Science.gov

Sample records for dna base-pair mismatch

  1. Electrical current through DNA containing mismatched base pairs

    NASA Astrophysics Data System (ADS)

    Edirisinghe, Neranjan; Apalkov, Vadym; Berashevich, Julia; Chakraborty, Tapash

    2010-06-01

    Mismatched base pairs, such as different conformations of the G·A mispair, cause only minor structural changes in the host DNA molecule, thereby making mispair recognition an arduous task. Electron transport in DNA that depends strongly on the hopping transfer integrals between the nearest base pairs, which in turn are affected by the presence of a mispair, might be an attractive approach in this regard. We report here on our investigations, via the I-V characteristics, of the effect of a mispair on the electrical properties of homogeneous and generic DNA molecules. The I-V characteristics of DNA were studied numerically within the double-stranded tight-binding model. The parameters of the tight-binding model, such as the transfer integrals and on-site energies, are determined from first-principles calculations. The changes in electrical current through the DNA chain due to the presence of a mispair depend on the conformation of the G·A mispair and are appreciable for DNA consisting of up to 90 base pairs. For homogeneous DNA sequences the current through DNA is suppressed and the strongest suppression is realized for the G(anti)·A(syn) conformation of the G·A mispair. For inhomogeneous (generic) DNA molecules, the mispair result can be either a suppression or an enhancement of the current, depending on the type of mispairs and actual DNA sequence.

  2. Unique magnetic signatures of mismatched base pairs in DNA

    NASA Astrophysics Data System (ADS)

    Apalkov, Vadim; Berashevich, Julia; Chakraborty, Tapash

    2010-02-01

    Magnetic properties of DNA containing mispairs, such as different conformations of the GṡA mispair, or a GṡT mispair inserted into the DNA chain, have been theoretically investigated. The essential ingredients for these studies, the charge transfer integrals, were evaluated from the DNA sequences containing the mispair and optimized in the solvent. We find that the magnetic susceptibilities of the host DNA chain containing a large number of Watson-Crick base pairs are significantly altered in the presence of the mispairs, and the effects depend on the choice of mispairs. In particular, insertion of even a single GṡA mispair changes the nature of magnetization (sign of the susceptibility) of the host DNA. We propose that measurement of the magnetic properties of DNA might provide a direct route to detection and identification of those mispairs.

  3. Guanine- 5-carboxylcytosine base pairs mimic mismatches during DNA replication.

    PubMed

    Shibutani, Toshihiro; Ito, Shinsuke; Toda, Mariko; Kanao, Rie; Collins, Leonard B; Shibata, Marika; Urabe, Miho; Koseki, Haruhiko; Masuda, Yuji; Swenberg, James A; Masutani, Chikahide; Hanaoka, Fumio; Iwai, Shigenori; Kuraoka, Isao

    2014-06-09

    The genetic information encoded in genomes must be faithfully replicated and transmitted to daughter cells. The recent discovery of consecutive DNA conversions by TET family proteins of 5-methylcytosine into 5-hydroxymethylcytosine, 5-formylcytosine, and 5-carboxylcytosine (5caC) suggests these modified cytosines act as DNA lesions, which could threaten genome integrity. Here, we have shown that although 5caC pairs with guanine during DNA replication in vitro, G·5caC pairs stimulated DNA polymerase exonuclease activity and were recognized by the mismatch repair (MMR) proteins. Knockdown of thymine DNA glycosylase increased 5caC in genome, affected cell proliferation via MMR, indicating MMR is a novel reader for 5caC. These results suggest the epigenetic modification products of 5caC behave as DNA lesions.

  4. Detection of base-pair mismatches in DNA using graphene-based nanopore device.

    PubMed

    Kundu, Sourav; Karmakar, S N

    2016-04-01

    We present a unique way to detect base-pair mismatches in DNA, leading to a different epigenetic disorder by the method of nanopore sequencing. Based on a tight-binding formulation of a graphene-based nanopore device, using the Green's function approach we study the changes in the electronic transport properties of the device as we translocate a double-stranded DNA through the nanopore embedded in a zigzag graphene nanoribbon. In the present work we are not only successful in detecting the usual AT and GC pairs but also a set of possible mismatches in the complementary base pairing.

  5. Detection of base-pair mismatches in DNA using graphene-based nanopore device

    NASA Astrophysics Data System (ADS)

    Kundu, Sourav; Karmakar, S. N.

    2016-04-01

    We present a unique way to detect base-pair mismatches in DNA, leading to a different epigenetic disorder by the method of nanopore sequencing. Based on a tight-binding formulation of a graphene-based nanopore device, using the Green’s function approach we study the changes in the electronic transport properties of the device as we translocate a double-stranded DNA through the nanopore embedded in a zigzag graphene nanoribbon. In the present work we are not only successful in detecting the usual AT and GC pairs but also a set of possible mismatches in the complementary base pairing.

  6. Thermodynamic properties of the specific binding between Ag+ ions and C:C mismatched base pairs in duplex DNA.

    PubMed

    Torigoe, Hidetaka; Miyakawa, Yukako; Ono, Akira; Kozasa, Tetsuo

    2011-02-01

    Metal-mediated base pairs formed by the interaction between metal ions and artificial bases in oligonucleotides have been developed for potential applications in nanotechnology. We recently found that a natural C:C mismatched base pair bound to an Ag(+) ion to generate a novel metal-mediated base pair in duplex DNA. Preparation of the novel C-Ag-C base pair involving natural bases is more convenient than that of metal-mediated base pairs involving artificial bases because time-consuming base synthesis is not required. Here, we examined the thermodynamic properties of the binding between the Ag(+) ion and each of single and double C:C mismatched base pair in duplex DNA by isothermal titration calorimetry. The Ag(+) ion specifically bound to the C:C mismatched base pair at a 1:1 molar ratio with 10(6) M(-1) binding constant, which was significantly larger than those for nonspecific metal ion-DNA interactions. The specific binding between the Ag(+) ion and the single C:C mismatched base pair was mainly driven by the positive dehydration entropy change and the negative binding enthalpy change. In the interaction between the Ag(+) ion and each of the consecutive and interrupted double C:C mismatched base pairs, stoichiometric binding at a 1:1 molar ratio was achieved in each step of the first and second Ag(+) binding. The binding affinity for the second Ag(+) binding was similar to that for the first Ag(+) binding. Stoichiometric binding without interference and negative cooperativity may be favorable for aligning multiple Ag(+) ions in duplex DNA for applications of the metal-mediated base pairs in nanotechnology.

  7. Targeting DNA base pair mismatch with artificial nucleobases. Advances and perspectives in triple helix strategy.

    PubMed

    Malnuit, Vincent; Duca, Maria; Benhida, Rachid

    2011-01-21

    This review, divided into three sections, describes the contribution of the chemists' community to the development and application of triple helix strategy by using artificial nucleic acids, particularly for the recognition of DNA sequences incorporating base pair inversions. Firstly, the development of nucleobases that recognise CG inversion is surveyed followed secondly by specific recognition of TA inverted base pair. Finally, we point out in the last section recent perspectives and applications, driven from knowledge in nucleic acids interactions, in the growing field of nanotechnology and supramolecular chemistry at the border area of physics, chemistry and molecular biology.

  8. Molecular recognition of T:G mismatched base pairs in DNA as studied by electrospray ionization mass spectrometry.

    PubMed

    Riccardi Sirtori, Federico; Aldini, Giancarlo; Colombo, Maristella; Colombo, Nicoletta; Malyszko, Jan; Vistoli, Giulio; D'Alessio, Roberto

    2012-06-01

    Postreplicative mismatch repair (MMR) is a cellular system involved in the recognition and correction of DNA polymerase errors that escape detection in proofreading. Of the various mismatched bases, T:G pairing in DNA is one of the more common mutations leading to the formation of tumors in humans. In addition, the absence of the MMR system can generate resistance to several chemotherapeutic agents, particularly DNA-damaging substances. The main purpose of this study was the setup and validation of an electrospray ionization (ESI) mass spectrometry method for the identification of small molecules that are able to recognize T:G mismatches in DNA targets. These findings could be useful for the discovery of new antitumor drugs. The analytical method is based on the ability of electrospray to preserve the noncovalent adducts present in solution and transfer them to the gas phase. Lexitropsin derivatives (polyimidazole compounds) have been previously described as selective for T:G mismatch binding by NMR and ITC studies. We synthesized and tested various polyimidazole derivatives, one of which in particular (NMS-057) showed a higher affinity for an oligonucleotide DNA sequence containing a T:G mismatched base pair. To rationalize these findings, molecular docking studies were performed using available NMR structures. Moreover, ESI-MS experiments, performed on an orbitrap mass spectrometer, highlighted the formation of heterodimeric complexes between DNA sequences, distamycin A, and polyimidazole compounds. Our results confirm that this ESI method could be a valuable tool for the identification of new molecules able to specifically recognize T:G mismatched base pairs.

  9. Thermodynamic and structural properties of the specific binding between Ag⁺ ion and C:C mismatched base pair in duplex DNA to form C-Ag-C metal-mediated base pair.

    PubMed

    Torigoe, Hidetaka; Okamoto, Itaru; Dairaku, Takenori; Tanaka, Yoshiyuki; Ono, Akira; Kozasa, Tetsuo

    2012-11-01

    Metal ion-nucleic acid interactions have attracted considerable interest for their involvement in structure formation and catalytic activity of nucleic acids. Although interactions between metal ion and mismatched base pair duplex are important to understand mechanism of gene mutations related to heavy metal ions, they have not been well-characterized. We recently found that the Ag(+) ion stabilized a C:C mismatched base pair duplex DNA. A C-Ag-C metal-mediated base pair was supposed to be formed by the binding between the Ag(+) ion and the C:C mismatched base pair to stabilize the duplex. Here, we examined specificity, thermodynamics and structure of possible C-Ag-C metal-mediated base pair. UV melting indicated that only the duplex with the C:C mismatched base pair, and not of the duplexes with the perfectly matched and other mismatched base pairs, was specifically stabilized on adding the Ag(+) ion. Isothermal titration calorimetry demonstrated that the Ag(+) ion specifically bound with the C:C base pair at 1:1 molar ratio with a binding constant of 10(6) M(-1), which was significantly larger than those for nonspecific metal ion-DNA interactions. Electrospray ionization mass spectrometry also supported the specific 1:1 binding between the Ag(+) ion and the C:C base pair. Circular dichroism spectroscopy and NMR revealed that the Ag(+) ion may bind with the N3 positions of the C:C base pair without distorting the higher-order structure of the duplex. We conclude that the specific formation of C-Ag-C base pair with large binding affinity would provide a binding mode of metal ion-DNA interactions, similar to that of the previously reported T-Hg-T base pair. The C-Ag-C base pair may be useful not only for understanding of molecular mechanism of gene mutations related to heavy metal ions but also for wide variety of potential applications of metal-mediated base pairs in various fields, such as material, life and environmental sciences.

  10. NMR and molecular modeling evidence for a Gter dot A mismatch base pair in a purine-rich DNA duplex

    SciTech Connect

    Li, Ying; Wilson, W.D. ); Zon, G. )

    1991-01-01

    {sup 1}H NMR experiments indicate that the oligomer 5{prime}-d(ATGAGCGAATA) forms an unusual 10-base-pair duplex with 4 G{center dot}A base pairs and a 3{prime} unpaired adenosine. NMR results indicate that guanoxine imino protons of the F{center dot}A mismatches are not hydrogen bonded but are stacked in the helix. A G{r arrow} I substitution in either G{center dot}A base pair causes a dramatic decrtease in duplex stability and indicates that hydrogen bonding of the guanosine amino group is critical. Nuclear Overhauser effect spectroscopy (NOESY) and two-dimensional correlated spectroscopy (COSY) results indicate that the overall duplex conformation is in the B-family. Cross-strand NOEs in two-dimensional NOESY spectra between a mismatched AH2 and an AH1{prime} of the other mismatched base pair and between a mismatched GH8 and GNH1 of the other mismatch establish a purine-purine stacking pattern, adenosine over adenosine and guanosine over guanosine, which strongly stabilizes the duplex. A computer graphics molecular model of the ususual duplex was constructed with G{center dot}A base pairs containing A-NH{sub 2} to GN3 and G-NH{sub 2} to AN7 hydrogen bonds and B-form base pairs on both sides of the G{center dot}A pairs (5{prime}-d(ATGAGC)). The energy-minimized duplex satisfies all experimental constraints from NOESY and COSY results. A hydrogen bond from G-NH{sub 2} of the mismatch to a phosphate oxygen is predicted.

  11. Atomistic understanding of the C·T mismatched DNA base pair tautomerization via the DPT: QM and QTAIM computational approaches.

    PubMed

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2013-11-15

    It was established that the cytosine·thymine (C·T) mismatched DNA base pair with cis-oriented N1H glycosidic bonds has propeller-like structure (|N3C4C4N3| = 38.4°), which is stabilized by three specific intermolecular interactions-two antiparallel N4H…O4 (5.19 kcal mol(-1)) and N3H…N3 (6.33 kcal mol(-1)) H-bonds and a van der Waals (vdW) contact O2…O2 (0.32 kcal mol(-1)). The C·T base mispair is thermodynamically stable structure (ΔG(int) = -1.54 kcal mol(-1) ) and even slightly more stable than the A·T Watson-Crick DNA base pair (ΔG(int) = -1.43 kcal mol(-1)) at the room temperature. It was shown that the C·T ↔ C*·T* tautomerization via the double proton transfer (DPT) is assisted by the O2…O2 vdW contact along the entire range of the intrinsic reaction coordinate (IRC). The positive value of the Grunenberg's compliance constants (31.186, 30.265, and 22.166 Å/mdyn for the C·T, C*·T*, and TS(C·T ↔ C*·T*), respectively) proves that the O2…O2 vdW contact is a stabilizing interaction. Based on the sweeps of the H-bond energies, it was found that the N4H…O4/O4H…N4, and N3H…N3 H-bonds in the C·T and C*·T* base pairs are anticooperative and weaken each other, whereas the middle N3H…N3 H-bond and the O2…O2 vdW contact are cooperative and mutually reinforce each other. It was found that the tautomerization of the C·T base mispair through the DPT is concerted and asynchronous reaction that proceeds via the TS(C·T ↔ C*·T*) stabilized by the loosened N4-H-O4 covalent bridge, N3H…N3 H-bond (9.67 kcal mol(-1) ) and O2…O2 vdW contact (0.41 kcal mol(-1) ). The nine key points, describing the evolution of the C·T ↔ C*·T* tautomerization via the DPT, were detected and completely investigated along the IRC. The C*·T* mispair was revealed to be the dynamically unstable structure with a lifetime 2.13·× 10(-13) s. In this case, as for the A·T Watson-Crick DNA base pair, activates the mechanism of the quantum protection of the C

  12. Anomeric 2'-Deoxycytidines and Silver Ions: Hybrid Base Pairs with Greatly Enhanced Stability and Efficient DNA Mismatch Detection with α-dC.

    PubMed

    Guo, Xiurong; Seela, Frank

    2017-09-04

    α-d-Nucleosides are rare in nature but can develop fascinating properties when incorporated into DNA. This work reports on the first silver-mediated base pair constructed from two anomeric nucleosides: α-dC and β-dC. The hybrid base pair was integrated into the DNA and DNA/RNA double helix. A 12-mer duplex with α-dC and β-dC pair exhibits a higher thermal stability (Tm =43 °C) than that incorporating the β-dC-Ag(+) -β-dC homo pair (Tm =34 °C). Furthermore, α-dC shows excellent mismatch discrimination for DNA single nucleotide polymorphism (SNP). All four SNPs were identified on the basis of large Tm value differences measured in the presence of silver ions. High resolution melting was not required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Single-base-pair discrimination of terminal mismatches by using oligonucleotide microarrays and neural network analyses

    NASA Technical Reports Server (NTRS)

    Urakawa, Hidetoshi; Noble, Peter A.; El Fantroussi, Said; Kelly, John J.; Stahl, David A.

    2002-01-01

    The effects of single-base-pair near-terminal and terminal mismatches on the dissociation temperature (T(d)) and signal intensity of short DNA duplexes were determined by using oligonucleotide microarrays and neural network (NN) analyses. Two perfect-match probes and 29 probes having a single-base-pair mismatch at positions 1 to 5 from the 5' terminus of the probe were designed to target one of two short sequences representing 16S rRNA. Nonequilibrium dissociation rates (i.e., melting profiles) of all probe-target duplexes were determined simultaneously. Analysis of variance revealed that position of the mismatch, type of mismatch, and formamide concentration significantly affected the T(d) and signal intensity. Increasing the concentration of formamide in the washing buffer decreased the T(d) and signal intensity, and it decreased the variability of the signal. Although T(d)s of probe-target duplexes with mismatches in the first or second position were not significantly different from one another, duplexes with mismatches in the third to fifth positions had significantly lower T(d)s than those with mismatches in the first or second position. The trained NNs predicted the T(d) with high accuracies (R(2) = 0.93). However, the NNs predicted the signal intensity only moderately accurately (R(2) = 0.67), presumably due to increased noise in the signal intensity at low formamide concentrations. Sensitivity analysis revealed that the concentration of formamide explained most (75%) of the variability in T(d)s, followed by position of the mismatch (19%) and type of mismatch (6%). The results suggest that position of the mismatch at or near the 5' terminus plays a greater role in determining the T(d) and signal intensity of duplexes than the type of mismatch.

  14. Single-base-pair discrimination of terminal mismatches by using oligonucleotide microarrays and neural network analyses

    NASA Technical Reports Server (NTRS)

    Urakawa, Hidetoshi; Noble, Peter A.; El Fantroussi, Said; Kelly, John J.; Stahl, David A.

    2002-01-01

    The effects of single-base-pair near-terminal and terminal mismatches on the dissociation temperature (T(d)) and signal intensity of short DNA duplexes were determined by using oligonucleotide microarrays and neural network (NN) analyses. Two perfect-match probes and 29 probes having a single-base-pair mismatch at positions 1 to 5 from the 5' terminus of the probe were designed to target one of two short sequences representing 16S rRNA. Nonequilibrium dissociation rates (i.e., melting profiles) of all probe-target duplexes were determined simultaneously. Analysis of variance revealed that position of the mismatch, type of mismatch, and formamide concentration significantly affected the T(d) and signal intensity. Increasing the concentration of formamide in the washing buffer decreased the T(d) and signal intensity, and it decreased the variability of the signal. Although T(d)s of probe-target duplexes with mismatches in the first or second position were not significantly different from one another, duplexes with mismatches in the third to fifth positions had significantly lower T(d)s than those with mismatches in the first or second position. The trained NNs predicted the T(d) with high accuracies (R(2) = 0.93). However, the NNs predicted the signal intensity only moderately accurately (R(2) = 0.67), presumably due to increased noise in the signal intensity at low formamide concentrations. Sensitivity analysis revealed that the concentration of formamide explained most (75%) of the variability in T(d)s, followed by position of the mismatch (19%) and type of mismatch (6%). The results suggest that position of the mismatch at or near the 5' terminus plays a greater role in determining the T(d) and signal intensity of duplexes than the type of mismatch.

  15. Alternative DNA base pairing through metal coordination.

    PubMed

    Clever, Guido H; Shionoya, Mitsuhiko

    2012-01-01

    Base-pairing in the naturally occurring DNA and RNA oligonucleotide duplexes is based on π-stacking, hydrogen bonding, and shape complementarity between the nucleobases adenine, thymine, guanine, and cytosine as well as on the hydrophobic-hydrophilic balance in aqueous media. This complex system of multiple supramolecular interactions is the product of a long-term evolutionary process and thus highly optimized to serve its biological functions such as information storage and processing. After the successful implementation of automated DNA synthesis, chemists have begun to introduce artificial modifications inside the core of the DNA double helix in order to study various aspects of base pairing, generate new base pairs orthogonal to the natural ones, and equip the biopolymer with entirely new functions. The idea to replace the hydrogen bonding interactions with metal coordination between ligand-like nucleosides and suitable transition metal ions culminated in the development of a plethora of artificial base-pairing systems termed "metal base-pairs" which were shown to strongly enhance the DNA duplex stability. Furthermore, they show great potential for the use of DNA as a molecular wire in nanoscale electronic architectures. Although single electrons have proven to be transmitted by natural DNA over a distance of several base pairs, the high ohmic resistance of unmodified oligonucleotides was identified as a serious obstacle. By exchanging some or all of the Watson-Crick base pairs in DNA with metal complexes, this problem may be solved. In the future, these research efforts are supposed to lead to DNA-like materials with superior conductivity for nano-electronic applications. Other fields of potential application such as DNA-based supramolecular architecture and catalysis may be strongly influenced by these developments as well. This text is meant to illustrate the basic concepts of metal-base pairing and give an outline over recent developments in this field.

  16. Mismatch repair in heteroduplex DNA.

    PubMed Central

    Wildenberg, J; Meselson, M

    1975-01-01

    DNA with base pair mismatches was prepared by annealing mixtures of genetically marked DNA from bacteriophage lambda. This heteroduplex DNA was used to transfect bacteria under conditions minimizing recombination. Genetic analysis of the progeny phages indicates that: (i) Mismatch repair occurs, usually giving rise to a DNA molecule with one chain with the genotype arising from repair and one parental chain. (ii) The frequency of repair of a given mismatch to wild type depends on the marker, ranging from 3 to 20%. (iii) Excision tracts may extend several hundred nucleotides but are usually shorter than about 2000 nucleotides. (iv) In Rec-mediated bacteriophage crosses, recombination of markers closer than about 10-3 nucleotide pairs frequently occurs by mismatch repair within heteroduplex DNA. (V) The average amount of heteroduplex DNA formed in a Rec-mediated recombination event is a few thousand nucleotide pairs. PMID:1094458

  17. Molecular switching behavior in isosteric DNA base pairs.

    PubMed

    Jissy, A K; Konar, Sukanya; Datta, Ayan

    2013-04-15

    The structures and proton-coupled behavior of adenine-thymine (A-T) and a modified base pair containing a thymine isostere, adenine-difluorotoluene (A-F), are studied in different solvents by dispersion-corrected density functional theory. The stability of the canonical Watson-Crick base pair and the mismatched pair in various solvents with low and high dielectric constants is analyzed. It is demonstrated that A-F base pairing is favored in solvents with low dielectric constant. The stabilization and conformational changes induced by protonation are also analyzed for the natural as well as the mismatched base pair. DNA sequences capable of changing their sequence conformation on protonation are used in the construction of pH-based molecular switches. An acidic medium has a profound influence in stabilizing the isostere base pair. Such a large gain in stability on protonation leads to an interesting pH-controlled molecular switch, which can be incorporated in a natural DNA tract.

  18. High fidelity of base pairing by 2-selenothymidine in DNA.

    PubMed

    Hassan, Abdalla E A; Sheng, Jia; Zhang, Wen; Huang, Zhen

    2010-02-24

    The base pairs are the contributors to the sequence-dependent recognition of nucleic acids, genetic information storage, and high fidelity of DNA polymerase replication. However, the wobble base pairing, where T pairs with G instead of A, reduces specific base-pairing recognition and compromises the high fidelity of the enzymatic polymerization. Via the selenium atomic probing at the 2-position of thymidine, we have investigated the wobble discrimination by manipulating the steric and electronic effects at the 2-exo position, providing a unique chemical strategy to enhance the base pair specificity. We report here the first synthesis of the novel 2-Se-thymidine ((Se)T) derivative, its phosphoramidite, and the Se-DNAs. Our biophysical and structural studies of the 2-Se-T DNAs reveal that the bulky 2-Se atom with a weak hydrogen-bonding ability can largely increase mismatch discriminations (including T/G wobble and T/C mismatched base pairs) while maintaining the (Se)T/A virtually identical to the native T/A base pair. The 2-Se atom bulkiness and the electronic effect are probably the main factors responsible for the discrimination against the formation of the wobble (Se)T/G base pair. Our investigations provide a potential novel tool to investigate the specific recognition of base pairs, which is the basis of high fidelity during replication, transcription, and translation. Furthermore, this Se-atom-specific substitution and probing are useful for X-ray crystal structure and function studies of nucleic acids.

  19. Method for sequencing DNA base pairs

    DOEpatents

    Sessler, Andrew M.; Dawson, John

    1993-01-01

    The base pairs of a DNA structure are sequenced with the use of a scanning tunneling microscope (STM). The DNA structure is scanned by the STM probe tip, and, as it is being scanned, the DNA structure is separately subjected to a sequence of infrared radiation from four different sources, each source being selected to preferentially excite one of the four different bases in the DNA structure. Each particular base being scanned is subjected to such sequence of infrared radiation from the four different sources as that particular base is being scanned. The DNA structure as a whole is separately imaged for each subjection thereof to radiation from one only of each source.

  20. Optimization of single-base-pair mismatch discrimination in oligonucleotide microarrays

    NASA Technical Reports Server (NTRS)

    Urakawa, Hidetoshi; El Fantroussi, Said; Smidt, Hauke; Smoot, James C.; Tribou, Erik H.; Kelly, John J.; Noble, Peter A.; Stahl, David A.

    2003-01-01

    The discrimination between perfect-match and single-base-pair-mismatched nucleic acid duplexes was investigated by using oligonucleotide DNA microarrays and nonequilibrium dissociation rates (melting profiles). DNA and RNA versions of two synthetic targets corresponding to the 16S rRNA sequences of Staphylococcus epidermidis (38 nucleotides) and Nitrosomonas eutropha (39 nucleotides) were hybridized to perfect-match probes (18-mer and 19-mer) and to a set of probes having all possible single-base-pair mismatches. The melting profiles of all probe-target duplexes were determined in parallel by using an imposed temperature step gradient. We derived an optimum wash temperature for each probe and target by using a simple formula to calculate a discrimination index for each temperature of the step gradient. This optimum corresponded to the output of an independent analysis using a customized neural network program. These results together provide an experimental and analytical framework for optimizing mismatch discrimination among all probes on a DNA microarray.

  1. Optimization of single-base-pair mismatch discrimination in oligonucleotide microarrays

    NASA Technical Reports Server (NTRS)

    Urakawa, Hidetoshi; El Fantroussi, Said; Smidt, Hauke; Smoot, James C.; Tribou, Erik H.; Kelly, John J.; Noble, Peter A.; Stahl, David A.

    2003-01-01

    The discrimination between perfect-match and single-base-pair-mismatched nucleic acid duplexes was investigated by using oligonucleotide DNA microarrays and nonequilibrium dissociation rates (melting profiles). DNA and RNA versions of two synthetic targets corresponding to the 16S rRNA sequences of Staphylococcus epidermidis (38 nucleotides) and Nitrosomonas eutropha (39 nucleotides) were hybridized to perfect-match probes (18-mer and 19-mer) and to a set of probes having all possible single-base-pair mismatches. The melting profiles of all probe-target duplexes were determined in parallel by using an imposed temperature step gradient. We derived an optimum wash temperature for each probe and target by using a simple formula to calculate a discrimination index for each temperature of the step gradient. This optimum corresponded to the output of an independent analysis using a customized neural network program. These results together provide an experimental and analytical framework for optimizing mismatch discrimination among all probes on a DNA microarray.

  2. Osmium complexation of mismatched DNA: effect of the bases adjacent to mismatched 5-methylcytosine.

    PubMed

    Nomura, Akiko; Tainaka, Kazuki; Okamoto, Akimitsu

    2009-03-18

    The efficiency of osmium complex formation at 5-methylcytosine in mismatched DNA duplexes is a key point for the design of sequence-specific detection of DNA methylation. Osmium complexation was not observed in fully matched duplexes, whereas the complexation site and efficiency in mismatched duplexes changed depending on the type of 5'-neighboring base of the 5-methylcytosine forming a mismatched base pair. In particular, when the base adjacent to the 5' side of the mismatched base pair was thymine, a unique "side reaction" was observed. However, the nature of the mismatched base pairs in the reaction site did not influence the selectivity of osmium complex formation with methylated DNA.

  3. Reactivity of cytosine and thymine in single-base-pair mismatches with hydroxylamine and osmium tetroxide and its application to the study of mutations.

    PubMed Central

    Cotton, R G; Rodrigues, N R; Campbell, R D

    1988-01-01

    The chemical reactivity of thymine (T), when mismatched with the bases cytosine, guanine, and thymine, and of cytosine (C), when mismatched with thymine, adenine, and cytosine, has been examined. Heteroduplex DNAs containing such mismatched base pairs were first incubated with osmium tetroxide (for T and C mismatches) or hydroxylamine (for C mismatches) and then incubated with piperidine to cleave the DNA at the modified mismatched base. This cleavage was studied with an internally labeled strand containing the mismatched T or C, such that DNA cleavage and thus reactivity could be detected by gel electrophoresis. Cleavage at a total of 13 T and 21 C mismatches isolated (by at least three properly paired bases on both sides) single-base-pair mismatches was identified. All T or C mismatches studied were cleaved. By using end-labeled DNA probes containing T or C single-base-pair mismatches and conditions for limited cleavage, we were able to show that cleavage was at the base predicted by sequence analysis and that mismatches in a length of DNA could be readily detected by such an approach. This procedure may enable detection of all single-base-pair mismatches by use of sense and antisense probes and thus may be used to identify the mutated base and its position in a heteroduplex. Images PMID:3260032

  4. Reactivity of cytosine and thymine in single-base-pair mismatches with hydroxylamine and osmium tetroxide and its application to the study of mutations

    SciTech Connect

    Cotton, R.G.H.; Rodrigues, N.R.; Campbell, R.D. )

    1988-06-01

    The chemical reactivity of thymine (T), when mismatched with the bases cytosine, guanine, and thymine, and of cytosine (C), when mismatched with thymine, adenine, and cytosine, has been examined. Heteroduplex DNAs containing such mismatched base pairs were first incubated with osmium tetroxide (for T and C mismatches) or hydroxylamine (for C mismatches) and then incubated with piperidine to cleave the DNA at the modified mismatched base. This cleavage was studied with an internally labeled strand containing the mismatched T or C, such that DNA cleavage and thus reactivity could be detected by gel electrophoresis. Cleavage at a total of 13 T and 21 C mismatches isolated (by at least three properly paired bases on both sides) single-base-pair mismatches was identified. All T or C mismatches studied were cleaved. By using end-labeled DNA probes containing T or C single-base-pair mismatches and conditions for limited cleavage, the authors were able to show that cleavage was at the base predicted by sequence analysis and that mismatches in a length of DNA could be readily detected by such an approach. This procedure may enable detection of all single-base-pair mismatches by use of sense and antisense probes and thus may be used by identify the mutated base and its position in a heteroduplex.

  5. Method for sequencing DNA base pairs

    DOEpatents

    Sessler, A.M.; Dawson, J.

    1993-12-14

    The base pairs of a DNA structure are sequenced with the use of a scanning tunneling microscope (STM). The DNA structure is scanned by the STM probe tip, and, as it is being scanned, the DNA structure is separately subjected to a sequence of infrared radiation from four different sources, each source being selected to preferentially excite one of the four different bases in the DNA structure. Each particular base being scanned is subjected to such sequence of infrared radiation from the four different sources as that particular base is being scanned. The DNA structure as a whole is separately imaged for each subjection thereof to radiation from one only of each source. 6 figures.

  6. The structural impact of DNA mismatches

    PubMed Central

    Rossetti, Giulia; Dans, Pablo D.; Gomez-Pinto, Irene; Ivani, Ivan; Gonzalez, Carlos; Orozco, Modesto

    2015-01-01

    The structure and dynamics of all the transversion and transition mismatches in three different DNA environments have been characterized by molecular dynamics simulations and NMR spectroscopy. We found that the presence of mismatches produced significant local structural alterations, especially in the case of purine transversions. Mismatched pairs often show promiscuous hydrogen bonding patterns, which interchange among each other in the nanosecond time scale. This therefore defines flexible base pairs, where breathing is frequent, and where distortions in helical parameters are strong, resulting in significant alterations in groove dimension. Even if the DNA structure is plastic enough to absorb the structural impact of the mismatch, local structural changes can be propagated far from the mismatch site, following the expected through-backbone and a previously unknown through-space mechanism. The structural changes related to the presence of mismatches help to understand the different susceptibility of mismatches to the action of repairing proteins. PMID:25820425

  7. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

    PubMed

    Takezawa, Yusuke; Shionoya, Mitsuhiko

    2012-12-18

    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

  8. NMR analysis of base-pair opening kinetics in DNA.

    PubMed

    Szulik, Marta W; Voehler, Markus; Stone, Michael P

    2014-12-12

    Base pairing in nucleic acids plays a crucial role in their structure and function. Differences in the base-pair opening and closing kinetics of individual double-stranded DNA sequences or between chemically modified base pairs provide insight into the recognition of these base pairs by DNA processing enzymes. This unit describes how to quantify the kinetics for localized base pairs by observing changes in the imino proton signals by nuclear magnetic resonance spectroscopy. The determination of all relevant parameters using state-of-the art techniques and NMR instrumentation, including cryoprobes, is discussed.

  9. Thermodynamics and kinetics for base pair opening in the DNA decamer duplexes containing cyclobutane pyrimidine dimer.

    PubMed

    Bang, Jongchul; Kang, Young-Min; Park, Chin-Ju; Lee, Joon-Hwa; Choi, Byong-Seok

    2009-06-18

    The cyclobutane pyrimidine dimer (CPD) is one of the major classes of cytotoxic and carcinogenic DNA photoproducts induced by UV light. Hydrogen exchange rates of the imino protons were measured for various CPD-containing DNA duplexes to better understand the mechanism for CPD recognition by XPC-hHR23B. The results here revealed that double T.G mismatches in a CPD lesion significantly destabilized six consecutive base pairs compared to other DNA duplexes. This flexibility in a DNA duplex caused at the CPD lesions with double T.G mismatches might be the key factor for damage recognition by XPC-hHR23B.

  10. DNA base-pair flipping with fluorescent perylenediimide pincers.

    PubMed

    Zeidan, Tarek A; Hariharan, Mahesh; Siegmund, Karsten; Lewis, Frederick D

    2010-07-30

    The synthesis, structure, and electronic spectra of a series of DNA hairpins possessing two perylenediimide (PDI) base pair surrogates are reported. The PDI chromophores are located in opposite strands of the hairpin base pair domain opposite abasic sites and are either adjacent to each other or separated by a variable number of AT or GC base pairs. Molecular modeling of the conjugate having adjacent PDI chromophores shows that they adopt a slipped, pi-stacked geometry with an angle of 40 degrees between the PDI long axes. The electronic absorption, fluorescence, and circular dichroism of this conjugate are consistent with a stacked PDI structure. Conjugates having one or two GC base pairs between the PDI chromophores display spectra that are consistent with isolated PDIs. Conjugates having 1-4 AT base pairs have more complex spectra, suggestive of an equilibrium between base paired and flipped structures having stacked PDIs. Heating of the conjugates possessing isolated PDI chromophores results in base pair flipping. The free energy for PDI stacking is greater than that for a single AT base pair and comparable to that for a single GC base pair or two AT base pairs.

  11. Base pair opening kinetics and dynamics in the DNA duplexes that specifically recognized by very short patch repair protein (Vsr).

    PubMed

    Cho, Sung Jae; Bang, Jongchul; Lee, Joon-Hwa; Choi, Byong-Seok

    2010-09-15

    In Escherichia coli, the very short patch (VSP) repair system is a major pathway for removal of T.G mismatches in Dcm target sequences. In the VSP repair pathway, the very short patch repair (Vsr) endonuclease selectively recognizes a T.G mismatch in Dcm target sequences and hydrolyzes the 5'-phosphate group of the mismatched thymine. The hydrogen exchange NMR studies here revealed that the T5.G18 mismatch in the Dcm target sequence significantly stabilizes own base pair but destabilizes the two neighboring G4.C19 and A6.T17 base pairs compare to other T.G mismatches. These unusual patterns of base pair stability in the Dcm target sequence can explain how the Vsr endonuclease specifically recognizes the mismatched Dcm target sequence and intercalates into the DNA. Copyright 2010 Elsevier Inc. All rights reserved.

  12. Discrimination of Single Base Pair Differences Among Individual DNA Molecules Using a Nanopore

    NASA Technical Reports Server (NTRS)

    Vercoutere, Wenonah; DeGuzman, Veronica

    2003-01-01

    The protein toxin alpha-hemolysin form nanometer scale channels across lipid membranes. Our lab uses a single channel in an artificial lipid bilayer in a patch clamp device to capture and examine individual DNA molecules. This nanopore detector used with a support vector machine (SVM) can analyze DNA hairpin molecules on the millisecond time scale. We distinguish duplex stem length, base pair mismatches, loop length, and single base pair differences. The residual current fluxes also reveal structural molecular dynamics elements. DNA end-fraying (terminal base pair dissociation) can be observed as near full blockades, or spikes, in current. This technique can be used to investigate other biological processes dependent on DNA end-fraying, such as the processing of HIV DNA by HIV integrase.

  13. Discrimination of Single Base Pair Differences Among Individual DNA Molecules Using a Nanopore

    NASA Technical Reports Server (NTRS)

    Vercoutere, Wenonah; DeGuzman, Veronica

    2003-01-01

    The protein toxin alpha-hemolysin form nanometer scale channels across lipid membranes. Our lab uses a single channel in an artificial lipid bilayer in a patch clamp device to capture and examine individual DNA molecules. This nanopore detector used with a support vector machine (SVM) can analyze DNA hairpin molecules on the millisecond time scale. We distinguish duplex stem length, base pair mismatches, loop length, and single base pair differences. The residual current fluxes also reveal structural molecular dynamics elements. DNA end-fraying (terminal base pair dissociation) can be observed as near full blockades, or spikes, in current. This technique can be used to investigate other biological processes dependent on DNA end-fraying, such as the processing of HIV DNA by HIV integrase.

  14. Stretching single-stranded DNA: interplay of electrostatic, base-pairing, and base-pair stacking interactions.

    PubMed Central

    Zhang, Y; Zhou, H; Ou-Yang, Z C

    2001-01-01

    Recent single-macromolecule observations revealed that the force/extension characteristics of single-stranded DNA (ssDNA) are closely related to solution ionic concentration and DNA sequence composition. To understand this, we studied the elastic property of ssDNA through the Monte Carlo implementation of a modified freely jointed chain (FJC), with electrostatic, base-pairing, and base-pair stacking interactions all incorporated. The simulated force-extension profiles for both random and designed sequences have attained quantitative agreements with the experimental data. In low-salt solution, electrostatic interaction dominates, and at low forces, the molecule can be more easily aligned than an unmodified FJC. In high-salt solution, secondary hairpin structure appears in ssDNA by the formation of base pairs between complementary bases, and external stretching causes a hairpin-coil structural transition, which is continuous for ssDNA made of random sequences. In designed sequences such as poly(dA-dT) and poly(dG-dC), the stacking potential between base pairs encourages the aggregation of base pairs into bulk hairpins and makes the hairpin-coil transition a discontinuous (first-order) process. The sensitivity of elongation to the base-pairing rule is also investigated. The comparison of modeling calculations and the experimental data suggests that the base pairing of single-stranded polynucleotide molecules tends to form a nested and independent planar hairpin structure rather than a random intersecting pattern. PMID:11463654

  15. Natural versus artificial creation of base pairs in DNA: origin of nucleobases from the perspectives of unnatural base pair studies.

    PubMed

    Hirao, Ichiro; Kimoto, Michiko; Yamashige, Rie

    2012-12-18

    Since life began on Earth, the four types of bases (A, G, C, and T(U)) that form two sets of base pairs have remained unchanged as the components of nucleic acids that replicate and transfer genetic information. Throughout evolution, except for the U to T modification, the four base structures have not changed. This constancy within the genetic code raises the question of how these complicated nucleotides were generated from the molecules in a primordial soup on the early Earth. At some prebiotic stage, the complementarity of base pairs might have accelerated the generation and accumulation of nucleotides or oligonucleotides. We have no clues whether one pair of nucleobases initially appeared on the early Earth during this process or a set of two base pairs appeared simultaneously. Recently, researchers have developed new artificial pairs of nucleobases (unnatural base pairs) that function alongside the natural base pairs. Some unnatural base pairs in duplex DNA can be efficiently and faithfully amplified in a polymerase chain reaction (PCR) using thermostable DNA polymerases. The addition of unnatural base pair systems could expand the genetic alphabet of DNA, thus providing a new mechanism for the generation novel biopolymers by the site-specific incorporation of functional components into nucleic acids and proteins. Furthermore, the process of unnatural base pair development might provide clues to the origin of the natural base pairs in a primordial soup on the early Earth. In this Account, we describe the development of three representative types of unnatural base pairs that function as a third pair of nucleobases in PCR and reconsider the origin of the natural nucleic acids. As researchers developing unnatural base pairs, they use repeated "proof of concept" experiments. As researchers design new base pairs, they improve the structures that function in PCR and eliminate those that do not. We expect that this process is similar to the one functioning in the

  16. Ultrafast dynamics in DNA base pairs following ultraviolet excitation.

    NASA Astrophysics Data System (ADS)

    Orr-Ewing, Andrew

    2015-03-01

    Photo-protective mechanisms in DNA are essential to maintain the integrity of the genetic code by preventing damage from absorption of solar ultraviolet (UV) radiation. We have used time-resolved infra-red (TRIR) spectroscopy to observe the dynamics of Watson-Crick nucleobase pairs following absorption of femtosecond UV laser pulses. The base pairs are prepared as nucleosides in solution, and photo-induced dynamics are probed in the carbonyl and N-H bond stretching regions using broadband IR pulses with picosecond time resolution. Results will be presented for the guanine-cytosine (G-C) base pair, contrasting the rapid recovery of ground-state products (the photo-protection pathway) with formation of other photoproducts which might represent photo-damage mechanisms. This work is a collaboration with the group of Prof F. Temps (Christian-Albrechts-Universitat zu Kiel). This research is supported by ERC Advanced Grant 290966 CAPRI.

  17. Physics of base-pairing dynamics in DNA

    NASA Astrophysics Data System (ADS)

    Manghi, Manoel; Destainville, Nicolas

    2016-05-01

    As a key molecule of life, Deoxyribo-Nucleic Acid (DNA) is the focus of numbers of investigations with the help of biological, chemical and physical techniques. From a physical point of view, both experimental and theoretical works have brought quantitative insights into DNA base-pairing dynamics that we review in this Report, putting emphasis on theoretical developments. We discuss the dynamics at the base-pair scale and its pivotal coupling with the polymer one, with a polymerization index running from a few nucleotides to tens of kilo-bases. This includes opening and closure of short hairpins and oligomers as well as zipping and unwinding of long macromolecules. We review how different physical mechanisms are either used by Nature or utilized in biotechnological processes to separate the two intertwined DNA strands, by insisting on quantitative results. They go from thermally-assisted denaturation bubble nucleation to force- or torque-driven mechanisms. We show that the helical character of the molecule, possibly supercoiled, can play a key role in many denaturation and renaturation processes. We categorize the mechanisms according to the relative timescales associated with base-pairing and chain orientational degrees of freedom such as bending and torsional elastic ones. In some specific situations, these chain orientational degrees of freedom can be integrated out, and the quasi-static approximation is valid. The complex dynamics then reduces to the diffusion in a low-dimensional free-energy landscape. In contrast, some important cases of experimental interest necessarily appeal to far-from-equilibrium statistical mechanics and hydrodynamics.

  18. Dynamics of DNA Mismatch Repair

    NASA Astrophysics Data System (ADS)

    Coats, Julie; Lin, Yuyen; Rasnik, Ivan

    2009-11-01

    DNA mismatch repair protects the genome from spontaneous mutations by recognizing errors, excising damage, and re-synthesizing DNA in a pathway that is highly conserved. Mismatch recognition is accomplished by the MutS family of proteins which are weak ATPases that bind specifically to damaged DNA, but the specific molecular mechanisms by which these proteins recognize damage and initiate excision are not known. Previous structural investigations have implied that protein-induced conformational changes are central to mismatch recognition. Because damage detection is a highly dynamic process in which conformational changes of the protein-DNA complexes occur on a time scale of a few seconds, it is difficult to obtain meaningful kinetic information with traditional ensemble techniques. In this work, we use single molecule fluorescence resonance energy transfer (smFRET) to study the conformational dynamics of fluorescently labeled DNA substrates in the presence of the mismatch repair protein MutS from E. coli and its human homolog MSH2/MSH6. Our studies allow us to obtain quantitative kinetic information about the rates of binding and dissociation and to determine the conformational states for each protein-DNA complex.

  19. Micromechanics of base pair unzipping in the DNA duplex.

    PubMed

    Volkov, Sergey N; Paramonova, Ekaterina V; Yakubovich, Alexander V; Solov'yov, Andrey V

    2012-01-25

    All-atom molecular dynamics (MD) simulations of DNA duplex unzipping in a water environment were performed. The investigated DNA double helix consists of a Drew-Dickerson dodecamer sequence and a hairpin (AAG) attached to the end of the double-helix chain. The considered system is used to examine the process of DNA strand separation under the action of an external force. This process occurs in vivo and now is being intensively investigated in experiments with single molecules. The DNA dodecamer duplex is consequently unzipped pair by pair by means of the steered MD. The unzipping trajectories turn out to be similar for the duplex parts with G·C content and rather distinct for the parts with A·T content. It is shown that during the unzipping each pair experiences two types of motion: relatively quick rotation together with all the duplex and slower motion in the frame of the unzipping fork. In the course of opening, the complementary pair passes through several distinct states: (i) the closed state in the double helix, (ii) the metastable preopened state in the unzipping fork and (iii) the unbound state. The performed simulations show that water molecules participate in the stabilization of the metastable states of the preopened base pairs in the DNA unzipping fork.

  20. Theoretical and experimental study of charge transfer through DNA: impact of mercury mediated T-Hg-T base pair.

    PubMed

    Kratochvílová, Irena; Golan, Martin; Vala, Martin; Špérová, Miroslava; Weiter, Martin; Páv, Ondřej; Šebera, Jakub; Rosenberg, Ivan; Sychrovský, Vladimír; Tanaka, Yoshiyuki; Bickelhaupt, F Matthias

    2014-05-22

    DNA-Hg complexes may play an important role in sensing DNA defects or in detecting the presence of Hg in the environment. A fundamental way of characterizing DNA-Hg complexes is to study the way the electric charge is transferred through the molecular chain. The main goal of this contribution was to investigate the impact of a mercury metal cation that links two thymine bases in a DNA T-T mismatched base pair (T-Hg-T) on charge transfer through the DNA molecule. We compared the charge transfer efficiencies in standard DNA, DNA with mismatched T-T base pairs, and DNA with a T-Hg(II)-T base pair. For this purpose, we measured the temperature dependence of steady-state fluorescence and UV-vis of the DNA molecules. The experimental results were confronted with the results obtained employing theoretical DFT methods. Generally, the efficiency of charge transfer was driven by mercury changing the spatial overlap of bases.

  1. Intermolecular magnetic interactions in stacked DNA base pairs.

    PubMed

    Martínez, Fernando A; Aucar, Gustavo A

    2017-10-09

    The influence of pi-stacking on the magnetic properties of atoms that belong to adenine-thymine and guanine-cytosine pairs in sequences of three and five layers of DNA base pairs was analysed. As probes we used NMR spectroscopic parameters, which are among the most useful tools to learn about the transmission of magnetic interactions in molecules. Four DFT functionals were employed: B3LYP, BHANDLYP, KT2 and KT3, together with the SOPPA method. Besides, given that the number of non-hydrogen atoms of the supramolecular systems studied here is larger than 50 we applied a locally dense basis set scheme. Our results show that the piling up of a few Watson-Crick base pairs above and below a given pair modifies its NMR spectroscopic parameters by an amount that may be measurable and the percentage of variation does not depend on dispersion. We found that magnetic shieldings are more sensitive than J-couplings, and also that some atoms are more sensitive than others. Stacking affects the shielding of non-hydrogen atoms like nitrogens, that are donors in hydrogen bonds, HBs, and the carbons bonded to them. The amount of variation of these shieldings was found to be from 2% to 5% when the pairs are considered first as isolated, and then, placed in the middle of a sequence of three layers of base pairs. Such a variation becomes vanishingly small when the sequence contains more than three layers, showing that the stacking effect on NMR spectroscopic parameters has a local nature. We have also found a pattern for shieldings. First, equivalent atoms of similar monomers (thymine and adenine, or guanine and cytosine) have similar values of absolute shieldings in isolated pairs, and the amount of variation from isolated pairs to aggregates of a few pairs is also similar, meaning that equivalent atoms are affected in a similar manner by pi-stacking. Second, the hydrogen atoms which belong to hydrogen bonds are more sensitive to the piling up than the non-hydrogen atoms.

  2. Synthesis and base pairing properties of DNA-RNA heteroduplex containing 5-hydroxyuridine.

    PubMed

    Cui, Song; Kim, Yong-Hoon; Jin, Cheng-Hao; Kim, Sang Kook; Rhee, Man-Hee; Kwon, Oh-Shin; Moon, Byung Jo

    2009-06-30

    5-Hydroxyuridine (5-OHU) is a major lesion of uridine and cytosine produced in RNA by various chemical oxidants. To elucidate its biochemical and biophysical effects on RNA replication, the site-specifically modified oligoribonucleotides containing 5-OHU were synthesized with C5-hydroxy-5'-O-DMTr-2'-TBDMS-uridine phosphoramidite using automated solid phase synthesis. The base-pairing properties of nucleotides opposite 5-OHU in 24 mer oligoribonulcleotides with dNTP were studied using three reverse transcriptases (Super-Script(TM)II-, AMV-, MMLV-RT) in cDNA synthesis. Adenine as well as guanine was incorporated preferentially by all reverse transcriptases. In the UV-melting temperature experiment, the results from the relative stabilities of the base pairs were A : 5-OHU > G : 5-OHU > T : 5-OHU approximately C : 5-OHU. Circular Dichroism (CD) studies showed that DNA-RNA containing 5-OHU heteroduplexes exhibit a similar conformation between the A-type RNA and B-type DNA. These results suggest that 5-OHU from oxidative damage was mainly influenced by adenine mismatch.

  3. Effect of phenolic radicals on the geometry and electronic structure of DNA base pairs: computational study

    NASA Astrophysics Data System (ADS)

    Zarei, Mohammad; Seif, Abdolvahab; Azizi, Khaled; Zarei, Mohanna; Bahrami, Jamil

    2016-04-01

    In this paper, we show the reaction of a hydroxyl, phenyl and phenoxy radicals with DNA base pairs by the density functional theory (DFT) calculations. The influence of solvation on the mechanism is also presented by the same DFT calculations under the continuum solvation model. The results showed that hydroxyl, phenyl and phenoxy radicals increase the length of the nearest hydrogen bond of adjacent DNA base pair which is accompanied by decrease in the length of furthest hydrogen bond of DNA base pair. Also, hydroxyl, phenyl and phenoxy radicals influenced the dihedral angle between DNA base pairs. According to the results, hydrogen bond lengths between AT and GC base pairs in water solvent are longer than vacuum. All of presented radicals influenced the structure and geometry of AT and GC base pairs, but phenoxy radical showed more influence on geometry and electronic properties of DNA base pairs compared with the phenyl and hydroxyl radicals.

  4. The Effect of Basepair Mismatch on DNA Strand Displacement.

    PubMed

    Broadwater, D W Bo; Kim, Harold D

    2016-04-12

    DNA strand displacement is a key reaction in DNA homologous recombination and DNA mismatch repair and is also heavily utilized in DNA-based computation and locomotion. Despite its ubiquity in science and engineering, sequence-dependent effects of displacement kinetics have not been extensively characterized. Here, we measured toehold-mediated strand displacement kinetics using single-molecule fluorescence in the presence of a single basepair mismatch. The apparent displacement rate varied significantly when the mismatch was introduced in the invading DNA strand. The rate generally decreased as the mismatch in the invader was encountered earlier in displacement. Our data indicate that a single base pair mismatch in the invader stalls branch migration and displacement occurs via direct dissociation of the destabilized incumbent strand from the substrate strand. We combined both branch migration and direct dissociation into a model, which we term the concurrent displacement model, and used the first passage time approach to quantitatively explain the salient features of the observed relationship. We also introduce the concept of splitting probabilities to justify that the concurrent model can be simplified into a three-step sequential model in the presence of an invader mismatch. We expect our model to become a powerful tool to design DNA-based reaction schemes with broad functionality.

  5. Positional and neighboring base pair effects on the thermodynamic stability of RNA single mismatches.

    PubMed

    Davis, Amber R; Znosko, Brent M

    2010-10-12

    Many naturally occurring RNA structures contain single mismatches, many of which occur near the ends of helices. However, previous thermodynamic studies have focused their efforts on thermodynamically characterizing centrally placed single mismatches. Additionally, algorithms currently used to predict secondary structure from sequence are based on two assumptions for predicting the stability of RNA duplexes containing this motif. It has been assumed that the thermodynamic contribution of small RNA motifs is independent of both its position in the duplex and the identity of the non-nearest neighbors. Thermodynamically characterizing single mismatches three nucleotides from both the 3' and 5' ends (i.e., off-center) of an RNA duplex and comparing these results to those of the same single mismatch-nearest neighbor combination centrally located have allowed for the investigation of these effects. The thermodynamic contributions of 13 single mismatch-nearest neighbor combinations are reported, but only nine combinations are studied at all three duplex positions and are used to determine trends and patterns. In general, the 5'- and 3'-shifted single mismatches are relatively similar, on average, and more favorable in free energy than centrally placed single mismatches. However, close examination and comparison shows there are several associated idiosyncrasies with these identified general trends. These peculiarities may be due, in part, to the identities of the single mismatch, the nearest neighbors, and the non-nearest neighbors, along with the effects of the single mismatch position in the duplex. The prediction algorithm recently proposed by Davis and Znosko [Davis, A. R., and Znosko, B. M. (2008) Biochemistry 47, 10178-10187] is used to predict the thermodynamic parameters of single mismatch contribution, and those values are compared to the measured values presented here. This comparison suggests the proposed model is a good approximation but could be improved by

  6. Molecular cloning of bovine thyroglobulin complementary DNA. Characterization of 2500-base-pair and 1900-base-pair fragments.

    PubMed

    Christophe, D; Brocas, H; Gannon, F; de Martynoff, G; Pays, E; Vassart, G

    1980-10-01

    Double-stranded thyroglobulin complementary DNA (cDNA) was synthesized from purified 33-S bovine thyroglobulin mRNA. This synthetic structural gene has previously been shown to contain three sites for the restriction endonuclease HindIII, yielding two internal fragments of 1900 and 2500 base pairs respectively. Recombinant molecules were prepared by ligating the HindIII-restricted cDNA to the plasmid pBR322 which had been linearized by the same enzyme. When Escherichia coli was transformed with this mixture, it yielded two kinds of colonies each harboring recombinant plasmids containing one of the two cDNA fragments. Both recombinant molecules hybridized specifically to translatable thyroglobulin mRNA. Sequence homology between the two cloned DNAs could not be detected by cross-hybridization experiments; this argues against the existence of internal structural repetition in thyroglobulin subunits. Together, the two cloned DNA fragments represent 55% of the 8000-base-pair double-stranded thyroglobulin DNA.

  7. Single-Molecule Measurements of Synthesis by DNA Polymerase with Base-Pair Resolution

    NASA Astrophysics Data System (ADS)

    Christian, Thomas; Romano, Louis; Rueda, David

    2010-03-01

    The catalytic mechanism of DNA polymerases involves multiple steps that precede and follow the transfer of a nucleotide to the 3'-hydroxyl of the growing DNA chain. Here we report a single-molecule approach to monitor the movement of E. coli DNA polymerase I (Klenow fragment) on a DNA template during DNA synthesis with single base-pair resolution. As each nucleotide is incorporated, the single-molecule F"orster resonance energy transfer intensity drops in discrete steps to values consistent with single nucleotide incorporations. Purines and pyrimidines are incorporated with comparable rates. A mismatched primer-template junction exhibits dynamics consistent with the primer moving into the exonuclease domain, which was used to determine the fraction of primer-termini bound to the exonuclease and polymerase sites. Most interestingly, we observe a structural change following the incorporation of a correctly paired nucleotide, consistent with transient movement of the polymerase past the pre-insertion site or a conformational change in the polymerase. This may represent a previously unobserved step in the mechanism of DNA synthesis that could be part of the proofreading process.

  8. Probing the nature of hydrogen bonds in DNA base pairs.

    PubMed

    Mo, Yirong

    2006-07-01

    Energy decomposition analyses based on the block-localized wave-function (BLW-ED) method are conducted to explore the nature of the hydrogen bonds in DNA base pairs in terms of deformation, Heitler-London, polarization, electron-transfer and dispersion-energy terms, where the Heitler-London energy term is composed of electrostatic and Pauli-exchange interactions. A modest electron-transfer effect is found in the Watson-Crick adenine-thymine (AT), guanine-cytosine (GC) and Hoogsteen adenine-thymine (H-AT) pairs, confirming the weak covalence in the hydrogen bonds. The electrostatic attraction and polarization effects account for most of the binding energies, particularly in the GC pair. Both theoretical and experimental data show that the GC pair has a binding energy (-25.4 kcal mol(-1) at the MP2/6-31G** level) twice that of the AT (-12.4 kcal mol(-1)) and H-AT (-12.8 kcal mol(-1)) pairs, compared with three conventional N-H...O(N) hydrogen bonds in the GC pair and two in the AT or H-AT pair. Although the remarkably strong binding between the guanine and cytosine bases benefits from the opposite orientations of the dipole moments in these two bases assisted by the pi-electron delocalization from the amine groups to the carbonyl groups, model calculations demonstrate that pi-resonance has very limited influence on the covalence of the hydrogen bonds. Thus, the often adopted terminology "resonance-assisted hydrogen bonding (RHAB)" may be replaced with "resonance-assisted binding" which highlights the electrostatic rather than electron-transfer nature of the enhanced stabilization, as hydrogen bonds are usually regarded as weak covalent bonds.

  9. Kinetic selection vs. free energy of DNA base pairing in control of polymerase fidelity.

    PubMed

    Oertell, Keriann; Harcourt, Emily M; Mohsen, Michael G; Petruska, John; Kool, Eric T; Goodman, Myron F

    2016-04-19

    What is the free energy source enabling high-fidelity DNA polymerases (pols) to favor incorporation of correct over incorrect base pairs by 10(3)- to 10(4)-fold, corresponding to free energy differences of ΔΔGinc∼ 5.5-7 kcal/mol? Standard ΔΔG° values (∼0.3 kcal/mol) calculated from melting temperature measurements comparing matched vs. mismatched base pairs at duplex DNA termini are far too low to explain pol accuracy. Earlier analyses suggested that pol active-site steric constraints can amplify DNA free energy differences at the transition state (kinetic selection). A recent paper [Olson et al. (2013)J Am Chem Soc135:1205-1208] used Vent pol to catalyze incorporations in the presence of inorganic pyrophosphate intended to equilibrate forward (polymerization) and backward (pyrophosphorolysis) reactions. A steady-state leveling off of incorporation profiles at long reaction times was interpreted as reaching equilibrium between polymerization and pyrophosphorolysis, yielding apparent ΔG° = -RTlnKeq, indicating ΔΔG° of 3.5-7 kcal/mol, sufficient to account for pol accuracy without need of kinetic selection. Here we perform experiments to measure and account for pyrophosphorolysis explicitly. We show that forward and reverse reactions attain steady states far from equilibrium for wrong incorporations such as G opposite T. Therefore,[Formula: see text]values obtained from such steady-state evaluations ofKeqare not dependent on DNA properties alone, but depend largely on constraints imposed on right and wrong substrates in the polymerase active site.

  10. Mismatch base pairing of the mutagen 8-oxoguanine and its derivatives with adenine: A theoretical search for possible antimutagenic agents

    NASA Astrophysics Data System (ADS)

    Singh, A. K.; Mishra, P. C.

    Molecular geometries of 8-oxoguanine (8OG), those of its substituted derivatives with the substitutions CH2, CF2, CO, CNH, O, and S in place of the N7H7 group, adenine (A), and the base pairs of 8OG and its substituted derivatives with adenine were optimized using the RHF/6-31+G* and B3LYP/6-31+G* methods in gas phase. All the molecules and their hydrogen-bonded complexes were solvated in aqueous media employing the polarized continuum model (PCM) of the self-consistent reaction field (SCRF) theory using the RHF/6-31+G* and B3LYP/6-31+G* methods. The optimized geometrical parameters of the 8OG-A base pair at the RHF/6-31+G* and B3LYP/6-31+G* levels of theory agree satisfactorily with those of an oligonucleotide containing the base pair found from X-ray crystallography. The pattern of hydrogen bonding in the CF2- and O-substituted 8OG-A base pair is of Watson-Crick type and that in the unsubstituted and CH2-, CNH-, and S-substituted base pairs is of Hoogsteen type. In the CO-substituted base pair, the hydrogen bonding pattern is of neither Watson-Crick nor Hoogsteen type. The CF2-substitution appears to introduce steric hindrance for stacking of DNA bases. On the basis of these results, it appears that among all the substituted 8OG molecules considered here, the O-substituted derivative may be useful as an antimutagenic drug. It is, however, subject to experimental verification. Content:text/plain; charset="UTF-8"

  11. DNA Triplet Repeat Expansion and Mismatch Repair

    PubMed Central

    Iyer, Ravi R.; Pluciennik, Anna; Napierala, Marek; Wells, Robert D.

    2016-01-01

    DNA mismatch repair is a conserved antimutagenic pathway that maintains genomic stability through rectification of DNA replication errors and attenuation of chromosomal rearrangements. Paradoxically, mutagenic action of mismatch repair has been implicated as a cause of triplet repeat expansions that cause neurological diseases such as Huntington disease and myotonic dystrophy. This mutagenic process requires the mismatch recognition factor MutSβ and the MutLα (and/or possibly MutLγ) endonuclease, and is thought to be triggered by the transient formation of unusual DNA structures within the expanded triplet repeat element. This review summarizes the current knowledge of DNA mismatch repair involvement in triplet repeat expansion, which encompasses in vitro biochemical findings, cellular studies, and various in vivo transgenic animal model experiments. We present current mechanistic hypotheses regarding mismatch repair protein function in mediating triplet repeat expansions and discuss potential therapeutic approaches targeting the mismatch repair pathway. PMID:25580529

  12. Unstable Hoogsteen base pairs adjacent to echinomycin binding sites within a DNA duplex

    SciTech Connect

    Gilbert, D.E.; van der Marel, G.A.; van Boom, J.H.; Feigon, J. )

    1989-05-01

    The bisintercalation complex present between the DNA octamer (d(ACGTACGT)){sub 2} and the cyclic octadepsipeptide antibiotic echinomycin has been studied by one- and two-dimensional proton NMR, and the results obtained have been compared with the crystal structures of related DNA-echinomycin complexes. Two echinomycins are found to bind cooperatively to each DNA duplex at the CpG steps, with the two quinoxaline rings of each echinomycin bisintercalating between the C{center dot}G and A{center dot}T base pairs. At low temperatures, the A{center dot}T base pairs on either side of the intercalation site adopt the Hoogsteen conformation, as observed in the crystal structures. However, as the temperature is raised, the Hoogsteen base pairs in the interior of the duplex are destabilized and are observed to be exchanging between the Hoogsteen base pair and either an open or a Watson-Crick base-paired state. The terminal A{center dot}T base pairs, which are not as constrained by the helix as the internal base pairs, remain stably Hoogsteen base-paired up to at least 45{degree}C. The implications of these results for the biological role of Hoogsteen base pairs in echinomycin-DNA complexes in vivo are discussed.

  13. Development of artificial nucleic acid that recognizes a CG base pair in triplex DNA formation.

    PubMed

    Hari, Yoshiyuki

    2013-01-01

    An oligonucleotide that can form a triplex with double-stranded DNA is called a triplex-forming oligonucleotide (TFO). TFOs have gained considerable attention because of their potential as gene targeting tools. However, triplex DNA formation involves inherent problems for practical use. The most important problem is that natural nucleotides in TFO do not have sufficient affinity and base pair-selectivity to pyrimidine-purine base pair, like a CG or TA base pair, within dsDNA. This suggests that dsDNA region including a CG or TA base pair cannot be targeted. Therefore, artificial nucleotides, especially with non-natural nucleobases, capable of direct recognition of a CG or TA base pair via hydrogen bond formation have been developed; however, nucleotides with better selectivity and stronger affinity are necessary for implementing this dsDNA-targeting technology using TFOs. Under such a background, we considered that facile and efficient synthesis of various nucleobase derivatives in TFOs would be useful for finding an ideal nucleobase for recognition of a CG or TA base pair because detailed and rational exploration of nucleobase structures is facilitated. Recently, to develop a nucleobase recognizing a CG base pair, we have used post-elongation modification, i.e., modification after oligonucleotide synthesis, for the facile synthesis of nucleobase derivatives. This review mainly summarizes our recent findings on the development of artificial nucleobases and nucleotides for recognition of a CG base pair in triplexes formed between dsDNA and TFOs.

  14. NMR study of oligonucleotides containing base pair mismatches and a human growth hormone peptide for the determination of solution structures

    SciTech Connect

    Roongta, V.A.

    1989-01-01

    Formation of unusual basepairs in DNA for random mutations in DNA was proposed in the sixties. These mismatches arise due to errors in replication, and from deamination of the 5-methylcytosine. The author's interest in studying mismatches and other oligonucleotides has been two fold. One is related to {sup 31}P chemical shifts and the backbone structure of oligonucleotides. He wanted to find out the significance of the dispersion of {sup 31}p chemical shifts in oligonucleotides. He wished to address whether this dispersion in {sup 31}P chemical shifts is related to global structural parameters of oligonucleotides like helix twist and whether he can prove the relationship between {sup 31}P chemical shifts and the backbone torsional angles epsilon and zeta. How does a mismatch affect {sup 31}P chemical shifts and the backbone torsional angle The second interest is related to solving the three dimensional structure of these biopolymers by using NMR data (NOESY distances) and computer simulations. His major study of these mismatches has been in the assignments of the protons resonances and the phosphorus resonances by 2D NMR. He has also tried to answer the question about the relationships between {sup 31}P chemical shifts and global parameters for DNA such as the helix twist. He has made substantial progress in determination of J(H3{prime}-P) coupling constants by 2D NMR and also in determining the relationship between the SIP chemical shifts and the backbone torsional angles by using the mismatch dodecamer sequences and the tetradecamer sequences. The 2D NMR data for the GG and GT mismatch have been used to determine three dimensional structures by using distance restrained molecular dynamics. The second project involved studying a 28 residue synthetic peptide by NMR.

  15. Bifacial Base-Pairing Behaviors of 5-Hydroxyuracil DNA Bases through Hydrogen Bonding and Metal Coordination.

    PubMed

    Takezawa, Yusuke; Nishiyama, Kotaro; Mashima, Tsukasa; Katahira, Masato; Shionoya, Mitsuhiko

    2015-10-12

    A novel bifacial ligand-bearing nucleobase, 5-hydroxyuracil (U(OH) ), which forms both a hydrogen-bonded base pair (U(OH) -A) and a metal-mediated base pair (U(OH) -M-U(OH) ) has been developed. The U(OH) -M-U(OH) base pairs were quantitatively formed in the presence of lanthanide ions such as Gd(III) when U(OH) -U(OH) pairs were consecutively incorporated into DNA duplexes. This result established metal-assisted duplex stabilization as well as DNA-templated assembly of lanthanide ions. Notably, a duplex possessing U(OH) -A base pairs was destabilized by addition of Gd(III) ions. This observation suggests that the hybridization behaviors of the U(OH) -containing DNA strands are altered by metal complexation. Thus, the U(OH) nucleobase with a bifacial base-pairing property holds great promise as a component for metal-responsive DNA materials.

  16. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

    PubMed

    Brovarets', O O

    2013-01-01

    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  17. Mismatch repair balances leading and lagging strand DNA replication fidelity.

    PubMed

    Lujan, Scott A; Williams, Jessica S; Pursell, Zachary F; Abdulovic-Cui, Amy A; Clark, Alan B; Nick McElhinny, Stephanie A; Kunkel, Thomas A

    2012-01-01

    The two DNA strands of the nuclear genome are replicated asymmetrically using three DNA polymerases, α, δ, and ε. Current evidence suggests that DNA polymerase ε (Pol ε) is the primary leading strand replicase, whereas Pols α and δ primarily perform lagging strand replication. The fact that these polymerases differ in fidelity and error specificity is interesting in light of the fact that the stability of the nuclear genome depends in part on the ability of mismatch repair (MMR) to correct different mismatches generated in different contexts during replication. Here we provide the first comparison, to our knowledge, of the efficiency of MMR of leading and lagging strand replication errors. We first use the strand-biased ribonucleotide incorporation propensity of a Pol ε mutator variant to confirm that Pol ε is the primary leading strand replicase in Saccharomyces cerevisiae. We then use polymerase-specific error signatures to show that MMR efficiency in vivo strongly depends on the polymerase, the mismatch composition, and the location of the mismatch. An extreme case of variation by location is a T-T mismatch that is refractory to MMR. This mismatch is flanked by an AT-rich triplet repeat sequence that, when interrupted, restores MMR to > 95% efficiency. Thus this natural DNA sequence suppresses MMR, placing a nearby base pair at high risk of mutation due to leading strand replication infidelity. We find that, overall, MMR most efficiently corrects the most potentially deleterious errors (indels) and then the most common substitution mismatches. In combination with earlier studies, the results suggest that significant differences exist in the generation and repair of Pol α, δ, and ε replication errors, but in a generally complementary manner that results in high-fidelity replication of both DNA strands of the yeast nuclear genome.

  18. Constructing optimal backbone segments for joining fixed DNA base pairs.

    PubMed Central

    Mazur, J; Jernigan, R L; Sarai, A

    1996-01-01

    A method is presented to link a sequence of space-fixed base pairs by the sugar-phosphate segments of single nucleotides and to evaluate the effects in the backbone caused by this positioning of the bases. The entire computational unit comprises several nucleotides that are energy-minimized, subject to constraints imposed by the sugar-phosphate backbone segments being anchored to space-fixed base pairs. The minimization schemes are based on two stages, a conjugate gradient method followed by a Newton-Raphson algorithm. Because our purpose is to examine the response, or relaxation, of an artificially stressed backbone, it is essential to be able to obtain, as closely as possible, a lowest minimum energy conformation of the backbone segment in conformational space. For this purpose, an algorithm is developed that leads to the generation of an assembly of many local energy minima. From these sets of local minima, one conformation corresponding to the one with the lowest minimum is then selected and designated to represent the backbone segment at its minimum. The effective electrostatic potential of mean force is expressed in terms of adjustable parameters that incorporate solvent screening action in the Coulombic interactions between charged backbone atoms; these parameters are adjusted to obtain the best fit of the nearest-neighbor phosphorous atoms in an x-ray structure. PMID:8874023

  19. Unprecedented dinuclear silver(I)-mediated base pair involving the DNA lesion 1,N(6)-ethenoadenine.

    PubMed

    Mandal, Soham; Hepp, Alexander; Müller, Jens

    2015-02-28

    The DNA lesion 1,N(6)-ethenoadenine (εA) has been investigated with respect to its metal-binding properties. A synthetic DNA duplex comprising an εA : εA mispair readily forms doubly silver(I)-mediated base pairs εA-Ag(I)2-εA, representing the first example for a dinuclear metal-mediated homo base pair of a purine derivative. It also constitutes the first example for a Hoogsteen-type metal-mediated homo base pair within a B-DNA duplex.

  20. Matching base-pair number dependence of the kinetics of DNA-DNA hybridization studied by surface plasmon fluorescence spectroscopy.

    PubMed

    Tawa, Keiko; Yao, Danfeng; Knoll, Wolfgang

    2005-08-15

    Two single-stranded DNA oligonucleotides consisting of complementary base-pairs can form double strands. This phenomenon is well studied in solutions, however, in order to clarify the physical mechanism of the hybridization occurring at a solid/solution interface, we studied the kinetics by surface plasmon fluorescence spectroscopy (SPFS): one single-stranded oligo-DNA (probe-DNA) was immobilized on the substrate, the other one (target-DNA) labelled with a fluorescent probe was added to the flow cell. After hybridization, the chromophores could be excited by the surface plasmon mode and their fluorescence detected with high sensitivity. The dependence of the k(on) and k(off) rate constants on the length of the hybridizing oligonucleotides was investigated by using a MM0 series (no mismatch) and the kinetics was found to be well described by a Langmuir adsorption model. From these measurements we found that also in the case of surface hybridization the affinity of the duplexes decreases as the number of matching base-pairs decreases from 15 to 10. In order to show that SPFS is the powerful technique with high sensitivity, the hybridization process for mixed target-oligos was measured by SPFS and analyzed by an expanded Langmuir model in which two components of target-oligo can bind to probe-DNA at the sensor surface competitively. Two sets of the k(on) and k(off) obtained from the experiment are successfully consistent with the k(on) and k(off) obtained from experiments for single (pure) target-DNA.

  1. Flexibility of short DNA helices with finite-length effect: From base pairs to tens of base pairs.

    PubMed

    Wu, Yuan-Yan; Bao, Lei; Zhang, Xi; Tan, Zhi-Jie

    2015-03-28

    Flexibility of short DNA helices is important for the biological functions such as nucleosome formation and DNA-protein recognition. Recent experiments suggest that short DNAs of tens of base pairs (bps) may have apparently higher flexibility than those of kilo bps, while there is still the debate on such high flexibility. In the present work, we have studied the flexibility of short DNAs with finite-length of 5-50 bps by the all-atomistic molecular dynamics simulations and Monte Carlo simulations with the worm-like chain model. Our microscopic analyses reveal that short DNAs have apparently high flexibility which is attributed to the significantly strong bending and stretching flexibilities of ∼6 bps at each helix end. Correspondingly, the apparent persistence length lp of short DNAs increases gradually from ∼29 nm to ∼45 nm as DNA length increases from 10 to 50 bps, in accordance with the available experimental data. Our further analyses show that the short DNAs with excluding ∼6 bps at each helix end have the similar flexibility with those of kilo bps and can be described by the worm-like chain model with lp ∼ 50 nm.

  2. Flexibility of short DNA helices with finite-length effect: From base pairs to tens of base pairs

    NASA Astrophysics Data System (ADS)

    Wu, Yuan-Yan; Bao, Lei; Zhang, Xi; Tan, Zhi-Jie

    2015-03-01

    Flexibility of short DNA helices is important for the biological functions such as nucleosome formation and DNA-protein recognition. Recent experiments suggest that short DNAs of tens of base pairs (bps) may have apparently higher flexibility than those of kilo bps, while there is still the debate on such high flexibility. In the present work, we have studied the flexibility of short DNAs with finite-length of 5-50 bps by the all-atomistic molecular dynamics simulations and Monte Carlo simulations with the worm-like chain model. Our microscopic analyses reveal that short DNAs have apparently high flexibility which is attributed to the significantly strong bending and stretching flexibilities of ˜6 bps at each helix end. Correspondingly, the apparent persistence length lp of short DNAs increases gradually from ˜29 nm to ˜45 nm as DNA length increases from 10 to 50 bps, in accordance with the available experimental data. Our further analyses show that the short DNAs with excluding ˜6 bps at each helix end have the similar flexibility with those of kilo bps and can be described by the worm-like chain model with lp ˜ 50 nm.

  3. Flexibility of short DNA helices with finite-length effect: From base pairs to tens of base pairs

    SciTech Connect

    Wu, Yuan-Yan; Bao, Lei; Zhang, Xi; Tan, Zhi-Jie

    2015-03-28

    Flexibility of short DNA helices is important for the biological functions such as nucleosome formation and DNA-protein recognition. Recent experiments suggest that short DNAs of tens of base pairs (bps) may have apparently higher flexibility than those of kilo bps, while there is still the debate on such high flexibility. In the present work, we have studied the flexibility of short DNAs with finite-length of 5–50 bps by the all-atomistic molecular dynamics simulations and Monte Carlo simulations with the worm-like chain model. Our microscopic analyses reveal that short DNAs have apparently high flexibility which is attributed to the significantly strong bending and stretching flexibilities of ∼6 bps at each helix end. Correspondingly, the apparent persistence length l{sub p} of short DNAs increases gradually from ∼29 nm to ∼45 nm as DNA length increases from 10 to 50 bps, in accordance with the available experimental data. Our further analyses show that the short DNAs with excluding ∼6 bps at each helix end have the similar flexibility with those of kilo bps and can be described by the worm-like chain model with l{sub p} ∼ 50 nm.

  4. DNA base pair hybridization and water-mediated metastable structures studied by molecular dynamics simulations.

    PubMed

    Qi, Wenpeng; Song, Bo; Lei, Xiaoling; Wang, Chunlei; Fang, Haiping

    2011-11-08

    The base pair hybridization of a DNA segment was studied using molecular dynamics simulation. The results show the obvious correlation between the probability of successful hybridization and the accessible surface area to water of two successive base pairs, including the unpaired base pair adjacent to paired base pair and this adjacent paired base pair. Importantly, two metastable structures in an A-T base pair were discovered by the analysis of the free energy landscape. Both structures involved addition of a water molecule to the linkage between the two nucleobases in one base pair. The existence of the metastable structures provide potential barriers to the Watson-Crick base pair, and numerical simulations show that those potential barriers can be surmounted by thermal fluctuations at higher temperatures. These studies contribute an important step toward the understanding of the mechanism in DNA hybridization, particularly the effect of temperature on DNA hybridization and polymerase chain reaction. These observations are expected to be helpful for facilitating experimental bio/nanotechnology designs involving fast hybridization.

  5. An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules

    PubMed Central

    Kimoto, Michiko; Kawai, Rie; Mitsui, Tsuneo; Yokoyama, Shigeyuki; Hirao, Ichiro

    2009-01-01

    Toward the expansion of the genetic alphabet, we present an unnatural base pair system for efficient PCR amplification, enabling the site-specific incorporation of extra functional components into DNA. This system can be applied to conventional PCR protocols employing DNA templates containing unnatural bases, natural and unnatural base triphosphates, and a 3′→5′ exonuclease-proficient DNA polymerase. For highly faithful and efficient PCR amplification involving the unnatural base pairing, we identified the natural-base sequences surrounding the unnatural bases in DNA templates by an in vitro selection technique, using a DNA library containing the unnatural base. The system facilitates the site-specific incorporation of a variety of modified unnatural bases, linked with functional groups of interest, into amplified DNA. DNA fragments (0.15 amol) containing the unnatural base pair can be amplified 107-fold by 30 cycles of PCR, with <1% total mutation rate of the unnatural base pair site. Using the system, we demonstrated efficient PCR amplification and functionalization of DNA fragments for the extremely sensitive detection of zeptomol-scale target DNA molecules from mixtures with excess amounts (pmol scale) of foreign DNA species. This unnatural base pair system will be applicable to a wide range of DNA/RNA-based technologies. PMID:19073696

  6. Bifunctional rhodium intercalator conjugates as mismatch-directing DNA alkylating agents.

    PubMed

    Schatzschneider, Ulrich; Barton, Jacqueline K

    2004-07-21

    A conjugate of a DNA mismatch-specific rhodium intercalator, containing the bulky chrysenediimine ligand, and an aniline mustard has been prepared, and targeting of mismatches in DNA by this conjugate has been examined. The preferential alkylation of mismatched over fully matched DNA is found by a mobility shift assay at concentrations where untethered organic mustards show little reaction. The binding site of the Rh intercalator was determined by DNA photocleavage, and the position of covalent modification was established on the basis of the enhanced depurination associated with N-alkylation. The site-selective alkylation at mismatched DNA renders these conjugates useful tools for the covalent tagging of DNA base pair mismatches and new chemotherapeutic design.

  7. Hoogsteen base pairs proximal and distal to echinomycin binding sites on DNA

    SciTech Connect

    Mendel, D.; Dervan, P.B.

    1987-02-01

    Forms of the DNA double helix containing non-Watson-Crick base-pairing have been discovered recently based on x-ray diffraction analysis of quionoxaline antibiotic-oligonucleotide complexes. In an effort to find evidence for Hoogsteen base-pairing at quinoxaline-binding sites in solution, chemical footprinting (differential cleavage reactivity) of echinomycin bound to DNA restriction fragments was examined. The authors report that purines (A>G) in the first and/or fourth base-pair positions of occupied echinomycin-binding sites are hyperreactive to diethyl pyrocarbonate. The correspondence of the solid-state data and the sites of diethyl pyrocarbonate hyperreactivity suggests that diethyl pyrocarbonate may be a sensitive reagent for the detection of Hoogsteen base-pairing in solution. Moreover, a 12-base-pair segment of alternating A-T DNA, which is 6 base pairs away from the nearest strong echinomycin-binding site, is also hyperreactive to diethyl pyrocarbonate in the presence of echinomycin. This hyperreactive segment may be an altered form of right-handed DNA that is entirely Hoogsteen base-paired.

  8. Raising the barrier for photoinduced DNA charge injection with a cyclohexyl artificial base pair.

    PubMed

    Singh, Arunoday P N; Harris, Michelle A; Young, Ryan M; Miller, Stephen A; Wasielewski, Michael R; Lewis, Frederick D

    2015-01-01

    The effects of an artificial cyclohexyl base pair on the quantum yields of fluorescence and dynamics of charge separation and charge recombination have been investigated for several synthetic DNA hairpins. The hairpins possess stilbenedicarboxamide, perylenediimide, or naphthalenediimide linkers and base-paired stems. In the absence of the artificial base pair hole injection into both adenine and guanine purine bases is exergonic and irreversible, except in the case of stilbene with adenine for which it is slightly endergonic and reversible. Insertion of the artificial base pair renders hole injection endergonic or isoergonic except in the case of the powerful naphthalene acceptor for which it remains exergonic. Both hole injection and charge recombination are slower for the naphthalene acceptor in the presence of the artificial base pair than in its absence. The effect of an artificial base pair on charge separation and charge recombination in hairpins possessing stilbene and naphthalene acceptor linkers and a stilbenediether donor capping group has also been investigated. In the case of the stilbene acceptor-stilbene donor capped hairpins photoinduced charge separation across six base pairs is efficient in the absence of the artificial base pair but does not occur in its presence. In the case of the naphthalene acceptor-stilbene donor capped hairpins the artificial base pair slows but does not stop charge separation and charge recombination, leading to the formation of long-lived charge separated states.

  9. Hydrophobic, Non-Hydrogen-Bonding Bases and Base Pairs in DNA

    PubMed Central

    Schweitzer, Barbara A.; Kool, Eric T.

    2009-01-01

    We report the properties of hydrophobic isosteres of pyrimidines and purines in synthetic DNA duplexes. Phenyl nucleosides 1 and 2 are nonpolar isosteres of the natural thymidine nucleoside, and indole nucleoside 3 is an analog of the complementary purine 2-aminodeoxyadenosine. The nucleosides were incorporated into synthetic oligodeoxynucleotides and were paired against each other and against the natural bases. Thermal denaturation experiments were used to measure the stabilities of the duplexes at neutral pH. It is found that the hydrophobic base analogs are nonselective in pairing with the four natural bases but selective for pairing with each other rather than with the natural bases. For example, compound 2 selectively pairs with itself rather than with A, T, G, or C; the magnitude of this selectivity is found to be 6.5–9.3 °C in Tm or 1.5–1.8 kcal/mol in free energy (25 °C). All possible hydrophobic pairing combinations of 1, 2, and 3 were examined. Results show that the pairing affinity depends on the nature of the pairs and on position in the duplex. The highest affinity pairs are found to be the 1–1 and 2–2 self-pairs and the 1–2 heteropair. The best stabilization occurs when the pairs are placed at the ends of duplexes rather than internally; the internal pairs may be destabilized by imperfect steric mimicry which leads to non-ideal duplex structure. In some cases the hydrophobic pairs are significantly stabilizing to the DNA duplex; for example, when situated at the end of a duplex, the 1–1 pair is more stabilizing than a T–A pair. When situated internally, the affinity of the 1–1 pair is the same as, or slightly better than, the analogous T–T mismatch pair, which is known to have two hydrogen bonds. The studies raise the possibility that hydrogen bonds may not always be required for the formation of stable duplex DNA-like structure. In addition, the results point out the importance of solvation and desolvation in natural base pairing

  10. Sequence dependency of canonical base pair opening in the DNA double helix.

    PubMed

    Lindahl, Viveca; Villa, Alessandra; Hess, Berk

    2017-04-01

    The flipping-out of a DNA base from the double helical structure is a key step of many cellular processes, such as DNA replication, modification and repair. Base pair opening is the first step of base flipping and the exact mechanism is still not well understood. We investigate sequence effects on base pair opening using extensive classical molecular dynamics simulations targeting the opening of 11 different canonical base pairs in two DNA sequences. Two popular biomolecular force fields are applied. To enhance sampling and calculate free energies, we bias the simulation along a simple distance coordinate using a newly developed adaptive sampling algorithm. The simulation is guided back and forth along the coordinate, allowing for multiple opening pathways. We compare the calculated free energies with those from an NMR study and check assumptions of the model used for interpreting the NMR data. Our results further show that the neighboring sequence is an important factor for the opening free energy, but also indicates that other sequence effects may play a role. All base pairs are observed to have a propensity for opening toward the major groove. The preferred opening base is cytosine for GC base pairs, while for AT there is sequence dependent competition between the two bases. For AT opening, we identify two non-canonical base pair interactions contributing to a local minimum in the free energy profile. For both AT and CG we observe long-lived interactions with water and with sodium ions at specific sites on the open base pair.

  11. Computational DNA hole spectroscopy: A new tool to predict mutation hotspots, critical base pairs, and disease ‘driver’ mutations

    PubMed Central

    Suárez, Martha Y.; Villagrán; Miller, John H.

    2015-01-01

    We report on a new technique, computational DNA hole spectroscopy, which creates spectra of electron hole probabilities vs. nucleotide position. A hole is a site of positive charge created when an electron is removed. Peaks in the hole spectrum depict sites where holes tend to localize and potentially trigger a base pair mismatch during replication. Our studies of mitochondrial DNA reveal a correlation between L-strand hole spectrum peaks and spikes in the human mutation spectrum. Importantly, we also find that hole peak positions that do not coincide with large variant frequencies often coincide with disease-implicated mutations and/or (for coding DNA) encoded conserved amino acids. This enables combining hole spectra with variant data to identify critical base pairs and potential disease ‘driver’ mutations. Such integration of DNA hole and variance spectra could ultimately prove invaluable for pinpointing critical regions of the vast non-protein-coding genome. An observed asymmetry in correlations, between the spectrum of human mtDNA variations and the L- and H-strand hole spectra, is attributed to asymmetric DNA replication processes that occur for the leading and lagging strands. PMID:26310834

  12. Computational DNA hole spectroscopy: A new tool to predict mutation hotspots, critical base pairs, and disease 'driver' mutations.

    PubMed

    Villagrán, Martha Y Suárez; Miller, John H

    2015-08-27

    We report on a new technique, computational DNA hole spectroscopy, which creates spectra of electron hole probabilities vs. nucleotide position. A hole is a site of positive charge created when an electron is removed. Peaks in the hole spectrum depict sites where holes tend to localize and potentially trigger a base pair mismatch during replication. Our studies of mitochondrial DNA reveal a correlation between L-strand hole spectrum peaks and spikes in the human mutation spectrum. Importantly, we also find that hole peak positions that do not coincide with large variant frequencies often coincide with disease-implicated mutations and/or (for coding DNA) encoded conserved amino acids. This enables combining hole spectra with variant data to identify critical base pairs and potential disease 'driver' mutations. Such integration of DNA hole and variance spectra could ultimately prove invaluable for pinpointing critical regions of the vast non-protein-coding genome. An observed asymmetry in correlations, between the spectrum of human mtDNA variations and the L- and H-strand hole spectra, is attributed to asymmetric DNA replication processes that occur for the leading and lagging strands.

  13. Structural, electronic, and optical properties of metallo base pairs in duplex DNA: a theoretical insight.

    PubMed

    Samanta, Pralok K; Manna, Arun K; Pati, Swapan K

    2012-11-01

    Using density functional theory calculations, we investigated the structural, energetic, electronic, and optical properties of recently synthesized duplex DNA containing metal-mediated base pairs. The studied duplex DNA consists of three imidazole (Im) units linked through metal (Im-M-Im, M = metal) and four flanking A:T base pairs (two on each side). We examined the role of artificial base pairing in the presence of two distinctive metal ions, diamagnetic Ag(+) and magnetic Cu(2+) ions, on the stability of duplex DNA. We found that metal-mediated base pairs form stable duplex DNA by direct metal ion coordination to the Im bases. Our results suggest a higher binding stability of base pairing mediated by Cu(2+) ions than by Ag(+) ions, which is attributed to a larger extent of orbital hybridization. We furthermore found that DNA modified with Im-Ag(+)-Im shows the low-energy optical absorption characteristic of π-π*orbital transition of WC A:T base pairs. On the other hand, we found that the low-energy optical absorption peaks for DNA modified with Im-Cu(2+)-Im originate from spin-spin interactions. Additionally, this complex exhibits weak ferromagnetic coupling between Cu(2+) ions and strong spin polarization, which could be used for memory devices. Moreover, analyzing the role of counter ions (Na(+)) and the presence of explicit water molecules on the structural stability and electronic properties of the DNA duplex modified with Im-Ag(+)-Im, we found that the impact of these two factors is negligible. Our results are fruitful for understanding the experimental data and suggest a potential route for constructing effective metal-mediated base pairs in duplex DNA for optoelectronic applications.

  14. Bubbles and mismatches in DNA melting

    NASA Astrophysics Data System (ADS)

    Zeng, Yan

    We obtained the first experimental measurements of the length of the denaturation bubble appearing in the DNA melting transition. This is achieved by working with short oligomers which can form only one bubble per molecule. We used sequences clamped at the ends with GC pairs (strong binding) and possessing AT rich (weaker binding) middle regions in order to have the bubble open in the middle, and sequences with GC pairs at one end and AT pairs at the other end in order to form the bubble at the end. Use a quenching technique to trap the bubble states, we could measure the length of the bubble and the relative weights of the bubble states as a function of temperature. We found that the average bubble size <ℓ> grows for increasing temperature, but reaches a plateau at a length of order B (the length of the AT region). After the plateau, the average bubble length jumps to 1. This jump of the order parameter is a signature of a discontinuous transition, one where the bubble size remains finite up to critical temperature of strand separation. When B increases, the extension of the plateau shrinks. This suggests a continuous transition for a homogenous sequence (e.g. all AT base pairs) in the thermodynamic limit. The presence of the bubble states decreases as B is reduced. By plotting the average statistical weight of the bubble states vs. B, we obtained the first direct measurement of the nucleation size of the bubble. For a bubble flanked by double-stranded regions, the nucleation size is ˜ 3 bases. For bubbles opening at the ends of the molecule there is no nucleation threshold. The measured statistical weights of the bubble states agree with the predictions of the widely used thermodynamic models in the case of unzipping from the ends; however, internal bubble states are not completely described by the model. For the first time we show experimentally that a single mismatch transforms a transition with many intermediates into a nearly two-state transition for

  15. Theory of tunneling across hydrogen-bonded base pairs for DNA recognition and sequencing

    NASA Astrophysics Data System (ADS)

    Lee, Myeong H.; Sankey, Otto F.

    2009-05-01

    We present the results of first-principles calculations for the electron tunnel current through hydrogen-bonded DNA base pairs and for (deoxy)nucleoside-nucleobase pairs. Electron current signals either through a base pair or through a deoxynucleoside-nucleobase pair are a potential mechanism for recognition or identification of the DNA base on a single-stranded DNA polymer. Four hydrogen-bonded complexes are considered: guanine-cytosine, diaminoadenine-thymine, adenine-thymine, and guanine-thymine. First, the electron tunneling properties are examined through their complex band structure (CBS) and the metal contact’s Fermi-level alignment. For gold contacts, the metal Fermi level lies near the highest occupied molecular orbital for all DNA base pairs. The decay constant determined by the complex band structure at the gold Fermi level shows that tunnel current decays more slowly for base pairs with three hydrogen bonds (guanine-cytosine and diaminoadenine-thymine) than for base pairs with two hydrogen bonds (adenine-thymine and guanine-thymine). The decay length and its dependence on hydrogen-bond length are examined. Second, the conductance is computed using density functional theory Green’s-function scattering methods and these results agree with estimates made from the tunneling decay constant obtained from the CBS. Changing from a base pair to a deoxynucleoside-nucleobase complex shows a significant decrease in conductance. It also becomes difficult to distinguish the current signal by only the number of hydrogen bonds.

  16. DNA terminal base pairs have weaker hydrogen bonds especially for AT under low salt concentration

    NASA Astrophysics Data System (ADS)

    Ferreira, Izabela; Amarante, Tauanne D.; Weber, Gerald

    2015-11-01

    DNA base pairs are known to open more easily at the helix terminal, a process usually called end fraying, the details of which are still poorly understood. Here, we present a mesoscopic model calculation based on available experimental data where we consider separately the terminal base pairs of a DNA duplex. Our results show an important reduction of hydrogen bond strength for terminal cytosine-guanine (CG) base pairs which is uniform over the whole range of salt concentrations, while for AT base pairs, we obtain a nearly 1/3 reduction but only at low salt concentrations. At higher salt concentrations, terminal adenine-thymine (AT) pair has almost the same hydrogen bond strength than interior bases. The calculated terminal stacking interaction parameters display some peculiarly contrasting behavior. While there is mostly no perceptible difference to internal stacking, for some cases, we observe an unusually strong dependence with salt concentration which does not appear follow any pattern or trend.

  17. Self-organised criticality in base-pair breathing in DNA with a defect

    NASA Astrophysics Data System (ADS)

    Duduială, Ciprian-Ionuţ; Wattis, Jonathan A. D.; Laughton, Charles A.

    2011-08-01

    We analyse base-pair breathing in a DNA sequence of 12 base-pairs with a defective base at its centre. We use both all-atom molecular dynamics (MD) simulations and a system of stochastic differential equations (SDEs). In both cases, Fourier analysis of the trajectories reveals self-organised critical behaviour in the breathing of base-pairs. The Fourier Transforms (FTs) of the inter-base distances show power-law behaviour with gradients close to -1. The scale-invariant behaviour we have found provides evidence for the view that base-pair breathing corresponds to the nucleation stage of large-scale DNA opening (or ‘melting’) and that this process is a (second-order) phase transition. Although the random forces in our SDE system were introduced as white noise, FTs of the displacements exhibit pink noise, as do the displacements in the AMBER/MD simulations.

  18. Stability and proton transfer in DNA base pairs of AMD473-DNA adduct

    NASA Astrophysics Data System (ADS)

    Sarmah, Pubalee; Deka, Ramesh C.

    2011-05-01

    We investigate the energetics of four different adducts of cisplatin analogue cis-[PtCl 2(NH 3)(2-picoline)] (AMD473) with a duplex DNA using DFT/ONIOM methods to probe their stabilities. Further, we study the possibilities of proton transfer between DNA base pairs of the most stable drug-DNA adduct. The adduct b(2-picoline trans to 3'-G and 2-methyl group directs to the DNA major groove) is found to be the most stable configuration among all the possible adducts. From the proton transfer analysis we found that the single proton transfer between N1 position of guanine (G) and N3 position of cytosine (C) of each GC pair gives a structure energetically as stable as the original one.

  19. Protein−DNA binding in the absence of specific base-pair recognition

    PubMed Central

    Afek, Ariel; Schipper, Joshua L.; Horton, John; Gordân, Raluca; Lukatsky, David B.

    2014-01-01

    Until now, it has been reasonably assumed that specific base-pair recognition is the only mechanism controlling the specificity of transcription factor (TF)−DNA binding. Contrary to this assumption, here we show that nonspecific DNA sequences possessing certain repeat symmetries, when present outside of specific TF binding sites (TFBSs), statistically control TF−DNA binding preferences. We used high-throughput protein−DNA binding assays to measure the binding levels and free energies of binding for several human TFs to tens of thousands of short DNA sequences with varying repeat symmetries. Based on statistical mechanics modeling, we identify a new protein−DNA binding mechanism induced by DNA sequence symmetry in the absence of specific base-pair recognition, and experimentally demonstrate that this mechanism indeed governs protein−DNA binding preferences. PMID:25313048

  20. Anharmonic Vibrational Signatures of DNA Bases and Watson-Crick Base Pairs

    NASA Astrophysics Data System (ADS)

    Wang, Gui-xiu; Ma, Xiao-yan; Wang, Jian-ping

    2009-12-01

    Changes of molecular structure and associated charge distributions, and changes of anharmonic vibrational parameters from DNA base monomers to the Watson-Crick base pairs, have been investigated at the density functional theory level. Through examination of the NH2, N-H, and C = O stretching vibrational modes that are involved in the multiple H-bonds in the base pairs, sensitivity of their diagonal and off-diagonal anharmonicities, as well as anharmonic vibrational couplings, to the structure change are predicted. Our results reveal the intrinsic connection between the anharmonic vibrational potentials, H-bonding, and electrostatic interactions in DNA bases.

  1. Determinants of DNA mismatch recognition within the polymerase domain of the Klenow fragment.

    PubMed

    Thompson, Elizabeth H Z; Bailey, Michael F; van der Schans, Edwin J C; Joyce, Catherine M; Millar, David P

    2002-01-22

    The Klenow fragment of Escherichia coli DNA polymerase I catalyzes template-directed synthesis of DNA and uses a separate 3'-5' exonuclease activity to edit misincorporated bases. The polymerase and exonuclease activities are contained in separate structural domains. In this study, nine Klenow fragment derivatives containing mutations within the polymerase domain were examined for their interaction with model primer-template duplexes. The partitioning of the DNA primer terminus between the polymerase and 3'-5' exonuclease active sites of the mutant proteins was assessed by time-resolved fluorescence anisotropy, utilizing a dansyl fluorophore attached to the DNA. Mutation of N845 or R668 disrupted favorable interactions between the Klenow fragment and a duplex containing a matched terminal base pair but had little effect when the terminus was mismatched. Thus, N845 and R668 are required for recognition of correct terminal base pairs in the DNA substrate. Mutation of N675, R835, R836, or R841 resulted in tighter polymerase site binding of DNA, suggesting that the side chains of these residues induce strain in the DNA and/or protein backbone. A double mutant (N675A/R841A) showed an even greater polymerase site partitioning than was displayed by either single mutation, indicating that such strain is additive. In both groups of mutant proteins, the ability to discriminate between duplexes containing matched or mismatched base pairs was impaired. In contrast, mutation of K758 or Q849 had no effect on partitioning relative to wild type, regardless of DNA mismatch character. These results demonstrate that DNA mismatch recognition is dependent on specific amino acid residues within the polymerase domain and is not governed solely by thermodynamic differences between correct and mismatched base pairs. Moreover, this study suggests a mechanism whereby the Klenow fragment is able to recognize polymerase errors following a misincorporation event, leading to their eventual

  2. Sequence dependency of canonical base pair opening in the DNA double helix

    PubMed Central

    Villa, Alessandra

    2017-01-01

    The flipping-out of a DNA base from the double helical structure is a key step of many cellular processes, such as DNA replication, modification and repair. Base pair opening is the first step of base flipping and the exact mechanism is still not well understood. We investigate sequence effects on base pair opening using extensive classical molecular dynamics simulations targeting the opening of 11 different canonical base pairs in two DNA sequences. Two popular biomolecular force fields are applied. To enhance sampling and calculate free energies, we bias the simulation along a simple distance coordinate using a newly developed adaptive sampling algorithm. The simulation is guided back and forth along the coordinate, allowing for multiple opening pathways. We compare the calculated free energies with those from an NMR study and check assumptions of the model used for interpreting the NMR data. Our results further show that the neighboring sequence is an important factor for the opening free energy, but also indicates that other sequence effects may play a role. All base pairs are observed to have a propensity for opening toward the major groove. The preferred opening base is cytosine for GC base pairs, while for AT there is sequence dependent competition between the two bases. For AT opening, we identify two non-canonical base pair interactions contributing to a local minimum in the free energy profile. For both AT and CG we observe long-lived interactions with water and with sodium ions at specific sites on the open base pair. PMID:28369121

  3. Tolerance of base pair size and shape in postlesion DNA synthesis.

    PubMed

    Gahlon, Hailey L; Schweizer, W Bernd; Sturla, Shana J

    2013-05-01

    The influence of base pair size and shape on the fidelity of DNA polymerase-mediated extension past lesion-containing mispairs was examined. Primer extension analysis was performed with synthetic nucleosides paired opposite the pro-mutagenic DNA lesion O(6)-benzylguanine (O(6)-BnG). These data indicate that the error-prone DNA polymerase IV (Dpo4) inefficiently extended past the larger Peri:O(6)-BnG base pair, and in contrast, error-free extension was observed for the smaller BIM:O(6)-BnG base pair. Steady-state kinetic analysis revealed that Dpo4 catalytic efficiency was strongly influenced by the primer:template base pair. Compared to the C:G pair, a 1.9- and 79,000-fold reduction in Dpo4 efficiency was observed for terminal C:O(6)-BnG and BIM:G base pairs respectively. These results demonstrate the impact of geometrical size and shape on polymerase-mediated mispair extension.

  4. Influence of the absolute configuration of npe-caged cytosine on DNA single base pair stability.

    PubMed

    Steinert, Hannah S; Schäfer, Florian; Jonker, Hendrik R A; Heckel, Alexander; Schwalbe, Harald

    2014-01-20

    Photolabile protecting groups are a versatile tool to trigger reactions by light irradiation. In this study, we have investigated the influence of the absolute configuration of the 1-(2-nitrophenyl)ethyl (NPE) cage group on a 15-base-pair duplex DNA. Using UV melting, we determined the global stability of the unmodified and the selectively (S)- and (R)-NPE-modified DNA sequences, respectively. We observe a differently destabilizing effect for the two NPE stereoisomers on the global stability. Analysis of the temperature dependence of imino proton exchange rates measured by NMR spectroscopy reveals that this effect can be attributed to decreased base pair stabilities of the caged and the 3'-neighbouring base pair, respectively. Furthermore, our NMR based structural models of the modified duplexes provide a structural basis for the distinct effect of the (S)- and the (R)-NPE group. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Unique base-pair breathing dynamics in PNA-DNA hybrids.

    PubMed

    Leijon, M; Sehlstedt, U; Nielsen, P E; Gräslund, A

    1997-08-22

    Kinetic and thermodynamic parameters, derived from 1H-NMR measurements of the imino proton exchange rates upon titration with the exchange catalyst ammonia, are reported for two mixed-sequence peptide nucleic acid (PNA)-DNA hybrids and their counterpart DNA duplex. The exchange times of the imino protons in the PNA strands extrapolate to very short base-pair lifetimes in the limit of infinite exchange catalyst concentration. This is not due to generally less stable base-pairs in PNA-DNA hybrids, since the lifetimes, apparent dissociation constants and thermodynamic stability (DeltaG degrees ) of the innermost DNA guanine imino protons are similar in the hybrid duplexes and in the DNA duplex. In addition, the apparent dissociation constants determined for PNA bases of the hybrids are of the same order as those of the corresponding bases in the DNA duplex. An exchange process from the closed state was found to be inconsistent with the experimental data. From these results, we conclude that opening and closing rates of the PNA guanine and thymine bases are at least two orders of magnitude higher than those of the corresponding bases in the DNA duplex. Unusual kinetics in the hybrids is also evident from the destabilization of the complementary DNA strand thymine bases, which exhibit base-pair dissociation constants increased by approximately two orders of magnitude compared to what is observed in the DNA duplex, while the DNA strand guanine bases are largely unaffected. The general pattern of the base-pair dynamics in the hybrids obtained when using trimethylamine as an exchange catalyst is the same as when using ammonia. However, the long base-pair lifetimes i. e. those of the DNA duplex and the guanine bases of the DNA strands in the hybrids, are approximately three to five times longer than when using ammonia. Thus, all opening events sensed by ammonia are not accessible to trimethylamine. These observations are discussed in regard to the mechanism of base-pair

  6. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

    PubMed

    Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

    2013-06-17

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.

  7. Molecular dynamics simulation of DNA base-pair opening by sharp bending

    NASA Astrophysics Data System (ADS)

    Cong, Peiwen; Dai, Liang; van der Maarel, Johan R. C.; Yan, Jie

    2013-03-01

    Many biological processes require sharp bending of DNA. According to worm-like chain model, the bending energy dominates the free energy cost of those processes containing DNA loops shorter than 40 nm, such as DNA wrapping around histones, Lac repressor looping and virus DNA packaging. However, several recent experimental observations suggest that the WLC model s not applicable under tight bending conditions. In full atom molecular dynamics simulations, a double stranded, 20 base-pairs DNA fragment is forced to bend by an external spring. It is found that one or two AT-rich regions are disrupted for sufficiently small end-to-end distance. The disrupted DNA base-pairs separate and usually stack with the neighbouring base-pairs to form a defect. It is shown that these defects are more bendable than the bending rigidity of the duplex in the regular B-form. The simulation suggests a curvature dependent, non-harmonic bending elasticity of the DNA backbone is necessary to describe the DNA conformation under tight bending conditions.

  8. Coupling into the base pair stack is necessary for DNA-mediated electrochemistry.

    PubMed

    Gorodetsky, Alon A; Green, Omar; Yavin, Eylon; Barton, Jacqueline K

    2007-01-01

    The electrochemistry of DNA films modified with different redox probes linked to DNA through saturated and conjugated tethers was investigated. Experiments feature two redox probes bound to DNA on two surfaces: anthraquinone (AQ)-modified uridines incorporated into thiolated DNA on gold (Au) and 2,2,6,6-tetramethylpiperidine 1-oxyl (TEMPO)-modified uridines in pyrene-labeled DNA on highly oriented pyrolytic graphite (HOPG). The electrochemistry of these labels when incorporated into DNA has been examined in DNA films containing both well matched and mismatched DNA. DNA-mediated electrochemistry is found to be effective for the TEMPO probe linked with an acetylene linker but not for a saturated TEMPO connected through an ethylenediamine linker. For the AQ probe, DNA-mediated electrochemistry is found with an acetylene linker to uridine but not with an alkyl chain to the 5' terminus of the oligonucleotide. Large electrochemical signals and effective discrimination of intervening base mismatches are achieved for the probes connected through the acetylene linkages, while probes connected through saturated linkages exhibit small electrochemical signals associated only with direct surface to probe charge transfer and poor mismatch discrimination. Thus DNA electrochemistry with these probes is dramatically influenced by the chemical nature of their linkage to DNA. These results highlight the importance of effective coupling into the pi-stack for long-range DNA-mediated electrochemistry.

  9. Double proton transfer in the isolated and DNA-embedded guanine-cytosine base pair

    NASA Astrophysics Data System (ADS)

    Zoete, Vincent; Meuwly, Markus

    2004-09-01

    The energetics and dynamics of double proton transfer (DPT) is investigated theoretically for the Watson-Crick conformation of the guanine-cytosine (GC) base pair. Using semiempirical density functional theory the isolated and DNA-embedded GC pair is considered. Differences in the energetics and dynamics of DPT thus addresses the question of how relevant studies of isolated base pairs are for the understanding of processes occurring in DNA. Two-dimensional potential energy surfaces involving the transferring hydrogen atoms and the proton donors and acceptors are presented for both systems. The DPT reaction is accompanied by a contraction of the distance between the two bases with virtually identical energetic barriers being 18.8 and 18.7 kcal/mol for the isolated and DNA-embedded system, respectively. However, the transition state for DPT in the DNA-embedded GC pair is offset by 0.1 Å to larger N-H separation compared to the isolated GC pair. Using activated ab initio molecular dynamics, DPT is readily observed for the isolated base pair with a minimal amount of 21.4 kcal/mol of initial average kinetic energy along the DPT normal mode vector. On a time scale of ≈100 fs DPT has occurred and the excess energy is redistributed. For the DNA-embedded GC pair considerably more kinetic energy is required (30.0 kcal/mol) for DPT and the process is completed within one hydrogen vibration. The relevance of studies of isolated base pairs and base pair analogs in regard of reactions or properties involving DNA is discussed.

  10. Single-molecule derivation of salt dependent base-pair free energies in DNA

    PubMed Central

    Huguet, Josep M.; Bizarro, Cristiano V.; Forns, Núria; Smith, Steven B.; Bustamante, Carlos; Ritort, Felix

    2010-01-01

    Accurate knowledge of the thermodynamic properties of nucleic acids is crucial to predicting their structure and stability. To date most measurements of base-pair free energies in DNA are obtained in thermal denaturation experiments, which depend on several assumptions. Here we report measurements of the DNA base-pair free energies based on a simplified system, the mechanical unzipping of single DNA molecules. By combining experimental data with a physical model and an optimization algorithm for analysis, we measure the 10 unique nearest-neighbor base-pair free energies with 0.1 kcal mol-1 precision over two orders of magnitude of monovalent salt concentration. We find an improved set of standard energy values compared with Unified Oligonucleotide energies and a unique set of 10 base-pair-specific salt-correction values. The latter are found to be strongest for AA/TT and weakest for CC/GG. Our unique energy values and salt corrections improve predictions of DNA unzipping forces and are fully compatible with melting temperatures for oligos. The method should make it possible to obtain free energies, enthalpies, and entropies in conditions not accessible by bulk methodologies. PMID:20716688

  11. Watson-Crick base pairing controls excited-state decay in natural DNA.

    PubMed

    Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

    2014-10-13

    Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states.

  12. Molecular Design of Ionization-Induced Proton Switching Element Based on Fluorinated DNA Base Pair.

    PubMed

    Tachikawa, Hiroto; Kawabata, Hiroshi

    2016-03-10

    To design theoretically the high-performance proton switching element based on DNA base pair, the effects of fluorine substitution on the rate of proton transfer (PT) in the DNA model base pair have been investigated by means of direct ab initio molecular dynamics (AIMD) method. The 2-aminopyridine dimer, (AP)2, was used as the model of the DNA base pair. One of the hydrogen atoms of the AP molecule in the dimer was substituted by a fluorine (F) atom, and the structures of the dimer, expressed by F-(AP)2, were fully optimized at the MP2/6-311++G(d,p) level. The direct AIMD calculations showed that the proton is transferred within the base pair after the vertical ionization. The rates of PT in F-(AP)2(+) were calculated and compared with that of (AP)2(+) without an F atom. It was found that PT rate is accelerated by the F-substitution. Also, the direction of PT between F-AP and AP molecules can be clearly controlled by the position of F-substitution (AP)2 in the dimer.

  13. Theoretical investigation on DNA/RNA base pairs mediated by copper, silver, and gold cations.

    PubMed

    Marino, Tiziana; Russo, Nino; Toscano, Marirosa; Pavelka, Matej

    2012-02-14

    B3LYP density functional based computations were performed in order to characterize the interactions present in some Cu(+), Ag(+), and Au(+) metal ion-mediated DNA and RNA base pairs from both structural and electronic points of view. Examined systems involve as ligands canonical Watson-Crick, Hoogsteen and Wobble base pairs. Two artificial Hoogsteen base pairs were also taken into account. Binding energy values indicate that complexes involving silver cations are less stable than those in which copper or gold are present, and propose a similar behaviour for these two latter ions. The nature of the bond linking metal ions and bases was described by the NBO analysis that suggests metal coordinative interactions to be covalent. An evaluation of the dispersion contributions for the investigated systems was performed with the B3LYP-D3 functional.

  14. B-DNA structure is intrinsically polymorphic: even at the level of base pair positions

    SciTech Connect

    Maehigashi, Tatsuya; Hsiao, Chiaolong; Woods, Kristen Kruger; Moulaei, Tinoush; Hud, Nicholas V.; Williams, Loren Dean

    2012-10-23

    Increasingly exact measurement of single crystal X-ray diffraction data offers detailed characterization of DNA conformation, hydration and electrostatics. However, instead of providing a more clear and unambiguous image of DNA, highly accurate diffraction data reveal polymorphism of the DNA atomic positions and conformation and hydration. Here we describe an accurate X-ray structure of B-DNA, painstakingly fit to a multistate model that contains multiple competing positions of most of the backbone and of entire base pairs. Two of ten base-pairs of CCAGGCCTGG are in multiple states distinguished primarily by differences in slide. Similarly, all the surrounding ions are seen to fractionally occupy discrete competing and overlapping sites. And finally, the vast majority of water molecules show strong evidence of multiple competing sites. Conventional resolution appears to give a false sense of homogeneity in conformation and interactions of DNA. In addition, conventional resolution yields an average structure that is not accurate, in that it is different from any of the multiple discrete structures observed at high resolution. Because base pair positional heterogeneity has not always been incorporated into model-building, even some high and ultrahigh-resolution structures of DNA do not indicate the full extent of conformational polymorphism.

  15. Yeast Pif1 helicase exhibits a one-base-pair stepping mechanism for unwinding duplex DNA.

    PubMed

    Ramanagoudr-Bhojappa, Ramanagouda; Chib, Shubeena; Byrd, Alicia K; Aarattuthodiyil, Suja; Pandey, Manjula; Patel, Smita S; Raney, Kevin D

    2013-05-31

    Kinetic analysis of the DNA unwinding and translocation activities of helicases is necessary for characterization of the biochemical mechanism(s) for this class of enzymes. Saccharomyces cerevisiae Pif1 helicase was characterized using presteady state kinetics to determine rates of DNA unwinding, displacement of streptavidin from biotinylated DNA, translocation on single-stranded DNA (ssDNA), and ATP hydrolysis activities. Unwinding of substrates containing varying duplex lengths was fit globally to a model for stepwise unwinding and resulted in an unwinding rate of ∼75 bp/s and a kinetic step size of 1 base pair. Pif1 is capable of displacing streptavidin from biotinylated oligonucleotides with a linear increase in the rates as the length of the oligonucleotides increased. The rate of translocation on ssDNA was determined by measuring dissociation from varying lengths of ssDNA and is essentially the same as the rate of unwinding of dsDNA, making Pif1 an active helicase. The ATPase activity of Pif1 on ssDNA was determined using fluorescently labeled phosphate-binding protein to measure the rate of phosphate release. The quantity of phosphate released corresponds to a chemical efficiency of 0.84 ATP/nucleotides translocated. Hence, when all of the kinetic data are considered, Pif1 appears to move along DNA in single nucleotide or base pair steps, powered by hydrolysis of 1 molecule of ATP.

  16. Free energy analysis and mechanism of base pair stacking in nicked DNA

    PubMed Central

    Häse, Florian; Zacharias, Martin

    2016-01-01

    The equilibrium of stacked and unstacked base pairs is of central importance for all nucleic acid structure formation processes. The stacking equilibrium is influenced by intramolecular interactions between nucleosides but also by interactions with the solvent. Realistic simulations on nucleic acid structure formation and flexibility require an accurate description of the stacking geometry and stability and its sequence dependence. Free energy simulations have been conducted on a series of double stranded DNA molecules with a central strand break (nick) in one strand. The change in free energy upon unstacking was calculated for all ten possible base pair steps using umbrella sampling along a center-of-mass separation coordinate and including a comparison of different water models. Comparison to experimental studies indicates qualitative agreement of the stability order but a general overestimation of base pair stacking interactions in the simulations. A significant dependence of calculated nucleobase stacking free energies on the employed water model was observed with the tendency of stacking free energies being more accurately reproduced by more complex water models. The simulation studies also suggest a mechanism of stacking/unstacking that involves significant motions perpendicular to the reaction coordinate and indicate that the equilibrium nicked base pair step may slightly differ from regular B-DNA geometry in a sequence-dependent manner. PMID:27407106

  17. Free energy analysis and mechanism of base pair stacking in nicked DNA.

    PubMed

    Häse, Florian; Zacharias, Martin

    2016-09-06

    The equilibrium of stacked and unstacked base pairs is of central importance for all nucleic acid structure formation processes. The stacking equilibrium is influenced by intramolecular interactions between nucleosides but also by interactions with the solvent. Realistic simulations on nucleic acid structure formation and flexibility require an accurate description of the stacking geometry and stability and its sequence dependence. Free energy simulations have been conducted on a series of double stranded DNA molecules with a central strand break (nick) in one strand. The change in free energy upon unstacking was calculated for all ten possible base pair steps using umbrella sampling along a center-of-mass separation coordinate and including a comparison of different water models. Comparison to experimental studies indicates qualitative agreement of the stability order but a general overestimation of base pair stacking interactions in the simulations. A significant dependence of calculated nucleobase stacking free energies on the employed water model was observed with the tendency of stacking free energies being more accurately reproduced by more complex water models. The simulation studies also suggest a mechanism of stacking/unstacking that involves significant motions perpendicular to the reaction coordinate and indicate that the equilibrium nicked base pair step may slightly differ from regular B-DNA geometry in a sequence-dependent manner. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Roles of the amino group of purine bases in the thermodynamic stability of DNA base pairing.

    PubMed

    Nakano, Shu-ichi; Sugimoto, Naoki

    2014-08-05

    The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I) and 2'-deoxyribo-2,6-diaminopurine (D) as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G • C > D • T ≈ I • C > A • T > G • T > I • T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

  19. Theory of phase segregation in DNA assemblies containing two different base-pair sequence types

    NASA Astrophysics Data System (ADS)

    (O’ Lee, Dominic J.; Wynveen, Aaron; Kornyshev, Alexei A.

    2017-01-01

    Spontaneous pairing of homologous DNA sequences—a challenging subject in molecular biophysics, often referred to as ‘homology recognition’—has been observed in vitro for several DNA systems. One of these experiments involved liquid crystalline quasi-columnar phases formed by a mixture of two kinds of double stranded DNA oligomer. Both oligomer types were of the same length and identical stoichiometric base-pair composition, but the base-pairs followed a different order. Phase segregation of the two DNA types was observed in the experiments, with the formation of boundaries between domains rich in molecules of one type (order) of base pair sequence. We formulate here a modified ‘X–Y model’ for phase segregation in such assemblies, obtain approximate solutions of the model, compare analytical results to Monte Carlo simulations, and rationalise past experimental observations. This study, furthermore, reveals the factors that affect the degree of segregation. Such information could be used in planning new versions of similar segregation experiments, needed for deepening our understanding of forces that might be involved, e.g., in gene–gene recognition.

  20. The structure of the human tRNALys3 anticodon bound to the HIV genome is stabilized by modified nucleosides and adjacent mismatch base pairs.

    PubMed

    Bilbille, Yann; Vendeix, Franck A P; Guenther, Richard; Malkiewicz, Andrzej; Ariza, Xavier; Vilarrasa, Jaume; Agris, Paul F

    2009-06-01

    Replication of human immunodeficiency virus (HIV) requires base pairing of the reverse transcriptase primer, human tRNA(Lys3), to the viral RNA. Although the major complementary base pairing occurs between the HIV primer binding sequence (PBS) and the tRNA's 3'-terminus, an important discriminatory, secondary contact occurs between the viral A-rich Loop I, 5'-adjacent to the PBS, and the modified, U-rich anticodon domain of tRNA(Lys3). The importance of individual and combined anticodon modifications to the tRNA/HIV-1 Loop I RNA's interaction was determined. The thermal stabilities of variously modified tRNA anticodon region sequences bound to the Loop I of viral sub(sero)types G and B were analyzed and the structure of one duplex containing two modified nucleosides was determined using NMR spectroscopy and restrained molecular dynamics. The modifications 2-thiouridine, s(2)U(34), and pseudouridine, Psi(39), appreciably stabilized the interaction of the anticodon region with the viral subtype G and B RNAs. The structure of the duplex results in two coaxially stacked A-form RNA stems separated by two mismatched base pairs, U(162)*Psi(39) and G(163)*A(38), that maintained a reasonable A-form helix diameter. The tRNA's s(2)U(34) stabilized the interaction between the A-rich HIV Loop I sequence and the U-rich anticodon, whereas the tRNA's Psi(39) stabilized the adjacent mismatched pairs.

  1. How Does Guanine-Cytosine Base Pair Affect Excess-Electron Transfer in DNA?

    PubMed

    Lin, Shih-Hsun; Fujitsuka, Mamoru; Majima, Tetsuro

    2015-06-25

    Charge transfer and proton transfer in DNA have attracted wide attention due to their relevance in biological processes and so on. Especially, excess-electron transfer (EET) in DNA has strong relation to DNA repair. However, our understanding on EET in DNA still remains limited. Herein, by using a strongly electron-donating photosensitizer, trimer of 3,4-ethylenedioxythiophene (3E), and an electron acceptor, diphenylacetylene (DPA), two series of functionalized DNA oligomers were synthesized for investigation of EET dynamics in DNA. The transient absorption measurements during femtosecond laser flash photolysis showed that guanine:cytosine (G:C) base pair affects EET dynamics in DNA by two possible mechanisms: the excess-electron quenching by proton transfer with the complementary G after formation of C(•-) and the EET hindrance by inserting a G:C base pair as a potential barrier in consecutive thymines (T's). In the present paper, we provided useful information based on the direct kinetic measurements, which allowed us to discuss EET through oligonucleotides for the investigation of DNA damage/repair.

  2. Human DNA Polymerase Kappa Encircles DNA: Implicatins for Mismatch Extension and Lesion Bypass

    SciTech Connect

    Lone,S.; Townson, S.; Uljon, S.; Johnson, R.; Brahma, A.; Nair, D.; Prakash, S.; Prakash, L.; Aggarwal, A.

    2007-01-01

    Human DNA polymerase (Pol ) is a proficient extender of mispaired primer termini on undamaged DNAs and is implicated in the extension step of lesion bypass. We present here the structure of Pol catalytic core in ternary complex with DNA and an incoming nucleotide. The structure reveals encirclement of the DNA by a unique 'N-clasp' at the N terminus of Pol , which augments the conventional right-handed grip on the DNA by the palm, fingers, and thumb domains and the PAD and provides additional thermodynamic stability. The structure also reveals an active-site cleft that is constrained by the close apposition of the N-clasp and the fingers domain, and therefore can accommodate only a single Watson-Crick base pair. Together, DNA encirclement and other structural features help explain Pol 's ability to extend mismatches and to promote replication through various minor groove DNA lesions, by extending from the nucleotide incorporated opposite the lesion by another polymerase.

  3. Sequence-Dependent T:G Base Pair Opening in DNA Double Helix Bound by Cren7, a Chromatin Protein Conserved among Crenarchaea

    PubMed Central

    Tian, Lei; Zhang, Zhenfeng; Wang, Hanqian; Zhao, Mohan; Dong, Yuhui; Gong, Yong

    2016-01-01

    T:G base pair arising from spontaneous deamination of 5mC or polymerase errors is a great challenge for DNA repair of hyperthermophilic archaea, especially Crenarchaea. Most strains in this phylum lack the protein homologues responsible for the recognition of the mismatch in the DNA repair pathways. To investigate whether Cren7, a highly conserved chromatin protein in Crenarchaea, serves a role in the repair of T:G mispairs, the crystal structures of Cren7-GTAATTGC and Cren7-GTGATCGC complexes were solved at 2.0 Å and 2.1 Å. In our structures, binding of Cren7 to the AT-rich DNA duplex (GTAATTGC) induces opening of T2:G15 but not T10:G7 base pair. By contrast, both T:G mispairs in the GC-rich DNA duplex (GTGATCGC) retain the classic wobble type. Structural analysis also showed DNA helical changes of GTAATTGC, especially in the steps around the open T:G base pair, as compared to GTGATCGC or the matched DNAs. Surface plasmon resonance assays revealed a 4-fold lower binding affinity of Cren7 for GTAATTGC than that for GTGATCGC, which was dominantly contributed by the decrease of association rate. These results suggested that binding of Cren7 to DNA leads to T:G mispair opening in a sequence dependent manner, and therefore propose the potential roles of Cren7 in DNA repair. PMID:27685992

  4. Sequence-Dependent T:G Base Pair Opening in DNA Double Helix Bound by Cren7, a Chromatin Protein Conserved among Crenarchaea.

    PubMed

    Tian, Lei; Zhang, Zhenfeng; Wang, Hanqian; Zhao, Mohan; Dong, Yuhui; Gong, Yong

    T:G base pair arising from spontaneous deamination of 5mC or polymerase errors is a great challenge for DNA repair of hyperthermophilic archaea, especially Crenarchaea. Most strains in this phylum lack the protein homologues responsible for the recognition of the mismatch in the DNA repair pathways. To investigate whether Cren7, a highly conserved chromatin protein in Crenarchaea, serves a role in the repair of T:G mispairs, the crystal structures of Cren7-GTAATTGC and Cren7-GTGATCGC complexes were solved at 2.0 Å and 2.1 Å. In our structures, binding of Cren7 to the AT-rich DNA duplex (GTAATTGC) induces opening of T2:G15 but not T10:G7 base pair. By contrast, both T:G mispairs in the GC-rich DNA duplex (GTGATCGC) retain the classic wobble type. Structural analysis also showed DNA helical changes of GTAATTGC, especially in the steps around the open T:G base pair, as compared to GTGATCGC or the matched DNAs. Surface plasmon resonance assays revealed a 4-fold lower binding affinity of Cren7 for GTAATTGC than that for GTGATCGC, which was dominantly contributed by the decrease of association rate. These results suggested that binding of Cren7 to DNA leads to T:G mispair opening in a sequence dependent manner, and therefore propose the potential roles of Cren7 in DNA repair.

  5. A quantum theoretical study of reactions of methyldiazonium ion with DNA base pairs

    NASA Astrophysics Data System (ADS)

    Shukla, P. K.; Ganapathy, Vinay; Mishra, P. C.

    2011-09-01

    Methylation of the DNA bases in the Watson-Crick GC and AT base pairs by the methyldiazonium ion was investigated employing density functional and second order Møller-Plesset (MP2) perturbation theories. Methylation at the N3, N7 and O6 sites of guanine, N1, N3 and N7 sites of adenine, O2 and N3 sites of cytosine and the O2 and O4 sites of thymine were considered. The computed reactivities for methylation follow the order N7(guanine) > N3(adenine) > O6(guanine) which is in agreement with experiment. The base pairing in DNA is found to play a significant role with regard to reactivities of the different sites.

  6. Aviram-Ratner rectifying mechanism for DNA base-pair sequencing through graphene nanogaps

    NASA Astrophysics Data System (ADS)

    Agapito, Luis A.; Gayles, Jacob; Wolowiec, Christian; Kioussis, Nicholas

    2012-04-01

    We demonstrate that biological molecules such as Watson-Crick DNA base pairs can behave as biological Aviram-Ratner electrical rectifiers because of the spatial separation and weak hydrogen bonding between the nucleobases. We have performed a parallel computational implementation of the ab initio non-equilibrium Green’s function (NEGF) theory to determine the electrical response of graphene—base-pair—graphene junctions. The results show an asymmetric (rectifying) current-voltage response for the cytosine-guanine base pair adsorbed on a graphene nanogap. In sharp contrast we find a symmetric response for the thymine-adenine case. We propose applying the asymmetry of the current-voltage response as a sensing criterion to the technological challenge of rapid DNA sequencing via graphene nanogaps.

  7. DNA separation and fluorescent detection in an optofluidic chip with sub-base-pair resolution

    NASA Astrophysics Data System (ADS)

    Pollnau, Markus; Hammer, Manfred; Dongre, Chaitanya; Hoekstra, Hugo J.

    2015-03-01

    DNA sequencing in a lab-on-a-chip aims at providing cheap, high-speed analysis of low reagent volumes to, e.g., identify genomic deletions or insertions associated with genetic illnesses. Detecting single base-pair insertions/deletions from DNA fragments in the diagnostically relevant range of 150-1000 base-pairs requires a sizing accuracy of S < 10-3. Here we demonstrate S = 4×10-4. A microfluidic chip was post-processed by femtosecond-laser writing of an optical waveguide. 12 blue-labeled and 23 red-labeled DNA fragments were separated in size by capillary electrophoresis, each set excited by either of two lasers power-modulated at different frequencies, their fluorescence detected by a photomultiplier, and blue/red signals distinguished by Fourier analysis. Different calibration strategies were tested: a) use either set of DNA molecules as reference to calibrate the set-up and identify the base-pair sizes of the other set in the same flow experiment, thereby eliminating variations in temperature, wall-coating and sieving-gel conditions, and actuation voltages; b) use the same molecular set as reference and sample with the same fluorescence label, flown in consecutive experiments; c) perform cross-experiments based on different molecular sets with different labels, flown in consecutive experiments. From the results we conclude: Applying quadratic instead of linear fit functions improves the calibration accuracy. Blue-labeled molecules are separated with higher accuracy. The influence of dye label is higher than fluctuations between two experiments. Choosing a single, suitable dye label combined with reference calibration and sample investigation in consecutive experiments results in S = 4×10-4, enabling detection of single base-pair insertion/deletion in a lab-on-a-chip.

  8. 6-Pyrazolylpurine as an Artificial Nucleobase for Metal-Mediated Base Pairing in DNA Duplexes

    PubMed Central

    Léon, J. Christian; Sinha, Indranil; Müller, Jens

    2016-01-01

    The artificial nucleobase 6-pyrazol-1-yl-purine (6PP) has been investigated with respect to its usability in metal-mediated base pairing. As was shown by temperature-dependent UV spectroscopy, 6PP may form weakly stabilizing 6PP–Ag(I)–6PP homo base pairs. Interestingly, 6PP can be used to selectively recognize a complementary pyrimidine nucleobase. The addition of Ag(I) to a DNA duplex comprising a central 6PP:C mispair (C = cytosine) leads to a slight destabilization of the duplex. In contrast, a stabilizing 6PP–Ag(I)–T base pair is formed with a complementary thymine (T) residue. It is interesting to note that 6PP is capable of differentiating between the pyrimidine moieties despite the fact that it is not as sterically crowded as 6-(3,5-dimethylpyrazol-1-yl)purine, an artificial nucleobase that had previously been suggested for the recognition of nucleic acid sequences via the formation of a metal-mediated base pair. Hence, the additional methyl groups of 6-(3,5-dimethylpyrazol-1-yl)purine may not be required for the specific recognition of the complementary nucleobase. PMID:27089326

  9. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine.

    PubMed

    Bhamra, Inder; Compagnone-Post, Patricia; O'Neil, Ian A; Iwanejko, Lesley A; Bates, Andrew D; Cosstick, Richard

    2012-11-01

    8-Nitro-2'-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2'-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2'-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson-Crick pair.

  10. Combined microfluidic-optical DNA analysis with single-base-pair sizing capability

    PubMed Central

    Pollnau, Markus; Hammer, Manfred; Dongre, Chaitanya; Hoekstra, Hugo J. W. M.

    2016-01-01

    DNA sequencing by microchip capillary electrophoresis (CE) enables cheap, high-speed analysis of low reagent volumes. One of its potential applications is the identification of genomic deletions or insertions associated with genetic illnesses. Detecting single base-pair insertions or deletions from DNA fragments in the diagnostically relevant size range of 150−1000 base-pairs requires a variance of σ2 < 10−3. In a microfluidic chip post-processed by femtosecond-laser writing of an optical waveguide we CE-separated 12 blue-labeled and 23 red-labeled DNA fragments in size. Each set was excited by either of two lasers power-modulated at different frequencies, their fluorescence detected by a photomultiplier, and blue and red signals distinguished by Fourier analysis. We tested different calibration strategies. Choice of the fluorescent label as well as the applied fit function strongly influence the obtained variance, whereas fluctuations between two consecutive experiments are less detrimental in a laboratory environment. We demonstrate a variance of σ2 ≈4 × 10−4, lower than required for the detection of single base-pair insertion or deletion in an optofluidic chip. PMID:28018736

  11. Single-molecule views of MutS on mismatched DNA

    PubMed Central

    Lee, Jong-Bong; Cho, Won-Ki; Park, Jonghyun; Jeon, Yongmoon; Kim, Daehyung; Lee, Seung Hwan; Fishel, Richard

    2014-01-01

    Base-pair mismatches that occur during DNA replication or recombination can reduce genetic stability or conversely increase genetic diversity. The genetics and biophysical mechanism of mismatch repair (MMR) has been extensively studied since its discovery nearly 50 years ago. MMR is a strand-specific excision-resynthesis reaction that is initiated by MutS homolog (MSH) binding to the mismatched nucleotides. The MSH mismatch-binding signal is then transmitted to the immediate downstream MutL homolog (MLH/PMS) MMR components and ultimately to a distant strand scission site where excision begins. The mechanism of signal transmission has been controversial for decades. We have utilized single molecule Forster Resonance Energy Transfer (smFRET), Fluorescence Tracking (smFT) and Polarization Total Internal Reflection Fluorescence (smP-TIRF) to examine the interactions and dynamic behaviors of single Thermus aquaticus MutS (TaqMutS) particles on mismatched DNA. We determined that Taq-MutS forms an incipient clamp to search for a mismatch in ∼1 s intervals by 1-dimensional (1D) thermal fluctuation-driven rotational diffusion while in continuous contact with the helical duplex DNA. When MutS encounters a mismatch it lingers for ∼3 s to exchange bound ADP for ATP (ADP → ATP exchange). ATP binding by TaqMutS induces an extremely stable clamp conformation (∼10 min) that slides off the mismatch and moves along the adjacent duplex DNA driven simply by 1D thermal diffusion. The ATP-bound sliding clamps rotate freely while in discontinuous contact with the DNA. The visualization of a train of MSH proteins suggests that dissociation of ATP-bound sliding clamps from the mismatch permits multiple mismatch-dependent loading events. These direct observations have provided critical clues into understanding the molecular mechanism of MSH proteins during MMR. PMID:24629484

  12. Design and development of three-dimensional DNA crystals utilizing CGAA parallel base paired motifs

    NASA Astrophysics Data System (ADS)

    Muser, Stephanie Elizabeth

    Three-dimensional (3D) DNA crystals hold great potential for various applications such as the development of molecular scaffolds for use in protein structure determination by x-ray crystallography. The programmability and predictability of DNA make it a powerful tool for self-assembly but it is hindered by the linearity of the duplex structure. Predictable noncanonical base pairs and motifs have the potential to connect linear double-helical DNA segments into complex 3D structures. The sequence d(GCGAAAGCT) has been observed to form 3D crystals containing both noncanonical parallel pairs and canonical Watson-Crick pairs. This provided a template structure that we used in expanding the design and development of 3D DNA crystals along with exploring the use of predictable noncanonical motifs. The structures we determined contained all but one or two of the designed secondary structure interactions, depending on pH.

  13. Identification of DNA lesions using a third base pair for amplification and nanopore sequencing.

    PubMed

    Riedl, Jan; Ding, Yun; Fleming, Aaron M; Burrows, Cynthia J

    2015-11-06

    Damage to the genome is implicated in the progression of cancer and stress-induced diseases. DNA lesions exist in low levels, and cannot be amplified by standard PCR because they are frequently strong blocks to polymerases. Here, we describe a method for PCR amplification of lesion-containing DNA in which the site and identity could be marked, copied and sequenced. Critical for this method is installation of either the dNaM or d5SICS nucleotides at the lesion site after processing via the base excision repair process. These marker nucleotides constitute an unnatural base pair, allowing large quantities of marked DNA to be made by PCR amplification. Sanger sequencing confirms the potential for this method to locate lesions by marking, amplifying and sequencing a lesion in the KRAS gene. Detection using the α-hemolysin nanopore is also developed to analyse the markers in individual DNA strands with the potential to identify multiple lesions per strand.

  14. An unnatural hydrophobic base pair system: site-specific incorporation of nucleotide analogs into DNA and RNA.

    PubMed

    Hirao, Ichiro; Kimoto, Michiko; Mitsui, Tsuneo; Fujiwara, Tsuyoshi; Kawai, Rie; Sato, Akira; Harada, Yoko; Yokoyama, Shigeyuki

    2006-09-01

    Methods for the site-specific incorporation of extra components into nucleic acids can be powerful tools for creating DNA and RNA molecules with increased functionality. We present an unnatural base pair system in which DNA containing an unnatural base pair can be amplified and function as a template for the site-specific incorporation of base analog substrates into RNA via transcription. The unnatural base pair is formed by specific hydrophobic shape complementation between the bases, but lacks hydrogen bonding interactions. In replication, this unnatural base pair exhibits high selectivity in combination with the usual triphosphates and modified triphosphates, gamma-amidotriphosphates, as substrates of 3' to 5' exonuclease-proficient DNA polymerases, allowing PCR amplification. In transcription, the unnatural base pair complementarity mediates the incorporation of these base substrates and their analogs, such as a biotinylated substrate, into RNA by T7 RNA polymerase (RNAP). With this system, functional components can be site-specifically incorporated into a large RNA molecule.

  15. Additional base-pair formation in DNA duplexes by a double-headed nucleotide.

    PubMed

    Madsen, Charlotte S; Witzke, Sarah; Kumar, Pawan; Negi, Kushuma; Sharma, Pawan K; Petersen, Michael; Nielsen, Poul

    2012-06-11

    We have designed and synthesised a double-headed nucleotide that presents two nucleobases in the interior of a dsDNA duplex. This nucleotide recognises and forms Watson-Crick base pairs with two complementary adenosines in a Watson-Crick framework. Furthermore, with judicious positioning in complementary strands, the nucleotide recognises itself through the formation of a T:T base pair. Thus, two novel nucleic acid motifs can be defined by using our double-headed nucleotide. Both motifs were characterised by UV melting experiments, CD and NMR spectroscopy and molecular dynamics simulations. Both motifs leave the thermostability of the native dsDNA duplex largely unaltered. Molecular dynamics calculations showed that the double-headed nucleotides are accommodated in the dsDNA by entirely local perturbations and that the modified duplexes retain an overall B-type geometry with the dsDNA unwound by around 25 or 60°, respectively, in each of the modified motifs. Both motifs can be accommodated twice in a dsDNA duplex without incurring any loss of stability and extrapolating from this observation and the results of modelling, it is conceivable that both can be multiplied several times within a dsDNA duplex. These new motifs extend the DNA recognition repertoire and may form the basis for a complete series of double-headed nucleotides based on all 16 base combinations of the four natural nucleobases. In addition, both motifs can be used in the design of nanoscale DNA structures in which a specific duplex twist is required.

  16. Kinetic Analysis of Base Pairing Preference for Nucleotide Incorporation Opposite Template Pyrimidines by Human DNA Polymerase ι

    PubMed Central

    Choi, Jeong-Yun; Lim, Seonhee; Eoff, Robert L.; Guengerich, F. Peter

    2009-01-01

    SUMMARY DNA polymerase (pol) ι, a member of the mammalian Y-family of DNA polymerases involved in translesion DNA synthesis, has been previously suggested to peculiarly utilize Hoogsteen base pairing for DNA synthesis opposite template purines, unlike pols η and κ which utilize Watson-Crick base pairing. To investigate the possible roles of Hoogsteen, Watson-Crick, and wobble base pairing modes in the selection of nucleotides opposite template pyrimidines by human pol ι, we carried out kinetic analyses of incorporation of modified purine nucleoside triphosphates including 7-deazapurines, inosine, 2-aminopurine, 2,6-diaminopurine, and 6-chloropurine, which affect H-bonding in base pair formation opposite template pyrimidines. Carbon substitution at the N7 atom of purine nucleoside triphosphates, which disrupts Hoogsteen base pairing, only slightly inhibited DNA synthesis opposite template pyrimidines by pol ι, which was not substantially different from human pols η and κ. Opposite template T, only the relative wobble stabilities (inferred from the potential numbers of H-bonds, steric, and electrostatic interactions but not measured) of base pairs were positively correlated to the relative efficiencies of nucleotide incorporation by pol ι but not the relative Watson-Crick or Hoogsteen stabilities, unlike pols η and κ. In contrast, opposite C only the relative Watson-Crick stabilities of base pairs were positively correlated to the relative efficiencies of nucleotide incorporation by pol ι, as with pols η and κ. These results suggest that pol ι might not indispensably require Hoogsteen base pairing for DNA synthesis opposite pyrimidines but rather might prefer wobble base pairing in the selection of nucleotides opposite T and Watson-Crick base pairing opposite C. PMID:19376129

  17. Base-pairing shift in the major groove of (CA)n tracts by B-DNA crystal structures.

    PubMed

    Timsit, Y; Vilbois, E; Moras, D

    1991-11-14

    the crystal packing of the B-DNA dodecamer d(ACCG-GCGCCACA).d(TGTGGCGCCGGT) is characterized by the reciprocal fit of double helices with specific base-backbone interactions in the major groove. Cooling the crystals below -10 degrees C stabilizes a new conformational state with a long-range sequence-dependent one-step shift in the major-groove base pairing. The tilt of the bases leads to the disruption of the Watson-Crick pairing in the major groove and to the formation of interactions with the 5' neighbour of their complement. This alteration propagates along the helical axis over more than half a turn. As a result, the molecular structure is normal when seen from the minor groove side and mismatched in the major groove. Comparison with a parent isomorphous dodecamer structure corresponding to the codon 10-13 of the c-Ha-ras proto-oncogene show that this new structural feature is sequence dependent and clearly favoured by (CA)n tracts. As(CA)n tracts of DNA are involved both in recombination and in transcription, this new recognition pattern should be considered in the analysis of the various processes involving the reading of the genetic information.

  18. Expanding the scope of replicable unnatural DNA: stepwise optimization of a predominantly hydrophobic base pair.

    PubMed

    Lavergne, Thomas; Degardin, Mélissa; Malyshev, Denis A; Quach, Henry T; Dhami, Kirandeep; Ordoukhanian, Phillip; Romesberg, Floyd E

    2013-04-10

    As part of an ongoing effort to expand the genetic alphabet for in vitro and eventually in vivo applications, we have synthesized a wide variety of predominantly hydrophobic unnatural base pairs exemplified by d5SICS-dMMO2 and d5SICS-dNaM. When incorporated into DNA, the latter is replicated and transcribed with greater efficiency and fidelity than the former; however, previous optimization efforts identified the para and methoxy-distal meta positions of dMMO2 as particularly promising for further optimization. Here, we report the stepwise optimization of dMMO2 via the synthesis and evaluation of 18 novel para-derivatized analogs of dMMO2, followed by further derivatization and evaluation of the most promising analogs with meta substituents. Subject to size constraints, we find that para substituents can optimize replication via both steric and electronic effects and that meta methoxy groups are unfavorable, while fluoro substituents can be beneficial or deleterious depending on the para substituent. In addition, we find that improvements in the efficiency of unnatural triphosphate insertion translate most directly into higher fidelity replication. Importantly, we identify multiple, unique base pair derivatives that when incorporated into DNA are well replicated. The most promising, d5SICS-dFEMO, is replicated under some conditions with greater efficiency and fidelity than d5SICS-dNaM. These results clearly demonstrate the generality of hydrophobic forces for the control of base pairing within DNA, provide a wealth of new SAR data, and importantly identify multiple new candidates for eventual in vivo evaluation.

  19. From rigid base pairs to semiflexible polymers: coarse-graining DNA.

    PubMed

    Becker, Nils B; Everaers, Ralf

    2007-08-01

    The elasticity of double-helical DNA on a nm length scale is captured in detail by the rigid base-pair model, whose conformation variables are the relative positions and orientations of adjacent base pairs. Corresponding sequence-dependent elastic potentials have been obtained from all-atom MD simulation and from high-resolution structural data. On the scale of 100 nm, DNA is successfully described by a continuous wormlike chain model with homogeneous elastic properties, characterized by a set of four elastic constants which have been measured in single-molecule experiments. We present here a theory that links these experiments on different scales, by systematically coarse-graining the rigid base-pair model to an effective wormlike chain description. The average helical geometry of the molecule is accounted for exactly, and repetitive as well as random sequences are considered. Structural disorder is shown to produce a small, additive and short-range correction to thermal conformation fluctuations as well as to entropic elasticity. We also discuss the limits of applicability of the homogeneous wormlike chain on short scales, quantifying the anisotropy of bending stiffness, the non-Gaussian bend angle distribution and the variability of stiffness, all of which are noticeable below a helical turn. The coarse-grained elastic parameters show remarkable overall agreement with experimental wormlike chain stiffness. For the best-matching potential, bending persistence lengths of dinucleotide repeats span a range of 37-53 nm, with a random DNA value of 43 nm. While twist stiffness is somewhat underestimated and stretch stiffness is overestimated, the counterintuitive negative sign and the magnitude of the twist-stretch coupling agree with recent experimental findings.

  20. Solid state radiation chemistry of co-crystallized DNA base pairs studied with EPR and ENDOR

    SciTech Connect

    Nelson, W.H.; Nimmala, S.; Hole, E.O.; Sagstuen, E.; Close, D.M.

    1995-12-31

    For a number of years, the authors` group has focused on identification of radicals formed from x-irradiation of DNA components by application of EPR and ENDOR spectroscopic techniques to samples in the form of single crystals. With single crystals as samples, it is possible to use the detailed packing and structural information available from x-ray or neutron diffraction reports. This report summarizes results from two crystal systems in which DNA bases are paired by hydrogen bonding. Extensive results are available from one of these, 1-methyl-thymine:9-methyladenine (MTMA), in which the base pairing is the Hoogsteen configuration. Although this configuration is different from that found by Watson-Crick in DNA, nonetheless the hydrogen bond between T(O4) and A(NH{sub 2}) is present. Although MTMA crystals have been studied previously, the objective was to apply the high-resolution technique of ENDOR to crystals irradiated and studied at temperatures of 10 K or lower in the effort to obtain direct evidence for specific proton transfers. The second system, from which the results are only preliminary, is 9-ethylguanine:1-methyl-5-fluorocytosine (GFC) in which the G:C bases pair is in the Watson Crick configuration. Both crystal systems are anhydrous, so the results include no possible effects from water interactions.

  1. Hydrogen bond disruption in DNA base pairs from (14)C transmutation.

    PubMed

    Sassi, Michel; Carter, Damien J; Uberuaga, Blas P; Stanek, Christopher R; Mancera, Ricardo L; Marks, Nigel A

    2014-09-04

    Recent ab initio molecular dynamics simulations have shown that radioactive carbon does not normally fragment DNA bases when it decays. Motivated by this finding, density functional theory and Bader analysis have been used to quantify the effect of C → N transmutation on hydrogen bonding in DNA base pairs. We find that (14)C decay has the potential to significantly alter hydrogen bonds in a variety of ways including direct proton shuttling (thymine and cytosine), thermally activated proton shuttling (guanine), and hydrogen bond breaking (cytosine). Transmutation substantially modifies both the absolute and relative strengths of the hydrogen bonding pattern, and in two instances (adenine and cytosine), the density at the critical point indicates development of mild covalent character. Since hydrogen bonding is an important component of Watson-Crick pairing, these (14)C-induced modifications, while infrequent, may trigger errors in DNA transcription and replication.

  2. Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

    PubMed

    Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

    2017-07-06

    The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

  3. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    PubMed

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non

  4. Electronic coupling between base pair dimers of LNA:DNA oligomers.

    PubMed

    Ivanova, Anela; Jezierski, Grzegorz; Rösch, Notker

    2008-01-21

    We calculated ab initio electronic coupling elements between neighboring base-pair dimers in a set of LNA:DNA oligomers with different numbers of locked nucleotides and compared them by averaging the values over ensembles of snapshots from molecular dynamics trajectories. Averaging was based on coupling elements for various ensembles comprising of 33,000 structures. The known pronounced variations of coupling elements on the nanosecond timescale due to thermal fluctuations of the DNA structure were confirmed. We found significant differences in electronic coupling at the dimer level between a non-modified DNA:DNA duplex and the corresponding duplex containing one fully LNA-substituted strand. We rationalized these differences by very dissimilar overlap in the pi-stack as a consequence of the LNA-modified system approximating an A-DNA-type helix. The calculated coupling elements for the non-modified reference duplex were similar to those of standard B-DNA and those for the fully modified oligomer resembled the matrix elements estimated for standard A-DNA.

  5. Unnatural imidazopyridopyrimidine:naphthyridine base pairs: selective incorporation and extension reaction by Deep Vent (exo- ) DNA polymerase.

    PubMed

    Ogata, Shintaro; Takahashi, Mayumi; Minakawa, Noriaki; Matsuda, Akira

    2009-09-01

    In our previous communication we reported the enzymatic recognition of unnatural imidazopyridopyrimidine:naphthyridine (Im:Na) base pairs, i.e. ImO(N):NaN(O) and ImN(O):NaO(N), using the Klenow fragment exo(-) [KF (exo(-))]. We describe herein the successful results of (i) improved enzymatic recognition for ImN(O):NaO(N) base pairs and (ii) further primer extension reactions after the Im:Na base pairs by Deep Vent DNA polymerase exo(-) [Deep Vent (exo(-))]. Since KF (exo(-)) did not catalyze primer extension reactions after the Im:Na base pair, we carried out a screening of DNA polymerases to promote the primer extension reaction as well as to improve the selectivity of base pair recognition. As a result, a family B DNA polymerase, especially Deep Vent (exo(-)), seemed most promising for this purpose. In the ImO(N):NaN(O) base pair, incorporation of NaN(O)TP against ImO(N) in the template was preferable to that of the natural dNTPs, while incorporation of dATP as well as dGTP competed with that of ImO(N)TP when NaN(O) was placed in the template. Thus, the selectivity of base pair recognition by Deep Vent (exo(-)) was less than that by KF (exo(-)) in the case of the ImO(N):NaN(O) base pair. On the other hand, incorporation of NaO(N)TP against ImN(O) in the template and that of ImN(O)TP against NaO(N) were both quite selective. Thus, the selectivity of base pair recognition was improved by Deep Vent (exo(-)) in the ImN(O):NaO(N) base pair. Moreover, this enzyme catalyzed further primer extension reactions after the ImN(O):NaO(N) base pair to afford a faithful replicate, which was confirmed by MALDI-TOF mass spectrometry as well as the kinetics data for extension fidelity next to the ImN(O):NaO(N) base pair. The results presented in this paper revealed that the ImN(O):NaO(N) base pair might be a third base pair beyond the Watson-Crick base pairs.

  6. Structural and thermodynamic studies on the adenine.guanine mismatch in B-DNA.

    PubMed Central

    Leonard, G A; Booth, E D; Brown, T

    1990-01-01

    The structure of the synthetic dodecamer d(CGCAAATTGGCG) has been shown by single crystal X-ray diffraction methods to be that of a B-DNA helix containing two A(anti).G(syn) base pairs. The refinement, based on data to a resolution of 2.25 A shows that the mismatch base pairs are held together by two hydrogen bonds. The syn-conformation of the guanine base of the mismatch is stabilised by hydrogen bonding to a network of solvent molecules in both the major and minor grooves. A pH-dependent ultraviolet melting study indicates that the duplex is stabilised by protonation, suggesting that the bases of the A.G mispair are present in their most common tautomeric forms and that the N(1)-atom of adenine is protonated. The structure refinement shows that there is some disorder in the sugar-phosphate backbone. PMID:2216754

  7. Eukaryotic Mismatch Repair in Relation to DNA Replication.

    PubMed

    Kunkel, Thomas A; Erie, Dorothy A

    2015-01-01

    Three processes act in series to accurately replicate the eukaryotic nuclear genome. The major replicative DNA polymerases strongly prevent mismatch formation, occasional mismatches that do form are proofread during replication, and rare mismatches that escape proofreading are corrected by mismatch repair (MMR). This review focuses on MMR in light of increasing knowledge about nuclear DNA replication enzymology and the rate and specificity with which mismatches are generated during leading- and lagging-strand replication. We consider differences in MMR efficiency in relation to mismatch recognition, signaling to direct MMR to the nascent strand, mismatch removal, and the timing of MMR. These studies are refining our understanding of relationships between generating and repairing replication errors to achieve accurate replication of both DNA strands of the nuclear genome.

  8. DNA . RNA heteroduplex containing 8-oxo-7,8-dihydroguanosine: base pairing, structures, and thermodynamic stability.

    PubMed

    Kim, Sang Kook; Lee, Sung Hwa; Kwon, Oh-Shin; Moon, Byung Jo

    2004-11-30

    Oligoribonucleotides containing 8-oxo-7,8-dihydroguanosine (8-oxoG) and 8-oxo-7,8-dihydro-2'-O-methylguanosine (8-oxoG-Me) were synthesized. The base pairing properties of 8-oxoG and 8-oxoG-Me in oligoribonucleotide in cDNA synthesis by reverse transcriptases were studied. dCMP was preferentially incorporated into the site opposite 8-oxoG or 8-oxoG-Me than into other dNMPs. TMP and dCMP were inserted preferentially into sites opposite 8-oxoG or 8-oxoG by reverse transcriptases. HIV-RT did not incorporate TMP, but RAV2-RT incorporated 50% more TMP than dCMP into the site opposite 8-oxoG. In the site opposite 8-oxoG-Me TMP was substantially incorporated by HIV-RT or RAV2-RT. Thermodynamic analysis of the DNA.RNA heteroduplex containing 8-oxoG revealed that 8-oxoG and 8-oxoG-Me formed base pairs with cytidine and thymidine with similar stability. The thermodynamic parameter (DeltaG degrees ) demonstrated that the formation of duplexes between 8-oxoG or 8-oxoG-Me and cytidine or thymidine is more thermodynamically favorable than with adenosine and guanosine. However, differences in the melting temperature and DeltaG degrees 's of 8-oxoG/dC and 8-oxoG/T were much smaller than between G/dC and G/T. CD spectra showed that DNA . RNA containing 8-oxoG or 8-oxoG-Me duplexes showed similarities between the A-type RNA and B-type DNA conformations.

  9. Mitochondrial DNA 4977-base pair common deletion in blood leukocytes and melanoma risk.

    PubMed

    Shen, Jie; Wan, Jie; Huff, Chad; Fang, Shenying; Lee, Jeffrey E; Zhao, Hua

    2016-05-01

    The 4977-base pair common deletion DmtDNA4977 is the most frequently observed mitochondrial DNA mutation in human tissues. Because mitochondrial DNA mutations are mainly caused by reactive oxygen species (ROS), and given that oxidative stress plays an important role in melanoma carcinogenesis, the investigation of DmtDNA4977 may be particularly relevant to the development of melanoma. In this study, we compared DmtDNA4977 levels in blood leukocytes from 206 melanoma patients and 219 healthy controls. Overall, melanoma cases had significantly higher levels of DmtDNA4977 than healthy controls (median: 0.60 vs 0.20, P = 0.008). The difference was evident among individuals who were older than 47 yrs, women, and had pigmentation risk factors (e.g., blond or red hair, blue eye, fair skin, light, or none tanning ability after prolonged sun exposure, and freckling in the sun as a child). The difference was also evident among those who had at least one lifetime sunburn with blistering and had no reported use of a sunlamp. Interestingly, among controls, DmtDNA4977 levels differed by phenotypic index and reported use of a sunlamp. In the risk assessment, increased levels of DmtDNA4977 were associated with a 1.23-fold increased risk of melanoma (odds ratio (OR): 1.23, 95% confidence interval (90% CI): 1.01, 1.50). A significant dose-response relationship was observed in quartile analysis (P = 0.001). In summary, our study suggests that high levels of DmtDNA4977 in blood leukocytes are associated with increased risk of melanoma and that association is affected by both pigmentation and personal history of sun exposure.

  10. Mitochondrial DNA 4977-base pair common deletion in blood leucocytes and melanoma risk

    PubMed Central

    Shen, Jie; Wan, Jie; Huff, Chad; Fang, Shenying; Lee, Jeffrey E.; Zhao, Hua

    2017-01-01

    The 4977-base pair common deletion DmtDNA4977 is the most frequently observed mitochondrial DNA mutation in human tissues. Because mitochondrial DNA mutations are mainly caused by reactive oxygen species (ROS), and given that oxidative stress plays an important role in melanoma carcinogenesis, the investigation of DmtDNA4977 may be particularly relevant to the development of melanoma. In the current study, we compared DmtDNA4977 levels in blood leucocytes from 206 melanoma patients and 219 healthy controls. Overall, melanoma cases had significantly higher levels of DmtDNA4977 than healthy controls (median: 0.60 vs 0.20, P=0.008). The difference was evident among individuals who were older than 47 years old, women, and had pigmentation risk factors (e.g. blond or red hair, blue eye, fair skin, light or none tanning ability after prolonged sun exposure, and freckling in the sun as a child). The difference was also evident among those who had at least one lifetime sunburn with blistering and had no reported use of a sunlamp. Interestingly, among controls, DmtDNA4977 levels differed by phenotypic index and reported use of a sunlamp. In the risk assessment, increased levels of DmtDNA4977 were associated with a 1.23-fold increased risk of melanoma (Odds ratio (OR): 1.23, 95% Confidence Interval (90% CI): 1.01, 1.50). A significant dose-response relationship was observed in quartile analysis (P=0.001). In summary, our study suggests that high levels of DmtDNA4977 in blood leucocytes are associated with increased risk of melanoma, and that association is affected by both pigmentation and personal history of sun exposure. PMID:26988264

  11. "False" thymine-1H-Enol guanine base pair. low misinsertion rate by DNA polymerase explained by computational chemistry consideration.

    PubMed

    Seclaman, E; Kurunczi, L; Simon, Z

    2007-03-01

    Formation of correct TA and GC and "false" thymine-1H-enol guanine (TGenol) base pairs is here considered to control nucleotide insertion into DNA via low substrate concentration Michaelis-Menten controlled kinetics. Contributions of base pairing to formation of Gibbs free energies in water solution, DeltaDeltaG, are calculated for the correct and false base pairs with the semi-empiric MNDO/PM3 method for base pairing energies in vacuum and the BEM method for hydration effects. The results for DeltaDeltaG indicate equal insertion rates for correct base pairing and a 10(-3)-10(-4) error probability for false insertion controlled by the TGenol false pair.

  12. Silver-mediated base pairings: towards dynamic DNA nanostructures with enhanced chemical and thermal stability

    NASA Astrophysics Data System (ADS)

    Swasey, Steven M.; Gwinn, Elisabeth G.

    2016-04-01

    The thermal and chemical fragility of DNA nanomaterials assembled by Watson-Crick (WC) pairing constrain the settings in which these materials can be used and how they can be functionalized. Here we investigate use of the silver cation, Ag+, as an agent for more robust, metal-mediated self-assembly, focusing on the simplest duplex building blocks that would be required for more elaborate Ag+-DNA nanostructures. Our studies of Ag+-induced assembly of non-complementary DNA oligomers employ strands of 2-24 bases, with varied base compositions, and use electrospray ionization mass spectrometry to determine product compositions. High yields of duplex products containing narrowly distributed numbers of Ag+ can be achieved by optimizing solution conditions. These Ag+-mediated duplexes are stable to at least 60 mM Mg2+, higher than is necessary for WC nanotechnology schemes such as tile assemblies and DNA origami, indicating that sequential stages of Ag+-mediated and WC-mediated assembly may be feasible. Circular dichroism spectroscopy suggests simple helical structures for Ag+-mediated duplexes with lengths to at least 20 base pairs, and further indicates that the structure of cytosine-rich duplexes is preserved at high urea concentrations. We therefore propose an approach towards dynamic DNA nanomaterials with enhanced thermal and chemical stability through designs that combine sturdy silver-mediated ‘frames’ with WC paired ‘pictures’.

  13. New insights into Hoogsteen base pairs in DNA duplexes from a structure-based survey

    PubMed Central

    Zhou, Huiqing; Hintze, Bradley J.; Kimsey, Isaac J.; Sathyamoorthy, Bharathwaj; Yang, Shan; Richardson, Jane S.; Al-Hashimi, Hashim M.

    2015-01-01

    Hoogsteen (HG) base pairs (bps) provide an alternative pairing geometry to Watson–Crick (WC) bps and can play unique functional roles in duplex DNA. Here, we use structural features unique to HG bps (syn purine base, HG hydrogen bonds and constricted C1′–C1′ distance across the bp) to search for HG bps in X-ray structures of DNA duplexes in the Protein Data Bank. The survey identifies 106 A•T and 34 G•C HG bps in DNA duplexes, many of which are undocumented in the literature. It also uncovers HG-like bps with syn purines lacking HG hydrogen bonds or constricted C1′–C1′ distances that are analogous to conformations that have been proposed to populate the WC-to-HG transition pathway. The survey reveals HG preferences similar to those observed for transient HG bps in solution by nuclear magnetic resonance, including stronger preferences for A•T versus G•C bps, TA versus GG steps, and also suggests enrichment at terminal ends with a preference for 5′-purine. HG bps induce small local perturbations in neighboring bps and, surprisingly, a small but significant degree of DNA bending (∼14°) directed toward the major groove. The survey provides insights into the preferences and structural consequences of HG bps in duplex DNA. PMID:25813047

  14. DNA Base Pair Resolution Measurements Using Resonance Energy Transfer Efficiency in Lanthanide Doped Nanoparticles

    PubMed Central

    Delplanque, Aleksandra; Wawrzynczyk, Dominika; Jaworski, Pawel; Matczyszyn, Katarzyna; Pawlik, Krzysztof; Buckle, Malcolm; Nyk, Marcin; Nogues, Claude; Samoc, Marek

    2015-01-01

    Lanthanide-doped nanoparticles are of considerable interest for biodetection and bioimaging techniques thanks to their unique chemical and optical properties. As a sensitive luminescence material, they can be used as (bio) probes in Förster Resonance Energy Transfer (FRET) where trivalent lanthanide ions (La3+) act as energy donors. In this paper we present an efficient method to transfer ultrasmall (ca. 8 nm) NaYF4 nanoparticles dispersed in organic solvent to an aqueous solution via oxidation of the oleic acid ligand. Nanoparticles were then functionalized with single strand DNA oligomers (ssDNA) by inducing covalent bonds between surface carboxylic groups and a 5’ amine modified-ssDNA. Hybridization with the 5’ fluorophore (Cy5) modified complementary ssDNA strand demonstrated the specificity of binding and allowed the fine control over the distance between Eu3+ ions doped nanoparticle and the fluorophore by varying the number of the dsDNA base pairs. First, our results confirmed nonradiative resonance energy transfer and demonstrate the dependence of its efficiency on the distance between the donor (Eu3+) and the acceptor (Cy5) with sensitivity at a nanometre scale. PMID:25748446

  15. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    NASA Astrophysics Data System (ADS)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  16. Active destabilization of base pairs by a DNA glycosylase wedge initiates damage recognition.

    PubMed

    Kuznetsov, Nikita A; Bergonzo, Christina; Campbell, Arthur J; Li, Haoquan; Mechetin, Grigory V; de los Santos, Carlos; Grollman, Arthur P; Fedorova, Olga S; Zharkov, Dmitry O; Simmerling, Carlos

    2015-01-01

    Formamidopyrimidine-DNA glycosylase (Fpg) excises 8-oxoguanine (oxoG) from DNA but ignores normal guanine. We combined molecular dynamics simulation and stopped-flow kinetics with fluorescence detection to track the events in the recognition of oxoG by Fpg and its mutants with a key phenylalanine residue, which intercalates next to the damaged base, changed to either alanine (F110A) or fluorescent reporter tryptophan (F110W). Guanine was sampled by Fpg, as evident from the F110W stopped-flow traces, but less extensively than oxoG. The wedgeless F110A enzyme could bend DNA but failed to proceed further in oxoG recognition. Modeling of the base eversion with energy decomposition suggested that the wedge destabilizes the intrahelical base primarily through buckling both surrounding base pairs. Replacement of oxoG with abasic (AP) site rescued the activity, and calculations suggested that wedge insertion is not required for AP site destabilization and eversion. Our results suggest that Fpg, and possibly other DNA glycosylases, convert part of the binding energy into active destabilization of their substrates, using the energy differences between normal and damaged bases for fast substrate discrimination.

  17. Inverse Temperature Dependence of Nuclear Quantum Effects in DNA Base Pairs

    PubMed Central

    2016-01-01

    Despite the inherently quantum mechanical nature of hydrogen bonding, it is unclear how nuclear quantum effects (NQEs) alter the strengths of hydrogen bonds. With this in mind, we use ab initio path integral molecular dynamics to determine the absolute contribution of NQEs to the binding in DNA base pair complexes, arguably the most important hydrogen-bonded systems of all. We find that depending on the temperature, NQEs can either strengthen or weaken the binding within the hydrogen-bonded complexes. As a somewhat counterintuitive consequence, NQEs can have a smaller impact on hydrogen bond strengths at cryogenic temperatures than at room temperature. We rationalize this in terms of a competition of NQEs between low-frequency and high-frequency vibrational modes. Extending this idea, we also propose a simple model to predict the temperature dependence of NQEs on hydrogen bond strengths in general. PMID:27195654

  18. Inverse Temperature Dependence of Nuclear Quantum Effects in DNA Base Pairs.

    PubMed

    Fang, Wei; Chen, Ji; Rossi, Mariana; Feng, Yexin; Li, Xin-Zheng; Michaelides, Angelos

    2016-06-02

    Despite the inherently quantum mechanical nature of hydrogen bonding, it is unclear how nuclear quantum effects (NQEs) alter the strengths of hydrogen bonds. With this in mind, we use ab initio path integral molecular dynamics to determine the absolute contribution of NQEs to the binding in DNA base pair complexes, arguably the most important hydrogen-bonded systems of all. We find that depending on the temperature, NQEs can either strengthen or weaken the binding within the hydrogen-bonded complexes. As a somewhat counterintuitive consequence, NQEs can have a smaller impact on hydrogen bond strengths at cryogenic temperatures than at room temperature. We rationalize this in terms of a competition of NQEs between low-frequency and high-frequency vibrational modes. Extending this idea, we also propose a simple model to predict the temperature dependence of NQEs on hydrogen bond strengths in general.

  19. Base-pairing energies of proton-bound heterodimers of cytosine and modified cytosines: implications for the stability of DNA i-motif conformations.

    PubMed

    Yang, Bo; Rodgers, M T

    2014-01-08

    The DNA i-motif conformation was discovered in (CCG)•(CGG)n trinucleotide repeats, which are associated with fragile X syndrome, the most widespread inherited cause of mental retardation in humans. The DNA i-motif is a four-stranded structure whose strands are held together by proton-bound dimers of cytosine (C(+)•C). The stronger base-pairing interactions in C(+)•C proton-bound dimers as compared to Watson-Crick G•C base pairs are the major forces responsible for stabilization of i-motif conformations. Methylation of cytosine results in silencing of the FMR1 gene and causes fragile X syndrome. However, the influence of methylation or other modifications such as halogenation of cytosine on the base-pairing energies (BPEs) in the i-motif remains elusive. To address this, proton-bound heterodimers of cytosine and 5-methylcytosine, 5-fluorocytosine, 5-bromocytosine, and 5-iodocytosine are probed in detail. Experimentally, the BPEs of proton-bound heterodimers of cytosine and modified cytosines are determined using threshold collision-induced dissociation (TCID) techniques. All modifications at the 5-position of cytosine are found to lower the BPE and therefore would tend to destabilize DNA i-motif conformations. However, the BPEs in these proton-bound heterodimers still significantly exceed those of the Watson-Crick G•C and neutral C•C base pairs, suggesting that C(+)•C mismatches are still energetically favored such that i-motif conformations are preserved. Excellent agreement between TCID measured BPEs and B3LYP calculated values is found with the def2-TZVPPD and 6-311+G(2d,2p) basis sets, suggesting that calculations at these levels of theory can be employed to provide reliable energetic predictions for related systems.

  20. DNA methylation analysis of chromosome 21 gene promoters at single base pair and single allele resolution.

    PubMed

    Zhang, Yingying; Rohde, Christian; Tierling, Sascha; Jurkowski, Tomasz P; Bock, Christoph; Santacruz, Diana; Ragozin, Sergey; Reinhardt, Richard; Groth, Marco; Walter, Jörn; Jeltsch, Albert

    2009-03-01

    Differential DNA methylation is an essential epigenetic signal for gene regulation, development, and disease processes. We mapped DNA methylation patterns of 190 gene promoter regions on chromosome 21 using bisulfite conversion and subclone sequencing in five human cell types. A total of 28,626 subclones were sequenced at high accuracy using (long-read) Sanger sequencing resulting in the measurement of the DNA methylation state of 580427 CpG sites. Our results show that average DNA methylation levels are distributed bimodally with enrichment of highly methylated and unmethylated sequences, both for amplicons and individual subclones, which represent single alleles from individual cells. Within CpG-rich sequences, DNA methylation was found to be anti-correlated with CpG dinucleotide density and GC content, and methylated CpGs are more likely to be flanked by AT-rich sequences. We observed over-representation of CpG sites in distances of 9, 18, and 27 bps in highly methylated amplicons. However, DNA sequence alone is not sufficient to predict an amplicon's DNA methylation status, since 43% of all amplicons are differentially methylated between the cell types studied here. DNA methylation in promoter regions is strongly correlated with the absence of gene expression and low levels of activating epigenetic marks like H3K4 methylation and H3K9 and K14 acetylation. Utilizing the single base pair and single allele resolution of our data, we found that i) amplicons from different parts of a CpG island frequently differ in their DNA methylation level, ii) methylation levels of individual cells in one tissue are very similar, and iii) methylation patterns follow a relaxed site-specific distribution. Furthermore, iv) we identified three cases of allele-specific DNA methylation on chromosome 21. Our data shed new light on the nature of methylation patterns in human cells, the sequence dependence of DNA methylation, and its function as epigenetic signal in gene regulation

  1. Inter-strand coupling and base pairing sequences in DNA charge transport.

    NASA Astrophysics Data System (ADS)

    Yudiarsah, Efta; Ulloa, Sergio

    2006-03-01

    The electronic transport properties of double-stranded DNA are studied using a tight-binding Hamiltonian. Transfer and scattering matrix methods for double strands are employed simultaneously in the calculation, guaranteeing numerical stability. Realistic on-site energies [1] and hopping constants are used in the model [2]. The role of inter-strand coupling is shown to be extremely important for random sequences typical of genetic DNA. In contrast, inter-strand coupling only changes slightly the charge transport properties for more periodic sequences. The effect of base-pairing across strands and details of the sequences were investigated. Our model shows that the resistance of DNA depends on the sequences and the ratio of the bases. This agrees with previous results by Roche [3]. The resistance is also shown to increase with the concentration of different bases in a homogenous strand, and we find that for certain sequences only short-range electronic transport is possible.[1] H. Sugiyama and I. Saito, J. Am. Chem. Soc. 118, 7063 (1996).[2] A. A. Voityuk, J. Jortner, M. Bixon, and N. Rosch, J. Chem. Phys. 114, 5614 (2001).[3] S. Roche, Phys. Rev. Lett. 91, 108101 (2003).

  2. Enhanced reduced representation bisulfite sequencing for assessment of DNA methylation at base pair resolution.

    PubMed

    Garrett-Bakelman, Francine E; Sheridan, Caroline K; Kacmarczyk, Thadeous J; Ishii, Jennifer; Betel, Doron; Alonso, Alicia; Mason, Christopher E; Figueroa, Maria E; Melnick, Ari M

    2015-02-24

    DNA methylation pattern mapping is heavily studied in normal and diseased tissues. A variety of methods have been established to interrogate the cytosine methylation patterns in cells. Reduced representation of whole genome bisulfite sequencing was developed to detect quantitative base pair resolution cytosine methylation patterns at GC-rich genomic loci. This is accomplished by combining the use of a restriction enzyme followed by bisulfite conversion. Enhanced Reduced Representation Bisulfite Sequencing (ERRBS) increases the biologically relevant genomic loci covered and has been used to profile cytosine methylation in DNA from human, mouse and other organisms. ERRBS initiates with restriction enzyme digestion of DNA to generate low molecular weight fragments for use in library preparation. These fragments are subjected to standard library construction for next generation sequencing. Bisulfite conversion of unmethylated cytosines prior to the final amplification step allows for quantitative base resolution of cytosine methylation levels in covered genomic loci. The protocol can be completed within four days. Despite low complexity in the first three bases sequenced, ERRBS libraries yield high quality data when using a designated sequencing control lane. Mapping and bioinformatics analysis is then performed and yields data that can be easily integrated with a variety of genome-wide platforms. ERRBS can utilize small input material quantities making it feasible to process human clinical samples and applicable in a range of research applications. The video produced demonstrates critical steps of the ERRBS protocol.

  3. The ChIP-exo Method: Identifying Protein-DNA Interactions with Near Base Pair Precision.

    PubMed

    Perreault, Andrea A; Venters, Bryan J

    2016-12-23

    Chromatin immunoprecipitation (ChIP) is an indispensable tool in the fields of epigenetics and gene regulation that isolates specific protein-DNA interactions. ChIP coupled to high throughput sequencing (ChIP-seq) is commonly used to determine the genomic location of proteins that interact with chromatin. However, ChIP-seq is hampered by relatively low mapping resolution of several hundred base pairs and high background signal. The ChIP-exo method is a refined version of ChIP-seq that substantially improves upon both resolution and noise. The key distinction of the ChIP-exo methodology is the incorporation of lambda exonuclease digestion in the library preparation workflow to effectively footprint the left and right 5' DNA borders of the protein-DNA crosslink site. The ChIP-exo libraries are then subjected to high throughput sequencing. The resulting data can be leveraged to provide unique and ultra-high resolution insights into the functional organization of the genome. Here, we describe the ChIP-exo method that we have optimized and streamlined for mammalian systems and next-generation sequencing-by-synthesis platform.

  4. DNA duplex stability of the thio-iso-guanine•methyl-iso-Cytosine base pair.

    PubMed

    Lee, Dongkye; Switzer, Christopher

    2015-01-01

    We report the synthesis, incorporation into oligonucleotides, and base-pairing properties of the 2-thio-variant of iso-guanine. Iso-guanine is the purine component of a nonstandard base pair with 5-methyl-iso-cytosine. The 2-thio-iso-guanine • 5-methyl-iso-cytosine base pair is found to have similar stability to an adenine • thymine pair.

  5. CanScript, an 18-Base pair DNA sequence, boosts tumor cell-specific promoter activity

    PubMed Central

    Huang, Yu-Hung; Cozzitorto, Joseph A; Richards, Nathan G; Eltoukhy, Ahmed A; Yeo, Charles J; Langer, Robert; Anderson, Daniel G; Brody, Jonathan R

    2010-01-01

    Gene therapy protocols for the treatment of cancer often employ gene promoter sequences that are known to be overexpressed in specific tumor cell types relative to normal cells. These promoters, while specific, are often weakly active. It would be desirable to increase the activity of such promoters, while at the same time retain specificity, so that the therapeutic gene is more robustly expressed. Using a luciferase reporter DNA construct in both in vitro cell transfection assays and in vivo mouse tumor models, we have determined that in the absence of any other DNA sequence, a previously identified 18-base pair enhancer sequence called CanScript, lying upstream of the MSLN gene, has ∼25% of the promoter activity of CAG, a very strong non-specific promoter/enhancer, in tumor cells in which MSLN is highly expressed. Furthermore, tandem repeat copies of CanScript enhance transcription in a dose-dependent manner and, when coupled with promoter sequences that are active in tumor cells, increase promoter activity. These findings suggest that the incorporation of CanScript into gene constructs may have application in enhancing activity of promoters used in cancer-targeting gene therapy strategies, thereby improving therapeutic efficacy. PMID:20798601

  6. Tertiary base pair interactions in slipped loop-DNA: an NMR and model building study.

    PubMed Central

    Ulyanov, N B; Bishop, K D; Ivanov, V I; James, T L

    1994-01-01

    Short direct repeat sequences are often found in regulatory regions of various genes; in some cases they display hypersensitivity to S1 nuclease cleavage in supercoiled plasmids. A non-standard DNA structure (Slipped Loop Structure, or SLS) has been proposed for these regions in order to explain the S1 cleavage data; the formation of this structure may be involved in the regulation of transcription. The structure can be generally classified as a particular type of pseudoknot. To date, no detailed stereochemical model has been developed. We have applied one-dimensional 1H NMR spectroscopy to study a synthetic DNA, 55 nucleotides in length, which cannot fold as a standard hairpin but which may favor the SLS formation. AT base pairs were identified, consistent only with the formation of an additional, tertiary miniduplex in the SLS. An all-atom stereochemically sound model has been developed for the SLS with the use of conformational calculations. The model building studies have demonstrated that the tertiary miniduplex can be formed for one of the plausible SLS isomers, but not for the other. Images PMID:7937152

  7. Tertiary base pair interactions in slipped loop-DNA: an NMR and model building study.

    PubMed

    Ulyanov, N B; Bishop, K D; Ivanov, V I; James, T L

    1994-10-11

    Short direct repeat sequences are often found in regulatory regions of various genes; in some cases they display hypersensitivity to S1 nuclease cleavage in supercoiled plasmids. A non-standard DNA structure (Slipped Loop Structure, or SLS) has been proposed for these regions in order to explain the S1 cleavage data; the formation of this structure may be involved in the regulation of transcription. The structure can be generally classified as a particular type of pseudoknot. To date, no detailed stereochemical model has been developed. We have applied one-dimensional 1H NMR spectroscopy to study a synthetic DNA, 55 nucleotides in length, which cannot fold as a standard hairpin but which may favor the SLS formation. AT base pairs were identified, consistent only with the formation of an additional, tertiary miniduplex in the SLS. An all-atom stereochemically sound model has been developed for the SLS with the use of conformational calculations. The model building studies have demonstrated that the tertiary miniduplex can be formed for one of the plausible SLS isomers, but not for the other.

  8. Osmium complex binding to mismatched methylcytosine: effect of adjacent bases.

    PubMed

    Nomura, Akiko; Tainaka, Kazuki; Okamoto, Akimitsu

    2009-01-01

    We investigated the efficiency of osmium complex formation at 5-methylcytosine in mismatched DNA duplexes. Osmium complexation was not observed in fully matched duplexes, whereas the complexation site and efficiency in mismatched duplexes depended on the 5'-neighboring base of the 5-methylcytosine. In particular, when the base adjacent to the 5' side of the mismatched base pair was thymine, a unique side reaction was observed. However, the mismatched base pairs did not influence the selectivity of osmium complexation with methylated DNA.

  9. DNA Mismatch Repair-Induced Double-Strand Breaks

    PubMed Central

    Nowosielska, Anetta; Marinus, M. G.

    2007-01-01

    Escherichia coli dam mutants are sensitized to the cytotoxic action of base analogs, cisplatin and N-methyl-N’-nitro-N-nitrosoguanidine (MNNG), while their mismatch repair (MMR)-deficient derivatives are tolerant to these agents. We showed previously, using pulse field gel electrophoresis, that MMR-mediated double-strand breaks (DSBs) are produced by cisplatin in dam recB (Ts) cells at the non-permissive temperature. We demonstrate here that the majority of these DSBs require DNA replication for their formation, consistent with a model in which replication forks collapse at nicks or gaps formed during MMR. DSBs were also detected in dam recB(Ts) ada ogt cells exposed to MNNG in a dose- and MMR-dependent manner. In contrast to cisplatin, the formation of these DSBs was not affected by DNA replication and it is proposed that two separate mechanisms result in DSB formation. Replication-independent DSBs arise from overlapping base excision and MMR repair tracts on complementary strands and constitute the majority of detectable DSBs in dam recB(Ts) ada ogt cells exposed to MNNG. Replication-dependent DSBs result from replication fork collapse at O6-meG base pairs undergoing MMR futile cycling and are more likely to contribute to cytotoxicity. This model is consistent with the observation that fast-growing dam recB (Ts) ada ogt cells, which have more chromosome replication origins, are more sensitive to the cytotoxic effect of MNNG than the same cells growing slowly. PMID:17827074

  10. Excited states of DNA base pairs using long-range corrected time-dependent density functional theory.

    PubMed

    Jensen, Lasse; Govind, Niranjan

    2009-09-10

    In this work, we present a study of the excitation energies of adenine, cytosine, guanine, thymine, and the adenine-thymine (AT) and guanine-cytosine (GC) base pairs using long-range corrected (LC) density functional theory. We compare three recent LC functionals, BNL, CAM-B3LYP, and LC-PBE0, with B3LYP and coupled cluster results from the literature. We find that the best overall performance is for the BNL functional based on LDA. However, in order to achieve this good agreement, a smaller attenuation parameter is needed, which leads to nonoptimum performance for ground-state properties. B3LYP, on the other hand, severely underestimates the charge-transfer (CT) transitions in the base pairs. Surprisingly, we also find that the CAM-B3LYP functional also underestimates the CT excitation energy for the GC base pair but correctly describes the AT base pair. This illustrates the importance of retaining the full long-range exact exchange even at distances as short as that of the DNA base pairs. The worst overall performance is obtained with the LC-PBE0 functional, which overestimates the excitations for the individual bases as well as the base pairs. It is therefore crucial to strike a good balance between the amount of local and long-range exact exchange. Thus, this work highlights the difficulties in obtained LC functionals, which provides a good description of both ground- and excited-state properties.

  11. Excited States of DNA Base Pairs Using Long-Range Corrected Time-Dependent Density Functional Theory

    SciTech Connect

    Jensen, Lasse; Govind, Niranjan

    2009-09-10

    In this work we present a study of the excitation energies of adenine, cytosine, guanine, thymine and the adenine-thymine (AT) and guanine-cytosine (GC) base pairs using long-range corrected (LC) density functional theory. We compare three recent LC-functionals, BNL, CAM-B3LYP and LC-PBE0 with B3LYP and coupled cluster results from the literature. We find that the best overall performance is for the BNL functional based on LDA. However, in order to achieve this good agreement a smaller attenuation parameter was needed which leads to non-optimum performance for ground state properties. B3LYP, on the other hand, severely underestimates the charge transfer (CT) transitions in the base pairs. Surprisingly we also find that the CAM-B3LYP functional also underestimates the CT excitation energy for the GC base pair, but correctly describes the AT base pair. This illustrates the importance of retaining the full long-range exact exchange even at distances as short as that of the DNA base pairs. The worst overall performance was obtained with the LC-PBE0 functional which overestimates the excitations for the individual bases as well as the base pairs. It is therefore crucial to strike a good balance between the amount of local and long-range exact exchange.

  12. Excited States of DNA Base Pairs Using Long-Range Corrected Time-Dependent Density Functional Theory

    NASA Astrophysics Data System (ADS)

    Jensen, Lasse; Govind, Niranjan

    2009-08-01

    In this work, we present a study of the excitation energies of adenine, cytosine, guanine, thymine, and the adenine-thymine (AT) and guanine-cytosine (GC) base pairs using long-range corrected (LC) density functional theory. We compare three recent LC functionals, BNL, CAM-B3LYP, and LC-PBE0, with B3LYP and coupled cluster results from the literature. We find that the best overall performance is for the BNL functional based on LDA. However, in order to achieve this good agreement, a smaller attenuation parameter is needed, which leads to nonoptimum performance for ground-state properties. B3LYP, on the other hand, severely underestimates the charge-transfer (CT) transitions in the base pairs. Surprisingly, we also find that the CAM-B3LYP functional also underestimates the CT excitation energy for the GC base pair but correctly describes the AT base pair. This illustrates the importance of retaining the full long-range exact exchange even at distances as short as that of the DNA base pairs. The worst overall performance is obtained with the LC-PBE0 functional, which overestimates the excitations for the individual bases as well as the base pairs. It is therefore crucial to strike a good balance between the amount of local and long-range exact exchange. Thus, this work highlights the difficulties in obtained LC functionals, which provides a good description of both ground- and excited-state properties.

  13. Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?

    PubMed

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.

  14. DNA mismatch repair and the DNA damage response

    PubMed Central

    Li, Zhongdao; Pearlman, Alexander H.; Hsieh, Peggy

    2015-01-01

    This review discusses the role of DNA mismatch repair (MMR) in the DNA damage response (DDR) that triggers cell cycle arrest and, in some cases, apoptosis. Although the focus is on findings from mammalian cells, much has been learned from studies in other organisms including bacteria and yeast [1,2]. MMR promotes a DDR mediated by a key signaling kinase, ATM and Rad3-related (ATR), in response to various types of DNA damage including some encountered in widely used chemotherapy regimes. An introduction to the DDR mediated by ATR reveals its immense complexity and highlights the many biological and mechanistic questions that remain. Recent findings and future directions are highlighted. PMID:26704428

  15. DNA mismatch repair and the DNA damage response.

    PubMed

    Li, Zhongdao; Pearlman, Alexander H; Hsieh, Peggy

    2016-02-01

    This review discusses the role of DNA mismatch repair (MMR) in the DNA damage response (DDR) that triggers cell cycle arrest and, in some cases, apoptosis. Although the focus is on findings from mammalian cells, much has been learned from studies in other organisms including bacteria and yeast [1,2]. MMR promotes a DDR mediated by a key signaling kinase, ATM and Rad3-related (ATR), in response to various types of DNA damage including some encountered in widely used chemotherapy regimes. An introduction to the DDR mediated by ATR reveals its immense complexity and highlights the many biological and mechanistic questions that remain. Recent findings and future directions are highlighted. Published by Elsevier B.V.

  16. The spontaneous replication error and the mismatch discrimination mechanisms of human DNA polymerase β

    PubMed Central

    Koag, Myong-Chul; Nam, Kwangho; Lee, Seongmin

    2014-01-01

    To provide molecular-level insights into the spontaneous replication error and the mismatch discrimination mechanisms of human DNA polymerase β (polβ), we report four crystal structures of polβ complexed with dG•dTTP and dA•dCTP mismatches in the presence of Mg2+ or Mn2+. The Mg2+-bound ground-state structures show that the dA•dCTP-Mg2+ complex adopts an ‘intermediate’ protein conformation while the dG•dTTP-Mg2+ complex adopts an open protein conformation. The Mn2+-bound ‘pre-chemistry-state’ structures show that the dA•dCTP-Mn2+ complex is structurally very similar to the dA•dCTP-Mg2+ complex, whereas the dG•dTTP-Mn2+ complex undergoes a large-scale conformational change to adopt a Watson–Crick-like dG•dTTP base pair and a closed protein conformation. These structural differences, together with our molecular dynamics simulation studies, suggest that polβ increases replication fidelity via a two-stage mismatch discrimination mechanism, where one is in the ground state and the other in the closed conformation state. In the closed conformation state, polβ appears to allow only a Watson–Crick-like conformation for purine•pyrimidine base pairs, thereby discriminating the mismatched base pairs based on their ability to form the Watson–Crick-like conformation. Overall, the present studies provide new insights into the spontaneous replication error and the replication fidelity mechanisms of polβ. PMID:25200079

  17. Chimeric Proteins to Detect DNA Damage and Mismatches

    SciTech Connect

    McCutchen-Maloney, S; Malfatti, M; Robbins, K M

    2002-01-14

    The goal of this project was to develop chimeric proteins composed of a DNA mismatch or damage binding protein and a nuclease, as well as methods to detect DNA mismatches and damage. We accomplished this through protein engineering based on using polymerase chain reactions (PCRs) to create chimeras with novel functions for damage and mismatch detection. This project addressed fundamental questions relating to disease susceptibility and radiation-induced damage in cells. It also supported and enhanced LLNL's competency in the emerging field of proteomics. In nature, DNA is constantly being subjected to damaging agents such as exposure to ultraviolet (UV) radiation and various environmental and dietary carcinogens. If DNA damage is not repaired however, mutations in DNA result that can eventually manifest in cancer and other diseases. In addition to damage-induced DNA mutations, single nucleotide polymorphisms (SNPs), which are variations in the genetic sequence between individuals, may predispose some to disease. As a result of the Human Genome Project, the integrity of a person's DNA can now be monitored. Therefore, methods to detect DNA damage, mutations, and SNPs are useful not only in basic research but also in the health and biotechnology industries. Current methods of detection often use radioactive labeling and rely on expensive instrumentation that is not readily available in many research settings. Our methods to detect DNA damage and mismatches employ simple gel electrophoresis and flow cytometry, thereby alleviating the need for radioactive labeling and expensive equipment. In FY2001, we explored SNP detection by developing methods based on the ability of the chimeric proteins to detect mismatches. Using multiplex assays with flow cytometry and fluorescent beads to which the DNA substrates where attached, we showed that several of the chimeras possess greater affinity for damaged and mismatched DNA than for native DNA. This affinity was demonstrated in

  18. Base-Pairing Energies of Protonated Nucleoside Base Pairs of dCyd and m(5)dCyd: Implications for the Stability of DNA i-Motif Conformations.

    PubMed

    Yang, Bo; Rodgers, M T

    2015-08-01

    Hypermethylation of cytosine in expanded (CCG)n•(CGG)n trinucleotide repeats results in Fragile X syndrome, the most common cause of inherited mental retardation. The (CCG)n•(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of protonated base pairs of cytosine. Here we investigate the effects of 5-methylation and the sugar moiety on the base-pairing energies (BPEs) of protonated cytosine base pairs by examining protonated nucleoside base pairs of 2'-deoxycytidine (dCyd) and 5-methyl-2'-deoxycytidine (m(5)dCyd) using threshold collision-induced dissociation techniques. 5-Methylation of a single or both cytosine residues leads to very small change in the BPE. However, the accumulated effect may be dramatic in diseased state trinucleotide repeats where many methylated base pairs may be present. The BPEs of the protonated nucleoside base pairs examined here significantly exceed those of Watson-Crick dGuo•dCyd and neutral dCyd•dCyd base pairs, such that these base-pairing interactions provide the major forces responsible for stabilization of DNA i-motif conformations. Compared with isolated protonated nucleobase pairs of cytosine and 1-methylcytosine, the 2'-deoxyribose sugar produces an effect similar to the 1-methyl substituent, and leads to a slight decrease in the BPE. These results suggest that the base-pairing interactions may be slightly weaker in nucleic acids, but that the extended backbone is likely to exert a relatively small effect on the total BPE. The proton affinity (PA) of m(5)dCyd is also determined by competitive analysis of the primary dissociation pathways that occur in parallel for the protonated (m(5)dCyd)H(+)(dCyd) nucleoside base pair and the absolute PA of dCyd previously reported.

  19. Base-Pairing Energies of Protonated Nucleoside Base Pairs of dCyd and m5dCyd: Implications for the Stability of DNA i-Motif Conformations

    NASA Astrophysics Data System (ADS)

    Yang, Bo; Rodgers, M. T.

    2015-08-01

    Hypermethylation of cytosine in expanded (CCG)n•(CGG)n trinucleotide repeats results in Fragile X syndrome, the most common cause of inherited mental retardation. The (CCG)n•(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of protonated base pairs of cytosine. Here we investigate the effects of 5-methylation and the sugar moiety on the base-pairing energies (BPEs) of protonated cytosine base pairs by examining protonated nucleoside base pairs of 2'-deoxycytidine (dCyd) and 5-methyl-2'-deoxycytidine (m5dCyd) using threshold collision-induced dissociation techniques. 5-Methylation of a single or both cytosine residues leads to very small change in the BPE. However, the accumulated effect may be dramatic in diseased state trinucleotide repeats where many methylated base pairs may be present. The BPEs of the protonated nucleoside base pairs examined here significantly exceed those of Watson-Crick dGuo•dCyd and neutral dCyd•dCyd base pairs, such that these base-pairing interactions provide the major forces responsible for stabilization of DNA i-motif conformations. Compared with isolated protonated nucleobase pairs of cytosine and 1-methylcytosine, the 2'-deoxyribose sugar produces an effect similar to the 1-methyl substituent, and leads to a slight decrease in the BPE. These results suggest that the base-pairing interactions may be slightly weaker in nucleic acids, but that the extended backbone is likely to exert a relatively small effect on the total BPE. The proton affinity (PA) of m5dCyd is also determined by competitive analysis of the primary dissociation pathways that occur in parallel for the protonated (m5dCyd)H+(dCyd) nucleoside base pair and the absolute PA of dCyd previously reported.

  20. Choline ion interactions with DNA atoms explain unique stabilization of A-T base pairs in DNA duplexes: a microscopic view.

    PubMed

    Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Sugimoto, Naoki

    2014-01-16

    Under physiological conditions, G-C base pairs are more stable than A-T base pairs. In a previous study, we showed that in the hydrated ionic liquid of choline dihydrogen phosphate, the stabilities of these base pairs are reversed. In the present study, we elucidated the unique binding interactions of choline ions with DNA atoms from a microscopic viewpoint using molecular dynamics simulations. Three times more choline ions bind to the DNA duplex than sodium ions. Sodium ions bind closely but not stably; in contrast, the choline ions bind through multiple hydrogen bonding networks with DNA atoms stably. The affinity of choline ion for the minor groove of A-T base pairs is more than 2 times that for other groove areas. In the narrow A-T minor groove, choline ion has high affinity for the ribose atoms of thymine. Choline ions also destabilize the formation of hydrogen bonds between G-C base pairs by binding to base atoms preferentially for both of duplex and single-strand DNA, which are associated with the bonds between G-C base pairs. Our new finding will not only lead to better control of DNA stability for use in DNA nanodevices, but also provide new insight into the stability of DNA duplexes under crowding conditions found in living cells.

  1. Base pairing enhances fluorescence and favors cyclobutane dimer formation induced upon absorption of UVA radiation by DNA.

    PubMed

    Banyasz, Akos; Vayá, Ignacio; Changenet-Barret, Pascale; Gustavsson, Thomas; Douki, Thierry; Markovitsi, Dimitra

    2011-04-13

    The photochemical properties of the DNA duplex (dA)(20)·(dT)(20) are compared with those of the parent single strands. It is shown that base pairing increases the probability of absorbing UVA photons, probably due to the formation of charge-transfer states. UVA excitation induces fluorescence peaking at ∼420 nm and decaying on the nanosecond time scale. The fluorescence quantum yield, the fluorescence lifetime, and the quantum yield for cyclobutane dimer formation increase upon base pairing. Such behavior contrasts with that of the UVC-induced processes.

  2. DNA binding and cleavage selectivity of the Escherichia coli DNA G:T-mismatch endonuclease (vsr protein).

    PubMed

    Gonzalez-Nicieza, R; Turner, D P; Connolly, B A

    2001-07-13

    The Escherichia coli vsr endonuclease recognises T:G base-pair mismatches in double-stranded DNA and initiates a repair pathway by hydrolysing the phosphate group 5' to the incorrectly paired T. The gene encoding the vsr endonuclease is next to the gene specifying the E. coli dcm DNA-methyltransferase; an enzyme that adds CH3 groups to the first dC within its target sequence CC[A/T]GG, giving C5MeC[A/T]GG. Deamination of the d5MeC results in CT[A/T]GG in which the first T is mis-paired with dG and it is believed that the endonuclease preferentially recognises T:G mismatches within the dcm recognition site. Here, the preference of the vsr endonuclease for bases surrounding the T:G mismatch has been evaluated. Determination of specificity constant (kst/KD; kst = rate constant for single turnover, KD = equilibrium dissociation constant) confirms vsr's preference for a T:G mismatch within a dcm sequence i.e. CT[A/T]GG (the underlined T being mis-paired with dG) is the best substrate. However, the enzyme is capable of binding and hydrolysing sequences that differ from the dcm target site by a single base-pair (dcm star sites). Individual alteration of any of the four bases surrounding the mismatched T gives a substrate, albeit with reduced binding affinity and slowed turnover rates. The vsr endonuclease has a much lower selectivity for the dcm sequence than type II restriction endonucleases have for their target sites. The results are discussed in the light of the known crystal structure of the vsr protein and its possible physiological role. Copyright 2001 Academic Press.

  3. DNA methylation by N-methyl-N-nitrosourea: methylation pattern changes in single- and double-stranded DNA, and in DNA with mismatched or bulged guanines.

    PubMed Central

    Wurdeman, R L; Douskey, M C; Gold, B

    1993-01-01

    The detection of abnormal DNA base pairing arrangements and conformations is chemically probed in synthetic 32P-end-labeled deoxyribonucleotide oligomers using N-methyl-N-nitrosourea (MNU) and 2,12,-dimethyl-3,7,11,17-tetraazabicyclo-[11.3.1]heptadeca-1 -[17],2,11,13,15 pentaene-Ni (II) (Ni-complex) with KHSO5. The DNA targets studied are single-stranded (s-s) DNA, double-stranded (d-s) DNA, d-s DNA with G-G, G-A and G-T mismatches, d-s DNA with a single bulged G and d-s DNA with two bulged G's. The effect of the non-Watson--Crick structures on the formation of N7-methylguanine (N7-MeG) by MNU and the oxidation of G by Ni-complex is reported along with the Tm's and circular dichroism spectra of the different duplex oligomers. The results for MNU and Ni-complex show that the qualitative and quantitative character of the cleavage patterns at a G3 run change with the nature of the abnormal base pairing motif. Based on the DNA substrates studied, the results indicate that a combination of reagents which report electronic and steric perturbations can be a useful approach to monitor DNA mismatches and bulges. Images PMID:8177747

  4. [Structural and energetic properties of the four configurations of the A.T and G.C DNA base pairs].

    PubMed

    Brovarets', O O

    2013-01-01

    Using the methods of non-empirical quantum chemistry at the MP2/6-311++G(2df,pd)// B3LYP/6-311++G(d,p) level of theory it was established for the first time, that Hoogsteen, reverse Hoogsteen, Watson-Crick and reverse Watson-Crick configurations of the A.T and G.C DNA base pairs are isoelectronic and isomorphic structures with similar dynamic properties. Based on these results, non-ionisation mechanism of the Hoogsteen <"breathing" of the G*.C* DNA base pair, namely transformation of the tautomerised (Lowdin's) G-C base pair with Watson-Crick geometry into the Hoogsteen electroneutral G*.C* H base pair stabilized by the three O6H...N4, N3H...N7 and C8H...02 H-bonds, was postulated. It is suggested that such scenario activates only in those cases, when DNA is not located in aqueous solution, but works together with proteins and cytosine protonation at the N3 atom is precluded.

  5. Molecular recognition of DNA base pairs by the formamido/pyrrole and formamido/imidazole pairings in stacked polyamides

    PubMed Central

    Buchmueller, Karen L.; Staples, Andrew M.; Uthe, Peter B.; Howard, Cameron M.; Pacheco, Kimberly A. O.; Cox, Kari K.; Henry, James A.; Bailey, Suzanna L.; Horick, Sarah M.; Nguyen, Binh; Wilson, W. David; Lee, Moses

    2005-01-01

    Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, –ImPy– and –PyPy–. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and ΔTM experiments. The f/Py pairing, when placed next to the –ImPy– or –PyPy– central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With –ImPy– central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson–Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the –PyPy– central pairings. PMID:15703305

  6. DNA mismatch repair: Dr. Jekyll and Mr. Hyde?

    PubMed

    Hsieh, Peggy

    2012-09-14

    In this issue, Peña-Diaz et al. (2012) describe a pathway for somatic mutation in nonlymphoid cells termed noncanonical DNA mismatch repair, whereby the error-prone translesion polymerase Pol-η substitutes for high-fidelity replicative polymerases to resynthesize excised regions opposite DNA damage. Copyright © 2012 Elsevier Inc. All rights reserved.

  7. Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

    PubMed

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-09-18

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events.

  8. Crystal structure of metallo DNA duplex containing consecutive Watson-Crick-like T-Hg(II)-T base pairs.

    PubMed

    Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2014-02-24

    The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials.

  9. Free energy landscape and transition pathways from Watson–Crick to Hoogsteen base pairing in free duplex DNA

    PubMed Central

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-01-01

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116

  10. Reversed-phase ion-pair liquid chromatography method for purification of duplex DNA with single base pair resolution

    PubMed Central

    Wysoczynski, Christina L.; Roemer, Sarah C.; Dostal, Vishantie; Barkley, Robert M.; Churchill, Mair E. A.; Malarkey, Christopher S.

    2013-01-01

    Obtaining quantities of highly pure duplex DNA is a bottleneck in the biophysical analysis of protein–DNA complexes. In traditional DNA purification methods, the individual cognate DNA strands are purified separately before annealing to form DNA duplexes. This approach works well for palindromic sequences, in which top and bottom strands are identical and duplex formation is typically complete. However, in cases where the DNA is non-palindromic, excess of single-stranded DNA must be removed through additional purification steps to prevent it from interfering in further experiments. Here we describe and apply a novel reversed-phase ion-pair liquid chromatography purification method for double-stranded DNA ranging in lengths from 17 to 51 bp. Both palindromic and non-palindromic DNA can be readily purified. This method has the unique ability to separate blunt double-stranded DNA from pre-attenuated (n-1, n-2, etc) synthesis products, and from DNA duplexes with single base pair overhangs. Additionally, palindromic DNA sequences with only minor differences in the central spacer sequence of the DNA can be separated, and the purified DNA is suitable for co-crystallization of protein–DNA complexes. Thus, double-stranded ion-pair liquid chromatography is a useful approach for duplex DNA purification for many applications. PMID:24013567

  11. Mechanism of mismatch recognition revealed by human MutS[beta] bound to unpaired DNA loops

    SciTech Connect

    Gupta, Shikha; Gellert, Martin; Yang, Wei

    2012-04-17

    DNA mismatch repair corrects replication errors, thus reducing mutation rates and microsatellite instability. Genetic defects in this pathway cause Lynch syndrome and various cancers in humans. Binding of a mispaired or unpaired base by bacterial MutS and eukaryotic MutS{alpha} is well characterized. We report here crystal structures of human MutS{beta} in complex with DNA containing insertion-deletion loops (IDL) of two, three, four or six unpaired nucleotides. In contrast to eukaryotic MutS{alpha} and bacterial MutS, which bind the base of a mismatched nucleotide, MutS{beta} binds three phosphates in an IDL. DNA is severely bent at the IDL; unpaired bases are flipped out into the major groove and partially exposed to solvent. A normal downstream base pair can become unpaired; a single unpaired base can thereby be converted to an IDL of two nucleotides and recognized by MutS{beta}. The C-terminal dimerization domains form an integral part of the MutS structure and coordinate asymmetrical ATP hydrolysis by Msh2 and Msh3 with mismatch binding to signal for repair.

  12. Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

    PubMed

    Xia, Shuangluo; Konigsberg, William H

    2014-04-01

    Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states.

  13. Toward a designed genetic system with biochemical function: polymerase synthesis of single and multiple size-expanded DNA base pairs.

    PubMed

    Lu, Haige; Krueger, Andrew T; Gao, Jianmin; Liu, Haibo; Kool, Eric T

    2010-06-21

    The development of alternative architectures for genetic information-encoding systems offers the possibility of new biotechnological tools as well as basic insights into the function of the natural system. In order to examine the potential of benzo-expanded DNA (xDNA) to encode and transfer biochemical information, we carried out a study of the processing of single xDNA pairs by DNA Polymerase I Klenow fragment (Kf, an A-family sterically rigid enzyme) and by the Sulfolobus solfataricus polymerase Dpo4 (a flexible Y-family polymerase). Steady-state kinetics were measured and compared for enzymatic synthesis of the four correct xDNA pairs and twelve mismatched pairs, by incorporation of dNTPs opposite single xDNA bases. Results showed that, like Kf, Dpo4 in most cases selected the correctly paired partner for each xDNA base, but with efficiency lowered by the enlarged pair size. We also evaluated kinetics for extension by these polymerases beyond xDNA pairs and mismatches, and for exonuclease editing by the Klenow exo+ polymerase. Interestingly, the two enzymes were markedly different: Dpo4 extended pairs with relatively high efficiencies (within 18-200-fold of natural DNA), whereas Kf essentially failed at extension. The favorable extension by Dpo4 was tested further by stepwise synthesis of up to four successive xDNA pairs on an xDNA template.

  14. Synthesis and base pairing studies of geranylated 2-thiothymidine, a natural variant of thymidine.

    PubMed

    Wang, Rui; Ranganathan, Srivathsan V; Basanta-Sanchez, Maria; Shen, Fusheng; Chen, Alan; Sheng, Jia

    2015-11-25

    The synthesis and base pairing of DNA duplexes containing the geranylated 2-thiothymidine have been investigated. This naturally existing hydrophobic modification could grant better base pairing stability to the T-G pair over normal T-A and other mismatched pairs in the duplex context. This study provides a potential explanation for the different codon recognition preferences of the geranylated tRNAs.

  15. DNA Bending Propensity in the Presence of Base Mismatches: Implications for DNA Repair

    PubMed Central

    Sharma, Monika; Predeus, Alexander V.; Mukherjee, Shayantani; Feig, Michael

    2013-01-01

    DNA bending is believed to facilitate the initial recognition of the mismatched base for repair. The repair efficiencies are dependent on both the mismatch type and neighboring nucleotide sequence. We have studied bending of several DNA duplexes containing canonical matches: A:T, G:C, various mismatches: A:A, A:C, G:A, G:G, G:T, C:C, C:T, T:T, and a bis-abasic site: X:X. Free energy profiles were generated for DNA bending using umbrella sampling. The highest energetic cost associated with DNA bending is observed for canonical matches while bending free energies are lower in the presence of mismatches, with the lowest value for the abasic site. In all of the sequences, DNA duplexes bend towards the major groove with widening of the minor groove. For homoduplexes, DNA bending is observed to occur via smooth deformations, whereas for heteroduplexes, kinks are observed at the mismatch site during strong bending. In general, pyrimidine:pyrimidine mismatches are the most destabilizing, while purine:purine mismatches lead to intermediate destabilization and purine:pyrimidine mismatches are the least destabilizing. The ease of bending is partially correlated with the binding affinity of MutS to the mismatch pairs and subsequent repair efficiencies, indicating that intrinsic DNA bending propensities are a key factor of mismatch recognition. PMID:23621762

  16. 2-Thiouracil deprived of thiocarbonyl function preferentially base pairs with guanine rather than adenine in RNA and DNA duplexes.

    PubMed

    Sochacka, Elzbieta; Szczepanowski, Roman H; Cypryk, Marek; Sobczak, Milena; Janicka, Magdalena; Kraszewska, Karina; Bartos, Paulina; Chwialkowska, Anna; Nawrot, Barbara

    2015-03-11

    2-Thiouracil-containing nucleosides are essential modified units of natural and synthetic nucleic acids. In particular, the 5-substituted-2-thiouridines (S2Us) present in tRNA play an important role in tuning the translation process through codon-anticodon interactions. The enhanced thermodynamic stability of S2U-containing RNA duplexes and the preferred S2U-A versus S2U-G base pairing are appreciated characteristics of S2U-modified molecular probes. Recently, we have demonstrated that 2-thiouridine (alone or within an RNA chain) is predominantly transformed under oxidative stress conditions to 4-pyrimidinone riboside (H2U) and not to uridine. Due to the important biological functions and various biotechnological applications for sulfur-containing nucleic acids, we compared the thermodynamic stabilities of duplexes containing desulfured products with those of 2-thiouracil-modified RNA and DNA duplexes. Differential scanning calorimetry experiments and theoretical calculations demonstrate that upon 2-thiouracil desulfuration to 4-pyrimidinone, the preferred base pairing of S2U with adenosine is lost, with preferred base pairing with guanosine observed instead. Therefore, biological processes and in vitro assays in which oxidative desulfuration of 2-thiouracil-containing components occurs may be altered. Moreover, we propose that the H2U-G base pair is a suitable model for investigation of the preferred recognition of 3'-G-ending versus A-ending codons by tRNA wobble nucleosides, which may adopt a 4-pyrimidinone-type structural motif.

  17. New insights into the mechanism of DNA mismatch repair

    PubMed Central

    Reyes, Gloria X.; Schmidt, Tobias T.; Kolodner, Richard D.; Hombauer, Hans

    2015-01-01

    The genome of all organisms is constantly being challenged by endogenous and exogenous sources of DNA damage. Errors like base:base mismatches or small insertions and deletions, primarily introduced by DNA polymerases during DNA replication are repaired by an evolutionary conserved DNA mismatch repair (MMR) system. The MMR system, together with the DNA replication machinery, promote repair by an excision and resynthesis mechanism during or after DNA replication, increasing replication fidelity by upto-three orders of magnitude. Consequently, inactivation of MMR genes results in elevated mutation rates that can lead to increased cancer susceptibility in humans. In this review, we summarize our current understanding of MMR with a focus on the different MMR protein complexes, their function and structure. We also discuss how recent findings have provided new insights in the spatio-temporal regulation and mechanism of MMR. PMID:25862369

  18. Varying DNA base-pair size in subangstrom increments: evidence for a loose, not large, active site in low-fidelity Dpo4 polymerase.

    PubMed

    Mizukami, Shin; Kim, Tae Woo; Helquist, Sandra A; Kool, Eric T

    2006-03-07

    We describe the first systematic test of steric effects in the active site of a Y-family DNA polymerase, Dpo4. It has been hypothesized that low-fidelity repair polymerases in this family more readily accept damaged or mismatched base pairs because of a sterically more open active site, which might place lower geometric constraints on the incipient pair. We have tested the origin of low fidelity by use of five nonpolar thymidine analogues that vary in size by a total of 1.0 A over the series. The efficiency and fidelity of base-pair synthesis was measured by steady-state kinetics for single-nucleotide insertions. Analogues were examined both as incoming deoxynucleoside triphosphate (dNTP) derivatives and as template bases. The results showed that Dpo4 preferred to pair the thymidine shape mimics with adenine and, surprisingly, the preferred size was at the center of the range, the same optimum size as recently found for the high-fidelity Klenow fragment (Kf) of Escherichia coli DNA Pol I. However, the size preference with Dpo4 was quite small, varying by a factor of only 30-35 from most to least efficient thymidine analogue. This is in marked contrast to Kf, which showed a rigid size preference, varying by 1100-fold from best to worst. The fidelity for the non-hydrogen-bonding analogues in pairing with A over T, C, or G was much lower in Dpo4 than in the previous high-fidelity enzyme. The data establish that, unlike Kf, Dpo4 has very low steric selectivity and that steric effects alone cannot explain the fidelity (albeit low) that Dpo4 has for a correct base pair; the findings suggest that hydrogen bonds may be important in determining the fidelity of this enzyme. The results suggest that the low steric selectivity of this enzyme is the result of a conformationally flexible or loose active site that adapts with small energetic cost to different base-pair sizes (as measured by the glycosidic C1'-C1' distance), rather than a spatially large active site.

  19. 1,8-Naphthyridine-2,7-diamine: a potential universal reader of Watson-Crick base pairs for DNA sequencing by electron tunneling.

    PubMed

    Liang, Feng; Lindsay, Stuart; Zhang, Peiming

    2012-11-21

    With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.

  20. Repair of mismatched basepairs in mammalian DNA

    SciTech Connect

    Taylor, J.H.; Hare, J.T.

    1991-08-01

    We have concentrated on three specific areas of our research plan. Our greatest emphasis is on the role of single strand nicks in influencing template strand selection in mismatch repair. We have found, that the ability of a nick in one strand to influence which strand is repaired is not a simple function of distance from the mismatched site but rather that an hot spot where a nick is more likely to have an influence can exist. The second line was production of single-genotype heteroduplexes in order to examine independently the repair of T/G and A/C mispairs within the same sequence context as in our mixed mispair preparations. We have shown preparations of supercoiled heteroduplex can be prepared that were exclusively T/G or exclusively A/C at the mispair site. The third effort has been to understand the difference in repair bias of different cell lines or different transfection conditions as it may relate to different repair systems in the cell. We have identified some of the sources of variation, including cell cycle position. We hope to continue this work to more precisely identify the phase of the cell cycle.

  1. Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing.

    PubMed

    Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon

    2010-08-18

    It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

  2. Robust IR-based detection of stable and fractionally populated G-C(+) and A-T Hoogsteen base pairs in duplex DNA.

    PubMed

    Stelling, Allison L; Xu, Yu; Zhou, Huiqing; Choi, Seung H; Clay, Mary C; Merriman, Dawn K; Al-Hashimi, Hashim M

    2017-06-01

    Noncanonical G-C(+) and A-T Hoogsteen base pairs can form in duplex DNA and play roles in recognition, damage repair, and replication. Identifying Hoogsteen base pairs in DNA duplexes remains challenging due to difficulties in resolving syn versus antipurine bases with X-ray crystallography; and size limitations and line broadening can make them difficult to characterize by NMR spectroscopy. Here, we show how infrared (IR) spectroscopy can identify G-C(+) and A-T Hoogsteen base pairs in duplex DNA across a range of different structural contexts. The utility of IR-based detection of Hoogsteen base pairs is demonstrated by characterizing the first example of adjacent A-T and G-C(+) Hoogsteen base pairs in a DNA duplex where severe broadening complicates detection with NMR. © 2017 Federation of European Biochemical Societies.

  3. Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

    PubMed

    Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

    2015-12-01

    Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA.

  4. DNA sequence of 15 base pairs is sufficient to mediate both glucocorticoid and progesterone induction of gene expression

    SciTech Connect

    Straehle, U.; Klock, G.; Schuetz, G.

    1987-11-01

    To define the recognition sequence of the glucocorticoid receptor and its relationship with that of the progesterone receptor, oligonucleotides derived from the glucocorticoid response element of the tyrosine aminotransferase gene were tested upstream of a heterologous promoter for their capacity to mediate effects of these two steroids. The authors show that a 15-base-pair sequence with partial symmetry is sufficient to confer glucocorticoid inducibility on the promoter of the herpes simplex virus thymidine kinase gene. The same 15-base-pair sequence mediates induction by progesterone. Point mutations in the recognition sequence affect inducibility by glucocorticoids and progesterone similarly. Together with the strong conservation of the sequence of the DNA-binding domain of the two receptors, these data suggest that both proteins recognize a sequence that is similar, if not the same.

  5. Anharmonic and harmonic intermolecular vibrational modes of the DNA base pairs

    NASA Astrophysics Data System (ADS)

    Špirko, Vladimír; Šponer, Jiří; Hobza, Pavel

    1997-01-01

    Intermolecular vibrational modes of the H-bonded adenine…thymine Watson-Crick (AT) base pair were studied for the first time using multidimensional nonharmonic treatment. Relying on a Born-Oppenheimer-like separation of the fast and slow vibrational motions, the complete multidimensional vibrational problem is reduced to a six-dimensional subproblem in which all rearrangements between the pair fragments (i.e., adenine and thymine) can be described. Following the Hougen-Bunker-Johns approach and using appropriate vibrational coordinates, a nonrigid reference is defined which covers all motions on the low-lying part of the intermolecular potential surface and which facilitates the derivation of a suitable model Hamiltonian. The potential energy surface is determined at the ab initio Hartree-Fock level with minimal basis set (HF/MINI-1) and an analytic potential energy function is obtained by fitting to the ab initio data. This function is used to calculate vibrational energy levels and effective geometries within the framework of the model Hamiltonian, disregarding the role of the kinematic and potential (in-plane)-(out-of-plane) interactions. The calculations are in reasonable agreement with the normal coordinate analysis (harmonic treatment) thus indicating physical correctness of this standard approach for an approximate description of the lowest vibrational states of the AT base pair. In addition, to get a deeper insight, harmonic vibrational frequencies of the AT pair and 28 other base pairs are evaluated at the same and higher levels of theory [ab initio Hartree-Fock level with split-valence basis set (HF/6-31G**)]. The HF/MINI-1 and HF/6-31G** intermolecular harmonic vibrational frequencies differ by less than 30%. For all the base pairs, the buckle and propeller vibrational modes [for definition and nomenclature see R. E. Dickerson et al., EMBO J. 8, 1 (1989)] are the lowest ones, all being in the narrow interval (from 4 to 30 cm-1 in the harmonic

  6. In vitro recognition of DNA base pairs by histones in histone-DNA complexes and reconstituted core particles: an ultraviolet resonance Raman study.

    PubMed Central

    Laigle, A; Chinsky, L; Turpin, P Y; Liquier, J; Taillandier, E

    1982-01-01

    Resonance Raman spectra of complexes between DNA and the four core histones, alone or associated, have been investigated in vitro using excitations at 300 and 257 nm, which give complementary informations about the DNA bases. H2A and H2B fractions recognize the G-C base pairs, while H3 and H4 (arginine rich fractions) recognize the A-T base pairs. The associated fractions form complexes with DNA which yield about the same DNA spectral modifications as the DNA-H4 complexes. This reveals the important role of the arginine rich fractions in the core particle formation and confirms the preferential in vitro assembly of nucleosome cores on A-T rich regions of DNA (25). PMID:7155896

  7. Robust silver-mediated imidazolo-dC base pairs in metal DNA: dinuclear silver bridges with exceptional stability in double helices with parallel and antiparallel strand orientation.

    PubMed

    Jana, Sunit Kumar; Guo, Xiurong; Mei, Hui; Seela, Frank

    2015-12-18

    A new unprecedented metal-mediated base pair was designed that stabilizes reverse Watson-Crick DNA (parallel strand orientation, ps) as well as canonical Watson-Crick DNA (antiparallel strand orientation, aps). This base pair contains two imidazolo-dC units decorated with furan residues. Tm measurements and spectroscopic studies reveal that each silver-mediated furano-imidazolo-dC forms exceptionally stable duplexes with ps and aps chain orientation. This stability increase by a silver-mediated base pair is the highest reported so far for ps and aps DNA helices.

  8. Copper(II)-Controlled Molecular Glue for Mismatched DNA.

    PubMed

    Kotera, Naoko; Guillot, Régis; Teulade-Fichou, Marie-Paule; Granzhan, Anton

    2017-04-04

    Isothermal hybridization of two DNA strands bearing three thymine-thymine (T:T) mismatches can be brought about in the presence of a stoichiometric amount of a bis-naphthalene macrocycle, 2,7-BisNP-NH. This process can be reverted by addition of a Cu(II) salt due to formation of a dinuclear metal complex which does not bind to DNA. Subsequent sequestration of Cu(II) releases the macrocycle and restores the hybridization state of DNA strands, thus allowing implementation of a fast fluorescent two-state DNA switch. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Centromeric Alpha-Satellite DNA Adopts Dimeric i-Motif Structures Capped by AT Hoogsteen Base Pairs.

    PubMed

    Garavís, Miguel; Escaja, Núria; Gabelica, Valérie; Villasante, Alfredo; González, Carlos

    2015-06-26

    Human centromeric alpha-satellite DNA is composed of tandem arrays of two types of 171 bp monomers; type A and type B. The differences between these types are concentrated in a 17 bp region of the monomer called the A/B box. Here, we have determined the solution structure of the C-rich strand of the two main variants of the human alpha-satellite A box. We show that, under acidic conditions, the C-rich strands of two A boxes self-recognize and form a head-to-tail dimeric i-motif stabilized by four intercalated hemi-protonated C:C(+) base pairs. Interestingly, the stack of C:C(+) base pairs is capped by T:T and Hoogsteen A:T base pairs. The two main variants of the A box adopt a similar three-dimensional structure, although the residues involved in the formation of the i-motif core are different in each case. Together with previous studies showing that the B box (known as the CENP-B box) also forms dimeric i-motif structures, our finding of this non-canonical structure in the A box shows that centromeric alpha satellites in all human chromosomes are able to form i-motifs, which consequently raises the possibility that these structures may play a role in the structural organization of the centromere. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Design and synthesis of heterocyclic cations for specific DNA recognition: from AT-rich to mixed-base-pair DNA sequences.

    PubMed

    Chai, Yun; Paul, Ananya; Rettig, Michael; Wilson, W David; Boykin, David W

    2014-02-07

    The compounds synthesized in this research were designed with the goal of establishing a new paradigm for mixed-base-pair DNA sequence-specific recognition. The design scheme starts with a cell-permeable heterocyclic cation that binds to AT base pair sites in the DNA minor groove. Modifications were introduced in the original compound to include an H-bond accepting group to specifically recognize the G-NH that projects into the minor groove. Therefore, a series of heterocyclic cations substituted with an azabenzimidazole ring has been designed and synthesized for mixed-base-pair DNA recognition. The most successful compound, 12a, had an azabenzimidazole to recognize G and additional modifications for general minor groove interactions. It binds to the DNA site -AAAGTTT- more strongly than the -AAATTT- site without GC and indicates the design success. Structural modifications of 12a generally weakened binding. The interactions of the new compound with a variety of DNA sequences with and without GC base pairs were evaluated by thermal melting analysis, circular dichroism, fluorescence emission spectroscopy, surface plasmon resonance, and molecular modeling.

  11. 2-Thiouracil deprived of thiocarbonyl function preferentially base pairs with guanine rather than adenine in RNA and DNA duplexes

    PubMed Central

    Sochacka, Elzbieta; Szczepanowski, Roman H.; Cypryk, Marek; Sobczak, Milena; Janicka, Magdalena; Kraszewska, Karina; Bartos, Paulina; Chwialkowska, Anna; Nawrot, Barbara

    2015-01-01

    2-Thiouracil-containing nucleosides are essential modified units of natural and synthetic nucleic acids. In particular, the 5-substituted-2-thiouridines (S2Us) present in tRNA play an important role in tuning the translation process through codon–anticodon interactions. The enhanced thermodynamic stability of S2U-containing RNA duplexes and the preferred S2U-A versus S2U-G base pairing are appreciated characteristics of S2U-modified molecular probes. Recently, we have demonstrated that 2-thiouridine (alone or within an RNA chain) is predominantly transformed under oxidative stress conditions to 4-pyrimidinone riboside (H2U) and not to uridine. Due to the important biological functions and various biotechnological applications for sulfur-containing nucleic acids, we compared the thermodynamic stabilities of duplexes containing desulfured products with those of 2-thiouracil-modified RNA and DNA duplexes. Differential scanning calorimetry experiments and theoretical calculations demonstrate that upon 2-thiouracil desulfuration to 4-pyrimidinone, the preferred base pairing of S2U with adenosine is lost, with preferred base pairing with guanosine observed instead. Therefore, biological processes and in vitro assays in which oxidative desulfuration of 2-thiouracil-containing components occurs may be altered. Moreover, we propose that the H2U-G base pair is a suitable model for investigation of the preferred recognition of 3′-G-ending versus A-ending codons by tRNA wobble nucleosides, which may adopt a 4-pyrimidinone-type structural motif. PMID:25690900

  12. Attacking mechanism of hydroxyl radical to DNA base-pair: density functional study in vacuum and in water.

    PubMed

    Shimizu, Eisuke; Tokuyama, Yuki; Okutsu, Naoko; Nomura, Kazuya; Danilov, Victor I; Kurita, Noriyuki

    2015-01-01

    Recently, the influence of radiation on human body has been recognized as a serious problem. In particular, highly reactive hydroxyl radicals *OH produced by the radiation react with DNA, resulting in a great damage on its structure and electronic properties. It is thus important to investigate the reaction mechanism of *OH to DNA for elucidating the initial damage in DNA induced by the radiation. In the present study, we search for transition states (TS) of the reaction between G-C/A-T base-pair and [Formula: see text] in vacuum and in water, by the density functional theory (DFT) calculations. At first, we obtain the stable structures for the dehydrogenated G-C and A-T, in which the hydrogen atom of NH2 group of G or A base is abstracted by [Formula: see text]. From the structures of the dehydrogenated as well as the natural base-pairs, the TS between these structures is searched for and the activation free energy (AFE) is estimated for the reaction. In vacuum, AFEs for the G-C and A-T are almost the same each other, while the stabilization energy by the reaction for G-C is about 4.9 kcal/mol larger than that for A-T, indicating that the population of the dehydrogenated G-C is remarkably larger than that of the dehydrogenated A-T in vacuum. On the other hand, in water approximated by the continuum solvation model, the AFE for A-T is 2.6 kcal/mol smaller than that for G-C, indicating that the reaction dehydrogenated by [Formula: see text] occurs more frequently for the solvated A-T base-pair than G-C.

  13. Characterization of a Thermostable 8-Oxoguanine DNA Glycosylase Specific for GO/N Mismatches from the Thermoacidophilic Archaeon Thermoplasma volcanium

    PubMed Central

    Fujii, Miki; Hata, Chieri; Ukita, Munetada; Fukushima, Chie; Matsuura, Chihiro; Kawashima-Ohya, Yoshie; Tomobe, Koji

    2016-01-01

    The oxidation of guanine (G) to 7,8-dihydro-8-oxoguanine (GO) forms one of the major DNA lesions generated by reactive oxygen species (ROS). The GO can be corrected by GO DNA glycosylases (Ogg), enzymes involved in base excision repair (BER). Unrepaired GO induces mismatched base pairing with adenine (A); as a result, the mismatch causes a point mutation, from G paired with cytosine (C) to thymine (T) paired with adenine (A), during DNA replication. Here, we report the characterization of a putative Ogg from the thermoacidophilic archaeon Thermoplasma volcanium. The 204-amino acid sequence of the putative Ogg (TVG_RS00315) shares significant sequence homology with the DNA glycosylases of Methanocaldococcus jannaschii (MjaOgg) and Sulfolobus solfataricus (SsoOgg). The six histidine-tagged recombinant TVG_RS00315 protein gene was expressed in Escherichia coli and purified. The Ogg protein is thermostable, with optimal activity near a pH of 7.5 and a temperature of 60°C. The enzyme displays DNA glycosylase, and apurinic/apyrimidinic (AP) lyase activities on GO/N (where N is A, T, G, or C) mismatch; yet it cannot eliminate U from U/G or T from T/G, as mismatch glycosylase (MIG) can. These results indicate that TvoOgg-encoding TVG_RS00315 is a member of the Ogg2 family of T. volcanium. PMID:27799846

  14. Impact of DNA mismatch repair system alterations on human fertility and related treatments.

    PubMed

    Hu, Min-hao; Liu, Shu-yuan; Wang, Ning; Wu, Yan; Jin, Fan

    2016-01-01

    DNA mismatch repair (MMR) is one of the biological pathways, which plays a critical role in DNA homeostasis, primarily by repairing base-pair mismatches and insertion/deletion loops that occur during DNA replication. MMR also takes part in other metabolic pathways and regulates cell cycle arrest. Defects in MMR are associated with genomic instability, predisposition to certain types of cancers and resistance to certain therapeutic drugs. Moreover, genetic and epigenetic alterations in the MMR system demonstrate a significant relationship with human fertility and related treatments, which helps us to understand the etiology and susceptibility of human infertility. Alterations in the MMR system may also influence the health of offspring conceived by assisted reproductive technology in humans. However, further studies are needed to explore the specific mechanisms by which the MMR system may affect human infertility. This review addresses the physiological mechanisms of the MMR system and associations between alterations of the MMR system and human fertility and related treatments, and potential effects on the next generation.

  15. Impact of DNA mismatch repair system alterations on human fertility and related treatments*

    PubMed Central

    Hu, Min-hao; Liu, Shu-yuan; Wang, Ning; Wu, Yan; Jin, Fan

    2016-01-01

    DNA mismatch repair (MMR) is one of the biological pathways, which plays a critical role in DNA homeostasis, primarily by repairing base-pair mismatches and insertion/deletion loops that occur during DNA replication. MMR also takes part in other metabolic pathways and regulates cell cycle arrest. Defects in MMR are associated with genomic instability, predisposition to certain types of cancers and resistance to certain therapeutic drugs. Moreover, genetic and epigenetic alterations in the MMR system demonstrate a significant relationship with human fertility and related treatments, which helps us to understand the etiology and susceptibility of human infertility. Alterations in the MMR system may also influence the health of offspring conceived by assisted reproductive technology in humans. However, further studies are needed to explore the specific mechanisms by which the MMR system may affect human infertility. This review addresses the physiological mechanisms of the MMR system and associations between alterations of the MMR system and human fertility and related treatments, and potential effects on the next generation. PMID:26739522

  16. Torque spectroscopy of DNA: base-pair stability, boundary effects, backbending, and breathing dynamics

    PubMed Central

    Oberstrass, Florian C.; Fernandes, Louis E.; Lebel, Paul; Bryant, Zev

    2013-01-01

    Changes in global DNA linking number can be accommodated by localized changes in helical structure. We have used single-molecule torque measurements to investigate sequence-specific strand separation and Z-DNA formation. By controlling the boundary conditions at the edges of sequences of interest, we have confirmed theoretical predictions of distinctive boundary-dependent backbending patterns in torque-twist relationships. Abrupt torque jumps are associated with the formation and collapse of DNA bubbles, permitting direct observations of DNA breathing dynamics. PMID:23679785

  17. Sequence dependence of base-pair stacking in right-handed DNA in solution: proton nuclear Overhauser effect NMR measurements.

    PubMed Central

    Patel, D J; Kozlowski, S A; Bhatt, R

    1983-01-01

    Single-crystal x-ray studies of d(C-G-C-G-A-A-T-T-C-G-C-G) exhibit base-pair propeller twisting [Dickerson, R. E. & Drew, H. R. (1981) J. Mol. Biol. 149, 761-786] that results in close contacts between adjacent purines in the minor groove in pyrimidine (3'-5')-purine steps and in the major groove in purine (3'-5')-pyrimidine steps [Calladine, C. R. (1982) J. Mol. Biol. 161, 343-362]. These observations require an approximately 3.4 A separation between the minor groove edges of adenosines on adjacent base pairs for the dA-dA step but predict a smaller separation for the dT-dA step and a larger separation for the dA-dT step in a D(A-T-T-A).d(T-A-A-T) fragment. We have confirmed these predictions from steady-state nuclear Overhauser effect measurements between assigned minor groove adenosine H-2 protons on adjacent base pairs in the proton NMR spectrum of the d(C1-G2-A3-T4-T5-A6-T6-A5-A4-T3-C2-G1) self-complementary dodecanucleotide duplex (henceforth called the Pribnow 12-mer) in solution. The measured cross-relaxation rates (product of steady-state nuclear Overhauser effect and selective spin- lattice relaxation rates) translate to interproton separations between adjacent adenosine H-2 protons of 4.22 A in the (dA3-dT4).(dA4-dT3) step, of 3.56 A in the (dT4-dT5).dA5-dA4) step, and of 3.17 A in the (dT5-dA6).(dT6-dA5) step for the Pribnow 12-mer duplex with an isotropic rotational correlation time of 9 ns at 5 degrees C. These proton NMR results show that the sequence-dependent base-pair stacking resulting from base-pair propeller twisting of defined handedness for right-handed DNA in the solid state is maintained in aqueous solution. PMID:6575384

  18. Base pair opening kinetics study of the aegPNA:DNA hydrid duplex containing a site-specific GNA-like chiral PNA monomer.

    PubMed

    Seo, Yeo-Jin; Lim, Jisoo; Lee, Eun-Hae; Ok, Taedong; Yoon, Juyoung; Lee, Joon-Hwa; Lee, Hee-Seung

    2011-09-01

    Peptide nucleic acids (PNA) are one of the most widely used synthetic DNA mimics where the four bases are attached to a N-(2-aminoethyl)glycine (aeg) backbone instead of the negative-charged phosphate backbone in DNA. We have developed a chimeric PNA (chiPNA), in which a chiral GNA-like γ(3)T monomer is incorporated into aegPNA backbone. The base pair opening kinetics of the aegPNA:DNA and chiPNA:DNA hybrid duplexes were studied by NMR hydrogen exchange experiments. This study revealed that the aegPNA:DNA hybrid is much more stable duplex and is less dynamic compared to DNA duplex, meaning that base pairs are opened and reclosed much more slowly. The site-specific incorporation of γ(3)T monomer in the aegPNA:DNA hybrid can destabilize a specific base pair and its neighbors, maintaining the thermal stabilities and dynamic properties of other base pairs. Our hydrogen exchange study firstly revealed the unique kinetic features of base pairs in the aegPNA:DNA and chiPNA:DNA hybrids, which will provide an insight into the development of methodology for specific DNA recognition using PNA fragments.

  19. [Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

    PubMed

    Brovarets', O O; Hovorun, D M

    2010-01-01

    A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*<---->Gua.Cyt<---->Gua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

  20. Nature of base stacking: reference quantum-chemical stacking energies in ten unique B-DNA base-pair steps.

    PubMed

    Sponer, Jirí; Jurecka, Petr; Marchan, Ivan; Luque, F Javier; Orozco, Modesto; Hobza, Pavel

    2006-03-20

    Base-stacking energies in ten unique B-DNA base-pair steps and some other arrangements were evaluated by the second-order Møller-Plesset (MP2) method, complete basis set (CBS) extrapolation, and correction for triple (T) electron-correlation contributions. The CBS(T) calculations were compared with decade-old MP2/6-31G*(0.25) reference data and AMBER force field. The new calculations show modest increases in stacking stabilization compared to the MP2/6-31G*(0.25) data and surprisingly large sequence-dependent variation of stacking energies. The absolute force-field values are in better agreement with the new reference data, while relative discrepancies between quantum-chemical (QM) and force-field values increase modestly. Nevertheless, the force field provides good qualitative description of stacking, and there is no need to introduce additional pair-additive electrostatic terms, such as distributed multipoles or out-of-plane charges. There is a rather surprising difference of about 0.1 A between the vertical separation of base pairs predicted by quantum chemistry and derived from crystal structures. Evaluations of different local arrangements of the 5'-CG-3' step indicate a sensitivity of the relative stacking energies to the level of calculation. Thus, describing quantitative relations between local DNA geometrical variations and stacking may be more complicated than usually assumed. The reference calculations are complemented by continuum-solvent assessment of solvent-screening effects.

  1. Charge-transfer and spin dynamics in DNA hairpin conjugates with perylenediimide as a base-pair surrogate.

    PubMed

    Zeidan, Tarek A; Carmieli, Raanan; Kelley, Richard F; Wilson, Thea M; Lewis, Frederick D; Wasielewski, Michael R

    2008-10-22

    A perylenediimide chromophore (P) was incorporated into DNA hairpins as a base-pair surrogate to prevent the self-aggregation of P that is typical when it is used as the hairpin linker. The photoinduced charge-transfer and spin dynamics of these hairpins were studied using femtosecond transient absorption spectroscopy and time-resolved EPR spectroscopy (TREPR). P is a photooxidant that is sufficiently powerful to quantitatively inject holes into adjacent adenine (A) and guanine (G) nucleobases. The charge-transfer dynamics observed following hole injection from P into the A-tract of the DNA hairpins is consistent with formation of a polaron involving an estimated 3-4 A bases. Trapping of the (A 3-4) (+*) polaron by a G base at the opposite end of the A-tract from P is competitive with charge recombination of the polaron and P (-*) only at short P-G distances. In a hairpin having 3 A-T base pairs between P and G ( 4G), the radical ion pair that results from trapping of the hole by G is spin-correlated and displays TREPR spectra at 295 and 85 K that are consistent with its formation from (1*)P by the radical-pair intersystem crossing mechanism. Charge recombination is spin-selective and produces (3*)P, which at 85 K exhibits a spin-polarized TREPR spectrum that is diagnostic of its origin from the spin-correlated radical ion pair. Interestingly, in a hairpin having no G bases ( 0G), TREPR spectra at 85 K revealed a spin-correlated radical pair with a dipolar interaction identical to that of 4G, implying that the A-base in the fourth A-T base pair away from the P chromophore serves as a hole trap. Our data suggest that hole injection and transport in these hairpins is completely dominated by polaron generation and movement to a trap site rather than by superexchange. On the other hand, the barrier for charge injection from G (+*) back onto the A-T base pairs is strongly activated, so charge recombination from G (or even A trap sites at 85 K) most likely proceeds by a

  2. The mode of binding ACMA-DNA relies on the base-pair nature.

    PubMed

    Busto, Natalia; García, Begoña; Leal, José M; Secco, Fernando; Venturini, Marcella

    2012-04-07

    A thermodynamic and kinetic study on the mode of binding of 9-amino-6-chloro-2-methoxi-acridine (ACMA) to poly(dA-dT)·poly(dA-dT) and poly(dG-dC)·poly(dG-dC) has been undertaken at pH = 7.0 and I = 0.1 M. The spectrophotometric, kinetic (T-jump), circular dichroism, viscometric and calorimetric information gathered point to formation of a fully intercalated ACMA complex with poly(dA-dT)·poly(dA-dT) and another one only partially intercalated (7%) with poly(dG-dC)·poly(dG-dC). The ACMA affinity with the A-T bases was higher than with the G-C bases. The two polynucleotide sequences give rise to external complexes when the ACMA concentration is raised, namely, the electrostatic complex poly(dA-dT)·poly(dA-dT)-ACMA and the major groove binding complex poly(dG-dC)·poly(dG-dC)-ACMA. A considerable quenching effect of the ACMA fluorescence is observed with poly(dA-dT)·poly(dA-dT), ascribable to face-to-face location in the intercalated A-T-ACMA base-pairs. The even stronger effect observed in the presence of poly(dG-dC)·poly(dG-dC) is related to the guanine residue from on- and off-slot ACMA positions.

  3. Stability of DNA duplexes containing GG, CC, AA, and TT mismatches.

    PubMed

    Tikhomirova, Anna; Beletskaya, Irina V; Chalikian, Tigran V

    2006-09-05

    We employed salt-dependent differential scanning calorimetric measurements to characterize the stability of six oligomeric DNA duplexes (5'-GCCGGAXTGCCGG-3'/5'-CCGGCAYTCCGGC-3') that contain in the central XY position the GC, AT, GG, CC, AA, or TT base pair. The heat-induced helix-to-coil transitions of all the duplexes are associated with positive changes in heat capacity, DeltaC(p), ranging from 0.43 to 0.53 kcal/mol. Positive values of DeltaC(p) result in strong temperature dependences of changes in enthalpy, DeltaH degrees, and entropy, DeltaS degrees , accompanying duplex melting and cause melting free energies, DeltaG degrees, to exhibit characteristically curved shapes. These observations suggest that DeltaC(p) needs to be carefully taken into account when the parameters of duplex stability are extrapolated to temperatures distant from the transition temperature, T(M). Comparison of the calorimetric and van't Hoff enthalpies revealed that none of the duplexes studied in this work exhibits two-state melting. Within the context of the central AXT/TYA triplet, the thermal and thermodynamic stabilities of the duplexes in question change in the following order: GC > AT > GG > AA approximately TT > CC. Our estimates revealed that the thermodynamic impact of the GG, AA, and TT mismatches is confined within the central triplet. In contrast, the thermodynamic impact of the CC mismatch propagates into the adjacent helix domains and may involve 7-9 bp. We discuss implications of our results for understanding the origins of initial recognition of mismatched DNA sites by enzymes of the DNA repair machinery.

  4. Tolerance of DNA Mismatches in Dmc1 Recombinase-mediated DNA Strand Exchange.

    PubMed

    Borgogno, María V; Monti, Mariela R; Zhao, Weixing; Sung, Patrick; Argaraña, Carlos E; Pezza, Roberto J

    2016-03-04

    Recombination between homologous chromosomes is required for the faithful meiotic segregation of chromosomes and leads to the generation of genetic diversity. The conserved meiosis-specific Dmc1 recombinase catalyzes homologous recombination triggered by DNA double strand breaks through the exchange of parental DNA sequences. Although providing an efficient rate of DNA strand exchange between polymorphic alleles, Dmc1 must also guard against recombination between divergent sequences. How DNA mismatches affect Dmc1-mediated DNA strand exchange is not understood. We have used fluorescence resonance energy transfer to study the mechanism of Dmc1-mediated strand exchange between DNA oligonucleotides with different degrees of heterology. The efficiency of strand exchange is highly sensitive to the location, type, and distribution of mismatches. Mismatches near the 3' end of the initiating DNA strand have a small effect, whereas most mismatches near the 5' end impede strand exchange dramatically. The Hop2-Mnd1 protein complex stimulates Dmc1-catalyzed strand exchange on homologous DNA or containing a single mismatch. We observed that Dmc1 can reject divergent DNA sequences while bypassing a few mismatches in the DNA sequence. Our findings have important implications in understanding meiotic recombination. First, Dmc1 acts as an initial barrier for heterologous recombination, with the mismatch repair system providing a second level of proofreading, to ensure that ectopic sequences are not recombined. Second, Dmc1 stepping over infrequent mismatches is likely critical for allowing recombination between the polymorphic sequences of homologous chromosomes, thus contributing to gene conversion and genetic diversity. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. Tolerance of DNA Mismatches in Dmc1 Recombinase-mediated DNA Strand Exchange*

    PubMed Central

    Borgogno, María V.; Monti, Mariela R.; Zhao, Weixing; Sung, Patrick; Argaraña, Carlos E.; Pezza, Roberto J.

    2016-01-01

    Recombination between homologous chromosomes is required for the faithful meiotic segregation of chromosomes and leads to the generation of genetic diversity. The conserved meiosis-specific Dmc1 recombinase catalyzes homologous recombination triggered by DNA double strand breaks through the exchange of parental DNA sequences. Although providing an efficient rate of DNA strand exchange between polymorphic alleles, Dmc1 must also guard against recombination between divergent sequences. How DNA mismatches affect Dmc1-mediated DNA strand exchange is not understood. We have used fluorescence resonance energy transfer to study the mechanism of Dmc1-mediated strand exchange between DNA oligonucleotides with different degrees of heterology. The efficiency of strand exchange is highly sensitive to the location, type, and distribution of mismatches. Mismatches near the 3′ end of the initiating DNA strand have a small effect, whereas most mismatches near the 5′ end impede strand exchange dramatically. The Hop2-Mnd1 protein complex stimulates Dmc1-catalyzed strand exchange on homologous DNA or containing a single mismatch. We observed that Dmc1 can reject divergent DNA sequences while bypassing a few mismatches in the DNA sequence. Our findings have important implications in understanding meiotic recombination. First, Dmc1 acts as an initial barrier for heterologous recombination, with the mismatch repair system providing a second level of proofreading, to ensure that ectopic sequences are not recombined. Second, Dmc1 stepping over infrequent mismatches is likely critical for allowing recombination between the polymorphic sequences of homologous chromosomes, thus contributing to gene conversion and genetic diversity. PMID:26709229

  6. Effect of protonation on the electronic properties of DNA base pairs: applications for molecular electronics.

    PubMed

    Mallajosyula, Sairam S; Pati, Swapan K

    2007-10-11

    Protonation of DNA basepairs is a reversible phenomenon that can be controlled by tuning the pH of the system. Under mild acidic conditions, the hydrogen-bonding pattern of the DNA basepairs undergoes a change. We study the effect of protonation on the electronic properties of the DNA basepairs to probe for possible molecular electronics applications. We find that, under mild acidic pH conditions, the A:T basepair shows excellent rectification behavior that is, however, absent in the G:C basepair. The mechanism of rectification has been discussed using a simple chemical potential model. We also consider the noncanonical A:A basepair and find that it can be used as efficient pH dependent molecular switch. The switching action in the A:A basepair is explained in the light of pi-pi interactions, which lead to efficient delocalization over the entire basepair.

  7. Structure of the 2-Aminopurine-Cytosine Base Pair Formed in the Polymerase Active Site of the RB69 Y567A-DNA Polymerase

    SciTech Connect

    Reha-Krantz, Linda J.; Hariharan, Chithra; Subuddhi, Usharani; Xia, Shuangluo; Zhao, Chao; Beckman, Jeff; Christian, Thomas; Konigsberg, William

    2011-11-21

    The adenine base analogue 2-aminopurine (2AP) is a potent base substitution mutagen in prokaryotes because of its enhanceed ability to form a mutagenic base pair with an incoming dCTP. Despite more than 50 years of research, the structure of the 2AP-C base pair remains unclear. We report the structure of the 2AP-dCTP base pair formed within the polymerase active site of the RB69 Y567A-DNA polymerase. A modified wobble 2AP-C base pair was detected with one H-bond between N1 of 2AP and a proton from the C4 amino group of cytosine and an apparent bifurcated H-bond between a proton on the 2-amino group of 2-aminopurine and the ring N3 and O2 atoms of cytosine. Interestingly, a primer-terminal region rich in AT base pairs, compared to GC base pairs, facilitated dCTP binding opposite template 2AP. We propose that the increased flexibility of the nucleotide binding pocket formed in the Y567A-DNA polymerase and increased 'breathing' at the primer-terminal junction of A+T-rich DNA facilitate dCTP binding opposite template 2AP. Thus, interactions between DNA polymerase residues with a dynamic primer-terminal junction play a role in determining base selectivity within the polymerase active site of RB69 DNA polymerase.

  8. Measurement and theory of hydrogen bonding contribution to isosteric DNA base pairs.

    PubMed

    Khakshoor, Omid; Wheeler, Steven E; Houk, K N; Kool, Eric T

    2012-02-15

    We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions between F and natural bases in nucleic acid duplexes and in a DNA polymerase active site. Since F is widely used to measure electrostatic contributions to pairing and replication, it is important to quantify the impact of this isostere on DNA stability. Here, we studied the pairing stability and selectivity of this compound and a closely related variant, dichlorotoluene deoxyriboside (L), in DNA, using both experimental and computational approaches. We measured the thermodynamics of duplex formation in three sequence contexts and with all possible pairing partners by thermal melting studies using the van't Hoff approach, and for selected cases by isothermal titration calorimetry (ITC). Experimental results showed that internal F-A pairing in DNA is destabilizing by 3.8 kcal/mol (van't Hoff, 37 °C) as compared with T-A pairing. At the end of a duplex, base-base interactions are considerably smaller; however, the net F-A interaction remains repulsive while T-A pairing is attractive. As for selectivity, F is found to be slightly selective for adenine over C, G, T by 0.5 kcal mol, as compared with thymine's selectivity of 2.4 kcal/mol. Interestingly, dichlorotoluene in DNA is slightly less destabilizing and slightly more selective than F, despite the lack of strongly electronegative fluorine atoms. Experimental data were complemented by computational results, evaluated at the M06-2X/6-31+G(d) and MP2/cc-pVTZ levels of theory. These computations suggest that the pairing energy of F to A

  9. DNA base pair stacks with high electric conductance: a systematic structural search.

    PubMed

    Berlin, Yuri A; Voityuk, Alexander A; Ratner, Mark A

    2012-09-25

    We report a computational search for DNA π-stack structures exhibiting high electric conductance in the hopping regime, based on the INDO/S calculations of electronic coupling and the method of data analysis called k-means clustering. Using homogeneous poly(G)-poly(C) and poly(A)-poly(T) stacks as the simplest structural models, we identify the configurations of neighboring G:C and A:T pairs that allow strong electronic coupling and, therefore, molecular electric conductance much larger than the values reported for the corresponding reference systems in the literature. A computational approach for modeling the impact of thermal fluctuations on the averaged dimer structure was also proposed and applied to the [(G:C),(G:C)] and [(A:T),(A:T)] duplexes. The results of this work may provide guidance for the construction of DNA devices and DNA-based elements of nanoscale molecular circuits. Several factors that cause changes of step parameters favorable to the formation of the predicted stack conformation with high electric conductance of DNA molecules are also discussed; favorable geometries may enhance the conductivity by factors as large as 15.

  10. Electron correlated and density functional studies on hydrogen-bonded proton transfer in adenine thymine base pair of DNA

    NASA Astrophysics Data System (ADS)

    Shimizu, Naoto; Kawano, Satoyuki; Tachikawa, Masanori

    2005-02-01

    The potential energy surface along the hydrogen-bonded proton transfer between the Watson-Crick (WC) adenine-thymine (A-T) base pair of deoxyribonucleic acid (DNA) and its tautomeric structures is calculated with 6-31G(d,p) basis set in Hartree-Fock (HF), density functional theory with Becke's three-parameter hybrid Lee-Yang-Parr exchange-correlation functional (B3LYP), second order Møller-Plesset perturbation (MP2), and coupled cluster singles and doubles (CCSD) levels. The tautomeric structure, where both two hydrogen-bonded protons in the A-T base pair have transferred each other, is found at all level of calculations. Though the optimized structure in which only one hydrogen-bonded proton in adenine has migrated to thymine is found at HF level, we could not obtain such optimized structure at both MP2 and B3LYP levels. Including electron correlations, the energy differences between the canonical A-T and the two hydrogen-bonded protons transferred tautomeric structure become smaller. Aside from this, potential energy surface from the WC A-T to the Hoogsteen type A-T gives almost the same among each level of calculation.

  11. Studies of base pair sequence effects on DNA solvation based on all-atom molecular dynamics simulations.

    PubMed

    Dixit, Surjit B; Mezei, Mihaly; Beveridge, David L

    2012-07-01

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization were observed in these simulations. The results were compared to essentially all known experimental data on the subject. Proximity analysis was employed to highlight the sequence dependent differences in solvation and ion localization properties in the grooves of DNA. Comparison of the MD-calculated DNA structure with canonical A- and B-forms supports the idea that the G/C-rich sequences are closer to canonical A- than B-form structures, while the reverse is true for the poly A sequences, with the exception of the alternating ATAT sequence. Analysis of hydration density maps reveals that the flexibility of solute molecule has a significant effect on the nature of observed hydration. Energetic analysis of solute-solvent interactions based on proximity analysis of solvent reveals that the GC or CG base pairs interact more strongly with water molecules in the minor groove of DNA that the AT or TA base pairs, while the interactions of the AT or TA pairs in the major groove are stronger than those of the GC or CG pairs. Computation of solvent-accessible surface area of the nucleotide units in the simulated trajectories reveals that the similarity with results derived from analysis of a database of crystallographic structures is excellent. The MD trajectories tend to follow Manning's counterion condensation theory, presenting a region of condensed counterions within a radius of about 17 A from the DNA surface independent of sequence. The GC and CG pairs tend to associate with cations in the major groove of the DNA structure to a greater extent than the AT and TA pairs. Cation association is more frequent in the minor groove of AT than the GC pairs. In general, the

  12. NMR study of the conformation of the 2-aminopurine: Cytosine mismatch in DNA

    SciTech Connect

    Fagan, P.A.; Wemmer, D.E. |; Goodman, M.F.

    1996-04-02

    DNA polymerase makes errors by misincorporating natural DNA bases and base analogs. Because of the wide variety of possible mismatches and the varying efficiency with which they are repaired, structural studies are necessary to understand in detail how these mispairs differ and can be distinguished from standard Watson-Crick base pairs. 2-Aminopurine (AP) is a highly mutagenic base analog. The objective of this study was to determine the geometry of the AP{center_dot}C mispair in DNA at neutral pH. Although several studies have focused on the AP{center_dot} mispair in DNA, there is not as of yet consensus on its structure. At least four models have been proposed for this mispair. Through the use of NMR spectroscopy with selective {sup 15}N-labeling of exocyclic amino nitrogens on bases of interest, we are able to resolve ambiguities in previous studies. We find here that, in two different DNA sequences, the AP{center_dot}C mispair at neutral and high pH is in a wobble geometry. The structure and stability of this base mispair is dependent upon the local base sequence. 48 refs., 4 figs., 1 tab.

  13. Kinetics and Thermodynamics of Watson-Crick Base Pairing Driven DNA Origami Dimerization.

    PubMed

    Zenk, John; Tuntivate, Chanon; Schulman, Rebecca

    2016-03-16

    We investigate the kinetics and thermodynamics of DNA origami dimerization using flat rectangle origami components and different architectures of Watson-Crick complementary single-stranded DNA ("sticky end") linking strategies. We systematically vary the number of linkers, the length of the sticky ends on the linker, and linker architecture and measure the corresponding yields as well as forward and reverse reaction rate constants through fluorescence quenching assays. Yields were further verified using atomic force microscopy. We calculate values of H° and ΔS° for various interface designs and find nonlinear van't Hoff behavior, best described by two linear equations, suggesting distinct regimes of dimerization between those with and those without well-formed interfaces. We find that self-assembly reactions can be tuned by manipulating the interface architecture without suffering a loss in yield, even when yield is high, ∼75-80%. We show that the second-order forward reaction rate constant (k(on)) depends on both linker architecture and number of linkers used, with typical values on the order of 10(5)-10(6) (M·s)(-1), values that are similar to those of bimolecular association of small, complementary DNA strands. The k(on) values are generally non-Arrhenius, tending to increase with decreasing temperature. Finally, we use kinetic and thermodynamic information about the optimal linking architecture to extend the system to an infinite, two-component repeating lattice system and show that we can form micron-sized lattices, with well-formed structures up to 8 μm(2).

  14. Dynamic DNA devices and assemblies formed by shape-complementary, non-base pairing 3D components

    NASA Astrophysics Data System (ADS)

    Gerling, Thomas; Wagenbauer, Klaus F.; Neuner, Andrea M.; Dietz, Hendrik

    2015-03-01

    We demonstrate that discrete three-dimensional (3D) DNA components can specifically self-assemble in solution on the basis of shape-complementarity and without base pairing. Using this principle, we produced homo- and heteromultimeric objects, including micrometer-scale one- and two-stranded filaments and lattices, as well as reconfigurable devices, including an actuator, a switchable gear, an unfoldable nanobook, and a nanorobot. These multidomain assemblies were stabilized via short-ranged nucleobase stacking bonds that compete against electrostatic repulsion between the components’ interfaces. Using imaging by electron microscopy, ensemble and single-molecule fluorescence resonance energy transfer spectroscopy, and electrophoretic mobility analysis, we show that the balance between attractive and repulsive interactions, and thus the conformation of the assemblies, may be finely controlled by global parameters such as cation concentration or temperature and by an allosteric mechanism based on strand-displacement reactions.

  15. Dynamic DNA devices and assemblies formed by shape-complementary, non-base pairing 3D components.

    PubMed

    Gerling, Thomas; Wagenbauer, Klaus F; Neuner, Andrea M; Dietz, Hendrik

    2015-03-27

    We demonstrate that discrete three-dimensional (3D) DNA components can specifically self-assemble in solution on the basis of shape-complementarity and without base pairing. Using this principle, we produced homo- and heteromultimeric objects, including micrometer-scale one- and two-stranded filaments and lattices, as well as reconfigurable devices, including an actuator, a switchable gear, an unfoldable nanobook, and a nanorobot. These multidomain assemblies were stabilized via short-ranged nucleobase stacking bonds that compete against electrostatic repulsion between the components' interfaces. Using imaging by electron microscopy, ensemble and single-molecule fluorescence resonance energy transfer spectroscopy, and electrophoretic mobility analysis, we show that the balance between attractive and repulsive interactions, and thus the conformation of the assemblies, may be finely controlled by global parameters such as cation concentration or temperature and by an allosteric mechanism based on strand-displacement reactions. Copyright © 2015, American Association for the Advancement of Science.

  16. Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.

    PubMed

    Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T

    2016-05-05

    Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.

  17. Electronic structure of an anticancer drug DC81 and its interaction with DNA base pairs

    NASA Astrophysics Data System (ADS)

    Tiwari, Gargi; Sharma, Dipendra; Dwivedi, K. K.; Dwivedi, M. K.

    2016-05-01

    The drug, 8-Hydroxy-7-methoxy-pyrrolo-[2,1-c][1,4] benzodiazepine-5-one, commonly christened as DC81 belongs to the pyrrolo-[2,1-c][1,4]benzodiazepine (PBDs) family. It is a member of the group of naturally occurring antitumour antibiotics produced by various Streptomyces species. The antitumour activity of DC81 is attributed to its sequence specific interaction with G-C rich DNA region in particular, for Pu-G-Pu motifs. In the present paper, physico-chemical properties DC81 have been carried out using an ab-initio method, HF/6-31G(d,p) with GAMESS program. MEP, HOMO and LUMO surfaces have been scanned. Ionization potential, electron affinity, electronegativity, global hardness and softness of the drug have been calculated. Further, drug-DNA interactions have been examined using modified second order perturbation theory along with multicentred-multipole expansion technique. Results have been discussed in the light of other theoretical and experimental observations. Efforts have been made to elucidate the binding patterns and thereby biological properties of the drug.

  18. Electronic structure of an anticancer drug DC81 and its interaction with DNA base pairs

    SciTech Connect

    Tiwari, Gargi Sharma, Dipendra Dwivedi, K. K.; Dwivedi, M. K.

    2016-05-06

    The drug, 8-Hydroxy-7-methoxy-pyrrolo-[2,1-c][1,4] benzodiazepine-5-one, commonly christened as DC81 belongs to the pyrrolo-[2,1-c][1,4]benzodiazepine (PBDs) family. It is a member of the group of naturally occurring antitumour antibiotics produced by various Streptomyces species. The antitumour activity of DC81 is attributed to its sequence specific interaction with G-C rich DNA region in particular, for Pu-G-Pu motifs. In the present paper, physico-chemical properties DC81 have been carried out using an ab-initio method, HF/6-31G(d,p) with GAMESS program. MEP, HOMO and LUMO surfaces have been scanned. Ionization potential, electron affinity, electronegativity, global hardness and softness of the drug have been calculated. Further, drug-DNA interactions have been examined using modified second order perturbation theory along with multicentred-multipole expansion technique. Results have been discussed in the light of other theoretical and experimental observations. Efforts have been made to elucidate the binding patterns and thereby biological properties of the drug.

  19. Synthesis and triplex-forming properties of oligonucleotides capable of recognizing corresponding DNA duplexes containing four base pairs.

    PubMed

    Ohkubo, Akihiro; Yamada, Kenji; Ito, Yu; Yoshimura, Kiichi; Miyauchi, Koichiro; Kanamori, Takashi; Masaki, Yoshiaki; Seio, Kohji; Yuasa, Hideya; Sekine, Mitsuo

    2015-07-13

    A triplex-forming oligonucleotide (TFO) could be a useful molecular tool for gene therapy and specific gene modification. However, unmodified TFOs have two serious drawbacks: low binding affinities and high sequence-dependencies. In this paper, we propose a new strategy that uses a new set of modified nucleobases for four-base recognition of TFOs, and thereby overcome these two drawbacks. TFOs containing a 2'-deoxy-4N-(2-guanidoethyl)-5-methylcytidine (d(g)C) residue for a C-G base pair have higher binding and base recognition abilities than those containing 2'-OMe-4N-(2-guanidoethyl)-5-methylcytidine (2'-OMe (g)C), 2'-OMe-4N-(2-guanidoethyl)-5-methyl-2-thiocytidine (2'-OMe (g)Cs), d(g)C and 4S-(2-guanidoethyl)-4-thiothymidine ((gs)T). Further, we observed that N-acetyl-2,7-diamino-1,8-naphtyridine ((DA)Nac) has a higher binding and base recognition abilities for a T-A base pair compared with that of dG and the other DNA derivatives. On the basis of this knowledge, we successfully synthesized a fully modified TFO containing (DA)Nac, d(g)C, 2'-OMe-2-thiothymidine (2'-OMe (s)T) and 2'-OMe-8-thioxoadenosine (2'-OMe (s)A) with high binding and base recognition abilities. To the best of our knowledge, this is the first report in which a fully modified TFO accurately recognizes a complementary DNA duplex having a mixed sequence under neutral conditions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. O⁶-carboxymethylguanine in DNA forms a sequence context-dependent wobble base-pair structure with thymine.

    PubMed

    Zhang, Fang; Tsunoda, Masaru; Kikuchi, Yuji; Wilkinson, Oliver; Millington, Christopher L; Margison, Geoffrey P; Williams, David M; Takénaka, Akio

    2014-06-01

    N-Nitrosation of glycine and its derivatives generates potent alkylating agents that can lead to the formation of O(6)-carboxymethylguanine (O(6)-CMG) in DNA. O(6)-CMG has been identified in DNA derived from human colon tissue and its occurrence has been linked to diets high in red and processed meats, implying an association with the induction of colorectal cancer. By analogy to O(6)-methylguanine, O(6)-CMG is expected to be mutagenic, inducing G-to-A mutations that may be the molecular basis of increased cancer risk. Previously, the crystal structure of the DNA dodecamer d(CGCG[O(6)-CMG]ATTCGCG) has been reported, in which O(6)-CMG forms a Watson-Crick-type pair with thymine similar to the canonical A:T pair. In order to further investigate the versatility of O(6)-CMG in base-pair formation, the structure of the DNA dodecamer d(CGC[O(6)-CMG]AATTTGCG) containing O(6)-CMG at a different position has been determined by X-ray crystallography using four crystal forms obtained under conditions containing different solvent ions (Sr(2+), Ba(2+), Mg(2+), K(+) or Na(+)) with and without Hoechst 33258. The most striking finding is that the pairing modes of O(6)-CMG with T are quite different from those previously reported. In the present dodecamer, the T bases are displaced (wobbled) into the major groove to form a hydrogen bond between the thymine N(3) N-H and the carboxyl group of O(6)-CMG. In addition, a water molecule is bridged through two hydrogen bonds between the thymine O(2) atom and the 2-amino group of O(6)-CMG to stabilize the pairing. These interaction modes commonly occur in the four crystal forms, regardless of the differences in crystallization conditions. The previous and the present results show that O(6)-CMG can form a base pair with T in two alternative modes: the Watson-Crick type and a high-wobble type, the nature of which may depend on the DNA-sequence context.

  1. Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

    PubMed

    Kryachko, E S; Remacle, F

    2005-12-08

    The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

  2. Chimeric proteins for detection and quantitation of DNA mutations, DNA sequence variations, DNA damage and DNA mismatches

    DOEpatents

    McCutchen-Maloney, Sandra L.

    2002-01-01

    Chimeric proteins having both DNA mutation binding activity and nuclease activity are synthesized by recombinant technology. The proteins are of the general formula A-L-B and B-L-A where A is a peptide having DNA mutation binding activity, L is a linker and B is a peptide having nuclease activity. The chimeric proteins are useful for detection and identification of DNA sequence variations including DNA mutations (including DNA damage and mismatches) by binding to the DNA mutation and cutting the DNA once the DNA mutation is detected.

  3. Evaluation of binding selectivity of a polyamide probe to single base-pair different DNA in A.T-rich region by electrospray ionization mass spectrometry.

    PubMed

    Li, Huihui; Yuan, Gu

    2006-12-01

    In this study, electrospray ionization mass spectrometry (ESI-MS) was used for the evaluation of the binding selectivity of a polyamide probe to single-base pair different DNA in an A.T-rich region. In this procedure, DeltaIr(dsn) was introduced as a parameter to compare the binding affinities of the polyamides with the duplex DNA. The results show that ESI-MS is a very useful tool for analysis of binding selectivity of a polyamide probe to single-base pair different DNA.

  4. 2-Methoxypyridine as Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability and NMR Structural Studies.

    PubMed

    Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks

    2017-08-31

    Development of nucleic acid base pair analogues that use new modes of molecular recognition is important for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme could enhance the thermal stability of DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability by ~10 ºC in DNA-DNA duplexes and ~20 ºC in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Comparative study of affinity and selectivity of ligands targeting abasic and mismatch sites in DNA using a fluorescence-melting assay.

    PubMed

    Kotera, Naoko; Granzhan, Anton; Teulade-Fichou, Marie-Paule

    2016-01-01

    Recently, several families of small-molecule ligands have been developed to selectively target DNA pairing defects, such as abasic sites and mismatched base pairs, with the aim to interfere with the DNA repair and the template function of the DNA. However, the affinity and selectivity (with respect to well-matched DNA) of these ligands has barely been evaluated in a systematic way. Herein, we report a comparative study of binding affinity and selectivity of a representative panel of 16 ligands targeting abasic sites and a T-T mismatch in DNA, using a fluorescence-monitored melting assay. We demonstrate that bisintercalator-type macrocyclic ligands are characterized by moderate affinity but exceptionally high selectivity with respect to well-matched DNA, whereas other reported ligands show either modest selectivity or rather low affinity in identical conditions.

  6. 2',4'-BNA bearing a chiral guanidinopyrrolidine-containing nucleobase with potent ability to recognize the CG base pair in a parallel-motif DNA triplex.

    PubMed

    Hari, Yoshiyuki; Akabane, Masaaki; Obika, Satoshi

    2013-08-28

    In order to expand the target sequence used in triplex DNA formation, seven novel nucleotide analogues were synthesized and incorporated into triplex-forming oligonucleotides by post-elongation modification approaches. Among them, , equipped with a suitable restricted conformation of sugar and nucleobase moieties, was found to have the highest sequence-selectivity and affinity towards CG base pairs within double-stranded DNA.

  7. Enhanced thermal stability and mismatch discrimination of mutation-carrying DNA duplexes and their kinetic and thermodynamic properties in microchannel laminar flow.

    PubMed

    Nagata, Maria Portia B; Yamashita, Kenichi; Miyazaki, Masaya; Nakamura, Hiroyuki; Maeda, Hideaki

    2009-07-01

    This article reports the enhancement of thermal stability involving normal duplex and mutation-carrying DNA duplexes in microchannel laminar flow. The application of an in-house temperature-controllable microchannel-type flow cell is demonstrated for improved discrimination of mismatch base pairs such as A-G and T-G that are difficult to distinguish due to the rather small thermal destabilizations. Enhancement in thermal stability is reflected by an increased thermal melting temperature achieved in microchannel laminar flow as compared with batch reactions. To examine the kinetics and thermodynamics of duplex-coil equilibrium of DNA oligomers, denaturation-renaturation hysteresis curves were measured. The influence of microchannel laminar flow on DNA base mismatch analysis was described from the kinetic and thermodynamic perspectives. An increasing trend was observed for association rate constant as flow rate increased. In contrast, an apparent decrease in dissociation rate constant was observed with increasing flow rate. The magnitudes of the activation energies of dissociation were nearly constant for both the batch and microchannel laminar flow systems at all flow rates. In contrast, the magnitudes of activation energies of association decreased as flow rate increased. These results clearly show how microchannel laminar flow induces change in reaction rate by effecting change in activation energy. We anticipate, therefore, that this approach based on microchannel laminar flow system holds great promise for improved mismatch discrimination in DNA analyses, particularly on single-base-pair mismatch, by pronouncedly enhancing thermal stability.

  8. Structural variability and the nature of intermolecular interactions in Watson-Crick B-DNA base pairs.

    PubMed

    Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J

    2010-07-29

    A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the

  9. Efficient and sequence-independent replication of DNA containing a third base pair establishes a functional six-letter genetic alphabet.

    PubMed

    Malyshev, Denis A; Dhami, Kirandeep; Quach, Henry T; Lavergne, Thomas; Ordoukhanian, Phillip; Torkamani, Ali; Romesberg, Floyd E

    2012-07-24

    The natural four-letter genetic alphabet, comprised of just two base pairs (dA-dT and dG-dC), is conserved throughout all life, and its expansion by the development of a third, unnatural base pair has emerged as a central goal of chemical and synthetic biology. We recently developed a class of candidate unnatural base pairs, exemplified by the pair formed between d5SICS and dNaM. Here, we examine the PCR amplification of DNA containing one or more d5SICS-dNaM pairs in a wide variety of sequence contexts. Under standard conditions, we show that this DNA may be amplified with high efficiency and greater than 99.9% fidelity. To more rigorously explore potential sequence effects, we used deep sequencing to characterize a library of templates containing the unnatural base pair as a function of amplification. We found that the unnatural base pair is efficiently replicated with high fidelity in virtually all sequence contexts. The results show that, for PCR and PCR-based applications, d5SICS-dNaM is functionally equivalent to a natural base pair, and when combined with dA-dT and dG-dC, it provides a fully functional six-letter genetic alphabet.

  10. Density functional theory investigation of interaction of zigzag (7,0) single-walled carbon nanotube with Watson-Crick DNA base pairs

    NASA Astrophysics Data System (ADS)

    Shukla, Manoj K.; Dubey, Madan; Zakar, Eugene; Namburu, Raju; Leszczynski, Jerzy

    2010-08-01

    A first-principles investigation of interaction of DNA base pairs on the outer surface of zigzag (7,0) single-walled carbon nanotube (CNT) was carried out at the M05-2X/6-31G(d) level of geometry optimization and BSSE corrected interaction energy calculation using the same theoretical level and the 6-311G(d,p), cc-pVDZ and cc-pVTZ basis sets. Study revealed that CNT forms complexes of similar strength with both base pairs. Electron density maps suggest that complexes are characterized by stacking interaction through coupling of π-charge clouds of base pairs and CNT. BSSE corrected interaction energies and density of states calculations indicated the weak nature of interaction between base pairs and CNT.

  11. Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

    PubMed

    Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

    2016-05-17

    The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures.

  12. Mechanisms in E. coli and Human Mismatch Repair (Nobel Lecture).

    PubMed

    Modrich, Paul

    2016-07-18

    DNA molecules are not completely stable, they are subject to chemical or photochemical damage and errors that occur during DNA replication resulting in mismatched base pairs. Through mechanistic studies Paul Modrich showed how replication errors are corrected by strand-directed mismatch repair in Escherichia coli and human cells.

  13. Type I-E CRISPR-cas systems discriminate target from non-target DNA through base pairing-independent PAM recognition.

    PubMed

    Westra, Edze R; Semenova, Ekaterina; Datsenko, Kirill A; Jackson, Ryan N; Wiedenheft, Blake; Severinov, Konstantin; Brouns, Stan J J

    2013-01-01

    Discriminating self and non-self is a universal requirement of immune systems. Adaptive immune systems in prokaryotes are centered around repetitive loci called CRISPRs (clustered regularly interspaced short palindromic repeat), into which invader DNA fragments are incorporated. CRISPR transcripts are processed into small RNAs that guide CRISPR-associated (Cas) proteins to invading nucleic acids by complementary base pairing. However, to avoid autoimmunity it is essential that these RNA-guides exclusively target invading DNA and not complementary DNA sequences (i.e., self-sequences) located in the host's own CRISPR locus. Previous work on the Type III-A CRISPR system from Staphylococcus epidermidis has demonstrated that a portion of the CRISPR RNA-guide sequence is involved in self versus non-self discrimination. This self-avoidance mechanism relies on sensing base pairing between the RNA-guide and sequences flanking the target DNA. To determine if the RNA-guide participates in self versus non-self discrimination in the Type I-E system from Escherichia coli we altered base pairing potential between the RNA-guide and the flanks of DNA targets. Here we demonstrate that Type I-E systems discriminate self from non-self through a base pairing-independent mechanism that strictly relies on the recognition of four unchangeable PAM sequences. In addition, this work reveals that the first base pair between the guide RNA and the PAM nucleotide immediately flanking the target sequence can be disrupted without affecting the interference phenotype. Remarkably, this indicates that base pairing at this position is not involved in foreign DNA recognition. Results in this paper reveal that the Type I-E mechanism of avoiding self sequences and preventing autoimmunity is fundamentally different from that employed by Type III-A systems. We propose the exclusive targeting of PAM-flanked sequences to be termed a target versus non-target discrimination mechanism.

  14. Type I-E CRISPR-Cas Systems Discriminate Target from Non-Target DNA through Base Pairing-Independent PAM Recognition

    PubMed Central

    Datsenko, Kirill A.; Jackson, Ryan N.; Wiedenheft, Blake; Severinov, Konstantin; Brouns, Stan J. J.

    2013-01-01

    Discriminating self and non-self is a universal requirement of immune systems. Adaptive immune systems in prokaryotes are centered around repetitive loci called CRISPRs (clustered regularly interspaced short palindromic repeat), into which invader DNA fragments are incorporated. CRISPR transcripts are processed into small RNAs that guide CRISPR-associated (Cas) proteins to invading nucleic acids by complementary base pairing. However, to avoid autoimmunity it is essential that these RNA-guides exclusively target invading DNA and not complementary DNA sequences (i.e., self-sequences) located in the host's own CRISPR locus. Previous work on the Type III-A CRISPR system from Staphylococcus epidermidis has demonstrated that a portion of the CRISPR RNA-guide sequence is involved in self versus non-self discrimination. This self-avoidance mechanism relies on sensing base pairing between the RNA-guide and sequences flanking the target DNA. To determine if the RNA-guide participates in self versus non-self discrimination in the Type I-E system from Escherichia coli we altered base pairing potential between the RNA-guide and the flanks of DNA targets. Here we demonstrate that Type I-E systems discriminate self from non-self through a base pairing-independent mechanism that strictly relies on the recognition of four unchangeable PAM sequences. In addition, this work reveals that the first base pair between the guide RNA and the PAM nucleotide immediately flanking the target sequence can be disrupted without affecting the interference phenotype. Remarkably, this indicates that base pairing at this position is not involved in foreign DNA recognition. Results in this paper reveal that the Type I-E mechanism of avoiding self sequences and preventing autoimmunity is fundamentally different from that employed by Type III-A systems. We propose the exclusive targeting of PAM-flanked sequences to be termed a target versus non-target discrimination mechanism. PMID:24039596

  15. Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

    PubMed

    Hwang, Hanshin; Taylor, John-Stephen

    2005-03-29

    We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the

  16. Dynamic control of strand excision during human DNA mismatch repair.

    PubMed

    Jeon, Yongmoon; Kim, Daehyung; Martín-López, Juana V; Lee, Ryanggeun; Oh, Jungsic; Hanne, Jeungphill; Fishel, Richard; Lee, Jong-Bong

    2016-03-22

    Mismatch repair (MMR) is activated by evolutionarily conserved MutS homologs (MSH) and MutL homologs (MLH/PMS). MSH recognizes mismatched nucleotides and form extremely stable sliding clamps that may be bound by MLH/PMS to ultimately authorize strand-specific excision starting at a distant 3'- or 5'-DNA scission. The mechanical processes associated with a complete MMR reaction remain enigmatic. The purified human (Homo sapien or Hs) 5'-MMR excision reaction requires the HsMSH2-HsMSH6 heterodimer, the 5' → 3' exonuclease HsEXOI, and the single-stranded binding heterotrimer HsRPA. The HsMLH1-HsPMS2 heterodimer substantially influences 5'-MMR excision in cell extracts but is not required in the purified system. Using real-time single-molecule imaging, we show that HsRPA or Escherichia coli EcSSB restricts HsEXOI excision activity on nicked or gapped DNA. HsMSH2-HsMSH6 activates HsEXOI by overcoming HsRPA/EcSSB inhibition and exploits multiple dynamic sliding clamps to increase tract length. Conversely, HsMLH1-HsPMS2 regulates tract length by controlling the number of excision complexes, providing a link to 5' MMR.

  17. Probing the interactions of the solvated electron with DNA by molecular dynamics simulations: II. bromodeoxyuridine-thymidine mismatched DNA.

    PubMed

    Gantchev, Tsvetan G; Hunting, Darel J

    2009-01-01

    The interaction of solvated electrons (e(-)(aq)) with DNA results in various types of DNA lesions. The in vitro and in vivo sensitisation of DNA to (e(-)(aq))-induced damage is achieved by incorporation of the electron-affinity radiosensitiser bromodeoxyuridine (BUdR) in place of thymidine. However, in DNA duplexes containing single-stranded regions (bulged BUdR-DNA), the type of lesion is different and the efficiency of damage is enhanced. In particular, DNA interstrand crosslinks (ICL) form at high efficiency in bulged DNA but are not detectable in completely duplex DNA. Knowledge about the processes and interactions leading to these differences is obscure. Previously, we addressed the problem by applying molecular modelling and molecular dynamics (MD) simulations to a system of normal (BUdR.A)-DNA and a hydrated electron, where the excess electron was modelled as a localised e(-)(H2O6) anionic cluster. The goal of the present study was to apply the same MD simulation to a wobble DNA-e(-)(aq) system, containing a pyrimidine-pyrimidine mismatched base pair, BUdR.T. The results show an overall dynamic pattern similar to that of the e(-)(aq) motion around normal DNA. However, the number of configuration states when e(-)(aq)) was particularly close to DNA is different. Moreover, in the (BUdR.T)-wobble DNA system, the electron frequently approaches the brominated strand, including BUdR, which was not observed with the normal (BUdR.A)-DNA. The structure and exchange of water at the sites of e(-)(aq) immobilisation near DNA were also characterised. The structural dynamics of the wobble DNA is prone to more extensive perturbations, including frequent formation of cross-strand (cs) interatomic contacts. The structural deviations correlated with e(-)(aq) approaching DNA from the major groove side, with sodium ions trapped deep in the minor groove. Altogether, the obtained results confirm and/or throw light on dynamic-structure determinants possibly responsible for the

  18. LNA modification of single-stranded DNA oligonucleotides allows subtle gene modification in mismatch-repair-proficient cells.

    PubMed

    van Ravesteyn, Thomas W; Dekker, Marleen; Fish, Alexander; Sixma, Titia K; Wolters, Astrid; Dekker, Rob J; Te Riele, Hein P J

    2016-04-12

    Synthetic single-stranded DNA oligonucleotides (ssODNs) can be used to generate subtle genetic modifications in eukaryotic and prokaryotic cells without the requirement for prior generation of DNA double-stranded breaks. However, DNA mismatch repair (MMR) suppresses the efficiency of gene modification by >100-fold. Here we present a commercially available ssODN design that evades MMR and enables subtle gene modification in MMR-proficient cells. The presence of locked nucleic acids (LNAs) in the ssODNs at mismatching bases, or also at directly adjacent bases, allowed 1-, 2-, or 3-bp substitutions in MMR-proficient mouse embryonic stem cells as effectively as in MMR-deficient cells. Additionally, in MMR-proficient Escherichia coli, LNA modification of the ssODNs enabled effective single-base-pair substitution. In vitro, LNA modification of mismatches precluded binding of purified E. coli MMR protein MutS. These findings make ssODN-directed gene modification particularly well suited for applications that require the evaluation of a large number of sequence variants with an easy selectable phenotype.

  19. LNA modification of single-stranded DNA oligonucleotides allows subtle gene modification in mismatch-repair-proficient cells

    PubMed Central

    van Ravesteyn, Thomas W.; Dekker, Marleen; Fish, Alexander; Sixma, Titia K.; Wolters, Astrid; Dekker, Rob J.; te Riele, Hein P. J.

    2016-01-01

    Synthetic single-stranded DNA oligonucleotides (ssODNs) can be used to generate subtle genetic modifications in eukaryotic and prokaryotic cells without the requirement for prior generation of DNA double-stranded breaks. However, DNA mismatch repair (MMR) suppresses the efficiency of gene modification by >100-fold. Here we present a commercially available ssODN design that evades MMR and enables subtle gene modification in MMR-proficient cells. The presence of locked nucleic acids (LNAs) in the ssODNs at mismatching bases, or also at directly adjacent bases, allowed 1-, 2-, or 3-bp substitutions in MMR-proficient mouse embryonic stem cells as effectively as in MMR-deficient cells. Additionally, in MMR-proficient Escherichia coli, LNA modification of the ssODNs enabled effective single-base-pair substitution. In vitro, LNA modification of mismatches precluded binding of purified E. coli MMR protein MutS. These findings make ssODN-directed gene modification particularly well suited for applications that require the evaluation of a large number of sequence variants with an easy selectable phenotype. PMID:26951689

  20. Solution structure of DAPI selectively bound in the minor groove of a DNA T.T mismatch-containing site: NMR and molecular dynamics studies.

    PubMed Central

    Trotta, E; Paci, M

    1998-01-01

    The solution structure of the complex between 4', 6-diamidino-2-phenylindole (DAPI) and DNA oligomer [d(GCGATTCGC)]2, containing a central T.T mismatch, has been characterized by combined use of proton one- and two-dimensional NMR spectroscopy, molecular mechanics and molecular dynamics computations including relaxation matrix refinement. The results show that the DAPI molecule binds in the minor groove of the central region 5'-ATT-3' of the DNA oligomer, which predominantly adopts a duplex structure with a global right-handed B-like conformation. In the final models of the complex, the DAPI molecule is located nearly isohelical with its NH indole proton oriented towards the DNA helix axis and forming a bifurcated hydrogen bond with the carbonyl O2 groups of a mismatched T5 and the T6 residue of the opposite strand. Mismatched thymines adopt a wobble base pair conformation and are found stacked between the flanking base pairs, inducing only minor local conformational changes in global duplex structure. In addition, no other binding mechanisms were observed, showing that minor groove binding of DAPI to the mismatch-containing site is favoured in comparison with any other previously reported interaction with G.C sequences. PMID:9753740

  1. Reply to Comment on 'Excited states of DNA base pairs using long-range corrected time-dependent density functional theory

    SciTech Connect

    Jensen, Lasse; Govind, Niranjan

    2009-09-18

    In this work we present a study of the excitation energies of adenine, cytosine, guanine, thymine and the adenine-thymine (AT) and guanine-cytosine (GC) base pairs using long-range corrected (LC) density functional theory. We compare three recent LC-functionals, BNL, CAM-B3LYP and LC-PBE0 with B3LYP and coupled cluster results from the literature. We find that the best overall performance is for the BNL functional based on LDA. However, in order to achieve this good agreement a smaller attenuation parameter was needed which leads to non-optimum performance for ground state properties. B3LYP, on the other hand, severely underestimates the charge transfer (CT) transitions in the base pairs. Surprisingly we also find that the CAM-B3LYP functional also underestimates the CT excitation energy for the GC base pair, but correctly describes the AT base pair. This illustrates the importance of retaining the full long-range exact exchange even at distances as short as that of the DNA base pairs. The worst overall performance was obtained with the LC-PBE0 functional which overestimates the excitations for the individual bases as well as the base pairs. It is therefore crucial to strike a good balance between the amount of local and long-range exact exchange.

  2. Base pair sensitivity and enhanced ON/OFF ratios of DNA-binding: donor-acceptor-donor fluorophores.

    PubMed

    Wilson, James N; Wigenius, Jens; Pitter, Demar R G; Qiu, Yanhua; Abrahamsson, Maria; Westerlund, Fredrik

    2013-10-10

    The photophysical properties of two recently reported live cell compatible, DNA-binding dyes, 4,6-bis(4-(4-methylpiperazin-1-yl)phenyl)pyrimidin-2-ol, 1, and [1,3-bis[4-(4-methylpiperazin-1-yl)phenyl]-1,3-propandioato-κO, κO']difluoroboron, 2, are characterized. Both dyes are quenched in aqueous solutions, while binding to sequences containing only AT pairs enhances the emission. Binding of the dyes to sequences containing only GC pairs does not produce a significant emission enhancement, and for sequences containing both AT and GC base pairs, emission is dependent on the length of the AT pair tracts. Through emission lifetime measurements and analysis of the dye redox potentials, photoinduced electron transfer with GC pairs is implicated as a quenching mechanism. Binding of the dyes to AT-rich regions is accompanied by bathochromic shifts of 26 and 30 nm, respectively. Excitation at longer wavelengths thus increases the ON/OFF ratio of the bound probes significantly and provides improved contrast ratios in solution as well as in fluorescence microscopy of living cells.

  3. DNA mismatch repair and its many roles in eukaryotic cells.

    PubMed

    Liu, Dekang; Keijzers, Guido; Rasmussen, Lene Juel

    2017-07-01

    DNA mismatch repair (MMR) is an important DNA repair pathway that plays critical roles in DNA replication fidelity, mutation avoidance and genome stability, all of which contribute significantly to the viability of cells and organisms. MMR is widely-used as a diagnostic biomarker for human cancers in the clinic, and as a biomarker of cancer susceptibility in animal model systems. Prokaryotic MMR is well-characterized at the molecular and mechanistic level; however, MMR is considerably more complex in eukaryotic cells than in prokaryotic cells, and in recent years, it has become evident that MMR plays novel roles in eukaryotic cells, several of which are not yet well-defined or understood. Many MMR-deficient human cancer cells lack mutations in known human MMR genes, which strongly suggests that essential eukaryotic MMR components/cofactors remain unidentified and uncharacterized. Furthermore, the mechanism by which the eukaryotic MMR machinery discriminates between the parental (template) and the daughter (nascent) DNA strand is incompletely understood and how cells choose between the EXO1-dependent and the EXO1-independent subpathways of MMR is not known. This review summarizes recent literature on eukaryotic MMR, with emphasis on the diverse cellular roles of eukaryotic MMR proteins, the mechanism of strand discrimination and cross-talk/interactions between and co-regulation of MMR and other DNA repair pathways in eukaryotic cells. The main conclusion of the review is that MMR proteins contribute to genome stability through their ability to recognize and promote an appropriate cellular response to aberrant DNA structures, especially when they arise during DNA replication. Although the molecular mechanism of MMR in the eukaryotic cell is still not completely understood, increased used of single-molecule analyses in the future may yield new insight into these unsolved questions. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Dynamic basis for one-dimensional DNA scanning by the mismatch repair complex Msh2-Msh6.

    PubMed

    Gorman, Jason; Chowdhury, Arindam; Surtees, Jennifer A; Shimada, Jun; Reichman, David R; Alani, Eric; Greene, Eric C

    2007-11-09

    The ability of proteins to locate specific sites or structures among a vast excess of nonspecific DNA is a fundamental theme in biology. Yet the basic principles that govern these mechanisms remain poorly understood. For example, mismatch repair proteins must scan millions of base pairs to find rare biosynthetic errors, and they then must probe the surrounding region to identify the strand discrimination signals necessary to distinguish the parental and daughter strands. To determine how these proteins might function we used single-molecule optical microscopy to answer the following question: how does the mismatch repair complex Msh2-Msh6 interrogate undamaged DNA? Here we show that Msh2-Msh6 slides along DNA via one-dimensional diffusion. These findings indicate that interactions between Msh2-Msh6 and DNA are dominated by lateral movement of the protein along the helical axis and have implications for how MutS family members travel along DNA at different stages of the repair reaction.

  5. DNA Electronic Circular Dichroism on the Inter-Base Pair Scale: An Experimental-Theoretical Case Study of the AT Homo-Oligonucleotide.

    PubMed

    Di Meo, Florent; Pedersen, Morten N; Rubio-Magnieto, Jenifer; Surin, Mathieu; Linares, Mathieu; Norman, Patrick

    2015-02-05

    A successful elucidation of the near-ultraviolet electronic circular dichroism spectrum of a short double-stranded DNA is reported. Time-dependent density functional theory methods are shown to accurately predict spectra and assign bands on the microscopic base-pair scale, a finding that opens the field for using circular dichroism spectroscopy as a sensitive nanoscale probe of DNA to reveal its complex interactions with the environment.

  6. Biasing Simulations of DNA Base Pair Parameters with Application to Propellor Twisting in AT/AT, AA/TT, and AC/GT Steps and Their Uracil Analogs.

    PubMed

    Peguero-Tejada, Alfredo; van der Vaart, Arjan

    2017-01-23

    An accurate and efficient implementation of the six DNA base pair parameters as order parameters for enhanced sampling simulations is presented. The parameter definitions are defined by vector algebra operations on a reduced atomic set of the base pair, and correlate very well with standard definitions. Application of the model is illustrated by umbrella sampling simulations of propeller twisting within AT/AT, AA/TT, and AC/GT steps and their uracil analogs. Strong correlations are found between propeller twisting and a number of conformational parameters, including buckle, opening, BI/BII backbone configuration, and sugar puckering. The thymine methyl group is observed to notably alter the local conformational free energy landscape, with effects within and directly upstream of the thymine containing base pair.

  7. Evolutionary Covariance Combined with Molecular Dynamics Predicts a Framework for Allostery in the MutS DNA Mismatch Repair Protein

    PubMed Central

    2017-01-01

    Mismatch repair (MMR) is an essential, evolutionarily conserved pathway that maintains genome stability by correcting base-pairing errors in DNA. Here we examine the sequence and structure of MutS MMR protein to decipher the amino acid framework underlying its two key activities—recognizing mismatches in DNA and using ATP to initiate repair. Statistical coupling analysis (SCA) identified a network (sector) of coevolved amino acids in the MutS protein family. The potential functional significance of this SCA sector was assessed by performing molecular dynamics (MD) simulations for alanine mutants of the top 5% of 160 residues in the distribution, and control nonsector residues. The effects on three independent metrics were monitored: (i) MutS domain conformational dynamics, (ii) hydrogen bonding between MutS and DNA/ATP, and (iii) relative ATP binding free energy. Each measure revealed that sector residues contribute more substantively to MutS structure–function than nonsector residues. Notably, sector mutations disrupted MutS contacts with DNA and/or ATP from a distance via contiguous pathways and correlated motions, supporting the idea that SCA can identify amino acid networks underlying allosteric communication. The combined SCA/MD approach yielded novel, experimentally testable hypotheses for unknown roles of many residues distributed across MutS, including some implicated in Lynch cancer syndrome. PMID:28135092

  8. DnaN clamp zones provide a platform for spatiotemporal coupling of mismatch detection to DNA replication.

    PubMed

    Lenhart, Justin S; Sharma, Anushi; Hingorani, Manju M; Simmons, Lyle A

    2013-02-01

    Mismatch repair (MMR) increases the fidelity of DNA replication by identifying and correcting replication errors. Processivity clamps are vital components of DNA replication and MMR, yet the mechanism and extent to which they participate in MMR remains unclear. We investigated the role of the Bacillus subtilis processivity clamp DnaN, and found that it serves as a platform for mismatch detection and coupling of repair to DNA replication. By visualizing functional MutS fluorescent fusions in vivo, we find that MutS forms foci independent of mismatch detection at sites of replication (i.e. the replisome). These MutS foci are directed to the replisome by DnaN clamp zones that aid mismatch detection by targeting the search to nascent DNA. Following mismatch detection, MutS disengages from the replisome, facilitating repair. We tested the functional importance of DnaN-mediated mismatch detection for MMR, and found that it accounts for 90% of repair. This high dependence on DnaN can be bypassed by increasing MutS concentration within the cell, indicating a secondary mode of detection in vivo whereby MutS directly finds mismatches without associating with the replisome. Overall, our results provide new insight into the mechanism by which DnaN couples mismatch recognition to DNA replication in living cells. © 2012 Blackwell Publishing Ltd.

  9. Method for locating and purifying DNA containing single base mismatches

    SciTech Connect

    Ford, J.P.; Novack, D.F.; Casna, N.J.

    1988-12-27

    A method is described for detecting guanine and thymine bases which are unpaired according to the Watson-Crick base pairing scheme in a double stranded polynucleotide molecule, each unpaired guanine or thymine base being immediately preceded by at least one base which is paired, and immediately followed by at least one base which is paired, the preceding and following paired bases being on the same polynucleotide sequence as the unpaired guanine or thymine base comprising: (a) reacting the double stranded polynucleotide molecule with a reagent capable of altering the electrophoretic mobility of a double stranded polynucleotide molecule by derivatizing unpaired guanine and thymine bases in the double stranded polynucleotide molecule, wherein the double stranded polynucleotide molecule is not a covalently closed circular DNA; (b) observing the electrophoretic mobility of the double stranded polynucleotide molecule which has been reacted with the reagent; and (c) determining the presence or absence of an alteration in the electrophoretic mobility; whereby the presence or absence of unpaired guanine and thymine bases in the double stranded polynucleotide molecule is detected.

  10. Maternal effect for DNA mismatch repair in the mouse.

    PubMed Central

    Gurtu, Vanessa E; Verma, Shelly; Grossmann, Allie H; Liskay, R Michael; Skarnes, William C; Baker, Sean M

    2002-01-01

    DNA mismatch repair (DMR) functions to maintain genome stability. Prokaryotic and eukaryotic cells deficient in DMR show a microsatellite instability (MSI) phenotype characterized by repeat length alterations at microsatellite sequences. Mice deficient in Pms2, a mammalian homolog of bacterial mutL, develop cancer and display MSI in all tissues examined, including the male germ line where a frequency of approximately 10% was observed. To determine the consequences of maternal DMR deficiency on genetic stability, we analyzed F(1) progeny from Pms2(-/-) female mice mated with wild-type males. Our analysis indicates that MSI in the female germ line was approximately 9%. MSI was also observed in paternal alleles, a surprising result since the alleles were obtained from wild-type males and the embryos were therefore DMR proficient. We propose that mosaicism for paternal alleles is a maternal effect that results from Pms2 deficiency during the early cleavage divisions. The absence of DMR in one-cell embryos leads to the formation of unrepaired replication errors in early cell divisions of the zygote. The occurrence of postzygotic mutation in the early mouse embryo suggests that Pms2 deficiency is a maternal effect, one of a limited number identified in the mouse and the first to involve a DNA repair gene. PMID:11805062

  11. NMR structure of duplex DNA containing the alpha-OH-PdG.dA base pair: a mutagenic intermediate of acrolein.

    PubMed

    Zaliznyak, Tanya; Lukin, Mark; El-khateeb, Mahmoud; Bonala, Rahda; Johnson, Francis; de los Santos, Carlos

    2010-04-01

    Acrolein, a cell metabolic product and main component of cigarette smoke, reacts with DNA generating alpha-OH-PdG lesions, which have the ability to pair with dATP during replication thereby causing G to T transversions. We describe the solution structure of an 11-mer DNA duplex containing the mutagenic alpha-OH-PdG.dA base pair intermediate, as determined by solution nuclear magnetic resonance (NMR) spectroscopy and retrained molecular dynamics (MD) simulations. The NMR data support a mostly regular right-handed helix that is only perturbed at its center by the presence of the lesion. Undamaged residues of the duplex are in anti orientation, forming standard Watson-Crick base pairs alignments. Duplication of proton signals at and near the damaged base pair reveals the presence of two enantiomeric duplexes, thus establishing the exocyclic nature of the lesion. The alpha-OH-PdG adduct assumes a syn conformation pairing to its partner dA base that is protonated at pH 6.6. The three-dimensional structure obtained by restrained molecular dynamics simulations show hydrogen bond interactions that stabilize alpha-OH-PdG in a syn conformation and across the lesion containing base pair. We discuss the implications of the structures for the mutagenic bypass of acrolein lesions.

  12. Demonstration that the shear force required to separate short double-stranded DNA does not increase significantly with sequence length for sequences longer than 25 base pairs.

    PubMed

    Hatch, K; Danilowicz, C; Coljee, V; Prentiss, M

    2008-07-01

    We have measured the shear force for short double-stranded DNA sequences pulled by either the 3'3' or 5'5' ends and find that the shear force is independent of the pulling technique. For the 50% GC sequences examined, the force is a linear function of DNA length up to 20 base pairs (bp); however, we show that, as predicted by deGennes, the shear force approaches an asymptotic value in the limit where the number of base pairs approaches infinity, where the shear force for a 32 bp sequence is within 5% of the asymptotic value of 61.4 pN . Fits to deGennes' theory suggest that the shear force is distributed over fewer than 10 bp at the end of the sequence, with the rest of the sequence experiencing negligible shear force. The single base pair rupture force and the ratio of the backbone spring constant to the base pair spring constant determined from fits of the data to deGennes' theory are consistent with ab initio predictions.

  13. Novel DNA mismatch-repair activity involving YB-1 in human mitochondria.

    PubMed

    de Souza-Pinto, Nadja C; Mason, Penelope A; Hashiguchi, Kazunari; Weissman, Lior; Tian, Jingyan; Guay, David; Lebel, Michel; Stevnsner, Tinna V; Rasmussen, Lene Juel; Bohr, Vilhelm A

    2009-06-04

    Maintenance of the mitochondrial genome (mtDNA) is essential for proper cellular function. The accumulation of damage and mutations in the mtDNA leads to diseases, cancer, and aging. Mammalian mitochondria have proficient base excision repair, but the existence of other DNA repair pathways is still unclear. Deficiencies in DNA mismatch repair (MMR), which corrects base mismatches and small loops, are associated with DNA microsatellite instability, accumulation of mutations, and cancer. MMR proteins have been identified in yeast and coral mitochondria; however, MMR proteins and function have not yet been detected in human mitochondria. Here we show that human mitochondria have a robust mismatch-repair activity, which is distinct from nuclear MMR. Key nuclear MMR factors were not detected in mitochondria, and similar mismatch-binding activity was observed in mitochondrial extracts from cells lacking MSH2, suggesting distinctive pathways for nuclear and mitochondrial MMR. We identified the repair factor YB-1 as a key candidate for a mitochondrial mismatch-binding protein. This protein localizes to mitochondria in human cells, and contributes significantly to the mismatch-binding and mismatch-repair activity detected in HeLa mitochondrial extracts, which are significantly decreased when the intracellular levels of YB-1 are diminished. Moreover, YB-1 depletion in cells increases mitochondrial DNA mutagenesis. Our results show that human mitochondria contain a functional MMR repair pathway in which YB-1 participates, likely in the mismatch-binding and recognition steps.

  14. Base pairing and base mis-pairing in nucleic acids

    NASA Technical Reports Server (NTRS)

    Wang, A. H. J.; Rich, A.

    1986-01-01

    In recent years we have learned that DNA is conformationally active. It can exist in a number of different stable conformations including both right-handed and left-handed forms. Using single crystal X-ray diffraction analysis we are able to discover not only additional conformations of the nucleic acids but also different types of hydrogen bonded base-base interactions. Although Watson-Crick base pairings are the predominant type of interaction in double helical DNA, they are not the only types. Recently, we have been able to examine mismatching of guanine-thymine base pairs in left-handed Z-DNA at atomic resolution (1A). A minimum amount of distortion of the sugar phosphate backbone is found in the G x T pairing in which the bases are held together by two hydrogen bonds in the wobble pairing interaction. Because of the high resolution of the analysis we can visualize water molecules which fill in to accommodate the other hydrogen bonding positions in the bases which are not used in the base-base interactions. Studies on other DNA oligomers have revealed that other types of non-Watson-Crick hydrogen bonding interactions can occur. In the structure of a DNA octamer with the sequence d(GCGTACGC) complexed to an antibiotic triostin A, it was found that the two central AT base pairs are held together by Hoogsteen rather than Watson-Crick base pairs. Similarly, the G x C base pairs at the ends are also Hoogsteen rather than Watson-Crick pairing. Hoogsteen base pairs make a modified helix which is distinct from the Watson-Crick double helix.

  15. Base pairing and base mis-pairing in nucleic acids

    NASA Technical Reports Server (NTRS)

    Wang, A. H. J.; Rich, A.

    1986-01-01

    In recent years we have learned that DNA is conformationally active. It can exist in a number of different stable conformations including both right-handed and left-handed forms. Using single crystal X-ray diffraction analysis we are able to discover not only additional conformations of the nucleic acids but also different types of hydrogen bonded base-base interactions. Although Watson-Crick base pairings are the predominant type of interaction in double helical DNA, they are not the only types. Recently, we have been able to examine mismatching of guanine-thymine base pairs in left-handed Z-DNA at atomic resolution (1A). A minimum amount of distortion of the sugar phosphate backbone is found in the G x T pairing in which the bases are held together by two hydrogen bonds in the wobble pairing interaction. Because of the high resolution of the analysis we can visualize water molecules which fill in to accommodate the other hydrogen bonding positions in the bases which are not used in the base-base interactions. Studies on other DNA oligomers have revealed that other types of non-Watson-Crick hydrogen bonding interactions can occur. In the structure of a DNA octamer with the sequence d(GCGTACGC) complexed to an antibiotic triostin A, it was found that the two central AT base pairs are held together by Hoogsteen rather than Watson-Crick base pairs. Similarly, the G x C base pairs at the ends are also Hoogsteen rather than Watson-Crick pairing. Hoogsteen base pairs make a modified helix which is distinct from the Watson-Crick double helix.

  16. Mechanism of cadmium-mediated inhibition of Msh2-Msh6 function in DNA mismatch repair.

    PubMed

    Wieland, Markus; Levin, Mikhail K; Hingorani, Karan S; Biro, F Noah; Hingorani, Manju M

    2009-10-13

    The observation that Cadmium (Cd(2+)) inhibits Msh2-Msh6, which is responsible for identifying base pair mismatches and other discrepancies in DNA, has led to the proposal that selective targeting of this protein and consequent suppression of DNA repair or apoptosis promote the carcinogenic effects of the heavy metal toxin. It has been suggested that Cd(2+) binding to specific sites on Msh2-Msh6 blocks its DNA binding and ATPase activities. To investigate the mechanism of inhibition, we measured Cd(2+) binding to Msh2-Msh6, directly and by monitoring changes in protein structure and enzymatic activity. Global fitting of the data to a multiligand binding model revealed that binding of about 100 Cd(2+) ions per Msh2-Msh6 results in its inactivation. This finding indicates that the inhibitory effect of Cd(2+) occurs via a nonspecific mechanism. Cd(2+) and Msh2-Msh6 interactions involve cysteine sulfhydryl groups, and the high Cd(2+):Msh2-Msh6 ratio implicates other ligands such as histidine, aspartate, glutamate, and the peptide backbone as well. Our study also shows that cadmium inactivates several unrelated enzymes similarly, consistent with a nonspecific mechanism of inhibition. Targeting of a variety of proteins, including Msh2-Msh6, in this generic manner would explain the marked broad-spectrum impact of Cd(2+) on biological processes. We propose that the presence of multiple nonspecific Cd(2+) binding sites on proteins and their propensity to change conformation on interaction with Cd(2+) are critical determinants of the susceptibility of corresponding biological systems to cadmium toxicity.

  17. The mismatched nucleotides in the 5'-terminal hairpin of minute virus of mice are required for efficient viral DNA replication.

    PubMed Central

    Costello, E; Sahli, R; Hirt, B; Beard, P

    1995-01-01

    The 5'-terminal sequence in the DNA of the parvovirus minute virus of mice (MVM) is a palindrome. It can form a hairpin, the stem of which is entirely base-paired except for three consecutive unpaired nucleotides which form a bubble. Since this structure is well conserved among different parvoviruses, we examined its importance for viral replication by generating MVM mutants with alterations in this region. A clone of MVMp DNA which contained the entire 3' end and more than half of the 5' palindrome was made. Although it lacked the sequence information to form a wild-type bubble, this DNA was infectious. On transfection into A9 fibroblasts, it gave rise to a virus (MVMs) which had a bubble in its 5' palindrome. The bubble consisted of four mismatched nucleotides in the same location as the unpaired nucleotides of the wild-type palindrome. Apparently, neighboring plasmid sequences were incorporated into the viral DNA, enabling formation of the mismatch. This observation suggested that a bubble is critical for growth of MVM but that its sequence is not. To find out whether MVM lacking a bubble in the 5' palindrome is viable, we made a second clone in which the plasmid sequences incorporated in MVMs were removed. Transfection of this DNA gave rise to a virus (MVMx) in which the nucleotides unpaired in the wild-type hairpin are now fully base-paired. Although MVMx can be propagated, it is defective in comparison with wild-type MVMp; it exhibited about a 50-fold-lower ratio of plaque-forming units to DNA content. In mixed infections, MVMp consistently outgrew the bubbleless MVMx. The rate of accumulation of DNA replication intermediates was lower for MVMx than for the wild-type virus. Quantitative analysis of the 5' termini of replicative form DNA suggested that the ability of MVMx to convert hairpin 5' termini to extended termini is impaired. In contrast, the virus with the altered bubble, MVMs, behaved like the wild-type MVMp in all the assays. We conclude that MVM

  18. Altering the electrostatic potential in the major groove: thermodynamic and structural characterization of 7-deaza-2'-deoxyadenosine:dT base pairing in DNA.

    PubMed

    Kowal, Ewa A; Ganguly, Manjori; Pallan, Pradeep S; Marky, Luis A; Gold, Barry; Egli, Martin; Stone, Michael P

    2011-12-01

    As part of an ongoing effort to explore the effect of major groove electrostatics on the thermodynamic stability and structure of DNA, a 7-deaza-2'-deoxyadenosine:dT (7-deaza-dA:dT) base pair in the Dickerson-Drew dodecamer (DDD) was studied. The removal of the electronegative N7 atom on dA and the replacement with an electropositive C-H in the major groove was expected to have a significant effect on major groove electrostatics. The structure of the 7-deaza-dA:dT base pair was determined at 1.1 Å resolution in the presence of Mg(2+). The 7-deaza-dA, which is isosteric for dA, had minimal effect on the base pairing geometry and the conformation of the DDD in the crystalline state. There was no major groove cation association with the 7-deaza-dA heterocycle. In solution, circular dichroism showed a positive Cotton effect centered at 280 nm and a negative Cotton effect centered at 250 nm that were characteristic of a right-handed helix in the B-conformation. However, temperature-dependent NMR studies showed increased exchange between the thymine N3 imino proton of the 7-deaza-dA:dT base pair and water, suggesting reduced stacking interactions and an increased rate of base pair opening. This correlated with the observed thermodynamic destabilization of the 7-deaza-dA modified duplex relative to the DDD. A combination of UV melting and differential scanning calorimetry experiments were conducted to evaluate the relative contributions of enthalpy and entropy in the thermodynamic destabilization of the DDD. The most significant contribution arose from an unfavorable enthalpy term, which probably results from less favorable stacking interactions in the modified duplex, which was accompanied by a significant reduction in the release of water and cations from the 7-deaza-dA modified DNA. © 2011 American Chemical Society

  19. Altering the Electrostatic Potential in the Major Groove: Thermodynamic and Structural Characterization of 7-Deaza-2′-deoxyadenosine:dT Base Pairing in DNA

    PubMed Central

    2011-01-01

    As part of an ongoing effort to explore the effect of major groove electrostatics on the thermodynamic stability and structure of DNA, a 7-deaza-2′-deoxyadenosine:dT (7-deaza-dA:dT) base pair in the Dickerson–Drew dodecamer (DDD) was studied. The removal of the electronegative N7 atom on dA and the replacement with an electropositive C–H in the major groove was expected to have a significant effect on major groove electrostatics. The structure of the 7-deaza-dA:dT base pair was determined at 1.1 Å resolution in the presence of Mg2+. The 7-deaza-dA, which is isosteric for dA, had minimal effect on the base pairing geometry and the conformation of the DDD in the crystalline state. There was no major groove cation association with the 7-deaza-dA heterocycle. In solution, circular dichroism showed a positive Cotton effect centered at 280 nm and a negative Cotton effect centered at 250 nm that were characteristic of a right-handed helix in the B-conformation. However, temperature-dependent NMR studies showed increased exchange between the thymine N3 imino proton of the 7-deaza-dA:dT base pair and water, suggesting reduced stacking interactions and an increased rate of base pair opening. This correlated with the observed thermodynamic destabilization of the 7-deaza-dA modified duplex relative to the DDD. A combination of UV melting and differential scanning calorimetry experiments were conducted to evaluate the relative contributions of enthalpy and entropy in the thermodynamic destabilization of the DDD. The most significant contribution arose from an unfavorable enthalpy term, which probably results from less favorable stacking interactions in the modified duplex, which was accompanied by a significant reduction in the release of water and cations from the 7-deaza-dA modified DNA. PMID:22059929

  20. Altering the Electrostatic Potential in the Major Groove: Thermodynamic and Structural Characterization of 7-Deaza-2;#8242;-deoxyadenosine:dT Base Pairing in DNA

    SciTech Connect

    Kowal, Ewa A.; Ganguly, Manjori; Pallan, Pradeep S.; Marky, Luis A.; Gold, Barry; Egli, Martin; Stone, Michael P.

    2012-02-15

    As part of an ongoing effort to explore the effect of major groove electrostatics on the thermodynamic stability and structure of DNA, a 7-deaza-2'-deoxyadenosine:dT (7-deaza-dA:dT) base pair in the Dickerson-Drew dodecamer (DDD) was studied. The removal of the electronegative N7 atom on dA and the replacement with an electropositive C-H in the major groove was expected to have a significant effect on major groove electrostatics. The structure of the 7-deaza-dA:dT base pair was determined at 1.1 {angstrom} resolution in the presence of Mg{sup 2+}. The 7-deaza-dA, which is isosteric for dA, had minimal effect on the base pairing geometry and the conformation of the DDD in the crystalline state. There was no major groove cation association with the 7-deaza-dA heterocycle. In solution, circular dichroism showed a positive Cotton effect centered at 280 nm and a negative Cotton effect centered at 250 nm that were characteristic of a right-handed helix in the B-conformation. However, temperature-dependent NMR studies showed increased exchange between the thymine N3 imino proton of the 7-deaza-dA:dT base pair and water, suggesting reduced stacking interactions and an increased rate of base pair opening. This correlated with the observed thermodynamic destabilization of the 7-deaza-dA modified duplex relative to the DDD. A combination of UV melting and differential scanning calorimetry experiments were conducted to evaluate the relative contributions of enthalpy and entropy in the thermodynamic destabilization of the DDD. The most significant contribution arose from an unfavorable enthalpy term, which probably results from less favorable stacking interactions in the modified duplex, which was accompanied by a significant reduction in the release of water and cations from the 7-deaza-dA modified DNA.

  1. 5-Methylation of cytosine in CG:CG base-pair steps: a physicochemical mechanism for the epigenetic control of DNA nanomechanics.

    PubMed

    Yusufaly, Tahir I; Li, Yun; Olson, Wilma K

    2013-12-27

    van der Waals density functional theory is integrated with analysis of a non-redundant set of protein-DNA crystal structures from the Nucleic Acid Database to study the stacking energetics of CG:CG base-pair steps, specifically the role of cytosine 5-methylation. Principal component analysis of the steps reveals the dominant collective motions to correspond to a tensile "opening" mode and two shear "sliding" and "tearing" modes in the orthogonal plane. The stacking interactions of the methyl groups globally inhibit CG:CG step overtwisting while simultaneously softening the modes locally via potential energy modulations that create metastable states. Additionally, the indirect effects of the methyl groups on possible base-pair steps neighboring CG:CG are observed to be of comparable importance to their direct effects on CG:CG. The results have implications for the epigenetic control of DNA mechanics.

  2. DNA hybridization to mismatched templates: A chip study

    NASA Astrophysics Data System (ADS)

    Naef, Felix; Lim, Daniel A.; Patil, Nila; Magnasco, Marcelo

    2002-04-01

    High-density oligonucleotide arrays are among the most rapidly expanding technologies in biology today. In the GeneChip system, the reconstruction of the sample mRNA concentrations depends upon the differential signal generated by hybridizing the RNA to two nearly identical templates: a perfect match probe (PM) containing the exact biological sequence; and a single mismatch (MM) differing from the PM by a single base substitution. It has been observed that a large fraction of MMs repeatably bind targets better than the PMs, against the obvious expectation of sequence specificity. We examine this problem via statistical analysis of a large set of microarray experiments. We classify the probes according to their signal to noise (S/N) ratio, defined as the eccentricity of a (PM,MM) pair's ``trajectory'' across many experiments. Of those probes having large S/N (>3) only a fraction behave consistently with the commonly assumed hybridization model. Our results imply that the physics of DNA hybridization in microarrays is more complex than expected, and suggest estimators for the target RNA concentration.

  3. Mouse models of DNA mismatch repair in cancer research

    PubMed Central

    Lee, Kyeryoung; Tosti, Elena; Edelmann, Winfried

    2016-01-01

    Germline mutations in DNA mismatch repair (MMR) genes are the cause of hereditary non-polyposis colorectal cancer/Lynch syndrome (HNPCC/LS) one of the most common cancer predisposition syndromes, and defects in MMR are also prevalent in sporadic colorectal cancers. In the past, the generation and analysis of mouse lines with knockout mutations in all of the known MMR genes has provided insight into how loss of individual MMR genes affects genome stability and contributes to cancer susceptibility. These studies also revealed essential functions for some of the MMR genes in B cell maturation and fertility. In this review, we will provide a brief overview of the cancer predisposition phenotypes of recently developed mouse models with targeted mutations in MutS and MutL homologs (Msh and Mlh, respectively) and their utility as preclinical models. The focus will be on mouse lines with conditional MMR mutations that have allowed more accurate modeling of human cancer syndromes in mice and that together with new technologies in gene targeting, hold great promise for the analysis of MMR-deficient intestinal tumors and other cancers which will drive the development of preventive and therapeutic treatment strategies. PMID:26708047

  4. Mouse models of DNA mismatch repair in cancer research.

    PubMed

    Lee, Kyeryoung; Tosti, Elena; Edelmann, Winfried

    2016-02-01

    Germline mutations in DNA mismatch repair (MMR) genes are the cause of hereditary non-polyposis colorectal cancer/Lynch syndrome (HNPCC/LS) one of the most common cancer predisposition syndromes, and defects in MMR are also prevalent in sporadic colorectal cancers. In the past, the generation and analysis of mouse lines with knockout mutations in all of the known MMR genes has provided insight into how loss of individual MMR genes affects genome stability and contributes to cancer susceptibility. These studies also revealed essential functions for some of the MMR genes in B cell maturation and fertility. In this review, we will provide a brief overview of the cancer predisposition phenotypes of recently developed mouse models with targeted mutations in MutS and MutL homologs (Msh and Mlh, respectively) and their utility as preclinical models. The focus will be on mouse lines with conditional MMR mutations that have allowed more accurate modeling of human cancer syndromes in mice and that together with new technologies in gene targeting, hold great promise for the analysis of MMR-deficient intestinal tumors and other cancers which will drive the development of preventive and therapeutic treatment strategies.

  5. Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

    PubMed

    Brovarets, Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H

  6. Synthesis of 5-[3-(2-aminopyrimidin-4-yl)aminopropyn-1-yl]uracil derivative that recognizes Ade-Thy base pairs in double-stranded DNA.

    PubMed

    Ito, Yu; Masaki, Yoshiaki; Kanamori, Takashi; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo

    2016-01-01

    5-[3-(2-Aminopyrimidin-4-yl)aminopropyn-1-yl]uracil (Ura(Pyr)) was designed as a new nucleobase to recognize Ade-Thy base pair in double-stranded DNA. We successfully synthesized the dexoynucleoside phosphoramidite having Ura(Pyr) and incorporated it into triplex forming oligonucleotides (TFOs). Melting temperature analysis revealed that introduction of Ura(Pyr) into TFOs could effectively stabilize their triplex structures without loss of base recognition capabilities.

  7. Base-pairing behavior of a carbocyclic Janus-AT nucleoside analogue capable of recognizing A and T within a DNA duplex.

    PubMed

    Largy, Eric; Liu, Wenbo; Hasan, Abid; Perrin, David M

    2013-11-04

    Janus-type nucleosides are heterocycles with two faces, each of which is designed to complement the H-bonding interactions of natural nucleosides comprising a canonical Watson-Crick base pair. By intercepting all of the hydrogen bonds contained within the base pair, oligomeric Janus nucleosides are expected to achieve sequence-specific DNA recognition through the formation of J-loops that will be more stable than D-loops, which simply replaces one base-pair with another. Herein, we report the synthesis of a novel Janus-AT nucleoside analogue, JAT , affixed on a carbocyclic analogue of deoxyribose that was converted to the corresponding phosphoramidite. A single JAT was successfully incorporated into a DNA strand by solid phase for targeting both A and T bases, and characterized through biophysical and computational methods. Experimental UV-melting and circular dichroism data demonstrated that within the context of a standard duplex, JAT associates preferentially with T over A, and much more poorly with C and G. Density functional theory calculations confirm that the JAT structure is well suited to associate only with A and T thereby highlighting the importance of the electronic structure in terms of H-bonding. Finally, molecular dynamics simulations validated the observation that JAT can substitute more effectively as an A-analogue than as a T-analogue without substantial distortion of the B-helix. Overall, this new Janus nucleotide is a promising tool for the targeting of A-T base pairs in DNA, and will lead to the development of oligo-Janus-nucleotide strands for sequence-specific DNA recognition.

  8. Approaches to diagnose DNA mismatch repair gene defects in cancer.

    PubMed

    Peña-Diaz, Javier; Rasmussen, Lene Juel

    2016-02-01

    The DNA repair pathway mismatch repair (MMR) is responsible for the recognition and correction of DNA biosynthetic errors caused by inaccurate nucleotide incorporation during replication. Faulty MMR leads to failure to address the mispairs or insertion deletion loops (IDLs) left behind by the replicative polymerases and results in increased mutation load at the genome. The realization that defective MMR leads to a hypermutation phenotype and increased risk of tumorigenesis highlights the relevance of this pathway for human disease. The association of MMR defects with increased risk of cancer development was first observed in colorectal cancer patients that carried inactivating germline mutations in MMR genes and the disease was named as hereditary non-polyposis colorectal cancer (HNPCC). Currently, a growing list of cancers is found to be MMR defective and HNPCC has been renamed Lynch syndrome (LS) partly to include the associated risk of developing extra-colonic cancers. In addition, a number of non-hereditary, mostly epigenetic, alterations of MMR genes have been described in sporadic tumors. Besides conferring a strong cancer predisposition, genetic or epigenetic inactivation of MMR genes also renders cells resistant to some chemotherapeutic agents. Therefore, diagnosis of MMR deficiency has important implications for the management of the patients, the surveillance of their relatives in the case of LS and for the choice of treatment. Some of the alterations found in MMR genes have already been well defined and their pathogenicity assessed. Despite this substantial wealth of knowledge, the effects of a large number of alterations remain uncharacterized (variants of uncertain significance, VUSs). The advent of personalized genomics is likely to increase the list of VUSs found in MMR genes and anticipates the need of diagnostic tools for rapid assessment of their pathogenicity. This review describes current tools and future strategies for addressing the relevance

  9. Critical Effect of Base Pairing of Target Pyrimidine on the Interstrand Photo-Cross-Linking of DNA via 3-Cyanovinylcarbazole Nucleoside.

    PubMed

    Sakamoto, Takashi; Ooe, Minako; Fujimoto, Kenzo

    2015-08-19

    To evaluate the effect of base pairing of the target pyrimidine on the interstrand photo-cross-linking reaction of DNA via 3-cyanovinylcarbazole nucleoside ((CNV)K), a complementary base of target pyrimidine was substituted with noncanonical purine bases or 1,3-propandiol (S). As the decrease of the hydrogen bonds in the base pairing of target C accelerated the photo-cross-linking reaction markedly (3.6- to 7.7-fold), it can be concluded that the number of hydrogen bonds in the base pairing, i.e., the stability of base pairing, of the target pyrimidine plays a critical role in the interstrand photo-cross-linking reaction. In the case of G to S substitution, the highest photoreactivity toward C was observed, whose photoreaction rate constant (k = 2.0 s(-1)) is comparable to that of (CNV)K toward T paired with A (k = 3.5 s(-1)). This is the most reactive photo-cross-linking reaction toward C in the sequence specific interstrand photo-cross-linking. This might facilitate the design of the photo-cross-linkable oligodeoxyribonucleotides for various target sequences.

  10. Charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion

    SciTech Connect

    Rahmi, Kinanti Aldilla Yudiarsah, Efta

    2016-04-19

    By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency. The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.

  11. Structure of p53 binding to the BAX response element reveals DNA unwinding and compression to accommodate base-pair insertion

    SciTech Connect

    Chen, Y.; Zhang, X.; Dantas Machado, A. C.; Ding, Y.; Chen, Z.; Qin, P. Z.; Rohs, R.; Chen, L.

    2013-07-08

    The p53 core domain binds to response elements (REs) that contain two continuous half-sites as a cooperative tetramer, but how p53 recognizes discontinuous REs is not well understood. Here we describe the crystal structure of the p53 core domain bound to a naturally occurring RE located at the promoter of the Bcl-2-associated X protein (BAX) gene, which contains a one base-pair insertion between the two half-sites. Surprisingly, p53 forms a tetramer on the BAX-RE that is nearly identical to what has been reported on other REs with a 0-bp spacer. Each p53 dimer of the tetramer binds in register to a half-site and maintains the same protein–DNA interactions as previously observed, and the two dimers retain all the protein–protein contacts without undergoing rotation or translation. To accommodate the additional base pair, the DNA is deformed and partially disordered around the spacer region, resulting in an apparent unwinding and compression, such that the interactions between the dimers are maintained. Furthermore, DNA deformation within the p53-bound BAX-RE is confirmed in solution by site-directed spin labeling measurements. Our results provide a structural insight into the mechanism by which p53 binds to discontinuous sites with one base-pair spacer.

  12. Mismatch repair of heteroduplex DNA intermediates of extrachromosomal recombination in mammalian cells.

    PubMed Central

    Deng, W P; Nickoloff, J A

    1994-01-01

    Previous work indicated that extrachromosomal recombination in mammalian cells could be explained by the single-strand annealing (SSA) model. This model predicts that extrachromosomal recombination leads to nonconservative crossover products and that heteroduplex DNA (hDNA) is formed by annealing of complementary single strands. Mismatched bases in hDNA may subsequently be repaired to wild-type or mutant sequences, or they may remain unrepaired and segregate following DNA replication. We describe a system to examine the formation and mismatch repair of hDNA in recombination intermediates. Our results are consistent with extrachromosomal recombination occurring via SSA and producing crossover recombinant products. As predicted by the SSA model, hDNA was present in double-strand break-induced recombination intermediates. By placing either silent or frameshift mutations in the predicted hDNA region, we have shown that mismatches are efficiently repaired prior to DNA replication. Images PMID:8264607

  13. Oxygen-aromatic contacts in intra-strand base pairs: analysis of high-resolution DNA crystal structures and quantum chemical calculations.

    PubMed

    Jain, Alok; Krishna Deepak, R N V; Sankararamakrishnan, Ramasubbu

    2014-07-01

    Three-dimensional structures of biomolecules are stabilized by a large number of non-covalent interactions and some of them such as van der Waals, electrostatic and hydrogen bond interactions are well characterized. Delocalized π-electron clouds of aromatic residues are known to be involved in cation-π, CH-π, OH-π and π-π interactions. In proteins, many examples have been found in which the backbone carbonyl oxygen of one residue makes close contact with the aromatic center of aromatic residues. Quantum chemical calculations suggest that such contacts may provide stability to the protein secondary structures. In this study, we have systematically analyzed the experimentally determined high-resolution DNA crystal structures and identified 91 examples in which the aromatic center of one base is in close contact (<3.5Ǻ) with the oxygen atom of preceding (Group-I) or succeeding base (Group-II). Examples from Group-I are overwhelmingly observed and cytosine or thymine is the preferred base contributing oxygen atom in Group-I base pairs. A similar analysis of high-resolution RNA structures surprisingly did not yield many examples of oxygen-aromatic contact of similar type between bases. Ab initio quantum chemical calculations on compounds based on DNA crystal structures and model compounds show that interactions between the bases in base pairs with oxygen-aromatic contacts are energetically favorable. Decomposition of interaction energies indicates that dispersion forces are the major cause for energetically stable interaction in these base pairs. We speculate that oxygen-aromatic contacts in intra-strand base pairs in a DNA structure may have biological significance. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. Is thymidine glycol containing DNA a substrate of E. coli DNA mismatch repair system?

    PubMed

    Perevozchikova, Svetlana A; Trikin, Roman M; Heinze, Roger J; Romanova, Elena A; Oretskaya, Tatiana S; Friedhoff, Peter; Kubareva, Elena A

    2014-01-01

    The DNA mismatch repair (MMR) system plays a crucial role in the prevention of replication errors and in the correction of some oxidative damages of DNA bases. In the present work the most abundant oxidized pyrimidine lesion, 5,6-dihydro-5,6-dihydroxythymidine (thymidine glycol, Tg) was tested for being recognized and processed by the E. coli MMR system, namely complex of MutS, MutL and MutH proteins. In a partially reconstituted MMR system with MutS-MutL-MutH proteins, G/Tg and A/Tg containing plasmids failed to provoke the incision of DNA. Tg residue in the 30-mer DNA duplex destabilized double helix due to stacking disruption with neighboring bases. However, such local structural changes are not important for E. coli MMR system to recognize this lesion. A lack of repair of Tg containing DNA could be due to a failure of MutS (a first acting protein of MMR system) to interact with modified DNA in a proper way. It was shown that Tg in DNA does not affect on ATPase activity of MutS. On the other hand, MutS binding affinities to DNA containing Tg in G/Tg and A/Tg pairs are lower than to DNA with a G/T mismatch and similar to canonical DNA. Peculiarities of MutS interaction with DNA was monitored by Förster resonance energy transfer (FRET) and fluorescence anisotropy. Binding of MutS to Tg containing DNAs did not result in the formation of characteristic DNA kink. Nevertheless, MutS homodimer orientation on Tg-DNA is similar to that in the case of G/T-DNA. In contrast to G/T-DNA, neither G/Tg- nor A/Tg-DNA was able to stimulate ADP release from MutS better than canonical DNA. Thus, Tg residue in DNA is unlikely to be recognized or processed by the E. coli MMR system. Probably, the MutS transformation to active "sliding clamp" conformation on Tg-DNA is problematic.

  15. Stability and Mismatch Discrimination of Locked Nucleic Acid–DNA Duplexes

    PubMed Central

    2011-01-01

    Locked nucleic acids (LNA; symbols of bases, +A, +C, +G, and +T) are introduced into chemically synthesized oligonucleotides to increase duplex stability and specificity. To understand these effects, we have determined thermodynamic parameters of consecutive LNA nucleotides. We present guidelines for the design of LNA oligonucleotides and introduce free online software that predicts the stability of any LNA duplex oligomer. Thermodynamic analysis shows that the single strand–duplex transition is characterized by a favorable enthalpic change and by an unfavorable loss of entropy. A single LNA modification confines the local conformation of nucleotides, causing a smaller, less unfavorable entropic loss when the single strand is restricted to the rigid duplex structure. Additional LNAs adjacent to the initial modification appear to enhance stacking and H-bonding interactions because they increase the enthalpic contributions to duplex stabilization. New nearest-neighbor parameters correctly forecast the positive and negative effects of LNAs on mismatch discrimination. Specificity is enhanced in a majority of sequences and is dependent on mismatch type and adjacent base pairs; the largest discriminatory boost occurs for the central +C·C mismatch within the +T+C+C sequence and the +A·G mismatch within the +T+A+G sequence. LNAs do not affect specificity in some sequences and even impair it for many +G·T and +C·A mismatches. The level of mismatch discrimination decreases the most for the central +G·T mismatch within the +G+G+C sequence and the +C·A mismatch within the +G+C+G sequence. We hypothesize that these discrimination changes are not unique features of LNAs but originate from the shift of the duplex conformation from B-form to A-form. PMID:21928795

  16. Interaction of the E. coli DNA G:T-mismatch endonuclease (vsr protein) with oligonucleotides containing its target sequence.

    PubMed

    Turner, D P; Connolly, B A

    2000-12-15

    The Escherichia coli vsr endonuclease recognises G:T base-pair mismatches in double-stranded DNA and initiates a repair pathway by hydrolysing the phosphate group 5' to the incorrectly paired T. The enzyme shows a preference for G:T mismatches within a particular sequence context, derived from the recognition site of the E. coli dcm DNA-methyltransferase (CC[A/T]GG). Thus, the preferred substrate for the vsr protein is (CT[A/T]GG), where the underlined T is opposed by a dG base. This paper provides quantitative data for the interaction of the vsr protein with a number of oligonucleotides containing G:T mismatches. Evaluation of specificity constant (k(st)/K(D); k(st)=rate constant for single turnover, K(D)=equilibrium dissociation constant) confirms vsr's preference for a G:T mismatch within a hemi-methylated dcm sequence, i.e. the best substrate is a duplex (both strands written in the 5'-3' orientation) composed of CT[A/T]GG and C(5Me)C[T/A]GG. Conversion of the mispaired T (underlined) to dU or the d(5Me)C to dC gave poorer substrates. No interaction was observed with oligonucleotides that lacked a G:T mismatch or did not possess a dcm sequence. An analysis of the fraction of active protein, by "reverse-titration" (i.e. adding increasing amounts of DNA to a fixed amount of protein followed by gel-mobility shift analysis) showed that less than 1% of the vsr endonuclease was able to bind to the substrate. This was confirmed using "competitive titrations" (where competitor oligonucleotides are used to displace a (32)P-labelled nucleic acid from the vsr protein) and burst kinetic analysis. This result is discussed in the light of previous in vitro and in vivo data which indicate that the MutL protein may be needed for full vsr activity. Copyright 2000 Academic Press.

  17. Compensating Bends in a 16 base-pair DNA Oligomer Containing a T3A3 Segment: A NMR Study of Global DNA Curvature

    SciTech Connect

    McAteer, Kathleen; Aceves Gaona, Alejandro; Michalczyk, Ryszard; Buchko, Garry W.; Isern, Nancy G.; Silks, Louis A.; Miller, John H.; Kennedy, Michael A.

    2004-12-15

    DNA curvature but no single model has been able to explain all the experimental data. An intriguing observation is that AnTn segments ligated in phase exhibit retarded migration in polyacrylamide gel electrophoresis (PAGE) but TnAn segments do not. We have determined a high-resolution structure of a 16 base-pair DNA oligomer [d(CGAGGTTTAAACCTCG)2] containing a T3A3 tract. The refinement included residual dipolar coupling (RDC) restraints. A radius of curvature, Rc, analysis was used to measure the overall bending in the molecule. A plot of the helical axis reference points showed a sigmoidal shape indicating a discontinuity at the central TpA step in the overall curvature. Because of the length of the 16mer it was possible to accurately measure Rc for the two halves of the molecule centered about the TpA step. The Rc for the overall molecule (Rc=128 nm) is large, i.e. a low overall magnitude of global bending, whereas the Rc for the two halves of the molecule (Rc=72 nm) is small indicating a much larger magnitude of localized bending. However the direction of bending in the two halves is in partial opposition leading to cancellation of the overall bending. This indicates that TnAn-containing DNA sequences are strongly and multiply bent locally, but are nearly straight globally which is consistent with PAGE results. The RDC refined structure lacked anomalous features present in NOE-only structures indicating the RDC and NOE measurements have a different sensitivity to conformational dynamics at the central TpA step. Because of its increased length and refinement using RDC restraints, the structure of the 16mer reported here provides new insight into the structural origins of the enigmatic PAGE behavior of AnTn and TnAn tracts and the large amplitude, slow base dynamics observed at TpA steps.

  18. Alteration of the Relative Stability of dA·dT and dG·dC Base Pairs in DNA

    PubMed Central

    Melchior, William B.; Von Hippel, Peter H.

    1973-01-01

    Several small alkylammonium ions can eliminate, or even reverse, the usual dependence of the DNA transition temperature on base composition. For example, in 3 M tetramethylammonium chloride, or 2.4 M tetraethylammonium chloride, DNAs of different base compositions all melt at a common temperature, and with a greatly decreased breadth of transition reflecting only the sequence-independent components of melting cooperativity. At still higher concentrations of such additives, dG·dC-rich DNAs melt at lower temperatures than dA·dT-rich molecules. Circular dichroism spectra show that these additives alter the structure of the DNA double helix very little at room temperature. This differential (base-specific) effect on helix stability is investigated with several small additives related to the tetraalkylammonium ions. Additives larger than tetraethylammonium ion have little differential effect on helix stability. Preferential binding of ions to dA·dT base pairs, requiring fit into a “groove” of DNA, is consistent with these data and with equilibrium binding studies. These differential effects can be distinguished from general destabilizing effects, which are independent of specific features of macromolecular conformation or chemistry. Possible experimental uses of this ability to alter the base-composition-dependent components of the stability of the DNA helix are discussed, as well as the insight this phenomenon provides into the molecular basis for the differential stability of dA·dT and dG·dC base pairs. PMID:4346879

  19. Exonuclease processivity of archaeal replicative DNA polymerase in association with PCNA is expedited by mismatches in DNA

    PubMed Central

    Yoda, Takuya; Tanabe, Maiko; Tsuji, Toshiyuki; Yoda, Takao; Ishino, Sonoko; Shirai, Tsuyoshi; Ishino, Yoshizumi; Takeyama, Haruko; Nishida, Hirokazu

    2017-01-01

    Family B DNA polymerases comprise polymerase and 3′ −>5′ exonuclease domains, and detect a mismatch in a newly synthesized strand to remove it in cooperation with Proliferating cell nuclear antigen (PCNA), which encircles the DNA to provide a molecular platform for efficient protein–protein and protein–DNA interactions during DNA replication and repair. Once the repair is completed, the enzyme must stop the exonucleolytic process and switch to the polymerase mode. However, the cue to stop the degradation is unclear. We constructed several PCNA mutants and found that the exonuclease reaction was enhanced in the mutants lacking the conserved basic patch, located on the inside surface of PCNA. These mutants may mimic the Pol/PCNA complex processing the mismatched DNA, in which PCNA cannot interact rigidly with the irregularly distributed phosphate groups outside the dsDNA. Indeed, the exonuclease reaction with the wild type PCNA was facilitated by mismatched DNA substrates. PCNA may suppress the exonuclease reaction after the removal of the mismatched nucleotide. PCNA seems to act as a “brake” that stops the exonuclease mode of the DNA polymerase after the removal of a mismatched nucleotide from the substrate DNA, for the prompt switch to the DNA polymerase mode. PMID:28300173

  20. Mismatch repair proteins recruit DNA methyltransferase 1 to sites of oxidative DNA damage.

    PubMed

    Ding, Ning; Bonham, Emily M; Hannon, Brooke E; Amick, Thomas R; Baylin, Stephen B; O'Hagan, Heather M

    2016-06-01

    At sites of chronic inflammation, epithelial cells are exposed to high levels of reactive oxygen species and undergo cancer-associated DNA methylation changes, suggesting that inflammation may initiate epigenetic alterations. Previously, we demonstrated that oxidative damage causes epigenetic silencing proteins to become part of a large complex that is localized to GC-rich regions of the genome, including promoter CpG islands that are epigenetically silenced in cancer. However, whether these proteins were recruited directly to damaged DNA or during the DNA repair process was unknown. Here we demonstrate that the mismatch repair protein heterodimer MSH2-MSH6 participates in the oxidative damage-induced recruitment of DNA methyltransferase 1 (DNMT1) to chromatin. Hydrogen peroxide treatment induces the interaction of MSH2-MSH6 with DNMT1, suggesting that the recruitment is through a protein-protein interaction. Importantly, the reduction in transcription for genes with CpG island-containing promoters caused by oxidative damage is abrogated by knockdown of MSH6 and/or DNMT1. Our findings provide evidence that the role of DNMT1 at sites of oxidative damage is to reduce transcription, potentially preventing transcription from interfering with the repair process. This study uniquely brings together several factors that are known to contribute to colon cancer, namely inflammation, mismatch repair proteins, and epigenetic changes. © The Author (2015). Published by Oxford University Press on behalf of Journal of Molecular Cell Biology, IBCB, SIBS, CAS. All rights reserved.

  1. Insights into electron tunneling across hydrogen-bonded base-pairs in complete molecular circuits for single-stranded DNA sequencing

    NASA Astrophysics Data System (ADS)

    Lee, Myeong H.; Sankey, Otto F.

    2009-01-01

    We report a first-principles study of electron ballistic transport through a molecular junction containing deoxycytidine-monophosphate (dCMP) connected to metal electrodes. A guanidinium ion and guanine nucleobase are tethered to gold electrodes on opposite sides to form hydrogen bonds with the dCMP molecule providing an electric circuit. The circuit mimics a component of a potential device for sequencing unmodified single-stranded DNA. The molecular conductance is obtained from DFT Green's function scattering methods and is compared to estimates from the electron tunneling decay constant obtained from the complex band structure. The result is that a complete molecular dCMP circuit of 'linker((CH2)2)-guanidinium-phosphate-deoxyribose-cytosine-guanine' has a very low conductance (of the order of fS) while the hydrogen-bonded guanine-cytosine base-pair has a moderate conductance (of the order of tens to hundreds of nS). Thus, while the transverse electron transfer through base-pairing is moderately conductive, electron transfer through a complete molecular dCMP circuit is not. The gold Fermi level is found to be aligned very close to the HOMO for both the guanine-cytosine base-pair and the complete molecular dCMP circuit. Results for two different plausible geometries of the hydrogen-bonded dCMP molecule reveal that the conductance varies from fS for an extended structure to pS for a slightly compressed structure.

  2. Insights into electron tunneling across hydrogen-bonded base-pairs in complete molecular circuits for single-stranded DNA sequencing.

    PubMed

    Lee, Myeong H; Sankey, Otto F

    2009-01-21

    We report a first-principles study of electron ballistic transport through a molecular junction containing deoxycytidine-monophosphate (dCMP) connected to metal electrodes. A guanidinium ion and guanine nucleobase are tethered to gold electrodes on opposite sides to form hydrogen bonds with the dCMP molecule providing an electric circuit. The circuit mimics a component of a potential device for sequencing unmodified single-stranded DNA. The molecular conductance is obtained from DFT Green's function scattering methods and is compared to estimates from the electron tunneling decay constant obtained from the complex band structure. The result is that a complete molecular dCMP circuit of 'linker((CH(2))(2))-guanidinium-phosphate-deoxyribose-cytosine-guanine' has a very low conductance (of the order of fS) while the hydrogen-bonded guanine-cytosine base-pair has a moderate conductance (of the order of tens to hundreds of nS). Thus, while the transverse electron transfer through base-pairing is moderately conductive, electron transfer through a complete molecular dCMP circuit is not. The gold Fermi level is found to be aligned very close to the HOMO for both the guanine-cytosine base-pair and the complete molecular dCMP circuit. Results for two different plausible geometries of the hydrogen-bonded dCMP molecule reveal that the conductance varies from fS for an extended structure to pS for a slightly compressed structure.

  3. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

    PubMed

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-13

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

  4. Discriminating DNA mismatches by electrochemical and gravimetric techniques.

    PubMed

    Mazouz, Zouhour; Fourati, Najla; Zerrouki, Chouki; Ommezine, Asma; Rebhi, Lamia; Yaakoubi, Nourdin; Kalfat, Rafik; Othmane, Ali

    2013-10-15

    A silicon nitride functionalized electrode and a 104 MHz lithium tantalate (LiTaO₃) surface acoustic wave (SAW) sensor have been used to investigate target-probe recognition processes. Electrochemical and gravimetric measurements have been considered to monitor hybridization of single base mismatch (SBM) in synthetic oligonucleotides and single-nucleotide polymorphisms ApoE in real clinical genotypes. Obvious discrimination of SBM in nucleotides has been shown by both gravimetric and electrochemical techniques, without labeling nor amplification. Investigations on mismatches nature and position have also been considered. For guanine-adenine (GA), guanine-thymine (GT) and guanine-guanine (GG) mismatches, the sensors responses present a dependence upon positions. Considering the capacitance variations and hybridization rates, results showed that gravimetric transduction is more sensitive than electrochemical one. Moreover, the highest value of GT hybridization rate (in the middle position) was found in accordance with the nearest-neighbor model, where the considered configuration appears as the most thermodynamically stable. For the real samples, where the electrochemical transduction, by combining capacitance and flat-band potential measurements, were found more sensitive, the results show that the realized sensor permits an unambiguous discrimination of recognition between fully complementary, non-complementary and single base mismatched targets, and even between the combination of differently matched strands. Copyright © 2013 Elsevier B.V. All rights reserved.

  5. Probing DNA hybridization efficiency and single base mismatch by X-ray photoelectron spectroscopy.

    PubMed

    Liu, Zheng-Chun; Zhang, Xin; He, Nong-Yue; Lu, Zu-Hong; Chen, Zhen-Cheng

    2009-07-01

    We demonstrated the use of X-ray photoelectron spectroscopy (XPS) to study DNA hybridization. Target DNA labeled with hexachloro-fluorescein (HEX) was hybridized to DNA arrays with four different probes. Each probe dot of the hybridized arrays was detected with XPS. The XPS Cl2p peak areas were found to decrease with an increase in mismatched bases in DNA probes. The Cl2p core-level peak area ratio of a probe perfectly matched to one, two and three base-mismatched probes accorded well with the results of conventional fluorescent imaging, which shows that XPS is a potential tool for analyzing DNA arrays. The DNA arrays' hybridization efficiency was assessed by the molar ratio of chlorine to phosphorus in a DNA strand, which was determined from the relevant XPS Cl2p and P2p core-level peak areas after hybridization. This could provide a new method to detect DNA hybridization efficiency.

  6. Isosteric and fluorescent DNA base pair formed by 4-amino-phthalimide and 2,4-diaminopyrimidine: melting, structure, and THz polar solvation dynamics.

    PubMed

    Dehmel, L; Berndt, F; Weinberger, M; Sajadi, M; Ioffe, I; Wagenknecht, H-A; Ernsting, N P

    2016-03-07

    An artificial base pair in the center of a duplex DNA oligomer, formed by 2,4-diaminopyrimidine and fluorescent 4-aminophthalimide C-nucleosides, is characterized spectroscopically, with a view towards its use in femtosecond solvation dynamics. Quantum-chemical calculations predict H-bonding energy equivalent to A:T. UV-vis absorption spectra provide insight into local melting at the 4-aminophthalimide modification site. Increase of temperature to nearly the melting temperature of the duplex leads to better hybridisation of the fluorescent nucleoside, contrary to native base pairs. This unusual observation is explained by the NMR solution structure of the duplex. Two conformations are adopted by the artificial pair due to backbone constraints, having either two or one interbase hydrogen bonds. In the latter, hydrogen bonding sites remain accessible for water solvation. The time-resolved dynamic Stokes' shift of 4-aminophthalimide fluorescence is consistent with that of a mixture of a slow and fast species. From the observations, the optimal linkage between 4-aminophthalimide and 2-deoxyribose for fitting into the duplex B-DNA structure is deduced.

  7. 5-Methylation of Cytosine in CG:CG Base-Pair Steps: A Physicochemical Mechanism for the Epigenetic Control of DNA Nanomechanics

    NASA Astrophysics Data System (ADS)

    Yusufaly, Tahir; Olson, Wilma; Li, Yun

    2014-03-01

    Van der Waals density functional theory is integrated with analysis of a non-redundant set of protein-DNA crystal structures from the Nucleic Acid Database to study the stacking energetics of CG:CG base-pair steps, specifically the role of cytosine 5-methylation. Principal component analysis of the steps reveals the dominant collective motions to correspond to a tensile ``opening'' mode and two shear ``sliding'' and ``tearing'' modes in the orthogonal plane. The stacking interactions of the methyl groups are observed to globally inhibit CG:CG step overtwisting while simultaneously softening the modes locally via potential energy modulations that create metastable states. The results have implications for the epigenetic control of DNA mechanics.

  8. Solvation of deoxynucleosides in aqueous mixtures of organic solvents probed through their intrinsic fluorescence: Implications for open base pair states in DNA

    NASA Astrophysics Data System (ADS)

    Ababneh, Anas Mohammad

    Because of the importance of solvation in the function of DNA, there is considerable interest in understanding the solvation network of its constituent components. This is of particular importance in connection with the closing of base pairs that have been disrupted as a result of structural fluctuations. Following the opening of a base pair, the open base is exposed to a heterogeneous environment which involves polar as well as nonpolar interactions. Toward the goal of understanding how the open bases interact with such a heterogeneous environment, we have studied the intrinsic fluorescence properties of the purine and pyrimidine nucleosides (dG, dA, dT, and dC) in organic solvents in the presence of small amounts of water. Exposure of the nucleoside to water was done by preparing solutions in three different ways: (i) "premixed" solution in which the nucleoside is dissolved in a water-organic solvent mixture, (ii) "carry its own water" solution in which the nucleoside is first dissolved in water and then diluted in the organic solvent, and (iii) "injected" solution in which water is added to a solution of the nucleoside in the organic solvent. The organic solvents used in the present study were: n-butanol, acetonitrile, methanol, n-propanol, isopropanol, and isobutanol. We find that for n-butanol and acetonitrile, which have a high degree of amphiphilicity and weak hydrogen bonding ability, respectively, the fluorescence spectral properties of the purines are found to depend on the sequence of the steps in which the aqueous mixture was formed. By contrast, no such dependence was observed in the other organic solvents. On the other hand, no such dependence was observed for the pyrimidines in any of the organic solvents used in the present study. These findings suggest that the final solvation network around the purines is dependent on the nature of the environment to which they were initially exposed. This would tend to present an impediment to the closing of

  9. Native mass spectrometry provides direct evidence for DNA mismatch-induced regulation of asymmetric nucleotide binding in mismatch repair protein MutS.

    PubMed

    Monti, Maria Chiara; Cohen, Serge X; Fish, Alexander; Winterwerp, Herrie H K; Barendregt, Arjan; Friedhoff, Peter; Perrakis, Anastassis; Heck, Albert J R; Sixma, Titia K; van den Heuvel, Robert H H; Lebbink, Joyce H G

    2011-10-01

    The DNA mismatch repair protein MutS recognizes mispaired bases in DNA and initiates repair in an ATP-dependent manner. Understanding of the allosteric coupling between DNA mismatch recognition and two asymmetric nucleotide binding sites at opposing sides of the MutS dimer requires identification of the relevant MutS.mmDNA.nucleotide species. Here, we use native mass spectrometry to detect simultaneous DNA mismatch binding and asymmetric nucleotide binding to Escherichia coli MutS. To resolve the small differences between macromolecular species bound to different nucleotides, we developed a likelihood based algorithm capable to deconvolute the observed spectra into individual peaks. The obtained mass resolution resolves simultaneous binding of ADP and AMP.PNP to this ABC ATPase in the absence of DNA. Mismatched DNA regulates the asymmetry in the ATPase sites; we observe a stable DNA-bound state containing a single AMP.PNP cofactor. This is the first direct evidence for such a postulated mismatch repair intermediate, and showcases the potential of native MS analysis in detecting mechanistically relevant reaction intermediates.

  10. Developmentally regulated excision of a 28-base-pair sequence from the Paramecium genome requires flanking DNA.

    PubMed

    Ku, M; Mayer, K; Forney, J D

    2000-11-01

    The micronuclear DNA of Paramecium tetraurelia is estimated to contain over 50,000 short DNA elements that are precisely removed during the formation of the transcriptionally active macronucleus. Each internal eliminated sequence (IES) is bounded by 5'-TA-3' dinucleotide repeats, a feature common to some classes of DNA transposons. We have developed an in vivo assay to analyze these highly efficient and precise DNA excision events. The microinjection of a cloned IES into mating cells results in accurately spliced products, and the transformed cells maintain the injected DNA as extrachromosomal molecules. A series of deletions flanking one side of a 28-bp IES were constructed and analyzed with the in vivo assay. Whereas 72 bp of DNA flanking the eliminated region is sufficient for excision, lengths of 31 and 18 bp result in reduced excision and removal of all wild-type sequences adjacent to the TA results in complete failure of excision. In contrast, nucleotide mutations within the middle of the 28-bp IES do not prevent excision. The results are consistent with a functional role for perfect inverted repeats flanking the IES.

  11. Acceleration of Long-Range Photoinduced Electron Transfer through DNA by Hydroxyquinolines as Artificial Base Pairs.

    PubMed

    Bätzner, Effi; Liang, Yu; Schweigert, Caroline; Unterreiner, Andreas-Neil; Wagenknecht, Hans-Achim

    2015-06-08

    The C-nucleoside based on the hydroxyquinoline ligand (Hq) is complementary to itself and forms stable Hq-Hq pairs in double-stranded DNA. These artificial Hq-Hq pairs may serve as artificial electron carriers for long-range photoinduced electron transfer in DNA, as elucidated by a combination of gel electrophoretic analysis of irradiated samples and time-resolved transient absorption spectroscopy. For this study, the Hq-Hq pair was combined with a DNA-based donor-acceptor system consisting of 6-N,N-dimethylaminopyrene conjugated to 2'-deoxyuridine as photoinducible electron donor, and methyl viologen attached to the 2'-position of uridine as electron acceptor. The Hq radical anion was identified in the time-resolved measurements and strand cleavage products support its role as an intermediate charge carrier. Hence, the Hq-Hq pair significantly enhances the electron hopping capability of DNA compared to natural DNA bases over long distances while keeping the self-assembly properties as the most attractive feature of DNA as a supramolecular architecture. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Interaction of an anti-cancer photosensitizer with a genomic DNA: From base pair specificity and thermodynamic landscape to tuning the rate of detergent-sequestered dissociation.

    PubMed

    Paul, Bijan K; Ghosh, Narayani; Mukherjee, Saptarshi

    2016-05-15

    A detailed characterization of the binding interaction of a potent cancer cell photosensitizer, norharmane (NHM) with a genomic DNA (herring sperm; hsDNA) is undertaken with particular emphasis on deciphering the strength, mode, dynamics, energetics and kinetics of binding. A major focus of the study underlies a successful exploration of the concept of detergent-sequestered dissociation of drug from the drug-DNA complex. Biophysical techniques such as absorption, steady-state and time-resolved fluorescence spectroscopy, circular dichroism, DNA helix melting, stopped-flow fluorescence kinetics and calorimetry have been used. A primarily intercalative mode of binding of NHM with DNA is shown. However, the overall interaction is governed by more than one type of binding forces. We demonstrate that the essential prerequisite of a slower dissociation rate of drug from DNA helix is achieved by tenable choice surfactants. Our results also highlight an effective tunability of the rate of dissociation of the DNA-intercalated drug via detergent-sequestration. A detailed isothermal titration calorimetric study unveils the key role of hydrophobic force underlying NHM-hsDNA association. This is further substantiated by the enthalpy-entropy compensation behavior. The major entropic contribution in detergent-induced dissociation of NHM from NHM-hsDNA complex is also demonstrated. Our results present not only a comprehensive structural and thermodynamic profile, base pair specificity, association kinetics for binding of NHM with DNA but also explore the thermodynamic and kinetic aspects of dissociation of bound drug. Characterization and tuning of the essential prerequisites for a drug to be efficient in anti-cancer functionality bear direct and widespread significance in contemporary global research. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. The DNA mismatch repair protein MutS forms a one-dimensional Tonks gas on DNA

    NASA Astrophysics Data System (ADS)

    Bundschuh, Ralf; Klajner, Piotr; Hanne, Jeungphill; Britton, Brooke M.; Liu, Jianquan; Park, Jonghyun; Lee, Jong-Bong; Fishel, Richard

    2014-03-01

    MutS is a protein involved in DNA mismatch repair. It recognizes the mismatch, forms a sliding clamp around the DNA, and displaces other proteins bound to the DNA prior to the actual repair process. Here, we present a quantitative model of an ensemble of MutS molecules on a short strand of DNA with one mismatch. We model the ensemble as a Tonks gas of passively diffusing one-dimensional particles of finite extension and include clamp formation at the mismatch and random detachment. The distributions of MutS number bound to the DNA for different mismatch positions and different MutS concentrations in solution fit very well with distributions determined by single molecule experiments, thereby establishing the Tonks gas as an excellent model of MutS action on DNA. This material is based upon work supported by the National Science Foundation under Grant No. 01105458 (RB), the National Institutes of Health under Grant No. CA67007 (RF), and the National Research Foundation of Korea under Grant No. 2011-0013901 (JBL).

  14. Electronic promotion effect of double proton transfer on conduction of DNA through improvement of transverse electronic communication of base pairs

    NASA Astrophysics Data System (ADS)

    Liu, Haiying; Li, Genqin; Zhang, Laibin; Li, Jilai; Wang, Meishan; Bu, Yuxiang

    2011-10-01

    The effect of double proton transfer (DPT) on charge migration of DNA was investigated by the nonequilibrium Green's function method combined with density functional theory. The results revealed that DPT not only lowers ionization potentials, but also improves the delocalization of the localized π-orbitals at each base moiety through adjusting energy levels and spatial distributions of their molecular orbitals. Furthermore, DPT leads to both the strengthening of the second-order interactions of the Watson-Crick H-bond zones, and the promotion of the charge transfer transitions between two pairing bases in the UV absorption spectra. Electronic transport calculations indicated that DPT can improve the charge migration along the DNA duplex for specific sequences through enhancing transverse base-to-base electronic communication. This work will provide a new insight into the understanding of DNA charge conduction which can be electronically promoted or regulated by DPT.

  15. Base pair switching by interconversion of sugar puckers in DNA extended by proteins of RecA-family: A model for homology search in homologous genetic recombination

    PubMed Central

    Nishinaka, Taro; Shinohara, Akira; Ito, Yutaka; Yokoyama, Shigeyuki; Shibata, Takehiko

    1998-01-01

    Escherichia coli RecA is a representative of proteins from the RecA family, which promote homologous pairing and strand exchange between double-stranded DNA and single-stranded DNA. These reactions are essential for homologous genetic recombination in various organisms. From NMR studies, we previously reported a novel deoxyribose-base stacking interaction between adjacent residues on the extended single-stranded DNA bound to RecA protein. In this study, we found that the same DNA structure was induced by the binding to Saccharomyces cerevisiae Rad51 protein, indicating that the unique DNA structure induced by the binding to RecA-homologs was conserved from prokaryotes to eukaryotes. On the basis of this structure, we have formulated the structure of duplex DNA within filaments formed by RecA protein and its homologs. Two types of molecular structures are presented. One is the duplex structure that has the N-type sugar pucker. Its helical pitch is ≈95 Å (18.6 bp/turn), corresponding to that of an active, or ATP-form of the RecA filament. The other is one that has the S-type sugar pucker. Its helical pitch is ≈64 Å (12.5 bp/turn), corresponding to that of an inactive, or ADP-form of the RecA filament. During this modeling, we found that the interconversion of sugar puckers between the N-type and the S-type rotates bases horizontally, while maintaining the deoxyribose-base stacking interaction. We propose that this base rotation enables base pair switching between double-stranded DNA and single-stranded DNA to take place, facilitating homologous pairing and strand exchange. A possible mechanism for strand exchange involving DNA rotation also is discussed. PMID:9736691

  16. The Eukaryotic Mismatch Recognition Complexes Track with the Replisome during DNA Synthesis

    PubMed Central

    Haye, Joanna E.; Gammie, Alison E.

    2015-01-01

    During replication, mismatch repair proteins recognize and repair mispaired bases that escape the proofreading activity of DNA polymerase. In this work, we tested the model that the eukaryotic mismatch recognition complex tracks with the advancing replisome. Using yeast, we examined the dynamics during replication of the leading strand polymerase Polε using Pol2 and the eukaryotic mismatch recognition complex using Msh2, the invariant protein involved in mismatch recognition. Specifically, we synchronized cells and processed samples using chromatin immunoprecipitation combined with custom DNA tiling arrays (ChIP-chip). The Polε signal was not detectable in G1, but was observed at active origins and replicating DNA throughout S-phase. The Polε signal provided the resolution to track origin firing timing and efficiencies as well as replisome progression rates. By detecting Polε and Msh2 dynamics within the same strain, we established that the mismatch recognition complex binds origins and spreads to adjacent regions with the replisome. In mismatch repair defective PCNA mutants, we observed that Msh2 binds to regions of replicating DNA, but the distribution and dynamics are altered, suggesting that PCNA is not the sole determinant for the mismatch recognition complex association with replicating regions, but may influence the dynamics of movement. Using biochemical and genomic methods, we provide evidence that both MutS complexes are in the vicinity of the replisome to efficiently repair the entire spectrum of mutations during replication. Our data supports the model that the proximity of MutSα/β to the replisome for the efficient repair of the newly synthesized strand before chromatin reassembles. PMID:26684201

  17. Improvement of DNA adenylation using T4 DNA ligase with a template strand and a strategically mismatched acceptor strand

    PubMed Central

    Patel, Maha P.; Baum, Dana A.; Silverman, Scott K.

    2008-01-01

    DNA with a 5′-adenylpyrophosphoryl cap (5′-adenylated DNA; AppDNA) is an activated form of DNA that is the biochemical intermediate of the reactions catalyzed by DNA ligase, RNA ligase, polynucleotide kinase, and other nucleic acid modifying enzymes. 5′-Adenylated DNA is also useful for in vitro selection experiments. Efficient preparation of 5′-adenylated DNA is therefore desirable for several biochemical applications. Here we have developed a DNA adenylation procedure that uses T4 DNA ligase and is more reliable than a previously reported approach that used the 5′-phosphorylated donor DNA substrate to be adenylated, a DNA template, and ATP but no acceptor strand. Our improved DNA adenylation procedure uses the above components as well as an acceptor strand that has a strategically chosen C-T acceptor-template mismatch directly adjacent to the adenylation site. This mismatch permits adenylation of the donor DNA substrate but largely suppresses subsequent ligation of the donor with the acceptor, as assayed on nine different DNA substrates that collectively have all four DNA nucleotides represented at each of the first two positions. The new DNA adenylation procedure is successful using either laboratory-prepared or commercial T4 DNA ligase and works well on the preparative (2 nmol) scale for all nine of the test DNA substrates. PMID:18022669

  18. Conformational analysis of a 139 base-pair DNA fragment containing a single-stranded break and its interaction with human poly(ADP-ribose) polymerase.

    PubMed

    Le Cam, E; Fack, F; Ménissier-de Murcia, J; Cognet, J A; Barbin, A; Sarantoglou, V; Révet, B; Delain, E; de Murcia, G

    1994-01-21

    The conformational changes induced by the introduction of a central and unique single-stranded break in a 139 base-pair DNA duplex have been analysed by means of polyacrylamide gel electrophoresis, HPLC and dark-field electron microscopy. Compared to the control DNA, the disruption of the covalent sugar-phosphate backbone induces a retardation detected both by gel electrophoresis and anion exchange based HPLC. Electron microscopic visualization of the DNA molecules reveals that most of them present a central fracture at the position of the nick. Measures of the angle at the apex were very well fitted by a simple model of isotropic flexible junction assuming spatial Hooke's law and simple basic Boltzmann statistics. This amounts to using a folded Gaussian distribution. The fit yields an angle equilibrium value phi 0 = 122 degrees for the nicked fragment. The angle distribution could also result from an equilibrium between two forms of the molecule with isotropic flexibility at the nicked site: a stacked and a very flexible unstacked form. The majority of bound poly(ADP-ribose) polymerase, a zinc-finger enzyme involved in DNA break detection, was localized at the apex of the V-shaped DNA duplex, with an accentuation of its general V-shaped conformation (phi 0 = 102 degrees).

  19. Mismatch Repair Proteins Are Activators of Toxic Responses to Chromium-DNA Damage

    PubMed Central

    Peterson-Roth, Elizabeth; Reynolds, Mindy; Quievryn, George; Zhitkovich, Anatoly

    2005-01-01

    Chromium(VI) is a toxic and carcinogenic metal that causes the formation of DNA phosphate-based adducts. Cr-DNA adducts are genotoxic in human cells, although they do not block replication in vitro. Here, we report that induction of cytotoxicity in Cr(VI)-treated human colon cells and mouse embryonic fibroblasts requires the presence of all major mismatch repair (MMR) proteins. Cr-DNA adducts lost their ability to block replication of Cr-modified plasmids in human colon cells lacking MLH1 protein. The presence of functional mismatch repair caused induction of p53-independent apoptosis associated with activation of caspases 2 and 7. Processing of Cr-DNA damage by mismatch repair resulted in the extensive formation of γ-H2AX foci in G2 phase, indicating generation of double-stranded breaks as secondary toxic lesions. Induction of γ-H2AX foci was observed at 6 to 12 h postexposure, which was followed by activation of apoptosis in the absence of significant G2 arrest. Our results demonstrate that mismatch repair system triggers toxic responses to Cr-DNA backbone modifications through stress mechanisms that are significantly different from those for other forms of DNA damage. Selection for Cr(VI) resistant, MMR-deficient cells may explain the very high frequency of lung cancers with microsatellite instability among chromate workers. PMID:15831465

  20. Rad51-mediated double-strand break repair and mismatch correction of divergent substrates.

    PubMed

    Anand, Ranjith; Beach, Annette; Li, Kevin; Haber, James

    2017-04-20

    The Rad51 (also known as RecA) family of recombinases executes the critical step in homologous recombination: the search for homologous DNA to serve as a template during the repair of DNA double-strand breaks (DSBs). Although budding yeast Rad51 has been extensively characterized in vitro, the stringency of its search and sensitivity to mismatched sequences in vivo remain poorly defined. Here, in Saccharomyces cerevisiae, we analysed Rad51-dependent break-induced replication in which the invading DSB end and its donor template share a 108-base-pair homology region and the donor carries different densities of single-base-pair mismatches. With every eighth base pair mismatched, repair was about 14% of that of completely homologous sequences. With every sixth base pair mismatched, repair was still more than 5%. Thus, completing break-induced replication in vivo overcomes the apparent requirement for at least 6-8 consecutive paired bases that has been inferred from in vitro studies. When recombination occurs without a protruding nonhomologous 3' tail, the mismatch repair protein Msh2 does not discourage homeologous recombination. However, when the DSB end contains a 3' protruding nonhomologous tail, Msh2 promotes the rejection of mismatched substrates. Mismatch correction of strand invasion heteroduplex DNA is strongly polar, favouring correction close to the DSB end. Nearly all mismatch correction depends on the proofreading activity of DNA polymerase-δ, although the repair proteins Msh2, Mlh1 and Exo1 influence the extent of correction.

  1. Twisting Motion Frequency Dependent I-V Characteristics of 102 Base Pairs Poly(dG)-Poly(dC) DNA Molecule

    NASA Astrophysics Data System (ADS)

    Yudiarsah, Efta

    2017-05-01

    The I-V characteristic of 102 base pair Poly(dG)-Poly(dC) DNA molecule have been calculated for several base pairs twisting motion frequencies. The calculation is carried out on doubled-stranded DNA model sandwiched in between two metallic electrodes. The effect is studied by taking into account twisting angle dependent on-site energy and hopping constant in the tight binding Hamiltonian of double-strand DNA model. We use semi-empirical Slater-Koster theory in the twisting angle dependent intra- and inter-strand hopping constant. We consider the temperature dependent sugar-phosphate backbone on-site energy by employing random energy disorder using uniform distribution function. The standard deviation of twisting angle is obtained by assuming that the average kinetic energy of twisting motions is proportional to system temperature. The transfer and scattering matrix methods are used simultaneously in calculating the transmission probability of charge on the molecule. We choose the contacts between molecule and both electrodes such that the main features of transport properties of the molecule do not change much by the presence of metallic electrodes. By assuming the voltage drops symmetrically at the contacts, Landauer-Buttiker Formalism is used in calculating the I-V characteristic of the molecule from transmission probability. The results show that the magnitude of current increases by twisting motion frequency increment. Larger current magnitude increment is observed at higher voltage. The influence of twisting motion frequency on the I-V characteristic is stronger at higher temperature, in the range of considered temperature.

  2. Structure of the 1,N2-Ethenodeoxyguanosine Adduct Opposite Cytosine in Duplex DNA: Hoogsteen Base Pairing at pH 5.2†

    PubMed Central

    2008-01-01

    The exocyclic 1,N2-ethenodeoxyguanosine (1,N2-ϵdG) adduct, arising from the reaction of vinyl halides and other vinyl monomers, including chloroacetaldehyde, and lipid peroxidation products with dG, was examined at pH 5.2 in the oligodeoxynucleotide duplex 5′-d(CGCATXGAATCC)-3′·5′-d(GGATTCCATGCG)-3′ (X = 1,N2-ϵdG). Previously, X(anti)·C(anti) pairing was established in this duplex, containing the 5′-TXG-3′ sequence context, at pH 8.6 [ShanmugamG., GoodenoughA. K., KozekovI. D., HarrisT. M., GuengerichF. P., RizzoC. J., and StoneM. P. (2007) Chem. Res. Toxicol.21, 1601−161117941687]. At pH 5.2, the 1,N2-ϵdG adduct decreased the thermal stability of the duplex by ∼13 °C. The 1,N2-ϵdG adduct rotated about the glycosyl bond from the anti to the syn conformation. This resulted in the observation of a strong nuclear Overhauser effect (NOE) between the imidazole proton of 1,N2-ϵdG and the anomeric proton of the attached deoxyribose, accompanied by an NOE to the minor groove A20 H2 proton from the complementary strand. The syn conformation of the glycosyl bond at 1,N2-ϵdG placed the exocyclic etheno moiety into the major groove. This resulted in the observation of NOEs between the etheno protons and the major groove protons of the 5′-neighboring thymine. The 1,N2-ϵdG adduct formed a Hoogsteen pair with the complementary cytosine, characterized by downfield shifts of the amino protons of the cytosine complementary to the exocyclic adduct. The pattern of chemical shift perturbations indicated that the lesion introduced a localized structural perturbation involving the modified base pair and its 3′- and 5′-neighbor base pairs. A second conformational equilibrium was observed, in which both the modified base pair and its 3′-neighboring G·C base pair formed tandem Hoogsteen pairs. The results support the conclusion that at neutral pH, in the 5′-TXG-3′ sequence, the 1,N2-ϵdG adduct exists as a blend of conformations in duplex DNA. These

  3. Theoretical study on the structure, stability, and electronic properties of the guanine-Zn-cytosine base pair in M-DNA

    SciTech Connect

    Fuentes-Cabrera, Miguel A; Sumpter, Bobby G; Sponer, Judit; Sponer, Jiri; Petit, Leon; Wells, Jack C

    2007-01-01

    M-DNA is a type of metalated DNA that forms at high pH and in the presence of Zn, Ni, and Co, with the metals placed in between each base pair, as in G-Zn-C. Experiments have found that M-DNA could be a promising candidate for a variety of nanotechnological applications, as it is speculated that the metal d-states enhance the conductivity, but controversy still clouds these findings. In this paper, we carry out a comprehensive ab initio study of eight G-Zn-C models in the gas phase to help discern the structure and electronic properties of Zn-DNA. Specifically, we study whether a model prefers to be planar and has electronic properties that correlate with Zn-DNA having a metallic-like conductivity. Out of all the studied models, there is only one which preserves its planarity upon full geometry optimization. Nevertheless, starting from this model, one can deduce a parallel Zn-DNA architecture only. This duplex would contain the imino proton, in contrast to what has been proposed experimentally. Among the nonplanar models, there is one that requires less than 8 kcal/mol to flatten (both in gas and solvent conditions), and we propose that it is a plausible model for building an antiparallel duplex. In this duplex, the imino proton would be replaced by Zn, in accordance with experimental models. Neither planar nor nonplanar models have electronic properties that correlate with Zn-DNA having a metallic-like conductivity due to Zn d-states. To understand whether density functional theory (DFT) can describe appropriately the electronic properties of M-DNAs, we have investigated the electronic properties of G-Co-C base pairs. We have found that when self-interaction corrections (SIC) are not included the HOMO state contains Co d-levels, whereas these levels are moved below the HOMO state when SIC are considered. This result indicates that caution should be exercised when studying the electronic properties of M-DNAs with functionals that do not account for strong

  4. Synthesis of a dA-dT base pair analogue and its effects on DNA-ligand binding.

    PubMed

    Lan, T; McLaughlin, L W

    2001-08-01

    Two nucleoside derivatives containing the base analogues 3-deazaadenine and 3-methyl-2-pyridone have been prepared as analogues of dA and dT, respectively. After conversion into the appropriately protected phosphoramidites, DNA sequences were prepared with site-specifically placed analogues. When present in a duplex DNA sequence, the analogues result in the deletion of one or both of the hydrogen bonding functional groups (the N3-nitrogen of dA and the O2-carbonyl of dT) present in the minor groove. Binding by two ligands, 4',6-diamidine-2-phenyl indole (DAPI) and Hoechst 33258 in the minor groove has been probed using a variety of DNA sequences. These sequences contain a d(GAATTC)2 core with analogue nucleosides substituted for one or more of the dA and dT residues. DAPI bound strongly to any sequence that contained both O2-carbonyls of the central two dT residues. The presence of a dc3A residue did in some cases enhance binding. With one of the central O2-carbonyls deleted, the binding was noticeably reduced, and with both absent, no significant binding could be detected. Similar although less dramatic results were observed with Hoechst 33258 binding to analogue sequences.

  5. Interdependence of DNA mismatch repair proteins MLH1 and MSH2 in apoptosis in human colorectal carcinoma cell lines.

    PubMed

    Hassen, Samar; Ali, Akhtar A; Kilaparty, Surya P; Al-Anbaky, Qudes A; Majeed, Waqar; Boman, Bruce M; Fields, Jeremy Z; Ali, Nawab

    2016-01-01

    The mammalian DNA mismatch repair (MMR) system consists of a number of proteins that play important roles in repair of base pair mismatch mutations and in maintenance of genomic integrity. A defect in this system can cause genetic instability, which can lead to carcinogenesis. For instance, a germline mutation in one of the mismatch repair proteins, especially MLH1 or MSH2, is responsible for hereditary non-polyposis colorectal cancer. These MMR proteins also play an important role in the induction of apoptosis. Accordingly, altered expression of or a defect in MLH1 or MSH2 may confer resistance to anti-cancer drugs used in chemotherapy. We hypothesized that the ability of these two MMR proteins to regulate apoptosis are interdependent. Moreover, a defect in either one may confer resistance to chemotherapy by an inability to trigger apoptosis. To this end, we studied three cell lines-SW480, LoVo, and HTC116. These cell lines were selected based on their differential expression of MLH1 and MSH2 proteins. SW480 expresses both MLH1 and MSH2; LoVo expresses only MLH1 but not MSH2; HCT116 expresses only MSH2 but not MLH1 protein. MTT assays, a measure of cytotoxicity, showed that there were different cytotoxic effects of an anti-cancer drug, etoposide, on these cell lines, effects that were correlated with the MMR status of the cells. Cells that are deficient in MLH1 protein (HCT116 cells) were resistant to the drug. Cells that express both MLH1 and MSH2 proteins (SW480 cells) showed caspase-3 cleavage, an indicator of apoptosis. Cells that lack MLH1 (HCT116 cells) did not show any caspase-3 cleavage. Expression of full-length MLH1 protein was decreased in MMR proficient (SW480) cells during apoptosis; it remained unchanged in cells that lack MSH2 (LoVo cells). The expression of MSH2 protein remained unchanged during apoptosis both in MMR proficient (SW480) and deficient (HCT116) cells. Studies on translocation of MLH1 protein from nucleus to cytosolic fraction, an

  6. Structure of the EndoMS-DNA Complex as Mismatch Restriction Endonuclease.

    PubMed

    Nakae, Setsu; Hijikata, Atsushi; Tsuji, Toshiyuki; Yonezawa, Kouki; Kouyama, Ken-Ichi; Mayanagi, Kouta; Ishino, Sonoko; Ishino, Yoshizumi; Shirai, Tsuyoshi

    2016-11-01

    Archaeal NucS nuclease was thought to degrade the single-stranded region of branched DNA, which contains flapped and splayed DNA. However, recent findings indicated that EndoMS, the orthologous enzyme of NucS, specifically cleaves double-stranded DNA (dsDNA) containing mismatched bases. In this study, we determined the structure of the EndoMS-DNA complex. The complex structure of the EndoMS dimer with dsDNA unexpectedly revealed that the mismatched bases were flipped out into binding sites, and the overall architecture most resembled that of restriction enzymes. The structure of the apo form was similar to the reported structure of Pyrococcus abyssi NucS, indicating that movement of the C-terminal domain from the resting state was required for activity. In addition, a model of the EndoMS-PCNA-DNA complex was preliminarily verified with electron microscopy. The structures strongly support the idea that EndoMS acts in a mismatch repair pathway.

  7. High association of T1858-G1896 precore mutations with impaired base pairing and high hepatitis B virus DNA levels in HBeAg-negative chronically infected patients.

    PubMed

    Castelain, Sandrine; Descamps, Véronique; Brochot, Etienne; Helle, François; Duverlie, Gilles; Nguyen-Khac, Eric; François, Catherine

    2017-07-01

    The progression of liver disease in hepatitis B virus (HBV) infection is fostered by active virus replication. Mutations in the basal core promoter (BCP) and precore (PC) regions of the HBV genome are known to have an impact on viral replication. The aim of the present study was to assess the correlation of mutation profiles in the BCP and PC regions with the viral load in HBeAg-negative chronically infected patients. The HBV genotype, BCP/PC mutations, serum HBV DNA levels, and associated serological markers were analyzed in 92 HBeAg-negative chronically infected patients. Sequence analysis of the BCP and PC regions revealed variability of 19% and 24.1%, respectively. This variability was primarily associated with five critical positions (1753, 1762, 1764, 1896 and 1899). An elevated HBV viral load (>20,000 IU/ml) was classically correlated with F2-F4 liver fibrosis, elevated serum alanine aminotransferase levels, 1762/1764 and 1753 combination mutations, and surprisingly, with an 1858T-1896G double mutation that impairs base pairing at the base of the bulge in the ε encapsidation signal. An analysis of covariance confirmed the independent nature of the relationship between the 1858T-1896G double mutation and the HBV viral load. In conclusion, independently of conventional parameters, this study demonstrates that a high serum HBV DNA level was also associated with PC 1858-1896 mutations. These BCP/PC mutations may have important clinical implications as predictive factors for HBV DNA increase.

  8. Saturation of DNA mismatch repair and error catastrophe by a base analogue in Escherichia coli.

    PubMed Central

    Negishi, Kazuo; Loakes, David; Schaaper, Roel M

    2002-01-01

    Deoxyribosyl-dihydropyrimido[4,5-c][1,2]oxazin-7-one (dP) is a potent mutagenic deoxycytidine-derived base analogue capable of pairing with both A and G, thereby causing G. C --> A. T and A. T --> G. C transition mutations. We have found that the Escherichia coli DNA mismatch-repair system can protect cells against this mutagenic action. At a low dose, dP is much more mutagenic in mismatch-repair-defective mutH, mutL, and mutS strains than in a wild-type strain. At higher doses, the difference between the wild-type and the mutator strains becomes small, indicative of saturation of mismatch repair. Introduction of a plasmid containing the E. coli mutL(+) gene significantly reduces dP-induced mutagenesis. Together, the results indicate that the mismatch-repair system can remove dP-induced replication errors, but that its capacity to remove dP-containing mismatches can readily be saturated. When cells are cultured at high dP concentration, mutant frequencies reach exceptionally high levels and viable cell counts are reduced. The observations are consistent with a hypothesis in which dP-induced cell killing and growth impairment result from excess mutations (error catastrophe), as previously observed spontaneously in proofreading-deficient mutD (dnaQ) strains. PMID:12196386

  9. Mismatched DNTP Incorporation By DNA Polymerase Beta Does Not Proceed Via Globally Different Conformational Pathways

    SciTech Connect

    Tang, K.-H.; Niebuhr, M.; Tung, C.-S.; Chan, H.-c.; Chou, C.-C.; Tsai, M.-D.

    2009-05-26

    Understanding how DNA polymerases control fidelity requires elucidation of the mechanisms of matched and mismatched dNTP incorporations. Little is known about the latter because mismatched complexes do not crystallize readily. In this report, we employed small-angle X-ray scattering (SAXS) and structural modeling to probe the conformations of different intermediate states of mammalian DNA polymerase {beta} (Pol {beta}) in its wild-type and an error-prone variant, I260Q. Our structural results indicate that the mismatched ternary complex lies in-between the open and the closed forms, but more closely resembles the open form for WT and the closed form for I260Q. On the basis of molecular modeling, this over-stabilization of mismatched ternary complex of I260Q is likely caused by formation of a hydrogen bonding network between the side chains of Gln{sup 260}, Tyr{sup 296}, Glu{sup 295} and Arg{sup 258}, freeing up Asp{sup 192} to coordinate MgdNTP. These results argue against recent reports suggesting that mismatched dNTP incorporations follow a conformational path distinctly different from that of matched dNTP incorporation, or that its conformational closing is a major contributor to fidelity.

  10. MSH-MLH complexes formed at a DNA mismatch are disrupted by the PCNA sliding clamp.

    PubMed

    Bowers, J; Tran, P T; Joshi, A; Liskay, R M; Alani, E

    2001-03-09

    In the yeast Saccharomyces cerevisiae, mismatch repair (MMR) is initiated by the binding of heterodimeric MutS homolog (MSH) complexes to mismatches that include single nucleotide and loop insertion/deletion mispairs. In in vitro experiments, the mismatch binding specificity of the MSH2-MSH6 heterodimer is eliminated if ATP is present. However, addition of the MutL homolog complex MLH1-PMS1 to binding reactions containing MSH2-MSH6, ATP, and mismatched substrate results in the formation of a stable ternary complex. The stability of this complex suggests that it represents an intermediate in MMR that is subsequently acted upon by other MMR factors. In support of this idea, we found that the replication processivity factor proliferating cell nuclear antigen (PCNA), which plays a critical role in MMR at step(s) prior to DNA resynthesis, disrupted preformed ternary complexes. These observations, in conjunction with experiments performed with streptavidin end-blocked mismatch substrates, suggested that PCNA interacts with an MSH-MLH complex formed on DNA mispairs.

  11. Phosphorylation of PCNA by EGFR inhibits mismatch repair and promotes misincorporation during DNA synthesis

    PubMed Central

    Ortega, Janice; Li, Jessie Y.; Lee, Sanghee; Tong, Dan; Gu, Liya; Li, Guo-Min

    2015-01-01

    Proliferating cell nuclear antigen (PCNA) plays essential roles in eukaryotic cells during DNA replication, DNA mismatch repair (MMR), and other events at the replication fork. Earlier studies show that PCNA is regulated by posttranslational modifications, including phosphorylation of tyrosine 211 (Y211) by the epidermal growth factor receptor (EGFR). However, the functional significance of Y211-phosphorylated PCNA remains unknown. Here, we show that PCNA phosphorylation by EGFR alters its interaction with mismatch-recognition proteins MutSα and MutSβ and interferes with PCNA-dependent activation of MutLα endonuclease, thereby inhibiting MMR at the initiation step. Evidence is also provided that Y211-phosphorylated PCNA induces nucleotide misincorporation during DNA synthesis. These findings reveal a novel mechanism by which Y211-phosphorylated PCNA promotes cancer development and progression via facilitating error-prone DNA replication and suppressing the MMR function. PMID:25825764

  12. An interplay of the base excision repair and mismatch repair pathways in active DNA demethylation

    PubMed Central

    Grin, Inga; Ishchenko, Alexander A.

    2016-01-01

    Active DNA demethylation (ADDM) in mammals occurs via hydroxylation of 5-methylcytosine (5mC) by TET and/or deamination by AID/APOBEC family enzymes. The resulting 5mC derivatives are removed through the base excision repair (BER) pathway. At present, it is unclear how the cell manages to eliminate closely spaced 5mC residues whilst avoiding generation of toxic BER intermediates and whether alternative DNA repair pathways participate in ADDM. It has been shown that non-canonical DNA mismatch repair (ncMMR) can remove both alkylated and oxidized nucleotides from DNA. Here, a phagemid DNA containing oxidative base lesions and methylated sites are used to examine the involvement of various DNA repair pathways in ADDM in murine and human cell-free extracts. We demonstrate that, in addition to short-patch BER, 5-hydroxymethyluracil and uracil mispaired with guanine can be processed by ncMMR and long-patch BER with concomitant removal of distant 5mC residues. Furthermore, the presence of multiple mispairs in the same MMR nick/mismatch recognition region together with BER-mediated nick formation promotes proficient ncMMR resulting in the reactivation of an epigenetically silenced reporter gene in murine cells. These findings suggest cooperation between BER and ncMMR in the removal of multiple mismatches that might occur in mammalian cells during ADDM. PMID:26843430

  13. Mismatch Repair Balances Leading and Lagging Strand DNA Replication Fidelity

    DTIC Science & Technology

    2012-10-11

    Pol e mutator variant to confirm that Pol e is the primary leading strand replicase in Saccharomyces cerevisiae . We then use polymerase-specific error...variables using Saccharomyces cerevisiae strains containing mutant alleles of the POL1 (Pol a), POL2 (Pol e) and POL3 (Pol d) genes. These mutant...AL, Johnston LH, Sugino A (1993) Pathway correcting DNA replication errors in Saccharomyces cerevisiae . Embo J 12: 1467–1473. 17. Morrison A, Sugino A

  14. Alternating d(GA)n DNA sequences form antiparallel stranded homoduplexes stabilized by the formation of G.A base pairs.

    PubMed Central

    Huertas, D; Bellsolell, L; Casasnovas, J M; Coll, M; Azorín, F

    1993-01-01

    Alternating d(GA)n DNA sequences form antiparallel stranded homoduplexes which are stabilized by the formation of G.A pairs. Three base pairings are known to occur between adenine and guanine: AH+ (anti).G(syn), A(anti).G(anti) and A(syn).G(anti). Protonation of the adenine residues is not involved in the stabilization of this structure, since it is observed at any pH value from 8.3 to 4.5; at pH < or = 4.0 antiparallel stranded d(GA.GA) DNA is destabilized. The results reported in this paper strongly suggest that antiparallel stranded d(GA.GA) homoduplexes are stabilized by the formation of alternating A(anti).G(anti) and G(anti).A(syn) pairs. In this structure, all guanine residues are in the anti conformation with their N7 position freely accessible to DMS methylation. On the other hand, adenines in one strand adopt the anti conformation, with their N7 position also free for reaction, while those of the opposite strand are in the syn conformation, with their N7 position hydrogen bonded to the guanine N1 group of the opposite strand. A regular right-handed helix can be generated using alternating G(anti).A(syn) and A(anti).G(anti) pairs. Images PMID:8404869

  15. CanScript, an 18-Base pair DNA sequence, boosts tumor cell-specific promoter activity: implications for targeted gene therapy.

    PubMed

    Huang, Yu-Hung; Cozzitorto, Joseph A; Richards, Nathan G; Eltoukhy, Ahmed A; Yeo, Charles J; Langer, Robert; Anderson, Daniel G; Brody, Jonathan R; Sawicki, Janet A

    2010-11-01

    Gene therapy protocols for the treatment of cancer often employ gene promoter sequences that are known to be over-expressed in specific tumor cell types relative to normal cells. These promoters, while specific, are often weakly active. It would be desirable to increase the activity of such promoters, while at the same time retain specificity, so that the therapeutic gene is more robustly expressed. Using a luciferase reporter DNA construct in both in vitro cell transfection assays and in vivo mouse tumor models, we have determined that in the absence of any other DNA sequence, a previously identified 18-base pair enhancer sequence called CanScript, lying upstream of the MSLN gene, has ~25% of the promoter activity of CAG, a very strong non-specific promoter/enhancer, in tumor cells in which MSLN is highly expressed. Furthermore, tandem repeat copies of CanScript enhance transcription in a dose-dependent manner and, when coupled with promoter sequences that are active in tumor cells, increase promoter activity. These findings suggest that the incorporation of CanScript into gene constructs may have application in enhancing activity of promoters used in cancer-targeting gene therapy strategies, thereby improving therapeutic efficacy.

  16. Poorly repaired mismatches in heteroduplex DNA are hyper-recombinagenic in Saccharomyces cerevisiae

    SciTech Connect

    Manivasakam, P.; Hastings, P.J.; Rosenberg, S.M.

    1996-02-01

    In yeast meiotic recombination, alleles used as genetic markers fall into two classes as regards their fate when incorporated into heteroduplex DNA. Normal alleles are those that form heteroduplexes that are nearly always recognized and corrected by the mismatch repair system operating in meiosis. High PMS (postmeiotic segregation) alleles form heteroduplexes that are inefficiently mismatch repaired. We propose that this hyperrecombination is caused by the high PMS allele blocking a mismatch repair tract initiated from the normal allele, thus preventing corepair of the two alleles, which would prevent formation of recombinants. The results of three point crosses involving two PMS alleles and a normal allele suggest that high PMS alleles placed between two alleles that are normally corepaired block that corepair. 30 refs., 7 figs., 3 tabs.

  17. Helicobacter pylori infection and expression of DNA mismatch repair proteins

    PubMed Central

    Mirzaee, Vahid; Molaei, Mahsa; Shalmani, Hamid Mohaghegh; Zali, Mohammad Reza

    2008-01-01

    AIM: To determine the expression of DNA (MMR) proteins, including hMLH1 and hMSH2, in gastric epithelial cells in the patients with or without Helicobacter pylori (H pylori)-infected gastritis. METHODS: Fifty H pylori-positive patients and 50 H pylori-negative patients were enrolled in the study. During endoscopy of patients with non-ulcer dyspepsia, two antral and two corpus biopsies were taken for histological examination (Giemsa stain) and for immunohistochemical staining of hMLH1 and hMSH2. RESULTS: The percentage of epithelial cell nuclei that demonstrated positivity for hMLH1 staining was 84.14 ± 7.32% in H pylori-negative patients, while it was 73.34 ± 10.10% in H pylori-positive patients (P < 0.0001). No significant difference was seen between the two groups regarding the percentage of epithelial cell nuclei that demonstrated positivity for hMSH2 staining (81.16 ± 8.32% in H pylori-negative versus 78.24 ± 8.71% in H pylori-positive patients; P = 0.09). CONCLUSION: This study indicates that H pylori might promote development of gastric carcinoma at least in part through its ability to affect the DNA MMR system. PMID:19034977

  18. Anthracycline-DNA interactions at unfavourable base-pair triplet-binding sites: structures of d(CGGCCG)/daunomycin and d(TGGCCA)/adriamycin complexes.

    PubMed

    Leonard, G A; Hambley, T W; McAuley-Hecht, K; Brown, T; Hunter, W N

    1993-09-01

    The structures of two hexanucleotide-anthracycline complexes d(CGGCCG)/daunomycin and d(TGGCCA)/adriamycin have been determined using single-crystal X-ray diffraction techniques. In both cases the anthracycline molecule is bound to non-preferred d(YGG) base-pair triplet sites. For both complexes the crystals are tetragonal and belong to the space group P4(1)2(1)2. Unit-cell dimensions are a = 28.07 (2), c = 53.35 (1) and a = 28.01 (1), c = 52.99 (1) A, respectively, and the asymmetric unit of both structures consists of one strand of DNA, one drug molecule and approximately 50 water molecules. For the d(CGGCCG) complex the refinement converged with an R factor of 0.21 for 1108 reflections with F >/= 2sigma(F) in the resolution range 7.0-1.9 A. For the complex involving d(TGGCCA) the final R value was 0.22 for 1475 reflections in the range 7.0-1.7 A with the same criterion for observed data. Both complexes are essentially isomorphous with related structures but differ in terms of the number of favourable van der Waals interactions of the amino sugars of the drug molecules with the DNA duplexes and the formation in the minor groove of heterodromic pentagonal arrangements of hydrogen bonds involving water molecules which link the amino sugars to the DNA. These differences in structure are used to rationalize the lack of affinity of daunomycin-type anthracyclines for d(YGG) and d(YGC) sites.

  19. DNA mismatch repair and the DNA damage response to ionizing radiation: making sense of apparently conflicting data.

    PubMed

    Martin, Lynn M; Marples, Brian; Coffey, Mary; Lawler, Mark; Lynch, Thomas H; Hollywood, Donal; Marignol, Laure

    2010-11-01

    The DNA mismatch repair (MMR) pathway detects and repairs DNA replication errors. While DNA MMR-proficiency is known to play a key role in the sensitivity to a number of DNA damaging agents, its role in the cytotoxicity of ionizing radiation (IR) is less well characterized. Available literature to date is conflicting regarding the influence of MMR status on radiosensitivity, and this has arisen as a subject of controversy in the field. The aim of this paper is to provide the first comprehensive overview of the experimental data linking MMR proteins and the DNA damage response to IR. A PubMed search was conducted using the key words "DNA mismatch repair" and "ionizing radiation". Relevant articles and their references were reviewed for their association between DNA MMR and IR. Recent data suggest that radiation dose and the type of DNA damage induced may dictate the involvement of the MMR system in the cellular response to IR. In particular, the literature supports a role for the MMR system in DNA damage recognition, cell cycle arrest, DNA repair and apoptosis. In this review we discuss our current understanding of the impact of MMR status on the cellular response to radiation in mammalian cells gained from past and present studies and attempt to provide an explanation for how MMR may determine the response to radiation. Copyright © 2010 Elsevier Ltd. All rights reserved.

  20. DNA conformations in mismatch repair probed in solution by X-ray scattering from gold nanocrystals.

    PubMed

    Hura, Greg L; Tsai, Chi-Lin; Claridge, Shelley A; Mendillo, Marc L; Smith, Jessica M; Williams, Gareth J; Mastroianni, Alexander J; Alivisatos, A Paul; Putnam, Christopher D; Kolodner, Richard D; Tainer, John A

    2013-10-22

    DNA metabolism and processing frequently require transient or metastable DNA conformations that are biologically important but challenging to characterize. We use gold nanocrystal labels combined with small angle X-ray scattering to develop, test, and apply a method to follow DNA conformations acting in the Escherichia coli mismatch repair (MMR) system in solution. We developed a neutral PEG linker that allowed gold-labeled DNAs to be flash-cooled and stored without degradation in sample quality. The 1,000-fold increased gold nanocrystal scattering vs. DNA enabled investigations at much lower concentrations than otherwise possible to avoid concentration-dependent tetramerization of the MMR initiation enzyme MutS. We analyzed the correlation scattering functions for the nanocrystals to provide higher resolution interparticle distributions not convoluted by the intraparticle distribution. We determined that mispair-containing DNAs were bent more by MutS than complementary sequence DNA (csDNA), did not promote tetramer formation, and allowed MutS conversion to a sliding clamp conformation that eliminated the DNA bends. Addition of second protein responder MutL did not stabilize the MutS-bent forms of DNA. Thus, DNA distortion is only involved at the earliest mispair recognition steps of MMR: MutL does not trap bent DNA conformations, suggesting migrating MutL or MutS/MutL complexes as a conserved feature of MMR. The results promote a mechanism of mismatch DNA bending followed by straightening in initial MutS and MutL responses in MMR. We demonstrate that small angle X-ray scattering with gold labels is an enabling method to examine protein-induced DNA distortions key to the DNA repair, replication, transcription, and packaging.

  1. DNA conformations in mismatch repair probed in solution by X-ray scattering from gold nanocrystals

    PubMed Central

    Hura, Greg L.; Tsai, Chi-Lin; Claridge, Shelley A.; Mendillo, Marc L.; Smith, Jessica M.; Williams, Gareth J.; Mastroianni, Alexander J.; Alivisatos, A. Paul; Putnam, Christopher D.; Kolodner, Richard D.; Tainer, John A.

    2013-01-01

    DNA metabolism and processing frequently require transient or metastable DNA conformations that are biologically important but challenging to characterize. We use gold nanocrystal labels combined with small angle X-ray scattering to develop, test, and apply a method to follow DNA conformations acting in the Escherichia coli mismatch repair (MMR) system in solution. We developed a neutral PEG linker that allowed gold-labeled DNAs to be flash-cooled and stored without degradation in sample quality. The 1,000-fold increased gold nanocrystal scattering vs. DNA enabled investigations at much lower concentrations than otherwise possible to avoid concentration-dependent tetramerization of the MMR initiation enzyme MutS. We analyzed the correlation scattering functions for the nanocrystals to provide higher resolution interparticle distributions not convoluted by the intraparticle distribution. We determined that mispair-containing DNAs were bent more by MutS than complementary sequence DNA (csDNA), did not promote tetramer formation, and allowed MutS conversion to a sliding clamp conformation that eliminated the DNA bends. Addition of second protein responder MutL did not stabilize the MutS-bent forms of DNA. Thus, DNA distortion is only involved at the earliest mispair recognition steps of MMR: MutL does not trap bent DNA conformations, suggesting migrating MutL or MutS/MutL complexes as a conserved feature of MMR. The results promote a mechanism of mismatch DNA bending followed by straightening in initial MutS and MutL responses in MMR. We demonstrate that small angle X-ray scattering with gold labels is an enabling method to examine protein-induced DNA distortions key to the DNA repair, replication, transcription, and packaging. PMID:24101514

  2. Recognition of GT mismatches by Vsr mismatch endonuclease

    PubMed Central

    Fox, Keith R.; Allinson, Sarah L.; Sahagun-Krause, Heidi; Brown, Tom

    2000-01-01

    The Vsr mismatch endonuclease recognises the sequence CTWGG (W = A or T) in which the underlined thymine is paired with guanine and nicks the DNA backbone on the 5′-side of the mispaired thymine. By using base analogues of G and T we have explored the functional groups on the mismatch pair which are recognised by the enzyme. Removal of the thymine 5-methyl group causes a 60% reduction in activity, while removing the 2-amino group of guanine reduces cleavage by 90%. Placing 2-aminopurine or nebularine opposite T generates mismatches which are cut at a much lower rate (0.1%). When either base is removed, generating a pseudoabasic site (1′,2′-dideoxyribose), the enzyme still produces site-specific cleavage, but at only 1% of the original rate. Although TT and CT mismatches at this position are cleaved at a low rate (~1%), mismatches with other bases (such as GA and AC) and Watson–Crick base pairs are not cleaved by the enzyme. There is also no cleavage when the mismatched T is replaced with difluorotoluene. PMID:10871403

  3. Recognition of GT mismatches by Vsr mismatch endonuclease.

    PubMed

    Fox, K R; Allinson, S L; Sahagun-Krause, H; Brown, T

    2000-07-01

    The Vsr mismatch endonuclease recognises the sequence CTWGG (W = A or T) in which the underlined thymine is paired with guanine and nicks the DNA backbone on the 5'-side of the mispaired thymine. By using base analogues of G and T we have explored the functional groups on the mismatch pair which are recognised by the enzyme. Removal of the thymine 5-methyl group causes a 60% reduction in activity, while removing the 2-amino group of guanine reduces cleavage by 90%. Placing 2-amino-purine or nebularine opposite T generates mis-matches which are cut at a much lower rate (0.1%). When either base is removed, generating a pseudoabasic site (1', 2'-dideoxyribose), the enzyme still produces site-specific cleavage, but at only 1% of the original rate. Although TT and CT mismatches at this position are cleaved at a low rate (approximately 1%), mismatches with other bases (such as GA and AC) and Watson-Crick base pairs are not cleaved by the enzyme. There is also no cleavage when the mismatched T is replaced with difluorotoluene.

  4. Identification of a mismatch-specific endonuclease in hyperthermophilic Archaea

    PubMed Central

    Ishino, Sonoko; Nishi, Yuki; Oda, Soichiro; Uemori, Takashi; Sagara, Takehiro; Takatsu, Nariaki; Yamagami, Takeshi; Shirai, Tsuyoshi; Ishino, Yoshizumi

    2016-01-01

    The common mismatch repair system processed by MutS and MutL and their homologs was identified in Bacteria and Eukarya. However, no evidence of a functional MutS/L homolog has been reported for archaeal organisms, and it is not known whether the mismatch repair system is conserved in Archaea. Here, we describe an endonuclease that cleaves double-stranded DNA containing a mismatched base pair, from the hyperthermophilic archaeon Pyrococcus furiosus. The corresponding gene revealed that the activity originates from PF0012, and we named this enzyme Endonuclease MS (EndoMS) as the mismatch-specific Endonuclease. The sequence similarity suggested that EndoMS is the ortholog of NucS isolated from Pyrococcus abyssi, published previously. Biochemical characterizations of the EndoMS homolog from Thermococcus kodakarensis clearly showed that EndoMS specifically cleaves both strands of double-stranded DNA into 5′-protruding forms, with the mismatched base pair in the central position. EndoMS cleaves G/T, G/G, T/T, T/C and A/G mismatches, with a more preference for G/T, G/G and T/T, but has very little or no effect on C/C, A/C and A/A mismatches. The discovery of this endonuclease suggests the existence of a novel mismatch repair process, initiated by the double-strand break generated by the EndoMS endonuclease, in Archaea and some Bacteria. PMID:27001046

  5. The vsr gene product of E. coli K-12 is a strand- and sequence-specific DNA mismatch endonuclease.

    PubMed

    Hennecke, F; Kolmar, H; Bründl, K; Fritz, H J

    1991-10-24

    In Escherichia coli K-12, the Dcm methyltransferase catalyses methylation of the inner cytosine residue in the sequence CCA/TGG. Hydrolytic deamination of 5-methylcytosine bases in DNA leads to thymine residues, and hence to T/G mismatches, pre-mutagenic DNA lesions consisting of two natural DNA constituents and thus devoid of an obvious marker of the damaged DNA strand. These mismatches are corrected by the VSP repair pathway, which is characterized by very short patches of DNA repair synthesis. It depends on genes vsr and polA and is strongly stimulated by mutL and mutS. The vsr gene product (Vsr; Mr 18,000) was purified and characterized as a DNA mismatch endonuclease, a unique and hitherto unknown type of enzyme. Vsr endonuclease nicks double-stranded DNA within the sequence CTA/TGN or NTA/TGG next to the underlined thymidine residue, which is mismatched to 2'-deoxyguanosine. The incision is mismatch-dependent and strand-specific. These results illustrate how Vsr endonuclease initiates VSP mismatch repair.

  6. Microsatellites in the Eukaryotic DNA Mismatch Repair Genes as Modulators of Evolutionary Mutation Rate

    NASA Technical Reports Server (NTRS)

    Chang, Dong Kyung; Metzgar, David; Wills, Christopher; Boland, C. Richard

    2003-01-01

    All "minor" components of the human DNA mismatch repair (MMR) system-MSH3, MSH6, PMS2, and the recently discovered MLH3-contain mononucleotide microsatellites in their coding sequences. This intriguing finding contrasts with the situation found in the major components of the DNA MMR system-MSH2 and MLH1-and, in fact, most human genes. Although eukaryotic genomes are rich in microsatellites, non-triplet microsatellites are rare in coding regions. The recurring presence of exonal mononucleotide repeat sequences within a single family of human genes would therefore be considered exceptional.

  7. A monofunctional platinum complex coordinated to a rhodium metalloinsertor selectively binds mismatched DNA in the minor groove.

    PubMed

    Weidmann, Alyson G; Barton, Jacqueline K

    2015-10-05

    We report the synthesis and characterization of a bimetallic complex derived from a new family of potent and selective metalloinsertors containing an unusual Rh-O axial coordination. This complex incorporates a monofunctional platinum center containing only one labile site for coordination to DNA, rather than two, and coordinates DNA nonclassically through adduct formation in the minor groove. This conjugate displays bifunctional, interdependent binding of mismatched DNA via metalloinsertion at a mismatch as well as covalent platinum binding. DNA sequencing experiments revealed that the preferred site of platinum coordination is not the traditional N7-guanine site in the major groove, but rather N3-adenine in the minor groove. The complex also displays enhanced cytotoxicity in mismatch repair-deficient and mismatch repair-proficient human colorectal carcinoma cell lines compared to the chemotherapeutic cisplatin, and it triggers cell death via an apoptotic pathway, rather than the necrotic pathway induced by rhodium metalloinsertors.

  8. A Monofunctional Platinum Complex Coordinated to a Rhodium Metalloinsertor Selectively Binds Mismatched DNA in the Minor Groove

    PubMed Central

    Weidmann, Alyson G.; Barton, Jacqueline K.

    2015-01-01

    We report the synthesis and characterization of a bimetallic complex derived from a new family of potent and selective metalloinsertors containing an unusual Rh—O axial coordination. This complex incorporates a monofunctional platinum center containing only one labile site for coordination to DNA, rather than two, and coordinates DNA non-classically through adduct formation in the minor groove. This conjugate displays bifunctional, interdependent binding of mismatched DNA via metalloinsertion at a mismatch as well as covalent platinum binding. DNA sequencing experiments revealed that the preferred site of platinum coordination is not the traditional N7-guanine site in the major groove, but rather N3-adenine in the minor groove. The complex also displays enhanced cytotoxicity in mismatch repair-deficient and mismatch repair-proficient human colorectal carcinoma cell lines compared to the chemotherapeutic cisplatin, and triggers cell death via an apoptotic pathway, rather than the necrotic pathway induced by rhodium metalloinsertors. PMID:26397309

  9. Role of Cell Cycle Regulation and MLH1, A Key DNA Mismatch Repair Protein, In Adaptive Survival Responses. Final Report

    SciTech Connect

    David A. Boothman

    1999-08-11

    Due to several interesting findings on both adaptive survival responses (ASRs) and DNA mismatch repair (MMR), this grant was separated into two discrete Specific Aim sets (each with their own discrete hypotheses). The described experiments were simultaneously performed.

  10. Replication infidelity via a mismatch with Watson-Crick geometry.

    PubMed

    Bebenek, Katarzyna; Pedersen, Lars C; Kunkel, Thomas A

    2011-02-01

    In describing the DNA double helix, Watson and Crick suggested that "spontaneous mutation may be due to a base occasionally occurring in one of its less likely tautomeric forms." Indeed, among many mispairing possibilities, either tautomerization or ionization of bases might allow a DNA polymerase to insert a mismatch with correct Watson-Crick geometry. However, despite substantial progress in understanding the structural basis of error prevention during polymerization, no DNA polymerase has yet been shown to form a natural base-base mismatch with Watson-Crick-like geometry. Here we provide such evidence, in the form of a crystal structure of a human DNA polymerase λ variant poised to misinsert dGTP opposite a template T. All atoms needed for catalysis are present at the active site and in positions that overlay with those for a correct base pair. The mismatch has Watson-Crick geometry consistent with a tautomeric or ionized base pair, with the pH dependence of misinsertion consistent with the latter. The results support the original idea that a base substitution can originate from a mismatch having Watson-Crick geometry, and they suggest a common catalytic mechanism for inserting a correct and an incorrect nucleotide. A second structure indicates that after misinsertion, the now primer-terminal G • T mismatch is also poised for catalysis but in the wobble conformation seen in other studies, indicating the dynamic nature of the pathway required to create a mismatch in fully duplex DNA.

  11. Cascading MutS and MutL sliding clamps control DNA diffusion to activate mismatch repair.

    PubMed

    Liu, Jiaquan; Hanne, Jeungphill; Britton, Brooke M; Bennett, Jared; Kim, Daehyung; Lee, Jong-Bong; Fishel, Richard

    2016-11-24

    Mismatched nucleotides arise from polymerase misincorporation errors, recombination between heteroallelic parents and chemical or physical DNA damage. Highly conserved MutS (MSH) and MutL (MLH/PMS) homologues initiate mismatch repair and, in higher eukaryotes, act as DNA damage sensors that can trigger apoptosis. Defects in human mismatch repair genes cause Lynch syndrome or hereditary non-polyposis colorectal cancer and 10-40% of related sporadic tumours. However, the collaborative mechanics of MSH and MLH/PMS proteins have not been resolved in any organism. We visualized Escherichia coli (Ec) ensemble mismatch repair and confirmed that EcMutS mismatch recognition results in the formation of stable ATP-bound sliding clamps that randomly diffuse along the DNA with intermittent backbone contact. The EcMutS sliding clamps act as a platform to recruit EcMutL onto the mismatched DNA, forming an EcMutS-EcMutL search complex that then closely follows the DNA backbone. ATP binding by EcMutL establishes a second long-lived DNA clamp that oscillates between the principal EcMutS-EcMutL search complex and unrestricted EcMutS and EcMutL sliding clamps. The EcMutH endonuclease that targets mismatch repair excision only binds clamped EcMutL, increasing its DNA association kinetics by more than 1,000-fold. The assembly of an EcMutS-EcMutL-EcMutH search complex illustrates how sequential stable sliding clamps can modulate one-dimensional diffusion mechanics along the DNA to direct mismatch repair.

  12. Formation of sheared G:A base pairs in an RNA duplex modelled after ribozymes, as revealed by NMR.

    PubMed Central

    Katahira, M; Kanagawa, M; Sato, H; Uesugi, S; Fujii, S; Kohno, T; Maeda, T

    1994-01-01

    The thermal stability and structure of an RNA duplex, r(GGACGAGUCC)2, the base sequence of which was modelled after both a hammerhead ribozyme and a lead ribozyme, were studied by CD and NMR. We previously demonstrated that the corresponding DNA duplex, d(GGACGAGTCC)2, formed unique 'sheared' G:A base pairs, where an amino proton, instead of an imino proton, of G is involved in the hydrogen bonding, and G and A bases are arranged 'side by side' instead of 'head to head' (Nucleic Acids Res. (1993) 21, 5418-5424). CD melting profiles showed that the RNA duplex is thermally more stable than the corresponding DNA duplex. NMR studies revealed that sheared G:A base pairs are formed in the RNA duplex, too, although the overall structure of the RNA is the A form, which differs from the B form taken on by the corresponding DNA. A model building study confirmed that sheared G:A base pairs can be accommodated in the double helical structure of the A form. A difference between the RNA and DNA duplexes in the stacking interaction involving G:A mismatch bases is also suggested. The demonstration that sheared G:A base pairs can be formed not only in DNA but also in RNA suggests that this base pairing plays an important role regarding the RNA structure. PMID:7519767

  13. Formation of sheared G:A base pairs in an RNA duplex modelled after ribozymes, as revealed by NMR.

    PubMed

    Katahira, M; Kanagawa, M; Sato, H; Uesugi, S; Fujii, S; Kohno, T; Maeda, T

    1994-07-25

    The thermal stability and structure of an RNA duplex, r(GGACGAGUCC)2, the base sequence of which was modelled after both a hammerhead ribozyme and a lead ribozyme, were studied by CD and NMR. We previously demonstrated that the corresponding DNA duplex, d(GGACGAGTCC)2, formed unique 'sheared' G:A base pairs, where an amino proton, instead of an imino proton, of G is involved in the hydrogen bonding, and G and A bases are arranged 'side by side' instead of 'head to head' (Nucleic Acids Res. (1993) 21, 5418-5424). CD melting profiles showed that the RNA duplex is thermally more stable than the corresponding DNA duplex. NMR studies revealed that sheared G:A base pairs are formed in the RNA duplex, too, although the overall structure of the RNA is the A form, which differs from the B form taken on by the corresponding DNA. A model building study confirmed that sheared G:A base pairs can be accommodated in the double helical structure of the A form. A difference between the RNA and DNA duplexes in the stacking interaction involving G:A mismatch bases is also suggested. The demonstration that sheared G:A base pairs can be formed not only in DNA but also in RNA suggests that this base pairing plays an important role regarding the RNA structure.

  14. High-resolution NMR studies of chimeric DNA-RNA-DNA duplexes, heteronomous base pairing, and continuous base stacking at junctions

    SciTech Connect

    Chou, Shanho Univ. of Washington, Seattle ); Flynn, P.; Wang, A.; Reid, B. )

    1991-05-28

    Two symmetrical DNA-RNA-DNA duplex chimeras, d(CGCG)r(AAUU)d(CGCG) (designated rAAUU) and d(CGCG)r(UAUA)d(CGCG) (designated rUAUA), and a nonsymmetrical chimeric duplex, d(CGTT)r(AUAA)d(TGCG)/d(CGCA)r(UUAU)d(AACG) (designated rAUAA), as well as their pure DNA analogues, containing dU instead of T, have been synthesized by solid-phase phosphoramidite methods and studied by high-resolution NMR techniques. The 1D imino proton NOE spectra of these d-r-d chimeras indicate normal Watson-Crick hydrogen bonding and base stacking at the junction region. Preliminary qualitative NOESY, COSY, and chemical shift data suggest that the internal RNA segment contains C3{prime}-endo (A-type) sugar conformations except for the first RNA residues (position 5 and 17) following the 3{prime} end of the DNA block, which, unlike the other six ribonucleotides, exhibit detectable H1{prime}-H2{prime} J coupling. The nucleosides of the two flanking DNA segments appear to adopt a fairly normal C2{prime}-endo B-DNA conformation except at the junction with the RNA blocks (residues 4 and 16), where the last DNA residue appears to adopt an intermediate sugar conformation. The data indicate that A-type and B-type conformations can coexist in a single short continuous nucleic acid duplex, but these results differ somewhat from previous theoretical model studies.

  15. A pyrimidopyrimidine Janus-AT nucleoside with improved base-pairing properties to both A and T within a DNA duplex: the stabilizing effect of a second endocyclic ring nitrogen.

    PubMed

    Largy, Eric; Liu, Wenbo; Hasan, Abid; Perrin, David M

    2014-02-03

    Janus bases are heterocyclic nucleic acid base analogs that present two different faces able to simultaneously hydrogen bond to nucleosides that form Watson-Crick base pairs. The synthesis of a Janus-AT nucleotide analogue, (N)JAT , that has an additional endocyclic ring nitrogen and is thus more capable of efficiently discriminating T/A over G/C bases when base-pairing in a standard duplex-DNA context is described. Conversion to a phosphoramidite ultimately afforded incorporation into an oligonucleotide. In contrast to the first generation of carbocyclic Janus heterocycles, it remains in its unprotonated state at physiological pH and, therefore, forms very stable Watson-Crick base pairs with either A or T bases. Biophysical and computational methods indicate that (N)JAT is an improved candidate for sequence-specific genome targeting.

  16. Femtomolar detection of single mismatches by discriminant analysis of DNA hybridization events using gold nanoparticles.

    PubMed

    Ma, Xingyi; Sim, Sang Jun

    2013-03-21

    Even though DNA-based nanosensors have been demonstrated for quantitative detection of analytes and diseases, hybridization events have never been numerically investigated for further understanding of DNA mediated interactions. Here, we developed a nanoscale platform with well-designed capture and detection gold nanoprobes to precisely evaluate the hybridization events. The capture gold nanoprobes were mono-laid on glass and the detection probes were fabricated via a novel competitive conjugation method. The two kinds of probes combined in a suitable orientation following the hybridization with the target. We found that hybridization efficiency was markedly dependent on electrostatic interactions between DNA strands, which can be tailored by adjusting the salt concentration of the incubation solution. Due to the much lower stability of the double helix formed by mismatches, the hybridization efficiencies of single mismatched (MMT) and perfectly matched DNA (PMT) were different. Therefore, we obtained an optimized salt concentration that allowed for discrimination of MMT from PMT without stringent control of temperature or pH. The results indicated this to be an ultrasensitive and precise nanosensor for the diagnosis of genetic diseases.

  17. Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

    DOEpatents

    McCutchen-Maloney, Sandra L.

    2002-01-01

    DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

  18. Solution structure of an oncogenic DNA duplex, the K-ras gene and the sequence containing a central C.A or A.G mismatch as a function of pH: nuclear magnetic resonance and molecular dynamics studies.

    PubMed

    Boulard, Y; Cognet, J A; Gabarro-Arpa, J; Le Bret, M; Carbonnaux, C; Fazakerley, G V

    1995-02-10

    The DNA duplex 5' d(GCCACCAGCTC)-d(GAGCTGGTGGC) corresponds to the sequence 29 to 39 of the K-ras gene, which contains a hot spot for mutations. This has been studied by one and two-dimensional nuclear magnetic resonance, energy minimization and molecular dynamics. The results show that it adopts a globally B-DNA type structure. We have introduced, at the central base-pair, the mismatches C.A and A.G. The mismatch position is that of the first base of the Gly12 codon, the hot spot. For the C.A mismatch we observe a structural change as a function of pH with an apparent pKa of 7.2. At low pH, the mismatch pair adopts a structure close to a classic wobble conformation with the cytidine residue displaced into the major groove. It is stabilised by two hydrogen bonds in which the adenosine residue is protonated and the cytidine residue has a significant C3'-endo population. At high pH, the mispair structure is in equilibrium between wobble and reverse wobble conformations. Similar studies are reported on the A.G mismatch, which also undergoes a transition as a function of pH. 31P spectra have been recorded on all systems and as a function of pH. No evidence for BII phosphodiester backbone conformations was found. The NMR results are well corroborated by molecular dynamics calculations performed with or without distance constraints. The dynamics at the mismatch sites have been examined. Although the overall structures are close to B-DNA, helical parameters fluctuate differently at these sites. Different hydrogen bonding alternatives in dynamic equilibrium that can involve three-centred hydrogen bonds are observed.

  19. Production of DNA minicircles less than 250 base pairs through a novel concentrated DNA circularization assay enabling minicircle design with NF-κB inhibition activity.

    PubMed

    Thibault, Thomas; Degrouard, Jeril; Baril, Patrick; Pichon, Chantal; Midoux, Patrick; Malinge, Jean-Marc

    2017-03-17

    Double-stranded DNA minicircles of less than 1000 bp in length have great interest in both fundamental research and therapeutic applications. Although minicircles have shown promising activity in gene therapy thanks to their good biostability and better intracellular trafficking, minicircles down to 250 bp in size have not yet been investigated from the test tube to the cell for lack of an efficient production method. Herein, we report a novel versatile plasmid-free method for the production of DNA minicircles comprising fewer than 250 bp. We designed a linear nicked DNA double-stranded oligonucleotide blunt-ended substrate for efficient minicircle production in a ligase-mediated and bending protein-assisted circularization reaction at high DNA concentration of 2 μM. This one pot multi-step reaction based-method yields hundreds of micrograms of minicircle with sequences of any base composition and position and containing or not a variety of site-specifically chemical modifications or physiological supercoiling. Biochemical and cellular studies were then conducted to design a 95 bp minicircle capable of binding in vitro two NF-κB transcription factors per minicircle and to efficiently inhibiting NF-κB-dependent transcriptional activity in human cells. Therefore, our production method could pave the way for the design of minicircles as new decoy nucleic acids. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Loss of DNA mismatch repair facilitates reactivation of a reporter plasmid damaged by cisplatin

    PubMed Central

    Cenni, B; Kim, H-K; Bubley, G J; Aebi, S; Fink, D; Teicher, B A; Howell, S B; Christen, R D

    1999-01-01

    In addition to recognizing and repairing mismatched bases in DNA, the mismatch repair (MMR) system also detects cisplatin DNA adducts and loss of MMR results in resistance to cisplatin. A comparison was made of the ability of MMR-proficient and -deficient cells to remove cisplatin adducts from their genome and to reactivate a transiently transfected plasmid that had previously been inactivated by cisplatin to express the firefly luciferase enzyme. MMR deficiency due to loss of hMLH1 function did not change the extent of platinum (Pt) accumulation or kinetics of removal from total cellular DNA. However, MMR-deficient cells, lacking either hMLH1 or hMSH2, generated twofold more luciferase activity from a cisplatin-damaged reporter plasmid than their MMR-proficient counterparts. Thus, detection of the cisplatin adducts by the MMR system reduced the efficiency of reactivation of the damaged luciferase gene compared to cells lacking this detector. The twofold reduction in reactivation efficiency was of the same order of magnitude as the difference in cisplatin sensitivity between the MMR-proficient and -deficient cells. We conclude that although MMR-proficient and -deficient cells remove Pt from their genome at equal rates, the loss of a functional MMR system facilitates the reactivation of a cisplatin-damaged reporter gene. © 1999 Cancer Research Campaign PMID:10360646

  1. Loss of DNA mismatch repair function and cancer predisposition in the mouse: animal models for human hereditary nonpolyposis colorectal cancer.

    PubMed

    Edelmann, Lisa; Edelmann, Winfried

    2004-08-15

    Germline mutations in DNA mismatch repair genes underlie one of the most common hereditary cancer predisposition syndromes known in humans, hereditary nonpolyposis colorectal cancer (HNPCC). Defects of the DNA mismatch repair system are also prevalent in sporadic colorectal cancers. The generation of mice with targeted inactivating mutations in the mismatch repair genes has facilitated the in vivo study of how these genes function and how their individual loss contributes to tumorigenesis. Although there are notable limitations when using murine models to study the molecular basis of human cancer, there is remarkable similarity between the two species with respect to the contribution of individual members of the mismatch repair system to cancer susceptibility, and mouse mutants have greatly enhanced our understanding of the normal role of these genes in mutation avoidance and suppression of tumorigenesis.

  2. DNA mismatch repair proteins are required for efficient herpes simplex virus 1 replication.

    PubMed

    Mohni, Kareem N; Mastrocola, Adam S; Bai, Ping; Weller, Sandra K; Heinen, Christopher D

    2011-12-01

    Herpes simplex virus 1 (HSV-1) is a double-stranded DNA virus that replicates in the nucleus of its human host cell and is known to interact with many cellular DNA repair proteins. In this study, we examined the role of cellular mismatch repair (MMR) proteins in the virus life cycle. Both MSH2 and MLH1 are required for efficient replication of HSV-1 in normal human cells and are localized to viral replication compartments. In addition, a previously reported interaction between MSH6 and ICP8 was confirmed by coimmunoprecipitation and extended to show that UL12 is also present in this complex. We also report for the first time that MLH1 associates with ND10 nuclear bodies and that like other ND10 proteins, MLH1 is recruited to the incoming genome. Knockdown of MLH1 inhibits immediate-early viral gene expression. MSH2, on the other hand, which is generally thought to play a role in mismatch repair at a step prior to that of MLH1, is not recruited to incoming genomes and appears to act at a later step in the viral life cycle. Silencing of MSH2 appears to inhibit early gene expression. Thus, both MLH1 and MSH2 are required but appear to participate in distinct events in the virus life cycle. The observation that MLH1 plays an earlier role in HSV-1 infection than does MSH2 is surprising and may indicate a novel function for MLH1 distinct from its known MSH2-dependent role in mismatch repair.

  3. DNA Mismatch Repair System: Repercussions in Cellular Homeostasis and Relationship with Aging

    PubMed Central

    Conde-Pérezprina, Juan Cristóbal; León-Galván, Miguel Ángel; Konigsberg, Mina

    2012-01-01

    The mechanisms that concern DNA repair have been studied in the last years due to their consequences in cellular homeostasis. The diverse and damaging stimuli that affect DNA integrity, such as changes in the genetic sequence and modifications in gene expression, can disrupt the steady state of the cell and have serious repercussions to pathways that regulate apoptosis, senescence, and cancer. These altered pathways not only modify cellular and organism longevity, but quality of life (“health-span”). The DNA mismatch repair system (MMR) is highly conserved between species; its role is paramount in the preservation of DNA integrity, placing it as a necessary focal point in the study of pathways that prolong lifespan, aging, and disease. Here, we review different insights concerning the malfunction or absence of the DNA-MMR and its impact on cellular homeostasis. In particular, we will focus on DNA-MMR mechanisms regulated by known repair proteins MSH2, MSH6, PMS2, and MHL1, among others. PMID:23213348

  4. Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

    PubMed

    Yang, Haozhe; Mei, Hui; Seela, Frank

    2015-07-06

    Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair.

  5. Evidence that the DNA mismatch repair system removes 1-nucleotide Okazaki fragment flaps.

    PubMed

    Kadyrova, Lyudmila Y; Dahal, Basanta K; Kadyrov, Farid A

    2015-10-02

    The DNA mismatch repair (MMR) system plays a major role in promoting genome stability and suppressing carcinogenesis. In this work, we investigated whether the MMR system is involved in Okazaki fragment maturation. We found that in the yeast Saccharomyces cerevisiae, the MMR system and the flap endonuclease Rad27 act in overlapping pathways that protect the nuclear genome from 1-bp insertions. In addition, we determined that purified yeast and human MutSα proteins recognize 1-nucleotide DNA and RNA flaps. In reconstituted human systems, MutSα, proliferating cell nuclear antigen, and replication factor C activate MutLα endonuclease to remove the flaps. ATPase and endonuclease mutants of MutLα are defective in the flap removal. These results suggest that the MMR system contributes to the removal of 1-nucleotide Okazaki fragment flaps.

  6. Differential DNA mismatch repair underlies mutation rate variation across the human genome.

    PubMed

    Supek, Fran; Lehner, Ben

    2015-05-07

    Cancer genome sequencing has revealed considerable variation in somatic mutation rates across the human genome, with mutation rates elevated in heterochromatic late replicating regions and reduced in early replicating euchromatin. Multiple mechanisms have been suggested to underlie this, but the actual cause is unknown. Here we identify variable DNA mismatch repair (MMR) as the basis of this variation. Analysing ∼17 million single-nucleotide variants from the genomes of 652 tumours, we show that regional autosomal mutation rates at megabase resolution are largely stable across cancer types, with differences related to changes in replication timing and gene expression. However, mutations arising after the inactivation of MMR are no longer enriched in late replicating heterochromatin relative to early replicating euchromatin. Thus, differential DNA repair and not differential mutation supply is the primary cause of the large-scale regional mutation rate variation across the human genome.

  7. Interaction between Mismatch Repair and Genetic Recombination in Saccharomyces Cerevisiae

    PubMed Central

    Alani, E.; Reenan, RAG.; Kolodner, R. D.

    1994-01-01

    The yeast Saccharomyces cerevisiae encodes a set of genes that show strong amino acid sequence similarity to MutS and MutL, proteins required for mismatch repair in Escherichia coli. We examined the role of MSH2 and PMS1, yeast homologs of mutS and mutL, respectively, in the repair of base pair mismatches formed during meiotic recombination. By using specifically marked HIS4 and ARG4 alleles, we showed that msh2 mutants displayed a severe defect in the repair of all base pair mismatches as well as 1-, 2- and 4-bp insertion/deletion mispairs. The msh2 and pms1 phenotypes were indistinguishable, suggesting that the wild-type gene products act in the same repair pathway. A comparison of gene conversion events in wild-type and msh2 mutants indicated that mismatch repair plays an important role in genetic recombination. (1) Tetrad analysis at five different loci revealed that, in msh2 mutants, the majority of aberrant segregants displayed a sectored phenotype, consistent with a failure to repair mismatches created during heteroduplex formation. In wild type, base pair mismatches were almost exclusively repaired toward conversion rather than restoration. (2) In msh2 strains 10-19% of the aberrant tetrads were Ab4:4. (3) Polarity gradients at HIS4 and ARG4 were nearly abolished in msh2 mutants. The frequency of gene conversion at the 3' end of these genes was increased and was nearly the frequency observed at the 5' end. (4) Co-conversion studies were consistent with mismatch repair acting to regulate heteroduplex DNA tract length. We favor a model proposing that recombination events occur through the formation and resolution of heteroduplex intermediates and that mismatch repair proteins specifically interact with recombination enzymes to regulate the length of symmetric heteroduplex DNA. PMID:8056309

  8. Comprehensive evaluation of medium and long range correlated density functionals in TD-DFT investigation of DNA bases and base pairs: gas phase and water solution study

    NASA Astrophysics Data System (ADS)

    Shukla, Manoj K.; Leszczynski, Jerzy

    2010-11-01

    A comprehensive analysis of the performance of the TD-DFT method using different density functionals including recently developed medium and long-range correlation corrected density functionals have been carried out for lower-lying electronic singlet valence transitions of nucleic acid bases and the Watson-Crick base pairs in the gas phase and in the water solution. The standard 6-311++G(d,p) basis set was used. Ground state geometries of bases and base pairs were optimized at the M05-2X/6-311++G(d,p) level. The nature of potential energy surfaces (PES) was ascertained through the harmonic vibrational frequency analysis; all geometries were found to be minima at the respective PES. Electronic singlet vertical transition energies were also computed at the CC2/def2-TZVP level in the gas phase. The effect of state-specific water solvation on TD-DFT computed transition energies was considered using the PCM model. For the isolated bases the performance of the B3LYP functional was generally found to be superior among all functionals, but it measurably fails for charge-transfer states in the base pairs. The CC2/def2-TZVP computed transition energies were also revealed to be inferior compared with B3LYP results for the isolated bases. The performance of the ωB97XD, CAM-B3LYP and BMK functionals were found to be similar and comparable with the CC2 results for the isolated bases. However, for the Watson-Crick adenine-thymine and guanine-cytosine base pairs the performance of the ωB97XD functional was found to be the best among all the studied functionals in the present work in predicting the locally excited transitions as well as charge transfer states.

  9. Loss of DNA mismatch repair imparts a selective advantage in planarian adult stem cells.

    PubMed

    Hollenbach, Jessica P; Resch, Alissa M; Palakodeti, Dasaradhi; Graveley, Brenton R; Heinen, Christopher D

    2011-01-01

    Lynch syndrome (LS) leads to an increased risk of early-onset colorectal and other types of cancer and is caused by germline mutations in DNA mismatch repair (MMR) genes. Loss of MMR function results in a mutator phenotype that likely underlies its role in tumorigenesis. However, loss of MMR also results in the elimination of a DNA damage-induced checkpoint/apoptosis activation barrier that may allow damaged cells to grow unchecked. A fundamental question is whether loss of MMR provides pre-cancerous stem cells an immediate selective advantage in addition to establishing a mutator phenotype. To test this hypothesis in an in vivo system, we utilized the planarian Schmidtea mediterranea which contains a significant population of identifiable adult stem cells. We identified a planarian homolog of human MSH2, a MMR gene which is mutated in 38% of LS cases. The planarian Smed-msh2 is expressed in stem cells and some progeny. We depleted Smed-msh2 mRNA levels by RNA-interference and found a striking survival advantage in these animals treated with a cytotoxic DNA alkylating agent compared to control animals. We demonstrated that this tolerance to DNA damage is due to the survival of mitotically active, MMR-deficient stem cells. Our results suggest that loss of MMR provides an in vivo survival advantage to the stem cell population in the presence of DNA damage that may have implications for tumorigenesis.

  10. Loss of DNA Mismatch Repair Imparts a Selective Advantage in Planarian Adult Stem Cells

    PubMed Central

    Hollenbach, Jessica P.; Resch, Alissa M.; Palakodeti, Dasaradhi; Graveley, Brenton R.; Heinen, Christopher D.

    2011-01-01

    Lynch syndrome (LS) leads to an increased risk of early-onset colorectal and other types of cancer and is caused by germline mutations in DNA mismatch repair (MMR) genes. Loss of MMR function results in a mutator phenotype that likely underlies its role in tumorigenesis. However, loss of MMR also results in the elimination of a DNA damage-induced checkpoint/apoptosis activation barrier that may allow damaged cells to grow unchecked. A fundamental question is whether loss of MMR provides pre-cancerous stem cells an immediate selective advantage in addition to establishing a mutator phenotype. To test this hypothesis in an in vivo system, we utilized the planarian Schmidtea mediterranea which contains a significant population of identifiable adult stem cells. We identified a planarian homolog of human MSH2, a MMR gene which is mutated in 38% of LS cases. The planarian Smed-msh2 is expressed in stem cells and some progeny. We depleted Smed-msh2 mRNA levels by RNA-interference and found a striking survival advantage in these animals treated with a cytotoxic DNA alkylating agent compared to control animals. We demonstrated that this tolerance to DNA damage is due to the survival of mitotically active, MMR-deficient stem cells. Our results suggest that loss of MMR provides an in vivo survival advantage to the stem cell population in the presence of DNA damage that may have implications for tumorigenesis. PMID:21747960

  11. Effect of bis(beta-chloroethyl)sulfide (BCES) on base mismatch repair of DNA in monkey kidney cells.

    PubMed

    Fan, L J; Bernstein, I A

    1991-11-01

    Sulfur mustard, bis(beta-chloroethyl)sulfide (BCES), a bifunctional alkylating agent, is a vesicant whose mode of action involves interference with the integrity of cellular DNA. Alkylation of DNA is responsible for some of the biological effects of BCES in tissue. Another possible mechanism by which BCES could exert its toxic effect is interference with high fidelity repair of damaged DNA. This study evaluated the possible effects of BCES on the repair of specific errors, i.e., mismatched bases, in the DNA. Heteroduplex (ht) DNA, formed between two temperature-sensitive mutants of SV40 virus, tsA239 and tsA255, each having a different point mutation in the gene for large T antigen, was used to study the effect of BCES on mismatched base repair in African green monkey kidney (AGMK) cells. AGMK cells were exposed to dilute solutions of BCES in methylene chloride (MC) prior to cationic lipofection with ht DNA. In order for the cells to produce wild type (wt) SV40 DNA at a nonpermissive temperature (41 degrees C), repair of at least one of the two mismatches in the DNA had to occur. It was observed that (a) as the concentration of BCES was increased, a proportionally longer delay in the appearance of wt DNA at 41 degrees C was observed in treated cells transfected with ht DNA as compared with cultures exposed to MC alone and then transfected with ht DNA, (b) there was no such effect in exposed AGMK cells transfected with wt DNA, (c) wt and ht DNA were transfected at similar rates in unexposed cells, and (d) BCES did not affect the rate of transfection of wt cells. These observations are consistent with the hypothesis that BCES affects mismatched base repair.

  12. Why the tautomerization of the G·C Watson-Crick base pair via the DPT does not cause point mutations during DNA replication? QM and QTAIM comprehensive analysis.

    PubMed

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    by the weakening of the lower H-bond. At that point, the upper N4H⋯O6 and O6H⋯N4 H-bonds in the G·C and G*·C* base pairs, respectively, remain constant at the changes of the middle and the lower H-bonds at the beginning and at the ending of the G·C ↔ G*·C* tautomerization. Aiming to answer the question posed in the title of the article, we established that the G*·C* Löwdin's base pair satisfies all the requirements necessary to cause point mutations in DNA except its lifetime, which is much less than the period of time required for the replication machinery to forcibly dissociate a base pair into the monomers (several ns) during DNA replication. So, from the physicochemical point of view, the G*·C* Löwdin's base pair cannot be considered as a source of point mutations arising during DNA replication.

  13. Effects of suppressing the DNA mismatch repair system on homeologous recombination in tomato.

    PubMed

    Tam, Sheh May; Hays, John B; Chetelat, Roger T

    2011-12-01

    In plant breeding, the ability to manipulate genetic (meiotic) recombination would be beneficial for facilitating gene transfer from wild relatives of crop plants. The DNA mismatch repair (MMR) system helps maintain genetic integrity by correcting base mismatches that arise via DNA synthesis or damage, and antagonizes recombination between homeologous (divergent) DNA sequences. Previous studies have established that the genomes of cultivated tomato (Solanum lycopersicum) and the wild relative S. lycopersicoides are substantially diverged (homeologous) such that recombination between their chromosomes is strongly reduced. Here, we report the effects on homeologous recombination of suppressing endogenous MMR genes in S. lycopersicum via RNAi-induced silencing of SlMSH2 and SlMSH7 or overexpressing dominant negatives of Arabidopsis MSH2 (AtMSH2-DN) in an alien substitution line (SL-8) of S. lycopersicoides in tomato. We show that certain inhibitions of MMR (RNAi of SlMSH7, AtMSH2-DN) are associated with modest increases in homeologous recombination, ranging from 3.8 to 29.2% (average rate of 17.8%) compared to controls. Unexpectedly, only the AtMSH2-DN proteins but not RNAi-induced silencing of MSH2 was found to increase homeologous recombination. The ratio of single to double crossovers (SCO:DCO ratio) decreased by approximately 50% in progeny of the AtMSH2-DN parents. An increase in the frequency of heterozygous SL-8 plants was also observed in the progeny of the SlMSH7-RNAi parents. Our findings may contribute to acceleration of introgression in cultivated tomato.

  14. Single-mismatch position-sensitive detection of DNA based on a bifunctional ruthenium complex.

    PubMed

    García, T; Revenga-Parra, M; Abruña, H D; Pariente, F; Lorenzo, E

    2008-01-01

    A ruthenium complex, pentaamine ruthenium [3-(2-phenanthren-9-yl-vinyl)-pyridine] (which we refer to as RuL in the text) generated in situ has been used as a sensitive and selective electrochemical indicator in DNA sensing. The complex incorporates dual functionalities with the Ru center providing a redox probe and the ligand (L) providing a fluorescent tag. The presence of the aromatic groups in the ligand endows the complex with an intercalative character and makes it capable of binding to double-stranded DNA (dsDNA) more efficiently than to single-stranded DNA (ssDNA). Combining spectroscopic and electrochemical techniques, we have elucidated the nature of the interactions. From these data we conclude that the binding mode is fundamentally intercalative. The ligand-based fluorescence allows characterization of the complex formation as well as for melting experiments to be carried out. The metal-based redox center is employed as an electrochemical indicator to detect the hybridization event in a DNA biosensor. The biosensor has been developed by immobilization of a thiolated capture probe sequence from Helicobacter pylori onto gold electrodes. With the use of this approach, complementary target sequences of Helicobacter can be quantified over the range of 106 to 708 pmol with a detection limit of 92+/-0.4 pmol and a linear correlation coefficient of 0.995. In addition, this approach allows the detection, without the need for a hybridization suppressor in solution, such as formamide, of not only a single mismatch but also its position in a specific sequence of H. pylori, due to the selective interaction of this bifunctional ruthenium complex with dsDNA.

  15. Introduction of specific point mutations into RNA polymerase II by gene targeting in mouse embryonic stem cells: evidence for a DNA mismatch repair mechanism.

    PubMed Central

    Steeg, C M; Ellis, J; Bernstein, A

    1990-01-01

    We have introduced two specific point mutations, located 20 base pairs apart, into the endogenous murine gene that encodes the largest subunit of RNA polymerase II (RPII215). The first mutation conferred resistance to the mushroom toxin alpha-amanitin (amar), and the second mutation generated a restriction fragment length polymorphism without altering the protein sequence. Targeted amar clones were generated at a frequency of 1 in 30 totipotent embryonic stem cells that expressed stably integrated DNA vectors after electroporation. Thirty to 40% of these clones had acquired both mutations, whereas, surprisingly, the remaining clones had acquired the specific amar point mutation but lacked the restriction fragment length polymorphism. We suggest that the latter clones were generated by independent DNA mismatch repair rather than by double crossover or gene conversion. These results demonstrate that it is possible to introduce specific point mutations into an endogenous gene in embryonic stem cells. Thus it should be possible to introduce single base substitutions into other cellular genes, including nonselectable genes, by optimizing the efficiency of gene transfer and/or the sensitivity of screening for targeted clones. Images PMID:1972278

  16. The impact of sequence divergence and DNA mismatch repair on homeologous recombination in Arabidopsis.

    PubMed

    Li, Liangliang; Jean, Martine; Belzile, François

    2006-03-01

    We examined the effects of substrate divergence and DNA mismatch repair (MMR) on recombination in Arabidopsis thaliana. Relative to the frequency observed in plants with a homologous construct (0% divergence), recombination was decreased 4.1-, 9.6-, 11.7- or 20.3-fold, respectively, in lines with constructs containing 0.5%, 2%, 4% or 9% divergence between the recombination substrates. To evaluate the contribution of the MMR system in this decrease, 12 independent reporter lines (two or three lines per reporter construct) were crossed to an AtMSH2 T-DNA insertional mutant. We examined the recombination frequency in progeny homozygous for a reporter T-DNA and homozygous either for the wild type or the mutant allele of AtMSH2. The loss of MMR activity led to a two- to ninefold increase in homeologous recombination and the size of the increase did not seem to correlate with the amount of divergence. Inversely, complementation of the insertional mutant with a wild-type cDNA of AtMSH2 reduced recombination. Our results demonstrate clearly that sequence divergence can dramatically reduce the recombination frequency in plants and that the MMR system plays a part in this decrease.

  17. Silver(I)-mediated Hoogsteen-type base pairs.

    PubMed

    Megger, Dominik A; Fonseca Guerra, Célia; Bickelhaupt, F Matthias; Müller, Jens

    2011-11-01

    Metal-mediated Hoogsteen-type base pairs are useful for the construction of DNA duplexes containing contiguous stretches of metal ions along the helical axis. To fine-tune the stability of such base pairs and the selectivity toward different metal ions, the availability of a selection of artificial nucleobases is highly desirable. In this study, we follow a theoretical approach utilizing dispersion-corrected density functional methods to evaluate a variety of artificial nucleobases as candidates for metal-mediated Hoogsteen-type base pairs. We focus on silver(I)-mediated Hoogsteen- and reverse Hoogsteen-type base pairs formed between 1-deaza- and 1,3-dideazapurine-derived nucleobases, respectively, and cytosine. Apart from two coordinative bonds, these base pairs are stabilized by a hydrogen bond. We elucidate the impact of different substituents at the C6 position and the presence or absence of an endocyclic N3 nitrogen atom on the overall stability of a base pair and concomitantly on the strength of the hydrogen and coordinative bonds. All artificial base pairs investigated in this study are less stable than the experimentally established benchmark base pair C-Ag(+)-G. The base pair formed from 1,3-dideaza-6-methoxypurine is isoenergetic to the experimentally observed C-Ag(+)-C base pair. This makes 1,3-dideaza-6-methoxypurine a promising candidate for the use as an artificial nucleobase in DNA.

  18. Slow conformational changes in MutS and DNA direct ordered transitions between mismatch search, recognition and signaling of DNA repair.

    PubMed

    Sharma, Anushi; Doucette, Christopher; Biro, F Noah; Hingorani, Manju M

    2013-11-15

    MutS functions in mismatch repair (MMR) to scan DNA for errors, identify a target site and trigger subsequent events in the pathway leading to error removal and DNA re-synthesis. These actions, enabled by the ATPase activity of MutS, are now beginning to be analyzed from the perspective of the protein itself. This study provides the first ensemble transient kinetic data on MutS conformational dynamics as it works with DNA and ATP in MMR. Using a combination of fluorescence probes (on Thermus aquaticus MutS and DNA) and signals (intensity, anisotropy and resonance energy transfer), we have monitored the timing of key conformational changes in MutS that are coupled to mismatch binding and recognition, ATP binding and hydrolysis, as well as sliding clamp formation and signaling of repair. Significant findings include (a) a slow step that follows weak initial interaction between MutS and DNA, in which concerted conformational changes in both macromolecules control mismatch recognition, and (b) rapid, binary switching of MutS conformations that is concerted with ATP binding and hydrolysis and (c) is stalled after mismatch recognition to control formation of the ATP-bound MutS sliding clamp. These rate-limiting pre- and post-mismatch recognition events outline the mechanism of action of MutS on DNA during initiation of MMR.

  19. Does the G.G*syn DNA mismatch containing canonical and rare tautomers of the guanine tautomerise through the DPT? A QM/QTAIM microstructural study

    NASA Astrophysics Data System (ADS)

    Brovarets', Ol'ha O.; Hovorun, Dmytro M.

    2014-12-01

    We have established that the asynchronous concerted double proton transfer (DPT), moving with a time gap and without stable intermediates, is the underlying mechanism for the tautomerisation of the G.G*syn DNA base mispair (C1 symmetry), formed by the keto and enol tautomers of the guanine in the anti- and syn-configurations, into the G*.G*syn base mispair (C1), formed by the enol and imino tautomers of the G base, using quantum-mechanical calculations and Bader's quantum theory of atoms in molecules. By constructing the sweeps of the geometric, electron-topological, energetic, polar and natural bond orbital properties along the intrinsic reaction coordinate of the G.G*syn↔G*.G*syn DPT tautomerisation, the nine key points, that are critical for the atomistic understanding of the tautomerisation reaction, were set and comprehensively analysed. It was found that the G.G*syn mismatch possesses pairing scheme with the formation of the O6...HO6 (7.01) and N1H...N7 (6.77) H-bonds, whereas the G*.G*syn mismatch - of the O6H...O6 (10.68) and N1...HN7 (9.59 kcal mol-1) H-bonds. Our results highlight that these H-bonds are significantly cooperative and mutually reinforce each other in both mismatches. The deformation energy necessary to apply for the G.G*syn base mispair to acquire the Watson-Crick sizes has been calculated. We have shown that the thermodynamically stable G*.G*syn base mispair is dynamically unstable structure with a lifetime of 4.1 × 10-15 s and any of its six low-lying intermolecular vibrations can develop during this period of time. These data exclude the possibility to change the tautomeric status of the bases under the dissociation of the G.G*syn mispair into the monomers during DNA replication. Finally, it has been made an attempt to draw from the physico-chemical properties of all four incorrect purine-purine DNA base pairs a general conclusion, which claims the role of the transversions in spontaneous point mutagenesis.

  20. Base-Pairing Energies of Proton-Bound Dimers and Proton Affinities of 1-Methyl-5-Halocytosines: Implications for the Effects of Halogenation on the Stability of the DNA i-Motif

    NASA Astrophysics Data System (ADS)

    Yang, Bo; Wu, R. R.; Rodgers, M. T.

    2015-09-01

    (CCG)n•(CGG)n trinucleotide repeats have been found to be associated with fragile X syndrome, the most widespread inherited cause of mental retardation in humans. The (CCG)n•(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of noncanonical proton-bound dimers of cytosine (C+•C). Halogenated cytosine residues are one form of DNA damage that may be important in altering the structure and stability of DNA or DNA-protein interactions and, hence, regulate gene expression. Previously, we investigated the effects of 5-halogenation and 1-methylation of cytosine on the base-pairing energies (BPEs) using threshold collision-induced dissociation (TCID) techniques. In the present study, we extend our work to include proton-bound homo- and heterodimers of cytosine, 1-methyl-5-fluorocytosine, and 1-methyl-5-bromocytosine. All modifications examined here are found to produce a decrease in the BPEs. However, the BPEs of all of the proton-bound dimers examined significantly exceed those of Watson-Crick G•C, neutral C•C base pairs, and various methylated variants such that DNA i-motif conformations should still be preserved in the presence of these modifications. The proton affinities (PAs) of the halogenated cytosines are also obtained from the experimental data by competitive analysis of the primary dissociation pathways that occur in parallel for the proton-bound heterodimers. 5-Halogenation leads to a decrease in the N3 PA of cytosine, whereas 1-methylation leads to an increase in the N3 PA. Thus, the 1-methyl-5-halocytosines exhibit PAs that are intermediate.

  1. Base-Pairing Energies of Proton-Bound Dimers and Proton Affinities of 1-Methyl-5-Halocytosines: Implications for the Effects of Halogenation on the Stability of the DNA i-Motif.

    PubMed

    Yang, Bo; Wu, R R; Rodgers, M T

    2015-09-01

    (CCG)(n)•(CGG)(n) trinucleotide repeats have been found to be associated with fragile X syndrome, the most widespread inherited cause of mental retardation in humans. The (CCG)(n)•(CGG)(n) repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of noncanonical proton-bound dimers of cytosine (C(+)•C). Halogenated cytosine residues are one form of DNA damage that may be important in altering the structure and stability of DNA or DNA-protein interactions and, hence, regulate gene expression. Previously, we investigated the effects of 5-halogenation and 1-methylation of cytosine on the base-pairing energies (BPEs) using threshold collision-induced dissociation (TCID) techniques. In the present study, we extend our work to include proton-bound homo- and heterodimers of cytosine, 1-methyl-5-fluorocytosine, and 1-methyl-5-bromocytosine. All modifications examined here are found to produce a decrease in the BPEs. However, the BPEs of all of the proton-bound dimers examined significantly exceed those of Watson-Crick G•C, neutral C•C base pairs, and various methylated variants such that DNA i-motif conformations should still be preserved in the presence of these modifications. The proton affinities (PAs) of the halogenated cytosines are also obtained from the experimental data by competitive analysis of the primary dissociation pathways that occur in parallel for the proton-bound heterodimers. 5-Halogenation leads to a decrease in the N3 PA of cytosine, whereas 1-methylation leads to an increase in the N3 PA. Thus, the 1-methyl-5-halocytosines exhibit PAs that are intermediate.

  2. Mitochondrial dysfunction and increased sensitivity to excitotoxicity in mice deficient in DNA mismatch repair.

    PubMed

    Francisconi, Simona; Codenotti, Mara; Ferrari Toninelli, Giulia; Uberti, Daniela; Memo, Maurizio

    2006-07-01

    The expression profile in the hippocampus of mice lacking one allele of the MutS homologue (Msh2), gene, which is one of the most representative components of the DNA mismatch repair system, was analysed to understand whether defects in the repair or in response to DNA damage could impact significantly on brain function. The overall results suggested a reduction in mitochondrial function as indicated by gene expression analysis, biochemical and behavioural studies. In the hippocampus of Msh2+/- mice, array data, validated by RT-PCR and western blot analysis, showed reduced expression levels of genes for cytochrome c oxidase subunit 2 (CoxII), ATP synthase subunit beta and superoxide dismutase 1. Biochemically, mitochondria from the hippocampus and cortex of these mice show reduced CoxII and increased aconitase activity. Behaviourally, these alterations resulted in mice with increased vulnerability to kainic acid-induced epileptic seizures and hippocampal neuronal loss. These data suggest that lack of an efficient system involved in recognizing and repairing DNA damage may generate a brain mitochondriopathy.

  3. Faster, safer, and better DNA purification by ultracentrifugation using GelRed stain and development of mismatch oligo DNA for genome walking.

    PubMed

    Kasajima, Ichiro; Ohtsubo, Norihiro; Sasaki, Katsutomo

    2014-01-01

    Purification of plant DNA involves lengthy ultracentrifugation using ethidium bromide. Here, ultracentrifugation method is improved by staining with GelRed. The resulting method is faster, safer and of higher sensitivity. Purified DNA quality was confirmed by treatment with restriction enzymes and isolation of gene promoters. New type of long adaptor with mismatch sequence was also developed for promoter isolation.

  4. The MutSα-Proliferating Cell Nuclear Antigen Interaction in Human DNA Mismatch Repair*S⃞♦

    PubMed Central

    Iyer, Ravi R.; Pohlhaus, Timothy J.; Chen, Sihong; Hura, Gregory L.; Dzantiev, Leonid; Beese, Lorena S.; Modrich, Paul

    2008-01-01

    We have examined the interaction parameters, conformation, and functional significance of the human MutSα· proliferating cell nuclear antigen (PCNA) complex in mismatch repair. The two proteins associate with a 1:1 stoichiometry and a KD of 0.7 μm in the absence or presence of heteroduplex DNA. PCNA does not influence the affinity of MutSα for a mismatch, and mismatch-bound MutSα binds PCNA. Small angle x-ray scattering studies have established the molecular parameters of the complex, which are consistent with an elongated conformation in which the two proteins associate in an end-to-end fashion in a manner that does not involve an extended unstructured tether, as has been proposed for yeast MutSα and PCNA (Shell, S. S., Putnam, C. D., and Kolodner, R. D. (2007) Mol. Cell26 ,565 -57817531814). MutSα variants lacking the PCNA interaction motif are functional in 3′- or 5′-directed mismatch-provoked excision, but display a partial defect in 5′-directed mismatch repair. This finding is consistent with the modest mutability conferred by inactivation of the MutSα PCNA interaction motif and suggests that interaction of the replication clamp with other repair protein(s) accounts for the essential role of PCNA in MutSα-dependent mismatch repair. PMID:18326858

  5. Helicobacter pylori infection modulates the expression of miRNAs associated with DNA mismatch repair pathway.

    PubMed

    Santos, Juliana C; Brianti, Mitsue T; Almeida, Victor R; Ortega, Manoela M; Fischer, Wolfgang; Haas, Rainer; Matheu, Ander; Ribeiro, Marcelo L

    2017-04-01

    Genetic and epigenetic inactivation of DNA mismatch repair (MMR) genes might lead to modifications in cancer-related gene expression and cancer development. Recently, it has been shown that the infection by Helicobacter pylori, the major causative agent of gastric cancer, induces DNA damage and inhibits MMR DNA repair. Also, it has been reported that microRNAs (miRs) have an important role in regulating genomic stability and MMR DNA repair. Thus, the aim of this study was to identify miRs regulating MMR pathway in H. pylori-associated gastric carcinogenesis. To address this question, a gastric epithelial cell line and AGS cancer gastric cells were infected with several H. pylori strains. MMR gene expression and miRs correlating with H. pylori strain infection were evaluated. The results showed that H. pylori infection significantly down-regulated the expression of all selected MMR genes. Also, H. pylori infection modulated the expression of several miRs (including miR-150-5p, miR-155-5p, and miR-3163), after 4, 8, and 12 h of infection. Computational prediction of candidate miRs and their predicted MMR targeting sites were obtained from TargetScan, mirDB, and MetaCore. The generated data indicated that the selected miRs (miR-150-5p, miR-155-5p, and miR-3163) could possibly target and modulate MMR genes (POLD3, MSH2, and MSH3, respectively). The target validation was performed using mimics and luciferase gene reporter assays. Briefly, this study shows that H. pylori impairs MMR DNA repair pathway and identifies miRs that regulate MMR gene expression in gastric cancer. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  6. An Optimized Pentaplex PCR for Detecting DNA Mismatch Repair-Deficient Colorectal Cancers

    PubMed Central

    Hamelin, Richard; Boland, C. Richard

    2010-01-01

    Purpose Microsatellite instability (MSI) is used to screen colorectal cancers (CRC) for Lynch Syndrome, and to predict outcome and response to treatment. The current technique for measuring MSI requires DNA from normal and neoplastic tissues, and fails to identify tumors with specific DNA mismatch repair (MMR) defects. We tested a panel of five quasi-monomorphic mononucleotide repeat markers amplified in a single multiplex PCR reaction (pentaplex PCR) to detect MSI. Experimental Design We investigated a cohort of 213 CRC patients, comprised of 114 MMR-deficient and 99 MMR-proficient tumors. Immunohistochemical (IHC) analysis evaluated the expression of MLH1, MSH2, PMS2 and MSH6. MSI status was defined by differences in the quasi-monomorphic variation range (QMVR) from a pool of normal DNA samples, and measuring differences in allele lengths in tumor DNA. Results Amplification of 426 normal alleles allowed optimization of the QMVR at each marker, and eliminated the requirement for matched reference DNA to define MSI in each sample. Using ≥2/5 unstable markers as the criteria for MSI resulted in a sensitivity of 95.6% (95% CI = 90.1–98.1%) and a positive predictive value of 100% (95% CI = 96.6%–100%). Detection of MSH6-deficiency was limited using all techniques. Data analysis with a three-marker panel (BAT26, NR21 and NR27) was comparable in sensitivity (97.4%) and positive predictive value (96.5%) to the five marker panel. Both approaches were superior to the standard approach to measuring MSI. Conclusions An optimized pentaplex (or triplex) PCR offers a facile, robust, very inexpensive, highly sensitive, and specific assay for the identification of MSI in CRC. PMID:20195377

  7. Quantifying the contributions of base selectivity, proofreading and mismatch repair to nuclear DNA replication in Saccharomyces cerevisiae.

    PubMed

    St Charles, Jordan A; Liberti, Sascha E; Williams, Jessica S; Lujan, Scott A; Kunkel, Thomas A

    2015-07-01

    Mismatches generated during eukaryotic nuclear DNA replication are removed by two evolutionarily conserved error correction mechanisms acting in series, proofreading and mismatch repair (MMR). Defects in both processes are associated with increased susceptibility to cancer. To better understand these processes, we have quantified base selectivity, proofreading and MMR during nuclear DNA replication in Saccharomyces cerevisiae. In the absence of proofreading and MMR, the primary leading and lagging strand replicases, polymerase ɛ and polymerase δ respectively, synthesize DNA in vivo with somewhat different error rates and specificity, and with apparent base selectivity that is more than 100 times higher than measured in vitro. Moreover, leading and lagging strand replication fidelity rely on a different balance between proofreading and MMR. On average, proofreading contributes more to replication fidelity than does MMR, but their relative contributions vary from nearly all proofreading of some mismatches to mostly MMR of other mismatches. Thus accurate replication of the two DNA strands results from a non-uniform and variable balance between error prevention, proofreading and MMR.

  8. Spontaneous frameshift mutations in Saccharomyces cerevisiae: accumulation during DNA replication and removal by proofreading and mismatch repair activities.

    PubMed Central

    Greene, C N; Jinks-Robertson, S

    2001-01-01

    The accumulation of frameshift mutations during DNA synthesis is determined by the rate at which frameshift intermediates are generated during DNA polymerization and the efficiency with which frameshift intermediates are removed by DNA polymerase-associated exonucleolytic proofreading activity and/or the postreplicative mismatch repair machinery. To examine the relative contributions of these factors to replication fidelity in Saccharomyces cerevisiae, we determined the reversion rates and spectra of the lys2 Delta Bgl +1 frameshift allele. Wild-type and homozygous mutant diploid strains with all possible combinations of defects in the exonuclease activities of DNA polymerases delta and epsilon (conferred by the pol3-01 and pol2-4 alleles, respectively) and in mismatch repair (deletion of MSH2) were analyzed. Although there was no direct correlation between homopolymer run length and frameshift accumulation in the wild-type strain, such a correlation was evident in the triple mutant strain lacking all repair capacity. Furthermore, examination of strains defective in one or two repair activities revealed distinct biases in the removal of the corresponding frameshift intermediates by exonucleolytic proofreading and/or mismatch repair. Finally, these analyses suggest that the mismatch repair machinery may be important for generating some classes of frameshift mutations in yeast. PMID:11560887

  9. Investigation of the Cu binding site at [dCdG] and [CG] base pairs in the absence of a DNA backbone

    NASA Astrophysics Data System (ADS)

    Kim, Mi-Ji; Kim, Bo-Ra; Kim, Ho-Tae

    2011-03-01

    We investigated the gas-phase nucleobases [CGH] +1, [Cu(CG)] +1, [Cu(CG-H)] +1, and nucleoside [Cu(dCdG)] +1 complexes using collision-induced dissociation (CID) MS/MS spectra. Two forms, the Watson-Crick complex form (cation-base-base) and an interstrand complex form (base-cation-base), were included in the analysis of the [cation-base pair] complex structures. The main cytosine loss dissociation channel of the [Cu(CG)] +1 complex was analyzed as the loss of an interstrand [Cu(CG)] +1 form instead of the Watson-Crick form. The -43 amu (CONH) and -68 amu (cytosine-CONH) loss fragments of the [Cu(CG-H)] +1 complex can be explained by the dissociation process of the interstrand [Cu(CG-H)] +1 form.

  10. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

    PubMed Central

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-01

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

  11. A Novel Electrochemical Sensor Based on [Ru(NH3)6]Cl3 as a Redox Indicator for the Detection of G-G Mismatched DNA.

    PubMed

    Zhu, Xiaoqian; Huang, Min; Li, Jiao; He, Hanping; Zhang, Xiuhua; Wang, Shengfu

    2017-01-01

    In this paper, a novel electrochemical sensor was developed for the rapid detection of G-G mismatched DNA based on hexaammineruthenium(III) chloride ([Ru(NH3)6]Cl3) as a redox indicator. The sensor platform was constructed by immobilizing small molecules (NC-linker) on the gold electrode via amide bonds. The as-prepared NC-linker as the nucleic acids recognition molecule can interact with the G base of DNA. After the sensor was incubated with G-G mismatched DNA, the double-stranded DNA (dsDNA) acted as carriers of the signal tags-[Ru(NH3)6]Cl3, which resulted in a remarkable electrochemical signal. More binding of [Ru(NH3)6]Cl3 led to increases of the electrochemical signal. Other mismatched DNA produced only a low response, as well as complementary DNA. Thus G-G mismatched DNA can be easily discriminated from other mismatched and complementary DNA based on the sensor. Furthermore, the method was simple, rapid and repeatable for the detection of G-G mismatched DNA. The selective detection of target dsDNA was achieved by a relative current ratio of the target and control DNA. These results demonstrated that this strategy could provide great promise for the rapid and specific detection of other sequence-specific DNA.

  12. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

    SciTech Connect

    Yeo, Hyun Koo; Lee, Jae Young

    2012-04-18

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

  13. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

    PubMed

    Yeo, Hyun Koo; Lee, Jae Young

    2010-05-01

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

  14. Influence of C-5 substituted cytosine and related nucleoside analogs on the formation of benzo[a]pyrene diol epoxide-dG adducts at CG base pairs of DNA.

    PubMed

    Guza, Rebecca; Kotandeniya, Delshanee; Murphy, Kristopher; Dissanayake, Thakshila; Lin, Chen; Giambasu, George Madalin; Lad, Rahul R; Wojciechowski, Filip; Amin, Shantu; Sturla, Shana J; Hudson, Robert H E; York, Darrin M; Jankowiak, Ryszard; Jones, Roger; Tretyakova, Natalia Y

    2011-05-01

    Endogenous 5-methylcytosine ((Me)C) residues are found at all CG dinucleotides of the p53 tumor suppressor gene, including the mutational 'hotspots' for smoking induced lung cancer. (Me)C enhances the reactivity of its base paired guanine towards carcinogenic diolepoxide metabolites of polycyclic aromatic hydrocarbons (PAH) present in cigarette smoke. In the present study, the structural basis for these effects was investigated using a series of unnatural nucleoside analogs and a representative PAH diolepoxide, benzo[a]pyrene diolepoxide (BPDE). Synthetic DNA duplexes derived from a frequently mutated region of the p53 gene (5'-CCCGGCACCC GC[(15)N(3),(13)C(1)-G]TCCGCG-3', + strand) were prepared containing [(15)N(3), (13)C(1)]-guanine opposite unsubstituted cytosine, (Me)C, abasic site, or unnatural nucleobase analogs. Following BPDE treatment and hydrolysis of the modified DNA to 2'-deoxynucleosides, N(2)-BPDE-dG adducts formed at the [(15)N(3), (13)C(1)]-labeled guanine and elsewhere in the sequence were quantified by mass spectrometry. We found that C-5 alkylcytosines and related structural analogs specifically enhance the reactivity of the base paired guanine towards BPDE and modify the diastereomeric composition of N(2)-BPDE-dG adducts. Fluorescence and molecular docking studies revealed that 5-alkylcytosines and unnatural nucleobase analogs with extended aromatic systems facilitate the formation of intercalative BPDE-DNA complexes, placing BPDE in a favorable orientation for nucleophilic attack by the N(2) position of guanine.

  15. Short Hairpin RNA Suppression of Thymidylate Synthase Produces DNA Mismatches and Results in Excellent Radiosensitization

    SciTech Connect

    Flanagan, Sheryl A.; Cooper, Kristin S.; Mannava, Sudha; Nikiforov, Mikhail A.; Shewach, Donna S.

    2012-12-01

    Purpose: To determine the effect of short hairpin ribonucleic acid (shRNA)-mediated suppression of thymidylate synthase (TS) on cytotoxicity and radiosensitization and the mechanism by which these events occur. Methods and Materials: shRNA suppression of TS was compared with 5-fluoro-2 Prime -deoxyuridine (FdUrd) inactivation of TS with or without ionizing radiation in HCT116 and HT29 colon cancer cells. Cytotoxicity and radiosensitization were measured by clonogenic assay. Cell cycle effects were measured by flow cytometry. The effects of FdUrd or shRNA suppression of TS on dNTP deoxynucleotide triphosphate imbalances and consequent nucleotide misincorporations into deoxyribonucleic acid (DNA) were analyzed by high-pressure liquid chromatography and as pSP189 plasmid mutations, respectively. Results: TS shRNA produced profound ({>=}90%) and prolonged ({>=}8 days) suppression of TS in HCT116 and HT29 cells, whereas FdUrd increased TS expression. TS shRNA also produced more specific and prolonged effects on dNTPs deoxynucleotide triphosphates compared with FdUrd. TS shRNA suppression allowed accumulation of cells in S-phase, although its effects were not as long-lasting as those of FdUrd. Both treatments resulted in phosphorylation of Chk1. TS shRNA alone was less cytotoxic than FdUrd but was equally effective as FdUrd in eliciting radiosensitization (radiation enhancement ratio: TS shRNA, 1.5-1.7; FdUrd, 1.4-1.6). TS shRNA and FdUrd produced a similar increase in the number and type of pSP189 mutations. Conclusions: TS shRNA produced less cytotoxicity than FdUrd but was equally effective at radiosensitizing tumor cells. Thus, the inhibitory effect of FdUrd on TS alone is sufficient to elicit radiosensitization with FdUrd, but it only partially explains FdUrd-mediated cytotoxicity and cell cycle inhibition. The increase in DNA mismatches after TS shRNA or FdUrd supports a causal and sufficient role for the depletion of dTTP thymidine triphosphate and consequent DNA

  16. DNA-Mediated Electrochemistry

    PubMed Central

    Gorodetsky, Alon A.; Buzzeo, Marisa C.

    2009-01-01

    The base pair stack of DNA has been demonstrated as a medium for long range charge transport chemistry both in solution and at DNA-modified surfaces. This chemistry is exquisitely sensitive to structural perturbations in the base pair stack as occur with lesions, single base mismatches, and protein binding. We have exploited this sensitivity for the development of reliable electrochemical assays based on DNA charge transport at self-assembled DNA monolayers. Here we discuss the characteristic features, applications, and advantages of DNA-mediated electrochemistry. PMID:18980370

  17. Concurrent genetic alterations in DNA polymerase proofreading and mismatch repair in human colorectal cancer

    PubMed Central

    Yoshida, Rintaro; Miyashita, Kaname; Inoue, Mayuko; Shimamoto, Akiyoshi; Yan, Zhao; Egashira, Akinori; Oki, Eiji; Kakeji, Yoshishiro; Oda, Shinya; Maehara, Yoshihiko

    2011-01-01

    Genomic sequences encoding the 3′ exonuclease (proofreading) domains of both replicative DNA polymerases, pol delta and pol epsilon, were explored simultaneously in human colorectal carcinomas including six established cell lines. Three unequivocal sequence alterations, including one previously reported, were found, and all these were considered as dysfunctional mutations in light of the local amino-acid sequences. In particular, the F367S mutation found in the POLE gene encoding the pol epsilon catalytic subunit, which includes the proofreading domain, is the first found in human diseases. Surprisingly, the tumours carrying these proofreading domain mutations were all defective in DNA mismatch repair (MMR). In addition to the two cell lines with acknowledged MMR gene mutations, the third tumour was also demonstrated to harbour a distinct mutation in MLH1, and indeed exhibited a microsatellite-unstable phenotype. These findings suggest that, in concert with MMR deficiency, defective polymerase proofreading may also contribute to the mutator phenotype observed in human colorectal cancer. Our observations may suggest previously unrecognised complexities in the molecular abnormalities underlying the mutator phenotype in human neoplasms. PMID:21157497

  18. Flanking sequence specificity determines coding microsatellite heteroduplex and mutation rates with defective DNA mismatch repair (MMR).

    PubMed

    Chung, H; Lopez, C G; Young, D J; Lai, J F; Holmstrom, J; Ream-Robinson, D; Cabrera, B L; Carethers, J M

    2010-04-15

    The activin type II receptor (ACVR2) contains two identical microsatellites in exons 3 and 10, but only the exon 10 microsatellite is frameshifted in mismatch repair (MMR)-defective colonic tumors. The reason for this selectivity is not known. We hypothesized that ACVR2 frameshifts were influenced by DNA sequences surrounding the microsatellite. We constructed plasmids in which exons 3 or 10 of ACVR2 were cloned +1 bp out of frame of enhanced green fluorescent protein (EGFP), allowing -1 bp frameshift to express EGFP. Plasmids were stably transfected into MMR-deficient cells, and subsequent non-fluorescent cells were sorted, cultured and harvested for mutation analysis. We swapped DNA sequences flanking the exon 3 and 10 microsatellites to test our hypothesis. Native ACVR2 exon 3 and 10 microsatellites underwent heteroduplex formation (A(7)/T(8)) in hMLH1(-/-) cells, but only exon 10 microsatellites fully mutated (A(7)/T(7)) in both hMLH1(-/-) and hMSH6(-/-) backgrounds, showing selectivity for exon 10 frameshifts and inability of exon 3 heteroduplexes to fully mutate. Substituting nucleotides flanking the exon 3 microsatellite for nucleotides flanking the exon 10 microsatellite significantly reduced heteroduplex and full mutation in hMLH1(-/-) cells. When the exon 3 microsatellite was flanked by nucleotides normally surrounding the exon 10 microsatellite, fully mutant exon 3 frameshifts appeared. Mutation selectivity for ACVR2 lies partly with flanking nucleotides surrounding each microsatellite.

  19. Synthesis of specific diastereomers of a DNA methylphosphonate heptamer, d(CpCpApApApCpA), and stability of base pairing with the normal DNA octamer d(TPGPTPTPTPGPGPC).

    PubMed Central

    Vyazovkina, E V; Savchenko, E V; Lokhov, S G; Engels, J W; Wickstrom, E; Lebedev, A V

    1994-01-01

    DNA methylphosphonates are candidate derivatives for use in antisense DNA therapy. Their efficacy is limited by weak hybridization. One hypothesis to explain this phenomenon holds that one configuration of the chiral methylphosphonate linkage, Rp, permits stronger base pairing than the other configuration, Sp. To test this hypothesis, four specific pairs of Rp and Sp diastereomers of the DNA methylphosphonate heptamer d(CpCpApApApCpA) were prepared by block coupling of different combinations of individual diastereomers of d(CpCpApA) and d(ApCpA). Each pair of the diastereomers of the heptamer was separated into individual diastereomes using affinity chromatography on a Lichrosorb-NH2 silica column with a covalently attached complementary normal DNA octamer, d(pTpGpTpTpTpGpGpC). The stabilities of complementary complexes of phosphodiester d(TpGpTpTpTpGpGpC) with 8 individual diastereomers of methylphosphonate d(CpCpApApApCpA) were studied by measuring their melting temperatures (Tm). A direct correlation of Tm values with the number of Rp methylphosphonate centers in the heptamer was found: the more Rp centers, the higher the stability of the complex. Tm values for the diastereomers with 6 all-Rp or all-Sp methylphosphonate centers were found to be 30.5 degrees and 12.5 degrees C, respectively, in 100 mM NaCl, 10 mM Na2HPO4, 1 mM EDTA, pH 7.0 with 15 microM of each oligomer. On the average, each substitution of one Rp-center to an Sp-center in the heptamer decreased the Tm by 3 degrees C. Under the same conditions, the Tm of the normal DNA heptamer with its complement was 21 degrees C. These results are consistent with the model that all-Rp methylphosphonate DNAs hybridize much more tightly to complementary normal DNA than do racemic methylphosphonate DNAs, and may therefore exhibit greater potency as antisense inhibitors. PMID:8036171

  20. Hybridization and sequencing of nucleic acids using base pair mismatches

    DOEpatents

    Fodor, Stephen P. A.; Lipshutz, Robert J.; Huang, Xiaohua

    2001-01-01

    Devices and techniques for hybridization of nucleic acids and for determining the sequence of nucleic acids. Arrays of nucleic acids are formed by techniques, preferably high resolution, light-directed techniques. Positions of hybridization of a target nucleic acid are determined by, e.g., epifluorescence microscopy. Devices and techniques are proposed to determine the sequence of a target nucleic acid more efficiently and more quickly through such synthesis and detection techniques.

  1. Base-pairing energies of protonated nucleobase pairs and proton affinities of 1-methylated cytosines: model systems for the effects of the sugar moiety on the stability of DNA i-motif conformations.

    PubMed

    Yang, Bo; Moehlig, Aaron R; Frieler, C E; Rodgers, M T

    2015-02-05

    Expansion of (CCG)n·(CGG)n trinucleotide repeats leads to hypermethylation of cytosine residues and results in Fragile X syndrome, the most common cause of inherited intellectual disability in humans. The (CCG)n·(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of noncanonical protonated nucleobase pairs of cytosine (C(+)·C). Previously, we investigated the effects of 5-methylation of cytosine on the base-pairing energies (BPEs) using threshold collision-induced dissociation (TCID) techniques. In the present work, we extend our investigations to include protonated homo- and heteronucleobase pairs of cytosine, 1-methylcytosine, 5-methylcytosine, and 1,5-dimethylcytosine. The 1-methyl substituent prevents most tautomerization processes of cytosine and serves as a mimic for the sugar moiety of DNA nucleotides. In contrast to permethylation of cytosine at the 5-position, 1-methylation is found to exert very little influence on the BPE. All modifications to both nucleobases lead to a small increase in the BPEs, with 5-methylation producing a larger enhancement than either 1-methyl or 1,5-dimethylation. In contrast, modifications to a single nucleobase are found to produce a small decrease in the BPEs, again with 5-methylation producing a larger effect than 1-methylation. However, the BPEs of all of the protonated nucleobase pairs examined here significantly exceed those of canonical G·C and neutral C·C base pairs, and thus should still provide the driving force stabilizing DNA i-motif conformations even in the presence of such modifications. The proton affinities of the methylated cytosines are also obtained from the TCID experiments by competitive analyses of the primary dissociation pathways that occur in parallel for the protonated heteronucleobase pairs.

  2. Crystal Structure of Human Thymine DNA Glycosylase Bound to DNA Elucidates Sequence-Specific Mismatch Recognition

    SciTech Connect

    Maiti, A.; Morgan, M.T.; Pozharski, E.; Drohat, A.C.

    2009-05-19

    Cytosine methylation at CpG dinucleotides produces m{sup 5}CpG, an epigenetic modification that is important for transcriptional regulation and genomic stability in vertebrate cells. However, m{sup 5}C deamination yields mutagenic G{center_dot}T mispairs, which are implicated in genetic disease, cancer, and aging. Human thymine DNA glycosylase (hTDG) removes T from G{center_dot}T mispairs, producing an abasic (or AP) site, and follow-on base excision repair proteins restore the G{center_dot}C pair. hTDG is inactive against normal A{center_dot}T pairs, and is most effective for G{center_dot}T mispairs and other damage located in a CpG context. The molecular basis of these important catalytic properties has remained unknown. Here, we report a crystal structure of hTDG (catalytic domain, hTDG{sup cat}) in complex with abasic DNA, at 2.8 {angstrom} resolution. Surprisingly, the enzyme crystallized in a 2:1 complex with DNA, one subunit bound at the abasic site, as anticipated, and the other at an undamaged (nonspecific) site. Isothermal titration calorimetry and electrophoretic mobility-shift experiments indicate that hTDG and hTDG{sup cat} can bind abasic DNA with 1:1 or 2:1 stoichiometry. Kinetics experiments show that the 1:1 complex is sufficient for full catalytic (base excision) activity, suggesting that the 2:1 complex, if adopted in vivo, might be important for some other activity of hTDG, perhaps binding interactions with other proteins. Our structure reveals interactions that promote the stringent specificity for guanine versus adenine as the pairing partner of the target base and interactions that likely confer CpG sequence specificity. We find striking differences between hTDG and its prokaryotic ortholog (MUG), despite the relatively high (32%) sequence identity.

  3. DNA Mismatch Repair Complex MutSβ Promotes GAA·TTC Repeat Expansion in Human Cells*

    PubMed Central

    Halabi, Anasheh; Ditch, Scott; Wang, Jeffrey; Grabczyk, Ed

    2012-01-01

    While DNA repair has been implicated in CAG·CTG repeat expansion, its role in the GAA·TTC expansion of Friedreich ataxia (FRDA) is less clear. We have developed a human cellular model that recapitulates the DNA repeat expansion found in FRDA patient tissues. In this model, GAA·TTC repeats expand incrementally and continuously. We have previously shown that the expansion rate is linked to transcription within the repeats. Our working hypothesis is that structures formed within the GAA·TTC repeat during transcription attract DNA repair enzymes that then facilitate the expansion process. MutSβ, a heterodimer of MSH2 and MSH3, is known to have a role in CAG·CTG repeat expansion. We now show that shRNA knockdown of either MSH2 or MSH3 slowed GAA·TTC expansion in our system. We further characterized the role of MutSβ in GAA·TTC expansion using a functional assay in primary FRDA patient-derived fibroblasts. These fibroblasts have no known propensity for instability in their native state. Ectopic expression of MSH2 and MSH3 induced GAA·TTC repeat expansion in the native FXN gene. MSH2 is central to mismatch repair and its absence or reduction causes a predisposition to cancer. Thus, despite its essential role in GAA·TTC expansion, MSH2 is not an attractive therapeutic target. The absence or reduction of MSH3 is not strongly associated with cancer predisposition. Accordingly, MSH3 has been suggested as a therapeutic target for CAG·CTG repeat expansion disorders. Our results suggest that MSH3 may also serve as a therapeutic target to slow the expansion of GAA·TTC repeats in the future. PMID:22787155

  4. Detection of coding microsatellite frameshift mutations in DNA mismatch repair-deficient mouse intestinal tumors.

    PubMed

    Woerner, Stefan M; Tosti, Elena; Yuan, Yan P; Kloor, Matthias; Bork, Peer; Edelmann, Winfried; Gebert, Johannes

    2015-11-01

    Different DNA mismatch repair (MMR)-deficient mouse strains have been developed as models for the inherited cancer predisposing Lynch syndrome. It is completely unresolved, whether coding mononucleotide repeat (cMNR) gene mutations in these mice can contribute to intestinal tumorigenesis and whether MMR-deficient mice are a suitable molecular model of human microsatellite instability (MSI)-associated intestinal tumorigenesis. A proof-of-principle study was performed to identify mouse cMNR-harboring genes affected by insertion/deletion mutations in MSI murine intestinal tumors. Bioinformatic algorithms were developed to establish a database of mouse cMNR-harboring genes. A panel of five mouse noncoding mononucleotide markers was used for MSI classification of intestinal matched normal/tumor tissues from MMR-deficient (Mlh1(-/-) , Msh2(-/-) , Msh2(LoxP/LoxP) ) mice. cMNR frameshift mutations of candidate genes were determined by DNA fragment analysis. Murine MSI intestinal tumors but not normal tissues from MMR-deficient mice showed cMNR frameshift mutations in six candidate genes (Elavl3, Tmem107, Glis2, Sdccag1, Senp6, Rfc3). cMNRs of mouse Rfc3 and Elavl3 are conserved in type and length in their human orthologs that are known to be mutated in human MSI colorectal, endometrial and gastric cancer. We provide evidence for the utility of a mononucleotide marker panel for detection of MSI in murine tumors, the existence of cMNR instability in MSI murine tumors, the utility of mouse subspecies DNA for identification of polymorphic repeats, and repeat conservation among some orthologous human/mouse genes, two of them showing instability in human and mouse MSI intestinal tumors. MMR-deficient mice hence are a useful molecular model system for analyzing MSI intestinal carcinogenesis.

  5. [Analysis of effectiveness of cDNA synthesis, induced using complementary primers and primers containing a noncomplementary base matrix].

    PubMed

    D'iachenko, L B; Chenchik, A A; Khaspekov, G L; Tatarenko, A O; Bibilashvili, R Sh

    1994-01-01

    We have studied the efficiency of DNA synthesis catalyzed by M-MLV reverse transcriptase or Thermus aquaticus DNA polymerase for primers (4-17 nucleotides long) either completely matched or possessing a single mismatched base pair at all possible positions in the primer. It has been shown that DNA synthesis efficiency depends not only on the position of mismatched base pair but on the length and primary structure of the primer. The enzyme, template, and primer concentrations determine the relative level of mismatched DNA synthesis.

  6. In silico studies to explore the mutagenic ability of 5-halo/oxy/li-oxy-uracil bases with guanine of DNA base pairs.

    PubMed

    Jana, Kalyanashis; Ganguly, Bishwajit

    2014-10-16

    DNA nucleobases are reactive in nature and undergo modifications by deamination, oxidation, alkylation, or hydrolysis processes. Many such modified bases are susceptible to mutagenesis when formed in cellular DNA. The mutagenesis can occur by mispairing with DNA nucleobases by a DNA polymerase during replication. We have performed a study of mispairing of DNA bases with unnatural bases computationally. 5-Halo uracils have been studied as mispairs in mutagenesis; however, the reports on their different forms are scarce in the literature. The stability of mispairs with keto form, enol form, and ionized form of 5-halo-uracil has been computed with the M06-2X/6-31+G** level of theory. The enol form of 5-halo-uracil showed remarkable stability toward DNA mispair compared to the corresponding keto and ionized forms. (F)U-G mispair showed the highest stability in the series and (Halo)(U(enol/ionized)-G mispair interactions energies are more stable than the natural G-C basepair of DNA. To enhance the stability of DNA mispairs, we have introduced the hydroxyl group in the place of halogen atoms, which provides additional hydrogen-bonding interactions in the system while forming the 5-membered ring. The study has been further extended with lithiated 5-hydroxymethyl-uracil to stabilize the DNA mispair. (CH2OLi)U(ionized)-G mispair has shown the highest stability (ΔG = -32.4 kcal/mol) with multi O-Li interactions. AIM (atoms in molecules) and EDA (energy decomposition analysis) analysis has been performed to examine the nature of noncovalent interactions in such mispairs. EDA analysis has shown that electrostatic energy mainly contributes toward the interaction energy of mispairs. The higher stability achieved in these studied mispairs can play a pivotal role in the mutagenesis and can help to attain the mutation for many desired biological processes.

  7. Relationship between DNA mismatch repair genes expression, Ku-genes expression and ploidy-related parameters in the progression of pigmented lesions of the skin.

    PubMed

    Korabiowska, Monika; Tscherny, Michael; Stachura, Jerzy; Ruschenburg, Ilka; Cordon-Cardo, Carlos; Brinck, Ulrich

    2002-01-01

    Defects of DNA repair systems in cutaneous tumours are related to DNA mismatch repair genes (MLH1, MSH2, PMS1, PMS2) and Ku70/80 genes involved in double- strand repair. In this study we investigated the statistical relationship between these systems and DNA-ploidy-related parameters in 19 naevus cell naevi, 23 lentigos maligna, 76 primary melanomas and 31 melanoma metastases, applying the correlation coefficient according to Spearman. In naevi significant correlations were found between Ku70/80 gene expression and some ploidy-related parameters. In lentigos, additionally, some significant correlations between the expression of DNA mismatch repair genes were found. Similar results were demonstrated for primary melanomas. In metastases no one significant correlation between DNA mismatch repair genes and Ku-genes was present. We postulate that DNA mismatch repair genes and Ku70/80 genes are functionally independent and that some of them are able to influence ploidy-related parameters.

  8. Molecular cloning and chromosomal localization of a novel human tracheo-bronchial mucin cDNA containing tandemly repeated sequences of 48 base pairs.

    PubMed

    Porchet, N; Nguyen, V C; Dufosse, J; Audie, J P; Guyonnet-Duperat, V; Gross, M S; Denis, C; Degand, P; Bernheim, A; Aubert, J P

    1991-03-15

    A lambda gt11 cDNA library constructed from human tracheo-bronchial mucosa was screened with a polyclonal antiserum raised to chemically deglycosylated pronase glycopeptides from human bronchial mucins. Out of 20 positives clones, one partial cDNA clone was isolated and allowed to map a novel human tracheo-bronchial mucin gene. It contains 48 nucleotide tandem repeats quite perfectly identical which encodes a protein containing about 50% of hydroxy amino-acids. This clone hybridized to polydisperse messages produced by human tracheo-bronchial and human colonic mucosae. The gene (proposed name MUC 4) from which cDNA is derived maps to chromosome 3.

  9. Functional role of DNA mismatch repair gene PMS2 in prostate cancer cells.

    PubMed

    Fukuhara, Shinichiro; Chang, Inik; Mitsui, Yozo; Chiyomaru, Takeshi; Yamamura, Soichiro; Majid, Shahana; Saini, Sharanjot; Deng, Guoren; Gill, Ankurpreet; Wong, Darryn K; Shiina, Hiroaki; Nonomura, Norio; Lau, Yun-Fai C; Dahiya, Rajvir; Tanaka, Yuichiro

    2015-06-30

    DNA mismatch repair (MMR) enzymes act as proofreading complexes that maintains genomic integrity and MMR-deficient cells show an increased mutation rate. MMR has also been shown to influence cell signaling and the regulation of tumor development. MMR consists of various genes and includes post-meiotic segregation (PMS) 2 which is a vital component of mutL-alpha. In prostate, the functional role of this gene has never been reported and in this study, our aim was to investigate the effect of PMS2 on growth properties of prostate cancer (PCa) cells. Previous studies have shown PMS2 to be deficient in DU145 cells and this lack of expression was confirmed by Western blotting whereas normal prostatic PWR-1E and RWPE-1 cells expressed this gene. PMS2 effects on various growth properties of DU145 were then determined by creating stable gene transfectants. Interestingly, PMS2 caused decreased cell proliferation, migration, invasion, and in vivo growth; and increased apoptosis as compared to vector control. We further analyzed genes affected by PMS2 expression and observe the apoptosis-related TMS1 gene to be significantly upregulated whereas anti-apoptotic BCL2A1 was downregulated. These results demonstrate a functional role for PMS2 to protect against PCa progression by enhancing apoptosis of PCa cells.

  10. The Arabidopsis DNA mismatch repair gene PMS1 restricts somatic recombination between homeologous sequences.

    PubMed

    Li, Liangliang; Dion, Eric; Richard, Gabriel; Domingue, Olivier; Jean, Martine; Belzile, François J

    2009-04-01

    The eukaryotic DNA mismatch repair (MMR) system contributes to maintaining the fidelity of genetic information by correcting replication errors and preventing illegitimate recombination events. This study aimed to examine the function(s) of the Arabidopsis thaliana PMS1 gene (AtPMS1), one of three homologs of the bacterial MutL gene in plants. Two independent mutant alleles (Atpms1-1 and Atpms1-2) were obtained and one of these (Atpms1-1) was studied in detail. The mutant exhibited a reduction in seed set and a bias against the transmission of the mutant allele. Somatic recombination, both homologous and homeologous, was examined using a set of reporter constructs. Homologous recombination remained unchanged in the mutant while homeologous recombination was between 1.7- and 4.8-fold higher than in the wild type. This increase in homeologous recombination frequency was not correlated with the degree of sequence divergence. In RNAi lines, a range of increases in homeologous recombination were observed with two lines showing a 3.3-fold and a 3.6-fold increase. These results indicate that the AtPMS1 gene contributes to an antirecombination activity aimed at restricting recombination between diverged sequences.

  11. DNA mismatch repair gene MSH6 implicated in determining age at natural menopause

    PubMed Central

    Perry, John R.B.; Hsu, Yi-Hsiang; Chasman, Daniel I.; Johnson, Andrew D.; Elks, Cathy; Albrecht, Eva; Andrulis, Irene L.; Beesley, Jonathan; Berenson, Gerald S.; Bergmann, Sven; Bojesen, Stig E.; Bolla, Manjeet K.; Brown, Judith; Buring, Julie E.; Campbell, Harry; Chang-Claude, Jenny; Chenevix-Trench, Georgia; Corre, Tanguy; Couch, Fergus J.; Cox, Angela; Czene, Kamila; D'adamo, Adamo Pio; Davies, Gail; Deary, Ian J.; Dennis, Joe; Easton, Douglas F.; Engelhardt, Ellen G.; Eriksson, Johan G.; Esko, Tõnu; Fasching, Peter A.; Figueroa, Jonine D.; Flyger, Henrik; Fraser, Abigail; Garcia-Closas, Montse; Gasparini, Paolo; Gieger, Christian; Giles, Graham; Guenel, Pascal; Hägg, Sara; Hall, Per; Hayward, Caroline; Hopper, John; Ingelsson, Erik; Kardia, Sharon L.R.; Kasiman, Katherine; Knight, Julia A.; Lahti, Jari; Lawlor, Debbie A.; Magnusson, Patrik K.E.; Margolin, Sara; Marsh, Julie A.; Metspalu, Andres; Olson, Janet E.; Pennell, Craig E.; Polasek, Ozren; Rahman, Iffat; Ridker, Paul M.; Robino, Antonietta; Rudan, Igor; Rudolph, Anja; Salumets, Andres; Schmidt, Marjanka K.; Schoemaker, Minouk J.; Smith, Erin N.; Smith, Jennifer A.; Southey, Melissa; Stöckl, Doris; Swerdlow, Anthony J.; Thompson, Deborah J.; Truong, Therese; Ulivi, Sheila; Waldenberger, Melanie; Wang, Qin; Wild, Sarah; Wilson, James F; Wright, Alan F.; Zgaga, Lina; Ong, Ken K.; Murabito, Joanne M.; Karasik, David; Murray, Anna

    2014-01-01

    The length of female reproductive lifespan is associated with multiple adverse outcomes, including breast cancer, cardiovascular disease and infertility. The biological processes that govern the timing of the beginning and end of reproductive life are not well understood. Genetic variants are known to contribute to ∼50% of the variation in both age at menarche and menopause, but to date the known genes explain <15% of the genetic component. We have used genome-wide association in a bivariate meta-analysis of both traits to identify genes involved in determining reproductive lifespan. We observed significant genetic correlation between the two traits using genome-wide complex trait analysis. However, we found no robust statistical evidence for individual variants with an effect on both traits. A novel association with age at menopause was detected for a variant rs1800932 in the mismatch repair gene MSH6 (P = 1.9 × 10−9), which was also associated with altered expression levels of MSH6 mRNA in multiple tissues. This study contributes to the growing evidence that DNA repair processes play a key role in ovarian ageing and could be an important therapeutic target for infertility. PMID:24357391

  12. Synthesis, base pairing and structure studies of geranylated RNA

    PubMed Central

    Wang, Rui; Vangaveti, Sweta; Ranganathan, Srivathsan V.; Basanta-Sanchez, Maria; Haruehanroengra, Phensinee; Chen, Alan; Sheng, Jia

    2016-01-01

    Natural RNAs utilize extensive chemical modifications to diversify their structures and functions. 2-Thiouridine geranylation is a special hydrophobic tRNA modification that has been discovered very recently in several bacteria, such as Escherichia coli, Enterobacter aerogenes, Pseudomonas aeruginosa and Salmonella Typhimurium. The geranylated residues are located in the first anticodon position of tRNAs specific for lysine, glutamine and glutamic acid. This big hydrophobic terpene functional group affects the codon recognition patterns and reduces frameshifting errors during translation. We aimed to systematically study the structure, function and biosynthesis mechanism of this geranylation pathway, as well as answer the question of why nature uses such a hydrophobic modification in hydrophilic RNA systems. Recently, we have synthesized the deoxy-analog of S-geranyluridine and showed the geranylated T-G pair is much stronger than the geranylated T-A pair and other mismatched pairs in the B-form DNA duplex context, which is consistent with the observation that the geranylated tRNAGluUUC recognizes GAG more efficiently than GAA. In this manuscript we report the synthesis and base pairing specificity studies of geranylated RNA oligos. We also report extensive molecular simulation studies to explore the structural features of the geranyl group in the context of A-form RNA and its effect on codon–anticodon interaction during ribosome binding. PMID:27307604

  13. A novel conception for spontaneous transversions caused by homo-pyrimidine DNA mismatches: a QM/QTAIM highlight.

    PubMed

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-09-07

    We have firstly shown that the T·T(w) and C·C(w) DNA mismatches with wobble (w) geometry stay in slow tautomeric equilibrium with short T·T*(WC) and C·C*(WC) Watson-Crick (WC) mispairs. These non-dissociative tautomeric rearrangements are controlled by the plane-symmetric, highly stable, highly polar and zwitterionic transition states. The obtained results allow us to understand in what way the T·T(w) and C·C(w) mismatches acquire enzymatically competent T·T*(WC) and C·C*(WC) conformations directly in the hydrophobic recognition pocket of a high-fidelity DNA-polymerase, thereby producing thermodynamically non-equilibrium spontaneous transversions. The simplest numerical estimation of the frequency ratio of the TT to CC spontaneous transversions satisfactorily agrees with experimental data.

  14. Complexes of DNA Bases and Watson-Crick Base Pairs Interaction with Neutral Silver Agn (n = 8, 10, 12) Clusters: A DFT and TDDFT Study.

    PubMed

    Srivastava, Ruby

    2017-03-21

    We study the binding of the neutral Agn (n = 8, 10, 12) to the DNA base- adenine (A), guanine (G) and Watson-Crick -adenine-thymine (AT), guanine-cytosine (GC) pairs. Geometries of complexes were optimized at the DFT level using the hybrid B3LYP functional. LANL2DZ effective core potential (ECP) was used for silver and 6-31+G(**) was used for all other atoms. NBO charges were analyzed using the Natural population analysis. The absorption properties of Agn-A,G/WC complexes were also studied using time-dependent density functional theory (TDDFT). The absorption spectra for these complexes show wavelength in the visible region. It was revealed that silver clusters interact more strongly with WC pairs than with isolated DNA complexes. Furthermore, it was found that the electronic charge transferred from silver to isolated DNA clusters are less than the electronic charge transferred from silver to the Agn-WC complexes. The vertical ionization potential, vertical electron affinity, hardness and electrophilicity index of Agn-DNA/WC complexes have also been discussed.

  15. DNA Binding and Recognition of a CC Mismatch in a DNA Duplex by Water-Soluble Peptidocalix[4]arenes: Synthesis and Applications.

    PubMed

    Alavijeh, Nahid S; Zadmard, Reza; Balalaie, Saeed; Alavijeh, Mohammad S; Soltani, Nima

    2016-10-07

    Water-soluble peptidocalix[4]arenes were synthesized by the introduction of arginine-rich narrow groove-binding residues at lower rims through solid-phase synthesis. The study of binding of these water-soluble bidentate ligands to well-matched and mismatched DNA duplexes by fluorescent titrations, ethidium bromide (EB) displacement assays, DNA-melting experiments, and circular dichroism (CD) analysis revealed a sequence-dependent groove-binding mechanism.

  16. Altered expression and new mutations in DNA mismatch repair genes MLH1 and MSH2 in melanoma brain metastases.

    PubMed

    Korabiowska, Monika; König, Fatima; Verheggen, Raphaela; Schlott, Thilo; Cordon-Cardo, Carlos; Romeike, Bernd; Brinck, Ulrich

    2004-01-01

    Brain metastases, including those of malignant melanoma (known for its high genomic instability), are the most common intracranial tumors. The main objective of this study was to investigate expression and mutation in the DNA mismatch repair system in melanoma brain metastases. Expression of MLH1, MSH2, PMS1 and PMS2 was investigated immunohistochemically in 31 melanoma metastatic tumors. Mutational analysis of MLH1 and MSH2 was performed in 17 melanoma brain metastases. Loss of MLH1 and MSH2 expression was found in 10/31 and 12/31 tumors. PMS1 (27/31) and PMS2 (28/31) expression was preserved in the majority of lesions. Potential missense mutation was found in MSH2 (exon 13) in 2/17 melanomas. Mutation in the intron sequence between exon 14 and 15 of MLH1 (exon 15) was observed in 4/17 cases. Our results indicate that the two major DNA mismatch repair genes, MLH1 and MSH2, are more frequently affected by alterations in the DNA mismatch repair system than the helper genes PMS1 and PMS2. The presence of mutations of MSH2 and MLH1 in melanoma brain metastases, which has not been found in primary melanomas, indicates the high genomic instability of melanoma brain metastases.

  17. HNA and ANA high-affinity arrays for detections of DNA and RNA single-base mismatches.

    PubMed

    Abramov, Mikhail; Schepers, Guy; Van Aerschot, Arthur; Van Hummelen, Paul; Herdewijn, Piet

    2008-06-15

    DNA microarrays and sensors have become essential tools in the functional analysis of sequence information. Recently we reported that chimeric hexitol (HNA) and altritol (ANA) nucleotide monomers with an anhydrohexitol sugar moiety are easily available and proved their chemistry to be compatible with DNA and RNA synthesis. In this communication we describe a novel analytical platform based on HNA and ANA units to be used as synthetic oligonucleotide arrays on a glass solid support for match/mismatch detection of DNA and RNA targets. Arrays were fabricated by immobilization of diene-modified oligonucleotides on maleimido-activated glass slides. To demonstrate the selectivity and sensitivity of the HNA/ANA arrays and to compare their properties with regular DNA arrays, sequences in the reverse transcriptase gene (codon 74) and the protease gene of HIV-1 (codon 10) were selected. Both, the relative intensity of the signal and match/mismatch discrimination increased up to fivefold for DNA targets and up to 3-3.5-fold for RNA targets applying HNA or ANA arrays (ANA>HNA>DNA). Certainly in the new field of miRNA detection, ANA arrays could prove very beneficial and their properties should be investigated in more detail.

  18. Hidden in Plain Sight: Subtle Effects of the 8-Oxoguanine Lesion on the Structure, Dynamics, and Thermodynamics of a 15-Base-Pair Oligodeoxynucleotide Duplex†

    PubMed Central

    Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.

    2011-01-01

    The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242

  19. Evolving approach and clinical significance of detecting DNA mismatch repair deficiency in colorectal carcinoma

    PubMed Central

    Shia, Jinru

    2016-01-01

    The last two decades have seen significant advancement in our understanding of colorectal tumors with DNA mismatch repair (MMR) deficiency. The ever-emerging revelations of new molecular and genetic alterations in various clinical conditions have necessitated constant refinement of disease terminology and classification. Thus, a case with the clinical condition of hereditary non-polyposis colorectal cancer as defined by the Amsterdam criteria may be one of Lynch syndrome characterized by a germline defect in one of the several MMR genes, one of the yet-to-be-defined “Lynch-like syndrome” if there is evidence of MMR deficiency in the tumor but no detectable germline MMR defect or tumor MLH1 promoter methylation, or “familial colorectal cancer type X” if there is no evidence of MMR deficiency. The detection of these conditions carries significant clinical implications. The detection tools and strategies are constantly evolving. The Bethesda guidelines symbolize a selective approach that uses clinical information and tumor histology as the basis to select high-risk individuals. Such a selective approach has subsequently been found to have limited sensitivity, and is thus gradually giving way to the alternative universal approach that tests all newly diagnosed colorectal cancers. Notably, the universal approach also has its own limitations; its cost-effectiveness in real practice, in particular, remains to be determined. Meanwhile, technological advances such as the next-generation sequencing are offering the promise of direct genetic testing for MMR deficiency at an affordable cost probably in the near future. This article reviews the up-to-date molecular definitions of the various conditions related to MMR deficiency, and discusses the tools and strategies that have been used in detecting these conditions. Special emphasis will be placed on the evolving nature and the clinical importance of the disease definitions and the detection strategies. PMID:25716099

  20. Principles of RNA base pairing: structures and energies of the trans Watson-Crick/sugar edge base pairs.

    PubMed

    Sponer, Judit E; Spackova, Nad'a; Leszczynski, Jerzy; Sponer, Jirí

    2005-06-09

    Due to the presence of the 2'-OH hydroxyl group of ribose, RNA molecules utilize an astonishing variability of base pairing patterns to build up their structures and perform the biological functions. Many of the key RNA base pairing families have no counterparts in DNA. In this study, the trans Watson-Crick/sugar edge (trans WC/SE) RNA base pair family has been characterized using quantum chemical and molecular mechanics calculations. Gas-phase optimized geometries from density functional theory (DFT) calculations and RIMP2 interaction energies are reported for the 10 crystallographically identified trans WC/SE base pairing patterns. Further, stable structures are predicted for all of the remaining six possible members of this family not seen in RNAs so far. Among these novel six base pairs, the computations substantially refine two structures suggested earlier based on simple isosteric considerations. For two additional trans WC/SE base pairs predicted in this study, no arrangement was suggested before. Thus, our study brings a complete set of trans WC/SE base pairing patterns. The present results are also contrasted with calculations reported recently for the cis WC/SE base pair family. The computed base pair sizes are in sound correlation with the X-ray data for all WC/SE pairing patterns including both their cis and trans isomers. This confirms that the isostericity of RNA base pairs, which is one of the key factors determining the RNA sequence conservation patterns, originates in the properties of the isolated base pairs. In contrast to the cis structures, however, the isosteric subgroups of the trans WC/SE family differ not only in their H-bonding patterns and steric dimensions but also in the intrinsic strength of the intermolecular interactions. The distribution of the total interaction energy over the sugar-base and base-base contributions is controlled by the cis-trans isomerism.

  1. An MboII/FokI trimming plasmid allowing consecutive cycles of precise 1- to 12-base-pair deletions in cloned DNA.

    PubMed

    Hasan, N; Kur, J; Szybalski, W

    1989-10-30

    A novel trimming plasmid has been designed which allows, in a preprogrammed fashion, the precise deletion of up to 12 bp per cleavage cycle, from one end of a cloned fragment. The plasmid, which carries the dhfr gene, contains unique recognition sites for two class-IIS restriction enzymes, MboII and FokI, which are arranged in the form of a cassette, so that consecutive cleavages with these endonucleases, followed by blunting with mung bean nuclease (MB), will precisely delete 12 bp of adjacent cloned DNA. When either MboII or FokI is used alone (followed by MB), 1 or 4 bp are removed, respectively. The final step in the trimming cycle is religation of the plasmid with T4 ligase. After required number of cycles, plasmids were transformed into Escherichia coli C600, and transformants selected by resistance to trimethoprim. Since the MboII/FokI cassette remains intact during these operations, one can repeat the cycle, consisting of cleaving, MB blunting and religation, several times, each time removing up to 12 bp from the cloned target DNA. Examples are provided of one-, two- and three-cycle trimmings.

  2. Trifunctional fluorescent unnatural nucleoside: Label free detection of T-T/C-C base mismatches, abasic site and bulge DNA.

    PubMed

    Bag, Subhendu Sekhar; Pradhan, Manoj Kumar; Talukdar, Sangita

    2017-08-01

    The detection and targeting of both the mismatched and abasic DNA is highly important which would ultimately help in designing new diagnostics and chemotherapeutics. Furthermore, sensing and targeting the bulge sequence with a fluorescent probe would be useful to study the role of bulges in nucleic acid function or could have significant therapeutic potential. Thus, detection of specific bulges by small fluorescent molecules is an attractive research area since the past several years. Many attempts have been made to prepare such compounds. We report herein a label free strategy for the detection of pyrimidine base mismatches (T/T and C/C), sensing of abasic site, and pyrimidine base bulge DNA using an unnatural tetrazolylpyrene nucleoside ((TPy)B(Do)) as a bare fluorescent probe. The H-bonding/hydrophobic force mediated interactions allow the sensing of all three deformed DNA via an enhancement of fluorescence signal using our simple "Just-Mix and Read" strategy. The binding of the probe to all the three deformed DNA duplexes is accompanied by an increase in the thermal melting stability of the deformed DNAs. That the probe binds efficiently to the minor groove near the deformed site was evident from spectroscopic studies. All the spectral evidences open up a multitude of possibilities for using our probe, tetrazolylpyrene nucleoside, as an efficient fluorescent light-up bio-probe for label free DNA detection. Copyright © 2017. Published by Elsevier B.V.

  3. Mutation detection by mismatch binding protein, MutS, in amplified DNA: Application to the cystic fibrosis gene

    SciTech Connect

    Lishanski, A.; Ostrander, E.A.; Rine, J. |

    1994-03-29

    An experimental strategy for detecting heterozygosity in genomic DNA has been developed based on preferential binding of Escherichia coli MutS protein to DNA molecules containing mismatched bases. The binding was detected by a gel mobility-shift assay. This approach was tested by using as a model the most commonly occurring mutations within the cystic fibrosis (CFTR) gene. Genomic DNA samples were amplified with 5{prime}-end-labeled primers that bracket the site of the {Delta}F508 3-bp deletion in exon 10 of the CFTR gene. The renatured PCR products from homozygotes produced homoduplexes; the PCR products from heterozygotes produced heteroduplexes and homoduplexes (1:1). MutS protein bound more strongly to heteroduplexes that correspond to heterozygous carriers of {Delta}F508 and contain a CTT or a GAA loop in one of the strands than to homoduplexes corresponding to homozygotes. The ability of MutS protein to detect heteroduplexes in PCR-amplified DNA extended to fragments {approximately} 500 bp long. The method was also able to detect carriers of the point mutations in exon 11 of the CFTR gene by a preferential binding of MutS to single-base mismatches in PCR-amplified DNA.

  4. Nuclear magnetic resonance solution structure of an N(2)-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: intercalation from the minor groove with ruptured Watson-Crick base pairing.

    PubMed

    Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H; Cai, Yuqin; Rodriguez, Fabian A; Sayer, Jane M; Jerina, Donald M; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E

    2012-12-04

    The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the nonplanar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14 position with the exocyclic amino group of guanine. Here, we present the first nuclear magnetic resonance solution structure of a DB[a,l]P-derived adduct, the 14R-(+)-trans-anti-DB[a,l]P-N(2)-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N(2)-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3'-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3'-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE-DNA adduct conformation differs from (1) the classical intercalation motif in which Watson-Crick base pairing is intact at the lesion site and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix. The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed.

  5. NMR solution structure of an N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: Intercalation from the minor groove with ruptured Watson-Crick base pairing

    PubMed Central

    Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H.; Cai, Yuqin; Rodriguez, Fabian A.; Sayer, Jane M.; Jerina, Donald M.; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.

    2012-01-01

    The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the non-planar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely-studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14-position with the exocyclic amino group of guanine. Here, we present the first NMR solution structure of a DB[a,l]P-derived adduct, the 14R (+)-trans-anti-DB[a,l]P–N2-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N2-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3’-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3’-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE - DNA adduct conformation differs from: (1) the classical intercalation motif where Watson-Crick base-pairing is intact at the lesion site, and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix . The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed. PMID:23121427

  6. Spectroscopic and structural impact of a stem base-pair change in DNA hairpins: GTTC-ACA-GAAC versus GTAC-ACA-GTAC

    NASA Astrophysics Data System (ADS)

    Lamoureux, Michèle; Patard, Louis; Hernandez, Belen; Couesnon, Thierry; Santini, Guillaume P. H.; Cognet, Jean A. H.; Gouyette, Catherine; Cordier, Christine

    2006-09-01

    Successive investigations over the last decade have revealed and confirmed a stable loop closure in a family of d-[GTAC-5Pur6N7N-GTAC] hairpins, where 5Pur6N7N is a AAA, GAG and AXC loop (X being any nucleotide). The trinucleotide loop is characterized by a well defined 5Pur-7N mispairing mode, and by upfield chemical shifts for three sugar protons of the apical nucleotide 6N. The GTTC-ACA-GAAC DNA hairpin, of interest for its likely involvement in Vibrio cholerae genome mutations, has now been investigated. The GTAC-ACA-GTAC DNA hairpin has also been studied because it is intermediate between the other structures, as it contains the loop of the hairpin under consideration and the stem of the above family. The two hairpins with the ACA loop are stable. They show the same mispairing mode and similar upfield shifts as the previous family, but GTTC-ACA-GAAC seems to be slightly less compact than any other. GTTC-ACA-GAAC is remarkable in that it exhibits a B II character for the phosphate-ester conformation at 8Gp9A, together with a swing of the upper hairpin into the major groove that, in particular, brings 6CH1' roughly as close to 7AH2 as to 6CH6. These unexpected structural features are qualitatively deduced from 1H and 31P NMR spectra, and confirmed by Raman spectroscopy. This comparative study shows that not only the loop sequence but also the stem sequence may control hairpin structures.

  7. Mismatch repair.

    PubMed

    Fishel, Richard

    2015-10-30

    Highly conserved MutS homologs (MSH) and MutL homologs (MLH/PMS) are the fundamental components of mismatch repair (MMR). After decades of debate, it appears clear that the MSH proteins initiate MMR by recognizing a mismatch and forming multiple extremely stable ATP-bound sliding clamps that diffuse without hydrolysis along the adjacent DNA. The function(s) of MLH/PMS proteins is less clear, although they too bind ATP and are targeted to MMR by MSH sliding clamps. Structural analysis combined with recent real-time single molecule and cellular imaging technologies are providing new and detailed insight into the thermal-driven motions that animate the complete MMR mechanism.

  8. DNA Mismatch Repair Status Predicts Need for Future Colorectal Surgery for Metachronous Neoplasms in Young Individuals Undergoing Colorectal Cancer Resection.

    PubMed

    Aronson, Melyssa; Holter, Spring; Semotiuk, Kara; Winter, Laura; Pollett, Aaron; Gallinger, Steven; Cohen, Zane; Gryfe, Robert

    2015-07-01

    The treatment of colorectal cancer in young patients involves both management of the incident cancer and consideration of the possibility of Lynch syndrome and the development of metachronous colorectal cancers. This study aims to assess the prognostic role of DNA mismatch repair deficiency and extended colorectal resection for metachronous colorectal neoplasia risk in young patients with colorectal cancer. This is a retrospective review of 285 patients identified in our GI cancer registry with colorectal cancer diagnosed at 35 years or younger in the absence of polyposis. Using univariate and multivariate analysis, we assessed the prognostic role of mismatch repair deficiency and standard clinicopathologic characteristics, including the extent of resection, on the rate of developing metachronous colorectal neoplasia requiring resection. Mismatch repair deficiency was identified in biospecimens from 44% of patients and was significantly associated with an increased risk for metachronous colorectal neoplasia requiring resection (10-year cumulative risk, 13.5% ± 4.2%) compared with 56% of patients with mismatch repair-intact colorectal cancer (10-year cumulative risk, 5.8% ± 3.3%; p = 0.011). In multivariate analysis, mismatch repair deficiency was associated with a HR of 3.65 (95% CI, 1.44-9.21; p = 0.006) for metachronous colorectal neoplasia, whereas extended resection with ileorectal or ileosigmoid anastomosis significantly decreased the risk of metachronous colorectal neoplasia (HR, 0.21; 95% CI, 0.05-0.90; p = 0.036). This study had a retrospective design, and, therefore, recommendations for colorectal cancer surgery and screening were not fully standardized. Quality of life after colorectal cancer surgery was not assessed. Young patients with colorectal cancer with molecular hallmarks of Lynch syndrome were at significantly higher risk for the development of subsequent colorectal neoplasia. This risk was significantly reduced in those who underwent extended

  9. Design of enzyme-interfaced DNA logic operations (AND, OR and INHIBIT) with an assaying application for single-base mismatch.

    PubMed

    Ma, Long; Diao, Aipo

    2015-06-25

    We devised AND, OR and INHIBIT logic gates. They were based on the enzyme-induced DNA base flipping mechanism, which caused significant local conformation changes in DNA. This can be monitored via photonic signals as outputs. We also provided a prototype of a built-in biosensor capable of distinguishing single-base mismatches in a DNA duplex.

  10. The unstructured linker arms of Mlh1-Pms1 are important for interactions with DNA during mismatch repair.

    PubMed

    Plys, Aaron J; Rogacheva, Maria V; Greene, Eric C; Alani, Eric

    2012-09-14

    DNA mismatch repair (MMR) models have proposed that MSH (MutS homolog) proteins identify DNA polymerase errors while interacting with the DNA replication fork. MLH (MutL homolog) proteins (primarily Mlh1-Pms1 in baker's yeast) then survey the genome for lesion-bound MSH proteins. The resulting MSH-MLH complex formed at a DNA lesion initiates downstream steps in repair. MLH proteins act as dimers and contain long (20-30 nm) unstructured arms that connect two terminal globular domains. These arms can vary between 100 and 300 amino acids in length, are highly divergent between organisms, and are resistant to amino acid substitutions. To test the roles of the linker arms in MMR, we engineered a protease cleavage site into the Mlh1 linker arm domain of baker's yeast Mlh1-Pms1. Cleavage of the Mlh1 linker arm in vitro resulted in a defect in Mlh1-Pms1 DNA binding activity, and in vivo proteolytic cleavage resulted in a complete defect in MMR. We then generated a series of truncation mutants bearing Mlh1 and Pms1 linker arms of varying lengths. This work revealed that MMR is greatly compromised when portions of the Mlh1 linker are removed, whereas repair is less sensitive to truncation of the Pms1 linker arm. Purified complexes containing truncations in Mlh1 and Pms1 linker arms were analyzed and found to have differential defects in DNA binding that also correlated with the ability to form a ternary complex with Msh2-Msh6 and mismatch DNA. These observations are consistent with the unstructured linker domains of MLH proteins providing distinct interactions with DNA during MMR.

  11. Relevance of GC content to the conservation of DNA polymerase III/mismatch repair system in Gram-positive bacteria

    PubMed Central

    Akashi, Motohiro; Yoshikawa, Hirofumi

    2013-01-01

    The mechanism of DNA replication is one of the driving forces of genome evolution. Bacterial DNA polymerase III, the primary complex of DNA replication, consists of PolC and DnaE. PolC is conserved in Gram-positive bacteria, especially in the Firmicutes with low GC content, whereas DnaE is widely conserved in most Gram-negative and Gram-positive bacteria. PolC contains two domains, the 3′-5′exonuclease domain and the polymerase domain, while DnaE only possesses the polymerase domain. Accordingly, DnaE does not have the proofreading function; in Escherichia coli, another enzyme DnaQ performs this function. In most bacteria, the fidelity of DNA replication is maintained by 3′-5′ exonuclease and a mismatch repair (MMR) system. However, we found that most Actinobacteria (a group of Gram-positive bacteria with high GC content) appear to have lost the MMR system and chromosomes may be replicated by DnaE-type DNA polymerase III with DnaQ-like 3′-5′ exonuclease. We tested the mutation bias of Bacillus subtilis, which belongs to the Firmicutes and found that the wild type strain is AT-biased while the mutS-deletant strain is remarkably GC-biased. If we presume that DnaE tends to make mistakes that increase GC content, these results can be explained by the mutS deletion (i.e., deletion of the MMR system). Thus, we propose that GC content is regulated by DNA polymerase and MMR system, and the absence of polC genes, which participate in the MMR system, may be the reason for the increase of GC content in Gram-positive bacteria such as Actinobacteria. PMID:24062730

  12. Crosstalk between BRCA-Fanconi anemia and mismatch repair pathways prevents MSH2-dependent aberrant DNA damage responses.

    PubMed

    Peng, Min; Xie, Jenny; Ucher, Anna; Stavnezer, Janet; Cantor, Sharon B

    2014-08-01

    Several proteins in the BRCA-Fanconi anemia (FA) pathway, such as FANCJ, BRCA1, and FANCD2, interact with mismatch repair (MMR) pathway factors, but the significance of this link remains unknown. Unlike the BRCA-FA pathway, the MMR pathway is not essential for cells to survive toxic DNA interstrand crosslinks (ICLs), although MMR proteins bind ICLs and other DNA structures that form at stalled replication forks. We hypothesized that MMR proteins corrupt ICL repair in cells that lack crosstalk between BRCA-FA and MMR pathways. Here, we show that ICL sensitivity of cells lacking the interaction between FANCJ and the MMR protein MLH1 is suppressed by depletion of the upstream mismatch recognition factor MSH2. MSH2 depletion suppresses an aberrant DNA damage response, restores cell cycle progression, and promotes ICL resistance through a Rad18-dependent mechanism. MSH2 depletion also suppresses ICL sensitivity in cells deficient for BRCA1 or FANCD2, but not FANCA. Rescue by Msh2 loss was confirmed in Fancd2-null primary mouse cells. Thus, we propose that regulation of MSH2-dependent DNA damage response underlies the importance of interactions between BRCA-FA and MMR pathways.

  13. Crosstalk between BRCA-Fanconi anemia and mismatch repair pathways prevents MSH2-dependent aberrant DNA damage responses

    PubMed Central

    Peng, Min; Xie, Jenny; Ucher, Anna; Stavnezer, Janet; Cantor, Sharon B

    2014-01-01

    Several proteins in the BRCA-Fanconi anemia (FA) pathway, such as FANCJ, BRCA1, and FANCD2, interact with mismatch repair (MMR) pathway factors, but the significance of this link remains unknown. Unlike the BRCA-FA pathway, the MMR pathway is not essential for cells to survive toxic DNA interstrand crosslinks (ICLs), although MMR proteins bind ICLs and other DNA structures that form at stalled replication forks. We hypothesized that MMR proteins corrupt ICL repair in cells that lack crosstalk between BRCA-FA and MMR pathways. Here, we show that ICL sensitivity of cells lacking the interaction between FANCJ and the MMR protein MLH1 is suppressed by depletion of the upstream mismatch recognition factor MSH2. MSH2 depletion suppresses an aberrant DNA damage response, restores cell cycle progression, and promotes ICL resistance through a Rad18-dependent mechanism. MSH2 depletion also suppresses ICL sensitivity in cells deficient for BRCA1 or FANCD2, but not FANCA. Rescue by Msh2 loss was confirmed in Fancd2-null primary mouse cells. Thus, we propose that regulation of MSH2-dependent DNA damage response underlies the importance of interactions between BRCA-FA and MMR pathways. PMID:24966277

  14. Mechanism for verification of mismatched and homoduplex DNAs by nucleotides-bound MutS analyzed by molecular dynamics simulations.

    PubMed

    Ishida, Hisashi; Matsumoto, Atsushi

    2016-09-01

    In order to understand how MutS recognizes mismatched DNA and induces the reaction of DNA repair using ATP, the dynamics of the complexes of MutS (bound to the ADP and ATP nucleotides, or not) and DNA (with mismatched and matched base-pairs) were investigated using molecular dynamics simulations. As for DNA, the structure of the base-pairs of the homoduplex DNA which interacted with the DNA recognition site of MutS was intermittently disturbed, indicating that the homoduplex DNA was unstable. As for MutS, the disordered loops in the ATPase domains, which are considered to be necessary for the induction of DNA repair, were close to (away from) the nucleotide-binding sites in the ATPase domains when the nucleotides were (not) bound to MutS. This indicates that the ATPase domains changed their structural stability upon ATP binding using the disordered loop. Conformational analysis by principal component analysis showed that the nucleotide binding changed modes which have structurally solid ATPase domains and the large bending motion of the DNA from higher to lower frequencies. In the MutS-mismatched DNA complex bound to two nucleotides, the bending motion of the DNA at low frequency modes may play a role in triggering the formation of the sliding clamp for the following DNA-repair reaction step. Moreover, MM-PBSA/GBSA showed that the MutS-homoduplex DNA complex bound to two nucleotides was unstable because of the unfavorable interactions between MutS and DNA. This would trigger the ATP hydrolysis or separation of MutS and DNA to continue searching for mismatch base-pairs. Proteins 2016; 84:1287-1303. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  15. Label-free detection of DNA single-base mismatches using a simple reflectance-based optical technique.

    PubMed

    Nava, G; Ceccarello, E; Giavazzi, F; Salina, M; Damin, F; Chiari, M; Buscaglia, M; Bellini, T; Zanchetta, G

    2016-05-21

    Rapid and quantitative detection of the binding of nucleic acids to surface-immobilized probes remains a challenge in many biomedical applications. We investigated the hybridization of a set of fully complementary and defected 12-base long DNA oligomers by using the Reflective Phantom Interface (RPI), a recently developed multiplexed label-free detection technique. Based on the simple measurement of reflected light intensity, this technology enables to quantify the hybridization directly as it occurs on the surface with a sensitivity of 10 pg mm(-2). We found a strong effect of single-base mismatches and of their location on hybridization kinetics and equilibrium binding. In line with previous studies, we found that DNA-DNA binding is weaker on a surface than in the bulk. Our data indicate that this effect is a consequence of weak nonspecific binding of the probes to the surface.

  16. Mutations in the Bacillus subtilis β Clamp That Separate Its Roles in DNA Replication from Mismatch Repair▿

    PubMed Central

    Dupes, Nicole M.; Walsh, Brian W.; Klocko, Andrew D.; Lenhart, Justin S.; Peterson, Heather L.; Gessert, David A.; Pavlick, Cassie E.; Simmons, Lyle A.

    2010-01-01

    The β clamp is an essential replication sliding clamp required for processive DNA synthesis. The β clamp is also critical for several additional aspects of DNA metabolism, including DNA mismatch repair (MMR). The dnaN5 allele of Bacillus subtilis encodes a mutant form of β clamp containing the G73R substitution. Cells with the dnaN5 allele are temperature sensitive for growth due to a defect in DNA replication at 49°C, and they show an increase in mutation frequency caused by a partial defect in MMR at permissive temperatures. We selected for intragenic suppressors of dnaN5 that rescued viability at 49°C to determine if the DNA replication defect could be separated from the MMR defect. We isolated three intragenic suppressors of dnaN5 that restored growth at the nonpermissive temperature while maintaining an increase in mutation frequency. All three dnaN alleles encoded the G73R substitution along with one of three novel missense mutations. The missense mutations isolated were S22P, S181G, and E346K. Of these, S181G and E346K are located near the hydrophobic cleft of the β clamp, a common site occupied by proteins that bind the β clamp. Using several methods, we show that the increase in mutation frequency resulting from each dnaN allele is linked to a defect in MMR. Moreover, we found that S181G and E346K allowed growth at elevated temperatures and did not have an appreciable effect on mutation frequency when separated from G73R. Thus, we found that specific residue changes in the B. subtilis β clamp separate the role of the β clamp in DNA replication from its role in MMR. PMID:20453097

  17. Universal and blocking primer mismatches limit the use of high-throughput DNA sequencing for the quantitative metabarcoding of arthropods.

    PubMed

    Piñol, J; Mir, G; Gomez-Polo, P; Agustí, N

    2015-07-01

    The quantification of the biological diversity in environmental samples using high-throughput DNA sequencing is hindered by the PCR bias caused by variable primer-template mismatches of the individual species. In some dietary studies, there is the added problem that samples are enriched with predator DNA, so often a predator-specific blocking oligonucleotide is used to alleviate the problem. However, specific blocking oligonucleotides could coblock nontarget species to some degree. Here, we accurately estimate the extent of the PCR biases induced by universal and blocking primers on a mock community prepared with DNA of twelve species of terrestrial arthropods. We also compare universal and blocking primer biases with those induced by variable annealing temperature and number of PCR cycles. The results show that reads of all species were recovered after PCR enrichment at our control conditions (no blocking oligonucleotide, 45 °C annealing temperature and 40 cycles) and high-throughput sequencing. They also show that the four factors considered biased the final proportions of the species to some degree. Among these factors, the number of primer-template mismatches of each species had a disproportionate effect (up to five orders of magnitude) on the amplification efficiency. In particular, the number of primer-template mismatches explained most of the variation (~3/4) in the amplification efficiency of the species. The effect of blocking oligonucleotide concentration on nontarget species relative abundance was also significant, but less important (below one order of magnitude). Considering the results reported here, the quantitative potential of the technique is limited, and only qualitative results (the species list) are reliable, at least when targeting the barcoding COI region.

  18. AP endonuclease 1 prevents the extension of a T/G mismatch by DNA polymerase β to prevent mutations in CpGs during base excision repair.

    PubMed

    Lai, Yanhao; Jiang, Zhongliang; Zhou, Jing; Osemota, Emmanuel; Liu, Yuan

    2016-07-01

    Dynamics of DNA methylation and demethylation at CpG clusters are involved in gene regulation. CpG clusters have been identified as hot spots of mutagenesis because of their susceptibility to oxidative DNA damage. Damaged Cs and Gs at CpGs can disrupt a normal DNA methylation pattern through modulation of DNA methylation and demethylation, leading to mutations and deregulation of gene expression. DNA base excision repair (BER) plays a dual role of repairing oxidative DNA damage and mediating an active DNA demethylation pathway on CpG clusters through removal of a T/G mismatch resulting from deamination of a 5mC adjacent to a guanine that can be simultaneously damaged by oxidative stress. However, it remains unknown how BER processes clustered lesions in CpGs and what are the consequences from the repair of these lesions. In this study, we examined BER of an abasic lesion next to a DNA demethylation intermediate, the T/G mismatch in a CpG dinucleotide, and its effect on the integrity of CpGs. Surprisingly, we found that the abasic lesion completely abolished the activity of thymine DNA glycosylase (TDG) for removing the mismatched T. However, we found that APE1 could still efficiently incise the abasic lesion leaving a 3-terminus mismatched T, which was subsequently extended by pol β. This in turn resulted in a C to T transition mutation. Interestingly, we also found that APE1 3'-5' exonuclease activity efficiently removed the mismatched T, thereby preventing pol β extension of the mismatched nucleotide and the resulting mutation. Our results demonstrate a crucial role of APE1 3'-5' exonuclease activity in combating mutations in CpG clusters caused by an intermediate of DNA demethylation during BER. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. HEREDITARY, SPORADIC AND METASTATIC COLORECTAL CANCER ARE COMMONLY DRIVEN BY SPECIFIC SPECTRUMS OF DEFECTIVE DNA MISMATCH REPAIR COMPONENTS

    PubMed Central

    CARETHERS, JOHN M.

    2016-01-01

    DNA mismatch repair (MMR) is one of several human cell mechanisms utilized to repair mutable mistakes within DNA, particularly after DNA is replicated. MMR function is dependent upon heterodimerization of specific MMR proteins that can recognize base-base mispairs as well as frameshifts at microsatellite sequences, followed by the triggering of other complementary proteins that execute excision and repair or initiate cell demise if repair is futile. MMR function is compromised in specific disease states, all of which can be biochemically recognized by faulty repair of microsatellite sequences, causing microsatellite instability. Germline mutation of an MMR gene causes Lynch syndrome, the most common inherited form of colorectal cancer (CRC), and biallelic germline mutations cause the rare constitutional mismatch repair deficiency syndrome. Somatic inactivation of MMR through epigenetic mechanisms is observed in 15% of sporadic CRC, and a smaller portion of CRCs possess biallelic somatic mutations. A novel inflammation-driven nuclear-to-cytoplasmic shift of the specific MMR protein hMSH3 is seen in up to 60% of sporadic CRCs that associates with metastasis and poor patient prognosis, unlike improved outcome when MMR is genetically inactivated. The mechanism for MMR inactication as well as the component affected dictates the clinical spectrum and clinical response for patients. PMID:28066040

  20. Enhancement of RecA-mediated self-assembly in DNA nanostructures through basepair mismatches and single-strand nicks.

    PubMed

    Corbett, Sybilla Louise; Sharma, Rajan; Davies, Alexander Giles; Wälti, Christoph

    2017-01-23

    The use of DNA as a structural material for nanometre-scale construction has grown extensively over the last decades. The development of more advanced DNA-based materials would benefit from a modular approach enabling the direct assembly of additional elements onto nanostructures after fabrication. RecA-based nucleoprotein filaments encapsulating short ssDNA have been demonstrated as a tool for highly efficient and fully programmable post-hoc patterning of duplex DNA scaffold. However, the underlying assembly process is not fully understood, in particular when patterning complex DNA topologies. Here, we report the effect of basepair-mismatched regions and single-strand nicks in the double-stranded DNA scaffold on the yield of RecA-based assembly. Significant increases in assembly yield are observed upon the introduction of unpaired basepairs directly adjacent to the assembly region. However, when the unpaired regions were introduced further from the assembly site the assembly yield initially decreased as the length of the unpaired region was increased. These results suggest that an unpaired region acts as a kinetic trap for RecA-based nucleoprotein filaments, impeding the assembly mechanism. Conversely, when the unpaired region is located directly adjacent to the assembly site, it leads to an increase in efficiency of RecA patterning owing to increased breathing of the assembly site.

  1. Enhancement of RecA-mediated self-assembly in DNA nanostructures through basepair mismatches and single-strand nicks

    NASA Astrophysics Data System (ADS)

    Corbett, Sybilla Louise; Sharma, Rajan; Davies, Alexander Giles; Wälti, Christoph

    2017-01-01

    The use of DNA as a structural material for nanometre-scale construction has grown extensively over the last decades. The development of more advanced DNA-based materials would benefit from a modular approach enabling the direct assembly of additional elements onto nanostructures after fabrication. RecA-based nucleoprotein filaments encapsulating short ssDNA have been demonstrated as a tool for highly efficient and fully programmable post-hoc patterning of duplex DNA scaffold. However, the underlying assembly process is not fully understood, in particular when patterning complex DNA topologies. Here, we report the effect of basepair-mismatched regions and single-strand nicks in the double-stranded DNA scaffold on the yield of RecA-based assembly. Significant increases in assembly yield are observed upon the introduction of unpaired basepairs directly adjacent to the assembly region. However, when the unpaired regions were introduced further from the assembly site the assembly yield initially decreased as the length of the unpaired region was increased. These results suggest that an unpaired region acts as a kinetic trap for RecA-based nucleoprotein filaments, impeding the assembly mechanism. Conversely, when the unpaired region is located directly adjacent to the assembly site, it leads to an increase in efficiency of RecA patterning owing to increased breathing of the assembly site.

  2. Enhancement of RecA-mediated self-assembly in DNA nanostructures through basepair mismatches and single-strand nicks

    PubMed Central

    Corbett, Sybilla Louise; Sharma, Rajan; Davies, Alexander Giles; Wälti, Christoph

    2017-01-01

    The use of DNA as a structural material for nanometre-scale construction has grown extensively over the last decades. The development of more advanced DNA-based materials would benefit from a modular approach enabling the direct assembly of additional elements onto nanostructures after fabrication. RecA-based nucleoprotein filaments encapsulating short ssDNA have been demonstrated as a tool for highly efficient and fully programmable post-hoc patterning of duplex DNA scaffold. However, the underlying assembly process is not fully understood, in particular when patterning complex DNA topologies. Here, we report the effect of basepair-mismatched regions and single-strand nicks in the double-stranded DNA scaffold on the yield of RecA-based assembly. Significant increases in assembly yield are observed upon the introduction of unpaired basepairs directly adjacent to the assembly region. However, when the unpaired regions were introduced further from the assembly site the assembly yield initially decreased as the length of the unpaired region was increased. These results suggest that an unpaired region acts as a kinetic trap for RecA-based nucleoprotein filaments, impeding the assembly mechanism. Conversely, when the unpaired region is located directly adjacent to the assembly site, it leads to an increase in efficiency of RecA patterning owing to increased breathing of the assembly site. PMID:28112216

  3. Aberrant DNA Methylation in Hereditary Non-Polyposis Colorectal Cancer without Mismatch Repair Deficiency

    PubMed Central

    Goel, Ajay; Xicola, Rosa M.; Nguyen, Thuy-Phuong; Doyle, Brian J; Sohn, Vanessa R.; Bandipalliam, Prathap; Reyes, Josep; Cordero, Carmen; Balaguer, Francesc; Castells, Antoni; Jover, Rodrigo; Andreu, Montserrat; Syngal, Sapna; Boland, C. Richard; Llor, Xavier

    2010-01-01

    Background & Aims Approximately half of the families that fulfill Amsterdam criteria for Lynch syndrome or hereditary non-polyposis colorectal cancer (HNPCC) do not have evidence of the germline mismatch repair (MMR) gene mutations that define this syndrome and result in microsatellite instability. The carcinogenic pathways and the best diagnostic approaches to detect microsatellite stable (MSS) HNPCC tumors are unclear. We investigated the contribution of epigenetic alterations to development of MSS HNPCC tumors. Methods Colorectal cancers were divided in four groups: 1. Microsatellite stable, Amsterdam positive (MSS HNPCC) (N=22); 2. Lynch syndrome cancers (identified mismatch repair mutations) (N=21); 3. Sporadic MSS (N=92); 4. Sporadic MSI (N=46). Methylation status was evaluated for CACNAG1, SOCS1, RUNX3, NEUROG1, MLH1, and LINE-1. KRAS and BRAF mutations status was analyzed. Results MSS HNPCC tumors displayed a significantly lower degree of LINE-1 methylation, marker for global methylation, than any other group. Whereas most MSS HNPCC tumors had some degree of CpG island methylation, none presented a high index of methylation. MSS HNPCC tumors had KRAS mutations exclusively in codon 12, but none harbored V600E BRAF mutations. Conclusions Tumors from Amsterdam-positive patients without mismatch repair deficiency (MSS HNPCC) have certain molecular features, including global hypomethylation that distinguish them from all other colorectal cancers. These characteristics could have an important impact on tumor behavior or treatment response. Studies are underway to further assess the cause and effects of these features. PMID:20102720

  4. pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

    PubMed

    Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

    2009-11-23

    Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

  5. Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

    PubMed

    Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-03-14

    We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

  6. Structural basis of transcription: mismatch-specific fidelity mechanisms and paused RNA polymerase II with frayed RNA.

    PubMed

    Sydow, Jasmin F; Brueckner, Florian; Cheung, Alan C M; Damsma, Gerke E; Dengl, Stefan; Lehmann, Elisabeth; Vassylyev, Dmitry; Cramer, Patrick

    2009-06-26

    We show that RNA polymerase (Pol) II prevents erroneous transcription in vitro with different strategies that depend on the type of DNARNA base mismatch. Certain mismatches are efficiently formed but impair RNA extension. Other mismatches allow for RNA extension but are inefficiently formed and efficiently proofread by RNA cleavage. X-ray analysis reveals that a TU mismatch impairs RNA extension by forming a wobble base pair at the Pol II active center that dissociates the catalytic metal ion and misaligns the RNA 3' end. The mismatch can also stabilize a paused state of Pol II with a frayed RNA 3' nucleotide. The frayed nucleotide binds in the Pol II pore either parallel or perpendicular to the DNA-RNA hybrid axis (fraying sites I and II, respectively) and overlaps the nucleoside triphosphate (NTP) site, explaining how it halts transcription during proofreading, before backtracking and RNA cleavage.

  7. Repair of mismatched basepairs in mammalian DNA. Progress report, March 1, 1990--February 28, 1991

    SciTech Connect

    Taylor, J.H.; Hare, J.T.

    1991-08-01

    We have concentrated on three specific areas of our research plan. Our greatest emphasis is on the role of single strand nicks in influencing template strand selection in mismatch repair. We have found, that the ability of a nick in one strand to influence which strand is repaired is not a simple function of distance from the mismatched site but rather that an hot spot where a nick is more likely to have an influence can exist. The second line was production of single-genotype heteroduplexes in order to examine independently the repair of T/G and A/C mispairs within the same sequence context as in our mixed mispair preparations. We have shown preparations of supercoiled heteroduplex can be prepared that were exclusively T/G or exclusively A/C at the mispair site. The third effort has been to understand the difference in repair bias of different cell lines or different transfection conditions as it may relate to different repair systems in the cell. We have identified some of the sources of variation, including cell cycle position. We hope to continue this work to more precisely identify the phase of the cell cycle.

  8. A Modified Protocol with Improved Detection Rate for Mis-Matched Donor HLA from Low Quantities of DNA in Urine Samples from Kidney Graft Recipients.

    PubMed

    Kwok, Janette; Choi, Leo C W; Ho, Jenny C Y; Chan, Gavin S W; Mok, Maggie M Y; Lam, Man-Fei; Chak, Wai-Leung; Cheuk, Au; Chau, Ka-Foon; Tong, Matthew; Chan, Kwok-Wah; Chan, Tak-Mao

    2016-01-01

    Urine from kidney transplant recipient has proven to be a viable source for donor DNA. However, an optimized protocol would be required to determine mis-matched donor HLA specificities in view of the scarcity of DNA obtained in some cases. In this study, fresh early morning urine specimens were obtained from 155 kidney transplant recipients with known donor HLA phenotype. DNA was extracted and typing of HLA-A, B and DRB1 loci by polymerase chain reaction-specific sequence primers was performed using tailor-made condition according to the concentration of extracted DNA. HLA typing of DNA extracted from urine revealed both recipient and donor HLA phenotypes, allowing the deduction of the unknown donor HLA and hence the degree of HLA mis-match. By adopting the modified procedures, mis-matched donor HLA phenotypes were successfully deduced in all of 35 tested urine samples at DNA quantities spanning the range of 620-24,000 ng. This urine-based method offers a promising and reliable non-invasive means for the identification of mis-matched donor HLA antigens in kidney transplant recipients with unknown donor HLA phenotype or otherwise inadequate donor information.

  9. A Modified Protocol with Improved Detection Rate for Mis-Matched Donor HLA from Low Quantities of DNA in Urine Samples from Kidney Graft Recipients

    PubMed Central

    Kwok, Janette; Choi, Leo C. W.; Ho, Jenny C. Y.; Chan, Gavin S. W.; Mok, Maggie M. Y.; Lam, Man-Fei; Chak, Wai-Leung; Cheuk, Au; Chau, Ka-Foon; Tong, Matthew; Chan, Kwok-Wah; Chan, Tak-Mao

    2016-01-01

    Background Urine from kidney transplant recipient has proven to be a viable source for donor DNA. However, an optimized protocol would be required to determine mis-matched donor HLA specificities in view of the scarcity of DNA obtained in some cases. Methods In this study, fresh early morning urine specimens were obtained from 155 kidney transplant recipients with known donor HLA phenotype. DNA was extracted and typing of HLA-A, B and DRB1 loci by polymerase chain reaction-specific sequence primers was performed using tailor-made condition according to the concentration of extracted DNA. Results HLA typing of DNA extracted from urine revealed both recipient and donor HLA phenotypes, allowing the deduction of the unknown donor HLA and hence the degree of HLA mis-match. By adopting the modified procedures, mis-matched donor HLA phenotypes were successfully deduced in all of 35 tested urine samples at DNA quantities spanning the range of 620–24,000 ng. Conclusions This urine-based method offers a promising and reliable non-invasive means for the identification of mis-matched donor HLA antigens in kidney transplant recipients with unknown donor HLA phenotype or otherwise inadequate donor information. PMID:27861530

  10. Role of the 5' --> 3' exonuclease and Klenow fragment of Escherichia coli DNA polymerase I in base mismatch repair.

    PubMed

    Imai, Masaru; Tago, Yu-ichiro; Ihara, Makoto; Kawata, Masakado; Yamamoto, Kazuo

    2007-08-01

    We have previously demonstrated that the Escherichia coli strain mutS DeltapolA had a higher rate of transition and minus frameshift mutations than mutS or DeltapolA strains. We argued that DNA polymerase I (PolI) corrects transition mismatches. PolI, encoded by the polA gene, possesses Klenow and 5' --> 3' exonuclease domains. In the present study, rates of mutation were found to be higher in Klenow-defective mutS strains and 5' --> 3' exonuclease-defective mutS strains than mutS or polA strains. The Klenow-defective or 5' --> 3' exonuclease-defective mutS strains showed a marked increase in transition mutations. Sites of transition mutations in mutS, Klenow-defective mutS and 5' --> 3' exonuclease-defective mutS strains are different. Thus, it is suggested that, in addition to mutS function, both the Klenow and 5' --> 3' exonuclease domains are involved in the decrease of transition mutations. Transition hot and warm spots in mutS+ polA+ strains were found to differ from those in mutS and mutS DeltapolA strains. We thus argue that all the spontaneous transition mutations in the wild-type strain do not arise from transition mismatches left unrepaired by the MutS system or MutS PolI system.

  11. Label-free DNA hybridization detection and single base-mismatch discrimination using CE-ICP-MS assay.

    PubMed

    Li, Yan; Sun, Shao-kai; Yang, Jia-lin; Jiang, Yan

    2011-12-07

    Detecting a specific DNA sequence and discriminating single base-mismatch is critical to clinical diagnosis, paternity testing, forensic sciences, food and drug industry, pathology, genetics, environmental monitoring, and anti-bioterrorism. To this end, capillary electrophoresis (CE) coupled with the inductively coupled plasma mass spectrometry (ICP-MS) method is developed using the displacing interaction between the target ssDNA and the competitor Hg(2+) for the first time. The thymine-rich capture ssDNA 1 is interacted with the competitor Hg(2+), forming an assembled complex in a hairpin-structure between the thymine bases arrangement at both sides of the capture ssDNA 1. In the presence of a target ssDNA with stronger affinity than that of the competitor Hg(2+), the energetically favorable hybridization between capture ssDNA 1 and the target ssDNA destroys the hairpin-structure and releases the competitor as free Hg(2+), which was then read out and accurately quantified by CE-ICP-MS assay. Under the optimal CE separation conditions, free Hg(2+) ions and its capture ssDNA 1 adduct were baseline separated and detected on-line by ICP-MS; the increased peak intensity of free Hg(2+) against the concentration of perfectly complementary target ssDNA was linear over the concentration range of 30-600 nmol L(-1) with a limit of detection of 8 nmol L(-1) (3s, n = 11) in the pre-incubated mixture containing 1 μmol L(-1) Hg(2+) and 0.2 μmol L(-1) capture ssDNA 1. This new assay method is simple in design since any target ssDNA binding can in principle result in free Hg(2+) release by 6-fold Hg(2+) signal amplification, avoiding oligonucleotide labeling or assistance by excess signal transducer and signal reporter to read out the target. Due to element-specific detection of ICP-MS in our assay procedure, the interference from the autofluorescence of substrata was eliminated.

  12. DPT tautomerisation of the G·A(syn) and A*·G*(syn) DNA mismatches: a QM/QTAIM combined atomistic investigation.

    PubMed

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2014-05-21

    By applying a combined QM and QTAIM atomistic computational approach we have established for the first time that the G·A(syn) and A*·G*(syn) DNA mismatches (rare tautomers are marked with an asterisk), causing spontaneous transversions with substantially various probabilities, radically differ from each other in their ability to tautomerise through the double proton transfer (DPT). The A*·G*(syn) mismatch tautomerises quite easily (ΔΔG(TS) ≈ 4·kT at room temperature) into the A·G*(syn) mismatch through the asynchronous concerted mechanism, whereas the G·A(syn) base mispair does not tautomerise via the DPT at all, since there is no local minimum corresponding to the tautomerised G*·A*(syn) mismatch on the potential energy surface. It was established that the A·G*(syn) base mispair is a dynamically unstable H-bonded complex with an extremely short lifetime of 2.17 × 10(-13) s. Consequently, the obtained results allow us to believe that spontaneous or forced dissociation of both the G·A(syn) and A*·G*(syn) DNA mismatches by the DNA-polymerase occurs with the preservation of the tautomeric status of the bases.

  13. Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs

    NASA Technical Reports Server (NTRS)

    Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.

    2011-01-01

    We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

  14. Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs

    NASA Technical Reports Server (NTRS)

    Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.

    2011-01-01

    We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

  15. New Therapeutic Opportunities Based on DNA Mismatch Repair and BRAF Status in Metastatic Colorectal Cancer.

    PubMed

    Cohen, Romain; Svrcek, Magali; Dreyer, Chantal; Cervera, Pascale; Duval, Alex; Pocard, Marc; Fléjou, Jean-François; de Gramont, Aimery; André, Thierry

    2016-03-01

    Recently, colorectal cancer (CRC) subtyping consortium identified four consensus molecular subtypes (CMS1-4). CMS1 is enriched for deficient mismatch repair (dMMR) and BRAF (V600E) tumors. Intriguingly, this subtype has better relapse-free survival but worse overall survival after relapse compared with the other subtypes. Growing evidence is accumulating on the benefit of specific therapeutic strategies such as immune checkpoint inhibition therapy in dMMR tumors and mitogen-activated protein kinase (MAPK) pathway targeted therapy in tumors harboring BRAF (V600E) mutation. After reviewing dMMR prognostic value, immune checkpoints as major targets for dMMR carcinomas will be highlighted. Following, BRAF (V600E) prognostic impact will be reviewed and therapeutic strategies with the combination of cytotoxic agents and especially the combinations of BRAF and MAPK inhibitors will be discussed.

  16. Kinetics of Mismatch Formation opposite Lesions by the Replicative DNA Polymerase from Bacteriophage RB69

    SciTech Connect

    Hogg, Matthew; Rudnicki, Jean; Midkiff, John; Reha-Krantz, Linda; Doubli, Sylvie; Wallace, Susan S.

    2010-04-12

    The fidelity of DNA replication is under constant threat from the formation of lesions within the genome. Oxidation of DNA bases leads to the formation of altered DNA bases such as 8-oxo-7,8-dihydroguanine, commonly called 8-oxoG, and 2-hydroxyadenenine, or 2-OHA. In this work we have examined the incorporation kinetics opposite these two oxidatively derived lesions as well as an abasic site analogue by the replicative DNA polymerase from bacteriophage RB69. We compared the kinetic parameters for both wild type and the low fidelity L561A variant. While nucleotide incorporation rates (k{sub pol}) were generally higher for the variant, the presence of a lesion in the templating position reduced the ability of both the wild-type and variant DNA polymerases to form ternary enzyme-DNA-dNTP complexes. Thus, the L561A substitution does not significantly affect the ability of the RB69 DNA polymerase to recognize damaged DNA; instead, the mutation increases the probability that nucleotide incorporation will occur. We have also solved the crystal structure of the L561A variant forming an 8-oxoG {center_dot} dATP mispair and show that the propensity for forming this mispair depends on an enlarged polymerase active site.

  17. Identification of Polycomb Group Protein EZH2-Mediated DNA Mismatch Repair Gene MSH2 in Human Uterine Fibroids.

    PubMed

    Yang, Qiwei; Laknaur, Archana; Elam, Lelyand; Ismail, Nahed; Gavrilova-Jordan, Larisa; Lue, John; Diamond, Michael P; Al-Hendy, Ayman

    2016-10-01

    Uterine fibroids (UFs) are benign smooth muscle neoplasms affecting up to 70% of reproductive age women. Treatment of symptomatic UFs places a significant economic burden on the US health-care system. Several specific genetic abnormalities have been described as etiologic factors of UFs, suggesting that a low DNA damage repair capacity may be involved in the formation of UF. In this study, we used human fibroid and adjacent myometrial tissues, as well as an in vitro cell culture model, to evaluate the expression of MutS homolog 2 (MSH2), which encodes a protein belongs to the mismatch repair system. In addition, we deciphered the mechanism by which polycomb repressive complex 2 protein, EZH2, deregulates MSH2 in UFs. The RNA expression analysis demonstrated the deregulation of MSH2 expression in UF tissues in comparison to its adjacent myometrium. Notably, protein levels of MSH2 were upregulated in 90% of fibroid tissues (9 of 10) as compared to matched adjacent myometrial tissues. Human fibroid primary cells treated with 3-deazaneplanocin A (DZNep), chemical inhibitor of EZH2, exhibited a significant increase in MSH2 expression (P < .05). Overexpression of EZH2 using an adenoviral vector approach significantly downregulated the expression of MSH2 (P < .05). Chromatin immunoprecipitation assay demonstrated that enrichment of H3K27me3 in promoter regions of MSH2 was significantly decreased in DZNep-treated fibroid cells as compared to vehicle control. These data suggest that EZH2-H3K27me3 regulatory mechanism dynamically changes the expression levels of DNA mismatch repair gene MSH2, through epigenetic mark H3K27me3. MSH2 may be considered as a marker for early detection of UFs. © The Author(s) 2016.

  18. Cyclin E and histone H3 levels are regulated by 5-fluorouracil in a DNA mismatch repair-dependent manner

    PubMed Central

    Chung, Heekyung; Chaudhry, Joy; Lopez, Claudia G

    2010-01-01

    Several studies indicate that the DNA mismatch repair (MMR) system may trigger cytotoxicity upon 5-fluorouracil (5-FU) recognition, but signaling pathways regulated by MMR in response to 5-FU are unknown. We hypothesize that recognition of 5-FU in DNA by MMR proteins trigger specific signaling cascades that results in slowing of the cell cycle and cell death. Whole human genome cDNA microarrays were used to examine relative signaling responses induced in MMR-proficient cells after 5-FU (5 µM) treatment for 24 hours. Analysis revealed 43 pathways differentially affected by 5-FU compared to control (p < 0.05), including cyclin and cell cycle regulation involving G1-S cell cycle transition, activation of Src, MAP K, p53 and base excision repair. In particular, 5-FU upregulated cyclins E1 and E2 (≥1.4-fold) and downregulated cdc25C, cyclins B1 and B2, histone H2A, H2B and H3 (≤-1.4-fold) over control. Cell cycle analysis revealed a G1/S arrest by 5-FU that was congruent with increased cyclin E and decreased cdc25C protein expression. Importantly, with knockdown of hMLH1 and hMSH2, we observed that decreased histone H3 expression by 5-FU was dependent on hMLH1. Additionally, 5-FU treatment dramatically decreased levels of several histone H3 modifications. Our data suggest that 5-FU induces a G1/S arrest by regulating cyclin E and cdc25C expression and MMR recognition of 5-FU in DNA may modulate cyclin E to affect the cell cycle. Furthermore, MMR recognition of 5-FU reduces histone H3 levels that could be related to DNA access by proteins and/or cell death during the G1/S phase of the cell cycle. PMID:20930505

  19. DNA mismatch repair deficiency and hereditary syndromes in Latino patients with colorectal cancer.

    PubMed

    Ricker, Charité N; Hanna, Diana L; Peng, Cheng; Nguyen, Nathalie T; Stern, Mariana C; Schmit, Stephanie L; Idos, Greg E; Patel, Ravi; Tsai, Steven; Ramirez, Veronica; Lin, Sonia; Shamasunadara, Vinay; Barzi, Afsaneh; Lenz, Heinz-Josef; Figueiredo, Jane C

    2017-10-01

    The landscape of hereditary syndromes and clinicopathologic characteristics among US Latino/Hispanic individuals with colorectal cancer (CRC) remains poorly understood. A total of 265 patients with CRC who were enrolled in the Hispanic Colorectal Cancer Study were included in the current study. Information regarding CRC risk factors was elicited through interviews, and treatment and survival data were abstracted from clinical charts. Tumor studies and germline genetic testing results were collected from medical records or performed using standard molecular methods. The mean age of the patients at the time of diagnosis was 53.7 years (standard deviation, 10.3 years), and 48.3% were female. Overall, 21.2% of patients reported a first-degree or second-degree relative with CRC; 3.4% met Amsterdam I/II criteria. With respect to Bethesda guidelines, 38.5% of patients met at least 1 criterion. Of the 161 individuals who had immunohistochemistry and/or microsatellite instability testing performed, 21 (13.0%) had mismatch repair (MMR)-deficient (dMMR) tumors. dMMR tumors were associated with female sex (61.9%), earlier age at the time of diagnosis (50.4 ± 12.4 years), proximal location (61.9%), and first-degree (23.8%) or second-degree (9.5%) family history of CRC. Among individuals with dMMR tumors, 13 (61.9%) had a germline MMR mutation (MutL homolog 1 [MLH1] in 6 patients; MutS homolog 2 [MSH2] in 4 patients; MutS homolog 6 [MHS6] in 2 patients; and PMS1 homolog 2, mismatch repair system component [PMS2] in 1 patient). The authors identified 2 additional MLH1 mutation carriers by genetic testing who had not received immunohistochemistry/microsatellite instability testing. In total, 5.7% of the entire cohort were confirmed to have Lynch syndrome. In addition, 6 individuals (2.3%) had a polyposis phenotype. The percentage of dMMR tumors noted among Latino individuals (13%) is similar to estimates in non-Hispanic white individuals. In the current study, the majority of

  20. Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

    PubMed

    Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

    2017-03-20

    The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H2···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R1ρ) experiments. An (15)N R1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H2···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

  1. Selenium compounds activate ATM-dependent DNA damage responses via the mismatch repair protein hMLH1 in colorectal cancer cells

    USDA-ARS?s Scientific Manuscript database

    Epidemiological and animal studies indicate that selenium supplementation suppresses risk of colorectal and other cancers. The majority of colorectal cancers are characterized by a defective DNA mismatch repair (MMR) process. Here, we have employed the MMR-deficient HCT 116 colorectal cancer cells ...

  2. Arsenic Inhibits DNA Mismatch Repair by Promoting EGFR Expression and PCNA Phosphorylation*

    PubMed Central

    Tong, Dan; Ortega, Janice; Kim, Christine; Huang, Jian; Gu, Liya; Li, Guo-Min

    2015-01-01

    Both genotoxic and non-genotoxic chemicals can act as carcinogens. However, while genotoxic compounds lead directly to mutations that promote unregulated cell growth, the mechanism by which non-genotoxic carcinogens lead to cellular transformation is poorly understood. Using a model non-genotoxic carcinogen, arsenic, we show here that exposure to arsenic inhibits mismatch repair (MMR) in human cells, possibly through its ability to stimulate epidermal growth factor receptor (EGFR)-dependent tyrosine phosphorylation of proliferating cellular nuclear antigen (PCNA). HeLa cells exposed to exogenous arsenic demonstrate a dose- and time-dependent increase in the levels of EGFR and tyrosine 211-phosphorylated PCNA. Cell extracts derived from arsenic-treated HeLa cells are defective in MMR, and unphosphorylated recombinant PCNA restores normal MMR activity to these extracts. These results suggest a model in which arsenic induces expression of EGFR, which in turn phosphorylates PCNA, and phosphorylated PCNA then inhibits MMR, leading to increased susceptibility to carcinogenesis. This study suggests a putative novel mechanism of action for arsenic and other non-genotoxic carcinogens. PMID:25907674

  3. Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

    PubMed

    Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

    2009-03-18

    It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids.