Science.gov

Sample records for dna base-pair mismatch

  1. Unique magnetic signatures of mismatched base pairs in DNA

    NASA Astrophysics Data System (ADS)

    Apalkov, Vadim; Berashevich, Julia; Chakraborty, Tapash

    2010-02-01

    Magnetic properties of DNA containing mispairs, such as different conformations of the GṡA mispair, or a GṡT mispair inserted into the DNA chain, have been theoretically investigated. The essential ingredients for these studies, the charge transfer integrals, were evaluated from the DNA sequences containing the mispair and optimized in the solvent. We find that the magnetic susceptibilities of the host DNA chain containing a large number of Watson-Crick base pairs are significantly altered in the presence of the mispairs, and the effects depend on the choice of mispairs. In particular, insertion of even a single GṡA mispair changes the nature of magnetization (sign of the susceptibility) of the host DNA. We propose that measurement of the magnetic properties of DNA might provide a direct route to detection and identification of those mispairs.

  2. Guanine- 5-carboxylcytosine base pairs mimic mismatches during DNA replication.

    PubMed

    Shibutani, Toshihiro; Ito, Shinsuke; Toda, Mariko; Kanao, Rie; Collins, Leonard B; Shibata, Marika; Urabe, Miho; Koseki, Haruhiko; Masuda, Yuji; Swenberg, James A; Masutani, Chikahide; Hanaoka, Fumio; Iwai, Shigenori; Kuraoka, Isao

    2014-06-09

    The genetic information encoded in genomes must be faithfully replicated and transmitted to daughter cells. The recent discovery of consecutive DNA conversions by TET family proteins of 5-methylcytosine into 5-hydroxymethylcytosine, 5-formylcytosine, and 5-carboxylcytosine (5caC) suggests these modified cytosines act as DNA lesions, which could threaten genome integrity. Here, we have shown that although 5caC pairs with guanine during DNA replication in vitro, G·5caC pairs stimulated DNA polymerase exonuclease activity and were recognized by the mismatch repair (MMR) proteins. Knockdown of thymine DNA glycosylase increased 5caC in genome, affected cell proliferation via MMR, indicating MMR is a novel reader for 5caC. These results suggest the epigenetic modification products of 5caC behave as DNA lesions.

  3. Detection of base-pair mismatches in DNA using graphene-based nanopore device

    NASA Astrophysics Data System (ADS)

    Kundu, Sourav; Karmakar, S. N.

    2016-04-01

    We present a unique way to detect base-pair mismatches in DNA, leading to a different epigenetic disorder by the method of nanopore sequencing. Based on a tight-binding formulation of a graphene-based nanopore device, using the Green’s function approach we study the changes in the electronic transport properties of the device as we translocate a double-stranded DNA through the nanopore embedded in a zigzag graphene nanoribbon. In the present work we are not only successful in detecting the usual AT and GC pairs but also a set of possible mismatches in the complementary base pairing.

  4. Detection of base-pair mismatches in DNA using graphene-based nanopore device.

    PubMed

    Kundu, Sourav; Karmakar, S N

    2016-04-01

    We present a unique way to detect base-pair mismatches in DNA, leading to a different epigenetic disorder by the method of nanopore sequencing. Based on a tight-binding formulation of a graphene-based nanopore device, using the Green's function approach we study the changes in the electronic transport properties of the device as we translocate a double-stranded DNA through the nanopore embedded in a zigzag graphene nanoribbon. In the present work we are not only successful in detecting the usual AT and GC pairs but also a set of possible mismatches in the complementary base pairing.

  5. Thermodynamic properties of the specific binding between Ag+ ions and C:C mismatched base pairs in duplex DNA.

    PubMed

    Torigoe, Hidetaka; Miyakawa, Yukako; Ono, Akira; Kozasa, Tetsuo

    2011-02-01

    Metal-mediated base pairs formed by the interaction between metal ions and artificial bases in oligonucleotides have been developed for potential applications in nanotechnology. We recently found that a natural C:C mismatched base pair bound to an Ag(+) ion to generate a novel metal-mediated base pair in duplex DNA. Preparation of the novel C-Ag-C base pair involving natural bases is more convenient than that of metal-mediated base pairs involving artificial bases because time-consuming base synthesis is not required. Here, we examined the thermodynamic properties of the binding between the Ag(+) ion and each of single and double C:C mismatched base pair in duplex DNA by isothermal titration calorimetry. The Ag(+) ion specifically bound to the C:C mismatched base pair at a 1:1 molar ratio with 10(6) M(-1) binding constant, which was significantly larger than those for nonspecific metal ion-DNA interactions. The specific binding between the Ag(+) ion and the single C:C mismatched base pair was mainly driven by the positive dehydration entropy change and the negative binding enthalpy change. In the interaction between the Ag(+) ion and each of the consecutive and interrupted double C:C mismatched base pairs, stoichiometric binding at a 1:1 molar ratio was achieved in each step of the first and second Ag(+) binding. The binding affinity for the second Ag(+) binding was similar to that for the first Ag(+) binding. Stoichiometric binding without interference and negative cooperativity may be favorable for aligning multiple Ag(+) ions in duplex DNA for applications of the metal-mediated base pairs in nanotechnology.

  6. Molecular recognition of T:G mismatched base pairs in DNA as studied by electrospray ionization mass spectrometry.

    PubMed

    Riccardi Sirtori, Federico; Aldini, Giancarlo; Colombo, Maristella; Colombo, Nicoletta; Malyszko, Jan; Vistoli, Giulio; D'Alessio, Roberto

    2012-06-01

    Postreplicative mismatch repair (MMR) is a cellular system involved in the recognition and correction of DNA polymerase errors that escape detection in proofreading. Of the various mismatched bases, T:G pairing in DNA is one of the more common mutations leading to the formation of tumors in humans. In addition, the absence of the MMR system can generate resistance to several chemotherapeutic agents, particularly DNA-damaging substances. The main purpose of this study was the setup and validation of an electrospray ionization (ESI) mass spectrometry method for the identification of small molecules that are able to recognize T:G mismatches in DNA targets. These findings could be useful for the discovery of new antitumor drugs. The analytical method is based on the ability of electrospray to preserve the noncovalent adducts present in solution and transfer them to the gas phase. Lexitropsin derivatives (polyimidazole compounds) have been previously described as selective for T:G mismatch binding by NMR and ITC studies. We synthesized and tested various polyimidazole derivatives, one of which in particular (NMS-057) showed a higher affinity for an oligonucleotide DNA sequence containing a T:G mismatched base pair. To rationalize these findings, molecular docking studies were performed using available NMR structures. Moreover, ESI-MS experiments, performed on an orbitrap mass spectrometer, highlighted the formation of heterodimeric complexes between DNA sequences, distamycin A, and polyimidazole compounds. Our results confirm that this ESI method could be a valuable tool for the identification of new molecules able to specifically recognize T:G mismatched base pairs.

  7. Thermodynamic and structural properties of the specific binding between Ag⁺ ion and C:C mismatched base pair in duplex DNA to form C-Ag-C metal-mediated base pair.

    PubMed

    Torigoe, Hidetaka; Okamoto, Itaru; Dairaku, Takenori; Tanaka, Yoshiyuki; Ono, Akira; Kozasa, Tetsuo

    2012-11-01

    Metal ion-nucleic acid interactions have attracted considerable interest for their involvement in structure formation and catalytic activity of nucleic acids. Although interactions between metal ion and mismatched base pair duplex are important to understand mechanism of gene mutations related to heavy metal ions, they have not been well-characterized. We recently found that the Ag(+) ion stabilized a C:C mismatched base pair duplex DNA. A C-Ag-C metal-mediated base pair was supposed to be formed by the binding between the Ag(+) ion and the C:C mismatched base pair to stabilize the duplex. Here, we examined specificity, thermodynamics and structure of possible C-Ag-C metal-mediated base pair. UV melting indicated that only the duplex with the C:C mismatched base pair, and not of the duplexes with the perfectly matched and other mismatched base pairs, was specifically stabilized on adding the Ag(+) ion. Isothermal titration calorimetry demonstrated that the Ag(+) ion specifically bound with the C:C base pair at 1:1 molar ratio with a binding constant of 10(6) M(-1), which was significantly larger than those for nonspecific metal ion-DNA interactions. Electrospray ionization mass spectrometry also supported the specific 1:1 binding between the Ag(+) ion and the C:C base pair. Circular dichroism spectroscopy and NMR revealed that the Ag(+) ion may bind with the N3 positions of the C:C base pair without distorting the higher-order structure of the duplex. We conclude that the specific formation of C-Ag-C base pair with large binding affinity would provide a binding mode of metal ion-DNA interactions, similar to that of the previously reported T-Hg-T base pair. The C-Ag-C base pair may be useful not only for understanding of molecular mechanism of gene mutations related to heavy metal ions but also for wide variety of potential applications of metal-mediated base pairs in various fields, such as material, life and environmental sciences.

  8. Atomistic understanding of the C·T mismatched DNA base pair tautomerization via the DPT: QM and QTAIM computational approaches.

    PubMed

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2013-11-15

    It was established that the cytosine·thymine (C·T) mismatched DNA base pair with cis-oriented N1H glycosidic bonds has propeller-like structure (|N3C4C4N3| = 38.4°), which is stabilized by three specific intermolecular interactions-two antiparallel N4H…O4 (5.19 kcal mol(-1)) and N3H…N3 (6.33 kcal mol(-1)) H-bonds and a van der Waals (vdW) contact O2…O2 (0.32 kcal mol(-1)). The C·T base mispair is thermodynamically stable structure (ΔG(int) = -1.54 kcal mol(-1) ) and even slightly more stable than the A·T Watson-Crick DNA base pair (ΔG(int) = -1.43 kcal mol(-1)) at the room temperature. It was shown that the C·T ↔ C*·T* tautomerization via the double proton transfer (DPT) is assisted by the O2…O2 vdW contact along the entire range of the intrinsic reaction coordinate (IRC). The positive value of the Grunenberg's compliance constants (31.186, 30.265, and 22.166 Å/mdyn for the C·T, C*·T*, and TS(C·T ↔ C*·T*), respectively) proves that the O2…O2 vdW contact is a stabilizing interaction. Based on the sweeps of the H-bond energies, it was found that the N4H…O4/O4H…N4, and N3H…N3 H-bonds in the C·T and C*·T* base pairs are anticooperative and weaken each other, whereas the middle N3H…N3 H-bond and the O2…O2 vdW contact are cooperative and mutually reinforce each other. It was found that the tautomerization of the C·T base mispair through the DPT is concerted and asynchronous reaction that proceeds via the TS(C·T ↔ C*·T*) stabilized by the loosened N4-H-O4 covalent bridge, N3H…N3 H-bond (9.67 kcal mol(-1) ) and O2…O2 vdW contact (0.41 kcal mol(-1) ). The nine key points, describing the evolution of the C·T ↔ C*·T* tautomerization via the DPT, were detected and completely investigated along the IRC. The C*·T* mispair was revealed to be the dynamically unstable structure with a lifetime 2.13·× 10(-13) s. In this case, as for the A·T Watson-Crick DNA base pair, activates the mechanism of the quantum protection of the C

  9. Single-base-pair discrimination of terminal mismatches by using oligonucleotide microarrays and neural network analyses

    NASA Technical Reports Server (NTRS)

    Urakawa, Hidetoshi; Noble, Peter A.; El Fantroussi, Said; Kelly, John J.; Stahl, David A.

    2002-01-01

    The effects of single-base-pair near-terminal and terminal mismatches on the dissociation temperature (T(d)) and signal intensity of short DNA duplexes were determined by using oligonucleotide microarrays and neural network (NN) analyses. Two perfect-match probes and 29 probes having a single-base-pair mismatch at positions 1 to 5 from the 5' terminus of the probe were designed to target one of two short sequences representing 16S rRNA. Nonequilibrium dissociation rates (i.e., melting profiles) of all probe-target duplexes were determined simultaneously. Analysis of variance revealed that position of the mismatch, type of mismatch, and formamide concentration significantly affected the T(d) and signal intensity. Increasing the concentration of formamide in the washing buffer decreased the T(d) and signal intensity, and it decreased the variability of the signal. Although T(d)s of probe-target duplexes with mismatches in the first or second position were not significantly different from one another, duplexes with mismatches in the third to fifth positions had significantly lower T(d)s than those with mismatches in the first or second position. The trained NNs predicted the T(d) with high accuracies (R(2) = 0.93). However, the NNs predicted the signal intensity only moderately accurately (R(2) = 0.67), presumably due to increased noise in the signal intensity at low formamide concentrations. Sensitivity analysis revealed that the concentration of formamide explained most (75%) of the variability in T(d)s, followed by position of the mismatch (19%) and type of mismatch (6%). The results suggest that position of the mismatch at or near the 5' terminus plays a greater role in determining the T(d) and signal intensity of duplexes than the type of mismatch.

  10. Alternative DNA base pairing through metal coordination.

    PubMed

    Clever, Guido H; Shionoya, Mitsuhiko

    2012-01-01

    Base-pairing in the naturally occurring DNA and RNA oligonucleotide duplexes is based on π-stacking, hydrogen bonding, and shape complementarity between the nucleobases adenine, thymine, guanine, and cytosine as well as on the hydrophobic-hydrophilic balance in aqueous media. This complex system of multiple supramolecular interactions is the product of a long-term evolutionary process and thus highly optimized to serve its biological functions such as information storage and processing. After the successful implementation of automated DNA synthesis, chemists have begun to introduce artificial modifications inside the core of the DNA double helix in order to study various aspects of base pairing, generate new base pairs orthogonal to the natural ones, and equip the biopolymer with entirely new functions. The idea to replace the hydrogen bonding interactions with metal coordination between ligand-like nucleosides and suitable transition metal ions culminated in the development of a plethora of artificial base-pairing systems termed "metal base-pairs" which were shown to strongly enhance the DNA duplex stability. Furthermore, they show great potential for the use of DNA as a molecular wire in nanoscale electronic architectures. Although single electrons have proven to be transmitted by natural DNA over a distance of several base pairs, the high ohmic resistance of unmodified oligonucleotides was identified as a serious obstacle. By exchanging some or all of the Watson-Crick base pairs in DNA with metal complexes, this problem may be solved. In the future, these research efforts are supposed to lead to DNA-like materials with superior conductivity for nano-electronic applications. Other fields of potential application such as DNA-based supramolecular architecture and catalysis may be strongly influenced by these developments as well. This text is meant to illustrate the basic concepts of metal-base pairing and give an outline over recent developments in this field.

  11. Molecular switching behavior in isosteric DNA base pairs.

    PubMed

    Jissy, A K; Konar, Sukanya; Datta, Ayan

    2013-04-15

    The structures and proton-coupled behavior of adenine-thymine (A-T) and a modified base pair containing a thymine isostere, adenine-difluorotoluene (A-F), are studied in different solvents by dispersion-corrected density functional theory. The stability of the canonical Watson-Crick base pair and the mismatched pair in various solvents with low and high dielectric constants is analyzed. It is demonstrated that A-F base pairing is favored in solvents with low dielectric constant. The stabilization and conformational changes induced by protonation are also analyzed for the natural as well as the mismatched base pair. DNA sequences capable of changing their sequence conformation on protonation are used in the construction of pH-based molecular switches. An acidic medium has a profound influence in stabilizing the isostere base pair. Such a large gain in stability on protonation leads to an interesting pH-controlled molecular switch, which can be incorporated in a natural DNA tract.

  12. High fidelity of base pairing by 2-selenothymidine in DNA.

    PubMed

    Hassan, Abdalla E A; Sheng, Jia; Zhang, Wen; Huang, Zhen

    2010-02-24

    The base pairs are the contributors to the sequence-dependent recognition of nucleic acids, genetic information storage, and high fidelity of DNA polymerase replication. However, the wobble base pairing, where T pairs with G instead of A, reduces specific base-pairing recognition and compromises the high fidelity of the enzymatic polymerization. Via the selenium atomic probing at the 2-position of thymidine, we have investigated the wobble discrimination by manipulating the steric and electronic effects at the 2-exo position, providing a unique chemical strategy to enhance the base pair specificity. We report here the first synthesis of the novel 2-Se-thymidine ((Se)T) derivative, its phosphoramidite, and the Se-DNAs. Our biophysical and structural studies of the 2-Se-T DNAs reveal that the bulky 2-Se atom with a weak hydrogen-bonding ability can largely increase mismatch discriminations (including T/G wobble and T/C mismatched base pairs) while maintaining the (Se)T/A virtually identical to the native T/A base pair. The 2-Se atom bulkiness and the electronic effect are probably the main factors responsible for the discrimination against the formation of the wobble (Se)T/G base pair. Our investigations provide a potential novel tool to investigate the specific recognition of base pairs, which is the basis of high fidelity during replication, transcription, and translation. Furthermore, this Se-atom-specific substitution and probing are useful for X-ray crystal structure and function studies of nucleic acids.

  13. Optimization of single-base-pair mismatch discrimination in oligonucleotide microarrays

    NASA Technical Reports Server (NTRS)

    Urakawa, Hidetoshi; El Fantroussi, Said; Smidt, Hauke; Smoot, James C.; Tribou, Erik H.; Kelly, John J.; Noble, Peter A.; Stahl, David A.

    2003-01-01

    The discrimination between perfect-match and single-base-pair-mismatched nucleic acid duplexes was investigated by using oligonucleotide DNA microarrays and nonequilibrium dissociation rates (melting profiles). DNA and RNA versions of two synthetic targets corresponding to the 16S rRNA sequences of Staphylococcus epidermidis (38 nucleotides) and Nitrosomonas eutropha (39 nucleotides) were hybridized to perfect-match probes (18-mer and 19-mer) and to a set of probes having all possible single-base-pair mismatches. The melting profiles of all probe-target duplexes were determined in parallel by using an imposed temperature step gradient. We derived an optimum wash temperature for each probe and target by using a simple formula to calculate a discrimination index for each temperature of the step gradient. This optimum corresponded to the output of an independent analysis using a customized neural network program. These results together provide an experimental and analytical framework for optimizing mismatch discrimination among all probes on a DNA microarray.

  14. Osmium complexation of mismatched DNA: effect of the bases adjacent to mismatched 5-methylcytosine.

    PubMed

    Nomura, Akiko; Tainaka, Kazuki; Okamoto, Akimitsu

    2009-03-18

    The efficiency of osmium complex formation at 5-methylcytosine in mismatched DNA duplexes is a key point for the design of sequence-specific detection of DNA methylation. Osmium complexation was not observed in fully matched duplexes, whereas the complexation site and efficiency in mismatched duplexes changed depending on the type of 5'-neighboring base of the 5-methylcytosine forming a mismatched base pair. In particular, when the base adjacent to the 5' side of the mismatched base pair was thymine, a unique "side reaction" was observed. However, the nature of the mismatched base pairs in the reaction site did not influence the selectivity of osmium complex formation with methylated DNA.

  15. Method for sequencing DNA base pairs

    DOEpatents

    Sessler, Andrew M.; Dawson, John

    1993-01-01

    The base pairs of a DNA structure are sequenced with the use of a scanning tunneling microscope (STM). The DNA structure is scanned by the STM probe tip, and, as it is being scanned, the DNA structure is separately subjected to a sequence of infrared radiation from four different sources, each source being selected to preferentially excite one of the four different bases in the DNA structure. Each particular base being scanned is subjected to such sequence of infrared radiation from the four different sources as that particular base is being scanned. The DNA structure as a whole is separately imaged for each subjection thereof to radiation from one only of each source.

  16. Method for sequencing DNA base pairs

    DOEpatents

    Sessler, A.M.; Dawson, J.

    1993-12-14

    The base pairs of a DNA structure are sequenced with the use of a scanning tunneling microscope (STM). The DNA structure is scanned by the STM probe tip, and, as it is being scanned, the DNA structure is separately subjected to a sequence of infrared radiation from four different sources, each source being selected to preferentially excite one of the four different bases in the DNA structure. Each particular base being scanned is subjected to such sequence of infrared radiation from the four different sources as that particular base is being scanned. The DNA structure as a whole is separately imaged for each subjection thereof to radiation from one only of each source. 6 figures.

  17. The structural impact of DNA mismatches

    PubMed Central

    Rossetti, Giulia; Dans, Pablo D.; Gomez-Pinto, Irene; Ivani, Ivan; Gonzalez, Carlos; Orozco, Modesto

    2015-01-01

    The structure and dynamics of all the transversion and transition mismatches in three different DNA environments have been characterized by molecular dynamics simulations and NMR spectroscopy. We found that the presence of mismatches produced significant local structural alterations, especially in the case of purine transversions. Mismatched pairs often show promiscuous hydrogen bonding patterns, which interchange among each other in the nanosecond time scale. This therefore defines flexible base pairs, where breathing is frequent, and where distortions in helical parameters are strong, resulting in significant alterations in groove dimension. Even if the DNA structure is plastic enough to absorb the structural impact of the mismatch, local structural changes can be propagated far from the mismatch site, following the expected through-backbone and a previously unknown through-space mechanism. The structural changes related to the presence of mismatches help to understand the different susceptibility of mismatches to the action of repairing proteins. PMID:25820425

  18. NMR analysis of base-pair opening kinetics in DNA.

    PubMed

    Szulik, Marta W; Voehler, Markus; Stone, Michael P

    2014-12-12

    Base pairing in nucleic acids plays a crucial role in their structure and function. Differences in the base-pair opening and closing kinetics of individual double-stranded DNA sequences or between chemically modified base pairs provide insight into the recognition of these base pairs by DNA processing enzymes. This unit describes how to quantify the kinetics for localized base pairs by observing changes in the imino proton signals by nuclear magnetic resonance spectroscopy. The determination of all relevant parameters using state-of-the art techniques and NMR instrumentation, including cryoprobes, is discussed.

  19. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

    PubMed

    Takezawa, Yusuke; Shionoya, Mitsuhiko

    2012-12-18

    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

  20. DNA base-pair flipping with fluorescent perylenediimide pincers.

    PubMed

    Zeidan, Tarek A; Hariharan, Mahesh; Siegmund, Karsten; Lewis, Frederick D

    2010-07-30

    The synthesis, structure, and electronic spectra of a series of DNA hairpins possessing two perylenediimide (PDI) base pair surrogates are reported. The PDI chromophores are located in opposite strands of the hairpin base pair domain opposite abasic sites and are either adjacent to each other or separated by a variable number of AT or GC base pairs. Molecular modeling of the conjugate having adjacent PDI chromophores shows that they adopt a slipped, pi-stacked geometry with an angle of 40 degrees between the PDI long axes. The electronic absorption, fluorescence, and circular dichroism of this conjugate are consistent with a stacked PDI structure. Conjugates having one or two GC base pairs between the PDI chromophores display spectra that are consistent with isolated PDIs. Conjugates having 1-4 AT base pairs have more complex spectra, suggestive of an equilibrium between base paired and flipped structures having stacked PDIs. Heating of the conjugates possessing isolated PDI chromophores results in base pair flipping. The free energy for PDI stacking is greater than that for a single AT base pair and comparable to that for a single GC base pair or two AT base pairs.

  1. Discrimination of Single Base Pair Differences Among Individual DNA Molecules Using a Nanopore

    NASA Technical Reports Server (NTRS)

    Vercoutere, Wenonah; DeGuzman, Veronica

    2003-01-01

    The protein toxin alpha-hemolysin form nanometer scale channels across lipid membranes. Our lab uses a single channel in an artificial lipid bilayer in a patch clamp device to capture and examine individual DNA molecules. This nanopore detector used with a support vector machine (SVM) can analyze DNA hairpin molecules on the millisecond time scale. We distinguish duplex stem length, base pair mismatches, loop length, and single base pair differences. The residual current fluxes also reveal structural molecular dynamics elements. DNA end-fraying (terminal base pair dissociation) can be observed as near full blockades, or spikes, in current. This technique can be used to investigate other biological processes dependent on DNA end-fraying, such as the processing of HIV DNA by HIV integrase.

  2. Stretching single-stranded DNA: interplay of electrostatic, base-pairing, and base-pair stacking interactions.

    PubMed Central

    Zhang, Y; Zhou, H; Ou-Yang, Z C

    2001-01-01

    Recent single-macromolecule observations revealed that the force/extension characteristics of single-stranded DNA (ssDNA) are closely related to solution ionic concentration and DNA sequence composition. To understand this, we studied the elastic property of ssDNA through the Monte Carlo implementation of a modified freely jointed chain (FJC), with electrostatic, base-pairing, and base-pair stacking interactions all incorporated. The simulated force-extension profiles for both random and designed sequences have attained quantitative agreements with the experimental data. In low-salt solution, electrostatic interaction dominates, and at low forces, the molecule can be more easily aligned than an unmodified FJC. In high-salt solution, secondary hairpin structure appears in ssDNA by the formation of base pairs between complementary bases, and external stretching causes a hairpin-coil structural transition, which is continuous for ssDNA made of random sequences. In designed sequences such as poly(dA-dT) and poly(dG-dC), the stacking potential between base pairs encourages the aggregation of base pairs into bulk hairpins and makes the hairpin-coil transition a discontinuous (first-order) process. The sensitivity of elongation to the base-pairing rule is also investigated. The comparison of modeling calculations and the experimental data suggests that the base pairing of single-stranded polynucleotide molecules tends to form a nested and independent planar hairpin structure rather than a random intersecting pattern. PMID:11463654

  3. Natural versus artificial creation of base pairs in DNA: origin of nucleobases from the perspectives of unnatural base pair studies.

    PubMed

    Hirao, Ichiro; Kimoto, Michiko; Yamashige, Rie

    2012-12-18

    Since life began on Earth, the four types of bases (A, G, C, and T(U)) that form two sets of base pairs have remained unchanged as the components of nucleic acids that replicate and transfer genetic information. Throughout evolution, except for the U to T modification, the four base structures have not changed. This constancy within the genetic code raises the question of how these complicated nucleotides were generated from the molecules in a primordial soup on the early Earth. At some prebiotic stage, the complementarity of base pairs might have accelerated the generation and accumulation of nucleotides or oligonucleotides. We have no clues whether one pair of nucleobases initially appeared on the early Earth during this process or a set of two base pairs appeared simultaneously. Recently, researchers have developed new artificial pairs of nucleobases (unnatural base pairs) that function alongside the natural base pairs. Some unnatural base pairs in duplex DNA can be efficiently and faithfully amplified in a polymerase chain reaction (PCR) using thermostable DNA polymerases. The addition of unnatural base pair systems could expand the genetic alphabet of DNA, thus providing a new mechanism for the generation novel biopolymers by the site-specific incorporation of functional components into nucleic acids and proteins. Furthermore, the process of unnatural base pair development might provide clues to the origin of the natural base pairs in a primordial soup on the early Earth. In this Account, we describe the development of three representative types of unnatural base pairs that function as a third pair of nucleobases in PCR and reconsider the origin of the natural nucleic acids. As researchers developing unnatural base pairs, they use repeated "proof of concept" experiments. As researchers design new base pairs, they improve the structures that function in PCR and eliminate those that do not. We expect that this process is similar to the one functioning in the

  4. Ultrafast dynamics in DNA base pairs following ultraviolet excitation.

    NASA Astrophysics Data System (ADS)

    Orr-Ewing, Andrew

    2015-03-01

    Photo-protective mechanisms in DNA are essential to maintain the integrity of the genetic code by preventing damage from absorption of solar ultraviolet (UV) radiation. We have used time-resolved infra-red (TRIR) spectroscopy to observe the dynamics of Watson-Crick nucleobase pairs following absorption of femtosecond UV laser pulses. The base pairs are prepared as nucleosides in solution, and photo-induced dynamics are probed in the carbonyl and N-H bond stretching regions using broadband IR pulses with picosecond time resolution. Results will be presented for the guanine-cytosine (G-C) base pair, contrasting the rapid recovery of ground-state products (the photo-protection pathway) with formation of other photoproducts which might represent photo-damage mechanisms. This work is a collaboration with the group of Prof F. Temps (Christian-Albrechts-Universitat zu Kiel). This research is supported by ERC Advanced Grant 290966 CAPRI.

  5. Dynamics of DNA Mismatch Repair

    NASA Astrophysics Data System (ADS)

    Coats, Julie; Lin, Yuyen; Rasnik, Ivan

    2009-11-01

    DNA mismatch repair protects the genome from spontaneous mutations by recognizing errors, excising damage, and re-synthesizing DNA in a pathway that is highly conserved. Mismatch recognition is accomplished by the MutS family of proteins which are weak ATPases that bind specifically to damaged DNA, but the specific molecular mechanisms by which these proteins recognize damage and initiate excision are not known. Previous structural investigations have implied that protein-induced conformational changes are central to mismatch recognition. Because damage detection is a highly dynamic process in which conformational changes of the protein-DNA complexes occur on a time scale of a few seconds, it is difficult to obtain meaningful kinetic information with traditional ensemble techniques. In this work, we use single molecule fluorescence resonance energy transfer (smFRET) to study the conformational dynamics of fluorescently labeled DNA substrates in the presence of the mismatch repair protein MutS from E. coli and its human homolog MSH2/MSH6. Our studies allow us to obtain quantitative kinetic information about the rates of binding and dissociation and to determine the conformational states for each protein-DNA complex.

  6. Physics of base-pairing dynamics in DNA

    NASA Astrophysics Data System (ADS)

    Manghi, Manoel; Destainville, Nicolas

    2016-05-01

    As a key molecule of life, Deoxyribo-Nucleic Acid (DNA) is the focus of numbers of investigations with the help of biological, chemical and physical techniques. From a physical point of view, both experimental and theoretical works have brought quantitative insights into DNA base-pairing dynamics that we review in this Report, putting emphasis on theoretical developments. We discuss the dynamics at the base-pair scale and its pivotal coupling with the polymer one, with a polymerization index running from a few nucleotides to tens of kilo-bases. This includes opening and closure of short hairpins and oligomers as well as zipping and unwinding of long macromolecules. We review how different physical mechanisms are either used by Nature or utilized in biotechnological processes to separate the two intertwined DNA strands, by insisting on quantitative results. They go from thermally-assisted denaturation bubble nucleation to force- or torque-driven mechanisms. We show that the helical character of the molecule, possibly supercoiled, can play a key role in many denaturation and renaturation processes. We categorize the mechanisms according to the relative timescales associated with base-pairing and chain orientational degrees of freedom such as bending and torsional elastic ones. In some specific situations, these chain orientational degrees of freedom can be integrated out, and the quasi-static approximation is valid. The complex dynamics then reduces to the diffusion in a low-dimensional free-energy landscape. In contrast, some important cases of experimental interest necessarily appeal to far-from-equilibrium statistical mechanics and hydrodynamics.

  7. Theoretical and experimental study of charge transfer through DNA: impact of mercury mediated T-Hg-T base pair.

    PubMed

    Kratochvílová, Irena; Golan, Martin; Vala, Martin; Špérová, Miroslava; Weiter, Martin; Páv, Ondřej; Šebera, Jakub; Rosenberg, Ivan; Sychrovský, Vladimír; Tanaka, Yoshiyuki; Bickelhaupt, F Matthias

    2014-05-22

    DNA-Hg complexes may play an important role in sensing DNA defects or in detecting the presence of Hg in the environment. A fundamental way of characterizing DNA-Hg complexes is to study the way the electric charge is transferred through the molecular chain. The main goal of this contribution was to investigate the impact of a mercury metal cation that links two thymine bases in a DNA T-T mismatched base pair (T-Hg-T) on charge transfer through the DNA molecule. We compared the charge transfer efficiencies in standard DNA, DNA with mismatched T-T base pairs, and DNA with a T-Hg(II)-T base pair. For this purpose, we measured the temperature dependence of steady-state fluorescence and UV-vis of the DNA molecules. The experimental results were confronted with the results obtained employing theoretical DFT methods. Generally, the efficiency of charge transfer was driven by mercury changing the spatial overlap of bases.

  8. The Effect of Basepair Mismatch on DNA Strand Displacement.

    PubMed

    Broadwater, D W Bo; Kim, Harold D

    2016-04-12

    DNA strand displacement is a key reaction in DNA homologous recombination and DNA mismatch repair and is also heavily utilized in DNA-based computation and locomotion. Despite its ubiquity in science and engineering, sequence-dependent effects of displacement kinetics have not been extensively characterized. Here, we measured toehold-mediated strand displacement kinetics using single-molecule fluorescence in the presence of a single basepair mismatch. The apparent displacement rate varied significantly when the mismatch was introduced in the invading DNA strand. The rate generally decreased as the mismatch in the invader was encountered earlier in displacement. Our data indicate that a single base pair mismatch in the invader stalls branch migration and displacement occurs via direct dissociation of the destabilized incumbent strand from the substrate strand. We combined both branch migration and direct dissociation into a model, which we term the concurrent displacement model, and used the first passage time approach to quantitatively explain the salient features of the observed relationship. We also introduce the concept of splitting probabilities to justify that the concurrent model can be simplified into a three-step sequential model in the presence of an invader mismatch. We expect our model to become a powerful tool to design DNA-based reaction schemes with broad functionality.

  9. Effect of phenolic radicals on the geometry and electronic structure of DNA base pairs: computational study

    NASA Astrophysics Data System (ADS)

    Zarei, Mohammad; Seif, Abdolvahab; Azizi, Khaled; Zarei, Mohanna; Bahrami, Jamil

    2016-04-01

    In this paper, we show the reaction of a hydroxyl, phenyl and phenoxy radicals with DNA base pairs by the density functional theory (DFT) calculations. The influence of solvation on the mechanism is also presented by the same DFT calculations under the continuum solvation model. The results showed that hydroxyl, phenyl and phenoxy radicals increase the length of the nearest hydrogen bond of adjacent DNA base pair which is accompanied by decrease in the length of furthest hydrogen bond of DNA base pair. Also, hydroxyl, phenyl and phenoxy radicals influenced the dihedral angle between DNA base pairs. According to the results, hydrogen bond lengths between AT and GC base pairs in water solvent are longer than vacuum. All of presented radicals influenced the structure and geometry of AT and GC base pairs, but phenoxy radical showed more influence on geometry and electronic properties of DNA base pairs compared with the phenyl and hydroxyl radicals.

  10. Molecular cloning of bovine thyroglobulin complementary DNA. Characterization of 2500-base-pair and 1900-base-pair fragments.

    PubMed

    Christophe, D; Brocas, H; Gannon, F; de Martynoff, G; Pays, E; Vassart, G

    1980-10-01

    Double-stranded thyroglobulin complementary DNA (cDNA) was synthesized from purified 33-S bovine thyroglobulin mRNA. This synthetic structural gene has previously been shown to contain three sites for the restriction endonuclease HindIII, yielding two internal fragments of 1900 and 2500 base pairs respectively. Recombinant molecules were prepared by ligating the HindIII-restricted cDNA to the plasmid pBR322 which had been linearized by the same enzyme. When Escherichia coli was transformed with this mixture, it yielded two kinds of colonies each harboring recombinant plasmids containing one of the two cDNA fragments. Both recombinant molecules hybridized specifically to translatable thyroglobulin mRNA. Sequence homology between the two cloned DNAs could not be detected by cross-hybridization experiments; this argues against the existence of internal structural repetition in thyroglobulin subunits. Together, the two cloned DNA fragments represent 55% of the 8000-base-pair double-stranded thyroglobulin DNA.

  11. Single-Molecule Measurements of Synthesis by DNA Polymerase with Base-Pair Resolution

    NASA Astrophysics Data System (ADS)

    Christian, Thomas; Romano, Louis; Rueda, David

    2010-03-01

    The catalytic mechanism of DNA polymerases involves multiple steps that precede and follow the transfer of a nucleotide to the 3'-hydroxyl of the growing DNA chain. Here we report a single-molecule approach to monitor the movement of E. coli DNA polymerase I (Klenow fragment) on a DNA template during DNA synthesis with single base-pair resolution. As each nucleotide is incorporated, the single-molecule F"orster resonance energy transfer intensity drops in discrete steps to values consistent with single nucleotide incorporations. Purines and pyrimidines are incorporated with comparable rates. A mismatched primer-template junction exhibits dynamics consistent with the primer moving into the exonuclease domain, which was used to determine the fraction of primer-termini bound to the exonuclease and polymerase sites. Most interestingly, we observe a structural change following the incorporation of a correctly paired nucleotide, consistent with transient movement of the polymerase past the pre-insertion site or a conformational change in the polymerase. This may represent a previously unobserved step in the mechanism of DNA synthesis that could be part of the proofreading process.

  12. DNA Triplet Repeat Expansion and Mismatch Repair

    PubMed Central

    Iyer, Ravi R.; Pluciennik, Anna; Napierala, Marek; Wells, Robert D.

    2016-01-01

    DNA mismatch repair is a conserved antimutagenic pathway that maintains genomic stability through rectification of DNA replication errors and attenuation of chromosomal rearrangements. Paradoxically, mutagenic action of mismatch repair has been implicated as a cause of triplet repeat expansions that cause neurological diseases such as Huntington disease and myotonic dystrophy. This mutagenic process requires the mismatch recognition factor MutSβ and the MutLα (and/or possibly MutLγ) endonuclease, and is thought to be triggered by the transient formation of unusual DNA structures within the expanded triplet repeat element. This review summarizes the current knowledge of DNA mismatch repair involvement in triplet repeat expansion, which encompasses in vitro biochemical findings, cellular studies, and various in vivo transgenic animal model experiments. We present current mechanistic hypotheses regarding mismatch repair protein function in mediating triplet repeat expansions and discuss potential therapeutic approaches targeting the mismatch repair pathway. PMID:25580529

  13. Mismatch base pairing of the mutagen 8-oxoguanine and its derivatives with adenine: A theoretical search for possible antimutagenic agents

    NASA Astrophysics Data System (ADS)

    Singh, A. K.; Mishra, P. C.

    Molecular geometries of 8-oxoguanine (8OG), those of its substituted derivatives with the substitutions CH2, CF2, CO, CNH, O, and S in place of the N7H7 group, adenine (A), and the base pairs of 8OG and its substituted derivatives with adenine were optimized using the RHF/6-31+G* and B3LYP/6-31+G* methods in gas phase. All the molecules and their hydrogen-bonded complexes were solvated in aqueous media employing the polarized continuum model (PCM) of the self-consistent reaction field (SCRF) theory using the RHF/6-31+G* and B3LYP/6-31+G* methods. The optimized geometrical parameters of the 8OG-A base pair at the RHF/6-31+G* and B3LYP/6-31+G* levels of theory agree satisfactorily with those of an oligonucleotide containing the base pair found from X-ray crystallography. The pattern of hydrogen bonding in the CF2- and O-substituted 8OG-A base pair is of Watson-Crick type and that in the unsubstituted and CH2-, CNH-, and S-substituted base pairs is of Hoogsteen type. In the CO-substituted base pair, the hydrogen bonding pattern is of neither Watson-Crick nor Hoogsteen type. The CF2-substitution appears to introduce steric hindrance for stacking of DNA bases. On the basis of these results, it appears that among all the substituted 8OG molecules considered here, the O-substituted derivative may be useful as an antimutagenic drug. It is, however, subject to experimental verification. Content:text/plain; charset="UTF-8"

  14. Mismatch repair balances leading and lagging strand DNA replication fidelity.

    PubMed

    Lujan, Scott A; Williams, Jessica S; Pursell, Zachary F; Abdulovic-Cui, Amy A; Clark, Alan B; Nick McElhinny, Stephanie A; Kunkel, Thomas A

    2012-01-01

    The two DNA strands of the nuclear genome are replicated asymmetrically using three DNA polymerases, α, δ, and ε. Current evidence suggests that DNA polymerase ε (Pol ε) is the primary leading strand replicase, whereas Pols α and δ primarily perform lagging strand replication. The fact that these polymerases differ in fidelity and error specificity is interesting in light of the fact that the stability of the nuclear genome depends in part on the ability of mismatch repair (MMR) to correct different mismatches generated in different contexts during replication. Here we provide the first comparison, to our knowledge, of the efficiency of MMR of leading and lagging strand replication errors. We first use the strand-biased ribonucleotide incorporation propensity of a Pol ε mutator variant to confirm that Pol ε is the primary leading strand replicase in Saccharomyces cerevisiae. We then use polymerase-specific error signatures to show that MMR efficiency in vivo strongly depends on the polymerase, the mismatch composition, and the location of the mismatch. An extreme case of variation by location is a T-T mismatch that is refractory to MMR. This mismatch is flanked by an AT-rich triplet repeat sequence that, when interrupted, restores MMR to > 95% efficiency. Thus this natural DNA sequence suppresses MMR, placing a nearby base pair at high risk of mutation due to leading strand replication infidelity. We find that, overall, MMR most efficiently corrects the most potentially deleterious errors (indels) and then the most common substitution mismatches. In combination with earlier studies, the results suggest that significant differences exist in the generation and repair of Pol α, δ, and ε replication errors, but in a generally complementary manner that results in high-fidelity replication of both DNA strands of the yeast nuclear genome.

  15. Development of artificial nucleic acid that recognizes a CG base pair in triplex DNA formation.

    PubMed

    Hari, Yoshiyuki

    2013-01-01

    An oligonucleotide that can form a triplex with double-stranded DNA is called a triplex-forming oligonucleotide (TFO). TFOs have gained considerable attention because of their potential as gene targeting tools. However, triplex DNA formation involves inherent problems for practical use. The most important problem is that natural nucleotides in TFO do not have sufficient affinity and base pair-selectivity to pyrimidine-purine base pair, like a CG or TA base pair, within dsDNA. This suggests that dsDNA region including a CG or TA base pair cannot be targeted. Therefore, artificial nucleotides, especially with non-natural nucleobases, capable of direct recognition of a CG or TA base pair via hydrogen bond formation have been developed; however, nucleotides with better selectivity and stronger affinity are necessary for implementing this dsDNA-targeting technology using TFOs. Under such a background, we considered that facile and efficient synthesis of various nucleobase derivatives in TFOs would be useful for finding an ideal nucleobase for recognition of a CG or TA base pair because detailed and rational exploration of nucleobase structures is facilitated. Recently, to develop a nucleobase recognizing a CG base pair, we have used post-elongation modification, i.e., modification after oligonucleotide synthesis, for the facile synthesis of nucleobase derivatives. This review mainly summarizes our recent findings on the development of artificial nucleobases and nucleotides for recognition of a CG base pair in triplexes formed between dsDNA and TFOs.

  16. Bifacial Base-Pairing Behaviors of 5-Hydroxyuracil DNA Bases through Hydrogen Bonding and Metal Coordination.

    PubMed

    Takezawa, Yusuke; Nishiyama, Kotaro; Mashima, Tsukasa; Katahira, Masato; Shionoya, Mitsuhiko

    2015-10-12

    A novel bifacial ligand-bearing nucleobase, 5-hydroxyuracil (U(OH) ), which forms both a hydrogen-bonded base pair (U(OH) -A) and a metal-mediated base pair (U(OH) -M-U(OH) ) has been developed. The U(OH) -M-U(OH) base pairs were quantitatively formed in the presence of lanthanide ions such as Gd(III) when U(OH) -U(OH) pairs were consecutively incorporated into DNA duplexes. This result established metal-assisted duplex stabilization as well as DNA-templated assembly of lanthanide ions. Notably, a duplex possessing U(OH) -A base pairs was destabilized by addition of Gd(III) ions. This observation suggests that the hybridization behaviors of the U(OH) -containing DNA strands are altered by metal complexation. Thus, the U(OH) nucleobase with a bifacial base-pairing property holds great promise as a component for metal-responsive DNA materials.

  17. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

    PubMed

    Brovarets', O O

    2013-01-01

    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  18. Bifunctional rhodium intercalator conjugates as mismatch-directing DNA alkylating agents.

    PubMed

    Schatzschneider, Ulrich; Barton, Jacqueline K

    2004-07-21

    A conjugate of a DNA mismatch-specific rhodium intercalator, containing the bulky chrysenediimine ligand, and an aniline mustard has been prepared, and targeting of mismatches in DNA by this conjugate has been examined. The preferential alkylation of mismatched over fully matched DNA is found by a mobility shift assay at concentrations where untethered organic mustards show little reaction. The binding site of the Rh intercalator was determined by DNA photocleavage, and the position of covalent modification was established on the basis of the enhanced depurination associated with N-alkylation. The site-selective alkylation at mismatched DNA renders these conjugates useful tools for the covalent tagging of DNA base pair mismatches and new chemotherapeutic design.

  19. Constructing optimal backbone segments for joining fixed DNA base pairs.

    PubMed Central

    Mazur, J; Jernigan, R L; Sarai, A

    1996-01-01

    A method is presented to link a sequence of space-fixed base pairs by the sugar-phosphate segments of single nucleotides and to evaluate the effects in the backbone caused by this positioning of the bases. The entire computational unit comprises several nucleotides that are energy-minimized, subject to constraints imposed by the sugar-phosphate backbone segments being anchored to space-fixed base pairs. The minimization schemes are based on two stages, a conjugate gradient method followed by a Newton-Raphson algorithm. Because our purpose is to examine the response, or relaxation, of an artificially stressed backbone, it is essential to be able to obtain, as closely as possible, a lowest minimum energy conformation of the backbone segment in conformational space. For this purpose, an algorithm is developed that leads to the generation of an assembly of many local energy minima. From these sets of local minima, one conformation corresponding to the one with the lowest minimum is then selected and designated to represent the backbone segment at its minimum. The effective electrostatic potential of mean force is expressed in terms of adjustable parameters that incorporate solvent screening action in the Coulombic interactions between charged backbone atoms; these parameters are adjusted to obtain the best fit of the nearest-neighbor phosphorous atoms in an x-ray structure. PMID:8874023

  20. Unprecedented dinuclear silver(I)-mediated base pair involving the DNA lesion 1,N(6)-ethenoadenine.

    PubMed

    Mandal, Soham; Hepp, Alexander; Müller, Jens

    2015-02-28

    The DNA lesion 1,N(6)-ethenoadenine (εA) has been investigated with respect to its metal-binding properties. A synthetic DNA duplex comprising an εA : εA mispair readily forms doubly silver(I)-mediated base pairs εA-Ag(I)2-εA, representing the first example for a dinuclear metal-mediated homo base pair of a purine derivative. It also constitutes the first example for a Hoogsteen-type metal-mediated homo base pair within a B-DNA duplex.

  1. Matching base-pair number dependence of the kinetics of DNA-DNA hybridization studied by surface plasmon fluorescence spectroscopy.

    PubMed

    Tawa, Keiko; Yao, Danfeng; Knoll, Wolfgang

    2005-08-15

    Two single-stranded DNA oligonucleotides consisting of complementary base-pairs can form double strands. This phenomenon is well studied in solutions, however, in order to clarify the physical mechanism of the hybridization occurring at a solid/solution interface, we studied the kinetics by surface plasmon fluorescence spectroscopy (SPFS): one single-stranded oligo-DNA (probe-DNA) was immobilized on the substrate, the other one (target-DNA) labelled with a fluorescent probe was added to the flow cell. After hybridization, the chromophores could be excited by the surface plasmon mode and their fluorescence detected with high sensitivity. The dependence of the k(on) and k(off) rate constants on the length of the hybridizing oligonucleotides was investigated by using a MM0 series (no mismatch) and the kinetics was found to be well described by a Langmuir adsorption model. From these measurements we found that also in the case of surface hybridization the affinity of the duplexes decreases as the number of matching base-pairs decreases from 15 to 10. In order to show that SPFS is the powerful technique with high sensitivity, the hybridization process for mixed target-oligos was measured by SPFS and analyzed by an expanded Langmuir model in which two components of target-oligo can bind to probe-DNA at the sensor surface competitively. Two sets of the k(on) and k(off) obtained from the experiment are successfully consistent with the k(on) and k(off) obtained from experiments for single (pure) target-DNA.

  2. Flexibility of short DNA helices with finite-length effect: From base pairs to tens of base pairs

    NASA Astrophysics Data System (ADS)

    Wu, Yuan-Yan; Bao, Lei; Zhang, Xi; Tan, Zhi-Jie

    2015-03-01

    Flexibility of short DNA helices is important for the biological functions such as nucleosome formation and DNA-protein recognition. Recent experiments suggest that short DNAs of tens of base pairs (bps) may have apparently higher flexibility than those of kilo bps, while there is still the debate on such high flexibility. In the present work, we have studied the flexibility of short DNAs with finite-length of 5-50 bps by the all-atomistic molecular dynamics simulations and Monte Carlo simulations with the worm-like chain model. Our microscopic analyses reveal that short DNAs have apparently high flexibility which is attributed to the significantly strong bending and stretching flexibilities of ˜6 bps at each helix end. Correspondingly, the apparent persistence length lp of short DNAs increases gradually from ˜29 nm to ˜45 nm as DNA length increases from 10 to 50 bps, in accordance with the available experimental data. Our further analyses show that the short DNAs with excluding ˜6 bps at each helix end have the similar flexibility with those of kilo bps and can be described by the worm-like chain model with lp ˜ 50 nm.

  3. Flexibility of short DNA helices with finite-length effect: From base pairs to tens of base pairs

    SciTech Connect

    Wu, Yuan-Yan; Bao, Lei; Zhang, Xi; Tan, Zhi-Jie

    2015-03-28

    Flexibility of short DNA helices is important for the biological functions such as nucleosome formation and DNA-protein recognition. Recent experiments suggest that short DNAs of tens of base pairs (bps) may have apparently higher flexibility than those of kilo bps, while there is still the debate on such high flexibility. In the present work, we have studied the flexibility of short DNAs with finite-length of 5–50 bps by the all-atomistic molecular dynamics simulations and Monte Carlo simulations with the worm-like chain model. Our microscopic analyses reveal that short DNAs have apparently high flexibility which is attributed to the significantly strong bending and stretching flexibilities of ∼6 bps at each helix end. Correspondingly, the apparent persistence length l{sub p} of short DNAs increases gradually from ∼29 nm to ∼45 nm as DNA length increases from 10 to 50 bps, in accordance with the available experimental data. Our further analyses show that the short DNAs with excluding ∼6 bps at each helix end have the similar flexibility with those of kilo bps and can be described by the worm-like chain model with l{sub p} ∼ 50 nm.

  4. Flexibility of short DNA helices with finite-length effect: From base pairs to tens of base pairs.

    PubMed

    Wu, Yuan-Yan; Bao, Lei; Zhang, Xi; Tan, Zhi-Jie

    2015-03-28

    Flexibility of short DNA helices is important for the biological functions such as nucleosome formation and DNA-protein recognition. Recent experiments suggest that short DNAs of tens of base pairs (bps) may have apparently higher flexibility than those of kilo bps, while there is still the debate on such high flexibility. In the present work, we have studied the flexibility of short DNAs with finite-length of 5-50 bps by the all-atomistic molecular dynamics simulations and Monte Carlo simulations with the worm-like chain model. Our microscopic analyses reveal that short DNAs have apparently high flexibility which is attributed to the significantly strong bending and stretching flexibilities of ∼6 bps at each helix end. Correspondingly, the apparent persistence length lp of short DNAs increases gradually from ∼29 nm to ∼45 nm as DNA length increases from 10 to 50 bps, in accordance with the available experimental data. Our further analyses show that the short DNAs with excluding ∼6 bps at each helix end have the similar flexibility with those of kilo bps and can be described by the worm-like chain model with lp ∼ 50 nm.

  5. An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules

    PubMed Central

    Kimoto, Michiko; Kawai, Rie; Mitsui, Tsuneo; Yokoyama, Shigeyuki; Hirao, Ichiro

    2009-01-01

    Toward the expansion of the genetic alphabet, we present an unnatural base pair system for efficient PCR amplification, enabling the site-specific incorporation of extra functional components into DNA. This system can be applied to conventional PCR protocols employing DNA templates containing unnatural bases, natural and unnatural base triphosphates, and a 3′→5′ exonuclease-proficient DNA polymerase. For highly faithful and efficient PCR amplification involving the unnatural base pairing, we identified the natural-base sequences surrounding the unnatural bases in DNA templates by an in vitro selection technique, using a DNA library containing the unnatural base. The system facilitates the site-specific incorporation of a variety of modified unnatural bases, linked with functional groups of interest, into amplified DNA. DNA fragments (0.15 amol) containing the unnatural base pair can be amplified 107-fold by 30 cycles of PCR, with <1% total mutation rate of the unnatural base pair site. Using the system, we demonstrated efficient PCR amplification and functionalization of DNA fragments for the extremely sensitive detection of zeptomol-scale target DNA molecules from mixtures with excess amounts (pmol scale) of foreign DNA species. This unnatural base pair system will be applicable to a wide range of DNA/RNA-based technologies. PMID:19073696

  6. Bubbles and mismatches in DNA melting

    NASA Astrophysics Data System (ADS)

    Zeng, Yan

    We obtained the first experimental measurements of the length of the denaturation bubble appearing in the DNA melting transition. This is achieved by working with short oligomers which can form only one bubble per molecule. We used sequences clamped at the ends with GC pairs (strong binding) and possessing AT rich (weaker binding) middle regions in order to have the bubble open in the middle, and sequences with GC pairs at one end and AT pairs at the other end in order to form the bubble at the end. Use a quenching technique to trap the bubble states, we could measure the length of the bubble and the relative weights of the bubble states as a function of temperature. We found that the average bubble size <ℓ> grows for increasing temperature, but reaches a plateau at a length of order B (the length of the AT region). After the plateau, the average bubble length jumps to 1. This jump of the order parameter is a signature of a discontinuous transition, one where the bubble size remains finite up to critical temperature of strand separation. When B increases, the extension of the plateau shrinks. This suggests a continuous transition for a homogenous sequence (e.g. all AT base pairs) in the thermodynamic limit. The presence of the bubble states decreases as B is reduced. By plotting the average statistical weight of the bubble states vs. B, we obtained the first direct measurement of the nucleation size of the bubble. For a bubble flanked by double-stranded regions, the nucleation size is ˜ 3 bases. For bubbles opening at the ends of the molecule there is no nucleation threshold. The measured statistical weights of the bubble states agree with the predictions of the widely used thermodynamic models in the case of unzipping from the ends; however, internal bubble states are not completely described by the model. For the first time we show experimentally that a single mismatch transforms a transition with many intermediates into a nearly two-state transition for

  7. Raising the barrier for photoinduced DNA charge injection with a cyclohexyl artificial base pair.

    PubMed

    Singh, Arunoday P N; Harris, Michelle A; Young, Ryan M; Miller, Stephen A; Wasielewski, Michael R; Lewis, Frederick D

    2015-01-01

    The effects of an artificial cyclohexyl base pair on the quantum yields of fluorescence and dynamics of charge separation and charge recombination have been investigated for several synthetic DNA hairpins. The hairpins possess stilbenedicarboxamide, perylenediimide, or naphthalenediimide linkers and base-paired stems. In the absence of the artificial base pair hole injection into both adenine and guanine purine bases is exergonic and irreversible, except in the case of stilbene with adenine for which it is slightly endergonic and reversible. Insertion of the artificial base pair renders hole injection endergonic or isoergonic except in the case of the powerful naphthalene acceptor for which it remains exergonic. Both hole injection and charge recombination are slower for the naphthalene acceptor in the presence of the artificial base pair than in its absence. The effect of an artificial base pair on charge separation and charge recombination in hairpins possessing stilbene and naphthalene acceptor linkers and a stilbenediether donor capping group has also been investigated. In the case of the stilbene acceptor-stilbene donor capped hairpins photoinduced charge separation across six base pairs is efficient in the absence of the artificial base pair but does not occur in its presence. In the case of the naphthalene acceptor-stilbene donor capped hairpins the artificial base pair slows but does not stop charge separation and charge recombination, leading to the formation of long-lived charge separated states.

  8. Hydrophobic, Non-Hydrogen-Bonding Bases and Base Pairs in DNA

    PubMed Central

    Schweitzer, Barbara A.; Kool, Eric T.

    2009-01-01

    We report the properties of hydrophobic isosteres of pyrimidines and purines in synthetic DNA duplexes. Phenyl nucleosides 1 and 2 are nonpolar isosteres of the natural thymidine nucleoside, and indole nucleoside 3 is an analog of the complementary purine 2-aminodeoxyadenosine. The nucleosides were incorporated into synthetic oligodeoxynucleotides and were paired against each other and against the natural bases. Thermal denaturation experiments were used to measure the stabilities of the duplexes at neutral pH. It is found that the hydrophobic base analogs are nonselective in pairing with the four natural bases but selective for pairing with each other rather than with the natural bases. For example, compound 2 selectively pairs with itself rather than with A, T, G, or C; the magnitude of this selectivity is found to be 6.5–9.3 °C in Tm or 1.5–1.8 kcal/mol in free energy (25 °C). All possible hydrophobic pairing combinations of 1, 2, and 3 were examined. Results show that the pairing affinity depends on the nature of the pairs and on position in the duplex. The highest affinity pairs are found to be the 1–1 and 2–2 self-pairs and the 1–2 heteropair. The best stabilization occurs when the pairs are placed at the ends of duplexes rather than internally; the internal pairs may be destabilized by imperfect steric mimicry which leads to non-ideal duplex structure. In some cases the hydrophobic pairs are significantly stabilizing to the DNA duplex; for example, when situated at the end of a duplex, the 1–1 pair is more stabilizing than a T–A pair. When situated internally, the affinity of the 1–1 pair is the same as, or slightly better than, the analogous T–T mismatch pair, which is known to have two hydrogen bonds. The studies raise the possibility that hydrogen bonds may not always be required for the formation of stable duplex DNA-like structure. In addition, the results point out the importance of solvation and desolvation in natural base pairing

  9. Computational DNA hole spectroscopy: A new tool to predict mutation hotspots, critical base pairs, and disease 'driver' mutations.

    PubMed

    Villagrán, Martha Y Suárez; Miller, John H

    2015-08-27

    We report on a new technique, computational DNA hole spectroscopy, which creates spectra of electron hole probabilities vs. nucleotide position. A hole is a site of positive charge created when an electron is removed. Peaks in the hole spectrum depict sites where holes tend to localize and potentially trigger a base pair mismatch during replication. Our studies of mitochondrial DNA reveal a correlation between L-strand hole spectrum peaks and spikes in the human mutation spectrum. Importantly, we also find that hole peak positions that do not coincide with large variant frequencies often coincide with disease-implicated mutations and/or (for coding DNA) encoded conserved amino acids. This enables combining hole spectra with variant data to identify critical base pairs and potential disease 'driver' mutations. Such integration of DNA hole and variance spectra could ultimately prove invaluable for pinpointing critical regions of the vast non-protein-coding genome. An observed asymmetry in correlations, between the spectrum of human mtDNA variations and the L- and H-strand hole spectra, is attributed to asymmetric DNA replication processes that occur for the leading and lagging strands.

  10. Computational DNA hole spectroscopy: A new tool to predict mutation hotspots, critical base pairs, and disease ‘driver’ mutations

    PubMed Central

    Suárez, Martha Y.; Villagrán; Miller, John H.

    2015-01-01

    We report on a new technique, computational DNA hole spectroscopy, which creates spectra of electron hole probabilities vs. nucleotide position. A hole is a site of positive charge created when an electron is removed. Peaks in the hole spectrum depict sites where holes tend to localize and potentially trigger a base pair mismatch during replication. Our studies of mitochondrial DNA reveal a correlation between L-strand hole spectrum peaks and spikes in the human mutation spectrum. Importantly, we also find that hole peak positions that do not coincide with large variant frequencies often coincide with disease-implicated mutations and/or (for coding DNA) encoded conserved amino acids. This enables combining hole spectra with variant data to identify critical base pairs and potential disease ‘driver’ mutations. Such integration of DNA hole and variance spectra could ultimately prove invaluable for pinpointing critical regions of the vast non-protein-coding genome. An observed asymmetry in correlations, between the spectrum of human mtDNA variations and the L- and H-strand hole spectra, is attributed to asymmetric DNA replication processes that occur for the leading and lagging strands. PMID:26310834

  11. Structural, electronic, and optical properties of metallo base pairs in duplex DNA: a theoretical insight.

    PubMed

    Samanta, Pralok K; Manna, Arun K; Pati, Swapan K

    2012-11-01

    Using density functional theory calculations, we investigated the structural, energetic, electronic, and optical properties of recently synthesized duplex DNA containing metal-mediated base pairs. The studied duplex DNA consists of three imidazole (Im) units linked through metal (Im-M-Im, M = metal) and four flanking A:T base pairs (two on each side). We examined the role of artificial base pairing in the presence of two distinctive metal ions, diamagnetic Ag(+) and magnetic Cu(2+) ions, on the stability of duplex DNA. We found that metal-mediated base pairs form stable duplex DNA by direct metal ion coordination to the Im bases. Our results suggest a higher binding stability of base pairing mediated by Cu(2+) ions than by Ag(+) ions, which is attributed to a larger extent of orbital hybridization. We furthermore found that DNA modified with Im-Ag(+)-Im shows the low-energy optical absorption characteristic of π-π*orbital transition of WC A:T base pairs. On the other hand, we found that the low-energy optical absorption peaks for DNA modified with Im-Cu(2+)-Im originate from spin-spin interactions. Additionally, this complex exhibits weak ferromagnetic coupling between Cu(2+) ions and strong spin polarization, which could be used for memory devices. Moreover, analyzing the role of counter ions (Na(+)) and the presence of explicit water molecules on the structural stability and electronic properties of the DNA duplex modified with Im-Ag(+)-Im, we found that the impact of these two factors is negligible. Our results are fruitful for understanding the experimental data and suggest a potential route for constructing effective metal-mediated base pairs in duplex DNA for optoelectronic applications.

  12. DNA terminal base pairs have weaker hydrogen bonds especially for AT under low salt concentration

    NASA Astrophysics Data System (ADS)

    Ferreira, Izabela; Amarante, Tauanne D.; Weber, Gerald

    2015-11-01

    DNA base pairs are known to open more easily at the helix terminal, a process usually called end fraying, the details of which are still poorly understood. Here, we present a mesoscopic model calculation based on available experimental data where we consider separately the terminal base pairs of a DNA duplex. Our results show an important reduction of hydrogen bond strength for terminal cytosine-guanine (CG) base pairs which is uniform over the whole range of salt concentrations, while for AT base pairs, we obtain a nearly 1/3 reduction but only at low salt concentrations. At higher salt concentrations, terminal adenine-thymine (AT) pair has almost the same hydrogen bond strength than interior bases. The calculated terminal stacking interaction parameters display some peculiarly contrasting behavior. While there is mostly no perceptible difference to internal stacking, for some cases, we observe an unusually strong dependence with salt concentration which does not appear follow any pattern or trend.

  13. Stability and proton transfer in DNA base pairs of AMD473-DNA adduct

    NASA Astrophysics Data System (ADS)

    Sarmah, Pubalee; Deka, Ramesh C.

    2011-05-01

    We investigate the energetics of four different adducts of cisplatin analogue cis-[PtCl 2(NH 3)(2-picoline)] (AMD473) with a duplex DNA using DFT/ONIOM methods to probe their stabilities. Further, we study the possibilities of proton transfer between DNA base pairs of the most stable drug-DNA adduct. The adduct b(2-picoline trans to 3'-G and 2-methyl group directs to the DNA major groove) is found to be the most stable configuration among all the possible adducts. From the proton transfer analysis we found that the single proton transfer between N1 position of guanine (G) and N3 position of cytosine (C) of each GC pair gives a structure energetically as stable as the original one.

  14. Anharmonic Vibrational Signatures of DNA Bases and Watson-Crick Base Pairs

    NASA Astrophysics Data System (ADS)

    Wang, Gui-xiu; Ma, Xiao-yan; Wang, Jian-ping

    2009-12-01

    Changes of molecular structure and associated charge distributions, and changes of anharmonic vibrational parameters from DNA base monomers to the Watson-Crick base pairs, have been investigated at the density functional theory level. Through examination of the NH2, N-H, and C = O stretching vibrational modes that are involved in the multiple H-bonds in the base pairs, sensitivity of their diagonal and off-diagonal anharmonicities, as well as anharmonic vibrational couplings, to the structure change are predicted. Our results reveal the intrinsic connection between the anharmonic vibrational potentials, H-bonding, and electrostatic interactions in DNA bases.

  15. Tolerance of base pair size and shape in postlesion DNA synthesis.

    PubMed

    Gahlon, Hailey L; Schweizer, W Bernd; Sturla, Shana J

    2013-05-01

    The influence of base pair size and shape on the fidelity of DNA polymerase-mediated extension past lesion-containing mispairs was examined. Primer extension analysis was performed with synthetic nucleosides paired opposite the pro-mutagenic DNA lesion O(6)-benzylguanine (O(6)-BnG). These data indicate that the error-prone DNA polymerase IV (Dpo4) inefficiently extended past the larger Peri:O(6)-BnG base pair, and in contrast, error-free extension was observed for the smaller BIM:O(6)-BnG base pair. Steady-state kinetic analysis revealed that Dpo4 catalytic efficiency was strongly influenced by the primer:template base pair. Compared to the C:G pair, a 1.9- and 79,000-fold reduction in Dpo4 efficiency was observed for terminal C:O(6)-BnG and BIM:G base pairs respectively. These results demonstrate the impact of geometrical size and shape on polymerase-mediated mispair extension.

  16. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

    PubMed

    Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

    2013-06-17

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.

  17. Unique base-pair breathing dynamics in PNA-DNA hybrids.

    PubMed

    Leijon, M; Sehlstedt, U; Nielsen, P E; Gräslund, A

    1997-08-22

    Kinetic and thermodynamic parameters, derived from 1H-NMR measurements of the imino proton exchange rates upon titration with the exchange catalyst ammonia, are reported for two mixed-sequence peptide nucleic acid (PNA)-DNA hybrids and their counterpart DNA duplex. The exchange times of the imino protons in the PNA strands extrapolate to very short base-pair lifetimes in the limit of infinite exchange catalyst concentration. This is not due to generally less stable base-pairs in PNA-DNA hybrids, since the lifetimes, apparent dissociation constants and thermodynamic stability (DeltaG degrees ) of the innermost DNA guanine imino protons are similar in the hybrid duplexes and in the DNA duplex. In addition, the apparent dissociation constants determined for PNA bases of the hybrids are of the same order as those of the corresponding bases in the DNA duplex. An exchange process from the closed state was found to be inconsistent with the experimental data. From these results, we conclude that opening and closing rates of the PNA guanine and thymine bases are at least two orders of magnitude higher than those of the corresponding bases in the DNA duplex. Unusual kinetics in the hybrids is also evident from the destabilization of the complementary DNA strand thymine bases, which exhibit base-pair dissociation constants increased by approximately two orders of magnitude compared to what is observed in the DNA duplex, while the DNA strand guanine bases are largely unaffected. The general pattern of the base-pair dynamics in the hybrids obtained when using trimethylamine as an exchange catalyst is the same as when using ammonia. However, the long base-pair lifetimes i. e. those of the DNA duplex and the guanine bases of the DNA strands in the hybrids, are approximately three to five times longer than when using ammonia. Thus, all opening events sensed by ammonia are not accessible to trimethylamine. These observations are discussed in regard to the mechanism of base-pair

  18. Molecular dynamics simulation of DNA base-pair opening by sharp bending

    NASA Astrophysics Data System (ADS)

    Cong, Peiwen; Dai, Liang; van der Maarel, Johan R. C.; Yan, Jie

    2013-03-01

    Many biological processes require sharp bending of DNA. According to worm-like chain model, the bending energy dominates the free energy cost of those processes containing DNA loops shorter than 40 nm, such as DNA wrapping around histones, Lac repressor looping and virus DNA packaging. However, several recent experimental observations suggest that the WLC model s not applicable under tight bending conditions. In full atom molecular dynamics simulations, a double stranded, 20 base-pairs DNA fragment is forced to bend by an external spring. It is found that one or two AT-rich regions are disrupted for sufficiently small end-to-end distance. The disrupted DNA base-pairs separate and usually stack with the neighbouring base-pairs to form a defect. It is shown that these defects are more bendable than the bending rigidity of the duplex in the regular B-form. The simulation suggests a curvature dependent, non-harmonic bending elasticity of the DNA backbone is necessary to describe the DNA conformation under tight bending conditions.

  19. Double proton transfer in the isolated and DNA-embedded guanine-cytosine base pair

    NASA Astrophysics Data System (ADS)

    Zoete, Vincent; Meuwly, Markus

    2004-09-01

    The energetics and dynamics of double proton transfer (DPT) is investigated theoretically for the Watson-Crick conformation of the guanine-cytosine (GC) base pair. Using semiempirical density functional theory the isolated and DNA-embedded GC pair is considered. Differences in the energetics and dynamics of DPT thus addresses the question of how relevant studies of isolated base pairs are for the understanding of processes occurring in DNA. Two-dimensional potential energy surfaces involving the transferring hydrogen atoms and the proton donors and acceptors are presented for both systems. The DPT reaction is accompanied by a contraction of the distance between the two bases with virtually identical energetic barriers being 18.8 and 18.7 kcal/mol for the isolated and DNA-embedded system, respectively. However, the transition state for DPT in the DNA-embedded GC pair is offset by 0.1 Å to larger N-H separation compared to the isolated GC pair. Using activated ab initio molecular dynamics, DPT is readily observed for the isolated base pair with a minimal amount of 21.4 kcal/mol of initial average kinetic energy along the DPT normal mode vector. On a time scale of ≈100 fs DPT has occurred and the excess energy is redistributed. For the DNA-embedded GC pair considerably more kinetic energy is required (30.0 kcal/mol) for DPT and the process is completed within one hydrogen vibration. The relevance of studies of isolated base pairs and base pair analogs in regard of reactions or properties involving DNA is discussed.

  20. Watson-Crick base pairing controls excited-state decay in natural DNA.

    PubMed

    Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

    2014-10-13

    Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states.

  1. Theoretical investigation on DNA/RNA base pairs mediated by copper, silver, and gold cations.

    PubMed

    Marino, Tiziana; Russo, Nino; Toscano, Marirosa; Pavelka, Matej

    2012-02-14

    B3LYP density functional based computations were performed in order to characterize the interactions present in some Cu(+), Ag(+), and Au(+) metal ion-mediated DNA and RNA base pairs from both structural and electronic points of view. Examined systems involve as ligands canonical Watson-Crick, Hoogsteen and Wobble base pairs. Two artificial Hoogsteen base pairs were also taken into account. Binding energy values indicate that complexes involving silver cations are less stable than those in which copper or gold are present, and propose a similar behaviour for these two latter ions. The nature of the bond linking metal ions and bases was described by the NBO analysis that suggests metal coordinative interactions to be covalent. An evaluation of the dispersion contributions for the investigated systems was performed with the B3LYP-D3 functional.

  2. B-DNA structure is intrinsically polymorphic: even at the level of base pair positions

    SciTech Connect

    Maehigashi, Tatsuya; Hsiao, Chiaolong; Woods, Kristen Kruger; Moulaei, Tinoush; Hud, Nicholas V.; Williams, Loren Dean

    2012-10-23

    Increasingly exact measurement of single crystal X-ray diffraction data offers detailed characterization of DNA conformation, hydration and electrostatics. However, instead of providing a more clear and unambiguous image of DNA, highly accurate diffraction data reveal polymorphism of the DNA atomic positions and conformation and hydration. Here we describe an accurate X-ray structure of B-DNA, painstakingly fit to a multistate model that contains multiple competing positions of most of the backbone and of entire base pairs. Two of ten base-pairs of CCAGGCCTGG are in multiple states distinguished primarily by differences in slide. Similarly, all the surrounding ions are seen to fractionally occupy discrete competing and overlapping sites. And finally, the vast majority of water molecules show strong evidence of multiple competing sites. Conventional resolution appears to give a false sense of homogeneity in conformation and interactions of DNA. In addition, conventional resolution yields an average structure that is not accurate, in that it is different from any of the multiple discrete structures observed at high resolution. Because base pair positional heterogeneity has not always been incorporated into model-building, even some high and ultrahigh-resolution structures of DNA do not indicate the full extent of conformational polymorphism.

  3. Human DNA Polymerase Kappa Encircles DNA: Implicatins for Mismatch Extension and Lesion Bypass

    SciTech Connect

    Lone,S.; Townson, S.; Uljon, S.; Johnson, R.; Brahma, A.; Nair, D.; Prakash, S.; Prakash, L.; Aggarwal, A.

    2007-01-01

    Human DNA polymerase (Pol ) is a proficient extender of mispaired primer termini on undamaged DNAs and is implicated in the extension step of lesion bypass. We present here the structure of Pol catalytic core in ternary complex with DNA and an incoming nucleotide. The structure reveals encirclement of the DNA by a unique 'N-clasp' at the N terminus of Pol , which augments the conventional right-handed grip on the DNA by the palm, fingers, and thumb domains and the PAD and provides additional thermodynamic stability. The structure also reveals an active-site cleft that is constrained by the close apposition of the N-clasp and the fingers domain, and therefore can accommodate only a single Watson-Crick base pair. Together, DNA encirclement and other structural features help explain Pol 's ability to extend mismatches and to promote replication through various minor groove DNA lesions, by extending from the nucleotide incorporated opposite the lesion by another polymerase.

  4. Yeast Pif1 helicase exhibits a one-base-pair stepping mechanism for unwinding duplex DNA.

    PubMed

    Ramanagoudr-Bhojappa, Ramanagouda; Chib, Shubeena; Byrd, Alicia K; Aarattuthodiyil, Suja; Pandey, Manjula; Patel, Smita S; Raney, Kevin D

    2013-05-31

    Kinetic analysis of the DNA unwinding and translocation activities of helicases is necessary for characterization of the biochemical mechanism(s) for this class of enzymes. Saccharomyces cerevisiae Pif1 helicase was characterized using presteady state kinetics to determine rates of DNA unwinding, displacement of streptavidin from biotinylated DNA, translocation on single-stranded DNA (ssDNA), and ATP hydrolysis activities. Unwinding of substrates containing varying duplex lengths was fit globally to a model for stepwise unwinding and resulted in an unwinding rate of ∼75 bp/s and a kinetic step size of 1 base pair. Pif1 is capable of displacing streptavidin from biotinylated oligonucleotides with a linear increase in the rates as the length of the oligonucleotides increased. The rate of translocation on ssDNA was determined by measuring dissociation from varying lengths of ssDNA and is essentially the same as the rate of unwinding of dsDNA, making Pif1 an active helicase. The ATPase activity of Pif1 on ssDNA was determined using fluorescently labeled phosphate-binding protein to measure the rate of phosphate release. The quantity of phosphate released corresponds to a chemical efficiency of 0.84 ATP/nucleotides translocated. Hence, when all of the kinetic data are considered, Pif1 appears to move along DNA in single nucleotide or base pair steps, powered by hydrolysis of 1 molecule of ATP.

  5. The structure of the human tRNALys3 anticodon bound to the HIV genome is stabilized by modified nucleosides and adjacent mismatch base pairs.

    PubMed

    Bilbille, Yann; Vendeix, Franck A P; Guenther, Richard; Malkiewicz, Andrzej; Ariza, Xavier; Vilarrasa, Jaume; Agris, Paul F

    2009-06-01

    Replication of human immunodeficiency virus (HIV) requires base pairing of the reverse transcriptase primer, human tRNA(Lys3), to the viral RNA. Although the major complementary base pairing occurs between the HIV primer binding sequence (PBS) and the tRNA's 3'-terminus, an important discriminatory, secondary contact occurs between the viral A-rich Loop I, 5'-adjacent to the PBS, and the modified, U-rich anticodon domain of tRNA(Lys3). The importance of individual and combined anticodon modifications to the tRNA/HIV-1 Loop I RNA's interaction was determined. The thermal stabilities of variously modified tRNA anticodon region sequences bound to the Loop I of viral sub(sero)types G and B were analyzed and the structure of one duplex containing two modified nucleosides was determined using NMR spectroscopy and restrained molecular dynamics. The modifications 2-thiouridine, s(2)U(34), and pseudouridine, Psi(39), appreciably stabilized the interaction of the anticodon region with the viral subtype G and B RNAs. The structure of the duplex results in two coaxially stacked A-form RNA stems separated by two mismatched base pairs, U(162)*Psi(39) and G(163)*A(38), that maintained a reasonable A-form helix diameter. The tRNA's s(2)U(34) stabilized the interaction between the A-rich HIV Loop I sequence and the U-rich anticodon, whereas the tRNA's Psi(39) stabilized the adjacent mismatched pairs.

  6. Free energy analysis and mechanism of base pair stacking in nicked DNA

    PubMed Central

    Häse, Florian; Zacharias, Martin

    2016-01-01

    The equilibrium of stacked and unstacked base pairs is of central importance for all nucleic acid structure formation processes. The stacking equilibrium is influenced by intramolecular interactions between nucleosides but also by interactions with the solvent. Realistic simulations on nucleic acid structure formation and flexibility require an accurate description of the stacking geometry and stability and its sequence dependence. Free energy simulations have been conducted on a series of double stranded DNA molecules with a central strand break (nick) in one strand. The change in free energy upon unstacking was calculated for all ten possible base pair steps using umbrella sampling along a center-of-mass separation coordinate and including a comparison of different water models. Comparison to experimental studies indicates qualitative agreement of the stability order but a general overestimation of base pair stacking interactions in the simulations. A significant dependence of calculated nucleobase stacking free energies on the employed water model was observed with the tendency of stacking free energies being more accurately reproduced by more complex water models. The simulation studies also suggest a mechanism of stacking/unstacking that involves significant motions perpendicular to the reaction coordinate and indicate that the equilibrium nicked base pair step may slightly differ from regular B-DNA geometry in a sequence-dependent manner. PMID:27407106

  7. Roles of the amino group of purine bases in the thermodynamic stability of DNA base pairing.

    PubMed

    Nakano, Shu-ichi; Sugimoto, Naoki

    2014-08-05

    The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I) and 2'-deoxyribo-2,6-diaminopurine (D) as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G • C > D • T ≈ I • C > A • T > G • T > I • T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

  8. Theory of phase segregation in DNA assemblies containing two different base-pair sequence types

    NASA Astrophysics Data System (ADS)

    (O’ Lee, Dominic J.; Wynveen, Aaron; Kornyshev, Alexei A.

    2017-01-01

    Spontaneous pairing of homologous DNA sequences—a challenging subject in molecular biophysics, often referred to as ‘homology recognition’—has been observed in vitro for several DNA systems. One of these experiments involved liquid crystalline quasi-columnar phases formed by a mixture of two kinds of double stranded DNA oligomer. Both oligomer types were of the same length and identical stoichiometric base-pair composition, but the base-pairs followed a different order. Phase segregation of the two DNA types was observed in the experiments, with the formation of boundaries between domains rich in molecules of one type (order) of base pair sequence. We formulate here a modified ‘X–Y model’ for phase segregation in such assemblies, obtain approximate solutions of the model, compare analytical results to Monte Carlo simulations, and rationalise past experimental observations. This study, furthermore, reveals the factors that affect the degree of segregation. Such information could be used in planning new versions of similar segregation experiments, needed for deepening our understanding of forces that might be involved, e.g., in gene–gene recognition.

  9. Sequence-Dependent T:G Base Pair Opening in DNA Double Helix Bound by Cren7, a Chromatin Protein Conserved among Crenarchaea

    PubMed Central

    Tian, Lei; Zhang, Zhenfeng; Wang, Hanqian; Zhao, Mohan; Dong, Yuhui; Gong, Yong

    2016-01-01

    T:G base pair arising from spontaneous deamination of 5mC or polymerase errors is a great challenge for DNA repair of hyperthermophilic archaea, especially Crenarchaea. Most strains in this phylum lack the protein homologues responsible for the recognition of the mismatch in the DNA repair pathways. To investigate whether Cren7, a highly conserved chromatin protein in Crenarchaea, serves a role in the repair of T:G mispairs, the crystal structures of Cren7-GTAATTGC and Cren7-GTGATCGC complexes were solved at 2.0 Å and 2.1 Å. In our structures, binding of Cren7 to the AT-rich DNA duplex (GTAATTGC) induces opening of T2:G15 but not T10:G7 base pair. By contrast, both T:G mispairs in the GC-rich DNA duplex (GTGATCGC) retain the classic wobble type. Structural analysis also showed DNA helical changes of GTAATTGC, especially in the steps around the open T:G base pair, as compared to GTGATCGC or the matched DNAs. Surface plasmon resonance assays revealed a 4-fold lower binding affinity of Cren7 for GTAATTGC than that for GTGATCGC, which was dominantly contributed by the decrease of association rate. These results suggested that binding of Cren7 to DNA leads to T:G mispair opening in a sequence dependent manner, and therefore propose the potential roles of Cren7 in DNA repair. PMID:27685992

  10. How Does Guanine-Cytosine Base Pair Affect Excess-Electron Transfer in DNA?

    PubMed

    Lin, Shih-Hsun; Fujitsuka, Mamoru; Majima, Tetsuro

    2015-06-25

    Charge transfer and proton transfer in DNA have attracted wide attention due to their relevance in biological processes and so on. Especially, excess-electron transfer (EET) in DNA has strong relation to DNA repair. However, our understanding on EET in DNA still remains limited. Herein, by using a strongly electron-donating photosensitizer, trimer of 3,4-ethylenedioxythiophene (3E), and an electron acceptor, diphenylacetylene (DPA), two series of functionalized DNA oligomers were synthesized for investigation of EET dynamics in DNA. The transient absorption measurements during femtosecond laser flash photolysis showed that guanine:cytosine (G:C) base pair affects EET dynamics in DNA by two possible mechanisms: the excess-electron quenching by proton transfer with the complementary G after formation of C(•-) and the EET hindrance by inserting a G:C base pair as a potential barrier in consecutive thymines (T's). In the present paper, we provided useful information based on the direct kinetic measurements, which allowed us to discuss EET through oligonucleotides for the investigation of DNA damage/repair.

  11. A quantum theoretical study of reactions of methyldiazonium ion with DNA base pairs

    NASA Astrophysics Data System (ADS)

    Shukla, P. K.; Ganapathy, Vinay; Mishra, P. C.

    2011-09-01

    Methylation of the DNA bases in the Watson-Crick GC and AT base pairs by the methyldiazonium ion was investigated employing density functional and second order Møller-Plesset (MP2) perturbation theories. Methylation at the N3, N7 and O6 sites of guanine, N1, N3 and N7 sites of adenine, O2 and N3 sites of cytosine and the O2 and O4 sites of thymine were considered. The computed reactivities for methylation follow the order N7(guanine) > N3(adenine) > O6(guanine) which is in agreement with experiment. The base pairing in DNA is found to play a significant role with regard to reactivities of the different sites.

  12. Aviram-Ratner rectifying mechanism for DNA base-pair sequencing through graphene nanogaps

    NASA Astrophysics Data System (ADS)

    Agapito, Luis A.; Gayles, Jacob; Wolowiec, Christian; Kioussis, Nicholas

    2012-04-01

    We demonstrate that biological molecules such as Watson-Crick DNA base pairs can behave as biological Aviram-Ratner electrical rectifiers because of the spatial separation and weak hydrogen bonding between the nucleobases. We have performed a parallel computational implementation of the ab initio non-equilibrium Green’s function (NEGF) theory to determine the electrical response of graphene—base-pair—graphene junctions. The results show an asymmetric (rectifying) current-voltage response for the cytosine-guanine base pair adsorbed on a graphene nanogap. In sharp contrast we find a symmetric response for the thymine-adenine case. We propose applying the asymmetry of the current-voltage response as a sensing criterion to the technological challenge of rapid DNA sequencing via graphene nanogaps.

  13. Single-molecule views of MutS on mismatched DNA

    PubMed Central

    Lee, Jong-Bong; Cho, Won-Ki; Park, Jonghyun; Jeon, Yongmoon; Kim, Daehyung; Lee, Seung Hwan; Fishel, Richard

    2014-01-01

    Base-pair mismatches that occur during DNA replication or recombination can reduce genetic stability or conversely increase genetic diversity. The genetics and biophysical mechanism of mismatch repair (MMR) has been extensively studied since its discovery nearly 50 years ago. MMR is a strand-specific excision-resynthesis reaction that is initiated by MutS homolog (MSH) binding to the mismatched nucleotides. The MSH mismatch-binding signal is then transmitted to the immediate downstream MutL homolog (MLH/PMS) MMR components and ultimately to a distant strand scission site where excision begins. The mechanism of signal transmission has been controversial for decades. We have utilized single molecule Forster Resonance Energy Transfer (smFRET), Fluorescence Tracking (smFT) and Polarization Total Internal Reflection Fluorescence (smP-TIRF) to examine the interactions and dynamic behaviors of single Thermus aquaticus MutS (TaqMutS) particles on mismatched DNA. We determined that Taq-MutS forms an incipient clamp to search for a mismatch in ∼1 s intervals by 1-dimensional (1D) thermal fluctuation-driven rotational diffusion while in continuous contact with the helical duplex DNA. When MutS encounters a mismatch it lingers for ∼3 s to exchange bound ADP for ATP (ADP → ATP exchange). ATP binding by TaqMutS induces an extremely stable clamp conformation (∼10 min) that slides off the mismatch and moves along the adjacent duplex DNA driven simply by 1D thermal diffusion. The ATP-bound sliding clamps rotate freely while in discontinuous contact with the DNA. The visualization of a train of MSH proteins suggests that dissociation of ATP-bound sliding clamps from the mismatch permits multiple mismatch-dependent loading events. These direct observations have provided critical clues into understanding the molecular mechanism of MSH proteins during MMR. PMID:24629484

  14. DNA separation and fluorescent detection in an optofluidic chip with sub-base-pair resolution

    NASA Astrophysics Data System (ADS)

    Pollnau, Markus; Hammer, Manfred; Dongre, Chaitanya; Hoekstra, Hugo J.

    2015-03-01

    DNA sequencing in a lab-on-a-chip aims at providing cheap, high-speed analysis of low reagent volumes to, e.g., identify genomic deletions or insertions associated with genetic illnesses. Detecting single base-pair insertions/deletions from DNA fragments in the diagnostically relevant range of 150-1000 base-pairs requires a sizing accuracy of S < 10-3. Here we demonstrate S = 4×10-4. A microfluidic chip was post-processed by femtosecond-laser writing of an optical waveguide. 12 blue-labeled and 23 red-labeled DNA fragments were separated in size by capillary electrophoresis, each set excited by either of two lasers power-modulated at different frequencies, their fluorescence detected by a photomultiplier, and blue/red signals distinguished by Fourier analysis. Different calibration strategies were tested: a) use either set of DNA molecules as reference to calibrate the set-up and identify the base-pair sizes of the other set in the same flow experiment, thereby eliminating variations in temperature, wall-coating and sieving-gel conditions, and actuation voltages; b) use the same molecular set as reference and sample with the same fluorescence label, flown in consecutive experiments; c) perform cross-experiments based on different molecular sets with different labels, flown in consecutive experiments. From the results we conclude: Applying quadratic instead of linear fit functions improves the calibration accuracy. Blue-labeled molecules are separated with higher accuracy. The influence of dye label is higher than fluctuations between two experiments. Choosing a single, suitable dye label combined with reference calibration and sample investigation in consecutive experiments results in S = 4×10-4, enabling detection of single base-pair insertion/deletion in a lab-on-a-chip.

  15. 6-Pyrazolylpurine as an Artificial Nucleobase for Metal-Mediated Base Pairing in DNA Duplexes

    PubMed Central

    Léon, J. Christian; Sinha, Indranil; Müller, Jens

    2016-01-01

    The artificial nucleobase 6-pyrazol-1-yl-purine (6PP) has been investigated with respect to its usability in metal-mediated base pairing. As was shown by temperature-dependent UV spectroscopy, 6PP may form weakly stabilizing 6PP–Ag(I)–6PP homo base pairs. Interestingly, 6PP can be used to selectively recognize a complementary pyrimidine nucleobase. The addition of Ag(I) to a DNA duplex comprising a central 6PP:C mispair (C = cytosine) leads to a slight destabilization of the duplex. In contrast, a stabilizing 6PP–Ag(I)–T base pair is formed with a complementary thymine (T) residue. It is interesting to note that 6PP is capable of differentiating between the pyrimidine moieties despite the fact that it is not as sterically crowded as 6-(3,5-dimethylpyrazol-1-yl)purine, an artificial nucleobase that had previously been suggested for the recognition of nucleic acid sequences via the formation of a metal-mediated base pair. Hence, the additional methyl groups of 6-(3,5-dimethylpyrazol-1-yl)purine may not be required for the specific recognition of the complementary nucleobase. PMID:27089326

  16. Combined microfluidic-optical DNA analysis with single-base-pair sizing capability

    PubMed Central

    Pollnau, Markus; Hammer, Manfred; Dongre, Chaitanya; Hoekstra, Hugo J. W. M.

    2016-01-01

    DNA sequencing by microchip capillary electrophoresis (CE) enables cheap, high-speed analysis of low reagent volumes. One of its potential applications is the identification of genomic deletions or insertions associated with genetic illnesses. Detecting single base-pair insertions or deletions from DNA fragments in the diagnostically relevant size range of 150−1000 base-pairs requires a variance of σ2 < 10−3. In a microfluidic chip post-processed by femtosecond-laser writing of an optical waveguide we CE-separated 12 blue-labeled and 23 red-labeled DNA fragments in size. Each set was excited by either of two lasers power-modulated at different frequencies, their fluorescence detected by a photomultiplier, and blue and red signals distinguished by Fourier analysis. We tested different calibration strategies. Choice of the fluorescent label as well as the applied fit function strongly influence the obtained variance, whereas fluctuations between two consecutive experiments are less detrimental in a laboratory environment. We demonstrate a variance of σ2 ≈4 × 10−4, lower than required for the detection of single base-pair insertion or deletion in an optofluidic chip. PMID:28018736

  17. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine.

    PubMed

    Bhamra, Inder; Compagnone-Post, Patricia; O'Neil, Ian A; Iwanejko, Lesley A; Bates, Andrew D; Cosstick, Richard

    2012-11-01

    8-Nitro-2'-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2'-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2'-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson-Crick pair.

  18. An unnatural hydrophobic base pair system: site-specific incorporation of nucleotide analogs into DNA and RNA.

    PubMed

    Hirao, Ichiro; Kimoto, Michiko; Mitsui, Tsuneo; Fujiwara, Tsuyoshi; Kawai, Rie; Sato, Akira; Harada, Yoko; Yokoyama, Shigeyuki

    2006-09-01

    Methods for the site-specific incorporation of extra components into nucleic acids can be powerful tools for creating DNA and RNA molecules with increased functionality. We present an unnatural base pair system in which DNA containing an unnatural base pair can be amplified and function as a template for the site-specific incorporation of base analog substrates into RNA via transcription. The unnatural base pair is formed by specific hydrophobic shape complementation between the bases, but lacks hydrogen bonding interactions. In replication, this unnatural base pair exhibits high selectivity in combination with the usual triphosphates and modified triphosphates, gamma-amidotriphosphates, as substrates of 3' to 5' exonuclease-proficient DNA polymerases, allowing PCR amplification. In transcription, the unnatural base pair complementarity mediates the incorporation of these base substrates and their analogs, such as a biotinylated substrate, into RNA by T7 RNA polymerase (RNAP). With this system, functional components can be site-specifically incorporated into a large RNA molecule.

  19. Identification of DNA lesions using a third base pair for amplification and nanopore sequencing.

    PubMed

    Riedl, Jan; Ding, Yun; Fleming, Aaron M; Burrows, Cynthia J

    2015-11-06

    Damage to the genome is implicated in the progression of cancer and stress-induced diseases. DNA lesions exist in low levels, and cannot be amplified by standard PCR because they are frequently strong blocks to polymerases. Here, we describe a method for PCR amplification of lesion-containing DNA in which the site and identity could be marked, copied and sequenced. Critical for this method is installation of either the dNaM or d5SICS nucleotides at the lesion site after processing via the base excision repair process. These marker nucleotides constitute an unnatural base pair, allowing large quantities of marked DNA to be made by PCR amplification. Sanger sequencing confirms the potential for this method to locate lesions by marking, amplifying and sequencing a lesion in the KRAS gene. Detection using the α-hemolysin nanopore is also developed to analyse the markers in individual DNA strands with the potential to identify multiple lesions per strand.

  20. Design and development of three-dimensional DNA crystals utilizing CGAA parallel base paired motifs

    NASA Astrophysics Data System (ADS)

    Muser, Stephanie Elizabeth

    Three-dimensional (3D) DNA crystals hold great potential for various applications such as the development of molecular scaffolds for use in protein structure determination by x-ray crystallography. The programmability and predictability of DNA make it a powerful tool for self-assembly but it is hindered by the linearity of the duplex structure. Predictable noncanonical base pairs and motifs have the potential to connect linear double-helical DNA segments into complex 3D structures. The sequence d(GCGAAAGCT) has been observed to form 3D crystals containing both noncanonical parallel pairs and canonical Watson-Crick pairs. This provided a template structure that we used in expanding the design and development of 3D DNA crystals along with exploring the use of predictable noncanonical motifs. The structures we determined contained all but one or two of the designed secondary structure interactions, depending on pH.

  1. Additional base-pair formation in DNA duplexes by a double-headed nucleotide.

    PubMed

    Madsen, Charlotte S; Witzke, Sarah; Kumar, Pawan; Negi, Kushuma; Sharma, Pawan K; Petersen, Michael; Nielsen, Poul

    2012-06-11

    We have designed and synthesised a double-headed nucleotide that presents two nucleobases in the interior of a dsDNA duplex. This nucleotide recognises and forms Watson-Crick base pairs with two complementary adenosines in a Watson-Crick framework. Furthermore, with judicious positioning in complementary strands, the nucleotide recognises itself through the formation of a T:T base pair. Thus, two novel nucleic acid motifs can be defined by using our double-headed nucleotide. Both motifs were characterised by UV melting experiments, CD and NMR spectroscopy and molecular dynamics simulations. Both motifs leave the thermostability of the native dsDNA duplex largely unaltered. Molecular dynamics calculations showed that the double-headed nucleotides are accommodated in the dsDNA by entirely local perturbations and that the modified duplexes retain an overall B-type geometry with the dsDNA unwound by around 25 or 60°, respectively, in each of the modified motifs. Both motifs can be accommodated twice in a dsDNA duplex without incurring any loss of stability and extrapolating from this observation and the results of modelling, it is conceivable that both can be multiplied several times within a dsDNA duplex. These new motifs extend the DNA recognition repertoire and may form the basis for a complete series of double-headed nucleotides based on all 16 base combinations of the four natural nucleobases. In addition, both motifs can be used in the design of nanoscale DNA structures in which a specific duplex twist is required.

  2. Structural and thermodynamic studies on the adenine.guanine mismatch in B-DNA.

    PubMed Central

    Leonard, G A; Booth, E D; Brown, T

    1990-01-01

    The structure of the synthetic dodecamer d(CGCAAATTGGCG) has been shown by single crystal X-ray diffraction methods to be that of a B-DNA helix containing two A(anti).G(syn) base pairs. The refinement, based on data to a resolution of 2.25 A shows that the mismatch base pairs are held together by two hydrogen bonds. The syn-conformation of the guanine base of the mismatch is stabilised by hydrogen bonding to a network of solvent molecules in both the major and minor grooves. A pH-dependent ultraviolet melting study indicates that the duplex is stabilised by protonation, suggesting that the bases of the A.G mispair are present in their most common tautomeric forms and that the N(1)-atom of adenine is protonated. The structure refinement shows that there is some disorder in the sugar-phosphate backbone. PMID:2216754

  3. Eukaryotic Mismatch Repair in Relation to DNA Replication.

    PubMed

    Kunkel, Thomas A; Erie, Dorothy A

    2015-01-01

    Three processes act in series to accurately replicate the eukaryotic nuclear genome. The major replicative DNA polymerases strongly prevent mismatch formation, occasional mismatches that do form are proofread during replication, and rare mismatches that escape proofreading are corrected by mismatch repair (MMR). This review focuses on MMR in light of increasing knowledge about nuclear DNA replication enzymology and the rate and specificity with which mismatches are generated during leading- and lagging-strand replication. We consider differences in MMR efficiency in relation to mismatch recognition, signaling to direct MMR to the nascent strand, mismatch removal, and the timing of MMR. These studies are refining our understanding of relationships between generating and repairing replication errors to achieve accurate replication of both DNA strands of the nuclear genome.

  4. From rigid base pairs to semiflexible polymers: coarse-graining DNA.

    PubMed

    Becker, Nils B; Everaers, Ralf

    2007-08-01

    The elasticity of double-helical DNA on a nm length scale is captured in detail by the rigid base-pair model, whose conformation variables are the relative positions and orientations of adjacent base pairs. Corresponding sequence-dependent elastic potentials have been obtained from all-atom MD simulation and from high-resolution structural data. On the scale of 100 nm, DNA is successfully described by a continuous wormlike chain model with homogeneous elastic properties, characterized by a set of four elastic constants which have been measured in single-molecule experiments. We present here a theory that links these experiments on different scales, by systematically coarse-graining the rigid base-pair model to an effective wormlike chain description. The average helical geometry of the molecule is accounted for exactly, and repetitive as well as random sequences are considered. Structural disorder is shown to produce a small, additive and short-range correction to thermal conformation fluctuations as well as to entropic elasticity. We also discuss the limits of applicability of the homogeneous wormlike chain on short scales, quantifying the anisotropy of bending stiffness, the non-Gaussian bend angle distribution and the variability of stiffness, all of which are noticeable below a helical turn. The coarse-grained elastic parameters show remarkable overall agreement with experimental wormlike chain stiffness. For the best-matching potential, bending persistence lengths of dinucleotide repeats span a range of 37-53 nm, with a random DNA value of 43 nm. While twist stiffness is somewhat underestimated and stretch stiffness is overestimated, the counterintuitive negative sign and the magnitude of the twist-stretch coupling agree with recent experimental findings.

  5. Expanding the scope of replicable unnatural DNA: stepwise optimization of a predominantly hydrophobic base pair.

    PubMed

    Lavergne, Thomas; Degardin, Mélissa; Malyshev, Denis A; Quach, Henry T; Dhami, Kirandeep; Ordoukhanian, Phillip; Romesberg, Floyd E

    2013-04-10

    As part of an ongoing effort to expand the genetic alphabet for in vitro and eventually in vivo applications, we have synthesized a wide variety of predominantly hydrophobic unnatural base pairs exemplified by d5SICS-dMMO2 and d5SICS-dNaM. When incorporated into DNA, the latter is replicated and transcribed with greater efficiency and fidelity than the former; however, previous optimization efforts identified the para and methoxy-distal meta positions of dMMO2 as particularly promising for further optimization. Here, we report the stepwise optimization of dMMO2 via the synthesis and evaluation of 18 novel para-derivatized analogs of dMMO2, followed by further derivatization and evaluation of the most promising analogs with meta substituents. Subject to size constraints, we find that para substituents can optimize replication via both steric and electronic effects and that meta methoxy groups are unfavorable, while fluoro substituents can be beneficial or deleterious depending on the para substituent. In addition, we find that improvements in the efficiency of unnatural triphosphate insertion translate most directly into higher fidelity replication. Importantly, we identify multiple, unique base pair derivatives that when incorporated into DNA are well replicated. The most promising, d5SICS-dFEMO, is replicated under some conditions with greater efficiency and fidelity than d5SICS-dNaM. These results clearly demonstrate the generality of hydrophobic forces for the control of base pairing within DNA, provide a wealth of new SAR data, and importantly identify multiple new candidates for eventual in vivo evaluation.

  6. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    PubMed

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non

  7. Electronic coupling between base pair dimers of LNA:DNA oligomers.

    PubMed

    Ivanova, Anela; Jezierski, Grzegorz; Rösch, Notker

    2008-01-21

    We calculated ab initio electronic coupling elements between neighboring base-pair dimers in a set of LNA:DNA oligomers with different numbers of locked nucleotides and compared them by averaging the values over ensembles of snapshots from molecular dynamics trajectories. Averaging was based on coupling elements for various ensembles comprising of 33,000 structures. The known pronounced variations of coupling elements on the nanosecond timescale due to thermal fluctuations of the DNA structure were confirmed. We found significant differences in electronic coupling at the dimer level between a non-modified DNA:DNA duplex and the corresponding duplex containing one fully LNA-substituted strand. We rationalized these differences by very dissimilar overlap in the pi-stack as a consequence of the LNA-modified system approximating an A-DNA-type helix. The calculated coupling elements for the non-modified reference duplex were similar to those of standard B-DNA and those for the fully modified oligomer resembled the matrix elements estimated for standard A-DNA.

  8. "False" thymine-1H-Enol guanine base pair. low misinsertion rate by DNA polymerase explained by computational chemistry consideration.

    PubMed

    Seclaman, E; Kurunczi, L; Simon, Z

    2007-03-01

    Formation of correct TA and GC and "false" thymine-1H-enol guanine (TGenol) base pairs is here considered to control nucleotide insertion into DNA via low substrate concentration Michaelis-Menten controlled kinetics. Contributions of base pairing to formation of Gibbs free energies in water solution, DeltaDeltaG, are calculated for the correct and false base pairs with the semi-empiric MNDO/PM3 method for base pairing energies in vacuum and the BEM method for hydration effects. The results for DeltaDeltaG indicate equal insertion rates for correct base pairing and a 10(-3)-10(-4) error probability for false insertion controlled by the TGenol false pair.

  9. Mitochondrial DNA 4977-base pair common deletion in blood leukocytes and melanoma risk.

    PubMed

    Shen, Jie; Wan, Jie; Huff, Chad; Fang, Shenying; Lee, Jeffrey E; Zhao, Hua

    2016-05-01

    The 4977-base pair common deletion DmtDNA4977 is the most frequently observed mitochondrial DNA mutation in human tissues. Because mitochondrial DNA mutations are mainly caused by reactive oxygen species (ROS), and given that oxidative stress plays an important role in melanoma carcinogenesis, the investigation of DmtDNA4977 may be particularly relevant to the development of melanoma. In this study, we compared DmtDNA4977 levels in blood leukocytes from 206 melanoma patients and 219 healthy controls. Overall, melanoma cases had significantly higher levels of DmtDNA4977 than healthy controls (median: 0.60 vs 0.20, P = 0.008). The difference was evident among individuals who were older than 47 yrs, women, and had pigmentation risk factors (e.g., blond or red hair, blue eye, fair skin, light, or none tanning ability after prolonged sun exposure, and freckling in the sun as a child). The difference was also evident among those who had at least one lifetime sunburn with blistering and had no reported use of a sunlamp. Interestingly, among controls, DmtDNA4977 levels differed by phenotypic index and reported use of a sunlamp. In the risk assessment, increased levels of DmtDNA4977 were associated with a 1.23-fold increased risk of melanoma (odds ratio (OR): 1.23, 95% confidence interval (90% CI): 1.01, 1.50). A significant dose-response relationship was observed in quartile analysis (P = 0.001). In summary, our study suggests that high levels of DmtDNA4977 in blood leukocytes are associated with increased risk of melanoma and that association is affected by both pigmentation and personal history of sun exposure.

  10. DNA Base Pair Resolution Measurements Using Resonance Energy Transfer Efficiency in Lanthanide Doped Nanoparticles

    PubMed Central

    Delplanque, Aleksandra; Wawrzynczyk, Dominika; Jaworski, Pawel; Matczyszyn, Katarzyna; Pawlik, Krzysztof; Buckle, Malcolm; Nyk, Marcin; Nogues, Claude; Samoc, Marek

    2015-01-01

    Lanthanide-doped nanoparticles are of considerable interest for biodetection and bioimaging techniques thanks to their unique chemical and optical properties. As a sensitive luminescence material, they can be used as (bio) probes in Förster Resonance Energy Transfer (FRET) where trivalent lanthanide ions (La3+) act as energy donors. In this paper we present an efficient method to transfer ultrasmall (ca. 8 nm) NaYF4 nanoparticles dispersed in organic solvent to an aqueous solution via oxidation of the oleic acid ligand. Nanoparticles were then functionalized with single strand DNA oligomers (ssDNA) by inducing covalent bonds between surface carboxylic groups and a 5’ amine modified-ssDNA. Hybridization with the 5’ fluorophore (Cy5) modified complementary ssDNA strand demonstrated the specificity of binding and allowed the fine control over the distance between Eu3+ ions doped nanoparticle and the fluorophore by varying the number of the dsDNA base pairs. First, our results confirmed nonradiative resonance energy transfer and demonstrate the dependence of its efficiency on the distance between the donor (Eu3+) and the acceptor (Cy5) with sensitivity at a nanometre scale. PMID:25748446

  11. Silver-mediated base pairings: towards dynamic DNA nanostructures with enhanced chemical and thermal stability

    NASA Astrophysics Data System (ADS)

    Swasey, Steven M.; Gwinn, Elisabeth G.

    2016-04-01

    The thermal and chemical fragility of DNA nanomaterials assembled by Watson-Crick (WC) pairing constrain the settings in which these materials can be used and how they can be functionalized. Here we investigate use of the silver cation, Ag+, as an agent for more robust, metal-mediated self-assembly, focusing on the simplest duplex building blocks that would be required for more elaborate Ag+-DNA nanostructures. Our studies of Ag+-induced assembly of non-complementary DNA oligomers employ strands of 2-24 bases, with varied base compositions, and use electrospray ionization mass spectrometry to determine product compositions. High yields of duplex products containing narrowly distributed numbers of Ag+ can be achieved by optimizing solution conditions. These Ag+-mediated duplexes are stable to at least 60 mM Mg2+, higher than is necessary for WC nanotechnology schemes such as tile assemblies and DNA origami, indicating that sequential stages of Ag+-mediated and WC-mediated assembly may be feasible. Circular dichroism spectroscopy suggests simple helical structures for Ag+-mediated duplexes with lengths to at least 20 base pairs, and further indicates that the structure of cytosine-rich duplexes is preserved at high urea concentrations. We therefore propose an approach towards dynamic DNA nanomaterials with enhanced thermal and chemical stability through designs that combine sturdy silver-mediated ‘frames’ with WC paired ‘pictures’.

  12. New insights into Hoogsteen base pairs in DNA duplexes from a structure-based survey

    PubMed Central

    Zhou, Huiqing; Hintze, Bradley J.; Kimsey, Isaac J.; Sathyamoorthy, Bharathwaj; Yang, Shan; Richardson, Jane S.; Al-Hashimi, Hashim M.

    2015-01-01

    Hoogsteen (HG) base pairs (bps) provide an alternative pairing geometry to Watson–Crick (WC) bps and can play unique functional roles in duplex DNA. Here, we use structural features unique to HG bps (syn purine base, HG hydrogen bonds and constricted C1′–C1′ distance across the bp) to search for HG bps in X-ray structures of DNA duplexes in the Protein Data Bank. The survey identifies 106 A•T and 34 G•C HG bps in DNA duplexes, many of which are undocumented in the literature. It also uncovers HG-like bps with syn purines lacking HG hydrogen bonds or constricted C1′–C1′ distances that are analogous to conformations that have been proposed to populate the WC-to-HG transition pathway. The survey reveals HG preferences similar to those observed for transient HG bps in solution by nuclear magnetic resonance, including stronger preferences for A•T versus G•C bps, TA versus GG steps, and also suggests enrichment at terminal ends with a preference for 5′-purine. HG bps induce small local perturbations in neighboring bps and, surprisingly, a small but significant degree of DNA bending (∼14°) directed toward the major groove. The survey provides insights into the preferences and structural consequences of HG bps in duplex DNA. PMID:25813047

  13. Active destabilization of base pairs by a DNA glycosylase wedge initiates damage recognition.

    PubMed

    Kuznetsov, Nikita A; Bergonzo, Christina; Campbell, Arthur J; Li, Haoquan; Mechetin, Grigory V; de los Santos, Carlos; Grollman, Arthur P; Fedorova, Olga S; Zharkov, Dmitry O; Simmerling, Carlos

    2015-01-01

    Formamidopyrimidine-DNA glycosylase (Fpg) excises 8-oxoguanine (oxoG) from DNA but ignores normal guanine. We combined molecular dynamics simulation and stopped-flow kinetics with fluorescence detection to track the events in the recognition of oxoG by Fpg and its mutants with a key phenylalanine residue, which intercalates next to the damaged base, changed to either alanine (F110A) or fluorescent reporter tryptophan (F110W). Guanine was sampled by Fpg, as evident from the F110W stopped-flow traces, but less extensively than oxoG. The wedgeless F110A enzyme could bend DNA but failed to proceed further in oxoG recognition. Modeling of the base eversion with energy decomposition suggested that the wedge destabilizes the intrahelical base primarily through buckling both surrounding base pairs. Replacement of oxoG with abasic (AP) site rescued the activity, and calculations suggested that wedge insertion is not required for AP site destabilization and eversion. Our results suggest that Fpg, and possibly other DNA glycosylases, convert part of the binding energy into active destabilization of their substrates, using the energy differences between normal and damaged bases for fast substrate discrimination.

  14. Base-pairing energies of proton-bound heterodimers of cytosine and modified cytosines: implications for the stability of DNA i-motif conformations.

    PubMed

    Yang, Bo; Rodgers, M T

    2014-01-08

    The DNA i-motif conformation was discovered in (CCG)•(CGG)n trinucleotide repeats, which are associated with fragile X syndrome, the most widespread inherited cause of mental retardation in humans. The DNA i-motif is a four-stranded structure whose strands are held together by proton-bound dimers of cytosine (C(+)•C). The stronger base-pairing interactions in C(+)•C proton-bound dimers as compared to Watson-Crick G•C base pairs are the major forces responsible for stabilization of i-motif conformations. Methylation of cytosine results in silencing of the FMR1 gene and causes fragile X syndrome. However, the influence of methylation or other modifications such as halogenation of cytosine on the base-pairing energies (BPEs) in the i-motif remains elusive. To address this, proton-bound heterodimers of cytosine and 5-methylcytosine, 5-fluorocytosine, 5-bromocytosine, and 5-iodocytosine are probed in detail. Experimentally, the BPEs of proton-bound heterodimers of cytosine and modified cytosines are determined using threshold collision-induced dissociation (TCID) techniques. All modifications at the 5-position of cytosine are found to lower the BPE and therefore would tend to destabilize DNA i-motif conformations. However, the BPEs in these proton-bound heterodimers still significantly exceed those of the Watson-Crick G•C and neutral C•C base pairs, suggesting that C(+)•C mismatches are still energetically favored such that i-motif conformations are preserved. Excellent agreement between TCID measured BPEs and B3LYP calculated values is found with the def2-TZVPPD and 6-311+G(2d,2p) basis sets, suggesting that calculations at these levels of theory can be employed to provide reliable energetic predictions for related systems.

  15. Inverse Temperature Dependence of Nuclear Quantum Effects in DNA Base Pairs

    PubMed Central

    2016-01-01

    Despite the inherently quantum mechanical nature of hydrogen bonding, it is unclear how nuclear quantum effects (NQEs) alter the strengths of hydrogen bonds. With this in mind, we use ab initio path integral molecular dynamics to determine the absolute contribution of NQEs to the binding in DNA base pair complexes, arguably the most important hydrogen-bonded systems of all. We find that depending on the temperature, NQEs can either strengthen or weaken the binding within the hydrogen-bonded complexes. As a somewhat counterintuitive consequence, NQEs can have a smaller impact on hydrogen bond strengths at cryogenic temperatures than at room temperature. We rationalize this in terms of a competition of NQEs between low-frequency and high-frequency vibrational modes. Extending this idea, we also propose a simple model to predict the temperature dependence of NQEs on hydrogen bond strengths in general. PMID:27195654

  16. Inverse Temperature Dependence of Nuclear Quantum Effects in DNA Base Pairs.

    PubMed

    Fang, Wei; Chen, Ji; Rossi, Mariana; Feng, Yexin; Li, Xin-Zheng; Michaelides, Angelos

    2016-06-02

    Despite the inherently quantum mechanical nature of hydrogen bonding, it is unclear how nuclear quantum effects (NQEs) alter the strengths of hydrogen bonds. With this in mind, we use ab initio path integral molecular dynamics to determine the absolute contribution of NQEs to the binding in DNA base pair complexes, arguably the most important hydrogen-bonded systems of all. We find that depending on the temperature, NQEs can either strengthen or weaken the binding within the hydrogen-bonded complexes. As a somewhat counterintuitive consequence, NQEs can have a smaller impact on hydrogen bond strengths at cryogenic temperatures than at room temperature. We rationalize this in terms of a competition of NQEs between low-frequency and high-frequency vibrational modes. Extending this idea, we also propose a simple model to predict the temperature dependence of NQEs on hydrogen bond strengths in general.

  17. Inter-strand coupling and base pairing sequences in DNA charge transport.

    NASA Astrophysics Data System (ADS)

    Yudiarsah, Efta; Ulloa, Sergio

    2006-03-01

    The electronic transport properties of double-stranded DNA are studied using a tight-binding Hamiltonian. Transfer and scattering matrix methods for double strands are employed simultaneously in the calculation, guaranteeing numerical stability. Realistic on-site energies [1] and hopping constants are used in the model [2]. The role of inter-strand coupling is shown to be extremely important for random sequences typical of genetic DNA. In contrast, inter-strand coupling only changes slightly the charge transport properties for more periodic sequences. The effect of base-pairing across strands and details of the sequences were investigated. Our model shows that the resistance of DNA depends on the sequences and the ratio of the bases. This agrees with previous results by Roche [3]. The resistance is also shown to increase with the concentration of different bases in a homogenous strand, and we find that for certain sequences only short-range electronic transport is possible.[1] H. Sugiyama and I. Saito, J. Am. Chem. Soc. 118, 7063 (1996).[2] A. A. Voityuk, J. Jortner, M. Bixon, and N. Rosch, J. Chem. Phys. 114, 5614 (2001).[3] S. Roche, Phys. Rev. Lett. 91, 108101 (2003).

  18. Enhanced reduced representation bisulfite sequencing for assessment of DNA methylation at base pair resolution.

    PubMed

    Garrett-Bakelman, Francine E; Sheridan, Caroline K; Kacmarczyk, Thadeous J; Ishii, Jennifer; Betel, Doron; Alonso, Alicia; Mason, Christopher E; Figueroa, Maria E; Melnick, Ari M

    2015-02-24

    DNA methylation pattern mapping is heavily studied in normal and diseased tissues. A variety of methods have been established to interrogate the cytosine methylation patterns in cells. Reduced representation of whole genome bisulfite sequencing was developed to detect quantitative base pair resolution cytosine methylation patterns at GC-rich genomic loci. This is accomplished by combining the use of a restriction enzyme followed by bisulfite conversion. Enhanced Reduced Representation Bisulfite Sequencing (ERRBS) increases the biologically relevant genomic loci covered and has been used to profile cytosine methylation in DNA from human, mouse and other organisms. ERRBS initiates with restriction enzyme digestion of DNA to generate low molecular weight fragments for use in library preparation. These fragments are subjected to standard library construction for next generation sequencing. Bisulfite conversion of unmethylated cytosines prior to the final amplification step allows for quantitative base resolution of cytosine methylation levels in covered genomic loci. The protocol can be completed within four days. Despite low complexity in the first three bases sequenced, ERRBS libraries yield high quality data when using a designated sequencing control lane. Mapping and bioinformatics analysis is then performed and yields data that can be easily integrated with a variety of genome-wide platforms. ERRBS can utilize small input material quantities making it feasible to process human clinical samples and applicable in a range of research applications. The video produced demonstrates critical steps of the ERRBS protocol.

  19. Osmium complex binding to mismatched methylcytosine: effect of adjacent bases.

    PubMed

    Nomura, Akiko; Tainaka, Kazuki; Okamoto, Akimitsu

    2009-01-01

    We investigated the efficiency of osmium complex formation at 5-methylcytosine in mismatched DNA duplexes. Osmium complexation was not observed in fully matched duplexes, whereas the complexation site and efficiency in mismatched duplexes depended on the 5'-neighboring base of the 5-methylcytosine. In particular, when the base adjacent to the 5' side of the mismatched base pair was thymine, a unique side reaction was observed. However, the mismatched base pairs did not influence the selectivity of osmium complexation with methylated DNA.

  20. DNA mismatch repair and the DNA damage response

    PubMed Central

    Li, Zhongdao; Pearlman, Alexander H.; Hsieh, Peggy

    2015-01-01

    This review discusses the role of DNA mismatch repair (MMR) in the DNA damage response (DDR) that triggers cell cycle arrest and, in some cases, apoptosis. Although the focus is on findings from mammalian cells, much has been learned from studies in other organisms including bacteria and yeast [1,2]. MMR promotes a DDR mediated by a key signaling kinase, ATM and Rad3-related (ATR), in response to various types of DNA damage including some encountered in widely used chemotherapy regimes. An introduction to the DDR mediated by ATR reveals its immense complexity and highlights the many biological and mechanistic questions that remain. Recent findings and future directions are highlighted. PMID:26704428

  1. DNA duplex stability of the thio-iso-guanine•methyl-iso-Cytosine base pair.

    PubMed

    Lee, Dongkye; Switzer, Christopher

    2015-01-01

    We report the synthesis, incorporation into oligonucleotides, and base-pairing properties of the 2-thio-variant of iso-guanine. Iso-guanine is the purine component of a nonstandard base pair with 5-methyl-iso-cytosine. The 2-thio-iso-guanine • 5-methyl-iso-cytosine base pair is found to have similar stability to an adenine • thymine pair.

  2. Tertiary base pair interactions in slipped loop-DNA: an NMR and model building study.

    PubMed Central

    Ulyanov, N B; Bishop, K D; Ivanov, V I; James, T L

    1994-01-01

    Short direct repeat sequences are often found in regulatory regions of various genes; in some cases they display hypersensitivity to S1 nuclease cleavage in supercoiled plasmids. A non-standard DNA structure (Slipped Loop Structure, or SLS) has been proposed for these regions in order to explain the S1 cleavage data; the formation of this structure may be involved in the regulation of transcription. The structure can be generally classified as a particular type of pseudoknot. To date, no detailed stereochemical model has been developed. We have applied one-dimensional 1H NMR spectroscopy to study a synthetic DNA, 55 nucleotides in length, which cannot fold as a standard hairpin but which may favor the SLS formation. AT base pairs were identified, consistent only with the formation of an additional, tertiary miniduplex in the SLS. An all-atom stereochemically sound model has been developed for the SLS with the use of conformational calculations. The model building studies have demonstrated that the tertiary miniduplex can be formed for one of the plausible SLS isomers, but not for the other. Images PMID:7937152

  3. Tertiary base pair interactions in slipped loop-DNA: an NMR and model building study.

    PubMed

    Ulyanov, N B; Bishop, K D; Ivanov, V I; James, T L

    1994-10-11

    Short direct repeat sequences are often found in regulatory regions of various genes; in some cases they display hypersensitivity to S1 nuclease cleavage in supercoiled plasmids. A non-standard DNA structure (Slipped Loop Structure, or SLS) has been proposed for these regions in order to explain the S1 cleavage data; the formation of this structure may be involved in the regulation of transcription. The structure can be generally classified as a particular type of pseudoknot. To date, no detailed stereochemical model has been developed. We have applied one-dimensional 1H NMR spectroscopy to study a synthetic DNA, 55 nucleotides in length, which cannot fold as a standard hairpin but which may favor the SLS formation. AT base pairs were identified, consistent only with the formation of an additional, tertiary miniduplex in the SLS. An all-atom stereochemically sound model has been developed for the SLS with the use of conformational calculations. The model building studies have demonstrated that the tertiary miniduplex can be formed for one of the plausible SLS isomers, but not for the other.

  4. Chimeric Proteins to Detect DNA Damage and Mismatches

    SciTech Connect

    McCutchen-Maloney, S; Malfatti, M; Robbins, K M

    2002-01-14

    The goal of this project was to develop chimeric proteins composed of a DNA mismatch or damage binding protein and a nuclease, as well as methods to detect DNA mismatches and damage. We accomplished this through protein engineering based on using polymerase chain reactions (PCRs) to create chimeras with novel functions for damage and mismatch detection. This project addressed fundamental questions relating to disease susceptibility and radiation-induced damage in cells. It also supported and enhanced LLNL's competency in the emerging field of proteomics. In nature, DNA is constantly being subjected to damaging agents such as exposure to ultraviolet (UV) radiation and various environmental and dietary carcinogens. If DNA damage is not repaired however, mutations in DNA result that can eventually manifest in cancer and other diseases. In addition to damage-induced DNA mutations, single nucleotide polymorphisms (SNPs), which are variations in the genetic sequence between individuals, may predispose some to disease. As a result of the Human Genome Project, the integrity of a person's DNA can now be monitored. Therefore, methods to detect DNA damage, mutations, and SNPs are useful not only in basic research but also in the health and biotechnology industries. Current methods of detection often use radioactive labeling and rely on expensive instrumentation that is not readily available in many research settings. Our methods to detect DNA damage and mismatches employ simple gel electrophoresis and flow cytometry, thereby alleviating the need for radioactive labeling and expensive equipment. In FY2001, we explored SNP detection by developing methods based on the ability of the chimeric proteins to detect mismatches. Using multiplex assays with flow cytometry and fluorescent beads to which the DNA substrates where attached, we showed that several of the chimeras possess greater affinity for damaged and mismatched DNA than for native DNA. This affinity was demonstrated in

  5. Excited States of DNA Base Pairs Using Long-Range Corrected Time-Dependent Density Functional Theory

    SciTech Connect

    Jensen, Lasse; Govind, Niranjan

    2009-09-10

    In this work we present a study of the excitation energies of adenine, cytosine, guanine, thymine and the adenine-thymine (AT) and guanine-cytosine (GC) base pairs using long-range corrected (LC) density functional theory. We compare three recent LC-functionals, BNL, CAM-B3LYP and LC-PBE0 with B3LYP and coupled cluster results from the literature. We find that the best overall performance is for the BNL functional based on LDA. However, in order to achieve this good agreement a smaller attenuation parameter was needed which leads to non-optimum performance for ground state properties. B3LYP, on the other hand, severely underestimates the charge transfer (CT) transitions in the base pairs. Surprisingly we also find that the CAM-B3LYP functional also underestimates the CT excitation energy for the GC base pair, but correctly describes the AT base pair. This illustrates the importance of retaining the full long-range exact exchange even at distances as short as that of the DNA base pairs. The worst overall performance was obtained with the LC-PBE0 functional which overestimates the excitations for the individual bases as well as the base pairs. It is therefore crucial to strike a good balance between the amount of local and long-range exact exchange.

  6. Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?

    PubMed

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.

  7. DNA methylation by N-methyl-N-nitrosourea: methylation pattern changes in single- and double-stranded DNA, and in DNA with mismatched or bulged guanines.

    PubMed Central

    Wurdeman, R L; Douskey, M C; Gold, B

    1993-01-01

    The detection of abnormal DNA base pairing arrangements and conformations is chemically probed in synthetic 32P-end-labeled deoxyribonucleotide oligomers using N-methyl-N-nitrosourea (MNU) and 2,12,-dimethyl-3,7,11,17-tetraazabicyclo-[11.3.1]heptadeca-1 -[17],2,11,13,15 pentaene-Ni (II) (Ni-complex) with KHSO5. The DNA targets studied are single-stranded (s-s) DNA, double-stranded (d-s) DNA, d-s DNA with G-G, G-A and G-T mismatches, d-s DNA with a single bulged G and d-s DNA with two bulged G's. The effect of the non-Watson--Crick structures on the formation of N7-methylguanine (N7-MeG) by MNU and the oxidation of G by Ni-complex is reported along with the Tm's and circular dichroism spectra of the different duplex oligomers. The results for MNU and Ni-complex show that the qualitative and quantitative character of the cleavage patterns at a G3 run change with the nature of the abnormal base pairing motif. Based on the DNA substrates studied, the results indicate that a combination of reagents which report electronic and steric perturbations can be a useful approach to monitor DNA mismatches and bulges. Images PMID:8177747

  8. Base-Pairing Energies of Protonated Nucleoside Base Pairs of dCyd and m5dCyd: Implications for the Stability of DNA i-Motif Conformations

    NASA Astrophysics Data System (ADS)

    Yang, Bo; Rodgers, M. T.

    2015-08-01

    Hypermethylation of cytosine in expanded (CCG)n•(CGG)n trinucleotide repeats results in Fragile X syndrome, the most common cause of inherited mental retardation. The (CCG)n•(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of protonated base pairs of cytosine. Here we investigate the effects of 5-methylation and the sugar moiety on the base-pairing energies (BPEs) of protonated cytosine base pairs by examining protonated nucleoside base pairs of 2'-deoxycytidine (dCyd) and 5-methyl-2'-deoxycytidine (m5dCyd) using threshold collision-induced dissociation techniques. 5-Methylation of a single or both cytosine residues leads to very small change in the BPE. However, the accumulated effect may be dramatic in diseased state trinucleotide repeats where many methylated base pairs may be present. The BPEs of the protonated nucleoside base pairs examined here significantly exceed those of Watson-Crick dGuo•dCyd and neutral dCyd•dCyd base pairs, such that these base-pairing interactions provide the major forces responsible for stabilization of DNA i-motif conformations. Compared with isolated protonated nucleobase pairs of cytosine and 1-methylcytosine, the 2'-deoxyribose sugar produces an effect similar to the 1-methyl substituent, and leads to a slight decrease in the BPE. These results suggest that the base-pairing interactions may be slightly weaker in nucleic acids, but that the extended backbone is likely to exert a relatively small effect on the total BPE. The proton affinity (PA) of m5dCyd is also determined by competitive analysis of the primary dissociation pathways that occur in parallel for the protonated (m5dCyd)H+(dCyd) nucleoside base pair and the absolute PA of dCyd previously reported.

  9. Base-Pairing Energies of Protonated Nucleoside Base Pairs of dCyd and m(5)dCyd: Implications for the Stability of DNA i-Motif Conformations.

    PubMed

    Yang, Bo; Rodgers, M T

    2015-08-01

    Hypermethylation of cytosine in expanded (CCG)n•(CGG)n trinucleotide repeats results in Fragile X syndrome, the most common cause of inherited mental retardation. The (CCG)n•(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of protonated base pairs of cytosine. Here we investigate the effects of 5-methylation and the sugar moiety on the base-pairing energies (BPEs) of protonated cytosine base pairs by examining protonated nucleoside base pairs of 2'-deoxycytidine (dCyd) and 5-methyl-2'-deoxycytidine (m(5)dCyd) using threshold collision-induced dissociation techniques. 5-Methylation of a single or both cytosine residues leads to very small change in the BPE. However, the accumulated effect may be dramatic in diseased state trinucleotide repeats where many methylated base pairs may be present. The BPEs of the protonated nucleoside base pairs examined here significantly exceed those of Watson-Crick dGuo•dCyd and neutral dCyd•dCyd base pairs, such that these base-pairing interactions provide the major forces responsible for stabilization of DNA i-motif conformations. Compared with isolated protonated nucleobase pairs of cytosine and 1-methylcytosine, the 2'-deoxyribose sugar produces an effect similar to the 1-methyl substituent, and leads to a slight decrease in the BPE. These results suggest that the base-pairing interactions may be slightly weaker in nucleic acids, but that the extended backbone is likely to exert a relatively small effect on the total BPE. The proton affinity (PA) of m(5)dCyd is also determined by competitive analysis of the primary dissociation pathways that occur in parallel for the protonated (m(5)dCyd)H(+)(dCyd) nucleoside base pair and the absolute PA of dCyd previously reported.

  10. Base pairing enhances fluorescence and favors cyclobutane dimer formation induced upon absorption of UVA radiation by DNA.

    PubMed

    Banyasz, Akos; Vayá, Ignacio; Changenet-Barret, Pascale; Gustavsson, Thomas; Douki, Thierry; Markovitsi, Dimitra

    2011-04-13

    The photochemical properties of the DNA duplex (dA)(20)·(dT)(20) are compared with those of the parent single strands. It is shown that base pairing increases the probability of absorbing UVA photons, probably due to the formation of charge-transfer states. UVA excitation induces fluorescence peaking at ∼420 nm and decaying on the nanosecond time scale. The fluorescence quantum yield, the fluorescence lifetime, and the quantum yield for cyclobutane dimer formation increase upon base pairing. Such behavior contrasts with that of the UVC-induced processes.

  11. [Structural and energetic properties of the four configurations of the A.T and G.C DNA base pairs].

    PubMed

    Brovarets', O O

    2013-01-01

    Using the methods of non-empirical quantum chemistry at the MP2/6-311++G(2df,pd)// B3LYP/6-311++G(d,p) level of theory it was established for the first time, that Hoogsteen, reverse Hoogsteen, Watson-Crick and reverse Watson-Crick configurations of the A.T and G.C DNA base pairs are isoelectronic and isomorphic structures with similar dynamic properties. Based on these results, non-ionisation mechanism of the Hoogsteen <"breathing" of the G*.C* DNA base pair, namely transformation of the tautomerised (Lowdin's) G-C base pair with Watson-Crick geometry into the Hoogsteen electroneutral G*.C* H base pair stabilized by the three O6H...N4, N3H...N7 and C8H...02 H-bonds, was postulated. It is suggested that such scenario activates only in those cases, when DNA is not located in aqueous solution, but works together with proteins and cytosine protonation at the N3 atom is precluded.

  12. Molecular recognition of DNA base pairs by the formamido/pyrrole and formamido/imidazole pairings in stacked polyamides

    PubMed Central

    Buchmueller, Karen L.; Staples, Andrew M.; Uthe, Peter B.; Howard, Cameron M.; Pacheco, Kimberly A. O.; Cox, Kari K.; Henry, James A.; Bailey, Suzanna L.; Horick, Sarah M.; Nguyen, Binh; Wilson, W. David; Lee, Moses

    2005-01-01

    Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, –ImPy– and –PyPy–. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and ΔTM experiments. The f/Py pairing, when placed next to the –ImPy– or –PyPy– central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With –ImPy– central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson–Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the –PyPy– central pairings. PMID:15703305

  13. New insights into the mechanism of DNA mismatch repair

    PubMed Central

    Reyes, Gloria X.; Schmidt, Tobias T.; Kolodner, Richard D.; Hombauer, Hans

    2015-01-01

    The genome of all organisms is constantly being challenged by endogenous and exogenous sources of DNA damage. Errors like base:base mismatches or small insertions and deletions, primarily introduced by DNA polymerases during DNA replication are repaired by an evolutionary conserved DNA mismatch repair (MMR) system. The MMR system, together with the DNA replication machinery, promote repair by an excision and resynthesis mechanism during or after DNA replication, increasing replication fidelity by upto-three orders of magnitude. Consequently, inactivation of MMR genes results in elevated mutation rates that can lead to increased cancer susceptibility in humans. In this review, we summarize our current understanding of MMR with a focus on the different MMR protein complexes, their function and structure. We also discuss how recent findings have provided new insights in the spatio-temporal regulation and mechanism of MMR. PMID:25862369

  14. Repair of mismatched basepairs in mammalian DNA

    SciTech Connect

    Taylor, J.H.; Hare, J.T.

    1991-08-01

    We have concentrated on three specific areas of our research plan. Our greatest emphasis is on the role of single strand nicks in influencing template strand selection in mismatch repair. We have found, that the ability of a nick in one strand to influence which strand is repaired is not a simple function of distance from the mismatched site but rather that an hot spot where a nick is more likely to have an influence can exist. The second line was production of single-genotype heteroduplexes in order to examine independently the repair of T/G and A/C mispairs within the same sequence context as in our mixed mispair preparations. We have shown preparations of supercoiled heteroduplex can be prepared that were exclusively T/G or exclusively A/C at the mispair site. The third effort has been to understand the difference in repair bias of different cell lines or different transfection conditions as it may relate to different repair systems in the cell. We have identified some of the sources of variation, including cell cycle position. We hope to continue this work to more precisely identify the phase of the cell cycle.

  15. Crystal structure of metallo DNA duplex containing consecutive Watson-Crick-like T-Hg(II)-T base pairs.

    PubMed

    Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2014-02-24

    The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials.

  16. Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

    PubMed

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-09-18

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events.

  17. Synthesis and base pairing studies of geranylated 2-thiothymidine, a natural variant of thymidine.

    PubMed

    Wang, Rui; Ranganathan, Srivathsan V; Basanta-Sanchez, Maria; Shen, Fusheng; Chen, Alan; Sheng, Jia

    2015-11-25

    The synthesis and base pairing of DNA duplexes containing the geranylated 2-thiothymidine have been investigated. This naturally existing hydrophobic modification could grant better base pairing stability to the T-G pair over normal T-A and other mismatched pairs in the duplex context. This study provides a potential explanation for the different codon recognition preferences of the geranylated tRNAs.

  18. Tolerance of DNA Mismatches in Dmc1 Recombinase-mediated DNA Strand Exchange.

    PubMed

    Borgogno, María V; Monti, Mariela R; Zhao, Weixing; Sung, Patrick; Argaraña, Carlos E; Pezza, Roberto J

    2016-03-04

    Recombination between homologous chromosomes is required for the faithful meiotic segregation of chromosomes and leads to the generation of genetic diversity. The conserved meiosis-specific Dmc1 recombinase catalyzes homologous recombination triggered by DNA double strand breaks through the exchange of parental DNA sequences. Although providing an efficient rate of DNA strand exchange between polymorphic alleles, Dmc1 must also guard against recombination between divergent sequences. How DNA mismatches affect Dmc1-mediated DNA strand exchange is not understood. We have used fluorescence resonance energy transfer to study the mechanism of Dmc1-mediated strand exchange between DNA oligonucleotides with different degrees of heterology. The efficiency of strand exchange is highly sensitive to the location, type, and distribution of mismatches. Mismatches near the 3' end of the initiating DNA strand have a small effect, whereas most mismatches near the 5' end impede strand exchange dramatically. The Hop2-Mnd1 protein complex stimulates Dmc1-catalyzed strand exchange on homologous DNA or containing a single mismatch. We observed that Dmc1 can reject divergent DNA sequences while bypassing a few mismatches in the DNA sequence. Our findings have important implications in understanding meiotic recombination. First, Dmc1 acts as an initial barrier for heterologous recombination, with the mismatch repair system providing a second level of proofreading, to ensure that ectopic sequences are not recombined. Second, Dmc1 stepping over infrequent mismatches is likely critical for allowing recombination between the polymorphic sequences of homologous chromosomes, thus contributing to gene conversion and genetic diversity.

  19. Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

    PubMed

    Xia, Shuangluo; Konigsberg, William H

    2014-04-01

    Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states.

  20. 2-Thiouracil deprived of thiocarbonyl function preferentially base pairs with guanine rather than adenine in RNA and DNA duplexes.

    PubMed

    Sochacka, Elzbieta; Szczepanowski, Roman H; Cypryk, Marek; Sobczak, Milena; Janicka, Magdalena; Kraszewska, Karina; Bartos, Paulina; Chwialkowska, Anna; Nawrot, Barbara

    2015-03-11

    2-Thiouracil-containing nucleosides are essential modified units of natural and synthetic nucleic acids. In particular, the 5-substituted-2-thiouridines (S2Us) present in tRNA play an important role in tuning the translation process through codon-anticodon interactions. The enhanced thermodynamic stability of S2U-containing RNA duplexes and the preferred S2U-A versus S2U-G base pairing are appreciated characteristics of S2U-modified molecular probes. Recently, we have demonstrated that 2-thiouridine (alone or within an RNA chain) is predominantly transformed under oxidative stress conditions to 4-pyrimidinone riboside (H2U) and not to uridine. Due to the important biological functions and various biotechnological applications for sulfur-containing nucleic acids, we compared the thermodynamic stabilities of duplexes containing desulfured products with those of 2-thiouracil-modified RNA and DNA duplexes. Differential scanning calorimetry experiments and theoretical calculations demonstrate that upon 2-thiouracil desulfuration to 4-pyrimidinone, the preferred base pairing of S2U with adenosine is lost, with preferred base pairing with guanosine observed instead. Therefore, biological processes and in vitro assays in which oxidative desulfuration of 2-thiouracil-containing components occurs may be altered. Moreover, we propose that the H2U-G base pair is a suitable model for investigation of the preferred recognition of 3'-G-ending versus A-ending codons by tRNA wobble nucleosides, which may adopt a 4-pyrimidinone-type structural motif.

  1. Toward a designed genetic system with biochemical function: polymerase synthesis of single and multiple size-expanded DNA base pairs.

    PubMed

    Lu, Haige; Krueger, Andrew T; Gao, Jianmin; Liu, Haibo; Kool, Eric T

    2010-06-21

    The development of alternative architectures for genetic information-encoding systems offers the possibility of new biotechnological tools as well as basic insights into the function of the natural system. In order to examine the potential of benzo-expanded DNA (xDNA) to encode and transfer biochemical information, we carried out a study of the processing of single xDNA pairs by DNA Polymerase I Klenow fragment (Kf, an A-family sterically rigid enzyme) and by the Sulfolobus solfataricus polymerase Dpo4 (a flexible Y-family polymerase). Steady-state kinetics were measured and compared for enzymatic synthesis of the four correct xDNA pairs and twelve mismatched pairs, by incorporation of dNTPs opposite single xDNA bases. Results showed that, like Kf, Dpo4 in most cases selected the correctly paired partner for each xDNA base, but with efficiency lowered by the enlarged pair size. We also evaluated kinetics for extension by these polymerases beyond xDNA pairs and mismatches, and for exonuclease editing by the Klenow exo+ polymerase. Interestingly, the two enzymes were markedly different: Dpo4 extended pairs with relatively high efficiencies (within 18-200-fold of natural DNA), whereas Kf essentially failed at extension. The favorable extension by Dpo4 was tested further by stepwise synthesis of up to four successive xDNA pairs on an xDNA template.

  2. Varying DNA base-pair size in subangstrom increments: evidence for a loose, not large, active site in low-fidelity Dpo4 polymerase.

    PubMed

    Mizukami, Shin; Kim, Tae Woo; Helquist, Sandra A; Kool, Eric T

    2006-03-07

    We describe the first systematic test of steric effects in the active site of a Y-family DNA polymerase, Dpo4. It has been hypothesized that low-fidelity repair polymerases in this family more readily accept damaged or mismatched base pairs because of a sterically more open active site, which might place lower geometric constraints on the incipient pair. We have tested the origin of low fidelity by use of five nonpolar thymidine analogues that vary in size by a total of 1.0 A over the series. The efficiency and fidelity of base-pair synthesis was measured by steady-state kinetics for single-nucleotide insertions. Analogues were examined both as incoming deoxynucleoside triphosphate (dNTP) derivatives and as template bases. The results showed that Dpo4 preferred to pair the thymidine shape mimics with adenine and, surprisingly, the preferred size was at the center of the range, the same optimum size as recently found for the high-fidelity Klenow fragment (Kf) of Escherichia coli DNA Pol I. However, the size preference with Dpo4 was quite small, varying by a factor of only 30-35 from most to least efficient thymidine analogue. This is in marked contrast to Kf, which showed a rigid size preference, varying by 1100-fold from best to worst. The fidelity for the non-hydrogen-bonding analogues in pairing with A over T, C, or G was much lower in Dpo4 than in the previous high-fidelity enzyme. The data establish that, unlike Kf, Dpo4 has very low steric selectivity and that steric effects alone cannot explain the fidelity (albeit low) that Dpo4 has for a correct base pair; the findings suggest that hydrogen bonds may be important in determining the fidelity of this enzyme. The results suggest that the low steric selectivity of this enzyme is the result of a conformationally flexible or loose active site that adapts with small energetic cost to different base-pair sizes (as measured by the glycosidic C1'-C1' distance), rather than a spatially large active site.

  3. 1,8-Naphthyridine-2,7-diamine: a potential universal reader of Watson-Crick base pairs for DNA sequencing by electron tunneling.

    PubMed

    Liang, Feng; Lindsay, Stuart; Zhang, Peiming

    2012-11-21

    With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.

  4. Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing.

    PubMed

    Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon

    2010-08-18

    It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

  5. Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

    PubMed

    Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

    2015-12-01

    Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA.

  6. DNA sequence of 15 base pairs is sufficient to mediate both glucocorticoid and progesterone induction of gene expression

    SciTech Connect

    Straehle, U.; Klock, G.; Schuetz, G.

    1987-11-01

    To define the recognition sequence of the glucocorticoid receptor and its relationship with that of the progesterone receptor, oligonucleotides derived from the glucocorticoid response element of the tyrosine aminotransferase gene were tested upstream of a heterologous promoter for their capacity to mediate effects of these two steroids. The authors show that a 15-base-pair sequence with partial symmetry is sufficient to confer glucocorticoid inducibility on the promoter of the herpes simplex virus thymidine kinase gene. The same 15-base-pair sequence mediates induction by progesterone. Point mutations in the recognition sequence affect inducibility by glucocorticoids and progesterone similarly. Together with the strong conservation of the sequence of the DNA-binding domain of the two receptors, these data suggest that both proteins recognize a sequence that is similar, if not the same.

  7. Characterization of a Thermostable 8-Oxoguanine DNA Glycosylase Specific for GO/N Mismatches from the Thermoacidophilic Archaeon Thermoplasma volcanium

    PubMed Central

    Fujii, Miki; Hata, Chieri; Ukita, Munetada; Fukushima, Chie; Matsuura, Chihiro; Kawashima-Ohya, Yoshie; Tomobe, Koji

    2016-01-01

    The oxidation of guanine (G) to 7,8-dihydro-8-oxoguanine (GO) forms one of the major DNA lesions generated by reactive oxygen species (ROS). The GO can be corrected by GO DNA glycosylases (Ogg), enzymes involved in base excision repair (BER). Unrepaired GO induces mismatched base pairing with adenine (A); as a result, the mismatch causes a point mutation, from G paired with cytosine (C) to thymine (T) paired with adenine (A), during DNA replication. Here, we report the characterization of a putative Ogg from the thermoacidophilic archaeon Thermoplasma volcanium. The 204-amino acid sequence of the putative Ogg (TVG_RS00315) shares significant sequence homology with the DNA glycosylases of Methanocaldococcus jannaschii (MjaOgg) and Sulfolobus solfataricus (SsoOgg). The six histidine-tagged recombinant TVG_RS00315 protein gene was expressed in Escherichia coli and purified. The Ogg protein is thermostable, with optimal activity near a pH of 7.5 and a temperature of 60°C. The enzyme displays DNA glycosylase, and apurinic/apyrimidinic (AP) lyase activities on GO/N (where N is A, T, G, or C) mismatch; yet it cannot eliminate U from U/G or T from T/G, as mismatch glycosylase (MIG) can. These results indicate that TvoOgg-encoding TVG_RS00315 is a member of the Ogg2 family of T. volcanium. PMID:27799846

  8. Impact of DNA mismatch repair system alterations on human fertility and related treatments*

    PubMed Central

    Hu, Min-hao; Liu, Shu-yuan; Wang, Ning; Wu, Yan; Jin, Fan

    2016-01-01

    DNA mismatch repair (MMR) is one of the biological pathways, which plays a critical role in DNA homeostasis, primarily by repairing base-pair mismatches and insertion/deletion loops that occur during DNA replication. MMR also takes part in other metabolic pathways and regulates cell cycle arrest. Defects in MMR are associated with genomic instability, predisposition to certain types of cancers and resistance to certain therapeutic drugs. Moreover, genetic and epigenetic alterations in the MMR system demonstrate a significant relationship with human fertility and related treatments, which helps us to understand the etiology and susceptibility of human infertility. Alterations in the MMR system may also influence the health of offspring conceived by assisted reproductive technology in humans. However, further studies are needed to explore the specific mechanisms by which the MMR system may affect human infertility. This review addresses the physiological mechanisms of the MMR system and associations between alterations of the MMR system and human fertility and related treatments, and potential effects on the next generation. PMID:26739522

  9. Anharmonic and harmonic intermolecular vibrational modes of the DNA base pairs

    NASA Astrophysics Data System (ADS)

    Špirko, Vladimír; Šponer, Jiří; Hobza, Pavel

    1997-01-01

    Intermolecular vibrational modes of the H-bonded adenine…thymine Watson-Crick (AT) base pair were studied for the first time using multidimensional nonharmonic treatment. Relying on a Born-Oppenheimer-like separation of the fast and slow vibrational motions, the complete multidimensional vibrational problem is reduced to a six-dimensional subproblem in which all rearrangements between the pair fragments (i.e., adenine and thymine) can be described. Following the Hougen-Bunker-Johns approach and using appropriate vibrational coordinates, a nonrigid reference is defined which covers all motions on the low-lying part of the intermolecular potential surface and which facilitates the derivation of a suitable model Hamiltonian. The potential energy surface is determined at the ab initio Hartree-Fock level with minimal basis set (HF/MINI-1) and an analytic potential energy function is obtained by fitting to the ab initio data. This function is used to calculate vibrational energy levels and effective geometries within the framework of the model Hamiltonian, disregarding the role of the kinematic and potential (in-plane)-(out-of-plane) interactions. The calculations are in reasonable agreement with the normal coordinate analysis (harmonic treatment) thus indicating physical correctness of this standard approach for an approximate description of the lowest vibrational states of the AT base pair. In addition, to get a deeper insight, harmonic vibrational frequencies of the AT pair and 28 other base pairs are evaluated at the same and higher levels of theory [ab initio Hartree-Fock level with split-valence basis set (HF/6-31G**)]. The HF/MINI-1 and HF/6-31G** intermolecular harmonic vibrational frequencies differ by less than 30%. For all the base pairs, the buckle and propeller vibrational modes [for definition and nomenclature see R. E. Dickerson et al., EMBO J. 8, 1 (1989)] are the lowest ones, all being in the narrow interval (from 4 to 30 cm-1 in the harmonic

  10. In vitro recognition of DNA base pairs by histones in histone-DNA complexes and reconstituted core particles: an ultraviolet resonance Raman study.

    PubMed Central

    Laigle, A; Chinsky, L; Turpin, P Y; Liquier, J; Taillandier, E

    1982-01-01

    Resonance Raman spectra of complexes between DNA and the four core histones, alone or associated, have been investigated in vitro using excitations at 300 and 257 nm, which give complementary informations about the DNA bases. H2A and H2B fractions recognize the G-C base pairs, while H3 and H4 (arginine rich fractions) recognize the A-T base pairs. The associated fractions form complexes with DNA which yield about the same DNA spectral modifications as the DNA-H4 complexes. This reveals the important role of the arginine rich fractions in the core particle formation and confirms the preferential in vitro assembly of nucleosome cores on A-T rich regions of DNA (25). PMID:7155896

  11. Robust silver-mediated imidazolo-dC base pairs in metal DNA: dinuclear silver bridges with exceptional stability in double helices with parallel and antiparallel strand orientation.

    PubMed

    Jana, Sunit Kumar; Guo, Xiurong; Mei, Hui; Seela, Frank

    2015-12-18

    A new unprecedented metal-mediated base pair was designed that stabilizes reverse Watson-Crick DNA (parallel strand orientation, ps) as well as canonical Watson-Crick DNA (antiparallel strand orientation, aps). This base pair contains two imidazolo-dC units decorated with furan residues. Tm measurements and spectroscopic studies reveal that each silver-mediated furano-imidazolo-dC forms exceptionally stable duplexes with ps and aps chain orientation. This stability increase by a silver-mediated base pair is the highest reported so far for ps and aps DNA helices.

  12. 2-Thiouracil deprived of thiocarbonyl function preferentially base pairs with guanine rather than adenine in RNA and DNA duplexes

    PubMed Central

    Sochacka, Elzbieta; Szczepanowski, Roman H.; Cypryk, Marek; Sobczak, Milena; Janicka, Magdalena; Kraszewska, Karina; Bartos, Paulina; Chwialkowska, Anna; Nawrot, Barbara

    2015-01-01

    2-Thiouracil-containing nucleosides are essential modified units of natural and synthetic nucleic acids. In particular, the 5-substituted-2-thiouridines (S2Us) present in tRNA play an important role in tuning the translation process through codon–anticodon interactions. The enhanced thermodynamic stability of S2U-containing RNA duplexes and the preferred S2U-A versus S2U-G base pairing are appreciated characteristics of S2U-modified molecular probes. Recently, we have demonstrated that 2-thiouridine (alone or within an RNA chain) is predominantly transformed under oxidative stress conditions to 4-pyrimidinone riboside (H2U) and not to uridine. Due to the important biological functions and various biotechnological applications for sulfur-containing nucleic acids, we compared the thermodynamic stabilities of duplexes containing desulfured products with those of 2-thiouracil-modified RNA and DNA duplexes. Differential scanning calorimetry experiments and theoretical calculations demonstrate that upon 2-thiouracil desulfuration to 4-pyrimidinone, the preferred base pairing of S2U with adenosine is lost, with preferred base pairing with guanosine observed instead. Therefore, biological processes and in vitro assays in which oxidative desulfuration of 2-thiouracil-containing components occurs may be altered. Moreover, we propose that the H2U-G base pair is a suitable model for investigation of the preferred recognition of 3′-G-ending versus A-ending codons by tRNA wobble nucleosides, which may adopt a 4-pyrimidinone-type structural motif. PMID:25690900

  13. Stability of DNA duplexes containing GG, CC, AA, and TT mismatches.

    PubMed

    Tikhomirova, Anna; Beletskaya, Irina V; Chalikian, Tigran V

    2006-09-05

    We employed salt-dependent differential scanning calorimetric measurements to characterize the stability of six oligomeric DNA duplexes (5'-GCCGGAXTGCCGG-3'/5'-CCGGCAYTCCGGC-3') that contain in the central XY position the GC, AT, GG, CC, AA, or TT base pair. The heat-induced helix-to-coil transitions of all the duplexes are associated with positive changes in heat capacity, DeltaC(p), ranging from 0.43 to 0.53 kcal/mol. Positive values of DeltaC(p) result in strong temperature dependences of changes in enthalpy, DeltaH degrees, and entropy, DeltaS degrees , accompanying duplex melting and cause melting free energies, DeltaG degrees, to exhibit characteristically curved shapes. These observations suggest that DeltaC(p) needs to be carefully taken into account when the parameters of duplex stability are extrapolated to temperatures distant from the transition temperature, T(M). Comparison of the calorimetric and van't Hoff enthalpies revealed that none of the duplexes studied in this work exhibits two-state melting. Within the context of the central AXT/TYA triplet, the thermal and thermodynamic stabilities of the duplexes in question change in the following order: GC > AT > GG > AA approximately TT > CC. Our estimates revealed that the thermodynamic impact of the GG, AA, and TT mismatches is confined within the central triplet. In contrast, the thermodynamic impact of the CC mismatch propagates into the adjacent helix domains and may involve 7-9 bp. We discuss implications of our results for understanding the origins of initial recognition of mismatched DNA sites by enzymes of the DNA repair machinery.

  14. Base pair opening kinetics study of the aegPNA:DNA hydrid duplex containing a site-specific GNA-like chiral PNA monomer.

    PubMed

    Seo, Yeo-Jin; Lim, Jisoo; Lee, Eun-Hae; Ok, Taedong; Yoon, Juyoung; Lee, Joon-Hwa; Lee, Hee-Seung

    2011-09-01

    Peptide nucleic acids (PNA) are one of the most widely used synthetic DNA mimics where the four bases are attached to a N-(2-aminoethyl)glycine (aeg) backbone instead of the negative-charged phosphate backbone in DNA. We have developed a chimeric PNA (chiPNA), in which a chiral GNA-like γ(3)T monomer is incorporated into aegPNA backbone. The base pair opening kinetics of the aegPNA:DNA and chiPNA:DNA hybrid duplexes were studied by NMR hydrogen exchange experiments. This study revealed that the aegPNA:DNA hybrid is much more stable duplex and is less dynamic compared to DNA duplex, meaning that base pairs are opened and reclosed much more slowly. The site-specific incorporation of γ(3)T monomer in the aegPNA:DNA hybrid can destabilize a specific base pair and its neighbors, maintaining the thermal stabilities and dynamic properties of other base pairs. Our hydrogen exchange study firstly revealed the unique kinetic features of base pairs in the aegPNA:DNA and chiPNA:DNA hybrids, which will provide an insight into the development of methodology for specific DNA recognition using PNA fragments.

  15. [Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

    PubMed

    Brovarets', O O; Hovorun, D M

    2010-01-01

    A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*<---->Gua.Cyt<---->Gua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

  16. Structure of the 2-Aminopurine-Cytosine Base Pair Formed in the Polymerase Active Site of the RB69 Y567A-DNA Polymerase

    SciTech Connect

    Reha-Krantz, Linda J.; Hariharan, Chithra; Subuddhi, Usharani; Xia, Shuangluo; Zhao, Chao; Beckman, Jeff; Christian, Thomas; Konigsberg, William

    2011-11-21

    The adenine base analogue 2-aminopurine (2AP) is a potent base substitution mutagen in prokaryotes because of its enhanceed ability to form a mutagenic base pair with an incoming dCTP. Despite more than 50 years of research, the structure of the 2AP-C base pair remains unclear. We report the structure of the 2AP-dCTP base pair formed within the polymerase active site of the RB69 Y567A-DNA polymerase. A modified wobble 2AP-C base pair was detected with one H-bond between N1 of 2AP and a proton from the C4 amino group of cytosine and an apparent bifurcated H-bond between a proton on the 2-amino group of 2-aminopurine and the ring N3 and O2 atoms of cytosine. Interestingly, a primer-terminal region rich in AT base pairs, compared to GC base pairs, facilitated dCTP binding opposite template 2AP. We propose that the increased flexibility of the nucleotide binding pocket formed in the Y567A-DNA polymerase and increased 'breathing' at the primer-terminal junction of A+T-rich DNA facilitate dCTP binding opposite template 2AP. Thus, interactions between DNA polymerase residues with a dynamic primer-terminal junction play a role in determining base selectivity within the polymerase active site of RB69 DNA polymerase.

  17. Effect of protonation on the electronic properties of DNA base pairs: applications for molecular electronics.

    PubMed

    Mallajosyula, Sairam S; Pati, Swapan K

    2007-10-11

    Protonation of DNA basepairs is a reversible phenomenon that can be controlled by tuning the pH of the system. Under mild acidic conditions, the hydrogen-bonding pattern of the DNA basepairs undergoes a change. We study the effect of protonation on the electronic properties of the DNA basepairs to probe for possible molecular electronics applications. We find that, under mild acidic pH conditions, the A:T basepair shows excellent rectification behavior that is, however, absent in the G:C basepair. The mechanism of rectification has been discussed using a simple chemical potential model. We also consider the noncanonical A:A basepair and find that it can be used as efficient pH dependent molecular switch. The switching action in the A:A basepair is explained in the light of pi-pi interactions, which lead to efficient delocalization over the entire basepair.

  18. Measurement and theory of hydrogen bonding contribution to isosteric DNA base pairs.

    PubMed

    Khakshoor, Omid; Wheeler, Steven E; Houk, K N; Kool, Eric T

    2012-02-15

    We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions between F and natural bases in nucleic acid duplexes and in a DNA polymerase active site. Since F is widely used to measure electrostatic contributions to pairing and replication, it is important to quantify the impact of this isostere on DNA stability. Here, we studied the pairing stability and selectivity of this compound and a closely related variant, dichlorotoluene deoxyriboside (L), in DNA, using both experimental and computational approaches. We measured the thermodynamics of duplex formation in three sequence contexts and with all possible pairing partners by thermal melting studies using the van't Hoff approach, and for selected cases by isothermal titration calorimetry (ITC). Experimental results showed that internal F-A pairing in DNA is destabilizing by 3.8 kcal/mol (van't Hoff, 37 °C) as compared with T-A pairing. At the end of a duplex, base-base interactions are considerably smaller; however, the net F-A interaction remains repulsive while T-A pairing is attractive. As for selectivity, F is found to be slightly selective for adenine over C, G, T by 0.5 kcal mol, as compared with thymine's selectivity of 2.4 kcal/mol. Interestingly, dichlorotoluene in DNA is slightly less destabilizing and slightly more selective than F, despite the lack of strongly electronegative fluorine atoms. Experimental data were complemented by computational results, evaluated at the M06-2X/6-31+G(d) and MP2/cc-pVTZ levels of theory. These computations suggest that the pairing energy of F to A

  19. Electron correlated and density functional studies on hydrogen-bonded proton transfer in adenine thymine base pair of DNA

    NASA Astrophysics Data System (ADS)

    Shimizu, Naoto; Kawano, Satoyuki; Tachikawa, Masanori

    2005-02-01

    The potential energy surface along the hydrogen-bonded proton transfer between the Watson-Crick (WC) adenine-thymine (A-T) base pair of deoxyribonucleic acid (DNA) and its tautomeric structures is calculated with 6-31G(d,p) basis set in Hartree-Fock (HF), density functional theory with Becke's three-parameter hybrid Lee-Yang-Parr exchange-correlation functional (B3LYP), second order Møller-Plesset perturbation (MP2), and coupled cluster singles and doubles (CCSD) levels. The tautomeric structure, where both two hydrogen-bonded protons in the A-T base pair have transferred each other, is found at all level of calculations. Though the optimized structure in which only one hydrogen-bonded proton in adenine has migrated to thymine is found at HF level, we could not obtain such optimized structure at both MP2 and B3LYP levels. Including electron correlations, the energy differences between the canonical A-T and the two hydrogen-bonded protons transferred tautomeric structure become smaller. Aside from this, potential energy surface from the WC A-T to the Hoogsteen type A-T gives almost the same among each level of calculation.

  20. DNA base pair stacks with high electric conductance: a systematic structural search.

    PubMed

    Berlin, Yuri A; Voityuk, Alexander A; Ratner, Mark A

    2012-09-25

    We report a computational search for DNA π-stack structures exhibiting high electric conductance in the hopping regime, based on the INDO/S calculations of electronic coupling and the method of data analysis called k-means clustering. Using homogeneous poly(G)-poly(C) and poly(A)-poly(T) stacks as the simplest structural models, we identify the configurations of neighboring G:C and A:T pairs that allow strong electronic coupling and, therefore, molecular electric conductance much larger than the values reported for the corresponding reference systems in the literature. A computational approach for modeling the impact of thermal fluctuations on the averaged dimer structure was also proposed and applied to the [(G:C),(G:C)] and [(A:T),(A:T)] duplexes. The results of this work may provide guidance for the construction of DNA devices and DNA-based elements of nanoscale molecular circuits. Several factors that cause changes of step parameters favorable to the formation of the predicted stack conformation with high electric conductance of DNA molecules are also discussed; favorable geometries may enhance the conductivity by factors as large as 15.

  1. Studies of base pair sequence effects on DNA solvation based on all-atom molecular dynamics simulations.

    PubMed

    Dixit, Surjit B; Mezei, Mihaly; Beveridge, David L

    2012-07-01

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization were observed in these simulations. The results were compared to essentially all known experimental data on the subject. Proximity analysis was employed to highlight the sequence dependent differences in solvation and ion localization properties in the grooves of DNA. Comparison of the MD-calculated DNA structure with canonical A- and B-forms supports the idea that the G/C-rich sequences are closer to canonical A- than B-form structures, while the reverse is true for the poly A sequences, with the exception of the alternating ATAT sequence. Analysis of hydration density maps reveals that the flexibility of solute molecule has a significant effect on the nature of observed hydration. Energetic analysis of solute-solvent interactions based on proximity analysis of solvent reveals that the GC or CG base pairs interact more strongly with water molecules in the minor groove of DNA that the AT or TA base pairs, while the interactions of the AT or TA pairs in the major groove are stronger than those of the GC or CG pairs. Computation of solvent-accessible surface area of the nucleotide units in the simulated trajectories reveals that the similarity with results derived from analysis of a database of crystallographic structures is excellent. The MD trajectories tend to follow Manning's counterion condensation theory, presenting a region of condensed counterions within a radius of about 17 A from the DNA surface independent of sequence. The GC and CG pairs tend to associate with cations in the major groove of the DNA structure to a greater extent than the AT and TA pairs. Cation association is more frequent in the minor groove of AT than the GC pairs. In general, the

  2. Chimeric proteins for detection and quantitation of DNA mutations, DNA sequence variations, DNA damage and DNA mismatches

    DOEpatents

    McCutchen-Maloney, Sandra L.

    2002-01-01

    Chimeric proteins having both DNA mutation binding activity and nuclease activity are synthesized by recombinant technology. The proteins are of the general formula A-L-B and B-L-A where A is a peptide having DNA mutation binding activity, L is a linker and B is a peptide having nuclease activity. The chimeric proteins are useful for detection and identification of DNA sequence variations including DNA mutations (including DNA damage and mismatches) by binding to the DNA mutation and cutting the DNA once the DNA mutation is detected.

  3. Comparative study of affinity and selectivity of ligands targeting abasic and mismatch sites in DNA using a fluorescence-melting assay.

    PubMed

    Kotera, Naoko; Granzhan, Anton; Teulade-Fichou, Marie-Paule

    2016-01-01

    Recently, several families of small-molecule ligands have been developed to selectively target DNA pairing defects, such as abasic sites and mismatched base pairs, with the aim to interfere with the DNA repair and the template function of the DNA. However, the affinity and selectivity (with respect to well-matched DNA) of these ligands has barely been evaluated in a systematic way. Herein, we report a comparative study of binding affinity and selectivity of a representative panel of 16 ligands targeting abasic sites and a T-T mismatch in DNA, using a fluorescence-monitored melting assay. We demonstrate that bisintercalator-type macrocyclic ligands are characterized by moderate affinity but exceptionally high selectivity with respect to well-matched DNA, whereas other reported ligands show either modest selectivity or rather low affinity in identical conditions.

  4. Enhanced thermal stability and mismatch discrimination of mutation-carrying DNA duplexes and their kinetic and thermodynamic properties in microchannel laminar flow.

    PubMed

    Nagata, Maria Portia B; Yamashita, Kenichi; Miyazaki, Masaya; Nakamura, Hiroyuki; Maeda, Hideaki

    2009-07-01

    This article reports the enhancement of thermal stability involving normal duplex and mutation-carrying DNA duplexes in microchannel laminar flow. The application of an in-house temperature-controllable microchannel-type flow cell is demonstrated for improved discrimination of mismatch base pairs such as A-G and T-G that are difficult to distinguish due to the rather small thermal destabilizations. Enhancement in thermal stability is reflected by an increased thermal melting temperature achieved in microchannel laminar flow as compared with batch reactions. To examine the kinetics and thermodynamics of duplex-coil equilibrium of DNA oligomers, denaturation-renaturation hysteresis curves were measured. The influence of microchannel laminar flow on DNA base mismatch analysis was described from the kinetic and thermodynamic perspectives. An increasing trend was observed for association rate constant as flow rate increased. In contrast, an apparent decrease in dissociation rate constant was observed with increasing flow rate. The magnitudes of the activation energies of dissociation were nearly constant for both the batch and microchannel laminar flow systems at all flow rates. In contrast, the magnitudes of activation energies of association decreased as flow rate increased. These results clearly show how microchannel laminar flow induces change in reaction rate by effecting change in activation energy. We anticipate, therefore, that this approach based on microchannel laminar flow system holds great promise for improved mismatch discrimination in DNA analyses, particularly on single-base-pair mismatch, by pronouncedly enhancing thermal stability.

  5. Dynamic DNA devices and assemblies formed by shape-complementary, non-base pairing 3D components.

    PubMed

    Gerling, Thomas; Wagenbauer, Klaus F; Neuner, Andrea M; Dietz, Hendrik

    2015-03-27

    We demonstrate that discrete three-dimensional (3D) DNA components can specifically self-assemble in solution on the basis of shape-complementarity and without base pairing. Using this principle, we produced homo- and heteromultimeric objects, including micrometer-scale one- and two-stranded filaments and lattices, as well as reconfigurable devices, including an actuator, a switchable gear, an unfoldable nanobook, and a nanorobot. These multidomain assemblies were stabilized via short-ranged nucleobase stacking bonds that compete against electrostatic repulsion between the components' interfaces. Using imaging by electron microscopy, ensemble and single-molecule fluorescence resonance energy transfer spectroscopy, and electrophoretic mobility analysis, we show that the balance between attractive and repulsive interactions, and thus the conformation of the assemblies, may be finely controlled by global parameters such as cation concentration or temperature and by an allosteric mechanism based on strand-displacement reactions.

  6. Dynamic DNA devices and assemblies formed by shape-complementary, non-base pairing 3D components

    NASA Astrophysics Data System (ADS)

    Gerling, Thomas; Wagenbauer, Klaus F.; Neuner, Andrea M.; Dietz, Hendrik

    2015-03-01

    We demonstrate that discrete three-dimensional (3D) DNA components can specifically self-assemble in solution on the basis of shape-complementarity and without base pairing. Using this principle, we produced homo- and heteromultimeric objects, including micrometer-scale one- and two-stranded filaments and lattices, as well as reconfigurable devices, including an actuator, a switchable gear, an unfoldable nanobook, and a nanorobot. These multidomain assemblies were stabilized via short-ranged nucleobase stacking bonds that compete against electrostatic repulsion between the components’ interfaces. Using imaging by electron microscopy, ensemble and single-molecule fluorescence resonance energy transfer spectroscopy, and electrophoretic mobility analysis, we show that the balance between attractive and repulsive interactions, and thus the conformation of the assemblies, may be finely controlled by global parameters such as cation concentration or temperature and by an allosteric mechanism based on strand-displacement reactions.

  7. Kinetics and Thermodynamics of Watson-Crick Base Pairing Driven DNA Origami Dimerization.

    PubMed

    Zenk, John; Tuntivate, Chanon; Schulman, Rebecca

    2016-03-16

    We investigate the kinetics and thermodynamics of DNA origami dimerization using flat rectangle origami components and different architectures of Watson-Crick complementary single-stranded DNA ("sticky end") linking strategies. We systematically vary the number of linkers, the length of the sticky ends on the linker, and linker architecture and measure the corresponding yields as well as forward and reverse reaction rate constants through fluorescence quenching assays. Yields were further verified using atomic force microscopy. We calculate values of H° and ΔS° for various interface designs and find nonlinear van't Hoff behavior, best described by two linear equations, suggesting distinct regimes of dimerization between those with and those without well-formed interfaces. We find that self-assembly reactions can be tuned by manipulating the interface architecture without suffering a loss in yield, even when yield is high, ∼75-80%. We show that the second-order forward reaction rate constant (k(on)) depends on both linker architecture and number of linkers used, with typical values on the order of 10(5)-10(6) (M·s)(-1), values that are similar to those of bimolecular association of small, complementary DNA strands. The k(on) values are generally non-Arrhenius, tending to increase with decreasing temperature. Finally, we use kinetic and thermodynamic information about the optimal linking architecture to extend the system to an infinite, two-component repeating lattice system and show that we can form micron-sized lattices, with well-formed structures up to 8 μm(2).

  8. Electronic structure of an anticancer drug DC81 and its interaction with DNA base pairs

    NASA Astrophysics Data System (ADS)

    Tiwari, Gargi; Sharma, Dipendra; Dwivedi, K. K.; Dwivedi, M. K.

    2016-05-01

    The drug, 8-Hydroxy-7-methoxy-pyrrolo-[2,1-c][1,4] benzodiazepine-5-one, commonly christened as DC81 belongs to the pyrrolo-[2,1-c][1,4]benzodiazepine (PBDs) family. It is a member of the group of naturally occurring antitumour antibiotics produced by various Streptomyces species. The antitumour activity of DC81 is attributed to its sequence specific interaction with G-C rich DNA region in particular, for Pu-G-Pu motifs. In the present paper, physico-chemical properties DC81 have been carried out using an ab-initio method, HF/6-31G(d,p) with GAMESS program. MEP, HOMO and LUMO surfaces have been scanned. Ionization potential, electron affinity, electronegativity, global hardness and softness of the drug have been calculated. Further, drug-DNA interactions have been examined using modified second order perturbation theory along with multicentred-multipole expansion technique. Results have been discussed in the light of other theoretical and experimental observations. Efforts have been made to elucidate the binding patterns and thereby biological properties of the drug.

  9. Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.

    PubMed

    Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T

    2016-05-05

    Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.

  10. O⁶-carboxymethylguanine in DNA forms a sequence context-dependent wobble base-pair structure with thymine.

    PubMed

    Zhang, Fang; Tsunoda, Masaru; Kikuchi, Yuji; Wilkinson, Oliver; Millington, Christopher L; Margison, Geoffrey P; Williams, David M; Takénaka, Akio

    2014-06-01

    N-Nitrosation of glycine and its derivatives generates potent alkylating agents that can lead to the formation of O(6)-carboxymethylguanine (O(6)-CMG) in DNA. O(6)-CMG has been identified in DNA derived from human colon tissue and its occurrence has been linked to diets high in red and processed meats, implying an association with the induction of colorectal cancer. By analogy to O(6)-methylguanine, O(6)-CMG is expected to be mutagenic, inducing G-to-A mutations that may be the molecular basis of increased cancer risk. Previously, the crystal structure of the DNA dodecamer d(CGCG[O(6)-CMG]ATTCGCG) has been reported, in which O(6)-CMG forms a Watson-Crick-type pair with thymine similar to the canonical A:T pair. In order to further investigate the versatility of O(6)-CMG in base-pair formation, the structure of the DNA dodecamer d(CGC[O(6)-CMG]AATTTGCG) containing O(6)-CMG at a different position has been determined by X-ray crystallography using four crystal forms obtained under conditions containing different solvent ions (Sr(2+), Ba(2+), Mg(2+), K(+) or Na(+)) with and without Hoechst 33258. The most striking finding is that the pairing modes of O(6)-CMG with T are quite different from those previously reported. In the present dodecamer, the T bases are displaced (wobbled) into the major groove to form a hydrogen bond between the thymine N(3) N-H and the carboxyl group of O(6)-CMG. In addition, a water molecule is bridged through two hydrogen bonds between the thymine O(2) atom and the 2-amino group of O(6)-CMG to stabilize the pairing. These interaction modes commonly occur in the four crystal forms, regardless of the differences in crystallization conditions. The previous and the present results show that O(6)-CMG can form a base pair with T in two alternative modes: the Watson-Crick type and a high-wobble type, the nature of which may depend on the DNA-sequence context.

  11. Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

    PubMed

    Kryachko, E S; Remacle, F

    2005-12-08

    The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

  12. Evaluation of binding selectivity of a polyamide probe to single base-pair different DNA in A.T-rich region by electrospray ionization mass spectrometry.

    PubMed

    Li, Huihui; Yuan, Gu

    2006-12-01

    In this study, electrospray ionization mass spectrometry (ESI-MS) was used for the evaluation of the binding selectivity of a polyamide probe to single-base pair different DNA in an A.T-rich region. In this procedure, DeltaIr(dsn) was introduced as a parameter to compare the binding affinities of the polyamides with the duplex DNA. The results show that ESI-MS is a very useful tool for analysis of binding selectivity of a polyamide probe to single-base pair different DNA.

  13. Dynamic control of strand excision during human DNA mismatch repair.

    PubMed

    Jeon, Yongmoon; Kim, Daehyung; Martín-López, Juana V; Lee, Ryanggeun; Oh, Jungsic; Hanne, Jeungphill; Fishel, Richard; Lee, Jong-Bong

    2016-03-22

    Mismatch repair (MMR) is activated by evolutionarily conserved MutS homologs (MSH) and MutL homologs (MLH/PMS). MSH recognizes mismatched nucleotides and form extremely stable sliding clamps that may be bound by MLH/PMS to ultimately authorize strand-specific excision starting at a distant 3'- or 5'-DNA scission. The mechanical processes associated with a complete MMR reaction remain enigmatic. The purified human (Homo sapien or Hs) 5'-MMR excision reaction requires the HsMSH2-HsMSH6 heterodimer, the 5' → 3' exonuclease HsEXOI, and the single-stranded binding heterotrimer HsRPA. The HsMLH1-HsPMS2 heterodimer substantially influences 5'-MMR excision in cell extracts but is not required in the purified system. Using real-time single-molecule imaging, we show that HsRPA or Escherichia coli EcSSB restricts HsEXOI excision activity on nicked or gapped DNA. HsMSH2-HsMSH6 activates HsEXOI by overcoming HsRPA/EcSSB inhibition and exploits multiple dynamic sliding clamps to increase tract length. Conversely, HsMLH1-HsPMS2 regulates tract length by controlling the number of excision complexes, providing a link to 5' MMR.

  14. 2',4'-BNA bearing a chiral guanidinopyrrolidine-containing nucleobase with potent ability to recognize the CG base pair in a parallel-motif DNA triplex.

    PubMed

    Hari, Yoshiyuki; Akabane, Masaaki; Obika, Satoshi

    2013-08-28

    In order to expand the target sequence used in triplex DNA formation, seven novel nucleotide analogues were synthesized and incorporated into triplex-forming oligonucleotides by post-elongation modification approaches. Among them, , equipped with a suitable restricted conformation of sugar and nucleobase moieties, was found to have the highest sequence-selectivity and affinity towards CG base pairs within double-stranded DNA.

  15. LNA modification of single-stranded DNA oligonucleotides allows subtle gene modification in mismatch-repair-proficient cells.

    PubMed

    van Ravesteyn, Thomas W; Dekker, Marleen; Fish, Alexander; Sixma, Titia K; Wolters, Astrid; Dekker, Rob J; Te Riele, Hein P J

    2016-04-12

    Synthetic single-stranded DNA oligonucleotides (ssODNs) can be used to generate subtle genetic modifications in eukaryotic and prokaryotic cells without the requirement for prior generation of DNA double-stranded breaks. However, DNA mismatch repair (MMR) suppresses the efficiency of gene modification by >100-fold. Here we present a commercially available ssODN design that evades MMR and enables subtle gene modification in MMR-proficient cells. The presence of locked nucleic acids (LNAs) in the ssODNs at mismatching bases, or also at directly adjacent bases, allowed 1-, 2-, or 3-bp substitutions in MMR-proficient mouse embryonic stem cells as effectively as in MMR-deficient cells. Additionally, in MMR-proficient Escherichia coli, LNA modification of the ssODNs enabled effective single-base-pair substitution. In vitro, LNA modification of mismatches precluded binding of purified E. coli MMR protein MutS. These findings make ssODN-directed gene modification particularly well suited for applications that require the evaluation of a large number of sequence variants with an easy selectable phenotype.

  16. LNA modification of single-stranded DNA oligonucleotides allows subtle gene modification in mismatch-repair-proficient cells

    PubMed Central

    van Ravesteyn, Thomas W.; Dekker, Marleen; Fish, Alexander; Sixma, Titia K.; Wolters, Astrid; Dekker, Rob J.; te Riele, Hein P. J.

    2016-01-01

    Synthetic single-stranded DNA oligonucleotides (ssODNs) can be used to generate subtle genetic modifications in eukaryotic and prokaryotic cells without the requirement for prior generation of DNA double-stranded breaks. However, DNA mismatch repair (MMR) suppresses the efficiency of gene modification by >100-fold. Here we present a commercially available ssODN design that evades MMR and enables subtle gene modification in MMR-proficient cells. The presence of locked nucleic acids (LNAs) in the ssODNs at mismatching bases, or also at directly adjacent bases, allowed 1-, 2-, or 3-bp substitutions in MMR-proficient mouse embryonic stem cells as effectively as in MMR-deficient cells. Additionally, in MMR-proficient Escherichia coli, LNA modification of the ssODNs enabled effective single-base-pair substitution. In vitro, LNA modification of mismatches precluded binding of purified E. coli MMR protein MutS. These findings make ssODN-directed gene modification particularly well suited for applications that require the evaluation of a large number of sequence variants with an easy selectable phenotype. PMID:26951689

  17. Probing the interactions of the solvated electron with DNA by molecular dynamics simulations: II. bromodeoxyuridine-thymidine mismatched DNA.

    PubMed

    Gantchev, Tsvetan G; Hunting, Darel J

    2009-01-01

    The interaction of solvated electrons (e(-)(aq)) with DNA results in various types of DNA lesions. The in vitro and in vivo sensitisation of DNA to (e(-)(aq))-induced damage is achieved by incorporation of the electron-affinity radiosensitiser bromodeoxyuridine (BUdR) in place of thymidine. However, in DNA duplexes containing single-stranded regions (bulged BUdR-DNA), the type of lesion is different and the efficiency of damage is enhanced. In particular, DNA interstrand crosslinks (ICL) form at high efficiency in bulged DNA but are not detectable in completely duplex DNA. Knowledge about the processes and interactions leading to these differences is obscure. Previously, we addressed the problem by applying molecular modelling and molecular dynamics (MD) simulations to a system of normal (BUdR.A)-DNA and a hydrated electron, where the excess electron was modelled as a localised e(-)(H2O6) anionic cluster. The goal of the present study was to apply the same MD simulation to a wobble DNA-e(-)(aq) system, containing a pyrimidine-pyrimidine mismatched base pair, BUdR.T. The results show an overall dynamic pattern similar to that of the e(-)(aq) motion around normal DNA. However, the number of configuration states when e(-)(aq)) was particularly close to DNA is different. Moreover, in the (BUdR.T)-wobble DNA system, the electron frequently approaches the brominated strand, including BUdR, which was not observed with the normal (BUdR.A)-DNA. The structure and exchange of water at the sites of e(-)(aq) immobilisation near DNA were also characterised. The structural dynamics of the wobble DNA is prone to more extensive perturbations, including frequent formation of cross-strand (cs) interatomic contacts. The structural deviations correlated with e(-)(aq) approaching DNA from the major groove side, with sodium ions trapped deep in the minor groove. Altogether, the obtained results confirm and/or throw light on dynamic-structure determinants possibly responsible for the

  18. Solution structure of DAPI selectively bound in the minor groove of a DNA T.T mismatch-containing site: NMR and molecular dynamics studies.

    PubMed Central

    Trotta, E; Paci, M

    1998-01-01

    The solution structure of the complex between 4', 6-diamidino-2-phenylindole (DAPI) and DNA oligomer [d(GCGATTCGC)]2, containing a central T.T mismatch, has been characterized by combined use of proton one- and two-dimensional NMR spectroscopy, molecular mechanics and molecular dynamics computations including relaxation matrix refinement. The results show that the DAPI molecule binds in the minor groove of the central region 5'-ATT-3' of the DNA oligomer, which predominantly adopts a duplex structure with a global right-handed B-like conformation. In the final models of the complex, the DAPI molecule is located nearly isohelical with its NH indole proton oriented towards the DNA helix axis and forming a bifurcated hydrogen bond with the carbonyl O2 groups of a mismatched T5 and the T6 residue of the opposite strand. Mismatched thymines adopt a wobble base pair conformation and are found stacked between the flanking base pairs, inducing only minor local conformational changes in global duplex structure. In addition, no other binding mechanisms were observed, showing that minor groove binding of DAPI to the mismatch-containing site is favoured in comparison with any other previously reported interaction with G.C sequences. PMID:9753740

  19. Structural variability and the nature of intermolecular interactions in Watson-Crick B-DNA base pairs.

    PubMed

    Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J

    2010-07-29

    A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the

  20. Efficient and sequence-independent replication of DNA containing a third base pair establishes a functional six-letter genetic alphabet.

    PubMed

    Malyshev, Denis A; Dhami, Kirandeep; Quach, Henry T; Lavergne, Thomas; Ordoukhanian, Phillip; Torkamani, Ali; Romesberg, Floyd E

    2012-07-24

    The natural four-letter genetic alphabet, comprised of just two base pairs (dA-dT and dG-dC), is conserved throughout all life, and its expansion by the development of a third, unnatural base pair has emerged as a central goal of chemical and synthetic biology. We recently developed a class of candidate unnatural base pairs, exemplified by the pair formed between d5SICS and dNaM. Here, we examine the PCR amplification of DNA containing one or more d5SICS-dNaM pairs in a wide variety of sequence contexts. Under standard conditions, we show that this DNA may be amplified with high efficiency and greater than 99.9% fidelity. To more rigorously explore potential sequence effects, we used deep sequencing to characterize a library of templates containing the unnatural base pair as a function of amplification. We found that the unnatural base pair is efficiently replicated with high fidelity in virtually all sequence contexts. The results show that, for PCR and PCR-based applications, d5SICS-dNaM is functionally equivalent to a natural base pair, and when combined with dA-dT and dG-dC, it provides a fully functional six-letter genetic alphabet.

  1. Density functional theory investigation of interaction of zigzag (7,0) single-walled carbon nanotube with Watson-Crick DNA base pairs

    NASA Astrophysics Data System (ADS)

    Shukla, Manoj K.; Dubey, Madan; Zakar, Eugene; Namburu, Raju; Leszczynski, Jerzy

    2010-08-01

    A first-principles investigation of interaction of DNA base pairs on the outer surface of zigzag (7,0) single-walled carbon nanotube (CNT) was carried out at the M05-2X/6-31G(d) level of geometry optimization and BSSE corrected interaction energy calculation using the same theoretical level and the 6-311G(d,p), cc-pVDZ and cc-pVTZ basis sets. Study revealed that CNT forms complexes of similar strength with both base pairs. Electron density maps suggest that complexes are characterized by stacking interaction through coupling of π-charge clouds of base pairs and CNT. BSSE corrected interaction energies and density of states calculations indicated the weak nature of interaction between base pairs and CNT.

  2. Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

    PubMed

    Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

    2016-05-17

    The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures.

  3. Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

    PubMed

    Hwang, Hanshin; Taylor, John-Stephen

    2005-03-29

    We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the

  4. Type I-E CRISPR-cas systems discriminate target from non-target DNA through base pairing-independent PAM recognition.

    PubMed

    Westra, Edze R; Semenova, Ekaterina; Datsenko, Kirill A; Jackson, Ryan N; Wiedenheft, Blake; Severinov, Konstantin; Brouns, Stan J J

    2013-01-01

    Discriminating self and non-self is a universal requirement of immune systems. Adaptive immune systems in prokaryotes are centered around repetitive loci called CRISPRs (clustered regularly interspaced short palindromic repeat), into which invader DNA fragments are incorporated. CRISPR transcripts are processed into small RNAs that guide CRISPR-associated (Cas) proteins to invading nucleic acids by complementary base pairing. However, to avoid autoimmunity it is essential that these RNA-guides exclusively target invading DNA and not complementary DNA sequences (i.e., self-sequences) located in the host's own CRISPR locus. Previous work on the Type III-A CRISPR system from Staphylococcus epidermidis has demonstrated that a portion of the CRISPR RNA-guide sequence is involved in self versus non-self discrimination. This self-avoidance mechanism relies on sensing base pairing between the RNA-guide and sequences flanking the target DNA. To determine if the RNA-guide participates in self versus non-self discrimination in the Type I-E system from Escherichia coli we altered base pairing potential between the RNA-guide and the flanks of DNA targets. Here we demonstrate that Type I-E systems discriminate self from non-self through a base pairing-independent mechanism that strictly relies on the recognition of four unchangeable PAM sequences. In addition, this work reveals that the first base pair between the guide RNA and the PAM nucleotide immediately flanking the target sequence can be disrupted without affecting the interference phenotype. Remarkably, this indicates that base pairing at this position is not involved in foreign DNA recognition. Results in this paper reveal that the Type I-E mechanism of avoiding self sequences and preventing autoimmunity is fundamentally different from that employed by Type III-A systems. We propose the exclusive targeting of PAM-flanked sequences to be termed a target versus non-target discrimination mechanism.

  5. Dynamic basis for one-dimensional DNA scanning by the mismatch repair complex Msh2-Msh6.

    PubMed

    Gorman, Jason; Chowdhury, Arindam; Surtees, Jennifer A; Shimada, Jun; Reichman, David R; Alani, Eric; Greene, Eric C

    2007-11-09

    The ability of proteins to locate specific sites or structures among a vast excess of nonspecific DNA is a fundamental theme in biology. Yet the basic principles that govern these mechanisms remain poorly understood. For example, mismatch repair proteins must scan millions of base pairs to find rare biosynthetic errors, and they then must probe the surrounding region to identify the strand discrimination signals necessary to distinguish the parental and daughter strands. To determine how these proteins might function we used single-molecule optical microscopy to answer the following question: how does the mismatch repair complex Msh2-Msh6 interrogate undamaged DNA? Here we show that Msh2-Msh6 slides along DNA via one-dimensional diffusion. These findings indicate that interactions between Msh2-Msh6 and DNA are dominated by lateral movement of the protein along the helical axis and have implications for how MutS family members travel along DNA at different stages of the repair reaction.

  6. Reply to Comment on 'Excited states of DNA base pairs using long-range corrected time-dependent density functional theory

    SciTech Connect

    Jensen, Lasse; Govind, Niranjan

    2009-09-18

    In this work we present a study of the excitation energies of adenine, cytosine, guanine, thymine and the adenine-thymine (AT) and guanine-cytosine (GC) base pairs using long-range corrected (LC) density functional theory. We compare three recent LC-functionals, BNL, CAM-B3LYP and LC-PBE0 with B3LYP and coupled cluster results from the literature. We find that the best overall performance is for the BNL functional based on LDA. However, in order to achieve this good agreement a smaller attenuation parameter was needed which leads to non-optimum performance for ground state properties. B3LYP, on the other hand, severely underestimates the charge transfer (CT) transitions in the base pairs. Surprisingly we also find that the CAM-B3LYP functional also underestimates the CT excitation energy for the GC base pair, but correctly describes the AT base pair. This illustrates the importance of retaining the full long-range exact exchange even at distances as short as that of the DNA base pairs. The worst overall performance was obtained with the LC-PBE0 functional which overestimates the excitations for the individual bases as well as the base pairs. It is therefore crucial to strike a good balance between the amount of local and long-range exact exchange.

  7. Mismatch Repair Balances Leading and Lagging Strand DNA Replication Fidelity

    DTIC Science & Technology

    2012-10-11

    the most deleterious mismatches (i.e., indel mismatches). Within classes of similar deleterious potential (base-base mismatches), evolution has...spontaneous mutation rates and the sequencing of URA3 mutants were as previously described [2,13,21], save that MSH2 was deleted from haploid pol2

  8. Base pair sensitivity and enhanced ON/OFF ratios of DNA-binding: donor-acceptor-donor fluorophores.

    PubMed

    Wilson, James N; Wigenius, Jens; Pitter, Demar R G; Qiu, Yanhua; Abrahamsson, Maria; Westerlund, Fredrik

    2013-10-10

    The photophysical properties of two recently reported live cell compatible, DNA-binding dyes, 4,6-bis(4-(4-methylpiperazin-1-yl)phenyl)pyrimidin-2-ol, 1, and [1,3-bis[4-(4-methylpiperazin-1-yl)phenyl]-1,3-propandioato-κO, κO']difluoroboron, 2, are characterized. Both dyes are quenched in aqueous solutions, while binding to sequences containing only AT pairs enhances the emission. Binding of the dyes to sequences containing only GC pairs does not produce a significant emission enhancement, and for sequences containing both AT and GC base pairs, emission is dependent on the length of the AT pair tracts. Through emission lifetime measurements and analysis of the dye redox potentials, photoinduced electron transfer with GC pairs is implicated as a quenching mechanism. Binding of the dyes to AT-rich regions is accompanied by bathochromic shifts of 26 and 30 nm, respectively. Excitation at longer wavelengths thus increases the ON/OFF ratio of the bound probes significantly and provides improved contrast ratios in solution as well as in fluorescence microscopy of living cells.

  9. Evolutionary Covariance Combined with Molecular Dynamics Predicts a Framework for Allostery in the MutS DNA Mismatch Repair Protein

    PubMed Central

    2017-01-01

    Mismatch repair (MMR) is an essential, evolutionarily conserved pathway that maintains genome stability by correcting base-pairing errors in DNA. Here we examine the sequence and structure of MutS MMR protein to decipher the amino acid framework underlying its two key activities—recognizing mismatches in DNA and using ATP to initiate repair. Statistical coupling analysis (SCA) identified a network (sector) of coevolved amino acids in the MutS protein family. The potential functional significance of this SCA sector was assessed by performing molecular dynamics (MD) simulations for alanine mutants of the top 5% of 160 residues in the distribution, and control nonsector residues. The effects on three independent metrics were monitored: (i) MutS domain conformational dynamics, (ii) hydrogen bonding between MutS and DNA/ATP, and (iii) relative ATP binding free energy. Each measure revealed that sector residues contribute more substantively to MutS structure–function than nonsector residues. Notably, sector mutations disrupted MutS contacts with DNA and/or ATP from a distance via contiguous pathways and correlated motions, supporting the idea that SCA can identify amino acid networks underlying allosteric communication. The combined SCA/MD approach yielded novel, experimentally testable hypotheses for unknown roles of many residues distributed across MutS, including some implicated in Lynch cancer syndrome. PMID:28135092

  10. DnaN clamp zones provide a platform for spatiotemporal coupling of mismatch detection to DNA replication.

    PubMed

    Lenhart, Justin S; Sharma, Anushi; Hingorani, Manju M; Simmons, Lyle A

    2013-02-01

    Mismatch repair (MMR) increases the fidelity of DNA replication by identifying and correcting replication errors. Processivity clamps are vital components of DNA replication and MMR, yet the mechanism and extent to which they participate in MMR remains unclear. We investigated the role of the Bacillus subtilis processivity clamp DnaN, and found that it serves as a platform for mismatch detection and coupling of repair to DNA replication. By visualizing functional MutS fluorescent fusions in vivo, we find that MutS forms foci independent of mismatch detection at sites of replication (i.e. the replisome). These MutS foci are directed to the replisome by DnaN clamp zones that aid mismatch detection by targeting the search to nascent DNA. Following mismatch detection, MutS disengages from the replisome, facilitating repair. We tested the functional importance of DnaN-mediated mismatch detection for MMR, and found that it accounts for 90% of repair. This high dependence on DnaN can be bypassed by increasing MutS concentration within the cell, indicating a secondary mode of detection in vivo whereby MutS directly finds mismatches without associating with the replisome. Overall, our results provide new insight into the mechanism by which DnaN couples mismatch recognition to DNA replication in living cells.

  11. Novel DNA mismatch-repair activity involving YB-1 in human mitochondria.

    PubMed

    de Souza-Pinto, Nadja C; Mason, Penelope A; Hashiguchi, Kazunari; Weissman, Lior; Tian, Jingyan; Guay, David; Lebel, Michel; Stevnsner, Tinna V; Rasmussen, Lene Juel; Bohr, Vilhelm A

    2009-06-04

    Maintenance of the mitochondrial genome (mtDNA) is essential for proper cellular function. The accumulation of damage and mutations in the mtDNA leads to diseases, cancer, and aging. Mammalian mitochondria have proficient base excision repair, but the existence of other DNA repair pathways is still unclear. Deficiencies in DNA mismatch repair (MMR), which corrects base mismatches and small loops, are associated with DNA microsatellite instability, accumulation of mutations, and cancer. MMR proteins have been identified in yeast and coral mitochondria; however, MMR proteins and function have not yet been detected in human mitochondria. Here we show that human mitochondria have a robust mismatch-repair activity, which is distinct from nuclear MMR. Key nuclear MMR factors were not detected in mitochondria, and similar mismatch-binding activity was observed in mitochondrial extracts from cells lacking MSH2, suggesting distinctive pathways for nuclear and mitochondrial MMR. We identified the repair factor YB-1 as a key candidate for a mitochondrial mismatch-binding protein. This protein localizes to mitochondria in human cells, and contributes significantly to the mismatch-binding and mismatch-repair activity detected in HeLa mitochondrial extracts, which are significantly decreased when the intracellular levels of YB-1 are diminished. Moreover, YB-1 depletion in cells increases mitochondrial DNA mutagenesis. Our results show that human mitochondria contain a functional MMR repair pathway in which YB-1 participates, likely in the mismatch-binding and recognition steps.

  12. Biasing Simulations of DNA Base Pair Parameters with Application to Propellor Twisting in AT/AT, AA/TT, and AC/GT Steps and Their Uracil Analogs.

    PubMed

    Peguero-Tejada, Alfredo; van der Vaart, Arjan

    2017-01-23

    An accurate and efficient implementation of the six DNA base pair parameters as order parameters for enhanced sampling simulations is presented. The parameter definitions are defined by vector algebra operations on a reduced atomic set of the base pair, and correlate very well with standard definitions. Application of the model is illustrated by umbrella sampling simulations of propeller twisting within AT/AT, AA/TT, and AC/GT steps and their uracil analogs. Strong correlations are found between propeller twisting and a number of conformational parameters, including buckle, opening, BI/BII backbone configuration, and sugar puckering. The thymine methyl group is observed to notably alter the local conformational free energy landscape, with effects within and directly upstream of the thymine containing base pair.

  13. The mismatched nucleotides in the 5'-terminal hairpin of minute virus of mice are required for efficient viral DNA replication.

    PubMed Central

    Costello, E; Sahli, R; Hirt, B; Beard, P

    1995-01-01

    The 5'-terminal sequence in the DNA of the parvovirus minute virus of mice (MVM) is a palindrome. It can form a hairpin, the stem of which is entirely base-paired except for three consecutive unpaired nucleotides which form a bubble. Since this structure is well conserved among different parvoviruses, we examined its importance for viral replication by generating MVM mutants with alterations in this region. A clone of MVMp DNA which contained the entire 3' end and more than half of the 5' palindrome was made. Although it lacked the sequence information to form a wild-type bubble, this DNA was infectious. On transfection into A9 fibroblasts, it gave rise to a virus (MVMs) which had a bubble in its 5' palindrome. The bubble consisted of four mismatched nucleotides in the same location as the unpaired nucleotides of the wild-type palindrome. Apparently, neighboring plasmid sequences were incorporated into the viral DNA, enabling formation of the mismatch. This observation suggested that a bubble is critical for growth of MVM but that its sequence is not. To find out whether MVM lacking a bubble in the 5' palindrome is viable, we made a second clone in which the plasmid sequences incorporated in MVMs were removed. Transfection of this DNA gave rise to a virus (MVMx) in which the nucleotides unpaired in the wild-type hairpin are now fully base-paired. Although MVMx can be propagated, it is defective in comparison with wild-type MVMp; it exhibited about a 50-fold-lower ratio of plaque-forming units to DNA content. In mixed infections, MVMp consistently outgrew the bubbleless MVMx. The rate of accumulation of DNA replication intermediates was lower for MVMx than for the wild-type virus. Quantitative analysis of the 5' termini of replicative form DNA suggested that the ability of MVMx to convert hairpin 5' termini to extended termini is impaired. In contrast, the virus with the altered bubble, MVMs, behaved like the wild-type MVMp in all the assays. We conclude that MVM

  14. Mouse models of DNA mismatch repair in cancer research

    PubMed Central

    Lee, Kyeryoung; Tosti, Elena; Edelmann, Winfried

    2016-01-01

    Germline mutations in DNA mismatch repair (MMR) genes are the cause of hereditary non-polyposis colorectal cancer/Lynch syndrome (HNPCC/LS) one of the most common cancer predisposition syndromes, and defects in MMR are also prevalent in sporadic colorectal cancers. In the past, the generation and analysis of mouse lines with knockout mutations in all of the known MMR genes has provided insight into how loss of individual MMR genes affects genome stability and contributes to cancer susceptibility. These studies also revealed essential functions for some of the MMR genes in B cell maturation and fertility. In this review, we will provide a brief overview of the cancer predisposition phenotypes of recently developed mouse models with targeted mutations in MutS and MutL homologs (Msh and Mlh, respectively) and their utility as preclinical models. The focus will be on mouse lines with conditional MMR mutations that have allowed more accurate modeling of human cancer syndromes in mice and that together with new technologies in gene targeting, hold great promise for the analysis of MMR-deficient intestinal tumors and other cancers which will drive the development of preventive and therapeutic treatment strategies. PMID:26708047

  15. Mouse models of DNA mismatch repair in cancer research.

    PubMed

    Lee, Kyeryoung; Tosti, Elena; Edelmann, Winfried

    2016-02-01

    Germline mutations in DNA mismatch repair (MMR) genes are the cause of hereditary non-polyposis colorectal cancer/Lynch syndrome (HNPCC/LS) one of the most common cancer predisposition syndromes, and defects in MMR are also prevalent in sporadic colorectal cancers. In the past, the generation and analysis of mouse lines with knockout mutations in all of the known MMR genes has provided insight into how loss of individual MMR genes affects genome stability and contributes to cancer susceptibility. These studies also revealed essential functions for some of the MMR genes in B cell maturation and fertility. In this review, we will provide a brief overview of the cancer predisposition phenotypes of recently developed mouse models with targeted mutations in MutS and MutL homologs (Msh and Mlh, respectively) and their utility as preclinical models. The focus will be on mouse lines with conditional MMR mutations that have allowed more accurate modeling of human cancer syndromes in mice and that together with new technologies in gene targeting, hold great promise for the analysis of MMR-deficient intestinal tumors and other cancers which will drive the development of preventive and therapeutic treatment strategies.

  16. NMR structure of duplex DNA containing the alpha-OH-PdG.dA base pair: a mutagenic intermediate of acrolein.

    PubMed

    Zaliznyak, Tanya; Lukin, Mark; El-khateeb, Mahmoud; Bonala, Rahda; Johnson, Francis; de los Santos, Carlos

    2010-04-01

    Acrolein, a cell metabolic product and main component of cigarette smoke, reacts with DNA generating alpha-OH-PdG lesions, which have the ability to pair with dATP during replication thereby causing G to T transversions. We describe the solution structure of an 11-mer DNA duplex containing the mutagenic alpha-OH-PdG.dA base pair intermediate, as determined by solution nuclear magnetic resonance (NMR) spectroscopy and retrained molecular dynamics (MD) simulations. The NMR data support a mostly regular right-handed helix that is only perturbed at its center by the presence of the lesion. Undamaged residues of the duplex are in anti orientation, forming standard Watson-Crick base pairs alignments. Duplication of proton signals at and near the damaged base pair reveals the presence of two enantiomeric duplexes, thus establishing the exocyclic nature of the lesion. The alpha-OH-PdG adduct assumes a syn conformation pairing to its partner dA base that is protonated at pH 6.6. The three-dimensional structure obtained by restrained molecular dynamics simulations show hydrogen bond interactions that stabilize alpha-OH-PdG in a syn conformation and across the lesion containing base pair. We discuss the implications of the structures for the mutagenic bypass of acrolein lesions.

  17. Base pairing and base mis-pairing in nucleic acids

    NASA Technical Reports Server (NTRS)

    Wang, A. H. J.; Rich, A.

    1986-01-01

    In recent years we have learned that DNA is conformationally active. It can exist in a number of different stable conformations including both right-handed and left-handed forms. Using single crystal X-ray diffraction analysis we are able to discover not only additional conformations of the nucleic acids but also different types of hydrogen bonded base-base interactions. Although Watson-Crick base pairings are the predominant type of interaction in double helical DNA, they are not the only types. Recently, we have been able to examine mismatching of guanine-thymine base pairs in left-handed Z-DNA at atomic resolution (1A). A minimum amount of distortion of the sugar phosphate backbone is found in the G x T pairing in which the bases are held together by two hydrogen bonds in the wobble pairing interaction. Because of the high resolution of the analysis we can visualize water molecules which fill in to accommodate the other hydrogen bonding positions in the bases which are not used in the base-base interactions. Studies on other DNA oligomers have revealed that other types of non-Watson-Crick hydrogen bonding interactions can occur. In the structure of a DNA octamer with the sequence d(GCGTACGC) complexed to an antibiotic triostin A, it was found that the two central AT base pairs are held together by Hoogsteen rather than Watson-Crick base pairs. Similarly, the G x C base pairs at the ends are also Hoogsteen rather than Watson-Crick pairing. Hoogsteen base pairs make a modified helix which is distinct from the Watson-Crick double helix.

  18. Mismatch repair of heteroduplex DNA intermediates of extrachromosomal recombination in mammalian cells.

    PubMed Central

    Deng, W P; Nickoloff, J A

    1994-01-01

    Previous work indicated that extrachromosomal recombination in mammalian cells could be explained by the single-strand annealing (SSA) model. This model predicts that extrachromosomal recombination leads to nonconservative crossover products and that heteroduplex DNA (hDNA) is formed by annealing of complementary single strands. Mismatched bases in hDNA may subsequently be repaired to wild-type or mutant sequences, or they may remain unrepaired and segregate following DNA replication. We describe a system to examine the formation and mismatch repair of hDNA in recombination intermediates. Our results are consistent with extrachromosomal recombination occurring via SSA and producing crossover recombinant products. As predicted by the SSA model, hDNA was present in double-strand break-induced recombination intermediates. By placing either silent or frameshift mutations in the predicted hDNA region, we have shown that mismatches are efficiently repaired prior to DNA replication. Images PMID:8264607

  19. Altering the Electrostatic Potential in the Major Groove: Thermodynamic and Structural Characterization of 7-Deaza-2;#8242;-deoxyadenosine:dT Base Pairing in DNA

    SciTech Connect

    Kowal, Ewa A.; Ganguly, Manjori; Pallan, Pradeep S.; Marky, Luis A.; Gold, Barry; Egli, Martin; Stone, Michael P.

    2012-02-15

    As part of an ongoing effort to explore the effect of major groove electrostatics on the thermodynamic stability and structure of DNA, a 7-deaza-2'-deoxyadenosine:dT (7-deaza-dA:dT) base pair in the Dickerson-Drew dodecamer (DDD) was studied. The removal of the electronegative N7 atom on dA and the replacement with an electropositive C-H in the major groove was expected to have a significant effect on major groove electrostatics. The structure of the 7-deaza-dA:dT base pair was determined at 1.1 {angstrom} resolution in the presence of Mg{sup 2+}. The 7-deaza-dA, which is isosteric for dA, had minimal effect on the base pairing geometry and the conformation of the DDD in the crystalline state. There was no major groove cation association with the 7-deaza-dA heterocycle. In solution, circular dichroism showed a positive Cotton effect centered at 280 nm and a negative Cotton effect centered at 250 nm that were characteristic of a right-handed helix in the B-conformation. However, temperature-dependent NMR studies showed increased exchange between the thymine N3 imino proton of the 7-deaza-dA:dT base pair and water, suggesting reduced stacking interactions and an increased rate of base pair opening. This correlated with the observed thermodynamic destabilization of the 7-deaza-dA modified duplex relative to the DDD. A combination of UV melting and differential scanning calorimetry experiments were conducted to evaluate the relative contributions of enthalpy and entropy in the thermodynamic destabilization of the DDD. The most significant contribution arose from an unfavorable enthalpy term, which probably results from less favorable stacking interactions in the modified duplex, which was accompanied by a significant reduction in the release of water and cations from the 7-deaza-dA modified DNA.

  20. Altering the electrostatic potential in the major groove: thermodynamic and structural characterization of 7-deaza-2'-deoxyadenosine:dT base pairing in DNA.

    PubMed

    Kowal, Ewa A; Ganguly, Manjori; Pallan, Pradeep S; Marky, Luis A; Gold, Barry; Egli, Martin; Stone, Michael P

    2011-12-01

    As part of an ongoing effort to explore the effect of major groove electrostatics on the thermodynamic stability and structure of DNA, a 7-deaza-2'-deoxyadenosine:dT (7-deaza-dA:dT) base pair in the Dickerson-Drew dodecamer (DDD) was studied. The removal of the electronegative N7 atom on dA and the replacement with an electropositive C-H in the major groove was expected to have a significant effect on major groove electrostatics. The structure of the 7-deaza-dA:dT base pair was determined at 1.1 Å resolution in the presence of Mg(2+). The 7-deaza-dA, which is isosteric for dA, had minimal effect on the base pairing geometry and the conformation of the DDD in the crystalline state. There was no major groove cation association with the 7-deaza-dA heterocycle. In solution, circular dichroism showed a positive Cotton effect centered at 280 nm and a negative Cotton effect centered at 250 nm that were characteristic of a right-handed helix in the B-conformation. However, temperature-dependent NMR studies showed increased exchange between the thymine N3 imino proton of the 7-deaza-dA:dT base pair and water, suggesting reduced stacking interactions and an increased rate of base pair opening. This correlated with the observed thermodynamic destabilization of the 7-deaza-dA modified duplex relative to the DDD. A combination of UV melting and differential scanning calorimetry experiments were conducted to evaluate the relative contributions of enthalpy and entropy in the thermodynamic destabilization of the DDD. The most significant contribution arose from an unfavorable enthalpy term, which probably results from less favorable stacking interactions in the modified duplex, which was accompanied by a significant reduction in the release of water and cations from the 7-deaza-dA modified DNA.

  1. 5-Methylation of cytosine in CG:CG base-pair steps: a physicochemical mechanism for the epigenetic control of DNA nanomechanics.

    PubMed

    Yusufaly, Tahir I; Li, Yun; Olson, Wilma K

    2013-12-27

    van der Waals density functional theory is integrated with analysis of a non-redundant set of protein-DNA crystal structures from the Nucleic Acid Database to study the stacking energetics of CG:CG base-pair steps, specifically the role of cytosine 5-methylation. Principal component analysis of the steps reveals the dominant collective motions to correspond to a tensile "opening" mode and two shear "sliding" and "tearing" modes in the orthogonal plane. The stacking interactions of the methyl groups globally inhibit CG:CG step overtwisting while simultaneously softening the modes locally via potential energy modulations that create metastable states. Additionally, the indirect effects of the methyl groups on possible base-pair steps neighboring CG:CG are observed to be of comparable importance to their direct effects on CG:CG. The results have implications for the epigenetic control of DNA mechanics.

  2. Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

    PubMed

    Brovarets, Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H

  3. Is thymidine glycol containing DNA a substrate of E. coli DNA mismatch repair system?

    PubMed

    Perevozchikova, Svetlana A; Trikin, Roman M; Heinze, Roger J; Romanova, Elena A; Oretskaya, Tatiana S; Friedhoff, Peter; Kubareva, Elena A

    2014-01-01

    The DNA mismatch repair (MMR) system plays a crucial role in the prevention of replication errors and in the correction of some oxidative damages of DNA bases. In the present work the most abundant oxidized pyrimidine lesion, 5,6-dihydro-5,6-dihydroxythymidine (thymidine glycol, Tg) was tested for being recognized and processed by the E. coli MMR system, namely complex of MutS, MutL and MutH proteins. In a partially reconstituted MMR system with MutS-MutL-MutH proteins, G/Tg and A/Tg containing plasmids failed to provoke the incision of DNA. Tg residue in the 30-mer DNA duplex destabilized double helix due to stacking disruption with neighboring bases. However, such local structural changes are not important for E. coli MMR system to recognize this lesion. A lack of repair of Tg containing DNA could be due to a failure of MutS (a first acting protein of MMR system) to interact with modified DNA in a proper way. It was shown that Tg in DNA does not affect on ATPase activity of MutS. On the other hand, MutS binding affinities to DNA containing Tg in G/Tg and A/Tg pairs are lower than to DNA with a G/T mismatch and similar to canonical DNA. Peculiarities of MutS interaction with DNA was monitored by Förster resonance energy transfer (FRET) and fluorescence anisotropy. Binding of MutS to Tg containing DNAs did not result in the formation of characteristic DNA kink. Nevertheless, MutS homodimer orientation on Tg-DNA is similar to that in the case of G/T-DNA. In contrast to G/T-DNA, neither G/Tg- nor A/Tg-DNA was able to stimulate ADP release from MutS better than canonical DNA. Thus, Tg residue in DNA is unlikely to be recognized or processed by the E. coli MMR system. Probably, the MutS transformation to active "sliding clamp" conformation on Tg-DNA is problematic.

  4. Synthesis of 5-[3-(2-aminopyrimidin-4-yl)aminopropyn-1-yl]uracil derivative that recognizes Ade-Thy base pairs in double-stranded DNA.

    PubMed

    Ito, Yu; Masaki, Yoshiaki; Kanamori, Takashi; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo

    2016-01-01

    5-[3-(2-Aminopyrimidin-4-yl)aminopropyn-1-yl]uracil (Ura(Pyr)) was designed as a new nucleobase to recognize Ade-Thy base pair in double-stranded DNA. We successfully synthesized the dexoynucleoside phosphoramidite having Ura(Pyr) and incorporated it into triplex forming oligonucleotides (TFOs). Melting temperature analysis revealed that introduction of Ura(Pyr) into TFOs could effectively stabilize their triplex structures without loss of base recognition capabilities.

  5. Base-pairing behavior of a carbocyclic Janus-AT nucleoside analogue capable of recognizing A and T within a DNA duplex.

    PubMed

    Largy, Eric; Liu, Wenbo; Hasan, Abid; Perrin, David M

    2013-11-04

    Janus-type nucleosides are heterocycles with two faces, each of which is designed to complement the H-bonding interactions of natural nucleosides comprising a canonical Watson-Crick base pair. By intercepting all of the hydrogen bonds contained within the base pair, oligomeric Janus nucleosides are expected to achieve sequence-specific DNA recognition through the formation of J-loops that will be more stable than D-loops, which simply replaces one base-pair with another. Herein, we report the synthesis of a novel Janus-AT nucleoside analogue, JAT , affixed on a carbocyclic analogue of deoxyribose that was converted to the corresponding phosphoramidite. A single JAT was successfully incorporated into a DNA strand by solid phase for targeting both A and T bases, and characterized through biophysical and computational methods. Experimental UV-melting and circular dichroism data demonstrated that within the context of a standard duplex, JAT associates preferentially with T over A, and much more poorly with C and G. Density functional theory calculations confirm that the JAT structure is well suited to associate only with A and T thereby highlighting the importance of the electronic structure in terms of H-bonding. Finally, molecular dynamics simulations validated the observation that JAT can substitute more effectively as an A-analogue than as a T-analogue without substantial distortion of the B-helix. Overall, this new Janus nucleotide is a promising tool for the targeting of A-T base pairs in DNA, and will lead to the development of oligo-Janus-nucleotide strands for sequence-specific DNA recognition.

  6. Critical Effect of Base Pairing of Target Pyrimidine on the Interstrand Photo-Cross-Linking of DNA via 3-Cyanovinylcarbazole Nucleoside.

    PubMed

    Sakamoto, Takashi; Ooe, Minako; Fujimoto, Kenzo

    2015-08-19

    To evaluate the effect of base pairing of the target pyrimidine on the interstrand photo-cross-linking reaction of DNA via 3-cyanovinylcarbazole nucleoside ((CNV)K), a complementary base of target pyrimidine was substituted with noncanonical purine bases or 1,3-propandiol (S). As the decrease of the hydrogen bonds in the base pairing of target C accelerated the photo-cross-linking reaction markedly (3.6- to 7.7-fold), it can be concluded that the number of hydrogen bonds in the base pairing, i.e., the stability of base pairing, of the target pyrimidine plays a critical role in the interstrand photo-cross-linking reaction. In the case of G to S substitution, the highest photoreactivity toward C was observed, whose photoreaction rate constant (k = 2.0 s(-1)) is comparable to that of (CNV)K toward T paired with A (k = 3.5 s(-1)). This is the most reactive photo-cross-linking reaction toward C in the sequence specific interstrand photo-cross-linking. This might facilitate the design of the photo-cross-linkable oligodeoxyribonucleotides for various target sequences.

  7. Structure of p53 binding to the BAX response element reveals DNA unwinding and compression to accommodate base-pair insertion

    SciTech Connect

    Chen, Y.; Zhang, X.; Dantas Machado, A. C.; Ding, Y.; Chen, Z.; Qin, P. Z.; Rohs, R.; Chen, L.

    2013-07-08

    The p53 core domain binds to response elements (REs) that contain two continuous half-sites as a cooperative tetramer, but how p53 recognizes discontinuous REs is not well understood. Here we describe the crystal structure of the p53 core domain bound to a naturally occurring RE located at the promoter of the Bcl-2-associated X protein (BAX) gene, which contains a one base-pair insertion between the two half-sites. Surprisingly, p53 forms a tetramer on the BAX-RE that is nearly identical to what has been reported on other REs with a 0-bp spacer. Each p53 dimer of the tetramer binds in register to a half-site and maintains the same protein–DNA interactions as previously observed, and the two dimers retain all the protein–protein contacts without undergoing rotation or translation. To accommodate the additional base pair, the DNA is deformed and partially disordered around the spacer region, resulting in an apparent unwinding and compression, such that the interactions between the dimers are maintained. Furthermore, DNA deformation within the p53-bound BAX-RE is confirmed in solution by site-directed spin labeling measurements. Our results provide a structural insight into the mechanism by which p53 binds to discontinuous sites with one base-pair spacer.

  8. Oxygen-aromatic contacts in intra-strand base pairs: analysis of high-resolution DNA crystal structures and quantum chemical calculations.

    PubMed

    Jain, Alok; Krishna Deepak, R N V; Sankararamakrishnan, Ramasubbu

    2014-07-01

    Three-dimensional structures of biomolecules are stabilized by a large number of non-covalent interactions and some of them such as van der Waals, electrostatic and hydrogen bond interactions are well characterized. Delocalized π-electron clouds of aromatic residues are known to be involved in cation-π, CH-π, OH-π and π-π interactions. In proteins, many examples have been found in which the backbone carbonyl oxygen of one residue makes close contact with the aromatic center of aromatic residues. Quantum chemical calculations suggest that such contacts may provide stability to the protein secondary structures. In this study, we have systematically analyzed the experimentally determined high-resolution DNA crystal structures and identified 91 examples in which the aromatic center of one base is in close contact (<3.5Ǻ) with the oxygen atom of preceding (Group-I) or succeeding base (Group-II). Examples from Group-I are overwhelmingly observed and cytosine or thymine is the preferred base contributing oxygen atom in Group-I base pairs. A similar analysis of high-resolution RNA structures surprisingly did not yield many examples of oxygen-aromatic contact of similar type between bases. Ab initio quantum chemical calculations on compounds based on DNA crystal structures and model compounds show that interactions between the bases in base pairs with oxygen-aromatic contacts are energetically favorable. Decomposition of interaction energies indicates that dispersion forces are the major cause for energetically stable interaction in these base pairs. We speculate that oxygen-aromatic contacts in intra-strand base pairs in a DNA structure may have biological significance.

  9. Exonuclease processivity of archaeal replicative DNA polymerase in association with PCNA is expedited by mismatches in DNA

    PubMed Central

    Yoda, Takuya; Tanabe, Maiko; Tsuji, Toshiyuki; Yoda, Takao; Ishino, Sonoko; Shirai, Tsuyoshi; Ishino, Yoshizumi; Takeyama, Haruko; Nishida, Hirokazu

    2017-01-01

    Family B DNA polymerases comprise polymerase and 3′ −>5′ exonuclease domains, and detect a mismatch in a newly synthesized strand to remove it in cooperation with Proliferating cell nuclear antigen (PCNA), which encircles the DNA to provide a molecular platform for efficient protein–protein and protein–DNA interactions during DNA replication and repair. Once the repair is completed, the enzyme must stop the exonucleolytic process and switch to the polymerase mode. However, the cue to stop the degradation is unclear. We constructed several PCNA mutants and found that the exonuclease reaction was enhanced in the mutants lacking the conserved basic patch, located on the inside surface of PCNA. These mutants may mimic the Pol/PCNA complex processing the mismatched DNA, in which PCNA cannot interact rigidly with the irregularly distributed phosphate groups outside the dsDNA. Indeed, the exonuclease reaction with the wild type PCNA was facilitated by mismatched DNA substrates. PCNA may suppress the exonuclease reaction after the removal of the mismatched nucleotide. PCNA seems to act as a “brake” that stops the exonuclease mode of the DNA polymerase after the removal of a mismatched nucleotide from the substrate DNA, for the prompt switch to the DNA polymerase mode. PMID:28300173

  10. Compensating Bends in a 16 base-pair DNA Oligomer Containing a T3A3 Segment: A NMR Study of Global DNA Curvature

    SciTech Connect

    McAteer, Kathleen; Aceves Gaona, Alejandro; Michalczyk, Ryszard; Buchko, Garry W.; Isern, Nancy G.; Silks, Louis A.; Miller, John H.; Kennedy, Michael A.

    2004-12-15

    DNA curvature but no single model has been able to explain all the experimental data. An intriguing observation is that AnTn segments ligated in phase exhibit retarded migration in polyacrylamide gel electrophoresis (PAGE) but TnAn segments do not. We have determined a high-resolution structure of a 16 base-pair DNA oligomer [d(CGAGGTTTAAACCTCG)2] containing a T3A3 tract. The refinement included residual dipolar coupling (RDC) restraints. A radius of curvature, Rc, analysis was used to measure the overall bending in the molecule. A plot of the helical axis reference points showed a sigmoidal shape indicating a discontinuity at the central TpA step in the overall curvature. Because of the length of the 16mer it was possible to accurately measure Rc for the two halves of the molecule centered about the TpA step. The Rc for the overall molecule (Rc=128 nm) is large, i.e. a low overall magnitude of global bending, whereas the Rc for the two halves of the molecule (Rc=72 nm) is small indicating a much larger magnitude of localized bending. However the direction of bending in the two halves is in partial opposition leading to cancellation of the overall bending. This indicates that TnAn-containing DNA sequences are strongly and multiply bent locally, but are nearly straight globally which is consistent with PAGE results. The RDC refined structure lacked anomalous features present in NOE-only structures indicating the RDC and NOE measurements have a different sensitivity to conformational dynamics at the central TpA step. Because of its increased length and refinement using RDC restraints, the structure of the 16mer reported here provides new insight into the structural origins of the enigmatic PAGE behavior of AnTn and TnAn tracts and the large amplitude, slow base dynamics observed at TpA steps.

  11. Insights into electron tunneling across hydrogen-bonded base-pairs in complete molecular circuits for single-stranded DNA sequencing.

    PubMed

    Lee, Myeong H; Sankey, Otto F

    2009-01-21

    We report a first-principles study of electron ballistic transport through a molecular junction containing deoxycytidine-monophosphate (dCMP) connected to metal electrodes. A guanidinium ion and guanine nucleobase are tethered to gold electrodes on opposite sides to form hydrogen bonds with the dCMP molecule providing an electric circuit. The circuit mimics a component of a potential device for sequencing unmodified single-stranded DNA. The molecular conductance is obtained from DFT Green's function scattering methods and is compared to estimates from the electron tunneling decay constant obtained from the complex band structure. The result is that a complete molecular dCMP circuit of 'linker((CH(2))(2))-guanidinium-phosphate-deoxyribose-cytosine-guanine' has a very low conductance (of the order of fS) while the hydrogen-bonded guanine-cytosine base-pair has a moderate conductance (of the order of tens to hundreds of nS). Thus, while the transverse electron transfer through base-pairing is moderately conductive, electron transfer through a complete molecular dCMP circuit is not. The gold Fermi level is found to be aligned very close to the HOMO for both the guanine-cytosine base-pair and the complete molecular dCMP circuit. Results for two different plausible geometries of the hydrogen-bonded dCMP molecule reveal that the conductance varies from fS for an extended structure to pS for a slightly compressed structure.

  12. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

    PubMed

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-13

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

  13. Native mass spectrometry provides direct evidence for DNA mismatch-induced regulation of asymmetric nucleotide binding in mismatch repair protein MutS.

    PubMed

    Monti, Maria Chiara; Cohen, Serge X; Fish, Alexander; Winterwerp, Herrie H K; Barendregt, Arjan; Friedhoff, Peter; Perrakis, Anastassis; Heck, Albert J R; Sixma, Titia K; van den Heuvel, Robert H H; Lebbink, Joyce H G

    2011-10-01

    The DNA mismatch repair protein MutS recognizes mispaired bases in DNA and initiates repair in an ATP-dependent manner. Understanding of the allosteric coupling between DNA mismatch recognition and two asymmetric nucleotide binding sites at opposing sides of the MutS dimer requires identification of the relevant MutS.mmDNA.nucleotide species. Here, we use native mass spectrometry to detect simultaneous DNA mismatch binding and asymmetric nucleotide binding to Escherichia coli MutS. To resolve the small differences between macromolecular species bound to different nucleotides, we developed a likelihood based algorithm capable to deconvolute the observed spectra into individual peaks. The obtained mass resolution resolves simultaneous binding of ADP and AMP.PNP to this ABC ATPase in the absence of DNA. Mismatched DNA regulates the asymmetry in the ATPase sites; we observe a stable DNA-bound state containing a single AMP.PNP cofactor. This is the first direct evidence for such a postulated mismatch repair intermediate, and showcases the potential of native MS analysis in detecting mechanistically relevant reaction intermediates.

  14. The DNA mismatch repair protein MutS forms a one-dimensional Tonks gas on DNA

    NASA Astrophysics Data System (ADS)

    Bundschuh, Ralf; Klajner, Piotr; Hanne, Jeungphill; Britton, Brooke M.; Liu, Jianquan; Park, Jonghyun; Lee, Jong-Bong; Fishel, Richard

    2014-03-01

    MutS is a protein involved in DNA mismatch repair. It recognizes the mismatch, forms a sliding clamp around the DNA, and displaces other proteins bound to the DNA prior to the actual repair process. Here, we present a quantitative model of an ensemble of MutS molecules on a short strand of DNA with one mismatch. We model the ensemble as a Tonks gas of passively diffusing one-dimensional particles of finite extension and include clamp formation at the mismatch and random detachment. The distributions of MutS number bound to the DNA for different mismatch positions and different MutS concentrations in solution fit very well with distributions determined by single molecule experiments, thereby establishing the Tonks gas as an excellent model of MutS action on DNA. This material is based upon work supported by the National Science Foundation under Grant No. 01105458 (RB), the National Institutes of Health under Grant No. CA67007 (RF), and the National Research Foundation of Korea under Grant No. 2011-0013901 (JBL).

  15. Mismatch Repair Proteins Are Activators of Toxic Responses to Chromium-DNA Damage

    PubMed Central

    Peterson-Roth, Elizabeth; Reynolds, Mindy; Quievryn, George; Zhitkovich, Anatoly

    2005-01-01

    Chromium(VI) is a toxic and carcinogenic metal that causes the formation of DNA phosphate-based adducts. Cr-DNA adducts are genotoxic in human cells, although they do not block replication in vitro. Here, we report that induction of cytotoxicity in Cr(VI)-treated human colon cells and mouse embryonic fibroblasts requires the presence of all major mismatch repair (MMR) proteins. Cr-DNA adducts lost their ability to block replication of Cr-modified plasmids in human colon cells lacking MLH1 protein. The presence of functional mismatch repair caused induction of p53-independent apoptosis associated with activation of caspases 2 and 7. Processing of Cr-DNA damage by mismatch repair resulted in the extensive formation of γ-H2AX foci in G2 phase, indicating generation of double-stranded breaks as secondary toxic lesions. Induction of γ-H2AX foci was observed at 6 to 12 h postexposure, which was followed by activation of apoptosis in the absence of significant G2 arrest. Our results demonstrate that mismatch repair system triggers toxic responses to Cr-DNA backbone modifications through stress mechanisms that are significantly different from those for other forms of DNA damage. Selection for Cr(VI) resistant, MMR-deficient cells may explain the very high frequency of lung cancers with microsatellite instability among chromate workers. PMID:15831465

  16. 5-Methylation of Cytosine in CG:CG Base-Pair Steps: A Physicochemical Mechanism for the Epigenetic Control of DNA Nanomechanics

    NASA Astrophysics Data System (ADS)

    Yusufaly, Tahir; Olson, Wilma; Li, Yun

    2014-03-01

    Van der Waals density functional theory is integrated with analysis of a non-redundant set of protein-DNA crystal structures from the Nucleic Acid Database to study the stacking energetics of CG:CG base-pair steps, specifically the role of cytosine 5-methylation. Principal component analysis of the steps reveals the dominant collective motions to correspond to a tensile ``opening'' mode and two shear ``sliding'' and ``tearing'' modes in the orthogonal plane. The stacking interactions of the methyl groups are observed to globally inhibit CG:CG step overtwisting while simultaneously softening the modes locally via potential energy modulations that create metastable states. The results have implications for the epigenetic control of DNA mechanics.

  17. Interaction of an anti-cancer photosensitizer with a genomic DNA: From base pair specificity and thermodynamic landscape to tuning the rate of detergent-sequestered dissociation.

    PubMed

    Paul, Bijan K; Ghosh, Narayani; Mukherjee, Saptarshi

    2016-05-15

    A detailed characterization of the binding interaction of a potent cancer cell photosensitizer, norharmane (NHM) with a genomic DNA (herring sperm; hsDNA) is undertaken with particular emphasis on deciphering the strength, mode, dynamics, energetics and kinetics of binding. A major focus of the study underlies a successful exploration of the concept of detergent-sequestered dissociation of drug from the drug-DNA complex. Biophysical techniques such as absorption, steady-state and time-resolved fluorescence spectroscopy, circular dichroism, DNA helix melting, stopped-flow fluorescence kinetics and calorimetry have been used. A primarily intercalative mode of binding of NHM with DNA is shown. However, the overall interaction is governed by more than one type of binding forces. We demonstrate that the essential prerequisite of a slower dissociation rate of drug from DNA helix is achieved by tenable choice surfactants. Our results also highlight an effective tunability of the rate of dissociation of the DNA-intercalated drug via detergent-sequestration. A detailed isothermal titration calorimetric study unveils the key role of hydrophobic force underlying NHM-hsDNA association. This is further substantiated by the enthalpy-entropy compensation behavior. The major entropic contribution in detergent-induced dissociation of NHM from NHM-hsDNA complex is also demonstrated. Our results present not only a comprehensive structural and thermodynamic profile, base pair specificity, association kinetics for binding of NHM with DNA but also explore the thermodynamic and kinetic aspects of dissociation of bound drug. Characterization and tuning of the essential prerequisites for a drug to be efficient in anti-cancer functionality bear direct and widespread significance in contemporary global research.

  18. Interdependence of DNA mismatch repair proteins MLH1 and MSH2 in apoptosis in human colorectal carcinoma cell lines.

    PubMed

    Hassen, Samar; Ali, Akhtar A; Kilaparty, Surya P; Al-Anbaky, Qudes A; Majeed, Waqar; Boman, Bruce M; Fields, Jeremy Z; Ali, Nawab

    2016-01-01

    The mammalian DNA mismatch repair (MMR) system consists of a number of proteins that play important roles in repair of base pair mismatch mutations and in maintenance of genomic integrity. A defect in this system can cause genetic instability, which can lead to carcinogenesis. For instance, a germline mutation in one of the mismatch repair proteins, especially MLH1 or MSH2, is responsible for hereditary non-polyposis colorectal cancer. These MMR proteins also play an important role in the induction of apoptosis. Accordingly, altered expression of or a defect in MLH1 or MSH2 may confer resistance to anti-cancer drugs used in chemotherapy. We hypothesized that the ability of these two MMR proteins to regulate apoptosis are interdependent. Moreover, a defect in either one may confer resistance to chemotherapy by an inability to trigger apoptosis. To this end, we studied three cell lines-SW480, LoVo, and HTC116. These cell lines were selected based on their differential expression of MLH1 and MSH2 proteins. SW480 expresses both MLH1 and MSH2; LoVo expresses only MLH1 but not MSH2; HCT116 expresses only MSH2 but not MLH1 protein. MTT assays, a measure of cytotoxicity, showed that there were different cytotoxic effects of an anti-cancer drug, etoposide, on these cell lines, effects that were correlated with the MMR status of the cells. Cells that are deficient in MLH1 protein (HCT116 cells) were resistant to the drug. Cells that express both MLH1 and MSH2 proteins (SW480 cells) showed caspase-3 cleavage, an indicator of apoptosis. Cells that lack MLH1 (HCT116 cells) did not show any caspase-3 cleavage. Expression of full-length MLH1 protein was decreased in MMR proficient (SW480) cells during apoptosis; it remained unchanged in cells that lack MSH2 (LoVo cells). The expression of MSH2 protein remained unchanged during apoptosis both in MMR proficient (SW480) and deficient (HCT116) cells. Studies on translocation of MLH1 protein from nucleus to cytosolic fraction, an

  19. Base pair switching by interconversion of sugar puckers in DNA extended by proteins of RecA-family: A model for homology search in homologous genetic recombination

    PubMed Central

    Nishinaka, Taro; Shinohara, Akira; Ito, Yutaka; Yokoyama, Shigeyuki; Shibata, Takehiko

    1998-01-01

    Escherichia coli RecA is a representative of proteins from the RecA family, which promote homologous pairing and strand exchange between double-stranded DNA and single-stranded DNA. These reactions are essential for homologous genetic recombination in various organisms. From NMR studies, we previously reported a novel deoxyribose-base stacking interaction between adjacent residues on the extended single-stranded DNA bound to RecA protein. In this study, we found that the same DNA structure was induced by the binding to Saccharomyces cerevisiae Rad51 protein, indicating that the unique DNA structure induced by the binding to RecA-homologs was conserved from prokaryotes to eukaryotes. On the basis of this structure, we have formulated the structure of duplex DNA within filaments formed by RecA protein and its homologs. Two types of molecular structures are presented. One is the duplex structure that has the N-type sugar pucker. Its helical pitch is ≈95 Å (18.6 bp/turn), corresponding to that of an active, or ATP-form of the RecA filament. The other is one that has the S-type sugar pucker. Its helical pitch is ≈64 Å (12.5 bp/turn), corresponding to that of an inactive, or ADP-form of the RecA filament. During this modeling, we found that the interconversion of sugar puckers between the N-type and the S-type rotates bases horizontally, while maintaining the deoxyribose-base stacking interaction. We propose that this base rotation enables base pair switching between double-stranded DNA and single-stranded DNA to take place, facilitating homologous pairing and strand exchange. A possible mechanism for strand exchange involving DNA rotation also is discussed. PMID:9736691

  20. Electronic promotion effect of double proton transfer on conduction of DNA through improvement of transverse electronic communication of base pairs

    NASA Astrophysics Data System (ADS)

    Liu, Haiying; Li, Genqin; Zhang, Laibin; Li, Jilai; Wang, Meishan; Bu, Yuxiang

    2011-10-01

    The effect of double proton transfer (DPT) on charge migration of DNA was investigated by the nonequilibrium Green's function method combined with density functional theory. The results revealed that DPT not only lowers ionization potentials, but also improves the delocalization of the localized π-orbitals at each base moiety through adjusting energy levels and spatial distributions of their molecular orbitals. Furthermore, DPT leads to both the strengthening of the second-order interactions of the Watson-Crick H-bond zones, and the promotion of the charge transfer transitions between two pairing bases in the UV absorption spectra. Electronic transport calculations indicated that DPT can improve the charge migration along the DNA duplex for specific sequences through enhancing transverse base-to-base electronic communication. This work will provide a new insight into the understanding of DNA charge conduction which can be electronically promoted or regulated by DPT.

  1. Structure of the EndoMS-DNA Complex as Mismatch Restriction Endonuclease.

    PubMed

    Nakae, Setsu; Hijikata, Atsushi; Tsuji, Toshiyuki; Yonezawa, Kouki; Kouyama, Ken-Ichi; Mayanagi, Kouta; Ishino, Sonoko; Ishino, Yoshizumi; Shirai, Tsuyoshi

    2016-11-01

    Archaeal NucS nuclease was thought to degrade the single-stranded region of branched DNA, which contains flapped and splayed DNA. However, recent findings indicated that EndoMS, the orthologous enzyme of NucS, specifically cleaves double-stranded DNA (dsDNA) containing mismatched bases. In this study, we determined the structure of the EndoMS-DNA complex. The complex structure of the EndoMS dimer with dsDNA unexpectedly revealed that the mismatched bases were flipped out into binding sites, and the overall architecture most resembled that of restriction enzymes. The structure of the apo form was similar to the reported structure of Pyrococcus abyssi NucS, indicating that movement of the C-terminal domain from the resting state was required for activity. In addition, a model of the EndoMS-PCNA-DNA complex was preliminarily verified with electron microscopy. The structures strongly support the idea that EndoMS acts in a mismatch repair pathway.

  2. MSH-MLH complexes formed at a DNA mismatch are disrupted by the PCNA sliding clamp.

    PubMed

    Bowers, J; Tran, P T; Joshi, A; Liskay, R M; Alani, E

    2001-03-09

    In the yeast Saccharomyces cerevisiae, mismatch repair (MMR) is initiated by the binding of heterodimeric MutS homolog (MSH) complexes to mismatches that include single nucleotide and loop insertion/deletion mispairs. In in vitro experiments, the mismatch binding specificity of the MSH2-MSH6 heterodimer is eliminated if ATP is present. However, addition of the MutL homolog complex MLH1-PMS1 to binding reactions containing MSH2-MSH6, ATP, and mismatched substrate results in the formation of a stable ternary complex. The stability of this complex suggests that it represents an intermediate in MMR that is subsequently acted upon by other MMR factors. In support of this idea, we found that the replication processivity factor proliferating cell nuclear antigen (PCNA), which plays a critical role in MMR at step(s) prior to DNA resynthesis, disrupted preformed ternary complexes. These observations, in conjunction with experiments performed with streptavidin end-blocked mismatch substrates, suggested that PCNA interacts with an MSH-MLH complex formed on DNA mispairs.

  3. Mismatched DNTP Incorporation By DNA Polymerase Beta Does Not Proceed Via Globally Different Conformational Pathways

    SciTech Connect

    Tang, K.-H.; Niebuhr, M.; Tung, C.-S.; Chan, H.-c.; Chou, C.-C.; Tsai, M.-D.

    2009-05-26

    Understanding how DNA polymerases control fidelity requires elucidation of the mechanisms of matched and mismatched dNTP incorporations. Little is known about the latter because mismatched complexes do not crystallize readily. In this report, we employed small-angle X-ray scattering (SAXS) and structural modeling to probe the conformations of different intermediate states of mammalian DNA polymerase {beta} (Pol {beta}) in its wild-type and an error-prone variant, I260Q. Our structural results indicate that the mismatched ternary complex lies in-between the open and the closed forms, but more closely resembles the open form for WT and the closed form for I260Q. On the basis of molecular modeling, this over-stabilization of mismatched ternary complex of I260Q is likely caused by formation of a hydrogen bonding network between the side chains of Gln{sup 260}, Tyr{sup 296}, Glu{sup 295} and Arg{sup 258}, freeing up Asp{sup 192} to coordinate MgdNTP. These results argue against recent reports suggesting that mismatched dNTP incorporations follow a conformational path distinctly different from that of matched dNTP incorporation, or that its conformational closing is a major contributor to fidelity.

  4. Saturation of DNA mismatch repair and error catastrophe by a base analogue in Escherichia coli.

    PubMed Central

    Negishi, Kazuo; Loakes, David; Schaaper, Roel M

    2002-01-01

    Deoxyribosyl-dihydropyrimido[4,5-c][1,2]oxazin-7-one (dP) is a potent mutagenic deoxycytidine-derived base analogue capable of pairing with both A and G, thereby causing G. C --> A. T and A. T --> G. C transition mutations. We have found that the Escherichia coli DNA mismatch-repair system can protect cells against this mutagenic action. At a low dose, dP is much more mutagenic in mismatch-repair-defective mutH, mutL, and mutS strains than in a wild-type strain. At higher doses, the difference between the wild-type and the mutator strains becomes small, indicative of saturation of mismatch repair. Introduction of a plasmid containing the E. coli mutL(+) gene significantly reduces dP-induced mutagenesis. Together, the results indicate that the mismatch-repair system can remove dP-induced replication errors, but that its capacity to remove dP-containing mismatches can readily be saturated. When cells are cultured at high dP concentration, mutant frequencies reach exceptionally high levels and viable cell counts are reduced. The observations are consistent with a hypothesis in which dP-induced cell killing and growth impairment result from excess mutations (error catastrophe), as previously observed spontaneously in proofreading-deficient mutD (dnaQ) strains. PMID:12196386

  5. An interplay of the base excision repair and mismatch repair pathways in active DNA demethylation

    PubMed Central

    Grin, Inga; Ishchenko, Alexander A.

    2016-01-01

    Active DNA demethylation (ADDM) in mammals occurs via hydroxylation of 5-methylcytosine (5mC) by TET and/or deamination by AID/APOBEC family enzymes. The resulting 5mC derivatives are removed through the base excision repair (BER) pathway. At present, it is unclear how the cell manages to eliminate closely spaced 5mC residues whilst avoiding generation of toxic BER intermediates and whether alternative DNA repair pathways participate in ADDM. It has been shown that non-canonical DNA mismatch repair (ncMMR) can remove both alkylated and oxidized nucleotides from DNA. Here, a phagemid DNA containing oxidative base lesions and methylated sites are used to examine the involvement of various DNA repair pathways in ADDM in murine and human cell-free extracts. We demonstrate that, in addition to short-patch BER, 5-hydroxymethyluracil and uracil mispaired with guanine can be processed by ncMMR and long-patch BER with concomitant removal of distant 5mC residues. Furthermore, the presence of multiple mispairs in the same MMR nick/mismatch recognition region together with BER-mediated nick formation promotes proficient ncMMR resulting in the reactivation of an epigenetically silenced reporter gene in murine cells. These findings suggest cooperation between BER and ncMMR in the removal of multiple mismatches that might occur in mammalian cells during ADDM. PMID:26843430

  6. Poorly repaired mismatches in heteroduplex DNA are hyper-recombinagenic in Saccharomyces cerevisiae

    SciTech Connect

    Manivasakam, P.; Hastings, P.J.; Rosenberg, S.M.

    1996-02-01

    In yeast meiotic recombination, alleles used as genetic markers fall into two classes as regards their fate when incorporated into heteroduplex DNA. Normal alleles are those that form heteroduplexes that are nearly always recognized and corrected by the mismatch repair system operating in meiosis. High PMS (postmeiotic segregation) alleles form heteroduplexes that are inefficiently mismatch repaired. We propose that this hyperrecombination is caused by the high PMS allele blocking a mismatch repair tract initiated from the normal allele, thus preventing corepair of the two alleles, which would prevent formation of recombinants. The results of three point crosses involving two PMS alleles and a normal allele suggest that high PMS alleles placed between two alleles that are normally corepaired block that corepair. 30 refs., 7 figs., 3 tabs.

  7. Helicobacter pylori infection and expression of DNA mismatch repair proteins

    PubMed Central

    Mirzaee, Vahid; Molaei, Mahsa; Shalmani, Hamid Mohaghegh; Zali, Mohammad Reza

    2008-01-01

    AIM: To determine the expression of DNA (MMR) proteins, including hMLH1 and hMSH2, in gastric epithelial cells in the patients with or without Helicobacter pylori (H pylori)-infected gastritis. METHODS: Fifty H pylori-positive patients and 50 H pylori-negative patients were enrolled in the study. During endoscopy of patients with non-ulcer dyspepsia, two antral and two corpus biopsies were taken for histological examination (Giemsa stain) and for immunohistochemical staining of hMLH1 and hMSH2. RESULTS: The percentage of epithelial cell nuclei that demonstrated positivity for hMLH1 staining was 84.14 ± 7.32% in H pylori-negative patients, while it was 73.34 ± 10.10% in H pylori-positive patients (P < 0.0001). No significant difference was seen between the two groups regarding the percentage of epithelial cell nuclei that demonstrated positivity for hMSH2 staining (81.16 ± 8.32% in H pylori-negative versus 78.24 ± 8.71% in H pylori-positive patients; P = 0.09). CONCLUSION: This study indicates that H pylori might promote development of gastric carcinoma at least in part through its ability to affect the DNA MMR system. PMID:19034977

  8. Identification of a mismatch-specific endonuclease in hyperthermophilic Archaea

    PubMed Central

    Ishino, Sonoko; Nishi, Yuki; Oda, Soichiro; Uemori, Takashi; Sagara, Takehiro; Takatsu, Nariaki; Yamagami, Takeshi; Shirai, Tsuyoshi; Ishino, Yoshizumi

    2016-01-01

    The common mismatch repair system processed by MutS and MutL and their homologs was identified in Bacteria and Eukarya. However, no evidence of a functional MutS/L homolog has been reported for archaeal organisms, and it is not known whether the mismatch repair system is conserved in Archaea. Here, we describe an endonuclease that cleaves double-stranded DNA containing a mismatched base pair, from the hyperthermophilic archaeon Pyrococcus furiosus. The corresponding gene revealed that the activity originates from PF0012, and we named this enzyme Endonuclease MS (EndoMS) as the mismatch-specific Endonuclease. The sequence similarity suggested that EndoMS is the ortholog of NucS isolated from Pyrococcus abyssi, published previously. Biochemical characterizations of the EndoMS homolog from Thermococcus kodakarensis clearly showed that EndoMS specifically cleaves both strands of double-stranded DNA into 5′-protruding forms, with the mismatched base pair in the central position. EndoMS cleaves G/T, G/G, T/T, T/C and A/G mismatches, with a more preference for G/T, G/G and T/T, but has very little or no effect on C/C, A/C and A/A mismatches. The discovery of this endonuclease suggests the existence of a novel mismatch repair process, initiated by the double-strand break generated by the EndoMS endonuclease, in Archaea and some Bacteria. PMID:27001046

  9. Microsatellites in the Eukaryotic DNA Mismatch Repair Genes as Modulators of Evolutionary Mutation Rate

    NASA Technical Reports Server (NTRS)

    Chang, Dong Kyung; Metzgar, David; Wills, Christopher; Boland, C. Richard

    2003-01-01

    All "minor" components of the human DNA mismatch repair (MMR) system-MSH3, MSH6, PMS2, and the recently discovered MLH3-contain mononucleotide microsatellites in their coding sequences. This intriguing finding contrasts with the situation found in the major components of the DNA MMR system-MSH2 and MLH1-and, in fact, most human genes. Although eukaryotic genomes are rich in microsatellites, non-triplet microsatellites are rare in coding regions. The recurring presence of exonal mononucleotide repeat sequences within a single family of human genes would therefore be considered exceptional.

  10. Replication infidelity via a mismatch with Watson-Crick geometry.

    PubMed

    Bebenek, Katarzyna; Pedersen, Lars C; Kunkel, Thomas A

    2011-02-01

    In describing the DNA double helix, Watson and Crick suggested that "spontaneous mutation may be due to a base occasionally occurring in one of its less likely tautomeric forms." Indeed, among many mispairing possibilities, either tautomerization or ionization of bases might allow a DNA polymerase to insert a mismatch with correct Watson-Crick geometry. However, despite substantial progress in understanding the structural basis of error prevention during polymerization, no DNA polymerase has yet been shown to form a natural base-base mismatch with Watson-Crick-like geometry. Here we provide such evidence, in the form of a crystal structure of a human DNA polymerase λ variant poised to misinsert dGTP opposite a template T. All atoms needed for catalysis are present at the active site and in positions that overlay with those for a correct base pair. The mismatch has Watson-Crick geometry consistent with a tautomeric or ionized base pair, with the pH dependence of misinsertion consistent with the latter. The results support the original idea that a base substitution can originate from a mismatch having Watson-Crick geometry, and they suggest a common catalytic mechanism for inserting a correct and an incorrect nucleotide. A second structure indicates that after misinsertion, the now primer-terminal G • T mismatch is also poised for catalysis but in the wobble conformation seen in other studies, indicating the dynamic nature of the pathway required to create a mismatch in fully duplex DNA.

  11. A monofunctional platinum complex coordinated to a rhodium metalloinsertor selectively binds mismatched DNA in the minor groove.

    PubMed

    Weidmann, Alyson G; Barton, Jacqueline K

    2015-10-05

    We report the synthesis and characterization of a bimetallic complex derived from a new family of potent and selective metalloinsertors containing an unusual Rh-O axial coordination. This complex incorporates a monofunctional platinum center containing only one labile site for coordination to DNA, rather than two, and coordinates DNA nonclassically through adduct formation in the minor groove. This conjugate displays bifunctional, interdependent binding of mismatched DNA via metalloinsertion at a mismatch as well as covalent platinum binding. DNA sequencing experiments revealed that the preferred site of platinum coordination is not the traditional N7-guanine site in the major groove, but rather N3-adenine in the minor groove. The complex also displays enhanced cytotoxicity in mismatch repair-deficient and mismatch repair-proficient human colorectal carcinoma cell lines compared to the chemotherapeutic cisplatin, and it triggers cell death via an apoptotic pathway, rather than the necrotic pathway induced by rhodium metalloinsertors.

  12. Role of Cell Cycle Regulation and MLH1, A Key DNA Mismatch Repair Protein, In Adaptive Survival Responses. Final Report

    SciTech Connect

    David A. Boothman

    1999-08-11

    Due to several interesting findings on both adaptive survival responses (ASRs) and DNA mismatch repair (MMR), this grant was separated into two discrete Specific Aim sets (each with their own discrete hypotheses). The described experiments were simultaneously performed.

  13. A Monofunctional Platinum Complex Coordinated to a Rhodium Metalloinsertor Selectively Binds Mismatched DNA in the Minor Groove

    PubMed Central

    Weidmann, Alyson G.; Barton, Jacqueline K.

    2015-01-01

    We report the synthesis and characterization of a bimetallic complex derived from a new family of potent and selective metalloinsertors containing an unusual Rh—O axial coordination. This complex incorporates a monofunctional platinum center containing only one labile site for coordination to DNA, rather than two, and coordinates DNA non-classically through adduct formation in the minor groove. This conjugate displays bifunctional, interdependent binding of mismatched DNA via metalloinsertion at a mismatch as well as covalent platinum binding. DNA sequencing experiments revealed that the preferred site of platinum coordination is not the traditional N7-guanine site in the major groove, but rather N3-adenine in the minor groove. The complex also displays enhanced cytotoxicity in mismatch repair-deficient and mismatch repair-proficient human colorectal carcinoma cell lines compared to the chemotherapeutic cisplatin, and triggers cell death via an apoptotic pathway, rather than the necrotic pathway induced by rhodium metalloinsertors. PMID:26397309

  14. Cascading MutS and MutL sliding clamps control DNA diffusion to activate mismatch repair.

    PubMed

    Liu, Jiaquan; Hanne, Jeungphill; Britton, Brooke M; Bennett, Jared; Kim, Daehyung; Lee, Jong-Bong; Fishel, Richard

    2016-11-24

    Mismatched nucleotides arise from polymerase misincorporation errors, recombination between heteroallelic parents and chemical or physical DNA damage. Highly conserved MutS (MSH) and MutL (MLH/PMS) homologues initiate mismatch repair and, in higher eukaryotes, act as DNA damage sensors that can trigger apoptosis. Defects in human mismatch repair genes cause Lynch syndrome or hereditary non-polyposis colorectal cancer and 10-40% of related sporadic tumours. However, the collaborative mechanics of MSH and MLH/PMS proteins have not been resolved in any organism. We visualized Escherichia coli (Ec) ensemble mismatch repair and confirmed that EcMutS mismatch recognition results in the formation of stable ATP-bound sliding clamps that randomly diffuse along the DNA with intermittent backbone contact. The EcMutS sliding clamps act as a platform to recruit EcMutL onto the mismatched DNA, forming an EcMutS-EcMutL search complex that then closely follows the DNA backbone. ATP binding by EcMutL establishes a second long-lived DNA clamp that oscillates between the principal EcMutS-EcMutL search complex and unrestricted EcMutS and EcMutL sliding clamps. The EcMutH endonuclease that targets mismatch repair excision only binds clamped EcMutL, increasing its DNA association kinetics by more than 1,000-fold. The assembly of an EcMutS-EcMutL-EcMutH search complex illustrates how sequential stable sliding clamps can modulate one-dimensional diffusion mechanics along the DNA to direct mismatch repair.

  15. Femtomolar detection of single mismatches by discriminant analysis of DNA hybridization events using gold nanoparticles.

    PubMed

    Ma, Xingyi; Sim, Sang Jun

    2013-03-21

    Even though DNA-based nanosensors have been demonstrated for quantitative detection of analytes and diseases, hybridization events have never been numerically investigated for further understanding of DNA mediated interactions. Here, we developed a nanoscale platform with well-designed capture and detection gold nanoprobes to precisely evaluate the hybridization events. The capture gold nanoprobes were mono-laid on glass and the detection probes were fabricated via a novel competitive conjugation method. The two kinds of probes combined in a suitable orientation following the hybridization with the target. We found that hybridization efficiency was markedly dependent on electrostatic interactions between DNA strands, which can be tailored by adjusting the salt concentration of the incubation solution. Due to the much lower stability of the double helix formed by mismatches, the hybridization efficiencies of single mismatched (MMT) and perfectly matched DNA (PMT) were different. Therefore, we obtained an optimized salt concentration that allowed for discrimination of MMT from PMT without stringent control of temperature or pH. The results indicated this to be an ultrasensitive and precise nanosensor for the diagnosis of genetic diseases.

  16. Formation of sheared G:A base pairs in an RNA duplex modelled after ribozymes, as revealed by NMR.

    PubMed Central

    Katahira, M; Kanagawa, M; Sato, H; Uesugi, S; Fujii, S; Kohno, T; Maeda, T

    1994-01-01

    The thermal stability and structure of an RNA duplex, r(GGACGAGUCC)2, the base sequence of which was modelled after both a hammerhead ribozyme and a lead ribozyme, were studied by CD and NMR. We previously demonstrated that the corresponding DNA duplex, d(GGACGAGTCC)2, formed unique 'sheared' G:A base pairs, where an amino proton, instead of an imino proton, of G is involved in the hydrogen bonding, and G and A bases are arranged 'side by side' instead of 'head to head' (Nucleic Acids Res. (1993) 21, 5418-5424). CD melting profiles showed that the RNA duplex is thermally more stable than the corresponding DNA duplex. NMR studies revealed that sheared G:A base pairs are formed in the RNA duplex, too, although the overall structure of the RNA is the A form, which differs from the B form taken on by the corresponding DNA. A model building study confirmed that sheared G:A base pairs can be accommodated in the double helical structure of the A form. A difference between the RNA and DNA duplexes in the stacking interaction involving G:A mismatch bases is also suggested. The demonstration that sheared G:A base pairs can be formed not only in DNA but also in RNA suggests that this base pairing plays an important role regarding the RNA structure. PMID:7519767

  17. Formation of sheared G:A base pairs in an RNA duplex modelled after ribozymes, as revealed by NMR.

    PubMed

    Katahira, M; Kanagawa, M; Sato, H; Uesugi, S; Fujii, S; Kohno, T; Maeda, T

    1994-07-25

    The thermal stability and structure of an RNA duplex, r(GGACGAGUCC)2, the base sequence of which was modelled after both a hammerhead ribozyme and a lead ribozyme, were studied by CD and NMR. We previously demonstrated that the corresponding DNA duplex, d(GGACGAGTCC)2, formed unique 'sheared' G:A base pairs, where an amino proton, instead of an imino proton, of G is involved in the hydrogen bonding, and G and A bases are arranged 'side by side' instead of 'head to head' (Nucleic Acids Res. (1993) 21, 5418-5424). CD melting profiles showed that the RNA duplex is thermally more stable than the corresponding DNA duplex. NMR studies revealed that sheared G:A base pairs are formed in the RNA duplex, too, although the overall structure of the RNA is the A form, which differs from the B form taken on by the corresponding DNA. A model building study confirmed that sheared G:A base pairs can be accommodated in the double helical structure of the A form. A difference between the RNA and DNA duplexes in the stacking interaction involving G:A mismatch bases is also suggested. The demonstration that sheared G:A base pairs can be formed not only in DNA but also in RNA suggests that this base pairing plays an important role regarding the RNA structure.

  18. Solution structure of an oncogenic DNA duplex, the K-ras gene and the sequence containing a central C.A or A.G mismatch as a function of pH: nuclear magnetic resonance and molecular dynamics studies.

    PubMed

    Boulard, Y; Cognet, J A; Gabarro-Arpa, J; Le Bret, M; Carbonnaux, C; Fazakerley, G V

    1995-02-10

    The DNA duplex 5' d(GCCACCAGCTC)-d(GAGCTGGTGGC) corresponds to the sequence 29 to 39 of the K-ras gene, which contains a hot spot for mutations. This has been studied by one and two-dimensional nuclear magnetic resonance, energy minimization and molecular dynamics. The results show that it adopts a globally B-DNA type structure. We have introduced, at the central base-pair, the mismatches C.A and A.G. The mismatch position is that of the first base of the Gly12 codon, the hot spot. For the C.A mismatch we observe a structural change as a function of pH with an apparent pKa of 7.2. At low pH, the mismatch pair adopts a structure close to a classic wobble conformation with the cytidine residue displaced into the major groove. It is stabilised by two hydrogen bonds in which the adenosine residue is protonated and the cytidine residue has a significant C3'-endo population. At high pH, the mispair structure is in equilibrium between wobble and reverse wobble conformations. Similar studies are reported on the A.G mismatch, which also undergoes a transition as a function of pH. 31P spectra have been recorded on all systems and as a function of pH. No evidence for BII phosphodiester backbone conformations was found. The NMR results are well corroborated by molecular dynamics calculations performed with or without distance constraints. The dynamics at the mismatch sites have been examined. Although the overall structures are close to B-DNA, helical parameters fluctuate differently at these sites. Different hydrogen bonding alternatives in dynamic equilibrium that can involve three-centred hydrogen bonds are observed.

  19. Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

    DOEpatents

    McCutchen-Maloney, Sandra L.

    2002-01-01

    DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

  20. A pyrimidopyrimidine Janus-AT nucleoside with improved base-pairing properties to both A and T within a DNA duplex: the stabilizing effect of a second endocyclic ring nitrogen.

    PubMed

    Largy, Eric; Liu, Wenbo; Hasan, Abid; Perrin, David M

    2014-02-03

    Janus bases are heterocyclic nucleic acid base analogs that present two different faces able to simultaneously hydrogen bond to nucleosides that form Watson-Crick base pairs. The synthesis of a Janus-AT nucleotide analogue, (N)JAT , that has an additional endocyclic ring nitrogen and is thus more capable of efficiently discriminating T/A over G/C bases when base-pairing in a standard duplex-DNA context is described. Conversion to a phosphoramidite ultimately afforded incorporation into an oligonucleotide. In contrast to the first generation of carbocyclic Janus heterocycles, it remains in its unprotonated state at physiological pH and, therefore, forms very stable Watson-Crick base pairs with either A or T bases. Biophysical and computational methods indicate that (N)JAT is an improved candidate for sequence-specific genome targeting.

  1. Loss of DNA mismatch repair facilitates reactivation of a reporter plasmid damaged by cisplatin

    PubMed Central

    Cenni, B; Kim, H-K; Bubley, G J; Aebi, S; Fink, D; Teicher, B A; Howell, S B; Christen, R D

    1999-01-01

    In addition to recognizing and repairing mismatched bases in DNA, the mismatch repair (MMR) system also detects cisplatin DNA adducts and loss of MMR results in resistance to cisplatin. A comparison was made of the ability of MMR-proficient and -deficient cells to remove cisplatin adducts from their genome and to reactivate a transiently transfected plasmid that had previously been inactivated by cisplatin to express the firefly luciferase enzyme. MMR deficiency due to loss of hMLH1 function did not change the extent of platinum (Pt) accumulation or kinetics of removal from total cellular DNA. However, MMR-deficient cells, lacking either hMLH1 or hMSH2, generated twofold more luciferase activity from a cisplatin-damaged reporter plasmid than their MMR-proficient counterparts. Thus, detection of the cisplatin adducts by the MMR system reduced the efficiency of reactivation of the damaged luciferase gene compared to cells lacking this detector. The twofold reduction in reactivation efficiency was of the same order of magnitude as the difference in cisplatin sensitivity between the MMR-proficient and -deficient cells. We conclude that although MMR-proficient and -deficient cells remove Pt from their genome at equal rates, the loss of a functional MMR system facilitates the reactivation of a cisplatin-damaged reporter gene. © 1999 Cancer Research Campaign PMID:10360646

  2. Loss of DNA mismatch repair function and cancer predisposition in the mouse: animal models for human hereditary nonpolyposis colorectal cancer.

    PubMed

    Edelmann, Lisa; Edelmann, Winfried

    2004-08-15

    Germline mutations in DNA mismatch repair genes underlie one of the most common hereditary cancer predisposition syndromes known in humans, hereditary nonpolyposis colorectal cancer (HNPCC). Defects of the DNA mismatch repair system are also prevalent in sporadic colorectal cancers. The generation of mice with targeted inactivating mutations in the mismatch repair genes has facilitated the in vivo study of how these genes function and how their individual loss contributes to tumorigenesis. Although there are notable limitations when using murine models to study the molecular basis of human cancer, there is remarkable similarity between the two species with respect to the contribution of individual members of the mismatch repair system to cancer susceptibility, and mouse mutants have greatly enhanced our understanding of the normal role of these genes in mutation avoidance and suppression of tumorigenesis.

  3. DNA mismatch repair proteins are required for efficient herpes simplex virus 1 replication.

    PubMed

    Mohni, Kareem N; Mastrocola, Adam S; Bai, Ping; Weller, Sandra K; Heinen, Christopher D

    2011-12-01

    Herpes simplex virus 1 (HSV-1) is a double-stranded DNA virus that replicates in the nucleus of its human host cell and is known to interact with many cellular DNA repair proteins. In this study, we examined the role of cellular mismatch repair (MMR) proteins in the virus life cycle. Both MSH2 and MLH1 are required for efficient replication of HSV-1 in normal human cells and are localized to viral replication compartments. In addition, a previously reported interaction between MSH6 and ICP8 was confirmed by coimmunoprecipitation and extended to show that UL12 is also present in this complex. We also report for the first time that MLH1 associates with ND10 nuclear bodies and that like other ND10 proteins, MLH1 is recruited to the incoming genome. Knockdown of MLH1 inhibits immediate-early viral gene expression. MSH2, on the other hand, which is generally thought to play a role in mismatch repair at a step prior to that of MLH1, is not recruited to incoming genomes and appears to act at a later step in the viral life cycle. Silencing of MSH2 appears to inhibit early gene expression. Thus, both MLH1 and MSH2 are required but appear to participate in distinct events in the virus life cycle. The observation that MLH1 plays an earlier role in HSV-1 infection than does MSH2 is surprising and may indicate a novel function for MLH1 distinct from its known MSH2-dependent role in mismatch repair.

  4. DNA Mismatch Repair System: Repercussions in Cellular Homeostasis and Relationship with Aging

    PubMed Central

    Conde-Pérezprina, Juan Cristóbal; León-Galván, Miguel Ángel; Konigsberg, Mina

    2012-01-01

    The mechanisms that concern DNA repair have been studied in the last years due to their consequences in cellular homeostasis. The diverse and damaging stimuli that affect DNA integrity, such as changes in the genetic sequence and modifications in gene expression, can disrupt the steady state of the cell and have serious repercussions to pathways that regulate apoptosis, senescence, and cancer. These altered pathways not only modify cellular and organism longevity, but quality of life (“health-span”). The DNA mismatch repair system (MMR) is highly conserved between species; its role is paramount in the preservation of DNA integrity, placing it as a necessary focal point in the study of pathways that prolong lifespan, aging, and disease. Here, we review different insights concerning the malfunction or absence of the DNA-MMR and its impact on cellular homeostasis. In particular, we will focus on DNA-MMR mechanisms regulated by known repair proteins MSH2, MSH6, PMS2, and MHL1, among others. PMID:23213348

  5. Evidence that the DNA mismatch repair system removes 1-nucleotide Okazaki fragment flaps.

    PubMed

    Kadyrova, Lyudmila Y; Dahal, Basanta K; Kadyrov, Farid A

    2015-10-02

    The DNA mismatch repair (MMR) system plays a major role in promoting genome stability and suppressing carcinogenesis. In this work, we investigated whether the MMR system is involved in Okazaki fragment maturation. We found that in the yeast Saccharomyces cerevisiae, the MMR system and the flap endonuclease Rad27 act in overlapping pathways that protect the nuclear genome from 1-bp insertions. In addition, we determined that purified yeast and human MutSα proteins recognize 1-nucleotide DNA and RNA flaps. In reconstituted human systems, MutSα, proliferating cell nuclear antigen, and replication factor C activate MutLα endonuclease to remove the flaps. ATPase and endonuclease mutants of MutLα are defective in the flap removal. These results suggest that the MMR system contributes to the removal of 1-nucleotide Okazaki fragment flaps.

  6. Interaction between Mismatch Repair and Genetic Recombination in Saccharomyces Cerevisiae

    PubMed Central

    Alani, E.; Reenan, RAG.; Kolodner, R. D.

    1994-01-01

    The yeast Saccharomyces cerevisiae encodes a set of genes that show strong amino acid sequence similarity to MutS and MutL, proteins required for mismatch repair in Escherichia coli. We examined the role of MSH2 and PMS1, yeast homologs of mutS and mutL, respectively, in the repair of base pair mismatches formed during meiotic recombination. By using specifically marked HIS4 and ARG4 alleles, we showed that msh2 mutants displayed a severe defect in the repair of all base pair mismatches as well as 1-, 2- and 4-bp insertion/deletion mispairs. The msh2 and pms1 phenotypes were indistinguishable, suggesting that the wild-type gene products act in the same repair pathway. A comparison of gene conversion events in wild-type and msh2 mutants indicated that mismatch repair plays an important role in genetic recombination. (1) Tetrad analysis at five different loci revealed that, in msh2 mutants, the majority of aberrant segregants displayed a sectored phenotype, consistent with a failure to repair mismatches created during heteroduplex formation. In wild type, base pair mismatches were almost exclusively repaired toward conversion rather than restoration. (2) In msh2 strains 10-19% of the aberrant tetrads were Ab4:4. (3) Polarity gradients at HIS4 and ARG4 were nearly abolished in msh2 mutants. The frequency of gene conversion at the 3' end of these genes was increased and was nearly the frequency observed at the 5' end. (4) Co-conversion studies were consistent with mismatch repair acting to regulate heteroduplex DNA tract length. We favor a model proposing that recombination events occur through the formation and resolution of heteroduplex intermediates and that mismatch repair proteins specifically interact with recombination enzymes to regulate the length of symmetric heteroduplex DNA. PMID:8056309

  7. Loss of DNA mismatch repair imparts a selective advantage in planarian adult stem cells.

    PubMed

    Hollenbach, Jessica P; Resch, Alissa M; Palakodeti, Dasaradhi; Graveley, Brenton R; Heinen, Christopher D

    2011-01-01

    Lynch syndrome (LS) leads to an increased risk of early-onset colorectal and other types of cancer and is caused by germline mutations in DNA mismatch repair (MMR) genes. Loss of MMR function results in a mutator phenotype that likely underlies its role in tumorigenesis. However, loss of MMR also results in the elimination of a DNA damage-induced checkpoint/apoptosis activation barrier that may allow damaged cells to grow unchecked. A fundamental question is whether loss of MMR provides pre-cancerous stem cells an immediate selective advantage in addition to establishing a mutator phenotype. To test this hypothesis in an in vivo system, we utilized the planarian Schmidtea mediterranea which contains a significant population of identifiable adult stem cells. We identified a planarian homolog of human MSH2, a MMR gene which is mutated in 38% of LS cases. The planarian Smed-msh2 is expressed in stem cells and some progeny. We depleted Smed-msh2 mRNA levels by RNA-interference and found a striking survival advantage in these animals treated with a cytotoxic DNA alkylating agent compared to control animals. We demonstrated that this tolerance to DNA damage is due to the survival of mitotically active, MMR-deficient stem cells. Our results suggest that loss of MMR provides an in vivo survival advantage to the stem cell population in the presence of DNA damage that may have implications for tumorigenesis.

  8. Effect of bis(beta-chloroethyl)sulfide (BCES) on base mismatch repair of DNA in monkey kidney cells.

    PubMed

    Fan, L J; Bernstein, I A

    1991-11-01

    Sulfur mustard, bis(beta-chloroethyl)sulfide (BCES), a bifunctional alkylating agent, is a vesicant whose mode of action involves interference with the integrity of cellular DNA. Alkylation of DNA is responsible for some of the biological effects of BCES in tissue. Another possible mechanism by which BCES could exert its toxic effect is interference with high fidelity repair of damaged DNA. This study evaluated the possible effects of BCES on the repair of specific errors, i.e., mismatched bases, in the DNA. Heteroduplex (ht) DNA, formed between two temperature-sensitive mutants of SV40 virus, tsA239 and tsA255, each having a different point mutation in the gene for large T antigen, was used to study the effect of BCES on mismatched base repair in African green monkey kidney (AGMK) cells. AGMK cells were exposed to dilute solutions of BCES in methylene chloride (MC) prior to cationic lipofection with ht DNA. In order for the cells to produce wild type (wt) SV40 DNA at a nonpermissive temperature (41 degrees C), repair of at least one of the two mismatches in the DNA had to occur. It was observed that (a) as the concentration of BCES was increased, a proportionally longer delay in the appearance of wt DNA at 41 degrees C was observed in treated cells transfected with ht DNA as compared with cultures exposed to MC alone and then transfected with ht DNA, (b) there was no such effect in exposed AGMK cells transfected with wt DNA, (c) wt and ht DNA were transfected at similar rates in unexposed cells, and (d) BCES did not affect the rate of transfection of wt cells. These observations are consistent with the hypothesis that BCES affects mismatched base repair.

  9. Effects of suppressing the DNA mismatch repair system on homeologous recombination in tomato.

    PubMed

    Tam, Sheh May; Hays, John B; Chetelat, Roger T

    2011-12-01

    In plant breeding, the ability to manipulate genetic (meiotic) recombination would be beneficial for facilitating gene transfer from wild relatives of crop plants. The DNA mismatch repair (MMR) system helps maintain genetic integrity by correcting base mismatches that arise via DNA synthesis or damage, and antagonizes recombination between homeologous (divergent) DNA sequences. Previous studies have established that the genomes of cultivated tomato (Solanum lycopersicum) and the wild relative S. lycopersicoides are substantially diverged (homeologous) such that recombination between their chromosomes is strongly reduced. Here, we report the effects on homeologous recombination of suppressing endogenous MMR genes in S. lycopersicum via RNAi-induced silencing of SlMSH2 and SlMSH7 or overexpressing dominant negatives of Arabidopsis MSH2 (AtMSH2-DN) in an alien substitution line (SL-8) of S. lycopersicoides in tomato. We show that certain inhibitions of MMR (RNAi of SlMSH7, AtMSH2-DN) are associated with modest increases in homeologous recombination, ranging from 3.8 to 29.2% (average rate of 17.8%) compared to controls. Unexpectedly, only the AtMSH2-DN proteins but not RNAi-induced silencing of MSH2 was found to increase homeologous recombination. The ratio of single to double crossovers (SCO:DCO ratio) decreased by approximately 50% in progeny of the AtMSH2-DN parents. An increase in the frequency of heterozygous SL-8 plants was also observed in the progeny of the SlMSH7-RNAi parents. Our findings may contribute to acceleration of introgression in cultivated tomato.

  10. Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

    PubMed

    Yang, Haozhe; Mei, Hui; Seela, Frank

    2015-07-06

    Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair.

  11. The impact of sequence divergence and DNA mismatch repair on homeologous recombination in Arabidopsis.

    PubMed

    Li, Liangliang; Jean, Martine; Belzile, François

    2006-03-01

    We examined the effects of substrate divergence and DNA mismatch repair (MMR) on recombination in Arabidopsis thaliana. Relative to the frequency observed in plants with a homologous construct (0% divergence), recombination was decreased 4.1-, 9.6-, 11.7- or 20.3-fold, respectively, in lines with constructs containing 0.5%, 2%, 4% or 9% divergence between the recombination substrates. To evaluate the contribution of the MMR system in this decrease, 12 independent reporter lines (two or three lines per reporter construct) were crossed to an AtMSH2 T-DNA insertional mutant. We examined the recombination frequency in progeny homozygous for a reporter T-DNA and homozygous either for the wild type or the mutant allele of AtMSH2. The loss of MMR activity led to a two- to ninefold increase in homeologous recombination and the size of the increase did not seem to correlate with the amount of divergence. Inversely, complementation of the insertional mutant with a wild-type cDNA of AtMSH2 reduced recombination. Our results demonstrate clearly that sequence divergence can dramatically reduce the recombination frequency in plants and that the MMR system plays a part in this decrease.

  12. Introduction of specific point mutations into RNA polymerase II by gene targeting in mouse embryonic stem cells: evidence for a DNA mismatch repair mechanism.

    PubMed Central

    Steeg, C M; Ellis, J; Bernstein, A

    1990-01-01

    We have introduced two specific point mutations, located 20 base pairs apart, into the endogenous murine gene that encodes the largest subunit of RNA polymerase II (RPII215). The first mutation conferred resistance to the mushroom toxin alpha-amanitin (amar), and the second mutation generated a restriction fragment length polymorphism without altering the protein sequence. Targeted amar clones were generated at a frequency of 1 in 30 totipotent embryonic stem cells that expressed stably integrated DNA vectors after electroporation. Thirty to 40% of these clones had acquired both mutations, whereas, surprisingly, the remaining clones had acquired the specific amar point mutation but lacked the restriction fragment length polymorphism. We suggest that the latter clones were generated by independent DNA mismatch repair rather than by double crossover or gene conversion. These results demonstrate that it is possible to introduce specific point mutations into an endogenous gene in embryonic stem cells. Thus it should be possible to introduce single base substitutions into other cellular genes, including nonselectable genes, by optimizing the efficiency of gene transfer and/or the sensitivity of screening for targeted clones. Images PMID:1972278

  13. Comprehensive evaluation of medium and long range correlated density functionals in TD-DFT investigation of DNA bases and base pairs: gas phase and water solution study

    NASA Astrophysics Data System (ADS)

    Shukla, Manoj K.; Leszczynski, Jerzy

    2010-11-01

    A comprehensive analysis of the performance of the TD-DFT method using different density functionals including recently developed medium and long-range correlation corrected density functionals have been carried out for lower-lying electronic singlet valence transitions of nucleic acid bases and the Watson-Crick base pairs in the gas phase and in the water solution. The standard 6-311++G(d,p) basis set was used. Ground state geometries of bases and base pairs were optimized at the M05-2X/6-311++G(d,p) level. The nature of potential energy surfaces (PES) was ascertained through the harmonic vibrational frequency analysis; all geometries were found to be minima at the respective PES. Electronic singlet vertical transition energies were also computed at the CC2/def2-TZVP level in the gas phase. The effect of state-specific water solvation on TD-DFT computed transition energies was considered using the PCM model. For the isolated bases the performance of the B3LYP functional was generally found to be superior among all functionals, but it measurably fails for charge-transfer states in the base pairs. The CC2/def2-TZVP computed transition energies were also revealed to be inferior compared with B3LYP results for the isolated bases. The performance of the ωB97XD, CAM-B3LYP and BMK functionals were found to be similar and comparable with the CC2 results for the isolated bases. However, for the Watson-Crick adenine-thymine and guanine-cytosine base pairs the performance of the ωB97XD functional was found to be the best among all the studied functionals in the present work in predicting the locally excited transitions as well as charge transfer states.

  14. Slow conformational changes in MutS and DNA direct ordered transitions between mismatch search, recognition and signaling of DNA repair.

    PubMed

    Sharma, Anushi; Doucette, Christopher; Biro, F Noah; Hingorani, Manju M

    2013-11-15

    MutS functions in mismatch repair (MMR) to scan DNA for errors, identify a target site and trigger subsequent events in the pathway leading to error removal and DNA re-synthesis. These actions, enabled by the ATPase activity of MutS, are now beginning to be analyzed from the perspective of the protein itself. This study provides the first ensemble transient kinetic data on MutS conformational dynamics as it works with DNA and ATP in MMR. Using a combination of fluorescence probes (on Thermus aquaticus MutS and DNA) and signals (intensity, anisotropy and resonance energy transfer), we have monitored the timing of key conformational changes in MutS that are coupled to mismatch binding and recognition, ATP binding and hydrolysis, as well as sliding clamp formation and signaling of repair. Significant findings include (a) a slow step that follows weak initial interaction between MutS and DNA, in which concerted conformational changes in both macromolecules control mismatch recognition, and (b) rapid, binary switching of MutS conformations that is concerted with ATP binding and hydrolysis and (c) is stalled after mismatch recognition to control formation of the ATP-bound MutS sliding clamp. These rate-limiting pre- and post-mismatch recognition events outline the mechanism of action of MutS on DNA during initiation of MMR.

  15. Does the G.G*syn DNA mismatch containing canonical and rare tautomers of the guanine tautomerise through the DPT? A QM/QTAIM microstructural study

    NASA Astrophysics Data System (ADS)

    Brovarets', Ol'ha O.; Hovorun, Dmytro M.

    2014-12-01

    We have established that the asynchronous concerted double proton transfer (DPT), moving with a time gap and without stable intermediates, is the underlying mechanism for the tautomerisation of the G.G*syn DNA base mispair (C1 symmetry), formed by the keto and enol tautomers of the guanine in the anti- and syn-configurations, into the G*.G*syn base mispair (C1), formed by the enol and imino tautomers of the G base, using quantum-mechanical calculations and Bader's quantum theory of atoms in molecules. By constructing the sweeps of the geometric, electron-topological, energetic, polar and natural bond orbital properties along the intrinsic reaction coordinate of the G.G*syn↔G*.G*syn DPT tautomerisation, the nine key points, that are critical for the atomistic understanding of the tautomerisation reaction, were set and comprehensively analysed. It was found that the G.G*syn mismatch possesses pairing scheme with the formation of the O6...HO6 (7.01) and N1H...N7 (6.77) H-bonds, whereas the G*.G*syn mismatch - of the O6H...O6 (10.68) and N1...HN7 (9.59 kcal mol-1) H-bonds. Our results highlight that these H-bonds are significantly cooperative and mutually reinforce each other in both mismatches. The deformation energy necessary to apply for the G.G*syn base mispair to acquire the Watson-Crick sizes has been calculated. We have shown that the thermodynamically stable G*.G*syn base mispair is dynamically unstable structure with a lifetime of 4.1 × 10-15 s and any of its six low-lying intermolecular vibrations can develop during this period of time. These data exclude the possibility to change the tautomeric status of the bases under the dissociation of the G.G*syn mispair into the monomers during DNA replication. Finally, it has been made an attempt to draw from the physico-chemical properties of all four incorrect purine-purine DNA base pairs a general conclusion, which claims the role of the transversions in spontaneous point mutagenesis.

  16. Why the tautomerization of the G·C Watson-Crick base pair via the DPT does not cause point mutations during DNA replication? QM and QTAIM comprehensive analysis.

    PubMed

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    by the weakening of the lower H-bond. At that point, the upper N4H⋯O6 and O6H⋯N4 H-bonds in the G·C and G*·C* base pairs, respectively, remain constant at the changes of the middle and the lower H-bonds at the beginning and at the ending of the G·C ↔ G*·C* tautomerization. Aiming to answer the question posed in the title of the article, we established that the G*·C* Löwdin's base pair satisfies all the requirements necessary to cause point mutations in DNA except its lifetime, which is much less than the period of time required for the replication machinery to forcibly dissociate a base pair into the monomers (several ns) during DNA replication. So, from the physicochemical point of view, the G*·C* Löwdin's base pair cannot be considered as a source of point mutations arising during DNA replication.

  17. Mitochondrial dysfunction and increased sensitivity to excitotoxicity in mice deficient in DNA mismatch repair.

    PubMed

    Francisconi, Simona; Codenotti, Mara; Ferrari Toninelli, Giulia; Uberti, Daniela; Memo, Maurizio

    2006-07-01

    The expression profile in the hippocampus of mice lacking one allele of the MutS homologue (Msh2), gene, which is one of the most representative components of the DNA mismatch repair system, was analysed to understand whether defects in the repair or in response to DNA damage could impact significantly on brain function. The overall results suggested a reduction in mitochondrial function as indicated by gene expression analysis, biochemical and behavioural studies. In the hippocampus of Msh2+/- mice, array data, validated by RT-PCR and western blot analysis, showed reduced expression levels of genes for cytochrome c oxidase subunit 2 (CoxII), ATP synthase subunit beta and superoxide dismutase 1. Biochemically, mitochondria from the hippocampus and cortex of these mice show reduced CoxII and increased aconitase activity. Behaviourally, these alterations resulted in mice with increased vulnerability to kainic acid-induced epileptic seizures and hippocampal neuronal loss. These data suggest that lack of an efficient system involved in recognizing and repairing DNA damage may generate a brain mitochondriopathy.

  18. Silver(I)-mediated Hoogsteen-type base pairs.

    PubMed

    Megger, Dominik A; Fonseca Guerra, Célia; Bickelhaupt, F Matthias; Müller, Jens

    2011-11-01

    Metal-mediated Hoogsteen-type base pairs are useful for the construction of DNA duplexes containing contiguous stretches of metal ions along the helical axis. To fine-tune the stability of such base pairs and the selectivity toward different metal ions, the availability of a selection of artificial nucleobases is highly desirable. In this study, we follow a theoretical approach utilizing dispersion-corrected density functional methods to evaluate a variety of artificial nucleobases as candidates for metal-mediated Hoogsteen-type base pairs. We focus on silver(I)-mediated Hoogsteen- and reverse Hoogsteen-type base pairs formed between 1-deaza- and 1,3-dideazapurine-derived nucleobases, respectively, and cytosine. Apart from two coordinative bonds, these base pairs are stabilized by a hydrogen bond. We elucidate the impact of different substituents at the C6 position and the presence or absence of an endocyclic N3 nitrogen atom on the overall stability of a base pair and concomitantly on the strength of the hydrogen and coordinative bonds. All artificial base pairs investigated in this study are less stable than the experimentally established benchmark base pair C-Ag(+)-G. The base pair formed from 1,3-dideaza-6-methoxypurine is isoenergetic to the experimentally observed C-Ag(+)-C base pair. This makes 1,3-dideaza-6-methoxypurine a promising candidate for the use as an artificial nucleobase in DNA.

  19. Helicobacter pylori infection modulates the expression of miRNAs associated with DNA mismatch repair pathway.

    PubMed

    Santos, Juliana C; Brianti, Mitsue T; Almeida, Victor R; Ortega, Manoela M; Fischer, Wolfgang; Haas, Rainer; Matheu, Ander; Ribeiro, Marcelo L

    2017-04-01

    Genetic and epigenetic inactivation of DNA mismatch repair (MMR) genes might lead to modifications in cancer-related gene expression and cancer development. Recently, it has been shown that the infection by Helicobacter pylori, the major causative agent of gastric cancer, induces DNA damage and inhibits MMR DNA repair. Also, it has been reported that microRNAs (miRs) have an important role in regulating genomic stability and MMR DNA repair. Thus, the aim of this study was to identify miRs regulating MMR pathway in H. pylori-associated gastric carcinogenesis. To address this question, a gastric epithelial cell line and AGS cancer gastric cells were infected with several H. pylori strains. MMR gene expression and miRs correlating with H. pylori strain infection were evaluated. The results showed that H. pylori infection significantly down-regulated the expression of all selected MMR genes. Also, H. pylori infection modulated the expression of several miRs (including miR-150-5p, miR-155-5p, and miR-3163), after 4, 8, and 12 h of infection. Computational prediction of candidate miRs and their predicted MMR targeting sites were obtained from TargetScan, mirDB, and MetaCore. The generated data indicated that the selected miRs (miR-150-5p, miR-155-5p, and miR-3163) could possibly target and modulate MMR genes (POLD3, MSH2, and MSH3, respectively). The target validation was performed using mimics and luciferase gene reporter assays. Briefly, this study shows that H. pylori impairs MMR DNA repair pathway and identifies miRs that regulate MMR gene expression in gastric cancer. © 2016 Wiley Periodicals, Inc.

  20. The MutSα-Proliferating Cell Nuclear Antigen Interaction in Human DNA Mismatch Repair*S⃞♦

    PubMed Central

    Iyer, Ravi R.; Pohlhaus, Timothy J.; Chen, Sihong; Hura, Gregory L.; Dzantiev, Leonid; Beese, Lorena S.; Modrich, Paul

    2008-01-01

    We have examined the interaction parameters, conformation, and functional significance of the human MutSα· proliferating cell nuclear antigen (PCNA) complex in mismatch repair. The two proteins associate with a 1:1 stoichiometry and a KD of 0.7 μm in the absence or presence of heteroduplex DNA. PCNA does not influence the affinity of MutSα for a mismatch, and mismatch-bound MutSα binds PCNA. Small angle x-ray scattering studies have established the molecular parameters of the complex, which are consistent with an elongated conformation in which the two proteins associate in an end-to-end fashion in a manner that does not involve an extended unstructured tether, as has been proposed for yeast MutSα and PCNA (Shell, S. S., Putnam, C. D., and Kolodner, R. D. (2007) Mol. Cell26 ,565 -57817531814). MutSα variants lacking the PCNA interaction motif are functional in 3′- or 5′-directed mismatch-provoked excision, but display a partial defect in 5′-directed mismatch repair. This finding is consistent with the modest mutability conferred by inactivation of the MutSα PCNA interaction motif and suggests that interaction of the replication clamp with other repair protein(s) accounts for the essential role of PCNA in MutSα-dependent mismatch repair. PMID:18326858

  1. Spontaneous frameshift mutations in Saccharomyces cerevisiae: accumulation during DNA replication and removal by proofreading and mismatch repair activities.

    PubMed Central

    Greene, C N; Jinks-Robertson, S

    2001-01-01

    The accumulation of frameshift mutations during DNA synthesis is determined by the rate at which frameshift intermediates are generated during DNA polymerization and the efficiency with which frameshift intermediates are removed by DNA polymerase-associated exonucleolytic proofreading activity and/or the postreplicative mismatch repair machinery. To examine the relative contributions of these factors to replication fidelity in Saccharomyces cerevisiae, we determined the reversion rates and spectra of the lys2 Delta Bgl +1 frameshift allele. Wild-type and homozygous mutant diploid strains with all possible combinations of defects in the exonuclease activities of DNA polymerases delta and epsilon (conferred by the pol3-01 and pol2-4 alleles, respectively) and in mismatch repair (deletion of MSH2) were analyzed. Although there was no direct correlation between homopolymer run length and frameshift accumulation in the wild-type strain, such a correlation was evident in the triple mutant strain lacking all repair capacity. Furthermore, examination of strains defective in one or two repair activities revealed distinct biases in the removal of the corresponding frameshift intermediates by exonucleolytic proofreading and/or mismatch repair. Finally, these analyses suggest that the mismatch repair machinery may be important for generating some classes of frameshift mutations in yeast. PMID:11560887

  2. Quantifying the contributions of base selectivity, proofreading and mismatch repair to nuclear DNA replication in Saccharomyces cerevisiae.

    PubMed

    St Charles, Jordan A; Liberti, Sascha E; Williams, Jessica S; Lujan, Scott A; Kunkel, Thomas A

    2015-07-01

    Mismatches generated during eukaryotic nuclear DNA replication are removed by two evolutionarily conserved error correction mechanisms acting in series, proofreading and mismatch repair (MMR). Defects in both processes are associated with increased susceptibility to cancer. To better understand these processes, we have quantified base selectivity, proofreading and MMR during nuclear DNA replication in Saccharomyces cerevisiae. In the absence of proofreading and MMR, the primary leading and lagging strand replicases, polymerase ɛ and polymerase δ respectively, synthesize DNA in vivo with somewhat different error rates and specificity, and with apparent base selectivity that is more than 100 times higher than measured in vitro. Moreover, leading and lagging strand replication fidelity rely on a different balance between proofreading and MMR. On average, proofreading contributes more to replication fidelity than does MMR, but their relative contributions vary from nearly all proofreading of some mismatches to mostly MMR of other mismatches. Thus accurate replication of the two DNA strands results from a non-uniform and variable balance between error prevention, proofreading and MMR.

  3. Short Hairpin RNA Suppression of Thymidylate Synthase Produces DNA Mismatches and Results in Excellent Radiosensitization

    SciTech Connect

    Flanagan, Sheryl A.; Cooper, Kristin S.; Mannava, Sudha; Nikiforov, Mikhail A.; Shewach, Donna S.

    2012-12-01

    Purpose: To determine the effect of short hairpin ribonucleic acid (shRNA)-mediated suppression of thymidylate synthase (TS) on cytotoxicity and radiosensitization and the mechanism by which these events occur. Methods and Materials: shRNA suppression of TS was compared with 5-fluoro-2 Prime -deoxyuridine (FdUrd) inactivation of TS with or without ionizing radiation in HCT116 and HT29 colon cancer cells. Cytotoxicity and radiosensitization were measured by clonogenic assay. Cell cycle effects were measured by flow cytometry. The effects of FdUrd or shRNA suppression of TS on dNTP deoxynucleotide triphosphate imbalances and consequent nucleotide misincorporations into deoxyribonucleic acid (DNA) were analyzed by high-pressure liquid chromatography and as pSP189 plasmid mutations, respectively. Results: TS shRNA produced profound ({>=}90%) and prolonged ({>=}8 days) suppression of TS in HCT116 and HT29 cells, whereas FdUrd increased TS expression. TS shRNA also produced more specific and prolonged effects on dNTPs deoxynucleotide triphosphates compared with FdUrd. TS shRNA suppression allowed accumulation of cells in S-phase, although its effects were not as long-lasting as those of FdUrd. Both treatments resulted in phosphorylation of Chk1. TS shRNA alone was less cytotoxic than FdUrd but was equally effective as FdUrd in eliciting radiosensitization (radiation enhancement ratio: TS shRNA, 1.5-1.7; FdUrd, 1.4-1.6). TS shRNA and FdUrd produced a similar increase in the number and type of pSP189 mutations. Conclusions: TS shRNA produced less cytotoxicity than FdUrd but was equally effective at radiosensitizing tumor cells. Thus, the inhibitory effect of FdUrd on TS alone is sufficient to elicit radiosensitization with FdUrd, but it only partially explains FdUrd-mediated cytotoxicity and cell cycle inhibition. The increase in DNA mismatches after TS shRNA or FdUrd supports a causal and sufficient role for the depletion of dTTP thymidine triphosphate and consequent DNA

  4. Base-Pairing Energies of Proton-Bound Dimers and Proton Affinities of 1-Methyl-5-Halocytosines: Implications for the Effects of Halogenation on the Stability of the DNA i-Motif.

    PubMed

    Yang, Bo; Wu, R R; Rodgers, M T

    2015-09-01

    (CCG)(n)•(CGG)(n) trinucleotide repeats have been found to be associated with fragile X syndrome, the most widespread inherited cause of mental retardation in humans. The (CCG)(n)•(CGG)(n) repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of noncanonical proton-bound dimers of cytosine (C(+)•C). Halogenated cytosine residues are one form of DNA damage that may be important in altering the structure and stability of DNA or DNA-protein interactions and, hence, regulate gene expression. Previously, we investigated the effects of 5-halogenation and 1-methylation of cytosine on the base-pairing energies (BPEs) using threshold collision-induced dissociation (TCID) techniques. In the present study, we extend our work to include proton-bound homo- and heterodimers of cytosine, 1-methyl-5-fluorocytosine, and 1-methyl-5-bromocytosine. All modifications examined here are found to produce a decrease in the BPEs. However, the BPEs of all of the proton-bound dimers examined significantly exceed those of Watson-Crick G•C, neutral C•C base pairs, and various methylated variants such that DNA i-motif conformations should still be preserved in the presence of these modifications. The proton affinities (PAs) of the halogenated cytosines are also obtained from the experimental data by competitive analysis of the primary dissociation pathways that occur in parallel for the proton-bound heterodimers. 5-Halogenation leads to a decrease in the N3 PA of cytosine, whereas 1-methylation leads to an increase in the N3 PA. Thus, the 1-methyl-5-halocytosines exhibit PAs that are intermediate.

  5. Base-Pairing Energies of Proton-Bound Dimers and Proton Affinities of 1-Methyl-5-Halocytosines: Implications for the Effects of Halogenation on the Stability of the DNA i-Motif

    NASA Astrophysics Data System (ADS)

    Yang, Bo; Wu, R. R.; Rodgers, M. T.

    2015-09-01

    (CCG)n•(CGG)n trinucleotide repeats have been found to be associated with fragile X syndrome, the most widespread inherited cause of mental retardation in humans. The (CCG)n•(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of noncanonical proton-bound dimers of cytosine (C+•C). Halogenated cytosine residues are one form of DNA damage that may be important in altering the structure and stability of DNA or DNA-protein interactions and, hence, regulate gene expression. Previously, we investigated the effects of 5-halogenation and 1-methylation of cytosine on the base-pairing energies (BPEs) using threshold collision-induced dissociation (TCID) techniques. In the present study, we extend our work to include proton-bound homo- and heterodimers of cytosine, 1-methyl-5-fluorocytosine, and 1-methyl-5-bromocytosine. All modifications examined here are found to produce a decrease in the BPEs. However, the BPEs of all of the proton-bound dimers examined significantly exceed those of Watson-Crick G•C, neutral C•C base pairs, and various methylated variants such that DNA i-motif conformations should still be preserved in the presence of these modifications. The proton affinities (PAs) of the halogenated cytosines are also obtained from the experimental data by competitive analysis of the primary dissociation pathways that occur in parallel for the proton-bound heterodimers. 5-Halogenation leads to a decrease in the N3 PA of cytosine, whereas 1-methylation leads to an increase in the N3 PA. Thus, the 1-methyl-5-halocytosines exhibit PAs that are intermediate.

  6. DNA-Mediated Electrochemistry

    PubMed Central

    Gorodetsky, Alon A.; Buzzeo, Marisa C.

    2009-01-01

    The base pair stack of DNA has been demonstrated as a medium for long range charge transport chemistry both in solution and at DNA-modified surfaces. This chemistry is exquisitely sensitive to structural perturbations in the base pair stack as occur with lesions, single base mismatches, and protein binding. We have exploited this sensitivity for the development of reliable electrochemical assays based on DNA charge transport at self-assembled DNA monolayers. Here we discuss the characteristic features, applications, and advantages of DNA-mediated electrochemistry. PMID:18980370

  7. Detection of coding microsatellite frameshift mutations in DNA mismatch repair-deficient mouse intestinal tumors.

    PubMed

    Woerner, Stefan M; Tosti, Elena; Yuan, Yan P; Kloor, Matthias; Bork, Peer; Edelmann, Winfried; Gebert, Johannes

    2015-11-01

    Different DNA mismatch repair (MMR)-deficient mouse strains have been developed as models for the inherited cancer predisposing Lynch syndrome. It is completely unresolved, whether coding mononucleotide repeat (cMNR) gene mutations in these mice can contribute to intestinal tumorigenesis and whether MMR-deficient mice are a suitable molecular model of human microsatellite instability (MSI)-associated intestinal tumorigenesis. A proof-of-principle study was performed to identify mouse cMNR-harboring genes affected by insertion/deletion mutations in MSI murine intestinal tumors. Bioinformatic algorithms were developed to establish a database of mouse cMNR-harboring genes. A panel of five mouse noncoding mononucleotide markers was used for MSI classification of intestinal matched normal/tumor tissues from MMR-deficient (Mlh1(-/-) , Msh2(-/-) , Msh2(LoxP/LoxP) ) mice. cMNR frameshift mutations of candidate genes were determined by DNA fragment analysis. Murine MSI intestinal tumors but not normal tissues from MMR-deficient mice showed cMNR frameshift mutations in six candidate genes (Elavl3, Tmem107, Glis2, Sdccag1, Senp6, Rfc3). cMNRs of mouse Rfc3 and Elavl3 are conserved in type and length in their human orthologs that are known to be mutated in human MSI colorectal, endometrial and gastric cancer. We provide evidence for the utility of a mononucleotide marker panel for detection of MSI in murine tumors, the existence of cMNR instability in MSI murine tumors, the utility of mouse subspecies DNA for identification of polymorphic repeats, and repeat conservation among some orthologous human/mouse genes, two of them showing instability in human and mouse MSI intestinal tumors. MMR-deficient mice hence are a useful molecular model system for analyzing MSI intestinal carcinogenesis.

  8. Crystal Structure of Human Thymine DNA Glycosylase Bound to DNA Elucidates Sequence-Specific Mismatch Recognition

    SciTech Connect

    Maiti, A.; Morgan, M.T.; Pozharski, E.; Drohat, A.C.

    2009-05-19

    Cytosine methylation at CpG dinucleotides produces m{sup 5}CpG, an epigenetic modification that is important for transcriptional regulation and genomic stability in vertebrate cells. However, m{sup 5}C deamination yields mutagenic G{center_dot}T mispairs, which are implicated in genetic disease, cancer, and aging. Human thymine DNA glycosylase (hTDG) removes T from G{center_dot}T mispairs, producing an abasic (or AP) site, and follow-on base excision repair proteins restore the G{center_dot}C pair. hTDG is inactive against normal A{center_dot}T pairs, and is most effective for G{center_dot}T mispairs and other damage located in a CpG context. The molecular basis of these important catalytic properties has remained unknown. Here, we report a crystal structure of hTDG (catalytic domain, hTDG{sup cat}) in complex with abasic DNA, at 2.8 {angstrom} resolution. Surprisingly, the enzyme crystallized in a 2:1 complex with DNA, one subunit bound at the abasic site, as anticipated, and the other at an undamaged (nonspecific) site. Isothermal titration calorimetry and electrophoretic mobility-shift experiments indicate that hTDG and hTDG{sup cat} can bind abasic DNA with 1:1 or 2:1 stoichiometry. Kinetics experiments show that the 1:1 complex is sufficient for full catalytic (base excision) activity, suggesting that the 2:1 complex, if adopted in vivo, might be important for some other activity of hTDG, perhaps binding interactions with other proteins. Our structure reveals interactions that promote the stringent specificity for guanine versus adenine as the pairing partner of the target base and interactions that likely confer CpG sequence specificity. We find striking differences between hTDG and its prokaryotic ortholog (MUG), despite the relatively high (32%) sequence identity.

  9. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

    PubMed Central

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-01

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

  10. Investigation of the Cu binding site at [dCdG] and [CG] base pairs in the absence of a DNA backbone

    NASA Astrophysics Data System (ADS)

    Kim, Mi-Ji; Kim, Bo-Ra; Kim, Ho-Tae

    2011-03-01

    We investigated the gas-phase nucleobases [CGH] +1, [Cu(CG)] +1, [Cu(CG-H)] +1, and nucleoside [Cu(dCdG)] +1 complexes using collision-induced dissociation (CID) MS/MS spectra. Two forms, the Watson-Crick complex form (cation-base-base) and an interstrand complex form (base-cation-base), were included in the analysis of the [cation-base pair] complex structures. The main cytosine loss dissociation channel of the [Cu(CG)] +1 complex was analyzed as the loss of an interstrand [Cu(CG)] +1 form instead of the Watson-Crick form. The -43 amu (CONH) and -68 amu (cytosine-CONH) loss fragments of the [Cu(CG-H)] +1 complex can be explained by the dissociation process of the interstrand [Cu(CG-H)] +1 form.

  11. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

    SciTech Connect

    Yeo, Hyun Koo; Lee, Jae Young

    2012-04-18

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

  12. Hybridization and sequencing of nucleic acids using base pair mismatches

    DOEpatents

    Fodor, Stephen P. A.; Lipshutz, Robert J.; Huang, Xiaohua

    2001-01-01

    Devices and techniques for hybridization of nucleic acids and for determining the sequence of nucleic acids. Arrays of nucleic acids are formed by techniques, preferably high resolution, light-directed techniques. Positions of hybridization of a target nucleic acid are determined by, e.g., epifluorescence microscopy. Devices and techniques are proposed to determine the sequence of a target nucleic acid more efficiently and more quickly through such synthesis and detection techniques.

  13. An operator at -280 base pairs that is required for repression of araBAD operon promoter: addition of DNA helical turns between the operator and promoter cyclically hinders repression.

    PubMed

    Dunn, T M; Hahn, S; Ogden, S; Schleif, R F

    1984-08-01

    A site has been found that is required for repression of the Escherichia coli araBAD operon. This site was detected by the in vivo properties of deletion mutants. In vitro protection studies with DNase I and dimethylsulfate showed that araC protein can specifically bind in this area to nucleotides lying at position -265 to -294 with respect to the araBAD operon promoter (PBAD) transcription start point. The previously known sites of protein binding in the ara operon lie between +20 and -160. Since the properties of deletion strains show that all the sites required for araBAD induction lie between +20 and -110, the new site at -280 exerts its repressive action over an unusually large distance along the DNA. Insertions of -16, -8, 0, 5, 11, 15, 24, and 31 base pairs of DNA between the new site and PBAD were constructed. Repression was impaired in those cases in which half-integral turns of the DNA helix were introduced, but repression was nearly normal for the insertions of 0, +11, and +31 base pairs.

  14. Influence of C-5 substituted cytosine and related nucleoside analogs on the formation of benzo[a]pyrene diol epoxide-dG adducts at CG base pairs of DNA.

    PubMed

    Guza, Rebecca; Kotandeniya, Delshanee; Murphy, Kristopher; Dissanayake, Thakshila; Lin, Chen; Giambasu, George Madalin; Lad, Rahul R; Wojciechowski, Filip; Amin, Shantu; Sturla, Shana J; Hudson, Robert H E; York, Darrin M; Jankowiak, Ryszard; Jones, Roger; Tretyakova, Natalia Y

    2011-05-01

    Endogenous 5-methylcytosine ((Me)C) residues are found at all CG dinucleotides of the p53 tumor suppressor gene, including the mutational 'hotspots' for smoking induced lung cancer. (Me)C enhances the reactivity of its base paired guanine towards carcinogenic diolepoxide metabolites of polycyclic aromatic hydrocarbons (PAH) present in cigarette smoke. In the present study, the structural basis for these effects was investigated using a series of unnatural nucleoside analogs and a representative PAH diolepoxide, benzo[a]pyrene diolepoxide (BPDE). Synthetic DNA duplexes derived from a frequently mutated region of the p53 gene (5'-CCCGGCACCC GC[(15)N(3),(13)C(1)-G]TCCGCG-3', + strand) were prepared containing [(15)N(3), (13)C(1)]-guanine opposite unsubstituted cytosine, (Me)C, abasic site, or unnatural nucleobase analogs. Following BPDE treatment and hydrolysis of the modified DNA to 2'-deoxynucleosides, N(2)-BPDE-dG adducts formed at the [(15)N(3), (13)C(1)]-labeled guanine and elsewhere in the sequence were quantified by mass spectrometry. We found that C-5 alkylcytosines and related structural analogs specifically enhance the reactivity of the base paired guanine towards BPDE and modify the diastereomeric composition of N(2)-BPDE-dG adducts. Fluorescence and molecular docking studies revealed that 5-alkylcytosines and unnatural nucleobase analogs with extended aromatic systems facilitate the formation of intercalative BPDE-DNA complexes, placing BPDE in a favorable orientation for nucleophilic attack by the N(2) position of guanine.

  15. Relationship between DNA mismatch repair genes expression, Ku-genes expression and ploidy-related parameters in the progression of pigmented lesions of the skin.

    PubMed

    Korabiowska, Monika; Tscherny, Michael; Stachura, Jerzy; Ruschenburg, Ilka; Cordon-Cardo, Carlos; Brinck, Ulrich

    2002-01-01

    Defects of DNA repair systems in cutaneous tumours are related to DNA mismatch repair genes (MLH1, MSH2, PMS1, PMS2) and Ku70/80 genes involved in double- strand repair. In this study we investigated the statistical relationship between these systems and DNA-ploidy-related parameters in 19 naevus cell naevi, 23 lentigos maligna, 76 primary melanomas and 31 melanoma metastases, applying the correlation coefficient according to Spearman. In naevi significant correlations were found between Ku70/80 gene expression and some ploidy-related parameters. In lentigos, additionally, some significant correlations between the expression of DNA mismatch repair genes were found. Similar results were demonstrated for primary melanomas. In metastases no one significant correlation between DNA mismatch repair genes and Ku-genes was present. We postulate that DNA mismatch repair genes and Ku70/80 genes are functionally independent and that some of them are able to influence ploidy-related parameters.

  16. Synthesis of specific diastereomers of a DNA methylphosphonate heptamer, d(CpCpApApApCpA), and stability of base pairing with the normal DNA octamer d(TPGPTPTPTPGPGPC).

    PubMed Central

    Vyazovkina, E V; Savchenko, E V; Lokhov, S G; Engels, J W; Wickstrom, E; Lebedev, A V

    1994-01-01

    DNA methylphosphonates are candidate derivatives for use in antisense DNA therapy. Their efficacy is limited by weak hybridization. One hypothesis to explain this phenomenon holds that one configuration of the chiral methylphosphonate linkage, Rp, permits stronger base pairing than the other configuration, Sp. To test this hypothesis, four specific pairs of Rp and Sp diastereomers of the DNA methylphosphonate heptamer d(CpCpApApApCpA) were prepared by block coupling of different combinations of individual diastereomers of d(CpCpApA) and d(ApCpA). Each pair of the diastereomers of the heptamer was separated into individual diastereomes using affinity chromatography on a Lichrosorb-NH2 silica column with a covalently attached complementary normal DNA octamer, d(pTpGpTpTpTpGpGpC). The stabilities of complementary complexes of phosphodiester d(TpGpTpTpTpGpGpC) with 8 individual diastereomers of methylphosphonate d(CpCpApApApCpA) were studied by measuring their melting temperatures (Tm). A direct correlation of Tm values with the number of Rp methylphosphonate centers in the heptamer was found: the more Rp centers, the higher the stability of the complex. Tm values for the diastereomers with 6 all-Rp or all-Sp methylphosphonate centers were found to be 30.5 degrees and 12.5 degrees C, respectively, in 100 mM NaCl, 10 mM Na2HPO4, 1 mM EDTA, pH 7.0 with 15 microM of each oligomer. On the average, each substitution of one Rp-center to an Sp-center in the heptamer decreased the Tm by 3 degrees C. Under the same conditions, the Tm of the normal DNA heptamer with its complement was 21 degrees C. These results are consistent with the model that all-Rp methylphosphonate DNAs hybridize much more tightly to complementary normal DNA than do racemic methylphosphonate DNAs, and may therefore exhibit greater potency as antisense inhibitors. PMID:8036171

  17. Functional role of DNA mismatch repair gene PMS2 in prostate cancer cells.

    PubMed

    Fukuhara, Shinichiro; Chang, Inik; Mitsui, Yozo; Chiyomaru, Takeshi; Yamamura, Soichiro; Majid, Shahana; Saini, Sharanjot; Deng, Guoren; Gill, Ankurpreet; Wong, Darryn K; Shiina, Hiroaki; Nonomura, Norio; Lau, Yun-Fai C; Dahiya, Rajvir; Tanaka, Yuichiro

    2015-06-30

    DNA mismatch repair (MMR) enzymes act as proofreading complexes that maintains genomic integrity and MMR-deficient cells show an increased mutation rate. MMR has also been shown to influence cell signaling and the regulation of tumor development. MMR consists of various genes and includes post-meiotic segregation (PMS) 2 which is a vital component of mutL-alpha. In prostate, the functional role of this gene has never been reported and in this study, our aim was to investigate the effect of PMS2 on growth properties of prostate cancer (PCa) cells. Previous studies have shown PMS2 to be deficient in DU145 cells and this lack of expression was confirmed by Western blotting whereas normal prostatic PWR-1E and RWPE-1 cells expressed this gene. PMS2 effects on various growth properties of DU145 were then determined by creating stable gene transfectants. Interestingly, PMS2 caused decreased cell proliferation, migration, invasion, and in vivo growth; and increased apoptosis as compared to vector control. We further analyzed genes affected by PMS2 expression and observe the apoptosis-related TMS1 gene to be significantly upregulated whereas anti-apoptotic BCL2A1 was downregulated. These results demonstrate a functional role for PMS2 to protect against PCa progression by enhancing apoptosis of PCa cells.

  18. DNA mismatch repair gene MSH6 implicated in determining age at natural menopause

    PubMed Central

    Perry, John R.B.; Hsu, Yi-Hsiang; Chasman, Daniel I.; Johnson, Andrew D.; Elks, Cathy; Albrecht, Eva; Andrulis, Irene L.; Beesley, Jonathan; Berenson, Gerald S.; Bergmann, Sven; Bojesen, Stig E.; Bolla, Manjeet K.; Brown, Judith; Buring, Julie E.; Campbell, Harry; Chang-Claude, Jenny; Chenevix-Trench, Georgia; Corre, Tanguy; Couch, Fergus J.; Cox, Angela; Czene, Kamila; D'adamo, Adamo Pio; Davies, Gail; Deary, Ian J.; Dennis, Joe; Easton, Douglas F.; Engelhardt, Ellen G.; Eriksson, Johan G.; Esko, Tõnu; Fasching, Peter A.; Figueroa, Jonine D.; Flyger, Henrik; Fraser, Abigail; Garcia-Closas, Montse; Gasparini, Paolo; Gieger, Christian; Giles, Graham; Guenel, Pascal; Hägg, Sara; Hall, Per; Hayward, Caroline; Hopper, John; Ingelsson, Erik; Kardia, Sharon L.R.; Kasiman, Katherine; Knight, Julia A.; Lahti, Jari; Lawlor, Debbie A.; Magnusson, Patrik K.E.; Margolin, Sara; Marsh, Julie A.; Metspalu, Andres; Olson, Janet E.; Pennell, Craig E.; Polasek, Ozren; Rahman, Iffat; Ridker, Paul M.; Robino, Antonietta; Rudan, Igor; Rudolph, Anja; Salumets, Andres; Schmidt, Marjanka K.; Schoemaker, Minouk J.; Smith, Erin N.; Smith, Jennifer A.; Southey, Melissa; Stöckl, Doris; Swerdlow, Anthony J.; Thompson, Deborah J.; Truong, Therese; Ulivi, Sheila; Waldenberger, Melanie; Wang, Qin; Wild, Sarah; Wilson, James F; Wright, Alan F.; Zgaga, Lina; Ong, Ken K.; Murabito, Joanne M.; Karasik, David; Murray, Anna

    2014-01-01

    The length of female reproductive lifespan is associated with multiple adverse outcomes, including breast cancer, cardiovascular disease and infertility. The biological processes that govern the timing of the beginning and end of reproductive life are not well understood. Genetic variants are known to contribute to ∼50% of the variation in both age at menarche and menopause, but to date the known genes explain <15% of the genetic component. We have used genome-wide association in a bivariate meta-analysis of both traits to identify genes involved in determining reproductive lifespan. We observed significant genetic correlation between the two traits using genome-wide complex trait analysis. However, we found no robust statistical evidence for individual variants with an effect on both traits. A novel association with age at menopause was detected for a variant rs1800932 in the mismatch repair gene MSH6 (P = 1.9 × 10−9), which was also associated with altered expression levels of MSH6 mRNA in multiple tissues. This study contributes to the growing evidence that DNA repair processes play a key role in ovarian ageing and could be an important therapeutic target for infertility. PMID:24357391

  19. The Arabidopsis DNA mismatch repair gene PMS1 restricts somatic recombination between homeologous sequences.

    PubMed

    Li, Liangliang; Dion, Eric; Richard, Gabriel; Domingue, Olivier; Jean, Martine; Belzile, François J

    2009-04-01

    The eukaryotic DNA mismatch repair (MMR) system contributes to maintaining the fidelity of genetic information by correcting replication errors and preventing illegitimate recombination events. This study aimed to examine the function(s) of the Arabidopsis thaliana PMS1 gene (AtPMS1), one of three homologs of the bacterial MutL gene in plants. Two independent mutant alleles (Atpms1-1 and Atpms1-2) were obtained and one of these (Atpms1-1) was studied in detail. The mutant exhibited a reduction in seed set and a bias against the transmission of the mutant allele. Somatic recombination, both homologous and homeologous, was examined using a set of reporter constructs. Homologous recombination remained unchanged in the mutant while homeologous recombination was between 1.7- and 4.8-fold higher than in the wild type. This increase in homeologous recombination frequency was not correlated with the degree of sequence divergence. In RNAi lines, a range of increases in homeologous recombination were observed with two lines showing a 3.3-fold and a 3.6-fold increase. These results indicate that the AtPMS1 gene contributes to an antirecombination activity aimed at restricting recombination between diverged sequences.

  20. Base-pairing energies of protonated nucleobase pairs and proton affinities of 1-methylated cytosines: model systems for the effects of the sugar moiety on the stability of DNA i-motif conformations.

    PubMed

    Yang, Bo; Moehlig, Aaron R; Frieler, C E; Rodgers, M T

    2015-02-05

    Expansion of (CCG)n·(CGG)n trinucleotide repeats leads to hypermethylation of cytosine residues and results in Fragile X syndrome, the most common cause of inherited intellectual disability in humans. The (CCG)n·(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of noncanonical protonated nucleobase pairs of cytosine (C(+)·C). Previously, we investigated the effects of 5-methylation of cytosine on the base-pairing energies (BPEs) using threshold collision-induced dissociation (TCID) techniques. In the present work, we extend our investigations to include protonated homo- and heteronucleobase pairs of cytosine, 1-methylcytosine, 5-methylcytosine, and 1,5-dimethylcytosine. The 1-methyl substituent prevents most tautomerization processes of cytosine and serves as a mimic for the sugar moiety of DNA nucleotides. In contrast to permethylation of cytosine at the 5-position, 1-methylation is found to exert very little influence on the BPE. All modifications to both nucleobases lead to a small increase in the BPEs, with 5-methylation producing a larger enhancement than either 1-methyl or 1,5-dimethylation. In contrast, modifications to a single nucleobase are found to produce a small decrease in the BPEs, again with 5-methylation producing a larger effect than 1-methylation. However, the BPEs of all of the protonated nucleobase pairs examined here significantly exceed those of canonical G·C and neutral C·C base pairs, and thus should still provide the driving force stabilizing DNA i-motif conformations even in the presence of such modifications. The proton affinities of the methylated cytosines are also obtained from the TCID experiments by competitive analyses of the primary dissociation pathways that occur in parallel for the protonated heteronucleobase pairs.

  1. A novel conception for spontaneous transversions caused by homo-pyrimidine DNA mismatches: a QM/QTAIM highlight.

    PubMed

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-09-07

    We have firstly shown that the T·T(w) and C·C(w) DNA mismatches with wobble (w) geometry stay in slow tautomeric equilibrium with short T·T*(WC) and C·C*(WC) Watson-Crick (WC) mispairs. These non-dissociative tautomeric rearrangements are controlled by the plane-symmetric, highly stable, highly polar and zwitterionic transition states. The obtained results allow us to understand in what way the T·T(w) and C·C(w) mismatches acquire enzymatically competent T·T*(WC) and C·C*(WC) conformations directly in the hydrophobic recognition pocket of a high-fidelity DNA-polymerase, thereby producing thermodynamically non-equilibrium spontaneous transversions. The simplest numerical estimation of the frequency ratio of the TT to CC spontaneous transversions satisfactorily agrees with experimental data.

  2. DNA Binding and Recognition of a CC Mismatch in a DNA Duplex by Water-Soluble Peptidocalix[4]arenes: Synthesis and Applications.

    PubMed

    Alavijeh, Nahid S; Zadmard, Reza; Balalaie, Saeed; Alavijeh, Mohammad S; Soltani, Nima

    2016-10-07

    Water-soluble peptidocalix[4]arenes were synthesized by the introduction of arginine-rich narrow groove-binding residues at lower rims through solid-phase synthesis. The study of binding of these water-soluble bidentate ligands to well-matched and mismatched DNA duplexes by fluorescent titrations, ethidium bromide (EB) displacement assays, DNA-melting experiments, and circular dichroism (CD) analysis revealed a sequence-dependent groove-binding mechanism.

  3. In silico studies to explore the mutagenic ability of 5-halo/oxy/li-oxy-uracil bases with guanine of DNA base pairs.

    PubMed

    Jana, Kalyanashis; Ganguly, Bishwajit

    2014-10-16

    DNA nucleobases are reactive in nature and undergo modifications by deamination, oxidation, alkylation, or hydrolysis processes. Many such modified bases are susceptible to mutagenesis when formed in cellular DNA. The mutagenesis can occur by mispairing with DNA nucleobases by a DNA polymerase during replication. We have performed a study of mispairing of DNA bases with unnatural bases computationally. 5-Halo uracils have been studied as mispairs in mutagenesis; however, the reports on their different forms are scarce in the literature. The stability of mispairs with keto form, enol form, and ionized form of 5-halo-uracil has been computed with the M06-2X/6-31+G** level of theory. The enol form of 5-halo-uracil showed remarkable stability toward DNA mispair compared to the corresponding keto and ionized forms. (F)U-G mispair showed the highest stability in the series and (Halo)(U(enol/ionized)-G mispair interactions energies are more stable than the natural G-C basepair of DNA. To enhance the stability of DNA mispairs, we have introduced the hydroxyl group in the place of halogen atoms, which provides additional hydrogen-bonding interactions in the system while forming the 5-membered ring. The study has been further extended with lithiated 5-hydroxymethyl-uracil to stabilize the DNA mispair. (CH2OLi)U(ionized)-G mispair has shown the highest stability (ΔG = -32.4 kcal/mol) with multi O-Li interactions. AIM (atoms in molecules) and EDA (energy decomposition analysis) analysis has been performed to examine the nature of noncovalent interactions in such mispairs. EDA analysis has shown that electrostatic energy mainly contributes toward the interaction energy of mispairs. The higher stability achieved in these studied mispairs can play a pivotal role in the mutagenesis and can help to attain the mutation for many desired biological processes.

  4. Altered expression and new mutations in DNA mismatch repair genes MLH1 and MSH2 in melanoma brain metastases.

    PubMed

    Korabiowska, Monika; König, Fatima; Verheggen, Raphaela; Schlott, Thilo; Cordon-Cardo, Carlos; Romeike, Bernd; Brinck, Ulrich

    2004-01-01

    Brain metastases, including those of malignant melanoma (known for its high genomic instability), are the most common intracranial tumors. The main objective of this study was to investigate expression and mutation in the DNA mismatch repair system in melanoma brain metastases. Expression of MLH1, MSH2, PMS1 and PMS2 was investigated immunohistochemically in 31 melanoma metastatic tumors. Mutational analysis of MLH1 and MSH2 was performed in 17 melanoma brain metastases. Loss of MLH1 and MSH2 expression was found in 10/31 and 12/31 tumors. PMS1 (27/31) and PMS2 (28/31) expression was preserved in the majority of lesions. Potential missense mutation was found in MSH2 (exon 13) in 2/17 melanomas. Mutation in the intron sequence between exon 14 and 15 of MLH1 (exon 15) was observed in 4/17 cases. Our results indicate that the two major DNA mismatch repair genes, MLH1 and MSH2, are more frequently affected by alterations in the DNA mismatch repair system than the helper genes PMS1 and PMS2. The presence of mutations of MSH2 and MLH1 in melanoma brain metastases, which has not been found in primary melanomas, indicates the high genomic instability of melanoma brain metastases.

  5. HNA and ANA high-affinity arrays for detections of DNA and RNA single-base mismatches.

    PubMed

    Abramov, Mikhail; Schepers, Guy; Van Aerschot, Arthur; Van Hummelen, Paul; Herdewijn, Piet

    2008-06-15

    DNA microarrays and sensors have become essential tools in the functional analysis of sequence information. Recently we reported that chimeric hexitol (HNA) and altritol (ANA) nucleotide monomers with an anhydrohexitol sugar moiety are easily available and proved their chemistry to be compatible with DNA and RNA synthesis. In this communication we describe a novel analytical platform based on HNA and ANA units to be used as synthetic oligonucleotide arrays on a glass solid support for match/mismatch detection of DNA and RNA targets. Arrays were fabricated by immobilization of diene-modified oligonucleotides on maleimido-activated glass slides. To demonstrate the selectivity and sensitivity of the HNA/ANA arrays and to compare their properties with regular DNA arrays, sequences in the reverse transcriptase gene (codon 74) and the protease gene of HIV-1 (codon 10) were selected. Both, the relative intensity of the signal and match/mismatch discrimination increased up to fivefold for DNA targets and up to 3-3.5-fold for RNA targets applying HNA or ANA arrays (ANA>HNA>DNA). Certainly in the new field of miRNA detection, ANA arrays could prove very beneficial and their properties should be investigated in more detail.

  6. Synthesis, base pairing and structure studies of geranylated RNA

    PubMed Central

    Wang, Rui; Vangaveti, Sweta; Ranganathan, Srivathsan V.; Basanta-Sanchez, Maria; Haruehanroengra, Phensinee; Chen, Alan; Sheng, Jia

    2016-01-01

    Natural RNAs utilize extensive chemical modifications to diversify their structures and functions. 2-Thiouridine geranylation is a special hydrophobic tRNA modification that has been discovered very recently in several bacteria, such as Escherichia coli, Enterobacter aerogenes, Pseudomonas aeruginosa and Salmonella Typhimurium. The geranylated residues are located in the first anticodon position of tRNAs specific for lysine, glutamine and glutamic acid. This big hydrophobic terpene functional group affects the codon recognition patterns and reduces frameshifting errors during translation. We aimed to systematically study the structure, function and biosynthesis mechanism of this geranylation pathway, as well as answer the question of why nature uses such a hydrophobic modification in hydrophilic RNA systems. Recently, we have synthesized the deoxy-analog of S-geranyluridine and showed the geranylated T-G pair is much stronger than the geranylated T-A pair and other mismatched pairs in the B-form DNA duplex context, which is consistent with the observation that the geranylated tRNAGluUUC recognizes GAG more efficiently than GAA. In this manuscript we report the synthesis and base pairing specificity studies of geranylated RNA oligos. We also report extensive molecular simulation studies to explore the structural features of the geranyl group in the context of A-form RNA and its effect on codon–anticodon interaction during ribosome binding. PMID:27307604

  7. Evolving approach and clinical significance of detecting DNA mismatch repair deficiency in colorectal carcinoma

    PubMed Central

    Shia, Jinru

    2016-01-01

    The last two decades have seen significant advancement in our understanding of colorectal tumors with DNA mismatch repair (MMR) deficiency. The ever-emerging revelations of new molecular and genetic alterations in various clinical conditions have necessitated constant refinement of disease terminology and classification. Thus, a case with the clinical condition of hereditary non-polyposis colorectal cancer as defined by the Amsterdam criteria may be one of Lynch syndrome characterized by a germline defect in one of the several MMR genes, one of the yet-to-be-defined “Lynch-like syndrome” if there is evidence of MMR deficiency in the tumor but no detectable germline MMR defect or tumor MLH1 promoter methylation, or “familial colorectal cancer type X” if there is no evidence of MMR deficiency. The detection of these conditions carries significant clinical implications. The detection tools and strategies are constantly evolving. The Bethesda guidelines symbolize a selective approach that uses clinical information and tumor histology as the basis to select high-risk individuals. Such a selective approach has subsequently been found to have limited sensitivity, and is thus gradually giving way to the alternative universal approach that tests all newly diagnosed colorectal cancers. Notably, the universal approach also has its own limitations; its cost-effectiveness in real practice, in particular, remains to be determined. Meanwhile, technological advances such as the next-generation sequencing are offering the promise of direct genetic testing for MMR deficiency at an affordable cost probably in the near future. This article reviews the up-to-date molecular definitions of the various conditions related to MMR deficiency, and discusses the tools and strategies that have been used in detecting these conditions. Special emphasis will be placed on the evolving nature and the clinical importance of the disease definitions and the detection strategies. PMID:25716099

  8. Mismatch repair.

    PubMed

    Fishel, Richard

    2015-10-30

    Highly conserved MutS homologs (MSH) and MutL homologs (MLH/PMS) are the fundamental components of mismatch repair (MMR). After decades of debate, it appears clear that the MSH proteins initiate MMR by recognizing a mismatch and forming multiple extremely stable ATP-bound sliding clamps that diffuse without hydrolysis along the adjacent DNA. The function(s) of MLH/PMS proteins is less clear, although they too bind ATP and are targeted to MMR by MSH sliding clamps. Structural analysis combined with recent real-time single molecule and cellular imaging technologies are providing new and detailed insight into the thermal-driven motions that animate the complete MMR mechanism.

  9. Mutation detection by mismatch binding protein, MutS, in amplified DNA: Application to the cystic fibrosis gene

    SciTech Connect

    Lishanski, A.; Ostrander, E.A.; Rine, J. |

    1994-03-29

    An experimental strategy for detecting heterozygosity in genomic DNA has been developed based on preferential binding of Escherichia coli MutS protein to DNA molecules containing mismatched bases. The binding was detected by a gel mobility-shift assay. This approach was tested by using as a model the most commonly occurring mutations within the cystic fibrosis (CFTR) gene. Genomic DNA samples were amplified with 5{prime}-end-labeled primers that bracket the site of the {Delta}F508 3-bp deletion in exon 10 of the CFTR gene. The renatured PCR products from homozygotes produced homoduplexes; the PCR products from heterozygotes produced heteroduplexes and homoduplexes (1:1). MutS protein bound more strongly to heteroduplexes that correspond to heterozygous carriers of {Delta}F508 and contain a CTT or a GAA loop in one of the strands than to homoduplexes corresponding to homozygotes. The ability of MutS protein to detect heteroduplexes in PCR-amplified DNA extended to fragments {approximately} 500 bp long. The method was also able to detect carriers of the point mutations in exon 11 of the CFTR gene by a preferential binding of MutS to single-base mismatches in PCR-amplified DNA.

  10. Complexes of DNA Bases and Watson-Crick Base Pairs Interaction with Neutral Silver Agn (n = 8, 10, 12) Clusters: A DFT and TDDFT Study.

    PubMed

    Srivastava, Ruby

    2017-03-21

    We study the binding of the neutral Agn (n = 8, 10, 12) to the DNA base- adenine (A), guanine (G) and Watson-Crick -adenine-thymine (AT), guanine-cytosine (GC) pairs. Geometries of complexes were optimized at the DFT level using the hybrid B3LYP functional. LANL2DZ effective core potential (ECP) was used for silver and 6-31+G(**) was used for all other atoms. NBO charges were analyzed using the Natural population analysis. The absorption properties of Agn-A,G/WC complexes were also studied using time-dependent density functional theory (TDDFT). The absorption spectra for these complexes show wavelength in the visible region. It was revealed that silver clusters interact more strongly with WC pairs than with isolated DNA complexes. Furthermore, it was found that the electronic charge transferred from silver to isolated DNA clusters are less than the electronic charge transferred from silver to the Agn-WC complexes. The vertical ionization potential, vertical electron affinity, hardness and electrophilicity index of Agn-DNA/WC complexes have also been discussed.

  11. The unstructured linker arms of Mlh1-Pms1 are important for interactions with DNA during mismatch repair.

    PubMed

    Plys, Aaron J; Rogacheva, Maria V; Greene, Eric C; Alani, Eric

    2012-09-14

    DNA mismatch repair (MMR) models have proposed that MSH (MutS homolog) proteins identify DNA polymerase errors while interacting with the DNA replication fork. MLH (MutL homolog) proteins (primarily Mlh1-Pms1 in baker's yeast) then survey the genome for lesion-bound MSH proteins. The resulting MSH-MLH complex formed at a DNA lesion initiates downstream steps in repair. MLH proteins act as dimers and contain long (20-30 nm) unstructured arms that connect two terminal globular domains. These arms can vary between 100 and 300 amino acids in length, are highly divergent between organisms, and are resistant to amino acid substitutions. To test the roles of the linker arms in MMR, we engineered a protease cleavage site into the Mlh1 linker arm domain of baker's yeast Mlh1-Pms1. Cleavage of the Mlh1 linker arm in vitro resulted in a defect in Mlh1-Pms1 DNA binding activity, and in vivo proteolytic cleavage resulted in a complete defect in MMR. We then generated a series of truncation mutants bearing Mlh1 and Pms1 linker arms of varying lengths. This work revealed that MMR is greatly compromised when portions of the Mlh1 linker are removed, whereas repair is less sensitive to truncation of the Pms1 linker arm. Purified complexes containing truncations in Mlh1 and Pms1 linker arms were analyzed and found to have differential defects in DNA binding that also correlated with the ability to form a ternary complex with Msh2-Msh6 and mismatch DNA. These observations are consistent with the unstructured linker domains of MLH proteins providing distinct interactions with DNA during MMR.

  12. Principles of RNA base pairing: structures and energies of the trans Watson-Crick/sugar edge base pairs.

    PubMed

    Sponer, Judit E; Spackova, Nad'a; Leszczynski, Jerzy; Sponer, Jirí

    2005-06-09

    Due to the presence of the 2'-OH hydroxyl group of ribose, RNA molecules utilize an astonishing variability of base pairing patterns to build up their structures and perform the biological functions. Many of the key RNA base pairing families have no counterparts in DNA. In this study, the trans Watson-Crick/sugar edge (trans WC/SE) RNA base pair family has been characterized using quantum chemical and molecular mechanics calculations. Gas-phase optimized geometries from density functional theory (DFT) calculations and RIMP2 interaction energies are reported for the 10 crystallographically identified trans WC/SE base pairing patterns. Further, stable structures are predicted for all of the remaining six possible members of this family not seen in RNAs so far. Among these novel six base pairs, the computations substantially refine two structures suggested earlier based on simple isosteric considerations. For two additional trans WC/SE base pairs predicted in this study, no arrangement was suggested before. Thus, our study brings a complete set of trans WC/SE base pairing patterns. The present results are also contrasted with calculations reported recently for the cis WC/SE base pair family. The computed base pair sizes are in sound correlation with the X-ray data for all WC/SE pairing patterns including both their cis and trans isomers. This confirms that the isostericity of RNA base pairs, which is one of the key factors determining the RNA sequence conservation patterns, originates in the properties of the isolated base pairs. In contrast to the cis structures, however, the isosteric subgroups of the trans WC/SE family differ not only in their H-bonding patterns and steric dimensions but also in the intrinsic strength of the intermolecular interactions. The distribution of the total interaction energy over the sugar-base and base-base contributions is controlled by the cis-trans isomerism.

  13. Crosstalk between BRCA-Fanconi anemia and mismatch repair pathways prevents MSH2-dependent aberrant DNA damage responses.

    PubMed

    Peng, Min; Xie, Jenny; Ucher, Anna; Stavnezer, Janet; Cantor, Sharon B

    2014-08-01

    Several proteins in the BRCA-Fanconi anemia (FA) pathway, such as FANCJ, BRCA1, and FANCD2, interact with mismatch repair (MMR) pathway factors, but the significance of this link remains unknown. Unlike the BRCA-FA pathway, the MMR pathway is not essential for cells to survive toxic DNA interstrand crosslinks (ICLs), although MMR proteins bind ICLs and other DNA structures that form at stalled replication forks. We hypothesized that MMR proteins corrupt ICL repair in cells that lack crosstalk between BRCA-FA and MMR pathways. Here, we show that ICL sensitivity of cells lacking the interaction between FANCJ and the MMR protein MLH1 is suppressed by depletion of the upstream mismatch recognition factor MSH2. MSH2 depletion suppresses an aberrant DNA damage response, restores cell cycle progression, and promotes ICL resistance through a Rad18-dependent mechanism. MSH2 depletion also suppresses ICL sensitivity in cells deficient for BRCA1 or FANCD2, but not FANCA. Rescue by Msh2 loss was confirmed in Fancd2-null primary mouse cells. Thus, we propose that regulation of MSH2-dependent DNA damage response underlies the importance of interactions between BRCA-FA and MMR pathways.

  14. Relevance of GC content to the conservation of DNA polymerase III/mismatch repair system in Gram-positive bacteria

    PubMed Central

    Akashi, Motohiro; Yoshikawa, Hirofumi

    2013-01-01

    The mechanism of DNA replication is one of the driving forces of genome evolution. Bacterial DNA polymerase III, the primary complex of DNA replication, consists of PolC and DnaE. PolC is conserved in Gram-positive bacteria, especially in the Firmicutes with low GC content, whereas DnaE is widely conserved in most Gram-negative and Gram-positive bacteria. PolC contains two domains, the 3′-5′exonuclease domain and the polymerase domain, while DnaE only possesses the polymerase domain. Accordingly, DnaE does not have the proofreading function; in Escherichia coli, another enzyme DnaQ performs this function. In most bacteria, the fidelity of DNA replication is maintained by 3′-5′ exonuclease and a mismatch repair (MMR) system. However, we found that most Actinobacteria (a group of Gram-positive bacteria with high GC content) appear to have lost the MMR system and chromosomes may be replicated by DnaE-type DNA polymerase III with DnaQ-like 3′-5′ exonuclease. We tested the mutation bias of Bacillus subtilis, which belongs to the Firmicutes and found that the wild type strain is AT-biased while the mutS-deletant strain is remarkably GC-biased. If we presume that DnaE tends to make mistakes that increase GC content, these results can be explained by the mutS deletion (i.e., deletion of the MMR system). Thus, we propose that GC content is regulated by DNA polymerase and MMR system, and the absence of polC genes, which participate in the MMR system, may be the reason for the increase of GC content in Gram-positive bacteria such as Actinobacteria. PMID:24062730

  15. An MboII/FokI trimming plasmid allowing consecutive cycles of precise 1- to 12-base-pair deletions in cloned DNA.

    PubMed

    Hasan, N; Kur, J; Szybalski, W

    1989-10-30

    A novel trimming plasmid has been designed which allows, in a preprogrammed fashion, the precise deletion of up to 12 bp per cleavage cycle, from one end of a cloned fragment. The plasmid, which carries the dhfr gene, contains unique recognition sites for two class-IIS restriction enzymes, MboII and FokI, which are arranged in the form of a cassette, so that consecutive cleavages with these endonucleases, followed by blunting with mung bean nuclease (MB), will precisely delete 12 bp of adjacent cloned DNA. When either MboII or FokI is used alone (followed by MB), 1 or 4 bp are removed, respectively. The final step in the trimming cycle is religation of the plasmid with T4 ligase. After required number of cycles, plasmids were transformed into Escherichia coli C600, and transformants selected by resistance to trimethoprim. Since the MboII/FokI cassette remains intact during these operations, one can repeat the cycle, consisting of cleaving, MB blunting and religation, several times, each time removing up to 12 bp from the cloned target DNA. Examples are provided of one-, two- and three-cycle trimmings.

  16. Nuclear magnetic resonance solution structure of an N(2)-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: intercalation from the minor groove with ruptured Watson-Crick base pairing.

    PubMed

    Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H; Cai, Yuqin; Rodriguez, Fabian A; Sayer, Jane M; Jerina, Donald M; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E

    2012-12-04

    The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the nonplanar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14 position with the exocyclic amino group of guanine. Here, we present the first nuclear magnetic resonance solution structure of a DB[a,l]P-derived adduct, the 14R-(+)-trans-anti-DB[a,l]P-N(2)-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N(2)-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3'-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3'-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE-DNA adduct conformation differs from (1) the classical intercalation motif in which Watson-Crick base pairing is intact at the lesion site and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix. The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed.

  17. Label-free detection of DNA single-base mismatches using a simple reflectance-based optical technique.

    PubMed

    Nava, G; Ceccarello, E; Giavazzi, F; Salina, M; Damin, F; Chiari, M; Buscaglia, M; Bellini, T; Zanchetta, G

    2016-05-21

    Rapid and quantitative detection of the binding of nucleic acids to surface-immobilized probes remains a challenge in many biomedical applications. We investigated the hybridization of a set of fully complementary and defected 12-base long DNA oligomers by using the Reflective Phantom Interface (RPI), a recently developed multiplexed label-free detection technique. Based on the simple measurement of reflected light intensity, this technology enables to quantify the hybridization directly as it occurs on the surface with a sensitivity of 10 pg mm(-2). We found a strong effect of single-base mismatches and of their location on hybridization kinetics and equilibrium binding. In line with previous studies, we found that DNA-DNA binding is weaker on a surface than in the bulk. Our data indicate that this effect is a consequence of weak nonspecific binding of the probes to the surface.

  18. Universal and blocking primer mismatches limit the use of high-throughput DNA sequencing for the quantitative metabarcoding of arthropods.

    PubMed

    Piñol, J; Mir, G; Gomez-Polo, P; Agustí, N

    2015-07-01

    The quantification of the biological diversity in environmental samples using high-throughput DNA sequencing is hindered by the PCR bias caused by variable primer-template mismatches of the individual species. In some dietary studies, there is the added problem that samples are enriched with predator DNA, so often a predator-specific blocking oligonucleotide is used to alleviate the problem. However, specific blocking oligonucleotides could coblock nontarget species to some degree. Here, we accurately estimate the extent of the PCR biases induced by universal and blocking primers on a mock community prepared with DNA of twelve species of terrestrial arthropods. We also compare universal and blocking primer biases with those induced by variable annealing temperature and number of PCR cycles. The results show that reads of all species were recovered after PCR enrichment at our control conditions (no blocking oligonucleotide, 45 °C annealing temperature and 40 cycles) and high-throughput sequencing. They also show that the four factors considered biased the final proportions of the species to some degree. Among these factors, the number of primer-template mismatches of each species had a disproportionate effect (up to five orders of magnitude) on the amplification efficiency. In particular, the number of primer-template mismatches explained most of the variation (~3/4) in the amplification efficiency of the species. The effect of blocking oligonucleotide concentration on nontarget species relative abundance was also significant, but less important (below one order of magnitude). Considering the results reported here, the quantitative potential of the technique is limited, and only qualitative results (the species list) are reliable, at least when targeting the barcoding COI region.

  19. HEREDITARY, SPORADIC AND METASTATIC COLORECTAL CANCER ARE COMMONLY DRIVEN BY SPECIFIC SPECTRUMS OF DEFECTIVE DNA MISMATCH REPAIR COMPONENTS

    PubMed Central

    CARETHERS, JOHN M.

    2016-01-01

    DNA mismatch repair (MMR) is one of several human cell mechanisms utilized to repair mutable mistakes within DNA, particularly after DNA is replicated. MMR function is dependent upon heterodimerization of specific MMR proteins that can recognize base-base mispairs as well as frameshifts at microsatellite sequences, followed by the triggering of other complementary proteins that execute excision and repair or initiate cell demise if repair is futile. MMR function is compromised in specific disease states, all of which can be biochemically recognized by faulty repair of microsatellite sequences, causing microsatellite instability. Germline mutation of an MMR gene causes Lynch syndrome, the most common inherited form of colorectal cancer (CRC), and biallelic germline mutations cause the rare constitutional mismatch repair deficiency syndrome. Somatic inactivation of MMR through epigenetic mechanisms is observed in 15% of sporadic CRC, and a smaller portion of CRCs possess biallelic somatic mutations. A novel inflammation-driven nuclear-to-cytoplasmic shift of the specific MMR protein hMSH3 is seen in up to 60% of sporadic CRCs that associates with metastasis and poor patient prognosis, unlike improved outcome when MMR is genetically inactivated. The mechanism for MMR inactication as well as the component affected dictates the clinical spectrum and clinical response for patients. PMID:28066040

  20. Enhancement of RecA-mediated self-assembly in DNA nanostructures through basepair mismatches and single-strand nicks

    NASA Astrophysics Data System (ADS)

    Corbett, Sybilla Louise; Sharma, Rajan; Davies, Alexander Giles; Wälti, Christoph

    2017-01-01

    The use of DNA as a structural material for nanometre-scale construction has grown extensively over the last decades. The development of more advanced DNA-based materials would benefit from a modular approach enabling the direct assembly of additional elements onto nanostructures after fabrication. RecA-based nucleoprotein filaments encapsulating short ssDNA have been demonstrated as a tool for highly efficient and fully programmable post-hoc patterning of duplex DNA scaffold. However, the underlying assembly process is not fully understood, in particular when patterning complex DNA topologies. Here, we report the effect of basepair-mismatched regions and single-strand nicks in the double-stranded DNA scaffold on the yield of RecA-based assembly. Significant increases in assembly yield are observed upon the introduction of unpaired basepairs directly adjacent to the assembly region. However, when the unpaired regions were introduced further from the assembly site the assembly yield initially decreased as the length of the unpaired region was increased. These results suggest that an unpaired region acts as a kinetic trap for RecA-based nucleoprotein filaments, impeding the assembly mechanism. Conversely, when the unpaired region is located directly adjacent to the assembly site, it leads to an increase in efficiency of RecA patterning owing to increased breathing of the assembly site.

  1. Enhancement of RecA-mediated self-assembly in DNA nanostructures through basepair mismatches and single-strand nicks

    PubMed Central

    Corbett, Sybilla Louise; Sharma, Rajan; Davies, Alexander Giles; Wälti, Christoph

    2017-01-01

    The use of DNA as a structural material for nanometre-scale construction has grown extensively over the last decades. The development of more advanced DNA-based materials would benefit from a modular approach enabling the direct assembly of additional elements onto nanostructures after fabrication. RecA-based nucleoprotein filaments encapsulating short ssDNA have been demonstrated as a tool for highly efficient and fully programmable post-hoc patterning of duplex DNA scaffold. However, the underlying assembly process is not fully understood, in particular when patterning complex DNA topologies. Here, we report the effect of basepair-mismatched regions and single-strand nicks in the double-stranded DNA scaffold on the yield of RecA-based assembly. Significant increases in assembly yield are observed upon the introduction of unpaired basepairs directly adjacent to the assembly region. However, when the unpaired regions were introduced further from the assembly site the assembly yield initially decreased as the length of the unpaired region was increased. These results suggest that an unpaired region acts as a kinetic trap for RecA-based nucleoprotein filaments, impeding the assembly mechanism. Conversely, when the unpaired region is located directly adjacent to the assembly site, it leads to an increase in efficiency of RecA patterning owing to increased breathing of the assembly site. PMID:28112216

  2. Enhancement of RecA-mediated self-assembly in DNA nanostructures through basepair mismatches and single-strand nicks.

    PubMed

    Corbett, Sybilla Louise; Sharma, Rajan; Davies, Alexander Giles; Wälti, Christoph

    2017-01-23

    The use of DNA as a structural material for nanometre-scale construction has grown extensively over the last decades. The development of more advanced DNA-based materials would benefit from a modular approach enabling the direct assembly of additional elements onto nanostructures after fabrication. RecA-based nucleoprotein filaments encapsulating short ssDNA have been demonstrated as a tool for highly efficient and fully programmable post-hoc patterning of duplex DNA scaffold. However, the underlying assembly process is not fully understood, in particular when patterning complex DNA topologies. Here, we report the effect of basepair-mismatched regions and single-strand nicks in the double-stranded DNA scaffold on the yield of RecA-based assembly. Significant increases in assembly yield are observed upon the introduction of unpaired basepairs directly adjacent to the assembly region. However, when the unpaired regions were introduced further from the assembly site the assembly yield initially decreased as the length of the unpaired region was increased. These results suggest that an unpaired region acts as a kinetic trap for RecA-based nucleoprotein filaments, impeding the assembly mechanism. Conversely, when the unpaired region is located directly adjacent to the assembly site, it leads to an increase in efficiency of RecA patterning owing to increased breathing of the assembly site.

  3. Repair of mismatched basepairs in mammalian DNA. Progress report, March 1, 1990--February 28, 1991

    SciTech Connect

    Taylor, J.H.; Hare, J.T.

    1991-08-01

    We have concentrated on three specific areas of our research plan. Our greatest emphasis is on the role of single strand nicks in influencing template strand selection in mismatch repair. We have found, that the ability of a nick in one strand to influence which strand is repaired is not a simple function of distance from the mismatched site but rather that an hot spot where a nick is more likely to have an influence can exist. The second line was production of single-genotype heteroduplexes in order to examine independently the repair of T/G and A/C mispairs within the same sequence context as in our mixed mispair preparations. We have shown preparations of supercoiled heteroduplex can be prepared that were exclusively T/G or exclusively A/C at the mispair site. The third effort has been to understand the difference in repair bias of different cell lines or different transfection conditions as it may relate to different repair systems in the cell. We have identified some of the sources of variation, including cell cycle position. We hope to continue this work to more precisely identify the phase of the cell cycle.

  4. A Modified Protocol with Improved Detection Rate for Mis-Matched Donor HLA from Low Quantities of DNA in Urine Samples from Kidney Graft Recipients

    PubMed Central

    Kwok, Janette; Choi, Leo C. W.; Ho, Jenny C. Y.; Chan, Gavin S. W.; Mok, Maggie M. Y.; Lam, Man-Fei; Chak, Wai-Leung; Cheuk, Au; Chau, Ka-Foon; Tong, Matthew; Chan, Kwok-Wah; Chan, Tak-Mao

    2016-01-01

    Background Urine from kidney transplant recipient has proven to be a viable source for donor DNA. However, an optimized protocol would be required to determine mis-matched donor HLA specificities in view of the scarcity of DNA obtained in some cases. Methods In this study, fresh early morning urine specimens were obtained from 155 kidney transplant recipients with known donor HLA phenotype. DNA was extracted and typing of HLA-A, B and DRB1 loci by polymerase chain reaction-specific sequence primers was performed using tailor-made condition according to the concentration of extracted DNA. Results HLA typing of DNA extracted from urine revealed both recipient and donor HLA phenotypes, allowing the deduction of the unknown donor HLA and hence the degree of HLA mis-match. By adopting the modified procedures, mis-matched donor HLA phenotypes were successfully deduced in all of 35 tested urine samples at DNA quantities spanning the range of 620–24,000 ng. Conclusions This urine-based method offers a promising and reliable non-invasive means for the identification of mis-matched donor HLA antigens in kidney transplant recipients with unknown donor HLA phenotype or otherwise inadequate donor information. PMID:27861530

  5. pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

    PubMed

    Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

    2009-11-23

    Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

  6. Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

    PubMed

    Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-03-14

    We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

  7. Label-free DNA hybridization detection and single base-mismatch discrimination using CE-ICP-MS assay.

    PubMed

    Li, Yan; Sun, Shao-kai; Yang, Jia-lin; Jiang, Yan

    2011-12-07

    Detecting a specific DNA sequence and discriminating single base-mismatch is critical to clinical diagnosis, paternity testing, forensic sciences, food and drug industry, pathology, genetics, environmental monitoring, and anti-bioterrorism. To this end, capillary electrophoresis (CE) coupled with the inductively coupled plasma mass spectrometry (ICP-MS) method is developed using the displacing interaction between the target ssDNA and the competitor Hg(2+) for the first time. The thymine-rich capture ssDNA 1 is interacted with the competitor Hg(2+), forming an assembled complex in a hairpin-structure between the thymine bases arrangement at both sides of the capture ssDNA 1. In the presence of a target ssDNA with stronger affinity than that of the competitor Hg(2+), the energetically favorable hybridization between capture ssDNA 1 and the target ssDNA destroys the hairpin-structure and releases the competitor as free Hg(2+), which was then read out and accurately quantified by CE-ICP-MS assay. Under the optimal CE separation conditions, free Hg(2+) ions and its capture ssDNA 1 adduct were baseline separated and detected on-line by ICP-MS; the increased peak intensity of free Hg(2+) against the concentration of perfectly complementary target ssDNA was linear over the concentration range of 30-600 nmol L(-1) with a limit of detection of 8 nmol L(-1) (3s, n = 11) in the pre-incubated mixture containing 1 μmol L(-1) Hg(2+) and 0.2 μmol L(-1) capture ssDNA 1. This new assay method is simple in design since any target ssDNA binding can in principle result in free Hg(2+) release by 6-fold Hg(2+) signal amplification, avoiding oligonucleotide labeling or assistance by excess signal transducer and signal reporter to read out the target. Due to element-specific detection of ICP-MS in our assay procedure, the interference from the autofluorescence of substrata was eliminated.

  8. New Therapeutic Opportunities Based on DNA Mismatch Repair and BRAF Status in Metastatic Colorectal Cancer.

    PubMed

    Cohen, Romain; Svrcek, Magali; Dreyer, Chantal; Cervera, Pascale; Duval, Alex; Pocard, Marc; Fléjou, Jean-François; de Gramont, Aimery; André, Thierry

    2016-03-01

    Recently, colorectal cancer (CRC) subtyping consortium identified four consensus molecular subtypes (CMS1-4). CMS1 is enriched for deficient mismatch repair (dMMR) and BRAF (V600E) tumors. Intriguingly, this subtype has better relapse-free survival but worse overall survival after relapse compared with the other subtypes. Growing evidence is accumulating on the benefit of specific therapeutic strategies such as immune checkpoint inhibition therapy in dMMR tumors and mitogen-activated protein kinase (MAPK) pathway targeted therapy in tumors harboring BRAF (V600E) mutation. After reviewing dMMR prognostic value, immune checkpoints as major targets for dMMR carcinomas will be highlighted. Following, BRAF (V600E) prognostic impact will be reviewed and therapeutic strategies with the combination of cytotoxic agents and especially the combinations of BRAF and MAPK inhibitors will be discussed.

  9. DPT tautomerisation of the G·A(syn) and A*·G*(syn) DNA mismatches: a QM/QTAIM combined atomistic investigation.

    PubMed

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2014-05-21

    By applying a combined QM and QTAIM atomistic computational approach we have established for the first time that the G·A(syn) and A*·G*(syn) DNA mismatches (rare tautomers are marked with an asterisk), causing spontaneous transversions with substantially various probabilities, radically differ from each other in their ability to tautomerise through the double proton transfer (DPT). The A*·G*(syn) mismatch tautomerises quite easily (ΔΔG(TS) ≈ 4·kT at room temperature) into the A·G*(syn) mismatch through the asynchronous concerted mechanism, whereas the G·A(syn) base mispair does not tautomerise via the DPT at all, since there is no local minimum corresponding to the tautomerised G*·A*(syn) mismatch on the potential energy surface. It was established that the A·G*(syn) base mispair is a dynamically unstable H-bonded complex with an extremely short lifetime of 2.17 × 10(-13) s. Consequently, the obtained results allow us to believe that spontaneous or forced dissociation of both the G·A(syn) and A*·G*(syn) DNA mismatches by the DNA-polymerase occurs with the preservation of the tautomeric status of the bases.

  10. Kinetics of Mismatch Formation opposite Lesions by the Replicative DNA Polymerase from Bacteriophage RB69

    SciTech Connect

    Hogg, Matthew; Rudnicki, Jean; Midkiff, John; Reha-Krantz, Linda; Doubli, Sylvie; Wallace, Susan S.

    2010-04-12

    The fidelity of DNA replication is under constant threat from the formation of lesions within the genome. Oxidation of DNA bases leads to the formation of altered DNA bases such as 8-oxo-7,8-dihydroguanine, commonly called 8-oxoG, and 2-hydroxyadenenine, or 2-OHA. In this work we have examined the incorporation kinetics opposite these two oxidatively derived lesions as well as an abasic site analogue by the replicative DNA polymerase from bacteriophage RB69. We compared the kinetic parameters for both wild type and the low fidelity L561A variant. While nucleotide incorporation rates (k{sub pol}) were generally higher for the variant, the presence of a lesion in the templating position reduced the ability of both the wild-type and variant DNA polymerases to form ternary enzyme-DNA-dNTP complexes. Thus, the L561A substitution does not significantly affect the ability of the RB69 DNA polymerase to recognize damaged DNA; instead, the mutation increases the probability that nucleotide incorporation will occur. We have also solved the crystal structure of the L561A variant forming an 8-oxoG {center_dot} dATP mispair and show that the propensity for forming this mispair depends on an enlarged polymerase active site.

  11. Cyclin E and histone H3 levels are regulated by 5-fluorouracil in a DNA mismatch repair-dependent manner

    PubMed Central

    Chung, Heekyung; Chaudhry, Joy; Lopez, Claudia G

    2010-01-01

    Several studies indicate that the DNA mismatch repair (MMR) system may trigger cytotoxicity upon 5-fluorouracil (5-FU) recognition, but signaling pathways regulated by MMR in response to 5-FU are unknown. We hypothesize that recognition of 5-FU in DNA by MMR proteins trigger specific signaling cascades that results in slowing of the cell cycle and cell death. Whole human genome cDNA microarrays were used to examine relative signaling responses induced in MMR-proficient cells after 5-FU (5 µM) treatment for 24 hours. Analysis revealed 43 pathways differentially affected by 5-FU compared to control (p < 0.05), including cyclin and cell cycle regulation involving G1-S cell cycle transition, activation of Src, MAP K, p53 and base excision repair. In particular, 5-FU upregulated cyclins E1 and E2 (≥1.4-fold) and downregulated cdc25C, cyclins B1 and B2, histone H2A, H2B and H3 (≤-1.4-fold) over control. Cell cycle analysis revealed a G1/S arrest by 5-FU that was congruent with increased cyclin E and decreased cdc25C protein expression. Importantly, with knockdown of hMLH1 and hMSH2, we observed that decreased histone H3 expression by 5-FU was dependent on hMLH1. Additionally, 5-FU treatment dramatically decreased levels of several histone H3 modifications. Our data suggest that 5-FU induces a G1/S arrest by regulating cyclin E and cdc25C expression and MMR recognition of 5-FU in DNA may modulate cyclin E to affect the cell cycle. Furthermore, MMR recognition of 5-FU reduces histone H3 levels that could be related to DNA access by proteins and/or cell death during the G1/S phase of the cell cycle. PMID:20930505

  12. Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs

    NASA Technical Reports Server (NTRS)

    Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.

    2011-01-01

    We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

  13. Selenium compounds activate ATM-dependent DNA damage responses via the mismatch repair protein hMLH1 in colorectal cancer cells

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Epidemiological and animal studies indicate that selenium supplementation suppresses risk of colorectal and other cancers. The majority of colorectal cancers are characterized by a defective DNA mismatch repair (MMR) process. Here, we have employed the MMR-deficient HCT 116 colorectal cancer cells ...

  14. How reliable is immunohistochemical staining for DNA mismatch repair proteins performed after neoadjuvant chemoradiation?

    PubMed

    Vilkin, Alex; Halpern, Marisa; Morgenstern, Sara; Brazovski, Eli; Gingold-Belfer, Rachel; Boltin, Doron; Purim, Ofer; Kundel, Yulia; Welinsky, Sara; Brenner, Baruch; Niv, Yaron; Levi, Zohar

    2014-10-01

    Immunohistochemistry (IHC) testing for mismatch repair proteins (MMRP) is currently being used primarily in colorectal cancer resection specimens. We aimed to compare the results of IHC staining performed on biopsy specimens obtained at endoscopy with that performed on surgical specimens after neoadjuvant therapy. Thirty-two rectal cancer subjects had paired preneoadjuvant and postneoadjuvant tissue available for IHC staining (MLH1, MSH2, MSH6, and PMS2), whereas 39 rectosigmoid cancer patients who did not receive neoadjuvant treatment served as controls. Each slide received a qualitative (absent, focal, and strong) and quantitative score (immunoreactivity [0-3] × percent positivity [0-4]). The quantitative scores of MMRP from the operative material were significantly lower in the neoadjuvant group than in the control (P < .05 for all).The scores of all MMRP from endoscopic biopsies were not significantly different between the neoadjuvant and the control groups. Disagreement between the endoscopic biopsy and the operative material was evident in 23 of 128 stains (18.5%) in the neoadjuvant group and in 12 of 156 stains (7.7%) in the control group (P = .009). In the neoadjuvant group, a disagreement pattern of "endoscopic strong operative focal" was observed in 28.1% for PMS2, 12.5% for MSH6, 12.5% for MLH1, and 6.3% for MSH2, and in the control group, this same disagreement pattern was found in 12.8% for PMS2, 7.7% for MSH6, 7.7% for MLH1, and 0% for MSH2. Based on our findings, we suggest that for rectal cancer, the endoscopic material rather than the operative material should serve as the primary material for IHC staining.

  15. Sequence and stress-response analyses of the DNA mismatch repair gene hexA in Lactococcus lactis.

    PubMed

    Ren, J; Park, J H; Dunn, N W; Kim, W S

    2001-10-01

    The DNA mismatch repair gene hexA was identified in Lactococcus lactis by PCR amplification by using a pair of primers homologous to the DNA-binding Dps protein. The gene in its entirety, including the regulatory regions, was sequenced, by using a strategy of chromosomal walking based on two PCR protocols. The open reading frame of 2526 bp was preceded by a strong ribosome-binding site (AGGAAG) and was followed by a potential transcription terminator (hairpin loop structure). The 5' terminus of the hexA mRNA was located 135 bp upstream of the start codon, and putative -10 and -35 regions were identified. The deduced amino acid sequence revealed two motifs, the ATP/GTP-binding site (P-loop) and the "MutS family signature". The hexA promoter was cloned into pMU1327, which contained a promoter-less CAT reporter gene, and the promoter activity was examined under oxidative-stress conditions. It appears that the promoter activity is down-shifted by H2O2 at 4 mM.

  16. The mismatch repair system modulates curcumin sensitivity through induction of DNA strand breaks and activation of G2-M checkpoint.

    PubMed

    Jiang, Zhihua; Jin, ShunQian; Yalowich, Jack C; Brown, Kevin D; Rajasekaran, Baskaran

    2010-03-01

    The highly conserved mismatch (MMR) repair system corrects postreplicative errors and modulates cellular responses to genotoxic agents. Here, we show that the MMR system strongly influences cellular sensitivity to curcumin. Compared with MMR-proficient cells, isogenically matched MMR-deficient cells displayed enhanced sensitivity to curcumin. Similarly, cells suppressed for MLH1 or MSH2 expression by RNA interference displayed increased curcumin sensitivity. Curcumin treatment generated comparable levels of reactive oxygen species and the mutagenic adduct 8-oxo-guanine in MMR-proficient and MMR-deficient cells; however, accumulation of gammaH2AX foci, a marker for DNA double-strand breaks (DSB), occurred only in MMR-positive cells in response to curcumin treatment. Additionally, MMR-positive cells showed activation of Chk1 and induction of G(2)-M cell cycle checkpoint following curcumin treatment and inhibition of Chk1 by UCN-01 abrogated Chk1 activation and heightened apoptosis in MMR-proficient cells. These results indicate that curcumin triggers the accumulation of DNA DSB and induction of a checkpoint response through a MMR-dependent mechanism. Conversely, in MMR-compromised cells, curcumin-induced DSB is significantly blunted, and as a result, cells fail to undergo cell cycle arrest, enter mitosis, and die through mitotic catastrophe. The results have potential therapeutic value, especially in the treatment of tumors with compromised MMR function.

  17. Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

    PubMed

    Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

    2017-03-20

    The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H2···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R1ρ) experiments. An (15)N R1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H2···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

  18. Calculation of the stabilization energies of oxidatively damaged guanine base pairs with guanine.

    PubMed

    Suzuki, Masayo; Kino, Katsuhito; Morikawa, Masayuki; Kobayashi, Takanobu; Komori, Rie; Miyazawa, Hiroshi

    2012-06-01

    DNA is constantly exposed to endogenous and exogenous oxidative stresses. Damaged DNA can cause mutations, which may increase the risk of developing cancer and other diseases. G:C-C:G transversions are caused by various oxidative stresses. 2,2,4-Triamino-5(2H)-oxazolone (Oz), guanidinohydantoin (Gh)/iminoallantoin (Ia) and spiro-imino-dihydantoin (Sp) are known products of oxidative guanine damage. These damaged bases can base pair with guanine and cause G:C-C:G transversions. In this study, the stabilization energies of these bases paired with guanine were calculated in vacuo and in water. The calculated stabilization energies of the Ia:G base pairs were similar to that of the native C:G base pair, and both bases pairs have three hydrogen bonds. By contrast, the calculated stabilization energies of Gh:G, which form two hydrogen bonds, were lower than the Ia:G base pairs, suggesting that the stabilization energy depends on the number of hydrogen bonds. In addition, the Sp:G base pairs were less stable than the Ia:G base pairs. Furthermore, calculations showed that the Oz:G base pairs were less stable than the Ia:G, Gh:G and Sp:G base pairs, even though experimental results showed that incorporation of guanine opposite Oz is more efficient than that opposite Gh/Ia and Sp.

  19. The nature of the transition mismatches with Watson-Crick architecture: the G*·T or G·T* DNA base mispair or both? A QM/QTAIM perspective for the biological problem.

    PubMed

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    This study provides the first accurate investigation of the tautomerization of the biologically important guanine*·thymine (G*·T) DNA base mispair with Watson-Crick geometry, involving the enol mutagenic tautomer of the G and the keto tautomer of the T, into the G·T* mispair (∆G = .99 kcal mol(-1), population = 15.8% obtained at the MP2 level of quantum-mechanical theory in the continuum with ε = 4), formed by the keto tautomer of the G and the enol mutagenic tautomer of the T base, using DFT and MP2 methods in vacuum and in the weakly polar medium (ε = 4), characteristic for the hydrophobic interfaces of specific protein-nucleic acid interactions. We were first able to show that the G*·T↔G·T* tautomerization occurs through the asynchronous concerted double proton transfer along two antiparallel O6H···O4 and N1···HN3 H-bonds and is assisted by the third N2H···O2 H-bond, that exists along the entire reaction pathway. The obtained results indicate that the G·T* base mispair is stable from the thermodynamic point of view complex, while it is dynamically unstable structure in vacuum and dynamically stable structure in the continuum with ε = 4 with lifetime of 6.4·10(-12) s, that, on the one side, makes it possible to develop all six low-frequency intermolecular vibrations, but, on the other side, it is by three orders less than the time (several ns) required for the replication machinery to forcibly dissociate a base pair into the monomers during DNA replication. One of the more significant findings to emerge from this study is that the short-lived G·T* base mispair, which electronic interaction energy between the bases (-23.76 kcal mol(-1)) exceeds the analogical value for the G·C Watson-Crick nucleobase pair (-20.38 kcal mol(-1)), "escapes from the hands" of the DNA replication machinery by fast transforming into the G*·T mismatch playing an indirect role of its supplier during the DNA replication. So

  20. Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

    PubMed

    Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

    2009-03-18

    It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

  1. Potential for DNA-based identification of Great Lakes fauna: match and mismatch between taxa inventories and DNA barcode libraries.

    PubMed

    Trebitz, Anett S; Hoffman, Joel C; Grant, George W; Billehus, Tyler M; Pilgrim, Erik M

    2015-07-22

    DNA-based identification of mixed-organism samples offers the potential to greatly reduce the need for resource-intensive morphological identification, which would be of value both to bioassessment and non-native species monitoring. The ability to assign species identities to DNA sequences found depends on the availability of comprehensive DNA reference libraries. Here, we compile inventories for aquatic metazoans extant in or threatening to invade the Laurentian Great Lakes and examine the availability of reference mitochondrial COI DNA sequences (barcodes) in the Barcode of Life Data System for them. We found barcode libraries largely complete for extant and threatening-to-invade vertebrates (100% of reptile, 99% of fish, and 92% of amphibian species had barcodes). In contrast, barcode libraries remain poorly developed for precisely those organisms where morphological identification is most challenging; 46% of extant invertebrates lacked reference barcodes with rates especially high among rotifers, oligochaetes, and mites. Lack of species-level identification for many aquatic invertebrates also is a barrier to matching DNA sequences with physical specimens. Attaining the potential for DNA-based identification of mixed-organism samples covering the breadth of aquatic fauna requires a concerted effort to build supporting barcode libraries and voucher collections.

  2. Potential for DNA-based identification of Great Lakes fauna: match and mismatch between taxa inventories and DNA barcode libraries

    PubMed Central

    Trebitz, Anett S.; Hoffman, Joel C.; Grant, George W.; Billehus, Tyler M.; Pilgrim, Erik M.

    2015-01-01

    DNA-based identification of mixed-organism samples offers the potential to greatly reduce the need for resource-intensive morphological identification, which would be of value both to bioassessment and non-native species monitoring. The ability to assign species identities to DNA sequences found depends on the availability of comprehensive DNA reference libraries. Here, we compile inventories for aquatic metazoans extant in or threatening to invade the Laurentian Great Lakes and examine the availability of reference mitochondrial COI DNA sequences (barcodes) in the Barcode of Life Data System for them. We found barcode libraries largely complete for extant and threatening-to-invade vertebrates (100% of reptile, 99% of fish, and 92% of amphibian species had barcodes). In contrast, barcode libraries remain poorly developed for precisely those organisms where morphological identification is most challenging; 46% of extant invertebrates lacked reference barcodes with rates especially high among rotifers, oligochaetes, and mites. Lack of species-level identification for many aquatic invertebrates also is a barrier to matching DNA sequences with physical specimens. Attaining the potential for DNA-based identification of mixed-organism samples covering the breadth of aquatic fauna requires a concerted effort to build supporting barcode libraries and voucher collections. PMID:26199185

  3. Potential for DNA-based identification of Great Lakes fauna: match and mismatch between taxa inventories and DNA barcode libraries

    NASA Astrophysics Data System (ADS)

    Trebitz, Anett S.; Hoffman, Joel C.; Grant, George W.; Billehus, Tyler M.; Pilgrim, Erik M.

    2015-07-01

    DNA-based identification of mixed-organism samples offers the potential to greatly reduce the need for resource-intensive morphological identification, which would be of value both to bioassessment and non-native species monitoring. The ability to assign species identities to DNA sequences found depends on the availability of comprehensive DNA reference libraries. Here, we compile inventories for aquatic metazoans extant in or threatening to invade the Laurentian Great Lakes and examine the availability of reference mitochondrial COI DNA sequences (barcodes) in the Barcode of Life Data System for them. We found barcode libraries largely complete for extant and threatening-to-invade vertebrates (100% of reptile, 99% of fish, and 92% of amphibian species had barcodes). In contrast, barcode libraries remain poorly developed for precisely those organisms where morphological identification is most challenging; 46% of extant invertebrates lacked reference barcodes with rates especially high among rotifers, oligochaetes, and mites. Lack of species-level identification for many aquatic invertebrates also is a barrier to matching DNA sequences with physical specimens. Attaining the potential for DNA-based identification of mixed-organism samples covering the breadth of aquatic fauna requires a concerted effort to build supporting barcode libraries and voucher collections.

  4. The cumulative effects of polymorphisms in the DNA mismatch repair genes and tobacco smoking in oesophageal cancer risk.

    PubMed

    Vogelsang, Matjaz; Wang, Yabing; Veber, Nika; Mwapagha, Lamech M; Parker, M Iqbal

    2012-01-01

    The DNA mismatch repair (MMR) enzymes repair errors in DNA that occur during normal DNA metabolism or are induced by certain cancer-contributing exposures. We assessed the association between 10 single-nucleotide polymorphisms (SNPs) in 5 MMR genes and oesophageal cancer risk in South Africans. Prior to genotyping, SNPs were selected from the HapMap database, based on their significantly different genotypic distributions between European ancestry populations and four HapMap populations of African origin. In the Mixed Ancestry group, the MSH3 rs26279 G/G versus A/A or A/G genotype was positively associated with cancer (OR = 2.71; 95% CI: 1.34-5.50). Similar associations were observed for PMS1 rs5742938 (GG versus AA or AG: OR = 1.73; 95% CI: 1.07-2.79) and MLH3 rs28756991 (AA or GA versus GG: OR = 2.07; 95% IC: 1.04-4.12). In Black individuals, however, no association between MMR polymorhisms and cancer risk was observed in individual SNP analysis. The interactions between MMR genes were evaluated using the model-based multifactor-dimensionality reduction approach, which showed a significant genetic interaction between SNPs in MSH2, MSH3 and PMS1 genes in Black and Mixed Ancestry subjects, respectively. The data also implies that pathogenesis of common polymorphisms in MMR genes is influenced by exposure to tobacco smoke. In conclusion, our findings suggest that common polymorphisms in MMR genes and/or their combined effects might be involved in the aetiology of oesophageal cancer.

  5. MonoSeq Variant Caller Reveals Novel Mononucleotide Run Indel Mutations in Tumors with Defective DNA Mismatch Repair

    PubMed Central

    Walker, Christopher J.; Miranda, Mario A.; O’Hern, Matthew J.; Blachly, James S.; Moyer, Cassandra L.; Ivanovich, Jennifer; Kroll, Karl W.; Eisfeld, Ann-Kathrin; Sapp, Caroline E.; Mutch, David G.; Cohn, David E.; Bundschuh, Ralf; Goodfellow, Paul J

    2016-01-01

    Next-generation sequencing has revolutionized cancer genetics, but accurately detecting mutations in repetitive DNA sequences, especially mononucleotide runs, remains a challenge. This is a particular concern for tumors with defective mismatch repair (MMR) that accumulate strand-slippage mutations. We developed MonoSeq to improve indel mutation detection in mononucleotide runs, and used MonoSeq to investigate strand-slippage mutations in endometrial cancers, a tumor type that has frequent loss of MMR. We performed extensive Sanger sequencing to validate both clonal and sub-clonal MonoSeq mutation calls. Eighty-one regions containing mononucleotide runs were sequenced in 542 primary endometrial cancers (223 with defective MMR). Our analyses revealed that the overall mutation rate in MMR-deficient tumors was 20–30-fold higher than in MMR normal tumors. MonoSeq analysis identified several previously unreported mutations, including a novel hotspot in an A7 run in the terminal exon of ARID5B.The ARID5B indel mutations were seen in both MMR-deficient and MMR normal tumors, suggesting biologic selection. Analysis of tumor mRNAs revealed the presence of mutant transcripts that could result in translation of neopeptides. Improved detection of mononucleotide run strand-slippage mutations has clear implications for comprehensive mutation detection in tumors with defective MMR. Indel frameshift mutations and the resultant antigenic peptides could help guide immunotherapy strategies. PMID:27346418

  6. MonoSeq Variant Caller Reveals Novel Mononucleotide Run Indel Mutations in Tumors with Defective DNA Mismatch Repair.

    PubMed

    Walker, Christopher J; Miranda, Mario A; O'Hern, Matthew J; Blachly, James S; Moyer, Cassandra L; Ivanovich, Jennifer; Kroll, Karl W; Eisfeld, Ann-Kathrin; Sapp, Caroline E; Mutch, David G; Cohn, David E; Bundschuh, Ralf; Goodfellow, Paul J

    2016-10-01

    Next-generation sequencing has revolutionized cancer genetics, but accurately detecting mutations in repetitive DNA sequences, especially mononucleotide runs, remains a challenge. This is a particular concern for tumors with defective mismatch repair (MMR) that accumulate strand-slippage mutations. We developed MonoSeq to improve indel mutation detection in mononucleotide runs, and used MonoSeq to investigate strand-slippage mutations in endometrial cancers, a tumor type that has frequent loss of MMR. We performed extensive Sanger sequencing to validate both clonal and subclonal MonoSeq mutation calls. Eighty-one regions containing mononucleotide runs were sequenced in 540 primary endometrial cancers (223 with defective MMR). Our analyses revealed that the overall mutation rate in MMR-deficient tumors was 20-30-fold higher than in MMR-normal tumors. MonoSeq analysis identified several previously unreported mutations, including a novel hotspot in an A7 run in the terminal exon of ARID5B.The ARID5B indel mutations were seen in both MMR-deficient and MMR-normal tumors, suggesting biologic selection. The analysis of tumor mRNAs revealed the presence of mutant transcripts that could result in translation of neopeptides. Improved detection of mononucleotide run strand-slippage mutations has clear implications for comprehensive mutation detection in tumors with defective MMR. Indel frameshift mutations and the resultant antigenic peptides could help guide immunotherapy strategies.

  7. Potential for DNA-based identification of Great Lakes fauna: Match and mismatch between taxa inventories and DNA barcode libraries

    EPA Science Inventory

    DNA-based identification of mixed-organism samples offers the potential to greatly reduce the need for resource-intensive morphological identification, which would be of value both to biotic condition assessment and non-native species early-detection monitoring. However, the abi...

  8. Investigation of a Sybr-Green-Based Method to Validate DNA Sequences for DNA Computing

    DTIC Science & Technology

    2005-05-01

    stranded DNA . We previously demonstrated that this technique can be exploited to distinguish between stably-hybridized Watson - Crick duplexes and...et al., 2004) we described the difference between the canonical Watson - Crick base pairs of DNA and the usually less stable mismatches that can also...computing, cross-hybridized duplexes represent errors. It is therefore crucial that DNA sequences be designed so that the formation of a Watson - Crick

  9. A novel DNA damage response mediated by DNA mismatch repair in Caenorhabditis elegans: induction of programmed autophagic cell death in non-dividing cells

    PubMed Central

    Moriwaki, Takahito; Kato, Yuichi; Nakamura, Chihiro; Ishikawa, Satoru; Zhang-Akiyama, Qiu-Mei

    2015-01-01

    DNA mismatch repair (MMR) contributes to genome integrity by correcting errors of DNA polymerase and inducing cell death in response to DNA damage. Dysfunction of MMR results in increased mutation frequency and cancer risk. Clinical researches revealed that MMR abnormalities induce cancers of non-dividing tissues, such as kidney and liver. However, how MMR suppresses cancer in non-dividing tissues is not understood. To address that mechanism, we analyzed the roles of MMR in non-dividing cells using Caenorhabditis elegans (C. elegans), in which all somatic cells are non-dividing in the adult stage. In this study, we used stable MMR-mutant lines with a balancer chromosome. First, we confirmed that deficiency of MMR leads to resistance to various mutagens in C. elegans dividing cells. Next, we performed drug resistance assays, and found that MMR-deficient adult worms were resistant to SN1-type alkylating and oxidizing agents. In addition, dead cell staining and reporter assays of an autophagy-related gene demonstrated that the cell death was autophagic cell death. Interestingly, this autophagic cell death was not suppressed by caffeine, implying that MMR induces death of non-dividing cells in an atl-1-independent manner. Hence, we propose the hypothesis that MMR prevents cancers in non-dividing tissues by directly inducing cell death. PMID:26413217

  10. Assessment of primer/template mismatch effects on real-time PCR amplification of target taxa for GMO quantification.

    PubMed

    Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc

    2009-10-28

    GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree.

  11. Applying and testing the conveniently optimized enzyme mismatch cleavage method to clinical DNA diagnosis.

    PubMed

    Niida, Yo; Kuroda, Mondo; Mitani, Yusuke; Okumura, Akiko; Yokoi, Ayano

    2012-11-01

    Establishing a simple and effective mutation screening method is one of the most compelling problems with applying genetic diagnosis to clinical use. Because there is no reliable and inexpensive screening system, amplifying by PCR and performing direct sequencing of every coding exon is the gold standard strategy even today. However, this approach is expensive and time consuming, especially when gene size or sample number is large. Previously, we developed CEL nuclease mediated heteroduplex incision with polyacrylamide gel electrophoresis and silver staining (CHIPS) as an ideal simple mutation screening system constructed with only conventional apparatuses and commercially available reagents. In this study, we evaluated the utility of CHIPS technology for genetic diagnosis in clinical practice by applying this system to screening for the COL2A1, WRN and RPS6KA3 mutations in newly diagnosed patients with Stickler syndrome (autosomal dominant inheritance), Werner syndrome (autosomal recessive inheritance) and Coffin-Lowry syndrome (X-linked inheritance), respectively. In all three genes, CHIPS detected all DNA variations including disease causative mutations within a day. Direct sequencing of all coding exons of these genes confirmed 100% sensitivity and specificity. We demonstrate high sensitivity, high cost performance and reliability of this simple system, with compatibility to all inheritance modes. Because of its low technology, CHIPS is ready to use and potentially disseminate to any laboratories in the world.

  12. 5-Methylcytosine DNA glycosylase activity is also present in the human MBD4 (G/T mismatch glycosylase) and in a related avian sequence.

    PubMed

    Zhu, B; Zheng, Y; Angliker, H; Schwarz, S; Thiry, S; Siegmann, M; Jost, J P

    2000-11-01

    A 1468 bp cDNA coding for the chicken homolog of the human MBD4 G/T mismatch DNA glycosylase was isolated and sequenced. The derived amino acid sequence (416 amino acids) shows 46% identity with the human MBD4 and the conserved catalytic region at the C-terminal end (170 amino acids) has 90% identity. The non-conserved region of the avian protein has no consensus sequence for the methylated DNA binding domain. The recombinant proteins from human and chicken have G/T mismatch as well as 5-methylcytosine (5-MeC) DNA glycosylase activities. When tested by gel shift assays, human recombinant protein with or without the methylated DNA binding domain binds equally well to symmetrically, hemimethylated DNA and non-methylated DNA. However, the enzyme has only 5-MeC DNA glycosylase activity with the hemimethylated DNA. Footprinting of human MBD4 and of an N-terminal deletion mutant with partially depurinated and depyrimidinated substrate reveal a selective binding of the proteins to the modified substrate around the CpG. As for 5-MeC DNA glycosylase purified from chicken embryos, MBD4 does not use oligonucleotides containing mCpA, mCpT or mCpC as substrates. An mCpG within an A+T-rich oligonucleotide is a much better substrate than an A+T-poor sequence. The K:(m) of human MBD4 for hemimethylated DNA is approximately 10(-7) M with a V:(max) of approximately 10(-11) mol/h/microgram protein. Deletion mutations show that G/T mismatch and 5-MeC DNA glycosylase are located in the C-terminal conserved region. In sharp contrast to the 5-MeC DNA glycosylase isolated from the chicken embryo DNA demethylation complex, the two enzymatic activities of MBD4 are strongly inhibited by RNA. In situ hybridization with antisense RNA indicate that MBD4 is only located in dividing cells of differentiating embryonic tissues.

  13. Choline Ions Stabilize A-T Base Pairs by Fitting into Minor Groove

    NASA Astrophysics Data System (ADS)

    Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Sugimoto, Naoki

    In a Watson-Crick base paired DNA duplex, G-C base pairs are more stable than A-T base pairs. However, in solvent containing choline ions, the stabilities of these base pairs are reversed. To elucidate the mechanism through which choline ions exert this effect from a microscopic viewpoint, we performed molecular dynamics simulations. We found that choline ions interact with a DNA duplex through multiple hydrogen bonds. The affinity of choline ion for the minor groove of A-T base pairs was higher than that for the major groove. The binding of choline ions to the minor groove of A-T base pairs supports groove formation without disturbing the formation of hydrogen bonds between the base pairs. In contrast, choline ions inhibit the formation of hydrogen bonds between G-C base pairs by binding to atoms of these bases that are involved in Watson-Crick hydrogen bonding. These findings will help us understand the stabilities of canonical DNA structures under the crowded conditions inside cells.

  14. Expression of hMSH2 protein of the human DNA mismatch repair system in oral lichen planus

    PubMed Central

    2004-01-01

    Lichen planus is a mucocutaneous disease of inflammatory nature and unknown etiology. It is characterized by a cell-mediated immunological response to induced antigenic change in skin and/or mucosa. The possible malignant transformation of lichen planus remains a subject of controversial discussions in the literature. hMSH2 is one of the human DNA mismatch repair (hMMR) genes and it plays an important role in reducing mutation and maintaining genomic stability. hMSH2 alterations have been reported in oral squamous cell carcinoma and there are evidences suggesting the association between oral lichen planus and squamous cell carcinoma. In this study, we aim to investigate the immunolocalization of hMSH2 protein in oral lichen planus compared to oral normal mucosa epithelium. We examined the expression of hMSH2 protein by immunohistochemistry in twenty-six cases of oral lichen planus. Clinically, 12 of them were categorized into reticular subtype and 14 were atrophic/erosive. Ten cases of normal mucosa were added to the control group. Results showed that the percentage of positive cells to hMSH2 was smaller in reticular (46.54%; p=0,006) and atrophic/erosive (48.79%; p=0,028) subtypes of oral lichen planus compared to normal mucosa (61.29%). The reduced expression of hMSH2 protein in oral lichen planus suggests that this lesion is more susceptible to mutation and therefore facilitate the development of oral squamous cell carcinoma. PMID:15912193

  15. Risk of colorectal cancer for people with a mutation in both a MUTYH and a DNA mismatch repair gene.

    PubMed

    Win, Aung Ko; Reece, Jeanette C; Buchanan, Daniel D; Clendenning, Mark; Young, Joanne P; Cleary, Sean P; Kim, Hyeja; Cotterchio, Michelle; Dowty, James G; MacInnis, Robert J; Tucker, Katherine M; Winship, Ingrid M; Macrae, Finlay A; Burnett, Terrilea; Le Marchand, Loïc; Casey, Graham; Haile, Robert W; Newcomb, Polly A; Thibodeau, Stephen N; Lindor, Noralane M; Hopper, John L; Gallinger, Steven; Jenkins, Mark A

    2015-12-01

    The base excision repair protein, MUTYH, functionally interacts with the DNA mismatch repair (MMR) system. As genetic testing moves from testing one gene at a time, to gene panel and whole exome next generation sequencing approaches, understandin g the risk associated with co-existence of germline mutations in these genes will be important for clinical interpretation and management. From the Colon Cancer Family Registry, we identified 10 carriers who had both a MUTYH mutation (6 with c.1187G>A p.(Gly396Asp), 3 with c.821G>A p.(Arg274Gln), and 1 with c.536A>G p.(Tyr179Cys)) and a MMR gene mutation (3 in MLH1, 6 in MSH2, and 1 in PMS2), 375 carriers of a single (monoallelic) MUTYH mutation alone, and 469 carriers of a MMR gene mutation alone. Of the 10 carriers of both gene mutations, 8 were diagnosed with colorectal cancer. Using a weighted cohort analysis, we estimated that risk of colorectal cancer for carriers of both a MUTYH and a MMR gene mutation was substantially higher than that for carriers of a MUTYH mutation alone [hazard ratio (HR) 21.5, 95% confidence interval (CI) 9.19-50.1; p < 0.001], but not different from that for carriers of a MMR gene mutation alone (HR 1.94, 95% CI 0.63-5.99; p = 0.25). Within the limited power of this study, there was no evidence that a monoallelic MUTYH gene mutation confers additional risk of colorectal cancer for carriers of a MMR gene mutation alone. Our finding suggests MUTYH mutation testing in MMR gene mutation carriers is not clinically informative.

  16. Risk of colorectal cancer for people with a mutation in both a MUTYH and a DNA mismatch repair gene

    PubMed Central

    Win, Aung Ko; Reece, Jeanette C.; Buchanan, Daniel D.; Clendenning, Mark; Young, Joanne P.; Cleary, Sean P.; Kim, Hyeja; Cotterchio, Michelle; Dowty, James G.; MacInnis, Robert J.; Tucker, Katherine M.; Winship, Ingrid M.; Macrae, Finlay A.; Burnett, Terrilea; Le Marchand, Loïc; Casey, Graham; Haile, Robert W.; Newcomb, Polly A.; Thibodeau, Stephen N.; Lindor, Noralane M.; Hopper, John L.; Gallinger, Steven; Jenkins, Mark A.

    2015-01-01

    The base excision repair protein, MUTYH, functionally interacts with the DNA mismatch repair (MMR) system. As genetic testing moves from testing one gene at a time, to gene panel and whole exome next generation sequencing approaches, understanding the risk associated with co-existence of germline mutations in these genes will be important for clinical interpretation and management. From the Colon Cancer Family Registry, we identified 10 carriers who had both a MUTYH mutation (6 with c.1187G>A p.(Gly396Asp), 3 with c.821G>A p.(Arg274Gln), and 1 with c.536A>G p.(Tyr179Cys)) and a MMR gene mutation (3 in MLH1, 6 in MSH2, and 1 in PMS2), 375 carriers of a single (monoallelic) MUTYH mutation alone, and 469 carriers of a MMR gene mutation alone. Of the 10 carriers of both gene mutations, 8 were diagnosed with colorectal cancer. Using a weighted cohort analysis, we estimated that risk of colorectal cancer for carriers of both a MUTYH and a MMR gene mutation was substantially higher than that for carriers of a MUTYH mutation alone [hazard ratio (HR) 21.5, 95 % confidence interval (CI) 9.19–50.1; p < 0.001], but not different from that for carriers of a MMR gene mutation alone (HR 1.94, 95 % CI 0.63–5.99; p = 0.25). Within the limited power of this study, there was no evidence that a monoallelic MUTYH gene mutation confers additional risk of colorectal cancer for carriers of a MMR gene mutation alone. Our finding suggests MUTYH mutation testing in MMR gene mutation carriers is not clinically informative. PMID:26202870

  17. Reduction of DNA mismatch repair protein expression in airway epithelial cells of premenopausal women chronically exposed to biomass smoke.

    PubMed

    Mukherjee, Bidisha; Dutta, Anindita; Chowdhury, Saswati; Roychoudhury, Sanghita; Ray, Manas Ranjan

    2014-02-01

    Biomass burning is a major source of indoor air pollution in rural India. This study examined whether chronic inhalation of biomass smoke causes change in the DNA mismatch repair (MMR) pathway in the airway cells. For this, airway cells exfoliated in sputum were collected from 72 premenopausal nonsmoking rural women (median age 34 years) who cooked with biomass (wood, dung, crop residues) and 68 control women who cooked with cleaner fuel liquefied petroleum gas (LPG) for the past 5 years or more. The levels of particulate matters with diameters less than 10 and 2.5 μm (PM10 and PM2.5) in indoor air were measured by real-time aerosol monitor. Benzene exposure was monitored by measuring trans,trans-muconic acid (t,t-MA) in urine by high-performance liquid chromatography with ultraviolet detector. Generation of reactive oxygen species (ROS) and level of superoxide dismutase (SOD) in airway cells were measured by flow cytometry and spectrophotometry, respectively. Immunocytochemical assay revealed lower percentage of airway epithelial cells expressing MMR proteins mutL homolog 1 (MLH1) and mutS homolog 2 (MSH2) in biomass-using women compared to LPG-using controls. Women who cooked with biomass had 6.7 times higher level of urinary t,t-MA, twofold increase in ROS generation, and 31 % depletion of SOD. Indoor air of biomass-using households had three times more particulate matters than that of controls. ROS, urinary t,t-MA, and particulate pollution in biomass-using kitchen had negative correlation, while SOD showed positive correlation with MSH2 and MLH1 expression. It appears that chronic exposure to biomass smoke reduces MMR response in airway epithelial cells, and oxidative stress plays an important role in the process.

  18. SPATIAL MISMATCH OR RACIAL MISMATCH?*

    PubMed Central

    Hellerstein, Judith K.; Neumark, David; McInerney, Melissa

    2008-01-01

    We contrast the spatial mismatch hypothesis with what we term the racial mismatch hypothesis – that the problem is not a lack of jobs, per se, where blacks live, but a lack of jobs where blacks live into which blacks are hired. We first report new evidence on the spatial mismatch hypothesis, using data from Census Long-Form respondents. We construct direct measures of the presence of jobs in detailed geographic areas, and find that these job density measures are related to employment of black male residents in ways that would be predicted by the spatial mismatch hypothesis – in particular that spatial mismatch is primarily an issue for low-skilled black male workers. We then look at mismatch along not only spatial lines but racial lines as well, by estimating the effects of job density measures that are disaggregated by race. We find that it is primarily black job density that influences black male employment, whereas white job density has little if any influence on their employment. The evidence implies that space alone plays a relatively minor role in low black male employment rates. PMID:19727422

  19. Contiguous metal-mediated base pairs comprising two Ag(I) ions.

    PubMed

    Megger, Dominik A; Guerra, Célia Fonseca; Hoffmann, Jan; Brutschy, Bernhard; Bickelhaupt, F Matthias; Müller, Jens

    2011-05-27

    The incorporation of transition-metal ions into nucleic acids by using metal-mediated base pairs has proved to be a promising strategy for the site-specific functionalization of these biomolecules. We report herein the formation of Ag(+)-mediated Hoogsteen-type base pairs comprising 1,3-dideaza-2'-deoxyadenosine and thymidine. By defunctionalizing the Watson-Crick edge of adenine, the formation of regular base pairs is prohibited. The additional substitution of the N3 nitrogen atom of adenine by a methine moiety increases the basicity of the exocyclic amino group. Hence, 1,3-dideazaadenine and thymine are able to incorporate two Ag(+) ions into their Hoogsteen-type base pair (as compared with one Ag(+) ion in base pairs with 1-deazaadenine and thymine). We show by using a combination of experimental techniques (UV and circular dichroism (CD) spectroscopies, dynamic light scattering, and mass spectrometry) that this type of base pair is compatible with different sequence contexts and can be used contiguously in DNA double helices. The most stable duplexes were observed when using a sequence containing alternating purine and pyrimidine nucleosides. Dispersion-corrected density functional theory calculations have been performed to provide insight into the structure, formation and stabilization of the twofold metalated base pair. They revealed that the metal ions within a base pair are separated by an Ag···Ag distance of about 2.88 Å. The Ag-Ag interaction contributes some 16 kcal mol(-1) to the overall stability of the doubly metal-mediated base pair, with the dominant contribution to the Ag-Ag bonding resulting from a donor-acceptor interaction between silver 4d-type and 4s orbitals. These Hoogsteen-type base pairs enable a higher functionalization of nucleic acids with metal ions than previously reported metal-mediated base pairs, thereby increasing the potential of DNA-based nanotechnology.

  20. Methylation Analysis of DNA Mismatch Repair Genes Using DNA Derived from the Peripheral Blood of Patients with Endometrial Cancer: Epimutation in Endometrial Carcinogenesis

    PubMed Central

    Takeda, Takashi; Banno, Kouji; Yanokura, Megumi; Adachi, Masataka; Iijima, Moito; Kunitomi, Haruko; Nakamura, Kanako; Iida, Miho; Nogami, Yuya; Umene, Kiyoko; Masuda, Kenta; Kobayashi, Yusuke; Yamagami, Wataru; Hirasawa, Akira; Tominaga, Eiichiro; Susumu, Nobuyuki; Aoki, Daisuke

    2016-01-01

    Germline mutation of DNA mismatch repair (MMR) genes is a cause of Lynch syndrome. Methylation of MutL homolog 1 (MLH1) and MutS homolog 2 (MSH2) has been detected in peripheral blood cells of patients with colorectal cancer. This methylation is referred to as epimutation. Methylation of these genes has not been studied in an unselected series of endometrial cancer cases. Therefore, we examined methylation of MLH1, MSH2, and MSH6 promoter regions of peripheral blood cells in 206 patients with endometrial cancer using a methylation-specific polymerase chain reaction (MSP). Germline mutation of MMR genes, microsatellite instability (MSI), and immunohistochemistry (IHC) were also analyzed in each case with epimutation. MLH1 epimutation was detected in a single patient out of a total of 206 (0.49%)—1 out of 58 (1.72%) with an onset age of less than 50 years. The patient with MLH1 epimutation showed high level MSI (MSI-H), loss of MLH1 expression and had developed endometrial cancer at 46 years old, complicated with colorectal cancer. No case had epimutation of MSH2 or MSH6. The MLH1 epimutation detected in a patient with endometrial cancer may be a cause of endometrial carcinogenesis. This result indicates that it is important to check epimutation in patients with endometrial cancer without a germline mutation of MMR genes. PMID:27754426

  1. Methylation Analysis of DNA Mismatch Repair Genes Using DNA Derived from the Peripheral Blood of Patients with Endometrial Cancer: Epimutation in Endometrial Carcinogenesis.

    PubMed

    Takeda, Takashi; Banno, Kouji; Yanokura, Megumi; Adachi, Masataka; Iijima, Moito; Kunitomi, Haruko; Nakamura, Kanako; Iida, Miho; Nogami, Yuya; Umene, Kiyoko; Masuda, Kenta; Kobayashi, Yusuke; Yamagami, Wataru; Hirasawa, Akira; Tominaga, Eiichiro; Susumu, Nobuyuki; Aoki, Daisuke

    2016-10-14

    Germline mutation of DNA mismatch repair (MMR) genes is a cause of Lynch syndrome. Methylation of MutL homolog 1 (MLH1) and MutS homolog 2 (MSH2) has been detected in peripheral blood cells of patients with colorectal cancer. This methylation is referred to as epimutation. Methylation of these genes has not been studied in an unselected series of endometrial cancer cases. Therefore, we examined methylation of MLH1, MSH2, and MSH6 promoter regions of peripheral blood cells in 206 patients with endometrial cancer using a methylation-specific polymerase chain reaction (MSP). Germline mutation of MMR genes, microsatellite instability (MSI), and immunohistochemistry (IHC) were also analyzed in each case with epimutation. MLH1 epimutation was detected in a single patient out of a total of 206 (0.49%)-1 out of 58 (1.72%) with an onset age of less than 50 years. The patient with MLH1 epimutation showed high level MSI (MSI-H), loss of MLH1 expression and had developed endometrial cancer at 46 years old, complicated with colorectal cancer. No case had epimutation of MSH2 or MSH6. The MLH1 epimutation detected in a patient with endometrial cancer may be a cause of endometrial carcinogenesis. This result indicates that it is important to check epimutation in patients with endometrial cancer without a germline mutation of MMR genes.

  2. Site-directed spin-labeling of DNA by the azide-alkyne 'click' reaction: nanometer distance measurements on 7-deaza-2'-deoxyadenosine and 2'-deoxyuridine nitroxide conjugates spatially separated or linked to a 'dA-dT' base pair.

    PubMed

    Ding, Ping; Wunnicke, Dorith; Steinhoff, Heinz-Jürgen; Seela, Frank

    2010-12-27

    Nucleobase-directed spin-labeling by the azide-alkyne 'click' (CuAAC) reaction has been performed for the first time with oligonucleotides. 7-Deaza-7-ethynyl-2'-deoxyadenosine (1) and 5-ethynyl-2'-deoxyuridine (2) were chosen to incorporate terminal triple bonds into DNA. Oligonucleotides containing 1 or 2 were synthesized on a solid phase and spin labeling with 4-azido-2,2,6,6-tetramethylpiperidine 1-oxyl (4-azido-TEMPO, 3) was performed by post-modification in solution. Two spin labels (3) were incorporated with high efficiency into the DNA duplex at spatially separated positions or into a 'dA-dT' base pair. Modification at the 5-position of the pyrimidine base or at the 7-position of the 7-deazapurine residue gave steric freedom to the spin label in the major groove of duplex DNA. By applying cw and pulse EPR spectroscopy, very accurate distances between spin labels, within the range of 1-2 nm, were measured. The spin-spin distance was 1.8±0.2 nm for DNA duplex 17(dA*(7,10))⋅11 containing two spin labels that are separated by two nucleotides within one individual strand. A distance of 1.4±0.2 nm was found for the spin-labeled 'dA-dT' base pair 15(dA*(7))⋅16(dT*(6)). The 'click' approach has the potential to be applied to all four constituents of DNA, which indicates the universal applicability of the method. New insights into the structural changes of canonical or modified DNA are expected to provide additional information on novel DNA structures, protein interaction, DNA architecture, and synthetic biology.

  3. Mechanism of the Glycosidic Bond Cleavage of Mismatched Thymine in Human Thymine DNA Glycosylase Revealed by Classical Molecular Dynamics and Quantum Mechanical/Molecular Mechanical Calculations.

    PubMed

    Kanaan, Natalia; Crehuet, Ramon; Imhof, Petra

    2015-09-24

    Base excision of mismatched or damaged nucleotides catalyzed by glycosylase enzymes is the first step of the base excision repair system, a machinery preserving the integrity of DNA. Thymine DNA glycosylase recognizes and removes mismatched thymine by cleaving the C1'-N1 bond between the base and the sugar ring. Our quantum mechanical/molecular mechanical calculations of this reaction in human thymine DNA glycosylase reveal a requirement for a positive charge in the active site to facilitate C1'-N1 bond scission: protonation of His151 significantly lowers the free energy barrier for C1'-N1 bond dissociation compared to the situation with neutral His151. Shuttling a proton from His151 to the thymine base further reduces the activation free energy for glycosidic bond cleavage. Classical molecular dynamics simulations of the H151A mutant suggest that the mutation to the smaller, neutral, residue increases the water accessibility of the thymine base, rendering direct proton transfer from the bulk feasible. Quantum mechanical/molecular mechanical calculations of the glycosidic bond cleavage reaction in the H151A mutant show that the activation free energy is slightly lower than in the wild-type enzyme, explaining the experimentally observed higher reaction rates in this mutant.

  4. Single-turnover and pre-steady-state kinetics of the reaction of the adenine glycosylase MutY with mismatch-containing DNA substrates.

    PubMed

    Porello, S L; Leyes, A E; David, S S

    1998-10-20

    The DNA repair enzyme MutY plays an important role in the prevention of DNA mutations resulting from the presence of the oxidatively damaged lesion 7,8-dihydro-8-oxo-2'-deoxyguanosine (OG) in DNA by the removal of misincorporated adenine residues in OG:A mispairs. MutY also exhibits adenine glycosylase activity toward adenine in G:A and C:A mismatches, although the importance of this activity in vivo has not been established. We have investigated the kinetic properties of MutY's glycosylase activity with OG:A and G:A containing DNA duplexes. Our results indicate that MutY's processing of these two substrates is distinctly different. By using single-turnover experiments, the intrinsic rate for adenine removal by MutY from an OG:A substrate was found to be at least 6-fold faster than that from the corresponding G:A substrate. However, under conditions where [MutY] < [DNA], OG:A substrates are not quantitatively converted to product due to the inefficient turnover resulting from slow product release. In contrast, with a G:A substrate MutY's dissociation from the corresponding product is more facile, such that complete conversion of the substrate to product can be achieved under similar conditions. The kinetic results illustrate that the glycosylase reaction catalyzed by MutY has significant differences depending on the characteristics of the substrate. The lingering of MutY with the product of its reaction with OG:A mispairs may be biologically significant to prevent premature removal of OG. Thus, this approach is providing insight into factors that may be influencing the repair of damaged and mismatched DNA in vivo by base-excision repair glycosylases.

  5. The physicochemical essence of the purine·pyrimidine transition mismatches with Watson-Crick geometry in DNA: A·C* versa A*·C. A QM and QTAIM atomistic understanding.

    PubMed

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    It was established for the first time by DFT and MP2 quantum-mechanical (QM) methods either in vacuum, so in the continuum with a low dielectric constant (ε = 4), typical for hydrophobic interfaces of specific protein-nucleic acid interactions, that the repertoire for the tautomerisation of the biologically important adenine · cytosine* (A · C*) mismatched DNA base pair, formed by the amino tautomer of the A and the imino mutagenic tautomer of the C, into the A*·C base mispair (∆G = 2.72 kcal mol(-1) obtained at the MP2 level of QM theory in the continuum with ε = 4), formed by the imino mutagenic tautomer of the A and the amino tautomer of the C, proceeds via the asynchronous concerted double proton transfer along two antiparallel H-bonds through the transition state (TSA · C* ↔ A* · C). The limiting stage of the A · C* → A* · C tautomerisation is the final proton transfer along the intermolecular N6H · · · N4 H-bond. It was found that the A · C*/A* · C DNA base mispairs with Watson-Crick geometry are associated by the N6H · · · N4/N4H · · · N6, N3H · · · N1/N1H · · · N3 and C2H · · · O2 H-bonds, respectively, while the TSA · C*↔ A* · C is joined by the N6-H-N4 covalent bridge and the N1H · · · N3 and C2H · · · O2 H-bonds. It was revealed that the A · C* ↔ A* · C tautomerisation is assisted by the true C2H · · · O2 H-bond, that in contrast to the two others conventional H-bonds exists along the entire intrinsic reaction coordinate (IRC) range herewith becoming stronger at the transition from vacuum to the continuum with ε = 4. To better understand the behavior of the intermolecular H-bonds and base mispairs along the IRC of the A · C* ↔ A* · C tautomerisation, the profiles of their electron-topological, energetical, geometrical, polar and charge characteristics are reported in this study. It was established based on the profiles of the H-bond energies that all three H-bonds are cooperative, mutually

  6. Preliminary Studies on Base Substitutions and Repair of DNA Mismatch Damage Stimulated by Low Energy N+ Ion Beam Implantation in Escherichia coli

    NASA Astrophysics Data System (ADS)

    Xie, Chuan-xiao; Guo, Jin-hua; Cheng, Bei-jiu; Yu, Zeng-liang

    2003-02-01

    Ever since the low energy N+ ion beam has been accepted that the mutation effects of ionizing radiation are attributed mainly to direct or indirect damage to DNA. Evidences based on naked DNA irradiation in support of a mutation spectrum appears to be consistent, but direct proof of such results in vivo are limited. Using mutS, dam and/or dcm defective Eschericha coli mutator strains, an preliminary experimental system on induction of in vivo mutation spectra of low energy N+ ion beam has been established in this study. It was observed that the mutation rates of rifampicin resistance induced by N+ implantation were quite high, ranging from 9.2 × 10-8 to 4.9 × 10-5 at the dosage of 5.2 × 1014 ions/cm2. Strains all had more than 90-fold higher mutation rate than its spontaneous mutation rate determined by this method. It reveals that base substitutions involve in induction of mutation of low energy nitrogen ion beam implantation. The mutation rates of mutator strains were nearly 500-fold (GM2929), 400-fold (GM5864) and 6-fold larger than that of AB1157. The GM2929 and GM5864 both lose the ability of repair DNA mismatch damage by virtue of both dam and dcm pathways defective (GM2929) or failing to assemble the repair complex (GM5864) respectively. It may explain the both strains had a similar higher mutation rate than GM124 did. It indicated that DNA cytosine methylase might play an important role in mismatch repair of DNA damage induced by N+ implantation. The further related research were also discussed.

  7. A periodic table of symmetric tandem mismatches in RNA.

    PubMed

    Wu, M; McDowell, J A; Turner, D H

    1995-03-14

    The stabilities and structures of a series of RNA octamers containing symmetric tandem mismatches were studied by UV melting and imino proton NMR. The free energy increments for tandem mismatch formation are found to depend upon both mismatch sequence and adjacent base pairs. The observed sequence dependence of tandem mismatch stability is UGGU > GUUG > GAAG > or = AGGA > UUUU > CAAC > or = CUUC approximately UCCU approximately CCCC approximately ACCA approximately AAAA, and the closing base pair dependence is 5'G3'C > 5'C3'G > 5'U3'A approximately 5'A3'U. These results differ from expectations based on models used in RNA folding algorithms and from the sequence dependence observed for folding of RNA hairpins. Imino proton NMR results indicate the sequence dependence is partially due to hydrogen bonding within mismatches.

  8. Structural, energetic and tautomeric properties of the T·T∗/T∗·T DNA mismatch involving mutagenic tautomer of thymine: A QM and QTAIM insight

    NASA Astrophysics Data System (ADS)

    Brovarets', Ol'ha O.; Zhurakivsky, Roman O.; Hovorun, Dmytro M.

    2014-01-01

    It was revealed by thorough study of the T·T∗ (C1) ↔ T∗·T (C1) tautomerisation via the synchronous concerted double proton transfer (DPT) through the TS (C2v) that the T·T∗/T∗·T H-bonded mismatch is dynamically stable non-planar complex with a lifetime 1.6 × 10-10 s. The 5 key points were firstly detected and completely investigated along the intrinsic reaction coordinate of the DPT tautomerisation. The reported data allow us to suggest that the T∗ mutagenic tautomer of the thymine (T) is shared with approximately equal probability between two DNA strands during the dissociation of the mispair by DNA polymerase.

  9. Sequence-specific base pair mimics are efficient topoisomerase IB inhibitors.

    PubMed

    Vekhoff, Pierre; Duca, Maria; Guianvarc'h, Dominique; Benhida, Rachid; Arimondo, Paola B

    2012-01-10

    Topoisomerase IB controls DNA topology by cleaving DNA transiently. This property is used by inhibitors, such as camptothecin, that stabilize, by inhibiting the religation step, the cleavage complex, in which the enzyme is covalently attached to the 3'-phosphate of the cleaved DNA strand. These drugs are used in clinics as antitumor agents. Because three-dimensional structural studies have shown that camptothecin derivatives act as base pair mimics and intercalate between two base pairs in the ternary DNA-topoisomerase-inhibitor complex, we hypothesized that base pairs mimics could act like campthotecin and inhibit the religation reaction after the formation of the topoisomerase I-DNA cleavage complex. We show here that three base pair mimics, nucleobases analogues of the aminophenyl-thiazole family, once targeted specifically to a DNA sequence were potent topoisomerase IB inhibitors. The targeting was achieved through covalent linkage to a sequence-specific DNA ligand, a triplex-forming oligonucleotide, and was necessary to position and keep the nucleobase analogue in the cleavage complex. In the absence of triplex formation, only a weak binding to the DNA and topoisomerase I-mediated DNA cleavage was observed. The three compounds were equally active once conjugated, implying that the intercalation of the nucleobase upon triplex formation is the essential feature for the inhibition activity.

  10. A bridging water anchors the tethered 5-(3-aminopropyl)-2'-deoxyuridine amine in the DNA major groove proximate to the N+2 C.G base pair: implications for formation of interstrand 5'-GNC-3' cross-links by nitrogen mustards.

    PubMed

    Wang, Feng; Li, Feng; Ganguly, Manjori; Marky, Luis A; Gold, Barry; Egli, Martin; Stone, Michael P

    2008-07-08

    Site-specific insertion of 5-(3-aminopropyl)-2'-deoxyuridine (Z3dU) and 7-deaza-dG into the Dickerson-Drew dodecamers 5'-d(C (1)G (2)C (3)G (4)A (5)A (6)T (7)T (8)C (9) Z (10)C (11)G (12))-3'.5'-d(C (13)G (14)C (15)G (16)A (17)A (18)T (19)T (20)C (21) Z (22)C (23)G (24))-3' (named DDD (Z10)) and 5'-d(C (1)G (2)C (3)G (4)A (5)A (6)T (7) X (8)C (9) Z (10)C (11)G (12))-3'.5'-d(C (13)G (14)C (15)G (16)A (17)A (18)T (19) X (20)C (21) Z (22)C (23)G (24))-3' (named DDD (2+Z10)) (X = Z3dU; Z = 7-deaza-dG) suggests a mechanism underlying the formation of interstrand N+2 DNA cross-links by nitrogen mustards, e.g., melphalan and mechlorethamine. Analysis of the DDD (2+Z10) duplex reveals that the tethered cations at base pairs A (5).X (20) and X (8).A (17) extend within the major groove in the 3'-direction, toward conserved Mg (2+) binding sites located adjacent to N+2 base pairs C (3).Z (22) and Z (10).C (15). Bridging waters located between the tethered amines and either Z (10) or Z (22) O (6) stabilize the tethered cations and allow interactions with the N + 2 base pairs without DNA bending. Incorporation of 7-deaza-dG into the DDD (2+Z10) duplex weakens but does not eliminate electrostatic interactions between tethered amines and Z (10) O (6) and Z (22) O (6). The results suggest a mechanism by which tethered N7-dG aziridinium ions, the active species involved in formation of interstrand 5'-GNC-3' cross-links by nitrogen mustards, modify the electrostatics of the major groove and position the aziridinium ions proximate to the major groove edge of the N+2 C.G base pair, facilitating interstrand cross-linking.

  11. DNA tandem repeat instability in the Escherichia coli chromosome is stimulated by mismatch repair at an adjacent CAG·CTG trinucleotide repeat

    PubMed Central

    Blackwood, John K.; Okely, Ewa A.; Zahra, Rabaab; Eykelenboom, John K.; Leach, David R. F.

    2010-01-01

    Approximately half the human genome is composed of repetitive DNA sequences classified into microsatellites, minisatellites, tandem repeats, and dispersed repeats. These repetitive sequences have coevolved within the genome but little is known about their potential interactions. Trinucleotide repeats (TNRs) are a subclass of microsatellites that are implicated in human disease. Expansion of CAG·CTG TNRs is responsible for Huntington disease, myotonic dystrophy, and a number of spinocerebellar ataxias. In yeast DNA double-strand break (DSB) formation has been proposed to be associated with instability and chromosome fragility at these sites and replication fork reversal (RFR) to be involved either in promoting or in preventing instability. However, the molecular basis for chromosome fragility of repetitive DNA remains poorly understood. Here we show that a CAG·CTG TNR array stimulates instability at a 275-bp tandem repeat located 6.3 kb away on the Escherichia coli chromosome. Remarkably, this stimulation is independent of both DNA double-strand break repair (DSBR) and RFR but is dependent on a functional mismatch repair (MMR) system. Our results provide a demonstration, in a simple model system, that MMR at one type of repetitive DNA has the potential to influence the stability of another. Furthermore, the mechanism of this stimulation places a limit on the universality of DSBR or RFR models of instability and chromosome fragility at CAG·CTG TNR sequences. Instead, our data suggest that explanations of chromosome fragility should encompass the possibility of chromosome gaps formed during MMR. PMID:21149728

  12. Control of DNA hybridization by photoswitchable molecular glue.

    PubMed

    Dohno, Chikara; Nakatani, Kazuhiko

    2011-12-01

    Hybridization of DNA is one of the most intriguing events in molecular recognition and is essential for living matter to inherit life beyond generations. In addition to the function of DNA as genetic material, DNA hybridization is a key to control the function of DNA-based materials in nanoscience. Since the hybridization of two single stranded DNAs is a thermodynamically favorable process, dissociation of the once formed DNA duplex is normally unattainable under isothermal conditions. As the progress of DNA-based nanoscience, methodology to control the DNA hybridization process has become increasingly important. Besides many reports using the chemically modified DNA for the regulation of hybridization, we focused our attention on the use of a small ligand as the molecular glue for the DNA. In 2001, we reported the first designed molecule that strongly and specifically bound to the mismatched base pairs in double stranded DNA. Further studies on the mismatch binding molecules provided us a key discovery of a novel mode of the binding of a mismatch binding ligand that induced the base flipping. With these findings we proposed the concept of molecular glue for DNA for the unidirectional control of DNA hybridization and, eventually photoswitchable molecular glue for DNA, which enabled the bidirectional control of hybridization under photoirradiation. In this tutorial review, we describe in detail how we integrated the mismatch binding ligand into photoswitchable molecular glue for DNA, and the application and perspective in DNA-based nanoscience.

  13. Theoretical study of silver-ion-mediated base pairs: the case of C-Ag-C and C-Ag-A systems.

    PubMed

    Fortino, Mariagrazia; Marino, Tiziana; Russo, Nino

    2015-05-28

    Silver-mediated base pairs applied to DNA represent a new biomacromolecular nanomaterial useful for generating nanodevices as ion sensors. Reported herein is a full quantum chemical study devoted to give further knowledge on the electronic and energetic properties of C-Ag-C and mixed C-Ag-A mismatched base pairs. The B3LYP functional in conjunction with the dispersion effects (D3) has been applied. Single-point calculations have been also performed by using the M06-L functional. The investigation of their behavior has been extended to the duplex DNA modeled by the (dC-Ag-dC)2 and (dC-Ag-dA)2 more complex systems. The solvent effect has been taken into account by the conductor-like screening model, COSMO. In the case of mixed C-Ag-A and (dC-Ag-dA)2 systems, both the Watson-Crick and Hoogsteen arrangements have been taken into account. Results show that for (dC-Ag-dA)2 systems, the binding energies are almost double that of the corresponding values of C-Ag-A ones.

  14. Genome filtering using methylation-sensitive restriction enzymes with six-base pair recognition sites

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The large fraction of repetitive DNA in many plant genomes has complicated all aspects of DNA sequencing and assembly, and thus techniques that enrich for genes and low-copy sequences have been employed to isolate gene space. Methyl sensitive restriction enzymes with six base pair recognition sites...

  15. Unusual Base-Pairing Interactions in Monomer–Template Complexes

    PubMed Central

    2016-01-01

    Many high-resolution crystal structures have contributed to our understanding of the reaction pathway for catalysis by DNA and RNA polymerases, but the structural basis of nonenzymatic template-directed RNA replication has not been studied in comparable detail. Here we present crystallographic studies of the binding of ribonucleotide monomers to RNA primer–template complexes, with the goal of improving our understanding of the mechanism of nonenzymatic RNA copying, and of catalysis by polymerases. To explore how activated ribonucleotides recognize and bind to RNA templates, we synthesized an unreactive phosphonate-linked pyrazole analogue of guanosine 5′-phosphoro-2-methylimidazolide (2-MeImpG), a highly activated nucleotide that has been used extensively to study nonenzymatic primer extension. We cocrystallized this analogue with structurally rigidified RNA primer–template complexes carrying single or multiple monomer binding sites, and obtained high-resolution X-ray structures of these complexes. In addition to Watson–Crick base pairing, we repeatedly observed noncanonical guanine:cytidine base pairs in our crystal structures. In most structures, the phosphate and leaving group moieties of the monomers were highly disordered, while in others the distance from O3′ of the primer to the phosphorus of the incoming monomer was too great to allow for reaction. We suggest that these effects significantly influence the rate and fidelity of nonenzymatic RNA replication, and that even primitive ribozyme polymerases could enhance RNA replication by enforcing Watson–Crick base pairing between monomers and primer–template complexes, and by bringing the reactive functional groups into closer proximity. PMID:28058281

  16. Comparable Stability of Hoogsteen and Watson–Crick Base Pairs in Ionic Liquid Choline Dihydrogen Phosphate

    PubMed Central

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-01

    The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194

  17. Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

    PubMed

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-08

    The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

  18. Epigenetic Enhancement of the Post-replicative DNA Mismatch Repair of Mammalian Genomes by a Hemi-mCpG-Np95-Dnmt1 Axis

    PubMed Central

    Wang, Keh-Yang; Chen, Chun-Chang; Tsai, Shih-Feng; Shen, Che-Kun James

    2016-01-01

    DNA methylation at C of CpG dyads (mCpG) in vertebrate genomes is essential for gene regulation, genome stability and development. We show in this study that proper functioning of post-replicative DNA mismatch repair (MMR) in mammalian cells relies on the presence of genomic mCpG, as well as on the maintenance DNA methyltransferase Dnmt1 independently of its catalytic activity. More importantly, high efficiency of mammalian MMR surveillance is achieved through a hemi-mCpG-Np95(Uhrf1)-Dnmt1 axis, in which the MMR surveillance complex(es) is recruited to post-replicative DNA by Dnmt1, requiring its interactions with MutSα, as well as with Np95 bound at the hemi-methylated CpG sites. Thus, efficiency of MMR surveillance over the mammalian genome in vivo is enhanced at the epigenetic level. This synergy endows vertebrate CpG methylation with a new biological significance and, consequently, an additional mechanism for the maintenance of vertebrate genome stability. PMID:27886214

  19. The Structure of a High Fidelity DNA Polymerase Bound to a Mismatched Nucleotide Reveals an ;Ajar; Intermediate Conformation in the Nucleotide Selection Mechanism

    SciTech Connect

    Wu, Eugene Y.; Beese, Lorena S.

    2011-10-10

    To achieve accurate DNA synthesis, DNA polymerases must rapidly sample and discriminate against incorrect nucleotides. Here we report the crystal structure of a high fidelity DNA polymerase I bound to DNA primer-template caught in the act of binding a mismatched (dG:dTTP) nucleoside triphosphate. The polymerase adopts a conformation in between the previously established 'open' and 'closed' states. In this 'ajar' conformation, the template base has moved into the insertion site but misaligns an incorrect nucleotide relative to the primer terminus. The displacement of a conserved active site tyrosine in the insertion site by the template base is accommodated by a distinctive kink in the polymerase O helix, resulting in a partially open ternary complex. We suggest that the ajar conformation allows the template to probe incoming nucleotides for complementarity before closure of the enzyme around the substrate. Based on solution fluorescence, kinetics, and crystallographic analyses of wild-type and mutant polymerases reported here, we present a three-state reaction pathway in which nucleotides either pass through this intermediate conformation to the closed conformation and catalysis or are misaligned within the intermediate, leading to destabilization of the closed conformation.

  20. 'Escherichia Coli' MutS Tetramerization Domain Structure Reveals That Stable Dimers But Not Tetramers are Essential for DNA Mismatch Repair in Vivo

    SciTech Connect

    Mendillo, M.L.; Putnam, C.D.; Kolodner, R.D.; /UC, San Diego

    2007-07-10

    The E. coli mispair binding protein MutS forms dimers and tetramers in vitro, although the functional form in vivo is under debate. Here we demonstrate that the MutS tetramer is extended in solution using small angle x-ray scattering (SAXS) and the crystal structure of the C-terminal 34 amino acids of MutS containing the tetramer-forming domain fused to maltose binding protein (MBP). Wild-type C-terminal MBP fusions formed tetramers and could bind MutS and MutS-MutL-DNA complexes. In contrast, Asp835Arg and Arg840Glu mutations predicted to disrupt tetrameric interactions only allowed dimerization of MBP. A chromosomal MutS truncation mutation eliminating the dimerization/tetramerization domain eliminated mismatch repair, whereas the tetramer-disrupting MutS Asp835Arg and Arg840Glu mutations only modestly affected MutS function. These results demonstrate that dimerization but not tetramerization of the MutS C- terminus is essential for mismatch repair.

  1. Truncation of the MSH2 C-terminal 60 amino acids disrupts effective DNA mismatch repair and is causative for Lynch syndrome.

    PubMed

    Wielders, Eva; Delzenne-Goette, Elly; Dekker, Rob; van der Valk, Martin; Te Riele, Hein

    2017-04-01

    Missense variants of DNA mismatch repair (MMR) genes pose a problem in clinical genetics as long as they cannot unambiguously be assigned as the cause of Lynch syndrome (LS). To study such variants of uncertain clinical significance, we have developed a functional assay based on direct measurement of MMR activity in mouse embryonic stem cells expressing mutant protein from the endogenous alleles. We have applied this protocol to a specific truncation mutant of MSH2 that removes 60 C-terminal amino acids and has been found in suspected LS families. We show that the stability of the MSH2/MSH6 heterodimer is severely perturbed, causing attenuated MMR in in vitro assays and cancer predisposition in mice. This mutation can therefore unambiguously be considered as deleterious and causative for LS.

  2. Tautomeric transition between wobble A·C DNA base mispair and Watson-Crick-like A·C* mismatch: microstructural mechanism and biological significance.

    PubMed

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-06-21

    Here, we use MP2/DFT quantum-chemical methods combined with Quantum Theory of Atoms in Molecules to study the tautomeric transition between wobble A·C(w) mismatch and Watson-Crick-like A·C*(WC) base mispair, proceeding non-dissociatively via sequential proton transfer between bases through the planar, highly stable and zwitterionic TS(A∙C-)(A∙C(W)<-->A∙C&(WC)) transition state joined by the participation of (A)N6(+)H∙∙∙N4(-)(C), (A)N1(+)H∙∙∙N4(-)(C) and (A)C2(+)H∙∙∙N3(-)(C) H-bonds. Notably, the A·C(w) ↔ A·C*(WC) tautomerization reaction is accompanied by 10 unique patterns of the specific intermolecular interactions that consistently replace each other. Our data suggest that biologically significant A·C(w) → A·C*(WC) tautomerization is a kinetically controlled pathway for formation of the enzymatically competent Watson-Crick-like A·C*(WC) DNA base mispair in the essentially hydrophobic recognition pocket of the high-fidelity DNA-polymerase, responsible for the occurrence of spontaneous point AC/CA incorporation errors during DNA biosynthesis.

  3. PCR-restriction fragment length polymorphism analysis of a diagnostic 452-base-pair DNA fragment discriminates between Cryptosporidium parvum and C. meleagridis and between C. parvum isolates of human and animal origin.

    PubMed

    Guyot, K; Follet-Dumoulin, A; Recourt, C; Lelièvre, E; Cailliez, J C; Dei-Cas, E

    2002-04-01

    Genomic DNAs from human Cryptosporidium isolates previously typed by analysis of the 18S ribosomal DNA locus (Cryptosporidium parvum bovine genotype, C. parvum human genotype, Cryptosporidium meleagridis, and Cryptosporidium felis) were used to amplify the diagnostic fragment described by Laxer et al. (M. A. Laxer, B. K. Timblin, and R. J. Patel, Am. J. Trop. Med. Hyg., 45:688-694, 1991). The obtained 452-bp amplified fragments were sequenced and aligned with the homologous Cryptosporidium wrairi sequence. Polymorphism was exploited to develop a restriction fragment length polymorphism method able to discriminate Cryptosporidium species and C. parvum genotypes.

  4. Neighbouring bases in template influence base-pairing of isoguanine.

    PubMed Central

    Maciejewska, Agnieszka M; Lichota, Katarzyna D; Kuśmierek, Jarosław T

    2003-01-01

    Assuming that the efficiency of the incorporation of 5-methyl-2'-deoxyisocytosine-5' triphosphate (dMiCTP) and dTTP opposite isoguanine (iG) is a measure of the proportion of the keto and enol tautomers of iG in the Thermus aquaticus DNA polymerase active centre, we studied the influence of temperature and iG-neighbouring bases in the template on base-pairing of iG. On the basis of experiments with four sequences (3'-TXT-5', 3'-GXG-5', 3'-CXC-5', 3'-CXT-5', where X=iG) at 37, 50, 65 and 80 degrees C, we found that 3'-neighbours decrease the fraction of the keto tautomer in the order C>G>or=T, whereas temperature apparently does not influence the tautomeric equilibrium of iG. The variability of the ratio of incorporation of dMiCTP versus dTTP (5-20) primarily reflects the variability of K (m) values, since V (max) values are roughly similar, which indicates that the iG.MiC and iG.T pairs fit the polymerase active centre equally well. The altering of the base-pairing of iG by sequence context is discussed in relation to tautomerism and miscoding of this oxidized adenine derivative. A key derivative for preparation oligodeoxynucleotides, O (2)-diphenylcarbamoyl- N (6)-[(dimethylamino)ethylidene]-2'-deoxyisoguanosine, is extremely labile (t (1/2)=3.5 min) in 3% trichloroacetic acid/dichloromethane, i.e. under the conditions of automated DNA synthesis, which results in low yield and length heterogeneity of templates. PMID:12387728

  5. Subtelomeric regions of yeast chromosomes contain a 36 base-pair tandemly repeated sequence.

    PubMed Central

    Horowitz, H; Haber, J E

    1984-01-01

    We have determined the nucleotide sequence of a region of DNA derived from the end of one chromosome of the yeast, Saccharomyces cerevisiae. Inspection of the sequence reveals the presence of 12 tandem direct repeats, each 36 nucleotides long and having nearly identical sequence. Each 36 base-pair repeat can be further subdivided into three tandem sub-repeats of a similar 12 base-pair sequence. Analysis of total genomic yeast DNA from several strains by Southern hybridization suggests that the number of tandem 36 base-pair repeat units may vary from approximately 8 to 25 among different telomeric regions. Differences in the number of repeats may have arisen by unequal crossing over between them. Furthermore, the finding that the pattern of bases at multiple variable positions within the repeat unit is not random suggests that these regions may undergo gene conversion events that render them homogeneous. Images PMID:6091055

  6. Nucleic acid duplexes incorporating a dissociable covalent base pair

    NASA Technical Reports Server (NTRS)

    Gao, K.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    1999-01-01

    We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure.

  7. Nucleic Acid Duplexes Incorporating a Dissociable Covalent Base Pair

    NASA Astrophysics Data System (ADS)

    Gao, Kui; Orgel, Leslie E.

    1999-12-01

    We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure.

  8. Synergistic effects in the melting of DNA hydration shell: melting of the minor groove hydration spine in poly(dA).poly(dT) and its effect on base pair stability.

    PubMed Central

    Chen, Y Z; Prohofsky, E W

    1993-01-01

    We propose that water of hydration in contact with the double helix can exist in several states. One state, found in the narrow groove of poly(dA).poly(dT), should be considered as frozen to the helix, i.e., an integral part of the double helix. We find that this enhanced helix greatly effects the stability of that helix against base separation melting. Most water surrounding the helix is, however, melted or disassociated with respect to being an integral part of helix and plays a much less significant role in stabilizing the helix dynamically, although these water molecules play an important role in stabilizing the helix conformation statically. We study the temperature dependence of the melting of the hydration spine and find that narrow groove nonbonded interactions are necessary to stabilize the spine above room temperature and to show the broad transition observed experimentally. This calculation requires that synergistic effects of nonbonded interactions between DNA and its hydration shell affect the state of water-base atom hydrogen bonds. The attraction of waters into narrow groove tends to retain waters in the groove and compress or strain these hydrogen bonds. PMID:8324179

  9. Effect of Base-Pairing Partner on the Thermodynamic Stability of the Diastereomeric Spiroiminodihydantoin Lesion.

    PubMed

    Gruessner, Brian; Dwarakanath, Megana; Stewart, Elizabeth; Bae, Yoon; Jamieson, Elizabeth R

    2016-03-21

    Oxidation of guanine by reactive oxygen species and high valent metals produces damaging DNA base lesions like 8-oxo-7,8-dihydroguanine (8-oxoG). 8-oxoG can be further oxidized to form the spiroiminodihydantoin (Sp) lesion, which is even more mutagenic. DNA polymerases preferentially incorporate purines opposite the Sp lesion, and DNA glycosylases excise the Sp lesion from the duplex, although the rate of repair is different for the two Sp diastereomers. To further understand the biological processing of the Sp lesion, differential scanning calorimetry studies were performed on a series of 15-mer DNA duplexes. The thermal and thermodynamic stabilities of each of the Sp diastereomers paired to the four standard DNA bases were investigated. It was found that, regardless of the base-pairing partner, the Sp lesion was always highly destabilizing in terms of DNA melting temperature, enthalpic stability, and overall duplex free energy. We found no significant differences between the two Sp diastereomers, but changing the base-pairing partner of the Sp lesion produced slight differences in stability. Specifically, duplexes with Sp:C pairings were always the most destabilized, whereas pairing the Sp lesion with a purine base modestly increased stability. Overall, these results suggest that, although the stability of the Sp diastereomers cannot explain the differences in the rates of repair by DNA glycosylases, the most stable base-pairing partners do correspond with the nucleotide preference of DNA polymerases.

  10. A Bridging Water Anchors the Tethered 5-(3-Aminopropyl)-2′-deoxyuridine Amine in the DNA Major Groove Proximate to the N+2 C·G Base Pair: Implications for Formation of Interstrand 5′-GNC-3′ Cross-Links by Nitrogen Mustards

    SciTech Connect

    Wang, Feng; Li, Feng; Ganguly, Manjori; Marky, Luis A.; Gold, Barry; Egli, Martin; Stone, Michael P.

    2008-11-14

    Site-specific insertion of t-(3-aminopropyl)-2'-deoxyuridine (Z3dU) and 7-deaza-dG into the Dickerson-Drew dodecamers 5'-d(C{sup 1}G{sup 2}C{sup 3}G{sup 4}A{sup 5}A{sup 6}T{sup 7}T{sup 8}C{sup 9}{und Z}{sup 10}C{sup 11}G{sup 12})-3'{center_dot}5'-d (C{sup 13}G{sup 14}C{sup 15}G{sup 16}A{sup 17}A{sup 18}T{sup 19}T{sup 20}C{sup 21}{und Z}{sup 22}C{sup 23}G{sup 24})-3' (named DDD{sup Z10}) and 5'-d(C{sup 1}G{sup 2}C{sup 3}G{sup 4}A{sup 5}A{sup 6}T{sup 7}{und X}{sup 20}C{sup 21}{und Z}{sup 22}C{sup 23}G{sup 24})-3' (named DDD{sup 2+Z10}) (X = 73dU; Z = 7-deaza-dG) suggests a mechanism underlying the formation of interstrand N+2 DNA cross-links by nitrogen mustards, e.g., melphalan and mechlorethamine. Analysis of the DDD{sup 2+Z10} duplex reveals that the tethered cations at base pairs A{sup 5}{center_dot}X{sup 20} and X{sup 8}{center_dot}A{sup 17} extend within the major groove in the 3'-direction, toward conserved Mg{sup 2+} binding sites located adjacent to N+2 base pairs C{sup 3}{center_dot}Z{sup 22} and Z{sup 10}{center_dot}C{sup 15}. Bridging waters located between the tethered amines and either Z{sup 10} or Z{sup 22} O{sup 6} stabilize the tethered cations and allow interactions with the N + 2 base pairs without DNA bending. Incorporation of 7-deaza-dG into the DDD{sup 2+Z10} duplex weakens but does not eliminate electrostatic interactions between tethered amines and Z{sup 10} O{sup 6} and Z{sup 22} O{sup 6}. The results suggest a mechanism by which tethered N7-dG aziridinium ions, the active species involved in formation of interstrand 5'-GNC-3' cross-links by nitrogen mustards, modify the electrostatics of the major groove and position the aziridinium ions proximate to the major groove edge of the N+2 C{center_dot}G base pair, facilitating interstrand cross-linking.

  11. Base-Pairing Systems Related to TNA: alpha-Threofuranosyl Oligonucleotides Containing Phosphoramidate Linkages

    NASA Technical Reports Server (NTRS)

    Meyer, Michael (Technical Monitor); Wu, Xiaolin; Guntha, Sreenivasulu; Ferenclc, Mathias; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

    2002-01-01

    (3'NH)- and (2'NH)-TNA, two isomeric phosphoramidate analogues of TNA (alpha-threofuranosyl-(3'-2') oligonucleotides), are shown to be efficient Watson-Crick base-pairing systems and to undergo intersystem crosspairing with TNA, RNA, and DNA.

  12. High Fidelity of Base Paring by 2-Selenothymidine in DNA

    SciTech Connect

    Hassan, A.; Sheng, J; Zhang, W; Huang, Z

    2010-01-01

    The base pairs are the contributors to the sequence-dependent recognition of nucleic acids, genetic information storage, and high fidelity of DNA polymerase replication. However, the wobble base pairing, where T pairs with G instead of A, reduces specific base-pairing recognition and compromises the high fidelity of the enzymatic polymerization. Via the selenium atomic probing at the 2-position of thymidine, we have investigated the wobble discrimination by manipulating the steric and electronic effects at the 2-exo position, providing a unique chemical strategy to enhance the base pair specificity. We report here the first synthesis of the novel 2-Se-thymidine ({sup Se}T) derivative, its phosphoramidite, and the Se-DNAs. Our biophysical and structural studies of the 2-Se-T DNAs reveal that the bulky 2-Se atom with a weak hydrogen-bonding ability can largely increase mismatch discriminations (including T/G wobble and T/C mismatched base pairs) while maintaining the {sup Se}T/A virtually identical to the native T/A base pair. The 2-Se atom bulkiness and the electronic effect are probably the main factors responsible for the discrimination against the formation of the wobble {sup Se}T/G base pair. Our investigations provide a potential novel tool to investigate the specific recognition of base pairs, which is the basis of high fidelity during replication, transcription, and translation. Furthermore, this Se-atom-specific substitution and probing are useful for X-ray crystal structure and function studies of nucleic acids.

  13. ATP binding and hydrolysis by Saccharomyces cerevisiae Msh2-Msh3 are differentially modulated by mismatch and double-strand break repair DNA substrates.

    PubMed

    Kumar, Charanya; Eichmiller, Robin; Wang, Bangchen; Williams, Gregory M; Bianco, Piero R; Surtees, Jennifer A

    2014-06-01

    In Saccharomyces cerevisiae, Msh2-Msh3-mediated mismatch repair (MMR) recognizes and targets insertion/deletion loops for repair. Msh2-Msh3 is also required for 3' non-homologous tail removal (3'NHTR) in double-strand break repair. In both pathways, Msh2-Msh3 binds double-strand/single-strand junctions and initiates repair in an ATP-dependent manner. However, we recently demonstrated that the two pathways have distinct requirements with respect to Msh2-Msh3 activities. We identified a set of aromatic residues in the nucleotide binding pocket (FLY motif) of Msh3 that, when mutated, disrupted MMR, but left 3'NHTR largely intact. One of these mutations, msh3Y942A, was predicted to disrupt the nucleotide sandwich and allow altered positioning of ATP within the pocket. To develop a mechanistic understanding of the differential requirements for ATP binding and/or hydrolysis in the two pathways, we characterized Msh2-Msh3 and Msh2-msh3Y942A ATP binding and hydrolysis activities in the presence of MMR and 3'NHTR DNA substrates. We observed distinct, substrate-dependent ATP hydrolysis and nucleotide turnover by Msh2-Msh3, indicating that the MMR and 3'NHTR DNA substrates differentially modify the ATP binding/hydrolysis activities of Msh2-Msh3. Msh2-msh3Y942A retained the ability to bind DNA and ATP but exhibited altered ATP hydrolysis and nucleotide turnover. We propose that both ATP and structure-specific repair substrates cooperate to direct Msh2-Msh3-mediated repair and suggest an explanation for the msh3Y942A separation-of-function phenotype.

  14. How many tautomerization pathways connect Watson-Crick-like G*·T DNA base mispair and wobble mismatches?

    PubMed

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    In this study, we have theoretically demonstrated the intrinsic ability of the wobble G·T(w)/G*·T*(w)/G·T(w1)/G·T(w2) and Watson-Crick-like G*·T(WC) DNA base mispairs to interconvert into each other via the DPT tautomerization. We have established that among all these transitions, only one single G·T(w) ↔ G*·T(WC) pathway is eligible from a biological perspective. It involves short-lived intermediate - the G·T*(WC) base mispair - and is governed by the planar, highly stable, and zwitterionic [Formula: see text] transition state stabilized by the participation of the unique pattern of the five intermolecular O6(+)H⋯O4(-), O6(+)H⋯N3(-), N1(+)H⋯N3(-), N1(+)H⋯O2(-), and N2(+)H⋯O2(-) H-bonds. This non-dissociative G·T(w) ↔ G*·T(WC) tautomerization occurs without opening of the pair: Bases within mispair remain connected by 14 different patterns of the specific intermolecular interactions that successively change each other along the IRC. Novel kinetically controlled mechanism of the thermodynamically non-equilibrium spontaneous point GT/TG incorporation errors has been suggested. The mutagenic effect of the analogues of the nucleotide bases, in particular 5-bromouracil, can be attributed to the decreasing of the barrier of the acquisition by the wobble pair containing these compounds of the enzymatically competent Watson-Crick's geometry via the intrapair mutagenic tautomerization directly in the essentially hydrophobic recognition pocket of the replication DNA-polymerase machinery. Proposed approaches are able to explain experimental data, namely growth of the rate of the spontaneous point incorporation errors during DNA biosynthesis with increasing temperature.

  15. Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

    PubMed

    Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

    2015-02-10

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

  16. A chemical approach to mapping nucleosomes at base pair resolution in yeast.

    PubMed

    Brogaard, Kristin R; Xi, Liqun; Wang, Ji-Ping; Widom, Jonathan

    2012-01-01

    Most eukaryotic DNA exists in DNA-protein complexes known as nucleosomes. The exact locations of nucleosomes along the genome play a critical role in chromosome functions and gene regulation. However, the current methods for nucleosome mapping do not provide the necessary accuracy to identify the precise nucleosome locations. Here we describe a new experimental approach that directly maps nucleosome center locations in vivo genome-wide at single base pair resolution.

  17. Breaking pseudo-twofold symmetry in the poliovirus 3'-UTR Y-stem by restoring Watson-Crick base pairs.

    PubMed

    Zoll, Jan; Tessari, Marco; Van Kuppeveld, Frank J M; Melchers, Willem J G; Heus, Hans A

    2007-05-01

    The previously described NMR structure of a 5'-CU-3'/5'-UU-3' motif, which is highly conserved within the 3'-UTR Y-stem of poliovirus-like enteroviruses, revealed striking regularities of the local helix geometry, thus retaining the pseudo-twofold symmetry of the RNA helix. A mutant virus with both pyrimidine base pairs changed into Watson-Crick replicated as wild type, indicating the functional importance of this symmetry relation in viral RNA replication. Here we investigated the effect of changing only one of the two pyrimidine base pairs to Watson-Crick. We determined the NMR structures of two Y-stem variants: one containing the 5'-CU-3'/5'-AU-3' motif, which has been found in wild-type virus isolates as well, and the other containing a 5'-CU-3'/5'-UG-3' motif, which is not present in any enterovirus sequenced to date. Both structures show single pyrimidine mismatches with intercalated bases. In the 5'-CU-3'/5'-AU-3' motif a C-U Watson-Crick-type base pair is formed that retains the pseudo-twofold symmetry, while in the 5'-CU-3'/5'-UG-3' motif a single asymmetric U-U mismatch breaks the twofold symmetry. Surprisingly, for the nonnatural variant no effect of the single base-pair replacement was observed on polioviral RNA replication using an in vitro replicon assay.

  18. Cytostatic evaluations of nucleoside analogs related to unnatural base pairs for a genetic expansion system.

    PubMed

    Kimoto, Michiko; Moriyama, Kei; Yokoyama, Shigeyuki; Hirao, Ichiro

    2007-10-15

    The introduction of an unnatural base pair into DNA enables the expansion of genetic information. To apply unnatural base pairs to in vivo systems, we evaluated the cytostatic toxicity of several nucleoside analogs by an MTT assay. Several nucleoside analogs based on two types of unnatural base pairs were tested. One is a hydrogen-bonded base pair between 2-amino-6-(2-thienyl)purine (s) and pyridin-2-one (y), and the other is a hydrophobic base pair between 7-(2-thienyl)imidazo[4,5-b]pyridine (Ds) and pyrrole-2-carbaldehyde (Pa). Among the nucleoside analogs, the ribonucleoside of 6-(2-thienyl)purine possessed the highest cytostatic activity against CCRF-CEM and especially HT-1080, as well as the normal fibroblast cell line, WI-38. The other analogs, including its 2'-deoxy, 2-amino, and 1-deazapurine nucleoside derivatives, were less active against CCRF-CEM and HT-1080, and the toxicity of these nucleosides toward WI-38 was low. The nucleosides of y and Pa were inactive against CCRF-CEM, HT-1080, and WI-38. In addition, no cytostatic synergism was observed with the combination of the pairing nucleosides of s and y or Ds and Pa.

  19. Solution structure, mechanism of replication, and optimization of an unnatural base pair.

    PubMed

    Malyshev, Denis A; Pfaff, Danielle A; Ippoliti, Shannon I; Hwang, Gil Tae; Dwyer, Tammy J; Romesberg, Floyd E

    2010-11-08

    As part of an ongoing effort to expand the genetic alphabet for in vitro and eventual in vivo applications, we have synthesized a wide variety of predominantly hydrophobic unnatural base pairs and evaluated their replication in DNA. Collectively, the results have led us to propose that these base pairs, which lack stabilizing edge-on interactions, are replicated by means of a unique intercalative mechanism. Here, we report the synthesis and characterization of three novel derivatives of the nucleotide analogue dMMO2, which forms an unnatural base pair with the nucleotide analogue d5SICS. Replacing the para-methyl substituent of dMMO2 with an annulated furan ring (yielding dFMO) has a dramatically negative effect on replication, while replacing it with a methoxy (dDMO) or with a thiomethyl group (dTMO) improves replication in both steady-state assays and during PCR amplification. Thus, dTMO-d5SICS, and especially dDMO-d5SICS, represent significant progress toward the expansion of the genetic alphabet. To elucidate the structure-activity relationships governing unnatural base pair replication, we determined the solution structure of duplex DNA containing the parental dMMO2-d5SICS pair, and also used this structure to generate models of the derivative base pairs. The results strongly support the intercalative mechanism of replication, reveal a surprisingly high level of specificity that may be achieved by optimizing packing interactions, and should prove invaluable for the further optimization of the unnatural base pair.

  20. Potential of the Akt inhibitor LY294005 to antagonize the efficacy of Cisplatin against HCT116 tumor cells in a DNA mismatch repair-dependent manner.

    PubMed

    Fedier, Andre; Erdmann, Ruediger; Boulikas, Teni; Fink, Daniel

    2006-11-01

    Human colorectal adenocarcinoma sublines either deficient (HCT116+ch2) or proficient (HCT116+ch3) in the function of MLH1, one of five proteins crucial to DNA mismatch repair (MMR), were used to investigate whether the Akt-specific inhibitor LY294005 could not only increase the efficacy of platinum drugs in HCT116 cells in general but also increase the efficacy of the cisplatinum compounds Cisplatin and Lipoplatin specifically in MLH1-deficient, Cisplatin- and Lipoplatin-resistant HCT116 cells. We report that, under the conditions it increased the efficacy of Docetaxel and did not affect that of 6-thioguanine, LY294005 decreased the sensitivity of both sublines to Cisplatin, Lipoplatin, Oxaliplatin, and Lipoxal. Notably, the LY294005-imposed decrease was significantly higher in the MLH1-proficient than in the MLH1-deficient subline with Cisplatin and Lipoplatin, whereas it was nearly the same in both sublines with Oxaliplatin and Lipoxal. These LY294005-imposed changes in drug sensitivity, i.e. increase with Docetaxel and decreases with platinum compounds, were not associated with the concomitant abrogation in the levels of phospho-Aktser473. Analogous changes in drug sensitivity were also observed with the PI3-kinase inhibitor LY294002, but these changes were associated with complete abrogation of phospho-Aktser473. These observations suggest a possible relationship between MMR-mediated cisplatinum DNA damage signaling and the Akt signaling pathway, e.g. a common target for both pathways. A possibly novel property of Akt in aggravating drug sensitivity may also be proposed.

  1. Programmable energy landscapes for kinetic control of DNA strand displacement.

    PubMed

    Machinek, Robert R F; Ouldridge, Thomas E; Haley, Natalie E C; Bath, Jonathan; Turberfield, Andrew J

    2014-11-10

    DNA is used to construct synthetic systems that sense, actuate, move and compute. The operation of many dynamic DNA devices depends on toehold-mediated strand displacement, by which one DNA strand displaces another from a duplex. Kinetic control of strand displacement is particularly important in autonomous molecular machinery and molecular computation, in which non-equilibrium systems are controlled through rates of competing processes. Here, we introduce a new method based on the creation of mismatched base pairs as kinetic barriers to strand displacement. Reaction rate constants can be tuned across three orders of magnitude by altering the position of such a defect without significantly changing the stabilities of reactants or products. By modelling reaction free-energy landscapes, we explore the mechanistic basis of this control mechanism. We also demonstrate that oxDNA, a coarse-grained model of DNA, is capable of accurately predicting and explaining the impact of mismatches on displacement kinetics.

  2. Base-pairing selectivity of a ureido-linked phenyl-2'-deoxycytidine derivative.

    PubMed

    Nakano, Shu-ichi; Oka, Hirohito; Yamaguchi, Daisuke; Fujii, Masayuki; Sugimoto, Naoki

    2012-12-28

    Incorporation of modified nucleotides into nucleic acid strands often produces conformational constraints and steric hindrances that may change the property of base pairing. In this study, we investigated a 2'-deoxycytidine derivative that tethers a phenyl moiety to the exocyclic amino group of cytosine linked through a ureido group. This derivative compound is structurally similar to the carbamoylated DNA base lesions produced in cells. The thermodynamic and structural studies showed that the modified dC formed the base pair with dG in the complementary strand, but the base-pairing selectivity toward dG was decreased under poly(ethylene glycol)-mediated osmotic stress. The phenyl group and the ureido linker attached to dC provided selectivity for the formation of base pairing exclusively with dG in a wide range of pH conditions, whereas unmodified dC stabilized the pairings with dA or dC in acidic solutions. Moreover, this modified base could not form self-pairing through intermolecular hydrogen bonds. We suggest that formation of weak pairing and protonation of the cytosine base are hindered due to the base modification. These data provide insights into the pairing selectivity of carbamoylated cytosine lesions produced in cells, and suggest applications of the 2'-deoxycytidine derivatives in medical technologies, molecular biology experiments, and synthesis of a supramolecular network of DNA strands.

  3. DNA-mediated charge transport for DNA repair

    PubMed Central

    Boon, Elizabeth M.; Livingston, Alison L.; Chmiel, Nikolas H.; David, Sheila S.; Barton, Jacqueline K.

    2003-01-01

    MutY, like many DNA base excision repair enzymes, contains a [4Fe4S]2+ cluster of undetermined function. Electrochemical studies of MutY bound to a DNA-modified gold electrode demonstrate that the [4Fe4S] cluster of MutY can be accessed in a DNA-mediated redox reaction. Although not detectable without DNA, the redox potential of DNA-bound MutY is ≈275 mV versus NHE, which is characteristic of HiPiP iron proteins. Binding to DNA is thus associated with a change in [4Fe4S]3+/2+ potential, activating the cluster toward oxidation. Given that DNA charge transport chemistry is exquisitely sensitive to perturbations in base pair structure, such as mismatches, we propose that this redox process of MutY bound to DNA exploits DNA charge transport and provides a DNA signaling mechanism to scan for mismatches and lesions in vivo. PMID:14559969

  4. Unnatural substrates reveal the importance of 8-oxoguanine for in vivo mismatch repair by MutY

    PubMed Central

    Livingston, Alison L.; O’Shea, Valerie L.; Kim, Taewoo; Kool, Eric T.; David, Sheila S.

    2009-01-01

    Escherchia coli MutY plays an important role in preventing mutations associated with the oxidative lesion 7,8-dihydro-8-oxo-2′-deoxyguanosine (OG) in DNA by excising adenines from OG:A mismatches as the first step of base excision repair. To determine the importance of specific steps in the base pair recognition and base removal process of MutY, we have evaluated the effects of modifications of the OG:A substrate on the kinetics of base removal, mismatch affinity and repair to G:C in an Escherchia coli-based assay. Surprisingly, adenine modification was tolerated in the cellular assay, while modification of OG results in minimal cellular repair. High affinity for the mismatch and efficient base removal require the presence of OG. Taken together, these results suggest that the presence of OG is a critical feature for MutY to locate OG:A mismatches and select the appropriate adenines for excision to initiate repair in vivo prior to replication. PMID:18026095

  5. Nucleotide sequence of the hexA gene for DNA mismatch repair in Streptococcus pneumoniae and homology of hexA to mutS of Escherichia coli and Salmonella typhimurium

    SciTech Connect

    Priebe, S.D.; Hadi, S.M.; Greenberg, B.; Lacks, S.A.

    1988-01-01

    The Hex system of heteroduplex DNA base mismatch repair operates in Streptococcus pneumoniae after transformation and replication to correct donor and nascent DNA strands, respectively. A functionally similar system, called Mut, operates in Escherichia coli and Salmonella typhimurium. The nucleotide sequence of a 3.8-kilobase segment from the S. pneumoniae chromosome that includes the 2.7-kilobase hexA gene was determined. Chromosomal DNA used as donor to measure Hex phenotype was irradiated with UV light. An open reading frame that could encode a 17-kilodalton polypeptide (OrfC) was located just upstream of the gene encoding a polypeptide of 95 kilodaltons corresponding to HexA. Shine-Dalgarno sequences and putative promoters were identified upstream of each protein start site. Insertion mutations showed that only HexA functioned in mismatch repair and that the promoter for hexA transcription was located within the OrfC-coding region. The HexA polypeptide contains a consensus sequence for ATP- or GTP-binding sites in proteins. Comparison of the entire HexA protein sequence to that of MutS of S. typhimurium, showed the proteins to be homologous, inasmuch as 36% of their amino acid residues were identical. This homology indicates that the Hex and Mut systems of mismatch repair evolved from an ancestor common to the gram-positive streptococci and the gram-negative enterobacteria. It is the first direct evidence linking the two systems.

  6. Mismatch discrimination in fluorescent in situ hybridization using different types of nucleic acids.

    PubMed

    Fontenete, Silvia; Silvia, Fontenete; Barros, Joana; Joana, Barros; Madureira, Pedro; Pedro, Madureira; Figueiredo, Céu; Céu, Figueiredo; Wengel, Jesper; Jesper, Wengel; Azevedo, Nuno Filipe; Filipe, Azevedo Nuno

    2015-05-01

    In the past few years, several researchers have focused their attention on nucleic acid mimics due to the increasing necessity of developing a more robust recognition of DNA or RNA sequences. Fluorescence in situ hybridization (FISH) is an example of a method where the use of these novel nucleic acid monomers might be crucial to the success of the analysis. To achieve the expected accuracy in detection, FISH probes should have high binding affinity towards their complementary strands and discriminate effectively the noncomplementary strands. In this study, we investigate the effect of different chemical modifications in fluorescent probes on their ability to successfully detect the complementary target and discriminate the mismatched base pairs by FISH. To our knowledge, this paper presents the first study where this analysis is performed with different types of FISH probes directly in biological targets, Helicobacter pylori and Helicobacter acinonychis. This is also the first study where unlocked nucleic acids (UNA) were used as chemistry modification in oligonucleotides for FISH methodologies. The effectiveness in detecting the specific target and in mismatch discrimination appears to be improved using locked nucleic acids (LNA)/2'-O-methyl RNA (2'OMe) or peptide nucleic acid (PNA) in comparison to LNA/DNA, LNA/UNA, or DNA probes. Further, the use of LNA modifications together with 2'OMe monomers allowed the use of shorter fluorescent probes and increased the range of hybridization temperatures at which FISH would work.

  7. Detection of DNA damage based on metal-mediated molecular beacon and DNA strands displacement reaction

    NASA Astrophysics Data System (ADS)

    Xiong, Yanxiang; Wei, Min; Wei, Wei; Yin, Lihong; Pu, Yuepu; Liu, Songqin

    2014-01-01

    DNA hairpin structure probes are usually designed by forming intra-molecular duplex based on Watson-Crick hydrogen bonds. In this paper, a molecular beacon based on silver ions-mediated cytosine-Ag+-cytosine base pairs was used to detect DNA. The inherent characteristic of the metal ligation facilitated the design of functional probe and the adjustment of its binding strength compared to traditional DNA hairpin structure probes, which make it be used to detect DNA in a simple, rapid and easy way with the help of DNA strands displacement reaction. The method was sensitive and also possesses the good specificity to differentiate the single base mismatched DNA from the complementary DNA. It was also successfully applied to study the damage effect of classic genotoxicity chemicals such as styrene oxide and sodium arsenite on DNA, which was significant in food science, environmental science and pharmaceutical science.

  8. Reversible bond formation enables the replication and amplification of a crosslinking salen complex as an orthogonal base pair

    NASA Astrophysics Data System (ADS)

    Kaul, Corinna; Müller, Markus; Wagner, Mirko; Schneider, Sabine; Carell, Thomas

    2011-10-01

    The universal genetic code relies on two hydrogen-bonded Watson-Crick base pairs that can form 64 triplet codons. This places a limit on the number of amino acids that can be encoded, which has motivated efforts to create synthetic base pairs that are orthogonal to the natural ones. An additional base pair would result in another 61 triplet codons. Artificial organic base pairs have been described in enzymatic incorporation studies, and inorganic T-Hg-T and C-Ag-C base pairs have been reported to form in primer extension studies. Here, we demonstrate a metal base pair that is fully orthogonal and can be replicated, and can even be amplified by polymerase chain reaction in the presence of the canonical pairs dA:dT and dG:dC. Crystal structures of a dS-Cu-dS base pair inside a polymerase show that reversible chemistry is possible directly inside the polymerase, which enables the efficient copying of the inorganic crosslink. The results open up the possibility of replicating and amplifying artificial inorganic DNA nanostructures by extending the genetic alphabet.

  9. Development of DNA mismatch repair gene, MutS, as a diagnostic marker for detection and phylogenetic analysis of algal Megaviruses.

    PubMed

    Wilson, William H; Gilg, Ilana C; Duarte, Amy; Ogata, Hiroyuki

    2014-10-01

    Megaviruses are generically defined as giant viruses with genomes up to 1.26Mb that infect eukaryotic unicellular protists; they are clearly delineated in DNA polymerase B phylogenetic trees; in addition, common features often include an associated virophage observed during infection; the presence of an amino acyl tRNA synthetase gene; and a nucleic acid mismatch repair protein, MutS gene. The archetypal representative of this evolving putative family is Mimivirus, an opportunistic pathogen of Acanthamoeba spp. originally thought to be a bacterium until its genome sequence was published in 2004. Subsequent analysis of marine metagenomic data revealed Megaviruses are likely ubiquitous on the surface ocean. Analysis of genome sequences of giant viruses isolated from naturally occurring marine protists such as microalgae and a microflagellate grazer, started the expansion of the Megaviridae. Here, we explored the possibility of developing Megavirus specific markers for mutS that could be used in virus molecular ecology studies. MutS is split into 15 different clades representing a wide range of cellular life, and two that contain Megaviruses, clade MutS7 and clade MutS8. We developed specific PCR primers that recognized Megavirus clade MutS8, a clade that we propose discriminates most of the algal Megaviruses. Analysis of seawater off the coast of Maine, US, revealed novel groups of algal Megaviruses that were present in all samples tested. The Megavirus clade MutS8 marker should be considered as a tool to reveal new diversity and distribution of this enigmatic group of viruses.

  10. Euler buckling and nonlinear kinking of double-stranded DNA

    PubMed Central

    Fields, Alexander P.; Meyer, Elisabeth A.; Cohen, Adam E.

    2013-01-01

    The bending stiffness of double-stranded DNA (dsDNA) at high curvatures is fundamental to its biological activity, yet this regime has been difficult to probe experimentally, and literature results have not been consistent. We created a ‘molecular vise’ in which base-pairing interactions generated a compressive force on sub-persistence length segments of dsDNA. Short dsDNA strands (<41 base pairs) resisted this force and remained straight; longer strands became bent, a phenomenon called ‘Euler buckling’. We monitored the buckling transition via Förster Resonance Energy Transfer (FRET) between appended fluorophores. For low-to-moderate concentrations of monovalent salt (up to ∼150 mM), our results are in quantitative agreement with the worm-like chain (WLC) model of DNA elasticity, without the need to invoke any ‘kinked’ states. Greater concentrations of monovalent salts or 1 mM Mg2+ induced an apparent softening of the dsDNA, which was best accounted for by a kink in the region of highest curvature. We tested the effects of all single-nucleotide mismatches on the DNA bending. Remarkably, the propensity to kink correlated with the thermodynamic destabilization of the mismatched DNA relative the perfectly complementary strand, suggesting that the kinked state is locally melted. The molecular vise is exquisitely sensitive to the sequence-dependent linear and nonlinear elastic properties of dsDNA. PMID:23956222

  11. Mismatch repair at stop codons is directed independent of GATC methylation on the Escherichia coli chromosome.

    PubMed

    Sneppen, Kim; Semsey, Szabolcs

    2014-12-05

    The mismatch repair system (MMR) corrects replication errors that escape proofreading. Previous studies on extrachromosomal DNA in Escherichia coli suggested that MMR uses hemimethylated GATC sites to identify the newly synthesized strand. In this work we asked how the distance of GATC sites and their methylation status affect the occurrence of single base substitutions on the E. coli chromosome. As a reporter system we used a lacZ gene containing an early TAA stop codon. We found that occurrence of point mutations at this stop codon is unaffected by GATC sites located more than 115 base pairs away. However, a GATC site located about 50 base pairs away resulted in a decreased mutation rate. This effect was independent of Dam methylation. The reversion rate of the stop codon increased only slightly in dam mutants compared to mutL and mutS mutants. We suggest that unlike on extrachromosomal DNA, GATC methylation is not the only strand discrimination signal for MMR on the E. coli chromosome.

  12. Mismatch repair at stop codons is directed independent of GATC methylation on the Escherichia coli chromosome

    NASA Astrophysics Data System (ADS)

    Sneppen, Kim; Semsey, Szabolcs

    2014-12-01

    The mismatch repair system (MMR) corrects replication errors that escape proofreading. Previous studies on extrachromosomal DNA in Escherichia coli suggested that MMR uses hemimethylated GATC sites to identify the newly synthesized strand. In this work we asked how the distance of GATC sites and their methylation status affect the occurrence of single base substitutions on the E. coli chromosome. As a reporter system we used a lacZ gene containing an early TAA stop codon. We found that occurrence of point mutations at this stop codon is unaffected by GATC sites located more than 115 base pairs away. However, a GATC site located about 50 base pairs away resulted in a decreased mutation rate. This effect was independent of Dam methylation. The reversion rate of the stop codon increased only slightly in dam mutants compared to mutL and mutS mutants. We suggest that unlike on extrachromosomal DNA, GATC methylation is not the only strand discrimination signal for MMR on the E. coli chromosome.

  13. Mismatch repair at stop codons is directed independent of GATC methylation on the Escherichia coli chromosome

    PubMed Central

    Sneppen, Kim; Semsey, Szabolcs

    2014-01-01

    The mismatch repair system (MMR) corrects replication errors that escape proofreading. Previous studies on extrachromosomal DNA in Escherichia coli suggested that MMR uses hemimethylated GATC sites to identify the newly synthesized strand. In this work we asked how the distance of GATC sites and their methylation status affect the occurrence of single base substitutions on the E. coli chromosome. As a reporter system we used a lacZ gene containing an early TAA stop codon. We found that occurrence of point mutations at this stop codon is unaffected by GATC sites located more than 115 base pairs away. However, a GATC site located about 50 base pairs away resulted in a decreased mutation rate. This effect was independent of Dam methylation. The reversion rate of the stop codon increased only slightly in dam mutants compared to mutL and mutS mutants. We suggest that unlike on extrachromosomal DNA, GATC methylation is not the only strand discrimination signal for MMR on the E. coli chromosome. PMID:25475788

  14. Mismatch Repair in Schizosaccharomyces Pombe Requires the Mutl Homologous Gene Pms1: Molecular Cloning and Functional Analysis

    PubMed Central

    Schar, P.; Baur, M.; Schneider, C.; Kohli, J.

    1997-01-01

    Homologues of the bacterial mutS and mutL genes involved in DNA mismatch repair have been found in organisms from bacteria to humans. Here, we describe the structure and function of a newly identified Schizosaccharomyces pombe gene that encodes a predicted amino acid sequence of 794 residues with a high degree of homology to MutL related proteins. On the basis of its closer relationship to the eukaryotic ``PMS'' genes than to the ``MLH'' genes, we have designated the S. pombe homologue pms1. Disruption of the pms1 gene causes a significant increase of spontaneous mutagenesis as documented by reversion rate measurements. Tetrad analyses of crosses homozygous for the pms1 mutation reveal a reduction of spore viability from >92% to 80% associated with a low proportion (~50%) of meioses producing four viable spores and a significant, allele-dependent increase of the level of post-meiotic segregation of genetic marker allele pairs. The mutant phenotypes are consistent with a general function of pms1 in correction of mismatched base pairs arising as a consequence of DNA polymerase errors during DNA synthesis, or of hybrid DNA formation between homologous but not perfectly complementary DNA strands during meiotic recombination. PMID:9258673

  15. Role of the Closing Base Pair for d(GCA) Hairpin Stability: Free Energy Analysis and Folding Simulations

    SciTech Connect

    Kannan, Srinivasaraghavan; Zacharias, Martin W.

    2011-06-30

    Hairpin loops belong to the most important structural motifs in folded nucleic acids. The d(GNA) sequence in DNA can form very stable trinucleotide hairpin loops depending, however, strongly on the closing base pair. Replica-exchange molecular dynamics (REMD) were employed to study hairpin folding of two DNA sequences, d(gcGCAgc) and d(cgGCAcg), with the same central loop motif but different closing base pairs starting from singlestranded structures. In both cases, conformations of the most populated conformational cluster at the lowest temperature showed close agreement with available experimental structures. For the loop sequence with the less stable G:C closing base pair, an alternative loop topology accumulated as second most populated conformational state indicating a possible loop structural heterogeneity. Comparative-free energy simulations on induced loop unfolding indicated higher stability of the loop with a C:G closing base pair by 3 kcal mol1 (compared to a G:C closing base pair) in very good agreement with experiment. The comparative energetic analysis of sampled unfolded, intermediate and folded conformational states identified electrostatic and packing interactions as the main contributions to the closing base pair dependence of the d(GCA) loop stability.

  16. Non-canonical actions of mismatch repair

    PubMed Central

    Crouse, Gray F.

    2015-01-01

    At the heart of the mismatch repair (MMR) system are proteins that recognize mismatches in DNA. Such mismatches can be mispairs involving normal or damaged bases or insertion/deletion loops due to strand misalignment. When such mispairs are generated during replication or recombination, MMR will direct removal of an incorrectly paired base or block recombination between nonidentical sequences. However, when mispairs are recognized outside the context of replication, proper strand discrimination between old and new DNA is lost, and MMR can act randomly and mutagenically on mispaired DNA. Such non-canonical actions of MMR are important in somatic hypermutation and class switch recombination, expansion of triplet repeats, and potentially in mutations arising in nondividing cells. MMR involvement in damage recognition and signaling is complex, with the end result likely dependent on the amount of DNA damage in a cell. PMID:26698648

  17. DNA functionalization by dynamic chemistry

    PubMed Central

    Kanlidere, Zeynep; Jochim, Oleg; Cal, Marta

    2016-01-01

    Summary Dynamic combinatorial chemistry (DCC) is an attractive method to efficiently generate libraries of molecules from simpler building blocks by reversible reactions under thermodynamic control. Here we focus on the chemical modification of DNA oligonucleotides with acyclic diol linkers and demonstrate their potential for the deoxyribonucleic acid functionalization and generation of libraries of reversibly interconverting building blocks. The syntheses of phosphoramidite building blocks derived from D-threoninol are presented in two variants with protected amino or thiol groups. The threoninol building blocks were successfully incorporated via automated solid-phase synthesis into 13mer oligonucleotides. The amino group containing phosphoramidite was used together with complementary single-strand DNA templates that influenced the Watson–Crick base-pairing equilibrium in the mixture with a set of aldehyde modified nucleobases. A significant fraction of all possible base-pair mismatches was obtained, whereas, the highest selectivity (over 80%) was found for the guanine aldehyde templated by the complementary cytosine containing DNA. The elevated occurrence of mismatches can be explained by increased backbone plasticity derived from the linear threoninol building block as a cyclic deoxyribose analogue. PMID:27829920

  18. Sequence-specific high mobility group box factors recognize 10-12-base pair minor groove motifs.

    PubMed

    van Beest, M; Dooijes, D; van De Wetering, M; Kjaerulff, S; Bonvin, A; Nielsen, O; Clevers, H

    2000-09-01

    Sequence-specific high mobility group (HMG) box factors bind and bend DNA via interactions in the minor groove. Three-dimensional NMR analyses have provided the structural basis for this interaction. The cognate HMG domain DNA motif is generally believed to span 6-8 bases. However, alignment of promoter elements controlled by the yeast genes ste11 and Rox1 has indicated strict conservation of a larger DNA motif. By site selection, we identify a highly specific 12-base pair motif for Ste11, AGAACAAAGAAA. Similarly, we show that Tcf1, MatMc, and Sox4 bind unique, highly specific DNA motifs of 12, 12, and 10 base pairs, respectively. Footprinting with a deletion mutant of Ste11 reveals a novel interaction between the 3' base pairs of the extended DNA motif and amino acids C-terminal to the HMG domain. The sequence-specific interaction of Ste11 with these 3' base pairs contributes significantly to binding and bending of the DNA motif.

  19. DNA Charge Transport over 34 nm

    PubMed Central

    Slinker, Jason D.; Muren, Natalie B.; Renfrew, Sara E.; Barton, Jacqueline K.

    2011-01-01

    Molecular wires show promise in nanoscale electronics but the synthesis of uniform, long conductive molecules is a significant challenge. DNA of precise length, by contrast, is easily synthesized, but its conductivity has not been explored over the distances required for nanoscale devices. Here we demonstrate DNA charge transport (CT) over 34 nm in 100-mer monolayers on gold. Multiplexed gold electrodes modified with 100-mer DNA yield sizable electrochemical signals from a distal, covalent Nile Blue redox probe. Significant signal attenuation upon incorporation of a single base pair mismatch demonstrates that CT is DNA-mediated. Efficient cleavage of these 100-mers by a restriction enzyme indicates that the DNA adopts a native conformation that is accessible to protein binding. Similar electron transfer rates are measured through 100-mer and 17-mer monolayers, consistent with rate-limiting electron tunneling through the saturated carbon linker. This DNA-mediated CT distance of 34 nm surpasses most reports of molecular wires. PMID:21336329

  20. Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.

    PubMed

    Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole

    2010-08-25

    Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.

  1. A mutate-and-map strategy accurately infers the base pairs of a 35-nucleotide model RNA

    PubMed Central

    Kladwang, Wipapat; Cordero, Pablo; Das, Rhiju

    2011-01-01

    We present a rapid experimental strategy for inferring base pairs in structured RNAs via an information-rich extension of classic chemical mapping approaches. The mutate-and-map method, previously applied to a DNA/RNA helix, systematically searches for single mutations that enhance the chemical accessibility of base-pairing partners distant in sequence. To test this strategy for structured RNAs, we have carried out mutate-and-map measurements for a 35-nt hairpin, called the MedLoop RNA, embedded within an 80-nt sequence. We demonstrate the synthesis of all 105 single mutants of the MedLoop RNA sequence and present high-throughput DMS, CMCT, and SHAPE modification measurements for this library at single-nucleotide resolution. The resulting two-dimensional data reveal visually clear, punctate features corresponding to RNA base pair interactions as well as more complex features; these signals can be qualitatively rationalized by comparison to secondary structure predictions. Finally, we present an automated, sequence-blind analysis that permits the confident identification of nine of the 10 MedLoop RNA base pairs at single-nucleotide resolution, while discriminating against all 1460 false-positive base pairs. These results establish the accuracy and information content of the mutate-and-map strategy and support its feasibility for rapidly characterizing the base-pairing patterns of larger and more complex RNA systems. PMID:21239468

  2. High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

    PubMed

    Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2015-11-02

    Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices.

  3. Binding energies of nucleobase complexes: Relevance to homology recognition of DNA

    NASA Astrophysics Data System (ADS)

    León, Sergio Cruz; Prentiss, Mara; Fyta, Maria

    2016-06-01

    The binding energies of complexes of DNA nucleobase pairs are evaluated using quantum mechanical calculations at the level of dispersion corrected density functional theory. We begin with Watson-Crick base pairs of singlets, duplets, and triplets and calculate their binding energies. At a second step, mismatches are incorporated into the Watson-Crick complexes in order to evaluate the variation in the binding energy with respect to the canonical Watson-Crick pairs. A linear variation of this binding energy with the degree of mismatching is observed. The binding energies for the duplets and triplets containing mismatches are further compared to the energies of the respective singlets in order to assess the degree of collectivity in these complexes. This study also suggests that mismatches do not considerably affect the energetics of canonical base pairs. Our work is highly relevant to the recognition process in DNA promoted through the RecA protein and suggests a clear distinction between recognition in singlets, and recognition in duplets or triplets. Our work assesses the importance of collectivity in the homology recognition of DNA.

  4. Mismatch repair during homologous and homeologous recombination.

    PubMed

    Spies, Maria; Fishel, Richard

    2015-03-02

    Homologous recombination (HR) and mismatch repair (MMR) are inextricably linked. HR pairs homologous chromosomes before meiosis I and is ultimately responsible for generating genetic diversity during sexual reproduction. HR is initiated in meiosis by numerous programmed DNA double-strand breaks (DSBs; several hundred in mammals). A characteristic feature of HR is the exchange of DNA strands, which results in the formation of heteroduplex DNA. Mismatched nucleotides arise in heteroduplex DNA because the participating parental chromosomes contain nonidentical sequences. These mismatched nucleotides may be processed by MMR, resulting in nonreciprocal exchange of genetic information (gene conversion). MMR and HR also play prominent roles in mitotic cells during genome duplication; MMR rectifies polymerase misincorporation errors, whereas HR contributes to replication fork maintenance, as well as the repair of spontaneous DSBs and genotoxic lesions that affect both DNA strands. MMR suppresses HR when the heteroduplex DNA contains excessive mismatched nucleotides, termed homeologous recombination. The regulation of homeologous recombination by MMR ensures the accuracy of DSB repair and significantly contributes to species barriers during sexual reproduction. This review discusses the history, genetics, biochemistry, biophysics, and the current state of studies on the role of MMR in homologous and homeologous recombination from bacteria to humans.

  5. Mismatch Repair during Homologous and Homeologous Recombination

    PubMed Central

    Spies, Maria; Fishel, Richard

    2015-01-01

    Homologous recombination (HR) and mismatch repair (MMR) are inextricably linked. HR pairs homologous chromosomes before meiosis I and is ultimately responsible for generating genetic diversity during sexual reproduction. HR is initiated in meiosis by numerous programmed DNA double-strand breaks (DSBs; several hundred in mammals). A characteristic feature of HR is the exchange of DNA strands, which results in the formation of heteroduplex DNA. Mismatched nucleotides arise in heteroduplex DNA because the participating parental chromosomes contain nonidentical sequences. These mismatched nucleotides may be processed by MMR, resulting in nonreciprocal exchange of genetic information (gene conversion). MMR and HR also play prominent roles in mitotic cells during genome duplication; MMR rectifies polymerase misincorporation errors, whereas HR contributes to replication fork maintenance, as well as the repair of spontaneous DSBs and genotoxic lesions that affect both DNA strands. MMR suppresses HR when the heteroduplex DNA contains excessive mismatched nucleotides, termed homeologous recombination. The regulation of homeologous recombination by MMR ensures the accuracy of DSB repair and significantly contributes to species barriers during sexual reproduction. This review discusses the history, genetics, biochemistry, biophysics, and the current state of studies on the role of MMR in homologous and homeologous recombination from bacteria to humans. PMID:25731766

  6. Charge transport in DNA nanowires connected to carbon nanotubes

    NASA Astrophysics Data System (ADS)

    Tan, Bikan; Hodak, Miroslav; Lu, Wenchang; Bernholc, J.

    2015-08-01

    DNA is perhaps the worlds most controllable nanowire, with potential applications in nanoelectronics and sensing. However, understanding of its charge transport (CT) properties remains elusive, with experiments reporting a wide range of behaviors from insulating to superconductive. We report extensive first-principle simulations that account for DNA's high flexibility and its native solvent environment. The results show that the CT along the DNA's long axis is strongly dependent on DNA's instantaneous conformation varying over many orders of magnitude. In high CT conformations, delocalized conductive states extending over up to 10 base pairs are found. Their low exponential decay constants further indicate that coherent CT, which is assumed to be active only over 2-3 base pairs in the commonly accepted DNA CT models, can act over much longer length scales. We also identify a simple geometrical rule that predicts CT properties of a given conformation with high accuracy. The effect of mismatched base pairs is also considered: while they decrease conductivities of specific DNA conformations, thermally induced conformational fluctuations wash out this effect. Overall, our results indicate that an immobilized partially dried poly(G)-poly(C) B-DNA is preferable for nanowire applications.

  7. Elimination of the Yeast Rad6 Ubiquitin Conjugase Enhances Base-Pair Transitions and G.c -> T.a Transversions as Well as Transposition of the Ty Element: Implications for the Control of Spontaneous Mutation

    PubMed Central

    Kang, X.; Yadao, F.; Gietz, R. D.; Kunz, B. A.

    1992-01-01

    The RAD6 gene of the yeast Saccharomyces cerevisiae encodes an enzyme that conjugates ubiquitin to other proteins. Defects in RAD6 confer a mutator phenotype due, in part, to an increased rate of transposition of the yeast Ty element. To further delineate the role of protein ubiquitination in the control of spontaneous mutagenesis in yeast, we have characterized 202 mutations that arose spontaneously in the SUP4-o gene carried on a centromere vector in a RAD6 deletion strain. The resulting mutational spectrum was compared to that for 354 spontaneous SUP4-o mutations isolated in the isogenic wild-type parent. This comparison revealed that the rad6 mutator enhanced the rate of single base-pair substitution, as well as Ty insertion, but did not affect the rates of the other mutational classes detected. Relative to the wild-type parent, Ty inserted at considerably more SUP4-o positions in the rad6 strain with a significantly smaller fraction detected at a transposition hotspot. These findings suggest that, in addition to the rate of transposition, protein ubiquitination might influence the target site specificity of Ty insertion. The increase in the substitution rate accounted for approximately 90% of the rad6 mutator effect but only the two transitions and the G.C -> T.A transversion were enhanced. Analysis of the distribution of these events within SUP4-o suggested that the site specificity of the substitutions was influenced by DNA sequence context. Transformation of heteroduplex plasmid DNAs into the two strains demonstrated that the rad6 mutator did not reduce the efficiency of correcting mismatches that could give rise to the transitions or transversion nor did it bias restoration of the mismatches to the incorrect base-pairs. These results are discussed in relation to possible mechanisms that might link ubiquitination of proteins to spontaneous mutation rates. PMID:1311695

  8. A high-throughput assay for the comprehensive profiling of DNA ligase fidelity.

    PubMed

    Lohman, Gregory J S; Bauer, Robert J; Nichols, Nicole M; Mazzola, Laurie; Bybee, Joanna; Rivizzigno, Danielle; Cantin, Elizabeth; Evans, Thomas C

    2016-01-29

    DNA ligases have broad application in molecular biology, from traditional cloning methods to modern synthetic biology and molecular diagnostics protocols. Ligation-based detection of polynucleotide sequences can be achieved by the ligation of probe oligonucleotides when annealed to a complementary target sequence. In order to achieve a high sensitivity and low background, the ligase must efficiently join correctly base-paired substrates, while discriminating against the ligation of substrates containing even one mismatched base pair. In the current study, we report the use of capillary electrophoresis to rapidly generate mismatch fidelity profiles that interrogate all 256 possible base-pair combinations at a ligation junction in a single experiment. Rapid screening of ligase fidelity in a 96-well plate format has allowed the study of ligase fidelity in unprecedented depth. As an example of this new method, herein we report the ligation fidelity of Thermus thermophilus DNA ligase at a range of temperatures, buffer pH and monovalent cation strength. This screen allows the selection of reaction conditions that maximize fidelity without sacrificing activity, while generating a profile of specific mismatches that ligate detectably under each set of conditions.

  9. Artificial mismatch hybridization

    DOEpatents

    Guo, Zhen; Smith, Lloyd M.

    1998-01-01

    An improved nucleic acid hybridization process is provided which employs a modified oligonucleotide and improves the ability to discriminate a control nucleic acid target from a variant nucleic acid target containing a sequence variation. The modified probe contains at least one artificial mismatch relative to the control nucleic acid target in addition to any mismatch(es) arising from the sequence variation. The invention has direct and advantageous application to numerous existing hybridization methods, including, applications that employ, for example, the Polymerase Chain Reaction, allele-specific nucleic acid sequencing methods, and diagnostic hybridization methods.

  10. The thermodynamics and kinetics of a nucleotide base pair

    NASA Astrophysics Data System (ADS)

    Wang, Yujie; Gong, Sha; Wang, Zhen; Zhang, Wenbing

    2016-03-01

    The thermodynamic and kinetic parameters of an RNA base pair were obtained through a long-time molecular dynamics simulation of the opening-closing switch process of the base pair near its melting temperature. The thermodynamic parameters were in good agreement with the nearest-neighbor model. The opening rates showed strong temperature dependence, however, the closing rates showed only weak temperature dependence. The transition path time was weakly temperature dependent and was insensitive to the energy barrier. The diffusion constant exhibited super-Arrhenius behavior. The free energy barrier of breaking a single base stack results from the enthalpy increase, ΔH, caused by the disruption of hydrogen bonding and base-stacking interactions. The free energy barrier of base pair closing comes from the unfavorable entropy loss, ΔS, caused by the restriction of torsional angles. These results suggest that a one-dimensional free energy surface is sufficient to accurately describe the dynamics of base pair opening and closing, and the dynamics are Brownian.

  11. DNA Electrochemistry with Tethered Methylene Blue

    PubMed Central

    Pheeney, Catrina G.

    2012-01-01

    Methylene blue (MB′), covalently attached to DNA through a flexible C12 alkyl linker, provides a sensitive redox reporter in DNA electrochemistry measurements. Tethered, intercalated MB′ is reduced through DNA-mediated charge transport; the incorporation of a single base mismatch at position 3, 10, or 14 of a 17-mer causes an attenuation of the signal to 62 ± 3% of the well-matched DNA, irrespective of position in the duplex. The redox signal intensity for MB′–DNA is found to be least 3-fold larger than that of Nile blue (NB)–DNA, indicating that MB′ is even more strongly coupled to the π-stack. The signal attenuation due to an intervening mismatch does, however, depend on DNA film density and the backfilling agent used to passivate the surface. These results highlight two mechanisms for reduction of MB′ on the DNA-modified electrode: reduction mediated by the DNA base pair stack and direct surface reduction of MB′ at the electrode. These two mechanisms are distinguished by their rates of electron transfer that differ by 20-fold. The extent of direct reduction at the surface can be controlled by assembly and buffer conditions. PMID:22512327

  12. Quantum chemical studies of structures and binding in noncanonical RNA base pairs: the trans Watson-Crick:Watson-Crick family.

    PubMed

    Sharma, Purshotam; Mitra, Abhijit; Sharma, Sitansh; Singh, Harjinder; Bhattacharyya, Dhananjay

    2008-06-01

    correlated with the identities of free and bound hydrogen bond donor/acceptor groups present in interacting bases in conjunction with their tertiary and neighboring group interaction potentials in the global context. It also suggests that the concept of isostericity alone may not always determine covariation potentials for base pairs, particularly for those which may be important for RNA dynamics. These considerations are more important than the absolute values of the interaction energies in their respective optimized geometries in rationalizing their occurrences in functional RNAs. They highlight the importance of revising some of the existing DNA based structure analysis approaches and may have significant implications for RNA structure and dynamics, especially in the context of structure prediction algorithms.

  13. Does the tautomeric status of the adenine bases change upon the dissociation of the A*·A(syn) Topal-Fresco DNA mismatch? A combined QM and QTAIM atomistic insight.

    PubMed

    Brovarets', Ol'ha O; Zhurakivsky, Roman O; Hovorun, Dmytro M

    2014-02-28

    We have scrupulously explored the tautomerisation mechanism via the double proton transfer of the A*·A(syn) Topal-Fresco base mispair (C(s) symmetry), formed by the imino and amino tautomers of the adenine DNA base in the anti- and syn-conformations, respectively, bridging quantum-mechanical calculations with Bader's quantum theory of atoms in molecules. It was found that the A*·A(syn) ↔ A·A*(syn) tautomerisation is the asynchronous concerted process. It was established that the A*·A(syn) DNA mismatch is stabilized by the N6H···N6 (6.35) and N1H···N7 (6.17) hydrogen (H) bonds, whereas the A·A*(syn) base mispair (Cs) by the N6H···N6 (8.82) and N7H···N1 (9.78) H-bonds and the C8H···HC2 HH-bond (0.30 kcal mol(-1)). Using the sweeps of the energies of the intermolecular H-bonds, it was observed that the N6H···N6 and N1H···N7/N7H···N1 H-bonds are anti-cooperative and mutually weaken each other in the A*·A(syn) and A·A*(syn) mispairs. It was revealed that the A·A*(syn) DNA mismatch is a dynamically unstable structure with a short lifetime of 1.12 × 10(-13) s and any of its 6 low-frequency intermolecular vibrations can develop during this period of time. This observation makes it impossible to change the tautomeric status of the A bases upon the dissociation of the A*·A(syn) base mispair into the monomers during DNA replication.

  14. Ultrafast deactivation processes in the 2-aminopyridine dimer and the adenine-thymine base pair: Similarities and differences

    SciTech Connect

    Ai Yuejie; Zhang Feng; Cui Ganglong; Fang Weihai; Luo Yi

    2010-08-14

    2-aminopyridine dimer has frequently been used as a model system for studying photochemistry of DNA base pairs. We examine here the relevance of 2-aminopyridine dimer for a Watson-Crick adenine-thymine base pair by studying UV-light induced photodynamics along two main hydrogen bridges after the excitation to the localized {sup 1}{pi}{pi}* excited-state. The respective two-dimensional potential-energy surfaces have been determined by time-dependent density functional theory with Coulomb-attenuated hybrid exchange-correlation functional (CAM-B3LYP). Different mechanistic aspects of the deactivation pathway have been analyzed and compared in detail for both systems, while the related reaction rates have also be obtained from Monte Carlo kinetic simulations. The limitations of the 2-aminopyridine dimer as a model system for the adenine-thymine base pair are discussed.

  15. Ultrafast deactivation processes in the 2-aminopyridine dimer and the adenine-thymine base pair: Similarities and differences

    NASA Astrophysics Data System (ADS)

    Ai, Yue-Jie; Zhang, Feng; Cui, Gang-Long; Luo, Yi; Fang, Wei-Hai

    2010-08-01

    2-aminopyridine dimer has frequently been used as a model system for studying photochemistry of DNA base pairs. We examine here the relevance of 2-aminopyridine dimer for a Watson-Crick adenine-thymine base pair by studying UV-light induced photodynamics along two main hydrogen bridges after the excitation to the localized π1π∗ excited-state. The respective two-dimensional potential-energy surfaces have been determined by time-dependent density functional theory with Coulomb-attenuated hybrid exchange-correlation functional (CAM-B3LYP). Different mechanistic aspects of the deactivation pathway have been analyzed and compared in detail for both systems, while the related reaction rates have also be obtained from Monte Carlo kinetic simulations. The limitations of the 2-aminopyridine dimer as a model system for the adenine-thymine base pair are discussed.

  16. Conformational analysis of a covalently cross-linked Watson-Crick base pair model.

    PubMed

    Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J

    2008-11-15

    Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

  17. Density Functional Study of the Influence of C5 Cytosine Substitution in Base Pairs with Guanine

    PubMed Central

    Moser, Adam; Guza, Rebecca; Tretyakova, Natalia; York, Darrin M.

    2009-01-01

    The present study employs density-functional electronic structure methods to investigate the effect of chemical modification at the C5 position of cytosine. A series of experimentally motivated chemical modifications are considered, including alkyl, halogen, aromatic, fused ring, and strong σ and π withdrawing functional groups. The effect of these modifications on cytosine geometry, electronic structure, proton affinities, gas phase basicities, cytosine-guanine base-pair hydrogen bond network and corresponding nucleophilicity at guanine are examined. Ultimately, these results play a part in dissecting the effect of endogenous cytosine methylation on the reactivity of neighboring guanine toward carcinogens and DNA alkylating agents. PMID:19890472

  18. A map of nucleosome positions in yeast at base-pair resolution.

    PubMed

    Brogaard, Kristin; Xi, Liqun; Wang, Ji-Ping; Widom, Jonathan

    2012-06-28

    The exact positions of nucleosomes along genomic DNA can influence many aspects of chromosome function. However, existing methods for mapping nucleosomes do not provide the necessary single-base-pair accuracy to determine these positions. Here we develop and apply a new approach for direct mapping of nucleosome centres on the basis of chemical modification of engineered histones. The resulting map locates nucleosome positions genome-wide in unprecedented detail and accuracy. It shows new aspects of the in vivo nucleosome organization that are linked to transcription factor binding, RNA polymerase pausing and the higher-order structure of the chromatin fibre.

  19. RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs

    NASA Astrophysics Data System (ADS)

    Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

    2017-02-01

    Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

  20. RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

    PubMed

    Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

    2017-02-01

    Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

  1. DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water

    SciTech Connect

    Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N.; Shulga, S.; Danilov, V. I.

    2016-02-01

    To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH{sub 2} group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH{sub 2} group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes.

  2. Café-au-lait macules and pediatric malignancy caused by biallelic mutations in the DNA mismatch repair (MMR) gene PMS2.

    PubMed

    Jackson, Carl-Christian; Holter, Spring; Pollett, Aaron; Clendenning, Mark; Chou, Shirley; Senter, Leigha; Ramphal, Raveena; Gallinger, Steven; Boycott, Kym

    2008-06-01

    A 14-year-old male presented with a T4 sigmoid adenocarcinoma, <10 colonic adenomas and multiple café-au-lait macules. Family history was not suggestive of a dominant hereditary form of colorectal cancer. Evaluation of the tumor revealed abnormal immunohistochemical staining of the PMS2 protein and high frequency microsatellite instability. Germline analysis identified biallelic PMS2 missense mutations. A new cancer syndrome caused by biallelic mutations in the mismatch repair genes, including PMS2, is now emerging and is characterized by café-au-lait macules, colonic polyps and a distinctive tumor spectrum.

  3. Configurations of base-pair complexes in solutions. [nucleotide chemistry

    NASA Technical Reports Server (NTRS)

    Egan, J. T.; Nir, S.; Rein, R.; Macelroy, R.

    1978-01-01

    A theoretical search for the most stable conformations (i.e., stacked or hydrogen bonded) of the base pairs A-U and G-C in water, CCl4, and CHCl3 solutions is presented. The calculations of free energies indicate a significant role of the solvent in determining the conformations of the base-pair complexes. The application of the continuum method yields preferred conformations in good agreement with experiment. Results of the calculations with this method emphasize the importance of both the electrostatic interactions between the two bases in a complex, and the dipolar interaction of the complex with the entire medium. In calculations with the solvation shell method, the last term, i.e., dipolar interaction of the complex with the entire medium, was added. With this modification the prediction of the solvation shell model agrees both with the continuum model and with experiment, i.e., in water the stacked conformation of the bases is preferred.

  4. On the deactivation mechanisms of adenine-thymine base pair.

    PubMed

    Gobbo, João Paulo; Saurí, Vicenta; Roca-Sanjuán, Daniel; Serrano-Andrés, Luis; Merchán, Manuela; Borin, Antonio Carlos

    2012-04-05

    In this contribution, the multiconfigurational second-order perturbation theory method based on a complete active space reference wave function (CASSCF/CASPT2) is applied to study all possible single and double proton/hydrogen transfers between the nucleobases in the adenine-thymine (AT) base pair, analyzing the role of excited states with different nature [localized (LE) and charge transfer (CT)], and considering concerted as well as step-wise mechanisms. According to the findings, once the lowest excited states, localized in adenine, are populated during UV irradiation of the Watson-Crick base pair, the proton transfer in the N-O bridge does not require high energy in order to populate a CT state. The latter state will immediately relax toward a crossing with the ground state, which will funnel the system to either the canonical structure or the imino-enol tautomer. The base pair is also capable of repairing itself easily since the imino-enol species is unstable to thermal conversion.

  5. A polymorphism in the MSH3 mismatch repair gene is associated with the levels of somatic instability of the expanded CTG repeat in the blood DNA of myotonic dystrophy type 1 patients.

    PubMed

    Morales, Fernando; Vásquez, Melissa; Santamaría, Carolina; Cuenca, Patricia; Corrales, Eyleen; Monckton, Darren G

    2016-04-01

    Somatic mosaicism of the expanded CTG repeat in myotonic dystrophy type 1 is age-dependent, tissue-specific and expansion-biased, contributing toward the tissue-specificity and progressive nature of the symptoms. Previously, using regression modelling of repeat instability we showed that variation in the rate of somatic expansion in blood DNA contributes toward variation in age of onset, directly implicating somatic expansion in the disease pathway. Here, we confirm these results using a larger more genetically homogenous Costa Rican DM1 cohort (p<0.001). Interestingly, we also provide evidence that supports subtle sex-dependent differences in repeat length-dependent age at onset and somatic mutational dynamics. Previously, we demonstrated that variation in the rate of somatic expansion was a heritable quantitative trait. Given the important role that DNA mismatch repair genes play in mediating expansions in mouse models, we tested for modifier gene effects with 13 DNA mismatch gene polymorphisms (one each in MSH2, PMS2, MSH6 and MLH1; and nine in MSH3). After correcting for allele length and age effects, we identified three polymorphisms in MSH3 that were associated with variation in somatic instability: Rs26279 (p=0.003); Rs1677658 (p=0.009); and Rs10168 (p=0.031). However, only the association with Rs26279 remained significant after multiple testing correction. Although we revealed a statistically significant association between Rs26279 and somatic instability, we did not detect an association with the age at onset. Individuals with the A/A genotype for Rs26279 tended to show a greater propensity to expand the CTG repeat than other genotypes. Interestingly, this SNP results in an amino acid change in the critical ATPase domain of MSH3 and is potentially functionally dimorphic. These data suggest that MSH3 is a key player in generating somatic variation in DM1 patients and further highlight MSH3 as a potential therapeutic target.

  6. Homologous and homeologous intermolecular gene conversion are not differentially affected by mutations in the DNA damage or the mismatch repair genes RAD1, RAD50, RAD51, RAD52, RAD54, PMS1 and MSH2

    SciTech Connect

    Porter, G.; Westmoreland, J.; Priebe, S.

    1996-06-01

    Mismatch repair (MMR) genes or genes involved in both DNA damage repair and homologous recombination might affect homeologous vs. homologous recombination differentially. Spontaneous mitotic gene conversion between a chromosome and a homologous or homeologous donor sequence (14% diverged) on a single copy plasmid was examined in wild-type Saccharomyces cerevisiae strains and in MMR or DNA damage repair mutants. Homologous recombination in rad51, rad52 and rad54 mutants was considerably reduced, while there was little effect of rad1, rad50, pms1 and msh2 null mutations. DNA divergence resulted in no differential effect on recombination rates in the wild type or the mutants; there was only a five- to 10-fold reduction in homeologous relative to homologous recombination regardless of background. Since DNA divergence is known to affect recombination in some systems, we propose that differences in the role of MMR depends on the mode of recombination and/or the level of divergence. Based on analysis of the recombination breakpoints, there is a minimum of three homologous bases required at a recombination junction. A comparison of Rad{sup +} vs. rad52 strains revealed that while all conversion tracts are continuous, elimination of RAD52 leads to the appearance of a novel class of very short conversion tracts. 67 refs., 5 figs., 4 tabs.

  7. Homologous and Homeologous Intermolecular Gene Conversion Are Not Differentially Affected by Mutations in the DNA Damage or the Mismatch Repair Genes Rad1, Rad50, Rad51, Rad52, Rad54, Pms1 and Msh2

    PubMed Central

    Porter, G.; Westmoreland, J.; Priebe, S.; Resnick, M. A.

    1996-01-01

    Mismatch repair (MMR) genes or genes involved in both DNA damage repair and homologous recombination might affect homeologous vs. homologous recombination differentially. Spontaneous mitotic gene conversion between a chromosome and a homologous or homeologous donor sequence (14% diverged) on a single copy plasmid was examined in wild-type Saccharomyces cerevisiae strains and in MMR or DNA damage repair mutants. Homologous recombination in rad51, rad52 and rad54 mutants was considerably reduced, while there was little effect of rad1, rad50, pms1 and msh2 null mutations. DNA divergence resulted in no differential effect on recombination rates in the wild type or the mutants; there was only a five- to 10-fold reduction in homeologous relative to homologous recombination regardless of background. Since DNA divergence is known to affect recombination in some systems, we propose that differences in the role of MMR depends on the mode of recombination and/or the level of divergence. Based on analysis of the recombination breakpoints, there is a minimum of three homologous bases required at a recombination junction. A comparison of Rad(+) vs. rad52 strains revealed that while all conversion tracts are continuous, elimination of RAD52 leads to the appearance of a novel class of very short conversion tracts. PMID:8725224

  8. Mismatch binding, ADP-ATP exchange and intramolecular signaling during mismatch repair

    PubMed Central

    Hingorani, Manju M.

    2015-01-01

    The focus of this article is on the DNA binding and ATPase activities of the mismatch repair (MMR) protein, MutS—our current understanding of how this protein uses ATP to fuel its actions on DNA and initiate repair via interactions with MutL, the next protein in the pathway. Structure-function and kinetic studies have yielded detailed views of the MutS mechanism of action in MMR. How MutS and MutL work together after mismatch recognition to enable strand-specific nicking, which leads to strand excision and synthesis, is less clear and remains an active area of investigation. PMID:26704427

  9. Nucleic acid unwinding by hepatitis C virus and bacteriophage t7 helicases is sensitive to base pair stability.

    PubMed

    Donmez, Ilker; Rajagopal, Vaishnavi; Jeong, Yong-Joo; Patel, Smita S

    2007-07-20

    Helicases are motor enzymes that convert the chemical energy of NTP hydrolysis into mechanical force for motion and nucleic acid strand separation. Within the cell, helicases process a range of nucleic acid sequences. It is not known whether this composite rate of moving and opening the strands of nucleic acids depends on the base sequence. Our presteady state kinetic studies of helicases from two classes, the ring-shaped T7 helicase and two forms of non-ring-shaped hepatitis C virus (HCV) helicase, show that both the unwinding rate and processivity depend on the sequence and decrease as the nucleic acid stability increases. The DNA unwinding activity of T7 helicase and the RNA unwinding activity of HCV helicases decrease steeply with increasing base pair stability. On the other hand, the DNA unwinding activity of HCV helicases is less sensitive to base pair stability. These results predict that helicases will fall into a spectrum of modest to high sensitivity to base pair stability depending on their biological role in the cell. Modeling of the dependence provided the degree of the active involvement of helicase in base pair destabilization during the unwinding process and distinguished between passive and active mechanisms of unwinding.

  10. Conditionally fluorescent molecular probes for detecting single base changes in double-stranded DNA.

    PubMed

    Chen, Sherry Xi; Zhang, David Yu; Seelig, Georg

    2013-09-01

    Small variations in nucleic acid sequences can have far-reaching phenotypic consequences. Reliably distinguishing closely related sequences is therefore important for research and clinical applications. Here, we demonstrate that conditionally fluorescent DNA probes are capable of distinguishing variations of a single base in a stretch of target DNA. These probes use a novel programmable mechanism in which each single nucleotide polymorphism generates two thermodynamically destabilizing mismatch bubbles rather than the single mismatch formed during typical hybridization-based assays. Up to a 12,000-fold excess of a target that contains a single nucleotide polymorphism is required to generate the same fluorescence as one equivalent of the intended target, and detection works reliably over a wide range of conditions. Using these probes we detected point mutations in a 198 base-pair subsequence of the Escherichia coli rpoB gene. That our probes are constructed from multiple oligonucleotides circumvents synthesis limitations and enables long continuous DNA sequences to be probed.

  11. Conditionally fluorescent molecular probes for detecting single base changes in double-stranded DNA

    NASA Astrophysics Data System (ADS)

    Chen, Sherry Xi; Zhang, David Yu; Seelig, Georg

    2013-09-01

    Small variations in nucleic acid sequences can have far-reaching phenotypic consequences. Reliably distinguishing closely related sequences is therefore important for research and clinical applications. Here, we demonstrate that conditionally fluorescent DNA probes are capable of distinguishing variations of a single base in a stretch of target DNA. These probes use a novel programmable mechanism in which each single nucleotide polymorphism generates two thermodynamically destabilizing mismatch bubbles rather than the single mismatch formed during typical hybridization-based assays. Up to a 12,000-fold excess of a target that contains a single nucleotide polymorphism is required to generate the same fluorescence as one equivalent of the intended target, and detection works reliably over a wide range of conditions. Using these probes we detected point mutations in a 198 base-pair subsequence of the Escherichia coli rpoB gene. That our probes are constructed from multiple oligonucleotides circumvents synthesis limitations and enables long continuous DNA sequences to be probed.

  12. Aberrant repair initiated by mismatch-specific thymine-DNA glycosylases provides a mechanism for the mutational bias observed in CpG islands

    PubMed Central

    Talhaoui, Ibtissam; Couve, Sophie; Gros, Laurent; Ishchenko, Alexander A.; Matkarimov, Bakhyt; Saparbaev, Murat K.

    2014-01-01

    The human thymine-DNA glycosylase (TDG) initiates the base excision repair (BER) pathway to remove spontaneous and induced DNA base damage. It was first biochemically characterized for its ability to remove T mispaired with G in CpG context. TDG is involved in the epigenetic regulation of gene expressions by protecting CpG-rich promoters from de novo DNA methylation. Here we demonstrate that TDG initiates aberrant repair by excising T when it is paired with a damaged adenine residue in DNA duplex. TDG targets the non-damaged DNA strand and efficiently excises T opposite of hypoxanthine (Hx), 1,N6-ethenoadenine, 7,8-dihydro-8-oxoadenine and abasic site in TpG/CpX context, where X is a modified residue. In vitro reconstitution of BER with duplex DNA containing Hx•T pair and TDG results in incorporation of cytosine across Hx. Furthermore, analysis of the mutation spectra inferred from single nucleotide polymorphisms in human population revealed a highly biased mutation pattern within CpG islands (CGIs), with enhanced mutation rate at CpA and TpG sites. These findings demonstrate that under experimental conditions used TDG catalyzes sequence context-dependent aberrant removal of thymine, which results in TpG, CpA→CpG mutations, thus providing a plausible mechanism for the putative evolutionary origin of the CGIs in mammalian genomes. PMID:24692658

  13. m1A and m1G Potently Disrupt A-RNA Structure Due to the Intrinsic Instability of Hoogsteen Base Pairs

    PubMed Central

    Zhou, Huiqing; Kimsey, Isaac J.; Nikolova, Evgenia N.; Sathyamoorthy, Bharathwaj; Grazioli, Gianmarc; McSally, James; Bai, Tianyu; Wunderlich, Christoph H.; Kreutz, Christoph; Andricioaei, Ioan; Al-Hashimi, Hashim M.

    2016-01-01

    The B-DNA double helix can dynamically accommodate G–C and A–T base pairs in either Watson-Crick or Hoogsteen configurations. Here, we show that G–C+ and A–U Hoogsteen base pairs are strongly disfavored in A-RNA. As a result, N1-methyl adenosine and N1-methyl guanosine, which occur in DNA as a form of alkylation damage, and in RNA as a posttranscriptional modification, have dramatically different consequences. They create G–C+ and A–U Hoogsteen base pairs in duplex DNA that maintain the structural integrity of the double helix, but block base pairing all together and induce local duplex melting in RNA, providing a mechanism for potently disrupting RNA structure through posttranscriptional modifications. The markedly different propensities to form Hoogsteen base pairs in B-DNA and A-RNA may help meet the opposing requirements of maintaining genome stability on one hand, and dynamically modulating the structure of the epitranscriptome on the other. PMID:27478929

  14. High Fidelity, Efficiency and Functionalization of Ds-Px Unnatural Base Pairs in PCR Amplification for a Genetic Alphabet Expansion System.

    PubMed

    Okamoto, Itaru; Miyatake, Yuya; Kimoto, Michiko; Hirao, Ichiro

    2016-11-18

    Genetic alphabet expansion of DNA using an artificial extra base pair (unnatural base pair) could augment nucleic acid and protein functionalities by increasing their components. We previously developed an unnatural base pair between 7-(2-thienyl)-imidazo[4,5-b]pyridine (Ds) and 2-nitro-4-propynylpyrrole (Px), which exhibits high fidelity as a third base pair in PCR amplification. Here, the fidelity and efficiency of Ds-Px pairing using modified Px bases with functional groups, such as diol, azide, ethynyl and biotin, were evaluated by an improved method with optimized PCR conditions. The results revealed that all of the base pairs between Ds and either one of the modified Px bases functioned with high amplification efficiency (0.76-0.81), high selectivity (≥99.96% per doubling), and less sequence dependency, in PCR using 3'-exonuclease-proficient Deep Vent DNA polymerase. We also demonstrated that the azide-Px in PCR-amplified DNA was efficiently modified with any functional groups by copper-free click reaction. This genetic alphabet expansion system could endow nucleic acids with a wide variety of increased functionalities by the site-specific incorporation of modified Px bases at desired positions in DNA.

  15. Mismatch repair genes of Streptococcus pneumoniae: HexA confers a mutator phenotype in Escherichia coli by negative complementation.

    PubMed

    Prudhomme, M; Méjean, V; Martin, B; Claverys, J P

    1991-11-01

    DNA repair systems able to correct base pair mismatches within newly replicated DNA or within heteroduplex molecules produced during recombination are widespread among living organisms. Evidence that such generalized mismatch repair systems evolved from a common ancestor is particularly strong for two of them, the Hex system of the gram-positive Streptococcus pneumoniae and the Mut system of the gram-negative Escherichia coli and Salmonella typhimurium. The homology existing between HexA and MutS and between HexB and MutL prompted us to investigate the effect of expressing hex genes in E. coli. Complementation of mutS or mutL mutations, which confer a mutator phenotype, was assayed by introducing on a multicopy plasmid the hexA and hexB genes, under the control of an inducible promoter, either individually or together in E. coli strains. No decrease in mutation rate was conferred by either hexA or hexB gene expression. However, a negative complementation effect was observed in wild-type E. coli cells: expression of hexA resulted in a typical Mut- mutator phenotype. hexB gene expression did not increase the mutation rate either individually or in conjunction with hexA. Since expression of hexA did not affect the mutation rate in mutS mutant cells and the hexA-induced mutator effect was recA independent, it is concluded that this effect results from inhibition of the Mut system. We suggest that HexA, like its homolog MutS, binds to mismatches resulting from replication errors, but in doing so it protects them from repair by the Mut system. In agreement with this hypothesis, an increase in mutS gene copy number abolished the hexA-induced mutator phenotype. HexA protein could prevent repair either by being unable to interact with Mut proteins or by producing nonfunctional repair complexes.

  16. A new general model for predicting melting thermodynamics of complementary and mismatched B-form duplexes containing locked nucleic acids: application to probe design for digital PCR detection of somatic mutations.

    PubMed

    Hughesman, Curtis; Fakhfakh, Kareem; Bidshahri, Roza; Lund, H Louise; Haynes, Charles

    2015-02-17

    Advances in real-time polymerase chain reaction (PCR), as well as the emergence of digital PCR (dPCR) and useful modified nucleotide chemistries, including locked nucleic acids (LNAs), have created the potential to improve and expand clinical applications of PCR through their ability to better quantify and differentiate amplification products, but fully realizing this potential will require robust methods for designing dual-labeled hydrolysis probes and predicting their hybridization thermodynamics as a function of their sequence, chemistry, and template complementarity. We present here a nearest-neighbor thermodynamic model that accurately predicts the melting thermodynamics of a short oligonucleotide duplexed either to its perfect complement or to a template containing mismatched base pairs. The model may be applied to pure-DNA duplexes or to duplexes for which one strand contains any number and pattern of LNA substitutions. Perturbations to duplex stability arising from mismatched DNA:DNA or LNA:DNA base pairs are treated at the Gibbs energy level to maintain statistical significance in the regressed model parameters. This approach, when combined with the model's accounting of the temperature dependencies of the melting enthalpy and entropy, permits accurate prediction of T(m) values for pure-DNA homoduplexes or LNA-substituted heteroduplexes containing one or two independent mismatched base pairs. Terms accounting for changes in solution conditions and terminal addition of fluorescent dyes and quenchers are then introduced so that the model may be used to accurately predict and thereby tailor the T(m) of a pure-DNA or LNA-substituted hydrolysis probe when duplexed either to its perfect-match template or to a template harboring a noncomplementary base. The model, which builds on classic nearest-neighbor thermodynamics, should therefore be of use to clinicians and biologists who require probes that distinguish and quantify two closely related alleles in either a

  17. Taxonomic challenges in freshwater fishes: a mismatch between morphology and DNA barcoding in fish of the north-eastern part of the Congo basin.

    PubMed

    Decru, Eva; Moelants, Tuur; De Gelas, Koen; Vreven, Emmanuel; Verheyen, Erik; Snoeks, Jos

    2016-01-01

    This study evaluates the utility of DNA barcoding to traditional morphology-based species identifications for the fish fauna of the north-eastern Congo basin. We compared DNA sequences (COI) of 821 samples from 206 morphologically identified species. Best match, best close match and all species barcoding analyses resulted in a rather low identification success of 87.5%, 84.5% and 64.1%, respectively. The ratio 'nearest-neighbour distance/maximum intraspecific divergence' was lower than 1 for 26.1% of the samples, indicating possible taxonomic problems. In ten genera, belonging to six families, the number of species inferred from mtDNA data exceeded the number of species identified using morphological features; and in four cases indications of possible synonymy were detected. Finally, the DNA barcodes confirmed previously known identification problems within certain genera of the Clariidae, Cyprinidae and Mormyridae. Our results underscore the large number of taxonomic problems lingering in the taxonomy of the fish fauna of the Congo basin and illustrate why DNA barcodes will contribute to future efforts to compile a reliable taxonomic inventory of the Congo basin fish fauna. Therefore, the obtained barcodes were deposited in the reference barcode library of the Barcode of Life Initiative.

  18. Imino proton NMR guides the reprogramming of A•T specific minor groove binders for mixed base pair recognition

    PubMed Central

    Harika, Narinder K.; Paul, Ananya; Stroeva, Ekaterina; Chai, Yun; Boykin, David W.; Germann, Markus W.; Wilson, W. David

    2016-01-01

    Sequence-specific binding to DNA is crucial for targeting transcription factor-DNA complexes to modulate gene expression. The heterocyclic diamidine, DB2277, specifically recognizes a single G•C base pair in the minor groove of mixed base pair sequences of the type AAAGTTT. NMR spectroscopy reveals the presence of major and minor species of the bound compound. To understand the principles that determine the binding affinity and orientation in mixed sequences of DNA, over thirty DNA hairpin substrates were examined by NMR and thermal melting. The NMR exchange dynamics between major and minor species shows that the exchange is much faster than compound dissociation determined from biosensor–surface plasmon resonance. Extensive modifications of DNA sequences resulted in a unique DNA sequence with binding site AAGATA that binds DB2277 in a single orientation. A molecular docking result agrees with the model representing rapid flipping of DB2277 between major and minor species. Imino spectral analysis of a 15N-labeled central G clearly shows the crucial role of the exocyclic amino group of G in sequence-specific recognition. Our results suggest that this approach can be expanded to additional modules for recognition of more sequence-specific DNA complexes. This approach provides substantial information about the sequence-specific, highly efficient, dynamic nature of minor groove binding agents. PMID:27131382

  19. Base pairing and structural insights into the 5-formylcytosine in RNA duplex

    PubMed Central

    Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia

    2016-01-01

    5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978

  20. Hypermutation in Burkholderia cepacia complex is mediated by DNA mismatch repair inactivation and is highly prevalent in cystic fibrosis chronic respiratory infection.

    PubMed

    Martina, Pablo; Feliziani, Sofía; Juan, Carlos; Bettiol, Marisa; Gatti, Blanca; Yantorno, Osvaldo; Smania, Andrea M; Oliver, Antonio; Bosch, Alejandra

    2014-11-01

    The Burkholderia cepacia complex (Bcc) represents an important group of pathogens involved in long-term lung infection in cystic fibrosis (CF) patients. A positive selection of hypermutators, linked to antimicrobial resistance development, has been previously reported for Pseudomonas aeruginosa in this chronic infection setting. Hypermutability, however, has not yet been systematically evaluated in Bcc species. A total of 125 well characterized Bcc isolates recovered from 48 CF patients, 10 non-CF patients and 15 environmental samples were analyzed. In order to determine the prevalence of mutators their spontaneous mutation rates to rifampicin resistance were determined. In addition, the genetic basis of the mutator phenotypes was investigated by sequencing the mutS and mutL genes, the main components of the mismatch repair system (MRS). The overall prevalence of hypermutators in the collection analyzed was 13.6%, with highest occurrence (40.7%) among the chronically infected CF patients, belonging mainly to B. cenocepacia, B. multivorans, B. cepacia, and B. contaminans -the most frequently recovered Bcc species from CF patients worldwide. Thirteen (76.5%) of the hypermutators were defective in mutS and/or mutL. Finally, searching for a possible association between antimicrobial resistance and hypermutability, the resistance-profiles to 17 antimicrobial agents was evaluated. High antimicrobial resistance rates were documented for all the Bcc species recovered from CF patients, but, except for ciprofloxacin, a significant association with hypermutation was not detected. In conclusion, in the present study we demonstrate for the first time that, MRS-deficient Bcc species mutators are highly prevalent and positively selected in CF chronic lung infections. Hypermutation therefore, might be playing a key role in increasing bacterial adaptability to the CF-airway environment, facilitating the persistence of chronic lung infections.

  1. Wobble↔Watson-Crick tautomeric transitions in the homo-purine DNA mismatches: a key to the intimate mechanisms of the spontaneous transversions.

    PubMed

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    The intrinsic capability of the homo-purine DNA base mispairs to perform wobble↔Watson-Crick/Topal-Fresco tautomeric transitions via the sequential intrapair double proton transfer was discovered for the first time using QM (MP2/DFT) and QTAIM methodologies that are crucial for understanding the microstructural mechanisms of the spontaneous transversions.

  2. Pyrimidine-pyrimidine base pairs stabilized by silver(I) ions.

    PubMed

    Urata, Hidehito; Yamaguchi, Eriko; Nakamura, Yasunari; Wada, Shun-ichi

    2011-01-21

    In the presence of Ag(I) ions, the C-T and m(5)iC (5-methylisocytosine)-T base pairs showed comparable stability to the C-Ag(I)-C base pair, and the m(5)iC-C base pair was highly stabilized by the synergetic effect of Ag(I) coordination and possible hydrogen bonding.

  3. Euler buckling and nonlinear kinking of double-stranded DNA

    NASA Astrophysics Data System (ADS)

    Fields, Alexander; Axelrod, Kevin; Cohen, Adam

    2012-02-01

    Bare double-stranded DNA is a stiff biopolymer with a persistence length of roughly 53 nm under physiological conditions. Cells and viruses employ extensive protein machinery to overcome this stiffness and bend, twist, and loop DNA to accomplish tasks such as packaging, recombination, gene regulation, and repair. The mechanical properties of DNA are of fundamental importance to the mechanism and thermodynamics of these processes, but physiologically relevant curvature has been difficult to access experimentally. We designed and synthesized a DNA hairpin construct in which base-pairing interactions generated a compressive force on a short segment of duplex DNA, inducing Euler buckling followed by bending to thermally inaccessible radii of curvature. The efficiency of F"orster resonance energy transfer (FRET) between two fluorophores covalently linked to the hairpin indicated the degree of buckling. Bulk and single-molecule measurements yielded distinctly different force-compression curves for intact DNA and for strands with single nicks, base pair mismatches, and damage sites. These results suggest that changes in local mechanical properties may play a significant role in the recognition of these features by DNA-binding proteins.

  4. Label-free DNA biosensor based on resistance change of platinum nanoparticles assemblies.

    PubMed

    Skotadis, Evangelos; Voutyras, Konstantinos; Chatzipetrou, Marianneza; Tsekenis, Georgios; Patsiouras, Lampros; Madianos, Leonidas; Chatzandroulis, Stavros; Zergioti, Ioanna; Tsoukalas, Dimitris

    2016-07-15

    A novel nanoparticle based biosensor for the fast and simple detection of DNA hybridization events is presented. The sensor utilizes hybridized DNA's charge transport properties, combining them with metallic nanoparticle networks that act as nano-gapped electrodes. The DNA hybridization events can be detected by a significant reduction in the sensor's resistance due to the conductive bridging offered by hybridized DNA. By modifying the nanoparticle surface coverage, which can be controlled experimentally being a function of deposition time, and the structural properties of the electrodes, an optimized biosensor for the in situ detection of DNA hybridization events is ultimately fabricated. The fabricated biosensor exhibits a wide response range, covering four orders of magnitude, a limit of detection of 1nM and can detect a single base pair mismatch between probe and complementary DNA.

  5. DNA Diagnostics: Nanotechnology-enhanced Electrochemical Detection of Nucleic Acids

    PubMed Central

    Wei, Fang; Lillehoj, Peter B.; Ho, Chih-Ming

    2010-01-01

    The detection of mismatched base pairs in DNA plays a crucial role in the diagnosis of genetic-related diseases and conditions, especially for early stage treatment. Among the various biosensors that have been employed for DNA detection, electrochemical sensors show great promise since they are capable of precise DNA recognition and efficient signal transduction. Advancements in micro- and nanotechnologies, specifically fabrication techniques and new nanomaterials, have enabled for the development of highly sensitive, highly specific sensors making them attractive for the detection of small sequence variations. Furthermore, the integration of sensors with sample preparation and fluidic processes enables for rapid, multiplexed DNA detection for point-of-care (POC) clinical diagnostics. PMID:20075759

  6. Structure and Stability of Individual DNA or RNA Hairpin Molecules Captured in an Ion Channel

    NASA Astrophysics Data System (ADS)

    Akeson, Mark

    2002-03-01

    Nanoscale pores can be used to analyze individual DNA or RNA molecules. For example, a prototype device based on the alpha-hemolysin protein permits serial examination of hundreds to thousands of molecules per minute. It is routinely used to identify individual polynucleotide homopolymers, and to read segments within single DNA or RNA block copolymers as they thread through a narrow, trans-membrane pore formed by the protein (1.5 nm limiting aperture). In recent reports, we have shown that this device can also be used to examine structural details of individual DNA or RNA hairpins at single base-pair precision. This is achieved by capturing each hairpin in a vestibule of the channel leading to the trans-membrane pore. Under a 120 mV applied voltage, ionic current through the channel is gated by the RNA or DNA hairpin as it is perched in the vestibule, resulting in a dynamic current pattern that is exquisitely sensitive to sequence identity. In this presentation, I will explain the ion channel device and then describe structural details of the hairpin molecules that can be resolved by the instrument. These include: i) Watson-Crick base-pair identity at the hairpin stem terminus; ii) duplex fraying caused by single base pair mismatches internal to the hairpin stem; and iii) A form (RNA) versus B form (DNA) helix conformation. I will then discuss alternative mechanisms that can account for the discrete gating patterns that underlie the analysis.

  7. Efficient Deactivation of a Model Base Pair via Excited-State Hydrogen Transfer

    NASA Astrophysics Data System (ADS)

    Schultz, Thomas; Samoylova, Elena; Radloff, Wolfgang; Hertel, Ingolf V.; Sobolewski, Andrzej L.; Domcke, Wolfgang

    2004-12-01

    We present experimental and theoretical evidence for an excited-state deactivation mechanism specific to hydrogen-bonded aromatic dimers, which may account, in part, for the photostability of the Watson-Crick base pairs in DNA. Femtosecond time-resolved mass spectroscopy of 2-aminopyridine clusters reveals an excited-state lifetime of 65 +/- 10 picoseconds for the near-planar hydrogen-bonded dimer, which is significantly shorter than the lifetime of either the monomer or the 3- and 4-membered nonplanar clusters. Ab initio calculations of reaction pathways and potential-energy profiles identify the mechanism of the enhanced excited-state decay of the dimer: Conical intersections connect the locally excited 1ππ* state and the electronic ground state with a 1ππ* charge-transfer state that is strongly stabilized by the transfer of a proton.

  8. Mismatch repair proteins: key regulators of genetic recombination.

    PubMed

    Surtees, J A; Argueso, J L; Alani, E

    2004-01-01

    Mismatch repair (MMR) systems are central to maintaining genome stability in prokaryotes and eukaryotes. MMR proteins play a fundamental role in avoiding mutations, primarily by removing misincorporation errors that occur during DNA replication. MMR proteins also act during genetic recombination in steps that include repairing mismatches in heteroduplex DNA, modulating meiotic crossover control, removing 3' non-homologous tails during double-strand break repair, and preventing recombination between divergent sequences. In this review we will, first, discuss roles for MMR proteins in repairing mismatches that occur during recombination, particularly during meiosis. We will also explore how studying this process has helped to refine models of double-strand break repair, and particularly to our understanding of gene conversion gradients. Second, we will examine the role of MMR proteins in repressing homeologous recombination, i.e. recombination between divergent sequences. We will also compare the requirements for MMR proteins in preventing homeologous recombination to the requirements for these proteins in mismatch repair.

  9. Construction and Application of a Rh–Pt DNA Metalloinsertor Conjugate

    PubMed Central

    2015-01-01

    We report the synthesis and characterization of a bimetallic conjugate (RhPt) in which an oxaliplatin derivative is tethered to a rhodium metalloinsertor through an aminomalonate leaving group ligand. The complex interacts with DNA through metalloinsertion at a base pair mismatch followed by formation of a covalent Pt–DNA adduct. Characterization of RhPt in mismatch repair-deficient HCT116O cells reveals increased cytotoxicity compared to cisplatin and oxaliplatin as well as relative to the unconjugated rhodium and platinum counterparts. Caspase and poly-ADP ribose polymerase inhibition assays indicate that RhPt induces apoptotic cell death. Inductively coupled plasma mass spectrometry (ICP-MS) experiments reveal that RhPt exhibits enhanced cellular uptake properties that contribute to its increased efficacy. PMID:25032512

  10. Conformational determinants of tandem GU mismatches in RNA: insights from molecular dynamics simulations and quantum mechanical calculations.

    PubMed

    Pan, Yongping; Priyakumar, U Deva; MacKerell, Alexander D

    2005-02-08

    Structure and energetic properties of base pair mismatches in duplex RNA have been the focus of numerous investigations due to their role in many important biological functions. Such efforts have contributed to the development of models for secondary structure prediction of RNA, including the nearest-neighbor model. In RNA duplexes containing GU mismatches, 5'-GU-3' tandem mismatches have a different thermodynamic stability than 5'-UG-3' mismatches. In addition, 5'-GU-3' mismatches in some sequence contexts do not follow the nearest-neighbor model for stability. To characterize the underlying atomic forces that determine the structural and thermodynamic properties of GU tandem mismatches, molecular dynamics (MD) simulations were performed on a series of 5'-GU-3' and 5'-UG-3' duplexes in different sequence contexts. Overall, the MD-derived structural models agree well with experimental data, including local deviations in base step helicoidal parameters in the region of the GU mismatches and the model where duplex stability is associated with the pattern of GU hydrogen bonding. Further analysis of the simulations, validated by data from quantum mechanical calculations, suggests that the experimentally observed differences in thermodynamic stability are dominated by GG interstrand followed by GU intrastrand base stacking interactions that dictate the one versus two hydrogen bonding scenarios for the GU pairs. In addition, the inability of 5'-GU-3' mismatches in different sequence contexts to all fit into the nearest-neighbor model is indicated to be associated with interactions of the central four base pairs with the surrounding base pairs. The results emphasize the role of GG and GU stacking interactions on the structure and thermodynamics of GU mismatches in RNA.

  11. Structure, stability and function of 5-chlorouracil modified A:U and G:U base pairs

    SciTech Connect

    Patra, Amritraj; Harp, Joel; Pallan, Pradeep S.; Zhao, Linlin; Abramov, Mikhail; Herdewijn, Piet; Egli, Martin

    2012-12-28

    The thymine analog 5-chlorouridine, first reported in the 1950s as anti-tumor agent, is known as an effective mutagen, clastogen and toxicant as well as an effective inducer of sister-chromatid exchange. Recently, the first microorganism with a chemically different genome was reported; the selected Escherichia coli strain relies on the four building blocks 5-chloro-2'-deoxyuridine (ClU), A, C and G instead of the standard T, A, C, G alphabet [Marlière,P., Patrouix,J., Döring,V., Herdewijn,P., Tricot,S., Cruveiller,S., Bouzon,M. and Mutzel,R. (2011) Chemical evolution of a bacterium’s genome. Angew. Chem. Int. Ed., 50, 7109–7114]. The residual fraction of T in the DNA of adapted bacteria was <2% and the switch from T to ClU was accompanied by a massive number of mutations, including >1500 A to G or G to A transitions in a culture. The former is most likely due to wobble base pairing between ClU and G, which may be more common for ClU than T. To identify potential changes in the geometries of base pairs and duplexes as a result of replacement of T by ClU, we determined four crystal structures of a B-form DNA dodecamer duplex containing ClU:A or ClU:G base pairs. The structures reveal nearly identical geometries of these pairs compared with T:A or T:G, respectively, and no consequences for stability and cleavage by an endonuclease (EcoRI). The lack of significant changes in the geometry of ClU:A and ClU:G base pairs relative to the corresponding native pairs is consistent with the sustained unlimited self-reproduction of E. coli strains with virtually complete T→ClU genome substitution.

  12. Tunnel Conductance of Watson-Crick Nucleoside-Base Pairs from Telegraph Noise

    PubMed Central

    Chang, Shuai; He, Jin; Lin, Lisha; Zhang, Peiming; Liang, Feng; Young, Michael; Huang, Shuo; Lindsay, Stuart

    2009-01-01

    The use of tunneling signals to sequence DNA is presently hampered by the small tunnel conductance of a junction spanning an entire DNA molecule. The design of a readout system that uses a shorter tunneling path requires knowledge of the absolute conductance across base-pairs. We have exploited the stochastic switching of hydrogen-bonded DNA base-nucleoside pairs trapped in a tunnel junction to determine the conductance of individual molecular pairs. This conductance is found to be sensitive to the geometry of the junction, but a subset of the data appears to come from unstrained molecular pairs. The conductances determined from these pairs are within a factor two of the predictions of density functional calculations. The experimental data reproduces the counterintuitive theoretical prediction that guanine-deoxycytidine pairs (3 H-bonds) have a smaller conductance than adenine-thymine pairs (2 H-bonds). A bimodal distribution of switching lifetimes shows that both H-bonds and molecule-metal contacts break. PMID:19420603

  13. Tunnel conductance of Watson-Crick nucleoside-base pairs from telegraph noise

    NASA Astrophysics Data System (ADS)

    Chang, Shuai; He, Jin; Lin, Lisha; Zhang, Peiming; Liang, Feng; Young, Michael; Huang, Shuo; Lindsay, Stuart

    2009-05-01

    The use of tunneling signals to sequence DNA is presently hampered by the small tunnel conductance of a junction spanning an entire DNA molecule. The design of a readout system that uses a shorter tunneling path requires knowledge of the absolute conductance across base pairs. We have exploited the stochastic switching of hydrogen-bonded DNA base-nucleoside pairs trapped in a tunnel junction to determine the conductance of individual molecular pairs. This conductance is found to be sensitive to the geometry of the junction, but a subset of the data appears to come from unstrained molecular pairs. The conductances determined from these pairs are within a factor of two of the predictions of density functional calculations. The experimental data reproduces the counterintuitive theoretical prediction that guanine-deoxycytidine pairs (3 H-bonds) have a smaller conductance than adenine-thymine pairs (2 H-bonds). A bimodal distribution of switching lifetimes shows that both H-bonds and molecule-metal contacts break.

  14. Real-time observation of DNA recognition and rejection by the RNA-guided endonuclease Cas9

    PubMed Central

    Singh, Digvijay; Sternberg, Samuel H.; Fei, Jingyi; Doudna, Jennifer A.; Ha, Taekjip

    2016-01-01

    Binding specificity of Cas9–guide RNA complexes to DNA is important for genome-engineering applications; however, how mismatches influence target recognition/rejection kinetics is not well understood. Here we used single-molecule FRET to probe real-time interactions between Cas9–RNA and DNA targets. The bimolecular association rate is only weakly dependent on sequence; however, the dissociation rate greatly increases from <0.006 s−1 to >2 s−1 upon introduction of mismatches proximal to protospacer-adjacent motif (PAM), demonstrating that mismatches encountered early during heteroduplex formation induce rapid rejection of off-target DNA. In contrast, PAM-distal mismatches up to 11 base pairs in length, which prevent DNA cleavage, still allow formation of a stable complex (dissociation rate <0.006 s−1), suggesting that extremely slow rejection could sequester Cas9–RNA, increasing the Cas9 expression level necessary for genome-editing, thereby aggravating off-target effects. We also observed at least two different bound FRET states that may represent distinct steps in target search and proofreading. PMID:27624851

  15. Weakened N3 Hydrogen Bonding by 5-Formylcytosine and 5-Carboxylcytosine Reduces Their Base-Pairing Stability.

    PubMed

    Dai, Qing; Sanstead, Paul J; Peng, Chunte Sam; Han, Dali; He, Chuan; Tokmakoff, Andrei

    2016-02-19

    In the active cytosine demethylation pathway, 5-methylcytosine (5mC) is oxidized sequentially to 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC). Thymine DNA glycosylase (TDG) selectively excises 5fC and 5caC but not cytosine (C), 5mC, and 5hmC. We propose that the electron-withdrawing properties of -CHO and -COOH in 5fC and 5caC increase N3 acidity, leading to weakened hydrogen bonding and reduced base pair stability relative to C, 5mC, and 5hmC, thereby facilitating the selective recognition of 5fC and 5caC by TDG. Through (13)C NMR, we measured the pKa at N3 of 5fC as 2.4 and the two pKa's of 5caC as 2.1 and 4.2. We used isotope-edited IR spectroscopy coupled with density functional theory (DFT) calculations to site-specifically assign the more acidic pKa of 5caC to protonation at N3, indicating that N3 acidity is increased in 5fC and 5caC relative to C. IR and UV melting studies of self-complementary DNA oligomers confirm reduced stability for 5fC-G and 5caC-G base pairs. Furthermore, while the 5fC-G base pair stability is insensitive to pH, the 5caC-G stability is reduced as pH decreases and the carboxyl group is increasingly protonated. Despite suggestions that 5fC and 5caC may exist in rare tautomeric structures which form wobble GC base pairs, our two-dimensional infrared (2D IR) spectroscopy of 5fC and 5caC free nucleosides confirms that both bases are predominantly in the canonical amino-keto form. Taken together, these findings support our model that weakened base pairing ability for 5fC and 5caC in dsDNA contributes to their selective recognition by TDG.

  16. Mutagenic effects induced by the attack of NO2 radical to the guanine-cytosine base pair

    PubMed Central

    Cerón-Carrasco, José P.; Requena, Alberto; Zúñiga, José; Jacquemin, Denis

    2015-01-01

    We investigate the attack of the nitrogen dioxide radical (NO•2) to the guanine—cytosine (GC) base pair and the subsequent tautomeric reactions able to induce mutations, by means of density functional theory (DFT) calculations. The conducted simulations allow us to identify the most reactive sites of the GC base pair. Indeed, the computed relative energies demonstrate that the addition of the NO•2 radical to the C8 position of the guanine base forms to the most stable adduct. Although the initial adducts might evolve to non-canonical structures via inter-base hydrogen bonds rearrangements, the probability for the proton exchange to occur lies in the same range as that observed for undamaged DNA. As a result, tautomeric errors in NO2-attacked DNA arises at the same rate as in canonical DNA, with no macroscopic impact on the overall stability of DNA. The potential mutagenic effects of the GC–NO•2 radical adducts likely involve side reactions, e.g., the GC deprotonation to the solvent, rather than proton exchange between guanine and cytosine basis. PMID:25798437

  17. Comparative melting and healing of B-DNA and Z-DNA by an infrared laser pulse

    NASA Astrophysics Data System (ADS)

    Man, Viet Hoang; Pan, Feng; Sagui, Celeste; Roland, Christopher

    2016-04-01

    We explore the use of a fast laser melting simulation approach combined with atomistic molecular dynamics simulations in order to determine the melting and healing responses of B-DNA and Z-DNA dodecamers with the same d(5'-CGCGCGCGCGCG-3')2 sequence. The frequency of the laser pulse is specifically tuned to disrupt Watson-Crick hydrogen bonds, thus inducing melting of the DNA duplexes. Subsequently, the structures relax and partially refold, depending on the field strength. In addition to the inherent interest of the nonequilibrium melting process, we propose that fast melting by an infrared laser pulse could be used as a technique for a fast comparison of relative stabilities of same-sequence oligonucleotides with different secondary structures with full atomistic detail of the structures and solvent. This could be particularly useful for nonstandard secondary structures involving non-canonical base pairs, mismatches, etc.

  18. Non-specificity and synergy at the binding site of the carboplatin-induced DNA adduct via molecular dynamics simulations of the MutSα-DNA recognition complex

    PubMed Central

    Negureanu, Lacramioara; Salsbury, Freddie R

    2013-01-01

    MutSα is the most abundant mismatch binding factor of human DNA mismatch repair (MMR) proteins. MMR maintain genetic stability by recognizing and repairing DNA defects. Failure to accomplish their function may lead to cancer. In addition, MutSα recognizes at least some types of DNA damage making it a target for anticancer agents. Here, complementing scarce experimental data, we report unique hydrogen bonding motifs associated with the recognition of the carboplatin induced DNA damage by MutSα. These data predict that carboplatin and cisplatin induced damaging DNA adducts are recognized by MutSα in a similar manner. Our simulations also indicate that loss of base pairing at the damage site results in (1) non-specific binding and (2) changes in the atomic flexibility at the lesion site and beyond. To further quantify alterations at MutSα-DNA interface in response to damage recognition non-bonding interactions and salt bridges were investigated. These data indicate (1) possible different packing and (2) disruption of the salt bridges at the MutSα-DNA interface in the damaged complex. These findings (1) underscore the general observation of disruptions at the MutSα-DNA interface and (2) highlight the nature of the anticancer effect of the carboplatin agent. The analysis was carried out from atomistic simulations. PMID:23799640

  19. High levels of transcription stimulate transversions at GC base pairs in yeast.

    PubMed

    Alexander, Matthew P; Begins, Kaitlyn J; Crall, William C; Holmes, Margaret P; Lippert, Malcolm J

    2013-01-01

    High-levels of transcription through a gene stimulate spontaneous mutation rate, a phenomenon termed transcription-associated mutation (TAM). While transcriptional effects on specific mutation classes have been identified using forward mutation and frameshift-reversion assays, little is yet known about transcription-associated base substitutions in yeast. To address this issue, we developed a new base substitution reversion assay (the lys2-TAG allele). We report a 22-fold increase in overall reversion rate in the high- relative to the low-transcription strain (from 2.1- to 47- × 10(-9) ). While all detectable base substitution types increased in the high-transcription strain, G→T and G→C transversions increased disproportionately by 58- and 52-fold, respectively. To assess a potential role of DNA damage in the TAM events, we measured mutation rates and spectra in individual strains defective in the repair of specific DNA lesions or null for the error-prone translesion DNA polymerase zeta (Pol zeta). Results exclude a role of 8-oxoGuanine, general oxidative damage, or apurinic/apyrimidinic sites in the generation of TAM G→T and G→C transversions. In contrast, the TAM transversions at GC base pairs depend on Pol zeta for occurrence implicating DNA damage, other than oxidative lesions or AP sites, in the TAM mechanism. Results further indicate that transcription-dependent G→T transversions in yeast differ mechanistically from equivalent events in E. coli reported by others. Given their occurrences in repair-proficient cells, transcription-associated G→T and G→C events represent a novel type of transcription-associated mutagenesis in normal cells with potentially important implications for evolution and genetic disease.

  20. Repetitive DNA in three Gramineae species with low DNA content.

    PubMed

    Deshpande, V G; Ranjekar, P K

    1980-08-01

    The genomes of three Gramineae species, namely finger millet (Eleusine coracana), pearl millet (Pennisetum americanum) and rice (Oryza sativa) are characterized by studying their DNA denaturation-reassociation properties. The reassociation kinetics measurement of the sonicated DNA (500--700 nucleotide pairs) indicate the presence of a heterogeneous, repetitive DNA fraction accounting for 49--54% of the total DNA in all three species. From the cot 1/2 value of the slow reassociating DNA, the genome size is estimated as 3.0 X 10(8) np in finger millet, 7.8 X 10(8) np in pearl millet and 9.0 X 10(8) np in rice. The melting patterns of the total DNAs reveal Tm value of 88.6 degrees C in the case of pearl millet and 85.0 degrees C in the case of finger millet and rice. Total repetitive and cot 1.0 DNA fractions in all the three species are isolated and their melting properties are compared with those of respective sonicated DNAs. In finger millet, the Tm values of cot 25 and cot 1 fractions are lower by 10.8 degrees C and 12.8 degrees C, respectively, than that of sonicated DNA and thus exhibit the presence of a base pair mismatch in the range of 10.8--12.8%. In rice, the Tm values of the fractions cot 50 and cot 1 are slightly lower than that of sonicated DNA and reveal a nucleotide mismatching of only 1.8--3.8%. In the case of pearl millet cot 10 DNA fraction a high-melting DNA component (Tm = 92 degrees C) representing 12% of the total cot 10 DNA and a low-melting component with a Tm of 78 degrees C are present. In cot 1 DNA fraction of pearl millet the proportion of the high-melting component is 35% and it has a Tm or 94.8 degrees C. Optical reassociation studies of cot 1.0 DNA fractions have revealed the presence of two kinetically distinct components, namely minor fast-reassociating and major slow-reassociating, having complexities in the range of 330--390 np and 1.28 X 10(5)--6.0 X 10(5) np, respectively in pearl millet and rice and only one DNA fraction with an

  1. Ligation reaction specificities of an NAD(+)-dependent DNA ligase from the hyperthermophile Aquifex aeolicus.

    PubMed

    Tong, J; Barany, F; Cao, W

    2000-03-15

    An NAD(+)-dependent DNA ligase from the hyperthermophilic bacterium Aquifex aeolicus was cloned, expressed in Escherichia coli and purified to homogeneity. The enzyme is most active in slightly alkaline pH conditions with either Mg(2+)or Mn(2+)as the metal cofactor. Ca(2+)and Ni(2+)mainly support formation of DNA-adenylate intermediates. The catalytic cycle is characterized by a low k (cat)value of 2 min(-1)with concomitant accumulation of the DNA - adenylate intermediate when Mg(2+)is used as the metal cofactor. The ligation rates of matched substrates vary by up to 4-fold, but exhibit a general trend of T/A < or = G/C < C/G < A/T on both the 3'- and 5'-side of the nick. Consistent with previous studies on Thermus ligases, this Aquifex ligase exhibits greater discrimination against a mismatched base pair on the 3'-side of the nick junction. The requirement of 3' complementarity for a ligation reaction is reaffirmed by results from 1 nt insertions on either the 3'- or 5'-side of the nick. Furthermore, most of the unligatable 3' mismatched base pairs prohibit formation of the DNA-adenylate intermediate, indicating that the substrate adenylation step is also a control point for ligation fidelity. Unlike previously studied ATP ligases, gapped substrates cannot be ligated and intermediate accumulation is minimal, suggesting that complete elimination of base pair complementarity on one side of the nick affects substrate adenylation on the 5'-side of the nick junction. Relationships among metal cofactors, ligation products and intermediate, and ligation fidelity are discussed.

  2. Structural landscape of base pairs containing post-transcriptional modifications in RNA.

    PubMed

    Seelam, Preethi P; Sharma, Purshotam; Mitra, Abhijit

    2017-03-24

    Base pairs involving post-transcriptionally modified nucleobases are believed to play important roles in a wide variety of functional RNAs. Here we present our attempts towards understanding the structural and functional role of naturally occurring modified base pairs using a combination of X-ray crystal structure database analysis, sequence analysis, and advanced quantum chemical methods. Our bioinformatics analysis reveals that despite their presence in all major secondary structural elements, modified base pairs are most prevalent in tRNA crystal structures, and most commonly involve guanine or uridine modifications. Further, analysis of tRNA sequences reveals additional examples of modified base pairs at structurally conserved tRNA regions, and highlights the conservation patterns of these base pairs in three domains of life. Comparison of structures and binding energies of modified base pairs with their unmodified counterparts, using quantum chemical methods, allowed us to classify the base modifications in terms of the nature of their electronic structure effects on base pairing. Analysis of specific structural contexts of modified base pairs in RNA crystal structures revealed several interesting scenarios, including those at the tRNA:rRNA interface, antibiotic-binding sites on the ribosome, and the three-way junctions within tRNA. These scenarios, when analyzed in the context of available experimental data, allowed us to correlate the occurrence and strength of modified base pairs with their specific functional roles. Overall, our study highlights the structural importance of modified base pairs in RNA, and points toward the need for greater appreciation of the role of modified bases and their interactions, in the context of many biological processes involving RNA.

  3. Labeling-free fluorescent detection of DNA hybridization through FRET from pyrene excimer to DNA intercalator SYBR green I.

    PubMed

    Zhou, Ruyi; Xu, Chen; Dong, Jie; Wang, Guojie

    2015-03-15

    A novel labeling-free fluorescence complex probe has been developed for DNA hybridization detection based on fluorescence resonance energy transfer (FRET) mechanism from pyrene excimer of pyrene-functionalized poly [2-(N, N-dimethylamino) ethyl methacrylate] (PFP) to SYBR Green I (SG, a specific intercalator of double-stranded DNA) in a cost-effective, rapid and simple manner. The complex probe consists of the positively charged PFP, SG and negatively charged single-stranded DNA (ssDNA). Upon adding a complementary strand to the complex probe solution, double-stranded DNA (dsDNA) was formed, followed by the intercalation of SG into dsDNA. The pyrene excimer emission was overlapped with the absorption of SG very well and the electrostatic interactions between PFP and dsDNA kept them in close proximity, enabling efficient FRET from pyrene excimer to SG. The fluorescence of SG in the duplex DNA resulting from FRET can be successfully applied to detect DNA hybridization with high sensitivity for a very low detection limit of 10nM and excellent selectivity for detection of single base pair mismatch.

  4. Heterochromatin base pair composition and diversification in holocentric chromosomes of kissing bugs (Hemiptera, Reduviidae).

    PubMed

    Bardella, Vanessa Bellini; Pita, Sebastián; Vanzela, André Luis Laforga; Galvão, Cleber; Panzera, Francisco

    2016-10-01

    The subfamily Triatominae (Hemiptera, Reduviidae) includes 150 species of blood-sucking insects, vectors of Chagas disease or American trypanosomiasis. Karyotypic information reveals a striking stability in the number of autosomes. However, this group shows substantial variability in genome size, the amount and distribution of C-heterochromatin, and the chromosome positions of 45S rDNA clusters. Here, we analysed the karyotypes of 41 species from six different genera with C-fluorescence banding in order to evaluate the base-pair richness of heterochromatic regions. Our results show a high heterogeneity in the fluorescent staining of the heterochromatin in both autosomes and sex chromosomes, never reported before within an insect subfamily with holocentric chromosomes. This technique allows a clear discrimination of the heterochromatic regions classified as similar by C-banding, constituting a new chromosome marker with taxonomic and evolutionary significance. The diverse fluorescent patterns are likely due to the amplification of different repeated sequences, reflecting an unusual dynamic rearrangement in the genomes of this subfamily. Further, we discuss the evolution of these repeated sequences in both autosomes and sex chromosomes in species of Triatominae.

  5. Heterochromatin base pair composition and diversification in holocentric chromosomes of kissing bugs (Hemiptera, Reduviidae)

    PubMed Central

    Bardella, Vanessa Bellini; Pita, Sebastián; Vanzela, André Luis Laforga; Galvão, Cleber; Panzera, Francisco

    2016-01-01

    The subfamily Triatominae (Hemiptera, Reduviidae) includes 150 species of blood-sucking insects, vectors of Chagas disease or American trypanosomiasis. Karyotypic information reveals a striking stability in the number of autosomes. However, this group shows substantial variability in genome size, the amount and distribution of C-heterochromatin, and the chromosome positions of 45S rDNA clusters. Here, we analysed the karyotypes of 41 species from six different genera with C-fluorescence banding in order to evaluate the base-pair richness of heterochromatic regions. Our results show a high heterogeneity in the fluorescent staining of the heterochromatin in both autosomes and sex chromosomes, never reported before within an insect subfamily with holocentric chromosomes. This technique allows a clear discrimination of the heterochromatic regions classified as similar by C-banding, constituting a new chromosome marker with taxonomic and evolutionary significance. The diverse fluorescent patterns are likely due to the amplification of different repeated sequences, reflecting an unusual dynamic rearrangement in the genomes of this subfamily. Further, we discuss the evolution of these repeated sequences in both autosomes and sex chromosomes in species of Triatominae. PMID:27759763

  6. Light-emitting self-assembled peptide nucleic acids exhibit both stacking interactions and Watson-Crick base pairing.

    PubMed

    Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud

    2015-04-01

    The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.

  7. Light-emitting self-assembled peptide nucleic acids exhibit both stacking interactions and Watson-Crick base pairing

    NASA Astrophysics Data System (ADS)

    Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V. Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J. W.; Patolsky, Fernando; Gazit, Ehud

    2015-05-01

    The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs—CG, GC and GG—could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.

  8. Avalanching mutations in biallelic mismatch repair deficiency syndrome.

    PubMed

    Waterfall, Joshua J; Meltzer, Paul S

    2015-03-01

    Tumors from pediatric patients generally contain relatively few somatic mutations. A new study reports a striking exception in individuals in whom biallelic germline deficiency for mismatch repair is compounded by somatic loss of function in DNA proofreading polymerases, resulting in 'ultra-hypermutated' malignant brain tumors.

  9. A dynamic bead-based microarray for parallel DNA detection

    NASA Astrophysics Data System (ADS)

    Sochol, R. D.; Casavant, B. P.; Dueck, M. E.; Lee, L. P.; Lin, L.

    2011-05-01

    A microfluidic system has been designed and constructed by means of micromachining processes to integrate both microfluidic mixing of mobile microbeads and hydrodynamic microbead arraying capabilities on a single chip to simultaneously detect multiple bio-molecules. The prototype system has four parallel reaction chambers, which include microchannels of 18 × 50 µm2 cross-sectional area and a microfluidic mixing section of 22 cm length. Parallel detection of multiple DNA oligonucleotide sequences was achieved via molecular beacon probes immobilized on polystyrene microbeads of 16 µm diameter. Experimental results show quantitative detection of three distinct DNA oligonucleotide sequences from the Hepatitis C viral (HCV) genome with single base-pair mismatch specificity. Our dynamic bead-based microarray offers an effective microfluidic platform to increase parallelization of reactions and improve microbead handling for various biological applications, including bio-molecule detection, medical diagnostics and drug screening.

  10. Convergent Transmission of RNAi Guide-Target Mismatch Information across Argonaute Internal Allosteric Network

    PubMed Central

    Joseph, Thomas T.; Osman, Roman

    2012-01-01

    In RNA interference, a guide strand derived from a short dsRNA such as a microRNA (miRNA) is loaded into Argonaute, the central protein in the RNA Induced Silencing Complex (RISC) that silences messenger RNAs on a sequence-specific basis. The positions of any mismatched base pairs in an miRNA determine which Argonaute subtype is used. Subsequently, the Argonaute-guide complex binds and silences complementary target mRNAs; certain Argonautes cleave the target. Mismatches between guide strand and the target mRNA decrease cleavage efficiency. Thus, loading and silencing both require that signals about the presence of a mismatched base pair are communicated from the mismatch site to effector sites. These effector sites include the active site, to prevent target cleavage; the binding groove, to modify nucleic acid binding affinity; and surface allosteric sites, to control recruitment of additional proteins to form the RISC. To examine how such signals may be propagated, we analyzed the network of internal allosteric pathways in Argonaute exhibited through correlations of residue-residue interactions. The emerging network can be described as a set of pathways emanating from the core of the protein near the active site, distributed into the bulk of the protein, and converging upon a distributed cluster of surface residues. Nucleotides in the guide strand “seed region” have a stronger relationship with the protein than other nucleotides, concordant with their importance in sequence selectivity. Finally, any of several seed region guide-target mismatches cause certain Argonaute residues to have modified correlations with the rest of the protein. This arises from the aggregation of relatively small interaction correlation changes distributed across a large subset of residues. These residues are in effector sites: the active site, binding groove, and surface, implying that direct functional consequences of guide-target mismatches are mediated through the cumulative

  11. DNA charge transport over 34 nm

    NASA Astrophysics Data System (ADS)

    Slinker, Jason D.; Muren, Natalie B.; Renfrew, Sara E.; Barton, Jacqueline K.

    2011-03-01

    Molecular wires show promise in nanoscale electronics, but the synthesis of uniform, long conductive molecules is a significant challenge. Deoxyribonucleic acid (DNA) of precise length, by contrast, is synthesized easily, but its conductivity over the distances required for nanoscale devices has not been explored. Here we demonstrate DNA charge transport (CT) over 34 nm in 100-mer monolayers on gold. Multiplexed gold electrodes modified with 100-mer DNA yield sizable electrochemical signals from a distal, covalent Nile Blue redox probe. Significant signal attenuation upon incorporation of a single base-pair mismatch demonstrates that CT is DNA-mediated. Efficient cleavage of these 100-mers by a restriction enzyme indicates that the DNA adopts a native conformation accessible to protein binding. Similar electron-transfer rates measured through 100-mer and 17-mer monolayers are consistent with rate-limiting electron tunnelling through the saturated carbon linker. This DNA-mediated CT distance of 34 nm surpasses that of most reports of molecular wires.

  12. Origins of sequence selectivity in homologous genetic recombination: insights from rapid kinetic probing of RecA-mediated DNA strand exchange.

    PubMed

    Lee, Andrew M; Xiao, Jie; Singleton, Scott F

    2006-07-07

    Despite intense effort over the past 30 years, the molecular determinants of sequence selectivity in RecA-mediated homologous recombination have remained elusive. Here, we describe when and how sequence homology is recognized between DNA strands during recombination in the context of a kinetic model for RecA-mediated DNA strand exchange. We characterized the transient intermediates of the reaction using pre-steady-state kinetic analysis of strand exchange using oligonucleotide substrates containing a single fluorescent G analog. We observed that the reaction system was sensitive to heterology between the DNA substrates; however, such a "heterology effect" was not manifest when functional groups were added to or removed from the edges of the base-pairs facing the minor groove of the substrate duplex. Hence, RecA-mediated recombination must occur without the involvement of a triple helix, even as a transient intermediate in the process. The fastest detectable reaction phase was accelerated when the structure or stability of the substrate duplex was perturbed by internal mismatches or the replacement of G.C by I.C base-pairs. These findings indicate that the sequence specificity in recombination is achieved by Watson-Crick pairing in the context of base-pair dynamics inherent to the extended DNA structure bound by RecA during strand exchange.

  13. N-H Stretching Excitations in Adenosine-Thymidine Base Pairs in Solution: Base Pair Geometries, Infrared Line Shapes and Ultrafast Vibrational Dynamics

    PubMed Central

    Greve, Christian; Preketes, Nicholas K.; Fidder, Henk; Costard, Rene; Koeppe, Benjamin; Heisler, Ismael A.; Mukamel, Shaul; Temps, Friedrich; Nibbering, Erik T. J.; Elsaesser, Thomas

    2013-01-01

    We explore the N-H stretching vibrations of adenosine-thymidine base pairs in chloroform solution with linear and nonlinear infrared spectroscopy. Based on estimates from NMR measurements and ab initio calculations, we conclude that adenosine and thymidine form hydrogen bonded base pairs in Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen configurations with similar probability. Steady-state concentration- and temperature dependent linear FT-IR studies, including H/D exchange experiments, reveal that these hydrogen-bonded base pairs have complex N-H/N-D stretching spectra with a multitude of spectral components. Nonlinear 2D-IR spectroscopic results, together with IR-pump-IR-probe measurements, as also corroborated by ab initio calculations, reveal that the number of N-H stretching transitions is larger than the total number of N-H stretching modes. This is explained by couplings to other modes, such as an underdamped low-frequency hydrogen-bond mode, and a Fermi resonance with NH2 bending overtone levels of the adenosine amino-group. Our results demonstrate that modeling based on local N-H stretching vibrations only is not sufficient and call for further refinement of the description of the N-H stretching manifolds of nucleic acid base pairs of adenosine and thymidine, incorporating a multitude of couplings with fingerprint and low-frequency modes. PMID:23234439

  14. NMR studies of G:A mismatches in oligodeoxyribonucleotide duplexes modelled after ribozymes.

    PubMed Central

    Katahira, M; Sato, H; Mishima, K; Uesugi, S; Fujii, S

    1993-01-01

    The structures of two oligodeoxyribonucleotide duplexes, the base sequences of which were modelled after both a hammerhead ribozyme and a small metalloribozyme, were studied by NMR. Both duplexes contain adjacent G:A mismatches; one has a PyGAPu:PyGAPu sequence and the other a PyGAPy:PuGAPu sequence. It is concluded on the basis of many characteristic NOEs that in both duplexes G:A base pairs are formed in the unique 'sheared' form, where an amino proton instead of an imino proton of G is involved in the hydrogen bonding, and G and A bases are arranged 'side by side' instead of 'head to head'. A photo-CIDNP experiment, which gives unique and independent information on the solvent accessibility of nucleotide bases, also supports G:A base pairing rather than a bulged-out structure of G and A residues. This is the first demonstration that not only the PyGAPu:PyGAPu sequence but also the PyGAPy:PuGAPu sequence can form the unique sheared G:A base pairs. Taking the previous studies on G:A mismatches into account, the idea is suggested that a PyGA:GAPu sequence is a minimum and essential element for the formation of the sheared G:A base pairs. The sheared G:A base pairs in the PyGAPu:PyGAPu sequence are suggested to be more stable than those in the P