Sample records for dna base pairing

  1. Unique Thermal Stability of Unnatural Hydrophobic Ds Bases in Double-Stranded DNAs.

    PubMed

    Kimoto, Michiko; Hirao, Ichiro

    2017-10-20

    Genetic alphabet expansion technology, the introduction of unnatural bases or base pairs into replicable DNA, has rapidly advanced as a new synthetic biology area. A hydrophobic unnatural base pair between 7-(2-thienyl)imidazo[4,5-b]pyridine (Ds) and 2-nitro-4-propynylpyrrole (Px) exhibited high fidelity as a third base pair in PCR. SELEX methods using the Ds-Px pair enabled high-affinity DNA aptamer generation, and introducing a few Ds bases into DNA aptamers extremely augmented their affinities and selectivities to target proteins. Here, to further scrutinize the functions of this highly hydrophobic Ds base, the thermal stabilities of double-stranded DNAs (dsDNA) containing a noncognate Ds-Ds or G-Ds pair were examined. The thermal stability of the Ds-Ds self-pair was as high as that of the natural G-C pair, and apart from the generally higher stability of the G-C pair than that of the A-T pair, most of the 5'-pyrimidine-Ds-purine-3' sequences, such as CDsA and TDsA, exhibited higher stability than the 5'-purine-Ds-pyrimidine-3' sequences, such as GDsC and ADsC, in dsDNAs. This trait enabled the GC-content-independent control of the thermal stability of the designed dsDNA fragments. The melting temperatures of dsDNA fragments containing the Ds-Ds pair can be predicted from the nearest-neighbor parameters including the Ds base. In addition, the noncognate G-Ds pair can efficiently distinguish its neighboring cognate natural base pairs from noncognate pairs. We demonstrated that real-time PCR using primers containing Ds accurately detected a single-nucleotide mismatch in target DNAs. These unique properties of the Ds base that affect the stabilities of the neighboring base pairs could impart new functions to DNA molecules and technologies.

  2. Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

    PubMed Central

    Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

    2015-01-01

    Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

  3. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

    PubMed

    Takezawa, Yusuke; Shionoya, Mitsuhiko

    2012-12-18

    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional DNA molecules such as artificial DNAzymes and DNA machines. In addition, the metallo-base pairing system is a powerful tool for the construction of homogeneous and heterogeneous metal arrays, which can lead to DNA-based nanomaterials such as electronic wires and magnetic devices. Recently researchers have investigated these systems as enzyme replacements, which may offer an additional contribution to chemical biology and synthetic biology through the expansion of the genetic alphabet.

  4. Bifacial Base-Pairing Behaviors of 5-Hydroxyuracil DNA Bases through Hydrogen Bonding and Metal Coordination.

    PubMed

    Takezawa, Yusuke; Nishiyama, Kotaro; Mashima, Tsukasa; Katahira, Masato; Shionoya, Mitsuhiko

    2015-10-12

    A novel bifacial ligand-bearing nucleobase, 5-hydroxyuracil (U(OH) ), which forms both a hydrogen-bonded base pair (U(OH) -A) and a metal-mediated base pair (U(OH) -M-U(OH) ) has been developed. The U(OH) -M-U(OH) base pairs were quantitatively formed in the presence of lanthanide ions such as Gd(III) when U(OH) -U(OH) pairs were consecutively incorporated into DNA duplexes. This result established metal-assisted duplex stabilization as well as DNA-templated assembly of lanthanide ions. Notably, a duplex possessing U(OH) -A base pairs was destabilized by addition of Gd(III) ions. This observation suggests that the hybridization behaviors of the U(OH) -containing DNA strands are altered by metal complexation. Thus, the U(OH) nucleobase with a bifacial base-pairing property holds great promise as a component for metal-responsive DNA materials. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    PubMed

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson-Crick base pair in SECIS element plays an important role in the selenocysteine expression by UGA codon.

  6. Theoretical study on the binding mechanism between N6-methyladenine and natural DNA bases.

    PubMed

    Song, Qi-Xia; Ding, Zhen-Dong; Liu, Jian-Hua; Li, Yan; Wang, Hai-Jun

    2013-03-01

    N6-methyladenine (m(6)A) is a rare base naturally occurring in DNA. It is different from the base adenine due to its N-CH(3). Therefore, the base not only pairs with thymine, but also with other DNA bases (cytosine, adenine and guanine). In this work, Møller-Plesset second-order (MP2) method has been used to investigate the binding mechanism between m(6)A and natural DNA bases in gas phase and in aqueous solution. The results show that N-CH(3) changed the way of N6-methyladenine binding to natural DNA bases. The binding style significantly influences the stability of base pairs. The trans-m(6)A:G and trans-m(6)A:C conformers are the most stable among all the base pairs. The existence of solvent can remarkably reduce the stability of the base pairs, and the DNA bases prefer pairing with trans-m(6)A to cis-m(6)A. Besides, the properties of these hydrogen bonds have been analyzed by atom in molecules (AIM) theory, natural bond orbital (NBO) analysis and Wiberg bond indexes (WBI). In addition, pairing with m(6)A decreases the binding energies compared to the normal Watson-Crick base pairs, it may explain the instability of the N6 site methylated DNA in theory.

  7. DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

    PubMed

    Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

    2012-10-11

    Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

  8. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

    PubMed

    Brovarets', O O

    2013-01-01

    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  9. Envisaging quantum transport phenomenon in a muddled base pair of DNA

    NASA Astrophysics Data System (ADS)

    Vohra, Rajan; Sawhney, Ravinder Singh

    2018-05-01

    The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.

  10. Structural energetics of the adenine tract from an intrinsic transcription terminator.

    PubMed

    Huang, Yuegao; Weng, Xiaoli; Russu, Irina M

    2010-04-02

    Intrinsic transcription termination sites generally contain a tract of adenines in the DNA template that yields a tract of uracils at the 3' end of the nascent RNA. To understand how this base sequence contributes to termination of transcription, we have investigated two nucleic acid structures. The first is the RNA-DNA hybrid that contains the uracil tract 5'-rUUUUUAU-3' from the tR2 intrinsic terminator of bacteriophage lambda. The second is the homologous DNA-DNA duplex that contains the adenine tract 5'-dATAAAAA-3'. This duplex is present at the tR2 site when the DNA is not transcribed. The opening and the stability of each rU-dA/dT-dA base pair in the two structures are characterized by imino proton exchange and nuclear magnetic resonance spectroscopy. The results reveal concerted opening of the central rU-dA base pairs in the RNA-DNA hybrid. Furthermore, the stability profile of the adenine tract in the RNA-DNA hybrid is very different from that of the tract in the template DNA-DNA duplex. In the RNA-DNA hybrid, the stabilities of rU-dA base pairs range from 4.3 to 6.5 kcal/mol (at 10 degrees C). The sites of lowest stability are identified at the central positions of the tract. In the template DNA-DNA duplex, the dT-dA base pairs are more stable than the corresponding rU-dA base pairs in the hybrid by 0.9 to 4.6 kcal/mol and, in contrast to the RNA-DNA hybrid, the central base pairs have the highest stability. These results suggest that the central rU-dA/dT-dA base pairs in the adenine tract make the largest energetic contributions to transcription termination by promoting both the dissociation of the RNA transcript and the closing of the transcription bubble. The results also suggest that the high stability of dT-dA base pairs in the DNA provides a signal for the pausing of RNA polymerase at the termination site. Copyright 2010 Elsevier Ltd. All rights reserved.

  11. Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

    PubMed

    Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

    2018-03-26

    DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Base pairing and base mis-pairing in nucleic acids

    NASA Technical Reports Server (NTRS)

    Wang, A. H. J.; Rich, A.

    1986-01-01

    In recent years we have learned that DNA is conformationally active. It can exist in a number of different stable conformations including both right-handed and left-handed forms. Using single crystal X-ray diffraction analysis we are able to discover not only additional conformations of the nucleic acids but also different types of hydrogen bonded base-base interactions. Although Watson-Crick base pairings are the predominant type of interaction in double helical DNA, they are not the only types. Recently, we have been able to examine mismatching of guanine-thymine base pairs in left-handed Z-DNA at atomic resolution (1A). A minimum amount of distortion of the sugar phosphate backbone is found in the G x T pairing in which the bases are held together by two hydrogen bonds in the wobble pairing interaction. Because of the high resolution of the analysis we can visualize water molecules which fill in to accommodate the other hydrogen bonding positions in the bases which are not used in the base-base interactions. Studies on other DNA oligomers have revealed that other types of non-Watson-Crick hydrogen bonding interactions can occur. In the structure of a DNA octamer with the sequence d(GCGTACGC) complexed to an antibiotic triostin A, it was found that the two central AT base pairs are held together by Hoogsteen rather than Watson-Crick base pairs. Similarly, the G x C base pairs at the ends are also Hoogsteen rather than Watson-Crick pairing. Hoogsteen base pairs make a modified helix which is distinct from the Watson-Crick double helix.

  13. 1,8-Naphthyridine-2,7-diamine: a potential universal reader of Watson-Crick base pairs for DNA sequencing by electron tunneling.

    PubMed

    Liang, Feng; Lindsay, Stuart; Zhang, Peiming

    2012-11-21

    With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.

  14. 1,8-Naphthyridine-2,7-diamine: A Potential Universal Reader of the Watson-Crick Base Pairs for DNA Sequencing by Electron Tunneling

    PubMed Central

    Liang, Feng; Lindsay, Stuart; Zhang, Peiming

    2013-01-01

    With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read the DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A:T and G:C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs. PMID:23038027

  15. Stacked-unstacked equilibrium at the nick site of DNA.

    PubMed

    Protozanova, Ekaterina; Yakovchuk, Peter; Frank-Kamenetskii, Maxim D

    2004-09-17

    Stability of duplex DNA with respect to separation of complementary strands is crucial for DNA executing its major functions in the cell and it also plays a central role in major biotechnology applications of DNA: DNA sequencing, polymerase chain reaction, and DNA microarrays. Two types of interaction are well known to contribute to DNA stability: stacking between adjacent base-pairs and pairing between complementary bases. However, their contribution into the duplex stability is yet to be determined. Now we fill this fundamental gap in our knowledge of the DNA double helix. We have prepared a series of 32, 300 bp-long DNA fragments with solitary nicks in the same position differing only in base-pairs flanking the nick. Electrophoretic mobility of these fragments in the gel has been studied. Assuming the equilibrium between stacked and unstacked conformations at the nick site, all 32 stacking free energy parameters have been obtained. Only ten of them are essential and they govern the stacking interactions between adjacent base-pairs in intact DNA double helix. A full set of DNA stacking parameters has been determined for the first time. From these data and from a well-known dependence of DNA melting temperature on G.C content, the contribution of base-pairing into duplex stability has been estimated. The obtained energy parameters of the DNA double helix are of paramount importance for understanding sequence-dependent DNA flexibility and for numerous biotechnology applications.

  16. Discrimination of Single Base Pair Differences Among Individual DNA Molecules Using a Nanopore

    NASA Technical Reports Server (NTRS)

    Vercoutere, Wenonah; DeGuzman, Veronica

    2003-01-01

    The protein toxin alpha-hemolysin form nanometer scale channels across lipid membranes. Our lab uses a single channel in an artificial lipid bilayer in a patch clamp device to capture and examine individual DNA molecules. This nanopore detector used with a support vector machine (SVM) can analyze DNA hairpin molecules on the millisecond time scale. We distinguish duplex stem length, base pair mismatches, loop length, and single base pair differences. The residual current fluxes also reveal structural molecular dynamics elements. DNA end-fraying (terminal base pair dissociation) can be observed as near full blockades, or spikes, in current. This technique can be used to investigate other biological processes dependent on DNA end-fraying, such as the processing of HIV DNA by HIV integrase.

  17. Sequence-dependent base pair stepping dynamics in XPD helicase unwinding

    PubMed Central

    Qi, Zhi; Pugh, Robert A; Spies, Maria; Chemla, Yann R

    2013-01-01

    Helicases couple the chemical energy of ATP hydrolysis to directional translocation along nucleic acids and transient duplex separation. Understanding helicase mechanism requires that the basic physicochemical process of base pair separation be understood. This necessitates monitoring helicase activity directly, at high spatio-temporal resolution. Using optical tweezers with single base pair (bp) resolution, we analyzed DNA unwinding by XPD helicase, a Superfamily 2 (SF2) DNA helicase involved in DNA repair and transcription initiation. We show that monomeric XPD unwinds duplex DNA in 1-bp steps, yet exhibits frequent backsteps and undergoes conformational transitions manifested in 5-bp backward and forward steps. Quantifying the sequence dependence of XPD stepping dynamics with near base pair resolution, we provide the strongest and most direct evidence thus far that forward, single-base pair stepping of a helicase utilizes the spontaneous opening of the duplex. The proposed unwinding mechanism may be a universal feature of DNA helicases that move along DNA phosphodiester backbones. DOI: http://dx.doi.org/10.7554/eLife.00334.001 PMID:23741615

  18. Imidazopyridine/Pyrrole and hydroxybenzimidazole/pyrrole pairs for DNA minor groove recognition.

    PubMed

    Renneberg, Dorte; Dervan, Peter B

    2003-05-14

    The DNA binding properties of fused heterocycles imidazo[4,5-b]pyridine (Ip) and hydroxybenzimidazole (Hz) paired with pyrrole (Py) in eight-ring hairpin polyamides are reported. The recognition profile of Ip/Py and Hz/Py pairs were compared to the five-membered ring pairs Im/Py and Hp/Py on a DNA restriction fragment at four 6-base pair recognition sites which vary at a single position 5'-TGTNTA-3', where N = G, C, T, A. The Ip/Py pair distinguishes G.C from C.G, T.A, and A.T, and the Hz/Py pair distinguishes T.A from A.T, G.C, and C.G, affording a new set of heterocycle pairs to target the four Watson-Crick base pairs in the minor groove of DNA.

  19. Energy barriers and rates of tautomeric transitions in DNA bases: ab initio quantum chemical study.

    PubMed

    Basu, Soumalee; Majumdar, Rabi; Das, Gourab K; Bhattacharyya, Dhananjay

    2005-12-01

    Tautomeric transitions of DNA bases are proton transfer reactions, which are important in biology. These reactions are involved in spontaneous point mutations of the genetic material. In the present study, intrinsic reaction coordinates (IRC) analyses through ab initio quantum chemical calculations have been carried out for the individual DNA bases A, T, G, C and also A:T and G:C base pairs to estimate the kinetic and thermodynamic barriers using MP2/6-31G** method for tautomeric transitions. Relatively higher values of kinetic barriers (about 50-60 kcal/mol) have been observed for the single bases, indicating that tautomeric alterations of isolated single bases are quite unlikely. On the other hand, relatively lower values of the kinetic barriers (about 20-25 kcal/mol) for the DNA base pairs A:T and G:C clearly suggest that the tautomeric shifts are much more favorable in DNA base pairs than in isolated single bases. The unusual base pairing A':C, T':G, C':A or G':T in the daughter DNA molecule, resulting from a parent DNA molecule with tautomeric shifts, is found to be stable enough to result in a mutation. The transition rate constants for the single DNA bases in addition to the base pairs are also calculated by computing the free energy differences between the transition states and the reactants.

  20. Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

    PubMed

    Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-03-14

    We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

  1. Stacking interactions and DNA intercalation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Dr. Shen; Cooper, Valentino R; Thonhauser, Prof. Timo

    2009-01-01

    The relationship between stacking interactions and the intercalation of proflavine and ellipticine within DNA is investigated using a nonempirical van der Waals density functional for the correlation energy. Our results, employing a binary stack model, highlight fundamental, qualitative differences between base-pair base-pair interactions and that of the stacked intercalator base pair system. Most notable result is the paucity of torque which so distinctively defines the Twist of DNA. Surprisingly, this model, when combined with a constraint on the twist of the surrounding base-pair steps to match the observed unwinding of the sugar-phosphate backbone, was sufficient for explaining the experimentally observedmore » proflavine intercalator configuration. Our extensive mapping of the potential energy surface of base-pair intercalator interactions can provide valuable information for future nonempirical studies of DNA intercalation dynamics.« less

  2. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    PubMed Central

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

    2015-01-01

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536

  3. Silver (I) as DNA glue: Ag(+)-mediated guanine pairing revealed by removing Watson-Crick constraints.

    PubMed

    Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G

    2015-05-14

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  4. Twin hydroxymethyluracil-A base pair steps define the binding site for the DNA-binding protein TF1.

    PubMed

    Grove, A; Figueiredo, M L; Galeone, A; Mayol, L; Geiduschek, E P

    1997-05-16

    The DNA-bending protein TF1 is the Bacillus subtilis bacteriophage SPO1-encoded homolog of the bacterial HU proteins and the Escherichia coli integration host factor. We recently proposed that TF1, which binds with high affinity (Kd was approximately 3 nM) to preferred sites within the hydroxymethyluracil (hmU)-containing phage genome, identifies its binding sites based on sequence-dependent DNA flexibility. Here, we show that two hmU-A base pair steps coinciding with two previously proposed sites of DNA distortion are critical for complex formation. The affinity of TF1 is reduced 10-fold when both of these hmU-A base pair steps are replaced with A-hmU, G-C, or C-G steps; only modest changes in affinity result when substitutions are made at other base pairs of the TF1 binding site. Replacement of all hmU residues with thymine decreases the affinity of TF1 greatly; remarkably, the high affinity is restored when the two hmU-A base pair steps corresponding to previously suggested sites of distortion are reintroduced into otherwise T-containing DNA. T-DNA constructs with 3-base bulges spaced apart by 9 base pairs of duplex also generate nM affinity of TF1. We suggest that twin hmU-A base pair steps located at the proposed sites of distortion are key to target site selection by TF1 and that recognition is based largely, if not entirely, on sequence-dependent DNA flexibility.

  5. Molecular recognition of DNA base pairs by the formamido/pyrrole and formamido/imidazole pairings in stacked polyamides.

    PubMed

    Buchmueller, Karen L; Staples, Andrew M; Uthe, Peter B; Howard, Cameron M; Pacheco, Kimberly A O; Cox, Kari K; Henry, James A; Bailey, Suzanna L; Horick, Sarah M; Nguyen, Binh; Wilson, W David; Lee, Moses

    2005-01-01

    Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, -ImPy- and -PyPy-. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and DeltaT (M) experiments. The f/Py pairing, when placed next to the -ImPy- or -PyPy- central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With -ImPy- central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson-Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the -PyPy- central pairings.

  6. Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

    PubMed

    Yang, Haozhe; Mei, Hui; Seela, Frank

    2015-07-06

    Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Synthesis and Properties of Size-expanded DNAs: Toward Designed, Functional Genetic Systems

    PubMed Central

    Krueger, Andrew T.; Lu, Haige; Lee, Alex H. F.; Kool, Eric T.

    2008-01-01

    We describe the design, synthesis, and properties of DNA-like molecules in which the base pairs are expanded by benzo homologation. The resulting size-expanded genetic helices are called xDNA (“expanded DNA”) and yDNA (“wide DNA”). The large component bases are fluorescent, and they display high stacking affinity. When singly substituted into natural DNA, they are destabilizing because the benzo-expanded base pair size is too large for the natural helix. However, when all base pairs are expanded, xDNA and yDNA form highly stable, sequence-selective double helices. The size-expanded DNAs are candidates for components of new, functioning genetic systems. In addition, the fluorescence of expanded DNA bases makes them potentially useful in probing nucleic acids. PMID:17309194

  8. Combined effects of metal complexation and size expansion in the electronic structure of DNA base pairs

    NASA Astrophysics Data System (ADS)

    Brancolini, Giorgia; Di Felice, Rosa

    2011-05-01

    Novel DNA derivatives have been recently investigated in the pursuit of modified DNA duplexes to tune the electronic structure of DNA-based assemblies for nanotechnology applications. Size-expanded DNAs (e.g., xDNA) and metalated DNAs (M-DNA) may enhance stacking interactions and induce metallic conductivity, respectively. Here we explore possible ways of tailoring the DNA electronic structure by combining the aromatic size expansion with the metal-doping. We select the salient structures from our recent study on natural DNA pairs complexed with transition metal ions and consider the equivalent model configurations for xDNA pairs. We present the results of density functional theory electronic structure calculations of the metalated expanded base-pairs with various localized basis sets and exchange-correlation functionals. Implicit solvent and coordination water molecules are also included. Our results indicate that the effect of base expansion is largest in Ag-xGC complexes, while Cu-xGC complexes are the most promising candidates for nanowires with enhanced electron transfer and also for on-purpose modification of the DNA double-helix for signal detection.

  9. Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

    PubMed

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-08

    The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

  10. Comparable Stability of Hoogsteen and Watson–Crick Base Pairs in Ionic Liquid Choline Dihydrogen Phosphate

    PubMed Central

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-01

    The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194

  11. m1A and m1G Potently Disrupt A-RNA Structure Due to the Intrinsic Instability of Hoogsteen Base Pairs

    PubMed Central

    Zhou, Huiqing; Kimsey, Isaac J.; Nikolova, Evgenia N.; Sathyamoorthy, Bharathwaj; Grazioli, Gianmarc; McSally, James; Bai, Tianyu; Wunderlich, Christoph H.; Kreutz, Christoph; Andricioaei, Ioan; Al-Hashimi, Hashim M.

    2016-01-01

    The B-DNA double helix can dynamically accommodate G–C and A–T base pairs in either Watson-Crick or Hoogsteen configurations. Here, we show that G–C+ and A–U Hoogsteen base pairs are strongly disfavored in A-RNA. As a result, N1-methyl adenosine and N1-methyl guanosine, which occur in DNA as a form of alkylation damage, and in RNA as a posttranscriptional modification, have dramatically different consequences. They create G–C+ and A–U Hoogsteen base pairs in duplex DNA that maintain the structural integrity of the double helix, but block base pairing all together and induce local duplex melting in RNA, providing a mechanism for potently disrupting RNA structure through posttranscriptional modifications. The markedly different propensities to form Hoogsteen base pairs in B-DNA and A-RNA may help meet the opposing requirements of maintaining genome stability on one hand, and dynamically modulating the structure of the epitranscriptome on the other. PMID:27478929

  12. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

    PubMed

    Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

    2013-06-17

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Molecular recognition of DNA base pairs by the formamido/pyrrole and formamido/imidazole pairings in stacked polyamides

    PubMed Central

    Buchmueller, Karen L.; Staples, Andrew M.; Uthe, Peter B.; Howard, Cameron M.; Pacheco, Kimberly A. O.; Cox, Kari K.; Henry, James A.; Bailey, Suzanna L.; Horick, Sarah M.; Nguyen, Binh; Wilson, W. David; Lee, Moses

    2005-01-01

    Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, –ImPy– and –PyPy–. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and ΔTM experiments. The f/Py pairing, when placed next to the –ImPy– or –PyPy– central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With –ImPy– central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson–Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the –PyPy– central pairings. PMID:15703305

  14. 2-Methoxypyridine as a Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability, and NMR Structural Studies.

    PubMed

    Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks

    2017-11-02

    The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Utilizing Molecular Dynamics ' Multipotent Methodologies to Measure Microscopic Motions of DNA Molecules: A Magniloquent Manuscript On DNA's Means and Mannerisms

    NASA Astrophysics Data System (ADS)

    Kingsland, Addie

    DNA is an amazing molecule which is the basic template for all genetics. It is the primary molecule for storing biological information, and has many applications in nanotechnology. Double-stranded DNA may contain mismatched base pairs beyond the Watson-Crick pairs guanine-cytosine and adenine-thymine. To date, no one has found a physical property of base pair mismatches which describes the behavior of naturally occurring mismatch repair enzymes. Many materials properties of DNA are also unknown, for instance, when pulling DNA in different configurations, different energy differences are observed with no obvious reason why. DNA mismatches also affect their local environment, for instance changing the quantum yield of nearby azobenzene moieties. We utilize molecular dynamics computer simulations to study the structure and dynamics for both matched and mismatched base pairs, within both biological and materials contexts, and in both equilibrium and biased dynamics. We show that mismatched pairs shift further in the plane normal to the DNA strand and are more likely to exhibit non-canonical structures, including the e-motif. Base pair mismatches alter their local environment, affecting the trans- to cis- photoisomerization quantum yield of azobenzene, as well as increasing the likelihood of observing the e-motif. We also show that by using simulated data, we can give new insights on theoretical models to calculate the energetics of pulling DNA strands apart. These results, all relatively inexpensive on modern computer hardware, can help guide the design of DNA-based nanotechnologies, as well as give new insights into the functioning of mismatch repair systems in cancer prevention.

  16. DNA-Mediated Electrochemistry

    PubMed Central

    Gorodetsky, Alon A.; Buzzeo, Marisa C.

    2009-01-01

    The base pair stack of DNA has been demonstrated as a medium for long range charge transport chemistry both in solution and at DNA-modified surfaces. This chemistry is exquisitely sensitive to structural perturbations in the base pair stack as occur with lesions, single base mismatches, and protein binding. We have exploited this sensitivity for the development of reliable electrochemical assays based on DNA charge transport at self-assembled DNA monolayers. Here we discuss the characteristic features, applications, and advantages of DNA-mediated electrochemistry. PMID:18980370

  17. KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.

    PubMed

    Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas

    2012-07-01

    Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.

  18. Exploring the Limits of DNA Size: Naphtho-homologated DNA Bases and Pairs

    PubMed Central

    Lee, Alex H. F.; Kool, Eric T.

    2008-01-01

    A new design for DNA bases and base pairs is described in which the pyrimidine bases are widened by naphtho-homologation. Two naphtho-homologated deoxyribosides, dyyT (1) and dyyC (2) were synthesized and could be incorporated into oligonucleotides as suitably protected phosphoramidite derivatives. The deoxyribosides were found to be fluorescent, with emission maxima at 446 and 433 nm, respectively. Studies with single substitutions of 1 and 2 in the natural DNA context revealed exceptionally strong base stacking propensity for both. Sequences containing multiple substitutions of 1 and 2 paired opposite adenine and guanine were subsequently mixed and studied by several analytical methods. Data from UV mixing experiments, FRET measurements, fluorescence quenching experiments, and hybridizations on beads suggest that complementary “doublewide DNA” (yyDNA) strands may self-assemble into helical complexes with 1:1 stoichiometry. Data from thermal denaturation plots and CD spectra were less conclusive. Control experiments in one sequence context gave evidence that yyDNA helices, if formed, are preferentially antiparallel and are sequence selective. Hypothesized base pairing schemes are analogous to Watson-Crick pairing, but with glycosidic C1′-C1′ distances widened by over 45%, to ca. 15.2 Å. The possible self-assembly of the double-wide DNA helix establishes a new limit for the size of information-encoding, DNA-like molecules, and the fluorescence of yyDNA bases suggests uses as reporters in monomeric and oligomeric forms. PMID:16834396

  19. Geometrical correlations in the nucleosomal DNA conformation and the role of the covalent bonds rigidity

    PubMed Central

    Ghorbani, Maryam; Mohammad-Rafiee, Farshid

    2011-01-01

    We develop a simple elastic model to study the conformation of DNA in the nucleosome core particle. In this model, the changes in the energy of the covalent bonds that connect the base pairs of each strand of the DNA double helix, as well as the lateral displacements and the rotation of adjacent base pairs are considered. We show that because of the rigidity of the covalent bonds in the sugar-phosphate backbones, the base pair parameters are highly correlated, especially, strong twist-roll-slide correlation in the conformation of the nucleosomal DNA is vividly observed in the calculated results. This simple model succeeds to account for the detailed features of the structure of the nucleosomal DNA, particularly, its more important base pair parameters, roll and slide, in good agreement with the experimental results. PMID:20972223

  20. Reversed-phase ion-pair liquid chromatography method for purification of duplex DNA with single base pair resolution

    PubMed Central

    Wysoczynski, Christina L.; Roemer, Sarah C.; Dostal, Vishantie; Barkley, Robert M.; Churchill, Mair E. A.; Malarkey, Christopher S.

    2013-01-01

    Obtaining quantities of highly pure duplex DNA is a bottleneck in the biophysical analysis of protein–DNA complexes. In traditional DNA purification methods, the individual cognate DNA strands are purified separately before annealing to form DNA duplexes. This approach works well for palindromic sequences, in which top and bottom strands are identical and duplex formation is typically complete. However, in cases where the DNA is non-palindromic, excess of single-stranded DNA must be removed through additional purification steps to prevent it from interfering in further experiments. Here we describe and apply a novel reversed-phase ion-pair liquid chromatography purification method for double-stranded DNA ranging in lengths from 17 to 51 bp. Both palindromic and non-palindromic DNA can be readily purified. This method has the unique ability to separate blunt double-stranded DNA from pre-attenuated (n-1, n-2, etc) synthesis products, and from DNA duplexes with single base pair overhangs. Additionally, palindromic DNA sequences with only minor differences in the central spacer sequence of the DNA can be separated, and the purified DNA is suitable for co-crystallization of protein–DNA complexes. Thus, double-stranded ion-pair liquid chromatography is a useful approach for duplex DNA purification for many applications. PMID:24013567

  1. Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

    PubMed Central

    Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

    2003-01-01

    Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

  2. Base pairing among three cis-acting sequences contributes to template switching during hepadnavirus reverse transcription.

    PubMed

    Liu, Ning; Tian, Ru; Loeb, Daniel D

    2003-02-18

    Synthesis of the relaxed-circular (RC) DNA genome of hepadnaviruses requires two template switches during plus-strand DNA synthesis: primer translocation and circularization. Although primer translocation and circularization use different donor and acceptor sequences, and are distinct temporally, they share the common theme of switching from one end of the minus-strand template to the other end. Studies of duck hepatitis B virus have indicated that, in addition to the donor and acceptor sequences, three other cis-acting sequences, named 3E, M, and 5E, are required for the synthesis of RC DNA by contributing to primer translocation and circularization. The mechanism by which 3E, M, and 5E act was not known. We present evidence that these sequences function by base pairing with each other within the minus-strand template. 3E base-pairs with one portion of M (M3) and 5E base-pairs with an adjacent portion of M (M5). We found that disrupting base pairing between 3E and M3 and between 5E and M5 inhibited primer translocation and circularization. More importantly, restoring base pairing with mutant sequences restored the production of RC DNA. These results are consistent with the model that, within duck hepatitis B virus capsids, the ends of the minus-strand template are juxtaposed via base pairing to facilitate the two template switches during plus-strand DNA synthesis.

  3. Molecular switching behavior in isosteric DNA base pairs.

    PubMed

    Jissy, A K; Konar, Sukanya; Datta, Ayan

    2013-04-15

    The structures and proton-coupled behavior of adenine-thymine (A-T) and a modified base pair containing a thymine isostere, adenine-difluorotoluene (A-F), are studied in different solvents by dispersion-corrected density functional theory. The stability of the canonical Watson-Crick base pair and the mismatched pair in various solvents with low and high dielectric constants is analyzed. It is demonstrated that A-F base pairing is favored in solvents with low dielectric constant. The stabilization and conformational changes induced by protonation are also analyzed for the natural as well as the mismatched base pair. DNA sequences capable of changing their sequence conformation on protonation are used in the construction of pH-based molecular switches. An acidic medium has a profound influence in stabilizing the isostere base pair. Such a large gain in stability on protonation leads to an interesting pH-controlled molecular switch, which can be incorporated in a natural DNA tract. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Altered minor-groove hydrogen bonds in DNA block transcription elongation by T7 RNA polymerase.

    PubMed

    Tanasova, Marina; Goeldi, Silvan; Meyer, Fabian; Hanawalt, Philip C; Spivak, Graciela; Sturla, Shana J

    2015-05-26

    DNA transcription depends upon the highly efficient and selective function of RNA polymerases (RNAPs). Modifications in the template DNA can impact the progression of RNA synthesis, and a number of DNA adducts, as well as abasic sites, arrest or stall transcription. Nonetheless, data are needed to understand why certain modifications to the structure of DNA bases stall RNA polymerases while others are efficiently bypassed. In this study, we evaluate the impact that alterations in dNTP/rNTP base-pair geometry have on transcription. T7 RNA polymerase was used to study transcription over modified purines and pyrimidines with altered H-bonding capacities. The results suggest that introducing wobble base-pairs into the DNA:RNA heteroduplex interferes with transcriptional elongation and stalls RNA polymerase. However, transcriptional stalling is not observed if mismatched base-pairs do not H-bond. Together, these studies show that RNAP is able to discriminate mismatches resulting in wobble base-pairs, and suggest that, in cases of modifications with minor steric impact, DNA:RNA heteroduplex geometry could serve as a controlling factor for initiating transcription-coupled DNA repair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Theoretical determination of one-electron redox potentials for DNA bases, base pairs, and stacks.

    PubMed

    Paukku, Y; Hill, G

    2011-05-12

    Electron affinities, ionization potentials, and redox potentials for DNA bases, base pairs, and N-methylated derivatives are computed at the DFT/M06-2X/6-31++G(d,p) level of theory. Redox properties of a guanine-guanine stack model are explored as well. Reduction and oxidation potentials are in good agreement with the experimental ones. Electron affinities of base pairs were found to be negative. Methylation of canonical bases affects the ionization potentials the most. Base pair formation and base stacking lower ionization potentials by 0.3 eV. Pairing of guanine with the 5-methylcytosine does not seem to influence the redox properties of this base pair much.

  6. Definition of the persistence length in the coarse-grained models of DNA elasticity.

    PubMed

    Fathizadeh, A; Eslami-Mossallam, B; Ejtehadi, M R

    2012-11-01

    By considering the detailed structure of DNA in the base pair level, two possible definitions of the persistence length are compared. One definition is related to the orientation of the terminal base pairs, and the other is based on the vectors which connect two adjacent base pairs at each end of the molecule. It is shown that although these definitions approach each other for long DNA molecules, they are dramatically different on short length scales. We show analytically that the difference mostly comes from the shear flexibility of the molecule and can be used to measure the shear modulus of DNA.

  7. Quantum entanglement and quantum information in biological systems (DNA)

    NASA Astrophysics Data System (ADS)

    Hubač, Ivan; Švec, Miloslav; Wilson, Stephen

    2017-12-01

    Recent studies of DNA show that the hydrogen bonds between given base pairs can be treated as diabatic systems with spin-orbit coupling. For solid state systems strong diabaticity and spin-orbit coupling the possibility of forming Majorana fermions has been discussed. We analyze the hydrogen bonds in the base pairs in DNA from this perspective. Our analysis is based on a quasiparticle supersymmetric transformation which couples electronic and vibrational motion and includes normal coordinates and the corresponding momenta. We define qubits formed by Majorana fermions in the hydrogen bonds and also discuss the entangled states in base pairs. Quantum information and quantum entropy are introduced. In addition to the well-known classical information connected with the DNA base pairs, we also consider quantum information and show that the classical and quantum information are closely connected.

  8. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    NASA Astrophysics Data System (ADS)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  9. Anomeric 2'-Deoxycytidines and Silver Ions: Hybrid Base Pairs with Greatly Enhanced Stability and Efficient DNA Mismatch Detection with α-dC.

    PubMed

    Guo, Xiurong; Seela, Frank

    2017-09-04

    α-d-Nucleosides are rare in nature but can develop fascinating properties when incorporated into DNA. This work reports on the first silver-mediated base pair constructed from two anomeric nucleosides: α-dC and β-dC. The hybrid base pair was integrated into the DNA and DNA/RNA double helix. A 12-mer duplex with α-dC and β-dC pair exhibits a higher thermal stability (T m =43 °C) than that incorporating the β-dC-Ag + -β-dC homo pair (T m =34 °C). Furthermore, α-dC shows excellent mismatch discrimination for DNA single nucleotide polymorphism (SNP). All four SNPs were identified on the basis of large T m value differences measured in the presence of silver ions. High resolution melting was not required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. NDI and DAN DNA: nucleic acid-directed assembly of NDI and DAN.

    PubMed

    Ikkanda, Brian A; Samuel, Stevan A; Iverson, Brent L

    2014-03-07

    Two novel DNA base surrogate phosphoramidites 1 and 2, based upon relatively electron-rich 1,5-dialkoxynaphthalene (DAN) and relatively electron-deficient 1,4,5,8-naphthalenetetracarboxylic diimide (NDI), respectively, were designed, synthesized, and incorporated into DNA oligonucleotide strands. The DAN and NDI artificial DNA bases were inserted within a three-base-pair region within the interior of a 12-mer oligonucleotide duplex in various sequential arrangements and investigated with CD spectroscopy and UV melting curve analysis. The CD spectra of the modified duplexes indicated B-form DNA topology. Melting curve analyses revealed trends in DNA duplex stability that correlate with the known association of DAN and NDI moieties in aqueous solution as well as the known favorable interactions between NDI and natural DNA base pairs. This demonstrates that DNA duplex stability and specificity can be driven by the electrostatic complementarity between DAN and NDI. In the most favorable case, an NDI-DAN-NDI arrangement in the middle of the DNA duplex was found to be approximately as stabilizing as three A-T base pairs.

  11. Charge transport through DNA based electronic barriers

    NASA Astrophysics Data System (ADS)

    Patil, Sunil R.; Chawda, Vivek; Qi, Jianqing; Anantram, M. P.; Sinha, Niraj

    2018-05-01

    We report charge transport in electronic 'barriers' constructed by sequence engineering in DNA. Considering the ionization potentials of Thymine-Adenine (AT) and Guanine-Cytosine (GC) base pairs, we treat AT as 'barriers'. The effect of DNA conformation (A and B form) on charge transport is also investigated. Particularly, the effect of width of 'barriers' on hole transport is investigated. Density functional theory (DFT) calculations are performed on energy minimized DNA structures to obtain the electronic Hamiltonian. The quantum transport calculations are performed using the Landauer-Buttiker framework. Our main findings are contrary to previous studies. We find that a longer A-DNA with more AT base pairs can conduct better than shorter A-DNA with a smaller number of AT base pairs. We also find that some sequences of A-DNA can conduct better than a corresponding B-DNA with the same sequence. The counterions mediated charge transport and long range interactions are speculated to be responsible for counter-intuitive length and AT content dependence of conductance of A-DNA.

  12. Base pairing among three cis-acting sequences contributes to template switching during hepadnavirus reverse transcription

    PubMed Central

    Liu, Ning; Tian, Ru; Loeb, Daniel D.

    2003-01-01

    Synthesis of the relaxed-circular (RC) DNA genome of hepadnaviruses requires two template switches during plus-strand DNA synthesis: primer translocation and circularization. Although primer translocation and circularization use different donor and acceptor sequences, and are distinct temporally, they share the common theme of switching from one end of the minus-strand template to the other end. Studies of duck hepatitis B virus have indicated that, in addition to the donor and acceptor sequences, three other cis-acting sequences, named 3E, M, and 5E, are required for the synthesis of RC DNA by contributing to primer translocation and circularization. The mechanism by which 3E, M, and 5E act was not known. We present evidence that these sequences function by base pairing with each other within the minus-strand template. 3E base-pairs with one portion of M (M3) and 5E base-pairs with an adjacent portion of M (M5). We found that disrupting base pairing between 3E and M3 and between 5E and M5 inhibited primer translocation and circularization. More importantly, restoring base pairing with mutant sequences restored the production of RC DNA. These results are consistent with the model that, within duck hepatitis B virus capsids, the ends of the minus-strand template are juxtaposed via base pairing to facilitate the two template switches during plus-strand DNA synthesis. PMID:12578983

  13. Enhanced Stability of DNA Nanostructures by Incorporation of Unnatural Base Pairs.

    PubMed

    Liu, Qing; Liu, Guocheng; Wang, Ting; Fu, Jing; Li, Rujiao; Song, Linlin; Wang, Zhen-Gang; Ding, Baoquan; Chen, Fei

    2017-11-03

    Self-assembled DNA nanostructures hold great promise in the fields of nanofabrication, biosensing and nanomedicine. However, the inherent low stability of the DNA double helices, formed by weak interactions, largely hinders the assembly and functions of DNA nanostructures. In this study, we redesigned and constructed a six-arm DNA junction by incorporation of the unnatural base pairs 5-Me-isoC/isoG and A/2-thioT into the double helices. They not only retained the structural integrity of the DNA nanostructure, but also showed enhanced thermal stability and resistance to T7 Exonuclease digestion. This research may expand the applications of DNA nanostructures in nanofabrication and biomedical fields, and furthermore, the genetic alphabet expansion with unnatural base pairs may enable us to construct more complicated and diversified self-assembled DNA nanostructures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

    PubMed

    Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

    2016-05-17

    The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Structural Basis for the Lesion-scanning Mechanism of the MutY DNA Glycosylase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Lan; Chakravarthy, Srinivas; Verdine, Gregory L.

    The highly mutagenic A:8-oxoguanine (oxoG) base pair is generated mainly by misreplication of the C:oxoG base pair, the oxidation product of the C:G base pair. The A:oxoG base pair is particularly insidious because neither base in it carries faithful information to direct the repair of the other. The bacterial MutY (MUTYH in humans) adenine DNA glycosylase is able to initiate the repair of A:oxoG by selectively cleaving the A base from the A:oxoG base pair. The difference between faithful repair and wreaking mutagenic havoc on the genome lies in the accurate discrimination between two structurally similar base pairs: A:oxoG andmore » A:T. Here we present two crystal structures of the MutY N-terminal domain in complex with either undamaged DNA or DNA containing an intrahelical lesion. These structures have captured for the first time a DNA glycosylase scanning the genome for a damaged base in the very first stage of lesion recognition and the base extrusion pathway. The mode of interaction observed here has suggested a common lesion-scanning mechanism across the entire helix-hairpin-helix superfamily to which MutY belongs. In addition, small angle X-ray scattering studies together with accompanying biochemical assays have suggested a possible role played by the C-terminal oxoG-recognition domain of MutY in lesion scanning.« less

  16. A systematic molecular dynamics study of nearest-neighbor effects on base pair and base pair step conformations and fluctuations in B-DNA

    PubMed Central

    Lavery, Richard; Zakrzewska, Krystyna; Beveridge, David; Bishop, Thomas C.; Case, David A.; Cheatham, Thomas; Dixit, Surjit; Jayaram, B.; Lankas, Filip; Laughton, Charles; Maddocks, John H.; Michon, Alexis; Osman, Roman; Orozco, Modesto; Perez, Alberto; Singh, Tanya; Spackova, Nada; Sponer, Jiri

    2010-01-01

    It is well recognized that base sequence exerts a significant influence on the properties of DNA and plays a significant role in protein–DNA interactions vital for cellular processes. Understanding and predicting base sequence effects requires an extensive structural and dynamic dataset which is currently unavailable from experiment. A consortium of laboratories was consequently formed to obtain this information using molecular simulations. This article describes results providing information not only on all 10 unique base pair steps, but also on all possible nearest-neighbor effects on these steps. These results are derived from simulations of 50–100 ns on 39 different DNA oligomers in explicit solvent and using a physiological salt concentration. We demonstrate that the simulations are converged in terms of helical and backbone parameters. The results show that nearest-neighbor effects on base pair steps are very significant, implying that dinucleotide models are insufficient for predicting sequence-dependent behavior. Flanking base sequences can notably lead to base pair step parameters in dynamic equilibrium between two conformational sub-states. Although this study only provides limited data on next-nearest-neighbor effects, we suggest that such effects should be analyzed before attempting to predict the sequence-dependent behavior of DNA. PMID:19850719

  17. Weak nanoscale chaos and anomalous relaxation in DNA

    NASA Astrophysics Data System (ADS)

    Mazur, Alexey K.

    2017-06-01

    Anomalous nonexponential relaxation in hydrated biomolecules is commonly attributed to the complexity of the free-energy landscapes, similarly to polymers and glasses. It was found recently that the hydrogen-bond breathing of terminal DNA base pairs exhibits a slow power-law relaxation attributable to weak Hamiltonian chaos, with parameters similar to experimental data. Here, the relationship is studied between this motion and spectroscopic signals measured in DNA with a small molecular photoprobe inserted into the base-pair stack. To this end, the earlier computational approach in combination with an analytical theory is applied to the experimental DNA fragment. It is found that the intensity of breathing dynamics is strongly increased in the internal base pairs that flank the photoprobe, with anomalous relaxation quantitatively close to that in terminal base pairs. A physical mechanism is proposed to explain the coupling between the relaxation of base-pair breathing and the experimental response signal. It is concluded that the algebraic relaxation observed experimentally is very likely a manifestation of weakly chaotic dynamics of hydrogen-bond breathing in the base pairs stacked to the photoprobe and that the weak nanoscale chaos can represent an ubiquitous hidden source of nonexponential relaxation in ultrafast spectroscopy.

  18. Weak nanoscale chaos and anomalous relaxation in DNA.

    PubMed

    Mazur, Alexey K

    2017-06-01

    Anomalous nonexponential relaxation in hydrated biomolecules is commonly attributed to the complexity of the free-energy landscapes, similarly to polymers and glasses. It was found recently that the hydrogen-bond breathing of terminal DNA base pairs exhibits a slow power-law relaxation attributable to weak Hamiltonian chaos, with parameters similar to experimental data. Here, the relationship is studied between this motion and spectroscopic signals measured in DNA with a small molecular photoprobe inserted into the base-pair stack. To this end, the earlier computational approach in combination with an analytical theory is applied to the experimental DNA fragment. It is found that the intensity of breathing dynamics is strongly increased in the internal base pairs that flank the photoprobe, with anomalous relaxation quantitatively close to that in terminal base pairs. A physical mechanism is proposed to explain the coupling between the relaxation of base-pair breathing and the experimental response signal. It is concluded that the algebraic relaxation observed experimentally is very likely a manifestation of weakly chaotic dynamics of hydrogen-bond breathing in the base pairs stacked to the photoprobe and that the weak nanoscale chaos can represent an ubiquitous hidden source of nonexponential relaxation in ultrafast spectroscopy.

  19. Role of 6-Mercaptopurine in the potential therapeutic targets DNA base pairs and G-quadruplex DNA: insights from quantum chemical and molecular dynamics simulations.

    PubMed

    Radhika, R; Shankar, R; Vijayakumar, S; Kolandaivel, P

    2018-05-01

    The theoretical studies on DNA with the anticancer drug 6-Mercaptopurine (6-MP) are investigated using theoretical methods to shed light on drug designing. Among the DNA base pairs considered, 6-MP is stacked with GC with the highest interaction energy of -46.19 kcal/mol. Structural parameters revealed that structure of the DNA base pairs is deviated from the planarity of the equilibrium position due to the formation of hydrogen bonds and stacking interactions with 6-MP. These deviations are verified through the systematic comparison between X-H bond contraction and elongation and the associated blue shift and red shift values by both NBO analysis and vibrational analysis. Bent's rule is verified for the C-H bond contraction in the 6-MP interacted base pairs. The AIM results disclose that the higher values of electron density (ρ) and Laplacian of electron density (∇ 2 ρ) indicate the increased overlap between the orbitals that represent the strong interaction and positive values of the total electron density show the closed-shell interaction. The relative sensitivity of the chemical shift values for the DNA base pairs with 6-MP is investigated to confirm the hydrogen bond strength. Molecular dynamics simulation studies of G-quadruplex DNA d(TGGGGT) 4 with 6-MP revealed that the incorporation of 6-MP appears to cause local distortions and destabilize the G-quadruplex DNA.

  20. Method for sequencing DNA base pairs

    DOEpatents

    Sessler, Andrew M.; Dawson, John

    1993-01-01

    The base pairs of a DNA structure are sequenced with the use of a scanning tunneling microscope (STM). The DNA structure is scanned by the STM probe tip, and, as it is being scanned, the DNA structure is separately subjected to a sequence of infrared radiation from four different sources, each source being selected to preferentially excite one of the four different bases in the DNA structure. Each particular base being scanned is subjected to such sequence of infrared radiation from the four different sources as that particular base is being scanned. The DNA structure as a whole is separately imaged for each subjection thereof to radiation from one only of each source.

  1. A structural determinant in the uracil DNA glycosylase superfamily for the removal of uracil from adenine/uracil base pairs

    PubMed Central

    Lee, Dong-Hoon; Liu, Yinling; Lee, Hyun-Wook; Xia, Bo; Brice, Allyn R.; Park, Sung-Hyun; Balduf, Hunter; Dominy, Brian N.; Cao, Weiguo

    2015-01-01

    The uracil DNA glycosylase superfamily consists of several distinct families. Family 2 mismatch-specific uracil DNA glycosylase (MUG) from Escherichia coli is known to exhibit glycosylase activity on three mismatched base pairs, T/U, G/U and C/U. Family 1 uracil N-glycosylase (UNG) from E. coli is an extremely efficient enzyme that can remove uracil from any uracil-containing base pairs including the A/U base pair. Here, we report the identification of an important structural determinant that underlies the functional difference between MUG and UNG. Substitution of a Lys residue at position 68 with Asn in MUG not only accelerates the removal of uracil from mismatched base pairs but also enables the enzyme to gain catalytic activity on A/U base pairs. Binding and kinetic analysis demonstrate that the MUG-K68N substitution results in enhanced ground state binding and transition state interactions. Molecular modeling reveals that MUG-K68N, UNG-N123 and family 5 Thermus thermophiles UDGb-A111N can form bidentate hydrogen bonds with the N3 and O4 moieties of the uracil base. Genetic analysis indicates the gain of function for A/U base pairs allows the MUG-K68N mutant to remove uracil incorporated into the genome during DNA replication. The implications of this study in the origin of life are discussed. PMID:25550433

  2. Structure of p73 DNA-binding domain tetramer modulates p73 transactivation

    PubMed Central

    Ethayathulla, Abdul S.; Tse, Pui-Wah; Monti, Paola; Nguyen, Sonha; Inga, Alberto; Fronza, Gilberto; Viadiu, Hector

    2012-01-01

    The transcription factor p73 triggers developmental pathways and overlaps stress-induced p53 transcriptional pathways. How p53-family response elements determine and regulate transcriptional specificity remains an unsolved problem. In this work, we have determined the first crystal structures of p73 DNA-binding domain tetramer bound to response elements with spacers of different length. The structure and function of the adaptable tetramer are determined by the distance between two half-sites. The structures with zero and one base-pair spacers show compact p73 DNA-binding domain tetramers with large tetramerization interfaces; a two base-pair spacer results in DNA unwinding and a smaller tetramerization interface, whereas a four base-pair spacer hinders tetramerization. Functionally, p73 is more sensitive to spacer length than p53, with one base-pair spacer reducing 90% of transactivation activity and longer spacers reducing transactivation to basal levels. Our results establish the quaternary structure of the p73 DNA-binding domain required as a scaffold to promote transactivation. PMID:22474346

  3. On the binding of indeno[1,2-c]isoquinolines in the DNA-topoisomerase I cleavage complex.

    PubMed

    Xiao, Xiangshu; Antony, Smitha; Pommier, Yves; Cushman, Mark

    2005-05-05

    An ab initio quantum mechanics calculation is reported which predicts the orientation of indenoisoquinoline 4 in the ternary cleavage complex formed from DNA and topoisomerase I (top1). The results of this calculation are consistent with the hypothetical structures previously proposed for the indenoisoquinoline-DNA-top1 ternary complexes based on molecular modeling, the crystal structure of a recently reported ternary complex, and the biological results obtained with a pair of diaminoalkyl-substituted indenoisoquinoline enantiomers. The results of these studies indicate that the pi-pi stacking interactions between the indenoisoquinolines and the neighboring DNA base pairs play a major role in determining binding orientation. The calculation of the electrostatic potential surface maps of the indenoisoquinolines and the adjacent DNA base pairs shows electrostatic complementarity in the observed binding orientation, leading to the conclusion that electrostatic attraction between the intercalators and the base pairs in the cleavage complex plays a major stabilizing role. On the other hand, the calculation of LUMO and HOMO energies of indenoisoquinoline 13b and neighboring DNA base pairs in conjunction with NBO analysis indicates that charge transfer complex formation plays a relatively minor role in stabilizing the ternary complexes derived from indenoisoquinolines, DNA, and top1. The results of these studies are important in understanding the existing structure-activity relationships for the indenoisoquinolines as top1 inhibitors and as anticancer agents, and they will be important in the future design of indenoisoquinoline-based top1 inhibitors.

  4. Sequence dependency of canonical base pair opening in the DNA double helix

    PubMed Central

    Villa, Alessandra

    2017-01-01

    The flipping-out of a DNA base from the double helical structure is a key step of many cellular processes, such as DNA replication, modification and repair. Base pair opening is the first step of base flipping and the exact mechanism is still not well understood. We investigate sequence effects on base pair opening using extensive classical molecular dynamics simulations targeting the opening of 11 different canonical base pairs in two DNA sequences. Two popular biomolecular force fields are applied. To enhance sampling and calculate free energies, we bias the simulation along a simple distance coordinate using a newly developed adaptive sampling algorithm. The simulation is guided back and forth along the coordinate, allowing for multiple opening pathways. We compare the calculated free energies with those from an NMR study and check assumptions of the model used for interpreting the NMR data. Our results further show that the neighboring sequence is an important factor for the opening free energy, but also indicates that other sequence effects may play a role. All base pairs are observed to have a propensity for opening toward the major groove. The preferred opening base is cytosine for GC base pairs, while for AT there is sequence dependent competition between the two bases. For AT opening, we identify two non-canonical base pair interactions contributing to a local minimum in the free energy profile. For both AT and CG we observe long-lived interactions with water and with sodium ions at specific sites on the open base pair. PMID:28369121

  5. Sequence of retrovirus provirus resembles that of bacterial transposable elements

    NASA Astrophysics Data System (ADS)

    Shimotohno, Kunitada; Mizutani, Satoshi; Temin, Howard M.

    1980-06-01

    The nucleotide sequences of the terminal regions of an infectious integrated retrovirus cloned in the modified λ phage cloning vector Charon 4A have been elucidated. There is a 569-base pair direct repeat at both ends of the viral DNA. The cell-virus junctions at each end consist of a 5-base pair direct repeat of cell DNA next to a 3-base pair inverted repeat of viral DNA. This structure resembles that of a transposable element and is consistent with the protovirus hypothesis that retroviruses evolved from the cell genome.

  6. Free energy landscape and transition pathways from Watson–Crick to Hoogsteen base pairing in free duplex DNA

    PubMed Central

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-01-01

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116

  7. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Egli, Martin; Pallan, Pradeep S.; Pattanayek, Rekha

    An experimental rationalization of the structure type encountered in DNA and RNA by systematically investigating the chemical and physical properties of alternative nucleic acids has identified systems with a variety of sugar-phosphate backbones that are capable of Watson-Crick base pairing and in some cases cross-pairing with the natural nucleic acids. The earliest among the model systems tested to date, (4{prime} {yields} 6{prime})-linked oligo(2{prime},3{prime}-dideoxy-{beta}-d-glucopyranosyl)nucleotides or homo-DNA, shows stable self-pairing, but the pairing rules for the four natural bases are not the same as those in DNA. However, a complete interpretation and understanding of the properties of the hexapyranosyl (4{prime} {yields} 6{prime})more » family of nucleic acids has been impeded until now by the lack of detailed 3D-structural data. We have determined the crystal structure of a homo-DNA octamer. It reveals a weakly twisted right-handed duplex with a strong inclination between the hexose-phosphate backbones and base-pair axes, and highly irregular values for helical rise and twist at individual base steps. The structure allows a rationalization of the inability of allo-, altro-, and glucopyranosyl-based oligonucleotides to form stable pairing systems.« less

  8. Watson-Crick base pairing controls excited-state decay in natural DNA.

    PubMed

    Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

    2014-10-13

    Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Crystal structure of metallo DNA duplex containing consecutive Watson-Crick-like T-Hg(II)-T base pairs.

    PubMed

    Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2014-02-24

    The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Reactivity of cytosine and thymine in single-base-pair mismatches with hydroxylamine and osmium tetroxide and its application to the study of mutations.

    PubMed Central

    Cotton, R G; Rodrigues, N R; Campbell, R D

    1988-01-01

    The chemical reactivity of thymine (T), when mismatched with the bases cytosine, guanine, and thymine, and of cytosine (C), when mismatched with thymine, adenine, and cytosine, has been examined. Heteroduplex DNAs containing such mismatched base pairs were first incubated with osmium tetroxide (for T and C mismatches) or hydroxylamine (for C mismatches) and then incubated with piperidine to cleave the DNA at the modified mismatched base. This cleavage was studied with an internally labeled strand containing the mismatched T or C, such that DNA cleavage and thus reactivity could be detected by gel electrophoresis. Cleavage at a total of 13 T and 21 C mismatches isolated (by at least three properly paired bases on both sides) single-base-pair mismatches was identified. All T or C mismatches studied were cleaved. By using end-labeled DNA probes containing T or C single-base-pair mismatches and conditions for limited cleavage, we were able to show that cleavage was at the base predicted by sequence analysis and that mismatches in a length of DNA could be readily detected by such an approach. This procedure may enable detection of all single-base-pair mismatches by use of sense and antisense probes and thus may be used to identify the mutated base and its position in a heteroduplex. Images PMID:3260032

  11. Method for sequencing DNA base pairs

    DOEpatents

    Sessler, A.M.; Dawson, J.

    1993-12-14

    The base pairs of a DNA structure are sequenced with the use of a scanning tunneling microscope (STM). The DNA structure is scanned by the STM probe tip, and, as it is being scanned, the DNA structure is separately subjected to a sequence of infrared radiation from four different sources, each source being selected to preferentially excite one of the four different bases in the DNA structure. Each particular base being scanned is subjected to such sequence of infrared radiation from the four different sources as that particular base is being scanned. The DNA structure as a whole is separately imaged for each subjection thereof to radiation from one only of each source. 6 figures.

  12. Extending the language of DNA molecular recognition by polyamides: unexpected influence of imidazole and pyrrole arrangement on binding affinity and specificity.

    PubMed

    Buchmueller, Karen L; Staples, Andrew M; Howard, Cameron M; Horick, Sarah M; Uthe, Peter B; Le, N Minh; Cox, Kari K; Nguyen, Binh; Pacheco, Kimberly A O; Wilson, W David; Lee, Moses

    2005-01-19

    Pyrrole (Py) and imidazole (Im) polyamides can be designed to target specific DNA sequences. The effect that the pyrrole and imidazole arrangement, plus DNA sequence, have on sequence specificity and binding affinity has been investigated using DNA melting (DeltaT(M)), circular dichroism (CD), and surface plasmon resonance (SPR) studies. SPR results obtained from a complete set of triheterocyclic polyamides show a dramatic difference in the affinity of f-ImPyIm for its cognate DNA (K(eq) = 1.9 x 10(8) M(-1)) and f-PyPyIm for its cognate DNA (K(eq) = 5.9 x 10(5) M(-1)), which could not have been anticipated prior to characterization of these compounds. Moreover, f-ImPyIm has a 10-fold greater affinity for CGCG than distamycin A has for its cognate, AATT. To understand this difference, the triamide dimers are divided into two structural groupings: central and terminal pairings. The four possible central pairings show decreasing selectivity and affinity for their respective cognate sequences: -ImPy > -PyPy- > -PyIm- approximately -ImIm-. These results extend the language of current design motifs for polyamide sequence recognition to include the use of "words" for recognizing two adjacent base pairs, rather than "letters" for binding to single base pairs. Thus, polyamides designed to target Watson-Crick base pairs should utilize the strength of -ImPy- and -PyPy- central pairings. The f/Im and f/Py terminal groups yielded no advantage for their respective C/G or T/A base pairs. The exception is with the -ImPy- central pairing, for which f/Im has a 10-fold greater affinity for C/G than f/Py has for T/A.

  13. Easy design of colorimetric logic gates based on nonnatural base pairing and controlled assembly of gold nanoparticles.

    PubMed

    Zhang, Li; Wang, Zhong-Xia; Liang, Ru-Ping; Qiu, Jian-Ding

    2013-07-16

    Utilizing the principles of metal-ion-mediated base pairs (C-Ag-C and T-Hg-T), the pH-sensitive conformational transition of C-rich DNA strand, and the ligand-exchange process triggered by DL-dithiothreitol (DTT), a system of colorimetric logic gates (YES, AND, INHIBIT, and XOR) can be rationally constructed based on the aggregation of the DNA-modified Au NPs. The proposed logic operation system is simple, which consists of only T-/C-rich DNA-modified Au NPs, and it is unnecessary to exquisitely design and alter the DNA sequence for different multiple molecular logic operations. The nonnatural base pairing combined with unique optical properties of Au NPs promises great potential in multiplexed ion sensing, molecular-scale computers, and other computational logic devices.

  14. Comparative reactivity of mismatched and unpaired bases in relation to their type and surroundings. Chemical cleavage of DNA mismatches in mutation detection analysis.

    PubMed

    Yakubovskaya, Marianna G; Belyakova, Anna A; Gasanova, Viktoria K; Belitsky, Gennady A; Dolinnaya, Nina G

    2010-07-01

    Systematic study of chemical reactivity of non-Watson-Crick base pairs depending on their type and microenvironment was performed on a model system that represents two sets of synthetic DNA duplexes with all types of mismatched and unmatched bases flanked by T.A or G.C pairs. Using comparative cleavage pattern analysis, we identified the main and additional target bases and performed quantitative study of the time course and efficacy of DNA modification caused by potassium permanganate or hydroxylamine. Potassium permanganate in combination with tetraethylammonium chloride was shown to induce DNA cleavage at all mismatched or bulged T residues, as well as at thymines of neighboring canonical pairs. Other mispaired (bulged) bases and thymine residues located on the second position from the mismatch site were not the targets for KMnO(4) attack. In contrast, hydroxylamine cleaved only heteroduplexes containing mismatched or unmatched C residues, and did not modify adjacent cytosines. However when G.C pairs flank bulged C residue, neighboring cytosines are also attacked by hydroxylamine due to defect migration. Chemical reactivity of target bases was shown to correlate strongly with the local disturbance of DNA double helix at mismatch or bulge site. With our model system, we were able to prove the absence of false-negative and false-positive results. Portion of heteroduplex reliably revealed in a mixture with corresponding homoduplex consists of 5% for bulge bases and "open" non-canonical pairs, and 10% for wobble base pairs giving minimal violations in DNA structure. This study provides a complete understanding of the principles of mutation detection methodology based on chemical cleavage of mismatches and clarifies the advantages and limitations of this approach in various biological and conformational studies of DNA. Copyright 2010 Elsevier Masson SAS. All rights reserved.

  15. Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands

    NASA Astrophysics Data System (ADS)

    Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree

    2018-05-01

    In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.

  16. Sequence-dependent response of DNA to torsional stress: a potential biological regulation mechanism.

    PubMed

    Reymer, Anna; Zakrzewska, Krystyna; Lavery, Richard

    2018-02-28

    Torsional restraints on DNA change in time and space during the life of the cell and are an integral part of processes such as gene expression, DNA repair and packaging. The mechanical behavior of DNA under torsional stress has been studied on a mesoscopic scale, but little is known concerning its response at the level of individual base pairs and the effects of base pair composition. To answer this question, we have developed a geometrical restraint that can accurately control the total twist of a DNA segment during all-atom molecular dynamics simulations. By applying this restraint to four different DNA oligomers, we are able to show that DNA responds to both under- and overtwisting in a very heterogeneous manner. Certain base pair steps, in specific sequence environments, are able to absorb most of the torsional stress, leaving other steps close to their relaxed conformation. This heterogeneity also affects the local torsional modulus of DNA. These findings suggest that modifying torsional stress on DNA could act as a modulator for protein binding via the heterogeneous changes in local DNA structure.

  17. Sequence-dependent response of DNA to torsional stress: a potential biological regulation mechanism

    PubMed Central

    Reymer, Anna; Zakrzewska, Krystyna; Lavery, Richard

    2018-01-01

    Abstract Torsional restraints on DNA change in time and space during the life of the cell and are an integral part of processes such as gene expression, DNA repair and packaging. The mechanical behavior of DNA under torsional stress has been studied on a mesoscopic scale, but little is known concerning its response at the level of individual base pairs and the effects of base pair composition. To answer this question, we have developed a geometrical restraint that can accurately control the total twist of a DNA segment during all-atom molecular dynamics simulations. By applying this restraint to four different DNA oligomers, we are able to show that DNA responds to both under- and overtwisting in a very heterogeneous manner. Certain base pair steps, in specific sequence environments, are able to absorb most of the torsional stress, leaving other steps close to their relaxed conformation. This heterogeneity also affects the local torsional modulus of DNA. These findings suggest that modifying torsional stress on DNA could act as a modulator for protein binding via the heterogeneous changes in local DNA structure. PMID:29267977

  18. Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

    PubMed

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-09-18

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Multi-Threaded DNA Tag/Anti-Tag Library Generator for Multi-Core Platforms

    DTIC Science & Technology

    2009-05-01

    base pair)  Watson ‐ Crick  strand pairs that bind perfectly within pairs, but poorly across pairs. A variety  of  DNA  strand hybridization metrics...AFRL-RI-RS-TR-2009-131 Final Technical Report May 2009 MULTI-THREADED DNA TAG/ANTI-TAG LIBRARY GENERATOR FOR MULTI-CORE PLATFORMS...TYPE Final 3. DATES COVERED (From - To) Jun 08 – Feb 09 4. TITLE AND SUBTITLE MULTI-THREADED DNA TAG/ANTI-TAG LIBRARY GENERATOR FOR MULTI-CORE

  20. Introducing a model of pairing based on base pair specific interactions between identical DNA sequences

    NASA Astrophysics Data System (ADS)

    (O' Lee, Dominic J.

    2018-02-01

    At present, there have been suggested two types of physical mechanism that may facilitate preferential pairing between DNA molecules, with identical or similar base pair texts, without separation of base pairs. One mechanism solely relies on base pair specific patterns of helix distortion being the same on the two molecules, discussed extensively in the past. The other mechanism proposes that there are preferential interactions between base pairs of the same composition. We introduce a model, built on this second mechanism, where both thermal stretching and twisting fluctuations are included, as well as the base pair specific helix distortions. Firstly, we consider an approximation for weak pairing interactions, or short molecules. This yields a dependence of the energy on the square root of the molecular length, which could explain recent experimental data. However, analysis suggests that this approximation is no longer valid at large DNA lengths. In a second approximation, for long molecules, we define two adaptation lengths for twisting and stretching, over which the pairing interaction can limit the accumulation of helix disorder. When the pairing interaction is sufficiently strong, both adaptation lengths are finite; however, as we reduce pairing strength, the stretching adaptation length remains finite but the torsional one becomes infinite. This second state persists to arbitrarily weak values of the pairing strength; suggesting that, if the molecules are long enough, the pairing energy scales as length. To probe differences between the two pairing mechanisms, we also construct a model of similar form. However, now, pairing between identical sequences solely relies on the intrinsic helix distortion patterns. Between the two models, we see interesting qualitative differences. We discuss our findings, and suggest new work to distinguish between the two mechanisms.

  1. The formation of catalytically competent enzyme-substrate complex is not a bottleneck in lesion excision by human alkyladenine DNA glycosylase.

    PubMed

    Kuznetsov, N A; Kiryutin, A S; Kuznetsova, A A; Panov, M S; Barsukova, M O; Yurkovskaya, A V; Fedorova, O S

    2017-04-01

    Human alkyladenine DNA glycosylase (AAG) protects DNA from alkylated and deaminated purine lesions. AAG flips out the damaged nucleotide from the double helix of DNA and catalyzes the hydrolysis of the N-glycosidic bond to release the damaged base. To understand better, how the step of nucleotide eversion influences the overall catalytic process, we performed a pre-steady-state kinetic analysis of AAG interaction with specific DNA-substrates, 13-base pair duplexes containing in the 7th position 1-N6-ethenoadenine (εA), hypoxanthine (Hx), and the stable product analogue tetrahydrofuran (F). The combination of the fluorescence of tryptophan, 2-aminopurine, and 1-N6-ethenoadenine was used to record conformational changes of the enzyme and DNA during the processes of DNA lesion recognition, damaged base eversion, excision of the N-glycosidic bond, and product release. The thermal stability of the duplexes characterized by the temperature of melting, T m , and the rates of spontaneous opening of individual nucleotide base pairs were determined by NMR spectroscopy. The data show that the relative thermal stability of duplexes containing a particular base pair in position 7, (T m (F/T) < T m (εA/T) < T m (Hx/T) < T m (A/T)) correlates with the rate of reversible spontaneous opening of the base pair. However, in contrast to that, the catalytic lesion excision rate is two orders of magnitude higher for Hx-containing substrates than for substrates containing εA, proving that catalytic activity is not correlated with the stability of the damaged base pair. Our study reveals that the formation of the catalytically competent enzyme-substrate complex is not the bottleneck controlling the catalytic activity of AAG.

  2. The repeating nucleotide sequence in the repetitive mitochondrial DNA from a "low-density" petite mutant of yeast.

    PubMed Central

    Van Kreijl, C F; Bos, J L

    1977-01-01

    The repeating nucleotide sequence of 68 base pairs in the mtDNA from an ethidium-induced cytoplasmic petite mutant of yeast has been determined. For sequence analysis specifically primed and terminated RNA copies, obtained by in vitro transcription of the separated strands, were use. The sequence consists of 66 consecutive AT base pairs flanked by two GC pairs and comprises nearly all of the mutant mitochondrial genome. The sequence, moreover, also represents the first part of wild-type mtDNA sequence so far. Images PMID:198740

  3. Conformational changes of the phenyl and naphthyl isocyanate-DNA adducts during DNA replication and by minor groove binding molecules

    PubMed Central

    Nakano, Shu-ichi; Uotani, Yuuki; Sato, Yuichi; Oka, Hirohito; Fujii, Masayuki; Sugimoto, Naoki

    2013-01-01

    DNA lesions produced by aromatic isocyanates have an extra bulky group on the nucleotide bases, with the capability of forming stacking interaction within a DNA helix. In this work, we investigated the conformation of the 2′-deoxyadenosine and 2′-deoxycytidine derivatives tethering a phenyl or naphthyl group, introduced in a DNA duplex. The chemical modification experiments using KMnO4 and 1-cyclohexyl-3 -(2-morpholinoethyl) carbodiimide metho-p-toluenesulfonate have shown that the 2′-deoxycytidine lesions form the base pair with guanine while the 2′-deoxyadenosine lesions have less ability of forming the base pair with thymine in solution. Nevertheless, the kinetic analysis shows that these DNA lesions are compatible with DNA ligase and DNA polymerase reactions, as much as natural DNA bases. We suggest that the adduct lesions have a capability of adopting dual conformations, depending on the difference in their interaction energies between stacking of the attached aromatic group and base pairing through hydrogen bonds. It is also presented that the attached aromatic groups change their orientation by interacting with the minor groove binding netropsin, distamycin and synthetic polyamide. The nucleotide derivatives would be useful for enhancing the phenotypic diversity of DNA molecules and for exploring new non-natural nucleotides. PMID:23873956

  4. NMR studies of DNA oligomers and their interactions with minor groove binding ligands

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fagan, Patricia A.

    1996-05-01

    The cationic peptide ligands distamycin and netropsin bind noncovalently to the minor groove of DNA. The binding site, orientation, stoichiometry, and qualitative affinity of distamycin binding to several short DNA oligomers were investigated by NMR spectroscopy. The oligomers studied contain A,T-rich or I,C-rich binding sites, where I = 2-desaminodeoxyguanosine. I•C base pairs are functional analogs of A•T base pairs in the minor groove. The different behaviors exhibited by distamycin and netropsin binding to various DNA sequences suggested that these ligands are sensitive probes of DNA structure. For sites of five or more base pairs, distamycin can form 1:1 or 2:1more » ligand:DNA complexes. Cooperativity in distamycin binding is low in sites such as AAAAA which has narrow minor grooves, and is higher in sites with wider minor grooves such as ATATAT. The distamycin binding and base pair opening lifetimes of I,C-containing DNA oligomers suggest that the I,C minor groove is structurally different from the A,T minor groove. Molecules which direct chemistry to a specific DNA sequence could be used as antiviral compounds, diagnostic probes, or molecular biology tools. The author studied two ligands in which reactive groups were tethered to a distamycin to increase the sequence specificity of the reactive agent.« less

  5. Development of a novel device to trap heavy metal cations: application of the specific interaction between heavy metal cation and mismatch DNA base pair.

    PubMed

    Torigoe, Hidetaka; Miyakawa, Yukako; Fukushi, Miyako; Ono, Akira; Kozasa, Tetsuo

    2009-01-01

    We have already found that Hg(II) cation specifically binds to T:T mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving T:T mismatch base pair by about 4 degrees C. We have also found that Ag(I) cation specifically binds to C:C mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving C:C mismatch base pair by about 4 degrees C. Using the specific interaction, we developed a novel device to trap each of Hg(II) and Ag(I) cation. The device is composed of 5'-biotinylated T-rich or C-rich DNA oligonucleotides, BIO-T20: 5'-Bio-T(20)-3' or BIO-C20: 5'-Bio-C(20)-3' (Bio is a biotin), immobilized on streptavidin-coated polystylene beads. When the BIO-T20-immobilized beads were added to a solution containing Hg(II) cation, and the beads trapping Hg(II) cation were collected by centrifugation, almost all of Hg(II) cation were removed from the solution. Also, when the BIO-C20-immobilized beads were added to a solution containing Ag(I) cation, and the beads trapping Ag(I) cation were collected by centrifugation, almost all of Ag(I) cation were removed from the solution. We conclude that, using the novel device developed in this study, Hg(II) and Ag(I) cation can be effectively removed from the solution.

  6. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Weina; Hellinga, Homme W.; Beese, Lorena S.

    Even though high-fidelity polymerases copy DNA with remarkable accuracy, some base-pair mismatches are incorporated at low frequency, leading to spontaneous mutagenesis. Using high-resolution X-ray crystallographic analysis of a DNA polymerase that catalyzes replication in crystals, we observe that a C {center_dot} A mismatch can mimic the shape of cognate base pairs at the site of incorporation. This shape mimicry enables the mismatch to evade the error detection mechanisms of the polymerase, which would normally either prevent mismatch incorporation or promote its nucleolytic excision. Movement of a single proton on one of the mismatched bases alters the hydrogen-bonding pattern such thatmore » a base pair forms with an overall shape that is virtually indistinguishable from a canonical, Watson-Crick base pair in double-stranded DNA. These observations provide structural evidence for the rare tautomer hypothesis of spontaneous mutagenesis, a long-standing concept that has been difficult to demonstrate directly.« less

  7. Evidence of pervasive biologically functional secondary structures within the genomes of eukaryotic single-stranded DNA viruses.

    PubMed

    Muhire, Brejnev Muhizi; Golden, Michael; Murrell, Ben; Lefeuvre, Pierre; Lett, Jean-Michel; Gray, Alistair; Poon, Art Y F; Ngandu, Nobubelo Kwanele; Semegni, Yves; Tanov, Emil Pavlov; Monjane, Adérito Luis; Harkins, Gordon William; Varsani, Arvind; Shepherd, Dionne Natalie; Martin, Darren Patrick

    2014-02-01

    Single-stranded DNA (ssDNA) viruses have genomes that are potentially capable of forming complex secondary structures through Watson-Crick base pairing between their constituent nucleotides. A few of the structural elements formed by such base pairings are, in fact, known to have important functions during the replication of many ssDNA viruses. Unknown, however, are (i) whether numerous additional ssDNA virus genomic structural elements predicted to exist by computational DNA folding methods actually exist and (ii) whether those structures that do exist have any biological relevance. We therefore computationally inferred lists of the most evolutionarily conserved structures within a diverse selection of animal- and plant-infecting ssDNA viruses drawn from the families Circoviridae, Anelloviridae, Parvoviridae, Nanoviridae, and Geminiviridae and analyzed these for evidence of natural selection favoring the maintenance of these structures. While we find evidence that is consistent with purifying selection being stronger at nucleotide sites that are predicted to be base paired than at sites predicted to be unpaired, we also find strong associations between sites that are predicted to pair with one another and site pairs that are apparently coevolving in a complementary fashion. Collectively, these results indicate that natural selection actively preserves much of the pervasive secondary structure that is evident within eukaryote-infecting ssDNA virus genomes and, therefore, that much of this structure is biologically functional. Lastly, we provide examples of various highly conserved but completely uncharacterized structural elements that likely have important functions within some of the ssDNA virus genomes analyzed here.

  8. Evidence of Pervasive Biologically Functional Secondary Structures within the Genomes of Eukaryotic Single-Stranded DNA Viruses

    PubMed Central

    Muhire, Brejnev Muhizi; Golden, Michael; Murrell, Ben; Lefeuvre, Pierre; Lett, Jean-Michel; Gray, Alistair; Poon, Art Y. F.; Ngandu, Nobubelo Kwanele; Semegni, Yves; Tanov, Emil Pavlov; Monjane, Adérito Luis; Harkins, Gordon William; Varsani, Arvind; Shepherd, Dionne Natalie

    2014-01-01

    Single-stranded DNA (ssDNA) viruses have genomes that are potentially capable of forming complex secondary structures through Watson-Crick base pairing between their constituent nucleotides. A few of the structural elements formed by such base pairings are, in fact, known to have important functions during the replication of many ssDNA viruses. Unknown, however, are (i) whether numerous additional ssDNA virus genomic structural elements predicted to exist by computational DNA folding methods actually exist and (ii) whether those structures that do exist have any biological relevance. We therefore computationally inferred lists of the most evolutionarily conserved structures within a diverse selection of animal- and plant-infecting ssDNA viruses drawn from the families Circoviridae, Anelloviridae, Parvoviridae, Nanoviridae, and Geminiviridae and analyzed these for evidence of natural selection favoring the maintenance of these structures. While we find evidence that is consistent with purifying selection being stronger at nucleotide sites that are predicted to be base paired than at sites predicted to be unpaired, we also find strong associations between sites that are predicted to pair with one another and site pairs that are apparently coevolving in a complementary fashion. Collectively, these results indicate that natural selection actively preserves much of the pervasive secondary structure that is evident within eukaryote-infecting ssDNA virus genomes and, therefore, that much of this structure is biologically functional. Lastly, we provide examples of various highly conserved but completely uncharacterized structural elements that likely have important functions within some of the ssDNA virus genomes analyzed here. PMID:24284329

  9. Genetic and DNA sequence analysis of the kanamycin resistance transposon Tn903.

    PubMed Central

    Grindley, N D; Joyce, C M

    1980-01-01

    The kanamycin resistance transposon Tn903 consists of a unique region of about 1000 base pairs bounded by a pair of 1050-base-pair inverted repeat sequences. Each repeat contains two Pvu II endonuclease cleavage sites separated by 520 base pairs. We have constructed derivatives of Tn903 in which this 520-base-pair fragment is deleted from one or both repeats. Those derivatives that lack both 520-base-pair fragments cannot transpose, whereas those that lack just one remain transposition proficient. One such transposable derivative, Tn903 delta I, has been selected for further study. We have determined the sequence of the intact inverted repeat. The 18 base pairs at each end are identical and inverted relative to one another, a structure characteristic of insertion sequences. Additional experiments indicate that a single inverted repeat from Tn903 can, in fact, transpose; we propose that this element be called IS903. To correlate the DNA sequence with genetic activities, we have created mutations by inserting a 10-base-pair DNA fragment at several sites within the intact repeat of Tn903 delta 1, and we have examined the effect of such insertions on transposability. The results suggest that IS903 encodes a 307-amino-acid polypeptide (a "transposase") that is absolutely required for transposition of IS903 or Tn903. Images PMID:6261245

  10. DNA bases ring-expanded with a cyclopentadiene free radical: a theoretical investigation of building blocks with diradical character.

    PubMed

    Zhao, Peiwen; Bu, Yuxiang

    2016-01-14

    In this work, we computationally design radical nucleobases which possess improved electronic properties, especially diradical properties through introducing a cyclopentadiene radical. We predict that the detailed electromagnetic features of base assemblies are based on the orientation of the extra five-membered cyclopentadiene ring. Broken symmetry DFT calculations take into account the relevant structures and properties. Our results reveal that both the radicalized DNA bases and the base pairs formed when they combine with their counterparts remain stable and display larger spin delocalization. The mode of embedding the cyclopentadiene free radical in the structures has some influence on the degree of π-conjugation, which results in various diradical characteristics. Single-layered radical base pairs all have an open-shell singlet ground state, but the energy difference between singlet and triplet is not significant. For two-layered radical base pairs, the situation is more complex. All of them have an open-shell state as their ground state, including an open-shell singlet state and an open-shell triplet state. That is, the majority of radical base pairs possess anti-ferromagnetic or ferromagnetic characteristics. We present here a more in-depth discussion and analyses to study the magnetic characteristics of radical bases and base pairs. As an important factor, two-layered radical base pairs also have been carefully analyzed. We hope that all the measurements and results presented here will stimulate further detailed insights into the related mechanisms in modified DNA bases and the design of better ring-expanded DNA magnetic materials.

  11. Distribution of Base Pair Alternations in a Periodic DNA Chain: Application of Pólya Counting to a Physical System

    NASA Astrophysics Data System (ADS)

    Hillebrand, Malcolm; Paterson-Jones, Guy; Kalosakas, George; Skokos, Charalampos

    2018-03-01

    In modeling DNA chains, the number of alternations between Adenine-Thymine (AT) and Guanine-Cytosine (GC) base pairs can be considered as a measure of the heterogeneity of the chain, which in turn could affect its dynamics. A probability distribution function of the number of these alternations is derived for circular or periodic DNA. Since there are several symmetries to account for in the periodic chain, necklace counting methods are used. In particular, Polya's Enumeration Theorem is extended for the case of a group action that preserves partitioned necklaces. This, along with the treatment of generating functions as formal power series, allows for the direct calculation of the number of possible necklaces with a given number of AT base pairs, GC base pairs and alternations. The theoretically obtained probability distribution functions of the number of alternations are accurately reproduced by Monte Carlo simulations and fitted by Gaussians. The effect of the number of base pairs on the characteristics of these distributions is also discussed, as well as the effect of the ratios of the numbers of AT and GC base pairs.

  12. Structural basis of DNA bending and oriented heterodimer binding by the basic leucine zipper domains of Fos and Jun.

    PubMed

    Leonard, D A; Rajaram, N; Kerppola, T K

    1997-05-13

    Interactions among transcription factors that bind to separate sequence elements require bending of the intervening DNA and juxtaposition of interacting molecular surfaces in an appropriate orientation. Here, we examine the effects of single amino acid substitutions adjacent to the basic regions of Fos and Jun as well as changes in sequences flanking the AP-1 site on DNA bending. Substitution of charged amino acid residues at positions adjacent to the basic DNA-binding domains of Fos and Jun altered DNA bending. The change in DNA bending was directly proportional to the change in net charge for all heterodimeric combinations between these proteins. Fos and Jun induced distinct DNA bends at different binding sites. Exchange of a single base pair outside of the region contacted in the x-ray crystal structure altered DNA bending. Substitution of base pairs flanking the AP-1 site had converse effects on the opposite directions of DNA bending induced by homodimers and heterodimers. These results suggest that Fos and Jun induce DNA bending in part through electrostatic interactions between amino acid residues adjacent to the basic region and base pairs flanking the AP-1 site. DNA bending by Fos and Jun at inverted binding sites indicated that heterodimers bind to the AP-1 site in a preferred orientation. Mutation of a conserved arginine within the basic regions of Fos and transversion of the central C:G base pair in the AP-1 site to G:C had complementary effects on the orientation of heterodimer binding and DNA bending. The conformational variability of the Fos-Jun-AP-1 complex may contribute to its functional versatility at different promoters.

  13. Raman spectroscopy of DNA-metal complexes. I. Interactions and conformational effects of the divalent cations: Mg, Ca, Sr, Ba, Mn, Co, Ni, Cu, Pd, and Cd.

    PubMed

    Duguid, J; Bloomfield, V A; Benevides, J; Thomas, G J

    1993-11-01

    Interactions of divalent metal cations (Mg2+, Ca2+, Ba2+, Sr2+, Mn2+, Co2+, Ni2+, Cu2+, Pd2+, and Cd2+) with DNA have been investigated by laser Raman spectroscopy. Both genomic calf-thymus DNA (> 23 kilobase pairs) and mononucleosomal fragments (160 base pairs) were employed as targets of metal interaction in solutions containing 5 weight-% DNA and metal:phosphate molar ratios of 0.6:1. Raman difference spectra reveal that transition metal cations (Mn2+, Co2+, Ni2+, Cu2+, Pd2+, and Cd2+) induce the greatest structural changes in B-DNA. The Raman (vibrational) band differences are extensive and indicate partial disordering of the B-form backbone, reduction in base stacking, reduction in base pairing, and specific metal interaction with acceptor sites on the purine (N7) and pyrimidine (N3) rings. Many of the observed spectral changes parallel those accompanying thermal denaturation of B-DNA and suggest that the metals link the bases of denatured DNA. While exocyclic carbonyls of dT, dG, and dC may stabilize metal ligation, correlation plots show that perturbations of the carbonyls are mainly a consequence of metal-induced denaturation of the double helix. Transition metal interactions with the DNA phosphates are weak in comparison to interactions with the bases, except in the case of Cu2+, which strongly perturbs both base and phosphate group vibrations. On the other hand, the Raman signature of B-DNA is largely unperturbed by Mg2+, Ca2+, Sr2+, and Ba2+, suggesting much weaker interactions of the alkaline earth metals with both base and phosphate sites. A notable exception is a moderate perturbation by alkaline earths of purine N7 sites in 160-base pair DNA, with Ca2+ causing the greatest effect. Correlation plots demonstrate a strong interrelationship between perturbations of Raman bands assigned to ring vibrations of the bases and those of bands assigned to exocyclic carbonyls and backbone phosphodiester groups. However, strong correlations do not occur between the Raman phosphodioxy band (centered near 1092 cm-1) and other Raman bands, suggesting that the former is not highly sensitive to the structural changes induced by divalent metal cations. The structural perturbations induced by divalent cations are much greater for > 23-kilobase pair DNA than for 160-base pair DNA, as evidenced by both the Raman difference spectra and the tendency toward the formation of insoluble aggregates. In the presence of transition metals, aggregation of high-molecular-weight DNA is evident at temperatures as low as 11 degrees C. A relationship between DNA melting and aggregation is proposed in which initial metal binding at major groove sites locally destabilizes the B-DNA double helix, causing displacement of the bases away from one another and exposing additional metal binding sites. Metal cation linkage of two displaced bases would allow separate DNA strands to crosslink. Aggregation is proposed to result from the formation of an extended network of these crosslinks.

  14. Dynamics of spontaneous flipping of a mismatched base in DNA duplex.

    PubMed

    Yin, Yandong; Yang, Lijiang; Zheng, Guanqun; Gu, Chan; Yi, Chengqi; He, Chuan; Gao, Yi Qin; Zhao, Xin Sheng

    2014-06-03

    DNA base flipping is a fundamental theme in DNA biophysics. The dynamics for a B-DNA base to spontaneously flip out of the double helix has significant implications in various DNA-protein interactions but are still poorly understood. The spontaneous base-flipping rate obtained previously via the imino proton exchange assay is most likely the rate of base wobbling instead of flipping. Using the diffusion-decelerated fluorescence correlation spectroscopy together with molecular dynamics simulations, we show that a base of a single mismatched base pair (T-G, T-T, or T-C) in a double-stranded DNA can spontaneously flip out of the DNA duplex. The extrahelical lifetimes are on the order of 10 ms, whereas the intrahelical lifetimes range from 0.3 to 20 s depending on the stability of the base pairs. These findings provide detailed understanding on the dynamics of DNA base flipping and lay down foundation to fully understand how exactly the repair proteins search and locate the target mismatched base among a vast excess of matched DNA bases.

  15. The fidelity of replication of the three-base-pair set adenine/thymine, hypoxanthine/cytosine and 6-thiopurine/5-methyl-2-pyrimidinone with T7 DNA polymerase

    PubMed Central

    2004-01-01

    With the goal of constructing a genetic alphabet consisting of a set of three base pairs, the fidelity of replication of the three base pairs TH (5-methyl-2-pyrimidinone)/HS (6-thiopurine; thiohypoxanthine), C/H (hypoxanthine) and T/A was evaluated using T7 DNA polymerase, a polymerase with a strong 3′→5′ exonuclease activity. An evaluation of the suitability of a new base pair for replication should include both the contribution of the fidelity of a polymerase activity and the contribution of proofreading by a 3′→5′ exonuclease activity. Using a steady-state kinetics method that included the contribution of the 3′→5′ exonuclease activity, the fidelity of replication was determined. The method determined the ratio of the apparent rate constant for the addition of a deoxynucleotide to the primer across from a template base by the polymerase activity and the rate constant for removal of the added deoxynucleotide from the primer by the 3′→5′ exonuclease activity. This ratio was designated the eni (efficiency of net incorporation). The eni of the base pair C/H was equal to or greater than the eni of T/A. The eni of the base pair TH/HS was 0.1 times that of A/T for TH in the template and 0.01 times that of A/T for HS in the template. The ratio of the eni of a mismatched deoxynucleotide to the eni of a matched deoxynucleotide was a measure of the error frequency. The error frequencies were as follows: thymine or TH opposite a template hypoxanthine, 2×10−6; HS opposite a template cytosine, <3×10−4. The remaining 24 mismatched combinations of bases gave no detectable net incorporation. Two mismatches, hypoxanthine opposite a template thymine or a template TH, showed trace incorporation in the presence of a standard dNTP complementary to the next template base. T7 DNA polymerase extended the primer beyond each of the matched base pairs of the set. The level of fidelity of replication of the three base pairs with T7 DNA polymerase suggests that they are adequate for a three-base-pair alphabet for DNA replication. PMID:15078225

  16. Sequence-dependent DNA deformability studied using molecular dynamics simulations.

    PubMed

    Fujii, Satoshi; Kono, Hidetoshi; Takenaka, Shigeori; Go, Nobuhiro; Sarai, Akinori

    2007-01-01

    Proteins recognize specific DNA sequences not only through direct contact between amino acids and bases, but also indirectly based on the sequence-dependent conformation and deformability of the DNA (indirect readout). We used molecular dynamics simulations to analyze the sequence-dependent DNA conformations of all 136 possible tetrameric sequences sandwiched between CGCG sequences. The deformability of dimeric steps obtained by the simulations is consistent with that by the crystal structures. The simulation results further showed that the conformation and deformability of the tetramers can highly depend on the flanking base pairs. The conformations of xATx tetramers show the most rigidity and are not affected by the flanking base pairs and the xYRx show by contrast the greatest flexibility and change their conformations depending on the base pairs at both ends, suggesting tetramers with the same central dimer can show different deformabilities. These results suggest that analysis of dimeric steps alone may overlook some conformational features of DNA and provide insight into the mechanism of indirect readout during protein-DNA recognition. Moreover, the sequence dependence of DNA conformation and deformability may be used to estimate the contribution of indirect readout to the specificity of protein-DNA recognition as well as nucleosome positioning and large-scale behavior of nucleic acids.

  17. Roles of the amino group of purine bases in the thermodynamic stability of DNA base pairing.

    PubMed

    Nakano, Shu-ichi; Sugimoto, Naoki

    2014-08-05

    The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I) and 2'-deoxyribo-2,6-diaminopurine (D) as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G • C > D • T ≈ I • C > A • T > G • T > I • T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

  18. End-to-end distance and contour length distribution functions of DNA helices

    NASA Astrophysics Data System (ADS)

    Zoli, Marco

    2018-06-01

    I present a computational method to evaluate the end-to-end and the contour length distribution functions of short DNA molecules described by a mesoscopic Hamiltonian. The method generates a large statistical ensemble of possible configurations for each dimer in the sequence, selects the global equilibrium twist conformation for the molecule, and determines the average base pair distances along the molecule backbone. Integrating over the base pair radial and angular fluctuations, I derive the room temperature distribution functions as a function of the sequence length. The obtained values for the most probable end-to-end distance and contour length distance, providing a measure of the global molecule size, are used to examine the DNA flexibility at short length scales. It is found that, also in molecules with less than ˜60 base pairs, coiled configurations maintain a large statistical weight and, consistently, the persistence lengths may be much smaller than in kilo-base DNA.

  19. Analyzing Population Genetics Using the Mitochondrial Control Region and Bioinformatics

    ERIC Educational Resources Information Center

    Sato, Takumi; Phillips, Bonnie; Latourelle, Sandra M.; Elwess, Nancy L.

    2010-01-01

    The 14-base pair hypervariable region in mitochondrial DNA (mtDNA) of Asian populations, specifically Japanese and Chinese students at Plattsburgh State University, was examined. Previous research on this 14-base pair region showed it to be susceptible to mutations and as a result indicated direct correlation with specific ethnic populations.…

  20. DNA sequence alignment by microhomology sampling during homologous recombination

    PubMed Central

    Qi, Zhi; Redding, Sy; Lee, Ja Yil; Gibb, Bryan; Kwon, YoungHo; Niu, Hengyao; Gaines, William A.; Sung, Patrick

    2015-01-01

    Summary Homologous recombination (HR) mediates the exchange of genetic information between sister or homologous chromatids. During HR, members of the RecA/Rad51 family of recombinases must somehow search through vast quantities of DNA sequence to align and pair ssDNA with a homologous dsDNA template. Here we use single-molecule imaging to visualize Rad51 as it aligns and pairs homologous DNA sequences in real-time. We show that Rad51 uses a length-based recognition mechanism while interrogating dsDNA, enabling robust kinetic selection of 8-nucleotide (nt) tracts of microhomology, which kinetically confines the search to sites with a high probability of being a homologous target. Successful pairing with a 9th nucleotide coincides with an additional reduction in binding free energy and subsequent strand exchange occurs in precise 3-nt steps, reflecting the base triplet organization of the presynaptic complex. These findings provide crucial new insights into the physical and evolutionary underpinnings of DNA recombination. PMID:25684365

  1. Dynamic investigation of DNA bending and wrapping by type II topoisomerases

    NASA Astrophysics Data System (ADS)

    Shao, Qing; Finzi, Laura; Dunlap, David

    2009-11-01

    Type II topoisomerases catalyze DNA decatenation and unwinding which is crucial for cell division, and therefore type II topoisomerases are some of the main targets of anti-cancer drugs. A recent crystal structure shows that, during the catalytic cycle, a yeast type II topoimerase can bend a 10 base pair DNA segment by up to 150 degrees. Bacterial gyrase, another type II topoisomerase, can wrap DNA into a tight 180 degree turn. Bending a stiff polymer like DNA requires considerable energy and could represent the rate limiting step in the catalytic (topological) cycle. Using modified deoxyribonucleotides in PCR reactions, stiffer DNA fragments have been produced and used as substrates for topoisomerase II-mediated relaxation of plectonemes introduced in single molecules using magnetic tweezers. The wrapping ability of gyrase decreases for diamino-purine-substituted DNA in which every base pair has three hydrogen-bonds. The overall rate of relaxation of plectonemes by recombinant human topoisomerase II alpha also decreases. These results reveal the dynamic properties of DNA bending and wrapping by type II topisomerases and suggest that A:T base pair melting is a rate determining step for bending and wrapping.

  2. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

    PubMed Central

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-01

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

  3. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

    PubMed

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-13

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

  4. RNA-DNA and DNA-DNA base-pairing at the upstream edge of the transcription bubble regulate translocation of RNA polymerase and transcription rate.

    PubMed

    KIreeva, Maria; Trang, Cyndi; Matevosyan, Gayane; Turek-Herman, Joshua; Chasov, Vitaly; Lubkowska, Lucyna; Kashlev, Mikhail

    2018-06-20

    Translocation of RNA polymerase (RNAP) along DNA may be rate-limiting for transcription elongation. The Brownian ratchet model posits that RNAP rapidly translocates back and forth until the post-translocated state is stabilized by NTP binding. An alternative model suggests that RNAP translocation is slow and poorly reversible. To distinguish between these two models, we take advantage of an observation that pyrophosphorolysis rates directly correlate with the abundance of the pre-translocated fraction. Pyrophosphorolysis by RNAP stabilized in the pre-translocated state by bacteriophage HK022 protein Nun was used as a reference point to determine the pre-translocated fraction in the absence of Nun. The stalled RNAP preferentially occupies the post-translocated state. The forward translocation rate depends, among other factors, on melting of the RNA-DNA base pair at the upstream edge of the transcription bubble. DNA-DNA base pairing immediately upstream from the RNA-DNA hybrid stabilizes the post-translocated state. This mechanism is conserved between E. coli RNAP and S. cerevisiae RNA polymerase II and is partially dependent on the lid domain of the catalytic subunit. Thus, the RNA-DNA hybrid and DNA reannealing at the upstream edge of the transcription bubble emerge as targets for regulation of the transcription elongation rate.

  5. A novel quantitative electrochemical method to monitor DNA double-strand breaks caused by a DNA cleavage agent at a DNA sensor.

    PubMed

    Banasiak, Anna; Cassidy, John; Colleran, John

    2018-06-01

    To date, DNA cleavage, caused by cleavage agents, has been monitored mainly by gel and capillary electrophoresis. However, these techniques are time-consuming, non-quantitative and require gel stains. In this work, a novel, simple and, importantly, a quantitative method for monitoring the DNA nuclease activity of potential anti-cancer drugs, at a DNA electrochemical sensor, is presented. The DNA sensors were prepared using thiol-modified oligonucleotides that self-assembled to create a DNA monolayer at gold electrode surfaces. The quantification of DNA double-strand breaks is based on calculating the DNA surface coverage, before and after exposure to a DNA cleavage agent. The nuclease properties of a model DNA cleavage agent, copper bis-phenanthroline ([Cu II (phen) 2 ] 2+ ), that can cleave DNA in a Fenton-type reaction, were quantified electrochemically. The DNA surface coverage decreased on average by 21% after subjecting the DNA sensor to a nuclease assay containing [Cu II (phen) 2 ] 2+ , a reductant and an oxidant. This percentage indicates that 6 base pairs were cleaved in the nuclease assay from the immobilised 30 base pair strands. The DNA cleavage can be also induced electrochemically in the absence of a chemical reductant. [Cu II (phen) 2 ] 2+ intercalates between DNA base pairs and, on application of a suitable potential, can be reduced to [Cu I (phen) 2 ] + , with dissolved oxygen acting as the required oxidant. This reduction process is facilitated through DNA strands via long-range electron transfer, resulting in DNA cleavage of 23%. The control measurements for both chemically and electrochemically induced cleavage revealed that DNA strand breaks did not occur under experimental conditions in the absence of [Cu II (phen) 2 ] 2+ . Copyright © 2018 Elsevier B.V. All rights reserved.

  6. J Genes for Heavy Chain Immunoglobulins of Mouse

    NASA Astrophysics Data System (ADS)

    Newell, Nanette; Richards, Julia E.; Tucker, Philip W.; Blattner, Frederick R.

    1980-09-01

    A 15.8-kilobase pair fragment of BALB/c mouse liver DNA, cloned in the Charon 4Aλ phage vector system, was shown to contain the μ heavy chain constant region (CHμ ) gene for the mouse immunoglobulin M. In addition, this fragment of DNA contains at least two J genes, used to code for the carboxyl terminal portion of heavy chain variable regions. These genes are located in genomic DNA about eight kilobase pairs to the 5' side of the CHμ gene. The complete nucleotide sequence of a 1120-base pair stretch of DNA that includes the two J genes has been determined.

  7. Pentopyranosyl Oligonucleotide Systems. Part 11: Systems with Shortened Backbones: D)-beta-Ribopyranosyl-(4 yields 3 )- and (L)-alpha - Lyxopyranosyl-(4 yields 3 )-oligonucleotides

    NASA Technical Reports Server (NTRS)

    Wippo, Harald; Reck, Folkert; Kudick, Rene; Ramaseshan, Mahesh; Ceulemans, Griet; Bolli, Martin; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

    2001-01-01

    The (L)-a-lyxopyranosyl-(4'yields 3')-oligonucleotide system-a member of a pentopyranosyl oligonucleotide family containing a shortened backbone-is capable of cooperative base-pairing and of cross-pairing with DNA and RNA. In contrast, corresponding (D)-beta-ribopyransoyl-(4' yields 3')-oligonucleotides do not show base-pairing under similar conditions. We conclude that oligonucleotide systems can violate the six-bonds-per-backbone-unit rule by having five bonds instead, if their vicinally bound phosphodiester bridges can assume an antiperiplanar conformation. An additional structural feature that seems relevant to the cross-pairing capability of the (L)-a-lyxopyranosyl-(4' yields 3')-oligonucleotide system is its (small) backbone/basepair axes inclination. An inclination which is similar to that in B-DNA seems to be a prerequisite for an oligonucleotide system s capability to cross-pair with DNA.

  8. Recognition tunneling measurement of the conductance of DNA bases embedded in self-assembled monolayers.

    PubMed

    Huang, Shuo; Chang, Shuai; He, Jin; Zhang, Peiming; Liang, Feng; Tuchband, Michael; Li, Shengqing; Lindsay, Stuart

    2010-12-09

    The DNA bases interact strongly with gold electrodes, complicating efforts to measure the tunneling conductance through hydrogen-bonded Watson Crick base pairs. When bases are embedded in a self-assembled alkane-thiol monolayer to minimize these interactions, new features appear in the tunneling data. These new features track the predictions of density-functional calculations quite well, suggesting that they reflect tunnel conductance through hydrogen-bonded base pairs.

  9. Recognition tunneling measurement of the conductance of DNA bases embedded in self-assembled monolayers

    PubMed Central

    Huang, Shuo; Chang, Shuai; He, Jin; Zhang, Peiming; Liang, Feng; Tuchband, Michael; Li, Shengqing; Lindsay, Stuart

    2010-01-01

    The DNA bases interact strongly with gold electrodes, complicating efforts to measure the tunneling conductance through hydrogen-bonded Watson Crick base pairs. When bases are embedded in a self-assembled alkane-thiol monolayer to minimize these interactions, new features appear in the tunneling data. These new features track the predictions of density-functional calculations quite well, suggesting that they reflect tunnel conductance through hydrogen-bonded base pairs. PMID:21197382

  10. How a low-fidelity DNA polymerase chooses non-Watson-Crick from Watson-Crick incorporation.

    PubMed

    Wu, Wen-Jin; Su, Mei-I; Wu, Jian-Li; Kumar, Sandeep; Lim, Liang-Hin; Wang, Chun-Wei Eric; Nelissen, Frank H T; Chen, Ming-Chuan Chad; Doreleijers, Jurgen F; Wijmenga, Sybren S; Tsai, Ming-Daw

    2014-04-02

    A dogma for DNA polymerase catalysis is that the enzyme binds DNA first, followed by MgdNTP. This mechanism contributes to the selection of correct dNTP by Watson-Crick base pairing, but it cannot explain how low-fidelity DNA polymerases overcome Watson-Crick base pairing to catalyze non-Watson-Crick dNTP incorporation. DNA polymerase X from the deadly African swine fever virus (Pol X) is a half-sized repair polymerase that catalyzes efficient dG:dGTP incorporation in addition to correct repair. Here we report the use of solution structures of Pol X in the free, binary (Pol X:MgdGTP), and ternary (Pol X:DNA:MgdGTP with dG:dGTP non-Watson-Crick pairing) forms, along with functional analyses, to show that Pol X uses multiple unprecedented strategies to achieve the mutagenic dG:dGTP incorporation. Unlike high fidelity polymerases, Pol X can prebind purine MgdNTP tightly and undergo a specific conformational change in the absence of DNA. The prebound MgdGTP assumes an unusual syn conformation stabilized by partial ring stacking with His115. Upon binding of a gapped DNA, also with a unique mechanism involving primarily helix αE, the prebound syn-dGTP forms a Hoogsteen base pair with the template anti-dG. Interestingly, while Pol X prebinds MgdCTP weakly, the correct dG:dCTP ternary complex is readily formed in the presence of DNA. H115A mutation disrupted MgdGTP binding and dG:dGTP ternary complex formation but not dG:dCTP ternary complex formation. The results demonstrate the first solution structural view of DNA polymerase catalysis, a unique DNA binding mode, and a novel mechanism for non-Watson-Crick incorporation by a low-fidelity DNA polymerase.

  11. Ab initio study of naphtho-homologated DNA bases.

    PubMed

    Vazquez-Mayagoita, Alvaro; Huertas, Oscar; Fuentes-Cabrera, Miguel; Sumpter, Bobby G; Orozco, Modesto; Luque, F Javier

    2008-02-21

    Naphtho-homologated DNA bases have been recently used to build a new type of size-expanded DNA known as yyDNA. We have used theoretical techniques to investigate the structure, tautomeric preferences, base-pairing ability, stacking interactions, and HOMO-LUMO gaps of the naphtho-bases. The structure of these bases is found to be similar to that of the benzo-fused predecessors (y-bases) with respect to the planarity of the aromatic rings and amino groups. Tautomeric studies reveal that the canonical-like forms of naphtho-thymine (yyT) and naphtho-adenine (yyA) are the most stable tautomers, leading to hydrogen-bonded dimers with the corresponding natural nucleobases that mimic the Watson-Crick pairing. However, the canonical-like species of naphtho-guanine (yyG) and naphtho-cytosine (yyC) are not the most stable tautomers, and the most favorable hydrogen-bonded dimers involve wobble-like pairings. The expanded size of the naphtho-bases leads to stacking interactions notably larger than those found for the natural bases, and they should presumably play a dominant contribution in modulating the structure of yyDNA duplexes. Finally, the HOMO-LUMO gap of the naphtho-bases is smaller than that of their benzo-base counterparts, indicating that size-expansion of DNA bases is an efficient way of reducing their HOMO-LUMO gap. These results are examined in light of the available experimental evidence reported for yyT and yyC.

  12. Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA.

    PubMed

    Chakraborty, Debayan; Wales, David J

    2018-01-04

    The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

  13. Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

    PubMed

    Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

    2015-12-01

    Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Development of a novel method to determine the concentration of heavy metal cations: application of the specific interaction between heavy metal cation and mismatch DNA base pair.

    PubMed

    Kozasa, Tetsuo; Miyakawa, Yukako; Fukushi, Miyako; Ono, Akira; Torigoe, Hidetaka

    2009-01-01

    We have already found that Hg(II) cation specifically binds to T:T mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving T:T mismatch base pair by about 4 degrees C. We have also found that Ag(I) cation specifically binds to C:C mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving C:C mismatch base pair by about 4 degrees C. Using the specific interaction, we developed a novel sensor to determine the concentration of each of Hg(II) and Ag(I) cation. The sensor is composed of a dye-labelled T-rich or C-rich DNA oligonucleotide, F2T6W2D: 5'-Fam-T(2)CT(2)CT(2)C(4)T(2)GT(2)GT(2)-Dabcyl-3' or F2C6W2D: 5'-Fam-C(2)TC(2)TC(2)T(4)C(2)AC(2)AC(2)-Dabcyl-3', where 6-carboxyfluorescein (Fam) is a fluorophore and Dabcyl is a quencher. The addition of Hg(II) cation decreased the intensity of Fam emission of F2T6W2D at 520 nm in a concentration-dependent manner. Also, the addition of Ag(I) cation decreased the intensity of Fam emission of F2C6W2D at 520 nm in a concentration-dependent manner. We conclude that, using the novel sensor developed in this study, the concentration of each of Hg(II) and Ag(I) cation can be determined from the intensity of Fam emission at 520 nm.

  15. Triple helical DNA in a duplex context and base pair opening

    PubMed Central

    Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra

    2014-01-01

    It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466

  16. Hydrogen bond disruption in DNA base pairs from (14)C transmutation.

    PubMed

    Sassi, Michel; Carter, Damien J; Uberuaga, Blas P; Stanek, Christopher R; Mancera, Ricardo L; Marks, Nigel A

    2014-09-04

    Recent ab initio molecular dynamics simulations have shown that radioactive carbon does not normally fragment DNA bases when it decays. Motivated by this finding, density functional theory and Bader analysis have been used to quantify the effect of C → N transmutation on hydrogen bonding in DNA base pairs. We find that (14)C decay has the potential to significantly alter hydrogen bonds in a variety of ways including direct proton shuttling (thymine and cytosine), thermally activated proton shuttling (guanine), and hydrogen bond breaking (cytosine). Transmutation substantially modifies both the absolute and relative strengths of the hydrogen bonding pattern, and in two instances (adenine and cytosine), the density at the critical point indicates development of mild covalent character. Since hydrogen bonding is an important component of Watson-Crick pairing, these (14)C-induced modifications, while infrequent, may trigger errors in DNA transcription and replication.

  17. NMR studies on the structure and dynamics of lac operator DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, S.C.

    Nuclear Magnetic Resonance spectroscopy was used to elucidate the relationships between structure, dynamics and function of the gene regulatory sequence corresponding to the lactose operon operator of Escherichia coli. The length of the DNA fragments examined varied from 13 to 36 base pair, containing all or part of the operator sequence. These DNA fragments are either derived genetically or synthesized chemically. Resonances of the imino protons were assigned by one dimensional inter-base pair nuclear Overhauser enhancement (NOE) measurements. Imino proton exchange rates were measured by saturation recovery methods. Results from the kinetic measurements show an interesting dynamic heterogeneity with amore » maximum opening rate centered about a GTG/CAC sequence which correlates with the biological function of the operator DNA. This particular three base pair sequence occurs frequently and often symmetrically in prokaryotic nd eukaryotic DNA sites where one anticipates specific protein interaction for gene regulation. The observed sequence dependent imino proton exchange rate may be a reflection of variation of the local structure of regulatory DNA. The results also indicate that the observed imino proton exchange rates are length dependent.« less

  18. All gene-sized DNA molecules in four species of hypotrichs have the same terminal sequence and an unusual 3' terminus.

    PubMed Central

    Klobutcher, L A; Swanton, M T; Donini, P; Prescott, D M

    1981-01-01

    In hypotrichous ciliates, all of the macronuclear DNA is in the form of low molecular weight molecules with an average size of approximately 2200 base pairs. Total macronuclear DNA from four hypotrichs has been shown to have inverted terminal repeats by direct sequence analysis. In Oxytricha nova, Oxytricha sp., and Stylonychia pustulata, this terminal sequence may be written as 5'-C4A4C4A4C4 ... 3'-G4T4G4T4G4T4G4T4G4 ... In Euplotes aediculatus, the sequences is similar but differs in the lengths of the duplex region (28 base pairs) and of the putative 3' extension (14 base pairs). Also in Euplotes, a second common sequence of 5 base pairs (A-A-C-T-T-T-T-G-A-A) occurs internal to the terminal repeat and a 17-base-pair heterogeneous region: 5'-C4A4C4A4C4A4C4(X)17T-T-G-A-A ... 3'-G2T4G4T4G4T4G4T4G4T4G4(X)17A-A-C-T-T ... The length of the terminal repeat sequence for O. nova was confirmed in cloned macronuclear DNA molecules. Images PMID:6265931

  19. Roles of the active site residues and metal cofactors in noncanonical base-pairing during catalysis by human DNA polymerase iota.

    PubMed

    Makarova, Alena V; Ignatov, Artem; Miropolskaya, Nataliya; Kulbachinskiy, Andrey

    2014-10-01

    Human DNA polymerase iota (Pol ι) is a Y-family polymerase that can bypass various DNA lesions but possesses very low fidelity of DNA synthesis in vitro. Structural analysis of Pol ι revealed a narrow active site that promotes noncanonical base-pairing during catalysis. To better understand the structure-function relationships in the active site of Pol ι we investigated substitutions of individual amino acid residues in its fingers domain that contact either the templating or the incoming nucleotide. Two of the substitutions, Y39A and Q59A, significantly decreased the catalytic activity but improved the fidelity of Pol ι. Surprisingly, in the presence of Mn(2+) ions, the wild-type and mutant Pol ι variants efficiently incorporated nucleotides opposite template purines containing modifications that disrupted either Hoogsteen or Watson-Crick base-pairing, suggesting that Pol ι may use various types of interactions during nucleotide addition. In contrast, in Mg(2+) reactions, wild-type Pol ι was dependent on Hoogsteen base-pairing, the Y39A mutant was essentially inactive, and the Q59A mutant promoted Watson-Crick interactions with template purines. The results suggest that Pol ι utilizes distinct mechanisms of nucleotide incorporation depending on the metal cofactor and reveal important roles of specific residues from the fingers domain in base-pairing and catalysis. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. DNA with Parallel Strand Orientation: A Nanometer Distance Study with Spin Labels in the Watson-Crick and the Reverse Watson-Crick Double Helix.

    PubMed

    Wunnicke, Dorith; Ding, Ping; Yang, Haozhe; Seela, Frank; Steinhoff, Heinz-Jürgen

    2015-10-29

    Parallel-stranded (ps) DNA characterized by its sugar-phosphate backbones pointing in the same direction represents an alternative pairing system to antiparallel-stranded (aps) DNA with the potential to inhibit transcription and translation. 25-mer oligonucleotides were selected containing only dA·dT base pairs to compare spin-labeled nucleobase distances over a range of 10 or 15 base pairs in ps DNA with those in aps DNA. By means of the copper(I)-catalyzed Huisgen-Meldal-Sharpless alkyne-azide cycloaddition, the spin label 4-azido-2,2,6,6-tetramethylpiperidine-1-oxyl was clicked to 7-ethynyl-7-deaza-2'-deoxyadenosine or 5-ethynyl-2'-deoxyuridine to yield 25-mer oligonucleotides incorporating two spin labels. The interspin distances between spin labeled residues were determined by pulse EPR spectroscopy. The results reveal that in ps DNA these distances are between 5 and 10% longer than in aps DNA when the labeled DNA segment is located near the center of the double helix. The interspin distance in ps DNA becomes shorter compared with aps DNA when one of the spin labels occupies a position near the end of the double helix.

  1. Using NMR and molecular dynamics to link structure and dynamics effects of the universal base 8-aza, 7-deaza, N8 linked adenosine analog

    PubMed Central

    Spring-Connell, Alexander M.; Evich, Marina G.; Debelak, Harald; Seela, Frank; Germann, Markus W.

    2016-01-01

    A truly universal nucleobase enables a host of novel applications such as simplified templates for PCR primers, randomized sequencing and DNA based devices. A universal base must pair indiscriminately to each of the canonical bases with little or preferably no destabilization of the overall duplex. In reality, many candidates either destabilize the duplex or do not base pair indiscriminatingly. The novel base 8-aza-7-deazaadenine (pyrazolo[3,4-d]pyrimidin- 4-amine) N8-(2′deoxyribonucleoside), a deoxyadenosine analog (UB), pairs with each of the natural DNA bases with little sequence preference. We have utilized NMR complemented with molecular dynamic calculations to characterize the structure and dynamics of a UB incorporated into a DNA duplex. The UB participates in base stacking with little to no perturbation of the local structure yet forms an unusual base pair that samples multiple conformations. These local dynamics result in the complete disappearance of a single UB proton resonance under native conditions. Accommodation of the UB is additionally stabilized via heightened backbone conformational sampling. NMR combined with various computational techniques has allowed for a comprehensive characterization of both structural and dynamic effects of the UB in a DNA duplex and underlines that the UB as a strong candidate for universal base applications. PMID:27566150

  2. Computational DNA hole spectroscopy: A new tool to predict mutation hotspots, critical base pairs, and disease ‘driver’ mutations

    PubMed Central

    Suárez, Martha Y.; Villagrán; Miller, John H.

    2015-01-01

    We report on a new technique, computational DNA hole spectroscopy, which creates spectra of electron hole probabilities vs. nucleotide position. A hole is a site of positive charge created when an electron is removed. Peaks in the hole spectrum depict sites where holes tend to localize and potentially trigger a base pair mismatch during replication. Our studies of mitochondrial DNA reveal a correlation between L-strand hole spectrum peaks and spikes in the human mutation spectrum. Importantly, we also find that hole peak positions that do not coincide with large variant frequencies often coincide with disease-implicated mutations and/or (for coding DNA) encoded conserved amino acids. This enables combining hole spectra with variant data to identify critical base pairs and potential disease ‘driver’ mutations. Such integration of DNA hole and variance spectra could ultimately prove invaluable for pinpointing critical regions of the vast non-protein-coding genome. An observed asymmetry in correlations, between the spectrum of human mtDNA variations and the L- and H-strand hole spectra, is attributed to asymmetric DNA replication processes that occur for the leading and lagging strands. PMID:26310834

  3. Computational DNA hole spectroscopy: A new tool to predict mutation hotspots, critical base pairs, and disease 'driver' mutations.

    PubMed

    Villagrán, Martha Y Suárez; Miller, John H

    2015-08-27

    We report on a new technique, computational DNA hole spectroscopy, which creates spectra of electron hole probabilities vs. nucleotide position. A hole is a site of positive charge created when an electron is removed. Peaks in the hole spectrum depict sites where holes tend to localize and potentially trigger a base pair mismatch during replication. Our studies of mitochondrial DNA reveal a correlation between L-strand hole spectrum peaks and spikes in the human mutation spectrum. Importantly, we also find that hole peak positions that do not coincide with large variant frequencies often coincide with disease-implicated mutations and/or (for coding DNA) encoded conserved amino acids. This enables combining hole spectra with variant data to identify critical base pairs and potential disease 'driver' mutations. Such integration of DNA hole and variance spectra could ultimately prove invaluable for pinpointing critical regions of the vast non-protein-coding genome. An observed asymmetry in correlations, between the spectrum of human mtDNA variations and the L- and H-strand hole spectra, is attributed to asymmetric DNA replication processes that occur for the leading and lagging strands.

  4. Charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta

    By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency.more » The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.« less

  5. Glucose-nucleobase pairs within DNA: impact of hydrophobicity, alternative linking unit and DNA polymerase nucleotide insertion studies† †Electronic supplementary information (ESI) available. See DOI: 10.1039/c7sc04850e

    PubMed Central

    Vengut-Climent, Empar; Peñalver, Pablo; Lucas, Ricardo; Gómez-Pinto, Irene; Aviñó, Anna; Muro-Pastor, Alicia M.; Galbis, Elsa; de Paz, M. Violante; Fonseca Guerra, Célia; Bickelhaupt, F. Matthias; Eritja, Ramón; González, Carlos

    2018-01-01

    Recently, we studied glucose-nucleobase pairs, a binding motif found in aminoglycoside–RNA recognition. DNA duplexes with glucose as a nucleobase were able to hybridize and were selective for purines. They were less stable than natural DNA but still fit well on regular B-DNA. These results opened up the possible use of glucose as a non-aromatic DNA base mimic. Here, we have studied the incorporation and thermal stability of glucose with different types of anchoring units and alternative apolar sugar-nucleobase pairs. When we explored butanetriol instead of glycerol as a wider anchoring unit, we did not gain duplex thermal stability. This result confirmed the necessity of a more conformationally restricted linker to increase the overall duplex stability. Permethylated glucose-nucleobase pairs showed similar stability to glucoside-nucleobase pairs but no selectivity for a specific nucleobase, possibly due to the absence of hydrogen bonds between them. The three-dimensional structure of the duplex solved by NMR located both, the hydrophobic permethylated glucose and the nucleobase, inside the DNA helix as in the case of glucose-nucleobase pairs. Quantum chemical calculations on glucose-nucleobase pairs indicate that the attachment of the sugar to the DNA skeleton through the OH1 or OH4 positions yields the highest binding energies. Moreover, glucose was very selective for guanine when attached through OH1 or OH4 to the DNA. Finally, we examined DNA polymerase insertion of nucleotides in front of the saccharide unit. KF– polymerase from E. coli inserted A and G opposite glc and 6dglc with low efficiency but notable selectivity. It is even capable of extending the new pair although its efficiency depended on the DNA sequence. In contrast, Bst 2.0, SIII and BIOTAQ™ DNA polymerases seem to display a loop-out mechanism possibly due to the flexible glycerol linker used instead of deoxyribose. PMID:29780486

  6. DNA dynamics in aqueous solution: opening the double helix

    NASA Technical Reports Server (NTRS)

    Pohorille, A.; Ross, W. S.; Tinoco, I. Jr; MacElroy, R. D. (Principal Investigator)

    1990-01-01

    The opening of a DNA base pair is a simple reaction that is a prerequisite for replication, transcription, and other vital biological functions. Understanding the molecular mechanisms of biological reactions is crucial for predicting and, ultimately, controlling them. Realistic computer simulations of the reactions can provide the needed understanding. To model even the simplest reaction in aqueous solution requires hundreds of hours of supercomputing time. We have used molecular dynamics techniques to simulate fraying of the ends of a six base pair double strand of DNA, [TCGCGA]2, where the four bases of DNA are denoted by T (thymine), C (cytosine), G (guanine), and A (adenine), and to estimate the free energy barrier to this process. The calculations, in which the DNA was surrounded by 2,594 water molecules, required 50 hours of CRAY-2 CPU time for every simulated 100 picoseconds. A free energy barrier to fraying, which is mainly characterized by the movement of adenine away from thymine into aqueous environment, was estimated to be 4 kcal/mol. Another fraying pathway, which leads to stacking between terminal adenine and thymine, was also observed. These detailed pictures of the motions and energetics of DNA base pair opening in water are a first step toward understanding how DNA will interact with any molecule.

  7. Dual door entry to exciplex emission in a chimeric DNA duplex containing non-nucleoside-nucleoside pair.

    PubMed

    Bag, Subhendu Sekhar; Talukdar, Sangita; Kundu, Rajen; Saito, Isao; Jana, Subhashis

    2014-01-25

    Dual door entry to exciplex formation was established in a chimeric DNA duplex wherein a fluorescent non-nucleosidic base surrogate () is paired against a fluorescent nucleosidic base surrogate (). Packing of the nucleobases via intercalative stacking interactions led to an exciplex emission either via FRET from the donor or direct excitation of the FRET acceptor .

  8. Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

    PubMed

    Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

    2017-07-06

    The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

  9. Reducing Electroosmotic Flow Enables DNA Separations in Ultrathin Channels.

    DTIC Science & Technology

    1998-08-01

    Chemical structure of DNA bases 2 Figure 1-2: Schematic diagram of DNA base pairing 5 Figure 1-3: Schematic diagram of the capillary and the...hydrogen atoms near one of the Figure 1-1: A. Chemical structure of the DNA backbone. B. Chemical structure of DNA bases . The DNA backbone consists...of pentose sugar (deoxyribose) held together by phosphodiester bonds. The DNA bases that are derivatives of purine are adenine (A) and guanine (G

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Okutsu, N.; Shimamura, K.; Shimizu, E.

    To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH{sub 2} group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH{sub 2} group of G-Cmore » base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes.« less

  11. A rule of seven in Watson-Crick base-pairing of mismatched sequences.

    PubMed

    Cisse, Ibrahim I; Kim, Hajin; Ha, Taekjip

    2012-05-13

    Sequence recognition through base-pairing is essential for DNA repair and gene regulation, but the basic rules governing this process remain elusive. In particular, the kinetics of annealing between two imperfectly matched strands is not well characterized, despite its potential importance in nucleic acid-based biotechnologies and gene silencing. Here we use single-molecule fluorescence to visualize the multiple annealing and melting reactions of two untethered strands inside a porous vesicle, allowing us to precisely quantify the annealing and melting rates. The data as a function of mismatch position suggest that seven contiguous base pairs are needed for rapid annealing of DNA and RNA. This phenomenological rule of seven may underlie the requirement for seven nucleotides of complementarity to seed gene silencing by small noncoding RNA and may help guide performance improvement in DNA- and RNA-based bio- and nanotechnologies, in which off-target effects can be detrimental.

  12. Negatively supercoiled simian virus 40 DNA contains Z-DNA segments within transcriptional enhancer sequences

    NASA Technical Reports Server (NTRS)

    Nordheim, A.; Rich, A.

    1983-01-01

    Three 8-base pair (bp) segments of alternating purine-pyrimidine from the simian virus 40 enhancer region form Z-DNA on negative supercoiling; minichromosome DNase I-hypersensitive sites determined by others bracket these three segments. A survey of transcriptional enhancer sequences reveals a pattern of potential Z-DNA-forming regions which occur in pairs 50-80 bp apart. This may influence local chromatin structure and may be related to transcriptional activation.

  13. Electrochemical DNA sensor for anthrax toxin activator gene atxA-detection of PCR amplicons.

    PubMed

    Das, Ritu; Goel, Ajay K; Sharma, Mukesh K; Upadhyay, Sanjay

    2015-12-15

    We report the DNA probe functionalized electrochemical genosensor for the detection of Bacillus anthracis, specific towards the regulatory gene atxA. The DNA sensor is fabricated on electrochemically deposited gold nanoparticle on self assembled layer of (3-Mercaptopropyl) trimethoxysilane (MPTS) on GC electrode. DNA hybridization is monitored by differential pulse voltammogram (DPV). The modified GC electrode is characterized by atomic force microscopy (AFM), cyclic voltammetry (CV), and electrochemical impedance spectroscopy (EIS) method. We also quantified the DNA probe density on electrode surface by the chronocoulometric method. The detection is specific and selective for atxA gene by DNA probe on the electrode surface. No report is available for the detection of B. anthracis by using atxA an anthrax toxin activator gene. In the light of real and complex sample, we have studied the PCR amplicons of 303, 361 and 568 base pairs by using symmetric and asymmetric PCR approaches. The DNA probe of atxA gene efficiently hybridizes with different base pairs of PCR amplicons. The detection limit is found to be 1.0 pM (S/N ratio=3). The results indicate that the DNA sensor is able to detect synthetic target as well as PCR amplicons of different base pairs. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds

    PubMed Central

    Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.

    2008-01-01

    We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765

  15. Ab initio Study of Naptho-Homologated DNA Bases

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sumpter, Bobby G; Vazquez-Mayagoitia, Alvaro; Huertas, Oscar

    2008-01-01

    Naptho-homologated DNA bases have been recently used to build a new type of size expanded DNA known as yyDNA. We have used theoretical techniques to investigate the structure, tautomeric preferences, base-pairing ability, stacking interactions, and HOMO-LUMO gaps of the naptho-bases. The structure of these bases is found to be similar to that of the benzo-fused predecessors (y-bases) with respect to the planarity of the aromatic rings and amino groups. Tautomeric studies reveal that the canonical-like form of naptho-thymine (yyT) and naptho-adenine (yyA) are the most stable tautomers, leading to hydrogen-bonded dimers with the corresponding natural nucleobases that mimic the Watson-Crickmore » pairing. However, the canonical-like species of naptho-guanine (yyG) and naptho-cytosine (yyC) are not the most stable tautomers, and the most favorable hydrogen-bonded dimers involve wobble-like pairings. The expanded size of the naphto-bases leads to stacking interactions notably larger than those found for the natural bases, and they should presumably play a dominant contribution in modulating the structure of yyDNA duplexes. Finally, the HOMO-LUMO gap of the naptho-bases is smaller than that of their benzo-base counterparts, indicating that size-expansion of DNA bases is an efficient way of reducing their HOMO-LUMO gap. These results are examined in light of the available experimental evidence reported for yyT and yyC.« less

  16. Insights into DNA-mediated interparticle interactions from a coarse-grained model

    NASA Astrophysics Data System (ADS)

    Ding, Yajun; Mittal, Jeetain

    2014-11-01

    DNA-functionalized particles have great potential for the design of complex self-assembled materials. The major hurdle in realizing crystal structures from DNA-functionalized particles is expected to be kinetic barriers that trap the system in metastable amorphous states. Therefore, it is vital to explore the molecular details of particle assembly processes in order to understand the underlying mechanisms. Molecular simulations based on coarse-grained models can provide a convenient route to explore these details. Most of the currently available coarse-grained models of DNA-functionalized particles ignore key chemical and structural details of DNA behavior. These models therefore are limited in scope for studying experimental phenomena. In this paper, we present a new coarse-grained model of DNA-functionalized particles which incorporates some of the desired features of DNA behavior. The coarse-grained DNA model used here provides explicit DNA representation (at the nucleotide level) and complementary interactions between Watson-Crick base pairs, which lead to the formation of single-stranded hairpin and double-stranded DNA. Aggregation between multiple complementary strands is also prevented in our model. We study interactions between two DNA-functionalized particles as a function of DNA grafting density, lengths of the hybridizing and non-hybridizing parts of DNA, and temperature. The calculated free energies as a function of pair distance between particles qualitatively resemble experimental measurements of DNA-mediated pair interactions.

  17. Effect of proton transfer on the electronic coupling in DNA

    NASA Astrophysics Data System (ADS)

    Rak, Janusz; Makowska, Joanna; Voityuk, Alexander A.

    2006-06-01

    The effects of single and double proton transfer within Watson-Crick base pairs on donor-acceptor electronic couplings, Vda, in DNA are studied on the bases of quantum chemical calculations. Four dimers [AT,AT], [GC,GC], [GC,AT] and [GC,TA)] are considered. Three techniques - the generalized Mulliken-Hush scheme, the fragment charge method and the diabatic states method - are employed to estimate Vda for hole transfer between base pairs. We show that both single- and double proton transfer (PT) reactions may substantially affect the electronic coupling in DNA. The electronic coupling in [AT,AT] is predicted to be most sensitive to PT. Single PT within the first base pair in the dimer leads to increase in the hole transfer efficiency by a factor of 4, while proton transfer within the second pair should substantially, by 2.7 times, decrease the rate of charge transfer. Thus, directional asymmetry of the PT effects on the electronic coupling is predicted. The changes in the Vda matrix elements correlate with the topological properties of orbitals of donor and acceptor and can be qualitatively rationalized in terms of resonance structures of donor and acceptor. Atomic pair contributions to the Vda matrix elements are also analyzed.

  18. Effect of genome sequence on the force-induced unzipping of a DNA molecule.

    PubMed

    Singh, N; Singh, Y

    2006-02-01

    We considered a dsDNA polymer in which distribution of bases are random at the base pair level but ordered at a length of 18 base pairs and calculated its force elongation behaviour in the constant extension ensemble. The unzipping force F(y) vs. extension y is found to have a series of maxima and minima. By changing base pairs at selected places in the molecule we calculated the change in F(y) curve and found that the change in the value of force is of the order of few pN and the range of the effect depending on the temperature, can spread over several base pairs. We have also discussed briefly how to calculate in the constant force ensemble a pause or a jump in the extension-time curve from the knowledge of F(y).

  19. Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

    PubMed

    Xia, Shuangluo; Konigsberg, William H

    2014-04-01

    Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

  20. Sequence-specific activation of the DNA sensor cGAS by Y-form DNA structures as found in primary HIV-1 cDNA.

    PubMed

    Herzner, Anna-Maria; Hagmann, Cristina Amparo; Goldeck, Marion; Wolter, Steven; Kübler, Kirsten; Wittmann, Sabine; Gramberg, Thomas; Andreeva, Liudmila; Hopfner, Karl-Peter; Mertens, Christina; Zillinger, Thomas; Jin, Tengchuan; Xiao, Tsan Sam; Bartok, Eva; Coch, Christoph; Ackermann, Damian; Hornung, Veit; Ludwig, Janos; Barchet, Winfried; Hartmann, Gunther; Schlee, Martin

    2015-10-01

    Cytosolic DNA that emerges during infection with a retrovirus or DNA virus triggers antiviral type I interferon responses. So far, only double-stranded DNA (dsDNA) over 40 base pairs (bp) in length has been considered immunostimulatory. Here we found that unpaired DNA nucleotides flanking short base-paired DNA stretches, as in stem-loop structures of single-stranded DNA (ssDNA) derived from human immunodeficiency virus type 1 (HIV-1), activated the type I interferon-inducing DNA sensor cGAS in a sequence-dependent manner. DNA structures containing unpaired guanosines flanking short (12- to 20-bp) dsDNA (Y-form DNA) were highly stimulatory and specifically enhanced the enzymatic activity of cGAS. Furthermore, we found that primary HIV-1 reverse transcripts represented the predominant viral cytosolic DNA species during early infection of macrophages and that these ssDNAs were highly immunostimulatory. Collectively, our study identifies unpaired guanosines in Y-form DNA as a highly active, minimal cGAS recognition motif that enables detection of HIV-1 ssDNA.

  1. Intervening sequences in a plant gene-comparison of the partial sequence of cDNA and genomic DNA of French bean phaseolin

    NASA Astrophysics Data System (ADS)

    Sun, S. M.; Slightom, J. L.; Hall, T. C.

    1981-01-01

    A plant gene coding for the major storage protein (phaseolin, G1-globulin) of the French bean was isolated from a genomic library constructed in the phage vector Charon 24A. Comparison of the nucleotide sequence of part of the gene with that of the cloned messenger RNA (cDNA) revealed the presence of three intervening sequences, all beginning with GTand ending with AG. The 5' and 3' boundaries of intervening sequences TVS-A (88 base pairs) and IVS-B (124 base pairs) are similar to those described for animal and viral genes, but the 3' boundary of IVS-C (129 base pairs) shows some differences. A sequence of 185 amino acids deduced from the cloned DMAs represents about 40% of a phaseolin polypeptide.

  2. Breathing dynamics based parameter sensitivity analysis of hetero-polymeric DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Talukder, Srijeeta; Sen, Shrabani; Chaudhury, Pinaki, E-mail: pinakc@rediffmail.com

    We study the parameter sensitivity of hetero-polymeric DNA within the purview of DNA breathing dynamics. The degree of correlation between the mean bubble size and the model parameters is estimated for this purpose for three different DNA sequences. The analysis leads us to a better understanding of the sequence dependent nature of the breathing dynamics of hetero-polymeric DNA. Out of the 14 model parameters for DNA stability in the statistical Poland-Scheraga approach, the hydrogen bond interaction ε{sub hb}(AT) for an AT base pair and the ring factor ξ turn out to be the most sensitive parameters. In addition, the stackingmore » interaction ε{sub st}(TA-TA) for an TA-TA nearest neighbor pair of base-pairs is found to be the most sensitive one among all stacking interactions. Moreover, we also establish that the nature of stacking interaction has a deciding effect on the DNA breathing dynamics, not the number of times a particular stacking interaction appears in a sequence. We show that the sensitivity analysis can be used as an effective measure to guide a stochastic optimization technique to find the kinetic rate constants related to the dynamics as opposed to the case where the rate constants are measured using the conventional unbiased way of optimization.« less

  3. [Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

    PubMed

    Brovarets', O O; Hovorun, D M

    2010-01-01

    A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*<---->Gua.Cyt<---->Gua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

  4. Viewing Human DNA Polymerase β Faithfully and Unfaithfully Bypass an Oxidative Lesion by Time-Dependent Crystallography

    DOE PAGES

    Vyas, Rajan; Reed, Andrew J.; Tokarsky, E. John; ...

    2015-03-31

    One common oxidative DNA lesion, 8-oxo-7,8-dihydro-2'-deoxyguanine (8-oxoG), is highly mutagenic in vivo due to its anti-conformation forming a Watson–Crick base pair with correct deoxycytidine 5'-triphosphate (dCTP) and its syn-conformation forming a Hoogsteen base pair with incorrect deoxyadenosine 5'-triphosphate (dATP). Here in this article, we utilized time-resolved X-ray crystallography to follow 8-oxoG bypass by human DNA polymerase β (hPolβ). In the 12 solved structures, both Watson–Crick (anti-8-oxoG:anti-dCTP) and Hoogsteen (syn-8-oxoG:anti-dATP) base pairing were clearly visible and were maintained throughout the chemical reaction. Additionally, a third Mg 2+ appeared during the process of phosphodiester bond formation and was located between the reactingmore » α- and β-phosphates of the dNTP, suggesting its role in stabilizing reaction intermediates. After phosphodiester bond formation, hPolβ reopened its conformation, pyrophosphate was released, and the newly incorporated primer 3'-terminal nucleotide stacked, rather than base paired, with 8-oxoG. These structures provide the first real-time pictures, to our knowledge, of how a polymerase correctly and incorrectly bypasses a DNA lesion.« less

  5. Viewing Human DNA Polymerase β Faithfully and Unfaithfully Bypass an Oxidative Lesion by Time-Dependent Crystallography

    PubMed Central

    Vyas, Rajan; Reed, Andrew J.; Tokarsky, E. John; Suo, Zucai

    2015-01-01

    One common oxidative DNA lesion, 8-oxo-7,8-dihydro-2′-deoxyguanine (8-oxoG), is highly mutagenic in vivo due to its anti-conformation forming a Watson–Crick base pair with correct deoxycytidine 5′-triphosphate (dCTP) and its syn-conformation forming a Hoogsteen base pair with incorrect deoxyadenosine 5′-triphosphate (dATP). Here, we utilized time-resolved X-ray crystallography to follow 8-oxoG bypass by human DNA polymerase β (hPolβ). In the 12 solved structures, both Watson–Crick (anti-8-oxoG:anti-dCTP) and Hoogsteen (syn-8-oxoG:anti-dATP) base pairing were clearly visible and were maintained throughout the chemical reaction. Additionally, a third Mg2+ appeared during the process of phosphodiester bond formation and was located between the reacting α- and β-phosphates of the dNTP, suggesting its role in stabilizing reaction intermediates. After phosphodiester bond formation, hPolβ reopened its conformation, pyrophosphate was released, and the newly incorporated primer 3′-terminal nucleotide stacked, rather than base paired, with 8-oxoG. These structures provide the first real-time pictures, to our knowledge, of how a polymerase correctly and incorrectly bypasses a DNA lesion. PMID:25825995

  6. Entropy Beacon: A Hairpin-Free DNA Amplification Strategy for Efficient Detection of Nucleic Acids

    PubMed Central

    2015-01-01

    Here, we propose an efficient strategy for enzyme- and hairpin-free nucleic acid detection called an entropy beacon (abbreviated as Ebeacon). Different from previously reported DNA hybridization/displacement-based strategies, Ebeacon is driven forward by increases in the entropy of the system, instead of free energy released from new base-pair formation. Ebeacon shows high sensitivity, with a detection limit of 5 pM target DNA in buffer and 50 pM in cellular homogenate. Ebeacon also benefits from the hairpin-free amplification strategy and zero-background, excellent thermostability from 20 °C to 50 °C, as well as good resistance to complex environments. In particular, based on the huge difference between the breathing rate of a single base pair and two adjacent base pairs, Ebeacon also shows high selectivity toward base mutations, such as substitution, insertion, and deletion and, therefore, is an efficient nucleic acid detection method, comparable to most reported enzyme-free strategies. PMID:26505212

  7. Thermodynamic Signature of DNA Damage: Characterization of DNA with a 5-Hydroxy-2'-deoxycytidine•2'-Deoxyguanosine Base Pair

    PubMed Central

    Ganguly, Manjori; Szulik, Marta W.; Donahue, Patrick S.; Clancy, Kate; Stone, Michael P.; Gold, Barry

    2012-01-01

    Oxidation of DNA due to exposure to reactive oxygen species is a major source of DNA damage. One of the oxidation lesions formed, 5-hydroxy-2'-deoxycytidine, has been shown to miscode by some replicative DNA polymerases but not by error prone polymerases capable of translesion synthesis. The 5-hydroxy-2'-deoxycytidine lesion is repaired by DNA glycosylases that require the 5-hydroxycytidine base to be extrahelical so it can enter into the enzyme's active site where it is excised off the DNA backbone to afford an abasic site. The thermodynamic and NMR results presented herein, describe the effect of a 5-hydroxy-2'-deoxycytidine•2'-deoxyguanosine base pair on the stability of two different DNA duplexes. The results demonstrate that the lesion is highly destabilizing and that the energy barrier for the unstacking of 5-hydroxy-2'-deoxycytidine from the DNA duplex may be low. This could provide a thermodynamic mode of adduct identification by DNA glycosylases that require the lesion to be extrahelical. PMID:22332945

  8. An intercalation-locked parallel-stranded DNA tetraplex

    DOE PAGES

    Tripathi, S.; Zhang, D.; Paukstelis, P. J.

    2015-01-27

    DNA has proved to be an excellent material for nanoscale construction because complementary DNA duplexes are programmable and structurally predictable. However, in the absence of Watson–Crick pairings, DNA can be structurally more diverse. Here, we describe the crystal structures of d(ACTCGGATGAT) and the brominated derivative, d(AC BrUCGGA BrUGAT). These oligonucleotides form parallel-stranded duplexes with a crystallographically equivalent strand, resulting in the first examples of DNA crystal structures that contains four different symmetric homo base pairs. Two of the parallel-stranded duplexes are coaxially stacked in opposite directions and locked together to form a tetraplex through intercalation of the 5'-most A–A basemore » pairs between adjacent G–G pairs in the partner duplex. The intercalation region is a new type of DNA tertiary structural motif with similarities to the i-motif. 1H– 1H nuclear magnetic resonance and native gel electrophoresis confirmed the formation of a parallel-stranded duplex in solution. Finally, we modified specific nucleotide positions and added d(GAY) motifs to oligonucleotides and were readily able to obtain similar crystals. This suggests that this parallel-stranded DNA structure may be useful in the rational design of DNA crystals and nanostructures.« less

  9. Mechanism for verification of mismatched and homoduplex DNAs by nucleotides-bound MutS analyzed by molecular dynamics simulations.

    PubMed

    Ishida, Hisashi; Matsumoto, Atsushi

    2016-09-01

    In order to understand how MutS recognizes mismatched DNA and induces the reaction of DNA repair using ATP, the dynamics of the complexes of MutS (bound to the ADP and ATP nucleotides, or not) and DNA (with mismatched and matched base-pairs) were investigated using molecular dynamics simulations. As for DNA, the structure of the base-pairs of the homoduplex DNA which interacted with the DNA recognition site of MutS was intermittently disturbed, indicating that the homoduplex DNA was unstable. As for MutS, the disordered loops in the ATPase domains, which are considered to be necessary for the induction of DNA repair, were close to (away from) the nucleotide-binding sites in the ATPase domains when the nucleotides were (not) bound to MutS. This indicates that the ATPase domains changed their structural stability upon ATP binding using the disordered loop. Conformational analysis by principal component analysis showed that the nucleotide binding changed modes which have structurally solid ATPase domains and the large bending motion of the DNA from higher to lower frequencies. In the MutS-mismatched DNA complex bound to two nucleotides, the bending motion of the DNA at low frequency modes may play a role in triggering the formation of the sliding clamp for the following DNA-repair reaction step. Moreover, MM-PBSA/GBSA showed that the MutS-homoduplex DNA complex bound to two nucleotides was unstable because of the unfavorable interactions between MutS and DNA. This would trigger the ATP hydrolysis or separation of MutS and DNA to continue searching for mismatch base-pairs. Proteins 2016; 84:1287-1303. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  10. Hidden in Plain Sight: Subtle Effects of the 8-Oxoguanine Lesion on the Structure, Dynamics, and Thermodynamics of a 15-Base-Pair Oligodeoxynucleotide Duplex†

    PubMed Central

    Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.

    2011-01-01

    The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242

  11. PHYLOGENETIC RELATIONSHIP OF ALEXANDRIUM MONILATUM (DINOPHYCEAE) TO OTHER ALEXANDRIUM SPECIES BASED ON 18S RIBOSOMAL RNA GENE SEQUENCES

    EPA Science Inventory

    The phylogenetic relationship of Alexandrium monilatum to other Alexandrium spp. was explored using 18S rDNA sequences. Maximum likelilhood phylogenetic analysis of the combined rDNA sequences established that A. monilatum paired with Alexandrium taylori and that the pair was the...

  12. Loblolly pine SSR markers for shortleaf pine genetics

    Treesearch

    C. Dana Nelson; Sedley Josserand; Craig S. Echt; Jeff Koppelman

    2007-01-01

    Simple sequence repeats (SSR) are highly informative DNA-based markers widely used in population genetic and linkage mapping studies. We have been developing PCR primer pairs for amplifying SSR markers for loblolly pine (Pinus taeda L.) using loblolly pine DNA and EST sequence data as starting materials. Fifty primer pairs known to reliably amplify...

  13. PHYLOGENETIC RELATIONSHIP OF ALEXANDRIUM MONILATUM (DINOPHYCAE)TO OTHER ALEXANDRIUM SPECIES BASED ON 18S RIBOSOMAL RNA GENE SEQUENCES

    EPA Science Inventory

    The phylogenetic relationship of Alexandrium monilatum to other Alexandrium spp. was explored using 18S rDNA sequences. Maximum likelihood phylogenetic analysis of the combined rDNA sequences established that A. monilatum paired with Alexandrium taylori and that the pair was the ...

  14. Determination of redox potentials for the Watson-Crick base pairs, DNA nucleosides, and relevant nucleoside analogues.

    PubMed

    Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy

    2007-05-17

    Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.

  15. In trans paired nicking triggers seamless genome editing without double-stranded DNA cutting.

    PubMed

    Chen, Xiaoyu; Janssen, Josephine M; Liu, Jin; Maggio, Ignazio; 't Jong, Anke E J; Mikkers, Harald M M; Gonçalves, Manuel A F V

    2017-09-22

    Precise genome editing involves homologous recombination between donor DNA and chromosomal sequences subjected to double-stranded DNA breaks made by programmable nucleases. Ideally, genome editing should be efficient, specific, and accurate. However, besides constituting potential translocation-initiating lesions, double-stranded DNA breaks (targeted or otherwise) are mostly repaired through unpredictable and mutagenic non-homologous recombination processes. Here, we report that the coordinated formation of paired single-stranded DNA breaks, or nicks, at donor plasmids and chromosomal target sites by RNA-guided nucleases based on CRISPR-Cas9 components, triggers seamless homology-directed gene targeting of large genetic payloads in human cells, including pluripotent stem cells. Importantly, in addition to significantly reducing the mutagenicity of the genome modification procedure, this in trans paired nicking strategy achieves multiplexed, single-step, gene targeting, and yields higher frequencies of accurately edited cells when compared to the standard double-stranded DNA break-dependent approach.CRISPR-Cas9-based gene editing involves double-strand breaks at target sequences, which are often repaired by mutagenic non-homologous end-joining. Here the authors use Cas9 nickases to generate coordinated single-strand breaks in donor and target DNA for precise homology-directed gene editing.

  16. Modeling DNA bubble formation at the atomic scale

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Beleva, V; Rasmussen, K. O.; Garcia, A. E.

    We describe the fluctuations of double stranded DNA molecules using a minimalist Go model over a wide range of temperatures. Minimalist models allow us to describe, at the atomic level, the opening and formation of bubbles in DNA double helices. This model includes all the geometrical constraints in helix melting imposed by the 3D structure of the molecule. The DNA forms melted bubbles within double helices. These bubbles form and break as a function of time. The equilibrium average number of broken base pairs shows a sharp change as a function of T. We observe a temperature profile of sequencemore » dependent bubble formation similar to those measured by Zeng et al. Long nuclei acid molecules melt partially through the formations of bubbles. It is known that CG rich sequences melt at higher temperatures than AT rich sequences. The melting temperature, however, is not solely determined by the CG content, but by the sequence through base stacking and solvent interactions. Recently, models that incorporate the sequence and nonlinear dynamics of DNA double strands have shown that DNA exhibits a very rich dynamics. Recent extensions of the Bishop-Peyrard model show that fluctuations in the DNA structure lead to opening in localized regions, and that these regions in the DNA are associated with transcription initiation sites. 1D and 2D models of DNA may contain enough information about stacking and base pairing interactions, but lack the coupling between twisting, bending and base pair opening imposed by the double helical structure of DNA that all atom models easily describe. However, the complexity of the energy function used in all atom simulations (including solvent, ions, etc) does not allow for the description of DNA folding/unfolding events that occur in the microsecond time scale.« less

  17. Biochemical behavior of N-oxidized cytosine and adenine bases in DNA polymerase-mediated primer extension reactions.

    PubMed

    Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo

    2011-04-01

    To clarify the biochemical behavior of 2'-deoxyribonucleoside 5'-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (C(o)) and adenine N-oxide (A(o)), we examined their base recognition ability in DNA duplex formation using melting temperature (T(m)) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the T(m) values of modified DNA-DNA duplexes incorporating 2'-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo(-)) and Vent (exo(-)) suggested that C(o) and A(o) selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo(-)) toward A(o) on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator.

  18. Stabilised DNA secondary structures with increasing transcription localise hypermutable bases for somatic hypermutation in IGHV3-23.

    PubMed

    Duvvuri, Bhargavi; Duvvuri, Venkata R; Wu, Jianhong; Wu, Gillian E

    2012-07-01

    Somatic hypermutation (SHM) mediated by activation-induced cytidine deaminase (AID) is a transcription-coupled mechanism most responsible for generating high affinity antibodies. An issue remaining enigmatic in SHM is how AID is preferentially targeted during transcription to hypermutable bases in its substrates (WRC motifs) on both DNA strands. AID targets only single stranded DNA. By modelling the dynamical behaviour of IGHV3-23 DNA, a commonly used human variable gene segment, we observed that hypermutable bases on the non-transcribed strand are paired whereas those on transcribed strand are mostly unpaired. Hypermutable bases (both paired and unpaired) are made accessible to AID in stabilised secondary structures formed with increasing transcription levels. This observation provides a rationale for the hypermutable bases on both the strands of DNA being targeted to a similar extent despite having differences in unpairedness. We propose that increasing transcription and RNAP II stalling resulting in the formation and stabilisation of stem-loop structures with AID hotspots in negatively supercoiled region can localise the hypermutable bases of both strands of DNA, to AID-mediated SHM.

  19. A common anchor facilitated GO-DNA nano-system for multiplex microRNA analysis in live cells.

    PubMed

    Yu, Jiantao; He, Sihui; Shao, Chen; Zhao, Haoran; Li, Jing; Tian, Leilei

    2018-04-19

    The design of a nano-system for the detection of intracellular microRNAs is challenging as it must fulfill complex requirements, i.e., it must have a high sensitivity to determine the dynamic expression level, a good reliability for multiplex and simultaneous detection, and a satisfactory biostability to work in biological environments. Instead of employing a commonly used physisorption or a full-conjugation strategy, here, a GO-DNA nano-system was developed under graft/base-pairing construction. The common anchor sequence was chemically grafted to GO to base-pair with various microRNA probes; and the hybridization with miRNAs drives the dyes on the probes to leave away from GO, resulting in "turned-on" fluorescence. This strategy not only simplifies the synthesis but also efficiently balances the loading yields of different probes. Moreover, the conjugation yield of GO with a base-paired hybrid has been improved by more than two-fold compared to that of the conjugation with a single strand. We demonstrated that base-paired DNA probes could be efficiently delivered into cells along with GO and are properly stabilized by the conjugated anchor sequence. The resultant GO-DNA nano-system exhibited high stability in a complex biological environment and good resistance to nucleases, and was able to accurately discriminate various miRNAs without cross-reaction. With all of these positive features, the GO-DNA nano-system can simultaneously detect three miRNAs and monitor their dynamic expression levels.

  20. Intramolecular CH···O hydrogen bonds in the AI and BI DNA-like conformers of canonical nucleosides and their Watson-Crick pairs. Quantum chemical and AIM analysis.

    PubMed

    Yurenko, Yevgen P; Zhurakivsky, Roman O; Samijlenko, Svitlana P; Hovorun, Dmytro M

    2011-08-01

    The aim of this work is to cast some light on the H-bonds in double-stranded DNA in its AI and BI forms. For this purpose, we have performed the MP2 and DFT quantum chemical calculations of the canonical nucleoside conformers, relative to the AI and BI DNA forms, and their Watson-Crick pairs, which were regarded as the simplest models of the double-stranded DNA. Based on the atoms-in-molecules analysis (AIM), five types of the CH···O hydrogen bonds, involving bases and sugar, were detected numerically from 1 to 3 per a conformer: C2'H···O5', C1'H···O2, C6H···O5', C8H···O5', and C6H···O4'. The energy values of H-bonds occupy the range of 2.3-5.6 kcal/mol, surely exceeding the kT value (0.62 kcal/mol). The nucleoside CH···O hydrogen bonds appeared to "survive" turns of bases against the sugar, sometimes in rather large ranges of the angle values, pertinent to certain conformations, which points out to the source of the DNA lability, necessary for the conformational adaptation in processes of its functioning. The calculation of the interactions in the dA·T nucleoside pair gives evidence, that additionally to the N6H···O4 and N1···N3H canonical H-bonds, between the bases adenine and thymine the third one (C2H···O2) is formed, which, though being rather weak (about 1 kcal/mol), satisfies the AIM criteria of H-bonding and may be classified as a true H-bond. The total energy of all the CH···O nontraditional intramolecular H-bonds in DNA nucleoside pairs appeared to be commensurable with the energy of H-bonds between the bases in Watson-Crick pairs, which implies their possible important role in the DNA shaping.

  1. Triple Helix Formation in a Topologically Controlled DNA Nanosystem.

    PubMed

    Yamagata, Yutaro; Emura, Tomoko; Hidaka, Kumi; Sugiyama, Hiroshi; Endo, Masayuki

    2016-04-11

    In the present study, we demonstrate single-molecule imaging of triple helix formation in DNA nanostructures. The binding of the single-molecule third strand to double-stranded DNA in a DNA origami frame was examined using two different types of triplet base pairs. The target DNA strand and the third strand were incorporated into the DNA frame, and the binding of the third strand was controlled by the formation of Watson-Crick base pairing. Triple helix formation was monitored by observing the structural changes in the incorporated DNA strands. It was also examined using a photocaged third strand wherein the binding of the third strand was directly observed using high-speed atomic force microscopy during photoirradiation. We found that the binding of the third strand could be controlled by regulating duplex formation and the uncaging of the photocaged strands in the designed nanospace. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. The role of the AT pairs in the acid denaturation of DNA.

    PubMed Central

    Hermann, P; Fredericq, E

    1977-01-01

    It has been determined previously that the protonation of the GC pairs induces a DNA conformation change which leads to a "metastable" structure. The role of the AT pairs, however, is no well known because the protonation does not modify their spectral properties. By means of an indirect method based on the binding of proflavine, it has been determined that the AT pairs are protonated before the acid-induced denaturation and that they seem to be unable to assume a conformation change when protonated. These results would indicate that the protonated AT pairs may be responsible for the induction of the acid denaturation and not the GC pairs as it was thought previously. PMID:20604

  3. Working the kinks out of nucleosomal DNA

    PubMed Central

    Olson, Wilma K.; Zhurkin, Victor B.

    2011-01-01

    Condensation of DNA in the nucleosome takes advantage of its double-helical architecture. The DNA deforms at sites where the base pairs face the histone octamer. The largest so-called kink-and-slide deformations occur in the vicinity of arginines that penetrate the minor groove. Nucleosome structures formed from the 601 positioning sequence differ subtly from those incorporating an AT-rich human α-satellite DNA. Restraints imposed by the histone arginines on the displacement of base pairs can modulate the sequence-dependent deformability of DNA and potentially contribute to the unique features of the different nucleosomes. Steric barriers mimicking constraints found in the nucleosome induce the simulated large-scale rearrangement of canonical B-DNA to kink-and-slide states. The pathway to these states shows non-harmonic behavior consistent with bending profiles inferred from AFM measurements. PMID:21482100

  4. Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing.

    PubMed

    Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon

    2010-08-18

    It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

  5. The mechanism of the emergence of distinct overstretched DNA states

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhu, You-Liang; Sun, Zhao-Yan, E-mail: zysun@ciac.ac.cn; Lu, Zhong-Yuan

    Although multiple overstretched DNA states were identified in experiments, the mechanism of the emergence of distinct states is still unclear. Molecular dynamics simulation is an ideal tool to clarify the mechanism, but the force loading rates in stretching achieved by conventional all-atom DNA models are much faster, which essentially affect overstretching states. We employed a modified coarse-grained DNA model with an unprecedented low loading rate in simulations to study the overstretching transitions of end-opened double-stranded DNA. We observed two-strand peeling off for DNA with low stability and the S-DNA with high stability under tension. By introducing a melting-forbidden model whichmore » prevents base-pair breaking, we still observed the overstretching transition induced by the formation of S-DNA due to the change of dihedral angle. Hence, we confirmed that the competition between the two strain-softening manners, i.e., base-pair breaking and dihedral angle variation, results in the emergence of distinct overstretched DNA states.« less

  6. Optical properties and electronic transitions of DNA oligonucleotides as a function of composition and stacking sequence.

    PubMed

    Schimelman, Jacob B; Dryden, Daniel M; Poudel, Lokendra; Krawiec, Katherine E; Ma, Yingfang; Podgornik, Rudolf; Parsegian, V Adrian; Denoyer, Linda K; Ching, Wai-Yim; Steinmetz, Nicole F; French, Roger H

    2015-02-14

    The role of base pair composition and stacking sequence in the optical properties and electronic transitions of DNA is of fundamental interest. We present and compare the optical properties of DNA oligonucleotides (AT)10, (AT)5(GC)5, and (AT-GC)5 using both ab initio methods and UV-vis molar absorbance measurements. Our data indicate a strong dependence of both the position and intensity of UV absorbance features on oligonucleotide composition and stacking sequence. The partial densities of states for each oligonucleotide indicate that the valence band edge arises from a feature associated with the PO4(3-) complex anion, and the conduction band edge arises from anti-bonding states in DNA base pairs. The results show a strong correspondence between the ab initio and experimentally determined optical properties. These results highlight the benefit of full spectral analysis of DNA, as opposed to reductive methods that consider only the 260 nm absorbance (A260) or simple purity ratios, such as A260/A230 or A260/A280, and suggest that the slope of the absorption edge onset may provide a useful metric for the degree of base pair stacking in DNA. These insights may prove useful for applications in biology, bioelectronics, and mesoscale self-assembly.

  7. Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory

    PubMed Central

    Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki

    2015-01-01

    In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600

  8. Complexes of DNA bases and Watson-Crick base pairs interaction with neutral silver Agn (n = 8, 10, 12) clusters: a DFT and TDDFT study.

    PubMed

    Srivastava, Ruby

    2018-03-01

    We study the binding of the neutral Ag n (n = 8, 10, 12) to the DNA base-adenine (A), guanine (G) and Watson-Crick -adenine-thymine, guanine-cytosine pairs. Geometries of complexes were optimized at the DFT level using the hybrid B3LYP functional. LANL2DZ effective core potential was used for silver and 6-31 + G ** was used for all other atoms. NBO charges were analyzed using the Natural population analysis. The absorption properties of Ag n -A,G/WC complexes were also studied using time-dependent density functional theory. The absorption spectra for these complexes show wavelength in the visible region. It was revealed that silver clusters interact more strongly with WC pairs than with isolated DNA complexes. Furthermore, it was found that the electronic charge transferred from silver to isolated DNA clusters are less than the electronic charge transferred from silver to the Ag n -WC complexes. The vertical ionization potential, vertical electron affinity, hardness, and electrophilicity index of Ag n -DNA/WC complexes have also been discussed.

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tripathi, S.; Zhang, D.; Paukstelis, P. J.

    DNA has proved to be an excellent material for nanoscale construction because complementary DNA duplexes are programmable and structurally predictable. However, in the absence of Watson–Crick pairings, DNA can be structurally more diverse. Here, we describe the crystal structures of d(ACTCGGATGAT) and the brominated derivative, d(AC BrUCGGA BrUGAT). These oligonucleotides form parallel-stranded duplexes with a crystallographically equivalent strand, resulting in the first examples of DNA crystal structures that contains four different symmetric homo base pairs. Two of the parallel-stranded duplexes are coaxially stacked in opposite directions and locked together to form a tetraplex through intercalation of the 5'-most A–A basemore » pairs between adjacent G–G pairs in the partner duplex. The intercalation region is a new type of DNA tertiary structural motif with similarities to the i-motif. 1H– 1H nuclear magnetic resonance and native gel electrophoresis confirmed the formation of a parallel-stranded duplex in solution. Finally, we modified specific nucleotide positions and added d(GAY) motifs to oligonucleotides and were readily able to obtain similar crystals. This suggests that this parallel-stranded DNA structure may be useful in the rational design of DNA crystals and nanostructures.« less

  10. Statistical and linguistic features of DNA sequences

    NASA Technical Reports Server (NTRS)

    Havlin, S.; Buldyrev, S. V.; Goldberger, A. L.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.

    1995-01-01

    We present evidence supporting the idea that the DNA sequence in genes containing noncoding regions is correlated, and that the correlation is remarkably long range--indeed, base pairs thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene. We resolve the problem of the "non-stationary" feature of the sequence of base pairs by applying a new algorithm called Detrended Fluctuation Analysis (DFA). We address the claim of Voss that there is no difference in the statistical properties of coding and noncoding regions of DNA by systematically applying the DFA algorithm, as well as standard FFT analysis, to all eukaryotic DNA sequences (33 301 coding and 29 453 noncoding) in the entire GenBank database. We describe a simple model to account for the presence of long-range power-law correlations which is based upon a generalization of the classic Levy walk. Finally, we describe briefly some recent work showing that the noncoding sequences have certain statistical features in common with natural languages. Specifically, we adapt to DNA the Zipf approach to analyzing linguistic texts, and the Shannon approach to quantifying the "redundancy" of a linguistic text in terms of a measurable entropy function. We suggest that noncoding regions in plants and invertebrates may display a smaller entropy and larger redundancy than coding regions, further supporting the possibility that noncoding regions of DNA may carry biological information.

  11. An algebraic hypothesis about the primeval genetic code architecture.

    PubMed

    Sánchez, Robersy; Grau, Ricardo

    2009-09-01

    A plausible architecture of an ancient genetic code is derived from an extended base triplet vector space over the Galois field of the extended base alphabet {D,A,C,G,U}, where symbol D represents one or more hypothetical bases with unspecific pairings. We hypothesized that the high degeneration of a primeval genetic code with five bases and the gradual origin and improvement of a primeval DNA repair system could make possible the transition from ancient to modern genetic codes. Our results suggest that the Watson-Crick base pairing G identical with C and A=U and the non-specific base pairing of the hypothetical ancestral base D used to define the sum and product operations are enough features to determine the coding constraints of the primeval and the modern genetic code, as well as, the transition from the former to the latter. Geometrical and algebraic properties of this vector space reveal that the present codon assignment of the standard genetic code could be induced from a primeval codon assignment. Besides, the Fourier spectrum of the extended DNA genome sequences derived from the multiple sequence alignment suggests that the called period-3 property of the present coding DNA sequences could also exist in the ancient coding DNA sequences. The phylogenetic analyses achieved with metrics defined in the N-dimensional vector space (B(3))(N) of DNA sequences and with the new evolutionary model presented here also suggest that an ancient DNA coding sequence with five or more bases does not contradict the expected evolutionary history.

  12. Base-Pairing Energies of Protonated Nucleoside Base Pairs of dCyd and m5dCyd: Implications for the Stability of DNA i-Motif Conformations

    NASA Astrophysics Data System (ADS)

    Yang, Bo; Rodgers, M. T.

    2015-08-01

    Hypermethylation of cytosine in expanded (CCG)n•(CGG)n trinucleotide repeats results in Fragile X syndrome, the most common cause of inherited mental retardation. The (CCG)n•(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of protonated base pairs of cytosine. Here we investigate the effects of 5-methylation and the sugar moiety on the base-pairing energies (BPEs) of protonated cytosine base pairs by examining protonated nucleoside base pairs of 2'-deoxycytidine (dCyd) and 5-methyl-2'-deoxycytidine (m5dCyd) using threshold collision-induced dissociation techniques. 5-Methylation of a single or both cytosine residues leads to very small change in the BPE. However, the accumulated effect may be dramatic in diseased state trinucleotide repeats where many methylated base pairs may be present. The BPEs of the protonated nucleoside base pairs examined here significantly exceed those of Watson-Crick dGuo•dCyd and neutral dCyd•dCyd base pairs, such that these base-pairing interactions provide the major forces responsible for stabilization of DNA i-motif conformations. Compared with isolated protonated nucleobase pairs of cytosine and 1-methylcytosine, the 2'-deoxyribose sugar produces an effect similar to the 1-methyl substituent, and leads to a slight decrease in the BPE. These results suggest that the base-pairing interactions may be slightly weaker in nucleic acids, but that the extended backbone is likely to exert a relatively small effect on the total BPE. The proton affinity (PA) of m5dCyd is also determined by competitive analysis of the primary dissociation pathways that occur in parallel for the protonated (m5dCyd)H+(dCyd) nucleoside base pair and the absolute PA of dCyd previously reported.

  13. Twisting Right to Left: A…A Mismatch in a CAG Trinucleotide Repeat Overexpansion Provokes Left-Handed Z-DNA Conformation

    PubMed Central

    2015-01-01

    Conformational polymorphism of DNA is a major causative factor behind several incurable trinucleotide repeat expansion disorders that arise from overexpansion of trinucleotide repeats located in coding/non-coding regions of specific genes. Hairpin DNA structures that are formed due to overexpansion of CAG repeat lead to Huntington’s disorder and spinocerebellar ataxias. Nonetheless, DNA hairpin stem structure that generally embraces B-form with canonical base pairs is poorly understood in the context of periodic noncanonical A…A mismatch as found in CAG repeat overexpansion. Molecular dynamics simulations on DNA hairpin stems containing A…A mismatches in a CAG repeat overexpansion show that A…A dictates local Z-form irrespective of starting glycosyl conformation, in sharp contrast to canonical DNA duplex. Transition from B-to-Z is due to the mechanistic effect that originates from its pronounced nonisostericity with flanking canonical base pairs facilitated by base extrusion, backbone and/or base flipping. Based on these structural insights we envisage that such an unusual DNA structure of the CAG hairpin stem may have a role in disease pathogenesis. As this is the first study that delineates the influence of a single A…A mismatch in reversing DNA helicity, it would further have an impact on understanding DNA mismatch repair. PMID:25876062

  14. Structural Mechanism behind Distinct Efficiency of Oct4/Sox2 Proteins in Differentially Spaced DNA Complexes

    PubMed Central

    Yesudhas, Dhanusha; Anwar, Muhammad Ayaz; Panneerselvam, Suresh; Durai, Prasannavenkatesh; Shah, Masaud; Choi, Sangdun

    2016-01-01

    The octamer-binding transcription factor 4 (Oct4) and sex-determining region Y (SRY)-box 2 (Sox2) proteins induce various transcriptional regulators to maintain cellular pluripotency. Most Oct4/Sox2 complexes have either 0 base pairs (Oct4/Sox20bp) or 3 base pairs (Oct4/Sox23bp) separation between their DNA-binding sites. Results from previous biochemical studies have shown that the complexes separated by 0 base pairs are associated with a higher pluripotency rate than those separated by 3 base pairs. Here, we performed molecular dynamics (MD) simulations and calculations to determine the binding free energy and per-residue free energy for the Oct4/Sox20bp and Oct4/Sox23bp complexes to identify structural differences that contribute to differences in induction rate. Our MD simulation results showed substantial differences in Oct4/Sox2 domain movements, as well as secondary-structure changes in the Oct4 linker region, suggesting a potential reason underlying the distinct efficiencies of these complexes during reprogramming. Moreover, we identified key residues and hydrogen bonds that potentially facilitate protein-protein and protein-DNA interactions, in agreement with previous experimental findings. Consequently, our results confess that differential spacing of the Oct4/Sox2 DNA binding sites can determine the magnitude of transcription of the targeted genes during reprogramming. PMID:26790000

  15. NMR scalar couplings across Watson–Crick base pair hydrogen bonds in DNA observed by transverse relaxation-optimized spectroscopy

    PubMed Central

    Pervushin, Konstantin; Ono, Akira; Fernández, César; Szyperski, Thomas; Kainosho, Masatsune; Wüthrich, Kurt

    1998-01-01

    This paper describes the NMR observation of 15N—15N and 1H—15N scalar couplings across the hydrogen bonds in Watson–Crick base pairs in a DNA duplex, hJNN and hJHN. These couplings represent new parameters of interest for both structural studies of DNA and theoretical investigations into the nature of the hydrogen bonds. Two dimensional [15N,1H]-transverse relaxation-optimized spectroscopy (TROSY) with a 15N-labeled 14-mer DNA duplex was used to measure hJNN, which is in the range 6–7 Hz, and the two-dimensional hJNN-correlation-[15N,1H]-TROSY experiment was used to correlate the chemical shifts of pairs of hydrogen bond-related 15N spins and to observe, for the first time, hJHN scalar couplings, with values in the range 2–3.6 Hz. TROSY-based studies of scalar couplings across hydrogen bonds should be applicable for large molecular sizes, including protein-bound nucleic acids. PMID:9826668

  16. A rapid, generally applicable method to engineer zinc fingers illustrated by targeting the HIV-1 promoter.

    PubMed

    Isalan, M; Klug, A; Choo, Y

    2001-07-01

    DNA-binding domains with predetermined sequence specificity are engineered by selection of zinc finger modules using phage display, allowing the construction of customized transcription factors. Despite remarkable progress in this field, the available protein-engineering methods are deficient in many respects, thus hampering the applicability of the technique. Here we present a rapid and convenient method that can be used to design zinc finger proteins against a variety of DNA-binding sites. This is based on a pair of pre-made zinc finger phage-display libraries, which are used in parallel to select two DNA-binding domains each of which recognizes given 5 base pair sequences, and whose products are recombined to produce a single protein that recognizes a composite (9 base pair) site of predefined sequence. Engineering using this system can be completed in less than two weeks and yields proteins that bind sequence-specifically to DNA with Kd values in the nanomolar range. To illustrate the technique, we have selected seven different proteins to bind various regions of the human immunodeficiency virus 1 (HIV-1) promoter.

  17. Manipulative interplay of two adozelesin molecules with d(ATTAAT)₂achieving ligand-stacked Watson-Crick and Hoogsteen base-paired duplex adducts.

    PubMed

    Hopton, Suzanne R; Thompson, Andrew S

    2011-05-17

    Previous structural studies of the cyclopropapyrroloindole (CPI) antitumor antibiotics have shown that these ligands bind covalently edge-on into the minor groove of double-stranded DNA. Reversible covalent modification of the DNA via N3 of adenine occurs in a sequence-specific fashion. Early nuclear magnetic resonance and molecular modeling studies with both mono- and bis-alkylating ligands indicated that the ligands fit tightly within the minor groove, causing little distortion of the helix. In this study, we propose a new binding model for several of the CPI-based analogues, in which the aromatic secondary rings form π-stacked complexes within the minor groove. One of the adducts, formed with adozelesin and the d(ATTAAT)(2) sequence, also demonstrates the ability of these ligands to manipulate the DNA of the binding site, resulting in a Hoogsteen base-paired adduct. Although this type of base pairing has been previously observed with the bisfunctional CPI analogue bizelesin, this is the first time that such an observation has been made with a monoalkylating nondimeric analogue. Together, these results provide a new model for the design of CPI-based antitumor antibiotics, which also has a significant bearing on other structurally related and structurally unrelated minor groove-binding ligands. They indicate the dynamic nature of ligand-DNA interactions, demonstrating both DNA conformational flexibility and the ability of two DNA-bound ligands to interact to form stable covalent modified complexes.

  18. Assessment of DNA Contamination in RNA Samples Based on Ribosomal DNA

    PubMed Central

    Hashemipetroudi, Seyyed Hamidreza; Nematzadeh, Ghorbanali; Ahmadian, Gholamreza; Yamchi, Ahad; Kuhlmann, Markus

    2018-01-01

    One method extensively used for the quantification of gene expression changes and transcript abundances is reverse-transcription quantitative real-time PCR (RT-qPCR). It provides accurate, sensitive, reliable, and reproducible results. Several factors can affect the sensitivity and specificity of RT-qPCR. Residual genomic DNA (gDNA) contaminating RNA samples is one of them. In gene expression analysis, non-specific amplification due to gDNA contamination will overestimate the abundance of transcript levels and can affect the RT-qPCR results. Generally, gDNA is detected by qRT-PCR using primer pairs annealing to intergenic regions or an intron of the gene of interest. Unfortunately, intron/exon annotations are not yet known for all genes from vertebrate, bacteria, protist, fungi, plant, and invertebrate metazoan species. Here we present a protocol for detection of gDNA contamination in RNA samples by using ribosomal DNA (rDNA)-based primers. The method is based on the unique features of rDNA: their multigene nature, highly conserved sequences, and high frequency in the genome. Also as a case study, a unique set of primers were designed based on the conserved region of ribosomal DNA (rDNA) in the Poaceae family. The universality of these primer pairs was tested by melt curve analysis and agarose gel electrophoresis. Although our method explains how rDNA-based primers can be applied for the gDNA contamination assay in the Poaceae family, it could be easily used to other prokaryote and eukaryote species PMID:29443017

  19. A non-canonical DNA structure enables homologous recombination in various genetic systems.

    PubMed

    Masuda, Tokiha; Ito, Yutaka; Terada, Tohru; Shibata, Takehiko; Mikawa, Tsutomu

    2009-10-30

    Homologous recombination, which is critical to genetic diversity, depends on homologous pairing (HP). HP is the switch from parental to recombinant base pairs, which requires expansion of inter-base pair spaces. This expansion unavoidably causes untwisting of the parental double-stranded DNA. RecA/Rad51-catalyzed ATP-dependent HP is extensively stimulated in vitro by negative supercoils, which compensates for untwisting. However, in vivo, double-stranded DNA is relaxed by bound proteins and thus is an unfavorable substrate for RecA/Rad51. In contrast, Mhr1, an ATP-independent HP protein required for yeast mitochondrial homologous recombination, catalyzes HP without the net untwisting of double-stranded DNA. Therefore, we questioned whether Mhr1 uses a novel strategy to promote HP. Here, we found that, like RecA, Mhr1 induced the extension of bound single-stranded DNA. In addition, this structure was induced by all evolutionarily and structurally distinct HP proteins so far tested, including bacterial RecO, viral RecT, and human Rad51. Thus, HP includes the common non-canonical DNA structure and uses a common core mechanism, independent of the species of HP proteins. We discuss the significance of multiple types of HP proteins.

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vyas, Rajan; Reed, Andrew J.; Tokarsky, E. John

    One common oxidative DNA lesion, 8-oxo-7,8-dihydro-2'-deoxyguanine (8-oxoG), is highly mutagenic in vivo due to its anti-conformation forming a Watson–Crick base pair with correct deoxycytidine 5'-triphosphate (dCTP) and its syn-conformation forming a Hoogsteen base pair with incorrect deoxyadenosine 5'-triphosphate (dATP). Here in this article, we utilized time-resolved X-ray crystallography to follow 8-oxoG bypass by human DNA polymerase β (hPolβ). In the 12 solved structures, both Watson–Crick (anti-8-oxoG:anti-dCTP) and Hoogsteen (syn-8-oxoG:anti-dATP) base pairing were clearly visible and were maintained throughout the chemical reaction. Additionally, a third Mg 2+ appeared during the process of phosphodiester bond formation and was located between the reactingmore » α- and β-phosphates of the dNTP, suggesting its role in stabilizing reaction intermediates. After phosphodiester bond formation, hPolβ reopened its conformation, pyrophosphate was released, and the newly incorporated primer 3'-terminal nucleotide stacked, rather than base paired, with 8-oxoG. These structures provide the first real-time pictures, to our knowledge, of how a polymerase correctly and incorrectly bypasses a DNA lesion.« less

  1. Application of differential scanning calorimetry to measure the differential binding of ions, water and protons in the unfolding of DNA molecules.

    PubMed

    Olsen, Chris M; Shikiya, Ronald; Ganugula, Rajkumar; Reiling-Steffensmeier, Calliste; Khutsishvili, Irine; Johnson, Sarah E; Marky, Luis A

    2016-05-01

    The overall stability of DNA molecules globally depends on base-pair stacking, base-pairing, polyelectrolyte effect and hydration contributions. In order to understand how they carry out their biological roles, it is essential to have a complete physical description of how the folding of nucleic acids takes place, including their ion and water binding. To investigate the role of ions, water and protons in the stability and melting behavior of DNA structures, we report here an experimental approach i.e., mainly differential scanning calorimetry (DSC), to determine linking numbers: the differential binding of ions (Δnion), water (ΔnW) and protons (ΔnH(+)) in the helix-coil transition of DNA molecules. We use DSC and temperature-dependent UV spectroscopic techniques to measure the differential binding of ions, water, and protons for the unfolding of a variety of DNA molecules: salmon testes DNA (ST-DNA), one dodecamer, one undecamer and one decamer duplexes, nine hairpin loops, and two triplexes. These methods can be applied to any conformational transition of a biomolecule. We determined complete thermodynamic profiles, including all three linking numbers, for the unfolding of each molecule. The favorable folding of a DNA helix results from a favorable enthalpy-unfavorable entropy compensation. DSC thermograms and UV melts as a function of salt, osmolyte and proton concentrations yielded releases of ions and water. Therefore, the favorable folding of each DNA molecule results from the formation of base-pair stacks and uptake of both counterions and water molecules. In addition, the triplex with C(+)GC base triplets yielded an uptake of protons. Furthermore, the folding of a DNA duplex is accompanied by a lower uptake of ions and a similar uptake of four water molecules as the DNA helix gets shorter. In addition, the oligomer duplexes and hairpin thermodynamic data suggest ion and water binding depends on the DNA sequence rather than DNA composition. Copyright © 2015. Published by Elsevier B.V.

  2. Sequence analysis of Leukemia DNA

    NASA Astrophysics Data System (ADS)

    Nacong, Nasria; Lusiyanti, Desy; Irawan, Muhammad. Isa

    2018-03-01

    Cancer is a very deadly disease, one of which is leukemia disease or better known as blood cancer. The cancer cell can be detected by taking DNA in laboratory test. This study focused on local alignment of leukemia and non leukemia data resulting from NCBI in the form of DNA sequences by using Smith-Waterman algorithm. SmithWaterman algorithm was invented by TF Smith and MS Waterman in 1981. These algorithms try to find as much as possible similarity of a pair of sequences, by giving a negative value to the unequal base pair (mismatch), and positive values on the same base pair (match). So that will obtain the maximum positive value as the end of the alignment, and the minimum value as the initial alignment. This study will use sequences of leukemia and 3 sequences of non leukemia.

  3. Nucleotide sequence analysis establishes the role of endogenous murine leukemia virus DNA segments in formation of recombinant mink cell focus-forming murine leukemia viruses.

    PubMed Central

    Khan, A S

    1984-01-01

    The sequence of 363 nucleotides near the 3' end of the pol gene and 564 nucleotides from the 5' terminus of the env gene in an endogenous murine leukemia viral (MuLV) DNA segment, cloned from AKR/J mouse DNA and designated as A-12, was obtained. For comparison, the nucleotide sequence in an analogous portion of AKR mink cell focus-forming (MCF) 247 MuLV provirus was also determined. Sequence features unique to MCF247 MuLV DNA in the 3' pol and 5' env regions were identified by comparison with nucleotide sequences in analogous regions of NFS -Th-1 xenotropic and AKR ecotropic MuLV proviruses. These included (i) an insertion of 12 base pairs encoding four amino acids located 60 base pairs from the 3' terminus of the pol gene and immediately preceding the env gene, (ii) the deletion of 12 base pairs (encoding four amino acids) and the insertion of 3 base pairs (encoding one amino acid) in the 5' portion of the env gene, and (iii) single base substitutions resulting in 2 MCF247 -specific amino acids in the 3' pol and 23 in the 5' env regions. Nucleotide sequence comparison involving the 3' pol and 5' env regions of AKR MCF247 , NFS xenotropic, and AKR ecotropic MuLV proviruses with the cloned endogenous MuLV DNA indicated that MCF247 proviral DNA sequences were conserved in the cloned endogenous MuLV proviral segment. In fact, total nucleotide sequence identity existed between the endogenous MuLV DNA and the MCF247 MuLV provirus in the 3' portion of the pol gene. In the 5' env region, only 4 of 564 nucleotides were different, resulting in three amino acid changes between AKR MCF247 MuLV DNA and the endogenous MuLV DNA present in clone A-12. In addition, nucleotide sequence comparison indicated that Moloney-and Friend-MCF MuLVs were also highly related in the 3' pol and 5' env regions to the cloned endogenous MuLV DNA. These results establish the role of endogenous MuLV DNA segments in generation of recombinant MCF viruses. PMID:6328017

  4. MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

    PubMed

    Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

    2016-01-01

    Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic strands to increase the success rate. It is a standalone web-based pipeline, which is fully configured within a virtual machine and thus can be readily used without any configuration. We have experimentally validated primer pairs designed by our pipeline and shown a very high success rate of primer pairs: out of 66 BSP primer pairs, 63 were successfully validated without any further optimization step and using the same qPCR conditions. The MSP-HTPrimer pipeline is freely available from http://sourceforge.net/p/msp-htprimer.

  5. Biochemical behavior of N-oxidized cytosine and adenine bases in DNA polymerase-mediated primer extension reactions

    PubMed Central

    Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo

    2011-01-01

    To clarify the biochemical behavior of 2′-deoxyribonucleoside 5′-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (Co) and adenine N-oxide (Ao), we examined their base recognition ability in DNA duplex formation using melting temperature (Tm) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the Tm values of modified DNA–DNA duplexes incorporating 2′-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo−) and Vent (exo−) suggested that Co and Ao selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo−) toward Ao on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator. PMID:21300642

  6. Physics of base-pairing dynamics in DNA

    NASA Astrophysics Data System (ADS)

    Manghi, Manoel; Destainville, Nicolas

    2016-05-01

    As a key molecule of life, Deoxyribo-Nucleic Acid (DNA) is the focus of numbers of investigations with the help of biological, chemical and physical techniques. From a physical point of view, both experimental and theoretical works have brought quantitative insights into DNA base-pairing dynamics that we review in this Report, putting emphasis on theoretical developments. We discuss the dynamics at the base-pair scale and its pivotal coupling with the polymer one, with a polymerization index running from a few nucleotides to tens of kilo-bases. This includes opening and closure of short hairpins and oligomers as well as zipping and unwinding of long macromolecules. We review how different physical mechanisms are either used by Nature or utilized in biotechnological processes to separate the two intertwined DNA strands, by insisting on quantitative results. They go from thermally-assisted denaturation bubble nucleation to force- or torque-driven mechanisms. We show that the helical character of the molecule, possibly supercoiled, can play a key role in many denaturation and renaturation processes. We categorize the mechanisms according to the relative timescales associated with base-pairing and chain orientational degrees of freedom such as bending and torsional elastic ones. In some specific situations, these chain orientational degrees of freedom can be integrated out, and the quasi-static approximation is valid. The complex dynamics then reduces to the diffusion in a low-dimensional free-energy landscape. In contrast, some important cases of experimental interest necessarily appeal to far-from-equilibrium statistical mechanics and hydrodynamics.

  7. Effects of sugar functional groups, hydrophobicity, and fluorination on carbohydrate-DNA stacking interactions in water.

    PubMed

    Lucas, Ricardo; Peñalver, Pablo; Gómez-Pinto, Irene; Vengut-Climent, Empar; Mtashobya, Lewis; Cousin, Jonathan; Maldonado, Olivia S; Perez, Violaine; Reynes, Virginie; Aviñó, Anna; Eritja, Ramón; González, Carlos; Linclau, Bruno; Morales, Juan C

    2014-03-21

    Carbohydrate-aromatic interactions are highly relevant for many biological processes. Nevertheless, experimental data in aqueous solution relating structure and energetics for sugar-arene stacking interactions are very scarce. Here, we evaluate how structural variations in a monosaccharide including carboxyl, N-acetyl, fluorine, and methyl groups affect stacking interactions with aromatic DNA bases. We find small differences on stacking interaction among the natural carbohydrates examined. The presence of fluorine atoms within the pyranose ring slightly increases the interaction with the C-G DNA base pair. Carbohydrate hydrophobicity is the most determinant factor. However, gradual increase in hydrophobicity of the carbohydrate does not translate directly into a steady growth in stacking interaction. The energetics correlates better with the amount of apolar surface buried upon sugar stacking on top of the aromatic DNA base pair.

  8. Screening the sequence selectivity of DNA-binding molecules using a gold nanoparticle-based colorimetric approach.

    PubMed

    Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A

    2007-09-15

    We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.

  9. Base-Pairing Systems Related to TNA: alpha-Threofuranosyl Oligonucleotides Containing Phosphoramidate Linkages

    NASA Technical Reports Server (NTRS)

    Meyer, Michael (Technical Monitor); Wu, Xiaolin; Guntha, Sreenivasulu; Ferenclc, Mathias; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

    2002-01-01

    (3'NH)- and (2'NH)-TNA, two isomeric phosphoramidate analogues of TNA (alpha-threofuranosyl-(3'-2') oligonucleotides), are shown to be efficient Watson-Crick base-pairing systems and to undergo intersystem crosspairing with TNA, RNA, and DNA.

  10. Structural basis of DNA folding and recognition in an AMP-DNA aptamer complex: distinct architectures but common recognition motifs for DNA and RNA aptamers complexed to AMP.

    PubMed

    Lin, C H; Patel, D J

    1997-11-01

    Structural studies by nuclear magnetic resonance (NMR) of RNA and DNA aptamer complexes identified through in vitro selection and amplification have provided a wealth of information on RNA and DNA tertiary structure and molecular recognition in solution. The RNA and DNA aptamers that target ATP (and AMP) with micromolar affinity exhibit distinct binding site sequences and secondary structures. We report below on the tertiary structure of the AMP-DNA aptamer complex in solution and compare it with the previously reported tertiary structure of the AMP-RNA aptamer complex in solution. The solution structure of the AMP-DNA aptamer complex shows, surprisingly, that two AMP molecules are intercalated at adjacent sites within a rectangular widened minor groove. Complex formation involves adaptive binding where the asymmetric internal bubble of the free DNA aptamer zippers up through formation of a continuous six-base mismatch segment which includes a pair of adjacent three-base platforms. The AMP molecules pair through their Watson-Crick edges with the minor groove edges of guanine residues. These recognition G.A mismatches are flanked by sheared G.A and reversed Hoogsteen G.G mismatch pairs. The AMP-DNA aptamer and AMP-RNA aptamer complexes have distinct tertiary structures and binding stoichiometries. Nevertheless, both complexes have similar structural features and recognition alignments in their binding pockets. Specifically, AMP targets both DNA and RNA aptamers by intercalating between purine bases and through identical G.A mismatch formation. The recognition G.A mismatch stacks with a reversed Hoogsteen G.G mismatch in one direction and with an adenine base in the other direction in both complexes. It is striking that DNA and RNA aptamers selected independently from libraries of 10(14) molecules in each case utilize identical mismatch alignments for molecular recognition with micromolar affinity within binding-site pockets containing common structural elements.

  11. Intrinsic flexibility of B-DNA: the experimental TRX scale.

    PubMed

    Heddi, Brahim; Oguey, Christophe; Lavelle, Christophe; Foloppe, Nicolas; Hartmann, Brigitte

    2010-01-01

    B-DNA flexibility, crucial for DNA-protein recognition, is sequence dependent. Free DNA in solution would in principle be the best reference state to uncover the relation between base sequences and their intrinsic flexibility; however, this has long been hampered by a lack of suitable experimental data. We investigated this relationship by compiling and analyzing a large dataset of NMR (31)P chemical shifts in solution. These measurements reflect the BI <--> BII equilibrium in DNA, intimately correlated to helicoidal descriptors of the curvature, winding and groove dimensions. Comparing the ten complementary DNA dinucleotide steps indicates that some steps are much more flexible than others. This malleability is primarily controlled at the dinucleotide level, modulated by the tetranucleotide environment. Our analyses provide an experimental scale called TRX that quantifies the intrinsic flexibility of the ten dinucleotide steps in terms of Twist, Roll, and X-disp (base pair displacement). Applying the TRX scale to DNA sequences optimized for nucleosome formation reveals a 10 base-pair periodic alternation of stiff and flexible regions. Thus, DNA flexibility captured by the TRX scale is relevant to nucleosome formation, suggesting that this scale may be of general interest to better understand protein-DNA recognition.

  12. Structure-affinity relationships for the binding of actinomycin D to DNA

    NASA Astrophysics Data System (ADS)

    Gallego, José; Ortiz, Angel R.; de Pascual-Teresa, Beatriz; Gago, Federico

    1997-03-01

    Molecular models of the complexes between actinomycin D and 14 different DNA hexamers were built based on the X-ray crystal structure of the actinomycin-d(GAAGCTTC)2 complex. The DNA sequences included the canonical GpC binding step flanked by different base pairs, nonclassical binding sites such as GpG and GpT, and sites containing 2,6-diamino- purine. A good correlation was found between the intermolecular interaction energies calculated for the refined complexes and the relative preferences of actinomycin binding to standard and modified DNA. A detailed energy decomposition into van der Waals and electrostatic components for the interactions between the DNA base pairs and either the chromophore or the peptidic part of the antibiotic was performed for each complex. The resulting energy matrix was then subjected to principal component analysis, which showed that actinomycin D discriminates among different DNA sequences by an interplay of hydrogen bonding and stacking interactions. The structure-affinity relationships for this important antitumor drug are thus rationalized and may be used to advantage in the design of novel sequence-specific DNA-binding agents.

  13. Zn2+ selectively stabilizes FdU-substituted DNA through a unique major groove binding motif

    PubMed Central

    Ghosh, Supratim; Salsbury, Freddie R.; Horita, David A.; Gmeiner, William H.

    2011-01-01

    We report, based on semi-empirical calculations, that Zn2+ binds duplex DNA containing consecutive FdU–dA base pairs in the major groove with distorted trigonal bipyramidal geometry. In this previously uncharacterized binding motif, O4 and F5 on consecutive FdU are axial ligands while three water molecules complete the coordination sphere. NMR spectroscopy confirmed Zn2+ complexation occurred with maintenance of base pairing while a slight hypsochromic shift in circular dichroism (CD) spectra indicated moderate structural distortion relative to B-form DNA. Zn2+ complexation inhibited ethidium bromide (EtBr) intercalation and stabilized FdU-substituted duplex DNA (ΔTm > 15°C). Mg2+ neither inhibited EtBr complexation nor had as strong of a stabilizing effect. DNA sequences that did not contain consecutive FdU were not stabilized by Zn2+. A lipofectamine preparation of the Zn2+–DNA complex displayed enhanced cytotoxicity toward prostate cancer cells relative to the individual components prepared as lipofectamine complexes indicating the potential utility of Zn2+–DNA complexes for cancer treatment. PMID:21296761

  14. Evidence for conformational capture mechanism for damage recognition by NER protein XPC/Rad4.

    NASA Astrophysics Data System (ADS)

    Chakraborty, Sagnik; Steinbach, Peter J.; Paul, Debamita; Min, Jung-Hyun; Ansari, Anjum

    Altered flexibility of damaged DNA sites is considered to play an important role in damage recognition by DNA repair proteins. Characterizing lesion-induced DNA dynamics has remained a challenge. We have combined ps-resolved fluorescence lifetime measurements with cytosine analog FRET pair uniquely sensitive to local unwinding/twisting to analyze DNA conformational distributions. This innovative approach maps out with unprecedented sensitivity the alternative conformations accessible to a series of DNA constructs containing 3-base-pair mismatch, suitable model lesions for the DNA repair protein xeroderma pigmentosum C (XPC) complex. XPC initiates eukaryotic nucleotide excision repair by recognizing various DNA lesions primarily through DNA deformability. Structural studies show that Rad4 (yeast ortholog of XPC) unwinds DNA at the lesion site and flips out two nucleotide pairs. Our results elucidate a broad range of conformations accessible to mismatched DNA even in the absence of the protein. Notably, the most severely distorted conformations share remarkable resemblance to the deformed conformation seen in the crystal structure of the Rad4-bound ``recognition'' complex supporting for the first time a possible ``conformational capture'' mechanism for damage recognition by XPC/Rad4. NSF Univ of Illinois-Chicago.

  15. Structure of an anti-HIV-1 hammerhead ribozyme complex with a 17-mer DNA substrate analog of HIV-1 gag RNA and a mechanism for the cleavage reaction: 750 MHz NMR and computer experiments

    NASA Technical Reports Server (NTRS)

    Ojha, R. P.; Dhingra, M. M.; Sarma, M. H.; Myer, Y. P.; Setlik, R. F.; Shibata, M.; Kazim, A. L.; Ornstein, R. L.; Rein, R.; Turner, C. J.; hide

    1997-01-01

    The structure of an anti-HIV-1 ribozyme-DNA abortive substrate complex was investigated by 750 MHz NMR and computer modeling experiments. The ribozyme was a chimeric molecule with 30 residues-18 DNA nucleotides, and 12 RNA residues in the conserved core. The DNA substrate analog had 17 residues. The chimeric ribozyme and the DNA substrate formed a shortened ribozyme-abortive substrate complex of 47 nucleotides with two DNA stems (stems I and III) and a loop consisting of the conserved core residues. Circular dichroism spectra showed that the DNA stems assume A-family conformation at the NMR concentration and a temperature of 15 degrees C, contrary to the conventional wisdom that DNA duplexes in aqueous solution populate entirely in the B-form. It is proposed that the A-family RNA residues at the core expand the A-family initiated at the core into the DNA stems because of the large free energy requirement for the formation of A/B junctions. Assignments of the base H8/H6 protons and H1' of the 47 residues were made by a NOESY walk. In addition to the methyl groups of all T's, the imino resonances of stems I and III and AH2's were assigned from appropriate NOESY walks. The extracted NMR data along with available crystallographic data, were used to derive a structural model of the complex. Stems I and III of the final model displayed a remarkable similarity to the A form of DNA; in stem III, a GC base pair was found to be moving into the floor of the minor groove defined by flanking AT pairs; data suggest the formation of a buckled rhombic structure with the adjacent pair; in addition, the base pair at the interface of stem III and the loop region displayed deformed geometry. The loop with the catalytic core, and the immediate region of the stems displayed conformational multiplicity within the NMR time scale. A catalytic mechanism for ribozyme action based on the derived structure, and consistent with biochemical data in the literature, is proposed. The complex between the anti HIV-1 gag ribozyme and its abortive DNA substrate manifests in the detection of a continuous track of A.T base pairs; this suggests that the interaction between the ribozyme and its DNA substrate is stronger than the one observed in the case of the free ribozyme where the bases in stem I and stem III regions interact strongly with the ribozyme core region (Sarma, R. H., et al. FEBS Letters 375, 317-23, 1995). The complex formation provides certain guidelines in the design of suitable therapeutic ribozymes. If the residues in the ribozyme stem regions interact with the conserved core, it may either prevent or interfere with the formation of a catalytically active tertiary structure.

  16. Capturing the radical ion-pair intermediate in DNA guanine oxidation

    PubMed Central

    Jie, Jialong; Liu, Kunhui; Wu, Lidan; Zhao, Hongmei; Song, Di; Su, Hongmei

    2017-01-01

    Although the radical ion pair has been frequently invoked as a key intermediate in DNA oxidative damage reactions and photoinduced electron transfer processes, the unambiguous detection and characterization of this species remain formidable and unresolved due to its extremely unstable nature and low concentration. We use the strategy that, at cryogenic temperatures, the transient species could be sufficiently stabilized to be detectable spectroscopically. By coupling the two techniques (the cryogenic stabilization and the time-resolved laser flash photolysis spectroscopy) together, we are able to capture the ion-pair transient G+•⋯Cl− in the chlorine radical–initiated DNA guanine (G) oxidation reaction, and provide direct evidence to ascertain the intricate type of addition/charge separation mechanism underlying guanine oxidation. The unique spectral signature of the radical ion-pair G+•⋯Cl− is identified, revealing a markedly intense absorption feature peaking at 570 nm that is distinctive from G+• alone. Moreover, the ion-pair spectrum is found to be highly sensitive to the protonation equilibria within guanine-cytosine base pair (G:C), which splits into two resolved bands at 480 and 610 nm as the acidic proton transfers along the central hydrogen bond from G+• to C. We thus use this exquisite sensitivity to track the intrabase-pair proton transfer dynamics in the double-stranded DNA oligonucleotides, which is of critical importance for the description of the proton-coupled charge transfer mechanisms in DNA. PMID:28630924

  17. Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory.

    PubMed

    Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-Ichi; Sugimoto, Naoki

    2015-12-02

    In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water-water interactions, (ii) ethylene glycol more effectively disrupted water-water interactions around Watson-Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson-Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Computational Approaches to Nucleic Acid Origami.

    PubMed

    Jabbari, Hosna; Aminpour, Maral; Montemagno, Carlo

    2015-10-12

    Recent advances in experimental DNA origami have dramatically expanded the horizon of DNA nanotechnology. Complex 3D suprastructures have been designed and developed using DNA origami with applications in biomaterial science, nanomedicine, nanorobotics, and molecular computation. Ribonucleic acid (RNA) origami has recently been realized as a new approach. Similar to DNA, RNA molecules can be designed to form complex 3D structures through complementary base pairings. RNA origami structures are, however, more compact and more thermodynamically stable due to RNA's non-canonical base pairing and tertiary interactions. With all these advantages, the development of RNA origami lags behind DNA origami by a large gap. Furthermore, although computational methods have proven to be effective in designing DNA and RNA origami structures and in their evaluation, advances in computational nucleic acid origami is even more limited. In this paper, we review major milestones in experimental and computational DNA and RNA origami and present current challenges in these fields. We believe collaboration between experimental nanotechnologists and computer scientists are critical for advancing these new research paradigms.

  19. A DNA methylation map of human cancer at single base-pair resolution.

    PubMed

    Vidal, E; Sayols, S; Moran, S; Guillaumet-Adkins, A; Schroeder, M P; Royo, R; Orozco, M; Gut, M; Gut, I; Lopez-Bigas, N; Heyn, H; Esteller, M

    2017-10-05

    Although single base-pair resolution DNA methylation landscapes for embryonic and different somatic cell types provided important insights into epigenetic dynamics and cell-type specificity, such comprehensive profiling is incomplete across human cancer types. This prompted us to perform genome-wide DNA methylation profiling of 22 samples derived from normal tissues and associated neoplasms, including primary tumors and cancer cell lines. Unlike their invariant normal counterparts, cancer samples exhibited highly variable CpG methylation levels in a large proportion of the genome, involving progressive changes during tumor evolution. The whole-genome sequencing results from selected samples were replicated in a large cohort of 1112 primary tumors of various cancer types using genome-scale DNA methylation analysis. Specifically, we determined DNA hypermethylation of promoters and enhancers regulating tumor-suppressor genes, with potential cancer-driving effects. DNA hypermethylation events showed evidence of positive selection, mutual exclusivity and tissue specificity, suggesting their active participation in neoplastic transformation. Our data highlight the extensive changes in DNA methylation that occur in cancer onset, progression and dissemination.

  20. Modeling DNA

    ERIC Educational Resources Information Center

    Robertson, Carol

    2016-01-01

    Deoxyribonucleic acid (DNA) is life's most amazing molecule. It carries the genetic instructions that almost every organism needs to develop and reproduce. In the human genome alone, there are some three billion DNA base pairs. The most difficult part of teaching DNA structure, however, may be getting students to visualize something as small as a…

  1. Use of Sequenom Sample ID Plus® SNP Genotyping in Identification of FFPE Tumor Samples

    PubMed Central

    Miller, Jessica K.; Buchner, Nicholas; Timms, Lee; Tam, Shirley; Luo, Xuemei; Brown, Andrew M. K.; Pasternack, Danielle; Bristow, Robert G.; Fraser, Michael; Boutros, Paul C.; McPherson, John D.

    2014-01-01

    Short tandem repeat (STR) analysis, such as the AmpFlSTR® Identifiler® Plus kit, is a standard, PCR-based human genotyping method used in the field of forensics. Misidentification of cell line and tissue DNA can be costly if not detected early; therefore it is necessary to have quality control measures such as STR profiling in place. A major issue in large-scale research studies involving archival formalin-fixed paraffin embedded (FFPE) tissues is that varying levels of DNA degradation can result in failure to correctly identify samples using STR genotyping. PCR amplification of STRs of several hundred base pairs is not always possible when DNA is degraded. The Sample ID Plus® panel from Sequenom allows for human DNA identification and authentication using SNP genotyping. In comparison to lengthy STR amplicons, this multiplexing PCR assay requires amplification of only 76–139 base pairs, and utilizes 47 SNPs to discriminate between individual samples. In this study, we evaluated both STR and SNP genotyping methods of sample identification, with a focus on paired FFPE tumor/normal DNA samples intended for next-generation sequencing (NGS). The ability to successfully validate the identity of FFPE samples can enable cost savings by reducing rework. PMID:24551080

  2. Use of Sequenom sample ID Plus® SNP genotyping in identification of FFPE tumor samples.

    PubMed

    Miller, Jessica K; Buchner, Nicholas; Timms, Lee; Tam, Shirley; Luo, Xuemei; Brown, Andrew M K; Pasternack, Danielle; Bristow, Robert G; Fraser, Michael; Boutros, Paul C; McPherson, John D

    2014-01-01

    Short tandem repeat (STR) analysis, such as the AmpFlSTR® Identifiler® Plus kit, is a standard, PCR-based human genotyping method used in the field of forensics. Misidentification of cell line and tissue DNA can be costly if not detected early; therefore it is necessary to have quality control measures such as STR profiling in place. A major issue in large-scale research studies involving archival formalin-fixed paraffin embedded (FFPE) tissues is that varying levels of DNA degradation can result in failure to correctly identify samples using STR genotyping. PCR amplification of STRs of several hundred base pairs is not always possible when DNA is degraded. The Sample ID Plus® panel from Sequenom allows for human DNA identification and authentication using SNP genotyping. In comparison to lengthy STR amplicons, this multiplexing PCR assay requires amplification of only 76-139 base pairs, and utilizes 47 SNPs to discriminate between individual samples. In this study, we evaluated both STR and SNP genotyping methods of sample identification, with a focus on paired FFPE tumor/normal DNA samples intended for next-generation sequencing (NGS). The ability to successfully validate the identity of FFPE samples can enable cost savings by reducing rework.

  3. Study of base pair mutations in proline-rich homeodomain (PRH)-DNA complexes using molecular dynamics.

    PubMed

    Jalili, Seifollah; Karami, Leila; Schofield, Jeremy

    2013-06-01

    Proline-rich homeodomain (PRH) is a regulatory protein controlling transcription and gene expression processes by binding to the specific sequence of DNA, especially to the sequence 5'-TAATNN-3'. The impact of base pair mutations on the binding between the PRH protein and DNA is investigated using molecular dynamics and free energy simulations to identify DNA sequences that form stable complexes with PRH. Three 20-ns molecular dynamics simulations (PRH-TAATTG, PRH-TAATTA and PRH-TAATGG complexes) in explicit solvent water were performed to investigate three complexes structurally. Structural analysis shows that the native TAATTG sequence forms a complex that is more stable than complexes with base pair mutations. It is also observed that upon mutation, the number and occupancy of the direct and water-mediated hydrogen bonds decrease. Free energy calculations performed with the thermodynamic integration method predict relative binding free energies of 0.64 and 2 kcal/mol for GC to AT and TA to GC mutations, respectively, suggesting that among the three DNA sequences, the PRH-TAATTG complex is more stable than the two mutated complexes. In addition, it is demonstrated that the stability of the PRH-TAATTA complex is greater than that of the PRH-TAATGG complex.

  4. Enhancing the response rate of strand displacement-based electrochemical aptamer sensors using bivalent binding aptamer-cDNA probes.

    PubMed

    Zhang, Ziping; Tao, Cancan; Yin, Jungang; Wang, Yunhui; Li, Yanshen

    2018-04-30

    Electrochemical aptamer (EA) sensors based on aptamer-cDNA duplex probes (cDNA: complementary DNA) and target induced strand displacement (TISD) recognition are sensitive, selective and capable of detecting a wide variety of target analytes. While substantial research efforts have focused on engineering of new signaling mechanisms for the improvement of sensor sensitivity, little attention was paid to the enhancement of sensor response rate. Typically, the previous TISD based EA sensors exhibited relatively long response times larger than 30min, which mainly resulted from the suboptimal aptamer-cDNA probe structure in which most of aptamer bases were paired to the cDNA bases. In an effort to improve the response rate of this type of sensors, we report here the rational engineering of a quickly responsive and sensitive aptamer-cDNA probe by employing the conception of bivalent interaction in supramolecular chemistry. We design a bivalent cDNA strand through linking two short monovalent cDNA sequences, and it is simultaneously hybridized to two electrode-immobilized aptamer probes to form a bivalent binding (BB) aptamer-cDNA probe. This class of BB probe possesses the advantages of less aptamer bases paired to the cDNA bases for quick response rate and good structural stability for high sensor sensitivity. By use of the rationally designed BB aptamer-cDNA probe, a TISD based EA sensor against ATP with significantly enhanced response rate (with a displacement equilibrium time of 4min) and high sensitivity was successfully constructed. We believe that our BB probe conception will help guide future designs and applications of TISD based EA sensors. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Optimization of single-base-pair mismatch discrimination in oligonucleotide microarrays

    NASA Technical Reports Server (NTRS)

    Urakawa, Hidetoshi; El Fantroussi, Said; Smidt, Hauke; Smoot, James C.; Tribou, Erik H.; Kelly, John J.; Noble, Peter A.; Stahl, David A.

    2003-01-01

    The discrimination between perfect-match and single-base-pair-mismatched nucleic acid duplexes was investigated by using oligonucleotide DNA microarrays and nonequilibrium dissociation rates (melting profiles). DNA and RNA versions of two synthetic targets corresponding to the 16S rRNA sequences of Staphylococcus epidermidis (38 nucleotides) and Nitrosomonas eutropha (39 nucleotides) were hybridized to perfect-match probes (18-mer and 19-mer) and to a set of probes having all possible single-base-pair mismatches. The melting profiles of all probe-target duplexes were determined in parallel by using an imposed temperature step gradient. We derived an optimum wash temperature for each probe and target by using a simple formula to calculate a discrimination index for each temperature of the step gradient. This optimum corresponded to the output of an independent analysis using a customized neural network program. These results together provide an experimental and analytical framework for optimizing mismatch discrimination among all probes on a DNA microarray.

  6. Unique active site promotes error-free replication opposite an 8-oxo-guanine lesion by human DNA polymerase iota

    PubMed Central

    Kirouac, Kevin N.; Ling, Hong

    2011-01-01

    The 8-oxo-guanine (8-oxo-G) lesion is the most abundant and mutagenic oxidative DNA damage existing in the genome. Due to its dual coding nature, 8-oxo-G causes most DNA polymerases to misincorporate adenine. Human Y-family DNA polymerase iota (polι) preferentially incorporates the correct cytosine nucleotide opposite 8-oxo-G. This unique specificity may contribute to polι’s biological role in cellular protection against oxidative stress. However, the structural basis of this preferential cytosine incorporation is currently unknown. Here we present four crystal structures of polι in complex with DNA containing an 8-oxo-G lesion, paired with correct dCTP or incorrect dATP, dGTP, and dTTP nucleotides. An exceptionally narrow polι active site restricts the purine bases in a syn conformation, which prevents the dual coding properties of 8-oxo-G by inhibiting syn/anti conformational equilibrium. More importantly, the 8-oxo-G base in a syn conformation is not mutagenic in polι because its Hoogsteen edge does not form a stable base pair with dATP in the narrow active site. Instead, the syn 8-oxo-G template base forms the most stable replicating base pair with correct dCTP due to its small pyrimidine base size and enhanced hydrogen bonding with the Hoogsteen edge of 8-oxo-G. In combination with site directed mutagenesis, we show that Gln59 in the finger domain specifically interacts with the additional O8 atom of the lesion base, which influences nucleotide selection, enzymatic efficiency, and replication stalling at the lesion site. Our work provides the structural mechanism of high-fidelity 8-oxo-G replication by a human DNA polymerase. PMID:21300901

  7. Acid-induced exchange of the imino proton in G.C pairs.

    PubMed Central

    Nonin, S; Leroy, J L; Gueron, M

    1996-01-01

    Acid-induced catalysis of imino proton exchange in G.C pairs of DNA duplexes is surprisingly fast, being nearly as fast as for the isolated nucleoside, despite base-pair dissociation constants in the range of 10(-5) at neutral or basic pH. It is also observed in terminal G.C pairs of duplexes and in base pairs of drug-DNA complexes. We have measured imino proton exchange in deoxyguanosine and in the duplex (ATATAGATCTATAT) as a function of pH. We show that acid-induced exchange can be assigned to proton transfer from N7-protonated guanosine to cytidine in the open state of the pair. This is faster than transfer from neutral guanosine (the process of intrinsic catalysis previously characterized at neutral ph) due to the lower imino proton pK of the protonated form, 7.2 instead of 9.4. Other interpretations are excluded by a study of exchange catalysis by formiate and cytidine as exchange catalysts. The cross-over pH between the regimes of pH-independent and acid-induced exchange rates is more basic in the case of base pairs than in the mononucleoside, suggestive of an increase by one to two decades in the dissociation constant of the base pair upon N7 protonation of G. Acid-induced catalysis is much weaker in A.T base pairs, as expected in view of the low pK for protonation of thymidine. PMID:8604298

  8. Acid-induced exchange of the imino proton in G.C pairs.

    PubMed

    Nonin, S; Leroy, J L; Gueron, M

    1996-02-15

    Acid-induced catalysis of imino proton exchange in G.C pairs of DNA duplexes is surprisingly fast, being nearly as fast as for the isolated nucleoside, despite base-pair dissociation constants in the range of 10(-5) at neutral or basic pH. It is also observed in terminal G.C pairs of duplexes and in base pairs of drug-DNA complexes. We have measured imino proton exchange in deoxyguanosine and in the duplex (ATATAGATCTATAT) as a function of pH. We show that acid-induced exchange can be assigned to proton transfer from N7-protonated guanosine to cytidine in the open state of the pair. This is faster than transfer from neutral guanosine (the process of intrinsic catalysis previously characterized at neutral ph) due to the lower imino proton pK of the protonated form, 7.2 instead of 9.4. Other interpretations are excluded by a study of exchange catalysis by formiate and cytidine as exchange catalysts. The cross-over pH between the regimes of pH-independent and acid-induced exchange rates is more basic in the case of base pairs than in the mononucleoside, suggestive of an increase by one to two decades in the dissociation constant of the base pair upon N7 protonation of G. Acid-induced catalysis is much weaker in A.T base pairs, as expected in view of the low pK for protonation of thymidine.

  9. Specificity and Catalytic Mechanism in Family 5 Uracil DNA Glycosylase*

    PubMed Central

    Xia, Bo; Liu, Yinling; Li, Wei; Brice, Allyn R.; Dominy, Brian N.; Cao, Weiguo

    2014-01-01

    UDGb belongs to family 5 of the uracil DNA glycosylase (UDG) superfamily. Here, we report that family 5 UDGb from Thermus thermophilus HB8 is not only a uracil DNA glycosyase acting on G/U, T/U, C/U, and A/U base pairs, but also a hypoxanthine DNA glycosylase acting on G/I, T/I, and A/I base pairs and a xanthine DNA glycosylase acting on all double-stranded and single-stranded xanthine-containing DNA. Analysis of potentials of mean force indicates that the tendency of hypoxanthine base flipping follows the order of G/I > T/I, A/I > C/I, matching the trend of hypoxanthine DNA glycosylase activity observed in vitro. Genetic analysis indicates that family 5 UDGb can also act as an enzyme to remove uracil incorporated into DNA through the existence of dUTP in the nucleotide pool. Mutational analysis coupled with molecular modeling and molecular dynamics analysis reveals that although hydrogen bonding to O2 of uracil underlies the UDG activity in a dissociative fashion, Tth UDGb relies on multiple catalytic residues to facilitate its excision of hypoxanthine and xanthine. This study underscores the structural and functional diversity in the UDG superfamily. PMID:24838246

  10. 3DNALandscapes: a database for exploring the conformational features of DNA.

    PubMed

    Zheng, Guohui; Colasanti, Andrew V; Lu, Xiang-Jun; Olson, Wilma K

    2010-01-01

    3DNALandscapes, located at: http://3DNAscapes.rutgers.edu, is a new database for exploring the conformational features of DNA. In contrast to most structural databases, which archive the Cartesian coordinates and/or derived parameters and images for individual structures, 3DNALandscapes enables searches of conformational information across multiple structures. The database contains a wide variety of structural parameters and molecular images, computed with the 3DNA software package and known to be useful for characterizing and understanding the sequence-dependent spatial arrangements of the DNA sugar-phosphate backbone, sugar-base side groups, base pairs, base-pair steps, groove structure, etc. The data comprise all DNA-containing structures--both free and bound to proteins, drugs and other ligands--currently available in the Protein Data Bank. The web interface allows the user to link, report, plot and analyze this information from numerous perspectives and thereby gain insight into DNA conformation, deformability and interactions in different sequence and structural contexts. The data accumulated from known, well-resolved DNA structures can serve as useful benchmarks for the analysis and simulation of new structures. The collective data can also help to understand how DNA deforms in response to proteins and other molecules and undergoes conformational rearrangements.

  11. Basis of Miscoding of the DNA Adduct N2,3-Ethenoguanine by Human Y-family DNA Polymerases*

    PubMed Central

    Zhao, Linlin; Pence, Matthew G.; Christov, Plamen P.; Wawrzak, Zdzislaw; Choi, Jeong-Yun; Rizzo, Carmelo J.; Egli, Martin; Guengerich, F. Peter

    2012-01-01

    N2,3-Ethenoguanine (N2,3-ϵG) is one of the exocyclic DNA adducts produced by endogenous processes (e.g. lipid peroxidation) and exposure to bioactivated vinyl monomers such as vinyl chloride, which is a known human carcinogen. Existing studies exploring the miscoding potential of this lesion are quite indirect because of the lability of the glycosidic bond. We utilized a 2′-fluoro isostere approach to stabilize this lesion and synthesized oligonucleotides containing 2′-fluoro-N2,3-ϵ-2′-deoxyarabinoguanosine to investigate the miscoding potential of N2,3-ϵG by Y-family human DNA polymerases (pols). In primer extension assays, pol η and pol κ replicated through N2,3-ϵG, whereas pol ι and REV1 yielded only 1-base incorporation. Steady-state kinetics revealed that dCTP incorporation is preferred opposite N2,3-ϵG with relative efficiencies in the order of pol κ > REV1 > pol η ≈ pol ι, and dTTP misincorporation is the major miscoding event by all four Y-family human DNA pols. Pol ι had the highest dTTP misincorporation frequency (0.71) followed by pol η (0.63). REV1 misincorporated dTTP and dGTP with much lower frequencies. Crystal structures of pol ι with N2,3-ϵG paired to dCTP and dTTP revealed Hoogsteen-like base pairing mechanisms. Two hydrogen bonds were observed in the N2,3-ϵG:dCTP base pair, whereas only one appears to be present in the case of the N2,3-ϵG:dTTP pair. Base pairing mechanisms derived from the crystal structures explain the slightly favored dCTP insertion for pol ι in steady-state kinetic analysis. Taken together, these results provide a basis for the mutagenic potential of N2,3-ϵG. PMID:22910910

  12. Conformations of stereoisomeric base adducts to 4-hydroxyequilenin.

    PubMed

    Ding, Shuang; Shapiro, Robert; Geacintov, Nicholas E; Broyde, Suse

    2003-06-01

    Exposure to estrogen through estrogen replacement therapy increases the risk of women developing cancer in hormone sensitive tissues. Premarin (Wyeth), which has been the most frequent choice for estrogen replacement therapy in the United States, contains the equine estrogens equilin and equilenin as major components. 4-Hydroxyequilenin (4-OHEN) is a phase I metabolite of both of these substances. This catechol estrogen autoxidizes to potent cytotoxic quinoids that can react with dG, dA, and dC to form unusual stereoisomeric cyclic adducts (Bolton, J. L., et al. (1998) Chem. Res. Toxicol. 11, 1113-1127). Like other bulky DNA adducts, these lesions may exhibit different susceptibilities to DNA repair and mutagenic potential, if not repaired in a structure-dependent manner. To ultimately gain insights into structure-function relationships, we computed conformations of stereoisomeric guanine, adenine, and cytosine base adducts using density functional theory. We find near mirror image conformations in stereoisomer adduct pairs for each modified base, suggesting opposite orientations with respect to the 5' --> 3' direction of the modified strand when the stereoisomer pairs are incorporated into duplex DNA. Such opposite orientations could cause stereoisomer pairs of lesions to respond differently to DNA replication and repair enzymes.

  13. DNA hybridization kinetics: zippering, internal displacement and sequence dependence.

    PubMed

    Ouldridge, Thomas E; Sulc, Petr; Romano, Flavio; Doye, Jonathan P K; Louis, Ard A

    2013-10-01

    Although the thermodynamics of DNA hybridization is generally well established, the kinetics of this classic transition is less well understood. Providing such understanding has new urgency because DNA nanotechnology often depends critically on binding rates. Here, we explore DNA oligomer hybridization kinetics using a coarse-grained model. Strand association proceeds through a complex set of intermediate states, with successful binding events initiated by a few metastable base-pairing interactions, followed by zippering of the remaining bonds. But despite reasonably strong interstrand interactions, initial contacts frequently dissociate because typical configurations in which they form differ from typical states of similar enthalpy in the double-stranded equilibrium ensemble. Initial contacts must be stabilized by two or three base pairs before full zippering is likely, resulting in negative effective activation enthalpies. Non-Arrhenius behavior arises because the number of base pairs required for nucleation increases with temperature. In addition, we observe two alternative pathways-pseudoknot and inchworm internal displacement-through which misaligned duplexes can rearrange to form duplexes. These pathways accelerate hybridization. Our results explain why experimentally observed association rates of GC-rich oligomers are higher than rates of AT- rich equivalents, and more generally demonstrate how association rates can be modulated by sequence choice.

  14. Base-Pairing Energies of Proton-Bound Dimers and Proton Affinities of 1-Methyl-5-Halocytosines: Implications for the Effects of Halogenation on the Stability of the DNA i-Motif

    NASA Astrophysics Data System (ADS)

    Yang, Bo; Wu, R. R.; Rodgers, M. T.

    2015-09-01

    (CCG)n•(CGG)n trinucleotide repeats have been found to be associated with fragile X syndrome, the most widespread inherited cause of mental retardation in humans. The (CCG)n•(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of noncanonical proton-bound dimers of cytosine (C+•C). Halogenated cytosine residues are one form of DNA damage that may be important in altering the structure and stability of DNA or DNA-protein interactions and, hence, regulate gene expression. Previously, we investigated the effects of 5-halogenation and 1-methylation of cytosine on the base-pairing energies (BPEs) using threshold collision-induced dissociation (TCID) techniques. In the present study, we extend our work to include proton-bound homo- and heterodimers of cytosine, 1-methyl-5-fluorocytosine, and 1-methyl-5-bromocytosine. All modifications examined here are found to produce a decrease in the BPEs. However, the BPEs of all of the proton-bound dimers examined significantly exceed those of Watson-Crick G•C, neutral C•C base pairs, and various methylated variants such that DNA i-motif conformations should still be preserved in the presence of these modifications. The proton affinities (PAs) of the halogenated cytosines are also obtained from the experimental data by competitive analysis of the primary dissociation pathways that occur in parallel for the proton-bound heterodimers. 5-Halogenation leads to a decrease in the N3 PA of cytosine, whereas 1-methylation leads to an increase in the N3 PA. Thus, the 1-methyl-5-halocytosines exhibit PAs that are intermediate.

  15. Structure, stability and behaviour of nucleic acids in ionic liquids

    PubMed Central

    Tateishi-Karimata, Hisae; Sugimoto, Naoki

    2014-01-01

    Nucleic acids have become a powerful tool in nanotechnology because of their conformational polymorphism. However, lack of a medium in which nucleic acid structures exhibit long-term stability has been a bottleneck. Ionic liquids (ILs) are potential solvents in the nanotechnology field. Hydrated ILs, such as choline dihydrogen phosphate (choline dhp) and deep eutectic solvent (DES) prepared from choline chloride and urea, are ‘green’ solvents that ensure long-term stability of biomolecules. An understanding of the behaviour of nucleic acids in hydrated ILs is necessary for developing DNA materials. We here review current knowledge about the structures and stabilities of nucleic acids in choline dhp and DES. Interestingly, in choline dhp, A–T base pairs are more stable than G–C base pairs, the reverse of the situation in buffered NaCl solution. Moreover, DNA triplex formation is markedly stabilized in hydrated ILs compared with aqueous solution. In choline dhp, the stability of Hoogsteen base pairs is comparable to that of Watson–Crick base pairs. Moreover, the parallel form of the G-quadruplex is stabilized in DES compared with aqueous solution. The behaviours of various DNA molecules in ILs detailed here should be useful for designing oligonucleotides for the development of nanomaterials and nanodevices. PMID:25013178

  16. Crystal structure of a four-stranded intercalated DNA: d(C4)

    NASA Technical Reports Server (NTRS)

    Chen, L.; Cai, L.; Zhang, X.; Rich, A.

    1994-01-01

    The crystal structure of d(C4) solved at 2.3-A resolution reveals a four-stranded molecule composed of two interdigitated or intercalated duplexes. The duplexes are held together by hemiprotonated cytosine-cytosine base pairs and are parallel stranded, but the two duplexes point in opposite directions. The molecule has a slow right-handed twist of 12.4 degrees between covalently linked cytosine base pairs, and the base stacking distance is 3.1 A. This is in general agreement with the NMR studies. A biological role for DNA in this conformation is suggested.

  17. A Thiazole Coumarin (TC) Turn-On Fluorescence Probe for AT-Base Pair Detection and Multipurpose Applications in Different Biological Systems

    NASA Astrophysics Data System (ADS)

    Narayanaswamy, Nagarjun; Kumar, Manoj; Das, Sadhan; Sharma, Rahul; Samanta, Pralok K.; Pati, Swapan K.; Dhar, Suman K.; Kundu, Tapas K.; Govindaraju, T.

    2014-09-01

    Sequence-specific recognition of DNA by small turn-on fluorescence probes is a promising tool for bioimaging, bioanalytical and biomedical applications. Here, the authors report a novel cell-permeable and red fluorescent hemicyanine-based thiazole coumarin (TC) probe for DNA recognition, nuclear staining and cell cycle analysis. TC exhibited strong fluorescence enhancement in the presence of DNA containing AT-base pairs, but did not fluoresce with GC sequences, single-stranded DNA, RNA and proteins. The fluorescence staining of HeLa S3 and HEK 293 cells by TC followed by DNase and RNase digestion studies depicted the selective staining of DNA in the nucleus over the cytoplasmic region. Fluorescence-activated cell sorting (FACS) analysis by flow cytometry demonstrated the potential application of TC in cell cycle analysis in HEK 293 cells. Metaphase chromosome and malaria parasite DNA imaging studies further confirmed the in vivo diagnostic and therapeutic applications of probe TC. Probe TC may find multiple applications in fluorescence spectroscopy, diagnostics, bioimaging and molecular and cell biology.

  18. Monte Carlo approach in assessing damage in higher order structures of DNA

    NASA Technical Reports Server (NTRS)

    Chatterjee, A.; Schmidt, J. B.; Holley, W. R.

    1994-01-01

    We have developed a computer monitor of nuclear DNA in the form of chromatin fibre. The fibres are modeled as a ideal solenoid consisting of twenty helical turns with six nucleosomes per turn. The chromatin model, in combination with are Monte Carlo theory of radiation damage induces by charged particles, based on general features of tack structure and stopping power theory, has been used to evaluate the influence of DNA structure on initial damage. An interesting has emerged from our calculations. Our calculated results predict the existence of strong spatial correlations in damage sites associated with the symmetries in the solenoidal model. We have calculated spectra of short fragments of double stranded DNA produced by multiple double strand breaks induced by both high and low LET radiation. The spectra exhibit peaks at multiples of approximately 85 base pairs (the nucleosome periodicity), and approximately 1000 base pairs (solenoid periodicity). Preliminary experiments to investigate the fragment distributions from irradiated DNA, made by B. Rydberg at Lawrence Berkeley Laboratory, confirm the existence of short DNA fragments and are in substantial agreement with the predictions of our theory.

  19. A Thiazole Coumarin (TC) Turn-On Fluorescence Probe for AT-Base Pair Detection and Multipurpose Applications in Different Biological Systems

    PubMed Central

    Narayanaswamy, Nagarjun; Kumar, Manoj; Das, Sadhan; Sharma, Rahul; Samanta, Pralok K.; Pati, Swapan K.; Dhar, Suman K.; Kundu, Tapas K.; Govindaraju, T.

    2014-01-01

    Sequence-specific recognition of DNA by small turn-on fluorescence probes is a promising tool for bioimaging, bioanalytical and biomedical applications. Here, the authors report a novel cell-permeable and red fluorescent hemicyanine-based thiazole coumarin (TC) probe for DNA recognition, nuclear staining and cell cycle analysis. TC exhibited strong fluorescence enhancement in the presence of DNA containing AT-base pairs, but did not fluoresce with GC sequences, single-stranded DNA, RNA and proteins. The fluorescence staining of HeLa S3 and HEK 293 cells by TC followed by DNase and RNase digestion studies depicted the selective staining of DNA in the nucleus over the cytoplasmic region. Fluorescence-activated cell sorting (FACS) analysis by flow cytometry demonstrated the potential application of TC in cell cycle analysis in HEK 293 cells. Metaphase chromosome and malaria parasite DNA imaging studies further confirmed the in vivo diagnostic and therapeutic applications of probe TC. Probe TC may find multiple applications in fluorescence spectroscopy, diagnostics, bioimaging and molecular and cell biology. PMID:25252596

  20. Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

    PubMed

    Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

    2009-03-18

    It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

  1. ATP hydrolysis provides functions that promote rejection of pairings between different copies of long repeated sequences

    PubMed Central

    Danilowicz, Claudia; Hermans, Laura; Coljee, Vincent; Prévost, Chantal

    2017-01-01

    Abstract During DNA recombination and repair, RecA family proteins must promote rapid joining of homologous DNA. Repeated sequences with >100 base pair lengths occupy more than 1% of bacterial genomes; however, commitment to strand exchange was believed to occur after testing ∼20–30 bp. If that were true, pairings between different copies of long repeated sequences would usually become irreversible. Our experiments reveal that in the presence of ATP hydrolysis even 75 bp sequence-matched strand exchange products remain quite reversible. Experiments also indicate that when ATP hydrolysis is present, flanking heterologous dsDNA regions increase the reversibility of sequence matched strand exchange products with lengths up to ∼75 bp. Results of molecular dynamics simulations provide insight into how ATP hydrolysis destabilizes strand exchange products. These results inspired a model that shows how pairings between long repeated sequences could be efficiently rejected even though most homologous pairings form irreversible products. PMID:28854739

  2. Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

    PubMed

    Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

    2010-10-14

    Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which implies that the anti orientation of the damaged base will be favored by hydrogen bonding in DNA helices. Additionally, regardless of the hydrogen-bonding face involved, cytosine forms the most stable base pair with the ortho adduct, which implies that misincorporation due to this type of damage is unlikely. Similarly, cytosine is the preferred binding partner for the Watson-Crick face of the para adduct. However, Hoogsteen interactions with the para adduct are stronger than those with natural 2'-deoxyguanosine or the ortho adduct, and this form of damage binds with nearly equal stability to both cytosine and guanine in the Hoogsteen orientation. Therefore, the para adduct may adopt multiple orientations in DNA helices and potentially cause mutations by forming pairs with different natural bases. Models of oligonucleotide duplexes must be used in future work to further evaluate other factors (stacking, major groove contacts) that may influence the conformation and binding preference of these adducts in DNA helices.

  3. In-stem labelling allows visualization of DNA strand displacements by distinct fluorescent colour change.

    PubMed

    Barrois, Sebastian; Wagenknecht, Hans-Achim

    2013-05-21

    The combination of thiazole orange (TO) and thiazole red (TR) as an internal pair of fluorescent DNA base surrogates ("DNA traffic lights") allows us to follow at least two consecutive DNA strand displacements in real time through a distinct fluorescence colour change from green to red and vice versa.

  4. Nanopore Analysis of the 5-Guanidinohydantoin to Iminoallantoin Isomerization in Duplex DNA.

    PubMed

    Zeng, Tao; Fleming, Aaron M; Ding, Yun; Ren, Hang; White, Henry S; Burrows, Cynthia J

    2018-04-06

    In DNA, guanine oxidation yields diastereomers of 5-guanidinohydantoin (Gh) as one of the major products. In nucleosides and single-stranded DNA, Gh is in a pH-dependent equilibrium with its constitutional isomer iminoallantoin (Ia). Herein, the isomerization reaction between Gh and Ia was monitored in duplex DNA using a protein nanopore by measuring the ionic current when duplex DNA interacts with the pore under an electrophoretic force. Monitoring current levels in this single-molecule method proved to be superior for analysis of population distributions in an equilibrating mixture of four isomers in duplex DNA as a function of pH. The results identified Gh as a major isomer observed when base paired with A, C, or G at pH 6.4-8.4, and Ia was a minor isomer of the reaction mixture that was only observed when the pH was >7.4 in the duplex DNA context. The present results suggest that Gh will be the dominant isomer in duplex DNA under physiological conditions regardless of the base-pairing partner in the duplex.

  5. Compositions and methods for detecting single nucleotide polymorphisms

    DOEpatents

    Yeh, Hsin-Chih; Werner, James; Martinez, Jennifer S.

    2016-11-22

    Described herein are nucleic acid based probes and methods for discriminating and detecting single nucleotide variants in nucleic acid molecules (e.g., DNA). The methods include use of a pair of probes can be used to detect and identify polymorphisms, for example single nucleotide polymorphism in DNA. The pair of probes emit a different fluorescent wavelength of light depending on the association and alignment of the probes when hybridized to a target nucleic acid molecule. Each pair of probes is capable of discriminating at least two different nucleic acid molecules that differ by at least a single nucleotide difference. The methods can probes can be used, for example, for detection of DNA polymorphisms that are indicative of a particular disease or condition.

  6. ESR1 Methylation: A Liquid Biopsy-Based Epigenetic Assay for the Follow-up of Patients with Metastatic Breast Cancer Receiving Endocrine Treatment.

    PubMed

    Mastoraki, Sophia; Strati, Areti; Tzanikou, Eleni; Chimonidou, Maria; Politaki, Eleni; Voutsina, Alexandra; Psyrri, Amanda; Georgoulias, Vassilis; Lianidou, Evi

    2018-03-15

    Purpose: Liquid biopsy provides real-time monitoring of tumor evolution and response to therapy through analysis of circulating tumor cells (CTCs) and plasma-circulating tumor DNA (ctDNA). ESR1 epigenetic silencing potentially affects response to endocrine treatment. We evaluated ESR1 methylation in CTCs and paired plasma ctDNA. We evaluated ESR1 methylation in CTCs and paired plasma ctDNA as a potential biomarker for response to everolimus/exemestane treatment. Experimental Design: A highly sensitive and specific real-time MSP assay for ESR1 methylation was developed and validated in (i) 65 primary breast tumors formalin-fixed paraffin-embedded (FFPE), (ii) EpCAM + CTC fractions (122 patients and 30 healthy donors; HD), (iii) plasma ctDNA (108 patients and 30HD), and (iv) in CTCs (CellSearch) and in paired plasma ctDNA for 58 patients with breast cancer. ESR1 methylation status was investigated in CTCs isolated from serial peripheral blood samples of 19 patients with ER + /HER2 - advanced breast cancer receiving everolimus/exemestane. Results: ESR1 methylation was detected in: (i) 25/65 (38.5%) FFPEs, (ii) EpCAM + CTC fractions : 26/112 (23.3%) patients and 1/30 (3.3%) HD, and (iii) plasma ctDNA: 8/108 (7.4%) patients and 1/30 (3.3%) HD. ESR1 methylation was highly concordant in 58 paired DNA samples, isolated from CTCs (CellSearch) and corresponding plasma. In serial peripheral blood samples of patients treated with everolimus/exemestane, ESR1 methylation was observed in 10/36 (27.8%) CTC-positive samples, and was associated with lack of response to treatment ( P = 0.023, Fisher exact test). Conclusions: We report for the first time the detection of ESR1 methylation in CTCs and a high concordance with paired plasma ctDNA. ESR1 methylation in CTCs was associated with lack of response to everolimus/exemestane regimen. ESR1 methylation should be further evaluated as a potential liquid biopsy-based biomarker. Clin Cancer Res; 24(6); 1500-10. ©2017 AACR . ©2017 American Association for Cancer Research.

  7. Enantiospecific recognition of DNA sequences by a proflavine Tröger base.

    PubMed

    Bailly, C; Laine, W; Demeunynck, M; Lhomme, J

    2000-07-05

    The DNA interaction of a chiral Tröger base derived from proflavine was investigated by DNA melting temperature measurements and complementary biochemical assays. DNase I footprinting experiments demonstrate that the binding of the proflavine-based Tröger base is both enantio- and sequence-specific. The (+)-isomer poorly interacts with DNA in a non-sequence-selective fashion. In sharp contrast, the corresponding (-)-isomer recognizes preferentially certain DNA sequences containing both A. T and G. C base pairs, such as the motifs 5'-GTT. AAC and 5'-ATGA. TCAT. This is the first experimental demonstration that acridine-type Tröger bases can be used for enantiospecific recognition of DNA sequences. Copyright 2000 Academic Press.

  8. Enzymatic Incorporation of Modified Purine Nucleotides in DNA.

    PubMed

    Abu El Asrar, Rania; Margamuljana, Lia; Abramov, Mikhail; Bande, Omprakash; Agnello, Stefano; Jang, Miyeon; Herdewijn, Piet

    2017-12-14

    A series of nucleotide analogues, with a hypoxanthine base moiety (8-aminohypoxanthine, 1-methyl-8-aminohypoxanthine, and 8-oxohypoxanthine), together with 5-methylisocytosine were tested as potential pairing partners of N 8 -glycosylated nucleotides with an 8-azaguanine or 8-aza-9-deazaguanine base moiety by using DNA polymerases (incorporation studies). The best results were obtained with the 5-methylisocytosine nucleotide followed by the 1-methyl-8-aminohypoxanthine nucleotide. The experiments demonstrated that small differences in the structure (8-azaguanine versus 8-aza-9-deazaguanine) might lead to significant differences in recognition efficiency and selectivity, base pairing by Hoogsteen recognition at the polymerase level is possible, 8-aza-9-deazaguanine represents a self-complementary base pair, and a correlation exists between in vitro incorporation studies and in vivo recognition by natural bases in Escherichia coli, but this recognition is not absolute (exceptions were observed). © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

    NASA Astrophysics Data System (ADS)

    Risqi, A. M.; Yudiarsah, E.

    2017-07-01

    Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

  10. DNA barcoding Indian freshwater fishes.

    PubMed

    Lakra, Wazir Singh; Singh, M; Goswami, Mukunda; Gopalakrishnan, A; Lal, K K; Mohindra, V; Sarkar, U K; Punia, P P; Singh, K V; Bhatt, J P; Ayyappan, S

    2016-11-01

    DNA barcoding is a promising technique for species identification using a short mitochondrial DNA sequence of cytochrome c oxidase I (COI) gene. In the present study, DNA barcodes were generated from 72 species of freshwater fish covering the Orders Cypriniformes, Siluriformes, Perciformes, Synbranchiformes, and Osteoglossiformes representing 50 genera and 19 families. All the samples were collected from diverse sites except the species endemic to a particular location. Species were represented by multiple specimens in the great majority of the barcoded species. A total of 284 COI sequences were generated. After amplification and sequencing of 700 base pair fragment of COI, primers were trimmed which invariably generated a 655 base pair barcode sequence. The average Kimura two-parameter (K2P) distances within-species, genera, families, and orders were 0.40%, 9.60%, 13.10%, and 17.16%, respectively. DNA barcode discriminated congeneric species without any confusion. The study strongly validated the efficiency of COI as an ideal marker for DNA barcoding of Indian freshwater fishes.

  11. Size-based molecular diagnostics using plasma DNA for noninvasive prenatal testing.

    PubMed

    Yu, Stephanie C Y; Chan, K C Allen; Zheng, Yama W L; Jiang, Peiyong; Liao, Gary J W; Sun, Hao; Akolekar, Ranjit; Leung, Tak Y; Go, Attie T J I; van Vugt, John M G; Minekawa, Ryoko; Oudejans, Cees B M; Nicolaides, Kypros H; Chiu, Rossa W K; Lo, Y M Dennis

    2014-06-10

    Noninvasive prenatal testing using fetal DNA in maternal plasma is an actively researched area. The current generation of tests using massively parallel sequencing is based on counting plasma DNA sequences originating from different genomic regions. In this study, we explored a different approach that is based on the use of DNA fragment size as a diagnostic parameter. This approach is dependent on the fact that circulating fetal DNA molecules are generally shorter than the corresponding maternal DNA molecules. First, we performed plasma DNA size analysis using paired-end massively parallel sequencing and microchip-based capillary electrophoresis. We demonstrated that the fetal DNA fraction in maternal plasma could be deduced from the overall size distribution of maternal plasma DNA. The fetal DNA fraction is a critical parameter affecting the accuracy of noninvasive prenatal testing using maternal plasma DNA. Second, we showed that fetal chromosomal aneuploidy could be detected by observing an aberrant proportion of short fragments from an aneuploid chromosome in the paired-end sequencing data. Using this approach, we detected fetal trisomy 21 and trisomy 18 with 100% sensitivity (T21: 36/36; T18: 27/27) and 100% specificity (non-T21: 88/88; non-T18: 97/97). For trisomy 13, the sensitivity and specificity were 95.2% (20/21) and 99% (102/103), respectively. For monosomy X, the sensitivity and specificity were both 100% (10/10 and 8/8). Thus, this study establishes the principle of size-based molecular diagnostics using plasma DNA. This approach has potential applications beyond noninvasive prenatal testing to areas such as oncology and transplantation monitoring.

  12. Size-based molecular diagnostics using plasma DNA for noninvasive prenatal testing

    PubMed Central

    Yu, Stephanie C. Y.; Chan, K. C. Allen; Zheng, Yama W. L.; Jiang, Peiyong; Liao, Gary J. W.; Sun, Hao; Akolekar, Ranjit; Leung, Tak Y.; Go, Attie T. J. I.; van Vugt, John M. G.; Minekawa, Ryoko; Oudejans, Cees B. M.; Nicolaides, Kypros H.; Chiu, Rossa W. K.; Lo, Y. M. Dennis

    2014-01-01

    Noninvasive prenatal testing using fetal DNA in maternal plasma is an actively researched area. The current generation of tests using massively parallel sequencing is based on counting plasma DNA sequences originating from different genomic regions. In this study, we explored a different approach that is based on the use of DNA fragment size as a diagnostic parameter. This approach is dependent on the fact that circulating fetal DNA molecules are generally shorter than the corresponding maternal DNA molecules. First, we performed plasma DNA size analysis using paired-end massively parallel sequencing and microchip-based capillary electrophoresis. We demonstrated that the fetal DNA fraction in maternal plasma could be deduced from the overall size distribution of maternal plasma DNA. The fetal DNA fraction is a critical parameter affecting the accuracy of noninvasive prenatal testing using maternal plasma DNA. Second, we showed that fetal chromosomal aneuploidy could be detected by observing an aberrant proportion of short fragments from an aneuploid chromosome in the paired-end sequencing data. Using this approach, we detected fetal trisomy 21 and trisomy 18 with 100% sensitivity (T21: 36/36; T18: 27/27) and 100% specificity (non-T21: 88/88; non-T18: 97/97). For trisomy 13, the sensitivity and specificity were 95.2% (20/21) and 99% (102/103), respectively. For monosomy X, the sensitivity and specificity were both 100% (10/10 and 8/8). Thus, this study establishes the principle of size-based molecular diagnostics using plasma DNA. This approach has potential applications beyond noninvasive prenatal testing to areas such as oncology and transplantation monitoring. PMID:24843150

  13. Fluorescence of size-expanded DNA bases: reporting on DNA sequence and structure with an unnatural genetic set.

    PubMed

    Krueger, Andrew T; Kool, Eric T

    2008-03-26

    We recently described the synthesis and helix assembly properties of expanded DNA (xDNA), which contains base pairs 2.4 A larger than natural DNA pairs. This designed genetic set is under study with the goals of mimicking the functions of the natural DNA-based genetic system and of developing useful research tools. Here, we study the fluorescence properties of the four expanded bases of xDNA (xA, xC, xG, xT) and evaluate how their emission varies with changes in oligomer length, composition, and hybridization. Experiments were carried out with short oligomers of xDNA nucleosides conjugated to a DNA oligonucleotide, and we investigated the effects of hybridizing these fluorescent oligomers to short complementary DNAs with varied bases opposite the xDNA bases. As monomer nucleosides, the xDNA bases absorb light in two bands: one at approximately 260 nm (similar to DNA) and one at longer wavelength ( approximately 330 nm). All are efficient violet-blue fluorophores with emission maxima at approximately 380-410 nm and quantum yields (Phifl) of 0.30-0.52. Short homo-oligomers of the xDNA bases (length 1-4 monomers) showed moderate self-quenching except xC, which showed enhancement of Phifl with increasing length. Interestingly, multimers of xA emitted at longer wavelengths (520 nm) as an apparent excimer. Hybridization of an oligonucleotide to the DNA adjacent to the xDNA bases (with the xDNA portion overhanging) resulted in no change in fluorescence. However, addition of one, two, or more DNA bases in these duplexes opposite the xDNA portion resulted in a number of significant fluorescence responses, including wavelength shifts, enhancements, or quenching. The strongest responses were the enhancement of (xG)n emission by hybridization of one or more adenines opposite them, and the quenching of (xT)n and (xC)n emission by guanines opposite. The data suggest multiple ways in which the xDNA bases, both alone and in oligomers, may be useful as tools in biophysical analysis and biotechnological applications.

  14. Physical mapping of the 5S and 18S rDNA in ten species of Hypostomus Lacépède 1803 (Siluriformes: Loricariidae): evolutionary tendencies in the genus.

    PubMed

    Bueno, Vanessa; Venere, Paulo César; Thums Konerat, Jocicléia; Zawadzki, Cláudio Henrique; Vicari, Marcelo Ricardo; Margarido, Vladimir Pavan

    2014-01-01

    Hypostomus is a diverse group with unclear aspects regarding its biology, including the mechanisms that led to chromosome diversification within the group. Fluorescence in situ hybridization (FISH) with 5S and 18S rDNA probes was performed on ten Hypostomini species. Hypostomus faveolus, H. cochliodon, H. albopunctatus, H. aff. paulinus, and H. topavae had only one chromosome pair with 18S rDNA sites, while H. ancistroides, H. commersoni, H. hermanni, H. regani, and H. strigaticeps had multiple 18S rDNA sites. Regarding the 5S rDNA genes, H. ancistroides, H. regani, H. albopunctatus, H. aff. paulinus, and H. topavae had 5S rDNA sites on only one chromosome pair and H. faveolus, H. cochliodon, H. commersoni, H. hermanni, and H. strigaticeps had multiple 5S rDNA sites. Most species had 18S rDNA sites in the telomeric region of the chromosomes. All species but H. cochliodon had 5S rDNA in the centromeric/pericentromeric region of one metacentric pair. Obtained results are discussed based on existent phylogenies for the genus, with comments on possible dispersion mechanisms to justify the variability of the rDNA sites in Hypostomus.

  15. Force regulated dynamics of RPA on a DNA fork

    PubMed Central

    Kemmerich, Felix E.; Daldrop, Peter; Pinto, Cosimo; Levikova, Maryna; Cejka, Petr; Seidel, Ralf

    2016-01-01

    Replication protein A (RPA) is a single-stranded DNA binding protein, involved in most aspects of eukaryotic DNA metabolism. Here, we study the behavior of RPA on a DNA substrate that mimics a replication fork. Using magnetic tweezers we show that both yeast and human RPA can open forked DNA when sufficient external tension is applied. In contrast, at low force, RPA becomes rapidly displaced by the rehybridization of the DNA fork. This process appears to be governed by the binding or the release of an RPA microdomain (toehold) of only few base-pairs length. This gives rise to an extremely rapid exchange dynamics of RPA at the fork. Fork rezipping rates reach up to hundreds of base-pairs per second, being orders of magnitude faster than RPA dissociation from ssDNA alone. Additionally, we show that RPA undergoes diffusive motion on ssDNA, such that it can be pushed over long distances by a rezipping fork. Generally the behavior of both human and yeast RPA homologs is very similar. However, in contrast to yeast RPA, the dissociation of human RPA from ssDNA is greatly reduced at low Mg2+ concentrations, such that human RPA can melt DNA in absence of force. PMID:27016742

  16. Evaluation of suitable DNA regions for molecular identification of high value medicinal plants in genus Kaempferia.

    PubMed

    Osathanunkul, Maslin; Dheeranupattana, Srisulak; Rotarayanont, Siriphron; Sookkhee, Siriwoot; Osathanunkul, Khukrit; Madesis, Panagiotis

    2017-12-02

    DNA barcoding coupled high resolution melting (Bar-HRM) is an emerging method for species discrimination based on DNA dissociation kinetics. The aim of this work was to evaluate the suitability of different primer sets, derived from selected DNA regions, for Bar-HRM analysis of species in Kaempferia (Zingiberaceae). Four primer pairs were evaluated (rbcL, rpoC, trnL and ITS1). It was observed that the ITS1 barcode was the most useful DNA barcoding region overall for species discrimination out of all of the regions and primers assessed. Thus, the primer pair derived from the ITS1 region was the single most effective region for the identification of the tested species, whereas the rbcL primer pair gave the lowest resolution. Our Bar-HRM developed here would not only be useful for identification of Kaempferia plant specimens lacking essential parts for morphological identification but will be useful for authenticating products in powdered form of a high value medicinal species Kaempferia parviflora, in particular.

  17. A Constant Rate of Spontaneous Mutation in DNA-Based Microbes

    NASA Astrophysics Data System (ADS)

    Drake, John W.

    1991-08-01

    In terms of evolution and fitness, the most significant spontaneous mutation rate is likely to be that for the entire genome (or its nonfrivolous fraction). Information is now available to calculate this rate for several DNA-based haploid microbes, including bacteriophages with single- or double-stranded DNA, a bacterium, a yeast, and a filamentous fungus. Their genome sizes vary by ≈6500-fold. Their average mutation rates per base pair vary by ≈16,000-fold, whereas their mutation rates per genome vary by only ≈2.5-fold, apparently randomly, around a mean value of 0.0033 per DNA replication. The average mutation rate per base pair is inversely proportional to genome size. Therefore, a nearly invariant microbial mutation rate appears to have evolved. Because this rate is uniform in such diverse organisms, it is likely to be determined by deep general forces, perhaps by a balance between the usually deleterious effects of mutation and the physiological costs of further reducing mutation rates.

  18. Influence of PNA containing 8-aza-7-deazaadenine on structure stability and binding affinity of PNA·DNA duplex: insights from thermodynamics, counter ion, hydration and molecular dynamics analysis.

    PubMed

    Gupta, Sharad K; Sur, Souvik; Prasad Ojha, Rajendra; Tandon, Vibha

    2013-07-01

    This paper describes the synthesis of a novel 8-aza-7-deazapurin-2,6-diamine (DPP)-containing peptide nucleic acid (PNA) monomer and Boc protecting group-based oligomerization of PNA, replacing adenine (A) with DPP monomers in the PNA strand. The PNA oligomers were synthesized against the biologically relevant SV40 promoter region (2494-AATTTTTTTTATTTA-2508) of pEGFP-N3 plasmid. The DPP-PNA·DNA duplex showed enhanced stability as compared to normal duplex (A-PNA·DNA). The electronic distribution of DPP monomer suggested that DPP had better electron donor properties over 2,6-diamino purine. UV melting and thermodynamic analysis revealed that the PNA oligomer containing a diaminopyrazolo(3,4-d)pyrimidine moiety (DPP) stabilized the PNA·DNA hybrids compared to A-PNA·DNA. DPP-PNA·DNA duplex showed higher water activity (Δnw = 38.5) in comparison to A-PNA·DNA duplex (Δnw = 14.5). The 50 ns molecular dynamics simulations of PNA·DNA duplex containing DPP or unmodified nucleobase-A showed average H-bond distances in the DPP-dT base pair of 2.90 Å (OH-N bond) and 2.91 Å (NH-N bond), which were comparably shorter than in the A-dT base pair, in which the average distances were 3.18 Å (OH-N bond) and 2.97 Å (NH-N bond), and there was one additional H-bond in the DPP-dT base pair of around 2.98 Å (O2H-N2 bond), supporting the higher stability of DPP-PNA·DNA. The analysis of molecular dynamics simulation data showed that the system binding free energy increased at a rate of approximately -4.5 kcal mol(-1) per DPP base of the PNA·DNA duplex. In summary, increased thermal stability, stronger hydrogen bonding and more stable conformation in the DPP-PNA·DNA duplex make it a better candidate as antisense/antigene therapeutic agents.

  19. Estimating Genomic Distance from DNA Sequence Location in Cell Nuclei by a Random Walk Model

    NASA Astrophysics Data System (ADS)

    van den Engh, Ger; Sachs, Rainer; Trask, Barbara J.

    1992-09-01

    The folding of chromatin in interphase cell nuclei was studied by fluorescent in situ hybridization with pairs of unique DNA sequence probes. The sites of DNA sequences separated by 100 to 2000 kilobase pairs (kbp) are distributed in interphase chromatin according to a random walk model. This model provides the basis for calculating the spacing of sequences along the linear DNA molecule from interphase distance measurements. An interphase mapping strategy based on this model was tested with 13 probes from a 4-megabase pair (Mbp) region of chromosome 4 containing the Huntington disease locus. The results confirmed the locations of the probes and showed that the remaining gap in the published maps of this region is negligible in size. Interphase distance measurements should facilitate construction of chromosome maps with an average marker density of one per 100 kbp, approximately ten times greater than that achieved by hybridization to metaphase chromosomes.

  20. A label-free DNA hairpin biosensor for colorimetric detection of target with suitable functional DNA partners.

    PubMed

    Nie, Ji; Zhang, De-Wen; Tie, Cai; Zhou, Ying-Lin; Zhang, Xin-Xiang

    2013-11-15

    The combination of aptamer and peroxidase-mimicking DNAzyme within a hairpin structure can form a functional DNA probe. The activities of both aptamer (as biorecognition element) and DNAzyme (as signal amplification element) are blocked via base pairing in the hairpin structure. The presence of target triggers the opening of the hairpin to form target/aptamer complex and releases G-quadruplex sequence which can generate amplified colorimetric signals. In this work, we elaborated a universal and simple procedure to design an efficient and sensitive hairpin probe with suitable functional DNA partners. A fill-in-the-blank process was developed for sequence design, and two key points including the pretreatment of the hairpin probe and the selection of suitable signal transducer sequence were proved to enhance the detection sensitivity. Cocaine was chosen as a model target for a proof of concept. A series of hairpins with different numbers of base pairs in the stem region were prepared. Hairpin-C10 with ten base pairs was screened out and a lowest detectable cocaine concentration of 5 μM by colorimetry was obtained. The proposed functional DNA hairpin showed good selectivity and satisfactory analysis in spiked biologic fluid. The whole "mix-and-measure" detection based on DNA hairpin without the need of immobilization and labeling was indicated to be time and labor saving. The strategy has potential to be transplanted into more smart hairpins toward other targets for general application in bioanalytical chemistry. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. Quantum-mechanical analysis of the energetic contributions to π stacking in nucleic acids versus rise, twist, and slide.

    PubMed

    Parker, Trent M; Hohenstein, Edward G; Parrish, Robert M; Hud, Nicholas V; Sherrill, C David

    2013-01-30

    Symmetry-adapted perturbation theory (SAPT) is applied to pairs of hydrogen-bonded nucleobases to obtain the energetic components of base stacking (electrostatic, exchange-repulsion, induction/polarization, and London dispersion interactions) and how they vary as a function of the helical parameters Rise, Twist, and Slide. Computed average values of Rise and Twist agree well with experimental data for B-form DNA from the Nucleic Acids Database, even though the model computations omitted the backbone atoms (suggesting that the backbone in B-form DNA is compatible with having the bases adopt their ideal stacking geometries). London dispersion forces are the most important attractive component in base stacking, followed by electrostatic interactions. At values of Rise typical of those in DNA (3.36 Å), the electrostatic contribution is nearly always attractive, providing further evidence for the importance of charge-penetration effects in π-π interactions (a term neglected in classical force fields). Comparison of the computed stacking energies with those from model complexes made of the "parent" nucleobases purine and 2-pyrimidone indicates that chemical substituents in DNA and RNA account for 20-40% of the base-stacking energy. A lack of correspondence between the SAPT results and experiment for Slide in RNA base-pair steps suggests that the backbone plays a larger role in determining stacking geometries in RNA than in B-form DNA. In comparisons of base-pair steps with thymine versus uracil, the thymine methyl group tends to enhance the strength of the stacking interaction through a combination of dispersion and electrosatic interactions.

  2. MSuPDA: A Memory Efficient Algorithm for Sequence Alignment.

    PubMed

    Khan, Mohammad Ibrahim; Kamal, Md Sarwar; Chowdhury, Linkon

    2016-03-01

    Space complexity is a million dollar question in DNA sequence alignments. In this regard, memory saving under pushdown automata can help to reduce the occupied spaces in computer memory. Our proposed process is that anchor seed (AS) will be selected from given data set of nucleotide base pairs for local sequence alignment. Quick splitting techniques will separate the AS from all the DNA genome segments. Selected AS will be placed to pushdown automata's (PDA) input unit. Whole DNA genome segments will be placed into PDA's stack. AS from input unit will be matched with the DNA genome segments from stack of PDA. Match, mismatch and indel of nucleotides will be popped from the stack under the control unit of pushdown automata. During the POP operation on stack, it will free the memory cell occupied by the nucleotide base pair.

  3. A mechanical mechanism for translocation of ring-shaped helicases on DNA and its demonstration in a macroscopic simulation system

    NASA Astrophysics Data System (ADS)

    Chou, Y. C.

    2018-04-01

    The asymmetry in the two-layered ring structure of helicases and the random thermal fluctuations of the helicase and DNA molecules are considered as the bases for the generation of the force required for translocation of the ring-shaped helicase on DNA. The helicase comprises a channel at its center with two unequal ends, through which strands of DNA can pass. The random collisions between the portion of the DNA strand in the central channel and the wall of the channel generate an impulsive force toward the small end. This impulsive force is the starting point for the helicase to translocate along the DNA with the small end in front. Such a physical mechanism may serve as a complementary for the chemomechanical mechanism of the translocation of helicase on DNA. When the helicase arrives at the junction of ssDNA and dsDNA (a fork), the collision between the helicase and the closest base pair may produce a sufficient impulsive force to break the weak hydrogen bond of the base pair. Thus, the helicase may advance and repeat the process of unwinding the dsDNA strand. This mechanism was tested in a macroscopic simulation system where the helicase was simulated using a truncated-cone structure and DNA was simulated with bead chains. Many features of translocation and unwinding such as translocation on ssDNA and dsDNA, unwinding of dsDNA, rewinding, strand switching, and Holliday junction resolution were reproduced.

  4. Detection of a variable number of ribosomal DNA loci by fluorescent in situ hybridization in Populus species.

    PubMed

    Prado, E A; Faivre-Rampant, P; Schneider, C; Darmency, M A

    1996-10-01

    Fluorescent in situ hybridization (FISH) was applied to related Populus species (2n = 19) in order to detect rDNA loci. An interspecific variability in the number of hybridization sites was revealed using as probe an homologous 25S clone from Populus deltoides. The application of image analysis methods to measure fluorescence intensity of the hybridization signals has enabled us to characterize major and minor loci in the 18S-5.8S-25S rDNA. We identified one pair of such rDNA clusters in Populus alba; two pairs, one major and one minor, in both Populus nigra and P. deltoides; and three pairs in Populus balsamifera, (two major and one minor) and Populus euroamericana (one major and two minor). FISH results are in agreement with those based on RFLP analysis. The pBG13 probe containing 5S sequence from flax detected two separate clusters corresponding to the two size classes of units that coexist within 5S rDNA of most Populus species. Key words : Populus spp., fluorescent in situ hybridization, FISH, rDNA variability, image analysis.

  5. A Molecular Dynamics-Quantum Mechanics Theoretical Study of DNA-Mediated Charge Transport in Hydrated Ionic Liquids.

    PubMed

    Meng, Zhenyu; Kubar, Tomas; Mu, Yuguang; Shao, Fangwei

    2018-05-08

    Charge transport (CT) through biomolecules is of high significance in the research fields of biology, nanotechnology, and molecular devices. Inspired by our previous work that showed the binding of ionic liquid (IL) facilitated charge transport in duplex DNA, in silico simulation is a useful means to understand the microscopic mechanism of the facilitation phenomenon. Here molecular dynamics simulations (MD) of duplex DNA in water and hydrated ionic liquids were employed to explore the helical parameters. Principal component analysis was further applied to capture the subtle conformational changes of helical DNA upon different environmental impacts. Sequentially, CT rates were calculated by a QM/MM simulation of the flickering resonance model based upon MD trajectories. Herein, MD simulation illustrated that the binding of ionic liquids can restrain dynamic conformation and lower the on-site energy of the DNA base. Confined movement among the adjacent base pairs was highly related to the increase of electronic coupling among base pairs, which may lead DNA to a CT facilitated state. Sequentially combining MD and QM/MM analysis, the rational correlations among the binding modes, the conformational changes, and CT rates illustrated the facilitation effects from hydrated IL on DNA CT and supported a conformational-gating mechanism.

  6. High-fidelity in vivo replication of DNA base shape mimics without Watson–Crick hydrogen bonds

    PubMed Central

    Delaney, James C.; Henderson, Paul T.; Helquist, Sandra A.; Morales, Juan C.; Essigmann, John M.; Kool, Eric T.

    2003-01-01

    We report studies testing the importance of Watson–Crick hydrogen bonding, base-pair geometry, and steric effects during DNA replication in living bacterial cells. Nonpolar DNA base shape mimics of thymine and adenine (abbreviated F and Q, respectively) were introduced into Escherichia coli by insertion into a phage genome followed by transfection of the vector into bacteria. Genetic assays showed that these two base mimics were bypassed with moderate to high efficiency in the cells and with very high efficiency under damage-response (SOS induction) conditions. Under both sets of conditions, the T-shape mimic (F) encoded genetic information in the bacteria as if it were thymine, directing incorporation of adenine opposite it with high fidelity. Similarly, the A mimic (Q) directed incorporation of thymine opposite itself with high fidelity. The data establish that Watson–Crick hydrogen bonding is not necessary for high-fidelity replication of a base pair in vivo. The results suggest that recognition of DNA base shape alone serves as the most powerful determinant of fidelity during transfer of genetic information in a living organism. PMID:12676985

  7. The presence of ancient human T-cell lymphotropic virus type I provirus DNA in an Andean mummy.

    PubMed

    Li, H C; Fujiyoshi, T; Lou, H; Yashiki, S; Sonoda, S; Cartier, L; Nunez, L; Munoz, I; Horai, S; Tajima, K

    1999-12-01

    The worldwide geographic and ethnic clustering of patients with diseases related to human T-cell lymphotropic virus type I (HTLV-I) may be explained by the natural history of HTLV-I infection. The genetic characteristics of indigenous people in the Andes are similar to those of the Japanese, and HTLV-I is generally detected in both groups. To clarify the common origin of HTLV-I in Asia and the Andes, we analyzed HTLV-I provirus DNA from Andean mummies about 1,500 years old. Two of 104 mummy bone marrow specimens yielded a band of human beta-globin gene DNA 110 base pairs in length, and one of these two produced bands of HTLV-I-pX (open reading frame encoding p40x, p27x) and HTLV-I-LTR (long terminal repeat) gene DNA 159 base pairs and 157 base pairs in length, respectively. The nucleotide sequences of ancient HTLV-I-pX and HTLV-I-LTR clones isolated from mummy bone marrow were similar to those in contemporary Andeans and Japanese, although there was microheterogeneity in the sequences of some mummy DNA clones. This result provides evidence that HTLV-I was carried with ancient Mongoloids to the Andes before the Colonial era. Analysis of ancient HTLV-I sequences could be a useful tool for studying the history of human retroviral infection as well as human prehistoric migration.

  8. Ancient HTLV type 1 provirus DNA of Andean mummy.

    PubMed

    Sonoda, S; Li, H C; Cartier, L; Nunez, L; Tajima, K

    2000-11-01

    The worldwide geographic and ethnic clustering of patients with diseases related to human T cell lymphotropic virus type 1 (HTLV-1) may be explained by the natural history of HTLV-1 infection. The genetic characteristics of indigenous people in the Andes are similar to those of the Japanese, and HTLV-1 is generally detected in both groups. To clarify the common origin of HTLV-1 in Asia and the Andes, we analyzed HTLV-1 provirus DNA from Andean mummies about 1500 years old. Two of 104 mummy bone marrow specimens yielded a band of human beta-globin gene DNA 110 base pairs in length, and one of these two produced bands of HTLV-1-pX (open reading frame encoding p(40x), p(27x)) and HTLV-1-LTR (long terminal repeat) gene DNA 159 base pairs and 157 base pairs in length, respectively. The nucleotide sequences of ancient HTLV-1-pX and HTLV-1-LTR clones isolated from mummy bone marrow were similar to those in contemporary Andeans and Japanese, although there was microheterogeneity in the sequences of some mummy DNA clones. This result provides evidence that HTLV-1 was carried with ancient Mongoloids to the Andes before the Colonial era. Analysis of ancient HTLV-1 sequences could be a useful tool for studying the history of human retroviral infection as well as human prehistoric migration.

  9. Mechanistic Basis for the Bypass of a Bulky DNA Adduct Catalyzed by a Y-Family DNA Polymerase

    PubMed Central

    Vyas, Rajan; Efthimiopoulos, Georgia; Tokarsky, E. John; Malik, Chanchal K.; Basu, Ashis K.; Suo, Zucai

    2015-01-01

    1-Nitropyrene (1-NP), an environmental pollutant, induces DNA damage in vivo and is considered to be carcinogenic. The DNA adducts formed by the 1-NP metabolites stall replicative DNA polymerases but are presumably bypassed by error-prone Y-family DNA polymerases at the expense of replication fidelity and efficiency in vivo. Our running start assays confirmed that a site-specifically placed 8-(deoxyguanosin-N2-yl)-1-aminopyrene (dG1,8), one of the DNA adducts derived from 1-NP, can be bypassed by Sulfolobus solfataricus DNA polymerase IV (Dpo4), although this representative Y-family enzyme was paused strongly by the lesion. Pre-steady-state kinetic assays were employed to determine the low nucleotide incorporation fidelity and establish a minimal kinetic mechanism for the dG1,8 bypass by Dpo4. To reveal a structural basis for dCTP incorporation opposite dG1,8, we solved the crystal structures of the complexes of Dpo4 and DNA containing a templating dG1,8 lesion in the absence or presence of dCTP. The Dpo4·DNA-dG1,8 binary structure shows that the aminopyrene moiety of the lesion stacks against the primer/template junction pair, while its dG moiety projected into the cleft between the Finger and Little Finger domains of Dpo4. In the Dpo4·DNA-dG1,8·dCTP ternary structure, the aminopyrene moiety of the dG1,8 lesion, is sandwiched between the nascent and junction base pairs, while its base is present in the major groove. Moreover, dCTP forms a Watson–Crick base pair with dG, two nucleotides upstream from the dG1,8 site, creating a complex for “-2” frameshift mutation. Mechanistically, these crystal structures provide additional insight into the aforementioned minimal kinetic mechanism. PMID:26327169

  10. A DNA methylation map of human cancer at single base-pair resolution

    PubMed Central

    Vidal, E; Sayols, S; Moran, S; Guillaumet-Adkins, A; Schroeder, M P; Royo, R; Orozco, M; Gut, M; Gut, I; Lopez-Bigas, N; Heyn, H; Esteller, M

    2017-01-01

    Although single base-pair resolution DNA methylation landscapes for embryonic and different somatic cell types provided important insights into epigenetic dynamics and cell-type specificity, such comprehensive profiling is incomplete across human cancer types. This prompted us to perform genome-wide DNA methylation profiling of 22 samples derived from normal tissues and associated neoplasms, including primary tumors and cancer cell lines. Unlike their invariant normal counterparts, cancer samples exhibited highly variable CpG methylation levels in a large proportion of the genome, involving progressive changes during tumor evolution. The whole-genome sequencing results from selected samples were replicated in a large cohort of 1112 primary tumors of various cancer types using genome-scale DNA methylation analysis. Specifically, we determined DNA hypermethylation of promoters and enhancers regulating tumor-suppressor genes, with potential cancer-driving effects. DNA hypermethylation events showed evidence of positive selection, mutual exclusivity and tissue specificity, suggesting their active participation in neoplastic transformation. Our data highlight the extensive changes in DNA methylation that occur in cancer onset, progression and dissemination. PMID:28581523

  11. Array based Discovery of Aptamer Pairs (Open Access Publisher’s Version)

    DTIC Science & Technology

    2014-12-11

    Array-based Discovery of Aptamer Pairs Minseon Cho,†,‡ Seung Soo Oh,‡ Jeff Nie,§ Ron Stewart,§ Monte J. Radeke,⊥ Michael Eisenstein,†,‡ Peter J...bidentate” target recognition, with affinities greatly exceeding either monovalent component. DNA aptamers are especially well-suited for such...constructs, because they can be linked via standard synthesis techniques without requiring chemical conjugation. Unfortunately, aptamer pairs are difficult

  12. Homology between DNA polymerases of poxviruses, herpesviruses, and adenoviruses: nucleotide sequence of the vaccinia virus DNA polymerase gene.

    PubMed Central

    Earl, P L; Jones, E V; Moss, B

    1986-01-01

    A 5400-base-pair segment of the vaccinia virus genome was sequenced and an open reading frame of 938 codons was found precisely where the DNA polymerase had been mapped by transfer of a phosphonoacetate-resistance marker. A single nucleotide substitution changing glycine at position 347 to aspartic acid accounts for the drug resistance of the mutant vaccinia virus. The 5' end of the DNA polymerase mRNA was located 80 base pairs before the methionine codon initiating the open reading frame. Correspondence between the predicted Mr 108,577 polypeptide and the 110,000 purified enzyme indicates that little or no proteolytic processing occurs. Extensive homology, extending over 435 amino acids, was found upon comparing the DNA polymerase of vaccinia virus and DNA polymerase of Epstein-Barr virus. A highly conserved sequence of 14 amino acids in the carboxyl-terminal regions of the above DNA polymerases is also present at a similar location in adenovirus DNA polymerase. This structure, which is predicted to form a turn flanked by beta-pleated sheets, may form part of an essential binding or catalytic site that accounts for its presence in DNA polymerases of poxviruses, herpesviruses, and adenoviruses. Images PMID:3012524

  13. 5-Methylation of Cytosine in CG:CG Base-Pair Steps: A Physicochemical Mechanism for the Epigenetic Control of DNA Nanomechanics

    NASA Astrophysics Data System (ADS)

    Yusufaly, Tahir; Olson, Wilma; Li, Yun

    2014-03-01

    Van der Waals density functional theory is integrated with analysis of a non-redundant set of protein-DNA crystal structures from the Nucleic Acid Database to study the stacking energetics of CG:CG base-pair steps, specifically the role of cytosine 5-methylation. Principal component analysis of the steps reveals the dominant collective motions to correspond to a tensile ``opening'' mode and two shear ``sliding'' and ``tearing'' modes in the orthogonal plane. The stacking interactions of the methyl groups are observed to globally inhibit CG:CG step overtwisting while simultaneously softening the modes locally via potential energy modulations that create metastable states. The results have implications for the epigenetic control of DNA mechanics.

  14. Chemical probes of the conformation of DNA modified by cis-diamminedichloroplatinum(II)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marrot, L.; Leng, M.

    The purpose of this work was to analyze at the nucleotide level the distortions induced by the binding of cis-diamminedichloroplatinum(II) (cis-DDP) to DNA by means of chemical probes. In order to test the chemical probes, experiments were first carried out on two platinated oligonucleotides. It has been verified by circular dichroism and gel electrophoresis that the binding of cis-DDP to an AG or to a GTG site within a double-stranded oligonucleotide distorts the double helix. The reactivity of the oligonucleotide platinated at the GTG site with chloroacetaldehyde, diethyl pyrocarbonate, and osmium tetraoxide, respectively, suggests a local denaturation of the doublemore » helix. The 5'G residue and the T residue within the adduct are no longer paired, while the 3'G residue is paired. The double helix is more distorted (but not denatured) at the 5' side of the adduct than at the 3' side. The reactivities of the chemical probes with six platinated DNA restriction fragments show that even at a relatively high level of platination only a few base pairs are unpaired but the double helix is largely distorted. No local denaturation has been detected at the GG sites separated from the nearest GG or AG sites by at least three base pairs. The AG sites separated from the nearest AG or GG sites by at least three base pairs do not denature the double helix locally when they are in the sequences puAG/pyTC. It is suggested that the distortion within these sequences is induced by adducts located further away along the DNA fragments, these sequences not being the major sites for the binding of cis-DDP.« less

  15. Epigenetic discrimination of identical twins from blood under the forensic scenario.

    PubMed

    Vidaki, Athina; Díez López, Celia; Carnero-Montoro, Elena; Ralf, Arwin; Ward, Kirsten; Spector, Timothy; Bell, Jordana T; Kayser, Manfred

    2017-11-01

    Monozygotic (MZ) twins share the same STR profile, demonstrating a practical problem in forensic casework. DNA methylation has provided a suitable resource for MZ twin differentiation; however, studies addressing the forensic feasibility are lacking. Here, we investigated epigenetic MZ twin differentiation from blood under the forensic scenario comprising i) the discovery of candidate markers in reference-type blood DNA via genome-wide analysis, ii) the technical validation of candidate markers in reference-type blood DNA using a suitable targeted method, and iii) the analysis of the validated markers in trace-type DNA. Genome-wide methylation analysis in blood DNA from 10 MZ twin pairs resulted in 19-111 twin-differentially methylated sites (tDMSs) per pair with >0.3 twin-to-twin differences. Considering all top three candidate tDMSs across all pairs in the technical validation based on methylation-specific qPCR, 67.85% generated >0.1 twin-to-twin differences. Of the validated tDMSs, 68.4% showed >0.1 twin-to-twin differences with qPCR in trace-type DNA across 8 pairs. Using an updated marker selection strategy, 8 additional candidate tDMSs were obtained for an example MZ pair, of which 7 showed >0.1 twin-to-twin differences in both reference- and trace-type DNA. Lastly, we introduce a high-resolution melting curve analysis of the entire fragment that can complement the proposed approach. Overall, our study demonstrates the general feasibility of epigenetic twin differentiation in the forensic context and highlights that the number of informative tDMSs in the final trace DNA analysis is crucial, as some candidate markers identified in reference DNA were shown not informative in the trace DNA due to various, including technical, reasons. Future studies will need to address the optimal number of epigenetic markers required for reliable identification of MZ twin individuals including statistical considerations. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Formation of rings from segments of HeLa-cell nuclear deoxyribonucleic acid

    PubMed Central

    Hardman, Norman

    1974-01-01

    Duplex segments of HeLa-cell nuclear DNA were generated by cleavage with DNA restriction endonuclease from Haemophilus influenzae. About 20–25% of the DNA segments produced, when partly degraded with exonuclease III and annealed, were found to form rings visible in the electron microscope. A further 5% of the DNA segments formed structures that were branched in configuration. Similar structures were generated from HeLa-cell DNA, without prior treatment with restriction endonuclease, when the complementary polynucleotide chains were exposed by exonuclease III action at single-chain nicks. After exposure of an average single-chain length of 1400 nucleotides per terminus at nicks in HeLa-cell DNA by exonuclease III, followed by annealing, the physical length of ring closures was estimated and found to be 0.02–0.1μm, or 50–300 base pairs. An almost identical distribution of lengths was recorded for the regions of complementary base sequence responsible for branch formation. It is proposed that most of the rings and branches are formed from classes of reiterated base sequence with an average length of 180 base pairs arranged intermittenly in HeLa-cell DNA. From the rate of formation of branched structures when HeLa-cell DNA segments were heat-denatured and annealed, it is estimated that the reiterated sequences are in families containing approximately 2400–24000 copies. ImagesPLATE 2PLATE 1 PMID:4462738

  17. Role of Electron-Driven Proton-Transfer Processes in the Ultrafast Deactivation of Photoexcited Anionic 8-oxoGuanine-Adenine and 8-oxoGuanine-Cytosine Base Pairs.

    PubMed

    Wu, Xiuxiu; Karsili, Tolga N V; Domcke, Wolfgang

    2017-01-14

    It has been reported that 8-oxo-7,8-dihydro-guanosine (8-oxo-G), which is the main product of oxidative damage of DNA, can repair cyclobutane pyrimidine dimer (CPD) lesions when incorporated into DNA or RNA strands in proximity to such lesions. It has therefore been suggested that the 8-oxo-G nucleoside may have been a primordial precursor of present-day flavins in DNA or RNA repair. Because the electron transfer leading to the splitting of a thymine-thymine pair in a CPD lesion occurs in the photoexcited state, a reasonably long excited-state lifetime of 8-oxo-G is required. The neutral (protonated) form of 8-oxo-G exhibits a very short (sub-picosecond) intrinsic excited-state lifetime which is unfavorable for repair. It has therefore been argued that the anionic (deprotonated) form of 8-oxo-G, which exhibits a much longer excited-state lifetime, is more likely to be a suitable cofactor for DNA repair. Herein, we have investigated the exited-state quenching mechanisms in the hydrogen-bonded complexes of deprotonated 8-oxo-G - with adenine (A) and cytosine (C) using ab initio wave-function-based electronic-structure calculations. The calculated reaction paths and potential-energy profiles reveal the existence of barrierless electron-driven inter-base proton-transfer reactions which lead to low-lying S₁/S₀ conical intersections. The latter can promote ultrafast excited-state deactivation of the anionic base pairs. While the isolated deprotonated 8-oxo-G - nucleoside may have been an efficient primordial repair cofactor, the excited states of the 8-oxo-G - -A and 8-oxo-G - -C base pairs are likely too short-lived to be efficient electron-transfer repair agents.

  18. Analyzing ion distributions around DNA: sequence-dependence of potassium ion distributions from microsecond molecular dynamics

    PubMed Central

    Pasi, Marco; Maddocks, John H.; Lavery, Richard

    2015-01-01

    Microsecond molecular dynamics simulations of B-DNA oligomers carried out in an aqueous environment with a physiological salt concentration enable us to perform a detailed analysis of how potassium ions interact with the double helix. The oligomers studied contain all 136 distinct tetranucleotides and we are thus able to make a comprehensive analysis of base sequence effects. Using a recently developed curvilinear helicoidal coordinate method we are able to analyze the details of ion populations and densities within the major and minor grooves and in the space surrounding DNA. The results show higher ion populations than have typically been observed in earlier studies and sequence effects that go beyond the nature of individual base pairs or base pair steps. We also show that, in some special cases, ion distributions converge very slowly and, on a microsecond timescale, do not reflect the symmetry of the corresponding base sequence. PMID:25662221

  19. The use of molecular dynamics simulations to evaluate the DNA sequence-selectivity of G-A cross-linking PBD-duocarmycin dimers.

    PubMed

    Jackson, Paul J M; Rahman, Khondaker M; Thurston, David E

    2017-01-01

    The pyrrolobenzodiazepine (PBD) and duocarmycin families are DNA-interactive agents that covalently bond to guanine (G) and adenine (A) bases, respectively, and that have been joined together to create synthetic dimers capable of cross-linking G-G, A-A, and G-A bases. Three G-A alkylating dimers have been reported in publications to date, with defined DNA-binding sites proposed for two of them. In this study we have used molecular dynamics simulations to elucidate preferred DNA-binding sites for the three published molecular types. For the PBD-CPI dimer UTA-6026 (1), our simulations correctly predicted its favoured binding site (i.e., 5'-C(G)AATTA-3') as identified by DNA cleavage studies. However, for the PBD-CI molecule ('Compound 11', 3), we were unable to reconcile the results of our simulations with the reported preferred cross-linking sequence (5'-ATTTTCC(G)-3'). We found that the molecule is too short to span the five base pairs between the A and G bases as claimed, but should target instead a sequence such as 5'-ATTTC(G)-3' with two less base pairs between the reacting G and A residues. Our simulation results for this hybrid dimer are also in accord with the very low interstrand cross-linking and in vitro cytotoxicity activities reported for it. Although a preferred cross-linking sequence was not reported for the third hybrid dimer ('27eS', 2), our simulations predict that it should span two base pairs between covalently reacting G and A bases (e.g., 5'-GTAT(A)-3'). Copyright © 2016. Published by Elsevier Ltd.

  20. [Quality of DNA from archival pathological samples of gallbladder cancer].

    PubMed

    Roa, Iván; de Toro, Gonzalo; Sánchez, Tamara; Slater, Jeannie; Ziegler, Anne Marie; Game, Anakaren; Arellano, Leonardo; Schalper, Kurt; de Aretxabala, Xabier

    2013-12-01

    The quality of the archival samples stored at pathology services could be a limiting factor for molecular biology studies. To determine the quality of DNA extracted from gallbladder cancer samples at different institutions. One hundred ninety four samples coming from five medical centers in Chile, were analyzed. DNA extraction was quantified determining genomic DNA concentration. The integrity of DNA was determined by polymerase chain reaction amplification of different length fragments of a constitutive gene (β-globin products of 110, 268 and 501 base pairs). The mean DNA concentration obtained in 194 gallbladder cancer samples was 48 ± 43.1 ng/µl. In 22% of samples, no amplification was achieved despite obtaining a mean DNA concentration of 58.3 ng/ul. In 81, 67 and 22% of samples, a DNA amplification of at least 110, 268 or 501 base pairs was obtained, respectively. No differences in DNA concentration according to the source of the samples were demonstrated. However, there were marked differences in DNA integrity among participating centers. Samples from public hospitals were of lower quality than those from private clinics. Despite some limitations, in 80% of cases, the integrity of DNA in archival samples from pathology services in our country would allow the use of molecular biology techniques.

  1. Intercalation of a Zn(II) complex containing ciprofloxacin drug between DNA base pairs.

    PubMed

    Shahabadi, Nahid; Asadian, Ali Ashraf; Mahdavi, Mryam

    2017-11-02

    In this study, an attempt has been made to study the interaction of a Zn(II) complex containing an antibiotic drug, ciprofloxacin, with calf thymus DNA using spectroscopic methods. It was found that Zn(II) complex could bind with DNA via intercalation mode as evidenced by: hyperchromism in UV-Vis spectrum; these spectral characteristics suggest that the Zn(II) complex interacts with DNA most likely through a mode that involves a stacking interaction between the aromatic chromophore and the base pairs of DNA. DNA binding constant (K b = 1.4 × 10 4 M -1 ) from spectrophotometric studies of the interaction of Zn(II) complex with DNA is comparable to those of some DNA intercalative polypyridyl Ru(II) complexes 1.0 -4.8 × 10 4 M -1 . CD study showed stabilization of the right-handed B form of DNA in the presence of Zn(II) complex as observed for the classical intercalator methylene blue. Thermodynamic parameters (ΔH < 0 and ΔS < 0) indicated that hydrogen bond and Van der Waals play main roles in this binding prose. Competitive fluorimetric studies with methylene blue (MB) dye have shown that Zn(II) complex exhibits the ability of this complex to displace with DNA-MB, indicating that it binds to DNA in strong competition with MB for the intercalation.

  2. Rupture of DNA aptamer: New insights from simulations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mishra, Rakesh Kumar; Nath, Shesh; Kumar, Sanjay

    2015-10-28

    Base-pockets (non-complementary base-pairs) in a double-stranded DNA play a crucial role in biological processes. Because of thermal fluctuations, it can lower the stability of DNA, whereas, in case of DNA aptamer, small molecules, e.g., adenosinemonophosphate and adenosinetriphosphate, form additional hydrogen bonds with base-pockets termed as “binding-pockets,” which enhance the stability. Using the Langevin dynamics simulations of coarse grained model of DNA followed by atomistic simulations, we investigated the influence of base-pocket and binding-pocket on the stability of DNA aptamer. Striking differences have been reported here for the separation induced by temperature and force, which require further investigation by single moleculemore » experiments.« less

  3. Modified nucleotides reveal the indirect role of the central base pairs in stabilizing the lac repressor-operator complex.

    PubMed Central

    Zhang, X; Gottlieb, P A

    1995-01-01

    Guanine residues in the lac operator were replaced by 2-aminopurine or purine analogues, pairing the modified nucleotides with C. The observed equilibrium dissociation constants for lac repressor binding to substituted operators were measured in 10 mM Tris, 150 mM KCl, 0.1 mM EDTA, 0.1 mM DTE, pH 7.6 at 25 degrees C. These measurements revealed five positions that destabilized the complex when substituted with either analogue. Two positions, which are related by a 2-fold symmetry, are in the major groove of the operator thought to directly interact with the protein. Three sites were in the central region of the operator. A purine analogue at a sixth site perturbed the local DNA structure and destabilized the complex. Alkylation interference experiments of the 2-aminopurine substituted operators demonstrated that, of the five affected, two substitutions displayed altered phosphate interference patterns at the phosphate adjacent to the substituted base. For these operators, complex formation was measured in different concentrations of KCl to assess the contribution of counterion release to the bimolecular process. The results indicated that both complexes were similar to wild-type, although minor changes were observed. The Kobs of the complex was then measured when 2-aminopurine or purine analogues were paired with uracil nucleotide, a base pair that serves to stabilize the DNA. The introduction of the new base pairs revealed two effects on the bimolecular interaction. For those operator sites that are thought to perturb the interaction directly, the affinity of the complex was weakened to levels observed for the singly-substituted operators. In contrast, the nucleotides of 2-aminopurine paired with uracil positioned in the central region of the operator served to enhance the stability of the complex. The purine-uracil base pair substitution on the other hand had a significant destabilizing effect on the interaction. We propose that the central base pairs modulate binding of the complex by altering the intrinsic properties of the DNA. Two specific attributes are required to achieve the lowest free energy of interaction. The DNA must have two interstrand hydrogen bonds to stabilize the duplex and it must have properties associated with directional bending or unwinding. This analysis does not rule out contributions by direct interactions between the protein and the central region of the operator but underscores how indirect effects play a major role in complex formation in this system. Images PMID:7784203

  4. [DNA structure from A to Z--biological implications of structural diversity of DNA].

    PubMed

    Bukowiecka-Matusiak, Małgorzata; Woźniak, Lucyna A

    2006-01-01

    Deoxyribonucleic acid (DNA) is a biopolymer of nucleotides, usually adopting a double-stranded helical form in cells, with complementary base pairing holding the two strands together. The most stable is B-DNA conformation, although numerous other double helical structures can occur under specific conditions (A-DNA, Z-DNA, P-DNA). The existence of multiple-stranded (triplex, tetraplex) forms in vivo and their biological function in cells are subject of intensive studies.

  5. Exact method for numerically analyzing a model of local denaturation in superhelically stressed DNA

    NASA Astrophysics Data System (ADS)

    Fye, Richard M.; Benham, Craig J.

    1999-03-01

    Local denaturation, the separation at specific sites of the two strands comprising the DNA double helix, is one of the most fundamental processes in biology, required to allow the base sequence to be read both in DNA transcription and in replication. In living organisms this process can be mediated by enzymes which regulate the amount of superhelical stress imposed on the DNA. We present a numerically exact technique for analyzing a model of denaturation in superhelically stressed DNA. This approach is capable of predicting the locations and extents of transition in circular superhelical DNA molecules of kilobase lengths and specified base pair sequences. It can also be used for closed loops of DNA which are typically found in vivo to be kilobases long. The analytic method consists of an integration over the DNA twist degrees of freedom followed by the introduction of auxiliary variables to decouple the remaining degrees of freedom, which allows the use of the transfer matrix method. The algorithm implementing our technique requires O(N2) operations and O(N) memory to analyze a DNA domain containing N base pairs. However, to analyze kilobase length DNA molecules it must be implemented in high precision floating point arithmetic. An accelerated algorithm is constructed by imposing an upper bound M on the number of base pairs that can simultaneously denature in a state. This accelerated algorithm requires O(MN) operations, and has an analytically bounded error. Sample calculations show that it achieves high accuracy (greater than 15 decimal digits) with relatively small values of M (M<0.05N) for kilobase length molecules under physiologically relevant conditions. Calculations are performed on the superhelical pBR322 DNA sequence to test the accuracy of the method. With no free parameters in the model, the locations and extents of local denaturation predicted by this analysis are in quantitatively precise agreement with in vitro experimental measurements. Calculations performed on the fructose-1,6-bisphosphatase gene sequence from yeast show that this approach can also accurately treat in vivo denaturation.

  6. Modeling the mechanical properties of DNA nanostructures.

    PubMed

    Arbona, Jean Michel; Aimé, Jean-Pierre; Elezgaray, Juan

    2012-11-01

    We discuss generalizations of a previously published coarse-grained description [Mergell et al., Phys. Rev. E 68, 021911 (2003)] of double stranded DNA (dsDNA). The model is defined at the base-pair level and includes the electrostatic repulsion between neighbor helices. We show that the model reproduces mechanical and elastic properties of several DNA nanostructures (DNA origamis). We also show that electrostatic interactions are necessary to reproduce atomic force microscopy measurements on planar DNA origamis.

  7. Construction of a primary DNA fingerprint database for cotton cultivars.

    PubMed

    Zhang, Y C; Kuang, M; Yang, W H; Xu, H X; Zhou, D Y; Wang, Y Q; Feng, X A; Su, C; Wang, F

    2013-06-13

    Forty core primers were used to construct a DNA fingerprint database of 132 cotton species based on multiplex fluorescence detection technology. A high first successful ratio of 99.04% was demonstrated with tetraplex polymerase chain reaction. Forty primer pairs amplified a total of 262 genotypes among 132 species, with an average of 6.55 per primer and values of polymorphism information content varying from 0.340 to 0.882. Conflicting DNA homozygous ratios were found in various species. The highest DNA homozygous ratio was found in landrace standard cultivars, which had an 81.46% DNA homozygous ratio. The lowest occurred in a group of 2010 leading cultivars with a homozygous ratio of 63.04%. Genetic diversity of the 132 species was briefly analyzed using unweighted pair-group method with arithmetic means.

  8. Binding of DNA hairpins to an assembler-strand as part of a primordial translation device

    NASA Astrophysics Data System (ADS)

    Baumann, Ulrich

    1987-09-01

    A crucial event in the process leading to the origin of life is the emergence of a simple translation device. To approach experimental realization of this device the binding ability of short DNA hairpins to complementary oligonucleotides fixed on a solid support was investigated. The binding is achieved by base pairing between the loop nucleotides of the hairpins containing different numbers of adenosine residues and oligothymidylates covalently linked to cellulose. The loop has to consist of at least five nucleotides to achieve binding. The exact number of established base pairs was determined in two ways. First, the elution temperatures of hairpins and those of oligoadenylates which had the length of the loop were compared. Secondly, the architecture of the loop was analyzed by means of the single-strand-specific nuclease from mung bean acting as structural probe. Onlyn-2 of n loop nucleotides of a hairpin are able to form base pairs. Therefore, a strong evidence for the formation of a triplet of base pairs between primeval tRNA and mRNA sufficient to stabilize the complex enzyme-free is given.

  9. Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs

    NASA Technical Reports Server (NTRS)

    Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.

    2011-01-01

    We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

  10. Sequence-dependent nucleosome sliding in rotation-coupled and uncoupled modes revealed by molecular simulations

    PubMed Central

    Tan, Cheng; Takada, Shoji

    2017-01-01

    While nucleosome positioning on eukaryotic genome play important roles for genetic regulation, molecular mechanisms of nucleosome positioning and sliding along DNA are not well understood. Here we investigated thermally-activated spontaneous nucleosome sliding mechanisms developing and applying a coarse-grained molecular simulation method that incorporates both long-range electrostatic and short-range hydrogen-bond interactions between histone octamer and DNA. The simulations revealed two distinct sliding modes depending on the nucleosomal DNA sequence. A uniform DNA sequence showed frequent sliding with one base pair step in a rotation-coupled manner, akin to screw-like motions. On the contrary, a strong positioning sequence, the so-called 601 sequence, exhibits rare, abrupt transitions of five and ten base pair steps without rotation. Moreover, we evaluated the importance of hydrogen bond interactions on the sliding mode, finding that strong and weak bonds favor respectively the rotation-coupled and -uncoupled sliding movements. PMID:29194442

  11. MSuPDA: A memory efficient algorithm for sequence alignment.

    PubMed

    Khan, Mohammad Ibrahim; Kamal, Md Sarwar; Chowdhury, Linkon

    2015-01-16

    Space complexity is a million dollar question in DNA sequence alignments. In this regards, MSuPDA (Memory Saving under Pushdown Automata) can help to reduce the occupied spaces in computer memory. Our proposed process is that Anchor Seed (AS) will be selected from given data set of Nucleotides base pairs for local sequence alignment. Quick Splitting (QS) techniques will separate the Anchor Seed from all the DNA genome segments. Selected Anchor Seed will be placed to pushdown Automata's (PDA) input unit. Whole DNA genome segments will be placed into PDA's stack. Anchor Seed from input unit will be matched with the DNA genome segments from stack of PDA. Whatever matches, mismatches or Indel, of Nucleotides will be POP from the stack under the control of control unit of Pushdown Automata. During the POP operation on stack it will free the memory cell occupied by the Nucleotide base pair.

  12. A Toda lattice model of DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Christiansen, P.L.; Scott, A.C.; Muto, V.

    In recent years the possibility that anharmonic excitations could play a role in the dynamics of SNA has been considered by several authors. It has been suggested that solitons may be generated thermally at biological temperatures. The denaturation of the DNA double helix has been investigated by statistical mechanics methods and by dynamical simulations. Here the potential for the hydrogen bond in each base pair is approximated by a Morse potential. In the present paper we describe the Toda lattice model of DNA. Temperature enters via the initial conditions and through a perturbation of the dynamical equations. The model ismore » refined by introduction of transversal motion of the Toda lattice and by transversal coupling of two lattices in the hydrogen bonds present in the base pairs. Using Lennard-Jones potentials to model these bonds we are able to obtain results concerning the open states of DNA at biological temperatures. 39 refs., 7 figs.« less

  13. Morphological and molecular genetic diversity of Strongyluris calotis (Nematoda: Ascaridida: Heterakidae) in South East and East Asian lizards.

    PubMed

    Tran, Binh Thi; Ong, An Vinh; Luc, Pham Van; Sato, Hiroshi

    2016-07-01

    Strongyluris calotis is a heterakid nematode in the large intestine of agamid lizards (Reptilia: Sauria: Agamidae) from the Oriental Region. The standard light microscopic definition of the species counts the "caudal papillae" as 10 pairs on male worms. However, previous work from our group using scanning electron microscopy (SEM) on the heterakid from agamid lizards in Japan, Taiwan, and Singapore revealed that this counting contained a pair of phasmids and that two pairs of postcloacal papillae were completely fused to form a pair of united papillae, thus resulting in "10 pairs." In the present study, we examined S. calotis specimens from the Emma Gray's forest lizard, Calotes emma (Agamidae), living in the plain forest at low altitude, and the Vietnam false bloodsucker, Pseudocalotes brevipes (Agamidae), living in the mountainous forest at high altitude in the northern part of Vietnam. Using SEM, the arrangement of caudal papillae in male worms from an Emma Gray's forest lizard was found to be comparable to classical S. calotis specimens from agamid lizards collected in Japan, Taiwan, and Singapore. However, male worms from Vietnam false bloodsuckers did not have a pair of united papillae but had 10 pairs of independent caudal papillae with a pair of phasmids. Molecular genetic analyses of the ribosomal RNA gene (rDNA) of worms of the classical S. calotis morphotype from Japan and Singapore and two S. calotis morphotypes from Vietnam demonstrated absolutely identical nucleotide sequences of partial 18S rDNA (at least 1764 base pairs (bp)) and 5.8S rDNA (158 bp). However, intraspecific differences were detected in other regions of the rDNA, related to the geographical distribution of hosts regardless of morphotype: 97.8-98.5 % identity (443-446 bp/453 bp) in the internal transcribed spacer (ITS)-1 region, 96.6-98.0 % identity (425-431 bp/440 bp) in the ITS-2 region, and 99.6-99.7 % identity (1149-1151 bp/1154 bp) in the 28S rDNA. Thus, in the future, taxonomic relationships of S. calotis distributed widely in the Oriental Region as well as other nominal Oriental Strongyluris spp., currently six in number, need to be extensively explored based on molecular genetic analyses in addition to intensive morphological characterization.

  14. Impact of Heterogeneity and Lattice Bond Strength on DNA Triangle Crystal Growth.

    PubMed

    Stahl, Evi; Praetorius, Florian; de Oliveira Mann, Carina C; Hopfner, Karl-Peter; Dietz, Hendrik

    2016-09-07

    One key goal of DNA nanotechnology is the bottom-up construction of macroscopic crystalline materials. Beyond applications in fields such as photonics or plasmonics, DNA-based crystal matrices could possibly facilitate the diffraction-based structural analysis of guest molecules. Seeman and co-workers reported in 2009 the first designed crystal matrices based on a 38 kDa DNA triangle that was composed of seven chains. The crystal lattice was stabilized, unprecedentedly, by Watson-Crick base pairing. However, 3D crystallization of larger designed DNA objects that include more chains such as DNA origami remains an unsolved problem. Larger objects would offer more degrees of freedom and design options with respect to tailoring lattice geometry and for positioning other objects within a crystal lattice. The greater rigidity of multilayer DNA origami could also positively influence the diffractive properties of crystals composed of such particles. Here, we rationally explore the role of heterogeneity and Watson-Crick interaction strengths in crystal growth using 40 variants of the original DNA triangle as model multichain objects. Crystal growth of the triangle was remarkably robust despite massive chemical, geometrical, and thermodynamical sample heterogeneity that we introduced, but the crystal growth sensitively depended on the sequences of base pairs next to the Watson-Crick sticky ends of the triangle. Our results point to weak lattice interactions and high concentrations as decisive factors for achieving productive crystallization, while sample heterogeneity and impurities played a minor role.

  15. Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.

    PubMed

    Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole

    2010-08-25

    Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.

  16. Detection of DNA damage based on metal-mediated molecular beacon and DNA strands displacement reaction

    NASA Astrophysics Data System (ADS)

    Xiong, Yanxiang; Wei, Min; Wei, Wei; Yin, Lihong; Pu, Yuepu; Liu, Songqin

    2014-01-01

    DNA hairpin structure probes are usually designed by forming intra-molecular duplex based on Watson-Crick hydrogen bonds. In this paper, a molecular beacon based on silver ions-mediated cytosine-Ag+-cytosine base pairs was used to detect DNA. The inherent characteristic of the metal ligation facilitated the design of functional probe and the adjustment of its binding strength compared to traditional DNA hairpin structure probes, which make it be used to detect DNA in a simple, rapid and easy way with the help of DNA strands displacement reaction. The method was sensitive and also possesses the good specificity to differentiate the single base mismatched DNA from the complementary DNA. It was also successfully applied to study the damage effect of classic genotoxicity chemicals such as styrene oxide and sodium arsenite on DNA, which was significant in food science, environmental science and pharmaceutical science.

  17. DNA rendering of polyhedral meshes at the nanoscale

    NASA Astrophysics Data System (ADS)

    Benson, Erik; Mohammed, Abdulmelik; Gardell, Johan; Masich, Sergej; Czeizler, Eugen; Orponen, Pekka; Högberg, Björn

    2015-07-01

    It was suggested more than thirty years ago that Watson-Crick base pairing might be used for the rational design of nanometre-scale structures from nucleic acids. Since then, and especially since the introduction of the origami technique, DNA nanotechnology has enabled increasingly more complex structures. But although general approaches for creating DNA origami polygonal meshes and design software are available, there are still important constraints arising from DNA geometry and sense/antisense pairing, necessitating some manual adjustment during the design process. Here we present a general method of folding arbitrary polygonal digital meshes in DNA that readily produces structures that would be very difficult to realize using previous approaches. The design process is highly automated, using a routeing algorithm based on graph theory and a relaxation simulation that traces scaffold strands through the target structures. Moreover, unlike conventional origami designs built from close-packed helices, our structures have a more open conformation with one helix per edge and are therefore stable under the ionic conditions usually used in biological assays.

  18. DNA rendering of polyhedral meshes at the nanoscale.

    PubMed

    Benson, Erik; Mohammed, Abdulmelik; Gardell, Johan; Masich, Sergej; Czeizler, Eugen; Orponen, Pekka; Högberg, Björn

    2015-07-23

    It was suggested more than thirty years ago that Watson-Crick base pairing might be used for the rational design of nanometre-scale structures from nucleic acids. Since then, and especially since the introduction of the origami technique, DNA nanotechnology has enabled increasingly more complex structures. But although general approaches for creating DNA origami polygonal meshes and design software are available, there are still important constraints arising from DNA geometry and sense/antisense pairing, necessitating some manual adjustment during the design process. Here we present a general method of folding arbitrary polygonal digital meshes in DNA that readily produces structures that would be very difficult to realize using previous approaches. The design process is highly automated, using a routeing algorithm based on graph theory and a relaxation simulation that traces scaffold strands through the target structures. Moreover, unlike conventional origami designs built from close-packed helices, our structures have a more open conformation with one helix per edge and are therefore stable under the ionic conditions usually used in biological assays.

  19. Minor groove binding of a bis-quaternary ammonium compound: the crystal structure of SN 7167 bound to d(CGCGAATTCGCG)2.

    PubMed Central

    Squire, C J; Clark, G R; Denny, W A

    1997-01-01

    The X-ray crystal structure of the complex between the synthetic antitumour and antiviral DNA binding ligand SN 7167 and the DNA oligonucleotide d(CGCGAATTCGCG)2 has been determined to an R factor of 18.3% at 2.6 A resolution. The ligand is located within the minor groove and covers almost 6 bp with the 1-methylpyridinium ring extending as far as the C9-G16 base pair and the 1-methylquinolinium ring lying between the G4-C21 and A5-T20 base pairs. The ligand interacts only weakly with the DNA, as evidenced by long range contacts and shallow penetration into the groove. This structure is compared with that of the complex between the parent compound SN 6999 and the alkylated DNA sequence d(CGC[e6G]AATTCGCG)2. There are significant differences between the two structures in the extent of DNA bending, ligand conformation and groove binding. PMID:9321660

  20. High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

    PubMed

    Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2015-11-02

    Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. A high-throughput assay for the comprehensive profiling of DNA ligase fidelity

    PubMed Central

    Lohman, Gregory J. S.; Bauer, Robert J.; Nichols, Nicole M.; Mazzola, Laurie; Bybee, Joanna; Rivizzigno, Danielle; Cantin, Elizabeth; Evans, Thomas C.

    2016-01-01

    DNA ligases have broad application in molecular biology, from traditional cloning methods to modern synthetic biology and molecular diagnostics protocols. Ligation-based detection of polynucleotide sequences can be achieved by the ligation of probe oligonucleotides when annealed to a complementary target sequence. In order to achieve a high sensitivity and low background, the ligase must efficiently join correctly base-paired substrates, while discriminating against the ligation of substrates containing even one mismatched base pair. In the current study, we report the use of capillary electrophoresis to rapidly generate mismatch fidelity profiles that interrogate all 256 possible base-pair combinations at a ligation junction in a single experiment. Rapid screening of ligase fidelity in a 96-well plate format has allowed the study of ligase fidelity in unprecedented depth. As an example of this new method, herein we report the ligation fidelity of Thermus thermophilus DNA ligase at a range of temperatures, buffer pH and monovalent cation strength. This screen allows the selection of reaction conditions that maximize fidelity without sacrificing activity, while generating a profile of specific mismatches that ligate detectably under each set of conditions. PMID:26365241

  2. A high-throughput assay for the comprehensive profiling of DNA ligase fidelity.

    PubMed

    Lohman, Gregory J S; Bauer, Robert J; Nichols, Nicole M; Mazzola, Laurie; Bybee, Joanna; Rivizzigno, Danielle; Cantin, Elizabeth; Evans, Thomas C

    2016-01-29

    DNA ligases have broad application in molecular biology, from traditional cloning methods to modern synthetic biology and molecular diagnostics protocols. Ligation-based detection of polynucleotide sequences can be achieved by the ligation of probe oligonucleotides when annealed to a complementary target sequence. In order to achieve a high sensitivity and low background, the ligase must efficiently join correctly base-paired substrates, while discriminating against the ligation of substrates containing even one mismatched base pair. In the current study, we report the use of capillary electrophoresis to rapidly generate mismatch fidelity profiles that interrogate all 256 possible base-pair combinations at a ligation junction in a single experiment. Rapid screening of ligase fidelity in a 96-well plate format has allowed the study of ligase fidelity in unprecedented depth. As an example of this new method, herein we report the ligation fidelity of Thermus thermophilus DNA ligase at a range of temperatures, buffer pH and monovalent cation strength. This screen allows the selection of reaction conditions that maximize fidelity without sacrificing activity, while generating a profile of specific mismatches that ligate detectably under each set of conditions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Uracil recognition by replicative DNA polymerases is limited to the archaea, not occurring with bacteria and eukarya.

    PubMed

    Wardle, Josephine; Burgers, Peter M J; Cann, Isaac K O; Darley, Kate; Heslop, Pauline; Johansson, Erik; Lin, Li-Jung; McGlynn, Peter; Sanvoisin, Jonathan; Stith, Carrie M; Connolly, Bernard A

    2008-02-01

    Family B DNA polymerases from archaea such as Pyrococcus furiosus, which live at temperatures approximately 100 degrees C, specifically recognize uracil in DNA templates and stall replication in response to this base. Here it is demonstrated that interaction with uracil is not restricted to hyperthermophilic archaea and that the polymerase from mesophilic Methanosarcina acetivorans shows identical behaviour. The family B DNA polymerases replicate the genomes of archaea, one of the three fundamental domains of life. This publication further shows that the DNA replicating polymerases from the other two domains, bacteria (polymerase III) and eukaryotes (polymerases delta and epsilon for nuclear DNA and polymerase gamma for mitochondrial) are also unable to recognize uracil. Uracil occurs in DNA as a result of deamination of cytosine, either in G:C base-pairs or, more rapidly, in single stranded regions produced, for example, during replication. The resulting G:U mis-pairs/single stranded uracils are promutagenic and, unless repaired, give rise to G:C to A:T transitions in 50% of the progeny. The confinement of uracil recognition to polymerases of the archaeal domain is discussed in terms of the DNA repair pathways necessary for the elimination of uracil.

  4. Simultaneous identification and DNA barcoding of six Eimeria species infecting turkeys using PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus.

    PubMed

    Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R

    2015-05-01

    Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.

  5. Identification of aster yellows phytoplasma in garlic and green onion by PCR-based methods.

    PubMed

    Khadhair, A H; Evans, I R; Choban, B

    2002-01-01

    In the summer of 1999, typical yellows-type symptoms were observed on garlic and green onion plants in a number of gardens and plots around Edmonton, Alberta, Canada. DNA was extracted from leaf tissues of evidently healthy and infected plants. DNA amplifications were conducted on these samples, using two primer pairs, R16F2n/R2 and R16(1)F1/R1, derived from phytoplasma rDNA sequences. DNA samples of aster yellows (AY), lime witches'-broom (LWB) and potato witches'-broom (PWB) phytoplasmas served as controls and were used to determine group relatedness. In a direct polymerase chain reaction (PCR) assay, DNA amplification with universal primer pair R16F2n/R2 gave the expected amplified products of 1.2 kb. Dilution (1/40) of each of the latter products were used as template and nested with specific primer pair R16(1)F1/R1. An expected PCR product of 1.1 kb was obtained from each phytoplasma-infected garlic and green onion samples, LWB and AY phytoplasmas but not from PWB phytoplasma. An aliquot from each amplification product (1.2 kb) with universal primers was subjected to PCR-based restriction fragment length polymorphism (RFLP) to identify phytoplasma isolates, using four restriction endonucleases (AluI, KpnI, MseI and RsaI). DNA amplification with specific primer pair R16(1)F1/R1 and RFLP analysis indicated the presence of AY phytoplasma in the infected garlic and green onion samples. These results suggest that AY phytoplasma in garlic and green onion samples belong to the subgroup 16Sr1-A.

  6. Simultaneous binding to the tracking strand, displaced strand and the duplex of a DNA fork enhances unwinding by Dda helicase

    PubMed Central

    Aarattuthodiyil, Suja; Byrd, Alicia K.; Raney, Kevin D.

    2014-01-01

    Interactions between helicases and the tracking strand of a DNA substrate are well-characterized; however, the role of the displaced strand is a less understood characteristic of DNA unwinding. Dda helicase exhibited greater processivity when unwinding a DNA fork compared to a ss/ds DNA junction substrate. The lag phase in the unwinding progress curve was reduced for the forked DNA compared to the ss/ds junction. Fewer kinetic steps were required to unwind the fork compared to the ss/ds junction, suggesting that binding to the fork leads to disruption of the duplex. DNA footprinting confirmed that interaction of Dda with a fork leads to two base pairs being disrupted whereas no disruption of base pairing was observed with the ss/ds junction. Neutralization of the phosphodiester backbone resulted in a DNA-footprinting pattern similar to that observed with the ss/ds junction, consistent with disruption of the interaction between Dda and the displaced strand. Several basic residues in the 1A domain which were previously proposed to bind to the incoming duplex DNA were replaced with alanines, resulting in apparent loss of interaction with the duplex. Taken together, these results suggest that Dda interaction with the tracking strand, displaced strand and duplex coordinates DNA unwinding. PMID:25249618

  7. Force regulated dynamics of RPA on a DNA fork.

    PubMed

    Kemmerich, Felix E; Daldrop, Peter; Pinto, Cosimo; Levikova, Maryna; Cejka, Petr; Seidel, Ralf

    2016-07-08

    Replication protein A (RPA) is a single-stranded DNA binding protein, involved in most aspects of eukaryotic DNA metabolism. Here, we study the behavior of RPA on a DNA substrate that mimics a replication fork. Using magnetic tweezers we show that both yeast and human RPA can open forked DNA when sufficient external tension is applied. In contrast, at low force, RPA becomes rapidly displaced by the rehybridization of the DNA fork. This process appears to be governed by the binding or the release of an RPA microdomain (toehold) of only few base-pairs length. This gives rise to an extremely rapid exchange dynamics of RPA at the fork. Fork rezipping rates reach up to hundreds of base-pairs per second, being orders of magnitude faster than RPA dissociation from ssDNA alone. Additionally, we show that RPA undergoes diffusive motion on ssDNA, such that it can be pushed over long distances by a rezipping fork. Generally the behavior of both human and yeast RPA homologs is very similar. However, in contrast to yeast RPA, the dissociation of human RPA from ssDNA is greatly reduced at low Mg(2+) concentrations, such that human RPA can melt DNA in absence of force. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. [Structural and Dipole Structure Peculiarities of Hoogsteen Base Pairs Formed in Complementary Nucleobases according to ab initio Quantum Mechanics Studies].

    PubMed

    Petrenko, Y M

    2015-01-01

    Ab initio quantum mechanics studies for the detection of structure and dipole structure peculiarities of Hoogsteen base pairs relative to Watson-Crick base pairs, were performed during our work. These base pairs are formed as a result of complementary interactions. It was revealed, that adenine-thymine Hoogsteen base pair and adenine-thymine Watson-Crick base pairs can be formed depending on initial configuration. Cytosine-guanine Hoogsteen pairs are formed only when cytosine was originally protonated. Both types of Hoogsteen pairs have noticeable difference in the bond distances and angles. These differences appeared in purine as well as in pyrimidine parts of the pairs. Hoogsteen pairs have mostly shorter hydrogen bond lengths and significantly larger angles of hydrogen bonds and larger angles between the hydrogen bonds than Watson-Crick base pairs. Notable differences are also observed with respect to charge distribution and dipole moment. Quantitative data on these differences are shown in our work. It is also reported that the values of local parameters (according to Cambridge classification of the parameters which determine DNA properties) in Hoogsteen base pairs, are greatly different from Watson-Crick ones.

  9. Studies of Single Biomolecules, DNA Conformational Dynamics, and Protein Binding

    DTIC Science & Technology

    2008-07-11

    Nucleotide Base pairs Hydrogen bonds FIG. 1: Ladder structure of DNA showing the Watson - Crick bonding of the bases A, T, G, and C which are suspended by a...protected against unwanted action of chemicals and proteins. The three-dimensional structure of DNA is the famed Watson - Crick double-helix, the equilibrium...quantitative analysis [88]. [1] A. Kornberg and T. A. Baker, DNA Replication (W. H. Freeman, New York, 1992). [2] J. D. Watson and F. H. C. Crick

  10. Altering the Electrostatic Potential in the Major Groove: Thermodynamic and Structural Characterization of 7-Deaza-2;#8242;-deoxyadenosine:dT Base Pairing in DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kowal, Ewa A.; Ganguly, Manjori; Pallan, Pradeep S.

    As part of an ongoing effort to explore the effect of major groove electrostatics on the thermodynamic stability and structure of DNA, a 7-deaza-2'-deoxyadenosine:dT (7-deaza-dA:dT) base pair in the Dickerson-Drew dodecamer (DDD) was studied. The removal of the electronegative N7 atom on dA and the replacement with an electropositive C-H in the major groove was expected to have a significant effect on major groove electrostatics. The structure of the 7-deaza-dA:dT base pair was determined at 1.1 {angstrom} resolution in the presence of Mg{sup 2+}. The 7-deaza-dA, which is isosteric for dA, had minimal effect on the base pairing geometry andmore » the conformation of the DDD in the crystalline state. There was no major groove cation association with the 7-deaza-dA heterocycle. In solution, circular dichroism showed a positive Cotton effect centered at 280 nm and a negative Cotton effect centered at 250 nm that were characteristic of a right-handed helix in the B-conformation. However, temperature-dependent NMR studies showed increased exchange between the thymine N3 imino proton of the 7-deaza-dA:dT base pair and water, suggesting reduced stacking interactions and an increased rate of base pair opening. This correlated with the observed thermodynamic destabilization of the 7-deaza-dA modified duplex relative to the DDD. A combination of UV melting and differential scanning calorimetry experiments were conducted to evaluate the relative contributions of enthalpy and entropy in the thermodynamic destabilization of the DDD. The most significant contribution arose from an unfavorable enthalpy term, which probably results from less favorable stacking interactions in the modified duplex, which was accompanied by a significant reduction in the release of water and cations from the 7-deaza-dA modified DNA.« less

  11. Altering the Electrostatic Potential in the Major Groove: Thermodynamic and Structural Characterization of 7-Deaza-2′-deoxyadenosine:dT Base Pairing in DNA

    PubMed Central

    2011-01-01

    As part of an ongoing effort to explore the effect of major groove electrostatics on the thermodynamic stability and structure of DNA, a 7-deaza-2′-deoxyadenosine:dT (7-deaza-dA:dT) base pair in the Dickerson–Drew dodecamer (DDD) was studied. The removal of the electronegative N7 atom on dA and the replacement with an electropositive C–H in the major groove was expected to have a significant effect on major groove electrostatics. The structure of the 7-deaza-dA:dT base pair was determined at 1.1 Å resolution in the presence of Mg2+. The 7-deaza-dA, which is isosteric for dA, had minimal effect on the base pairing geometry and the conformation of the DDD in the crystalline state. There was no major groove cation association with the 7-deaza-dA heterocycle. In solution, circular dichroism showed a positive Cotton effect centered at 280 nm and a negative Cotton effect centered at 250 nm that were characteristic of a right-handed helix in the B-conformation. However, temperature-dependent NMR studies showed increased exchange between the thymine N3 imino proton of the 7-deaza-dA:dT base pair and water, suggesting reduced stacking interactions and an increased rate of base pair opening. This correlated with the observed thermodynamic destabilization of the 7-deaza-dA modified duplex relative to the DDD. A combination of UV melting and differential scanning calorimetry experiments were conducted to evaluate the relative contributions of enthalpy and entropy in the thermodynamic destabilization of the DDD. The most significant contribution arose from an unfavorable enthalpy term, which probably results from less favorable stacking interactions in the modified duplex, which was accompanied by a significant reduction in the release of water and cations from the 7-deaza-dA modified DNA. PMID:22059929

  12. Duplex Interrogation by a Direct DNA Repair Protein in Search of Base Damage

    PubMed Central

    Yi, Chengqi; Chen, Baoen; Qi, Bo; Zhang, Wen; Jia, Guifang; Zhang, Liang; Li, Charles J.; Dinner, Aaron R.; Yang, Cai-Guang; He, Chuan

    2012-01-01

    ALKBH2 is a direct DNA repair dioxygenase guarding mammalian genome against N1-methyladenine, N3-methylcytosine, and 1,N6-ethenoadenine damage. A prerequisite for repair is to identify these lesions in the genome. Here we present crystal structures of ALKBH2 bound to different duplex DNAs. Together with computational and biochemical analyses, our results suggest that DNA interrogation by ALKBH2 displays two novel features: i) ALKBH2 probes base-pair stability and detects base pairs with reduced stability; ii) ALKBH2 does not have nor need a “damage-checking site”, which is critical for preventing spurious base-cleavage for several glycosylases. The demethylation mechanism of ALKBH2 insures that only cognate lesions are oxidized and reversed to normal bases, and that a flipped, non-substrate base remains intact in the active site. Overall, the combination of duplex interrogation and oxidation chemistry allows ALKBH2 to detect and process diverse lesions efficiently and correctly. PMID:22659876

  13. A nucleotide-analogue-induced gain of function corrects the error-prone nature of human DNA polymerase iota.

    PubMed

    Ketkar, Amit; Zafar, Maroof K; Banerjee, Surajit; Marquez, Victor E; Egli, Martin; Eoff, Robert L

    2012-06-27

    Y-family DNA polymerases participate in replication stress and DNA damage tolerance mechanisms. The properties that allow these enzymes to copy past bulky adducts or distorted template DNA can result in a greater propensity for them to make mistakes. Of the four human Y-family members, human DNA polymerase iota (hpol ι) is the most error-prone. In the current study, we elucidate the molecular basis for improving the fidelity of hpol ι through use of the fixed-conformation nucleotide North-methanocarba-2'-deoxyadenosine triphosphate (N-MC-dATP). Three crystal structures were solved of hpol ι in complex with DNA containing a template 2'-deoxythymidine (dT) paired with an incoming dNTP or modified nucleotide triphosphate. The ternary complex of hpol ι inserting N-MC-dATP opposite dT reveals that the adenine ring is stabilized in the anti orientation about the pseudo-glycosyl torsion angle, which mimics precisely the mutagenic arrangement of dGTP:dT normally preferred by hpol ι. The stabilized anti conformation occurs without notable contacts from the protein but likely results from constraints imposed by the bicyclo[3.1.0]hexane scaffold of the modified nucleotide. Unmodified dATP and South-MC-dATP each adopt syn glycosyl orientations to form Hoogsteen base pairs with dT. The Hoogsteen orientation exhibits weaker base-stacking interactions and is less catalytically favorable than anti N-MC-dATP. Thus, N-MC-dATP corrects the error-prone nature of hpol ι by preventing the Hoogsteen base-pairing mode normally observed for hpol ι-catalyzed insertion of dATP opposite dT. These results provide a previously unrecognized means of altering the efficiency and the fidelity of a human translesion DNA polymerase.

  14. A nucleotide analogue induced gain of function corrects the error-prone nature of human DNA polymerase iota

    PubMed Central

    Ketkar, Amit; Zafar, Maroof K.; Banerjee, Surajit; Marquez, Victor E.; Egli, Martin; Eoff, Robert L

    2012-01-01

    Y-family DNA polymerases participate in replication stress and DNA damage tolerance mechanisms. The properties that allow these enzymes to copy past bulky adducts or distorted template DNA can result in a greater propensity for them to make mistakes. Of the four human Y-family members, human DNA polymerase iota (hpol ι) is the most error-prone. In the current study, we elucidate the molecular basis for improving the fidelity of hpol ι through use of the fixed-conformation nucleotide North-methanocarba-2′-deoxyadenosine triphosphate (N-MC-dATP). Three crystal structures were solved of hpol ι in complex with DNA containing a template 2′-deoxythymidine (dT) paired with an incoming dNTP or modified nucleotide triphosphate. The ternary complex of hpol ι inserting N-MC-dATP opposite dT reveals that the adenine ring is stabilized in the anti orientation about the pseudo-glycosyl torsion angle (χ), which mimics precisely the mutagenic arrangement of dGTP:dT normally preferred by hpol ι. The stabilized anti conformation occurs without notable contacts from the protein but likely results from constraints imposed by the bicyclo[3.1.0]hexane scaffold of the modified nucleotide. Unmodified dATP and South-MC-dATP each adopt syn glycosyl orientations to form Hoogsteen base pairs with dT. The Hoogsteen orientation exhibits weaker base stacking interactions and is less catalytically favorable than anti N-MC-dATP. Thus, N-MC-dATP corrects the error-prone nature of hpol ι by preventing the Hoogsteen base-pairing mode normally observed for hpol ι-catalyzed insertion of dATP opposite dT. These results provide a previously unrecognized means of altering the efficiency and the fidelity of a human translesion DNA polymerase. PMID:22632140

  15. Mechanism of error-free DNA synthesis across N1-methyl-deoxyadenosine by human DNA polymerase-ι

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jain, Rinku; Choudhury, Jayati Roy; Buku, Angeliki

    N1-methyl-deoxyadenosine (1-MeA) is formed by methylation of deoxyadenosine at the N1 atom. 1-MeA presents a block to replicative DNA polymerases due to its inability to participate in Watson-Crick (W-C) base pairing. Here we determine how human DNA polymerase-ι (Polι) promotes error-free replication across 1-MeA. Steady state kinetic analyses indicate that Polι is ~100 fold more efficient in incorporating the correct nucleotide T versus the incorrect nucleotide C opposite 1-MeA. To understand the basis of this selectivity, we determined ternary structures of Polι bound to template 1-MeA and incoming dTTP or dCTP. In both structures, template 1-MeA rotates to the synmore » conformation but pairs differently with dTTP versus dCTP. Thus, whereas dTTP partakes in stable Hoogsteen base pairing with 1-MeA, dCTP fails to gain a “foothold” and is largely disordered. Together, our kinetic and structural studies show how Polι maintains discrimination between correct and incorrect incoming nucleotide opposite 1-MeA in preserving genome integrity.« less

  16. Manipulation of double-stranded DNA melting by force

    NASA Astrophysics Data System (ADS)

    Singh, Amit Raj; Granek, Rony

    2017-09-01

    By integrating elasticity—as described by the Gaussian network model—with bond binding energies that distinguish between different base-pair identities and stacking configurations, we study the force induced melting of a double-stranded DNA (dsDNA). Our approach is a generalization of our previous study of thermal dsDNA denaturation [J. Chem. Phys. 145, 144101 (2016), 10.1063/1.4964285] to that induced by force at finite temperatures. It allows us to obtain semimicroscopic information about the opening of the chain, such as whether the dsDNA opens from one of the ends or from the interior, forming an internal bubble. We study different types of force manipulation: (i) "end unzipping," with force acting at a single end base pair perpendicular to the helix, (ii) "midunzipping," with force acting at a middle base pair perpendicular to the helix, and (iii) "end shearing," where the force acts at opposite ends along the helix. By monitoring the free-energy landscape and probability distribution of intermediate denaturation states, we show that different dominant intermediate states are stabilized depending on the type of force manipulation used. In particular, the bubble state of the sequence L60B36, which we have previously found to be a stable state during thermal denaturation, is absent for end unzipping and end shearing, whereas very similar bubbles are stabilized by midunzipping, or when the force location is near the middle of the chain. Ours results offer a simple tool for stabilizing bubbles and loops using force manipulations at different temperatures, and may implicate on the mechanism in which DNA enzymes or motors open regions of the chain.

  17. Covalent Bonding of Pyrrolobenzodiazepines (PBDs) to Terminal Guanine Residues within Duplex and Hairpin DNA Fragments

    PubMed Central

    Mantaj, Julia; Jackson, Paul J. M.; Karu, Kersti; Rahman, Khondaker M.; Thurston, David E.

    2016-01-01

    Pyrrolobenzodiazepines (PBDs) are covalent-binding DNA-interactive agents with growing importance as payloads in Antibody Drug Conjugates (ADCs). Until now, PBDs were thought to covalently bond to C2-NH2 groups of guanines in the DNA-minor groove across a three-base-pair recognition sequence. Using HPLC/MS methodology with designed hairpin and duplex oligonucleotides, we have now demonstrated that the PBD Dimer SJG-136 and the C8-conjugated PBD Monomer GWL-78 can covalently bond to a terminal guanine of DNA, with the PBD skeleton spanning only two base pairs. Control experiments with the non-C8-conjugated anthramycin along with molecular dynamics simulations suggest that the C8-substituent of a PBD Monomer, or one-half of a PBD Dimer, may provide stability for the adduct. This observation highlights the importance of PBD C8-substituents, and also suggests that PBDs may bind to terminal guanines within stretches of DNA in cells, thus representing a potentially novel mechanism of action at the end of DNA strand breaks. PMID:27055050

  18. Statistical properties of DNA sequences

    NASA Technical Reports Server (NTRS)

    Peng, C. K.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Simons, M.; Stanley, H. E.

    1995-01-01

    We review evidence supporting the idea that the DNA sequence in genes containing non-coding regions is correlated, and that the correlation is remarkably long range--indeed, nucleotides thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene. We resolve the problem of the "non-stationarity" feature of the sequence of base pairs by applying a new algorithm called detrended fluctuation analysis (DFA). We address the claim of Voss that there is no difference in the statistical properties of coding and non-coding regions of DNA by systematically applying the DFA algorithm, as well as standard FFT analysis, to every DNA sequence (33301 coding and 29453 non-coding) in the entire GenBank database. Finally, we describe briefly some recent work showing that the non-coding sequences have certain statistical features in common with natural and artificial languages. Specifically, we adapt to DNA the Zipf approach to analyzing linguistic texts. These statistical properties of non-coding sequences support the possibility that non-coding regions of DNA may carry biological information.

  19. Submolecular Structure and Orientation of Oligonucleotide Duplexes Tethered to Gold Electrodes Probed by Infrared Reflection Absorption Spectroscopy: Effect of the Electrode Potentials.

    PubMed

    Kékedy-Nagy, László; Ferapontova, Elena E; Brand, Izabella

    2017-02-23

    Unique electronic and ligand recognition properties of the DNA double helix provide basis for DNA applications in biomolecular electronic and biosensor devices. However, the relation between the structure of DNA at electrified interfaces and its electronic properties is still not well understood. Here, potential-driven changes in the submolecular structure of DNA double helices composed of either adenine-thymine (dAdT) 25 or cytosine-guanine (dGdC) 20 base pairs tethered to the gold electrodes are for the first time analyzed by in situ polarization modulation infrared reflection absorption spectroscopy (PM IRRAS) performed under the electrochemical control. It is shown that the conformation of the DNA duplexes tethered to gold electrodes via the C 6 alkanethiol linker strongly depends on the nucleic acid sequence composition. The tilt of purine and pyrimidine rings of the complementary base pairs (dAdT and dGdC) depends on the potential applied to the electrode. By contrast, neither the conformation nor orientation of the ionic in character phosphate-sugar backbone is affected by the electrode potentials. At potentials more positive than the potential of zero charge (pzc), a gradual tilting of the double helix is observed. In this tilted orientation, the planes of the complementary purine and pyrimidine rings lie ideally parallel to each other. These potentials do not affect the integral stability of the DNA double helix at the charged interface. At potentials more negative than the pzc, DNA helices adopt a vertical to the gold surface orientation. Tilt of the purine and pyrimidine rings depends on the composition of the double helix. In monolayers composed of (dAdT) 25 molecules the rings of the complementary base pairs lie parallel to each other. By contrast, the tilt of purine and pyrimidine rings in (dGdC) 20 helices depends on the potential applied to the electrode. Such potential-induced mobility of the complementary base pairs can destabilize the helix structure at a submolecular level. These pioneer results on the potential-driven changes in the submolecular structure of double stranded DNA adsorbed on conductive supports contribute to further understanding of the potential-driven sequence-specific electronic properties of surface-tethered oligonucleotides.

  20. Replication of a carcinogenic nitropyrene DNA lesion by human Y-family DNA polymerase

    PubMed Central

    Kirouac, Kevin N.; Basu, Ashis K.; Ling, Hong

    2013-01-01

    Nitrated polycyclic aromatic hydrocarbons are common environmental pollutants, of which many are mutagenic and carcinogenic. 1-Nitropyrene is the most abundant nitrated polycyclic aromatic hydrocarbon, which causes DNA damage and is carcinogenic in experimental animals. Error-prone translesion synthesis of 1-nitropyrene–derived DNA lesions generates mutations that likely play a role in the etiology of cancer. Here, we report two crystal structures of the human Y-family DNA polymerase iota complexed with the major 1-nitropyrene DNA lesion at the insertion stage, incorporating either dCTP or dATP nucleotide opposite the lesion. Polι maintains the adduct in its active site in two distinct conformations. dCTP forms a Watson–Crick base pair with the adducted guanine and excludes the pyrene ring from the helical DNA, which inhibits replication beyond the lesion. By contrast, the mismatched dATP stacks above the pyrene ring that is intercalated in the helix and achieves a productive conformation for misincorporation. The intra-helical bulky pyrene mimics a base pair in the active site and facilitates adenine misincorporation. By structure-based mutagenesis, we show that the restrictive active site of human polη prevents the intra-helical conformation and A-base misinsertions. This work provides one of the molecular mechanisms for G to T transversions, a signature mutation in human lung cancer. PMID:23268450

  1. DNA Nanotechnology for Cancer Therapy

    PubMed Central

    Kumar, Vinit; Palazzolo, Stefano; Bayda, Samer; Corona, Giuseppe; Toffoli, Giuseppe; Rizzolio, Flavio

    2016-01-01

    DNA nanotechnology is an emerging and exciting field, and represents a forefront frontier for the biomedical field. The specificity of the interactions between complementary base pairs makes DNA an incredible building material for programmable and very versatile two- and three-dimensional nanostructures called DNA origami. Here, we analyze the DNA origami and DNA-based nanostructures as a drug delivery system. Besides their physical-chemical nature, we dissect the critical factors such as stability, loading capability, release and immunocompatibility, which mainly limit in vivo applications. Special attention was dedicated to highlighting the boundaries to be overcome to bring DNA nanostructures closer to the bedside of patients. PMID:27022418

  2. Molecular mechanical studies of DNA flexibility: Coupled backbone torsion angles and base-pair openings

    PubMed Central

    Keepers, Joe W.; Kollman, Peter A.; Weiner, Paul K.; James, Thomas L.

    1982-01-01

    Molecular mechanics studies have been carried out on “B-DNA-like” structures of [d(C-G-C-G-A-A-T-T-C-G-C-G)]2 and [d(A)]12·[d(T)]12. Each of the backbone torsion angles (ψ, φ, ω, ω′, φ′) has been “forced” to alternative values from the normal B-DNA values (g+, t, g-, g-, t conformations). Compensating torsion angle changes preserve most of the base stacking energy in the double helix. In a second part of the study, one purine N3-pyrimidine N1 distance at a time has been forced to a value of 6 Å in an attempt to simulate the base opening motions required to rationalize proton exchange data for DNA. When the 6-Å constraint is removed, many of the structures revert to the normal Watson-Crick hydrogen-bonded structure, but a number are trapped in structures ≈5 kcal/mol higher in energy than the starting B-DNA structure. The relative energy of these structures, some of which involve a non-Watson-Crick thymine C2(carbonyl)[unk]adenine 6NH2 hydrogen bond, are qualitatively consistent with the ΔH for a “base pair-open state” suggested by Mandal et al. of 4-6 kcal/mol [Mandal, C., Kallenbach, N. R. & Englander, S. W. (1979) J. Mol. Biol. 135, 391-411]. The picture of DNA flexibility emerging from this study depicts the backbone as undergoing rapid motion between local torsional minima on a nanosecond time scale. Backbone motion is mainly localized within a dinucleoside segment and generally not conformationally coupled along the chain or across the base pairs. Base motions are much smaller in magnitude than backbone motions. Base sliding allows imino N—H exchange, but it is localized, and only a small fraction of the N—H groups is exposed at any one time. Stacking and hydrogen bonding cause a rigid core of bases in the center of the molecule accounting for the hydrodynamic properties of DNA. PMID:6957879

  3. Sequence periodicity in nucleosomal DNA and intrinsic curvature.

    PubMed

    Nair, T Murlidharan

    2010-05-17

    Most eukaryotic DNA contained in the nucleus is packaged by wrapping DNA around histone octamers. Histones are ubiquitous and bind most regions of chromosomal DNA. In order to achieve smooth wrapping of the DNA around the histone octamer, the DNA duplex should be able to deform and should possess intrinsic curvature. The deformability of DNA is a result of the non-parallelness of base pair stacks. The stacking interaction between base pairs is sequence dependent. The higher the stacking energy the more rigid the DNA helix, thus it is natural to expect that sequences that are involved in wrapping around the histone octamer should be unstacked and possess intrinsic curvature. Intrinsic curvature has been shown to be dictated by the periodic recurrence of certain dinucleotides. Several genome-wide studies directed towards mapping of nucleosome positions have revealed periodicity associated with certain stretches of sequences. In the current study, these sequences have been analyzed with a view to understand their sequence-dependent structures. Higher order DNA structures and the distribution of molecular bend loci associated with 146 base nucleosome core DNA sequence from C. elegans and chicken have been analyzed using the theoretical model for DNA curvature. The curvature dispersion calculated by cyclically permuting the sequences revealed that the molecular bend loci were delocalized throughout the nucleosome core region and had varying degrees of intrinsic curvature. The higher order structures associated with nucleosomes of C.elegans and chicken calculated from the sequences revealed heterogeneity with respect to the deviation of the DNA axis. The results points to the possibility of context dependent curvature of varying degrees to be associated with nucleosomal DNA.

  4. Kinetic selection vs. free energy of DNA base pairing in control of polymerase fidelity.

    PubMed

    Oertell, Keriann; Harcourt, Emily M; Mohsen, Michael G; Petruska, John; Kool, Eric T; Goodman, Myron F

    2016-04-19

    What is the free energy source enabling high-fidelity DNA polymerases (pols) to favor incorporation of correct over incorrect base pairs by 10(3)- to 10(4)-fold, corresponding to free energy differences of ΔΔGinc∼ 5.5-7 kcal/mol? Standard ΔΔG° values (∼0.3 kcal/mol) calculated from melting temperature measurements comparing matched vs. mismatched base pairs at duplex DNA termini are far too low to explain pol accuracy. Earlier analyses suggested that pol active-site steric constraints can amplify DNA free energy differences at the transition state (kinetic selection). A recent paper [Olson et al. (2013)J Am Chem Soc135:1205-1208] used Vent pol to catalyze incorporations in the presence of inorganic pyrophosphate intended to equilibrate forward (polymerization) and backward (pyrophosphorolysis) reactions. A steady-state leveling off of incorporation profiles at long reaction times was interpreted as reaching equilibrium between polymerization and pyrophosphorolysis, yielding apparent ΔG° = -RTlnKeq, indicating ΔΔG° of 3.5-7 kcal/mol, sufficient to account for pol accuracy without need of kinetic selection. Here we perform experiments to measure and account for pyrophosphorolysis explicitly. We show that forward and reverse reactions attain steady states far from equilibrium for wrong incorporations such as G opposite T. Therefore,[Formula: see text]values obtained from such steady-state evaluations ofKeqare not dependent on DNA properties alone, but depend largely on constraints imposed on right and wrong substrates in the polymerase active site.

  5. Hairpin-shaped tetranuclear palladium(II) complex: synthesis, crystal structure, DNA binding and cytotoxicity activity studies.

    PubMed

    Gao, En-Jun; Wang, Ke-Hua; Zhu, Ming-Chang; Liu, Lei

    2010-07-01

    A novel tetranuclear palladium(II) complex [Pd(4)(phen)(4) (micro-pydc)(4)].10H(2)O (phen = 1,10-phenanthroline, pydc = pyridine-3,4-dicarboxylate) has been synthesized and characterized. In the tetranuclear complex, two pairs of dipalladated [Pd(phen)] moieties are bridged together by four pydc, presenting a hairpin molecular shape. The binding of the title complex with fish sperm DNA (FS-DNA) has been investigated by UV spectrum and fluorescence spectrum. All the results indicate that the complex bind to DNA in an intercalative mode and considerating the molecular shape and size, the dipalladated phenanthroline moieties bisintercalate to the base pairs of DNA. Agarose gel electrophoresis assay demonstrates the ability of the complex to cleave the pBR322 plasmid DNA. Cytotoxic activity studies show the complex exhibited good cytotoxic activity against four different cancer cell lines. Crown Copyright (c) 2010. Published by Elsevier Masson SAS. All rights reserved.

  6. Circulating tumor DNA functions as an alternative for tissue to overcome tumor heterogeneity in advanced gastric cancer.

    PubMed

    Gao, Jing; Wang, Haixing; Zang, Wanchun; Li, Beifang; Rao, Guanhua; Li, Lei; Yu, Yang; Li, Zhongwu; Dong, Bin; Lu, Zhihao; Jiang, Zhi; Shen, Lin

    2017-09-01

    Overcoming tumor heterogeneity is a major challenge for personalized treatment of gastric cancer, especially for human epidermal growth factor receptor-2 targeted therapy. Analysis of circulating tumor DNA allows a more comprehensive analysis of tumor heterogeneity than traditional biopsies in lung cancer and breast cancer, but little is known in gastric cancer. We assessed mutation profiles of ctDNA and primary tumors from 30 patients with advanced gastric cancer, then performed a comprehensive analysis of tumor mutations by multiple biopsies from five patients, and finally analyzed the concordance of HER2 amplification in ctDNA and paired tumor tissues in 70 patients. By comparing with a single tumor sample, ctDNA displayed a low concordance of mutation profile, only approximately 50% (138/275) somatic mutations were found in paired tissue samples, however, when compared with multiple biopsies, most DNA mutations in ctDNA were also shown in paired tumor tissues. ctDNA had a high concordance (91.4%, Kappa index = 0.784, P < 0.001) of HER2 amplification with tumor tissues, suggesting it might be an alternative for tissue. It implied that ctDNA-based assessment could partially overcome the tumor heterogeneity, and might serve as a potential surrogate for HER2 analysis in gastric cancer. © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

  7. Characterization of a tandemly repeated DNA sequence family originally derived by retroposition of tRNA(Glu) in the newt.

    PubMed

    Nagahashi, S; Endoh, H; Suzuki, Y; Okada, N

    1991-11-20

    A previous report from this laboratory showed that in vitro transcription of total genomic DNA of the newt Cynopus pyrrhogaster resulted in a discrete sized 8 S RNA, which represented highly repetitive and transcribable sequences with a glutamic acid tRNA-like structure in the newt genome. We isolated four independent clones from a newt genomic library and determined the complete sequences of three 2000 to 2400 base-pair PstI fragments spanning the 8 S RNA gene. The glutamic acid tRNA-related segment in the 8 S RNA gene contains the CCA sequence expected as the 3' terminus of a tRNA molecule. Further, the 11 nucleotides located 13 nucleotides upstream from one of the two transcription initiation sites of the 8 S RNA were found to be repeated in the region upstream from the termination site, suggesting that the original unit, which is shorter than the 8 S RNA, was retrotransposed via cDNA intermediates from the PolIII transcript. In the upstream region of the 8 S RNA gene, a 360 nucleotide unit containing the glutamic acid tRNA-related segment was found to be duplicated (clones NE1 and NE10) or triplicated (clone NE3). Except for the difference in the number of the 360 nucleotide unit, the three sequences of the 2000 to 2400 base-pair PstI fragment were essentially the same with only a few mutations and minor deletions. Inverse polymerase chain reaction and sequence determination of the products, together with a Southern hybridization experiment, demonstrated that the family consists of a tandemly repeated unit of 3300, 3700 or 4100 base-pairs. Thus during evolution, this family in the newt was created by retroposition via cDNA intermediates, followed by duplication or triplication of the 360 nucleotide unit and multiplication of the 3300 to 4100 base-pair region at the DNA level.

  8. Recombination-dependent mtDNA partitioning: in vivo role of Mhr1p to promote pairing of homologous DNA.

    PubMed

    Ling, Feng; Shibata, Takehiko

    2002-09-02

    Yeast mhr1-1 was isolated as a defective mutation in mitochondrial DNA (mtDNA) recombination. About half of mhr1-1 cells lose mtDNA during growth at a higher temperature. Here, we show that mhr1-1 exhibits a defect in the partitioning of nascent mtDNA into buds and is a base-substitution mutation in MHR1 encoding a mitochondrial matrix protein. We found that the Mhr1 protein (Mhr1p) has activity to pair single-stranded DNA and homologous double-stranded DNA to form heteroduplex joints in vitro, and that mhr1-1 causes the loss of this activity, indicating its role in homologous mtDNA recombination. While the majority of the mtDNA in the mother cells consists of head-to-tail concatemers, more than half of the mtDNA in the buds exists as genome-sized monomers. The mhr1-1 deltacce1 double mutant cells do not maintain any mtDNA, indicating the strict dependence of mtDNA maintenance on recombination functions. These results suggest a mechanism for mtDNA inheritance similar to that operating in the replication and packaging of phage DNA.

  9. [The inadequacy of using the autosomal STR markers for the establishment of the kinship in the parent-child pairs].

    PubMed

    Kovtun, P A; Kuklev, M Iu; Lapenkov, M I; Plakhina, N V

    2013-01-01

    This article is concerned with the management of the disputable situations arising in the course of establishment of the kinship based on the analysis of autosomal STR loci. It is proposed to enhance the accuracy of determining thekinsip relations in the parent-child pairs (in the absence of one of the parents) by using additional sets of genetic markers localized for example on sex chromosomes, mitochondrial DNA (mtDNA) and bi-allele markers.

  10. A universal DNA-based protein detection system.

    PubMed

    Tran, Thua N N; Cui, Jinhui; Hartman, Mark R; Peng, Songming; Funabashi, Hisakage; Duan, Faping; Yang, Dayong; March, John C; Lis, John T; Cui, Haixin; Luo, Dan

    2013-09-25

    Protein immune detection requires secondary antibodies which must be carefully selected in order to avoid interspecies cross-reactivity, and is therefore restricted by the limited availability of primary/secondary antibody pairs. Here we present a versatile DNA-based protein detection system using a universal adapter to interface between IgG antibodies and DNA-modified reporter molecules. As a demonstration of this capability, we successfully used DNA nano-barcodes, quantum dots, and horseradish peroxidase enzyme to detect multiple proteins using our DNA-based labeling system. Our system not only eliminates secondary antibodies but also serves as a novel method platform for protein detection with modularity, high capacity, and multiplexed capability.

  11. A Universal DNA-Based Protein Detection System

    PubMed Central

    Tran, Thua N. N.; Cui, Jinhui; Hartman, Mark R.; Peng, Songming; Funabashi, Hisakage; Duan, Faping; Yang, Dayong; March, John C.; Lis, John T.; Cui, Haixin; Luo, Dan

    2014-01-01

    Protein immune detection requires secondary antibodies which must be carefully selected in order to avoid interspecies cross-reactivity, and is therefore restricted by the limited availability of primary/secondary antibody pairs. Here we present a versatile DNA-based protein detection system using a universal adapter to interface between IgG antibodies and DNA-modified reporter molecules. As a demonstration of this capability, we successfully used DNA nano-barcodes, quantum dots, and horseradish peroxidase enzyme to detect multiple proteins using our DNA-based labeling system. Our system not only eliminates secondary antibodies but also serves as a novel method platform for protein detection with modularity, high capacity, and multiplexed capability. PMID:23978265

  12. Technological applications arising from the interactions of DNA bases with metal ions.

    PubMed

    Park, Ki Soo; Park, Hyun Gyu

    2014-08-01

    An intense interest has grown in the unique interactions of nucleic acids with metal ions, which lead to the formation of metal-base pairs and the generation of fluorescent nanomaterials. In this review, different types of metal-base pairs, especially those formed from naturally occurring nucleosides, are described with emphasis also being given to recent advances made in employing these complexes to govern enzymatic reactions. The review also contains a comprehensive description of DNA-templated inorganic nanomaterials such as silver nanoclusters which possess excellent fluorescence properties. Finally, a summary is given about how these materials have led to recent advances in the field of nanobiotechnology. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. THz spectra and corresponding vibrational modes of DNA base pair cocrystals and polynucleotides

    NASA Astrophysics Data System (ADS)

    Wang, Fang; Zhao, Dongbo; Dong, Hao; Jiang, Ling; Huang, Lin; Liu, Yunfei; Li, Shuhua

    2018-07-01

    The generalized energy-based fragmentation (GEBF) approach has been applied to study the THz spectra and vibrational modes of base pair cocrystals under periodic boundary conditions (denoted as PBC-GEBF). Results of vibrational mode reveal that hydrogen bonds play a pivotal role in the pairing process of base crystals, where most Nsbnd H and Csbnd H bonds stretch to some extent. We also found that hydrogen bonds of a self-made A:T cocrystal completely break in a transition from liquid to the solid state, while self-made C:G cocrystal is different and easier to form a cocrystal, as confirmed by X-ray diffraction (XRD) and terahertz (THz) spectra. Furthermore, we have studied DNA polynucleotides (in both A and B forms) found that the vibrational modes changed a lot during the process of their forming double strand. Despite the key role played by hydrogen bonds, the key contribution originates from collective motions of the main skeleton. A comparative study of the spectra of some stranded fragments suggests that different sequences or forms have similar spectra in THz band. They distinguish from each other mainly in the low-frequency regions, especially below 1 THz. This study would make great contributions to the molecular dynamics model based DNA long-chain structure simulation in the future study.

  14. DNA Hairpins Containing the Cytidine Analog Pyrrolo-dC: Structural, Thermodynamic, and Spectroscopic Studies

    PubMed Central

    Zhang, Xu; Wadkins, Randy M.

    2009-01-01

    Structures formed by single-strand DNA have become increasingly interesting because of their roles in a number of biological processes, particularly transcription and its regulation. Of particular importance is the fact that antitumor drugs such as Actinomycin D can selectively bind DNA hairpins over fully paired, double-strand DNA. A new fluorescent base analog, pyrrolo-deoxycytidine (PdC), can now be routinely incorporated into single-strand DNA. The fluorescence of PdC is particularly useful for studying the formation of single-strand DNA in regions of double-strand DNA. The fluorescence is quenched when PdC is paired with a complementary guanine residue, and thus is greatly enhanced upon formation of single-strand DNA. Hence, any process that results in melting or opening of DNA strands produces an increase in the fluorescence intensity of this base analog. In this study we measured the structural effects of incorporating PdC into DNA hairpins, and the effect of this incorporation on the binding of the hairpins by a fluorescent analog of the drug Actinomycin D. Two hairpin DNAs were used: one with PdC in the stem (basepaired) and one with PdC in the loop (unpaired). The thermal stability, 7-aminoactinomycin D binding, and three-dimensional structures of PdC incorporated into these DNA hairpins were all quite similar as compared to the hairpins containing an unmodified dC residue. Fluorescence lifetime measurements indicate that two lifetimes are present in PdC, and that the increase in fluorescence of the unpaired PdC residue compared to the basepaired PdC is due to an increase in the contribution of the longer lifetime to the average fluorescence lifetime. Our data indicate that PdC can be used effectively to differentiate paired and unpaired bases in DNA hairpin secondary structures, and should be similarly applicable for related structures such as cruciforms and quadruplexes. Further, our data indicate that PdC can act as a fluorescence resonance energy transfer donor for the fluorescent drug 7-aminoactinomycin D. PMID:19254547

  15. DNA hairpins containing the cytidine analog pyrrolo-dC: structural, thermodynamic, and spectroscopic studies.

    PubMed

    Zhang, Xu; Wadkins, Randy M

    2009-03-04

    Structures formed by single-strand DNA have become increasingly interesting because of their roles in a number of biological processes, particularly transcription and its regulation. Of particular importance is the fact that antitumor drugs such as Actinomycin D can selectively bind DNA hairpins over fully paired, double-strand DNA. A new fluorescent base analog, pyrrolo-deoxycytidine (PdC), can now be routinely incorporated into single-strand DNA. The fluorescence of PdC is particularly useful for studying the formation of single-strand DNA in regions of double-strand DNA. The fluorescence is quenched when PdC is paired with a complementary guanine residue, and thus is greatly enhanced upon formation of single-strand DNA. Hence, any process that results in melting or opening of DNA strands produces an increase in the fluorescence intensity of this base analog. In this study we measured the structural effects of incorporating PdC into DNA hairpins, and the effect of this incorporation on the binding of the hairpins by a fluorescent analog of the drug Actinomycin D. Two hairpin DNAs were used: one with PdC in the stem (basepaired) and one with PdC in the loop (unpaired). The thermal stability, 7-aminoactinomycin D binding, and three-dimensional structures of PdC incorporated into these DNA hairpins were all quite similar as compared to the hairpins containing an unmodified dC residue. Fluorescence lifetime measurements indicate that two lifetimes are present in PdC, and that the increase in fluorescence of the unpaired PdC residue compared to the basepaired PdC is due to an increase in the contribution of the longer lifetime to the average fluorescence lifetime. Our data indicate that PdC can be used effectively to differentiate paired and unpaired bases in DNA hairpin secondary structures, and should be similarly applicable for related structures such as cruciforms and quadruplexes. Further, our data indicate that PdC can act as a fluorescence resonance energy transfer donor for the fluorescent drug 7-aminoactinomycin D.

  16. In vitro excision of adeno-associated virus DNA from recombinant plasmids: Isolation of an enzyme fraction from HeLa cells that cleaves DNA at poly(G) sequences

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gottlieb, J.; Muzyczka, N.

    1988-06-01

    When circular recombinant plasmids containing adeno-associated virus (AAV) DNA sequences are transfected into human cells, the AAV provirus is rescued. Using these circular AAV plasmids as substrates, the authors isolated an enzyme fraction from HeLa cell nuclear extracts that excises intact AAV DNA in vitro from vector DNA and produces linear DNA products. The recognition signal for the enzyme is a polypurine-polypyrimidine sequence which is at least 9 residues long and rich in G . C base pairs. Such sequences are present in AAV recombinant plasmids as part of the first 15 base pairs of the AAV terminal repeat andmore » in some cases as the result of cloning the AAV genome by G . C tailing. The isolated enzyme fraction does not have significant endonucleolytic activity on single-stranded or double-stranded DNA. Plasmid DNA that is transfected into tissue culture cells is cleaved in vivo to produce a pattern of DNA fragments similar to that seen with purified enzyme in vitro. The activity has been called endo R for rescue, and its behavior suggests that it may have a role in recombination of cellular chromosomes.« less

  17. Noncanonical self-assembly of multifunctional DNA nanoflowers for biomedical applications.

    PubMed

    Zhu, Guizhi; Hu, Rong; Zhao, Zilong; Chen, Zhuo; Zhang, Xiaobing; Tan, Weihong

    2013-11-06

    DNA nanotechnology has been extensively explored to assemble various functional nanostructures for versatile applications. Mediated by Watson-Crick base-pairing, these DNA nanostructures have been conventionally assembled through hybridization of many short DNA building blocks. Here we report the noncanonical self-assembly of multifunctional DNA nanostructures, termed as nanoflowers (NFs), and the versatile biomedical applications. These NFs were assembled from long DNA building blocks generated via rolling circle replication (RCR) of a designer template. NF assembly was driven by liquid crystallization and dense packaging of building blocks, without relying on Watson-Crick base-pairing between DNA strands, thereby avoiding the otherwise conventional complicated DNA sequence design. NF sizes were readily tunable in a wide range, by simply adjusting such parameters as assembly time and template sequences. NFs were exceptionally resistant to nuclease degradation, denaturation, or dissociation at extremely low concentration, presumably resulting from the dense DNA packaging in NFs. The exceptional biostability is critical for biomedical applications. By rational design, NFs can be readily incorporated with myriad functional moieties. All these properties make NFs promising for versatile applications. As a proof-of-principle demonstration, in this study, NFs were integrated with aptamers, bioimaging agents, and drug loading sites, and the resultant multifunctional NFs were demonstrated for selective cancer cell recognition, bioimaging, and targeted anticancer drug delivery.

  18. Noncanonical self-assembly of multifunctional DNA nanoflowers for biomedical applications

    PubMed Central

    Zhu, Guizhi; Hu, Rong; Zhao, Zilong; Chen, Zhuo; Zhang, Xiaobing; Tan, Weihong

    2013-01-01

    DNA nanotechnology has been extensively explored to assemble various functional nanostructures for versatile applications. Mediated by Watson-Crick base-pairing, these DNA nanostructures have been conventionally assembled through hybridization of many short DNA building blocks. Here we report the noncanonical self-assembly of multifunctional DNA nanostructures, termed as nanoflowers (NFs), and the versatile biomedical applications. These NFs were assembled from long DNA building blocks generated via Rolling Circle Replication (RCR) of a designer template. NF assembly was driven by liquid crystallization and dense packaging of building blocks, without relying on Watson-Crick base-pairing between DNA strands, thereby avoiding the otherwise conventional complicated DNA sequence design. NF sizes were readily tunable in a wide range, by simply adjusting such parameters as assembly time and template sequences. NFs were exceptionally resistant to nuclease degradation, denaturation, or dissociation at extremely low concentration, presumably resulting from the dense DNA packaging in NFs. The exceptional biostability is critical for biomedical applications. By rational design, NFs can be readily incorporated with myriad functional moieties. All these properties make NFs promising for versatile applications. As a proof-of-principle demonstration, in this study, NFs were integrated with aptamers, bioimaging agents, and drug loading sites, and the resultant multifunctional NFs were demonstrated for selective cancer cell recognition, bioimaging, and targeted anticancer drug delivery. PMID:24164620

  19. Unusual target site disruption by the rare-cutting HNH restriction endonuclease PacI

    PubMed Central

    Shen, Betty; Heiter, Daniel F.; Chan, Siu-Hong; Wang, Hua; Xu, Shuang-Yong; Morgan, Richard D.; Wilson, Geoffrey G.; Stoddard, Barry L.

    2010-01-01

    The crystal structure of the rare-cutting HNH restriction endonuclease PacI in complex with its eight base pair target recognition sequence 5'-TTAATTAA-3' has been determined to 1.9 Å resolution. The enzyme forms an extended homodimer, with each subunit containing two zinc-bound motifs surrounding a ββα-metal catalytic site. The latter is unusual in that a tyrosine residue likely initiates strand-cleavage. PacI dramatically distorts its target sequence from Watson-Crick duplex DNA basepairing, with every base separated from its original partner. Two bases on each strand are unpaired, four are engaged in non-canonical A:A and T:T base pairs, and the remaining two bases are matched with new Watson-Crick partners. This represents a highly unusual DNA binding mechanism for a restriction endonuclease, and implies that initial recognition of the target site might involve significantly different contacts from those visualized in the DNA-bound cocrystal structures. PMID:20541511

  20. Synthesis, characterization and biological evaluation of novel α, β unsaturated amides.

    PubMed

    Esmailzadeh, K; Housaindokht, M R; Moradi, A; Esmaeili, A A; Sharifi, Z

    2016-05-15

    Three derivatives of α,β unsaturated amides have been successfully synthesized via Ugi-four component (U-4CR) reaction. The interactions of the amides with calf thymus deoxyribonucleic acid (ct-DNA) have been investigated in the Tris-HCl buffer (pH=7.4) using viscometric, spectroscopic, thermal denaturation studies, and also molecular docking. By UV-Vis absorption spectroscopy studies, adding CT-DNA to the compound solution caused the hypochromism indicates that there are interactions between the compounds and DNA base pairs. In competitive fluorescence with methylene blue as an intercalator probe, adding compounds to DNA-MB solution caused an increase in emission spectra of the complex. This could be because of compound replacing, with similar binding mode of MB, between the DNA base pairs due to release of bonded MB molecules from DNA-MB complex. Thermal denaturation studies and viscometric experiments also indicated that all three investigated compounds bind to CT-DNA by non-classical intercalation mode. Additionally, molecular docking technique predicted partial intercalation binding mode for the compounds. Also, the highest binding energy was obtained for compound 5a. These results are in agreement with results obtained by empirical methods. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Sensitivity of hydrogen bonds of DNA and RNA to hydration, as gauged by 1JNH measurements in ethanol-water mixtures.

    PubMed

    Manalo, Marlon N; Kong, Xiangming; LiWang, Andy

    2007-04-01

    Hydrogen-bond lengths of nucleic acids are (1) longer in DNA than in RNA, and (2) sequence dependent. The physicochemical basis for these variations in hydrogen-bond lengths is unknown, however. Here, the notion that hydration plays a significant role in nucleic acid hydrogen-bond lengths is tested. Watson-Crick N1...N3 hydrogen-bond lengths of several DNA and RNA duplexes are gauged using imino 1J(NH) measurements, and ethanol is used as a cosolvent to lower water activity. We find that 1J(NH) values of DNA and RNA become less negative with added ethanol, which suggests that mild dehydration reduces hydrogen-bond lengths even as the overall thermal stabilities of these duplexes decrease. The 1J(NH) of DNA are increased in 8 mol% ethanol to those of RNA in water, which suggests that the greater hydration of DNA plays a significant role in its longer hydrogen bonds. The data also suggest that ethanol-induced dehydration is greater for the more hydrated G:C base pairs and thereby results in greater hydrogen-bond shortening than for the less hydrated A:T/U base pairs of DNA and RNA.

  2. Optimisation of DNA extraction from the crustacean Daphnia

    PubMed Central

    Athanasio, Camila Gonçalves; Chipman, James K.; Viant, Mark R.

    2016-01-01

    Daphnia are key model organisms for mechanistic studies of phenotypic plasticity, adaptation and microevolution, which have led to an increasing demand for genomics resources. A key step in any genomics analysis, such as high-throughput sequencing, is the availability of sufficient and high quality DNA. Although commercial kits exist to extract genomic DNA from several species, preparation of high quality DNA from Daphnia spp. and other chitinous species can be challenging. Here, we optimise methods for tissue homogenisation, DNA extraction and quantification customised for different downstream analyses (e.g., LC-MS/MS, Hiseq, mate pair sequencing or Nanopore). We demonstrate that if Daphnia magna are homogenised as whole animals (including the carapace), absorbance-based DNA quantification methods significantly over-estimate the amount of DNA, resulting in using insufficient starting material for experiments, such as preparation of sequencing libraries. This is attributed to the high refractive index of chitin in Daphnia’s carapace at 260 nm. Therefore, unless the carapace is removed by overnight proteinase digestion, the extracted DNA should be quantified with fluorescence-based methods. However, overnight proteinase digestion will result in partial fragmentation of DNA therefore the prepared DNA is not suitable for downstream methods that require high molecular weight DNA, such as PacBio, mate pair sequencing and Nanopore. In conclusion, we found that the MasterPure DNA purification kit, coupled with grinding of frozen tissue, is the best method for extraction of high molecular weight DNA as long as the extracted DNA is quantified with fluorescence-based methods. This method generated high yield and high molecular weight DNA (3.10 ± 0.63 ng/µg dry mass, fragments >60 kb), free of organic contaminants (phenol, chloroform) and is suitable for large number of downstream analyses. PMID:27190714

  3. Characterization of DNA condensates induced by poly(ethylene oxide) and polylysine.

    PubMed Central

    Laemmli, U K

    1975-01-01

    High-molecular-weight DNA is known to collapse into very compact particles in a salt solution containing polymers like poly(ethylene oxide) [(EO)n] or polyacrylate. The biological relevance of this phenomenon is suggested by our recent finding that high concentrations of the highly acidic internal peptides found in the mature T4 bacteriophage head, as well as poly(glutamic acid) and poly(aspartic acid), can collapse DNA in a similar manner. The structure of DNAs collapsed by various methods has been studied with electron microscope. We find (EO)n collapses T4 or T7 bacteriophage DNA into compact particles only slightly larger than the size of the T4 and T7 head, respectively. In contrast, polylysine collapses DNA into different types of structures. Double-stranded DNA collapsed with (EO)n is cut by the single-strand specific Neurospora crassa endonuclease (EC 3.1.4.21) into small fragments. Extensive digestion only occurs above the critical concentration of polymer required for DNA collapse, demonstrating the (EO)n-collapsed DNA contains enzyme-vulnerable regions (probably at each fold), which are preferentially attacked. The size of the DNA fragments produced by limit-digestion with the nuclease ranges between 200 and 400 base pairs when DNA is collapsed by (EO)n. Only fragments of DNA which are larger than 600 base pairs are cut by the endonuclease in (EO)n-containing solution. Images PMID:1060108

  4. Assessment of amsacrine binding with DNA using UV-visible, circular dichroism and Raman spectroscopic techniques.

    PubMed

    Jangir, Deepak Kumar; Dey, Sanjay Kumar; Kundu, Suman; Mehrotra, Ranjana

    2012-09-03

    Proper understanding of the mechanism of binding of drugs to their targets in cell is a fundamental requirement to develop new drug therapy regimen. Amsacrine is a rationally designed anticancer drug, used to treat leukemia and lymphoma. Binding with cellular DNA is a crucial step in its mechanism of cytotoxicity. Despite numerous studies, DNA binding properties of amsacrine are poorly understood. Its reversible binding with DNA does not permit X-ray crystallography or NMR spectroscopic evaluation of amsacrine-DNA complexes. In the present work, interaction of amsacrine with calf thymus DNA is investigated at physiological conditions. UV-visible, FT-Raman and circular dichroism spectroscopic techniques were employed to determine the binding mode, binding constant, sequence specificity and conformational effects of amsacrine binding to native calf thymus DNA. Our results illustrate that amsacrine interacts with DNA by and large through intercalation between base pairs. Binding constant of the amsacrine-DNA complex was found to be K=1.2±0.1×10(4) M(-1) which is indicative of moderate type of binding of amsacrine to DNA. Raman spectroscopic results suggest that amsacrine has a binding preference of intercalation between AT base pairs of DNA. Minor groove binding is also observed in amsacrine-DNA complexes. These results are in good agreement with in silico investigation of amsacrine binding to DNA and thus provide detailed insight into DNA binding properties of amsacrine, which could ultimately, renders its cytotoxic efficacy. Copyright © 2012 Elsevier B.V. All rights reserved.

  5. 16S rDNA-based metagenomic analysis of dental plaque and lung bacteria in patients with severe acute exacerbations of chronic obstructive pulmonary disease.

    PubMed

    Tan, L; Wang, H; Li, C; Pan, Y

    2014-12-01

    Acute exacerbations of chronic obstructive pulmonary disease (AE-COPD) are leading causes of mortality in hospital intensive care units. We sought to determine whether dental plaque biofilms might harbor pathogenic bacteria that can eventually cause lung infections in patients with severe AE-COPD. Paired samples of subgingival plaque biofilm and tracheal aspirate were collected from 53 patients with severe AE-COPD. Total bacterial DNA was extracted from each sample individually for polymerase chain reaction amplification and/or generation of bacterial 16S rDNA sequences and cDNA libraries. We used a metagenomic approach, based on bacterial 16S rDNA sequences, to compare the distribution of species present in dental plaque and lung. Analysis of 1060 sequences (20 clones per patient) revealed a wide range of aerobic, anaerobic, pathogenic, opportunistic, novel and uncultivable bacterial species. Species indistinguishable between the paired subgingival plaque and tracheal aspirate samples (97-100% similarity in 16S rDNA sequence) were dental plaque pathogens (Aggregatibacter actinomycetemcomitans, Capnocytophaga sputigena, Porphyromonas gingivalis, Tannerella forsythia and Treponema denticola) and lung pathogens (Acinetobacter baumannii, Klebsiella pneumoniae, Pseudomonas aeruginosa and Streptococcus pneumoniae). Real-time polymerase chain reaction of 16S rDNA indicated lower levels of Pseudomonas aeruginosa and Porphyromonas gingivalis colonizing the dental plaques compared with the paired tracheal aspirate samples. These results support the hypothesis that dental bacteria may contribute to the pathology of severe AE-COPD. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  6. Unique Dynamic Properties of DNA Duplexes Containing Interstrand Crosslinks†

    PubMed Central

    Friedman, Joshua I.; Jiang, Yu Lin; Miller, Paul S.; Stivers, James T.

    2010-01-01

    Bifunctional DNA alkylating agents form a diverse assortment of covalent DNA interstrand crosslinked (ICL) structures that are potent cytotoxins. Since it is implausible that cells could possess distinct DNA repair systems for each individual ICL, it is believed that common structural and dynamic features of ICL damage are recognized, rather than specific structural characteristics of each cross-linking agent. Investigation of the structural and dynamic properties of ICLs that might be important for recognition has been complicated by heterogeneous incorporation of these lesions into DNA. To address this problem we have synthesized and characterized several homogenous ICL-DNAs containing site–specific staggered N4-cytosine-ethyl-N4-cytosine crosslinks. Staggered crosslinks were introduced in two ways: in a manner that preserves the overall structure of B-form duplex DNA, and in a manner that highly distorts the DNA structure, with the goal of understanding how structural and dynamic properties of diverse ICL duplexes might flag these sites for repair. Measurements of base pair opening dynamics in the B-form ICL duplex by 1H NMR linewidth or imino proton solvent exchange showed that the guanine base opposite to the crosslinked cytosine opened at least an order of magnitude more slowly than when in a control matched normal duplex. To a lesser degree, the B-form ICL also induced a decrease in base pair opening dynamics that extended from the site of the crosslink to adjacent base pairs. In contrast, the non-B-form ICL showed extensive conformational dynamics at the site of the cross link, which extended over the entire DNA sequence. Since DNA duplexes containing the B-form and non-B-form ICL crosslinks have both been shown to be incised when incubated in mammalian whole cell extracts, while a matched normal duplex is not, we conclude that intrinsic DNA dynamics is not a requirement for specific damage incision of these ICLs. Instead, we propose a general model where destabilized ICL-duplexes serve to energetically facilitate binding of DNA repair factors that must induce bubbles or other distortions in the duplex. However, the essential requirement for incision is an immobile Y-junction where the repair factors are stably bound at the site of the ICL, and the two DNA strands are unpaired. PMID:21174443

  7. Why the tautomerization of the G·C Watson-Crick base pair via the DPT does not cause point mutations during DNA replication? QM and QTAIM comprehensive analysis.

    PubMed

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    The ground-state tautomerization of the G·C Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4), corresponding to a hydrophobic interface of protein-nucleic acid interactions, using DFT and MP2 levels of quantum-mechanical (QM) theory and quantum theory "Atoms in molecules" (QTAIM). Based on the sweeps of the electron-topological, geometric, polar, and energetic parameters, which describe the course of the G·C ↔ G*·C* tautomerization (mutagenic tautomers of the G and C bases are marked with an asterisk) through the DPT along the intrinsic reaction coordinate (IRC), it was proved that it is, strictly speaking, a concerted asynchronous process both at the DFT and MP2 levels of theory, in which protons move with a small time gap in vacuum, while this time delay noticeably increases in the continuum with ϵ = 4. It was demonstrated using the conductor-like polarizable continuum model (CPCM) that the continuum with ϵ = 4 does not qualitatively affect the course of the tautomerization reaction. The DPT in the G·C Watson-Crick base pair occurs without any intermediates both in vacuum and in the continuum with ϵ = 4 at the DFT/MP2 levels of theory. The nine key points along the IRC of the G·C base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These key points have been used to define the reactant, transition state, and product regions of the DPT reaction in the G·C base pair. Analysis of the energetic characteristics of the H-bonds allows us to arrive at a definite conclusion that the middle N1H⋯N3/N3H⋯N1 and the lower N2H⋯O2/N2H⋯O2 parallel H-bonds in the G·C/G*·C* base pairs, respectively, are anticooperative, that is, the strengthening of the middle H-bond is accompanied by the weakening of the lower H-bond. At that point, the upper N4H⋯O6 and O6H⋯N4 H-bonds in the G·C and G*·C* base pairs, respectively, remain constant at the changes of the middle and the lower H-bonds at the beginning and at the ending of the G·C ↔ G*·C* tautomerization. Aiming to answer the question posed in the title of the article, we established that the G*·C* Löwdin's base pair satisfies all the requirements necessary to cause point mutations in DNA except its lifetime, which is much less than the period of time required for the replication machinery to forcibly dissociate a base pair into the monomers (several ns) during DNA replication. So, from the physicochemical point of view, the G*·C* Löwdin's base pair cannot be considered as a source of point mutations arising during DNA replication.

  8. Mechanism of Ribonucleotide Incorporation by Human DNA Polymerase η*

    PubMed Central

    Su, Yan; Egli, Martin; Guengerich, F. Peter

    2016-01-01

    Ribonucleotides and 2′-deoxyribonucleotides are the basic units for RNA and DNA, respectively, and the only difference is the extra 2′-OH group on the ribonucleotide sugar. Cellular rNTP concentrations are much higher than those of dNTP. When copying DNA, DNA polymerases not only select the base of the incoming dNTP to form a Watson-Crick pair with the template base but also distinguish the sugar moiety. Some DNA polymerases use a steric gate residue to prevent rNTP incorporation by creating a clash with the 2′-OH group. Y-family human DNA polymerase η (hpol η) is of interest because of its spacious active site (especially in the major groove) and tolerance of DNA lesions. Here, we show that hpol η maintains base selectivity when incorporating rNTPs opposite undamaged DNA and the DNA lesions 7,8-dihydro-8-oxo-2′-deoxyguanosine and cyclobutane pyrimidine dimer but with rates that are 103-fold lower than for inserting the corresponding dNTPs. X-ray crystal structures show that the hpol η scaffolds the incoming rNTP to pair with the template base (dG) or 7,8-dihydro-8-oxo-2′-deoxyguanosine with a significant propeller twist. As a result, the 2′-OH group avoids a clash with the steric gate, Phe-18, but the distance between primer end and Pα of the incoming rNTP increases by 1 Å, elevating the energy barrier and slowing polymerization compared with dNTP. In addition, Tyr-92 was identified as a second line of defense to maintain the position of Phe-18. This is the first crystal structure of a DNA polymerase with an incoming rNTP opposite a DNA lesion. PMID:26740629

  9. Filter Paper-based Nucleic Acid Storage in High-throughput Solid Tumor Genotyping.

    PubMed

    Stachler, Matthew; Jia, Yonghui; Sharaf, Nematullah; Wade, Jacqueline; Longtine, Janina; Garcia, Elizabeth; Sholl, Lynette M

    2015-01-01

    Molecular testing of tumors from formalin-fixed paraffin-embedded (FFPE) tissue blocks is central to clinical practice; however, it requires histology support and increases test turnaround time. Prospective fresh frozen tissue collection requires special handling, additional storage space, and may not be feasible for small specimens. Filter paper-based collection of tumor DNA reduces the need for histology support, requires little storage space, and preserves high-quality nucleic acid. We investigated the performance of tumor smears on filter paper in solid tumor genotyping, as compared with paired FFPE samples. Whatman FTA Micro Card (FTA preps) smears were prepared from 21 fresh tumor samples. A corresponding cytology smear was used to assess tumor cellularity and necrosis. DNA was isolated from FTA preps and FFPE core samples using automated methods and quantified using SYBR green dsDNA detection. Samples were genotyped for 471 mutations on a mass spectrophotometry-based platform (Sequenom). DNA concentrations from FTA preps and FFPE correlated for untreated carcinomas but not for mesenchymal tumors (Spearman σ=0.39 and σ=-0.1, respectively). Average DNA concentrations were lower from FTA preps as compared with FFPE, but DNA quality was higher with less fragmentation. Seventy-six percent of FTA preps and 86% of FFPE samples generated adequate DNA for genotyping. FTA preps tended to perform poorly for collection of DNA from pretreated carcinomas and mesenchymal neoplasms. Of the 16 paired DNA samples that were genotyped, 15 (94%) gave entirely concordant results. Filter paper-based sample preservation is a feasible alternative to FFPE for use in automated, high-throughput genotyping of carcinomas.

  10. Biophysics of Artificially Expanded Genetic Information Systems. Thermodynamics of DNA Duplexes Containing Matches and Mismatches Involving 2-Amino-3-nitropyridin-6-one (Z) and Imidazo[1,2-a]-1,3,5-triazin-4(8H)one (P).

    PubMed

    Wang, Xiaoyu; Hoshika, Shuichi; Peterson, Raymond J; Kim, Myong-Jung; Benner, Steven A; Kahn, Jason D

    2017-05-19

    Synthetic nucleobases presenting non-Watson-Crick arrangements of hydrogen bond donor and acceptor groups can form additional nucleotide pairs that stabilize duplex DNA independent of the standard A:T and G:C pairs. The pair between 2-amino-3-nitropyridin-6-one 2'-deoxyriboside (presenting a {donor-donor-acceptor} hydrogen bonding pattern on the Watson-Crick face of the small component, trivially designated Z) and imidazo[1,2-a]-1,3,5-triazin-4(8H)one 2'-deoxyriboside (presenting an {acceptor-acceptor-donor} hydrogen bonding pattern on the large component, trivially designated P) is one of these extra pairs for which a substantial amount of molecular biology has been developed. Here, we report the results of UV absorbance melting measurements and determine the energetics of binding of DNA strands containing Z and P to give short duplexes containing Z:P pairs as well as various mismatches comprising Z and P. All measurements were done at 1 M NaCl in buffer (10 mM Na cacodylate, 0.5 mM EDTA, pH 7.0). Thermodynamic parameters (ΔH°, ΔS°, and ΔG° 37 ) for oligonucleotide hybridization were extracted. Consistent with the Watson-Crick model that considers both geometric and hydrogen bonding complementarity, the Z:P pair was found to contribute more to duplex stability than any mismatches involving either nonstandard nucleotide. Further, the Z:P pair is more stable than a C:G pair. The Z:G pair was found to be the most stable mismatch, forming either a deprotonated mismatched pair or a wobble base pair analogous to the stable T:G mismatch. The C:P pair is less stable, perhaps analogous to the wobble pair observed for C:O 6 -methyl-G, in which the pyrimidine is displaced into the minor groove. The Z:A and T:P mismatches are much less stable. Parameters for predicting the thermodynamics of oligonucleotides containing Z and P bases are provided. This represents the first case where this has been done for a synthetic genetic system.

  11. QM and QM/MM Studies on Excited-State Relaxation Mechanisms of Unnatural Bases in Vacuo and Base Pairs in DNA.

    PubMed

    Wang, Qian; Xie, Xiao-Ying; Han, Juan; Cui, Ganglong

    2017-11-22

    Semisynthetic alphabet can potentially increase the genetic information stored in DNA through the formation of unusual base pairs such as d5SICS:dNaM. However, recent experiments show that near-visible-light irradiation on the d5SICS and dNaM chromophores could lead to genetic mutations and damages. Until now, their photophysical mechanisms remain elusive. Herein, we have employed MS-CASPT2//CASSCF and QM(MS-CASPT2//CASSCF)/MM methods to explore the spectroscopic properties and excited-state relaxation mechanisms of d5SICS, dNaM, and d5SICS:dNaM in DNA. We have found that (1) the S 2 state of d5SICS, the S 1 state of dNaM, and the S 2 state of d5SICS:dNaM are initially populated upon near-visible-light irradiation and (2) for d5SICS and d5SICS:dNaM, there are several parallel relaxation pathways to populate the lowest triplet state, but for dNaM, a main relaxation pathway is uncovered. Moreover, we have found that the excited-state relaxation mechanism of d5SICS:dNaM in DNA is similar to that of the isolated d5SICS chromophore. These mechanistic insights contribute to the understanding of photophysics and photochemistry of unusual base pairs and to the design of better semisynthetic genetic alphabet.

  12. Mitochondrial Enzyme Plays Critical Role in Chemotherapy-Induced Heart Damage | Center for Cancer Research

    Cancer.gov

    Doxorubicin (DOX) is an effective drug for treating cancers ranging from leukemia and lymphoma to solid tumors, such as breast cancer. DOX kills dividing cells in two ways: inserting between the base pairs of DNA and trapping a complex of DNA and an enzyme that cuts DNA, topoisomerase 2α, preventing DNA repair. However, DOX also causes congestive heart failure in about 30

  13. Reduced rDNA Copy Number Does Not Affect “Competitive” Chromosome Pairing in XYY Males of Drosophila melanogaster

    PubMed Central

    Maggert, Keith A.

    2014-01-01

    The ribosomal DNA (rDNA) arrays are causal agents in X-Y chromosome pairing in meiosis I of Drosophila males. Despite broad variation in X-linked and Y-linked rDNA copy number, polymorphisms in regulatory/spacer sequences between rRNA genes, and variance in copy number of interrupting R1 and R2 retrotransposable elements, there is little evidence that different rDNA arrays affect pairing efficacy. I investigated whether induced rDNA copy number polymorphisms affect chromosome pairing in a “competitive” situation in which complex pairing configurations were possible using males with XYY constitution. Using a common normal X chromosome, one of two different full-length Y chromosomes, and a third chromosome from a series of otherwise-isogenic rDNA deletions, I detected no differences in X-Y or Y-Y pairing or chromosome segregation frequencies that could not be attributed to random variation alone. This work was performed in the context of an undergraduate teaching program at Texas A&M University, and I discuss the pedagogical utility of this and other such experiments. PMID:24449686

  14. Sub-Terrahertz Spectroscopy of E.COLI Dna: Experiment, Statistical Model, and MD Simulations

    NASA Astrophysics Data System (ADS)

    Sizov, I.; Dorofeeva, T.; Khromova, T.; Gelmont, B.; Globus, T.

    2012-06-01

    We will present result of combined experimental and computational study of sub-THz absorption spectra from Escherichia coli (E.coli) DNA. Measurements were conducted using a Bruker FTIR spectrometer with a liquid helium cooled bolometer and a recently developed frequency domain sensor operating at room temperature, with spectral resolution of 0.25 cm-1 and 0.03 cm-1, correspondingly. We have earlier demonstrated that molecular dynamics (MD) simulation can be effectively applied for characterizing relatively small biological molecules, such as transfer RNA or small protein thioredoxin from E. coli , and help to understand and predict their absorption spectra. Large size of DNA macromolecules ( 5 million base pairs for E. coli DNA) prevents, however, direct application of MD simulation at the current level of computational capabilities. Therefore, by applying a second order Markov chain approach and Monte-Carlo technique, we have developed a new statistical model to construct DNA sequences from biological cells. These short representative sequences (20-60 base pairs) are built upon the most frequently repeated fragments (2-10 base pairs) in the original DNA. Using this new approach, we constructed DNA sequences for several non-pathogenic strains of E.coli, including a well-known strain BL21, uro-pathogenic strain, CFT073, and deadly EDL933 strain (O157:H7), and used MD simulations to calculate vibrational absorption spectra of these strains. Significant differences are clearly present in spectra of strains in averaged spectra and in all components for particular orientations. The mechanism of interaction of THz radiation with a biological molecule is studied by analyzing dynamics of atoms and correlation of local vibrations in the modeled molecule. Simulated THz vibrational spectra of DNA are compared with experimental results. With the spectral resolution of 0.1 cm-1 or better, which is now available in experiments, the very easy discrimination between different strains of the same bacteria becomes possible.

  15. Charge transport and ac response under light illumination in gate-modulated DNA molecular junctions.

    PubMed

    Zhang, Yan; Zhu, Wen-Huan; Ding, Guo-Hui; Dong, Bing; Wang, Xue-Feng

    2015-05-22

    Using a two-strand tight-binding model and within nonequilibrium Green's function approach, we study charge transport through DNA sequences (GC)NGC and (GC)1(TA)NTA (GC)3 sandwiched between two Pt electrodes. We show that at low temperature DNA sequence (GC)NGC exhibits coherent charge carrier transport at very small bias, since the highest occupied molecular orbital in the GC base pair can be aligned with the Fermi energy of the metallic electrodes by a gate voltage. A weak distance dependent conductance is found in DNA sequence (GC)1(TA)NTA (GC)3 with large NTA. Different from the mechanism of thermally induced hopping of charges proposed by the previous experiments, we find that this phenomenon is dominated by quantum tunnelling through discrete quantum well states in the TA base pairs. In addition, ac response of this DNA junction under light illumination is also investigated. The suppression of ac conductances of the left and right lead of DNA sequences at some particular frequencies is attributed to the excitation of electrons in the DNA to the lead Fermi surface by ac potential, or the excitation of electrons in deep DNA energy levels to partially occupied energy levels in the transport window. Therefore, measuring ac response of DNA junctions can reveal a wealth of information about the intrinsic dynamics of DNA molecules.

  16. Detection of DNA damage based on metal-mediated molecular beacon and DNA strands displacement reaction.

    PubMed

    Xiong, Yanxiang; Wei, Min; Wei, Wei; Yin, Lihong; Pu, Yuepu; Liu, Songqin

    2014-01-24

    DNA hairpin structure probes are usually designed by forming intra-molecular duplex based on Watson-Crick hydrogen bonds. In this paper, a molecular beacon based on silver ions-mediated cytosine-Ag(+)-cytosine base pairs was used to detect DNA. The inherent characteristic of the metal ligation facilitated the design of functional probe and the adjustment of its binding strength compared to traditional DNA hairpin structure probes, which make it be used to detect DNA in a simple, rapid and easy way with the help of DNA strands displacement reaction. The method was sensitive and also possesses the good specificity to differentiate the single base mismatched DNA from the complementary DNA. It was also successfully applied to study the damage effect of classic genotoxicity chemicals such as styrene oxide and sodium arsenite on DNA, which was significant in food science, environmental science and pharmaceutical science. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. Structural studies on Pax-8 Prd domain/DNA complex.

    PubMed

    Campagnolo, M; Pesaresi, A; Zelezetsky, I; Geremia, S; Randaccio, L; Bisca, A; Tell, G

    2007-04-01

    Pax-8 is a member of the Pax family of transcription factors and is essential in the development of thyroid follicular cells. Pax-8 has two DNA-binding domains: the paired domain and the homeo domain. In this study, a preliminary X-ray diffraction analysis of the mammalian Pax-8 paired domain in complex with the C-site of the thyroglobulin promoter was achieved. The Pax-8 paired domain was crystallized by the hanging-drop vapor-diffusion method in complex with both a blunt-ended 26 bp DNA fragment and with a sticky-ended 24 bp DNA fragment with two additional overhanging bases. Crystallization experiments make clear that the growth of transparent crystals with large dimensions and regular shape is particularly influenced by ionic strength. The crystals of Pax-8 complex with blunt-ended and sticky-ended DNA, diffracted synchrotron radiation to 6.0 and 8.0 A resolution and belongs both to the C centered monoclinic system with cell dimensions: a = 89.88 A, b = 80.05 A, c = 67.73 A, and beta = 124.3 degrees and a = 256.56, b = 69.07, c = 99.32 A, and beta = 98.1 degrees , respectively. Fluorescence experiments suggest that the crystalline disorder, deduced by the poor diffraction, can be attributed to the low homogeneity of the protein-DNA sample. The theoretical comparative model of the Pax-8 paired domain complexed with the C-site of the thyroglobulin promoter shows the probable presence of some specific protein-DNA interactions already observed in other Pax proteins and the important role of the cysteine residues of PAI subdomain in the redox control of the DNA recognition.

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rechkoblit, Olga; Delaney, James C.; Essigmann, John M.

    DNA is susceptible to alkylation damage by a number of environmental agents that modify the Watson-Crick edge of the bases. Such lesions, if not repaired, may be bypassed by Y-family DNA polymerases. The bypass polymerase Dpo4 is strongly inhibited by 1-methylguanine (m1G) and 3-methylcytosine (m3C), with nucleotide incorporation opposite these lesions being predominantly mutagenic. Further, extension after insertion of both correct and incorrect bases, introduces additional base substitution and deletion errors. Crystal structures of the Dpo4 ternary extension complexes with correct and mismatched 3'-terminal primer bases opposite the lesions reveal that both m1G and m3C remain positioned within the DNAmore » template/primer helix. However, both correct and incorrect pairing partners exhibit pronounced primer terminal nucleotide distortion, being primarily evicted from the DNA helix when opposite m1G or misaligned when pairing with m3C. Our studies provide insights into mechanisms related to hindered and mutagenic bypass of methylated lesions and models associated with damage recognition by repair demethylases.« less

  19. Sequence Effect on the Formation of DNA Minidumbbells.

    PubMed

    Liu, Yuan; Lam, Sik Lok

    2017-11-16

    The DNA minidumbbell (MDB) is a recently identified non-B structure. The reported MDBs contain two TTTA, CCTG, or CTTG type II loops. At present, the knowledge and understanding of the sequence criteria for MDB formation are still limited. In this study, we performed a systematic high-resolution nuclear magnetic resonance (NMR) and native gel study to investigate the effect of sequence variations in tandem repeats on the formation of MDBs. Our NMR results reveal the importance of hydrogen bonds, base-base stacking, and hydrophobic interactions from each of the participating residues. We conclude that in the MDBs formed by tandem repeats, C-G loop-closing base pairs are more stabilizing than T-A loop-closing base pairs, and thymine residues in both the second and third loop positions are more stabilizing than cytosine residues. The results from this study enrich our knowledge on the sequence criteria for the formation of MDBs, paving a path for better exploring their potential roles in biological systems and DNA nanotechnology.

  20. Sequence periodicity in nucleosomal DNA and intrinsic curvature

    PubMed Central

    2010-01-01

    Background Most eukaryotic DNA contained in the nucleus is packaged by wrapping DNA around histone octamers. Histones are ubiquitous and bind most regions of chromosomal DNA. In order to achieve smooth wrapping of the DNA around the histone octamer, the DNA duplex should be able to deform and should possess intrinsic curvature. The deformability of DNA is a result of the non-parallelness of base pair stacks. The stacking interaction between base pairs is sequence dependent. The higher the stacking energy the more rigid the DNA helix, thus it is natural to expect that sequences that are involved in wrapping around the histone octamer should be unstacked and possess intrinsic curvature. Intrinsic curvature has been shown to be dictated by the periodic recurrence of certain dinucleotides. Several genome-wide studies directed towards mapping of nucleosome positions have revealed periodicity associated with certain stretches of sequences. In the current study, these sequences have been analyzed with a view to understand their sequence-dependent structures. Results Higher order DNA structures and the distribution of molecular bend loci associated with 146 base nucleosome core DNA sequence from C. elegans and chicken have been analyzed using the theoretical model for DNA curvature. The curvature dispersion calculated by cyclically permuting the sequences revealed that the molecular bend loci were delocalized throughout the nucleosome core region and had varying degrees of intrinsic curvature. Conclusions The higher order structures associated with nucleosomes of C.elegans and chicken calculated from the sequences revealed heterogeneity with respect to the deviation of the DNA axis. The results points to the possibility of context dependent curvature of varying degrees to be associated with nucleosomal DNA. PMID:20487515

  1. Sequencing of adenine in DNA by scanning tunneling microscopy

    NASA Astrophysics Data System (ADS)

    Tanaka, Hiroyuki; Taniguchi, Masateru

    2017-08-01

    The development of DNA sequencing technology utilizing the detection of a tunnel current is important for next-generation sequencer technologies based on single-molecule analysis technology. Using a scanning tunneling microscope, we previously reported that dI/dV measurements and dI/dV mapping revealed that the guanine base (purine base) of DNA adsorbed onto the Cu(111) surface has a characteristic peak at V s = -1.6 V. If, in addition to guanine, the other purine base of DNA, namely, adenine, can be distinguished, then by reading all the purine bases of each single strand of a DNA double helix, the entire base sequence of the original double helix can be determined due to the complementarity of the DNA base pair. Therefore, the ability to read adenine is important from the viewpoint of sequencing. Here, we report on the identification of adenine by STM topographic and spectroscopic measurements using a synthetic DNA oligomer and viral DNA.

  2. Repair of clustered DNA damage caused by high LET radiation in human fibroblasts

    NASA Technical Reports Server (NTRS)

    Rydberg, B.; Lobrich, M.; Cooper, P. K.; Chatterjee, A. (Principal Investigator)

    1998-01-01

    It has recently been demonstrated experimentally that DNA damage induced by high LET radiation in mammalian cells is non-randomly distributed along the DNA molecule in the form of clusters of various sizes. The sizes of such clusters range from a few base-pairs to at least 200 kilobase-pairs. The high biological efficiency of high LET radiation for induction of relevant biological endpoints is probably a consequence of this clustering, although the exact mechanisms by which the clustering affects the biological outcome is not known. We discuss here results for induction and repair of base damage, single-strand breaks and double-strand breaks for low and high LET radiations. These results are discussed in the context of clustering. Of particular interest is to determine how clustering at different scales affects overall rejoining and fidelity of rejoining of DNA double-strand breaks. However, existing methods for measuring repair of DNA strand breaks are unable to resolve breaks that are close together in a cluster. This causes problems in interpretation of current results from high LET radiation and will require new methods to be developed.

  3. A metallo-DNA nanowire with uninterrupted one-dimensional silver array

    NASA Astrophysics Data System (ADS)

    Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Hattori, Yoshikazu; Saneyoshi, Hisao; Ono, Akira; Tanaka, Yoshiyuki

    2017-10-01

    The double-helix structure of DNA, in which complementary strands reversibly hybridize to each other, not only explains how genetic information is stored and replicated, but also has proved very attractive for the development of nanomaterials. The discovery of metal-mediated base pairs has prompted the generation of short metal-DNA hybrid duplexes by a bottom-up approach. Here we describe a metallo-DNA nanowire—whose structure was solved by high-resolution X-ray crystallography—that consists of dodecamer duplexes held together by four different metal-mediated base pairs (the previously observed C-Ag-C, as well as G-Ag-G, G-Ag-C and T-Ag-T) and linked to each other through G overhangs involved in interduplex G-Ag-G. The resulting hybrid nanowires are 2 nm wide with a length of the order of micrometres to millimetres, and hold the silver ions in uninterrupted one-dimensional arrays along the DNA helical axis. The hybrid nanowires are further assembled into three-dimensional lattices by interactions between adenine residues, fully bulged out of the double helix.

  4. Mesoscopic modeling of DNA denaturation rates: Sequence dependence and experimental comparison

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dahlen, Oda, E-mail: oda.dahlen@ntnu.no; Erp, Titus S. van, E-mail: titus.van.erp@ntnu.no

    Using rare event simulation techniques, we calculated DNA denaturation rate constants for a range of sequences and temperatures for the Peyrard-Bishop-Dauxois (PBD) model with two different parameter sets. We studied a larger variety of sequences compared to previous studies that only consider DNA homopolymers and DNA sequences containing an equal amount of weak AT- and strong GC-base pairs. Our results show that, contrary to previous findings, an even distribution of the strong GC-base pairs does not always result in the fastest possible denaturation. In addition, we applied an adaptation of the PBD model to study hairpin denaturation for which experimentalmore » data are available. This is the first quantitative study in which dynamical results from the mesoscopic PBD model have been compared with experiments. Our results show that present parameterized models, although giving good results regarding thermodynamic properties, overestimate denaturation rates by orders of magnitude. We believe that our dynamical approach is, therefore, an important tool for verifying DNA models and for developing next generation models that have higher predictive power than present ones.« less

  5. Brain cDNA clone for human cholinesterase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McTiernan, C.; Adkins, S.; Chatonnet, A.

    1987-10-01

    A cDNA library from human basal ganglia was screened with oligonucleotide probes corresponding to portions of the amino acid sequence of human serum cholinesterase. Five overlapping clones, representing 2.4 kilobases, were isolated. The sequenced cDNA contained 207 base pairs of coding sequence 5' to the amino terminus of the mature protein in which there were four ATG translation start sites in the same reading frame as the protein. Only the ATG coding for Met-(-28) lay within a favorable consensus sequence for functional initiators. There were 1722 base pairs of coding sequence corresponding to the protein found circulating in human serum.more » The amino acid sequence deduced from the cDNA exactly matched the 574 amino acid sequence of human serum cholinesterase, as previously determined by Edman degradation. Therefore, our clones represented cholinesterase rather than acetylcholinesterase. It was concluded that the amino acid sequences of cholinesterase from two different tissues, human brain and human serum, were identical. Hybridization of genomic DNA blots suggested that a single gene, or very few genes coded for cholinesterase.« less

  6. Charge-transfer optical absorption mechanism of DNA:Ag-nanocluster complexes

    NASA Astrophysics Data System (ADS)

    Longuinhos, R.; Lúcio, A. D.; Chacham, H.; Alexandre, S. S.

    2016-05-01

    Optical properties of DNA:Ag-nanoclusters complexes have been successfully applied experimentally in Chemistry, Physics, and Biology. Nevertheless, the mechanisms behind their optical activity remain unresolved. In this work, we present a time-dependent density functional study of optical absorption in DNA:Ag4. In all 23 different complexes investigated, we obtain new absorption peaks in the visible region that are not found in either the isolated Ag4 or isolated DNA base pairs. Absorption from red to green are predominantly of charge-transfer character, from the Ag4 to the DNA fragment, while absorption in the blue-violet range are mostly associated to electronic transitions of a mixed character, involving either DNA-Ag4 hybrid orbitals or intracluster orbitals. We also investigate the role of exchange-correlation functionals in the calculated optical spectra. Significant differences are observed between the calculations using the PBE functional (without exact exchange) and the CAM-B3LYP functional (which partly includes exact exchange). Specifically, we observe a tendency of charge-transfer excitations to involve purines bases, and the PBE spectra error is more pronounced in the complexes where the Ag cluster is bound to the purines. Finally, our results also highlight the importance of adding both the complementary base pair and the sugar-phosphate backbone in order to properly characterize the absorption spectrum of DNA:Ag complexes.

  7. Charge-transfer optical absorption mechanism of DNA:Ag-nanocluster complexes.

    PubMed

    Longuinhos, R; Lúcio, A D; Chacham, H; Alexandre, S S

    2016-05-01

    Optical properties of DNA:Ag-nanoclusters complexes have been successfully applied experimentally in Chemistry, Physics, and Biology. Nevertheless, the mechanisms behind their optical activity remain unresolved. In this work, we present a time-dependent density functional study of optical absorption in DNA:Ag_{4}. In all 23 different complexes investigated, we obtain new absorption peaks in the visible region that are not found in either the isolated Ag_{4} or isolated DNA base pairs. Absorption from red to green are predominantly of charge-transfer character, from the Ag_{4} to the DNA fragment, while absorption in the blue-violet range are mostly associated to electronic transitions of a mixed character, involving either DNA-Ag_{4} hybrid orbitals or intracluster orbitals. We also investigate the role of exchange-correlation functionals in the calculated optical spectra. Significant differences are observed between the calculations using the PBE functional (without exact exchange) and the CAM-B3LYP functional (which partly includes exact exchange). Specifically, we observe a tendency of charge-transfer excitations to involve purines bases, and the PBE spectra error is more pronounced in the complexes where the Ag cluster is bound to the purines. Finally, our results also highlight the importance of adding both the complementary base pair and the sugar-phosphate backbone in order to properly characterize the absorption spectrum of DNA:Ag complexes.

  8. DNA nanotechnology from the test tube to the cell.

    PubMed

    Chen, Yuan-Jyue; Groves, Benjamin; Muscat, Richard A; Seelig, Georg

    2015-09-01

    The programmability of Watson-Crick base pairing, combined with a decrease in the cost of synthesis, has made DNA a widely used material for the assembly of molecular structures and dynamic molecular devices. Working in cell-free settings, researchers in DNA nanotechnology have been able to scale up system complexity and quantitatively characterize reaction mechanisms to an extent that is infeasible for engineered gene circuits or other cell-based technologies. However, the most intriguing applications of DNA nanotechnology - applications that best take advantage of the small size, biocompatibility and programmability of DNA-based systems - lie at the interface with biology. Here, we review recent progress in the transition of DNA nanotechnology from the test tube to the cell. We highlight key successes in the development of DNA-based imaging probes, prototypes of smart therapeutics and drug delivery systems, and explore the future challenges and opportunities for cellular DNA nanotechnology.

  9. Validation of a PCR-based method for the detection of various rendered materials in feedstuffs using a forensic DNA extraction kit.

    PubMed

    Myers, Michael J; Yancy, Haile F; Araneta, Michael; Armour, Jennifer; Derr, Janice; Hoostelaere, Lawrence A D; Farmer, Doris; Jackson, Falana; Kiessling, William M; Koch, Henry; Lin, Huahua; Liu, Yan; Mowlds, Gabrielle; Pinero, David; Riter, Ken L; Sedwick, John; Shen, Yuelian; Wetherington, June; Younkins, Ronsha

    2006-01-01

    A method trial was initiated to validate the use of a commercial DNA forensic kit to extract DNA from animal feed as part of a PCR-based method. Four different PCR primer pairs (one bovine pair, one porcine pair, one ovine primer pair, and one multispecies pair) were also evaluated. Each laboratory was required to analyze a total of 120 dairy feed samples either not fortified (control, true negative) or fortified with bovine meat and bone meal, porcine meat and bone meal (PMBM), or lamb meal. Feeds were fortified with the animal meals at a concentration of 0.1% (wt/wt). Ten laboratories participated in this trial, and each laboratory was required to evaluate two different primer pairs, i.e., each PCR primer pair was evaluated by five different laboratories. The method was considered to be validated for a given animal source when three or more laboratories achieved at least 97% accuracy (29 correct of 30 samples for 96.7% accuracy, rounded up to 97%) in detecting the fortified samples for that source. Using this criterion, the method was validated for the bovine primer because three laboratories met the criterion, with an average accuracy of 98.9%. The average false-positive rate was 3.0% in these laboratories. A fourth laboratory was 80% accurate in identifying the samples fortified with bovine meat and bone meal. A fifth laboratory was not able to consistently extract the DNA from the feed samples and did not achieve the criterion for accuracy for either the bovine or multispecies PCR primers. For the porcine primers, the method was validated, with four laboratories meeting the criterion for accuracy with an average accuracy of 99.2%. The fifth laboratory had a 93.3% accuracy outcome for the porcine primer. Collectively, these five laboratories had a 1.3% false-positive rate for the porcine primer. No laboratory was able to meet the criterion for accuracy with the ovine primers, most likely because of problems with the synthesis of the primer pair; none of the positive control DNA samples could be detected with the ovine primers. The multispecies primer pair was validated in three laboratories for use with bovine meat and bone meal and lamb meal but not with PMBM. The three laboratories had an average accuracy of 98.9% for bovine meat and bone meal, 97.8% for lamb meal, and 63.3% for PMBM. When examined on an individual laboratory basis, one of these four laboratories could not identify a single feed sample containing PMBM by using the multispecies primer, whereas the other laboratory identified only one PMBM-fortified sample, suggesting that the limit of detection for PMBM with this primer pair is around 0.1% (wt/wt). The results of this study demonstrated that the DNA forensic kit can be used to extract DNA from animal feed, which can then be used for PCR analysis to detect animal-derived protein present in the feed sample.

  10. DNA nanostructure-based drug delivery nanosystems in cancer therapy.

    PubMed

    Wu, Dandan; Wang, Lei; Li, Wei; Xu, Xiaowen; Jiang, Wei

    2017-11-25

    DNA as a novel biomaterial can be used to fabricate different kinds of DNA nanostructures based on its principle of GC/AT complementary base pairing. Studies have shown that DNA nanostructure is a nice drug carrier to overcome big obstacles existing in cancer therapy such as systemic toxicity and unsatisfied drug efficacy. Thus, different types of DNA nanostructure-based drug delivery nanosystems have been designed in cancer therapy. To improve treating efficacy, they are also developed into more functional drug delivery nanosystems. In recent years, some important progresses have been made. The objective of this review is to make a retrospect and summary about these different kinds of DNA nanostructure-based drug delivery nanosystems and their latest progresses: (1) active targeting; (2) mutidrug co-delivery; (3) construction of stimuli-responsive/intelligent nanosystems. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Bacillus Strains Most Closely Related to Bacillus nealsonii Are Not Effectively Circumscribed within the Taxonomic Species Definition

    PubMed Central

    Peak, K. Kealy; Duncan, Kathleen E.; Luna, Vicki A.; King, Debra S.; McCarthy, Peter J.; Cannons, Andrew C.

    2011-01-01

    Bacillus strains with >99.7% 16S rRNA gene sequence similarity were characterized with DNA:DNA hybridization, cellular fatty acid (CFA) analysis, and testing of 100 phenotypic traits. When paired with the most closely related type strain, percent DNA:DNA similarities (% S) for six Bacillus strains were all far below the recommended 70% threshold value for species circumscription with Bacillus nealsonii. An apparent genomic group of four Bacillus strain pairings with 94%–70% S was contradicted by the failure of the strains to cluster in CFA- and phenotype-based dendrograms as well as by their differentiation with 9–13 species level discriminators such as nitrate reduction, temperature range, and acid production from carbohydrates. The novel Bacillus strains were monophyletic and very closely related based on 16S rRNA gene sequence. Coherent genomic groups were not however supported by similarly organized phenotypic clusters. Therefore, the strains were not effectively circumscribed within the taxonomic species definition. PMID:22046187

  12. NMR solution structure of an N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: Intercalation from the minor groove with ruptured Watson-Crick base pairing

    PubMed Central

    Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H.; Cai, Yuqin; Rodriguez, Fabian A.; Sayer, Jane M.; Jerina, Donald M.; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.

    2012-01-01

    The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the non-planar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely-studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14-position with the exocyclic amino group of guanine. Here, we present the first NMR solution structure of a DB[a,l]P-derived adduct, the 14R (+)-trans-anti-DB[a,l]P–N2-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N2-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3’-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3’-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE - DNA adduct conformation differs from: (1) the classical intercalation motif where Watson-Crick base-pairing is intact at the lesion site, and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix . The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed. PMID:23121427

  13. Nuclear magnetic resonance solution structure of an N(2)-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: intercalation from the minor groove with ruptured Watson-Crick base pairing.

    PubMed

    Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H; Cai, Yuqin; Rodriguez, Fabian A; Sayer, Jane M; Jerina, Donald M; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E

    2012-12-04

    The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the nonplanar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14 position with the exocyclic amino group of guanine. Here, we present the first nuclear magnetic resonance solution structure of a DB[a,l]P-derived adduct, the 14R-(+)-trans-anti-DB[a,l]P-N(2)-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N(2)-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3'-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3'-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE-DNA adduct conformation differs from (1) the classical intercalation motif in which Watson-Crick base pairing is intact at the lesion site and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix. The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed.

  14. Poincaré recurrences of DNA sequences

    NASA Astrophysics Data System (ADS)

    Frahm, K. M.; Shepelyansky, D. L.

    2012-01-01

    We analyze the statistical properties of Poincaré recurrences of Homo sapiens, mammalian, and other DNA sequences taken from the Ensembl Genome data base with up to 15 billion base pairs. We show that the probability of Poincaré recurrences decays in an algebraic way with the Poincaré exponent β≈4 even if the oscillatory dependence is well pronounced. The correlations between recurrences decay with an exponent ν≈0.6 that leads to an anomalous superdiffusive walk. However, for Homo sapiens sequences, with the largest available statistics, the diffusion coefficient converges to a finite value on distances larger than one million base pairs. We argue that the approach based on Poncaré recurrences determines new proximity features between different species and sheds a new light on their evolution history.

  15. DNA base pair resolution measurements using resonance energy transfer efficiency in lanthanide doped nanoparticles.

    PubMed

    Delplanque, Aleksandra; Wawrzynczyk, Dominika; Jaworski, Pawel; Matczyszyn, Katarzyna; Pawlik, Krzysztof; Buckle, Malcolm; Nyk, Marcin; Nogues, Claude; Samoc, Marek

    2015-01-01

    Lanthanide-doped nanoparticles are of considerable interest for biodetection and bioimaging techniques thanks to their unique chemical and optical properties. As a sensitive luminescence material, they can be used as (bio) probes in Förster Resonance Energy Transfer (FRET) where trivalent lanthanide ions (La3+) act as energy donors. In this paper we present an efficient method to transfer ultrasmall (ca. 8 nm) NaYF4 nanoparticles dispersed in organic solvent to an aqueous solution via oxidation of the oleic acid ligand. Nanoparticles were then functionalized with single strand DNA oligomers (ssDNA) by inducing covalent bonds between surface carboxylic groups and a 5' amine modified-ssDNA. Hybridization with the 5' fluorophore (Cy5) modified complementary ssDNA strand demonstrated the specificity of binding and allowed the fine control over the distance between Eu3+ ions doped nanoparticle and the fluorophore by varying the number of the dsDNA base pairs. First, our results confirmed nonradiative resonance energy transfer and demonstrate the dependence of its efficiency on the distance between the donor (Eu3+) and the acceptor (Cy5) with sensitivity at a nanometre scale.

  16. Genetic instability associated with loop or stem–loop structures within transcription units can be independent of nucleotide excision repair

    PubMed Central

    Burns, John A; Chowdhury, Moinuddin A; Cartularo, Laura; Berens, Christian; Scicchitano, David A

    2018-01-01

    Abstract Simple sequence repeats (SSRs) are found throughout the genome, and under some conditions can change in length over time. Germline and somatic expansions of trinucleotide repeats are associated with a series of severely disabling illnesses, including Huntington's disease. The underlying mechanisms that effect SSR expansions and contractions have been experimentally elusive, but models suggesting a role for DNA repair have been proposed, in particular the involvement of transcription-coupled nucleotide excision repair (TCNER) that removes transcription-blocking DNA damage from the transcribed strand of actively expressed genes. If the formation of secondary DNA structures that are associated with SSRs were to block RNA polymerase progression, TCNER could be activated, resulting in the removal of the aberrant structure and a concomitant change in the region's length. To test this, TCNER activity in primary human fibroblasts was assessed on defined DNA substrates containing extrahelical DNA loops that lack discernible internal base pairs or DNA stem–loops that contain base pairs within the stem. The results show that both structures impede transcription elongation, but there is no corresponding evidence that nucleotide excision repair (NER) or TCNER operates to remove them. PMID:29474673

  17. Electrostatic coupling between DNA and its counterions modulates the observed translational diffusion coefficients.

    PubMed

    Stellwagen, Earle; Stellwagen, Nancy C

    2015-09-01

    Free solution capillary electrophoresis (CE) is a useful technique for measuring the translational diffusion coefficients of charged analytes. The measurements are relatively fast if the polarity of the electric field is reversed to drive the analyte back and forth past the detection window during each run. We have tested the validity of the resulting diffusion coefficients using double-stranded DNA molecules ranging in size from 20 to 960 base pairs as the model system. The diffusion coefficients of small DNAs are equal to values in the literature measured by other techniques. However, the diffusion coefficients of DNA molecules larger than ∼30 base pairs are anomalously high and deviate increasingly from the literature values with increasing DNA molar mass. The anomalously high diffusion coefficients are due to electrostatic coupling between the DNA and its counterions. As a result, the measured diffusion coefficients vary with the diffusion coefficient of the counterion, as well as with cation concentration and electric field strength. These effects can be reduced or eliminated by measuring apparent diffusion coefficients of the DNA at several different electric field strengths and extrapolating the results to zero electric field.

  18. C-5 Propynyl Modifications Enhance the Mechanical Stability of DNA.

    PubMed

    Aschenbrenner, Daniela; Baumann, Fabian; Milles, Lukas F; Pippig, Diana A; Gaub, Hermann E

    2015-07-20

    Increased thermal or mechanical stability of DNA duplexes is desired for many applications in nanotechnology or -medicine where DNA is used as a programmable building block. Modifications of pyrimidine bases are known to enhance thermal stability and have the advantage of standard base-pairing and easy integration during chemical DNA synthesis. Through single-molecule force spectroscopy experiments with atomic force microscopy and the molecular force assay we investigated the effect of pyrimidines harboring C-5 propynyl modifications on the mechanical stability of double-stranded DNA. Utilizing these complementary techniques, we show that propynyl bases significantly increase the mechanical stability if the DNA is annealed at high temperature. In contrast, modified DNA complexes formed at room temperature and short incubation times display the same stability as non-modified DNA duplexes. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Automated property optimization via ab initio O(N) elongation method: Application to (hyper-)polarizability in DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Orimoto, Yuuichi, E-mail: orimoto.yuuichi.888@m.kyushu-u.ac.jp; Aoki, Yuriko; Japan Science and Technology Agency, CREST, 4-1-8 Hon-chou, Kawaguchi, Saitama 332-0012

    An automated property optimization method was developed based on the ab initio O(N) elongation (ELG) method and applied to the optimization of nonlinear optical (NLO) properties in DNA as a first test. The ELG method mimics a polymerization reaction on a computer, and the reaction terminal of a starting cluster is attacked by monomers sequentially to elongate the electronic structure of the system by solving in each step a limited space including the terminal (localized molecular orbitals at the terminal) and monomer. The ELG-finite field (ELG-FF) method for calculating (hyper-)polarizabilities was used as the engine program of the optimization method,more » and it was found to show linear scaling efficiency while maintaining high computational accuracy for a random sequenced DNA model. Furthermore, the self-consistent field convergence was significantly improved by using the ELG-FF method compared with a conventional method, and it can lead to more feasible NLO property values in the FF treatment. The automated optimization method successfully chose an appropriate base pair from four base pairs (A, T, G, and C) for each elongation step according to an evaluation function. From test optimizations for the first order hyper-polarizability (β) in DNA, a substantial difference was observed depending on optimization conditions between “choose-maximum” (choose a base pair giving the maximum β for each step) and “choose-minimum” (choose a base pair giving the minimum β). In contrast, there was an ambiguous difference between these conditions for optimizing the second order hyper-polarizability (γ) because of the small absolute value of γ and the limitation of numerical differential calculations in the FF method. It can be concluded that the ab initio level property optimization method introduced here can be an effective step towards an advanced computer aided material design method as long as the numerical limitation of the FF method is taken into account.« less

  20. Automated property optimization via ab initio O(N) elongation method: Application to (hyper-)polarizability in DNA.

    PubMed

    Orimoto, Yuuichi; Aoki, Yuriko

    2016-07-14

    An automated property optimization method was developed based on the ab initio O(N) elongation (ELG) method and applied to the optimization of nonlinear optical (NLO) properties in DNA as a first test. The ELG method mimics a polymerization reaction on a computer, and the reaction terminal of a starting cluster is attacked by monomers sequentially to elongate the electronic structure of the system by solving in each step a limited space including the terminal (localized molecular orbitals at the terminal) and monomer. The ELG-finite field (ELG-FF) method for calculating (hyper-)polarizabilities was used as the engine program of the optimization method, and it was found to show linear scaling efficiency while maintaining high computational accuracy for a random sequenced DNA model. Furthermore, the self-consistent field convergence was significantly improved by using the ELG-FF method compared with a conventional method, and it can lead to more feasible NLO property values in the FF treatment. The automated optimization method successfully chose an appropriate base pair from four base pairs (A, T, G, and C) for each elongation step according to an evaluation function. From test optimizations for the first order hyper-polarizability (β) in DNA, a substantial difference was observed depending on optimization conditions between "choose-maximum" (choose a base pair giving the maximum β for each step) and "choose-minimum" (choose a base pair giving the minimum β). In contrast, there was an ambiguous difference between these conditions for optimizing the second order hyper-polarizability (γ) because of the small absolute value of γ and the limitation of numerical differential calculations in the FF method. It can be concluded that the ab initio level property optimization method introduced here can be an effective step towards an advanced computer aided material design method as long as the numerical limitation of the FF method is taken into account.

  1. Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

    PubMed

    Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

    2015-02-10

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

  2. Differential stabilities and sequence-dependent base pair opening dynamics of Watson–Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine

    DOE PAGES

    Szulik, Marta W.; Pallan, Pradeep S.; Nocek, Boguslaw; ...

    2015-01-29

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T 8X 9G 10-3' sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC didmore » not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A 5:T 8, whereas 5caC did not. At the oxidized base pair G 4:X 9, 5fC exhibited an increase in the imino proton exchange rate and the calculated k op. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C 3:G 10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G 4:X 9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N 4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. Furthermore, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.« less

  3. Differential Stabilities and Sequence-Dependent Base Pair Opening Dynamics of Watson–Crick Base Pairs with 5-Hydroxymethylcytosine, 5-Formylcytosine, or 5-Carboxylcytosine

    PubMed Central

    2016-01-01

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5′-CG-3′ sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5′-T8X9G10-3′ sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes. PMID:25632825

  4. Atomic-scale imaging of DNA using scanning tunnelling microscopy.

    PubMed

    Driscoll, R J; Youngquist, M G; Baldeschwieler, J D

    1990-07-19

    The scanning tunnelling microscope (STM) has been used to visualize DNA under water, under oil and in air. Images of single-stranded DNA have shown that submolecular resolution is possible. Here we describe atomic-resolution imaging of duplex DNA. Topographic STM images of uncoated duplex DNA on a graphite substrate obtained in ultra-high vacuum are presented that show double-helical structure, base pairs, and atomic-scale substructure. Experimental STM profiles show excellent correlation with atomic contours of the van der Waals surface of A-form DNA derived from X-ray crystallography. A comparison of variations in the barrier to quantum mechanical tunnelling (barrier-height) with atomic-scale topography shows correlation over the phosphate-sugar backbone but anticorrelation over the base pairs. This relationship may be due to the different chemical characteristics of parts of the molecule. Further investigation of this phenomenon should lead to a better understanding of the physics of imaging adsorbates with the STM and may prove useful in sequencing DNA. The improved resolution compared with previously published STM images of DNA may be attributable to ultra-high vacuum, high data-pixel density, slow scan rate, a fortuitously clean and sharp tip and/or a relatively dilute and extremely clean sample solution. This work demonstrates the potential of the STM for characterization of large biomolecular structures, but additional development will be required to make such high resolution imaging of DNA and other large molecules routine.

  5. G-quadruplexes Significantly Stimulate Pif1 Helicase-catalyzed Duplex DNA Unwinding*

    PubMed Central

    Duan, Xiao-Lei; Liu, Na-Nv; Yang, Yan-Tao; Li, Hai-Hong; Li, Ming; Dou, Shuo-Xing; Xi, Xu-Guang

    2015-01-01

    The evolutionarily conserved G-quadruplexes (G4s) are faithfully inherited and serve a variety of cellular functions such as telomere maintenance, gene regulation, DNA replication initiation, and epigenetic regulation. Different from the Watson-Crick base-pairing found in duplex DNA, G4s are formed via Hoogsteen base pairing and are very stable and compact DNA structures. Failure of untangling them in the cell impedes DNA-based transactions and leads to genome instability. Cells have evolved highly specific helicases to resolve G4 structures. We used a recombinant nuclear form of Saccharomyces cerevisiae Pif1 to characterize Pif1-mediated DNA unwinding with a substrate mimicking an ongoing lagging strand synthesis stalled by G4s, which resembles a replication origin and a G4-structured flap in Okazaki fragment maturation. We find that the presence of G4 may greatly stimulate the Pif1 helicase to unwind duplex DNA. Further studies reveal that this stimulation results from G4-enhanced Pif1 dimerization, which is required for duplex DNA unwinding. This finding provides new insights into the properties and functions of G4s. We discuss the observed activation phenomenon in relation to the possible regulatory role of G4s in the rapid rescue of the stalled lagging strand synthesis by helping the replicator recognize and activate the replication origin as well as by quickly removing the G4-structured flap during Okazaki fragment maturation. PMID:25627683

  6. New t-gap insertion-deletion-like metrics for DNA hybridization thermodynamic modeling.

    PubMed

    D'yachkov, Arkadii G; Macula, Anthony J; Pogozelski, Wendy K; Renz, Thomas E; Rykov, Vyacheslav V; Torney, David C

    2006-05-01

    We discuss the concept of t-gap block isomorphic subsequences and use it to describe new abstract string metrics that are similar to the Levenshtein insertion-deletion metric. Some of the metrics that we define can be used to model a thermodynamic distance function on single-stranded DNA sequences. Our model captures a key aspect of the nearest neighbor thermodynamic model for hybridized DNA duplexes. One version of our metric gives the maximum number of stacked pairs of hydrogen bonded nucleotide base pairs that can be present in any secondary structure in a hybridized DNA duplex without pseudoknots. Thermodynamic distance functions are important components in the construction of DNA codes, and DNA codes are important components in biomolecular computing, nanotechnology, and other biotechnical applications that employ DNA hybridization assays. We show how our new distances can be calculated by using a dynamic programming method, and we derive a Varshamov-Gilbert-like lower bound on the size of some of codes using these distance functions as constraints. We also discuss software implementation of our DNA code design methods.

  7. Mitochondrial DNA Copy Number in Sleep Duration Discordant Monozygotic Twins.

    PubMed

    Wrede, Joanna E; Mengel-From, Jonas; Buchwald, Dedra; Vitiello, Michael V; Bamshad, Michael; Noonan, Carolyn; Christiansen, Lene; Christensen, Kaare; Watson, Nathaniel F

    2015-10-01

    Mitochondrial DNA (mtDNA) copy number is an important component of mitochondrial function and varies with age, disease, and environmental factors. We aimed to determine whether mtDNA copy number varies with habitual differences in sleep duration within pairs of monozygotic twins. Academic clinical research center. 15 sleep duration discordant monozygotic twin pairs (30 twins, 80% female; mean age 42.1 years [SD 15.0]). Sleep duration was phenotyped with wrist actigraphy. Each twin pair included a "normal" (7-9 h/24) and "short" (< 7 h/24) sleeping twin. Fasting peripheral blood leukocyte DNA was assessed for mtDNA copy number via the n-fold difference between qPCR measured mtDNA and nuclear DNA creating an mtDNA measure without absolute units. We used generalized estimating equation linear regression models accounting for the correlated data structure to assess within-pair effects of sleep duration on mtDNA copy number. Mean within-pair sleep duration difference per 24 hours was 94.3 minutes (SD 62.6 min). We found reduced sleep duration (β = 0.06; 95% CI 0.004, 0.12; P < 0.05) and sleep efficiency (β = 0.51; 95% CI 0.06, 0.95; P < 0.05) were significantly associated with reduced mtDNA copy number within twin pairs. Thus every 1-minute decrease in actigraphy-defined sleep duration was associated with a decrease in mtDNA copy number of 0.06. Likewise, a 1% decrease in actigraphy-defined sleep efficiency was associated with a decrease in mtDNA copy number of 0.51. Reduced sleep duration and sleep efficiency were associated with reduced mitochondrial DNA copy number in sleep duration discordant monozygotic twins offering a potential mechanism whereby short sleep impairs health and longevity through mitochondrial stress. © 2015 Associated Professional Sleep Societies, LLC.

  8. THz spectra and corresponding vibrational modes of DNA base pair cocrystals and polynucleotides.

    PubMed

    Wang, Fang; Zhao, Dongbo; Dong, Hao; Jiang, Ling; Huang, Lin; Liu, Yunfei; Li, Shuhua

    2018-07-05

    The generalized energy-based fragmentation (GEBF) approach has been applied to study the THz spectra and vibrational modes of base pair cocrystals under periodic boundary conditions (denoted as PBC-GEBF). Results of vibrational mode reveal that hydrogen bonds play a pivotal role in the pairing process of base crystals, where most NH and CH bonds stretch to some extent. We also found that hydrogen bonds of a self-made A:T cocrystal completely break in a transition from liquid to the solid state, while self-made C:G cocrystal is different and easier to form a cocrystal, as confirmed by X-ray diffraction (XRD) and terahertz (THz) spectra. Furthermore, we have studied DNA polynucleotides (in both A and B forms) found that the vibrational modes changed a lot during the process of their forming double strand. Despite the key role played by hydrogen bonds, the key contribution originates from collective motions of the main skeleton. A comparative study of the spectra of some stranded fragments suggests that different sequences or forms have similar spectra in THz band. They distinguish from each other mainly in the low-frequency regions, especially below 1 THz. This study would make great contributions to the molecular dynamics model based DNA long-chain structure simulation in the future study. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. Tobacco chloroplast tRNALys(UUU) gene contains a 2.5-kilobase-pair intron: An open reading frame and a conserved boundary sequence in the intron

    PubMed Central

    Sugita, Mamoru; Shinozaki, Kazuo; Sugiura, Masahiro

    1985-01-01

    The nucleotide sequence of a tRNALys(UUU) gene on tobacco (Nicotiana tabacum) chloroplast DNA has been determined. This gene is located 215 base pairs upstream from the gene for the 32,000-dalton thylakoid membrane protein on the same DNA strand and has a 2526-base-pair intron in the anticodon loop. The intron boundary sequence does not follow the G-U/A-G rule but is similar to those of tobacco chloroplast split genes for tRNAGly(UCC) and ribosomal proteins L2 and S12. The intron contains one major open reading frame of 509 codons. The codon usage in the open reading frame resembles those observed in the genes for tobacco chloroplast proteins so far analyzed. The primary transcript of this tRNA gene is 2.7 kilobases long. Images PMID:16593561

  10. Tobacco chloroplast tRNA(UUU) gene contains a 2.5-kilobase-pair intron: An open reading frame and a conserved boundary sequence in the intron.

    PubMed

    Sugita, M; Shinozaki, K; Sugiura, M

    1985-06-01

    The nucleotide sequence of a tRNA(Lys)(UUU) gene on tobacco (Nicotiana tabacum) chloroplast DNA has been determined. This gene is located 215 base pairs upstream from the gene for the 32,000-dalton thylakoid membrane protein on the same DNA strand and has a 2526-base-pair intron in the anticodon loop. The intron boundary sequence does not follow the G-U/A-G rule but is similar to those of tobacco chloroplast split genes for tRNA(Gly)(UCC) and ribosomal proteins L2 and S12. The intron contains one major open reading frame of 509 codons. The codon usage in the open reading frame resembles those observed in the genes for tobacco chloroplast proteins so far analyzed. The primary transcript of this tRNA gene is 2.7 kilobases long.

  11. Electrophoretic detection and separation of mutant DNA using replaceable polymer matrices

    DOEpatents

    Karger, Barry L.; Thilly, William G.; Foret, Frantisek; Khrapko, Konstaintin; Koehavong, Phouthone; Cohen, Aharon S.; Giese, Roger W.

    1997-01-01

    The disclosure relates to a method for resolving double-stranded DNA species differing by at least one base pair. Each of the species is characterized by an iso-melting domain with a unique melting temperature contiguous with a melting domain of higher thermal stability.

  12. Unusual hydrogen bonding patterns in AF (aminofluorene) and AAF (acetylaminofluorene) modified DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Broyde, S.; Hingerty, B.E.; Shapiro, R.

    1989-01-01

    New structures are presented for AF and AAF modified DNAs that place the carcinogen in the minor groove of a B-DNA helix. These structures employ non-Watson-Crick base pairing schemes with syn guanine at the modification site. 32 refs., 9 figs.

  13. Formation and Repair of Mismatches Containing Ribonucleotides and Oxidized Bases at Repeated DNA Sequences*

    PubMed Central

    Cilli, Piera; Minoprio, Anna; Bossa, Cecilia; Bignami, Margherita; Mazzei, Filomena

    2015-01-01

    The cellular pool of ribonucleotide triphosphates (rNTPs) is higher than that of deoxyribonucleotide triphosphates. To ensure genome stability, DNA polymerases must discriminate against rNTPs and incorporated ribonucleotides must be removed by ribonucleotide excision repair (RER). We investigated DNA polymerase β (POL β) capacity to incorporate ribonucleotides into trinucleotide repeated DNA sequences and the efficiency of base excision repair (BER) and RER enzymes (OGG1, MUTYH, and RNase H2) when presented with an incorrect sugar and an oxidized base. POL β incorporated rAMP and rCMP opposite 7,8-dihydro-8-oxoguanine (8-oxodG) and extended both mispairs. In addition, POL β was able to insert and elongate an oxidized rGMP when paired with dA. We show that RNase H2 always preserves the capacity to remove a single ribonucleotide when paired to an oxidized base or to incise an oxidized ribonucleotide in a DNA duplex. In contrast, BER activity is affected by the presence of a ribonucleotide opposite an 8-oxodG. In particular, MUTYH activity on 8-oxodG:rA mispairs is fully inhibited, although its binding capacity is retained. This results in the reduction of RNase H2 incision capability of this substrate. Thus complex mispairs formed by an oxidized base and a ribonucleotide can compromise BER and RER in repeated sequences. PMID:26338705

  14. Design and Applications of Noncanonical DNA Base Pairs.

    PubMed

    Jissy, A K; Datta, Ayan

    2014-01-02

    While the Watson-Crick base pairs are known to stabilize the DNA double helix and play a vital role in storage/replication of genetic information, their replacement with non-Watson-Crick base pairs has recently been shown to have interesting practical applications. Nowadays, theoretical calculations are routinely performed on very complex systems to gain a better understanding of how molecules interact with each other. We not only bring together some of the basic concepts of how mispaired or unnatural nucleobases interact with each other but also look at how such an understanding influences the prediction of novel properties and development of new materials. We highlight the recent developments in this field of research. In this Perspective, we discuss the success of DFT methods, particularly, dispersion-corrected DFT, for applications such as pH-controlled molecular switching, electric-field-induced stacking of disk-like molecules with guanine quartets, and optical birefringence of alkali-metal-coordinated guanine quartets. The synergy between theoretical models and real applications is highlighted.

  15. A facile approach to prepare a dual functionalized DNA based material in a bio-deep eutectic solvent.

    PubMed

    Mondal, Dibyendu; Bhatt, Jitkumar; Sharma, Mukesh; Chatterjee, Shruti; Prasad, Kamalesh

    2014-04-18

    DNA (Salmon testes) was functionalized by Fe3O4 nanoparticles and protonated layered dititanate sheets (H2·Ti2O5·H2O) in a mixture of choline chloride and ethylene glycol (a deep eutectic solvent) to yield a hybrid material having magnetic and antibacterial properties. Ti sheets were found to interact with the phosphate moieties, while Fe interacted with the base pair of DNA in the hybrid material.

  16. Developing Single-Molecule TPM Experiments for Direct Observation of Successful RecA-Mediated Strand Exchange Reaction

    PubMed Central

    Fan, Hsiu-Fang; Cox, Michael M.; Li, Hung-Wen

    2011-01-01

    RecA recombinases play a central role in homologous recombination. Once assembled on single-stranded (ss) DNA, RecA nucleoprotein filaments mediate the pairing of homologous DNA sequences and strand exchange processes. We have designed two experiments based on tethered particle motion (TPM) to investigate the fates of the invading and the outgoing strands during E. coli RecA-mediated pairing and strand exchange at the single-molecule level in the absence of force. TPM experiments measure the tethered bead Brownian motion indicative of the DNA tether length change resulting from RecA binding and dissociation. Experiments with beads labeled on either the invading strand or the outgoing strand showed that DNA pairing and strand exchange occurs successfully in the presence of either ATP or its non-hydrolyzable analog, ATPγS. The strand exchange rates and efficiencies are similar under both ATP and ATPγS conditions. In addition, the Brownian motion time-courses suggest that the strand exchange process progresses uni-directionally in the 5′-to-3′ fashion, using a synapse segment with a wide and continuous size distribution. PMID:21765895

  17. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yeo, Hyun Koo; Lee, Jae Young

    2012-04-18

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

  18. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

    PubMed

    Yeo, Hyun Koo; Lee, Jae Young

    2010-05-01

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

  19. BioWires: Conductive DNA Nanowires in a Computationally-Optimized, Synthetic Biological Platform for Nanoelectronic Fabrication

    NASA Technical Reports Server (NTRS)

    Vecchioni, Simon; Toomey, Emily; Capece, Mark C.; Rothschild, Lynn; Wind, Shalom

    2017-01-01

    DNA is an ideal template for a biological nanowire-it has a linear structure several atoms thick; it possesses addressable nucleobase geometry that can be precisely defined; and it is massively scalable into branched networks. Until now, the drawback of DNA as a conducting nanowire been, simply put, its low conductance. To address this deficiency, we extensively characterize a chemical variant of canonical DNA that exploits the affinity of natural cytosine bases for silver ions. We successfully construct chains of single silver ions inside double-stranded DNA, confirm the basic dC-Ag+-dC bond geometry and kinetics, and show length-tunability dependent on mismatch distribution, ion availability and enzyme activity. An analysis of the absorbance spectra of natural DNA and silver-binding, poly-cytosine DNA demonstrates the heightened thermostability of the ion chain and its resistance to aqueous stresses such as precipitation, dialysis and forced reduction. These chemically critical traits lend themselves to an increase in electrical conductivity of over an order of magnitude for 11-base silver-paired duplexes over natural strands when assayed by STM break junction. We further construct and implement a genetic pathway in the E. coli bacterium for the biosynthesis of highly ionizable DNA sequences. Toward future circuits, we construct a model of transcription network architectures to determine the most efficient and robust connectivity for cell-based fabrication, and we perform sequence optimization with a genetic algorithm to identify oligonucleotides robust to changes in the base-pairing energy landscape. We propose that this system will serve as a synthetic biological fabrication platform for more complex DNA nanotechnology and nanoelectronics with applications to deep space and low resource environments.

  20. DNA binding studies of a new dicationic porphyrin. Insights into interligand interactions.

    PubMed

    Shelton, Alexander H; Rodger, Alison; McMillin, David R

    2007-08-07

    Cationic porphyrins have an affinity for DNA and potential for applications in the fields of photodynamic therapy and cellular imaging. This report describes a new dicationic porphyrin, 5,15-dimethyl-10,20-di(N-methylpyridinium-4-yl)porphyrin, abbreviated H2tMe2D4. Although tetrasubstituted, H2tMe2D4 presents modest steric requirements and forms in reasonable yield by a "2+2" synthetic method. Accordingly, studies of the zinc(II)- and copper(II)-containing derivatives, Zn(tMe2D4) and Cu(tMe2D4), have also been possible. Methods used to characterize DNA-binding motifs include absorption, emission, linear, and circular dichroism spectroscopies, as well as viscometry. An unusually detailed picture of porphyrin uptake emerges. As the ratio of DNA to porphyrin increases during a typical titration, H2tMe2D4 or Cu(tMe2D4) initially aggregates on the host and then shifts to intercalative binding at close quarters before finally dispersing into non-interacting intercalation sites of the host. Emission studies of the copper(II) porphyrin have been very valuable. The existence of a measurable signal is diagnostic of intercalative binding, and the saturation behavior establishes that internalization typically monopolizes approximately three base pairs. In the moderate loading regime, emission data are most telling because dipole-dipole interactions between near-neighbor porphyrins tend to confuse other spectroscopic assays. The third ligand, Zn(tMe2D4), behaves differently in that the uptake is a strictly cooperative process. The mode of binding also varies with the base content of the DNA host. When the DNA is rich in A=T base pairs, the porphyrin remains five-coordinate and binds externally; however, Zn(tMe2D4) loses its axial ligand and binds by intercalation if the host contains only G[triple bond]C base pairs.

  1. Replication infidelity via a mismatch with Watson-Crick geometry.

    PubMed

    Bebenek, Katarzyna; Pedersen, Lars C; Kunkel, Thomas A

    2011-02-01

    In describing the DNA double helix, Watson and Crick suggested that "spontaneous mutation may be due to a base occasionally occurring in one of its less likely tautomeric forms." Indeed, among many mispairing possibilities, either tautomerization or ionization of bases might allow a DNA polymerase to insert a mismatch with correct Watson-Crick geometry. However, despite substantial progress in understanding the structural basis of error prevention during polymerization, no DNA polymerase has yet been shown to form a natural base-base mismatch with Watson-Crick-like geometry. Here we provide such evidence, in the form of a crystal structure of a human DNA polymerase λ variant poised to misinsert dGTP opposite a template T. All atoms needed for catalysis are present at the active site and in positions that overlay with those for a correct base pair. The mismatch has Watson-Crick geometry consistent with a tautomeric or ionized base pair, with the pH dependence of misinsertion consistent with the latter. The results support the original idea that a base substitution can originate from a mismatch having Watson-Crick geometry, and they suggest a common catalytic mechanism for inserting a correct and an incorrect nucleotide. A second structure indicates that after misinsertion, the now primer-terminal G • T mismatch is also poised for catalysis but in the wobble conformation seen in other studies, indicating the dynamic nature of the pathway required to create a mismatch in fully duplex DNA.

  2. Structural DNA Nanotechnology: State of the Art and Future Perspective

    PubMed Central

    2015-01-01

    Over the past three decades DNA has emerged as an exceptional molecular building block for nanoconstruction due to its predictable conformation and programmable intra- and intermolecular Watson–Crick base-pairing interactions. A variety of convenient design rules and reliable assembly methods have been developed to engineer DNA nanostructures of increasing complexity. The ability to create designer DNA architectures with accurate spatial control has allowed researchers to explore novel applications in many directions, such as directed material assembly, structural biology, biocatalysis, DNA computing, nanorobotics, disease diagnosis, and drug delivery. This Perspective discusses the state of the art in the field of structural DNA nanotechnology and presents some of the challenges and opportunities that exist in DNA-based molecular design and programming. PMID:25029570

  3. Hydrolysis of N3-methyl-2'-deoxycytidine: model compound for reactivity of protonated cytosine residues in DNA.

    PubMed

    Sowers, L C; Sedwick, W D; Shaw, B R

    1989-11-01

    Protonation of cytosine residues at physiological pH may occur in DNA as a consequence of both alkylation and aberrant base-pair formation. When cytosine derivatives are protonated, they undergo hydrolysis reactions at elevated rates and can either deaminate to form the corresponding uracil derivatives or depyrimidinate generating abasic sites. The kinetic parameters for reaction of protonated cytosine are derived by studying the hydrolysis of N3-methyl-2'-deoxycytidine (m3dC), a cytosine analogue which is predominantly protonated at physiological pH. Both deamination and depyrimidimation reaction rates are shown to be linearly dependent upon the fraction of protonated molecules. We present here thermodynamic parameters which allow determination of hydrolysis rates of m3dC as functions of pH and temperature. Protonation of cytosine residues in DNA, as induced by aberrant base-pair formation or base modification, may accelerate the rate of both deamination and depyrimidation up to several thousand-fold under physiological conditions.

  4. Detection of hemolytic Listeria monocytogenes by using DNA colony hybridization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Datta, A.R.; Wentz, B.A.; Hill, W.E.

    1987-09-01

    A fragment of about 500 base pairs of the beta-hemolysin gene from Listeria monocytogenes was used to screen different bacterial strains by DNA colony hybridization. The cells in the colonies were lysed by microwaves in the presence of sodium hydroxide. Of 52 different strains of Listeria species screened, only the DNA from beta-hemolytic (CAMP-positive) strains of L. monocytogenes hybridized with this probe.

  5. A search for specificity in DNA-drug interactions.

    PubMed

    Cruciani, G; Goodford, P J

    1994-06-01

    The GRID force field and a principal component analysis have been used in order to predict the interactions of small chemical groups with all 64 different triplet sequences of B-DNA. Factors that favor binding to guanine-cytosine base pairs have been identified, and a dictionary of ligand groups and their locations is presented as a guide to the design of specific DNA ligands.

  6. MO-AB-BRA-04: Radiation Measurements with a DNA Double-Strand-Break Dosimeter

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Obeidat, M; Cline, K; Stathakis, S

    Purpose: Many types of dosimeters are used to measure radiation, but none of them directly measures the biological effect of this dose. The purpose here is to create a dosimeter that can measure the probability of double-strand breaks (DSB) for DNA, which is directly related to the biological effect of radiation. Methods: The dosimeter has DNA strands, which are labeled on one end with biotin and on the other with fluorescein. The biotin attaches these strands to magnetic beads. We suspended the DNA dosimeter in phosphate-buffered saline (PBS) as it matches the internal environment of the body. We placed smallmore » volumes (50µL) of the DNA dosimeter into tubes and irradiated these samples in a water-equivalent plastic phantom with several doses (three samples per dose). After irradiating the samples, a magnet was placed against the tubes. The fluorescein attached to broken DNA strands was extracted (called the supernatant) and placed into a different tube. The fluorescein on the unbroken strands remained attached to the beads in the tube and was re-suspended with 50µL of PBS. A fluorescence reader was used to measure the fluorescence for both the re-suspended beads and supernatant. To prove that we are measuring DSB, we tested dosimeter response with two different lengths of attached DNA strands (1 and 4 kilo-base pair). Results: The probability of DSB at the dose levels of 5, 10, 25, and 50 Gy were 0.05, 0.08, 0.12, and 0.19, respectively, while the coefficients of variation were 0.14, 0.07, 0.02, and 0.01, respectively. The 4 kilo-base-pair dosimeter produced 5.3 times the response of the 1 kilo-base-pair dosimeter. Conclusion: The DNA dosimeter yields a measurable response to dose that scales with the DNA strand length. The goal now is to refine the dosimeter fabrication to reproducibly create a low coefficient of variation for the lower doses. This work was supported in part by Yarmouk University (Irbid, Jordan) and CPRIT (RP140105)« less

  7. Evaluation of Microbial Diversity in Wetland through Polymerase Chain Reaction (PCR) and Restriction Fragment Length Polymorphism (RFLP)

    DTIC Science & Technology

    2006-06-01

    51 Appendix C. Promega Restriction Digest Protocol ....................................................53...Rsa1 Restriction Digest Results............................................................................180 9. DNA Base Pair Comparison...particular restriction endonuclease, the length of the fragments produced will differ when the DNA is digested with a restriction enzyme (Edwards

  8. Electrophoretic detection and separation of mutant DNA using replaceable polymer matrices

    DOEpatents

    Karger, B.L.; Thilly, W.G.; Foret, F.; Khrapko, K.; Koehavong, P.; Cohen, A.S.; Giese, R.W.

    1997-05-27

    The disclosure relates to a method for resolving double-stranded DNA species differing by at least one base pair. Each of the species is characterized by an iso-melting domain with a unique melting temperature contiguous with a melting domain of higher thermal stability. 18 figs.

  9. Engaging with Molecular Form to Understand Function

    ERIC Educational Resources Information Center

    Barber, Nicola C.; Stark, Louisa A.

    2014-01-01

    Cells are bustling factories with diverse and prolific arrays of molecular machinery. Remarkably, this machinery self-organizes to carry out the complex biochemical activities characteristic of life. When Watson and Crick published the structure of DNA, they noted that DNA base pairing creates a double-stranded form that provides a means of…

  10. Bio-activity of aminosulfonyl ureas in the light of nucleic acid bases and DNA base pair interaction.

    PubMed

    Mondal Roy, Sutapa

    2018-08-01

    The quantum chemical descriptors based on density functional theory (DFT) are applied to predict the biological activity (log IC 50 ) of one class of acyl-CoA: cholesterol O-acyltransferase (ACAT) inhibitors, viz. aminosulfonyl ureas. ACAT are very effective agents for reduction of triglyceride and cholesterol levels in human body. Successful two parameter quantitative structure-activity relationship (QSAR) models are developed with a combination of relevant global and local DFT based descriptors for prediction of biological activity of aminosulfonyl ureas. The global descriptors, electron affinity of the ACAT inhibitors (EA) and/or charge transfer (ΔN) between inhibitors and model biosystems (NA bases and DNA base pairs) along with the local group atomic charge on sulfonyl moiety (∑Q Sul ) of the inhibitors reveals more than 90% efficacy of the selected descriptors for predicting the experimental log (IC 50 ) values. Copyright © 2018 Elsevier Ltd. All rights reserved.

  11. Synthesis and DNA interaction of a mixed proflavine-phenanthroline Tröger base.

    PubMed

    Baldeyrou, Brigitte; Tardy, Christelle; Bailly, Christian; Colson, Pierre; Houssier, Claude; Charmantray, Franck; Demeunynck, Martine

    2002-04-01

    We report the synthesis of an asymmetric Tröger base containing the two well characterised DNA binding chromophores, proflavine and phenanthroline. The mode of interaction of the hybrid molecule was investigated by circular and linear dichroism experiments and a biochemical assay using DNA topoisomerase I. The data are compatible with a model in which the proflavine moiety intercalates between DNA base pairs and the phenanthroline ring occupies the DNA groove. DNase I cleavage experiments were carried out to investigate the sequence preference of the hybrid ligand and a well resolved footprint was detected at a site encompassing two adjacent 5'-GTC.5-GAC triplets. The sequence preference of the asymmetric molecule is compared to that of the symmetric analogues.

  12. Capturing a DNA duplex under near-physiological conditions

    NASA Astrophysics Data System (ADS)

    Zhang, Huijuan; Xu, Wei; Liu, Xiaogang; Stellacci, Francesco; Thong, John T. L.

    2010-10-01

    We report in situ trapping of a thiolated DNA duplex with eight base pairs into a polymer-protected gold nanogap device under near-physiological conditions. The double-stranded DNA was captured by electrophoresis and covalently attached to the nanogap electrodes through sulfur-gold bonding interaction. The immobilization of the DNA duplex was confirmed by direct electrical measurements under near-physiological conditions. The conductance of the DNA duplex was estimated to be 0.09 μS. We also demonstrate the control of DNA dehybridization by heating the device to temperatures above the melting point of the DNA.

  13. Homology Between Burkitt Herpes Viral DNA and DNA in Continuous Lymphoblastoid Cells from Patients with Infectious Mononucleosis

    PubMed Central

    Kieff, Elliott; Levine, Judith

    1974-01-01

    At least 90% of the sequences of purified, in vitro labeled, DNA from Epstein-Barr virus (prepared from HR-1, Burkitt's lymphoblastoid cells) are homologous to the DNA of the herpes virus contained in cell lines derived from patients with infectious mononucleosis. The thermal stability of the homologous and heterologous hybrid DNA molecules could not be differentiated, indicating at least 97% matching of base pairs between DNA of Epstein-Barr virus and the herpes viral DNA contained in the lymphoblasts from patients with infectious mononucleosis. PMID:4360941

  14. MODULATION BY IONIC STRENGTH AND SUPERHELICITY OF BENZO[a]PYRENE DIOL EPOXIDE INDUCED DNA ALKYLATION AND UNWINDING

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gamper, Howard B.; Straub, Kenneth; Calvin, Melvin

    Superhelical and partially relaxed SV40 DNA were reacted in vitro with (+)7{beta}, 8{alpha}-dihydroxy-9{alpha},10{alpha}-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene (BaP diol epoxide). The modified DNA contained N{sup 2} guanine and N{sup 6} adeninte hydrocarbon adducts in the ratio 86:14. Superhelical SV40 DNA was approximately 6% more susceptible to modification than partially relaxed viral DNA. Counterions inhibited DNA alkylation by up to 90%, Mg{sup 2+} being 50-fold more effective than Na{sup +}. The sensitivity of covalent binding to helix stability is consistent with a reaction complex in which BaP diol epoxide is intercalated. The superhelical density of the modified DNA substrates was determined electrophoretically relative to partiallymore » relaxed standards and an unwinding angle for the hydrocarbon adducts was calculated. The angle was dependent upon the superhelicity of the DNA molecule and ranged from 330{sup o} to 30{sup o}. This data indicates that the modified base pairs are disrupted and, in the presence of torsional strain, act as centers for the further denaturation of up to 8 adjacent base pairs. In the absence of such strain the alkylation sites have an ordered structure with the attached hydrocarbon probably oriented in the minor or major groove of the helix.« less

  15. 2-Thiouracil deprived of thiocarbonyl function preferentially base pairs with guanine rather than adenine in RNA and DNA duplexes

    PubMed Central

    Sochacka, Elzbieta; Szczepanowski, Roman H.; Cypryk, Marek; Sobczak, Milena; Janicka, Magdalena; Kraszewska, Karina; Bartos, Paulina; Chwialkowska, Anna; Nawrot, Barbara

    2015-01-01

    2-Thiouracil-containing nucleosides are essential modified units of natural and synthetic nucleic acids. In particular, the 5-substituted-2-thiouridines (S2Us) present in tRNA play an important role in tuning the translation process through codon–anticodon interactions. The enhanced thermodynamic stability of S2U-containing RNA duplexes and the preferred S2U-A versus S2U-G base pairing are appreciated characteristics of S2U-modified molecular probes. Recently, we have demonstrated that 2-thiouridine (alone or within an RNA chain) is predominantly transformed under oxidative stress conditions to 4-pyrimidinone riboside (H2U) and not to uridine. Due to the important biological functions and various biotechnological applications for sulfur-containing nucleic acids, we compared the thermodynamic stabilities of duplexes containing desulfured products with those of 2-thiouracil-modified RNA and DNA duplexes. Differential scanning calorimetry experiments and theoretical calculations demonstrate that upon 2-thiouracil desulfuration to 4-pyrimidinone, the preferred base pairing of S2U with adenosine is lost, with preferred base pairing with guanosine observed instead. Therefore, biological processes and in vitro assays in which oxidative desulfuration of 2-thiouracil-containing components occurs may be altered. Moreover, we propose that the H2U-G base pair is a suitable model for investigation of the preferred recognition of 3′-G-ending versus A-ending codons by tRNA wobble nucleosides, which may adopt a 4-pyrimidinone-type structural motif. PMID:25690900

  16. Biochemical investigations into the mutagenic potential of 8-oxo-2'-deoxyguanosine using nucleotide analogues.

    PubMed

    Hamm, Michelle L; Crowley, Kelly A; Ghio, Michael; Lindell, Maria A M; McFadden, Emily J; Silberg, Jordan S L; Weaver, Amelia M

    2012-11-19

    8-Oxo-2'-deoxyguanosine (OdG) is an abundant DNA lesion produced during oxidative damage to DNA. It can form relatively stable base pairs with both dC and dA that mimic natural dG:dC and dT:dA base pairs, respectively. Thus, when in the template strand, OdG can direct the insertion of either dCTP or dATP during replication, the latter of which can lead to a dG → T transversion. The potential for OdG to cause mutation is dependent on the preference for dCTP or dATP insertion opposite OdG, as well as the ability to extend past the resulting base pairs. The C2-amine and C8-oxygen could play major roles during these reactions since both would lie outside the Watson-Crick cognate base pairs shape in the major groove when OdG base pairs to dA and dC, respectively, and both have the ability to form strong interactions, like hydrogen bonds. To gain a more generalized understanding of how the C2-amine and C8-oxygen of OdG affect its mutagenic potential, the incorporation opposite and extension past seven analogues of dG/OdG that vary at C2 and/or C8 were characterized for three DNA polymerases, including an exonuclease-deficient version of the replicative polymerase from RB69 (RB69), human polymerase (pol) β, and polymerase IV from Sulfolobus solfataricus P2 (Dpo4). Based on the results from these studies, as well as those from previous studies with RB69, pol β, Dpo4, and two A-family polymerases, the influence of the C2-amine and C8-oxygen during each incorporation and extension reaction with each polymerase is discussed. In general, it appears that when the C2-amine and the C8-oxygen are in the minor groove, they allow OdG to retain interactions that are normally present during insertion and extension. However, when the two groups are in the major groove, they each tend to form novel active site interactions, both stabilizing and destabilizing, that are not present during insertion and extension with natural DNA.

  17. Mapping Structurally Defined Guanine Oxidation Products along DNA Duplexes: Influence of Local Sequence Context and Endogenous Cytosine Methylation

    PubMed Central

    2015-01-01

    DNA oxidation by reactive oxygen species is nonrandom, potentially leading to accumulation of nucleobase damage and mutations at specific sites within the genome. We now present the first quantitative data for sequence-dependent formation of structurally defined oxidative nucleobase adducts along p53 gene-derived DNA duplexes using a novel isotope labeling-based approach. Our results reveal that local nucleobase sequence context differentially alters the yields of 2,2,4-triamino-2H-oxal-5-one (Z) and 8-oxo-7,8-dihydro-2′-deoxyguanosine (OG) in double stranded DNA. While both lesions are overproduced within endogenously methylated MeCG dinucleotides and at 5′ Gs in runs of several guanines, the formation of Z (but not OG) is strongly preferred at solvent-exposed guanine nucleobases at duplex ends. Targeted oxidation of MeCG sequences may be caused by a lowered ionization potential of guanine bases paired with MeC and the preferential intercalation of riboflavin photosensitizer adjacent to MeC:G base pairs. Importantly, some of the most frequently oxidized positions coincide with the known p53 lung cancer mutational “hotspots” at codons 245 (GGC), 248 (CGG), and 158 (CGC) respectively, supporting a possible role of oxidative degradation of DNA in the initiation of lung cancer. PMID:24571128

  18. Molecular DNA-based detection of ionising radiation in meat.

    PubMed

    Şakalar, Ergün

    2017-05-01

    Ionising radiation induces molecular alterations, such as formation of ions, free radicals, and new stable molecules, and cleavage of the chemical bonds of the molecules present in food. Irradiation-treated meat should be labelled to control the process and to ensure free consumer choice. Therefore, sensitive analytical methods are required to detect the irradiation dose. Meat samples were exposed to radiation doses of 0, 0.272, 0.497, 1.063, 3.64, 8.82 and 17.42 kGy in an industrial 60 Co gamma cell. Primers were designed to amplify 998, 498 and 250-base pair (bp) regions of the 18S rRNA gene of nuclear DNA from the irradiated samples. A new DNA-based method was developed to quantify the radiation exposed to the unstored meat and the meat stored at -20 °C for 3 and 6 months. The method was able to detect meat samples stored and unstored with dose limits of 1.063 and 3.64 kGy, respectively. The level of irradiation can be detected using primer pairs that target particularly different-sized sequences for DNA amplification by PCR. This method can be widely used for the analysis of not only meat samples, but also all biological materials containing DNA. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  19. Additional hydrogen bonds and base-pair kinetics in the symmetrical AMP-DNA aptamer complex.

    PubMed Central

    Nonin-Lecomte, S; Lin, C H; Patel, D J

    2001-01-01

    The solution structure of an adenosine monophosphate (AMP)-DNA aptamer complex has been determined previously [Lin, C. H., and Patel, D. J. (1997) Chem. Biol. 4:817-832]. On a symmetrical aptamer complex containing the same binding loop, but with better resolved spectra, we have identified two additional hydrogen bond-mediated associations in the binding loop. One of these involves a rapidly exchanging G imino proton. The phosphate group of the AMP ligand was identified as the acceptor by comparison with other aptamer complexes. Imino proton exchange measurements also yielded the dissociation constants of the stem and binding loop base pairs. This study shows that nuclear magnetic resonance-based imino proton exchange is a good probe for detection of weak hydrogen-bond associations. PMID:11721004

  20. Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

    PubMed

    Brovarets, Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H-bonds in the А·Т base pair are cooperative, reinforcing each other, whereas the C2H⋯O2 H-bond in the А(∗)·Т(∗) base pair behaves anticooperatively, in other words it gets weakened while two others get strengthened. From a quantum-mechanical point of view, the A(∗)·T(∗) Löwdin's base pair appeared to be dynamically unstable because the electronic energy of the back-reaction barrier of the A·T → A(∗)·T(∗) tautomerization does not exceed zero-point vibrational energy associated with the mode for which vibrational frequency becomes imaginary in the TS of tautomerization. Additionally, it was demonstrated using the conductor-like polarizable continuum model that the effects of biomolecular environment (ϵ = 4) cannot ensure dynamic stabilization of the A(∗)·T(∗) Löwdin's base pair. These findings, together with data available from the literature, indicate that the tautomerization of the A·T Watson-Crick base pair to the A(∗)·T(∗) Löwdin's base pair through the DPT cannot be a source of spontaneous point errors that occur during DNA replication.

  1. Replication infidelity via a mismatch with Watson–Crick geometry

    PubMed Central

    Bebenek, Katarzyna; Pedersen, Lars C.; Kunkel, Thomas A.

    2011-01-01

    In describing the DNA double helix, Watson and Crick suggested that “spontaneous mutation may be due to a base occasionally occurring in one of its less likely tautomeric forms.” Indeed, among many mispairing possibilities, either tautomerization or ionization of bases might allow a DNA polymerase to insert a mismatch with correct Watson–Crick geometry. However, despite substantial progress in understanding the structural basis of error prevention during polymerization, no DNA polymerase has yet been shown to form a natural base–base mismatch with Watson–Crick-like geometry. Here we provide such evidence, in the form of a crystal structure of a human DNA polymerase λ variant poised to misinsert dGTP opposite a template T. All atoms needed for catalysis are present at the active site and in positions that overlay with those for a correct base pair. The mismatch has Watson–Crick geometry consistent with a tautomeric or ionized base pair, with the pH dependence of misinsertion consistent with the latter. The results support the original idea that a base substitution can originate from a mismatch having Watson–Crick geometry, and they suggest a common catalytic mechanism for inserting a correct and an incorrect nucleotide. A second structure indicates that after misinsertion, the now primer-terminal G•T mismatch is also poised for catalysis but in the wobble conformation seen in other studies, indicating the dynamic nature of the pathway required to create a mismatch in fully duplex DNA. PMID:21233421

  2. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Otto, C., Thomas, G.A.; Peticolas, W.L.; Rippe, K.

    Raman spectra of the parallel-stranded duplex formed from the deoxyoligonucleotides 5{prime}-d-((A){sub 10}TAATTTTAAATATTT)-3{prime} (D1) and 5{prime}-d((T){sub 10}ATTAAAATTTATAAA)-3{prime} (D2) in H{sub 2}O and D{sub 2}O have been acquired. The spectra of the parallel-stranded DNA are then compared to the spectra of the antiparallel double helix formed from the deoxyoligonucleotides D1 and 5{prime}-d(AAATATTTAAAATTA-(T){sub 10})-3{prime} (D3). The Raman spectra of the antiparallel-stranded (aps) duplex are reminiscent of the spectra of poly(d(A)){center dot}poly(d(T)) and a B-form structure similar to that adopted by the homopolymer duplex is assigned to the antiparallel double helix. The spectra of the parallel-stranded (ps) and antiparallel-stranded duplexes differ significantly due tomore » changes in helical organization, i.e., base pairing, base stacking, and backbone conformation. Large changes observed in the carbonyl stretching region implicate the involvement of the C(2) carbonyl of thymine in base pairing. The interaction of adenine with the C(2) carbonyl of thymine is consistent with formation of reverse Watson-Crick base pairing in parallel-stranded DNA. Phosphate-furanose vibrations similar to those observed for B-form DNA of heterogeneous sequence and high A,T content are observed at 843 and 1,092 cm{sup {minus}1} in the spectra of the parallel-stranded duplex.« less

  3. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Faucher, Frédérick; Robey-Bond, Susan M.; Wallace, Susan S.

    DNA is subject to a multitude of oxidative damages generated by oxidizing agents from metabolism and exogenous sources and by ionizing radiation. Guanine is particularly vulnerable to oxidation, and the most common oxidative product 8-oxoguanine (8-oxoG) is the most prevalent lesion observed in DNA molecules. 8-OxoG can form a normal Watson-Crick pair with cytosine (8-oxoG:C), but it can also form a stable Hoogsteen pair with adenine (8-oxoG:A), leading to a G:C {yields} T:A transversion after replication. Fortunately, 8-oxoG is recognized and excised by either of two DNA glycosylases of the base excision repair pathway: formamidopyrimidine-DNA glycosylase and 8-oxoguanine DNA glycosylasemore » (Ogg). While Clostridium acetobutylicum Ogg (CacOgg) DNA glycosylase can specifically recognize and remove 8-oxoG, it displays little preference for the base opposite the lesion, which is unusual for a member of the Ogg1 family. This work describes the crystal structures of CacOgg in its apo form and in complex with 8-oxo-2'-deoxyguanosine. A structural comparison between the apo form and the liganded form of the enzyme reveals a structural reorganization of the C-terminal domain upon binding of 8-oxoG, similar to that reported for human OGG1. A structural comparison of CacOgg with human OGG1, in complex with 8-oxoG containing DNA, provides a structural rationale for the lack of opposite base specificity displayed by CacOgg.« less

  4. N(4)C-ethyl-N(4)C cross-linked DNA: synthesis and characterization of duplexes with interstrand cross-links of different orientations.

    PubMed

    Noronha, Anne M; Noll, David M; Wilds, Christopher J; Miller, Paul S

    2002-01-22

    The preparation and physical properties of short DNA duplexes that contain a N(4)C-ethyl-N(4)C interstrand cross-link are described. Duplexes that contain an interstrand cross-link between mismatched C-C residues and duplexes in which the C residues of a -CG- or -GC- step are linked to give "staggered" interstrand cross-links were prepared using a novel N(4)C-ethyl-N(4)C phosphoramidite reagent. Duplexes with the C-C mismatch cross-link have UV thermal transition temperatures that are 25 degrees C higher than the melting temperatures of control duplexes in which the cross-link is replaced with a G-C base pair. It appears that this cross-link stabilizes adjacent base pairs and does not perturb the structure of the helix, a conclusion that is supported by the CD spectrum of this duplex and by molecular models. An even higher level of stabilization, 49 degrees C, is seen with the duplex that contains a -CG- staggered cross-link. Molecular models suggest that this cross-link may induce propeller twisting in the cross-linked base pairs, and the CD spectrum of this duplex exhibits an unusual negative band at 298 nm, although the remainder of the spectrum is similar to that of B-form DNA. Mismatched C-C or -CG- staggered cross-linked duplexes that have complementary overhanging ends can undergo self-ligation catalyzed by T4 DNA ligase. Analysis of the ligated oligomers by nondenaturing polyacrylamide gel electrophoresis shows that the resulting oligomers migrate in a manner similar to that of a mixture of non-cross-linked control oligomers and suggests that these cross-links do not result in significant bending of the helix. However, the orientation of the staggered cross-link can have a significant effect on the structure and stability of the cross-linked duplex. Thus, the thermal stability of the duplex that contains a -GC- staggered cross-link is 10 degrees C lower than the melting temperature of the control, non-cross-linked duplex. Unlike the -CG- staggered cross-link, in which the cross-linked base pairs can still maintain hydrogen bond contacts, molecular models suggest that formation of the -GC- staggered cross-link disrupts hydrogen bonding and may also perturb adjacent base pairs leading to an overall reduction in helix stability. Duplexes with specifically positioned and oriented cross-links can be used as substrates to study DNA repair mechanisms.

  5. Estimates of electronic coupling for excess electron transfer in DNA

    NASA Astrophysics Data System (ADS)

    Voityuk, Alexander A.

    2005-07-01

    Electronic coupling Vda is one of the key parameters that determine the rate of charge transfer through DNA. While there have been several computational studies of Vda for hole transfer, estimates of electronic couplings for excess electron transfer (ET) in DNA remain unavailable. In the paper, an efficient strategy is established for calculating the ET matrix elements between base pairs in a π stack. Two approaches are considered. First, we employ the diabatic-state (DS) method in which donor and acceptor are represented with radical anions of the canonical base pairs adenine-thymine (AT) and guanine-cytosine (GC). In this approach, similar values of Vda are obtained with the standard 6-31G* and extended 6-31++G** basis sets. Second, the electronic couplings are derived from lowest unoccupied molecular orbitals (LUMOs) of neutral systems by using the generalized Mulliken-Hush or fragment charge methods. Because the radical-anion states of AT and GC are well reproduced by LUMOs of the neutral base pairs calculated without diffuse functions, the estimated values of Vda are in good agreement with the couplings obtained for radical-anion states using the DS method. However, when the calculation of a neutral stack is carried out with diffuse functions, LUMOs of the system exhibit the dipole-bound character and cannot be used for estimating electronic couplings. Our calculations suggest that the ET matrix elements Vda for models containing intrastrand thymine and cytosine bases are essentially larger than the couplings in complexes with interstrand pyrimidine bases. The matrix elements for excess electron transfer are found to be considerably smaller than the corresponding values for hole transfer and to be very responsive to structural changes in a DNA stack.

  6. 1H NMR studies of the 5-(hydroxymethyl)-2'-deoxyuridine containing TF1 binding site.

    PubMed

    Pasternack, L B; Bramham, J; Mayol, L; Galeone, A; Jia, X; Kearns, D R

    1996-07-15

    The pyrimidine base 5-(hydroxymethyl)-2'-deoxyuridine (HmU) is a common nucleotide in SPO1 phage DNA. Numerous transcriptional proteins bind HmU-containing DNA preferentially implicating a regulatory function of HmU. We have investigated the conformation and dynamics of d-(5'-CHmUCHmUACACGHmUGHmUAGAG-OH-3')2 (HmU-DNA). This oligonucleotide mimics the consensus sequence of Transcription Factor 1 (TF1). The HmU-DNA was compared to the thymine-containing oligonucleotide. NOESY and DQF COSY spectroscopy provided resonance assignments of nonexchangeable and exchangeable protons, intranucleotide, internucleotide and intrastrand proton-proton distances, and dihedral angle constraints. Methylene protons of the hydroxymethyl group are nonequivalent protons and the hydroxymethyl group is not freely rotating. The hydroxymethyl group adopts a specific orientation with the OH group oriented on the 3' side of the plane of the base. Analysis of imino proton resonances and NOEs indicates additional end base pair fraying and a temperature-induced transition to a conformation in which the internal HmU-A base pairs are disrupted or have reduced lifetimes. Orientation of the hydroxymethyl group indicates the presence of internucleotide intrastrand hydrogen bonding between the HmU12C5 hydroxyl group and A13. All sugars in both DNAs show a C2'endo conformation (typical of B-DNA).

  7. Molecular dynamics simulation of the opposite-base preference and interactions in the active site of formamidopyrimidine-DNA glycosylase.

    PubMed

    Popov, Alexander V; Endutkin, Anton V; Vorobjev, Yuri N; Zharkov, Dmitry O

    2017-05-08

    Formamidopyrimidine-DNA glycosylase (Fpg) removes abundant pre-mutagenic 8-oxoguanine (oxoG) bases from DNA through nucleophilic attack of its N-terminal proline at C1' of the damaged nucleotide. Since oxoG efficiently pairs with both C and A, Fpg must excise oxoG from pairs with C but not with A, otherwise a mutation occurs. The crystal structures of several Fpg-DNA complexes have been solved, yet no structure with A opposite the lesion is available. Here we use molecular dynamic simulation to model interactions in the pre-catalytic complex of Lactococcus lactis Fpg with DNA containing oxoG opposite C or A, the latter in either syn or anti conformation. The catalytic dyad, Pro1-Glu2, was modeled in all four possible protonation states. Only one transition was observed in the experimental reaction rate pH dependence plots, and Glu2 kept the same set of interactions regardless of its protonation state, suggesting that it does not limit the reaction rate. The adenine base opposite oxoG was highly distorting for the adjacent nucleotides: in the more stable syn models it formed non-canonical bonds with out-of-register nucleotides in both the damaged and the complementary strand, whereas in the anti models the adenine either formed non-canonical bonds or was expelled into the major groove. The side chains of Arg109 and Phe111 that Fpg inserts into DNA to maintain its kinked conformation tended to withdraw from their positions if A was opposite to the lesion. The region showing the largest differences in the dynamics between oxoG:C and oxoG:A substrates was unexpectedly remote from the active site, located near the linker joining the two domains of Fpg. This region was also highly conserved among 124 analyzed Fpg sequences. Three sites trapping water molecules through multiple bonds were identified on the protein-DNA interface, apparently helping to maintain enzyme-induced DNA distortion and participating in oxoG recognition. Overall, the discrimination against A opposite to the lesion seems to be due to incorrect DNA distortion around the lesion-containing base pair and, possibly, to gross movement of protein domains connected by the linker.

  8. DNA logic gate based on metallo-toehold strand displacement.

    PubMed

    Deng, Wei; Xu, Huaguo; Ding, Wei; Liang, Haojun

    2014-01-01

    DNA is increasingly being used as an ideal material for the construction of nanoscale structures, circuits, and machines. Toehold-mediated DNA strand displacement reactions play a very important role in these enzyme-free constructions. In this study, the concept of metallo-toehold was utilized to further develop a mechanism for strand displacement driven by Ag+ ions, in which the intercalation of cytosine-cytosine mismatched base pairs on the toeholds provides additional control by varying of the concentration of Ag+ ions. The characteristics of displacement reaction in response to different concentration of Ag+ ions are investigated by fluorescence spectral and non-denaturing polyacrylamide gel electrophoresis. The reaction can successfully occur when the concentration of Ag+ ions is suitabe; excess Ag+ ions block the reaction. Furthermore, the displacement reaction can be tuned and controlled most efficiently under the condition of two C:C mismatched base pairs placed on the six-nt toehold. Based on our research, a mechanism was developed to construct Boolean logic gate AND and OR by employing strand displacement reaction as a tool, Ag+ and Hg2+ as input.

  9. Ag(I)-mediated homo and hetero pairs of guanosine and cytidine: monitoring by circular dichroism spectroscopy.

    PubMed

    Goncharova, Iryna

    2014-01-24

    Ag(I)-containing compounds are attractive as antibacterial and antifungal agents. The renewed interest in the application of silver(I) compounds has led to the need for detailed knowledge of the mechanism of their action. One of the possible ways is the coordination of Ag(I) to G-C pairs of DNA, where Ag(+) ions form Ag(I)-mediated base pairs and inhibit the transcription. Herein, a systematic chiroptical study on silver(I)-mediated homo and mixed pairs of the C-G complementary-base derivatives cytidine(C) and 5'-guanosine monophosphate(G) in water is presented. Ag(I)-mediated homo and hetero pairs of G and C and their self-assembled species were studied under two pH levels (7.0 and 10.0) by vibrational (VCD) and electronic circular dichroism(ECD). VCD was used for the first time in this field and showed itself to be a powerful method for obtaining specific structural information in solution. Based on results of the VCD experiments, the different geometries of the homo pairs were proposed under pH 7.0 and 10.0. ECD was used as a diagnostic tool to characterize the studied systems and as a contact point between the previously defined structures of the metal or proton mediated pairs of nucleobases and the systems studied here. On the basis of the obtained data, the formation of the self-assembled species of cytidine with a structure similar to the i-motif structure in DNA was proposed at pH 10.0. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. Ag(I)-mediated homo and hetero pairs of guanosine and cytidine: Monitoring by circular dichroism spectroscopy

    NASA Astrophysics Data System (ADS)

    Goncharova, Iryna

    2014-01-01

    Ag(I)-containing compounds are attractive as antibacterial and antifungal agents. The renewed interest in the application of silver(I) compounds has led to the need for detailed knowledge of the mechanism of their action. One of the possible ways is the coordination of Ag(I) to G-C pairs of DNA, where Ag+ ions form Ag(I)-mediated base pairs and inhibit the transcription. Herein, a systematic chiroptical study on silver(I)-mediated homo and mixed pairs of the C-G complementary-base derivatives cytidine(C) and 5‧-guanosine monophosphate(G) in water is presented. Ag(I)-mediated homo and hetero pairs of G and C and their self-assembled species were studied under two pH levels (7.0 and 10.0) by vibrational (VCD) and electronic circular dichroism(ECD). VCD was used for the first time in this field and showed itself to be a powerful method for obtaining specific structural information in solution. Based on results of the VCD experiments, the different geometries of the homo pairs were proposed under pH 7.0 and 10.0. ECD was used as a diagnostic tool to characterize the studied systems and as a contact point between the previously defined structures of the metal or proton mediated pairs of nucleobases and the systems studied here. On the basis of the obtained data, the formation of the self-assembled species of cytidine with a structure similar to the i-motif structure in DNA was proposed at pH 10.0.

  11. Theory of nucleosome corkscrew sliding in the presence of synthetic DNA ligands.

    PubMed

    Mohammad-Rafiee, Farshid; Kulić, Igor M; Schiessel, Helmut

    2004-11-12

    Histone octamers show a heat-induced mobility along DNA. Recent theoretical studies have established two mechanisms that are qualitatively and quantitatively compatible with in vitro experiments on nucleosome sliding: octamer repositioning through one-base-pair twist defects and through ten-base-pair bulge defects. A recent experiment demonstrated that the repositioning is strongly suppressed in the presence of minor-groove binding DNA ligands. In the present study, we give a quantitative theory for nucleosome repositioning in the presence of such ligands. We show that the experimentally observed octamer mobilities are consistent with the picture of bound ligands blocking the passage of twist defects through the nucleosome. This strongly supports the model of twist defects inducing a corkscrew motion of the nucleosome as the underlying mechanism of nucleosome sliding. We provide a theoretical estimate of the nucleosomal mobility without adjustable parameters, as a function of ligand concentration, binding affinity, binding site orientation, temperature and DNA anisotropy. Having this mobility in hand, we speculate on the interaction between a nucleosome and a transcribing RNA polymerase, and suggest a novel mechanism that might account for polymerase-induced nucleosome repositioning on short DNA templates.

  12. Cytogenetic analysis in three Bryconamericus species (Characiformes, Characidae): first description of the 5S rDNA-bearing chromosome pairs in the genus

    PubMed Central

    2013-01-01

    Background Nowadays, the genus Bryconamericus is placed in subfamily Stevardiinae within of Characidae, but not shows consistent evidence of monophyletism. The purpose of this work was to study the chromosomes of three species of Bryconamericus, aiming to add cytogenetic knowledge and contribute to the understanding of the chromosomal evolution of this genus. Results The chromosomes of three species of Bryconamericus were analyzed using cytogenetic techniques. The karyotype of Bryconamericus stramineus contained 6 metacentric (m) + 10 submetacentric (sm) + 16 subtelocentric (st) + 20 acrocentric (a), the fundamental number (FN) of 84, one silver impregnated (Ag-NOR) pair, one pair bearing the 18S ribosomal DNA sites, another pair bearing the 5S rDNA sites, and a few positive C-bands. Bryconamericus turiuba had a karyotype containing 8 m + 10sm + 14st + 20a (FN = 84), one chromosome pair Ag-NOR, two pairs bearing the 18S rDNA sites, two pairs bearing the 5S rDNA sites, and a few C-band regions. Bryconamericus cf. iheringii had a karyotype containing 10 m + 14sm + 18st + 10a (FN = 94), including one pair with a secondary constriction Ag-NOR positive. In this karyotype the fluorescent in situ hybridization (FISH) showed the 18S and 5S rDNA probe in adjacent position. Conclusions The results obtained in this work showed different characteristics in the organization of two multigene families, indicating that distinct evolutionary forces acting on the diversity of rDNA sequences in the genome of three Bryconamericus species. PMID:23547656

  13. Evidence for the role of DNA strand passage in the mechanism of action of microcin B17 on DNA gyrase.

    PubMed

    Pierrat, Olivier A; Maxwell, Anthony

    2005-03-22

    Microcin B17 (MccB17) is a DNA gyrase poison; in previous work, this bacterial toxin was found to slowly and incompletely inhibit the reactions of supercoiling and relaxation of DNA by gyrase and to stabilize the cleavage complex, depending on the presence of ATP and the DNA topology. We now show that the action of MccB17 on the gyrase ATPase reaction and cleavage complex formation requires a linear DNA fragment of more than 150 base pairs. MccB17 is unable to stimulate the ATPase reaction by stabilizing the weak interactions between short linear DNA fragments (70 base pairs or less) and gyrase, in contrast with the quinolone ciprofloxacin. However, MccB17 can affect the ATP-dependent relaxation of DNA by gyrase lacking its DNA-wrapping or ATPase domains. From these findings, we propose a mode of action of MccB17 requiring a DNA molecule long enough to allow the transport of a segment through the DNA gate of the enzyme. Furthermore, we suggest that MccB17 may trap a transient intermediate state of the gyrase reaction present only during DNA strand passage and enzyme turnover. The proteolytic signature of MccB17 from trypsin treatment of the full enzyme requires DNA and ATP and shows a protection of the C-terminal 47-kDa domain of gyrase, indicating the involvement of this domain in the toxin mode of action and consistent with its proposed role in the mechanism of DNA strand passage. We suggest that the binding site of MccB17 is in the C-terminal domain of GyrB.

  14. [Association between obesity and DNA methylation among the 7-16 year-old twins].

    PubMed

    Li, C X; Gao, Y; Gao, W J; Yu, C Q; Lyu, J; Lyu, R R; Duan, J L; Sun, Y; Guo, X H; Wang, S F; Zhou, B; Wang, G; Cao, W H; Li, L M

    2018-04-10

    Objective: On whole-genome scale, we tried to explore the correlation between obesity-related traits and DNA methylation sites, based on discordant monozygotic twin pairs. Methods: A total of 90 pairs of 6-17 year-old twins were recruited in Chaoyang district, Yanqing district and Fangshan district in Beijing in 2016. Information on twins was gathered through a self-designed questionnaire and results: from physical examination, including height, weight and waist circumference of the subjects under study. DNA methylation detection was chosen on the Illumina Human Methylation EPIC BeadChip. R 3.3.1 language was used to read the DNA methylation signal under quality control on samples and probes. Ebayes function of empirical Bayes paired moderated t -test was used to identify the differential methylated CpG sites (DMCs). VarFit function of empirical Bayes paired moderated Levene test was used to identify the differentially variables CpG sits (DVCs) in obese and normal groups. Results According to the obesity discordance criteria, we collected 23 pairs of twins (age range 7 to 16 years), including 12 male pairs. A total of 817 471 qualified CpG loci were included in the genome-wide correlation analysis. According to the significance level of FDR set as <0.05, no positive sites would meet this standard. When DMC CpG site cg05684382, with the smallest P value (1.26E-06) as on chromosome 12, the DVC CpG site cg26188191 with the smallest P value (6.44E-06) appeared in CMIP gene on chromosome 16. Conclusions: In this study, we analyzed the genome-wide DNA methylation and its correlation with obesity traits. After multiple testing corrections, no positive sites were found to have associated with obesity. However, results from the correlation analysis demonstrated sites cg05684382 (chr: 12) and cg26188191 (chr: 16) might have played a role in the development of obesity. This study provides a methodologic reference for the studies on discordance twins related problems.

  15. RDNAnalyzer: A tool for DNA secondary structure prediction and sequence analysis.

    PubMed

    Afzal, Muhammad; Shahid, Ahmad Ali; Shehzadi, Abida; Nadeem, Shahid; Husnain, Tayyab

    2012-01-01

    RDNAnalyzer is an innovative computer based tool designed for DNA secondary structure prediction and sequence analysis. It can randomly generate the DNA sequence or user can upload the sequences of their own interest in RAW format. It uses and extends the Nussinov dynamic programming algorithm and has various application for the sequence analysis. It predicts the DNA secondary structure and base pairings. It also provides the tools for routinely performed sequence analysis by the biological scientists such as DNA replication, reverse compliment generation, transcription, translation, sequence specific information as total number of nucleotide bases, ATGC base contents along with their respective percentages and sequence cleaner. RDNAnalyzer is a unique tool developed in Microsoft Visual Studio 2008 using Microsoft Visual C# and Windows Presentation Foundation and provides user friendly environment for sequence analysis. It is freely available. http://www.cemb.edu.pk/sw.html RDNAnalyzer - Random DNA Analyser, GUI - Graphical user interface, XAML - Extensible Application Markup Language.

  16. Base-unpaired regions in supercoiled replicative form DNA of coliphage M13

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dasgupta, S.; Allison, D.P.; Snyder, C.E.

    Superhelical covalently closed circular replicative form DNA (RF I) of coliphage M13 appears as a relaxed molecule that has a base-unpaired region in the form of a bubble (100 to 200 base pairs long) seen in electron micrographs when spread in the presence of formaldehyde and formamide or after pretreatment with glyoxal. S1 endonuclease, specific for single-stranded DNA, converts superhelical M13 RF I DNA, but not nonsuperhelical M13 RF I to a significant extent, into unit-length linear molecules by sequential nicking of two strands. The locations of S1 nuclease-susceptible sites and glyoxal-fixed base-unpaired regions were both related to the fivemore » A-T-rich regions in M13 RF DNA. While S1 nuclease does not show preference for any of these sites, glyoxal-fixed bubbles occur predominantly at the major A-T-rich region in M13 RF DNA.« less

  17. Distinguishing Individual DNA Bases in a Network by Non-Resonant Tip-Enhanced Raman Scattering.

    PubMed

    Zhang, Rui; Zhang, Xianbiao; Wang, Huifang; Zhang, Yao; Jiang, Song; Hu, Chunrui; Zhang, Yang; Luo, Yi; Dong, Zhenchao

    2017-05-08

    The importance of identifying DNA bases at the single-molecule level is well recognized for many biological applications. Although such identification can be achieved by electrical measurements using special setups, it is still not possible to identify single bases in real space by optical means owing to the diffraction limit. Herein, we demonstrate the outstanding ability of scanning tunneling microscope (STM)-controlled non-resonant tip-enhanced Raman scattering (TERS) to unambiguously distinguish two individual complementary DNA bases (adenine and thymine) with a spatial resolution down to 0.9 nm. The distinct Raman fingerprints identified for the two molecules allow to differentiate in real space individual DNA bases in coupled base pairs. The demonstrated ability of non-resonant Raman scattering with super-high spatial resolution will significantly extend the applicability of TERS, opening up new routes for single-molecule DNA sequencing. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Energetic basis for selective recognition of T*G mismatched base pairs in DNA by imidazole-rich polyamides.

    PubMed

    Lacy, Eilyn R; Nguyen, Binh; Le, Minh; Cox, Kari K; OHare, Caroline; Hartley, John A; Lee, Moses; Wilson, W David

    2004-01-01

    To complement available structure and binding results and to develop a detailed understanding of the basis for selective molecular recognition of T.G mismatches in DNA by imidazole containing polyamides, a full thermodynamic profile for formation of the T.G-polyamide complex has been determined. The amide-linked heterocycles f-ImImIm and f-PyImIm (where f is formamido group, Im is imidazole and Py is pyrrole) were studied by using biosensor-surface plasmon resonance (SPR) and isothermal titration calorimetry (ITC) with a T.G mismatch containing DNA hairpin duplex and a similar DNA with only Watson-Crick base pairs. Large negative binding enthalpies for all of the polyamide-DNA complexes indicate that the interactions are enthalpically driven. SPR results show slower complex formation and stronger binding of f-ImImIm to the T.G than to the match site. The thermodynamic analysis indicates that the enhanced binding to the T.G site is the result of better entropic contributions. Negative heat capacity changes for the complex are correlated with calculated solvent accessible surface area changes and indicate hydrophobic contributions to complex formation. DNase I footprinting analysis in a long DNA sequence provided supporting evidence that f-ImImIm binds selectively to T.G mismatch sites.

  19. Energetic basis for selective recognition of T·G mismatched base pairs in DNA by imidazole-rich polyamides

    PubMed Central

    Lacy, Eilyn R.; Nguyen, Binh; Le, Minh; Cox, Kari K.; O'Hare, Caroline; Hartley, John A.; Lee, Moses; Wilson, W. David

    2004-01-01

    To complement available structure and binding results and to develop a detailed understanding of the basis for selective molecular recognition of T·G mismatches in DNA by imidazole containing polyamides, a full thermodynamic profile for formation of the T·G–polyamide complex has been determined. The amide-linked heterocycles f-ImImIm and f-PyImIm (where f is formamido group, Im is imidazole and Py is pyrrole) were studied by using biosensor-surface plasmon resonance (SPR) and isothermal titration calorimetry (ITC) with a T·G mismatch containing DNA hairpin duplex and a similar DNA with only Watson–Crick base pairs. Large negative binding enthalpies for all of the polyamide–DNA complexes indicate that the interactions are enthalpically driven. SPR results show slower complex formation and stronger binding of f-ImImIm to the T·G than to the match site. The thermodynamic analysis indicates that the enhanced binding to the T·G site is the result of better entropic contributions. Negative heat capacity changes for the complex are correlated with calculated solvent accessible surface area changes and indicate hydrophobic contributions to complex formation. DNase I footprinting analysis in a long DNA sequence provided supporting evidence that f-ImImIm binds selectively to T·G mismatch sites. PMID:15064359

  20. Selective DNA-Mediated Assembly of Gold Nanoparticles on Electroded Substrates

    DTIC Science & Technology

    2008-06-01

    might use the Watson - Crick base-pairing of DNA as a means for ultrahigh-precision engineering is well- known.5,6 The idea is to use the highly specific...Selective DNA -Mediated Assembly of Gold Nanoparticles on Electroded Substrates K. E. Sapsford,†,‡,∇ D. Park,§ E. R. Goldman,‡ E. E. Foos,| S. A...electrodes via DNA hybridization. Protocols are demonstrated for maximizing selectivity and coverage using 15mers as the active binding agents. Detailed

  1. Development of a Diagnostic Tool to Detect DNA Methylation Biomarkers for Early-Stage Lung Cancer

    DTIC Science & Technology

    2015-02-01

    include: 1) a DNA recognition domain that recognizes the specific DNA sequence of interest and 2) one half of the leucine zipper pair. The second...piece will include 1) the second half of the leucine zipper pair, 2) a flexible linker flanked by a FRET pair that determines the local (within 30 bp...each other to determine the resolution of our probes. All DNA fragments are methylated using bacterial methyltransferase. Since only a single CG

  2. Label-free DNA biosensor based on resistance change of platinum nanoparticles assemblies.

    PubMed

    Skotadis, Evangelos; Voutyras, Konstantinos; Chatzipetrou, Marianneza; Tsekenis, Georgios; Patsiouras, Lampros; Madianos, Leonidas; Chatzandroulis, Stavros; Zergioti, Ioanna; Tsoukalas, Dimitris

    2016-07-15

    A novel nanoparticle based biosensor for the fast and simple detection of DNA hybridization events is presented. The sensor utilizes hybridized DNA's charge transport properties, combining them with metallic nanoparticle networks that act as nano-gapped electrodes. The DNA hybridization events can be detected by a significant reduction in the sensor's resistance due to the conductive bridging offered by hybridized DNA. By modifying the nanoparticle surface coverage, which can be controlled experimentally being a function of deposition time, and the structural properties of the electrodes, an optimized biosensor for the in situ detection of DNA hybridization events is ultimately fabricated. The fabricated biosensor exhibits a wide response range, covering four orders of magnitude, a limit of detection of 1nM and can detect a single base pair mismatch between probe and complementary DNA. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Rapid discrimination of Isaria javanica and Isaria poprawskii from Isaria spp. using high resolution DNA melting assays

    USDA-ARS?s Scientific Manuscript database

    The current study evaluates the potential of using high resolution DNA melting assays to discriminate species in the genus, Isaria. The study utilizes a previously identified 103 base pair PCR amplicon, which was reported to be selective for Isaria fumosorosea. Our study finds the amplicon selective...

  4. Study on the stability of the DNA hairpin d(ATCCAT-GTTA-TAGGAT) employing molecular dynamics simulation

    NASA Astrophysics Data System (ADS)

    Wu, Sangwook

    2015-03-01

    DNA hairpin plays a critical role in the regulation of gene expression and DNA recombination. We studied the conformation of the DNA hairpin, d(ATCCAT-GTTA-TAGGAT) (PDB id:1AC7), employing molecular dynamics (MD) simulation. Despite the non-canonical Watson-Crick base pair (G:A) in the tetraloop (GTTA), MD simulation reveals that the conformation of the DNA hairpin is remarkably stable. In this study, we discuss about the physical/chemical origin of the stability of the DNA hairpin. Department of Biomedical Engineering, Korea University, Seoul 136-703, Korea.

  5. Pairing of heterochromatin in response to cellular stress.

    PubMed

    Abdel-Halim, H I; Mullenders, L H F; Boei, J J W A

    2006-07-01

    We previously reported that exposure of human cells to DNA-damaging agents (X-rays and mitomycin C (MMC)) induces pairing of the homologous paracentromeric heterochromatin of chromosome 9 (9q12-13). Here, we show that UV irradiation and also heat shock treatment of human cells lead to similar effects. Since the various agents induce very different types and frequencies of damage to cellular constituents, the data suggest a general stress response as the underlying mechanism. Moreover, local UV irradiation experiments revealed that pairing of heterochromatin is an event that can be triggered without induction of DNA damage in the heterochromatic sequences. The repair deficient xeroderma pigmentosum cells (group F) previously shown to fail pairing after MMC displayed elevated pairing after heat shock treatment but not after UV exposure. Taken together, the present results indicate that pairing of heterochromatin following exposure to DNA-damaging agents is initiated by a general stress response and that the sensing of stress or the maintenance of the paired status of the heterochromatin might be dependent on DNA repair.

  6. The ChIP-exo Method: Identifying Protein-DNA Interactions with Near Base Pair Precision.

    PubMed

    Perreault, Andrea A; Venters, Bryan J

    2016-12-23

    Chromatin immunoprecipitation (ChIP) is an indispensable tool in the fields of epigenetics and gene regulation that isolates specific protein-DNA interactions. ChIP coupled to high throughput sequencing (ChIP-seq) is commonly used to determine the genomic location of proteins that interact with chromatin. However, ChIP-seq is hampered by relatively low mapping resolution of several hundred base pairs and high background signal. The ChIP-exo method is a refined version of ChIP-seq that substantially improves upon both resolution and noise. The key distinction of the ChIP-exo methodology is the incorporation of lambda exonuclease digestion in the library preparation workflow to effectively footprint the left and right 5' DNA borders of the protein-DNA crosslink site. The ChIP-exo libraries are then subjected to high throughput sequencing. The resulting data can be leveraged to provide unique and ultra-high resolution insights into the functional organization of the genome. Here, we describe the ChIP-exo method that we have optimized and streamlined for mammalian systems and next-generation sequencing-by-synthesis platform.

  7. Mutagenesis of the lac promoter region in M13 mp10 phage DNA by 4'-hydroxymethyl-4,5',8-trimethylpsoralen

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Piette, J.; Decuyper-Debergh, D.; Gamper, H.

    Double-stranded M13 phage DNA (M13 mp10 replicative form) was photoreacted with 4'-hydroxymethyl-4,5',8-trimethylpsoralen, using light of wavelength greater than 320 nm or greater than 390 nm to generate predominantly crosslinks or monoadducts, respectively. The damaged DNAs were scored for inactivation and mutagenesis after transfection into Escherichia coli. The appearance of light-blue or colorless plaques on indicator medium showed that mutation had occurred in the lac insert of the viral DNA. A comparison of the consequences of the two phototreatments with psoralen supports the idea that crosslinks are both more lethal and more mutagenic than monoadducts. Numerous mutant clones partially or totallymore » deficient in beta-galactosidase were plaque-purified and amplified. The viral DNA of each clone was sequenced by the dideoxy chain-terminating procedure. All of the observed base-pair changes were mapped to the lac promoter region and consisted of 3 transition, 14 transversion, and 6 single base-pair frame-shift mutations. The predominant mutation was a T.A----G.C transversion.« less

  8. Circular dichroism and DNA secondary structure.

    PubMed Central

    Baase, W A; Johnson, W C

    1979-01-01

    The change in average rotation of the DNA helix has been determined for the transfer from 0.05 M NaCl to 3.0 M CsCl, 6.2 M LiCl and 5.4 M NH4Cl. This work, combined with data at lower salt from other laboratories, allows us to relate the intensity of the CD of DNA at 275 nm directly to the change in the number of base pairs per turn. The change in secondary structure for the transfer of DNA from 0.05 M NaCl (where it is presumably in the B-form) to high salt (where the characteristic CD has been interpreted as corresponding to C-form geometry) is found to be -0.22 (+/- 0.02) base pairs per turn. In the case of mononucleosomes, where the CD indicates the "C-form", the change in secondary structure (including temperature effects) would add -0.31 (+/- 0.03) turns about the histone core to the -1.25 turns estimated from work on SV40 chromatin. Accurate winding angles and molar extinction coefficients were determined for ethidium. PMID:424316

  9. Exploring the common molecular basis for the universal DNA mutation bias: Revival of Loewdin mutation model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fu, Liang-Yu; Center for Bioinformatics, Huazhong Agricultural University, Wuhan 430070; Wang, Guang-Zhong

    2011-06-10

    Highlights: {yields} There exists a universal G:C {yields} A:T mutation bias in three domains of life. {yields} This universal mutation bias has not been sufficiently explained. {yields} A DNA mutation model proposed by Loewdin 40 years ago offers a common explanation. -- Abstract: Recently, numerous genome analyses revealed the existence of a universal G:C {yields} A:T mutation bias in bacteria, fungi, plants and animals. To explore the molecular basis for this mutation bias, we examined the three well-known DNA mutation models, i.e., oxidative damage model, UV-radiation damage model and CpG hypermutation model. It was revealed that these models cannot providemore » a sufficient explanation to the universal mutation bias. Therefore, we resorted to a DNA mutation model proposed by Loewdin 40 years ago, which was based on inter-base double proton transfers (DPT). Since DPT is a fundamental and spontaneous chemical process and occurs much more frequently within GC pairs than AT pairs, Loewdin model offers a common explanation for the observed universal mutation bias and thus has broad biological implications.« less

  10. The mechanism and regularity of quenching the effect of bases on fluorophores: the base-quenched probe method.

    PubMed

    Mao, Huihui; Luo, Guanghua; Zhan, Yuxia; Zhang, Jun; Yao, Shuang; Yu, Yang

    2018-04-30

    The base-quenched probe method for detecting single nucleotide polymorphisms (SNPs) relies on real-time PCR and melting-curve analysis, which might require only one pair of primers and one probe. At present, it has been successfully applied to detect SNPs of multiple genes. However, the mechanism of the base-quenched probe method remains unclear. Therefore, we investigated the possible mechanism of fluorescence quenching by DNA bases in aqueous solution using spectroscopic techniques. It showed that the possible mechanism might be photo-induced electron transfer. We next analyzed electron transfer or transmission between DNA bases and fluorophores. The data suggested that in single-stranded DNA, the electrons of the fluorophore are transferred to the orbital of pyrimidine bases (thymine (T) and cytosine (C)), or that the electron orbitals of the fluorophore are occupied by electrons from purine bases (guanine (G) and adenine (A)), which lead to fluorescence quenching. In addition, the electrons of a fluorophore excited by light can be transmitted along double-stranded DNA, which gives rise to stronger fluorescence quenching. Furthermore, we demonstrated that the quenching efficiency of bases is in the order of G > C ≥ A ≥ T and the capability of electron transmission of base-pairs in double-stranded DNA is in the order of CG[combining low line] ≥ GC[combining low line] > TA[combining low line] ≥ AT[combining low line] (letters representing bases on the complementary strand of the probe are bold and underlined), and the most common commercial fluorophores including FAM, HEX, TET, JOE, and TAMRA could be influenced by bases and are in line with this mechanism and regularity.

  11. Transition-state destabilization reveals how human DNA polymerase β proceeds across the chemically unstable lesion N7-methylguanine

    PubMed Central

    Ouzon-Shubeita, Hala; Lee, Seongmin

    2014-01-01

    N7-Methyl-2′-deoxyguanosine (m7dG) is the predominant lesion formed by methylating agents. A systematic investigation on the effect of m7dG on DNA replication has been difficult due to the chemical instability of m7dG. To gain insights into the m7dG effect, we employed a 2′-fluorine-mediated transition-state destabilzation strategy. Specifically, we determined kinetic parameters for dCTP insertion opposite a chemically stable m7dG analogue, 2′-fluoro-m7dG (Fm7dG), by human DNA polymerase β (polβ) and solved three X-ray structures of polβ in complex with the templating Fm7dG paired with incoming dCTP or dTTP analogues. The kinetic studies reveal that the templating Fm7dG slows polβ catalysis ∼300-fold, suggesting that m7dG in genomic DNA may impede replication by some DNA polymerases. The structural analysis reveals that Fm7dG forms a canonical Watson–Crick base pair with dCTP, but metal ion coordination is suboptimal for catalysis in the polβ-Fm7dG:dCTP complex, which partially explains the slow insertion of dCTP opposite Fm7dG by polβ. In addition, the polβ-Fm7dG:dTTP structure shows open protein conformations and staggered base pair conformations, indicating that N7-methylation of dG does not promote a promutagenic replication. Overall, the first systematic studies on the effect of m7dG on DNA replication reveal that polβ catalysis across m7dG is slow, yet highly accurate. PMID:24966350

  12. Pms2 and uracil-DNA glycosylases act jointly in the mismatch repair pathway to generate Ig gene mutations at A-T base pairs.

    PubMed

    Girelli Zubani, Giulia; Zivojnovic, Marija; De Smet, Annie; Albagli-Curiel, Olivier; Huetz, François; Weill, Jean-Claude; Reynaud, Claude-Agnès; Storck, Sébastien

    2017-04-03

    During somatic hypermutation (SHM) of immunoglobulin genes, uracils introduced by activation-induced cytidine deaminase are processed by uracil-DNA glycosylase (UNG) and mismatch repair (MMR) pathways to generate mutations at G-C and A-T base pairs, respectively. Paradoxically, the MMR-nicking complex Pms2/Mlh1 is apparently dispensable for A-T mutagenesis. Thus, how detection of U:G mismatches is translated into the single-strand nick required for error-prone synthesis is an open question. One model proposed that UNG could cooperate with MMR by excising a second uracil in the vicinity of the U:G mismatch, but it failed to explain the low impact of UNG inactivation on A-T mutagenesis. In this study, we show that uracils generated in the G1 phase in B cells can generate equal proportions of A-T and G-C mutations, which suggests that UNG and MMR can operate within the same time frame during SHM. Furthermore, we show that Ung -/- Pms2 -/- mice display a 50% reduction in mutations at A-T base pairs and that most remaining mutations at A-T bases depend on two additional uracil glycosylases, thymine-DNA glycosylase and SMUG1. These results demonstrate that Pms2/Mlh1 and multiple uracil glycosylases act jointly, each one with a distinct strand bias, to enlarge the immunoglobulin gene mutation spectrum from G-C to A-T bases. © 2017 Girelli Zubani et al.

  13. Pms2 and uracil-DNA glycosylases act jointly in the mismatch repair pathway to generate Ig gene mutations at A-T base pairs

    PubMed Central

    De Smet, Annie; Albagli-Curiel, Olivier; Huetz, François; Weill, Jean-Claude

    2017-01-01

    During somatic hypermutation (SHM) of immunoglobulin genes, uracils introduced by activation-induced cytidine deaminase are processed by uracil-DNA glycosylase (UNG) and mismatch repair (MMR) pathways to generate mutations at G-C and A-T base pairs, respectively. Paradoxically, the MMR-nicking complex Pms2/Mlh1 is apparently dispensable for A-T mutagenesis. Thus, how detection of U:G mismatches is translated into the single-strand nick required for error-prone synthesis is an open question. One model proposed that UNG could cooperate with MMR by excising a second uracil in the vicinity of the U:G mismatch, but it failed to explain the low impact of UNG inactivation on A-T mutagenesis. In this study, we show that uracils generated in the G1 phase in B cells can generate equal proportions of A-T and G-C mutations, which suggests that UNG and MMR can operate within the same time frame during SHM. Furthermore, we show that Ung−/−Pms2−/− mice display a 50% reduction in mutations at A-T base pairs and that most remaining mutations at A-T bases depend on two additional uracil glycosylases, thymine-DNA glycosylase and SMUG1. These results demonstrate that Pms2/Mlh1 and multiple uracil glycosylases act jointly, each one with a distinct strand bias, to enlarge the immunoglobulin gene mutation spectrum from G-C to A-T bases. PMID:28283534

  14. Formation and Repair of Mismatches Containing Ribonucleotides and Oxidized Bases at Repeated DNA Sequences.

    PubMed

    Cilli, Piera; Minoprio, Anna; Bossa, Cecilia; Bignami, Margherita; Mazzei, Filomena

    2015-10-23

    The cellular pool of ribonucleotide triphosphates (rNTPs) is higher than that of deoxyribonucleotide triphosphates. To ensure genome stability, DNA polymerases must discriminate against rNTPs and incorporated ribonucleotides must be removed by ribonucleotide excision repair (RER). We investigated DNA polymerase β (POL β) capacity to incorporate ribonucleotides into trinucleotide repeated DNA sequences and the efficiency of base excision repair (BER) and RER enzymes (OGG1, MUTYH, and RNase H2) when presented with an incorrect sugar and an oxidized base. POL β incorporated rAMP and rCMP opposite 7,8-dihydro-8-oxoguanine (8-oxodG) and extended both mispairs. In addition, POL β was able to insert and elongate an oxidized rGMP when paired with dA. We show that RNase H2 always preserves the capacity to remove a single ribonucleotide when paired to an oxidized base or to incise an oxidized ribonucleotide in a DNA duplex. In contrast, BER activity is affected by the presence of a ribonucleotide opposite an 8-oxodG. In particular, MUTYH activity on 8-oxodG:rA mispairs is fully inhibited, although its binding capacity is retained. This results in the reduction of RNase H2 incision capability of this substrate. Thus complex mispairs formed by an oxidized base and a ribonucleotide can compromise BER and RER in repeated sequences. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Recognition of T·G mismatched base pairs in DNA by stacked imidazole-containing polyamides: surface plasmon resonance and circular dichroism studies

    PubMed Central

    Lacy, Eilyn R.; Cox, Kari K.; Wilson, W. David; Lee, Moses

    2002-01-01

    An imidazole-containing polyamide trimer, f-ImImIm, where f is a formamido group, was recently found using NMR methods to recognize T·G mismatched base pairs. In order to characterize in detail the T·G recognition affinity and specificity of imidazole-containing polyamides, f-ImIm, f-ImImIm and f-PyImIm were synthesized. The kinetics and thermodynamics for the polyamides binding to Watson–Crick and mismatched (containing one or two T·G, A·G or G·G mismatched base pairs) hairpin oligonucleotides were determined by surface plasmon resonance and circular dichroism (CD) methods. f-ImImIm binds significantly more strongly to the T·G mismatch-containing oligonucleotides than to the sequences with other mismatched or with Watson–Crick base pairs. Compared with the Watson–Crick CCGG sequence, f-ImImIm associates more slowly with DNAs containing T·G mismatches in place of one or two C·G base pairs and, more importantly, the dissociation rate from the T·G oligonucleotides is very slow (small kd). These results clearly demonstrate the binding selectivity and enhanced affinity of side-by-side imidazole/imidazole pairings for T·G mismatches and show that the affinity and specificity increase arise from much lower kd values with the T·G mismatched duplexes. CD titration studies of f-ImImIm complexes with T·G mismatched sequences produce strong induced bands at ∼330 nm with clear isodichroic points, in support of a single minor groove complex. CD DNA bands suggest that the complexes remain in the B conformation. PMID:11937638

  16. Confirming the 3D Solution Structure of a Short Double-Stranded DNA Sequence Using NMR Spectroscopy

    ERIC Educational Resources Information Center

    Ruhayel, Rasha A.; Berners-Price, Susan J.

    2010-01-01

    2D [superscript 1]H NOESY NMR spectroscopy is routinely used to give information on the closeness of hydrogen atoms through space. This work is based on a 2D [superscript 1]H NOESY NMR spectrum of a 12 base-pair DNA duplex. This 6-h laboratory workshop aims to provide advanced-level chemistry students with a basic, yet solid, understanding of how…

  17. Two-Dimensional Nanoporous Networks Formed by Liquid-to-Solid Transfer of Hydrogen-Bonded Macrocycles Built from DNA Bases.

    PubMed

    Bilbao, Nerea; Destoop, Iris; De Feyter, Steven; González-Rodríguez, David

    2016-01-11

    We present an approach that makes use of DNA base pairing to produce hydrogen-bonded macrocycles whose supramolecular structure can be transferred from solution to a solid substrate. A hierarchical assembly process ultimately leads to two-dimensional nanostructured porous networks that are able to host size-complementary guests. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Array-Based Discovery of Aptamer Pairs

    DTIC Science & Technology

    2014-12-11

    affinities greatly exceeding either monovalent component. DNA aptamers are especially well-suited for such constructs, because they can be linked via...standard synthesis techniques without requiring chemical conjugation. Unfortunately, aptamer pairs are difficult to generate, primarily because...conventional selection methods preferentially yield aptamers that recognize a dominant “hot spot” epitope. Our 1. REPORT DATE (DD-MM-YYYY) 4. TITLE AND

  19. DNA nanotechnology: a future perspective

    PubMed Central

    2013-01-01

    In addition to its genetic function, DNA is one of the most distinct and smart self-assembling nanomaterials. DNA nanotechnology exploits the predictable self-assembly of DNA oligonucleotides to design and assemble innovative and highly discrete nanostructures. Highly ordered DNA motifs are capable of providing an ultra-fine framework for the next generation of nanofabrications. The majority of these applications are based upon the complementarity of DNA base pairing: adenine with thymine, and guanine with cytosine. DNA provides an intelligent route for the creation of nanoarchitectures with programmable and predictable patterns. DNA strands twist along one helix for a number of bases before switching to the other helix by passing through a crossover junction. The association of two crossovers keeps the helices parallel and holds them tightly together, allowing the assembly of bigger structures. Because of the DNA molecule's unique and novel characteristics, it can easily be applied in a vast variety of multidisciplinary research areas like biomedicine, computer science, nano/optoelectronics, and bionanotechnology. PMID:23497147

  20. Luminescence resonance energy transfer-based nucleic acid hybridization assay on cellulose paper with upconverting phosphor as donors.

    PubMed

    Zhou, Feng; Noor, M Omair; Krull, Ulrich J

    2014-03-04

    A bioassay based on DNA hybridization on cellulose paper is a promising format for gene fragment detection that may be suited for in-field and rapid diagnostic applications. We demonstrate for the first time that luminescence resonance energy transfer (LRET) associated with upconverting phosphors (UCPs) can be used to develop a paper-based DNA hybridization assay with high sensitivity, selectivity and fast response. UCPs with strong green emission were synthesized and subsequently functionalized with streptavidin (UCP-strep). UCP-strep particles were immobilized on cellulose paper, and then biotinylated single-stranded oligonucleotide probes were conjugated onto the UCPs via streptavidin-biotin linkage. The UCPs served as donors that were LRET-paired with Cy3-labeled target DNA. Selective DNA hybridization enabled the proximity required for LRET-sensitized emission from Cy3, which was used as the detection signal. Hybridization was complete within 2 min, and the limit of detection of the method was 34 fmol, which is a significant improvement in comparison to an analogous fluorescence resonance energy transfer (FRET) assay based on quantum dots. The assay exhibited excellent resistance to nonspecific adsorption of noncomplementary short/long DNA and protein. The selectivity of the assay was further evaluated by one base pair mismatched (1BPM) DNA detection, where a maximum signal ratio of 3.1:1 was achieved between fully complementary and 1BPM samples. This work represents a preliminary but significant step for the development of paper-based UCP-LRET nucleic acid hybridization assays, which offer potential for lowering the limit of detection of luminescent hybridization assays due to the negligible background signal associated with optical excitation by near-infrared (NIR) light.

  1. Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

    PubMed

    Hwang, Hanshin; Taylor, John-Stephen

    2005-03-29

    We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the Klenow fragment, and the lesser role of shape selection in insertion by pol eta due to its more open and less constrained active site.

  2. Synthesis, DNA binding, topoisomerase inhibition and cytotoxic properties of 2-chloroethylnitrosourea derivatives of hoechst 33258.

    PubMed

    Bielawski, Krzysztof; Bielawska, Anna; Anchim, Tomasz; Wołczyński, Sławomir

    2005-06-01

    A number of novel 2-chloroethylnitrosourea derivatives of Hoechst 33258 were synthesized and examined for cytotoxicity in breast cancer cell cultures and for inhibition of topoisomerases I and II. Evaluation of the cytotoxicity of these compounds employing a MTT assay and inhibition of [3H]thymidine incorporation into DNA in both MDA-MB-231 and MCF-7 breast cancer cells demonstrated that these compounds were more active than Hoechst 33258. The DNA-binding ability of these compounds was evaluated by an ultrafiltration method using calf thymus DNA, poly(dA-dT)2 and poly(dG-dC)2, indicated that these compounds as well as Hoechst 33258 well interact with AT base pair compared with GC pair. Binding studies indicate that these compounds bind more tightly to double-stranded DNA than the parent compound Hoechst 33258. The degree to which these compounds inhibited cell growth breast cancer cells was generally consistent with their relative DNA binding affinity. Mechanistic studies revealed that these compounds act as topoisomerase I (topo I) or topoisomerase II (topo II) inhibitors in plasmid relaxation assays.

  3. Mismatch and G-Stack Modulated Probe Signals on SNP Microarrays

    PubMed Central

    Binder, Hans; Fasold, Mario; Glomb, Torsten

    2009-01-01

    Background Single nucleotide polymorphism (SNP) arrays are important tools widely used for genotyping and copy number estimation. This technology utilizes the specific affinity of fragmented DNA for binding to surface-attached oligonucleotide DNA probes. We analyze the variability of the probe signals of Affymetrix GeneChip SNP arrays as a function of the probe sequence to identify relevant sequence motifs which potentially cause systematic biases of genotyping and copy number estimates. Methodology/Principal Findings The probe design of GeneChip SNP arrays enables us to disentangle different sources of intensity modulations such as the number of mismatches per duplex, matched and mismatched base pairings including nearest and next-nearest neighbors and their position along the probe sequence. The effect of probe sequence was estimated in terms of triple-motifs with central matches and mismatches which include all 256 combinations of possible base pairings. The probe/target interactions on the chip can be decomposed into nearest neighbor contributions which correlate well with free energy terms of DNA/DNA-interactions in solution. The effect of mismatches is about twice as large as that of canonical pairings. Runs of guanines (G) and the particular type of mismatched pairings formed in cross-allelic probe/target duplexes constitute sources of systematic biases of the probe signals with consequences for genotyping and copy number estimates. The poly-G effect seems to be related to the crowded arrangement of probes which facilitates complex formation of neighboring probes with at minimum three adjacent G's in their sequence. Conclusions The applied method of “triple-averaging” represents a model-free approach to estimate the mean intensity contributions of different sequence motifs which can be applied in calibration algorithms to correct signal values for sequence effects. Rules for appropriate sequence corrections are suggested. PMID:19924253

  4. Nanomaterials Based on DNA

    PubMed Central

    Seeman, Nadrian C.

    2012-01-01

    The combination of synthetic stable branched DNA and sticky ended cohesion has led to the development of structural DNA nanotechnology over the past 30 years. The basis of this enterprise is that it is possible to construct novel DNA-based materials by combining these features in a self-assembly protocol. Thus, simple branched molecules lead directly to the construction of polyhedra whose edges consist of double helical DNA, and whose vertices correspond to the branch points. Stiffer branched motifs can be used to produce self-assembled two-dimensional and three-dimensional periodic lattices of DNA (crystals). DNA has also been used to make a variety of nanomechanical devices, including molecules that change their shapes, and molecules that can walk along a DNA sidewalk. Devices have been incorporated into two-dimensional DNA arrangements; sequence-dependent devices are driven by increases in nucleotide pairing at each step in their machine cycles. PMID:20222824

  5. Influence of C-5 substituted cytosine and related nucleoside analogs on the formation of benzo[a]pyrene diol epoxide-dG adducts at CG base pairs of DNA.

    PubMed

    Guza, Rebecca; Kotandeniya, Delshanee; Murphy, Kristopher; Dissanayake, Thakshila; Lin, Chen; Giambasu, George Madalin; Lad, Rahul R; Wojciechowski, Filip; Amin, Shantu; Sturla, Shana J; Hudson, Robert H E; York, Darrin M; Jankowiak, Ryszard; Jones, Roger; Tretyakova, Natalia Y

    2011-05-01

    Endogenous 5-methylcytosine ((Me)C) residues are found at all CG dinucleotides of the p53 tumor suppressor gene, including the mutational 'hotspots' for smoking induced lung cancer. (Me)C enhances the reactivity of its base paired guanine towards carcinogenic diolepoxide metabolites of polycyclic aromatic hydrocarbons (PAH) present in cigarette smoke. In the present study, the structural basis for these effects was investigated using a series of unnatural nucleoside analogs and a representative PAH diolepoxide, benzo[a]pyrene diolepoxide (BPDE). Synthetic DNA duplexes derived from a frequently mutated region of the p53 gene (5'-CCCGGCACCC GC[(15)N(3),(13)C(1)-G]TCCGCG-3', + strand) were prepared containing [(15)N(3), (13)C(1)]-guanine opposite unsubstituted cytosine, (Me)C, abasic site, or unnatural nucleobase analogs. Following BPDE treatment and hydrolysis of the modified DNA to 2'-deoxynucleosides, N(2)-BPDE-dG adducts formed at the [(15)N(3), (13)C(1)]-labeled guanine and elsewhere in the sequence were quantified by mass spectrometry. We found that C-5 alkylcytosines and related structural analogs specifically enhance the reactivity of the base paired guanine towards BPDE and modify the diastereomeric composition of N(2)-BPDE-dG adducts. Fluorescence and molecular docking studies revealed that 5-alkylcytosines and unnatural nucleobase analogs with extended aromatic systems facilitate the formation of intercalative BPDE-DNA complexes, placing BPDE in a favorable orientation for nucleophilic attack by the N(2) position of guanine. © The Author(s) 2011. Published by Oxford University Press.

  6. Influence of C-5 substituted cytosine and related nucleoside analogs on the formation of benzo[a]pyrene diol epoxide-dG adducts at CG base pairs of DNA

    PubMed Central

    Guza, Rebecca; Kotandeniya, Delshanee; Murphy, Kristopher; Dissanayake, Thakshila; Lin, Chen; Giambasu, George Madalin; Lad, Rahul R.; Wojciechowski, Filip; Amin, Shantu; Sturla, Shana J.; Hudson, Robert H.E.; York, Darrin M.; Jankowiak, Ryszard; Jones, Roger; Tretyakova, Natalia Y.

    2011-01-01

    Endogenous 5-methylcytosine (MeC) residues are found at all CG dinucleotides of the p53 tumor suppressor gene, including the mutational ‘hotspots’ for smoking induced lung cancer. MeC enhances the reactivity of its base paired guanine towards carcinogenic diolepoxide metabolites of polycyclic aromatic hydrocarbons (PAH) present in cigarette smoke. In the present study, the structural basis for these effects was investigated using a series of unnatural nucleoside analogs and a representative PAH diolepoxide, benzo[a]pyrene diolepoxide (BPDE). Synthetic DNA duplexes derived from a frequently mutated region of the p53 gene (5′-CCCGGCACCC GC[15N3,13C1-G]TCCGCG-3′, + strand) were prepared containing [15N3, 13C1]-guanine opposite unsubstituted cytosine, MeC, abasic site, or unnatural nucleobase analogs. Following BPDE treatment and hydrolysis of the modified DNA to 2′-deoxynucleosides, N2-BPDE-dG adducts formed at the [15N3, 13C1]-labeled guanine and elsewhere in the sequence were quantified by mass spectrometry. We found that C-5 alkylcytosines and related structural analogs specifically enhance the reactivity of the base paired guanine towards BPDE and modify the diastereomeric composition of N2-BPDE-dG adducts. Fluorescence and molecular docking studies revealed that 5-alkylcytosines and unnatural nucleobase analogs with extended aromatic systems facilitate the formation of intercalative BPDE–DNA complexes, placing BPDE in a favorable orientation for nucleophilic attack by the N2 position of guanine. PMID:21245046

  7. Light-emitting self-assembled peptide nucleic acids exhibit both stacking interactions and Watson-Crick base pairing.

    PubMed

    Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud

    2015-04-01

    The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.

  8. Single-molecule fluorescence reveals the unwinding stepping mechanism of replicative helicase.

    PubMed

    Syed, Salman; Pandey, Manjula; Patel, Smita S; Ha, Taekjip

    2014-03-27

    Bacteriophage T7 gp4 serves as a model protein for replicative helicases that couples deoxythymidine triphosphate (dTTP) hydrolysis to directional movement and DNA strand separation. We employed single-molecule fluorescence resonance energy transfer methods to resolve steps during DNA unwinding by T7 helicase. We confirm that the unwinding rate of T7 helicase decreases with increasing base pair stability. For duplexes containing >35% guanine-cytosine (GC) base pairs, we observed stochastic pauses every 2-3 bp during unwinding. The dwells on each pause were distributed nonexponentially, consistent with two or three rounds of dTTP hydrolysis before each unwinding step. Moreover, we observed backward movements of the enzyme on GC-rich DNAs at low dTTP concentrations. Our data suggest a coupling ratio of 1:1 between base pairs unwound and dTTP hydrolysis, and they further support the concept that nucleic acid motors can have a hierarchy of different-sized steps or can accumulate elastic energy before transitioning to a subsequent phase. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  9. Synthetic Biology Parts for the Storage of Increased Genetic Information in Cells.

    PubMed

    Morris, Sydney E; Feldman, Aaron W; Romesberg, Floyd E

    2017-10-20

    To bestow cells with novel forms and functions, the goal of synthetic biology, we have developed the unnatural nucleoside triphosphates dNaMTP and dTPT3TP, which form an unnatural base pair (UBP) and expand the genetic alphabet. While the UBP may be retained in the DNA of a living cell, its retention is sequence-dependent. We now report a steady-state kinetic characterization of the rate with which the Klenow fragment of E. coli DNA polymerase I synthesizes the UBP and its mispairs in a variety of sequence contexts. Correct UBP synthesis is as efficient as for a natural base pair, except in one sequence context, and in vitro performance is correlated with in vivo performance. The data elucidate the determinants of efficient UBP synthesis, show that the dNaM-dTPT3 UBP is the first generally recognized natural-like base pair, and importantly, demonstrate that dNaMTP and dTPT3TP are well optimized and standardized parts for the expansion of the genetic alphabet.

  10. Metallated DNA Aptamers For Prostate Cancer Treatment

    DTIC Science & Technology

    2012-03-01

    including a polydA tail in one aptamer complex and a polydT tail in a second aptamer complex, with dimerization occurring by Watson - Crick base pair...by ANSI Std. Z39.18 W81XWH-10-1-0132 Metallated DNA Aptamers for Prostate Cancer Treatment Dr. William Gmeiner Wake Forest University Winston...efficacious for prostate cancer treatment. Significant progress has been made on refining novel Zn2+-binding DNA motifs that utilize FdU

  11. Specialized Genetic Recombination Systems in Bacteria: Their Involvement in Gene Expression and Evolution,

    DTIC Science & Technology

    1980-01-01

    genetics (Hayes 1968). This marvelous process is important in providing us with the breadth of phenotypic diversity that one sees within a single plant or...separate overall pro- cesses, but may share common components of DNA metabolism, such as winding/unwinding enzymes, ligase, polymerases , various nucle...incorpuoted DNA segmnent are re- paired by DNA polymerase and ligase. Any diffoernces (base mispairing’S, nil- cleotide additions or deletions) between

  12. Structural studies of p53 inactivation by DNA-contact mutations and its rescue by suppressor mutations via alternative protein–DNA interactions

    PubMed Central

    Eldar, Amir; Rozenberg, Haim; Diskin-Posner, Yael; Rohs, Remo; Shakked, Zippora

    2013-01-01

    A p53 hot-spot mutation found frequently in human cancer is the replacement of R273 by histidine or cysteine residues resulting in p53 loss of function as a tumor suppressor. These mutants can be reactivated by the incorporation of second-site suppressor mutations. Here, we present high-resolution crystal structures of the p53 core domains of the cancer-related proteins, the rescued proteins and their complexes with DNA. The structures show that inactivation of p53 results from the incapacity of the mutated residues to form stabilizing interactions with the DNA backbone, and that reactivation is achieved through alternative interactions formed by the suppressor mutations. Detailed structural and computational analysis demonstrates that the rescued p53 complexes are not fully restored in terms of DNA structure and its interface with p53. Contrary to our previously studied wild-type (wt) p53-DNA complexes showing non-canonical Hoogsteen A/T base pairs of the DNA helix that lead to local minor-groove narrowing and enhanced electrostatic interactions with p53, the current structures display Watson–Crick base pairs associated with direct or water-mediated hydrogen bonds with p53 at the minor groove. These findings highlight the pivotal role played by R273 residues in supporting the unique geometry of the DNA target and its sequence-specific complex with p53. PMID:23863845

  13. Structural basis for proficient incorporation of dTTP opposite O6-methylguanine by human DNA polymerase iota.

    PubMed

    Pence, Matthew G; Choi, Jeong-Yun; Egli, Martin; Guengerich, F Peter

    2010-12-24

    O(6)-methylguanine (O(6)-methylG) is highly mutagenic and is commonly found in DNA exposed to methylating agents, even physiological ones (e.g. S-adenosylmethionine). The efficiency of a truncated, catalytic DNA polymerase ι core enzyme was determined for nucleoside triphosphate incorporation opposite O(6)-methylG, using steady-state kinetic analyses. The results presented here corroborate previous work from this laboratory using full-length pol ι, which showed that dTTP incorporation occurs with high efficiency opposite O(6)-methylG. Misincorporation of dTTP opposite O(6)-methylG occurred with ∼6-fold higher efficiency than incorporation of dCTP. Crystal structures of the truncated form of pol ι with O(6)-methylG as the template base and incoming dCTP or dTTP were solved and showed that O(6)-methylG is rotated into the syn conformation in the pol ι active site and that dTTP misincorporation by pol ι is the result of Hoogsteen base pairing with the adduct. Both dCTP and dTTP base paired with the Hoogsteen edge of O(6)-methylG. A single, short hydrogen bond formed between the N3 atom of dTTP and the N7 atom of O(6)-methylG. Protonation of the N3 atom of dCTP and bifurcation of the N3 hydrogen between the N7 and O(6) atoms of O(6)-methylG allow base pairing of the lesion with dCTP. We conclude that differences in the Hoogsteen hydrogen bonding between nucleotides is the main factor in the preferential selectivity of dTTP opposite O(6)-methylG by human pol ι, in contrast to the mispairing modes observed previously for O(6)-methylG in the structures of the model DNA polymerases Sulfolobus solfataricus Dpo4 and Bacillus stearothermophilus DNA polymerase I.

  14. Contacts between the factor TUF and RPG sequences.

    PubMed

    Vignais, M L; Huet, J; Buhler, J M; Sentenac, A

    1990-08-25

    The yeast TUF factor binds specifically to RPG-like sequences involved in multiple functions at enhancers, silencers, and telomeres. We have characterized the interaction of TUF with its optimal binding sequence, rpg-1 (1-ACACCCATACATTT-14), using a gel DNA-binding assay in combination with methylation protection and mutagenesis experiments. As many as 10 base pairs appear to be engaged in factor binding. Analysis of a collection of 30 different RPG mutants demonstrated the importance of 8 base pairs at position 2, 3, 4, 5, 6, 7, 10, and 12 and the critical role of the central GC pair at position 5. Methylation protection data on four different natural sites confirmed a close contact at positions 4, 5, 6, and 10 and suggested additional contacts at base pairs 8, 12, and 13. The derived consensus sequence was RCAAYCCRYNCAYY. A quantitative band shift analysis was used to determine the equilibrium dissociation constant for the complex of TUF and its optimal binding site rpg-1. The specific dissociation constant (K8) was found to be 1.3 x 10(-11) M. The comparison of the K8 value with the dissociation constant obtained for nonspecific DNA sites (Kn8 = 8.7 x 10(-6) M) shows the high binding selectivity of TUF for its specific RPG target.

  15. Direct observation of single flexible polymers using single stranded DNA†

    PubMed Central

    Brockman, Christopher; Kim, Sun Ju

    2012-01-01

    Over the last 15 years, double stranded DNA (dsDNA) has been used as a model polymeric system for nearly all single polymer dynamics studies. However, dsDNA is a semiflexible polymer with markedly different molecular properties compared to flexible chains, including synthetic organic polymers. In this work, we report a new system for single polymer studies of flexible chains based on single stranded DNA (ssDNA). We developed a method to synthesize ssDNA for fluorescence microscopy based on rolling circle replication, which generates long strands (>65 kb) of ssDNA containing “designer” sequences, thereby preventing intramolecular base pair interactions. Polymers are synthesized to contain amine-modified bases randomly distributed along the backbone, which enables uniform labelling of polymer chains with a fluorescent dye to facilitate fluorescence microscopy and imaging. Using this approach, we synthesized ssDNA chains with long contour lengths (>30 μm) and relatively low dye loading ratios (~1 dye per 100 bases). In addition, we used epifluorescence microscopy to image single ssDNA polymer molecules stretching in flow in a microfluidic device. Overall, we anticipate that ssDNA will serve as a useful model system to probe the dynamics of polymeric materials at the molecular level. PMID:22956981

  16. [The study of complex-formation of DNA with the antimicrobial drug decamethoxine].

    PubMed

    Sorokin, V A; Blagoĭ, Iu P; Valeev, V A; Gladchenko, G O; Sukhodub, L F; Volianskiĭ, Iu L

    1990-01-01

    The interaction of effective antibacterial drug decametoxyn with natural DNA was studied by UV-spectroscopy. Decametoxyn shows a specificity to nucleotides: it decreases the cooperativity of melting and the thermal stability of DNA parts enriched by AT pairs. The characteristics of the helix-coil transition on the DNA parts enriched by GC-pairs are invariable. Interaction with AT-pairs results in their partial or complete melting at room temperature, followed by intermolecule aggregation. Interacting with phosphates decametoxyn manifests itself not as a dication but as two single-charged ions.

  17. Mitochondrial DNA Copy Number in Sleep Duration Discordant Monozygotic Twins

    PubMed Central

    Wrede, Joanna E.; Mengel-From, Jonas; Buchwald, Dedra; Vitiello, Michael V.; Bamshad, Michael; Noonan, Carolyn; Christiansen, Lene; Christensen, Kaare; Watson, Nathaniel F.

    2015-01-01

    Study Objectives: Mitochondrial DNA (mtDNA) copy number is an important component of mitochondrial function and varies with age, disease, and environmental factors. We aimed to determine whether mtDNA copy number varies with habitual differences in sleep duration within pairs of monozygotic twins. Setting: Academic clinical research center. Participants: 15 sleep duration discordant monozygotic twin pairs (30 twins, 80% female; mean age 42.1 years [SD 15.0]). Design: Sleep duration was phenotyped with wrist actigraphy. Each twin pair included a “normal” (7–9 h/24) and “short” (< 7 h/24) sleeping twin. Fasting peripheral blood leukocyte DNA was assessed for mtDNA copy number via the n-fold difference between qPCR measured mtDNA and nuclear DNA creating an mtDNA measure without absolute units. We used generalized estimating equation linear regression models accounting for the correlated data structure to assess within-pair effects of sleep duration on mtDNA copy number. Measurements and Results: Mean within-pair sleep duration difference per 24 hours was 94.3 minutes (SD 62.6 min). We found reduced sleep duration (β = 0.06; 95% CI 0.004, 0.12; P < 0.05) and sleep efficiency (β = 0.51; 95% CI 0.06, 0.95; P < 0.05) were significantly associated with reduced mtDNA copy number within twin pairs. Thus every 1-minute decrease in actigraphy-defined sleep duration was associated with a decrease in mtDNA copy number of 0.06. Likewise, a 1% decrease in actigraphy-defined sleep efficiency was associated with a decrease in mtDNA copy number of 0.51. Conclusions: Reduced sleep duration and sleep efficiency were associated with reduced mitochondrial DNA copy number in sleep duration discordant monozygotic twins offering a potential mechanism whereby short sleep impairs health and longevity through mitochondrial stress. Citation: Wrede JE, Mengel-From J, Buchwald D, Vitiello MV, Bamshad M, Noonan C, Christiansen L, Christensen K, Watson NF. Mitochondrial DNA copy number in sleep duration discordant monozygotic twins. SLEEP 2015;38(10):1655–1658. PMID:26039967

  18. Rolling Circle Amplification For Spatially Directed Synthesis Of A Solid Phase Anchored Single-Stranded DNA Molecule

    NASA Astrophysics Data System (ADS)

    Reiß, Edda; Hölzel, Ralph; von Nickisch-Rosenegk, Markus; Bier, Frank F.

    2006-09-01

    In this article the usefulness of the enzyme phi29 DNA polymerase and the principle of rolling circle amplification (RCA) for creating single-stranded DNA (ssDNA) nanostructures is described. Currently we are working on the spatial orientation of a growing ssDNA molecule during its RCA-based synthesis by the application of a hydrodynamic force. Starting at an immobilized primer at single molecule level, the aim is to construct a nanostructure of known location and orientation, providing multiple repeating binding sites that can be addressed via complementary base-pairing. Proof-of-principle experiments demonstrate the potential of the enzymatic reaction. ssDNA molecules of more than 20 μm length were created at an immobilized primer and detected by means of fluorescence microscopy.

  19. No Genetic Influence for Childhood Behavior Problems From DNA Analysis

    PubMed Central

    Trzaskowski, Maciej; Dale, Philip S.; Plomin, Robert

    2013-01-01

    Objective Twin studies of behavior problems in childhood point to substantial genetic influence. It is now possible to estimate genetic influence using DNA alone in samples of unrelated individuals, not relying on family-based designs such as twins. A linear mixed model, which incorporates DNA microarray data, has confirmed twin results by showing substantial genetic influence for diverse traits in adults. Here we present direct comparisons between twin and DNA heritability estimates for childhood behavior problems as rated by parents, teachers, and children themselves. Method Behavior problem data from 2,500 UK-representative 12-year-old twin pairs were used in twin analyses; DNA analyses were based on 1 member of the twin pair with genotype data for 1.7 million DNA markers. Diverse behavior problems were assessed, including autistic, depressive, and hyperactive symptoms. Genetic influence from DNA was estimated using genome-wide complex trait analysis (GCTA), and the twin estimates of heritability were based on standard twin model fitting. Results Behavior problems in childhood—whether rated by parents, teachers, or children themselves—show no significant genetic influence using GCTA, even though twin study estimates of heritability are substantial in the same sample, and even though both GCTA and twin study estimates of genetic influence are substantial for cognitive and anthropometric traits. Conclusions We suggest that this new type of “missing heritability,” that is, the gap between GCTA and twin study estimates for behavior problems in childhood, is due to nonadditive genetic influence, which will make it more difficult to identify genes responsible for heritability. PMID:24074471

  20. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    PubMed

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  1. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes

    PubMed Central

    Kondo, Jiro; Westhof, Eric

    2011-01-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

  2. Genetic dissection of the consensus sequence for the class 2 and class 3 flagellar promoters

    PubMed Central

    Wozniak, Christopher E.; Hughes, Kelly T.

    2008-01-01

    Summary Computational searches for DNA binding sites often utilize consensus sequences. These search models make assumptions that the frequency of a base pair in an alignment relates to the base pair’s importance in binding and presume that base pairs contribute independently to the overall interaction with the DNA binding protein. These two assumptions have generally been found to be accurate for DNA binding sites. However, these assumptions are often not satisfied for promoters, which are involved in additional steps in transcription initiation after RNA polymerase has bound to the DNA. To test these assumptions for the flagellar regulatory hierarchy, class 2 and class 3 flagellar promoters were randomly mutagenized in Salmonella. Important positions were then saturated for mutagenesis and compared to scores calculated from the consensus sequence. Double mutants were constructed to determine how mutations combined for each promoter type. Mutations in the binding site for FlhD4C2, the activator of class 2 promoters, better satisfied the assumptions for the binding model than did mutations in the class 3 promoter, which is recognized by the σ28 transcription factor. These in vivo results indicate that the activator sites within flagellar promoters can be modeled using simple assumptions but that the DNA sequences recognized by the flagellar sigma factor require more complex models. PMID:18486950

  3. Induced Polarization Influences the Fundamental Forces in DNA Base Flipping

    PubMed Central

    2015-01-01

    Base flipping in DNA is an important process involved in genomic repair and epigenetic control of gene expression. The driving forces for these processes are not fully understood, especially in the context of the underlying dynamics of the DNA and solvent effects. We studied double-stranded DNA oligomers that have been previously characterized by imino proton exchange NMR using both additive and polarizable force fields. Our results highlight the importance of induced polarization on the base flipping process, yielding near-quantitative agreement with experimental measurements of the equilibrium between the base-paired and flipped states. Further, these simulations allow us to quantify for the first time the energetic implications of polarization on the flipping pathway. Free energy barriers to base flipping are reduced by changes in dipole moments of both the flipped bases that favor solvation of the bases in the open state and water molecules adjacent to the flipping base. PMID:24976900

  4. Cytotoxicity and Antineoplastic Activities of Alkylamines and Their Borane Derivatives

    PubMed Central

    Tse, Elaine Y.; Muhammad, Rosallah A.

    1996-01-01

    The alkylamines and their related boron derivatives demonstrated potent cytotoxicity against the growth of murine and human tissue cultured cells. These agents did not necessarily require the boron atom to possess potent cytotoxic action in certain tumor lines. Their ability to suppress tumor cell growth was based on their inhibition of DNA and protein syntheses. DNA synthesis was reduced because purine synthesis was blocked at the enzyme site of IMP dehydrogenase by the agents. In addition ribonucleotide reductase and nucleoside kinase activities were reduced by the agents which would account for the reduced d[NTP] pools. The DNA template or molecule may be a target of the drugs with regard to binding of the drug to nucleoside bases or intercalaction of the drug between DNA base pairs. Only some Of the agents caused DNA fragmentation with reduced DNA viscosity. These effects would contribute to overall cell death afforded by the agents. PMID:18472803

  5. An experimentally-informed coarse-grained 3-site-per-nucleotide model of DNA: Structure, thermodynamics, and dynamics of hybridization

    PubMed Central

    Hinckley, Daniel M.; Freeman, Gordon S.; Whitmer, Jonathan K.; de Pablo, Juan J.

    2013-01-01

    A new 3-Site-Per-Nucleotide coarse-grained model for DNA is presented. The model includes anisotropic potentials between bases involved in base stacking and base pair interactions that enable the description of relevant structural properties, including the major and minor grooves. In an improvement over available coarse-grained models, the correct persistence length is recovered for both ssDNA and dsDNA, allowing for simulation of non-canonical structures such as hairpins. DNA melting temperatures, measured for duplexes and hairpins by integrating over free energy surfaces generated using metadynamics simulations, are shown to be in quantitative agreement with experiment for a variety of sequences and conditions. Hybridization rate constants, calculated using forward-flux sampling, are also shown to be in good agreement with experiment. The coarse-grained model presented here is suitable for use in biological and engineering applications, including nucleosome positioning and DNA-templated engineering. PMID:24116642

  6. Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

    PubMed

    Kryachko, E S; Remacle, F

    2005-12-08

    The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

  7. A Bayesian mixture model for chromatin interaction data.

    PubMed

    Niu, Liang; Lin, Shili

    2015-02-01

    Chromatin interactions mediated by a particular protein are of interest for studying gene regulation, especially the regulation of genes that are associated with, or known to be causative of, a disease. A recent molecular technique, Chromatin interaction analysis by paired-end tag sequencing (ChIA-PET), that uses chromatin immunoprecipitation (ChIP) and high throughput paired-end sequencing, is able to detect such chromatin interactions genomewide. However, ChIA-PET may generate noise (i.e., pairings of DNA fragments by random chance) in addition to true signal (i.e., pairings of DNA fragments by interactions). In this paper, we propose MC_DIST based on a mixture modeling framework to identify true chromatin interactions from ChIA-PET count data (counts of DNA fragment pairs). The model is cast into a Bayesian framework to take into account the dependency among the data and the available information on protein binding sites and gene promoters to reduce false positives. A simulation study showed that MC_DIST outperforms the previously proposed hypergeometric model in terms of both power and type I error rate. A real data study showed that MC_DIST may identify potential chromatin interactions between protein binding sites and gene promoters that may be missed by the hypergeometric model. An R package implementing the MC_DIST model is available at http://www.stat.osu.edu/~statgen/SOFTWARE/MDM.

  8. DNA nanostructure-directed assembly of metal nanoparticle superlattices

    NASA Astrophysics Data System (ADS)

    Julin, Sofia; Nummelin, Sami; Kostiainen, Mauri A.; Linko, Veikko

    2018-05-01

    Structural DNA nanotechnology provides unique, well-controlled, versatile, and highly addressable motifs and templates for assembling materials at the nanoscale. These methods to build from the bottom-up using DNA as a construction material are based on programmable and fully predictable Watson-Crick base pairing. Researchers have adopted these techniques to an increasing extent for creating numerous DNA nanostructures for a variety of uses ranging from nanoelectronics to drug-delivery applications. Recently, an increasing effort has been put into attaching nanoparticles (the size range of 1-20 nm) to the accurate DNA motifs and into creating metallic nanostructures (typically 20-100 nm) using designer DNA nanoshapes as molds or stencils. By combining nanoparticles with the superior addressability of DNA-based scaffolds, it is possible to form well-ordered materials with intriguing and completely new optical, plasmonic, electronic, and magnetic properties. This focused review discusses the DNA structure-directed nanoparticle assemblies covering the wide range of different one-, two-, and three-dimensional systems.

  9. New branched DNA constructs.

    PubMed

    Chandra, Madhavaiah; Keller, Sascha; Gloeckner, Christian; Bornemann, Benjamin; Marx, Andreas

    2007-01-01

    The Watson-Crick base pairing of DNA is an advantageous phenomenon that can be exploited when using DNA as a scaffold for directed self-organization of nanometer-sized objects. Several reports have appeared in the literature that describe the generation of branched DNA (bDNA) with variable numbers of arms that self-assembles into predesigned architectures. These bDNA units are generated by using cleverly designed rigid crossover DNA molecules. Alternatively, bDNA can be generated by using synthetic branch points derived from either nucleoside or non-nucleoside building blocks. Branched DNA has scarcely been explored for use in nanotechnology or from self-assembling perspectives. Herein, we wish to report our results for the synthesis, characterization, and assembling properties of asymmetrical bDNA molecules that are able to generate linear and circular bDNA constructs. Our strategy for the generation of bDNA is based on a branching point that makes use of a novel protecting-group strategy. The bDNA units were generated by means of automated DNA synthesis methods and were used to generate novel objects by employing chemical and biological techniques. The entities generated might be useful building blocks for DNA-based nanobiotechnology.

  10. DNA attachment to support structures

    DOEpatents

    Balhorn, Rodney L.; Barry, Christopher H.

    2002-01-01

    Microscopic beads or other structures are attached to nucleic acids (DNA) using a terminal transferase. The transferase adds labeled dideoxy nucleotide bases to the ends of linear strands of DNA. The labels, such as the antigens digoxigenin and biotin, bind to the antibody compounds or other appropriate complementary ligands, which are bound to the microscopic beads or other support structures. The method does not require the synthesis of a synthetic oligonucleotide probe. The method can be used to tag or label DNA even when the DNA has an unknown sequence, has blunt ends, or is a very large fragment (e.g., >500 kilobase pairs).

  11. CasA mediates Cas3-catalyzed target degradation during CRISPR RNA-guided interference.

    PubMed

    Hochstrasser, Megan L; Taylor, David W; Bhat, Prashant; Guegler, Chantal K; Sternberg, Samuel H; Nogales, Eva; Doudna, Jennifer A

    2014-05-06

    In bacteria, the clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) DNA-targeting complex Cascade (CRISPR-associated complex for antiviral defense) uses CRISPR RNA (crRNA) guides to bind complementary DNA targets at sites adjacent to a trinucleotide signature sequence called the protospacer adjacent motif (PAM). The Cascade complex then recruits Cas3, a nuclease-helicase that catalyzes unwinding and cleavage of foreign double-stranded DNA (dsDNA) bearing a sequence matching that of the crRNA. Cascade comprises the CasA-E proteins and one crRNA, forming a structure that binds and unwinds dsDNA to form an R loop in which the target strand of the DNA base pairs with the 32-nt RNA guide sequence. Single-particle electron microscopy reconstructions of dsDNA-bound Cascade with and without Cas3 reveal that Cascade positions the PAM-proximal end of the DNA duplex at the CasA subunit and near the site of Cas3 association. The finding that the DNA target and Cas3 colocalize with CasA implicates this subunit in a key target-validation step during DNA interference. We show biochemically that base pairing of the PAM region is unnecessary for target binding but critical for Cas3-mediated degradation. In addition, the L1 loop of CasA, previously implicated in PAM recognition, is essential for Cas3 activation following target binding by Cascade. Together, these data show that the CasA subunit of Cascade functions as an essential partner of Cas3 by recognizing DNA target sites and positioning Cas3 adjacent to the PAM to ensure cleavage.

  12. Lactose-modified DNA tile nanostructures as drug carriers.

    PubMed

    Akkus Sut, Pinar; Tunc, Cansu Umran; Culha, Mustafa

    2016-09-01

    DNA hybridization allows the preparation of nanoscale DNA structures with desired shape and size. DNA structures using simple base pairing can be used for the delivery of drug molecules into the cells. Since DNA carries multiple negative charges, their cellular uptake efficiency is low. Thus, the modification of the DNA structures with molecules that may enhance the cellular internalization may be an option. The objective of this study is to construct DNA-based nanocarrier system and to investigate the cellular uptake of DNA tile with/without lactose modification. Doxorubicin was intercalated to DNA tile and cellular uptake of drug-loaded DNA-based carrier with/without lactose modification was investigated in vitro. HeLa, BT-474, and MDA-MB-231 cancer cells were used for cellular uptake studies and cytotoxicity assays. Using fluorescence spectroscopy, flow cytometry, and confocal microscopy, cellular uptake behavior of DNA tile was investigated. The cytotoxicity of DNA tile structures was determined with WST-1 assay. The results show that modification with lactose effectively increases the intracellular uptake of doxorubicin loaded DNA tile structure by cancer cells compared with the unmodified DNA tile. The findings of this study suggest that DNA-based nanostructures modified with carbohydrates can be used as suitable multifunctional nanocarriers with simple chemical modifications.

  13. A new general model for predicting melting thermodynamics of complementary and mismatched B-form duplexes containing locked nucleic acids: application to probe design for digital PCR detection of somatic mutations.

    PubMed

    Hughesman, Curtis; Fakhfakh, Kareem; Bidshahri, Roza; Lund, H Louise; Haynes, Charles

    2015-02-17

    Advances in real-time polymerase chain reaction (PCR), as well as the emergence of digital PCR (dPCR) and useful modified nucleotide chemistries, including locked nucleic acids (LNAs), have created the potential to improve and expand clinical applications of PCR through their ability to better quantify and differentiate amplification products, but fully realizing this potential will require robust methods for designing dual-labeled hydrolysis probes and predicting their hybridization thermodynamics as a function of their sequence, chemistry, and template complementarity. We present here a nearest-neighbor thermodynamic model that accurately predicts the melting thermodynamics of a short oligonucleotide duplexed either to its perfect complement or to a template containing mismatched base pairs. The model may be applied to pure-DNA duplexes or to duplexes for which one strand contains any number and pattern of LNA substitutions. Perturbations to duplex stability arising from mismatched DNA:DNA or LNA:DNA base pairs are treated at the Gibbs energy level to maintain statistical significance in the regressed model parameters. This approach, when combined with the model's accounting of the temperature dependencies of the melting enthalpy and entropy, permits accurate prediction of T(m) values for pure-DNA homoduplexes or LNA-substituted heteroduplexes containing one or two independent mismatched base pairs. Terms accounting for changes in solution conditions and terminal addition of fluorescent dyes and quenchers are then introduced so that the model may be used to accurately predict and thereby tailor the T(m) of a pure-DNA or LNA-substituted hydrolysis probe when duplexed either to its perfect-match template or to a template harboring a noncomplementary base. The model, which builds on classic nearest-neighbor thermodynamics, should therefore be of use to clinicians and biologists who require probes that distinguish and quantify two closely related alleles in either a quantitative PCR or dPCR assay. This potential is demonstrated by using the model to design allele-specific probes that completely discriminate and quantify clinically relevant mutant alleles (BRAF V600E and KIT D816V) in a dPCR assay.

  14. A next generation semiconductor based sequencing approach for the identification of meat species in DNA mixtures.

    PubMed

    Bertolini, Francesca; Ghionda, Marco Ciro; D'Alessandro, Enrico; Geraci, Claudia; Chiofalo, Vincenzo; Fontanesi, Luca

    2015-01-01

    The identification of the species of origin of meat and meat products is an important issue to prevent and detect frauds that might have economic, ethical and health implications. In this paper we evaluated the potential of the next generation semiconductor based sequencing technology (Ion Torrent Personal Genome Machine) for the identification of DNA from meat species (pig, horse, cattle, sheep, rabbit, chicken, turkey, pheasant, duck, goose and pigeon) as well as from human and rat in DNA mixtures through the sequencing of PCR products obtained from different couples of universal primers that amplify 12S and 16S rRNA mitochondrial DNA genes. Six libraries were produced including PCR products obtained separately from 13 species or from DNA mixtures containing DNA from all species or only avian or only mammalian species at equimolar concentration or at 1:10 or 1:50 ratios for pig and horse DNA. Sequencing obtained a total of 33,294,511 called nucleotides of which 29,109,688 with Q20 (87.43%) in a total of 215,944 reads. Different alignment algorithms were used to assign the species based on sequence data. Error rate calculated after confirmation of the obtained sequences by Sanger sequencing ranged from 0.0003 to 0.02 for the different species. Correlation about the number of reads per species between different libraries was high for mammalian species (0.97) and lower for avian species (0.70). PCR competition limited the efficiency of amplification and sequencing for avian species for some primer pairs. Detection of low level of pig and horse DNA was possible with reads obtained from different primer pairs. The sequencing of the products obtained from different universal PCR primers could be a useful strategy to overcome potential problems of amplification. Based on these results, the Ion Torrent technology can be applied for the identification of meat species in DNA mixtures.

  15. A Next Generation Semiconductor Based Sequencing Approach for the Identification of Meat Species in DNA Mixtures

    PubMed Central

    Bertolini, Francesca; Ghionda, Marco Ciro; D’Alessandro, Enrico; Geraci, Claudia; Chiofalo, Vincenzo; Fontanesi, Luca

    2015-01-01

    The identification of the species of origin of meat and meat products is an important issue to prevent and detect frauds that might have economic, ethical and health implications. In this paper we evaluated the potential of the next generation semiconductor based sequencing technology (Ion Torrent Personal Genome Machine) for the identification of DNA from meat species (pig, horse, cattle, sheep, rabbit, chicken, turkey, pheasant, duck, goose and pigeon) as well as from human and rat in DNA mixtures through the sequencing of PCR products obtained from different couples of universal primers that amplify 12S and 16S rRNA mitochondrial DNA genes. Six libraries were produced including PCR products obtained separately from 13 species or from DNA mixtures containing DNA from all species or only avian or only mammalian species at equimolar concentration or at 1:10 or 1:50 ratios for pig and horse DNA. Sequencing obtained a total of 33,294,511 called nucleotides of which 29,109,688 with Q20 (87.43%) in a total of 215,944 reads. Different alignment algorithms were used to assign the species based on sequence data. Error rate calculated after confirmation of the obtained sequences by Sanger sequencing ranged from 0.0003 to 0.02 for the different species. Correlation about the number of reads per species between different libraries was high for mammalian species (0.97) and lower for avian species (0.70). PCR competition limited the efficiency of amplification and sequencing for avian species for some primer pairs. Detection of low level of pig and horse DNA was possible with reads obtained from different primer pairs. The sequencing of the products obtained from different universal PCR primers could be a useful strategy to overcome potential problems of amplification. Based on these results, the Ion Torrent technology can be applied for the identification of meat species in DNA mixtures. PMID:25923709

  16. Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems.

    PubMed

    Ximenes, Camila; Brandão, Eduardo; Oliveira, Paula; Rocha, Abraham; Rego, Tamisa; Medeiros, Rafael; Aguiar-Santos, Ana; Ferraz, João; Reis, Christian; Araujo, Paulo; Carvalho, Luiz; Melo, Fabio L

    2014-12-01

    The Global Program for the Elimination of Lymphatic Filariasis (GPELF) aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR)-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2) and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2), which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.

  17. Preferential Nucleosome Assembly at DNA Triplet Repeats from the Myotonic Dystrophy Gene

    NASA Astrophysics Data System (ADS)

    Wang, Yuh-Hwa; Amirhaeri, Sorour; Kang, Seongman; Wells, Robert D.; Griffith, Jack D.

    1994-07-01

    The expansion of CTG repeats in DNA occurs in or near genes involved in several human diseases, including myotonic dystrophy and Huntington's disease. Nucleosomes, the basic structural element of chromosomes, consist of 146 base pairs of DNA coiled about an octamer of histone proteins and mediate general transcriptional repression. Electron microscopy was used to examine in vitro the nucleosome assembly of DNA containing repeating CTG triplets. The efficiency of nucleosome formation increased with expanded triplet blocks, suggesting that such blocks may repress transcription through the creation of stable nucleosomes.

  18. Quantum chemical investigations of AlN-doped C60 for use as a nano-biosensor in detection of mispairing between DNA bases.

    PubMed

    Siddiqui, Shamoon Ahmad; Bouarissa, Nadir; Rasheed, Tabish; Al-Hajry, A

    2014-12-01

    Quantum chemical calculations were carried out to study the electronic structure and stability of adenine-thymine and the rare tautomer of adenine-thymine base pairs along with their Cu 2+ complexes and their interactions with AlN-modified fullerene (C58AlN) using Density Functional Theory (B3LYP method). Since, these two forms of base pairs and their Cu 2+ complexes have almost similar electronic structures, their chemical differentiation is an extremely difficult task. In this investigation, we have observed that AlN-doped C 60 could be used as a potentially viable nanoscale sensor to detect these two base pairs as well as their Cu2+ complexes.

  19. DNA-bending properties of TF1.

    PubMed

    Schneider, G J; Sayre, M H; Geiduschek, E P

    1991-10-05

    Transcription factor 1 (TF1) is the Bacillus subtilis phage SPO1-encoded member of the family of DNA-binding proteins that includes Escherichia coli HU and integration host factor, IHF. A gel electrophoretic retardation method has been used to show that a TF1 dimer binding to one of its preferred sites in (5-hydroxymethyl)uracil (hmUra)-containing DNA sharply bends the latter. In fact, the DNA-bending properties of TF1 and E. coli IHF are indistinguishable. Substitutions at amino acid 61 in the DNA-binding "arm" of TF1 are known to affect DNA-binding affinity and site selectivity. Experiments described here show that these substitutions also affect DNA bending. The selectivity of TF1 binding is very greatly diminished and the affinity is reduced when hmUra is replaced in DNA by thymine (T). An extension of the gel retardation method that permits an analysis of DNA bending by non-specifically bound TF1 is proposed. Under the assumptions of this analysis, the reduced affinity of TF1 for T-containing DNA is shown to be associated with bending that is still sharp. The analysis of the TF1-DNA interaction has also been extended by hydroxyl radical (.OH) and methylation interference footprinting at two DNA sites. At each of these sites, and on each strand, TF1 strongly protects three segments of DNA from attack by OH. Patches of protected DNA are centered approximately ten base-pairs apart and fall on one side of the B-helix. Methylation in either the major or minor groove in the central ten base-pairs of the two TF1 binding sites quantitatively diminishes, but does not abolish, TF1 binding. We propose that multiple protein contacts allow DNA to wrap around the relatively small TF1 dimer, considerably deforming the DNA B-helix in the process.

  20. Metadynamics Simulation Study on the Conformational Transformation of HhaI Methyltransferase: An Induced-Fit Base-Flipping Hypothesis

    PubMed Central

    Ye, Fei; Zhao, Dan; Chen, Shijie; Jiang, Ren-Wang; Jiang, Hualiang; Luo, Cheng

    2014-01-01

    DNA methyltransferases play crucial roles in establishing and maintenance of DNA methylation, which is an important epigenetic mark. Flipping the target cytosine out of the DNA helical stack and into the active site of protein provides DNA methyltransferases with an opportunity to access and modify the genetic information hidden in DNA. To investigate the conversion process of base flipping in the HhaI methyltransferase (M.HhaI), we performed different molecular simulation approaches on M.HhaI-DNA-S-adenosylhomocysteine ternary complex. The results demonstrate that the nonspecific binding of DNA to M.HhaI is initially induced by electrostatic interactions. Differences in chemical environment between the major and minor grooves determine the orientation of DNA. Gln237 at the target recognition loop recognizes the GCGC base pair from the major groove side by hydrogen bonds. In addition, catalytic loop motion is a key factor during this process. Our study indicates that base flipping is likely to be an “induced-fit” process. This study provides a solid foundation for future studies on the discovery and development of mechanism-based DNA methyltransferases regulators. PMID:25045662

  1. A single-molecule sequencing assay for the comprehensive profiling of T4 DNA ligase fidelity and bias during DNA end-joining.

    PubMed

    Potapov, Vladimir; Ong, Jennifer L; Langhorst, Bradley W; Bilotti, Katharina; Cahoon, Dan; Canton, Barry; Knight, Thomas F; Evans, Thomas C; Lohman, Gregory Js

    2018-05-08

    DNA ligases are key enzymes in molecular and synthetic biology that catalyze the joining of breaks in duplex DNA and the end-joining of DNA fragments. Ligation fidelity (discrimination against the ligation of substrates containing mismatched base pairs) and bias (preferential ligation of particular sequences over others) have been well-studied in the context of nick ligation. However, almost no data exist for fidelity and bias in end-joining ligation contexts. In this study, we applied Pacific Biosciences Single-Molecule Real-Time sequencing technology to directly sequence the products of a highly multiplexed ligation reaction. This method has been used to profile the ligation of all three-base 5'-overhangs by T4 DNA ligase under typical ligation conditions in a single experiment. We report the relative frequency of all ligation products with or without mismatches, the position-dependent frequency of each mismatch, and the surprising observation that 5'-TNA overhangs ligate extremely inefficiently compared to all other Watson-Crick pairings. The method can easily be extended to profile other ligases, end-types (e.g. blunt ends and overhangs of different lengths), and the effect of adjacent sequence on the ligation results. Further, the method has the potential to provide new insights into the thermodynamics of annealing and the kinetics of end-joining reactions.

  2. Molecular docking studies of curcumin natural derivatives with DNA topoisomerase I and II-DNA complexes.

    PubMed

    Kumar, Anil; Bora, Utpal

    2014-12-01

    DNA topoisomerase I (topo I) and II (topo II) are essential enzymes that solve the topological problems of DNA by allowing DNA strands or double helices to pass through each other during cellular processes such as replication, transcription, recombination, and chromatin remodeling. Their critical roles make topoisomerases an attractive drug target against cancer. The present molecular docking study provides insights into the inhibition of topo I and II by curcumin natural derivatives. The binding modes suggested that curcumin natural derivatives docked at the site of DNA cleavage parallel to the axis of DNA base pairing. Cyclocurcumin and curcumin sulphate were predicted to be the most potent inhibitors amongst all the curcumin natural derivatives docked. The binding modes of cyclocurcumin and curcumin sulphate were similar to known inhibitors of topo I and II. Residues like Arg364, Asn722 and base A113 (when docked to topo I-DNA complex) and residues Asp479, Gln778 and base T9 (when docked to topo II-DNA complex) seem to play important role in the binding of curcumin natural derivatives at the site of DNA cleavage.

  3. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Szulik, Marta W.; Pallan, Pradeep S.; Nocek, Boguslaw

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T 8X 9G 10-3' sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC didmore » not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A 5:T 8, whereas 5caC did not. At the oxidized base pair G 4:X 9, 5fC exhibited an increase in the imino proton exchange rate and the calculated k op. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C 3:G 10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G 4:X 9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N 4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. Furthermore, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.« less

  4. Modelling of DNA-protein recognition

    NASA Technical Reports Server (NTRS)

    Rein, R.; Garduno, R.; Colombano, S.; Nir, S.; Haydock, K.; Macelroy, R. D.

    1980-01-01

    Computer model-building procedures using stereochemical principles together with theoretical energy calculations appear to be, at this stage, the most promising route toward the elucidation of DNA-protein binding schemes and recognition principles. A review of models and bonding principles is conducted and approaches to modeling are considered, taking into account possible di-hydrogen-bonding schemes between a peptide and a base (or a base pair) of a double-stranded nucleic acid in the major groove, aspects of computer graphic modeling, and a search for isogeometric helices. The energetics of recognition complexes is discussed and several models for peptide DNA recognition are presented.

  5. G-Quadruplexes in DNA Replication: A Problem or a Necessity?

    PubMed

    Valton, Anne-Laure; Prioleau, Marie-Noëlle

    2016-11-01

    DNA replication is a highly regulated process that ensures the correct duplication of the genome at each cell cycle. A precise cell type-specific temporal program controls the duplication of complex vertebrate genomes in an orderly manner. This program is based on the regulation of both replication origin firing and replication fork progression. G-quadruplexes (G4s), DNA secondary structures displaying noncanonical Watson-Crick base pairing, have recently emerged as key controllers of genome duplication. Here we discuss the various means by which G4s affect this fundamental cellular process. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae).

    PubMed

    Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo

    2013-01-01

    Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country's economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 'Azul', Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies.

  7. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae)

    PubMed Central

    Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo

    2013-01-01

    Abstract Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 ‘Azul’, Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies. PMID:24260700

  8. Structural DNA Nanotechnology: Artificial Nanostructures for Biomedical Research.

    PubMed

    Ke, Yonggang; Castro, Carlos; Choi, Jong Hyun

    2018-06-04

    Structural DNA nanotechnology utilizes synthetic or biologic DNA as designer molecules for the self-assembly of artificial nanostructures. The field is founded upon the specific interactions between DNA molecules, known as Watson-Crick base pairing. After decades of active pursuit, DNA has demonstrated unprecedented versatility in constructing artificial nanostructures with significant complexity and programmability. The nanostructures could be either static, with well-controlled physicochemical properties, or dynamic, with the ability to reconfigure upon external stimuli. Researchers have devoted considerable effort to exploring the usability of DNA nanostructures in biomedical research. We review the basic design methods for fabricating both static and dynamic DNA nanostructures, along with their biomedical applications in fields such as biosensing, bioimaging, and drug delivery.

  9. The energetic basis of the DNA double helix: a combined microcalorimetric approach

    PubMed Central

    Vaitiekunas, Paulius; Crane-Robinson, Colyn; Privalov, Peter L.

    2015-01-01

    Microcalorimetric studies of DNA duplexes and their component single strands showed that association enthalpies of unfolded complementary strands into completely folded duplexes increase linearly with temperature and do not depend on salt concentration, i.e. duplex formation results in a constant heat capacity decrement, identical for CG and AT pairs. Although duplex thermostability increases with CG content, the enthalpic and entropic contributions of an AT pair to duplex formation exceed that of a CG pair when compared at the same temperature. The reduced contribution of AT pairs to duplex stabilization comes not from their lower enthalpy, as previously supposed, but from their larger entropy contribution. This larger enthalpy and particularly the greater entropy results from water fixed by the AT pair in the minor groove. As the increased entropy of an AT pair exceeds that of melting ice, the water molecule fixed by this pair must affect those of its neighbors. Water in the minor groove is, thus, orchestrated by the arrangement of AT groups, i.e. is context dependent. In contrast, water hydrating exposed nonpolar surfaces of bases is responsible for the heat capacity increment on dissociation and, therefore, for the temperature dependence of all thermodynamic characteristics of the double helix. PMID:26304541

  10. Programmable and Multifunctional DNA-Based Materials for Biomedical Applications.

    PubMed

    Zhang, Yuezhou; Tu, Jing; Wang, Dongqing; Zhu, Haitao; Maity, Sajal Kumar; Qu, Xiangmeng; Bogaert, Bram; Pei, Hao; Zhang, Hongbo

    2018-06-01

    DNA encodes the genetic information; recently, it has also become a key player in material science. Given the specific Watson-Crick base-pairing interactions between only four types of nucleotides, well-designed DNA self-assembly can be programmable and predictable. Stem-loops, sticky ends, Holliday junctions, DNA tiles, and lattices are typical motifs for forming DNA-based structures. The oligonucleotides experience thermal annealing in a near-neutral buffer containing a divalent cation (usually Mg 2+ ) to produce a variety of DNA nanostructures. These structures not only show beautiful landscape, but can also be endowed with multifaceted functionalities. This Review begins with the fundamental characterization and evolutionary trajectory of DNA-based artificial structures, but concentrates on their biomedical applications. The coverage spans from controlled drug delivery to high therapeutic profile and accurate diagnosis. A variety of DNA-based materials, including aptamers, hydrogels, origamis, and tetrahedrons, are widely utilized in different biomedical fields. In addition, to achieve better performance and functionality, material hybridization is widely witnessed, and DNA nanostructure modification is also discussed. Although there are impressive advances and high expectations, the development of DNA-based structures/technologies is still hindered by several commonly recognized challenges, such as nuclease instability, lack of pharmacokinetics data, and relatively high synthesis cost. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Dynamic DNA devices and assemblies formed by shape-complementary, non-base pairing 3D components

    NASA Astrophysics Data System (ADS)

    Gerling, Thomas; Wagenbauer, Klaus F.; Neuner, Andrea M.; Dietz, Hendrik

    2015-03-01

    We demonstrate that discrete three-dimensional (3D) DNA components can specifically self-assemble in solution on the basis of shape-complementarity and without base pairing. Using this principle, we produced homo- and heteromultimeric objects, including micrometer-scale one- and two-stranded filaments and lattices, as well as reconfigurable devices, including an actuator, a switchable gear, an unfoldable nanobook, and a nanorobot. These multidomain assemblies were stabilized via short-ranged nucleobase stacking bonds that compete against electrostatic repulsion between the components’ interfaces. Using imaging by electron microscopy, ensemble and single-molecule fluorescence resonance energy transfer spectroscopy, and electrophoretic mobility analysis, we show that the balance between attractive and repulsive interactions, and thus the conformation of the assemblies, may be finely controlled by global parameters such as cation concentration or temperature and by an allosteric mechanism based on strand-displacement reactions.

  12. Cloning, sequencing, and expression of cDNA for human. beta. -glucuronidase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Oshima, A.; Kyle, J.W.; Miller, R.D.

    1987-02-01

    The authors report here the cDNA sequence for human placental ..beta..-glucuronidase (..beta..-D-glucuronoside glucuronosohydrolase, EC 3.2.1.31) and demonstrate expression of the human enzyme in transfected COS cells. They also sequenced a partial cDNA clone from human fibroblasts that contained a 153-base-pair deletion within the coding sequence and found a second type of cDNA clone from placenta that contained the same deletion. Nuclease S1 mapping studies demonstrated two types of mRNAs in human placenta that corresponded to the two types of cDNA clones isolated. The NH/sub 2/-terminal amino acid sequence determined for human spleen ..beta..-glucuronidase agreed with that inferred from the DNAmore » sequence of the two placental clones, beginning at amino acid 23, suggesting a cleaved signal sequence of 22 amino acids. When transfected into COS cells, plasmids containing either placental clone expressed an immunoprecipitable protein that contained N-linked oligosaccharides as evidenced by sensitivity to endoglycosidase F. However, only transfection with the clone containing the 153-base-pair segment led to expression of human ..beta..-glucuronidase activity. These studies provide the sequence for the full-length cDNA for human ..beta..-glucuronidase, demonstrate the existence of two populations of mRNA for ..beta..-glucuronidase in human placenta, only one of which specifies a catalytically active enzyme, and illustrate the importance of expression studies in verifying that a cDNA is functionally full-length.« less

  13. RDNAnalyzer: A tool for DNA secondary structure prediction and sequence analysis

    PubMed Central

    Afzal, Muhammad; Shahid, Ahmad Ali; Shehzadi, Abida; Nadeem, Shahid; Husnain, Tayyab

    2012-01-01

    RDNAnalyzer is an innovative computer based tool designed for DNA secondary structure prediction and sequence analysis. It can randomly generate the DNA sequence or user can upload the sequences of their own interest in RAW format. It uses and extends the Nussinov dynamic programming algorithm and has various application for the sequence analysis. It predicts the DNA secondary structure and base pairings. It also provides the tools for routinely performed sequence analysis by the biological scientists such as DNA replication, reverse compliment generation, transcription, translation, sequence specific information as total number of nucleotide bases, ATGC base contents along with their respective percentages and sequence cleaner. RDNAnalyzer is a unique tool developed in Microsoft Visual Studio 2008 using Microsoft Visual C# and Windows Presentation Foundation and provides user friendly environment for sequence analysis. It is freely available. Availability http://www.cemb.edu.pk/sw.html Abbreviations RDNAnalyzer - Random DNA Analyser, GUI - Graphical user interface, XAML - Extensible Application Markup Language. PMID:23055611

  14. Disturbance of DNA conformation by the binding of testosterone-based platinum drugs via groove-face and intercalative interactions: a molecular dynamics simulation study

    PubMed Central

    2013-01-01

    Background To explore novel platinum-based anticancer agents that are distinct from the structure and interaction mode of the traditional cisplatin by forming the bifunctional intrastrand 1,2 GpG adduct, the monofunctional platinum + DNA adducts with extensive non-covalent interactions had been studied. It was reported that the monofunctional testosterone-based platinum(II) agents present the high anticancer activity. Moreover, it was also found that the testosterone-based platinum agents could cause the DNA helix to undergo significant unwinding and bending over the non-testosterone-based platinum agents. However, the interaction mechanisms of these platinum agents with DNA at the atomic level are not yet clear so far. Results In the present work, we used molecular dynamics (MD) simulations and DNA conformational dynamics calculations to study the DNA distortion properties of the testosterone-based platinum + DNA, the improved testosterone-based platinum + DNA and the non-testosterone-based platinum + DNA adducts. The results show that the intercalative interaction of the improved flexible testosterone-based platinum agent with DNA molecule could cause larger DNA conformational distortion than the groove-face interaction of the rigid testosterone-based platinum agent with DNA molecule. Further investigations for the non-testosterone-based platinum agent reveal the occurrence of insignificant change of DNA conformation due to the absence of testosterone ligand in such agent. Based on the DNA dynamics analysis, the DNA base motions relating to DNA groove parameter changes and hydrogen bond destruction of DNA base pairs were also discussed in this work. Conclusions The flexible linker in the improved testosterone-based platinum agent causes an intercalative interaction with DNA in the improved testosterone-based platinum + DNA adduct, which is different from the groove-face interaction caused by a rigid linker in the testosterone-based platinum agent. The present investigations provide useful information of DNA conformation affected by a testosterone-based platinum complex at the atomic level. PMID:23517640

  15. A versatile genome-scale PCR-based pipeline for high-definition DNA FISH.

    PubMed

    Bienko, Magda; Crosetto, Nicola; Teytelman, Leonid; Klemm, Sandy; Itzkovitz, Shalev; van Oudenaarden, Alexander

    2013-02-01

    We developed a cost-effective genome-scale PCR-based method for high-definition DNA FISH (HD-FISH). We visualized gene loci with diffraction-limited resolution, chromosomes as spot clusters and single genes together with transcripts by combining HD-FISH with single-molecule RNA FISH. We provide a database of over 4.3 million primer pairs targeting the human and mouse genomes that is readily usable for rapid and flexible generation of probes.

  16. Rangewide phylogeography of the western U.S. endemic frog Rana boylii (Ranidae): Implications for the conservation of frogs and rivers

    Treesearch

    A.J. Lind; H.B. Shaffer; P.Q. Spinks; G.M. Fellers

    2011-01-01

    Genetic data are increasingly being used in conservation planning for declining species. We sampled both the ecological and distributional limits of the foothill yellow-legged frog, Rana boylii to characterize mitochondrial DNA (mtDNA) variation in this declining, riverine amphibian. We evaluated 1525 base pairs (bp) of cytochrome b...

  17. cDNA isolated from a human T-cell library encodes a member of the protein-tyrosine-phosphatase family

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cool, D.E.; Tonks, N.K.; Charbonneau, H.

    1989-07-01

    A human peripheral T-cell cDNA library was screened with two labeled synthetic oligonucleotides encoding regions of a human placenta protein-tyrosine-phosphatase. One positive clone was isolated and the nucleotide sequence was determined. It contained 1,305 base pairs of open reading frame followed by a TAA stop codon and 978 base pairs of 3{prime} untranslated end, although a poly(A){sup +} tail was not found. An initiator methionine residue was predicted at position 61, which would result in a protein of 415 amino acid residues. This was supported by the synthesis of a M{sub r} 48,000 protein in an in vitro reticulocyte lysatemore » translation system using RNA transcribed from the cloned cDNA and T7 RNA polymerase. The deduced amino acid sequence was compared to other known proteins revealing 65% identity to the low M{sub r} PTPase 1B isolated from placenta. In view of the high degree of similarity, the T-cell cDNA likely encodes a newly discovered protein-tyrosine-phosphatase, thus expanding this family of genes.« less

  18. Scaling features of noncoding DNA

    NASA Technical Reports Server (NTRS)

    Stanley, H. E.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Peng, C. K.; Simons, M.

    1999-01-01

    We review evidence supporting the idea that the DNA sequence in genes containing noncoding regions is correlated, and that the correlation is remarkably long range--indeed, base pairs thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene, and utilize this fact to build a Coding Sequence Finder Algorithm, which uses statistical ideas to locate the coding regions of an unknown DNA sequence. Finally, we describe briefly some recent work adapting to DNA the Zipf approach to analyzing linguistic texts, and the Shannon approach to quantifying the "redundancy" of a linguistic text in terms of a measurable entropy function, and reporting that noncoding regions in eukaryotes display a larger redundancy than coding regions. Specifically, we consider the possibility that this result is solely a consequence of nucleotide concentration differences as first noted by Bonhoeffer and his collaborators. We find that cytosine-guanine (CG) concentration does have a strong "background" effect on redundancy. However, we find that for the purine-pyrimidine binary mapping rule, which is not affected by the difference in CG concentration, the Shannon redundancy for the set of analyzed sequences is larger for noncoding regions compared to coding regions.

  19. Conformational analysis of a covalently cross-linked Watson-Crick base pair model.

    PubMed

    Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J

    2008-11-15

    Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

  20. An Enzyme-Catalyzed Multistep DNA Refolding Mechanism in Hairpin Telomere Formation

    PubMed Central

    Shi, Ke; Huang, Wai Mun; Aihara, Hideki

    2013-01-01

    Hairpin telomeres of bacterial linear chromosomes are generated by a DNA cutting–rejoining enzyme protelomerase. Protelomerase resolves a concatenated dimer of chromosomes as the last step of chromosome replication, converting a palindromic DNA sequence at the junctions between chromosomes into covalently closed hairpins. The mechanism by which protelomerase transforms a duplex DNA substrate into the hairpin telomeres remains largely unknown. We report here a series of crystal structures of the protelomerase TelA bound to DNA that represent distinct stages along the reaction pathway. The structures suggest that TelA converts a linear duplex substrate into hairpin turns via a transient strand-refolding intermediate that involves DNA-base flipping and wobble base-pairs. The extremely compact di-nucleotide hairpin structure of the product is fully stabilized by TelA prior to strand ligation, which drives the reaction to completion. The enzyme-catalyzed, multistep strand refolding is a novel mechanism in DNA rearrangement reactions. PMID:23382649

Top