Hebert, Paul D. N.
2017-01-01
Premise of the study: Constructing complete, accurate plant DNA barcode reference libraries can be logistically challenging for large-scale floras. Here we demonstrate the promise and challenges of using herbarium collections for building a DNA barcode reference library for the vascular plant flora of Canada. Methods: Our study examined 20,816 specimens representing 5076 of 5190 vascular plant species in Canada (98%). For 98% of the specimens, at least one of the DNA barcode regions was recovered from the plastid loci rbcL and matK and from the nuclear ITS2 region. We used beta regression to quantify the effects of age, type of preservation, and taxonomic affiliation (family) on DNA sequence recovery. Results: Specimen age and method of preservation had significant effects on sequence recovery for all markers, but influenced some families more (e.g., Boraginaceae) than others (e.g., Asteraceae). Discussion: Our DNA barcode library represents an unparalleled resource for metagenomic and ecological genetic research working on temperate and arctic biomes. An observed decline in sequence recovery with specimen age may be associated with poor primer matches, intragenomic variation (for ITS2), or inhibitory secondary compounds in some taxa. PMID:29299394
FBIS: A regional DNA barcode archival & analysis system for Indian fishes
Nagpure, Naresh Sahebrao; Rashid, Iliyas; Pathak, Ajey Kumar; Singh, Mahender; Singh, Shri Prakash; Sarkar, Uttam Kumar
2012-01-01
DNA barcode is a new tool for taxon recognition and classification of biological organisms based on sequence of a fragment of mitochondrial gene, cytochrome c oxidase I (COI). In view of the growing importance of the fish DNA barcoding for species identification, molecular taxonomy and fish diversity conservation, we developed a Fish Barcode Information System (FBIS) for Indian fishes, which will serve as a regional DNA barcode archival and analysis system. The database presently contains 2334 sequence records of COI gene for 472 aquatic species belonging to 39 orders and 136 families, collected from available published data sources. Additionally, it contains information on phenotype, distribution and IUCN Red List status of fishes. The web version of FBIS was designed using MySQL, Perl and PHP under Linux operating platform to (a) store and manage the acquisition (b) analyze and explore DNA barcode records (c) identify species and estimate genetic divergence. FBIS has also been integrated with appropriate tools for retrieving and viewing information about the database statistics and taxonomy. It is expected that FBIS would be useful as a potent information system in fish molecular taxonomy, phylogeny and genomics. Availability The database is available for free at http://mail.nbfgr.res.in/fbis/ PMID:22715304
Reading the Complex Skipper Butterfly Fauna of One Tropical Place
Janzen, Daniel H.; Hallwachs, Winnie; Burns, John M.; Hajibabaei, Mehrdad; Bertrand, Claudia; Hebert, Paul D. N.
2011-01-01
Background An intense, 30-year, ongoing biodiversity inventory of Lepidoptera, together with their food plants and parasitoids, is centered on the rearing of wild-caught caterpillars in the 120,000 terrestrial hectares of dry, rain, and cloud forest of Area de Conservacion Guanacaste (ACG) in northwestern Costa Rica. Since 2003, DNA barcoding of all species has aided their identification and discovery. We summarize the process and results for a large set of the species of two speciose subfamilies of ACG skipper butterflies (Hesperiidae) and emphasize the effectiveness of barcoding these species (which are often difficult and time-consuming to identify). Methodology/Principal Findings Adults are DNA barcoded by the Biodiversity Institute of Ontario, Guelph, Canada; and they are identified by correlating the resulting COI barcode information with more traditional information such as food plant, facies, genitalia, microlocation within ACG, caterpillar traits, etc. This process has found about 303 morphologically defined species of eudamine and pyrgine Hesperiidae breeding in ACG (about 25% of the ACG butterfly fauna) and another 44 units indicated by distinct barcodes (n = 9,094), which may be additional species and therefore may represent as much as a 13% increase. All but the members of one complex can be identified by their DNA barcodes. Conclusions/Significance Addition of DNA barcoding to the methodology greatly improved the inventory, both through faster (hence cheaper) accurate identification of the species that are distinguishable without barcoding, as well as those that require it, and through the revelation of species “hidden” within what have long been viewed as single species. Barcoding increased the recognition of species-level specialization. It would be no more appropriate to ignore barcode data in a species inventory than it would be to ignore adult genitalia variation or caterpillar ecology. PMID:21857895
Clerc-Blain, Jessica L E; Starr, Julian R; Bull, Roger D; Saarela, Jeffery M
2010-01-01
Previous research on barcoding sedges (Carex) suggested that basic searches within a global barcoding database would probably not resolve more than 60% of the world's some 2000 species. In this study, we take an alternative approach and explore the performance of plant DNA barcoding in the Carex lineage from an explicitly regional perspective. We characterize the utility of a subset of the proposed protein-coding and noncoding plastid barcoding regions (matK, rpoB, rpoC1, rbcL, atpF-atpH, psbK-psbI) for distinguishing species of Carex and Kobresia in the Canadian Arctic Archipelago, a clearly defined eco-geographical region representing 1% of the Earth's landmass. Our results show that matK resolves the greatest number of species of any single-locus (95%), and when combined in a two-locus barcode, it provides 100% species resolution in all but one combination (matK + atpFH) during unweighted pair-group method with arithmetic mean averages (UPGMA) analyses. Noncoding regions were equally or more variable than matK, but as single markers they resolve substantially fewer taxa than matK alone. When difficulties with sequencing and alignment due to microstructural variation in noncoding regions are also considered, our results support other studies in suggesting that protein-coding regions are more practical as barcoding markers. Plastid DNA barcodes are an effective identification tool for species of Carex and Kobresia in the Canadian Arctic Archipelago, a region where the number of co-existing closely related species is limited. We suggest that if a regional approach to plant DNA barcoding was applied on a global scale, it could provide a solution to the generally poor species resolution seen in previous barcoding studies. © 2009 Blackwell Publishing Ltd.
Al-Rshaidat, Mamoon M D; Snider, Allison; Rosebraugh, Sydney; Devine, Amanda M; Devine, Thomas D; Plaisance, Laetitia; Knowlton, Nancy; Leray, Matthieu
2016-09-01
High-throughput sequencing (HTS) of DNA barcodes (metabarcoding), particularly when combined with standardized sampling protocols, is one of the most promising approaches for censusing overlooked cryptic invertebrate communities. We present biodiversity estimates based on sequencing of the cytochrome c oxidase subunit 1 (COI) gene for coral reefs of the Gulf of Aqaba, a semi-enclosed system in the northern Red Sea. Samples were obtained from standardized sampling devices (Autonomous Reef Monitoring Structures (ARMS)) deployed for 18 months. DNA barcoding of non-sessile specimens >2 mm revealed 83 OTUs in six phyla, of which only 25% matched a reference sequence in public databases. Metabarcoding of the 2 mm - 500 μm and sessile bulk fractions revealed 1197 OTUs in 15 animal phyla, of which only 4.9% matched reference barcodes. These results highlight the scarcity of COI data for cryptobenthic organisms of the Red Sea. Compared with data obtained using similar methods, our results suggest that Gulf of Aqaba reefs are less diverse than two Pacific coral reefs but much more diverse than an Atlantic oyster reef at a similar latitude. The standardized approaches used here show promise for establishing baseline data on biodiversity, monitoring the impacts of environmental change, and quantifying patterns of diversity at regional and global scales.
Arculeo, Marco; Bonello, Juan J.; Bonnici, Leanne; Cannas, Rita; Carbonara, Pierluigi; Cau, Alessandro; Charilaou, Charis; El Ouamari, Najib; Fiorentino, Fabio; Follesa, Maria Cristina; Garofalo, Germana; Golani, Daniel; Guarniero, Ilaria; Hanner, Robert; Hemida, Farid; Kada, Omar; Lo Brutto, Sabrina; Mancusi, Cecilia; Morey, Gabriel; Schembri, Patrick J.; Serena, Fabrizio; Sion, Letizia; Stagioni, Marco; Tursi, Angelo; Vrgoc, Nedo; Steinke, Dirk; Tinti, Fausto
2017-01-01
Cartilaginous fish are particularly vulnerable to anthropogenic stressors and environmental change because of their K-selected reproductive strategy. Accurate data from scientific surveys and landings are essential to assess conservation status and to develop robust protection and management plans. Currently available data are often incomplete or incorrect as a result of inaccurate species identifications, due to a high level of morphological stasis, especially among closely related taxa. Moreover, several diagnostic characters clearly visible in adult specimens are less evident in juveniles. Here we present results generated by the ELASMOMED Consortium, a regional network aiming to sample and DNA-barcode the Mediterranean Chondrichthyans with the ultimate goal to provide a comprehensive DNA barcode reference library. This library will support and improve the molecular taxonomy of this group and the effectiveness of management and conservation measures. We successfully barcoded 882 individuals belonging to 42 species (17 sharks, 24 batoids and one chimaera), including four endemic and several threatened ones. Morphological misidentifications were found across most orders, further confirming the need for a comprehensive DNA barcoding library as a valuable tool for the reliable identification of specimens in support of taxonomist who are reviewing current identification keys. Despite low intraspecific variation among their barcode sequences and reduced samples size, five species showed preliminary evidence of phylogeographic structure. Overall, the ELASMOMED initiative further emphasizes the key role accurate DNA barcoding libraries play in establishing reliable diagnostic species specific features in otherwise taxonomically problematic groups for biodiversity management and conservation actions. PMID:28107413
Molecular Approach to the Identification of Fish in the South China Sea
Zhang, Junbin; Hanner, Robert
2012-01-01
Background DNA barcoding is one means of establishing a rapid, accurate, and cost-effective system for the identification of species. It involves the use of short, standard gene targets to create sequence profiles of known species against sequences of unknowns that can be matched and subsequently identified. The Fish Barcode of Life (FISH-BOL) campaign has the primary goal of gathering DNA barcode records for all the world's fish species. As a contribution to FISH-BOL, we examined the degree to which DNA barcoding can discriminate marine fishes from the South China Sea. Methodology/Principal Findings DNA barcodes of cytochrome oxidase subunit I (COI) were characterized using 1336 specimens that belong to 242 species fishes from the South China Sea. All specimen provenance data (including digital specimen images and geospatial coordinates of collection localities) and collateral sequence information were assembled using Barcode of Life Data System (BOLD; www.barcodinglife.org). Small intraspecific and large interspecific differences create distinct genetic boundaries among most species. In addition, the efficiency of two mitochondrial genes, 16S rRNA (16S) and cytochrome b (cytb), and one nuclear ribosomal gene, 18S rRNA (18S), was also evaluated for a few select groups of species. Conclusions/Significance The present study provides evidence for the effectiveness of DNA barcoding as a tool for monitoring marine biodiversity. Open access data of fishes from the South China Sea can benefit relative applications in ecology and taxonomy. PMID:22363454
Benefits and Limitations of DNA Barcoding and Metabarcoding in Herbal Product Authentication
Raclariu, Ancuta Cristina; Heinrich, Michael; Ichim, Mihael Cristin
2017-01-01
Abstract Introduction Herbal medicines play an important role globally in the health care sector and in industrialised countries they are often considered as an alternative to mono‐substance medicines. Current quality and authentication assessment methods rely mainly on morphology and analytical phytochemistry‐based methods detailed in pharmacopoeias. Herbal products however are often highly processed with numerous ingredients, and even if these analytical methods are accurate for quality control of specific lead or marker compounds, they are of limited suitability for the authentication of biological ingredients. Objective To review the benefits and limitations of DNA barcoding and metabarcoding in complementing current herbal product authentication. Method Recent literature relating to DNA based authentication of medicinal plants, herbal medicines and products are summarised to provide a basic understanding of how DNA barcoding and metabarcoding can be applied to this field. Results Different methods of quality control and authentication have varying resolution and usefulness along the value chain of these products. DNA barcoding can be used for authenticating products based on single herbal ingredients and DNA metabarcoding for assessment of species diversity in processed products, and both methods should be used in combination with appropriate hyphenated chemical methods for quality control. Conclusions DNA barcoding and metabarcoding have potential in the context of quality control of both well and poorly regulated supply systems. Standardisation of protocols for DNA barcoding and DNA sequence‐based identification are necessary before DNA‐based biological methods can be implemented as routine analytical approaches and approved by the competent authorities for use in regulated procedures. © 2017 The Authors. Phytochemical Analysis Published by John Wiley & Sons Ltd. PMID:28906059
Zhu, Debin; Tang, Yabing; Xing, Da; Chen, Wei R.
2018-01-01
Bio-barcode assay based on oligonucleotide-modified gold nanoparticles (Au-NPs) provides a PCR-free method for quantitative detection of nucleic acid targets. However, the current bio-barcode assay requires lengthy experimental procedures including the preparation and release of barcode DNA probes from the target-nanoparticle complex, and immobilization and hybridization of the probes for quantification. Herein, we report a novel PCR-free electrochemiluminescence (ECL)-based bio-barcode assay for the quantitative detection of genetically modified organism (GMO) from raw materials. It consists of tris-(2’2’-bipyridyl) ruthenium (TBR)-labele barcode DNA, nucleic acid hybridization using Au-NPs and biotin-labeled probes, and selective capture of the hybridization complex by streptavidin-coated paramagnetic beads. The detection of target DNA is realized by direct measurement of ECL emission of TBR. It can quantitatively detect target nucleic acids with high speed and sensitivity. This method can be used to quantitatively detect GMO fragments from real GMO products. PMID:18386909
Havemann, Nadine; Gossner, Martin M.; Hendrich, Lars; Morinière, Jèrôme; Niedringhaus, Rolf; Schäfer, Peter
2018-01-01
With about 5,000 species worldwide, the Heteroptera or true bugs are the most diverse taxon among the hemimetabolous insects in aquatic and semi-aquatic ecosystems. Species may be found in almost every freshwater environment and have very specific habitat requirements, making them excellent bioindicator organisms for water quality. However, a correct determination by morphology is challenging in many species groups due to high morphological variability and polymorphisms within, but low variability between species. Furthermore, it is very difficult or even impossible to identify the immature life stages or females of some species, e.g., of the corixid genus Sigara. In this study we tested the effectiveness of a DNA barcode library to discriminate species of the Gerromorpha and Nepomorpha of Germany. We analyzed about 700 specimens of 67 species, with 63 species sampled in Germany, covering more than 90% of all recorded species. Our library included various morphological similar taxa, e.g., species within the genera Sigara and Notonecta as well as water striders of the genus Gerris. Fifty-five species (82%) were unambiguously assigned to a single Barcode Index Number (BIN) by their barcode sequences, whereas BIN sharing was observed for 10 species. Furthermore, we found monophyletic lineages for 52 analyzed species. Our data revealed interspecific K2P distances with below 2.2% for 18 species. Intraspecific distances above 2.2% were shown for 11 species. We found evidence for hybridization between various corixid species (Sigara, Callicorixa), but our molecular data also revealed exceptionally high intraspecific distances as a consequence of distinct mitochondrial lineages for Cymatia coleoptrata and the pygmy backswimmer Plea minutissima. Our study clearly demonstrates the usefulness of DNA barcodes for the identification of the aquatic Heteroptera of Germany and adjacent regions. In this context, our data set represents an essential baseline for a reference library for bioassessment studies of freshwater habitats using modern high-throughput technologies in the near future. The existing data also opens new questions regarding the causes of observed low inter- and high intraspecific genetic variation and furthermore highlight the necessity of taxonomic revisions for various taxa, combining both molecular and morphological data. PMID:29736329
Using DNA barcoding to differentiate invasive Dreissena species (Mollusca, Bivalvia)
Marescaux, Jonathan; Van Doninck, Karine
2013-01-01
Abstract The zebra mussel (Dreissena polymorpha) and the quagga mussel (Dreissena rostriformis bugensis) are considered as the most competitive invaders in freshwaters of Europe and North America. Although shell characteristics exist to differentiate both species, phenotypic plasticity in the genus Dreissena does not always allow a clear identification. Therefore, the need to find an accurate identification method is essential. DNA barcoding has been proven to be an adequate procedure to discriminate species. The cytochrome c oxidase subunit I mitochondrial gene (COI) is considered as the standard barcode for animals. We tested the use of this gene as an efficient DNA barcode and found that it allow rapid and accurate identification of adult Dreissena individuals. PMID:24453560
Comparing COI and ITS as DNA barcode markers for mushrooms and allies (Agaricomycotina).
Dentinger, Bryn T M; Didukh, Maryna Y; Moncalvo, Jean-Marc
2011-01-01
DNA barcoding is an approach to rapidly identify species using short, standard genetic markers. The mitochondrial cytochrome oxidase I gene (COI) has been proposed as the universal barcode locus, but its utility for barcoding in mushrooms (ca. 20,000 species) has not been established. We succeeded in generating 167 partial COI sequences (~450 bp) representing ~100 morphospecies from ~650 collections of Agaricomycotina using several sets of new primers. Large introns (~1500 bp) at variable locations were detected in ~5% of the sequences we obtained. We suspect that widespread presence of large introns is responsible for our low PCR success (~30%) with this locus. We also sequenced the nuclear internal transcribed spacer rDNA regions (ITS) to compare with COI. Among the small proportion of taxa for which COI could be sequenced, COI and ITS perform similarly as a barcode. However, in a densely sampled set of closely related taxa, COI was less divergent than ITS and failed to distinguish all terminal clades. Given our results and the wealth of ITS data already available in public databases, we recommend that COI be abandoned in favor of ITS as the primary DNA barcode locus in mushrooms.
Comparing COI and ITS as DNA Barcode Markers for Mushrooms and Allies (Agaricomycotina)
Dentinger, Bryn T. M.; Didukh, Maryna Y.; Moncalvo, Jean-Marc
2011-01-01
DNA barcoding is an approach to rapidly identify species using short, standard genetic markers. The mitochondrial cytochrome oxidase I gene (COI) has been proposed as the universal barcode locus, but its utility for barcoding in mushrooms (ca. 20,000 species) has not been established. We succeeded in generating 167 partial COI sequences (∼450 bp) representing ∼100 morphospecies from ∼650 collections of Agaricomycotina using several sets of new primers. Large introns (∼1500 bp) at variable locations were detected in ∼5% of the sequences we obtained. We suspect that widespread presence of large introns is responsible for our low PCR success (∼30%) with this locus. We also sequenced the nuclear internal transcribed spacer rDNA regions (ITS) to compare with COI. Among the small proportion of taxa for which COI could be sequenced, COI and ITS perform similarly as a barcode. However, in a densely sampled set of closely related taxa, COI was less divergent than ITS and failed to distinguish all terminal clades. Given our results and the wealth of ITS data already available in public databases, we recommend that COI be abandoned in favor of ITS as the primary DNA barcode locus in mushrooms. PMID:21966418
Forensic identification of CITES protected slimming cactus (Hoodia) using DNA barcoding.
Gathier, Gerard; van der Niet, Timotheus; Peelen, Tamara; van Vugt, Rogier R; Eurlings, Marcel C M; Gravendeel, Barbara
2013-11-01
Slimming cactus (Hoodia), found only in southwestern Africa, is a well-known herbal product for losing weight. Consequently, Hoodia extracts are sought-after worldwide despite a CITES Appendix II status. The failure to eradicate illegal trade is due to problems with detecting and identifying Hoodia using morphological and chemical characters. Our aim was to evaluate the potential of molecular identification of Hoodia based on DNA barcoding. Screening of nrITS1 and psbA-trnH DNA sequences from 26 accessions of Ceropegieae resulted in successful identification, while conventional chemical profiling using DLI-MS led to inaccurate detection and identification of Hoodia. The presence of Hoodia in herbal products was also successfully established using DNA sequences. A validation procedure of our DNA barcoding protocol demonstrated its robustness to changes in PCR conditions. We conclude that DNA barcoding is an effective tool for Hoodia detection and identification which can contribute to preventing illegal trade. © 2013 American Academy of Forensic Sciences.
Brehm, Gunnar; Hebert, Paul D. N.; Colwell, Robert K.; Adams, Marc-Oliver; Bodner, Florian; Friedemann, Katrin; Möckel, Lars; Fiedler, Konrad
2016-01-01
We sampled 14,603 geometrid moths along a forested elevational gradient from 1020–3021 m in the southern Ecuadorian Andes, and then employed DNA barcoding to refine decisions on species boundaries initially made by morphology. We compared the results with those from an earlier study on the same but slightly shorter gradient that relied solely on morphological criteria to discriminate species. The present analysis revealed 1857 putative species, an 80% increase in species richness from the earlier study that detected only 1010 species. Measures of species richness and diversity that are less dependent on sample size were more than twice as high as in the earlier study, even when analysis was restricted to an identical elevational range. The estimated total number of geometrid species (new dataset) in the sampled area is 2350. Species richness at single sites was 32–43% higher, and the beta diversity component rose by 43–51%. These impacts of DNA barcoding on measures of richness reflect its capacity to reveal cryptic species that were overlooked in the first study. The overall results confirmed unique diversity patterns reported in the first investigation. Species diversity was uniformly high along the gradient, declining only slightly above 2800 m. Species turnover also showed little variation along the gradient, reinforcing the lack of evidence for discrete faunal zones. By confirming these major biodiversity patterns, the present study establishes that incomplete species delineation does not necessarily conceal trends of biodiversity along ecological gradients, but it impedes determination of the true magnitude of diversity and species turnover. PMID:26959368
Ståhlberg, Anders; Krzyzanowski, Paul M; Jackson, Jennifer B; Egyud, Matthew; Stein, Lincoln; Godfrey, Tony E
2016-06-20
Detection of cell-free DNA in liquid biopsies offers great potential for use in non-invasive prenatal testing and as a cancer biomarker. Fetal and tumor DNA fractions however can be extremely low in these samples and ultra-sensitive methods are required for their detection. Here, we report an extremely simple and fast method for introduction of barcodes into DNA libraries made from 5 ng of DNA. Barcoded adapter primers are designed with an oligonucleotide hairpin structure to protect the molecular barcodes during the first rounds of polymerase chain reaction (PCR) and prevent them from participating in mis-priming events. Our approach enables high-level multiplexing and next-generation sequencing library construction with flexible library content. We show that uniform libraries of 1-, 5-, 13- and 31-plex can be generated. Utilizing the barcodes to generate consensus reads for each original DNA molecule reduces background sequencing noise and allows detection of variant alleles below 0.1% frequency in clonal cell line DNA and in cell-free plasma DNA. Thus, our approach bridges the gap between the highly sensitive but specific capabilities of digital PCR, which only allows a limited number of variants to be analyzed, with the broad target capability of next-generation sequencing which traditionally lacks the sensitivity to detect rare variants. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Yan, Li-Jun; Liu, Jie; Möller, Michael; Zhang, Lin; Zhang, Xue-Mei; Li, De-Zhu; Gao, Lian-Ming
2015-07-01
The Himalaya-Hengduan Mountains encompass two global biodiversity hotspots with high levels of biodiversity and endemism. This area is one of the diversification centres of the genus Rhododendron, which is recognized as one of the most taxonomically challenging plant taxa due to recent adaptive radiations and rampant hybridization. In this study, four DNA barcodes were evaluated on 531 samples representing 173 species of seven sections of four subgenera in Rhododendron, with a high sampling density from the Himalaya-Hengduan Mountains employing three analytical methods. The varied approaches (nj, pwg and blast) had different species identification powers with blast performing best. With the pwg analysis, the discrimination rates for single barcodes varied from 12.21% to 25.19% with ITS < rbcL < matK < psbA-trnH. Combinations of ITS + psbA-trnH + matK and the four barcodes showed the highest discrimination ability (both 41.98%) among all possible combinations. As a single barcode, psbA-trnH performed best with a relatively high performance (25.19%). Overall, the three-marker combination of ITS + psbA-trnH + matK was found to be the best DNA barcode for identifying Rhododendron species. The relatively low discriminative efficiency of DNA barcoding in this genus (~42%) may possibly be attributable to too low sequence divergences as a result of a long generation time of Rhododendron and complex speciation patterns involving recent radiations and hybridizations. Taking the morphology, distribution range and habitat of the species into account, DNA barcoding provided additional information for species identification and delivered a preliminary assessment of biodiversity for the large genus Rhododendron in the biodiversity hotspots of the Himalaya-Hengduan Mountains. © 2014 John Wiley & Sons Ltd.
Best, Katharine; Oakes, Theres; Heather, James M.; Shawe-Taylor, John; Chain, Benny
2015-01-01
The polymerase chain reaction (PCR) is one of the most widely used techniques in molecular biology. In combination with High Throughput Sequencing (HTS), PCR is widely used to quantify transcript abundance for RNA-seq, and in the context of analysis of T and B cell receptor repertoires. In this study, we combine DNA barcoding with HTS to quantify PCR output from individual target molecules. We develop computational tools that simulate both the PCR branching process itself, and the subsequent subsampling which typically occurs during HTS sequencing. We explore the influence of different types of heterogeneity on sequencing output, and compare them to experimental results where the efficiency of amplification is measured by barcodes uniquely identifying each molecule of starting template. Our results demonstrate that the PCR process introduces substantial amplification heterogeneity, independent of primer sequence and bulk experimental conditions. This heterogeneity can be attributed both to inherited differences between different template DNA molecules, and the inherent stochasticity of the PCR process. The results demonstrate that PCR heterogeneity arises even when reaction and substrate conditions are kept as constant as possible, and therefore single molecule barcoding is essential in order to derive reproducible quantitative results from any protocol combining PCR with HTS. PMID:26459131
DNA barcode variability and host plant usage of fruit flies (Diptera: Tephritidae) in Thailand.
Kunprom, Chonticha; Pramual, Pairot
2016-10-01
The objectives of this study were to examine the genetic variation in fruit flies (Diptera: Tephritidae) in Thailand and to test the efficiency of the mitochondrial cytochrome c oxidase subunit I (COI) barcoding region for species-level identification. Twelve fruit fly species were collected from 24 host plant species of 13 families. The number of host plant species for each fruit fly species ranged between 1 and 11, with Bactrocera correcta found in the most diverse host plants. A total of 123 COI sequences were obtained from these fruit fly species. Sequences from the NCBI database were also included, for a total of 17 species analyzed. DNA barcoding identification analysis based on the best close match method revealed a good performance, with 94.4% of specimens correctly identified. However, many specimens (3.6%) had ambiguous identification, mostly due to intra- and interspecific overlap between members of the B. dorsalis complex. A phylogenetic tree based on the mitochondrial barcode sequences indicated that all species, except for the members of the B. dorsalis complex, were monophyletic with strong support. Our work supports recent calls for synonymization of these species. Divergent lineages were observed within B. correcta and B. tuberculata, and this suggested that these species need further taxonomic reexamination.
Lammers, Youri; Peelen, Tamara; Vos, Rutger A; Gravendeel, Barbara
2014-02-06
Mixtures of internationally traded organic substances can contain parts of species protected by the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES). These mixtures often raise the suspicion of border control and customs offices, which can lead to confiscation, for example in the case of Traditional Chinese medicines (TCMs). High-throughput sequencing of DNA barcoding markers obtained from such samples provides insight into species constituents of mixtures, but manual cross-referencing of results against the CITES appendices is labor intensive. Matching DNA barcodes against NCBI GenBank using BLAST may yield misleading results both as false positives, due to incorrectly annotated sequences, and false negatives, due to spurious taxonomic re-assignment. Incongruence between the taxonomies of CITES and NCBI GenBank can result in erroneous estimates of illegal trade. The HTS barcode checker pipeline is an application for automated processing of sets of 'next generation' barcode sequences to determine whether these contain DNA barcodes obtained from species listed on the CITES appendices. This analytical pipeline builds upon and extends existing open-source applications for BLAST matching against the NCBI GenBank reference database and for taxonomic name reconciliation. In a single operation, reads are converted into taxonomic identifications matched with names on the CITES appendices. By inclusion of a blacklist and additional names databases, the HTS barcode checker pipeline prevents false positives and resolves taxonomic heterogeneity. The HTS barcode checker pipeline can detect and correctly identify DNA barcodes of CITES-protected species from reads obtained from TCM samples in just a few minutes. The pipeline facilitates and improves molecular monitoring of trade in endangered species, and can aid in safeguarding these species from extinction in the wild. The HTS barcode checker pipeline is available at https://github.com/naturalis/HTS-barcode-checker.
2014-01-01
Background Mixtures of internationally traded organic substances can contain parts of species protected by the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES). These mixtures often raise the suspicion of border control and customs offices, which can lead to confiscation, for example in the case of Traditional Chinese medicines (TCMs). High-throughput sequencing of DNA barcoding markers obtained from such samples provides insight into species constituents of mixtures, but manual cross-referencing of results against the CITES appendices is labor intensive. Matching DNA barcodes against NCBI GenBank using BLAST may yield misleading results both as false positives, due to incorrectly annotated sequences, and false negatives, due to spurious taxonomic re-assignment. Incongruence between the taxonomies of CITES and NCBI GenBank can result in erroneous estimates of illegal trade. Results The HTS barcode checker pipeline is an application for automated processing of sets of 'next generation’ barcode sequences to determine whether these contain DNA barcodes obtained from species listed on the CITES appendices. This analytical pipeline builds upon and extends existing open-source applications for BLAST matching against the NCBI GenBank reference database and for taxonomic name reconciliation. In a single operation, reads are converted into taxonomic identifications matched with names on the CITES appendices. By inclusion of a blacklist and additional names databases, the HTS barcode checker pipeline prevents false positives and resolves taxonomic heterogeneity. Conclusions The HTS barcode checker pipeline can detect and correctly identify DNA barcodes of CITES-protected species from reads obtained from TCM samples in just a few minutes. The pipeline facilitates and improves molecular monitoring of trade in endangered species, and can aid in safeguarding these species from extinction in the wild. The HTS barcode checker pipeline is available at https://github.com/naturalis/HTS-barcode-checker. PMID:24502833
Genetic assessment of ornamental fish species from North East India.
Dhar, Bishal; Ghosh, Sankar Kumar
2015-01-25
Ornamental fishes are traded with multiple names from various parts around the world, including North East India. Most are collected from the wild, due to lack of species-specific culture or breeding, and therefore, such unmanaged collection of the wild and endemic species could lead to severe threats to biodiversity. Despite many regulatory policies, trade of threatened species, including the IUCN listed species have been largely uncontrolled, due to species identification problems arising from the utilization of multiple trade names. So, the development of species-specific DNA marker is indispensable where DNA Barcoding is proved to be helpful in species identification. Here, we investigated, through DNA Barcoding and morphological assessment, the identification of 128 ornamental fish specimens exported from NE India from different exporters. The generated sequences were subjected to similarity match in BOLD-IDS as well as BLASTN, and analysed using MEGA5.2 for species identification through Neighbour-Joining (NJ) clustering, and K2P distance based approach. The analysis revealed straightforward identification of 84 specimens into 35 species, while 44 specimens were difficult to distinguish based on CO1 barcode alone. However, these cases were resolved through morphology, NJ and distanced based method and found to be belonging to 16 species. Among the 51 identified species, 14 species represented multiple trade names; 17 species belonged to threatened category. Species-level identification through DNA Barcoding along with traditional morphotaxonomy reflects its efficacy in regulating ornamental fish trade and therefore, appeals for their conservation in nature. The use of trade names rather than the zoological name created the passage for trafficking of the threatened species and demands immediate attention for sustaining wildlife conservation. Copyright © 2014 Elsevier B.V. All rights reserved.
Magnacca, Karl N; Brown, Mark J F
2010-06-11
The past several years have seen a flurry of papers seeking to clarify the utility and limits of DNA barcoding, particularly in areas such as species discovery and paralogy due to nuclear pseudogenes. Heteroplasmy, the coexistence of multiple mitochondrial haplotypes in a single organism, has been cited as a potentially serious problem for DNA barcoding but its effect on identification accuracy has not been tested. In addition, few studies of barcoding have tested a large group of closely-related species with a well-established morphological taxonomy. In this study we examine both of these issues, by densely sampling the Hawaiian Hylaeus bee radiation. Individuals from 21 of the 49 a priori morphologically-defined species exhibited coding sequence heteroplasmy at levels of 1-6% or more. All homoplasmic species were successfully identified by COI using standard methods of analysis, but only 71% of heteroplasmic species. The success rate in identifying heteroplasmic species was increased to 86% by treating polymorphisms as character states rather than ambiguities. Nuclear pseudogenes (numts) were also present in four species, and were distinguishable from heteroplasmic sequences by patterns of nucleotide and amino acid change. Heteroplasmy significantly decreased the reliability of species identification. In addition, the practical issue of dealing with large numbers of polymorphisms- and resulting increased time and labor required - makes the development of DNA barcode databases considerably more complex than has previously been suggested. The impact of heteroplasmy on the utility of DNA barcoding as a bulk specimen identification tool will depend upon its frequency across populations, which remains unknown. However, DNA barcoding is still likely to remain an important identification tool for those species that are difficult or impossible to identify through morphology, as is the case for the ecologically important solitary bee fauna.
2010-01-01
Background The past several years have seen a flurry of papers seeking to clarify the utility and limits of DNA barcoding, particularly in areas such as species discovery and paralogy due to nuclear pseudogenes. Heteroplasmy, the coexistence of multiple mitochondrial haplotypes in a single organism, has been cited as a potentially serious problem for DNA barcoding but its effect on identification accuracy has not been tested. In addition, few studies of barcoding have tested a large group of closely-related species with a well-established morphological taxonomy. In this study we examine both of these issues, by densely sampling the Hawaiian Hylaeus bee radiation. Results Individuals from 21 of the 49 a priori morphologically-defined species exhibited coding sequence heteroplasmy at levels of 1-6% or more. All homoplasmic species were successfully identified by COI using standard methods of analysis, but only 71% of heteroplasmic species. The success rate in identifying heteroplasmic species was increased to 86% by treating polymorphisms as character states rather than ambiguities. Nuclear pseudogenes (numts) were also present in four species, and were distinguishable from heteroplasmic sequences by patterns of nucleotide and amino acid change. Conclusions Heteroplasmy significantly decreased the reliability of species identification. In addition, the practical issue of dealing with large numbers of polymorphisms- and resulting increased time and labor required - makes the development of DNA barcode databases considerably more complex than has previously been suggested. The impact of heteroplasmy on the utility of DNA barcoding as a bulk specimen identification tool will depend upon its frequency across populations, which remains unknown. However, DNA barcoding is still likely to remain an important identification tool for those species that are difficult or impossible to identify through morphology, as is the case for the ecologically important solitary bee fauna. PMID:20540728
Cruaud, Corinne; Bousquet, Jean; Frascaria-Lacoste, Nathalie
2012-01-01
The utility of DNA barcoding for identifying representative specimens of the circumpolar tree genus Fraxinus (56 species) was investigated. We examined the genetic variability of several loci suggested in chloroplast DNA barcode protocols such as matK, rpoB, rpoC1 and trnH-psbA in a large worldwide sample of Fraxinus species. The chloroplast intergenic spacer rpl32-trnL was further assessed in search for a potentially variable and useful locus. The results of the study suggest that the proposed cpDNA loci, alone or in combination, cannot fully discriminate among species because of the generally low rates of substitution in the chloroplast genome of Fraxinus. The intergenic spacer trnH-psbA was the best performing locus, but genetic distance-based discrimination was moderately successful and only resulted in the separation of the samples at the subgenus level. Use of the BLAST approach was better than the neighbor-joining tree reconstruction method with pairwise Kimura's two-parameter rates of substitution, but allowed for the correct identification of only less than half of the species sampled. Such rates are substantially lower than the success rate required for a standardised barcoding approach. Consequently, the current cpDNA barcodes are inadequate to fully discriminate Fraxinus species. Given that a low rate of substitution is common among the plastid genomes of trees, the use of the plant cpDNA “universal” barcode may not be suitable for the safe identification of tree species below a generic or sectional level. Supplementary barcoding loci of the nuclear genome and alternative solutions are proposed and discussed. PMID:22479532
Molecular taxonomic techniques such as DNA barcoding offer interesting new capabilities for studying community biodiversity for applications like biological monitoring. Beyond DNA barcoding, new DNA sequencing technologies (i.e. Next-Generation Sequencing) present even greater po...
Challenges and progress in making DNA-based AIS early detection monitoring operational
The ability of DNA barcoding to find additional species in hard-to-sample locations or hard-to-identify samples is well established. Nevertheless, adoption of DNA barcoding into regular monitoring programs has been slow, in part due to issues of standardization and interpretation...
DNA barcoding insect–host plant associations
Jurado-Rivera, José A.; Vogler, Alfried P.; Reid, Chris A.M.; Petitpierre, Eduard; Gómez-Zurita, Jesús
2008-01-01
Short-sequence fragments (‘DNA barcodes’) used widely for plant identification and inventorying remain to be applied to complex biological problems. Host–herbivore interactions are fundamental to coevolutionary relationships of a large proportion of species on the Earth, but their study is frequently hampered by limited or unreliable host records. Here we demonstrate that DNA barcodes can greatly improve this situation as they (i) provide a secure identification of host plant species and (ii) establish the authenticity of the trophic association. Host plants of leaf beetles (subfamily Chrysomelinae) from Australia were identified using the chloroplast trnL(UAA) intron as barcode amplified from beetle DNA extracts. Sequence similarity and phylogenetic analyses provided precise identifications of each host species at tribal, generic and specific levels, depending on the available database coverage in various plant lineages. The 76 species of Chrysomelinae included—more than 10 per cent of the known Australian fauna—feed on 13 plant families, with preference for Australian radiations of Myrtaceae (eucalypts) and Fabaceae (acacias). Phylogenetic analysis of beetles shows general conservation of host association but with rare host shifts between distant plant lineages, including a few cases where barcodes supported two phylogenetically distant host plants. The study demonstrates that plant barcoding is already feasible with the current publicly available data. By sequencing plant barcodes directly from DNA extractions made from herbivorous beetles, strong physical evidence for the host association is provided. Thus, molecular identification using short DNA fragments brings together the detection of species and the analysis of their interactions. PMID:19004756
Barcoding Sponges: An Overview Based on Comprehensive Sampling
Vargas, Sergio; Schuster, Astrid; Sacher, Katharina; Büttner, Gabrielle; Schätzle, Simone; Läuchli, Benjamin; Hall, Kathryn; Hooper, John N. A.; Erpenbeck, Dirk; Wörheide, Gert
2012-01-01
Background Phylum Porifera includes ∼8,500 valid species distributed world-wide in aquatic ecosystems ranging from ephemeral fresh-water bodies to coastal environments and the deep-sea. The taxonomy and systematics of sponges is complicated, and morphological identification can be both time consuming and erroneous due to phenotypic convergence and secondary losses, etc. DNA barcoding can provide sponge biologists with a simple and rapid method for the identification of samples of unknown taxonomic membership. The Sponge Barcoding Project (www.spongebarcoding.org), the first initiative to barcode a non-bilaterian metazoan phylum, aims to provide a comprehensive DNA barcode database for Phylum Porifera. Methodology/Principal Findings ∼7,400 sponge specimens have been extracted, and amplification of the standard COI barcoding fragment has been attempted for approximately 3,300 museum samples with ∼25% mean amplification success. Based on this comprehensive sampling, we present the first report on the workflow and progress of the sponge barcoding project, and discuss some common pitfalls inherent to the barcoding of sponges. Conclusion A DNA-barcoding workflow capable of processing potentially large sponge collections has been developed and is routinely used for the Sponge Barcoding Project with success. Sponge specific problems such as the frequent co-amplification of non-target organisms have been detected and potential solutions are currently under development. The initial success of this innovative project have already demonstrated considerable refinement of sponge systematics, evaluating morphometric character importance, geographic phenotypic variability, and the utility of the standard barcoding fragment for Porifera (despite its conserved evolution within this basal metazoan phylum). PMID:22802937
Looking back on a decade of barcoding crustaceans
Raupach, Michael J.; Radulovici, Adriana E.
2015-01-01
Abstract Species identification represents a pivotal component for large-scale biodiversity studies and conservation planning but represents a challenge for many taxa when using morphological traits only. Consequently, alternative identification methods based on molecular markers have been proposed. In this context, DNA barcoding has become a popular and accepted method for the identification of unknown animals across all life stages by comparison to a reference library. In this review we examine the progress of barcoding studies for the Crustacea using the Web of Science data base from 2003 to 2014. All references were classified in terms of taxonomy covered, subject area (identification/library, genetic variability, species descriptions, phylogenetics, methods, pseudogenes/numts), habitat, geographical area, authors, journals, citations, and the use of the Barcode of Life Data Systems (BOLD). Our analysis revealed a total number of 164 barcoding studies for crustaceans with a preference for malacostracan crustaceans, in particular Decapoda, and for building reference libraries in order to identify organisms. So far, BOLD did not establish itself as a popular informatics platform among carcinologists although it offers many advantages for standardized data storage, analyses and publication. PMID:26798245
The Trichoptera barcode initiative: a strategy for generating a species-level Tree of Life.
Zhou, Xin; Frandsen, Paul B; Holzenthal, Ralph W; Beet, Clare R; Bennett, Kristi R; Blahnik, Roger J; Bonada, Núria; Cartwright, David; Chuluunbat, Suvdtsetseg; Cocks, Graeme V; Collins, Gemma E; deWaard, Jeremy; Dean, John; Flint, Oliver S; Hausmann, Axel; Hendrich, Lars; Hess, Monika; Hogg, Ian D; Kondratieff, Boris C; Malicky, Hans; Milton, Megan A; Morinière, Jérôme; Morse, John C; Mwangi, François Ngera; Pauls, Steffen U; Gonzalez, María Razo; Rinne, Aki; Robinson, Jason L; Salokannel, Juha; Shackleton, Michael; Smith, Brian; Stamatakis, Alexandros; StClair, Ros; Thomas, Jessica A; Zamora-Muñoz, Carmen; Ziesmann, Tanja; Kjer, Karl M
2016-09-05
DNA barcoding was intended as a means to provide species-level identifications through associating DNA sequences from unknown specimens to those from curated reference specimens. Although barcodes were not designed for phylogenetics, they can be beneficial to the completion of the Tree of Life. The barcode database for Trichoptera is relatively comprehensive, with data from every family, approximately two-thirds of the genera, and one-third of the described species. Most Trichoptera, as with most of life's species, have never been subjected to any formal phylogenetic analysis. Here, we present a phylogeny with over 16 000 unique haplotypes as a working hypothesis that can be updated as our estimates improve. We suggest a strategy of implementing constrained tree searches, which allow larger datasets to dictate the backbone phylogeny, while the barcode data fill out the tips of the tree. We also discuss how this phylogeny could be used to focus taxonomic attention on ambiguous species boundaries and hidden biodiversity. We suggest that systematists continue to differentiate between 'Barcode Index Numbers' (BINs) and 'species' that have been formally described. Each has utility, but they are not synonyms. We highlight examples of integrative taxonomy, using both barcodes and morphology for species description.This article is part of the themed issue 'From DNA barcodes to biomes'. © 2016 The Authors.
Barcoding and Border Biosecurity: Identifying Cyprinid Fishes in the Aquarium Trade
Collins, Rupert A.; Armstrong, Karen F.; Meier, Rudolf; Yi, Youguang; Brown, Samuel D. J.; Cruickshank, Robert H.; Keeling, Suzanne; Johnston, Colin
2012-01-01
Background Poorly regulated international trade in ornamental fishes poses risks to both biodiversity and economic activity via invasive alien species and exotic pathogens. Border security officials need robust tools to confirm identifications, often requiring hard-to-obtain taxonomic literature and expertise. DNA barcoding offers a potentially attractive tool for quarantine inspection, but has yet to be scrutinised for aquarium fishes. Here, we present a barcoding approach for ornamental cyprinid fishes by: (1) expanding current barcode reference libraries; (2) assessing barcode congruence with morphological identifications under numerous scenarios (e.g. inclusion of GenBank data, presence of singleton species, choice of analytical method); and (3) providing supplementary information to identify difficult species. Methodology/Principal Findings We sampled 172 ornamental cyprinid fish species from the international trade, and provide data for 91 species currently unrepresented in reference libraries (GenBank/Bold). DNA barcodes were found to be highly congruent with our morphological assignments, achieving success rates of 90–99%, depending on the method used (neighbour-joining monophyly, bootstrap, nearest neighbour, GMYC, percent threshold). Inclusion of data from GenBank (additional 157 spp.) resulted in a more comprehensive library, but at a cost to success rate due to the increased number of singleton species. In addition to DNA barcodes, our study also provides supporting data in the form of specimen images, morphological characters, taxonomic bibliography, preserved vouchers, and nuclear rhodopsin sequences. Using this nuclear rhodopsin data we also uncovered evidence of interspecific hybridisation, and highlighted unrecognised diversity within popular aquarium species, including the endangered Indian barb Puntius denisonii. Conclusions/Significance We demonstrate that DNA barcoding provides a highly effective biosecurity tool for rapidly identifying ornamental fishes. In cases where DNA barcodes are unable to offer an identification, we improve on previous studies by consolidating supplementary information from multiple data sources, and empower biosecurity agencies to confidently identify high-risk fishes in the aquarium trade. PMID:22276096
Boyer, Stephane; Brown, Samuel D. J.; Collins, Rupert A.; Cruickshank, Robert H.; Lefort, Marie-Caroline; Malumbres-Olarte, Jagoba; Wratten, Stephen D.
2012-01-01
DNA barcoding remains a challenge when applied to diet analyses, ancient DNA studies, environmental DNA samples and, more generally, in any cases where DNA samples have not been adequately preserved. Because the size of the commonly used barcoding marker (COI) is over 600 base pairs (bp), amplification fails when the DNA molecule is degraded into smaller fragments. However, relevant information for specimen identification may not be evenly distributed along the barcoding region, and a shorter target can be sufficient for identification purposes. This study proposes a new, widely applicable, method to compare the performance of all potential ‘mini-barcodes’ for a given molecular marker and to objectively select the shortest and most informative one. Our method is based on a sliding window analysis implemented in the new R package SPIDER (Species IDentity and Evolution in R). This method is applicable to any taxon and any molecular marker. Here, it was tested on earthworm DNA that had been degraded through digestion by carnivorous landsnails. A 100 bp region of 16 S rDNA was selected as the shortest informative fragment (mini-barcode) required for accurate specimen identification. Corresponding primers were designed and used to amplify degraded earthworm (prey) DNA from 46 landsnail (predator) faeces using 454-pyrosequencing. This led to the detection of 18 earthworm species in the diet of the snail. We encourage molecular ecologists to use this method to objectively select the most informative region of the gene they aim to amplify from degraded DNA. The method and tools provided here, can be particularly useful (1) when dealing with degraded DNA for which only small fragments can be amplified, (2) for cases where no consensus has yet been reached on the appropriate barcode gene, or (3) to allow direct analysis of short reads derived from massively parallel sequencing without the need for bioinformatic consolidation. PMID:22666489
ITS1: a DNA barcode better than ITS2 in eukaryotes?
Wang, Xin-Cun; Liu, Chang; Huang, Liang; Bengtsson-Palme, Johan; Chen, Haimei; Zhang, Jian-Hui; Cai, Dayong; Li, Jian-Qin
2015-05-01
A DNA barcode is a short piece of DNA sequence used for species determination and discovery. The internal transcribed spacer (ITS/ITS2) region has been proposed as the standard DNA barcode for fungi and seed plants and has been widely used in DNA barcoding analyses for other biological groups, for example algae, protists and animals. The ITS region consists of both ITS1 and ITS2 regions. Here, a large-scale meta-analysis was carried out to compare ITS1 and ITS2 from three aspects: PCR amplification, DNA sequencing and species discrimination, in terms of the presence of DNA barcoding gaps, species discrimination efficiency, sequence length distribution, GC content distribution and primer universality. In total, 85 345 sequence pairs in 10 major groups of eukaryotes, including ascomycetes, basidiomycetes, liverworts, mosses, ferns, gymnosperms, monocotyledons, eudicotyledons, insects and fishes, covering 611 families, 3694 genera, and 19 060 species, were analysed. Using similarity-based methods, we calculated species discrimination efficiencies for ITS1 and ITS2 in all major groups, families and genera. Using Fisher's exact test, we found that ITS1 has significantly higher efficiencies than ITS2 in 17 of the 47 families and 20 of the 49 genera, which are sample-rich. By in silico PCR amplification evaluation, primer universality of the extensively applied ITS1 primers was found superior to that of ITS2 primers. Additionally, shorter length of amplification product and lower GC content was discovered to be two other advantages of ITS1 for sequencing. In summary, ITS1 represents a better DNA barcode than ITS2 for eukaryotic species. © 2014 John Wiley & Sons Ltd.
Xu, Chao; Dong, Wenpan; Shi, Shuo; Cheng, Tao; Li, Changhao; Liu, Yanlei; Wu, Ping; Wu, Hongkun; Gao, Peng; Zhou, Shiliang
2015-11-01
A well-covered reference library is crucial for successful identification of species by DNA barcoding. The biggest difficulty in building such a reference library is the lack of materials of organisms. Herbarium collections are potentially an enormous resource of materials. In this study, we demonstrate that it is likely to build such reference libraries using the reconstructed (self-primed PCR amplified) DNA from the herbarium specimens. We used 179 rosaceous specimens to test the effects of DNA reconstruction, 420 randomly sampled specimens to estimate the usable percentage and another 223 specimens of true cherries (Cerasus, Rosaceae) to test the coverage of usable specimens to the species. The barcode rbcLb (the central four-sevenths of rbcL gene) and matK was each amplified in two halves and sequenced on Roche GS 454 FLX+. DNA from the herbarium specimens was typically shorter than 300 bp. DNA reconstruction enabled amplification fragments of 400-500 bp without bringing or inducing any sequence errors. About one-third of specimens in the national herbarium of China (PE) were proven usable after DNA reconstruction. The specimens in PE cover all Chinese true cherry species and 91.5% of vascular species listed in Flora of China. It is very possible to build well-covered reference libraries for DNA barcoding of vascular species in China. As exemplified in this study, DNA reconstruction and DNA-labelled next-generation sequencing can accelerate the construction of local reference libraries. By putting the local reference libraries together, a global library for DNA barcoding becomes closer to reality. © 2015 John Wiley & Sons Ltd.
Insect barcode information system.
Pratheepa, Maria; Jalali, Sushil Kumar; Arokiaraj, Robinson Silvester; Venkatesan, Thiruvengadam; Nagesh, Mandadi; Panda, Madhusmita; Pattar, Sharath
2014-01-01
Insect Barcode Information System called as Insect Barcode Informática (IBIn) is an online database resource developed by the National Bureau of Agriculturally Important Insects, Bangalore. This database provides acquisition, storage, analysis and publication of DNA barcode records of agriculturally important insects, for researchers specifically in India and other countries. It bridges a gap in bioinformatics by integrating molecular, morphological and distribution details of agriculturally important insects. IBIn was developed using PHP/My SQL by using relational database management concept. This database is based on the client- server architecture, where many clients can access data simultaneously. IBIn is freely available on-line and is user-friendly. IBIn allows the registered users to input new information, search and view information related to DNA barcode of agriculturally important insects.This paper provides a current status of insect barcode in India and brief introduction about the database IBIn. http://www.nabg-nbaii.res.in/barcode.
The Role of DNA Barcodes in Understanding and Conservation of Mammal Diversity in Southeast Asia
Francis, Charles M.; Borisenko, Alex V.; Ivanova, Natalia V.; Eger, Judith L.; Lim, Burton K.; Guillén-Servent, Antonio; Kruskop, Sergei V.; Mackie, Iain; Hebert, Paul D. N.
2010-01-01
Background Southeast Asia is recognized as a region of very high biodiversity, much of which is currently at risk due to habitat loss and other threats. However, many aspects of this diversity, even for relatively well-known groups such as mammals, are poorly known, limiting ability to develop conservation plans. This study examines the value of DNA barcodes, sequences of the mitochondrial COI gene, to enhance understanding of mammalian diversity in the region and hence to aid conservation planning. Methodology and Principal Findings DNA barcodes were obtained from nearly 1900 specimens representing 165 recognized species of bats. All morphologically or acoustically distinct species, based on classical taxonomy, could be discriminated with DNA barcodes except four closely allied species pairs. Many currently recognized species contained multiple barcode lineages, often with deep divergence suggesting unrecognized species. In addition, most widespread species showed substantial genetic differentiation across their distributions. Our results suggest that mammal species richness within the region may be underestimated by at least 50%, and there are higher levels of endemism and greater intra-specific population structure than previously recognized. Conclusions DNA barcodes can aid conservation and research by assisting field workers in identifying species, by helping taxonomists determine species groups needing more detailed analysis, and by facilitating the recognition of the appropriate units and scales for conservation planning. PMID:20838635
Vasconcelos, Raquel; Montero-Mendieta, Santiago; Simó-Riudalbas, Marc; Sindaco, Roberto; Santos, Xavier; Fasola, Mauro; Llorente, Gustavo; Razzetti, Edoardo; Carranza, Salvador
2016-01-01
Few DNA barcoding studies of squamate reptiles have been conducted. Due to the significance of the Socotra Archipelago (a UNESCO Natural World Heritage site and a biodiversity hotspot) and the conservation interest of its reptile fauna (94% endemics), we performed the most comprehensive DNA barcoding study on an island group to date to test its applicability to specimen identification and species discovery. Reptiles constitute Socotra's most important vertebrate fauna, yet their taxonomy remains under-studied. We successfully DNA-barcoded 380 individuals of all 31 presently recognized species. The specimen identification success rate is moderate to high, and almost all species presented local barcoding gaps. The unexpected high levels of intra-specific variability found within some species suggest cryptic diversity. Species richness may be under-estimated by 13.8-54.4%. This has implications in the species' ranges and conservation status that should be considered for conservation planning. Other phylogenetic studies using mitochondrial and nuclear markers are congruent with our results. We conclude that, despite its reduced length (663 base pairs), cytochrome c oxidase 1, COI, is very useful for specimen identification and for detecting intra-specific diversity, and has a good phylogenetic signal. We recommend DNA barcoding to be applied to other biodiversity hotspots for quickly and cost-efficiently flagging species discovery, preferentially incorporated into an integrative taxonomic framework.
Simó-Riudalbas, Marc; Sindaco, Roberto; Santos, Xavier; Fasola, Mauro; Llorente, Gustavo; Razzetti, Edoardo; Carranza, Salvador
2016-01-01
Few DNA barcoding studies of squamate reptiles have been conducted. Due to the significance of the Socotra Archipelago (a UNESCO Natural World Heritage site and a biodiversity hotspot) and the conservation interest of its reptile fauna (94% endemics), we performed the most comprehensive DNA barcoding study on an island group to date to test its applicability to specimen identification and species discovery. Reptiles constitute Socotra’s most important vertebrate fauna, yet their taxonomy remains under-studied. We successfully DNA-barcoded 380 individuals of all 31 presently recognized species. The specimen identification success rate is moderate to high, and almost all species presented local barcoding gaps. The unexpected high levels of intra-specific variability found within some species suggest cryptic diversity. Species richness may be under-estimated by 13.8–54.4%. This has implications in the species’ ranges and conservation status that should be considered for conservation planning. Other phylogenetic studies using mitochondrial and nuclear markers are congruent with our results. We conclude that, despite its reduced length (663 base pairs), cytochrome c oxidase 1, COI, is very useful for specimen identification and for detecting intra-specific diversity, and has a good phylogenetic signal. We recommend DNA barcoding to be applied to other biodiversity hotspots for quickly and cost-efficiently flagging species discovery, preferentially incorporated into an integrative taxonomic framework. PMID:26930572
Chakraborty, Mohua; Dhar, Bishal; Ghosh, Sankar Kumar
2017-11-01
The DNA barcodes are generally interpreted using distance-based and character-based methods. The former uses clustering of comparable groups, based on the relative genetic distance, while the latter is based on the presence or absence of discrete nucleotide substitutions. The distance-based approach has a limitation in defining a universal species boundary across the taxa as the rate of mtDNA evolution is not constant throughout the taxa. However, character-based approach more accurately defines this using a unique set of nucleotide characters. The character-based analysis of full-length barcode has some inherent limitations, like sequencing of the full-length barcode, use of a sparse-data matrix and lack of a uniform diagnostic position for each group. A short continuous stretch of a fragment can be used to resolve the limitations. Here, we observe that a 154-bp fragment, from the transversion-rich domain of 1367 COI barcode sequences can successfully delimit species in the three most diverse orders of freshwater fishes. This fragment is used to design species-specific barcode motifs for 109 species by the character-based method, which successfully identifies the correct species using a pattern-matching program. The motifs also correctly identify geographically isolated population of the Cypriniformes species. Further, this region is validated as a species-specific mini-barcode for freshwater fishes by successful PCR amplification and sequencing of the motif (154 bp) using the designed primers. We anticipate that use of such motifs will enhance the diagnostic power of DNA barcode, and the mini-barcode approach will greatly benefit the field-based system of rapid species identification. © 2017 John Wiley & Sons Ltd.
Review and future prospects for DNA barcoding methods in forensic palynology.
Bell, Karen L; Burgess, Kevin S; Okamoto, Kazufusa C; Aranda, Roman; Brosi, Berry J
2016-03-01
Pollen can be a critical forensic marker in cases where determining geographic origin is important, including investigative leads, missing persons cases, and intelligence applications. However, its use has previously been limited by the need for a high level of specialization by expert palynologists, slow speeds of identification, and relatively poor taxonomic resolution (typically to the plant family or genus level). By contrast, identification of pollen through DNA barcoding has the potential to overcome all three of these limitations, and it may seem surprising that the method has not been widely implemented. Despite what might seem a straightforward application of DNA barcoding to pollen, there are technical issues that have delayed progress. However, recent developments of standard methods for DNA barcoding of pollen, along with improvements in high-throughput sequencing technology, have overcome most of these technical issues. Based on these recent methodological developments in pollen DNA barcoding, we believe that now is the time to start applying these techniques in forensic palynology. In this article, we discuss the potential for these methods, and outline directions for future research to further improve on the technology and increase its applicability to a broader range of situations. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Vartak, Vivek Rohidas; Narasimmalu, Rajendran; Annam, Pavan Kumar; Singh, Dhirendra P; Lakra, Wazir S
2015-01-01
Detection of improper labelling of raw and processed seafood is of global importance for reducing commercial fraud and enhancing food safety. Crabs are crustaceans with intricate morphological as well as genetic divergence among species and are popular as seafood in restaurants. Owing to the high number of crab species available, it can be difficult to identify those included in particular food dishes, thus increasing the chance of supersession. DNA barcoding is an advanced technology for detecting improper food labelling and has been used successfully to authenticate seafood. This study identified 11 edible crab species from India by classical taxonomy and developed molecular barcodes with the cytochrome c oxidase I (COI) gene. These barcodes were used as reference barcodes for detecting any improper labelling of 50 restaurant crab samples. Neighbour-joining tree analysis with COI barcodes showed distinct clusters of restaurant samples with respective reference species. The study demonstrated 100% improper labelling of restaurant samples to cover up acts of inferior crab supersession. DNA barcoding successfully identified 11 edible crabs in accordance with classical taxonomy and discerned improper crab food labelling in restaurants of India. © 2014 Society of Chemical Industry.
DNA barcoding commercially important aquatic invertebrates of Turkey.
Keskin, Emre; Atar, Hasan Hüseyin
2013-08-01
DNA barcoding was used in order to identify aquatic invertebrates sampled from fisheries bycatch and discards. A total of 440 unique cytochrome c oxidase sub unit I (COI) barcodes were generated for 22 species from three important phyla (Arthropoda, Cnidaria, and Mollusca). All the species were sequenced and submitted to GenBank and Barcode of Life Database (BOLD) databases using 654 bp-long fragment of mitochondrial COI gene. Two of them (Pontastacus leptodactylus and Rapana bezoar) were first records of the species for the BOLD database and six of them (Carcinus aestuarii, Loligo vulgaris, Melicertus kerathurus, Nephrops norvegicus, Scyllarides latus, and Scyllarus arctus) were first standard (>648 bp) COI barcode records for the GenBank database. COI barcodes were analyzed for nucleotide composition, nucleotide pair frequencies, and Kimura's two-parameter genetic distance. Mean genetic distance among species was found increasing at higher taxonomic levels. Neighbor-joining trees generated were congruent with morphometric-based taxonomic classification. Findings of this study clearly demonstrate that DNA barcodes could be used as an efficient molecular tool in identification of not only target species from fisheries but also bycatch and discard species, and so it could provide us leverage for a better understanding in monitoring and management of fisheries and biodiversity.
USDA-ARS?s Scientific Manuscript database
Morphology-based keys support accurate identification of many taxa. However, identification can be difficult for taxa that are not well studied, very small, members of cryptic species complexes, or represented by immature stages. For such cases, DNA barcodes may provide diagnostic characters. Ecolog...
Challenges and progress in making DNA-based monitoring operational AIS early detection as testbed
The ability of DNA barcoding to find additional species in hard-to-sample locations or hard-to-identify samples is well established. Nevertheless, adoption of DNA barcoding into regular monitoring programs has been slow, in part due to issues of standardization and interpretation...
2017-01-01
In the last two decades, there has been a tremendous increase in the global use of herbal medicinal products (HMPs) due to their claimed health benefits. This has led to increase in their demand and consequently, also, resulted in massive adulteration. This is due to the fact that most of the traditional methods cannot identify closely related species in a process product form. Therefore the urgent need for simple and rapid identification methods resulted in the discovery of a novel technique. DNA barcoding is a process that uses short DNA sequence from the standard genome for species identification. This technique is reliable and is not affected by external factors such as climates, age, or plant part. The difficulties in isolation of DNA of high quality in addition to other factors are among the challenges encountered using the DNA barcoding in the authentication of HMP. These limitations indicated that using DNA barcoding alone may ineffectively authenticate the HMP. Therefore, the combination of DNA barcoding with chromatographic fingerprint, a popular and generally accepted technique for the assessment and quality control of HMP, will offer an efficient solution to effectively evaluate the authenticity and quality consistency of HMP. Detailed and quality information about the main composition of the HMPs will help to ascertain their efficacy and safety as these are very important for quality control. PMID:28536641
TaxI: a software tool for DNA barcoding using distance methods
Steinke, Dirk; Vences, Miguel; Salzburger, Walter; Meyer, Axel
2005-01-01
DNA barcoding is a promising approach to the diagnosis of biological diversity in which DNA sequences serve as the primary key for information retrieval. Most existing software for evolutionary analysis of DNA sequences was designed for phylogenetic analyses and, hence, those algorithms do not offer appropriate solutions for the rapid, but precise analyses needed for DNA barcoding, and are also unable to process the often large comparative datasets. We developed a flexible software tool for DNA taxonomy, named TaxI. This program calculates sequence divergences between a query sequence (taxon to be barcoded) and each sequence of a dataset of reference sequences defined by the user. Because the analysis is based on separate pairwise alignments this software is also able to work with sequences characterized by multiple insertions and deletions that are difficult to align in large sequence sets (i.e. thousands of sequences) by multiple alignment algorithms because of computational restrictions. Here, we demonstrate the utility of this approach with two datasets of fish larvae and juveniles from Lake Constance and juvenile land snails under different models of sequence evolution. Sets of ribosomal 16S rRNA sequences, characterized by multiple indels, performed as good as or better than cox1 sequence sets in assigning sequences to species, demonstrating the suitability of rRNA genes for DNA barcoding. PMID:16214755
Polylox barcoding reveals haematopoietic stem cell fates realized in vivo
Rössler, Jens; Wang, Xi; Postrach, Daniel; Busch, Katrin; Rode, Immanuel; Klapproth, Kay; Dietlein, Nikolaus; Quedenau, Claudia; Chen, Wei; Sauer, Sascha; Wolf, Stephan; Höfer, Thomas; Rodewald, Hans-Reimer
2017-01-01
Developmental deconvolution of complex organs and tissues at the level of individual cells remains challenging. Non-invasive genetic fate mapping1 has been widely used, but the low number of distinct fluorescent marker proteins limits its resolution. Much higher numbers of cell markers have been generated using viral integration sites2, viral barcodes3, and strategies based on transposons4 and CRISPR/Cas9 genome editing5; however, temporal and tissue-specific induction of barcodes in situ has not been achieved. Here we report the development of an artificial DNA recombination locus (termed Polylox) that enables broadly applicable endogenous barcoding based on the Cre-loxP recombination system6,7. Polylox recombination in situ reaches a practical diversity of several hundred thousand barcodes, allowing tagging of single cells. We have used this experimental system, combined with fate mapping, to assess haematopoietic stem cell (HSC) fates in vivo. Classical models of haematopoietic lineage specification assume a tree with few major branches. More recently, driven in part by the development of more efficient single-cell assays and improved transplantation efficiencies, different models have been proposed, in which unilineage priming may occur in mice and humans at the level of HSCs8–10. We have introduced barcodes into HSC progenitors in embryonic mice, and found that the adult HSC compartment is a mosaic of embryo-derived HSC clones, some of which are unexpectedly large. Most HSC clones gave rise to multilineage or oligolineage fates, arguing against unilineage priming, and suggesting coherent usage of the potential of cells in a clone. The spreading of barcodes, both after induction in embryos and in adult mice, revealed a basic split between common myeloid-erythroid development and common lymphocyte development, supporting the long-held but contested view of a tree-like haematopoietic structure. PMID:28813413
Polylox barcoding reveals haematopoietic stem cell fates realized in vivo.
Pei, Weike; Feyerabend, Thorsten B; Rössler, Jens; Wang, Xi; Postrach, Daniel; Busch, Katrin; Rode, Immanuel; Klapproth, Kay; Dietlein, Nikolaus; Quedenau, Claudia; Chen, Wei; Sauer, Sascha; Wolf, Stephan; Höfer, Thomas; Rodewald, Hans-Reimer
2017-08-24
Developmental deconvolution of complex organs and tissues at the level of individual cells remains challenging. Non-invasive genetic fate mapping has been widely used, but the low number of distinct fluorescent marker proteins limits its resolution. Much higher numbers of cell markers have been generated using viral integration sites, viral barcodes, and strategies based on transposons and CRISPR-Cas9 genome editing; however, temporal and tissue-specific induction of barcodes in situ has not been achieved. Here we report the development of an artificial DNA recombination locus (termed Polylox) that enables broadly applicable endogenous barcoding based on the Cre-loxP recombination system. Polylox recombination in situ reaches a practical diversity of several hundred thousand barcodes, allowing tagging of single cells. We have used this experimental system, combined with fate mapping, to assess haematopoietic stem cell (HSC) fates in vivo. Classical models of haematopoietic lineage specification assume a tree with few major branches. More recently, driven in part by the development of more efficient single-cell assays and improved transplantation efficiencies, different models have been proposed, in which unilineage priming may occur in mice and humans at the level of HSCs. We have introduced barcodes into HSC progenitors in embryonic mice, and found that the adult HSC compartment is a mosaic of embryo-derived HSC clones, some of which are unexpectedly large. Most HSC clones gave rise to multilineage or oligolineage fates, arguing against unilineage priming, and suggesting coherent usage of the potential of cells in a clone. The spreading of barcodes, both after induction in embryos and in adult mice, revealed a basic split between common myeloid-erythroid development and common lymphocyte development, supporting the long-held but contested view of a tree-like haematopoietic structure.
Geiger, M F; Herder, F; Monaghan, M T; Almada, V; Barbieri, R; Bariche, M; Berrebi, P; Bohlen, J; Casal-Lopez, M; Delmastro, G B; Denys, G P J; Dettai, A; Doadrio, I; Kalogianni, E; Kärst, H; Kottelat, M; Kovačić, M; Laporte, M; Lorenzoni, M; Marčić, Z; Özuluğ, M; Perdices, A; Perea, S; Persat, H; Porcelotti, S; Puzzi, C; Robalo, J; Šanda, R; Schneider, M; Šlechtová, V; Stoumboudi, M; Walter, S; Freyhof, J
2014-11-01
Incomplete knowledge of biodiversity remains a stumbling block for conservation planning and even occurs within globally important Biodiversity Hotspots (BH). Although technical advances have boosted the power of molecular biodiversity assessments, the link between DNA sequences and species and the analytics to discriminate entities remain crucial. Here, we present an analysis of the first DNA barcode library for the freshwater fish fauna of the Mediterranean BH (526 spp.), with virtually complete species coverage (498 spp., 98% extant species). In order to build an identification system supporting conservation, we compared species determination by taxonomists to multiple clustering analyses of DNA barcodes for 3165 specimens. The congruence of barcode clusters with morphological determination was strongly dependent on the method of cluster delineation, but was highest with the general mixed Yule-coalescent (GMYC) model-based approach (83% of all species recovered as GMYC entity). Overall, genetic morphological discontinuities suggest the existence of up to 64 previously unrecognized candidate species. We found reduced identification accuracy when using the entire DNA-barcode database, compared with analyses on databases for individual river catchments. This scale effect has important implications for barcoding assessments and suggests that fairly simple identification pipelines provide sufficient resolution in local applications. We calculated Evolutionarily Distinct and Globally Endangered scores in order to identify candidate species for conservation priority and argue that the evolutionary content of barcode data can be used to detect priority species for future IUCN assessments. We show that large-scale barcoding inventories of complex biotas are feasible and contribute directly to the evaluation of conservation priorities. © 2014 John Wiley & Sons Ltd.
Amini, Bahram; Kamali, Mehdi; Salouti, Mojtaba; Yaghmaei, Parichehreh
2017-06-15
Bio-barcode DNA based on gold nanoparticle (bDNA-GNPs) as a new generation of biosensor based detection tools, holds promise for biological science studies. They are of enormous importance in the emergence of rapid and sensitive procedures for detecting toxins of microorganisms. Exotoxin A (ETA) is the most toxic virulence factor of Pseudomonas aeruginosa. ETA has ADP-ribosylation activity and decisively affects the protein synthesis of the host cells. In the present study, we developed a fluorescence bio-barcode technology to trace P. aeruginosa ETA. The GNPs were coated with the first target-specific DNA probe 1 (1pDNA) and bio-barcode DNA, which acted as a signal reporter. The magnetic nanoparticles (MNPs) were coated with the second target-specific DNA probe 2 (2pDNA) that was able to recognize the other end of the target DNA. After binding the nanoparticles with the target DNA, the following sandwich structure was formed: MNP 2pDNA/tDNA/1pDNA-GNP-bDNA. After isolating the sandwiches by a magnetic field, the DNAs of the probes which have been hybridized to their complementary DNA, GNPs and MNPs, via the hydrogen, electrostatic and covalently bonds, were released from the sandwiches after dissolving in dithiothreitol solution (DTT 0.8M). This bio-barcode DNA with known DNA sequence was then detected by fluorescence spectrophotometry. The findings showed that the new method has the advantages of fast, high sensitivity (the detection limit was 1.2ng/ml), good selectivity, and wide linear range of 5-200ng/ml. The regression analysis also showed that there was a good linear relationship (∆F=0.57 [target DNA]+21.31, R 2 =0.9984) between the fluorescent intensity and the target DNA concentration in the samples. Copyright © 2016. Published by Elsevier B.V.
Polseela, Raxsina; Jaturas, Narong; Thanwisai, Aunchalee; Sing, Kong-Wah; Wilson, John-James
2016-09-01
Sandflies vary in their distributions and role in pathogen transmission. Attempts to record distributions of sandflies in Thailand have faced difficulties due to their high abundance and diversity. We aim to provide an insight into the diversity of sandflies in Thailand by (i) conducting a literature review, and (ii) DNA barcoding sandflies collected from Wihan Cave where eight morphologically characterized species were recorded. DNA barcodes generated for 193 sandflies fell into 13 distinct species clusters under four genera (Chinius, Idiophlebotomus, Phlebotomus and Sergentomyia). Five of these species could be assigned Linnaean species names unambiguously and two others corresponded to characterized morphospecies. Two species represented a complex under the name Sergentomyia barraudi while the remaining four had not been recognized before in any form. The resulting species checklist and DNA barcode library contribute to a growing set of records for sandflies which is useful for monitoring and vector control.
Shiroguchi, Katsuyuki; Jia, Tony Z.; Sims, Peter A.; Xie, X. Sunney
2012-01-01
RNA sequencing (RNA-Seq) is a powerful tool for transcriptome profiling, but is hampered by sequence-dependent bias and inaccuracy at low copy numbers intrinsic to exponential PCR amplification. We developed a simple strategy for mitigating these complications, allowing truly digital RNA-Seq. Following reverse transcription, a large set of barcode sequences is added in excess, and nearly every cDNA molecule is uniquely labeled by random attachment of barcode sequences to both ends. After PCR, we applied paired-end deep sequencing to read the two barcodes and cDNA sequences. Rather than counting the number of reads, RNA abundance is measured based on the number of unique barcode sequences observed for a given cDNA sequence. We optimized the barcodes to be unambiguously identifiable, even in the presence of multiple sequencing errors. This method allows counting with single-copy resolution despite sequence-dependent bias and PCR-amplification noise, and is analogous to digital PCR but amendable to quantifying a whole transcriptome. We demonstrated transcriptome profiling of Escherichia coli with more accurate and reproducible quantification than conventional RNA-Seq. PMID:22232676
González-Vaquero, Rocío Ana; Roig-Alsina, Arturo; Packer, Laurence
2016-10-01
Special care is needed in the delimitation and identification of halictid bee species, which are renowned for being morphologically monotonous. Corynura Spinola and Halictillus Moure (Halictidae: Augochlorini) contain species that are key elements in southern South American ecosystems. These bees are very difficult to identify due to close morphological similarity among species and high sexual dimorphism. We analyzed 170 barcode-compliant COI sequences from 19 species. DNA barcodes were useful to confirm gender associations and to detect two new cryptic species. Interspecific distances were significantly higher than those reported for other bees. Maximum intraspecific divergence was less than 1% in 14 species. Barcode index numbers (BINs) were useful to identify putative species that need further study. More than one BIN was assigned to five species. The name Corynura patagonica (Cockerell) probably refers to two cryptic species. The results suggest that Corynura and Halictillus species can be identified using DNA barcodes. The sequences of the species included in this study can be used as a reference to assess the identification of unknown specimens. This study provides additional support for the use of DNA barcodes in bee taxonomy and the identification of specimens, which is particularly relevant in insects of ecological importance such as pollinators.
2013-01-01
Background DNA barcoding of land plants has relied traditionally on a small number of markers from the plastid genome. In contrast, low-copy nuclear genes have received little attention as DNA barcodes because of the absence of universal primers for PCR amplification. Results From pooled-species 454 transcriptome data we identified two variable intron-less nuclear loci for each of two species-rich genera of the Hawaiian flora: Clermontia (Campanulaceae) and Cyrtandra (Gesneriaceae) and compared their utility as DNA barcodes with that of plastid genes. We found that nuclear genes showed an overall greater variability, but also displayed a high level of heterozygosity, intraspecific variation, and retention of ancient alleles. Thus, nuclear genes displayed fewer species-diagnostic haplotypes compared to plastid genes and no interspecies gaps. Conclusions The apparently greater coalescence times of nuclear genes are likely to limit their utility as barcodes, as only a small proportion of their alleles were fixed and unique to individual species. In both groups, species-diagnostic markers from either genome were scarce on the youngest island; a minimum age of ca. two million years may be needed for a species flock to be barcoded. For young plant groups, nuclear genes may not be a superior alternative to slowly evolving plastid genes. PMID:23394592
Advances in DNA metabarcoding for food and wildlife forensic species identification.
Staats, Martijn; Arulandhu, Alfred J; Gravendeel, Barbara; Holst-Jensen, Arne; Scholtens, Ingrid; Peelen, Tamara; Prins, Theo W; Kok, Esther
2016-07-01
Species identification using DNA barcodes has been widely adopted by forensic scientists as an effective molecular tool for tracking adulterations in food and for analysing samples from alleged wildlife crime incidents. DNA barcoding is an approach that involves sequencing of short DNA sequences from standardized regions and comparison to a reference database as a molecular diagnostic tool in species identification. In recent years, remarkable progress has been made towards developing DNA metabarcoding strategies, which involves next-generation sequencing of DNA barcodes for the simultaneous detection of multiple species in complex samples. Metabarcoding strategies can be used in processed materials containing highly degraded DNA e.g. for the identification of endangered and hazardous species in traditional medicine. This review aims to provide insight into advances of plant and animal DNA barcoding and highlights current practices and recent developments for DNA metabarcoding of food and wildlife forensic samples from a practical point of view. Special emphasis is placed on new developments for identifying species listed in the Convention on International Trade of Endangered Species (CITES) appendices for which reliable methods for species identification may signal and/or prevent illegal trade. Current technological developments and challenges of DNA metabarcoding for forensic scientists will be assessed in the light of stakeholders' needs.
Alberdi, Antton; Garin, Inazio; Aizpurua, Ostaizka; Aihartza, Joxerra
2012-01-01
Molecular analysis of diet overcomes the considerable limitations of traditional techniques for identifying prey remains in bat faeces. We collected faeces from individual Mountain Long-eared Bats Plecotus macrobullaris trapped using mist nets during the summers of 2009 and 2010 in the Pyrenees. We analysed their diet using DNA mini-barcodes to identify prey species. In addition, we inferred some basic features of the bat's foraging ecology that had not yet been addressed. P. macrobullaris fed almost exclusively on moths (97.8%). As prey we detected one dipteran genus (Tipulidae) and 29 moth taxa: 28 were identified at species level (23 Noctuidae, 1 Crambidae, 1 Geometridae, 1 Pyralidae, 1 Sphingidae, 1 Tortricidae), and one at genus level (Rhyacia sp., Noctuidae). Known ecological information about the prey species allowed us to determine that bats had foraged at elevations between 1,500 and 2,500 m amsl (above mean sea level), mostly in subalpine meadows, followed by other open habitats such as orophilous grasslands and alpine meadows. No forest prey species were identified in the diet. As 96.4% of identified prey species were tympanate moths and no evidence of gleaning behaviour was revealed, we suggest P. macrobullaris probably forages by aerial hawking using faint echolocation pulses to avoid detection by hearing moths. As we could identify 87.8% of the analysed sequences (64.1% of the MOTUs, Molecular Operational Taxonomic Units) at species level, we conclude that DNA mini-barcodes are a very useful tool to analyse the diet of moth-specialist bats.
Multilocus inference of species trees and DNA barcoding.
Mallo, Diego; Posada, David
2016-09-05
The unprecedented amount of data resulting from next-generation sequencing has opened a new era in phylogenetic estimation. Although large datasets should, in theory, increase phylogenetic resolution, massive, multilocus datasets have uncovered a great deal of phylogenetic incongruence among different genomic regions, due both to stochastic error and to the action of different evolutionary process such as incomplete lineage sorting, gene duplication and loss and horizontal gene transfer. This incongruence violates one of the fundamental assumptions of the DNA barcoding approach, which assumes that gene history and species history are identical. In this review, we explain some of the most important challenges we will have to face to reconstruct the history of species, and the advantages and disadvantages of different strategies for the phylogenetic analysis of multilocus data. In particular, we describe the evolutionary events that can generate species tree-gene tree discordance, compare the most popular methods for species tree reconstruction, highlight the challenges we need to face when using them and discuss their potential utility in barcoding. Current barcoding methods sacrifice a great amount of statistical power by only considering one locus, and a transition to multilocus barcodes would not only improve current barcoding methods, but also facilitate an eventual transition to species-tree-based barcoding strategies, which could better accommodate scenarios where the barcode gap is too small or inexistent.This article is part of the themed issue 'From DNA barcodes to biomes'. © 2016 The Authors.
Virgilio, Massimiliano; Jordaens, Kurt; Breman, Floris C; Backeljau, Thierry; De Meyer, Marc
2012-01-01
We propose a general working strategy to deal with incomplete reference libraries in the DNA barcoding identification of species. Considering that (1) queries with a large genetic distance with their best DNA barcode match are more likely to be misidentified and (2) imposing a distance threshold profitably reduces identification errors, we modelled relationships between identification performances and distance thresholds in four DNA barcode libraries of Diptera (n = 4270), Lepidoptera (n = 7577), Hymenoptera (n = 2067) and Tephritidae (n = 602 DNA barcodes). In all cases, more restrictive distance thresholds produced a gradual increase in the proportion of true negatives, a gradual decrease of false positives and more abrupt variations in the proportions of true positives and false negatives. More restrictive distance thresholds improved precision, yet negatively affected accuracy due to the higher proportions of queries discarded (viz. having a distance query-best match above the threshold). Using a simple linear regression we calculated an ad hoc distance threshold for the tephritid library producing an estimated relative identification error <0.05. According to the expectations, when we used this threshold for the identification of 188 independently collected tephritids, less than 5% of queries with a distance query-best match below the threshold were misidentified. Ad hoc thresholds can be calculated for each particular reference library of DNA barcodes and should be used as cut-off mark defining whether we can proceed identifying the query with a known estimated error probability (e.g. 5%) or whether we should discard the query and consider alternative/complementary identification methods.
Identification of Species in Tripterygium (Celastraceae) Based on DNA Barcoding.
Zhang, Xiaomei; Li, Na; Yao, Yuanyuan; Liang, Xuming; Qu, Xianyou; Liu, Xiang; Zhu, Yingjie; Yang, Dajian; Sun, Wei
2016-11-01
Species of genus Tripterygium (Celastraceae) have attracted much attention owing to their excellent effect on treating autoimmune and inflammatory diseases. However, due to high market demand causing overexploitation, natural populations of genus Tripterygium have rapidly declined. Tripterygium medicinal materials are mainly collected from the wild, making the quality of medicinal materials unstable. Additionally, identification of herbal materials from Tripterygium species and their adulterants is difficult based on morphological characters. Therefore, an accurate, convenient, and stability method is urgently needed. In this wok, we developed a DNA barcoding technique to distinguish T. wilfordii HOOK. f., T. hypoglaucum (LÉVL.) HUTCH, and T. regelii SPRAGUE et TAKEDA and their adulterants based on four uniform and standard DNA regions (internal transcribed spacer 2 (ITS2), matK, rbcL, and psbA-trnH). DNA was extracted from 26 locations of fresh leaves. Phylogenetic tree was constructed with Neighbor-Joining (NJ) method, while barcoding gap was analyzed to assess identification efficiency. Compared with the other DNA barcodes applied individually or in combination, ITS2+psbA-trnH was demonstrated as the optimal barcode. T. hypoglaucum and T. wilfordii can be considered as conspecific, while T. regelii was recognized as a separate species. Furthermore, identification of commercial Tripterygium samples was conducted using BLAST against GenBank and Species Identification System for Traditional Chinese Medicine. Our results indicated that DNA barcoding is a convenient, effective, and stability method to identify and distinguish Tripterygium and its adulterants, and could be applied as the quality control for Tripterygium medicinal preparations and monitoring of the medicinal herb trade in markets.
Virgilio, Massimiliano; Jordaens, Kurt; Breman, Floris C.; Backeljau, Thierry; De Meyer, Marc
2012-01-01
We propose a general working strategy to deal with incomplete reference libraries in the DNA barcoding identification of species. Considering that (1) queries with a large genetic distance with their best DNA barcode match are more likely to be misidentified and (2) imposing a distance threshold profitably reduces identification errors, we modelled relationships between identification performances and distance thresholds in four DNA barcode libraries of Diptera (n = 4270), Lepidoptera (n = 7577), Hymenoptera (n = 2067) and Tephritidae (n = 602 DNA barcodes). In all cases, more restrictive distance thresholds produced a gradual increase in the proportion of true negatives, a gradual decrease of false positives and more abrupt variations in the proportions of true positives and false negatives. More restrictive distance thresholds improved precision, yet negatively affected accuracy due to the higher proportions of queries discarded (viz. having a distance query-best match above the threshold). Using a simple linear regression we calculated an ad hoc distance threshold for the tephritid library producing an estimated relative identification error <0.05. According to the expectations, when we used this threshold for the identification of 188 independently collected tephritids, less than 5% of queries with a distance query-best match below the threshold were misidentified. Ad hoc thresholds can be calculated for each particular reference library of DNA barcodes and should be used as cut-off mark defining whether we can proceed identifying the query with a known estimated error probability (e.g. 5%) or whether we should discard the query and consider alternative/complementary identification methods. PMID:22359600
DNA barcoding has the capability to uncover cryptic diversity otherwise undetectable using morphology alone. For aquatic bioassessment, this opportunity to discover hidden biodiversity presents new data for incorporation into environmental monitoring programs. Unfortunately, the ...
When COI barcodes deceive: complete genomes reveal introgression in hairstreaks
Shen, Jinhui; Borek, Dominika; Robbins, Robert K.; Opler, Paul A.; Otwinowski, Zbyszek; Grishin, Nick V.
2017-01-01
Two species of hairstreak butterflies from the genus Calycopis are known in the United States: C. cecrops and C. isobeon. Analysis of mitochondrial COI barcodes of Calycopis revealed cecrops-like specimens from the eastern US with atypical barcodes that were 2.6% different from either USA species, but similar to Central American Calycopis species. To address the possibility that the specimens with atypical barcodes represent an undescribed cryptic species, we sequenced complete genomes of 27 Calycopis specimens of four species: C. cecrops, C. isobeon, C. quintana and C. bactra. Some of these specimens were collected up to 60 years ago and preserved dry in museum collections, but nonetheless produced genomes as complete as fresh samples. Phylogenetic trees reconstructed using the whole mitochondrial and nuclear genomes were incongruent. While USA Calycopis with atypical barcodes grouped with Central American species C. quintana by mitochondria, nuclear genome trees placed them within typical USA C. cecrops in agreement with morphology, suggesting mitochondrial introgression. Nuclear genomes also show introgression, especially between C. cecrops and C. isobeon. About 2.3% of each C. cecrops genome has probably (p-value < 0.01, FDR < 0.1) introgressed from C. isobeon and about 3.4% of each C. isobeon genome may have come from C. cecrops. The introgressed regions are enriched in genes encoding transmembrane proteins, mitochondria-targeting proteins and components of the larval cuticle. This study provides the first example of mitochondrial introgression in Lepidoptera supported by complete genome sequencing. Our results caution about relying solely on COI barcodes and mitochondrial DNA for species identification or discovery. PMID:28179510
The Trichoptera barcode initiative: a strategy for generating a species-level Tree of Life
Frandsen, Paul B.; Holzenthal, Ralph W.; Beet, Clare R.; Bennett, Kristi R.; Blahnik, Roger J.; Bonada, Núria; Cartwright, David; Chuluunbat, Suvdtsetseg; Cocks, Graeme V.; Collins, Gemma E.; deWaard, Jeremy; Dean, John; Flint, Oliver S.; Hausmann, Axel; Hendrich, Lars; Hess, Monika; Hogg, Ian D.; Kondratieff, Boris C.; Malicky, Hans; Milton, Megan A.; Morinière, Jérôme; Morse, John C.; Mwangi, François Ngera; Pauls, Steffen U.; Gonzalez, María Razo; Rinne, Aki; Robinson, Jason L.; Salokannel, Juha; Shackleton, Michael; Smith, Brian; Stamatakis, Alexandros; StClair, Ros; Thomas, Jessica A.; Zamora-Muñoz, Carmen; Ziesmann, Tanja
2016-01-01
DNA barcoding was intended as a means to provide species-level identifications through associating DNA sequences from unknown specimens to those from curated reference specimens. Although barcodes were not designed for phylogenetics, they can be beneficial to the completion of the Tree of Life. The barcode database for Trichoptera is relatively comprehensive, with data from every family, approximately two-thirds of the genera, and one-third of the described species. Most Trichoptera, as with most of life's species, have never been subjected to any formal phylogenetic analysis. Here, we present a phylogeny with over 16 000 unique haplotypes as a working hypothesis that can be updated as our estimates improve. We suggest a strategy of implementing constrained tree searches, which allow larger datasets to dictate the backbone phylogeny, while the barcode data fill out the tips of the tree. We also discuss how this phylogeny could be used to focus taxonomic attention on ambiguous species boundaries and hidden biodiversity. We suggest that systematists continue to differentiate between ‘Barcode Index Numbers’ (BINs) and ‘species’ that have been formally described. Each has utility, but they are not synonyms. We highlight examples of integrative taxonomy, using both barcodes and morphology for species description. This article is part of the themed issue ‘From DNA barcodes to biomes’. PMID:27481793
Zhang, Jian-Qiang; Meng, Shi-Yong; Wen, Jun; Rao, Guang-Yuan
2015-01-01
DNA barcoding, the identification of species using one or a few short standardized DNA sequences, is an important complement to traditional taxonomy. However, there are particular challenges for barcoding plants, especially for species with complex evolutionary histories. We herein evaluated the utility of five candidate sequences - rbcL, matK, trnH-psbA, trnL-F and the internal transcribed spacer (ITS) - for barcoding Rhodiola species, a group of high-altitude plants frequently used as adaptogens, hemostatics and tonics in traditional Tibetan medicine. Rhodiola was suggested to have diversified rapidly recently. The genus is thus a good model for testing DNA barcoding strategies for recently diversified medicinal plants. This study analyzed 189 accessions, representing 47 of the 55 recognized Rhodiola species in the Flora of China treatment. Based on intraspecific and interspecific divergence and degree of monophyly statistics, ITS was the best single-locus barcode, resolving 66% of the Rhodiola species. The core combination rbcL+matK resolved only 40.4% of them. Unsurprisingly, the combined use of all five loci provided the highest discrimination power, resolving 80.9% of the species. However, this is weaker than the discrimination power generally reported in barcoding studies of other plant taxa. The observed complications may be due to the recent diversification, incomplete lineage sorting and reticulate evolution of the genus. These processes are common features of numerous plant groups in the high-altitude regions of the Qinghai-Tibetan Plateau.
bold: The Barcode of Life Data System (http://www.barcodinglife.org)
RATNASINGHAM, SUJEEVAN; HEBERT, PAUL D N
2007-01-01
The Barcode of Life Data System (bold) is an informatics workbench aiding the acquisition, storage, analysis and publication of DNA barcode records. By assembling molecular, morphological and distributional data, it bridges a traditional bioinformatics chasm. bold is freely available to any researcher with interests in DNA barcoding. By providing specialized services, it aids the assembly of records that meet the standards needed to gain BARCODE designation in the global sequence databases. Because of its web-based delivery and flexible data security model, it is also well positioned to support projects that involve broad research alliances. This paper provides a brief introduction to the key elements of bold, discusses their functional capabilities, and concludes by examining computational resources and future prospects. PMID:18784790
Selection of a DNA barcode for Nectriaceae from fungal whole-genomes.
Zeng, Zhaoqing; Zhao, Peng; Luo, Jing; Zhuang, Wenying; Yu, Zhihe
2012-01-01
A DNA barcode is a short segment of sequence that is able to distinguish species. A barcode must ideally contain enough variation to distinguish every individual species and be easily obtained. Fungi of Nectriaceae are economically important and show high species diversity. To establish a standard DNA barcode for this group of fungi, the genomes of Neurospora crassa and 30 other filamentous fungi were compared. The expect value was treated as a criterion to recognize homologous sequences. Four candidate markers, Hsp90, AAC, CDC48, and EF3, were tested for their feasibility as barcodes in the identification of 34 well-established species belonging to 13 genera of Nectriaceae. Two hundred and fifteen sequences were analyzed. Intra- and inter-specific variations and the success rate of PCR amplification and sequencing were considered as important criteria for estimation of the candidate markers. Ultimately, the partial EF3 gene met the requirements for a good DNA barcode: No overlap was found between the intra- and inter-specific pairwise distances. The smallest inter-specific distance of EF3 gene was 3.19%, while the largest intra-specific distance was 1.79%. In addition, there was a high success rate in PCR and sequencing for this gene (96.3%). CDC48 showed sufficiently high sequence variation among species, but the PCR and sequencing success rate was 84% using a single pair of primers. Although the Hsp90 and AAC genes had higher PCR and sequencing success rates (96.3% and 97.5%, respectively), overlapping occurred between the intra- and inter-specific variations, which could lead to misidentification. Therefore, we propose the EF3 gene as a possible DNA barcode for the nectriaceous fungi.
Lobo, Jorge; Teixeira, Marcos A L; Borges, Luisa M S; Ferreira, Maria S G; Hollatz, Claudia; Gomes, Pedro T; Sousa, Ronaldo; Ravara, Ascensão; Costa, Maria H; Costa, Filipe O
2016-01-01
Annelid polychaetes have been seldom the focus of dedicated DNA barcoding studies, despite their ecological relevance and often dominance, particularly in soft-bottom estuarine and coastal marine ecosystems. Here, we report the first assessment of the performance of DNA barcodes in the discrimination of shallow water polychaete species from the southern European Atlantic coast, focusing on specimens collected in estuaries and coastal ecosystems of Portugal. We analysed cytochrome oxidase I DNA barcodes (COI-5P) from 164 specimens, which were assigned to 51 morphospecies. To our data set from Portugal, we added available published sequences selected from the same species, genus or family, to inspect for taxonomic congruence among studies and collection location. The final data set comprised 290 specimens and 79 morphospecies, which generated 99 Barcode Index Numbers (BINs) within Barcode of Life Data Systems (BOLD). Among these, 22 BINs were singletons, 47 other BINs were concordant, confirming the initial identification based on morphological characters, and 30 were discordant, most of which consisted on multiple BINs found for the same morphospecies. Some of the most prominent cases in the latter category include Hediste diversicolor (O.F. Müller, 1776) (7), Eulalia viridis (Linnaeus, 1767) (2) and Owenia fusiformis (delle Chiaje, 1844) (5), all of them reported from Portugal and frequently used in ecological studies as environmental quality indicators. Our results for these species showed discordance between molecular lineages and morphospecies, or added additional relatively divergent lineages. The potential inaccuracies in environmental assessments, where underpinning polychaete species diversity is poorly resolved or clarified, demand additional and extensive investigation of the DNA barcode diversity in this group, in parallel with alpha taxonomy efforts. © 2015 John Wiley & Sons Ltd.
Huang, Xiao-cui; Ci, Xiu-qin; Conran, John G; Li, Jie
2015-01-01
Within a regional floristic context, DNA barcoding is more useful to manage plant diversity inventories on a large scale and develop valuable conservation strategies. However, there are no DNA barcode studies from tropical areas of China, which represents one of the biodiversity hotspots around the world. A DNA barcoding database of an Asian tropical trees with high diversity was established at Xishuangbanna Nature Reserve, Yunnan, southwest China using rbcL and matK as standard barcodes, as well as trnH-psbA and ITS as supplementary barcodes. The performance of tree species identification success was assessed using 2,052 accessions from four plots belonging to two vegetation types in the region by three methods: Neighbor-Joining, Maximum-Likelihood and BLAST. We corrected morphological field identification errors (9.6%) for the three plots using rbcL and matK based on Neighbor-Joining tree. The best barcode region for PCR and sequencing was rbcL (97.6%, 90.8%), followed by trnH-psbA (93.6%, 85.6%), while matK and ITS obtained relative low PCR and sequencing success rates. However, ITS performed best for both species (44.6-58.1%) and genus (72.8-76.2%) identification. With trnH-psbA slightly less effective for species identification. The two standard barcode rbcL and matK gave poor results for species identification (24.7-28.5% and 31.6-35.3%). Compared with other studies from comparable tropical forests (e.g. Cameroon, the Amazon and India), the overall performance of the four barcodes for species identification was lower for the Xishuangbanna Nature Reserve, possibly because of species/genus ratios and species composition between these tropical areas. Although the core barcodes rbcL and matK were not suitable for species identification of tropical trees from Xishuangbanna Nature Reserve, they could still help with identification at the family and genus level. Considering the relative sequence recovery and the species identification performance, we recommend the use of trnH-psbA and ITS in combination as the preferred barcodes for tropical tree species identification in China.
Bourguignon, Thomas; Šobotník, Jan; Hanus, Robert; Krasulová, Jana; Vrkoslav, Vladimír; Cvačka, Josef; Roisin, Yves
2013-12-01
Species boundaries are traditionally inferred using morphological characters, although morphology sometimes fails to correctly delineate species. To overcome this limitation, researchers have widely taken advantage of alternative methods such as DNA barcoding or analysis of cuticular hydrocarbons (CHs) profiles, but rarely use them simultaneously in an iterative taxonomic approach. Here, we follow such an approach using morphology, DNA barcoding and CHs profiles to precisely discriminate species of soldierless termites, a diversified clade constituting about one-third of the Neotropical termite species richness, but poorly resolved taxonomically due to the paucity of useful characters. We sampled soldierless termites in various forest types of the Nouragues Nature Reserve, French Guiana. Our results show that morphological species determination generally matches DNA barcoding, which only suggests the existence of three cryptic species in the 31 morphological species. Among them, Longustitermes manni is the only species whose splitting is corroborated by ecological data, other widely distributed species being supported by DNA barcoding. On the contrary, although CHs profiles provide a certain taxonomic signal, they often suggest inconsistent groupings which are not supported by other methods. Overall, our data support DNA barcoding and morphology as two efficient methods to distinguish soldierless termite species. Copyright © 2013 Elsevier Inc. All rights reserved.
Wu, Yunke; Trepanowski, Nevada F; Molongoski, John J; Reagel, Peter F; Lingafelter, Steven W; Nadel, Hannah; Myers, Scott W; Ray, Ann M
2017-01-16
Global trade facilitates the inadvertent movement of insect pests and subsequent establishment of populations outside their native ranges. Despite phytosanitary measures, nonnative insects arrive at United States (U.S.) ports of entry as larvae in solid wood packaging material (SWPM). Identification of wood-boring larval insects is important for pest risk analysis and management, but is difficult beyond family level due to highly conserved morphology. Therefore, we integrated DNA barcoding and rearing of larvae to identify wood-boring insects in SWPM. From 2012 to 2015, we obtained larvae of 338 longhorned beetles (Cerambycidae) and 38 metallic wood boring beetles (Buprestidae) intercepted in SWPM associated with imported products at six U.S. ports. We identified 265 specimens to species or genus using DNA barcodes. Ninety-three larvae were reared to adults and identified morphologically. No conflict was found between the two approaches, which together identified 275 cerambycids (23 genera) and 16 buprestids (4 genera). Our integrated approach confirmed novel DNA barcodes for seven species (10 specimens) of woodborers not in public databases. This study demonstrates the utility of DNA barcoding as a tool for regulatory agencies. We provide important documentation of potential beetle pests that may cross country borders through the SWPM pathway.
Wu, Yunke; Trepanowski, Nevada F.; Molongoski, John J.; Reagel, Peter F.; Lingafelter, Steven W.; Nadel, Hannah; Myers, Scott W.; Ray, Ann M.
2017-01-01
Global trade facilitates the inadvertent movement of insect pests and subsequent establishment of populations outside their native ranges. Despite phytosanitary measures, nonnative insects arrive at United States (U.S.) ports of entry as larvae in solid wood packaging material (SWPM). Identification of wood-boring larval insects is important for pest risk analysis and management, but is difficult beyond family level due to highly conserved morphology. Therefore, we integrated DNA barcoding and rearing of larvae to identify wood-boring insects in SWPM. From 2012 to 2015, we obtained larvae of 338 longhorned beetles (Cerambycidae) and 38 metallic wood boring beetles (Buprestidae) intercepted in SWPM associated with imported products at six U.S. ports. We identified 265 specimens to species or genus using DNA barcodes. Ninety-three larvae were reared to adults and identified morphologically. No conflict was found between the two approaches, which together identified 275 cerambycids (23 genera) and 16 buprestids (4 genera). Our integrated approach confirmed novel DNA barcodes for seven species (10 specimens) of woodborers not in public databases. This study demonstrates the utility of DNA barcoding as a tool for regulatory agencies. We provide important documentation of potential beetle pests that may cross country borders through the SWPM pathway. PMID:28091577
Pei, Nancai; Erickson, David L; Chen, Bufeng; Ge, Xuejun; Mi, Xiangcheng; Swenson, Nathan G; Zhang, Jin-Long; Jones, Frank A; Huang, Chun-Lin; Ye, Wanhui; Hao, Zhanqing; Hsieh, Chang-Fu; Lum, Shawn; Bourg, Norman A; Parker, John D; Zimmerman, Jess K; McShea, William J; Lopez, Ida C; Sun, I-Fang; Davies, Stuart J; Ma, Keping; Kress, W John
2015-10-12
To determine how well DNA barcodes from the chloroplast region perform in forest dynamics plots (FDPs) from global CTFS-ForestGEO network, we analyzed DNA barcoding sequences of 1277 plant species from a wide phylogenetic range (3 FDPs in tropics, 5 in subtropics and 5 in temperate zone) and compared the rates of species discrimination (RSD). We quantified RSD by two DNA barcode combinations (rbcL + matK and rbcL + matK + trnH-psbA) using a monophyly-based method (GARLI). We defined two indexes of closely-related taxa (Gm/Gt and S/G ratios) and correlated these ratios with RSD. The combination of rbcL + matK averagely discriminated 88.65%, 83.84% and 72.51% at the local, regional and global scales, respectively. An additional locus trnH-psbA increased RSD by 2.87%, 1.49% and 3.58% correspondingly. RSD varied along a latitudinal gradient and were negatively correlated with ratios of closely-related taxa. Successes of species discrimination generally depend on scales in global FDPs. We suggested that the combination of rbcL + matK + trnH-psbA is currently applicable for DNA barcoding-based phylogenetic studies on forest communities.
Synthesis of a multi-functional DNA nanosphere barcode system for direct cell detection.
Han, Sangwoo; Lee, Jae Sung; Lee, Jong Bum
2017-09-28
Nucleic acid-based technologies have been applied to numerous biomedical applications. As a novel material for target detection, DNA has been used to construct a barcode system with a range of structures. This paper reports multi-functionalized DNA nanospheres (DNANSs) by rolling circle amplification (RCA) with several functionalized nucleotides. DNANSs with a barcode system were designed to exhibit fluorescence for coding enhanced signals and contain biotin for more functionalities, including targeting through the biotin-streptavidin (biotin-STA) interaction. Functionalized deoxynucleotide triphosphates (dNTPs) were mixed in the RCA process and functional moieties can be expressed on the DNANSs. The anti-epidermal growth factor receptor antibodies (anti-EGFR Abs) can be conjugated on DNANSs for targeting cancer cells specifically. As a proof of concept, the potential of the multi-functional DNANS barcode was demonstrated by direct cell detection as a simple detection method. The DNANS barcode provides a new route for the simple and rapid selective recognition of cancer cells.
Meher, Prabina Kumar; Sahu, Tanmaya Kumar; Rao, A R
2016-11-05
DNA barcoding is a molecular diagnostic method that allows automated and accurate identification of species based on a short and standardized fragment of DNA. To this end, an attempt has been made in this study to develop a computational approach for identifying the species by comparing its barcode with the barcode sequence of known species present in the reference library. Each barcode sequence was first mapped onto a numeric feature vector based on k-mer frequencies and then Random forest methodology was employed on the transformed dataset for species identification. The proposed approach outperformed similarity-based, tree-based, diagnostic-based approaches and found comparable with existing supervised learning based approaches in terms of species identification success rate, while compared using real and simulated datasets. Based on the proposed approach, an online web interface SPIDBAR has also been developed and made freely available at http://cabgrid.res.in:8080/spidbar/ for species identification by the taxonomists. Copyright © 2016 Elsevier B.V. All rights reserved.
Mishra, Priyanka; Kumar, Amit; Nagireddy, Akshitha; Shukla, Ashutosh K.
2017-01-01
DNA barcoding is used as a universal tool for delimiting species boundaries in taxonomically challenging groups, with different plastid and nuclear regions (rbcL, matK, ITS and psbA-trnH) being recommended as primary DNA barcodes for plants. We evaluated the feasibility of using these regions in the species-rich genus Terminalia, which exhibits various overlapping morphotypes with pantropical distribution, owing to its complex taxonomy. Terminalia bellerica and T. chebula are ingredients of the famous Ayurvedic Rasayana formulation Triphala, used for detoxification and rejuvenation. High demand for extracted phytochemicals as well as the high trade value of several species renders mandatory the need for the correct identification of traded plant material. Three different analytical methods with single and multilocus barcoding regions were tested to develop a DNA barcode reference library from 222 individuals representing 41 Terminalia species. All the single barcodes tested had a lower discriminatory power than the multilocus regions, and the combination of matK+ITS had the highest resolution rate (94.44%). The average intra-specific variations (0.0188±0.0019) were less than the distance to the nearest neighbour (0.106±0.009) with matK and ITS. Distance-based Neighbour Joining analysis outperformed the character-based Maximum Parsimony method in the identification of traded species such as T. arjuna, T. chebula and T. tomentosa, which are prone to adulteration. rbcL was shown to be a highly conservative region with only 3.45% variability between all of the sequences. The recommended barcode combination, rbcL+matK, failed to perform in the genus Terminalia. Considering the complexity of resolution observed with single regions, the present study proposes the combination of matK+ITS as the most successful barcode in Terminalia. PMID:28829803
Raja, Huzefa A; Baker, Timothy R; Little, Jason G; Oberlies, Nicholas H
2017-01-01
One challenge in the dietary supplement industry is confirmation of species identity for processed raw materials, i.e. those modified by milling, drying, or extraction, which move through a multilevel supply chain before reaching the finished product. This is particularly difficult for samples containing fungal mycelia, where processing removes morphological characteristics, such that they do not present sufficient variation to differentiate species by traditional techniques. To address this issue, we have demonstrated the utility of DNA barcoding to verify the taxonomic identity of fungi found commonly in the food and dietary supplement industry; such data are critical for protecting consumer health, by assuring both safety and quality. By using DNA barcoding of nuclear ribosomal internal transcribed spacer (ITS) of the rRNA gene with fungal specific ITS primers, ITS barcodes were generated for 33 representative fungal samples, all of which could be used by consumers for food and/or dietary supplement purposes. In the majority of cases, we were able to sequence the ITS region from powdered mycelium samples, grocery store mushrooms, and capsules from commercial dietary supplements. After generating ITS barcodes utilizing standard procedures accepted by the Consortium for the Barcode of Life, we tested their utility by performing a BLAST search against authenticate published ITS sequences in GenBank. In some cases, we also downloaded published, homologous sequences of the ITS region of fungi inspected in this study and examined the phylogenetic relationships of barcoded fungal species in light of modern taxonomic and phylogenetic studies. We anticipate that these data will motivate discussions on DNA barcoding based species identification as applied to the verification/certification of mushroom-containing dietary supplements. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.
Falade, Mofolusho O.; Opene, Anthony J.; Benson, Otarigho
2016-01-01
DNA barcoding has been adopted as a gold standard rapid, precise and unifying identification system for animal species and provides a database of genetic sequences that can be used as a tool for universal species identification. In this study, we employed mitochondrial genes 16S rRNA (16S) and cytochrome oxidase subunit I (COI) for the identification of some Nigerian freshwater catfish and Tilapia species. Approximately 655 bp were amplified from the 5′ region of the mitochondrial cytochrome C oxidase subunit I (COI) gene whereas 570 bp were amplified for the 16S rRNA gene. Nucleotide divergences among sequences were estimated based on Kimura 2-parameter distances and the genetic relationships were assessed by constructing phylogenetic trees using the neighbour-joining (NJ) and maximum likelihood (ML) methods. Analyses of consensus barcode sequences for each species, and alignment of individual sequences from within a given species revealed highly consistent barcodes (99% similarity on average), which could be compared with deposited sequences in public databases. The nucleotide distance between species belonging to different genera based on COI ranged from 0.17% between Sarotherodon melanotheron and Coptodon zillii to 0.49% between Clarias gariepinus and C. zillii, indicating that S. melanotheron and C. zillii are closely related. Based on the data obtained, the utility of COI gene was confirmed in accurate identification of three fish species from Southwest Nigeria. PMID:27990256
Tanabe, Akifumi S; Toju, Hirokazu
2013-01-01
Taxonomic identification of biological specimens based on DNA sequence information (a.k.a. DNA barcoding) is becoming increasingly common in biodiversity science. Although several methods have been proposed, many of them are not universally applicable due to the need for prerequisite phylogenetic/machine-learning analyses, the need for huge computational resources, or the lack of a firm theoretical background. Here, we propose two new computational methods of DNA barcoding and show a benchmark for bacterial/archeal 16S, animal COX1, fungal internal transcribed spacer, and three plant chloroplast (rbcL, matK, and trnH-psbA) barcode loci that can be used to compare the performance of existing and new methods. The benchmark was performed under two alternative situations: query sequences were available in the corresponding reference sequence databases in one, but were not available in the other. In the former situation, the commonly used "1-nearest-neighbor" (1-NN) method, which assigns the taxonomic information of the most similar sequences in a reference database (i.e., BLAST-top-hit reference sequence) to a query, displays the highest rate and highest precision of successful taxonomic identification. However, in the latter situation, the 1-NN method produced extremely high rates of misidentification for all the barcode loci examined. In contrast, one of our new methods, the query-centric auto-k-nearest-neighbor (QCauto) method, consistently produced low rates of misidentification for all the loci examined in both situations. These results indicate that the 1-NN method is most suitable if the reference sequences of all potentially observable species are available in databases; otherwise, the QCauto method returns the most reliable identification results. The benchmark results also indicated that the taxon coverage of reference sequences is far from complete for genus or species level identification in all the barcode loci examined. Therefore, we need to accelerate the registration of reference barcode sequences to apply high-throughput DNA barcoding to genus or species level identification in biodiversity research.
Tanabe, Akifumi S.; Toju, Hirokazu
2013-01-01
Taxonomic identification of biological specimens based on DNA sequence information (a.k.a. DNA barcoding) is becoming increasingly common in biodiversity science. Although several methods have been proposed, many of them are not universally applicable due to the need for prerequisite phylogenetic/machine-learning analyses, the need for huge computational resources, or the lack of a firm theoretical background. Here, we propose two new computational methods of DNA barcoding and show a benchmark for bacterial/archeal 16S, animal COX1, fungal internal transcribed spacer, and three plant chloroplast (rbcL, matK, and trnH-psbA) barcode loci that can be used to compare the performance of existing and new methods. The benchmark was performed under two alternative situations: query sequences were available in the corresponding reference sequence databases in one, but were not available in the other. In the former situation, the commonly used “1-nearest-neighbor” (1-NN) method, which assigns the taxonomic information of the most similar sequences in a reference database (i.e., BLAST-top-hit reference sequence) to a query, displays the highest rate and highest precision of successful taxonomic identification. However, in the latter situation, the 1-NN method produced extremely high rates of misidentification for all the barcode loci examined. In contrast, one of our new methods, the query-centric auto-k-nearest-neighbor (QCauto) method, consistently produced low rates of misidentification for all the loci examined in both situations. These results indicate that the 1-NN method is most suitable if the reference sequences of all potentially observable species are available in databases; otherwise, the QCauto method returns the most reliable identification results. The benchmark results also indicated that the taxon coverage of reference sequences is far from complete for genus or species level identification in all the barcode loci examined. Therefore, we need to accelerate the registration of reference barcode sequences to apply high-throughput DNA barcoding to genus or species level identification in biodiversity research. PMID:24204702
Moving DNA barcoding toward bioassessment application: roadmap of challenges and solutions
DNA barcoding holds promise for helping to address several challenges associated with taxonomic based bioassessments; these include the time and effort necessary to identify hundreds of specimens per sample location, incomplete or unavailable local taxonomy that limits the abili...
Does DNA barcoding improve performance of traditional stream bioassessment metrics?
Benthic macroinvertebrate community composition is used to assess wetland and stream condition and to help differentiate the effects of stressors among sites. Deoxyribonucleic acid (DNA) barcoding has been promoted as a way to increase taxonomic resolution and, thereby, to increa...
Laskar, Boni A.; Bhattacharjee, Maloyjo J.; Dhar, Bishal; Mahadani, Pradosh; Kundu, Shantanu; Ghosh, Sankar K.
2013-01-01
Background The taxonomic validity of Northeast Indian endemic Mahseer species, Tor progeneius and Neolissochilus hexastichus, has been argued repeatedly. This is mainly due to disagreements in recognizing the species based on morphological characters. Consequently, both the species have been concealed for many decades. DNA barcoding has become a promising and an independent technique for accurate species level identification. Therefore, utilization of such technique in association with the traditional morphotaxonomic description can resolve the species dilemma of this important group of sport fishes. Methodology/Principal Findings Altogether, 28 mahseer specimens including paratypes were studied from different locations in Northeast India, and 24 morphometric characters were measured invariably. The Principal Component Analysis with morphometric data revealed five distinct groups of sample that were taxonomically categorized into 4 species, viz., Tor putitora, T. progeneius, Neolissochilus hexagonolepis and N. hexastichus. Analysis with a dataset of 76 DNA barcode sequences of different mahseer species exhibited that the queries of T. putitora and N. hexagonolepis clustered cohesively with the respective conspecific database sequences maintaining 0.8% maximum K2P divergence. The closest congeneric divergence was 3 times higher than the mean conspecific divergence and was considered as barcode gap. The maximum divergence among the samples of T. progeneius and T. putitora was 0.8% that was much below the barcode gap, indicating them being synonymous. The query sequences of N. hexastichus invariably formed a discrete and a congeneric clade with the database sequences and maintained the interspecific divergence that supported its distinct species status. Notably, N. hexastichus was encountered in a single site and seemed to be under threat. Conclusion This study substantiated the identification of N. hexastichus to be a true species, and tentatively regarded T. progeneius to be a synonym of T. putitora. It would guide the conservationists to initiate priority conservation of N. hexastichus and T. putitora. PMID:23341979
Multiplex single-molecule interaction profiling of DNA-barcoded proteins.
Gu, Liangcai; Li, Chao; Aach, John; Hill, David E; Vidal, Marc; Church, George M
2014-11-27
In contrast with advances in massively parallel DNA sequencing, high-throughput protein analyses are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule protein detection using optical methods is limited by the number of spectrally non-overlapping chromophores. Here we introduce a single-molecular-interaction sequencing (SMI-seq) technology for parallel protein interaction profiling leveraging single-molecule advantages. DNA barcodes are attached to proteins collectively via ribosome display or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide thin film to construct a random single-molecule array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies) and analysed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimetre. Furthermore, protein interactions can be measured on the basis of the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor and antibody-binding profiling, are demonstrated. SMI-seq enables 'library versus library' screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity.
Multiplex single-molecule interaction profiling of DNA barcoded proteins
Gu, Liangcai; Li, Chao; Aach, John; Hill, David E.; Vidal, Marc; Church, George M.
2014-01-01
In contrast with advances in massively parallel DNA sequencing1, high-throughput protein analyses2-4 are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule (SM) protein detection achieved using optical methods5 is limited by the number of spectrally nonoverlapping chromophores. Here, we introduce a single molecular interaction-sequencing (SMI-Seq) technology for parallel protein interaction profiling leveraging SM advantages. DNA barcodes are attached to proteins collectively via ribosome display6 or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide (PAA) thin film to construct a random SM array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies)7 and analyzed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimeter. Furthermore, protein interactions can be measured based on the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor (GPCR) and antibody binding profiling, were demonstrated. SMI-Seq enables “library vs. library” screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity. PMID:25252978
Analysis of informational redundancy in the protein-assembling machinery
NASA Astrophysics Data System (ADS)
Berkovich, Simon
2004-03-01
Entropy analysis of the DNA structure does not reveal a significant departure from randomness indicating lack of informational redundancy. This signifies the absence of a hidden meaning in the genome text and supports the 'barcode' interpretation of DNA given in [1]. Lack of informational redundancy is a characteristic property of an identification label rather than of a message of instructions. Yet randomness of DNA has to induce non-random structures of the proteins. Protein synthesis is a two-step process: transcription into RNA with gene splicing and formation a structure of amino acids. Entropy estimations, performed by A. Djebbari, show typical values of redundancy of the biomolecules along these pathways: DNA gene 4proteins 15-40in gene expression, the RNA copy carries the same information as the original DNA template. Randomness is essentially eliminated only at the step of the protein creation by a degenerate code. According to [1], the significance of the substitution of U for T with a subsequent gene splicing is that these transformations result in a different pattern of RNA oscillations, so the vital DNA communications are protected against extraneous noise coming from the protein making activities. 1. S. Berkovich, "On the 'barcode' functionality of DNA, or the Phenomenon of Life in the Physical Universe", Dorrance Publishing Co., Pittsburgh, 2003
Hussain, Fatma; Ahmed, Nisar; Ghorbani, Abdolbaset
2018-01-01
In pursuit of developing fast and accurate species-level molecular identification methods, we tested six DNA barcodes, namely ITS2, matK, rbcLa, ITS2+matK, ITS2+rbcLa, matK+rbcLa and ITS2+matK+rbcLa, for their capacity to identify frequently consumed but geographically isolated medicinal species of Fabaceae and Poaceae indigenous to the desert of Cholistan. Data were analysed by BLASTn sequence similarity, pairwise sequence divergence in TAXONDNA, and phylogenetic (neighbour-joining and maximum-likelihood trees) methods. Comparison of six barcode regions showed that ITS2 has the highest number of variable sites (209/360) for tested Fabaceae and (106/365) Poaceae species, the highest species-level identification (40%) in BLASTn procedure, distinct DNA barcoding gap, 100% correct species identification in BM and BCM functions of TAXONDNA, and clear cladding pattern with high nodal support in phylogenetic trees in both families. ITS2+matK+rbcLa followed ITS2 in its species-level identification capacity. The study was concluded with advocating the DNA barcoding as an effective tool for species identification and ITS2 as the best barcode region in identifying medicinal species of Fabaceae and Poaceae. Current research has practical implementation potential in the fields of pharmaco-vigilance, trade of medicinal plants and biodiversity conservation. PMID:29576968
Testing DNA barcodes in closely related species of Curcuma (Zingiberaceae) from Myanmar and China.
Chen, Juan; Zhao, Jietang; Erickson, David L; Xia, Nianhe; Kress, W John
2015-03-01
The genus Curcuma L. is commonly used as spices, medicines, dyes and ornamentals. Owing to its economic significance and lack of clear-cut morphological differences between species, this genus is an ideal case for developing DNA barcodes. In this study, four chloroplast DNA regions (matK, rbcL, trnH-psbA and trnL-F) and one nuclear region (ITS2) were generated for 44 Curcuma species and five species from closely related genera, represented by 96 samples. PCR amplification success rate, intra- and inter-specific genetic distance variation and the correct identification percentage were taken into account to assess candidate barcode regions. PCR and sequence success rate were high in matK (89.7%), rbcL (100%), trnH-psbA (100%), trnL-F (95.7%) and ITS2 (82.6%) regions. The results further showed that four candidate chloroplast barcoding regions (matK, rbcL, trnH-psbA and trnL-F) yield no barcode gaps, indicating that the genus Curcuma represents a challenging group for DNA barcoding. The ITS2 region presented large interspecific variation and provided the highest correct identification rates (46.7%) based on BLASTClust method among the five regions. However, the ITS2 only provided 7.9% based on NJ tree method. An increase in discriminatory power needs the development of more variable markers. © 2014 John Wiley & Sons Ltd.
Umdale, Suraj D; Kshirsagar, Parthraj R; Lekhak, Manoj M; Gaikwad, Nikhil B
2017-07-01
Smithia conferta Sm. is an annual herb widely used in Indian traditional medical practice and commonly known as "Lakshman booti" in Sanskrit. Morphological resemblance among the species of genus Smithia Aiton . leads to inaccurate identification and adulteration. This causes inconsistent therapeutic effects and also affects the quality of herbal medicine. This study aimed to generate potential barcode for authentication of S. conferta and its adulterants through DNA barcoding technique. Genomic DNA extracted from S. conferta and its adulterants was used as templates for polymerase chain reaction amplification of the barcoding regions. The amplicons were directed for sequencing, and species identification was conducted using BLASTn and unweighted pair-group method with arithmetic mean trees. In addition, the secondary structures of internal transcribed spacer (ITS) 2 region were predicted. The nucleotide sequence of ITS provides species-specific single nucleotide polymorphisms and sequence divergence (22%) than psb A- trn H (10.9%) and rbc L (3.1%) sequences. The ITS barcode indicates that S. conferta and Smithia sensitiva are closely related compared to other species. ITS is the most applicable barcode for molecular authentication of S. conferta , and further chloroplast barcodes should be tested for phylogenetic analysis of genus Smithia. The present investigation is the first effort of utilization of DNA barcode for molecular authentication of S. conferta and its adulterants. Also, this study expanded the application of the ITS2 sequence data in the authentication. The ITS has been proved as a potential and reliable candidate barcode for the authentication of S. conferta . Abbreviations used: BLASTn: Basic Local Alignment Search Tool for Nucleotide; MEGA: Molecular Evolutionary Genetic Analysis; EMBL: European Molecular Biology Laboratory; psb A- trn H: Photosystem II protein D1- stuctural RNA: His tRNA gene; rbcL: Ribulose 1,5 bi-phosphate carboxylase/oxygenase large subunit gene.
NASA Astrophysics Data System (ADS)
Havermans, C.; Nagy, Z. T.; Sonet, G.; De Broyer, C.; Martin, P.
2011-03-01
Recent molecular analyses revealed that several so-called "circum-Antarctic" benthic crustacean species appeared to be complexes of cryptic species with restricted distributions. In this study we used a DNA barcoding approach based on mitochondrial cytochrome oxidase I gene sequences in order to detect possible cryptic diversity and to test the circumpolarity of some lysianassoid species. The orchomenid genus complex consists of the genera Abyssorchomene, Falklandia, Orchomenella, Orchomenyx and Pseudorchomene. Species of this genus complex are found throughout the Southern Ocean and show a high species richness and level of endemism. In the majority of the studied species, a genetic homogeneity was found even among specimens from remote sampling sites, which indicates a possible circum-Antarctic and eurybathic distribution. In four investigated species ( Orchomenella ( Orchomenopsis) acanthurus, Orchomenella ( Orchomenopsis) cavimanus, Orchomenella ( Orchomenella) franklini and Orchomenella ( Orchomenella) pinguides), genetically divergent lineages and possible cryptic taxa were revealed. After a detailed morphological analysis, O. ( O.) pinguides appeared to be composed of two distinct species, formerly synonymized under O. ( O.) pinguides. The different genetic patterns observed in these orchomenid species might be explained by the evolutionary histories undergone by these species and by their different dispersal and gene flow capacities.
Escaping introns in COI through cDNA barcoding of mushrooms: Pleurotus as a test case.
Avin, Farhat A; Subha, Bhassu; Tan, Yee-Shin; Braukmann, Thomas W A; Vikineswary, Sabaratnam; Hebert, Paul D N
2017-09-01
DNA barcoding involves the use of one or more short, standardized DNA fragments for the rapid identification of species. A 648-bp segment near the 5' terminus of the mitochondrial cytochrome c oxidase subunit I (COI) gene has been adopted as the universal DNA barcode for members of the animal kingdom, but its utility in mushrooms is complicated by the frequent occurrence of large introns. As a consequence, ITS has been adopted as the standard DNA barcode marker for mushrooms despite several shortcomings. This study employed newly designed primers coupled with cDNA analysis to examine COI sequence diversity in six species of Pleurotus and compared these results with those for ITS. The ability of the COI gene to discriminate six species of Pleurotus , the commonly cultivated oyster mushroom, was examined by analysis of cDNA. The amplification success, sequence variation within and among species, and the ability to design effective primers was tested. We compared ITS sequences to their COI cDNA counterparts for all isolates. ITS discriminated between all six species, but some sequence results were uninterpretable, because of length variation among ITS copies. By comparison, a complete COI sequences were recovered from all but three individuals of Pleurotus giganteus where only the 5' region was obtained. The COI sequences permitted the resolution of all species when partial data was excluded for P. giganteus . Our results suggest that COI can be a useful barcode marker for mushrooms when cDNA analysis is adopted, permitting identifications in cases where ITS cannot be recovered or where it offers higher resolution when fresh tissue is. The suitability of this approach remains to be confirmed for other mushrooms.
Assessment of mangroves from Goa, west coast India using DNA barcode.
Saddhe, Ankush Ashok; Jamdade, Rahul Arvind; Kumar, Kundan
2016-01-01
Mangroves are salt-tolerant forest ecosystems of tropical and subtropical intertidal regions. They are among most productive, diverse, biologically important ecosystem and inclined toward threatened system. Identification of mangrove species is of critical importance in conserving and utilizing biodiversity, which apparently hindered by a lack of taxonomic expertise. In recent years, DNA barcoding using plastid markers rbcL and matK has been suggested as an effective method to enrich traditional taxonomic expertise for rapid species identification and biodiversity inventories. In the present study, we performed assessment of available 14 mangrove species of Goa, west coast India based on core DNA barcode markers, rbcL and matK. PCR amplification success rate, intra- and inter-specific genetic distance variation and the correct identification percentage were taken into account to assess candidate barcode regions. PCR and sequence success rate were high in rbcL (97.7 %) and matK (95.5 %) region. The two candidate chloroplast barcoding regions (rbcL, matK) yielded barcode gaps. Our results clearly demonstrated that matK locus assigned highest correct identification rates (72.09 %) based on TaxonDNA Best Match criteria. The concatenated rbcL + matK loci were able to adequately discriminate all mangrove genera and species to some extent except those in Rhizophora, Sonneratia and Avicennia. Our study provides the first endorsement of the species resolution among mangroves using plastid genes with few exceptions. Our future work will be focused on evaluation of other barcode markers to delineate complete resolution of mangrove species and identification of putative hybrids.
Zhang, Jian-Qiang; Meng, Shi-Yong; Wen, Jun; Rao, Guang-Yuan
2015-01-01
DNA barcoding, the identification of species using one or a few short standardized DNA sequences, is an important complement to traditional taxonomy. However, there are particular challenges for barcoding plants, especially for species with complex evolutionary histories. We herein evaluated the utility of five candidate sequences — rbcL, matK, trnH-psbA, trnL-F and the internal transcribed spacer (ITS) — for barcoding Rhodiola species, a group of high-altitude plants frequently used as adaptogens, hemostatics and tonics in traditional Tibetan medicine. Rhodiola was suggested to have diversified rapidly recently. The genus is thus a good model for testing DNA barcoding strategies for recently diversified medicinal plants. This study analyzed 189 accessions, representing 47 of the 55 recognized Rhodiola species in the Flora of China treatment. Based on intraspecific and interspecific divergence and degree of monophyly statistics, ITS was the best single-locus barcode, resolving 66% of the Rhodiola species. The core combination rbcL+matK resolved only 40.4% of them. Unsurprisingly, the combined use of all five loci provided the highest discrimination power, resolving 80.9% of the species. However, this is weaker than the discrimination power generally reported in barcoding studies of other plant taxa. The observed complications may be due to the recent diversification, incomplete lineage sorting and reticulate evolution of the genus. These processes are common features of numerous plant groups in the high-altitude regions of the Qinghai-Tibetan Plateau. PMID:25774915
DNA barcoding of medicinal plant material for identification
USDA-ARS?s Scientific Manuscript database
Because of the increasing demand for herbal remedies and for authentication of the source material, it is vital to provide a single database containing information about authentic plant materials and their potential adulterants. The database should provide DNA barcodes for data retrieval and similar...
Capacity for DNA-barcode based taxonomy in support of Great Lakes biological monitoring
Enumerating organisms collected via nets and sediment grabs is a mainstay of aquatic ecology. Since morphological taxonomy can require considerable resources and expertise, DNA barcode-based identification of mixed-organism samples offers a valuable tool in support of biological...
Do DNA barcoding delimitation methods affect our view of stream biodiversity?
How we delimit molecular operational taxonomic units (MOTUs) is an important aspect in the use of DNA barcoding for bioassessment. Four delimitation methods were examined to gain an understanding of their relative strengths at organizing data from 5300 specimens collected during ...
Gao, Ting; Yao, Hui; Song, Jingyuan; Zhu, Yingjie; Liu, Chang; Chen, Shilin
2010-10-26
Five DNA regions, namely, rbcL, matK, ITS, ITS2, and psbA-trnH, have been recommended as primary DNA barcodes for plants. Studies evaluating these regions for species identification in the large plant taxon, which includes a large number of closely related species, have rarely been reported. The feasibility of using the five proposed DNA regions was tested for discriminating plant species within Asteraceae, the largest family of flowering plants. Among these markers, ITS2 was the most useful in terms of universality, sequence variation, and identification capability in the Asteraceae family. The species discriminating power of ITS2 was also explored in a large pool of 3,490 Asteraceae sequences that represent 2,315 species belonging to 494 different genera. The result shows that ITS2 correctly identified 76.4% and 97.4% of plant samples at the species and genus levels, respectively. In addition, ITS2 displayed a variable ability to discriminate related species within different genera. ITS2 is the best DNA barcode for the Asteraceae family. This approach significantly broadens the application of DNA barcoding to resolve classification problems in the family Asteraceae at the genera and species levels.
The problems and promise of DNA barcodes for species diagnosis of primate biomaterials
Lorenz, Joseph G; Jackson, Whitney E; Beck, Jeanne C; Hanner, Robert
2005-01-01
The Integrated Primate Biomaterials and Information Resource (www.IPBIR.org) provides essential research reagents to the scientific community by establishing, verifying, maintaining, and distributing DNA and RNA derived from primate cell cultures. The IPBIR uses mitochondrial cytochrome c oxidase subunit I sequences to verify the identity of samples for quality control purposes in the accession, cell culture, DNA extraction processes and prior to shipping to end users. As a result, IPBIR is accumulating a database of ‘DNA barcodes’ for many species of primates. However, this quality control process is complicated by taxon specific patterns of ‘universal primer’ failure, as well as the amplification or co-amplification of nuclear pseudogenes of mitochondrial origins. To overcome these difficulties, taxon specific primers have been developed, and reverse transcriptase PCR is utilized to exclude these extraneous sequences from amplification. DNA barcoding of primates has applications to conservation and law enforcement. Depositing barcode sequences in a public database, along with primer sequences, trace files and associated quality scores, makes this species identification technique widely accessible. Reference DNA barcode sequences should be derived from, and linked to, specimens of known provenance in web-accessible collections in order to validate this system of molecular diagnostics. PMID:16214744
Kress, W John; Erickson, David L
2007-06-06
A useful DNA barcode requires sufficient sequence variation to distinguish between species and ease of application across a broad range of taxa. Discovery of a DNA barcode for land plants has been limited by intrinsically lower rates of sequence evolution in plant genomes than that observed in animals. This low rate has complicated the trade-off in finding a locus that is universal and readily sequenced and has sufficiently high sequence divergence at the species-level. Here, a global plant DNA barcode system is evaluated by comparing universal application and degree of sequence divergence for nine putative barcode loci, including coding and non-coding regions, singly and in pairs across a phylogenetically diverse set of 48 genera (two species per genus). No single locus could discriminate among species in a pair in more than 79% of genera, whereas discrimination increased to nearly 88% when the non-coding trnH-psbA spacer was paired with one of three coding loci, including rbcL. In silico trials were conducted in which DNA sequences from GenBank were used to further evaluate the discriminatory power of a subset of these loci. These trials supported the earlier observation that trnH-psbA coupled with rbcL can correctly identify and discriminate among related species. A combination of the non-coding trnH-psbA spacer region and a portion of the coding rbcL gene is recommended as a two-locus global land plant barcode that provides the necessary universality and species discrimination.
Xu, Chang; Nezami Ranjbar, Mohammad R; Wu, Zhong; DiCarlo, John; Wang, Yexun
2017-01-03
Detection of DNA mutations at very low allele fractions with high accuracy will significantly improve the effectiveness of precision medicine for cancer patients. To achieve this goal through next generation sequencing, researchers need a detection method that 1) captures rare mutation-containing DNA fragments efficiently in the mix of abundant wild-type DNA; 2) sequences the DNA library extensively to deep coverage; and 3) distinguishes low level true variants from amplification and sequencing errors with high accuracy. Targeted enrichment using PCR primers provides researchers with a convenient way to achieve deep sequencing for a small, yet most relevant region using benchtop sequencers. Molecular barcoding (or indexing) provides a unique solution for reducing sequencing artifacts analytically. Although different molecular barcoding schemes have been reported in recent literature, most variant calling has been done on limited targets, using simple custom scripts. The analytical performance of barcode-aware variant calling can be significantly improved by incorporating advanced statistical models. We present here a highly efficient, simple and scalable enrichment protocol that integrates molecular barcodes in multiplex PCR amplification. In addition, we developed smCounter, an open source, generic, barcode-aware variant caller based on a Bayesian probabilistic model. smCounter was optimized and benchmarked on two independent read sets with SNVs and indels at 5 and 1% allele fractions. Variants were called with very good sensitivity and specificity within coding regions. We demonstrated that we can accurately detect somatic mutations with allele fractions as low as 1% in coding regions using our enrichment protocol and variant caller.
Deciphering amphibian diversity through DNA barcoding: chances and challenges.
Vences, Miguel; Thomas, Meike; Bonett, Ronald M; Vieites, David R
2005-10-29
Amphibians globally are in decline, yet there is still a tremendous amount of unrecognized diversity, calling for an acceleration of taxonomic exploration. This process will be greatly facilitated by a DNA barcoding system; however, the mitochondrial population structure of many amphibian species presents numerous challenges to such a standardized, single locus, approach. Here we analyse intra- and interspecific patterns of mitochondrial variation in two distantly related groups of amphibians, mantellid frogs and salamanders, to determine the promise of DNA barcoding with cytochrome oxidase subunit I (cox1) sequences in this taxon. High intraspecific cox1 divergences of 7-14% were observed (18% in one case) within the whole set of amphibian sequences analysed. These high values are not caused by particularly high substitution rates of this gene but by generally deep mitochondrial divergences within and among amphibian species. Despite these high divergences, cox1 sequences were able to correctly identify species including disparate geographic variants. The main problems with cox1 barcoding of amphibians are (i) the high variability of priming sites that hinder the application of universal primers to all species and (ii) the observed distinct overlap of intraspecific and interspecific divergence values, which implies difficulties in the definition of threshold values to identify candidate species. Common discordances between geographical signatures of mitochondrial and nuclear markers in amphibians indicate that a single-locus approach can be problematic when high accuracy of DNA barcoding is required. We suggest that a number of mitochondrial and nuclear genes may be used as DNA barcoding markers to complement cox1.
DNA barcodes for Mexican Cactaceae, plants under pressure from wild collecting.
Yesson, Chris; Bárcenas, Rolando T; Hernández, Héctor M; Ruiz-Maqueda, María de la Luz; Prado, Alberto; Rodríguez, Víctor M; Hawkins, Julie A
2011-09-01
DNA barcodes could be a useful tool for plant conservation. Of particular importance is the ability to identify unknown plant material, such as from customs seizures of illegally collected specimens. Mexican cacti are an example of a threatened group, under pressure because of wild collection for the xeriscaping trade and private collectors. Mexican cacti also provide a taxonomically and geographically coherent group with which to test DNA barcodes. Here, we sample the matK barcode for 528 species of Cactaceae including approximately 75% of Mexican species and test the utility of the matK region for species-level identification. We find that the matK DNA barcode can be used to identify uniquely 77% of species sampled, and 79-87% of species of particular conservation importance. However, this is far below the desired rate of 95% and there are significant issues for PCR amplification because of the variability of primer sites. Additionally, we test the nuclear ITS regions for the cactus subfamily Opuntioideae and for the genus Ariocarpus (subfamily Cactoideae). We observed higher rates of variation for ITS (86% unique for Opuntioideae sampled) but a much lower PCR success, encountering significant intra-individual polymorphism in Ariocarpus precluding the use of this marker in this taxon. We conclude that the matK region should provide useful information as a DNA barcode for Cactaceae if the problems with primers can be addressed, but matK alone is not sufficiently variable to achieve species-level identification. Additional complementary regions should be investigated as ITS is shown to be unsuitable. © 2011 Blackwell Publishing Ltd.
FUNGAL BIOGEOGRAPHY. Response to Comment on "Global diversity and geography of soil fungi".
Tedersoo, Leho; Bahram, Mohammad; Põlme, Sergei; Anslan, Sten; Riit, Taavi; Kõljalg, Urmas; Nilsson, R Henrik; Hildebrand, Falk; Abarenkov, Kessy
2015-08-28
Schadt and Rosling (Technical Comment, 26 June 2015, p. 1438) argue that primer-template mismatches neglected the fungal class Archaeorhizomycetes in a global soil survey. Amplicon-based metabarcoding of nine barcode-primer pair combinations and polymerase chain reaction (PCR)-free shotgun metagenomics revealed that barcode and primer choice and PCR bias drive the diversity and composition of microorganisms in general, but the Archaeorhizomycetes were little affected in the global study. We urge that careful choice of DNA markers and primers is essential for ecological studies using high-throughput sequencing for identification. Copyright © 2015, American Association for the Advancement of Science.
Long-range barcode labeling-sequencing
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, Feng; Zhang, Tao; Singh, Kanwar K.
Methods for sequencing single large DNA molecules by clonal multiple displacement amplification using barcoded primers. Sequences are binned based on barcode sequences and sequenced using a microdroplet-based method for sequencing large polynucleotide templates to enable assembly of haplotype-resolved complex genomes and metagenomes.
Rebijith, K B; Asokan, R; Kumar, N K Krishna; Srikumar, K K; Ramamurthy, V V; Bhat, P Shivarama
2012-10-01
Rapid, accurate, and timely identification of insects as a group is important and challenging worldwide, as they outnumber all other animals in number and diversity. DNA barcoding is a method for the identification of species in a wide range of animal taxa, which uses the 5' region of the mitochondrial cytochrome c oxidase-I (CO-I). Yet another easy, accurate, and economical method of species discrimination is by developing species-specific markers, which produce specific amplicon for the species in question. The method is handy because it is not limited by life stages, sex, polymorphism, and other factors. Herein, we measured the usefulness of CO-I for the species discrimination of mirids in India viz. Helopeltis antonii Signoret, H. thievora Waterhouse, H. bradyi Waterhouse, and Pachypeltis maesarum Kirkaldy in their various life stages. Furthermore, our study showed the utility of species-specific markers in differentiating H. antonii (295) and H. bradyi (514) regardless of their life stages. Analysis of CO-I gene revealed <1% intraspecific divergence for all four species examined, whereas the interspecific distances ranged from 7 to 13%. This study showed that the DNA barcode and species-specific markers will aid the identification of mirids in India and will stand as a decisive tool in formulating integrated pest management (IPM) strategy, quick identification of invasive and cryptic species, haplotypes, biotypes, and other factors, if any.
NASA Astrophysics Data System (ADS)
McFadden, Catherine S.; van Ofwegen, Leen P.
2013-03-01
The encrusting soft coral Incrustatus comauensis is a common denizen of hard substrates in the shallow sub-tidal zone from the central Chilean fjords to the Cape Horn region of southern South America. DNA barcoding of specimens collected from the Beagle Channel, Tierra del Fuego, Argentina, revealed the presence of a second, cryptic species of Incrustatus that is syntopic with I. comauensis. We describe Incrustatus niarchosi, a new species that can be distinguished morphologically from I. comauensis by differences in the microscopic ornamentation of the coenenchymal sclerites. To date, I. niarchosi n. sp. is known only from the Beagle Channel. A population of I. comauensis discovered in the intertidal zone in eastern Tierra del Fuego represents a new record of the species for that habitat and geographic region. Although the intertidal population is also distinct genetically, it is morphologically indistinguishable from sub-tidal Chilean populations of I. comauensis, and at present, there is insufficient evidence to support its status as a separate species.
Kane, Nolan; Sveinsson, Saemundur; Dempewolf, Hannes; Yang, Ji Yong; Zhang, Dapeng; Engels, Johannes M M; Cronk, Quentin
2012-02-01
To reliably identify lineages below the species level such as subspecies or varieties, we propose an extension to DNA-barcoding using next-generation sequencing to produce whole organellar genomes and substantial nuclear ribosomal sequence. Because this method uses much longer versions of the traditional DNA-barcoding loci in the plastid and ribosomal DNA, we call our approach ultra-barcoding (UBC). We used high-throughput next-generation sequencing to scan the genome and generate reliable sequence of high copy number regions. Using this method, we examined whole plastid genomes as well as nearly 6000 bases of nuclear ribosomal DNA sequences for nine genotypes of Theobroma cacao and an individual of the related species T. grandiflorum, as well as an additional publicly available whole plastid genome of T. cacao. All individuals of T. cacao examined were uniquely distinguished, and evidence of reticulation and gene flow was observed. Sequence variation was observed in some of the canonical barcoding regions between species, but other regions of the chloroplast were more variable both within species and between species, as were ribosomal spacers. Furthermore, no single region provides the level of data available using the complete plastid genome and rDNA. Our data demonstrate that UBC is a viable, increasingly cost-effective approach for reliably distinguishing varieties and even individual genotypes of T. cacao. This approach shows great promise for applications where very closely related or interbreeding taxa must be distinguished.
Barcoding Fauna Bavarica: 78% of the Neuropterida Fauna Barcoded!
Morinière, Jérome; Hendrich, Lars; Hausmann, Axel; Hebert, Paul; Haszprunar, Gerhard; Gruppe, Axel
2014-01-01
This publication provides the first comprehensive DNA barcode data set for the Neuropterida of Central Europe, including 80 of the 102 species (78%) recorded from Bavaria (Germany) and three other species from nearby regions (Austria, France and the UK). Although the 286 specimens analyzed had a heterogeneous conservation history (60% dried; 30% in 80% EtOH; 10% fresh specimens in 95% EtOH), 237 (83%) generated a DNA barcode. Eleven species (13%) shared a BIN, but three of these taxa could be discriminated through barcodes. Four pairs of closely allied species shared barcodes including Chrysoperla pallida Henry et al., 2002 and C. lucasina Lacroix, 1912; Wesmaelius concinnus (Stephens, 1836) and W. quadrifasciatus (Reuter, 1894); Hemerobius handschini Tjeder, 1957 and H. nitidulus Fabricius, 1777; and H. atrifrons McLachlan, 1868 and H. contumax Tjeder, 1932. Further studies are needed to test the possible synonymy of these species pairs or to determine if other genetic markers permit their discrimination. Our data highlight five cases of potential cryptic diversity within Bavarian Neuropterida: Nineta flava (Scopoli, 1763), Sympherobius pygmaeus (Rambur, 1842), Sisyra nigra (Retzius, 1783), Semidalis aleyrodiformis (Stephens, 1836) and Coniopteryx pygmaea Enderlein, 1906 are each split into two or three BINs. The present DNA barcode library not only allows the identification of adult and larval stages, but also provides valuable information for alpha-taxonomy, and for ecological and evolutionary research. PMID:25286434
Pardo, Cristina; Lopez, Lua; Peña, Viviana; Hernández-Kantún, Jazmin; Le Gall, Line; Bárbara, Ignacio; Barreiro, Rodolfo
2014-01-01
Maerl beds are sensitive biogenic habitats built by an accumulation of loose-lying, non-geniculate coralline algae. While these habitats are considered hot-spots of marine biodiversity, the number and distribution of maerl-forming species is uncertain because homoplasy and plasticity of morphological characters are common. As a result, species discrimination based on morphological features is notoriously challenging, making these coralline algae the ideal candidates for a DNA barcoding study. Here, mitochondrial (COI-5P DNA barcode fragment) and plastidial (psbA gene) sequence data were used in a two-step approach to delimit species in 224 collections of maerl sampled from Svalbard (78°96’N) to the Canary Islands (28°64’N) that represented 10 morphospecies from four genera and two families. First, the COI-5P dataset was analyzed with two methods based on distinct criteria (ABGD and GMYC) to delineate 16 primary species hypotheses (PSHs) arranged into four major lineages. Second, chloroplast (psbA) sequence data served to consolidate these PSHs into 13 secondary species hypotheses (SSHs) that showed biologically plausible ranges. Using several lines of evidence (e.g. morphological characters, known species distributions, sequences from type and topotype material), six SSHs were assigned to available species names that included the geographically widespread Phymatolithon calcareum, Lithothamnion corallioides, and L. glaciale; possible identities of other SSHs are discussed. Concordance between SSHs and morphospecies was minimal, highlighting the convenience of DNA barcoding for an accurate identification of maerl specimens. Our survey indicated that a majority of maerl forming species have small distribution ranges and revealed a gradual replacement of species with latitude. PMID:25111057
Hubert, Nicolas; Meyer, Christopher P; Bruggemann, Henrich J; Guérin, Fabien; Komeno, Roberto J L; Espiau, Benoit; Causse, Romain; Williams, Jeffrey T; Planes, Serge
2012-01-01
Diversity in coral reef fishes is not evenly distributed and tends to accumulate in the Indo-Malay-Philippines Archipelago (IMPA). The comprehension of the mechanisms that initiated this pattern is in its infancy despite its importance for the conservation of coral reefs. Considering the IMPA either as an area of overlap or a cradle of marine biodiversity, the hypotheses proposed to account for this pattern rely on extant knowledge about taxonomy and species range distribution. The recent large-scale use of standard molecular data (DNA barcoding), however, has revealed the importance of taking into account cryptic diversity when assessing tropical biodiversity. We DNA barcoded 2276 specimens belonging to 668 coral reef fish species through a collaborative effort conducted concomitantly in both Indian and Pacific oceans to appraise the importance of cryptic diversity in species with an Indo-Pacific distribution range. Of the 141 species sampled on each side of the IMPA, 62 presented no spatial structure whereas 67 exhibited divergent lineages on each side of the IMPA with K2P distances ranging between 1% and 12%, and 12 presented several lineages with K2P distances ranging between 3% and 22%. Thus, from this initial pool of 141 nominal species with Indo-Pacific distribution, 79 dissolved into 165 biological units among which 162 were found in a single ocean. This result is consistent with the view that the IMPA accumulates diversity as a consequence of its geological history, its location on the junction between the two main tropical oceans and the presence of a land bridge during glacial times in the IMPA that fostered allopatric divergence and secondary contacts between the Indian and Pacific oceans.
Hubert, Nicolas; Meyer, Christopher P.; Bruggemann, Henrich J.; Guérin, Fabien; Komeno, Roberto J. L.; Espiau, Benoit; Causse, Romain; Williams, Jeffrey T.; Planes, Serge
2012-01-01
Diversity in coral reef fishes is not evenly distributed and tends to accumulate in the Indo-Malay-Philippines Archipelago (IMPA). The comprehension of the mechanisms that initiated this pattern is in its infancy despite its importance for the conservation of coral reefs. Considering the IMPA either as an area of overlap or a cradle of marine biodiversity, the hypotheses proposed to account for this pattern rely on extant knowledge about taxonomy and species range distribution. The recent large-scale use of standard molecular data (DNA barcoding), however, has revealed the importance of taking into account cryptic diversity when assessing tropical biodiversity. We DNA barcoded 2276 specimens belonging to 668 coral reef fish species through a collaborative effort conducted concomitantly in both Indian and Pacific oceans to appraise the importance of cryptic diversity in species with an Indo-Pacific distribution range. Of the 141 species sampled on each side of the IMPA, 62 presented no spatial structure whereas 67 exhibited divergent lineages on each side of the IMPA with K2P distances ranging between 1% and 12%, and 12 presented several lineages with K2P distances ranging between 3% and 22%. Thus, from this initial pool of 141 nominal species with Indo-Pacific distribution, 79 dissolved into 165 biological units among which 162 were found in a single ocean. This result is consistent with the view that the IMPA accumulates diversity as a consequence of its geological history, its location on the junction between the two main tropical oceans and the presence of a land bridge during glacial times in the IMPA that fostered allopatric divergence and secondary contacts between the Indian and Pacific oceans. PMID:22438862
Osterhage, Deborah; Pogonoski, John J.; Appleyard, Sharon A.; White, William T.
2016-01-01
Fishes are one of the most intensively studied marine taxonomic groups yet cryptic species are still being discovered. An integrated taxonomic approach is used herein to delineate and describe a new cryptic seamoth (genus Pegasus) from what was previously a wide-ranging species. Preliminary mitochondrial DNA barcoding indicated possible speciation in Pegasus volitans specimens collected in surveys of the Torres Strait and Great Barrier Reef off Queensland in Australia. Morphological and meristic investigations found key differences in a number of characters between P. volitans and the new species, P. tetrabelos. Further mt DNA barcoding of both the COI and the slower mutating 16S genes of additional specimens provided strong support for two separate species. Pegasus tetrabelos and P. volitans are sympatric in northern Australia and were frequently caught together in trawls at the same depths. PMID:26934529
Identification of Rays through DNA Barcoding: An Application for Ecologists
Cerutti-Pereyra, Florencia; Meekan, Mark G.; Wei, Nu-Wei V.; O'Shea, Owen; Bradshaw, Corey J. A.; Austin, Chris M.
2012-01-01
DNA barcoding potentially offers scientists who are not expert taxonomists a powerful tool to support the accuracy of field studies involving taxa that are diverse and difficult to identify. The taxonomy of rays has received reasonable attention in Australia, although the fauna in remote locations such as Ningaloo Reef, Western Australia is poorly studied and the identification of some species in the field is problematic. Here, we report an application of DNA-barcoding to the identification of 16 species (from 10 genera) of tropical rays as part of an ecological study. Analysis of the dataset combined across all samples grouped sequences into clearly defined operational taxonomic units, with two conspicuous exceptions: the Neotrygon kuhlii species complex and the Aetobatus species complex. In the field, the group that presented the most difficulties for identification was the spotted whiptail rays, referred to as the ‘uarnak’ complex. Two sets of problems limited the successful application of DNA barcoding: (1) the presence of cryptic species, species complexes with unresolved taxonomic status and intra-specific geographical variation, and (2) insufficient numbers of entries in online databases that have been verified taxonomically, and the presence of lodged sequences in databases with inconsistent names. Nevertheless, we demonstrate the potential of the DNA barcoding approach to confirm field identifications and to highlight species complexes where taxonomic uncertainty might confound ecological data. PMID:22701556
Fiannaca, Antonino; La Rosa, Massimo; Rizzo, Riccardo; Urso, Alfonso
2015-07-01
In this paper, an alignment-free method for DNA barcode classification that is based on both a spectral representation and a neural gas network for unsupervised clustering is proposed. In the proposed methodology, distinctive words are identified from a spectral representation of DNA sequences. A taxonomic classification of the DNA sequence is then performed using the sequence signature, i.e., the smallest set of k-mers that can assign a DNA sequence to its proper taxonomic category. Experiments were then performed to compare our method with other supervised machine learning classification algorithms, such as support vector machine, random forest, ripper, naïve Bayes, ridor, and classification tree, which also consider short DNA sequence fragments of 200 and 300 base pairs (bp). The experimental tests were conducted over 10 real barcode datasets belonging to different animal species, which were provided by the on-line resource "Barcode of Life Database". The experimental results showed that our k-mer-based approach is directly comparable, in terms of accuracy, recall and precision metrics, with the other classifiers when considering full-length sequences. In addition, we demonstrate the robustness of our method when a classification is performed task with a set of short DNA sequences that were randomly extracted from the original data. For example, the proposed method can reach the accuracy of 64.8% at the species level with 200-bp fragments. Under the same conditions, the best other classifier (random forest) reaches the accuracy of 20.9%. Our results indicate that we obtained a clear improvement over the other classifiers for the study of short DNA barcode sequence fragments. Copyright © 2015 Elsevier B.V. All rights reserved.
Morise, Hisashi; Miyazaki, Erika; Yoshimitsu, Shoko; Eki, Toshihiko
2012-01-01
Soil nematodes play crucial roles in the soil food web and are a suitable indicator for assessing soil environments and ecosystems. Previous nematode community analyses based on nematode morphology classification have been shown to be useful for assessing various soil environments. Here we have conducted DNA barcode analysis for soil nematode community analyses in Japanese soils. We isolated nematodes from two different environmental soils of an unmanaged flowerbed and an agricultural field using the improved flotation-sieving method. Small subunit (SSU) rDNA fragments were directly amplified from each of 68 (flowerbed samples) and 48 (field samples) isolated nematodes to determine the nucleotide sequence. Sixteen and thirteen operational taxonomic units (OTUs) were obtained by multiple sequence alignment from the flowerbed and agricultural field nematodes, respectively. All 29 SSU rDNA-derived OTUs (rOTUs) were further mapped onto a phylogenetic tree with 107 known nematode species. Interestingly, the two nematode communities examined were clearly distinct from each other in terms of trophic groups: Animal predators and plant feeders were markedly abundant in the flowerbed soils, in contrast, bacterial feeders were dominantly observed in the agricultural field soils. The data from the flowerbed nematodes suggests a possible food web among two different trophic nematode groups and plants (weeds) in the closed soil environment. Finally, DNA sequences derived from the mitochondrial cytochrome oxidase c subunit 1 (COI) gene were determined as a DNA barcode from 43 agricultural field soil nematodes. These nematodes were assigned to 13 rDNA-derived OTUs, but in the COI gene analysis were assigned to 23 COI gene-derived OTUs (cOTUs), indicating that COI gene-based barcoding may provide higher taxonomic resolution than conventional SSU rDNA-barcoding in soil nematode community analysis. PMID:23284767
2009-01-01
Background Parthenium argentatum (guayule) is an industrial crop that produces latex, which was recently commercialized as a source of latex rubber safe for people with Type I latex allergy. The complete plastid genome of P. argentatum was sequenced. The sequence provides important information useful for genetic engineering strategies. Comparison to the sequences of plastid genomes from three other members of the Asteraceae, Lactuca sativa, Guitozia abyssinica and Helianthus annuus revealed details of the evolution of the four genomes. Chloroplast-specific DNA barcodes were developed for identification of Parthenium species and lines. Results The complete plastid genome of P. argentatum is 152,803 bp. Based on the overall comparison of individual protein coding genes with those in L. sativa, G. abyssinica and H. annuus, we demonstrate that the P. argentatum chloroplast genome sequence is most closely related to that of H. annuus. Similar to chloroplast genomes in G. abyssinica, L. sativa and H. annuus, the plastid genome of P. argentatum has a large 23 kb inversion with a smaller 3.4 kb inversion, within the large inversion. Using the matK and psbA-trnH spacer chloroplast DNA barcodes, three of the four Parthenium species tested, P. tomentosum, P. hysterophorus and P. schottii, can be differentiated from P. argentatum. In addition, we identified lines within P. argentatum. Conclusion The genome sequence of the P. argentatum chloroplast will enrich the sequence resources of plastid genomes in commercial crops. The availability of the complete plastid genome sequence may facilitate transformation efficiency by using the precise sequence of endogenous flanking sequences and regulatory elements in chloroplast transformation vectors. The DNA barcoding study forms the foundation for genetic identification of commercially significant lines of P. argentatum that are important for producing latex. PMID:19917140
Cristescu, Melania E
2014-10-01
DNA-based species identification, known as barcoding, transformed the traditional approach to the study of biodiversity science. The field is transitioning from barcoding individuals to metabarcoding communities. This revolution involves new sequencing technologies, bioinformatics pipelines, computational infrastructure, and experimental designs. In this dynamic genomics landscape, metabarcoding studies remain insular and biodiversity estimates depend on the particular methods used. In this opinion article, I discuss the need for a coordinated advancement of DNA-based species identification that integrates taxonomic and barcoding information. Such an approach would facilitate access to almost 3 centuries of taxonomic knowledge and 1 decade of building repository barcodes. Conservation projects are time sensitive, research funding is becoming restricted, and informed decisions depend on our ability to embrace integrative approaches to biodiversity science. Copyright © 2014 Elsevier Ltd. All rights reserved.
Authentication of Botanical Origin in Herbal Teas by Plastid Noncoding DNA Length Polymorphisms.
Uncu, Ali Tevfik; Uncu, Ayse Ozgur; Frary, Anne; Doganlar, Sami
2015-07-01
The aim of this study was to develop a DNA barcode assay to authenticate the botanical origin of herbal teas. To reach this aim, we tested the efficiency of a PCR-capillary electrophoresis (PCR-CE) approach on commercial herbal tea samples using two noncoding plastid barcodes, the trnL intron and the intergenic spacer between trnL and trnF. Barcode DNA length polymorphisms proved successful in authenticating the species origin of herbal teas. We verified the validity of our approach by sequencing species-specific barcode amplicons from herbal tea samples. Moreover, we displayed the utility of PCR-CE assays coupled with sequencing to identify the origin of undeclared plant material in herbal tea samples. The PCR-CE assays proposed in this work can be applied as routine tests for the verification of botanical origin in herbal teas and can be extended to authenticate all types of herbal foodstuffs.
Identification of processed Chinese medicinal materials using DNA mini-barcoding.
Song, Ming; Dong, Gang-Qiang; Zhang, Ya-Qin; Liu, Xia; Sun, Wei
2017-07-01
Most of Chinese medicinal herbs are subjected to traditional processing procedures, including stir-frying, charring, steaming, boiling, and calcining before they are released into dispensaries. The marketing and identification of processed medicinal materials is a growing issue in the marketplace. However, conventional methods of identification have limitations, while DNA mini-barcoding, based on the sequencing of a short-standardized region, has received considerable attention as a new potential means to identify processed medicinal materials. In the present study, six DNA barcode loci including ITS2, psbA-trnH, rbcL, matK, trnL (UAA) intron and its P6 loop, were employed for the authentication of 45 processed samples belonging to 15 species. We evaluated the amplification efficiency of each locus. We also examined the identification accuracy of the potential mini-barcode locus, of trnL (UAA) intron P6 loop. Our results showed that the five primary barcode loci were successfully amplified in only 8.89%-20% of the processed samples, while the amplification rates of the trnL (UAA) intron P6 loop were higher, at 75.56% successful amplification. We compared the mini-barcode sequences with Genbank using the Blast program. The analysis showed that 45.23% samples could be identified to genus level, while only one sample could be identified to the species level. We conclude that trnL (UAA) p6 loop is a candidate mini-barcode that has shown its potential and may become a universal mini-barcode as complementary barcode for authenticity testing and will play an important role in medicinal materials control. Copyright © 2017 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.
rbcL and matK earn two thumbs up as the core DNA barcode for ferns.
Li, Fay-Wei; Kuo, Li-Yaung; Rothfels, Carl J; Ebihara, Atsushi; Chiou, Wen-Liang; Windham, Michael D; Pryer, Kathleen M
2011-01-01
DNA barcoding will revolutionize our understanding of fern ecology, most especially because the accurate identification of the independent but cryptic gametophyte phase of the fern's life history--an endeavor previously impossible--will finally be feasible. In this study, we assess the discriminatory power of the core plant DNA barcode (rbcL and matK), as well as alternatively proposed fern barcodes (trnH-psbA and trnL-F), across all major fern lineages. We also present plastid barcode data for two genera in the hyperdiverse polypod clade--Deparia (Woodsiaceae) and the Cheilanthes marginata group (currently being segregated as a new genus of Pteridaceae)--to further evaluate the resolving power of these loci. Our results clearly demonstrate the value of matK data, previously unavailable in ferns because of difficulties in amplification due to a major rearrangement of the plastid genome. With its high sequence variation, matK complements rbcL to provide a two-locus barcode with strong resolving power. With sequence variation comparable to matK, trnL-F appears to be a suitable alternative barcode region in ferns, and perhaps should be added to the core barcode region if universal primer development for matK fails. In contrast, trnH-psbA shows dramatically reduced sequence variation for the majority of ferns. This is likely due to the translocation of this segment of the plastid genome into the inverted repeat regions, which are known to have a highly constrained substitution rate. Our study provides the first endorsement of the two-locus barcode (rbcL+matK) in ferns, and favors trnL-F over trnH-psbA as a potential back-up locus. Future work should focus on gathering more fern matK sequence data to facilitate universal primer development.
Conran, John G.; Li, Jie
2015-01-01
Background Within a regional floristic context, DNA barcoding is more useful to manage plant diversity inventories on a large scale and develop valuable conservation strategies. However, there are no DNA barcode studies from tropical areas of China, which represents one of the biodiversity hotspots around the world. Methodology and Principal Findings A DNA barcoding database of an Asian tropical trees with high diversity was established at Xishuangbanna Nature Reserve, Yunnan, southwest China using rbcL and matK as standard barcodes, as well as trnH–psbA and ITS as supplementary barcodes. The performance of tree species identification success was assessed using 2,052 accessions from four plots belonging to two vegetation types in the region by three methods: Neighbor-Joining, Maximum-Likelihood and BLAST. We corrected morphological field identification errors (9.6%) for the three plots using rbcL and matK based on Neighbor-Joining tree. The best barcode region for PCR and sequencing was rbcL (97.6%, 90.8%), followed by trnH–psbA (93.6%, 85.6%), while matK and ITS obtained relative low PCR and sequencing success rates. However, ITS performed best for both species (44.6–58.1%) and genus (72.8–76.2%) identification. With trnH–psbA slightly less effective for species identification. The two standard barcode rbcL and matK gave poor results for species identification (24.7–28.5% and 31.6–35.3%). Compared with other studies from comparable tropical forests (e.g. Cameroon, the Amazon and India), the overall performance of the four barcodes for species identification was lower for the Xishuangbanna Nature Reserve, possibly because of species/genus ratios and species composition between these tropical areas. Conclusions/Significance Although the core barcodes rbcL and matK were not suitable for species identification of tropical trees from Xishuangbanna Nature Reserve, they could still help with identification at the family and genus level. Considering the relative sequence recovery and the species identification performance, we recommend the use of trnH–psbA and ITS in combination as the preferred barcodes for tropical tree species identification in China. PMID:26121045
Kukita, Yoji; Matoba, Ryo; Uchida, Junji; Hamakawa, Takuya; Doki, Yuichiro; Imamura, Fumio; Kato, Kikuya
2015-08-01
Circulating tumour DNA (ctDNA) is an emerging field of cancer research. However, current ctDNA analysis is usually restricted to one or a few mutation sites due to technical limitations. In the case of massively parallel DNA sequencers, the number of false positives caused by a high read error rate is a major problem. In addition, the final sequence reads do not represent the original DNA population due to the global amplification step during the template preparation. We established a high-fidelity target sequencing system of individual molecules identified in plasma cell-free DNA using barcode sequences; this system consists of the following two steps. (i) A novel target sequencing method that adds barcode sequences by adaptor ligation. This method uses linear amplification to eliminate the errors introduced during the early cycles of polymerase chain reaction. (ii) The monitoring and removal of erroneous barcode tags. This process involves the identification of individual molecules that have been sequenced and for which the number of mutations have been absolute quantitated. Using plasma cell-free DNA from patients with gastric or lung cancer, we demonstrated that the system achieved near complete elimination of false positives and enabled de novo detection and absolute quantitation of mutations in plasma cell-free DNA. © The Author 2015. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Jin, Qian; Han, Huilin; Hu, XiMin; Li, XinHai; Zhu, ChaoDong; Ho, Simon Y. W.; Ward, Robert D.; Zhang, Ai-bing
2013-01-01
With the ongoing loss of biodiversity, there is a great need for fast and effective ways to assess species richness and diversity: DNA barcoding provides a powerful new tool for this. We investigated this approach by focusing on the Tibetan plateau, which is one of the world's top biodiversity hotspots. There have been few studies of its invertebrates, although they constitute the vast majority of the region's diversity. Here we investigated species diversity of the lepidopteran family Noctuidae, across different environmental gradients, using measurements based on traditional morphology as well as on DNA barcoding. The COI barcode showed an average interspecific K2P distance of , which is about four times larger than the mean intraspecific distance (). Using six diversity indices, we did not detect any significant differences in estimated species diversity between measurements based on traditional morphology and on DNA barcoding. Furthermore, we found strong positive correlations between them, indicating that barcode-based measures of species diversity can serve as a good surrogate for morphology-based measures in most situations tested. Eastern communities were found to have significantly higher diversity than Western ones. Among 22 environmental factors tested, we found that three (precipitation of driest month, precipitation of driest quarter, and precipitation of coldest quarter) were significantly correlated with species diversity. Our results indicate that these factors could be the key ecological factors influencing the species diversity of the lepidopteran family Noctuidae on the Tibetan plateau. PMID:23741330
Chao, Zhi; Liao, Jing; Liang, Zhenbiao; Huang, Suhua; Zhang, Liang; Li, Junde
2014-01-01
Objective: To test the feasibility of DNA barcoding for accurate identification of Jinqian Baihua She and its adulterants. Materials and Methods: Standard cytochrome C oxidase subunit I (COI) gene fragments were sequenced for DNA barcoding of 39 samples from 9 snake species, including Bungarus multicinctus, the officially recognized origin animal by Chinese Pharmacopoeia, and other 8 adulterate species. The aligned sequences, 658 base pairs in length, were analyzed for divergence using the Kimura-2-parameter (K2P) distance model with MEGA5.0. Results: The mean intraspecific K2P distance was 0.0103 and the average interspecific genetic distance was 0.2178 in B. multicinctus, far greater than the minimal interspecific genetic distance of 0.027 recommended for species identification. A neighbor-joining (NJ) tree was constructed, in which each species formed a monophyletic clade with bootstrap supports of 100%. All the data were submitted to Barcode of Life Data system version 3.0 (BOLD, http://www.barcodinglife.org) under the project title “DNA barcoding Bungarus multicinctus and its adulterants”. Ten samples of commercially available crude drugs of JBS were identified using the identification engine provided by BOLD. All the samples were clearly identified at the species level, among which five were found to be the adulterants and identified as Dinodon rufozonatum. Conclusion: DNA barcoding using the standard COI gene fragments provides an effective and accurate means for JBS identification and authentication. PMID:25422545
Nwani, Christopher D; Becker, Sven; Braid, Heather E; Ude, Emmanuel F; Okogwu, Okechukwu I; Hanner, Robert
2011-10-01
Fishes are the main animal protein source for human beings and play a vital role in aquatic ecosystems and food webs. Fish identification can be challenging, especially in the tropics (due to high diversity), and this is particularly true for larval forms or fragmentary remains. DNA barcoding, which uses the 5' region of the mitochondrial cytochrome c oxidase subunit I (COI) as a target gene, is an efficient method for standardized species-level identification for biodiversity assessment and conservation, pending the establishment of reference sequence libraries. In this study, fishes were collected from three rivers in southeastern Nigeria, identified morphologically, and imaged digitally. DNA was extracted, PCR-amplified, and the standard barcode region was bidirectionally sequenced for 363 individuals belonging to 70 species in 38 genera. All specimen provenance data and associated sequence information were recorded in the barcode of life data systems (BOLD; www.barcodinglife.org ). Analytical tools on BOLD were used to assess the performance of barcoding to identify species. Using neighbor-joining distance comparison, the average genetic distance was 60-fold higher between species than within species, as pairwise genetic distance estimates averaged 10.29% among congeners and only 0.17% among conspecifics. Despite low levels of divergence within species, we observed river system-specific haplotype partitioning within eight species (11.4% of all species). Our preliminary results suggest that DNA barcoding is very effective for species identification of Nigerian freshwater fishes.
Yao, Hui; Song, Jing-Yuan; Ma, Xin-Ye; Liu, Chang; Li, Ying; Xu, Hong-Xi; Han, Jian-Ping; Duan, Li-Sheng; Chen, Shi-Lin
2009-05-01
DNA barcoding is a novel technology that uses a standard DNA sequence to facilitate species identification. Although a consensus has not been reached regarding which DNA sequences can be used as the best plant barcodes, the psbA-trnH spacer region has been tested extensively in recent years. In this study, we hypothesize that the psbA-trnH spacer regions are also effective barcodes for Dendrobium species. We have sequenced the chloroplast psbA-trnH intergenic spacers of 17 Dendrobium species to test this hypothesis. The sequences were found to be significantly different from those of other species, with percentages of variation ranging from 0.3 % to 2.3 % and an average of 1.2 %. In contrast, the intraspecific variation among the Dendrobium species studied ranged from 0 % to 0.1 %. The sequence difference between the psbA-trnH sequences of 17 Dendrobium species and one Bulbophyllum odoratissimum ranged from 2.0 % to 3.1 %, with an average of 2.5 %. Our results support the notion that the psbA-trnH intergenic spacer region could be used as a barcode to distinguish various Dendrobium species and to differentiate Dendrobium species from other adulterating species. Copyright Georg Thieme Verlag KG Stuttgart. New York.
Elías-Gutiérrez, Manuel; Valdez-Moreno, Martha; Topan, Janet; Young, Monica R; Cohuo-Colli, José Angel
2018-03-01
Currently, freshwater zooplankton sampling and identification methodologies have remained virtually unchanged since they were first established in the beginning of the XX century. One major contributing factor to this slow progress is the limited success of modern genetic methodologies, such as DNA barcoding, in several of the main groups. This study demonstrates improved protocols which enable the rapid assessment of most animal taxa inhabiting any freshwater system by combining the use of light traps, careful fixation at low temperatures using ethanol, and zooplankton-specific primers. We DNA-barcoded 2,136 specimens from a diverse array of taxonomic assemblages (rotifers, mollusks, mites, crustaceans, insects, and fishes) from several Canadian and Mexican lakes with an average sequence success rate of 85.3%. In total, 325 Barcode Index Numbers (BINs) were detected with only three BINs (two cladocerans and one copepod) shared between Canada and Mexico, suggesting a much narrower distribution range of freshwater zooplankton than previously thought. This study is the first to broadly explore the metazoan biodiversity of freshwater systems with DNA barcodes to construct a reference library that represents the first step for future programs which aim to monitor ecosystem health, track invasive species, or improve knowledge of the ecology and distribution of freshwater zooplankton.
Scaling up discovery of hidden diversity in fungi: impacts of barcoding approaches.
Yahr, Rebecca; Schoch, Conrad L; Dentinger, Bryn T M
2016-09-05
The fungal kingdom is a hyperdiverse group of multicellular eukaryotes with profound impacts on human society and ecosystem function. The challenge of documenting and describing fungal diversity is exacerbated by their typically cryptic nature, their ability to produce seemingly unrelated morphologies from a single individual and their similarity in appearance to distantly related taxa. This multiplicity of hurdles resulted in the early adoption of DNA-based comparisons to study fungal diversity, including linking curated DNA sequence data to expertly identified voucher specimens. DNA-barcoding approaches in fungi were first applied in specimen-based studies for identification and discovery of taxonomic diversity, but are now widely deployed for community characterization based on sequencing of environmental samples. Collectively, fungal barcoding approaches have yielded important advances across biological scales and research applications, from taxonomic, ecological, industrial and health perspectives. A major outstanding issue is the growing problem of 'sequences without names' that are somewhat uncoupled from the traditional framework of fungal classification based on morphology and preserved specimens. This review summarizes some of the most significant impacts of fungal barcoding, its limitations, and progress towards the challenge of effective utilization of the exponentially growing volume of data gathered from high-throughput sequencing technologies.This article is part of the themed issue 'From DNA barcodes to biomes'. © 2016 The Authors.
[DNA barcoding and its utility in commonly-used medicinal snakes].
Huang, Yong; Zhang, Yue-yun; Zhao, Cheng-jian; Xu, Yong-li; Gu, Ying-le; Huang, Wen-qi; Lin, Kui; Li, Li
2015-03-01
Identification accuracy of traditional Chinese medicine is crucial for the traditional Chinese medicine research, production and application. DNA barcoding based on the mitochondrial gene coding for cytochrome c oxidase subunit I (COI), are more and more used for identification of traditional Chinese medicine. Using universal barcoding primers to sequence, we discussed the feasibility of DNA barcoding method for identification commonly-used medicinal snakes (a total of 109 samples belonging to 19 species 15 genera 6 families). The phylogenetic trees using Neighbor-joining were constructed. The results indicated that the mean content of G + C(46.5%) was lower than that of A + T (53.5%). As calculated by Kimera-2-parameter model, the mean intraspecies genetic distance of Trimeresurus albolabris, Ptyas dhumnades and Lycodon rufozonatus was greater than 2%. Further phylogenetic relationship results suggested that identification of one sample of T. albolabris was erroneous. The identification of some samples of P. dhumnades was also not correct, namely originally P. korros was identified as P. dhumnades. Factors influence on intraspecific genetic distance difference of L. rufozonatus need to be studied further. Therefore, DNA barcoding for identification of medicinal snakes is feasible, and greatly complements the morphological classification method. It is necessary to further study in identification of traditional Chinese medicine.
Wen, Jun; Ebihara, Atsushi; Li, De-Zhu
2016-01-01
DNA barcoding is a fast-developing technique to identify species by using short and standard DNA sequences. Universal selection of DNA barcodes in ferns remains unresolved. In this study, five plastid regions (rbcL, matK, trnH-psbA, trnL-F and rps4-trnS) and eight nuclear regions (ITS, pgiC, gapC, LEAFY, ITS2, IBR3_2, DET1, and SQD1_1) were screened and evaluated in the fern genus Adiantum from China and neighboring areas. Due to low primer universality (matK) and/or the existence of multiple copies (ITS), the commonly used barcodes matK and ITS were not appropriate for Adiantum. The PCR amplification rate was extremely low in all nuclear genes except for IBR3_2. rbcL had the highest PCR amplification rate (94.33%) and sequencing success rate (90.78%), while trnH-psbA had the highest species identification rate (75%). With the consideration of discriminatory power, cost-efficiency and effort, the two-barcode combination of rbcL+ trnH-psbA seems to be the best choice for barcoding Adiantum, and perhaps basal polypod ferns in general. The nuclear IBR3_2 showed 100% PCR amplification success rate in Adiantum, however, it seemed that only diploid species could acquire clean sequences without cloning. With cloning, IBR3_2 can successfully distinguish cryptic species and hybrid species from their related species. Because hybridization and allopolyploidy are common in ferns, we argue for including a selected group of nuclear loci as barcodes, especially via the next-generation sequencing, as it is much more efficient to obtain single-copy nuclear loci without the cloning procedure. PMID:27603700
DNA barcodes from four loci provide poor resolution of taxonomic groups in the genus Crataegus.
Zarrei, Mehdi; Talent, Nadia; Kuzmina, Maria; Lee, Jeanette; Lund, Jensen; Shipley, Paul R; Stefanović, Saša; Dickinson, Timothy A
2015-04-28
DNA barcodes can facilitate identification of organisms especially when morphological characters are limited or unobservable. To what extent this potential is realized in specific groups of plants remains to be determined. Libraries of barcode sequences from well-studied authoritatively identified plants represented by herbarium voucher specimens are needed in order for DNA barcodes to serve their intended purpose, where this is possible, and to understand the reasons behind their failure to do so, when this occurs. We evaluated four loci, widely regarded as universal DNA barcodes for plants, for their utility in hawthorn species identification. Three plastid regions, matK, rbcLa and psbA-trnH, and the internal transcribed spacer 2 (ITS2) of nuclear ribosomal DNA discriminate only some of the species of Crataegus that can be recognized on the basis of their morphology etc. This is, in part, because in Rosaceae tribe Maleae most individual plastid loci yield relatively little taxonomic resolution and, in part, because the effects of allopolyploidization have not been eliminated by concerted evolution of the ITS regions. Although individual plastid markers provided generally poor resolution of taxonomic groups in Crataegus, a few species were notable exceptions. In contrast, analyses of concatenated sequences of the 3 plastid barcode loci plus 11 additional plastid loci gave a well-resolved maternal phylogeny. In the ITS2 tree, different individuals of some species formed groups with taxonomically unrelated species. This is a sign of lineage sorting due to incomplete concerted evolution in ITS2. Incongruence between the ITS2 and plastid trees is best explained by hybridization between different lineages within the genus. In aggregate, limited between-species variation in plastid loci, hybridization and a lack of concerted evolution in ITS2 all combine to limit the utility of standard barcoding markers in Crataegus. These results have implications for authentication of hawthorn materials in natural health products. Published by Oxford University Press on behalf of the Annals of Botany Company.
DNA barcodes from four loci provide poor resolution of taxonomic groups in the genus Crataegus
Zarrei, Mehdi; Talent, Nadia; Kuzmina, Maria; Lee, Jeanette; Lund, Jensen; Shipley, Paul R.; Stefanović, Saša; Dickinson, Timothy A.
2015-01-01
DNA barcodes can facilitate identification of organisms especially when morphological characters are limited or unobservable. To what extent this potential is realized in specific groups of plants remains to be determined. Libraries of barcode sequences from well-studied authoritatively identified plants represented by herbarium voucher specimens are needed in order for DNA barcodes to serve their intended purpose, where this is possible, and to understand the reasons behind their failure to do so, when this occurs. We evaluated four loci, widely regarded as universal DNA barcodes for plants, for their utility in hawthorn species identification. Three plastid regions, matK, rbcLa and psbA-trnH, and the internal transcribed spacer 2 (ITS2) of nuclear ribosomal DNA discriminate only some of the species of Crataegus that can be recognized on the basis of their morphology etc. This is, in part, because in Rosaceae tribe Maleae most individual plastid loci yield relatively little taxonomic resolution and, in part, because the effects of allopolyploidization have not been eliminated by concerted evolution of the ITS regions. Although individual plastid markers provided generally poor resolution of taxonomic groups in Crataegus, a few species were notable exceptions. In contrast, analyses of concatenated sequences of the 3 plastid barcode loci plus 11 additional plastid loci gave a well-resolved maternal phylogeny. In the ITS2 tree, different individuals of some species formed groups with taxonomically unrelated species. This is a sign of lineage sorting due to incomplete concerted evolution in ITS2. Incongruence between the ITS2 and plastid trees is best explained by hybridization between different lineages within the genus. In aggregate, limited between-species variation in plastid loci, hybridization and a lack of concerted evolution in ITS2 all combine to limit the utility of standard barcoding markers in Crataegus. These results have implications for authentication of hawthorn materials in natural health products. PMID:25926325
Yang, Jia; Vázquez, Lucía; Chen, Xiaodan; Li, Huimin; Zhang, Hao; Liu, Zhanlin; Zhao, Guifang
2017-01-01
Chloroplast DNA (cpDNA) is frequently used for species demography, evolution, and species discrimination of plants. However, the lack of efficient and universal markers often brings particular challenges for genetic studies across different plant groups. In this study, chloroplast genomes from two closely related species (Quercus rubra and Castanea mollissima) in Fagaceae were compared to explore universal cpDNA markers for the Chinese oak species in Quercus subgenus Quercus, a diverse species group without sufficient molecular differentiation. With the comparison, nine and 14 plastid markers were selected as barcoding and phylogeographic candidates for the Chinese oaks. Five (psbA-trnH, matK-trnK, ycf3-trnS, matK, and ycf1) of the nine plastid candidate barcodes, with the addition of newly designed ITS and a single-copy nuclear gene (SAP), were then tested on 35 Chinese oak species employing four different barcoding approaches (genetic distance-, BLAST-, character-, and tree-based methods). The four methods showed different species identification powers with character-based method performing the best. Of the seven barcodes tested, a barcoding gap was absent in all of them across the Chinese oaks, while ITS and psbA-trnH provided the highest species resolution (30.30%) with the character- and BLAST-based methods, respectively. The six-marker combination (psbA-trnH + matK-trnK + matK + ycf1 + ITS + SAP) showed the best species resolution (84.85%) using the character-based method for barcoding the Chinese oaks. The barcoding results provided additional implications for taxonomy of the Chinese oaks in subg. Quercus, basically identifying three major infrageneric clades of the Chinese oaks (corresponding to Groups Quercus, Cerris, and Ilex) referenced to previous phylogenetic classification of Quercus. While the morphology-based allocations proposed for the Chinese oaks in subg. Quercus were challenged. A low variation rate of the chloroplast genome, and complex speciation patterns involving incomplete lineage sorting, interspecific hybridization and introgression, possibly have negative impacts on the species assignment and phylogeny of oak species. PMID:28579999
Schoch, Conrad L.; Seifert, Keith A.; Huhndorf, Sabine; Robert, Vincent; Spouge, John L.; Levesque, C. André; Chen, Wen; Bolchacova, Elena; Voigt, Kerstin; Crous, Pedro W.; Miller, Andrew N.; Wingfield, Michael J.; Aime, M. Catherine; An, Kwang-Deuk; Bai, Feng-Yan; Barreto, Robert W.; Begerow, Dominik; Bergeron, Marie-Josée; Blackwell, Meredith; Boekhout, Teun; Bogale, Mesfin; Boonyuen, Nattawut; Burgaz, Ana R.; Buyck, Bart; Cai, Lei; Cai, Qing; Cardinali, G.; Chaverri, Priscila; Coppins, Brian J.; Crespo, Ana; Cubas, Paloma; Cummings, Craig; Damm, Ulrike; de Beer, Z. Wilhelm; de Hoog, G. Sybren; Del-Prado, Ruth; Dentinger, Bryn; Diéguez-Uribeondo, Javier; Divakar, Pradeep K.; Douglas, Brian; Dueñas, Margarita; Duong, Tuan A.; Eberhardt, Ursula; Edwards, Joan E.; Elshahed, Mostafa S.; Fliegerova, Katerina; Furtado, Manohar; García, Miguel A.; Ge, Zai-Wei; Griffith, Gareth W.; Griffiths, K.; Groenewald, Johannes Z.; Groenewald, Marizeth; Grube, Martin; Gryzenhout, Marieka; Guo, Liang-Dong; Hagen, Ferry; Hambleton, Sarah; Hamelin, Richard C.; Hansen, Karen; Harrold, Paul; Heller, Gregory; Herrera, Cesar; Hirayama, Kazuyuki; Hirooka, Yuuri; Ho, Hsiao-Man; Hoffmann, Kerstin; Hofstetter, Valérie; Högnabba, Filip; Hollingsworth, Peter M.; Hong, Seung-Beom; Hosaka, Kentaro; Houbraken, Jos; Hughes, Karen; Huhtinen, Seppo; Hyde, Kevin D.; James, Timothy; Johnson, Eric M.; Johnson, Joan E.; Johnston, Peter R.; Jones, E.B. Gareth; Kelly, Laura J.; Kirk, Paul M.; Knapp, Dániel G.; Kõljalg, Urmas; Kovács, Gábor M.; Kurtzman, Cletus P.; Landvik, Sara; Leavitt, Steven D.; Liggenstoffer, Audra S.; Liimatainen, Kare; Lombard, Lorenzo; Luangsa-ard, J. Jennifer; Lumbsch, H. Thorsten; Maganti, Harinad; Maharachchikumbura, Sajeewa S. N.; Martin, María P.; May, Tom W.; McTaggart, Alistair R.; Methven, Andrew S.; Meyer, Wieland; Moncalvo, Jean-Marc; Mongkolsamrit, Suchada; Nagy, László G.; Nilsson, R. Henrik; Niskanen, Tuula; Nyilasi, Ildikó; Okada, Gen; Okane, Izumi; Olariaga, Ibai; Otte, Jürgen; Papp, Tamás; Park, Duckchul; Petkovits, Tamás; Pino-Bodas, Raquel; Quaedvlieg, William; Raja, Huzefa A.; Redecker, Dirk; Rintoul, Tara L.; Ruibal, Constantino; Sarmiento-Ramírez, Jullie M.; Schmitt, Imke; Schüßler, Arthur; Shearer, Carol; Sotome, Kozue; Stefani, Franck O.P.; Stenroos, Soili; Stielow, Benjamin; Stockinger, Herbert; Suetrong, Satinee; Suh, Sung-Oui; Sung, Gi-Ho; Suzuki, Motofumi; Tanaka, Kazuaki; Tedersoo, Leho; Telleria, M. Teresa; Tretter, Eric; Untereiner, Wendy A.; Urbina, Hector; Vágvölgyi, Csaba; Vialle, Agathe; Vu, Thuy Duong; Walther, Grit; Wang, Qi-Ming; Wang, Yan; Weir, Bevan S.; Weiß, Michael; White, Merlin M.; Xu, Jianping; Yahr, Rebecca; Yang, Zhu L.; Yurkov, Andrey; Zamora, Juan-Carlos; Zhang, Ning; Zhuang, Wen-Ying; Schindel, David
2012-01-01
Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups. PMID:22454494
Schoch, Conrad L; Seifert, Keith A; Huhndorf, Sabine; Robert, Vincent; Spouge, John L; Levesque, C André; Chen, Wen
2012-04-17
Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups.
Guarnizo, Carlos E.; Paz, Andrea; Muñoz-Ortiz, Astrid; Flechas, Sandra V.; Méndez-Narváez, Javier; Crawford, Andrew J.
2015-01-01
Colombia hosts the second highest amphibian species diversity on Earth, yet its fauna remains poorly studied, especially using molecular genetic techniques. We present the results of the first wide-scale DNA barcoding survey of anurans of Colombia, focusing on a transect across the Eastern Cordillera. We surveyed 10 sites between the Magdalena Valley to the west and the eastern foothills of the Eastern Cordillera, sequencing portions of the mitochondrial 16S ribosomal RNA and cytochrome oxidase subunit 1 (CO1) genes for 235 individuals from 52 nominal species. We applied two barcode algorithms, Automatic Barcode Gap Discovery and Refined Single Linkage Analysis, to estimate the number of clusters or “unconfirmed candidate species” supported by DNA barcode data. Our survey included ~7% of the anuran species known from Colombia. While barcoding algorithms differed slightly in the number of clusters identified, between three and ten nominal species may be obscuring candidate species (in some cases, more than one cryptic species per nominal species). Our data suggest that the high elevations of the Eastern Cordillera and the low elevations of the Chicamocha canyon acted as geographic barriers in at least seven nominal species, promoting strong genetic divergences between populations associated with the Eastern Cordillera. PMID:26000447
Evaluation of candidate barcoding markers in Orinus (Poaceae).
Su, X; Liu, Y P; Chen, Z; Chen, K L
2016-04-26
Orinus is an alpine endemic genus of Poaceae. Because of the imperfect specimens, high level of intraspecific morphological variability, and homoplasies of morphological characters, it is relatively difficult to delimitate species of Orinus by using morphology alone. To this end, the DNA barcoding has shown great potential in identifying species. The present study is the first attempt to test the feasibility of four proposed DNA barcoding markers (matK, rbcL, trnH-psbA, and ITS) in identifying four currently revised species of Orinus from the Qinghai-Tibetan Plateau (QTP). Among all the single-barcode candidates, the differentiation power was the highest for the nuclear internal transcribed spacer (ITS), while the chloroplast barcodes matK (M), rbcL (R), and trnH-psbA (H) could not identify the species. Meanwhile, the differentiation efficiency of the nuclear ITS (I) was also higher than any two- or three-locus combination of chloroplast barcodes, or even a combination of ITS and any chloroplast barcode except H + I and R + I. All the combinations of chloroplast barcodes plus the nuclear ITS, H + I, and R + I differentiated the highest portion of species. The highest differentiation rate for the barcodes or barcode combinations examined here was 100% (H + I and R + I). In summary, this case study showed that the nuclear ITS region represents a more promising barcode than any maternally inherited chloroplast region or combination of chloroplast regions in differentiating Orinus species from the QTP. Moreover, combining the ITS region with chloroplast regions may improve the barcoding success rate.
Kress, W. John; Erickson, David L.
2007-01-01
Background A useful DNA barcode requires sufficient sequence variation to distinguish between species and ease of application across a broad range of taxa. Discovery of a DNA barcode for land plants has been limited by intrinsically lower rates of sequence evolution in plant genomes than that observed in animals. This low rate has complicated the trade-off in finding a locus that is universal and readily sequenced and has sufficiently high sequence divergence at the species-level. Methodology/Principal Findings Here, a global plant DNA barcode system is evaluated by comparing universal application and degree of sequence divergence for nine putative barcode loci, including coding and non-coding regions, singly and in pairs across a phylogenetically diverse set of 48 genera (two species per genus). No single locus could discriminate among species in a pair in more than 79% of genera, whereas discrimination increased to nearly 88% when the non-coding trnH-psbA spacer was paired with one of three coding loci, including rbcL. In silico trials were conducted in which DNA sequences from GenBank were used to further evaluate the discriminatory power of a subset of these loci. These trials supported the earlier observation that trnH-psbA coupled with rbcL can correctly identify and discriminate among related species. Conclusions/Significance A combination of the non-coding trnH-psbA spacer region and a portion of the coding rbcL gene is recommended as a two-locus global land plant barcode that provides the necessary universality and species discrimination. PMID:17551588
Yao, Peng-Cheng; Gao, Hai-Yan; Wei, Ya-Nan; Zhang, Jian-Hang; Chen, Xiao-Yong
2017-01-01
Environmental conditions in coastal salt marsh habitats have led to the development of specialist genetic adaptations. We evaluated six DNA barcode loci of the 53 species of Poaceae and 15 species of Chenopodiaceae from China's coastal salt marsh area and inland area. Our results indicate that the optimum DNA barcode was ITS for coastal salt-tolerant Poaceae and matK for the Chenopodiaceae. Sampling strategies for ten common species of Poaceae and Chenopodiaceae were analyzed according to optimum barcode. We found that by increasing the number of samples collected from the coastal salt marsh area on the basis of inland samples, the number of haplotypes of Arundinella hirta, Digitaria ciliaris, Eleusine indica, Imperata cylindrica, Setaria viridis, and Chenopodium glaucum increased, with a principal coordinate plot clearly showing increased distribution points. The results of a Mann-Whitney test showed that for Digitaria ciliaris, Eleusine indica, Imperata cylindrica, and Setaria viridis, the distribution of intraspecific genetic distances was significantly different when samples from the coastal salt marsh area were included (P < 0.01). These results suggest that increasing the sample size in specialist habitats can improve measurements of intraspecific genetic diversity, and will have a positive effect on the application of the DNA barcodes in widely distributed species. The results of random sampling showed that when sample size reached 11 for Chloris virgata, Chenopodium glaucum, and Dysphania ambrosioides, 13 for Setaria viridis, and 15 for Eleusine indica, Imperata cylindrica and Chenopodium album, average intraspecific distance tended to reach stability. These results indicate that the sample size for DNA barcode of globally distributed species should be increased to 11–15. PMID:28934362
Yao, Peng-Cheng; Gao, Hai-Yan; Wei, Ya-Nan; Zhang, Jian-Hang; Chen, Xiao-Yong; Li, Hong-Qing
2017-01-01
Environmental conditions in coastal salt marsh habitats have led to the development of specialist genetic adaptations. We evaluated six DNA barcode loci of the 53 species of Poaceae and 15 species of Chenopodiaceae from China's coastal salt marsh area and inland area. Our results indicate that the optimum DNA barcode was ITS for coastal salt-tolerant Poaceae and matK for the Chenopodiaceae. Sampling strategies for ten common species of Poaceae and Chenopodiaceae were analyzed according to optimum barcode. We found that by increasing the number of samples collected from the coastal salt marsh area on the basis of inland samples, the number of haplotypes of Arundinella hirta, Digitaria ciliaris, Eleusine indica, Imperata cylindrica, Setaria viridis, and Chenopodium glaucum increased, with a principal coordinate plot clearly showing increased distribution points. The results of a Mann-Whitney test showed that for Digitaria ciliaris, Eleusine indica, Imperata cylindrica, and Setaria viridis, the distribution of intraspecific genetic distances was significantly different when samples from the coastal salt marsh area were included (P < 0.01). These results suggest that increasing the sample size in specialist habitats can improve measurements of intraspecific genetic diversity, and will have a positive effect on the application of the DNA barcodes in widely distributed species. The results of random sampling showed that when sample size reached 11 for Chloris virgata, Chenopodium glaucum, and Dysphania ambrosioides, 13 for Setaria viridis, and 15 for Eleusine indica, Imperata cylindrica and Chenopodium album, average intraspecific distance tended to reach stability. These results indicate that the sample size for DNA barcode of globally distributed species should be increased to 11-15.
Serrao, Natasha R; Steinke, Dirk; Hanner, Robert H
2014-01-01
Detecting and documenting the occurrence of invasive species outside their native range requires tools to support their identification. This can be challenging for taxa with diverse life stages and/or problematic or unresolved morphological taxonomies. DNA barcoding provides a potent method for identifying invasive species, as it allows for species identification at all life stages, including fragmentary remains. It also provides an efficient interim taxonomic framework for quantifying cryptic genetic diversity by parsing barcode sequences into discontinuous haplogroup clusters (typical of reproductively isolated species) and labelling them with unique alphanumeric identifiers. Snakehead fishes are a diverse group of opportunistic predators endemic to Asia and Africa that may potentially pose significant threats as aquatic invasive species. At least three snakehead species (Channa argus, C. maculata, and C. marulius) are thought to have entered North America through the aquarium and live-food fish markets, and have established populations, yet their origins remain unclear. The objectives of this study were to assemble a library of DNA barcode sequences derived from expert identified reference specimens in order to determine the identity and aid invasion pathway analysis of the non-indigenous species found in North America using DNA barcodes. Sequences were obtained from 121 tissue samples representing 25 species and combined with public records from GenBank for a total of 36 putative species, which then partitioned into 49 discrete haplogroups. Multiple divergent clusters were observed within C. gachua, C. marulius, C. punctata and C. striata suggesting the potential presence of cryptic species diversity within these lineages. Our findings demonstrate that DNA barcoding is a valuable tool for species identification in challenging and under-studied taxonomic groups such as snakeheads, and provides a useful framework for inferring invasion pathway analysis.
Lowenstein, Jacob H; Osmundson, Todd W; Becker, Sven; Hanner, Robert; Stiassny, Melanie L J
2011-10-01
Here we describe preliminary efforts to integrate DNA barcoding into an ongoing inventory of the Lower Congo River (LCR) ichthyofauna. The 350 km stretch of the LCR from Pool Malebo to Boma includes the world's largest river rapids. The LCR ichthyofauna is hyperdiverse and rich in endemism due to high habitat heterogeneity, numerous dispersal barriers, and its downstream location in the basin. We have documented 328 species from the LCR, 25% of which are thought to be endemic. In addition to detailing progress made to generate a reference sequence library of DNA barcodes for these fishes, we ask how DNA can be used at the current stage of the Fish Barcode of Life initiative, as a work in progress currently of limited utility to a wide audience. Two possibilities that we explore are the potential for DNA barcodes to generate discrete diagnostic characters for species, and to help resolve problematic taxa lacking clear morphologically diagnostic characters such as many species of the cyprinid genus Labeo, which we use as a case study. Our molecular analysis helped to clarify the validity of some species that were the subject of historical debate, and we were able to construct a molecular key for all monophyletic and morphologically recognizable species. Several species sampled from across the Congo Basin and widely distributed throughout Central and West Africa were recovered as paraphyletic based on our molecular data. Our study underscores the importance of generating reference barcodes for specimens collected from, or in close proximity to, type localities, particularly where species are poorly understood taxonomically and the extent of their geographical distributions have yet to be established.
Saarela, Jeffery M.; Sokoloff, Paul C.; Gillespie, Lynn J.; Consaul, Laurie L.; Bull, Roger D.
2013-01-01
Accurate identification of Arctic plant species is critical for understanding potential climate-induced changes in their diversity and distributions. To facilitate rapid identification we generated DNA barcodes for the core plastid barcode loci (rbcL and matK) for 490 vascular plant species, representing nearly half of the Canadian Arctic flora and 93% of the flora of the Canadian Arctic Archipelago. Sequence recovery was higher for rbcL than matK (93% and 81%), and rbcL was easier to recover than matK from herbarium specimens (92% and 77%). Distance-based and sequence-similarity analyses of combined rbcL + matK data discriminate 97% of genera, 56% of species, and 7% of infraspecific taxa. There is a significant negative correlation between the number of species sampled per genus and the percent species resolution per genus. We characterize barcode variation in detail in the ten largest genera sampled (Carex, Draba, Festuca, Pedicularis, Poa, Potentilla, Puccinellia, Ranunculus, Salix, and Saxifraga) in the context of their phylogenetic relationships and taxonomy. Discrimination with the core barcode loci in these genera ranges from 0% in Salix to 85% in Carex. Haplotype variation in multiple genera does not correspond to species boundaries, including Taraxacum, in which the distribution of plastid haplotypes among Arctic species is consistent with plastid variation documented in non-Arctic species. Introgression of Poa glauca plastid DNA into multiple individuals of P. hartzii is problematic for identification of these species with DNA barcodes. Of three supplementary barcode loci (psbA–trnH, psbK–psbI, atpF–atpH) collected for a subset of Poa and Puccinellia species, only atpF–atpH improved discrimination in Puccinellia, compared with rbcL and matK. Variation in matK in Vaccinium uliginosum and rbcL in Saxifraga oppositifolia corresponds to variation in other loci used to characterize the phylogeographic histories of these Arctic-alpine species. PMID:24348895
How effective are DNA barcodes in the identification of African rainforest trees?
Parmentier, Ingrid; Duminil, Jérôme; Kuzmina, Maria; Philippe, Morgane; Thomas, Duncan W; Kenfack, David; Chuyong, George B; Cruaud, Corinne; Hardy, Olivier J
2013-01-01
DNA barcoding of rain forest trees could potentially help biologists identify species and discover new ones. However, DNA barcodes cannot always distinguish between closely related species, and the size and completeness of barcode databases are key parameters for their successful application. We test the ability of rbcL, matK and trnH-psbA plastid DNA markers to identify rain forest trees at two sites in Atlantic central Africa under the assumption that a database is exhaustive in terms of species content, but not necessarily in terms of haplotype diversity within species. We assess the accuracy of identification to species or genus using a genetic distance matrix between samples either based on a global multiple sequence alignment (GD) or on a basic local alignment search tool (BLAST). Where a local database is available (within a 50 ha plot), barcoding was generally reliable for genus identification (95-100% success), but less for species identification (71-88%). Using a single marker, best results for species identification were obtained with trnH-psbA. There was a significant decrease of barcoding success in species-rich clades. When the local database was used to identify the genus of trees from another region and did include all genera from the query individuals but not all species, genus identification success decreased to 84-90%. The GD method performed best but a global multiple sequence alignment is not applicable on trnH-psbA. Barcoding is a useful tool to assign unidentified African rain forest trees to a genus, but identification to a species is less reliable, especially in species-rich clades, even using an exhaustive local database. Combining two markers improves the accuracy of species identification but it would only marginally improve genus identification. Finally, we highlight some limitations of the BLAST algorithm as currently implemented and suggest possible improvements for barcoding applications.
How Effective Are DNA Barcodes in the Identification of African Rainforest Trees?
Parmentier, Ingrid; Duminil, Jérôme; Kuzmina, Maria; Philippe, Morgane; Thomas, Duncan W.; Kenfack, David; Chuyong, George B.; Cruaud, Corinne; Hardy, Olivier J.
2013-01-01
Background DNA barcoding of rain forest trees could potentially help biologists identify species and discover new ones. However, DNA barcodes cannot always distinguish between closely related species, and the size and completeness of barcode databases are key parameters for their successful application. We test the ability of rbcL, matK and trnH-psbA plastid DNA markers to identify rain forest trees at two sites in Atlantic central Africa under the assumption that a database is exhaustive in terms of species content, but not necessarily in terms of haplotype diversity within species. Methodology/Principal Findings We assess the accuracy of identification to species or genus using a genetic distance matrix between samples either based on a global multiple sequence alignment (GD) or on a basic local alignment search tool (BLAST). Where a local database is available (within a 50 ha plot), barcoding was generally reliable for genus identification (95–100% success), but less for species identification (71–88%). Using a single marker, best results for species identification were obtained with trnH-psbA. There was a significant decrease of barcoding success in species-rich clades. When the local database was used to identify the genus of trees from another region and did include all genera from the query individuals but not all species, genus identification success decreased to 84–90%. The GD method performed best but a global multiple sequence alignment is not applicable on trnH-psbA. Conclusions/Significance Barcoding is a useful tool to assign unidentified African rain forest trees to a genus, but identification to a species is less reliable, especially in species-rich clades, even using an exhaustive local database. Combining two markers improves the accuracy of species identification but it would only marginally improve genus identification. Finally, we highlight some limitations of the BLAST algorithm as currently implemented and suggest possible improvements for barcoding applications. PMID:23565134
Saarela, Jeffery M; Sokoloff, Paul C; Gillespie, Lynn J; Consaul, Laurie L; Bull, Roger D
2013-01-01
Accurate identification of Arctic plant species is critical for understanding potential climate-induced changes in their diversity and distributions. To facilitate rapid identification we generated DNA barcodes for the core plastid barcode loci (rbcL and matK) for 490 vascular plant species, representing nearly half of the Canadian Arctic flora and 93% of the flora of the Canadian Arctic Archipelago. Sequence recovery was higher for rbcL than matK (93% and 81%), and rbcL was easier to recover than matK from herbarium specimens (92% and 77%). Distance-based and sequence-similarity analyses of combined rbcL + matK data discriminate 97% of genera, 56% of species, and 7% of infraspecific taxa. There is a significant negative correlation between the number of species sampled per genus and the percent species resolution per genus. We characterize barcode variation in detail in the ten largest genera sampled (Carex, Draba, Festuca, Pedicularis, Poa, Potentilla, Puccinellia, Ranunculus, Salix, and Saxifraga) in the context of their phylogenetic relationships and taxonomy. Discrimination with the core barcode loci in these genera ranges from 0% in Salix to 85% in Carex. Haplotype variation in multiple genera does not correspond to species boundaries, including Taraxacum, in which the distribution of plastid haplotypes among Arctic species is consistent with plastid variation documented in non-Arctic species. Introgression of Poa glauca plastid DNA into multiple individuals of P. hartzii is problematic for identification of these species with DNA barcodes. Of three supplementary barcode loci (psbA-trnH, psbK-psbI, atpF-atpH) collected for a subset of Poa and Puccinellia species, only atpF-atpH improved discrimination in Puccinellia, compared with rbcL and matK. Variation in matK in Vaccinium uliginosum and rbcL in Saxifraga oppositifolia corresponds to variation in other loci used to characterize the phylogeographic histories of these Arctic-alpine species.
Potential of DNA sequences to identify zoanthids (Cnidaria: Zoantharia).
Sinniger, Frederic; Reimer, James D; Pawlowski, Jan
2008-12-01
The order Zoantharia is known for its chaotic taxonomy and difficult morphological identification. One method that potentially could help for examining such troublesome taxa is DNA barcoding, which identifies species using standard molecular markers. The mitochondrial cytochrome oxidase subunit I (COI) has been utilized to great success in groups such as birds and insects; however, its applicability in many other groups is controversial. Recently, some studies have suggested that barcoding is not applicable to anthozoans. Here, we examine the use of COI and mitochondrial 16S ribosomal DNA for zoanthid identification. Despite the absence of a clear barcoding gap, our results show that for most of 54 zoanthid samples, both markers could separate samples to the species, or species group, level, particularly when easily accessible ecological or distributional data were included. Additionally, we have used the short V5 region of mt 16S rDNA to identify eight old (13 to 50 years old) museum samples. We discuss advantages and disadvantages of COI and mt 16S rDNA as barcodes for Zoantharia, and recommend that either one or both of these markers be considered for zoanthid identification in the future.
DNA barcoding detects contamination and substitution in North American herbal products
2013-01-01
Background Herbal products available to consumers in the marketplace may be contaminated or substituted with alternative plant species and fillers that are not listed on the labels. According to the World Health Organization, the adulteration of herbal products is a threat to consumer safety. Our research aimed to investigate herbal product integrity and authenticity with the goal of protecting consumers from health risks associated with product substitution and contamination. Methods We used DNA barcoding to conduct a blind test of the authenticity for (i) 44 herbal products representing 12 companies and 30 different species of herbs, and (ii) 50 leaf samples collected from 42 herbal species. Our laboratory also assembled the first standard reference material (SRM) herbal barcode library from 100 herbal species of known provenance that were used to identify the unknown herbal products and leaf samples. Results We recovered DNA barcodes from most herbal products (91%) and all leaf samples (100%), with 95% species resolution using a tiered approach (rbcL + ITS2). Most (59%) of the products tested contained DNA barcodes from plant species not listed on the labels. Although we were able to authenticate almost half (48%) of the products, one-third of these also contained contaminants and or fillers not listed on the label. Product substitution occurred in 30/44 of the products tested and only 2/12 companies had products without any substitution, contamination or fillers. Some of the contaminants we found pose serious health risks to consumers. Conclusions Most of the herbal products tested were of poor quality, including considerable product substitution, contamination and use of fillers. These activities dilute the effectiveness of otherwise useful remedies, lowering the perceived value of all related products because of a lack of consumer confidence in them. We suggest that the herbal industry should embrace DNA barcoding for authenticating herbal products through testing of raw materials used in manufacturing products. The use of an SRM DNA herbal barcode library for testing bulk materials could provide a method for 'best practices? in the manufacturing of herbal products. This would provide consumers with safe, high quality herbal products. PMID:24120035
2010-01-01
Background Five DNA regions, namely, rbcL, matK, ITS, ITS2, and psbA-trnH, have been recommended as primary DNA barcodes for plants. Studies evaluating these regions for species identification in the large plant taxon, which includes a large number of closely related species, have rarely been reported. Results The feasibility of using the five proposed DNA regions was tested for discriminating plant species within Asteraceae, the largest family of flowering plants. Among these markers, ITS2 was the most useful in terms of universality, sequence variation, and identification capability in the Asteraceae family. The species discriminating power of ITS2 was also explored in a large pool of 3,490 Asteraceae sequences that represent 2,315 species belonging to 494 different genera. The result shows that ITS2 correctly identified 76.4% and 97.4% of plant samples at the species and genus levels, respectively. In addition, ITS2 displayed a variable ability to discriminate related species within different genera. Conclusions ITS2 is the best DNA barcode for the Asteraceae family. This approach significantly broadens the application of DNA barcoding to resolve classification problems in the family Asteraceae at the genera and species levels. PMID:20977734
Googling DNA sequences on the World Wide Web.
Hajibabaei, Mehrdad; Singer, Gregory A C
2009-11-10
New web-based technologies provide an excellent opportunity for sharing and accessing information and using web as a platform for interaction and collaboration. Although several specialized tools are available for analyzing DNA sequence information, conventional web-based tools have not been utilized for bioinformatics applications. We have developed a novel algorithm and implemented it for searching species-specific genomic sequences, DNA barcodes, by using popular web-based methods such as Google. We developed an alignment independent character based algorithm based on dividing a sequence library (DNA barcodes) and query sequence to words. The actual search is conducted by conventional search tools such as freely available Google Desktop Search. We implemented our algorithm in two exemplar packages. We developed pre and post-processing software to provide customized input and output services, respectively. Our analysis of all publicly available DNA barcode sequences shows a high accuracy as well as rapid results. Our method makes use of conventional web-based technologies for specialized genetic data. It provides a robust and efficient solution for sequence search on the web. The integration of our search method for large-scale sequence libraries such as DNA barcodes provides an excellent web-based tool for accessing this information and linking it to other available categories of information on the web.
PCR cycles above routine numbers do not compromise high-throughput DNA barcoding results.
Vierna, J; Doña, J; Vizcaíno, A; Serrano, D; Jovani, R
2017-10-01
High-throughput DNA barcoding has become essential in ecology and evolution, but some technical questions still remain. Increasing the number of PCR cycles above the routine 20-30 cycles is a common practice when working with old-type specimens, which provide little amounts of DNA, or when facing annealing issues with the primers. However, increasing the number of cycles can raise the number of artificial mutations due to polymerase errors. In this work, we sequenced 20 COI libraries in the Illumina MiSeq platform. Libraries were prepared with 40, 45, 50, 55, and 60 PCR cycles from four individuals belonging to four species of four genera of cephalopods. We found no relationship between the number of PCR cycles and the number of mutations despite using a nonproofreading polymerase. Moreover, even when using a high number of PCR cycles, the resulting number of mutations was low enough not to be an issue in the context of high-throughput DNA barcoding (but may still remain an issue in DNA metabarcoding due to chimera formation). We conclude that the common practice of increasing the number of PCR cycles should not negatively impact the outcome of a high-throughput DNA barcoding study in terms of the occurrence of point mutations.
Reed, Robert N.; Hopken, Matthew W.; Steen, David A.; Falk, Bryan G.; Piaggio, Antoinette J.
2016-01-01
Early detection of invasive species is critical to increasing the probability of successful management. At the primary stage of an invasion, invasive species are easier to control as the population is likely represented by just a few individuals. Detection of these first few individuals can be challenging, particularly if they are cryptic or otherwise characterized by low detectability. The engagement of members of the public may be critical to early detection as there are far more citizen s on the landscape than trained biologists. However, it can be difficult to assess the credibility of public reporting, especially when a diagnostic digital image or a physical specimen in good condition are lacking. DNA barcoding can be used for verification when morphological identification of a specimen is not possible or uncertain (i.e., degraded or partial specimen). DNA barcoding relies on obtaining a DNA sequence from a relatively small fragment of mitochondrial DNA and comparing it to a database of sequences containing a variety of expertly identified species. He rein we report the successful identification of a degraded specimen of a non-native, potentially invasive reptile species (Varanus niloticus) via DNA barcoding, after discovery and reporting by a member of the public.
On site DNA barcoding by nanopore sequencing
Menegon, Michele; Cantaloni, Chiara; Rodriguez-Prieto, Ana; Centomo, Cesare; Abdelfattah, Ahmed; Rossato, Marzia; Bernardi, Massimo; Xumerle, Luciano; Loader, Simon; Delledonne, Massimo
2017-01-01
Biodiversity research is becoming increasingly dependent on genomics, which allows the unprecedented digitization and understanding of the planet’s biological heritage. The use of genetic markers i.e. DNA barcoding, has proved to be a powerful tool in species identification. However, full exploitation of this approach is hampered by the high sequencing costs and the absence of equipped facilities in biodiversity-rich countries. In the present work, we developed a portable sequencing laboratory based on the portable DNA sequencer from Oxford Nanopore Technologies, the MinION. Complementary laboratory equipment and reagents were selected to be used in remote and tough environmental conditions. The performance of the MinION sequencer and the portable laboratory was tested for DNA barcoding in a mimicking tropical environment, as well as in a remote rainforest of Tanzania lacking electricity. Despite the relatively high sequencing error-rate of the MinION, the development of a suitable pipeline for data analysis allowed the accurate identification of different species of vertebrates including amphibians, reptiles and mammals. In situ sequencing of a wild frog allowed us to rapidly identify the species captured, thus confirming that effective DNA barcoding in the field is possible. These results open new perspectives for real-time-on-site DNA sequencing thus potentially increasing opportunities for the understanding of biodiversity in areas lacking conventional laboratory facilities. PMID:28977016
A single mini-barcode test to screen for Australian mammalian predators from environmental samples
MacDonald, Anna J; Sarre, Stephen D
2017-01-01
Abstract Identification of species from trace samples is now possible through the comparison of diagnostic DNA fragments against reference DNA sequence databases. DNA detection of animals from non-invasive samples, such as predator faeces (scats) that contain traces of DNA from their species of origin, has proved to be a valuable tool for the management of elusive wildlife. However, application of this approach can be limited by the availability of appropriate genetic markers. Scat DNA is often degraded, meaning that longer DNA sequences, including standard DNA barcoding markers, are difficult to recover. Instead, targeted short diagnostic markers are required to serve as diagnostic mini-barcodes. The mitochondrial genome is a useful source of such trace DNA markers because it provides good resolution at the species level and occurs in high copy numbers per cell. We developed a mini-barcode based on a short (178 bp) fragment of the conserved 12S ribosomal ribonucleic acid mitochondrial gene sequence, with the goal of discriminating amongst the scats of large mammalian predators of Australia. We tested the sensitivity and specificity of our primers and can accurately detect and discriminate amongst quolls, cats, dogs, foxes, and devils from trace DNA samples. Our approach provides a cost-effective, time-efficient, and non-invasive tool that enables identification of all 8 medium-large mammal predators in Australia, including native and introduced species, using a single test. With modification, this approach is likely to be of broad applicability elsewhere. PMID:28810700
DNA barcoding using skin exuviates can improve identification and biodiversity studies of snakes.
Khedkar, Trupti; Sharma, Rashmi; Tiknaik, Anita; Khedkar, Gulab; Naikwade, Bhagwat S; Ron, Tetsuzan Benny; Haymer, David
2016-01-01
Snakes represent a taxonomically underdeveloped group of animals in India with a lack of experts and incomplete taxonomic descriptions being the main deterrents to advances in this area. Molecular taxonomic approaches using DNA barcoding could aid in snake identification as well as studies of biodiversity. Here a non-invasive sampling method using DNA barcoding is tested using skin exuviates. Taxonomically authenticated samples were collected and tested for validation and comparisons to unknown snake exuviate samples. This approach was also used to construct the first comprehensive study targeting the snake species from Maharashtra state in India. A total of 92 skin exuviate samples were collected and tested for this study. Of these, 81 samples were successfully DNA barcoded and compared with unknown samples for assignment of taxonomic identity. Good quality DNA was obtained irrespective of age and quality of the exuviate material, and all unknown samples were successfully identified. A total of 23 species of snakes were identified, six of which were in the list of Endangered species (Red Data Book). Intra- and inter-specific distance values were also calculated, and these were sufficient to allow discrimination among species and between species without ambiguity in most cases. Two samples were suspected to represent cryptic species based on deep K2P divergence values (>3%), and one sample could be identified to the genus level only. Eleven samples failed to amplify COI sequences, suggesting the need for alternative PCR primer pairs. This study clearly documents how snake skin exuviates can be used for DNA barcoding, estimates of diversity and population genetic structuring in a noninvasive manner.
DNA reference libraries of French Guianese mosquitoes for barcoding and metabarcoding
Leroy, Céline; Guidez, Amandine; Dusfour, Isabelle; Girod, Romain; Dejean, Alain; Murienne, Jérôme
2017-01-01
The mosquito family (Diptera: Culicidae) constitutes the most medically important group of arthropods because certain species are vectors of human pathogens. In some parts of the world, the diversity is so high that the accurate delimitation and/or identification of species is challenging. A DNA-based identification system for all animals has been proposed, the so-called DNA barcoding approach. In this study, our objectives were (i) to establish DNA barcode libraries for the mosquitoes of French Guiana based on the COI and the 16S markers, (ii) to compare distance-based and tree-based methods of species delimitation to traditional taxonomy, and (iii) to evaluate the accuracy of each marker in identifying specimens. A total of 266 specimens belonging to 75 morphologically identified species or morphospecies were analyzed allowing us to delimit 86 DNA clusters with only 21 of them already present in the BOLD database. We thus provide a substantial contribution to the global mosquito barcoding initiative. Our results confirm that DNA barcodes can be successfully used to delimit and identify mosquito species with only a few cases where the marker could not distinguish closely related species. Our results also validate the presence of new species identified based on morphology, plus potential cases of cryptic species. We found that both COI and 16S markers performed very well, with successful identifications at the species level of up to 98% for COI and 97% for 16S when compared to traditional taxonomy. This shows great potential for the use of metabarcoding for vector monitoring and eco-epidemiological studies. PMID:28575090
Pawar, Rahul S; Handy, Sara M; Cheng, Raymond; Shyong, Nicole; Grundel, Erich
2017-07-01
About 7 % of the U. S. population reports using botanical dietary supplements. Increased use of such supplements has led to discussions related to their authenticity and quality. Reports of adulteration with substandard materials or pharmaceuticals are of concern because such substitutions, whether inadvertent or deliberate, may reduce the efficacy of specific botanicals or lead to adverse events. Methods for verifying the identity of botanicals include macroscopic and microscopic examinations, chemical analysis, and DNA-based methods including DNA barcoding. Macroscopic and microscopic examinations may fail when a supplement consists of botanicals that have been processed beyond the ability to provide morphological characterizations. Chemical analysis of specific marker compounds encounters problems when these compounds are not distinct to a given species or when purified reference standards are not available. Recent investigations describing DNA barcoding analysis of botanical dietary supplements have raised concerns about the authenticity of the supplements themselves as well as the appropriateness of using DNA barcoding techniques with finished botanical products. We collected 112 market samples of frequently consumed botanical dietary supplements of ginkgo, soy, valerian, yohimbe, and St. John's wort and analyzed each for specific chemical markers (i.e., flavonol glycosides, total isoflavones, total valerenic acids, yohimbine, and hypericins, respectively). We used traditional DNA barcoding techniques targeting the nuclear ITS2 gene and the chloroplast gene psb A- trn H on the same samples to determine the presence of DNA of the labelled ingredient. We compared the results obtained by both methods to assess the contribution of each in determining the identity of the samples. Georg Thieme Verlag KG Stuttgart · New York.
DNA Barcoding Identifies Argentine Fishes from Marine and Brackish Waters
Mabragaña, Ezequiel; Díaz de Astarloa, Juan Martín; Hanner, Robert; Zhang, Junbin; González Castro, Mariano
2011-01-01
Background DNA barcoding has been advanced as a promising tool to aid species identification and discovery through the use of short, standardized gene targets. Despite extensive taxonomic studies, for a variety of reasons the identification of fishes can be problematic, even for experts. DNA barcoding is proving to be a useful tool in this context. However, its broad application is impeded by the need to construct a comprehensive reference sequence library for all fish species. Here, we make a regional contribution to this grand challenge by calibrating the species discrimination efficiency of barcoding among 125 Argentine fish species, representing nearly one third of the known fauna, and examine the utility of these data to address several key taxonomic uncertainties pertaining to species in this region. Methodology/Principal Findings Specimens were collected and morphologically identified during crusies conducted between 2005 and 2008. The standard BARCODE fragment of COI was amplified and bi-directionally sequenced from 577 specimens (mean of 5 specimens/species), and all specimens and sequence data were archived and interrogated using analytical tools available on the Barcode of Life Data System (BOLD; www.barcodinglife.org). Nearly all species exhibited discrete clusters of closely related haplogroups which permitted the discrimination of 95% of the species (i.e. 119/125) examined while cases of shared haplotypes were detected among just three species-pairs. Notably, barcoding aided the identification of a new species of skate, Dipturus argentinensis, permitted the recognition of Genypterus brasiliensis as a valid species and questions the generic assignment of Paralichthys isosceles. Conclusions/Significance This study constitutes a significant contribution to the global barcode reference sequence library for fishes and demonstrates the utility of barcoding for regional species identification. As an independent assessment of alpha taxonomy, barcodes provide robust support for most morphologically based taxon concepts and also highlight key areas of taxonomic uncertainty worthy of reappraisal. PMID:22174860
G.A. Davis; N.P. Havill; Z.N. Adelman; A. Caccone; L.T. Kok; S.M. Salom
2011-01-01
Molecular diagnostics based on DNA barcodes can be powerful identification tools in the absence of distinctive morphological characters for distinguishing between closely related species. A specific example is distinguishing the endemic species Laricobius rubidus from Laricobius nigrinus, a biological control agent of hemlock...
Pugedo, Marina Lages; de Andrade Neto, Francisco Ricardo; Pessali, Tiago Casarim; Birindelli, José Luís Olivan; Carvalho, Daniel Cardoso
2016-06-01
Molecular identification through DNA barcoding has been proposed as a way to standardize a global biodiversity identification system using a partial sequence of the mitochondrial COI gene. We applied an integrative approach using DNA barcoding and traditional morphology-based bioassessment to identify fish from a neotropical region possessing low taxonomic knowledge: the Jequitinhonha River Basin (Southeastern Brazil). The Jequitinhonha River Basin (JRB) has a high rate of endemism and is considered an area of high priority for fish conservation, with estimates indicating the presence of around 110 native and non-indigenous species. DNA barcodes were obtained from 260 individuals belonging to 52 species distributed among 35 genera, 21 families and 6 orders, including threatened and rare species such as Rhamdia jequitinhonha and Steindachneridion amblyurum. The mean Kimura two-parameter genetic distances within species, genera and families were: 0.44, 12.16 and 20.58 %, respectively. Mean intraspecific genetic variation ranged from 0 to 11.43 %, and high values (>2 %) were recovered for five species. Species with a deep intraspecific distance, possibly flagging overlooked taxa, were detected within the genus Pimelodella. Fifteen species, only identified to the genus level, had unique BINs, with a nearest neighbor distance over 2 % and therefore, potential new candidate species supported by DNA barcoding. The integrative taxonomy approach using DNA barcoding and traditional taxonomy may be a remedy to taxonomy impediment, accelerating species identification by flagging potential new candidate species and to adequately conserve the megadiverse neotropical ichthyofauna.
USDA-ARS?s Scientific Manuscript database
DNA barcodes have proven invaluable in identifying and distinguishing insect pests, for example for determining the provenance of exotic invasives, but relatively few insect natural enemies have been barcoded. We used Folmer et al.’s universal invertebrate primers (1994), and those designed by Heber...
Benzaquem, Denise Corrêa; Oliveira, Claudio; da Silva Batista, Jaqueline; Zuanon, Jansen; Porto, Jorge Ivan Rebelo
2015-01-01
Nannostomus is comprised of 20 species. Popularly known as pencilfishes the vast majority of these species lives in the flooded forests of the Amazon basin and are popular in the ornamental trade. Among the lebiasinids, it is the only genus to have undergone more than one taxonomic revision. Even so, it still possesses poorly defined species. Here, we report the results of an application of DNA barcoding to the identification of pencilfishes and highlight the deeply divergent clades within four nominal species. We surveyed the sequence variation in the mtDNA cytochrome c oxidase subunit I gene among 110 individuals representing 14 nominal species that were collected from several rivers along the Amazon basin. The mean Kimura-2-parameter distances within species and genus were 2% and 19,0%, respectively. The deep lineage divergences detected in N. digrammus, N. trifasciatus, N. unifasciatus and N. eques suggest the existence of hidden diversity in Nannostomus species. For N. digrammus and N. trifasciatus, in particular, the estimated divergences in some lineages were so high that doubt about their conspecific status is raised. PMID:25658694
Silva, F L; Wiedenbrug, S
2014-02-01
In this study, we use DNA barcodes for species delimitation to solve taxonomic conflicts in 86 specimens of 14 species belonging to the Corynoneura group (Diptera: Chironomidae: Orthocladiinae), from the Atlantic Forest, Brazil. Molecular analysis of cytochrome c-oxidase subunit I (COI) gene sequences supported 14 cohesive species groups, of which two similar groups were subsequently associated with morphological variation at the pupal stage. Eleven species previously described based on morphological criteria were linked to DNA markers. Furthermore, there is the possibility that there may be cryptic species within the Corynoneura group, since one group of species presented internal grouping, although no morphological divergence was observed. Our results support DNA-barcoding as an excellent tool for species delimitation in groups where taxonomy by means of morphology is difficult or even impossible.
Mapping global biodiversity connections with DNA barcodes: Lepidoptera of Pakistan.
Ashfaq, Muhammad; Akhtar, Saleem; Rafi, Muhammad Athar; Mansoor, Shahid; Hebert, Paul D N
2017-01-01
Sequences from the DNA barcode region of the mitochondrial COI gene are an effective tool for specimen identification and for the discovery of new species. The Barcode of Life Data Systems (BOLD) (www.boldsystems.org) currently hosts 4.5 million records from animals which have been assigned to more than 490,000 different Barcode Index Numbers (BINs), which serve as a proxy for species. Because a fourth of these BINs derive from Lepidoptera, BOLD has a strong capability to both identify specimens in this order and to support studies of faunal overlap. DNA barcode sequences were obtained from 4503 moths from 329 sites across Pakistan, specimens that represented 981 BINs from 52 families. Among 379 species with a Linnaean name assignment, all were represented by a single BIN excepting five species that showed a BIN split. Less than half (44%) of the 981 BINs had counterparts in other countries; the remaining BINs were unique to Pakistan. Another 218 BINs of Lepidoptera from Pakistan were coupled with the 981 from this study before being compared with all 116,768 BINs for this order. As expected, faunal overlap was highest with India (21%), Sri Lanka (21%), United Arab Emirates (20%) and with other Asian nations (2.1%), but it was very low with other continents including Africa (0.6%), Europe (1.3%), Australia (0.6%), Oceania (1.0%), North America (0.1%), and South America (0.1%). This study indicates the way in which DNA barcoding facilitates measures of faunal overlap even when taxa have not been assigned to a Linnean species.
Tian, Qian; Zhao, Wenjun; Lu, Songyu; Zhu, Shuifang; Li, Shidong
2016-01-01
Genus Xanthomonas comprises many economically important plant pathogens that affect a wide range of hosts. Indeed, fourteen Xanthomonas species/pathovars have been regarded as official quarantine bacteria for imports in China. To date, however, a rapid and accurate method capable of identifying all of the quarantine species/pathovars has yet to be developed. In this study, we therefore evaluated the capacity of DNA barcoding as a digital identification method for discriminating quarantine species/pathovars of Xanthomonas. For these analyses, 327 isolates, representing 45 Xanthomonas species/pathovars, as well as five additional species/pathovars from GenBank (50 species/pathovars total), were utilized to test the efficacy of four DNA barcode candidate genes (16S rRNA gene, cpn60, gyrB, and avrBs2). Of these candidate genes, cpn60 displayed the highest rate of PCR amplification and sequencing success. The tree-building (Neighbor-joining), ‘best close match’, and barcode gap methods were subsequently employed to assess the species- and pathovar-level resolution of each gene. Notably, all isolates of each quarantine species/pathovars formed a monophyletic group in the neighbor-joining tree constructed using the cpn60 sequences. Moreover, cpn60 also demonstrated the most satisfactory results in both barcoding gap analysis and the ‘best close match’ test. Thus, compared with the other markers tested, cpn60 proved to be a powerful DNA barcode, providing a reliable and effective means for the species- and pathovar-level identification of the quarantine plant pathogen Xanthomonas. PMID:27861494
Mapping global biodiversity connections with DNA barcodes: Lepidoptera of Pakistan
Akhtar, Saleem; Rafi, Muhammad Athar; Mansoor, Shahid; Hebert, Paul D. N.
2017-01-01
Sequences from the DNA barcode region of the mitochondrial COI gene are an effective tool for specimen identification and for the discovery of new species. The Barcode of Life Data Systems (BOLD) (www.boldsystems.org) currently hosts 4.5 million records from animals which have been assigned to more than 490,000 different Barcode Index Numbers (BINs), which serve as a proxy for species. Because a fourth of these BINs derive from Lepidoptera, BOLD has a strong capability to both identify specimens in this order and to support studies of faunal overlap. DNA barcode sequences were obtained from 4503 moths from 329 sites across Pakistan, specimens that represented 981 BINs from 52 families. Among 379 species with a Linnaean name assignment, all were represented by a single BIN excepting five species that showed a BIN split. Less than half (44%) of the 981 BINs had counterparts in other countries; the remaining BINs were unique to Pakistan. Another 218 BINs of Lepidoptera from Pakistan were coupled with the 981 from this study before being compared with all 116,768 BINs for this order. As expected, faunal overlap was highest with India (21%), Sri Lanka (21%), United Arab Emirates (20%) and with other Asian nations (2.1%), but it was very low with other continents including Africa (0.6%), Europe (1.3%), Australia (0.6%), Oceania (1.0%), North America (0.1%), and South America (0.1%). This study indicates the way in which DNA barcoding facilitates measures of faunal overlap even when taxa have not been assigned to a Linnean species. PMID:28339501
Mini-DNA barcode in identification of the ornamental fish: A case study from Northeast India.
Dhar, Bishal; Ghosh, Sankar Kumar
2017-09-05
The ornamental fishes were exported under the trade names or generic names, thus creating problems in species identification. In this regard, DNA barcoding could effectively elucidate the actual species status. However, the problem arises if the specimen is having taxonomic disputes, falsified by trade/generic names, etc., On the other hand, barcoding the archival museum specimens would be of greater benefit to address such issues as it would create firm, error-free reference database for rapid identification of any species. This can be achieved only by generating short sequences as DNA from chemically preserved are mostly degraded. Here we aimed to identify a short stretch of informative sites within the full-length barcode segment, capable of delineating diverse group of ornamental fish species, commonly traded from NE India. We analyzed 287 full-length barcode sequences from the major fish orders and compared the interspecific K2P distance with nucleotide substitutions patterns and found a strong correlation of interspecies distance with transversions (0.95, p<0.001). We, therefore, proposed a short stretch of 171bp (transversion rich) segment as mini-barcode. The proposed segment was compared with the full-length barcodes and found to delineate the species effectively. Successful PCR amplification and sequencing of the 171bp segment using designed primers for different orders validated it as mini-barcodes for ornamental fishes. Thus, our findings would be helpful in strengthening the global database with the sequence of archived fish species as well as an effective identification tool of the traded ornamental fish species, as a less time consuming, cost effective field-based application. Copyright © 2017 Elsevier B.V. All rights reserved.
Links, Matthew G; Dumonceaux, Tim J; Hemmingsen, Sean M; Hill, Janet E
2012-01-01
Barcoding with molecular sequences is widely used to catalogue eukaryotic biodiversity. Studies investigating the community dynamics of microbes have relied heavily on gene-centric metagenomic profiling using two genes (16S rRNA and cpn60) to identify and track Bacteria. While there have been criteria formalized for barcoding of eukaryotes, these criteria have not been used to evaluate gene targets for other domains of life. Using the framework of the International Barcode of Life we evaluated DNA barcodes for Bacteria. Candidates from the 16S rRNA gene and the protein coding cpn60 gene were evaluated. Within complete bacterial genomes in the public domain representing 983 species from 21 phyla, the largest difference between median pairwise inter- and intra-specific distances ("barcode gap") was found from cpn60. Distribution of sequence diversity along the ∼555 bp cpn60 target region was remarkably uniform. The barcode gap of the cpn60 universal target facilitated the faithful de novo assembly of full-length operational taxonomic units from pyrosequencing data from a synthetic microbial community. Analysis supported the recognition of both 16S rRNA and cpn60 as DNA barcodes for Bacteria. The cpn60 universal target was found to have a much larger barcode gap than 16S rRNA suggesting cpn60 as a preferred barcode for Bacteria. A large barcode gap for cpn60 provided a robust target for species-level characterization of data. The assembly of consensus sequences for barcodes was shown to be a reliable method for the identification and tracking of novel microbes in metagenomic studies.
Identification of a Herbal Powder by Deoxyribonucleic Acid Barcoding and Structural Analyses.
Sheth, Bhavisha P; Thaker, Vrinda S
2015-10-01
Authentic identification of plants is essential for exploiting their medicinal properties as well as to stop the adulteration and malpractices with the trade of the same. To identify a herbal powder obtained from a herbalist in the local vicinity of Rajkot, Gujarat, using deoxyribonucleic acid (DNA) barcoding and molecular tools. The DNA was extracted from a herbal powder and selected Cassia species, followed by the polymerase chain reaction (PCR) and sequencing of the rbcL barcode locus. Thereafter the sequences were subjected to National Center for Biotechnology Information (NCBI) basic local alignment search tool (BLAST) analysis, followed by the protein three-dimension structure determination of the rbcL protein from the herbal powder and Cassia species namely Cassia fistula, Cassia tora and Cassia javanica (sequences obtained in the present study), Cassia Roxburghii, and Cassia abbreviata (sequences retrieved from Genbank). Further, the multiple and pairwise structural alignment were carried out in order to identify the herbal powder. The nucleotide sequences obtained from the selected species of Cassia were submitted to Genbank (Accession No. JX141397, JX141405, JX141420). The NCBI BLAST analysis of the rbcL protein from the herbal powder showed an equal sequence similarity (with reference to different parameters like E value, maximum identity, total score, query coverage) to C. javanica and C. roxburghii. In order to solve the ambiguities of the BLAST result, a protein structural approach was implemented. The protein homology models obtained in the present study were submitted to the protein model database (PM0079748-PM0079753). The pairwise structural alignment of the herbal powder (as template) and C. javanica and C. roxburghii (as targets individually) revealed a close similarity of the herbal powder with C. javanica. A strategy as used here, incorporating the integrated use of DNA barcoding and protein structural analyses could be adopted, as a novel rapid and economic procedure, especially in cases when protein coding loci are considered. Authentic identification of plants is essential for exploiting their medicinal properties as well as to stop the adulteration and malpractices with the trade of the same. A herbal powder was obtained from a herbalist in the local vicinity of Rajkot, Gujarat. An integrated approach using DNA barcoding and structural analyses was carried out to identify the herbal powder. The herbal powder was identified as Cassia javanica L.
Telling plant species apart with DNA: from barcodes to genomes
Li, De-Zhu; van der Bank, Michelle
2016-01-01
Land plants underpin a multitude of ecosystem functions, support human livelihoods and represent a critically important component of terrestrial biodiversity—yet many tens of thousands of species await discovery, and plant identification remains a substantial challenge, especially where material is juvenile, fragmented or processed. In this opinion article, we tackle two main topics. Firstly, we provide a short summary of the strengths and limitations of plant DNA barcoding for addressing these issues. Secondly, we discuss options for enhancing current plant barcodes, focusing on increasing discriminatory power via either gene capture of nuclear markers or genome skimming. The former has the advantage of establishing a defined set of target loci maximizing efficiency of sequencing effort, data storage and analysis. The challenge is developing a probe set for large numbers of nuclear markers that works over sufficient phylogenetic breadth. Genome skimming has the advantage of using existing protocols and being backward compatible with existing barcodes; and the depth of sequence coverage can be increased as sequencing costs fall. Its non-targeted nature does, however, present a major informatics challenge for upscaling to large sample sets. This article is part of the themed issue ‘From DNA barcodes to biomes’. PMID:27481790
Species delimitation (grouping individuals into distinct taxonomic groups) is an essential part of evolutionary, conservation, and molecular ecology. Deoxyribonucleic acid (DNA) barcodes, short fragments of the cytochrome c oxidase subunit I (COI) gene, are being used in environm...
Wang, Xu; Qiu, Yue; Wei, Cong
2016-03-02
One new species of the genus Hyalessa China, H. wangi sp. nov., from Yunnan, China is described. Partial mitochondrial COI gene (DNA barcoding) of this new species is sequenced and uploaded to GenBank. A key to all species of Hyalessa is provided.
Use of DNA Barcodes to Identify Invasive Armyworm Spodoptera Species in Florida
Nagoshi, Rodney N.; Brambila, Julieta; Meagher, Robert L.
2011-01-01
A critical component for sustaining adequate food production is the protection of local agriculture from invasive pest insects. Essential to this goal is the ability to accurately distinguish foreign from closely related domestic species, a process that has traditionally required identification using diagnostic morphological “keys” that can be both subtle and labor-intensive. This is the case for the Lepidopteran group of insects represented by Spodoptera, a genus of Noctuidae “armyworm” moths that includes several important agricultural pests. Two of the most destructive species, Spodoptera littoralis (Boisduval) (Lepidoptera: Noctuidae) and S. litura (F.) are not yet established in North America. To facilitate the monitoring for these pests, the feasibility of using DNA barcoding methodology for distinguishing between domestic and foreign Spodoptera species was tested. A DNA barcoding database was derived for a subset of Spodoptera species native to Florida, with an emphasis on those attracted to pheromone blends developed for S. litura or S. littoralis. These were then compared to the barcode sequences of S. litura collected from Taiwan and S. littoralis from Portugal. Consistent discrimination of the different species was obtained with phenetic relationships produced that were generally in agreement with phylogenetic studies using morphological characteristics. The data presented here indicate that DNA barcoding has the potential to be an efficient and accurate supplement to morphological methods for the identification of invasive Spodoptera pests in North America. PMID:22239735
Use of DNA barcodes to identify flowering plants.
Kress, W John; Wurdack, Kenneth J; Zimmer, Elizabeth A; Weigt, Lee A; Janzen, Daniel H
2005-06-07
Methods for identifying species by using short orthologous DNA sequences, known as "DNA barcodes," have been proposed and initiated to facilitate biodiversity studies, identify juveniles, associate sexes, and enhance forensic analyses. The cytochrome c oxidase 1 sequence, which has been found to be widely applicable in animal barcoding, is not appropriate for most species of plants because of a much slower rate of cytochrome c oxidase 1 gene evolution in higher plants than in animals. We therefore propose the nuclear internal transcribed spacer region and the plastid trnH-psbA intergenic spacer as potentially usable DNA regions for applying barcoding to flowering plants. The internal transcribed spacer is the most commonly sequenced locus used in plant phylogenetic investigations at the species level and shows high levels of interspecific divergence. The trnH-psbA spacer, although short ( approximately 450-bp), is the most variable plastid region in angiosperms and is easily amplified across a broad range of land plants. Comparison of the total plastid genomes of tobacco and deadly nightshade enhanced with trials on widely divergent angiosperm taxa, including closely related species in seven plant families and a group of species sampled from a local flora encompassing 50 plant families (for a total of 99 species, 80 genera, and 53 families), suggest that the sequences in this pair of loci have the potential to discriminate among the largest number of plant species for barcoding purposes.
Use of DNA barcodes to identify invasive armyworm Spodoptera species in Florida.
Nagoshi, Rodney N; Brambila, Julieta; Meagher, Robert L
2011-01-01
A critical component for sustaining adequate food production is the protection of local agriculture from invasive pest insects. Essential to this goal is the ability to accurately distinguish foreign from closely related domestic species, a process that has traditionally required identification using diagnostic morphological "keys" that can be both subtle and labor-intensive. This is the case for the Lepidopteran group of insects represented by Spodoptera, a genus of Noctuidae "armyworm" moths that includes several important agricultural pests. Two of the most destructive species, Spodoptera littoralis (Boisduval) (Lepidoptera: Noctuidae) and S. litura (F.) are not yet established in North America. To facilitate the monitoring for these pests, the feasibility of using DNA barcoding methodology for distinguishing between domestic and foreign Spodoptera species was tested. A DNA barcoding database was derived for a subset of Spodoptera species native to Florida, with an emphasis on those attracted to pheromone blends developed for S. litura or S. littoralis. These were then compared to the barcode sequences of S. litura collected from Taiwan and S. littoralis from Portugal. Consistent discrimination of the different species was obtained with phenetic relationships produced that were generally in agreement with phylogenetic studies using morphological characteristics. The data presented here indicate that DNA barcoding has the potential to be an efficient and accurate supplement to morphological methods for the identification of invasive Spodoptera pests in North America.
Poovitha, Sundar; Stalin, Nithaniyal; Balaji, Raju; Parani, Madasamy
2016-12-01
The genus Hibiscus L. includes several taxa of medicinal value and species used for the extraction of natural dyes. These applications require the use of authentic plant materials. DNA barcoding is a molecular method for species identification, which helps in reliable authentication by using one or more DNA barcode marker. In this study, we have collected 44 accessions, representing 16 species of Hibiscus, distributed in the southern peninsular India, to evaluate the discriminatory power of the two core barcodes rbcLa and matK together with the suggested additional regions trnH-psbA and ITS2. No intraspecies divergence was observed among the accessions studied. Interspecies divergence was 0%-9.6% with individual markers, which increased to 0%-12.5% and 0.8%-20.3% when using two- and three-marker combinations, respectively. Differentiation of all the species of Hibiscus was possible with the matK DNA barcode marker. Also, in two-marker combinations, only those combinations with matK differentiated all the species. Though all the three-marker combinations showed 100% species differentiation, species resolution was consistently better when the matK marker formed part of the combination. These results clearly showed that matK is more suitable when compared to rbcLa, trnH-psbA, and ITS2 for species identification in Hibiscus.
A DNA Barcode Library for North American Pyraustinae (Lepidoptera: Pyraloidea: Crambidae).
Yang, Zhaofu; Landry, Jean-François; Hebert, Paul D N
2016-01-01
Although members of the crambid subfamily Pyraustinae are frequently important crop pests, their identification is often difficult because many species lack conspicuous diagnostic morphological characters. DNA barcoding employs sequence diversity in a short standardized gene region to facilitate specimen identifications and species discovery. This study provides a DNA barcode reference library for North American pyraustines based upon the analysis of 1589 sequences recovered from 137 nominal species, 87% of the fauna. Data from 125 species were barcode compliant (>500bp, <1% n), and 99 of these taxa formed a distinct cluster that was assigned to a single BIN. The other 26 species were assigned to 56 BINs, reflecting frequent cases of deep intraspecific sequence divergence and a few instances of barcode sharing, creating a total of 155 BINs. Two systems for OTU designation, ABGD and BIN, were examined to check the correspondence between current taxonomy and sequence clusters. The BIN system performed better than ABGD in delimiting closely related species, while OTU counts with ABGD were influenced by the value employed for relative gap width. Different species with low or no interspecific divergence may represent cases of unrecognized synonymy, whereas those with high intraspecific divergence require further taxonomic scrutiny as they may involve cryptic diversity. The barcode library developed in this study will also help to advance understanding of relationships among species of Pyraustinae.
Fernandes, Telmo J R; Costa, Joana; Oliveira, M Beatriz P P; Mafra, Isabel
2017-09-01
This work aimed to exploit the use of DNA mini-barcodes combined with high resolution melting (HRM) for the authentication of gadoid species: Atlantic cod (Gadus morhua), Pacific cod (Gadus macrocephalus), Alaska pollock (Theragra chalcogramma) and saithe (Pollachius virens). Two DNA barcode regions, namely cytochrome c oxidase subunit I (COI) and cytochrome b (cytb), were analysed in silico to identify genetic variability among the four species and used, subsequently, to develop a real-time PCR method coupled with HRM analysis. The cytb mini-barcode enabled best discrimination of the target species with a high level of confidence (99.3%). The approach was applied successfully to identify gadoid species in 30 fish-containing foods, 30% of which were not as declared on the label. Herein, a novel approach for rapid, simple and cost-effective discrimination/clustering, as a tool to authenticate Gadidae fish species, according to their genetic relationship, is proposed. Copyright © 2017 Elsevier Ltd. All rights reserved.
Tropical montane nymphalids in Mexico: DNA barcodes reveal greater diversity.
Escalante, Patricia; Ibarra-Vazquez, Adolfo; Rosas-Escobar, Patricia
2010-12-01
DNA sequences obtained for the Barcode of Life library in the All Lepidoptera Campaign project Nymphalidae of Central Mexico were analyzed as a test of species limits and to explore possible phylogenetic groupings in the Preponini tribe. Using specimens in the National Insect Collection of the Instituto de Biología of the Universidad Nacional Autónoma de México, 78 specimens were assayed for cytochrome oxidase c subunit 1. Disregarding the missing data, there were 458 conserved sites, 200 variable sites and 187 parsimony-informative sites. The neighbor-joining and maximum likelihood analyses indicate that none of the three genera of Preponini as currently circumscribed are reciprocally monophyletic. As per species limits, high levels of barcode variation in the Prepona deiphile complex suggest the existence of at least two new endemic species to Mexico. The divergent taxa were escalantiana from the Tuxtlas region in Veracruz, and ibarra from Sierra Madre del Sur in the Pacific states of southern Mexico. The genetic distance in the CO1 fragment between them and the other deiphile populations ranged from 2.7 to 8.0%. We recommend that morphological data need to be re-examined and that additional molecular data for species ought to be gathered before a particular biogeographic model can be proposed for the group in Mesoamerica.
Bringloe, Trevor T; Cottenie, Karl; Martin, Gillian K; Adamowicz, Sarah J
2016-12-01
Additive diversity partitioning (α, β, and γ) is commonly used to study the distribution of species-level diversity across spatial scales. Here, we first investigate whether published studies of additive diversity partitioning show signs of difficulty attaining species-level resolution due to inherent limitations with morphological identifications. Second, we present a DNA barcoding approach to delineate specimens of stream caddisfly larvae (order Trichoptera) and consider the importance of taxonomic resolution on classical (additive) measures of beta (β) diversity. Caddisfly larvae were sampled using a hierarchical spatial design in two regions (subarctic Churchill, Manitoba, Canada; temperate Pennsylvania, USA) and then additively partitioned according to Barcode Index Numbers (molecular clusters that serve as a proxy for species), genus, and family levels; diversity components were expressed as proportional species turnover. We screened 114 articles of additive diversity partitioning and found that a third reported difficulties with achieving species-level identifications, with a clear taxonomic tendency towards challenges identifying invertebrate taxa. Regarding our own study, caddisfly BINs appeared to show greater subregional turnover (e.g., proportional additive β) compared to genus or family levels. Diversity component studies failing to achieve species resolution due to morphological identifications may therefore be underestimating diversity turnover at larger spatial scales.
Doña, Jorge; Ruiz-Ruano, Francisco J; Jovani, Roger
2016-11-01
Eight subspecies have been proposed within the Tawny Owl (Strix aluco) species. However, recent molecular data have challenged this view, encouraging further work in this species complex. Here we reevaluated the taxonomic status between the North-Western African Tawny Owl, S. a. mauritanica, and its closest Iberian Tawny Owl population (from the S. a. sylvatica to S. a. aluco clade) separated by the Strait of Gibraltar. The Tawny Owl is a non-migratory and territorial species, and juvenile dispersal is restricted to a few kilometers around the natal site. This limited dispersal and the barrier imposed by the Strait of Gibraltar predicted a strong differentiation between the two populations. We tested this using DNA barcoding, Bayesian phylogenetic and species delimitation analysis. We found that an 81.1% of variation is due to the intergroups variation. In addition, the inter-intraspecific distances distribution revealed a barcoding gap among the two subspecies. Also, posterior probabilities and the P AB value allowed to reject the hypothesis that observed degree of distinctiveness is due to random coalescence processes. These findings clearly support the Strait of Gibraltar as an isolating barrier for this species. The subspecific status is confirmed and species status is even suggested for S. a. mauritanica.
Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G
2017-07-19
Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.
de Groot, G. Arjen; During, Heinjo J.; Maas, Jan W.; Schneider, Harald; Vogel, Johannes C.; Erkens, Roy H. J.
2011-01-01
Although consensus has now been reached on a general two-locus DNA barcode for land plants, the selected combination of markers (rbcL + matK) is not applicable for ferns at the moment. Yet especially for ferns, DNA barcoding is potentially of great value since fern gametophytes—while playing an essential role in fern colonization and reproduction—generally lack the morphological complexity for morphology-based identification and have therefore been underappreciated in ecological studies. We evaluated the potential of a combination of rbcL with a noncoding plastid marker, trnL-F, to obtain DNA-identifications for fern species. A regional approach was adopted, by creating a reference database of trusted rbcL and trnL-F sequences for the wild-occurring homosporous ferns of NW-Europe. A combination of parsimony analyses and distance-based analyses was performed to evaluate the discriminatory power of the two-region barcode. DNA was successfully extracted from 86 tiny fern gametophytes and was used as a test case for the performance of DNA-based identification. Primer universality proved high for both markers. Based on the combined rbcL + trnL-F dataset, all genera as well as all species with non-equal chloroplast genomes formed their own well supported monophyletic clade, indicating a high discriminatory power. Interspecific distances were larger than intraspecific distances for all tested taxa. Identification tests on gametophytes showed a comparable result. All test samples could be identified to genus level, species identification was well possible unless they belonged to a pair of Dryopteris species with completely identical chloroplast genomes. Our results suggest a high potential of the combined use of rbcL and trnL-F as a two-locus cpDNA barcode for identification of fern species. A regional approach may be preferred for ecological tests. We here offer such a ready-to-use barcoding approach for ferns, which opens the way for answering a whole range of questions previously unaddressed in fern gametophyte ecology. PMID:21298108
Mishra, Priyanka; Shukla, Ashutosh K; Sundaresan, Velusamy
2018-01-01
Senna alexandrina (Fabaceae) is a globally recognized medicinal plant for its laxative properties as well as the only source of sennosides, and is highly exported bulk herb from India. Its major procurement is exclusively from limited cultivation, which leads to risks of deliberate or unintended adulteration. The market raw materials are in powdered or finished product form, which lead to difficulties in authentication. Here, DNA barcode tags based on chloroplast genes ( rbcL and matK ) and intergenic spacers ( psbA-trnH and ITS ) were developed for S. alexandrina along with the allied species. The ability and performance of the ITS1 region to discriminate among the Senna species resulted in the present proposal of the ITS1 tags as successful barcode. Further, these tags were coupled with high-resolution melting (HRM) curve analysis in a real-time PCR genotyping method to derive Bar-HRM (Barcoding-HRM) assays. Suitable HRM primer sets were designed through SNP detection and mutation scanning in genomic signatures of Senna species. The melting profiles of S. alexandrina and S . italica subsp. micrantha were almost identical and the remaining five species were clearly separated so that they can be differentiated by HRM method. The sensitivity of the method was utilized to authenticate market samples [Herbal Sample Assays (HSAs)]. HSA01 ( S. alexandrina crude drug sample from Bangalore) and HSA06 ( S. alexandrina crude drug sample from Tuticorin, Tamil Nadu, India) were found to be highly contaminated with S . italica subsp. micrantha . Species admixture samples mixed in varying percentage was identified sensitively with detection of contamination as low as 1%. The melting profiles of PCR amplicons are clearly distinct, which enables the authentic differentiation of species by the HRM method. This study reveals that DNA barcoding coupled with HRM is an efficient molecular tool to authenticate Senna herbal products in the market for quality control in the drug supply chain. CIMAP Communication Number: CIMAP/PUB/2017/31.
Mishra, Priyanka; Shukla, Ashutosh K.; Sundaresan, Velusamy
2018-01-01
Senna alexandrina (Fabaceae) is a globally recognized medicinal plant for its laxative properties as well as the only source of sennosides, and is highly exported bulk herb from India. Its major procurement is exclusively from limited cultivation, which leads to risks of deliberate or unintended adulteration. The market raw materials are in powdered or finished product form, which lead to difficulties in authentication. Here, DNA barcode tags based on chloroplast genes (rbcL and matK) and intergenic spacers (psbA-trnH and ITS) were developed for S. alexandrina along with the allied species. The ability and performance of the ITS1 region to discriminate among the Senna species resulted in the present proposal of the ITS1 tags as successful barcode. Further, these tags were coupled with high-resolution melting (HRM) curve analysis in a real-time PCR genotyping method to derive Bar-HRM (Barcoding-HRM) assays. Suitable HRM primer sets were designed through SNP detection and mutation scanning in genomic signatures of Senna species. The melting profiles of S. alexandrina and S. italica subsp. micrantha were almost identical and the remaining five species were clearly separated so that they can be differentiated by HRM method. The sensitivity of the method was utilized to authenticate market samples [Herbal Sample Assays (HSAs)]. HSA01 (S. alexandrina crude drug sample from Bangalore) and HSA06 (S. alexandrina crude drug sample from Tuticorin, Tamil Nadu, India) were found to be highly contaminated with S. italica subsp. micrantha. Species admixture samples mixed in varying percentage was identified sensitively with detection of contamination as low as 1%. The melting profiles of PCR amplicons are clearly distinct, which enables the authentic differentiation of species by the HRM method. This study reveals that DNA barcoding coupled with HRM is an efficient molecular tool to authenticate Senna herbal products in the market for quality control in the drug supply chain. CIMAP Communication Number: CIMAP/PUB/2017/31 PMID:29593755
Challenges and progress in making DNA-based AIS early ...
The ability of DNA barcoding to find additional species in hard-to-sample locations or hard-to-identify samples is well established. Nevertheless, adoption of DNA barcoding into regular monitoring programs has been slow, in part due to issues of standardization and interpretation that need resolving. In this presentation, we describe our progress towards incorporating DNA-based identification into broad-spectrum aquatic invasive species early-detection monitoring in the Laurentian Great Lakes. Our work uses community biodiversity information as the basis for evaluating survey performance for various taxonomic groups. Issues we are tackling in bringing DNA-based data to bear on AIS monitoring design include: 1) Standardizing methodology and work flow from field collection and sample handling through bioinformatics post-processing; 2) Determining detection sensitivity and accounting for inter-species differences in DNA amplification and primer affinity; 3) Differentiating sequencing and barcoding errors from legitimate new finds when range and natural history information is limited; and 4) Accounting for the different nature of morphology- vs. DNA-based biodiversity information in subsequent analysis (e.g., via species accumulation curves, multi-metric indices). not applicable
Digitally encoded DNA nanostructures for multiplexed, single-molecule protein sensing with nanopores
NASA Astrophysics Data System (ADS)
Bell, Nicholas A. W.; Keyser, Ulrich F.
2016-07-01
The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.
Bell, Nicholas A W; Keyser, Ulrich F
2016-07-01
The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.
Tang, Songsong; Gu, Yuan; Lu, Huiting; Dong, Haifeng; Zhang, Kai; Dai, Wenhao; Meng, Xiangdan; Yang, Fan; Zhang, Xueji
2018-04-03
Herein, a highly-sensitive microRNA (miRNA) detection strategy was developed by combining bio-bar-code assay (BBA) with catalytic hairpin assembly (CHA). In the proposed system, two nanoprobes of magnetic nanoparticles functionalized with DNA probes (MNPs-DNA) and gold nanoparticles with numerous barcode DNA (AuNPs-DNA) were designed. In the presence of target miRNA, the MNP-DNA and AuNP-DNA hybridized with target miRNA to form a "sandwich" structure. After "sandwich" structures were separated from the solution by the magnetic field and dehybridized by high temperature, the barcode DNA sequences were released by dissolving AuNPs. The released barcode DNA sequences triggered the toehold strand displacement assembly of two hairpin probes, leading to recycle of barcode DNA sequences and producing numerous fluorescent CHA products for miRNA detection. Under the optimal experimental conditions, the proposed two-stage amplification system could sensitively detect target miRNA ranging from 10 pM to 10 aM with a limit of detection (LOD) down to 97.9 zM. It displayed good capability to discriminate single base and three bases mismatch due to the unique sandwich structure. Notably, it presented good feasibility for selective multiplexed detection of various combinations of synthetic miRNA sequences and miRNAs extracted from different cell lysates, which were in agreement with the traditional polymerase chain reaction analysis. The two-stage amplification strategy may be significant implication in the biological detection and clinical diagnosis. Copyright © 2017 Elsevier B.V. All rights reserved.
The D1-D2 region of the large subunit ribosomal DNA as barcode for ciliates.
Stoeck, T; Przybos, E; Dunthorn, M
2014-05-01
Ciliates are a major evolutionary lineage within the alveolates, which are distributed in nearly all habitats on our planet and are an essential component for ecosystem function, processes and stability. Accurate identification of these unicellular eukaryotes through, for example, microscopy or mating type reactions is reserved to few specialists. To satisfy the demand for a DNA barcode for ciliates, which meets the standard criteria for DNA barcodes defined by the Consortium for the Barcode of Life (CBOL), we here evaluated the D1-D2 region of the ribosomal DNA large subunit (LSU-rDNA). Primer universality for the phylum Ciliophora was tested in silico with available database sequences as well as in the laboratory with 73 ciliate species, which represented nine of 12 ciliate classes. Primers tested in this study were successful for all tested classes. To test the ability of the D1-D2 region to resolve conspecific and congeneric sequence divergence, 63 Paramecium strains were sampled from 24 mating species. The average conspecific D1-D2 variation was 0.18%, whereas congeneric sequence divergence averaged 4.83%. In pairwise genetic distance analyses, we identified a D1-D2 sequence divergence of <0.6% as an ideal threshold to discriminate Paramecium species. Using this definition, only 3.8% of all conspecific and 3.9% of all congeneric sequence comparisons had the potential of false assignments. Neighbour-joining analyses inferred monophyly for all taxa but for two Paramecium octaurelia strains. Here, we present a protocol for easy DNA amplification of single cells and voucher deposition. In conclusion, the presented data pinpoint the D1-D2 region as an excellent candidate for an official CBOL barcode for ciliated protists. © 2013 John Wiley & Sons Ltd.
Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.
2012-01-01
DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820
Evaluation of DNA barcode candidates for the discrimination of Artemisia L.
Liu, Geyu; Ning, Huixia; Ayidaerhan, Nurbolati; Aisa, Haji Akber
2017-11-01
Because of the very similar morphologies and wide diversity of Artemisia L. varieties, they are difficult to identify, and there have been many arguments about the systematic classification Artemisia L., especially concerning the division of species. DNA barcode technology is used to rapidly identify species based on standard short DNA sequences. To evaluate seven candidate DNA barcodes (ITS, ITS2, psbA-trnH, rbcL, matK, rpoB, and rpoC1) regarding their ability to identify closely related species of the Artemisia genus in Xinjiang. The corresponding PCR amplification efficiency, detectable genetic divergence, identification efficiency and phylogenetic tree were assessed. We found that the internal transcribed spacer (ITS) region exhibited the highest interspecific divergence, which was significantly higher than the observed intraspecific variation and showed the highest identification efficiency, followed by ITS2, psbA-trnH and, finally, rpoB. matK, rbcL, and rpoC1 performed poorly in this evaluation. ITS, ITS2, and psbA-trnH were able to perfectly identify the tested species Artemisia annua, A. absinthium, A. rupestris, A. tonurnefortiana, A. austriaca, A. dracunculus, A. vulgaris, and A. macrocephala. Therefore, we propose the ITS, ITS2, and psbA-trnH regions as promising DNA barcodes for the closely related species of Artemisia L. in Xinjiang.
Syromyatnikov, Mikhail Y; Golub, Victor B; Kokina, Anastasia V; Victoria A Soboleva; Popov, Vasily N
2017-01-01
The genus Eurygaster Laporte, 1833 includes ten species five of which inhabit the European part of Russia. The harmful species of the genus is E. integriceps . Eurygaster species identification based on the morphological traits is very difficult, while that of the species at the egg or larval stages is extremely difficult or impossible. Eurygaster integriceps , E. maura , and E. testudinaria differ only slightly between each other morphologically, E. maura and E. testudinaria being almost indiscernible. DNA barcoding based on COI sequences have shown that E. integriceps differs significantly from these closely related species, which enables its rapid and accurate identification. Based on COI nucleotide sequences, three species of Sunn pests, E. maura , E. testudinarius , E. dilaticollis , could not be differentiated from each other through DNA barcoding. The difference in the DNA sequences between the COI gene of E. integriceps and COI genes of E. maura and E. testudinarius was more than 4%. In the present study DNA barcoding of two Eurygaster species was performed for the first time on E. integriceps , the most dangerous pest in the genus, and E. dilaticollis that only inhabits natural ecosystems. The PCR-RFLP method was developed in this work for the rapid identification of E. integriceps .
DNA Barcoding for the Identification and Authentication of Animal Species in Traditional Medicine.
Yang, Fan; Ding, Fei; Chen, Hong; He, Mingqi; Zhu, Shixin; Ma, Xin; Jiang, Li; Li, Haifeng
2018-01-01
Animal-based traditional medicine not only plays a significant role in therapeutic practices worldwide but also provides a potential compound library for drug discovery. However, persistent hunting and illegal trade markedly threaten numerous medicinal animal species, and increasing demand further provokes the emergence of various adulterants. As the conventional methods are difficult and time-consuming to detect processed products or identify animal species with similar morphology, developing novel authentication methods for animal-based traditional medicine represents an urgent need. During the last decade, DNA barcoding offers an accurate and efficient strategy that can identify existing species and discover unknown species via analysis of sequence variation in a standardized region of DNA. Recent studies have shown that DNA barcoding as well as minibarcoding and metabarcoding is capable of identifying animal species and discriminating the authentics from the adulterants in various types of traditional medicines, including raw materials, processed products, and complex preparations. These techniques can also be used to detect the unlabelled and threatened animal species in traditional medicine. Here, we review the recent progress of DNA barcoding for the identification and authentication of animal species used in traditional medicine, which provides a reference for quality control and trade supervision of animal-based traditional medicine.
Syromyatnikov, Mikhail Y.; Golub, Victor B.; Kokina, Anastasia V.; Victoria A. Soboleva; Popov, Vasily N.
2017-01-01
Abstract The genus Eurygaster Laporte, 1833 includes ten species five of which inhabit the European part of Russia. The harmful species of the genus is E. integriceps. Eurygaster species identification based on the morphological traits is very difficult, while that of the species at the egg or larval stages is extremely difficult or impossible. Eurygaster integriceps, E. maura, and E. testudinaria differ only slightly between each other morphologically, E. maura and E. testudinaria being almost indiscernible. DNA barcoding based on COI sequences have shown that E. integriceps differs significantly from these closely related species, which enables its rapid and accurate identification. Based on COI nucleotide sequences, three species of Sunn pests, E. maura, E. testudinarius, E. dilaticollis, could not be differentiated from each other through DNA barcoding. The difference in the DNA sequences between the COI gene of E. integriceps and COI genes of E. maura and E. testudinarius was more than 4%. In the present study DNA barcoding of two Eurygaster species was performed for the first time on E. integriceps, the most dangerous pest in the genus, and E. dilaticollis that only inhabits natural ecosystems. The PCR-RFLP method was developed in this work for the rapid identification of E. integriceps. PMID:29118620
DNA Barcoding for the Identification and Authentication of Animal Species in Traditional Medicine
Yang, Fan; Ding, Fei; Chen, Hong; He, Mingqi; Zhu, Shixin; Ma, Xin; Jiang, Li
2018-01-01
Animal-based traditional medicine not only plays a significant role in therapeutic practices worldwide but also provides a potential compound library for drug discovery. However, persistent hunting and illegal trade markedly threaten numerous medicinal animal species, and increasing demand further provokes the emergence of various adulterants. As the conventional methods are difficult and time-consuming to detect processed products or identify animal species with similar morphology, developing novel authentication methods for animal-based traditional medicine represents an urgent need. During the last decade, DNA barcoding offers an accurate and efficient strategy that can identify existing species and discover unknown species via analysis of sequence variation in a standardized region of DNA. Recent studies have shown that DNA barcoding as well as minibarcoding and metabarcoding is capable of identifying animal species and discriminating the authentics from the adulterants in various types of traditional medicines, including raw materials, processed products, and complex preparations. These techniques can also be used to detect the unlabelled and threatened animal species in traditional medicine. Here, we review the recent progress of DNA barcoding for the identification and authentication of animal species used in traditional medicine, which provides a reference for quality control and trade supervision of animal-based traditional medicine. PMID:29849709
Identification of Belgian mosquito species (Diptera: Culicidae) by DNA barcoding.
Versteirt, V; Nagy, Z T; Roelants, P; Denis, L; Breman, F C; Damiens, D; Dekoninck, W; Backeljau, T; Coosemans, M; Van Bortel, W
2015-03-01
Since its introduction in 2003, DNA barcoding has proven to be a promising method for the identification of many taxa, including mosquitoes (Diptera: Culicidae). Many mosquito species are potential vectors of pathogens, and correct identification in all life stages is essential for effective mosquito monitoring and control. To use DNA barcoding for species identification, a reliable and comprehensive reference database of verified DNA sequences is required. Hence, DNA sequence diversity of mosquitoes in Belgium was assessed using a 658 bp fragment of the mitochondrial cytochrome oxidase I (COI) gene, and a reference data set was established. Most species appeared as well-supported clusters. Intraspecific Kimura 2-parameter (K2P) distances averaged 0.7%, and the maximum observed K2P distance was 6.2% for Aedes koreicus. A small overlap between intra- and interspecific K2P distances for congeneric sequences was observed. Overall, the identification success using best match and the best close match criteria were high, that is above 98%. No clear genetic division was found between the closely related species Aedes annulipes and Aedes cantans, which can be confused using morphological identification only. The members of the Anopheles maculipennis complex, that is Anopheles maculipennis s.s. and An. messeae, were weakly supported as monophyletic taxa. This study showed that DNA barcoding offers a reliable framework for mosquito species identification in Belgium except for some closely related species. © 2014 John Wiley & Sons Ltd.
DNA Barcoding of Zooplankton in the Hampton Roads Area: A Biodiversity Assessment
NASA Astrophysics Data System (ADS)
Salcedo, A.; Rodríguez, Á. E.; Gibson, D. M.
2016-02-01
The study of zooplankton biodiversity and distribution is crucial to understand oceanic ecosystems and anticipate the effects of climate change. Previously, identification of zooplankton relied in morphological identification employed by expert taxonomists. DNA barcoding, a technique that uses the mitochondrial DNA (mtDNA) Cytochrome Oxidase 1 (CO1) gene is widely used for taxonomic identification. Thus, this molecular technique will be used to begin a detailed characterization of zooplankton diversity, abundance and community structure in the Hampton Roads Area (HRA). Stations 1 (Jones Creek) and 3 (lower Chesapeake Bay) were sampled in June 19, 2015. Stations 1, 2 (James River), and 3 were sampled in September 2015. Zooplankton samples were collected in triplicates with a 0.5m, 200 µm mesh net. Physical parameters (dissolved oxygen, salinity, temperature and, water transparency) were measured. Species identified as Opistonema oglinum (Atlantic Thread Herring) and Paracalanus parvus copepods were found at station 3; Anchoa mitchilli and Acartia tonsa copepods were found at stations 1 and 3. This study indicates that mtDNA-CO1 barcoding is suitable to identify zooplankton to the species level and helps validate DNA barcoding as a faster, more accurate taxonomic approach. The long term objective of this project is to provide a comprehensive assessment of zooplankton in the HRA and to generate a reference record for broad monitoring programs; vital for a better understanding and management of ecologically and commercially important species.
Unexpected diversity of sandflies (Diptera: Psychodidae) in tourist caves in Northern Thailand.
Sukantamala, Jedsada; Sing, Kong-Wah; Jaturas, Narong; Polseela, Raxsina; Wilson, John-James
2017-11-01
Certain species of Phlebotomine sandflies (Diptera: Psychodidae) are vectors of the protozoa which causes leishmaniasis. Sandflies are found breeding in enclosed places like caves. Thailand is a popular tourist destination, including for ecotourism activities like caving, which increases the risk of contact between tourists and sandflies. Surveillance of sandflies is important for monitoring this risk but identification of species based on morphology is challenged by phenotypic plasticity and cryptic diversity. DNA barcodes have been used for the identification of sandflies in Thailand. We collected sandflies using CDC light trap from four tourist caves in Northern Thailand. Female sandflies were provisionally sorted into 13 morphospecies and 19 unidentified specimens. DNA was extracted from the thorax and legs of sandflies and the DNA barcode region of cytochrome c oxidase I mtDNA amplified and sequenced. The specimens were sorted into 22 molecular operational taxonomic units (MOTU) based on the 145 DNA barcodes, which is significantly more than the morphospecies. Several of the taxa thought to be present in multiple caves, based on morphospecies sorting, split into cave-specific MOTU which likely represent cryptic species. Several MOTU reported in an earlier study from Wihan Cave, Thailand, were also found in these caves. This supports the use of DNA barcodes to investigate species diversity of sandflies and their useful role in surveillance of sandflies in Thailand.
rbcL and matK Earn Two Thumbs Up as the Core DNA Barcode for Ferns
Li, Fay-Wei; Kuo, Li-Yaung; Rothfels, Carl J.; Ebihara, Atsushi; Chiou, Wen-Liang; Windham, Michael D.; Pryer, Kathleen M.
2011-01-01
Background DNA barcoding will revolutionize our understanding of fern ecology, most especially because the accurate identification of the independent but cryptic gametophyte phase of the fern's life history—an endeavor previously impossible—will finally be feasible. In this study, we assess the discriminatory power of the core plant DNA barcode (rbcL and matK), as well as alternatively proposed fern barcodes (trnH-psbA and trnL-F), across all major fern lineages. We also present plastid barcode data for two genera in the hyperdiverse polypod clade—Deparia (Woodsiaceae) and the Cheilanthes marginata group (currently being segregated as a new genus of Pteridaceae)—to further evaluate the resolving power of these loci. Principal Findings Our results clearly demonstrate the value of matK data, previously unavailable in ferns because of difficulties in amplification due to a major rearrangement of the plastid genome. With its high sequence variation, matK complements rbcL to provide a two-locus barcode with strong resolving power. With sequence variation comparable to matK, trnL-F appears to be a suitable alternative barcode region in ferns, and perhaps should be added to the core barcode region if universal primer development for matK fails. In contrast, trnH-psbA shows dramatically reduced sequence variation for the majority of ferns. This is likely due to the translocation of this segment of the plastid genome into the inverted repeat regions, which are known to have a highly constrained substitution rate. Conclusions Our study provides the first endorsement of the two-locus barcode (rbcL+matK) in ferns, and favors trnL-F over trnH-psbA as a potential back-up locus. Future work should focus on gathering more fern matK sequence data to facilitate universal primer development. PMID:22028918
Ordoñez, June Feliciano F; Ventolero, Minerva Fatimae H; Santos, Mudjekeewis D
2017-07-01
The introduction of genetically enhanced tilapia has significantly boosted the performance of Philippine aquaculture industry. While enhanced strains contribute to the increase in tilapia production, genetic characterization of present tilapia stocks is critical to maintain their quality and to ensure the genetic gains are sustained. To understand and determine the genetic relationship of the genetically enhanced strains produced in the Philippines, mitochondrial cytochrome oxidase subunit I (COI) gene using DNA barcoding approach was analyzed. Specimens representing 10 genetically enhanced strains (GIFT, FaST, GET-EXCEL, GST, SST, COLD, YY-male, GMT, Molobicus, and BEST), three red tilapia (Taiwan red, Florida red, and FAC-red), and two pure lines (initially identified as O. aureus and O. spilurus) were collected, sequenced, and identified using DNA barcoding. Results revealed that farmed tilapias consisted of four different Oreochromis species. As expected, COI could not distinguish individuals at the strain level but surprisingly, mismatch between the species of maternal origin and present-day offspring was observed. This particular result may pose a question on the genetic purity and integrity of the strains being distributed to farmers and suggests a re-evaluation of the effectiveness of major tilapia breeding centers in maintaining their stocks.
Nithaniyal, Stalin; Newmaster, Steven G; Ragupathy, Subramanyam; Krishnamoorthy, Devanathan; Vassou, Sophie Lorraine; Parani, Madasamy
2014-01-01
India is rich with biodiversity, which includes a large number of endemic, rare and threatened plant species. Previous studies have used DNA barcoding to inventory species for applications in biodiversity monitoring, conservation impact assessment, monitoring of illegal trading, authentication of traded medicinal plants etc. This is the first tropical dry evergreen forest (TDEF) barcode study in the World and the first attempt to assemble a reference barcode library for the trees of India as part of a larger project initiated by this research group. We sampled 429 trees representing 143 tropical dry evergreen forest (TDEF) species, which included 16 threatened species. DNA barcoding was completed using rbcL and matK markers. The tiered approach (1st tier rbcL; 2nd tier matK) correctly identified 136 out of 143 species (95%). This high level of species resolution was largely due to the fact that the tree species were taxonomically diverse in the TDEF. Ability to resolve taxonomically diverse tree species of TDEF was comparable among the best match method, the phylogenetic method, and the characteristic attribute organization system method. We demonstrated the utility of the TDEF reference barcode library to authenticate wood samples from timber operations in the TDEF. This pilot research study will enable more comprehensive surveys of the illegal timber trade of threatened species in the TDEF. This TDEF reference barcode library also contains trees that have medicinal properties, which could be used to monitor unsustainable and indiscriminate collection of plants from the wild for their medicinal value.
Nithaniyal, Stalin; Newmaster, Steven G.; Ragupathy, Subramanyam; Krishnamoorthy, Devanathan; Vassou, Sophie Lorraine; Parani, Madasamy
2014-01-01
Background India is rich with biodiversity, which includes a large number of endemic, rare and threatened plant species. Previous studies have used DNA barcoding to inventory species for applications in biodiversity monitoring, conservation impact assessment, monitoring of illegal trading, authentication of traded medicinal plants etc. This is the first tropical dry evergreen forest (TDEF) barcode study in the World and the first attempt to assemble a reference barcode library for the trees of India as part of a larger project initiated by this research group. Methodology/Principal Findings We sampled 429 trees representing 143 tropical dry evergreen forest (TDEF) species, which included 16 threatened species. DNA barcoding was completed using rbcL and matK markers. The tiered approach (1st tier rbcL; 2nd tier matK) correctly identified 136 out of 143 species (95%). This high level of species resolution was largely due to the fact that the tree species were taxonomically diverse in the TDEF. Ability to resolve taxonomically diverse tree species of TDEF was comparable among the best match method, the phylogenetic method, and the characteristic attribute organization system method. Conclusions We demonstrated the utility of the TDEF reference barcode library to authenticate wood samples from timber operations in the TDEF. This pilot research study will enable more comprehensive surveys of the illegal timber trade of threatened species in the TDEF. This TDEF reference barcode library also contains trees that have medicinal properties, which could be used to monitor unsustainable and indiscriminate collection of plants from the wild for their medicinal value. PMID:25259794
Shen, Yanjun; Guan, Lihong; Wang, Dengqiang; Gan, Xiaoni
2016-05-01
The Yangtze River is the longest river in China and is divided into upstream and mid-downstream regions by the Three Gorges (the natural barriers of the Yangtze River), resulting in a complex distribution of fish. Dramatic changes to habitat environments may ultimately threaten fish survival; thus, it is necessary to evaluate the genetic diversity and propose protective measures. Species identification is the most significant task in many fields of biological research and in conservation efforts. DNA barcoding, which constitutes the analysis of a short fragment of the mitochondrial cytochrome c oxidase subunit I (COI) sequence, has been widely used for species identification. In this study, we collected 561 COI barcode sequences from 35 fish from the midstream of the Yangtze River. The intraspecific distances of all species were below 2% (with the exception of Acheilognathus macropterus and Hemibarbus maculatus). Nevertheless, all species could be unambiguously identified from the trees, barcoding gaps and taxonomic resolution ratio values. Furthermore, the COI barcode diversity was found to be low (≤0.5%), with the exception of H. maculatus (0.87%), A. macropterus (2.02%) and Saurogobio dabryi (0.82%). No or few shared haplotypes were detected between the upstream and downstream populations for ten species with overall nucleotide diversities greater than 0.00%, which indicated the likelihood of significant population genetic structuring. Our analyses indicated that DNA barcoding is an effective tool for the identification of cyprinidae fish in the midstream of the Yangtze River. It is vital that some protective measures be taken immediately because of the low COI barcode diversity.
Morinière, Jérôme; Hendrich, Lars; Balke, Michael; Beermann, Arne J; König, Tobias; Hess, Monika; Koch, Stefan; Müller, Reinhard; Leese, Florian; Hebert, Paul D N; Hausmann, Axel; Schubart, Christoph D; Haszprunar, Gerhard
2017-11-01
Mayflies, stoneflies and caddisflies (Ephemeroptera, Plecoptera and Trichoptera) are prominent representatives of aquatic macroinvertebrates, commonly used as indicator organisms for water quality and ecosystem assessments. However, unambiguous morphological identification of EPT species, especially their immature life stages, is a challenging, yet fundamental task. A comprehensive DNA barcode library based upon taxonomically well-curated specimens is needed to overcome the problematic identification. Once available, this library will support the implementation of fast, cost-efficient and reliable DNA-based identifications and assessments of ecological status. This study represents a major step towards a DNA barcode reference library as it covers for two-thirds of Germany's EPT species including 2,613 individuals belonging to 363 identified species. As such, it provides coverage for 38 of 44 families (86%) and practically all major bioindicator species. DNA barcode compliant sequences (≥500 bp) were recovered from 98.74% of the analysed specimens. Whereas most species (325, i.e., 89.53%) were unambiguously assigned to a single Barcode Index Number (BIN) by its COI sequence, 38 species (18 Ephemeroptera, nine Plecoptera and 11 Trichoptera) were assigned to a total of 89 BINs. Most of these additional BINs formed nearest neighbour clusters, reflecting the discrimination of geographical subclades of a currently recognized species. BIN sharing was uncommon, involving only two species pairs of Ephemeroptera. Interestingly, both maximum pairwise and nearest neighbour distances were substantially higher for Ephemeroptera compared to Plecoptera and Trichoptera, possibly indicating older speciation events, stronger positive selection or faster rate of molecular evolution. © 2017 John Wiley & Sons Ltd.
Dahruddin, Hadi; Hutama, Aditya; Busson, Frédéric; Sauri, Sopian; Hanner, Robert; Keith, Philippe; Hadiaty, Renny; Hubert, Nicolas
2017-03-01
Among the 899 species of freshwater fishes reported from Sundaland biodiversity hotspot, nearly 50% are endemics. The functional integrity of aquatic ecosystems is currently jeopardized by human activities, and landscape conversion led to the decline of fish populations in several part of Sundaland, particularly in Java. The inventory of the Javanese ichthyofauna has been discontinuous, and the taxonomic knowledge is scattered in the literature. This study provides a DNA barcode reference library for the inland fishes of Java and Bali with the aim to streamline the inventory of fishes in this part of Sundaland. Owing to the lack of available checklist for estimating the taxonomic coverage of this study, a checklist was compiled based on online catalogues. A total of 95 sites were visited, and a library including 1046 DNA barcodes for 159 species was assembled. Nearest neighbour distance was 28-fold higher than maximum intraspecific distance on average, and a DNA barcoding gap was observed. The list of species with DNA barcodes displayed large discrepancies with the checklist compiled here as only 36% (i.e. 77 species) and 60% (i.e. 24 species) of the known species were sampled in Java and Bali, respectively. This result was contrasted by a high number of new occurrences and the ceiling of the accumulation curves for both species and genera. These results highlight the poor taxonomic knowledge of this ichthyofauna, and the apparent discrepancy between present and historical occurrence data is to be attributed to species extirpations, synonymy and misidentifications in previous studies. © 2016 John Wiley & Sons Ltd.
Barcoding of fresh water fishes from Pakistan.
Karim, Asma; Iqbal, Asad; Akhtar, Rehan; Rizwan, Muhammad; Amar, Ali; Qamar, Usman; Jahan, Shah
2016-07-01
DNA bar-coding is a taxonomic method that uses small genetic markers in organisms' mitochondrial DNA (mt DNA) for identification of particular species. It uses sequence diversity in a 658-base pair fragment near the 5' end of the mitochondrial cytochrome c oxidase subunit 1 (CO1) gene as a tool for species identification. DNA barcoding is more accurate and reliable method as compared with the morphological identification. It is equally useful in juveniles as well as adult stages of fishes. The present study was conducted to identify three farm fish species of Pakistan (Cyprinus carpio, Cirrhinus mrigala, and Ctenopharyngodon idella) genetically. All of them belonged to family cyprinidae. CO1 gene was amplified. PCR products were sequenced and analyzed by bioinformatic software. Conspecific, congenric, and confamilial k2P nucleotide divergence was estimated. From these findings, it was concluded that the gene sequence, CO1, may serve as milestone for the identification of related species at molecular level.
Testing the Efficacy of DNA Barcodes for Identifying the Vascular Plants of Canada.
Braukmann, Thomas W A; Kuzmina, Maria L; Sills, Jesse; Zakharov, Evgeny V; Hebert, Paul D N
2017-01-01
Their relatively slow rates of molecular evolution, as well as frequent exposure to hybridization and introgression, often make it difficult to discriminate species of vascular plants with the standard barcode markers (rbcL, matK, ITS2). Previous studies have examined these constraints in narrow geographic or taxonomic contexts, but the present investigation expands analysis to consider the performance of these gene regions in discriminating the species in local floras at sites across Canada. To test identification success, we employed a DNA barcode reference library with sequence records for 96% of the 5108 vascular plant species known from Canada, but coverage varied from 94% for rbcL to 60% for ITS2 and 39% for matK. Using plant lists from 27 national parks and one scientific reserve, we tested the efficacy of DNA barcodes in identifying the plants in simulated species assemblages from six biogeographic regions of Canada using BLAST and mothur. Mean pairwise distance (MPD) and mean nearest taxon distance (MNTD) were strong predictors of barcode performance for different plant families and genera, and both metrics supported ITS2 as possessing the highest genetic diversity. All three genes performed strongly in assigning the taxa present in local floras to the correct genus with values ranging from 91% for rbcL to 97% for ITS2 and 98% for matK. However, matK delivered the highest species discrimination (~81%) followed by ITS2 (~72%) and rbcL (~44%). Despite the low number of plant taxa in the Canadian Arctic, DNA barcodes had the least success in discriminating species from this biogeographic region with resolution ranging from 36% with rbcL to 69% with matK. Species resolution was higher in the other settings, peaking in the Woodland region at 52% for rbcL and 87% for matK. Our results indicate that DNA barcoding is very effective in identifying Canadian plants to a genus, and that it performs well in discriminating species in regions where floristic diversity is highest.
Testing the Efficacy of DNA Barcodes for Identifying the Vascular Plants of Canada
Kuzmina, Maria L.; Sills, Jesse; Zakharov, Evgeny V.; Hebert, Paul D. N.
2017-01-01
Their relatively slow rates of molecular evolution, as well as frequent exposure to hybridization and introgression, often make it difficult to discriminate species of vascular plants with the standard barcode markers (rbcL, matK, ITS2). Previous studies have examined these constraints in narrow geographic or taxonomic contexts, but the present investigation expands analysis to consider the performance of these gene regions in discriminating the species in local floras at sites across Canada. To test identification success, we employed a DNA barcode reference library with sequence records for 96% of the 5108 vascular plant species known from Canada, but coverage varied from 94% for rbcL to 60% for ITS2 and 39% for matK. Using plant lists from 27 national parks and one scientific reserve, we tested the efficacy of DNA barcodes in identifying the plants in simulated species assemblages from six biogeographic regions of Canada using BLAST and mothur. Mean pairwise distance (MPD) and mean nearest taxon distance (MNTD) were strong predictors of barcode performance for different plant families and genera, and both metrics supported ITS2 as possessing the highest genetic diversity. All three genes performed strongly in assigning the taxa present in local floras to the correct genus with values ranging from 91% for rbcL to 97% for ITS2 and 98% for matK. However, matK delivered the highest species discrimination (~81%) followed by ITS2 (~72%) and rbcL (~44%). Despite the low number of plant taxa in the Canadian Arctic, DNA barcodes had the least success in discriminating species from this biogeographic region with resolution ranging from 36% with rbcL to 69% with matK. Species resolution was higher in the other settings, peaking in the Woodland region at 52% for rbcL and 87% for matK. Our results indicate that DNA barcoding is very effective in identifying Canadian plants to a genus, and that it performs well in discriminating species in regions where floristic diversity is highest. PMID:28072819