Biswas, Kristi; Taylor, Michael W.; Gear, Kim
2017-01-01
The application of high-throughput, next-generation sequencing technologies has greatly improved our understanding of the human oral microbiome. While deciphering this diverse microbial community using such approaches is more accurate than traditional culture-based methods, experimental bias introduced during critical steps such as DNA extraction may compromise the results obtained. Here, we systematically evaluate four commonly used microbial DNA extraction methods (MoBio PowerSoil® DNA Isolation Kit, QIAamp® DNA Mini Kit, Zymo Bacterial/Fungal DNA Mini PrepTM, phenol:chloroform-based DNA isolation) based on the following criteria: DNA quality and yield, and microbial community structure based on Illumina amplicon sequencing of the V3–V4 region of the 16S rRNA gene of bacteria and the internal transcribed spacer (ITS) 1 region of fungi. Our results indicate that DNA quality and yield varied significantly with DNA extraction method. Representation of bacterial genera in plaque and saliva samples did not significantly differ across DNA extraction methods and DNA extraction method showed no effect on the recovery of fungal genera from plaque. By contrast, fungal diversity from saliva was affected by DNA extraction method, suggesting that not all protocols are suitable to study the salivary mycobiome. PMID:28099455
Davoren, Jon; Vanek, Daniel; Konjhodzić, Rijad; Crews, John; Huffine, Edwin; Parsons, Thomas J.
2007-01-01
Aim To quantitatively compare a silica extraction method with a commonly used phenol/chloroform extraction method for DNA analysis of specimens exhumed from mass graves. Methods DNA was extracted from twenty randomly chosen femur samples, using the International Commission on Missing Persons (ICMP) silica method, based on Qiagen Blood Maxi Kit, and compared with the DNA extracted by the standard phenol/chloroform-based method. The efficacy of extraction methods was compared by real time polymerase chain reaction (PCR) to measure DNA quantity and the presence of inhibitors and by amplification with the PowerPlex 16 (PP16) multiplex nuclear short tandem repeat (STR) kit. Results DNA quantification results showed that the silica-based method extracted on average 1.94 ng of DNA per gram of bone (range 0.25-9.58 ng/g), compared with only 0.68 ng/g by the organic method extracted (range 0.0016-4.4880 ng/g). Inhibition tests showed that there were on average significantly lower levels of PCR inhibitors in DNA isolated by the organic method. When amplified with PP16, all samples extracted by silica-based method produced 16 full loci profiles, while only 75% of the DNA extracts obtained by organic technique amplified 16 loci profiles. Conclusions The silica-based extraction method showed better results in nuclear STR typing from degraded bone samples than a commonly used phenol/chloroform method. PMID:17696302
Studies on the formation and stability of triplex DNA using fluorescence correlation spectroscopy.
Hu, Hongyan; Huang, Xiangyi; Ren, Jicun
2016-05-01
Triplex DNA has become one of the most useful recognition motifs in the design of new molecular biology tools, therapeutic agents and sophisticated DNA-based nanomaterials because of its direct recognition of natural double-stranded DNA. In this paper, we developed a sensitive and microscale method to study the formation and stability characterization of triplex DNA using fluorescence correlation spectroscopy (FCS). The principle of this method is mainly based on the excellent capacity of FCS for sensitively distinguishing between free single-strand DNA (ssDNA) fluorescent probes and fluorescent probe-double-strand DNA (dsDNA) hybridized complexes. First, we systematically investigated the experimental conditions of triplex DNA formation. Then, we evaluated the equilibrium association constants (K(a)) under different ssDNA probe lengths, composition and pH. Finally, we used FCS to measure the hybridization fraction of a 20-mer perfectly matched ssDNA probe and three single-base mismatched ssDNA probes with 146-mer dsDNA. Our data illustrated that FCS is a useful tool for the direct determination of the thermodynamic parameters of triplex DNA formation and discrimination of a single-base mismatch of triplex DNA without denaturation. Compared with current methods, our method is characterized by high sensitivity, good universality and small sample and reagent requirements. More importantly, our method has the potential to become a platform for triplex DNA research in vitro. Copyright © 2015 John Wiley & Sons, Ltd.
PCR-based detection of a rare linear DNA in cell culture.
Saveliev, Sergei V.
2002-11-11
The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 10(7) or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.
PCR-based detection of a rare linear DNA in cell culture
2002-01-01
The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 107 or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials. PMID:12734566
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu, Liyou; Yi, T. Y.; Van Nostrand, Joy
Phylogenetic analyses were done for the Shewanella strains isolated from Baltic Sea (38 strains), US DOE Hanford Uranium bioremediation site [Hanford Reach of the Columbia River (HRCR), 11 strains], Pacific Ocean and Hawaiian sediments (8 strains), and strains from other resources (16 strains) with three out group strains, Rhodopseudomonas palustris, Clostridium cellulolyticum, and Thermoanaerobacter ethanolicus X514, using DNA relatedness derived from WCGA-based DNA-DNA hybridizations, sequence similarities of 16S rRNA gene and gyrB gene, and sequence similarities of 6 loci of Shewanella genome selected from a shared gene list of the Shewanella strains with whole genome sequenced based on the averagemore » nucleotide identity of them (ANI). The phylogenetic trees based on 16S rRNA and gyrB gene sequences, and DNA relatedness derived from WCGA hybridizations of the tested Shewanella strains share exactly the same sub-clusters with very few exceptions, in which the strains were basically grouped by species. However, the phylogenetic analysis based on DNA relatedness derived from WCGA hybridizations dramatically increased the differentiation resolution at species and strains level within Shewanella genus. When the tree based on DNA relatedness derived from WCGA hybridizations was compared to the tree based on the combined sequences of the selected functional genes (6 loci), we found that the resolutions of both methods are similar, but the clustering of the tree based on DNA relatedness derived from WMGA hybridizations was clearer. These results indicate that WCGA-based DNA-DNA hybridization is an idea alternative of conventional DNA-DNA hybridization methods and it is superior to the phylogenetics methods based on sequence similarities of single genes. Detailed analysis is being performed for the re-classification of the strains examined.« less
Wei, Wei; Gao, Chunyan; Xiong, Yanxiang; Zhang, Yuanjian; Liu, Songqin; Pu, Yuepu
2015-01-01
DNA methylation plays an important role in many biological events and is associated with various diseases. Most traditional methods for detection of DNA methylation are based on the complex and expensive bisulfite method. In this paper, we report a novel fluorescence method to detect DNA and DNA methylation based on graphene oxide (GO) and restriction endonuclease HpaII. The skillfully designed probe DNA labeled with 5-carboxyfluorescein (FAM) and optimized GO concentration keep the probe/target DNA still adsorbed on the GO. After the cleavage action of HpaII the labeled FAM is released from the GO surface and its fluorescence recovers, which could be used to detect DNA in the linear range of 50 pM-50 nM with a detection limit of 43 pM. DNA methylation induced by transmethylase (Mtase) or other chemical reagents prevents HpaII from recognizing and cleaving the specific site; as a result, fluorescence cannot recover. The fluorescence recovery efficiency is closely related to the DNA methylation level, which can be used to detect DNA methylation by comparing it with the fluorescence in the presence of intact target DNA. The method for detection of DNA and DNA methylation is simple, reliable and accurate. Copyright © 2014 Elsevier B.V. All rights reserved.
Sato, Y; Sugie, R; Tsuchiya, B; Kameya, T; Natori, M; Mukai, K
2001-12-01
To obtain an adequate quality and quantity of DNA from formalin-fixed and paraffin-embedded tissue, six different DNA extraction methods were compared. Four methods used deparaffinization by xylene followed by proteinase K digestion and phenol-chloroform extraction. The temperature of the different steps was changed to obtain higher yields and improved quality of extracted DNA. The remaining two methods used microwave heating for deparaffinization. The best DNA extraction method consisted of deparaffinization by microwave irradiation, protein digestion with proteinase K at 48 degrees C overnight, and no further purification steps. By this method, the highest DNA yield was obtained and the amplification of a 989-base pair beta-globin gene fragment was achieved. Furthermore, DNA extracted by means of this procedure from five gastric carcinomas was successfully used for single strand conformation polymorphism and direct sequencing assays of the beta-catenin gene. Because the microwave-based DNA extraction method presented here is simple, has a lower contamination risk, and results in a higher yield of DNA compared with the ordinary organic chemical reagent-based extraction method, it is considered applicable to various clinical and basic fields.
Metallic Nanostructures Based on DNA Nanoshapes
Shen, Boxuan; Tapio, Kosti; Linko, Veikko; Kostiainen, Mauri A.; Toppari, Jari Jussi
2016-01-01
Metallic nanostructures have inspired extensive research over several decades, particularly within the field of nanoelectronics and increasingly in plasmonics. Due to the limitations of conventional lithography methods, the development of bottom-up fabricated metallic nanostructures has become more and more in demand. The remarkable development of DNA-based nanostructures has provided many successful methods and realizations for these needs, such as chemical DNA metallization via seeding or ionization, as well as DNA-guided lithography and casting of metallic nanoparticles by DNA molds. These methods offer high resolution, versatility and throughput and could enable the fabrication of arbitrarily-shaped structures with a 10-nm feature size, thus bringing novel applications into view. In this review, we cover the evolution of DNA-based metallic nanostructures, starting from the metallized double-stranded DNA for electronics and progress to sophisticated plasmonic structures based on DNA origami objects. PMID:28335274
DNA-based identification methods could increase the ability of aquatic resource managers to track patterns of invasive species, especially for taxa that are difficult to identify morphologically. Nonetheless, use of DNA-based identification methods in aquatic surveys is still unc...
Liu, Meiying; Yuan, Min; Lou, Xinhui; Mao, Hongju; Zheng, Dongmei; Zou, Ruxing; Zou, Nengli; Tang, Xiangrong; Zhao, Jianlong
2011-07-15
We report here an optical approach that enables highly selective and colorimetric single-base mismatch detection without the need of target modification, precise temperature control or stringent washes. The method is based on the finding that nucleoside monophosphates (dNMPs), which are digested elements of DNA, can better stabilize unmodified gold nanoparticles (AuNPs) than single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) with the same base-composition and concentration. The method combines the exceptional mismatch discrimination capability of the structure-selective nucleases with the attractive optical property of AuNPs. Taking S1 nuclease as one example, the perfectly matched 16-base synthetic DNA target was distinctively differentiated from those with single-base mutation located at any position of the 16-base synthetic target. Single-base mutations present in targets with varied length up to 80-base, located either in the middle or near to the end of the targets, were all effectively detected. In order to prove that the method can be potentially used for real clinic samples, the single-base mismatch detections with two HBV genomic DNA samples were conducted. To further prove the generality of this method and potentially overcome the limitation on the detectable lengths of the targets of the S1 nuclease-based method, we also demonstrated the use of a duplex-specific nuclease (DSN) for color reversed single-base mismatch detection. The main limitation of the demonstrated methods is that it is limited to detect mutations in purified ssDNA targets. However, the method coupled with various convenient ssDNA generation and purification techniques, has the potential to be used for the future development of detector-free testing kits in single nucleotide polymorphism screenings for disease diagnostics and treatments. Copyright © 2011 Elsevier B.V. All rights reserved.
Direct Detection and Sequencing of Damaged DNA Bases
2011-01-01
Products of various forms of DNA damage have been implicated in a variety of important biological processes, such as aging, neurodegenerative diseases, and cancer. Therefore, there exists great interest to develop methods for interrogating damaged DNA in the context of sequencing. Here, we demonstrate that single-molecule, real-time (SMRT®) DNA sequencing can directly detect damaged DNA bases in the DNA template - as a by-product of the sequencing method - through an analysis of the DNA polymerase kinetics that are altered by the presence of a modified base. We demonstrate the sequencing of several DNA templates containing products of DNA damage, including 8-oxoguanine, 8-oxoadenine, O6-methylguanine, 1-methyladenine, O4-methylthymine, 5-hydroxycytosine, 5-hydroxyuracil, 5-hydroxymethyluracil, or thymine dimers, and show that these base modifications can be readily detected with single-modification resolution and DNA strand specificity. We characterize the distinct kinetic signatures generated by these DNA base modifications. PMID:22185597
Direct detection and sequencing of damaged DNA bases.
Clark, Tyson A; Spittle, Kristi E; Turner, Stephen W; Korlach, Jonas
2011-12-20
Products of various forms of DNA damage have been implicated in a variety of important biological processes, such as aging, neurodegenerative diseases, and cancer. Therefore, there exists great interest to develop methods for interrogating damaged DNA in the context of sequencing. Here, we demonstrate that single-molecule, real-time (SMRT®) DNA sequencing can directly detect damaged DNA bases in the DNA template - as a by-product of the sequencing method - through an analysis of the DNA polymerase kinetics that are altered by the presence of a modified base. We demonstrate the sequencing of several DNA templates containing products of DNA damage, including 8-oxoguanine, 8-oxoadenine, O6-methylguanine, 1-methyladenine, O4-methylthymine, 5-hydroxycytosine, 5-hydroxyuracil, 5-hydroxymethyluracil, or thymine dimers, and show that these base modifications can be readily detected with single-modification resolution and DNA strand specificity. We characterize the distinct kinetic signatures generated by these DNA base modifications.
Programmable Regulation of DNA Conjugation to Gold Nanoparticles via Strand Displacement.
Zhang, Cheng; Wu, Ranfeng; Li, Yifan; Zhang, Qiang; Yang, Jing
2017-10-31
Methods for conjugating DNA to gold nanoparticles (AuNPs) have recently attracted considerable attention. The ability to control such conjugation in a programmable way is of great interest. Here, we have developed a logic-based method for manipulating the conjugation of thiolated DNA species to AuNPs via cascading DNA strand displacement. Using this method, several logic-based operation systems are established and up to three kinds of DNA signals are introduced at the same time. In addition, a more sensitive catalytic logic-based operation is also achieved based on an entropy-driven process. In the experiment, all of the DNA/AuNPs conjugation results are verified by agrose gel. This strategy promises great potential for automatically conjugating DNA stands onto label-free gold nanoparticles and can be extended to constructing DNA/nanoparticle devices for applications in diagnostics, biosensing, and molecular robotics.
Highly sensitive detection of DNA methylation levels by using a quantum dot-based FRET method
NASA Astrophysics Data System (ADS)
Ma, Yunfei; Zhang, Honglian; Liu, Fangming; Wu, Zhenhua; Lu, Shaohua; Jin, Qinghui; Zhao, Jianlong; Zhong, Xinhua; Mao, Hongju
2015-10-01
DNA methylation is the most frequently studied epigenetic modification that is strongly involved in genomic stability and cellular plasticity. Aberrant changes in DNA methylation status are ubiquitous in human cancer and the detection of these changes can be informative for cancer diagnosis. Herein, we reported a facile quantum dot-based (QD-based) fluorescence resonance energy transfer (FRET) technique for the detection of DNA methylation. The method relies on methylation-sensitive restriction enzymes for the differential digestion of genomic DNA based on its methylation status. Digested DNA is then subjected to PCR amplification for the incorporation of Alexa Fluor-647 (A647) fluorophores. DNA methylation levels can be detected qualitatively through gel analysis and quantitatively by the signal amplification from QDs to A647 during FRET. Furthermore, the methylation levels of three tumor suppressor genes, PCDHGB6, HOXA9 and RASSF1A, in 20 lung adenocarcinoma and 20 corresponding adjacent nontumorous tissue (NT) samples were measured to verify the feasibility of the QD-based FRET method and a high sensitivity for cancer detection (up to 90%) was achieved. Our QD-based FRET method is a convenient, continuous and high-throughput method, and is expected to be an alternative for detecting DNA methylation as a biomarker for certain human cancers.DNA methylation is the most frequently studied epigenetic modification that is strongly involved in genomic stability and cellular plasticity. Aberrant changes in DNA methylation status are ubiquitous in human cancer and the detection of these changes can be informative for cancer diagnosis. Herein, we reported a facile quantum dot-based (QD-based) fluorescence resonance energy transfer (FRET) technique for the detection of DNA methylation. The method relies on methylation-sensitive restriction enzymes for the differential digestion of genomic DNA based on its methylation status. Digested DNA is then subjected to PCR amplification for the incorporation of Alexa Fluor-647 (A647) fluorophores. DNA methylation levels can be detected qualitatively through gel analysis and quantitatively by the signal amplification from QDs to A647 during FRET. Furthermore, the methylation levels of three tumor suppressor genes, PCDHGB6, HOXA9 and RASSF1A, in 20 lung adenocarcinoma and 20 corresponding adjacent nontumorous tissue (NT) samples were measured to verify the feasibility of the QD-based FRET method and a high sensitivity for cancer detection (up to 90%) was achieved. Our QD-based FRET method is a convenient, continuous and high-throughput method, and is expected to be an alternative for detecting DNA methylation as a biomarker for certain human cancers. Electronic supplementary information (ESI) available: Synthesis of CdSe/CdS/ZnS core/shell/shell QDs. Sequences of primers used for amplifying the promoter regions in bisulfate-modified DNA. Comparison of detected methylation levels in different gene promoters using the QD-based FRET method versus bisulfite pyrosequencing. Methylation levels of the RASSF1A gene in one pair of NT and cancer samples as indicated by pyrosequencing. Theoretical calculation of the Förster distance R0. See DOI: 10.1039/c5nr04956c
A comparison of DNA fragmentation methods - Applications for the biochip technology.
Sapojnikova, Nelly; Asatiani, Nino; Kartvelishvili, Tamar; Asanishvili, Lali; Zinkevich, Vitaly; Bogdarina, Irina; Mitchell, Julian; Al-Humam, Abdulmohsen
2017-08-20
The efficiency of hybridization signal detection in a biochip is affected by the method used for test DNA preparation, such as fragmentation, amplification and fluorescent labelling. DNA fragmentation is the commonest methods used and it is recognised as a critical step in biochip analysis. Currently methods used for DNA fragmentation are based either on sonication or on the enzymatic digestion. In this study, we compared the effect of different types of enzymatic DNA fragmentations, using DNase I to generate ssDNA breaks, NEBNext dsDNA fragmentase and SaqAI restrictase, on DNA labelling. DNA from different Desulfovibrio species was used as a substrate for these enzymes. Of the methods used, DNA fragmented by NEBNext dsDNA Fragmentase digestion was subsequently labelled with the greatest efficiency. As a result of this, the use of this enzyme to fragment target DNA increases the sensitivity of biochip-based detection significantly, and this is an important consideration when determining the presence of targeted DNA in ecological and medical samples. Copyright © 2017 Elsevier B.V. All rights reserved.
[DNA quantification of blood samples pre-treated with pyramidon].
Zhu, Chuan-Hong; Zheng, Dao-Li; Ni, Rao-Zhi; Wang, Hai-Sheng; Ning, Ping; Fang, Hui; Liu, Yan
2014-06-01
To study DNA quantification and STR typing of samples pre-treated with pyramidon. The blood samples of ten unrelated individuals were anticoagulated in EDTA. The blood stains were made on the filter paper. The experimental groups were divided into six groups in accordance with the storage time, 30 min, 1 h, 3 h, 6 h, 12 h and 24h after pre-treated with pyramidon. DNA was extracted by three methods: magnetic bead-based extraction, QIAcube DNA purification method and Chelex-100 method. The quantification of DNA was made by fluorescent quantitative PCR. STR typing was detected by PCR-STR fluorescent technology. In the same DNA extraction method, the sample DNA decreased gradually with times after pre-treatment with pyramidon. In the same storage time, the DNA quantification in different extraction methods had significant differences. Sixteen loci DNA typing were detected in 90.56% of samples. Pyramidon pre-treatment could cause DNA degradation, but effective STR typing can be achieved within 24 h. The magnetic bead-based extraction is the best method for STR profiling and DNA extraction.
Method for rapid base sequencing in DNA and RNA
Jett, J.H.; Keller, R.A.; Martin, J.C.; Moyzis, R.K.; Ratliff, R.L.; Shera, E.B.; Stewart, C.C.
1987-10-07
A method is provided for the rapid base sequencing of DNA or RNA fragments wherein a single fragment of DNA or RNA is provided with identifiable bases and suspended in a moving flow stream. An exonuclease sequentially cleaves individual bases from the end of the suspended fragment. The moving flow stream maintains the cleaved bases in an orderly train for subsequent detection and identification. In a particular embodiment, individual bases forming the DNA or RNA fragments are individually tagged with a characteristic fluorescent dye. The train of bases is then excited to fluorescence with an output spectrum characteristic of the individual bases. Accordingly, the base sequence of the original DNA or RNA fragment can be reconstructed. 2 figs.
Method for rapid base sequencing in DNA and RNA
Jett, J.H.; Keller, R.A.; Martin, J.C.; Moyzis, R.K.; Ratliff, R.L.; Shera, E.B.; Stewart, C.C.
1990-10-09
A method is provided for the rapid base sequencing of DNA or RNA fragments wherein a single fragment of DNA or RNA is provided with identifiable bases and suspended in a moving flow stream. An exonuclease sequentially cleaves individual bases from the end of the suspended fragment. The moving flow stream maintains the cleaved bases in an orderly train for subsequent detection and identification. In a particular embodiment, individual bases forming the DNA or RNA fragments are individually tagged with a characteristic fluorescent dye. The train of bases is then excited to fluorescence with an output spectrum characteristic of the individual bases. Accordingly, the base sequence of the original DNA or RNA fragment can be reconstructed. 2 figs.
Method for rapid base sequencing in DNA and RNA
Jett, James H.; Keller, Richard A.; Martin, John C.; Moyzis, Robert K.; Ratliff, Robert L.; Shera, E. Brooks; Stewart, Carleton C.
1990-01-01
A method is provided for the rapid base sequencing of DNA or RNA fragments wherein a single fragment of DNA or RNA is provided with identifiable bases and suspended in a moving flow stream. An exonuclease sequentially cleaves individual bases from the end of the suspended fragment. The moving flow stream maintains the cleaved bases in an orderly train for subsequent detection and identification. In a particular embodiment, individual bases forming the DNA or RNA fragments are individually tagged with a characteristic fluorescent dye. The train of bases is then excited to fluorescence with an output spectrum characteristic of the individual bases. Accordingly, the base sequence of the original DNA or RNA fragment can be reconstructed.
DNA-based methods have considerably increased our understanding of the bacterial diversity of water distribution systems (WDS). However, as DNA may persist after cell death, the use of DNA-based methods cannot be used to describe metabolically-active microbes. In contrast, intra...
Benefits and Limitations of DNA Barcoding and Metabarcoding in Herbal Product Authentication.
Raclariu, Ancuta Cristina; Heinrich, Michael; Ichim, Mihael Cristin; de Boer, Hugo
2018-03-01
Herbal medicines play an important role globally in the health care sector and in industrialised countries they are often considered as an alternative to mono-substance medicines. Current quality and authentication assessment methods rely mainly on morphology and analytical phytochemistry-based methods detailed in pharmacopoeias. Herbal products however are often highly processed with numerous ingredients, and even if these analytical methods are accurate for quality control of specific lead or marker compounds, they are of limited suitability for the authentication of biological ingredients. To review the benefits and limitations of DNA barcoding and metabarcoding in complementing current herbal product authentication. Recent literature relating to DNA based authentication of medicinal plants, herbal medicines and products are summarised to provide a basic understanding of how DNA barcoding and metabarcoding can be applied to this field. Different methods of quality control and authentication have varying resolution and usefulness along the value chain of these products. DNA barcoding can be used for authenticating products based on single herbal ingredients and DNA metabarcoding for assessment of species diversity in processed products, and both methods should be used in combination with appropriate hyphenated chemical methods for quality control. DNA barcoding and metabarcoding have potential in the context of quality control of both well and poorly regulated supply systems. Standardisation of protocols for DNA barcoding and DNA sequence-based identification are necessary before DNA-based biological methods can be implemented as routine analytical approaches and approved by the competent authorities for use in regulated procedures. © 2017 The Authors. Phytochemical Analysis Published by John Wiley & Sons Ltd. © 2017 The Authors. Phytochemical Analysis Published by John Wiley & Sons Ltd.
Optimisation of DNA extraction from the crustacean Daphnia
Athanasio, Camila Gonçalves; Chipman, James K.; Viant, Mark R.
2016-01-01
Daphnia are key model organisms for mechanistic studies of phenotypic plasticity, adaptation and microevolution, which have led to an increasing demand for genomics resources. A key step in any genomics analysis, such as high-throughput sequencing, is the availability of sufficient and high quality DNA. Although commercial kits exist to extract genomic DNA from several species, preparation of high quality DNA from Daphnia spp. and other chitinous species can be challenging. Here, we optimise methods for tissue homogenisation, DNA extraction and quantification customised for different downstream analyses (e.g., LC-MS/MS, Hiseq, mate pair sequencing or Nanopore). We demonstrate that if Daphnia magna are homogenised as whole animals (including the carapace), absorbance-based DNA quantification methods significantly over-estimate the amount of DNA, resulting in using insufficient starting material for experiments, such as preparation of sequencing libraries. This is attributed to the high refractive index of chitin in Daphnia’s carapace at 260 nm. Therefore, unless the carapace is removed by overnight proteinase digestion, the extracted DNA should be quantified with fluorescence-based methods. However, overnight proteinase digestion will result in partial fragmentation of DNA therefore the prepared DNA is not suitable for downstream methods that require high molecular weight DNA, such as PacBio, mate pair sequencing and Nanopore. In conclusion, we found that the MasterPure DNA purification kit, coupled with grinding of frozen tissue, is the best method for extraction of high molecular weight DNA as long as the extracted DNA is quantified with fluorescence-based methods. This method generated high yield and high molecular weight DNA (3.10 ± 0.63 ng/µg dry mass, fragments >60 kb), free of organic contaminants (phenol, chloroform) and is suitable for large number of downstream analyses. PMID:27190714
USDA-ARS?s Scientific Manuscript database
Analysis of DNA methylation patterns relies increasingly on sequencing-based profiling methods. The four most frequently used sequencing-based technologies are the bisulfite-based methods MethylC-seq and reduced representation bisulfite sequencing (RRBS), and the enrichment-based techniques methylat...
Yamamoto, F; Yamamoto, M
2004-07-01
We previously developed a PCR-based DNA fingerprinting technique named the Methylation Sensitive (MS)-AFLP method, which permits comparative genome-wide scanning of methylation status with a manageable number of fingerprinting experiments. The technique uses the methylation sensitive restriction enzyme NotI in the context of the existing Amplified Fragment Length Polymorphism (AFLP) method. Here we report the successful conversion of this gel electrophoresis-based DNA fingerprinting technique into a DNA microarray hybridization technique (DNA Microarray MS-AFLP). By performing a total of 30 (15 x 2 reciprocal labeling) DNA Microarray MS-AFLP hybridization experiments on genomic DNA from two breast and three prostate cancer cell lines in all pairwise combinations, and Southern hybridization experiments using more than 100 different probes, we have demonstrated that the DNA Microarray MS-AFLP is a reliable method for genetic and epigenetic analyses. No statistically significant differences were observed in the number of differences between the breast-prostate hybridization experiments and the breast-breast or prostate-prostate comparisons.
DNA-Based Methods in the Immunohematology Reference Laboratory
Denomme, Gregory A
2010-01-01
Although hemagglutination serves the immunohematology reference laboratory well, when used alone, it has limited capability to resolve complex problems. This overview discusses how molecular approaches can be used in the immunohematology reference laboratory. In order to apply molecular approaches to immunohematology, knowledge of genes, DNA-based methods, and the molecular bases of blood groups are required. When applied correctly, DNA-based methods can predict blood groups to resolve ABO/Rh discrepancies, identify variant alleles, and screen donors for antigen-negative units. DNA-based testing in immunohematology is a valuable tool used to resolve blood group incompatibilities and to support patients in their transfusion needs. PMID:21257350
Turner, Cameron R.; Miller, Derryl J.; Coyne, Kathryn J.; Corush, Joel
2014-01-01
Indirect, non-invasive detection of rare aquatic macrofauna using aqueous environmental DNA (eDNA) is a relatively new approach to population and biodiversity monitoring. As such, the sensitivity of monitoring results to different methods of eDNA capture, extraction, and detection is being investigated in many ecosystems and species. One of the first and largest conservation programs with eDNA-based monitoring as a central instrument focuses on Asian bigheaded carp (Hypophthalmichthys spp.), an invasive fish spreading toward the Laurentian Great Lakes. However, the standard eDNA methods of this program have not advanced since their development in 2010. We developed new, quantitative, and more cost-effective methods and tested them against the standard protocols. In laboratory testing, our new quantitative PCR (qPCR) assay for bigheaded carp eDNA was one to two orders of magnitude more sensitive than the existing endpoint PCR assays. When applied to eDNA samples from an experimental pond containing bigheaded carp, the qPCR assay produced a detection probability of 94.8% compared to 4.2% for the endpoint PCR assays. Also, the eDNA capture and extraction method we adapted from aquatic microbiology yielded five times more bigheaded carp eDNA from the experimental pond than the standard method, at a per sample cost over forty times lower. Our new, more sensitive assay provides a quantitative tool for eDNA-based monitoring of bigheaded carp, and the higher-yielding eDNA capture and extraction method we describe can be used for eDNA-based monitoring of any aquatic species. PMID:25474207
Turner, Cameron R; Miller, Derryl J; Coyne, Kathryn J; Corush, Joel
2014-01-01
Indirect, non-invasive detection of rare aquatic macrofauna using aqueous environmental DNA (eDNA) is a relatively new approach to population and biodiversity monitoring. As such, the sensitivity of monitoring results to different methods of eDNA capture, extraction, and detection is being investigated in many ecosystems and species. One of the first and largest conservation programs with eDNA-based monitoring as a central instrument focuses on Asian bigheaded carp (Hypophthalmichthys spp.), an invasive fish spreading toward the Laurentian Great Lakes. However, the standard eDNA methods of this program have not advanced since their development in 2010. We developed new, quantitative, and more cost-effective methods and tested them against the standard protocols. In laboratory testing, our new quantitative PCR (qPCR) assay for bigheaded carp eDNA was one to two orders of magnitude more sensitive than the existing endpoint PCR assays. When applied to eDNA samples from an experimental pond containing bigheaded carp, the qPCR assay produced a detection probability of 94.8% compared to 4.2% for the endpoint PCR assays. Also, the eDNA capture and extraction method we adapted from aquatic microbiology yielded five times more bigheaded carp eDNA from the experimental pond than the standard method, at a per sample cost over forty times lower. Our new, more sensitive assay provides a quantitative tool for eDNA-based monitoring of bigheaded carp, and the higher-yielding eDNA capture and extraction method we describe can be used for eDNA-based monitoring of any aquatic species.
Maas, Miriam; van Roon, Annika; Dam-Deisz, Cecile; Opsteegh, Marieke; Massolo, Alessandro; Deksne, Gunita; Teunis, Peter; van der Giessen, Joke
2016-10-30
A new method, based on a magnetic capture based DNA extraction followed by qPCR, was developed for the detection of the zoonotic parasite Echinococcus multilocularis in definitive hosts. Latent class analysis was used to compare this new method with the currently used phenol-chloroform DNA extraction followed by single tube nested PCR. In total, 60 red foxes and coyotes from three different locations were tested with both molecular methods and the sedimentation and counting technique (SCT) or intestinal scraping technique (IST). Though based on a limited number of samples, it could be established that the magnetic capture based DNA extraction followed by qPCR showed similar sensitivity and specificity as the currently used phenol-chloroform DNA extraction followed by single tube nested PCR. All methods have a high specificity as shown by Bayesian latent class analysis. Both molecular assays have higher sensitivities than the combined SCT and IST, though the uncertainties in sensitivity estimates were wide for all assays tested. The magnetic capture based DNA extraction followed by qPCR has the advantage of not requiring hazardous chemicals like the phenol-chloroform DNA extraction followed by single tube nested PCR. This supports the replacement of the phenol-chloroform DNA extraction followed by single tube nested PCR by the magnetic capture based DNA extraction followed by qPCR for molecular detection of E. multilocularis in definitive hosts. Copyright © 2016 Elsevier B.V. All rights reserved.
Benefits and Limitations of DNA Barcoding and Metabarcoding in Herbal Product Authentication
Raclariu, Ancuta Cristina; Heinrich, Michael; Ichim, Mihael Cristin
2017-01-01
Abstract Introduction Herbal medicines play an important role globally in the health care sector and in industrialised countries they are often considered as an alternative to mono‐substance medicines. Current quality and authentication assessment methods rely mainly on morphology and analytical phytochemistry‐based methods detailed in pharmacopoeias. Herbal products however are often highly processed with numerous ingredients, and even if these analytical methods are accurate for quality control of specific lead or marker compounds, they are of limited suitability for the authentication of biological ingredients. Objective To review the benefits and limitations of DNA barcoding and metabarcoding in complementing current herbal product authentication. Method Recent literature relating to DNA based authentication of medicinal plants, herbal medicines and products are summarised to provide a basic understanding of how DNA barcoding and metabarcoding can be applied to this field. Results Different methods of quality control and authentication have varying resolution and usefulness along the value chain of these products. DNA barcoding can be used for authenticating products based on single herbal ingredients and DNA metabarcoding for assessment of species diversity in processed products, and both methods should be used in combination with appropriate hyphenated chemical methods for quality control. Conclusions DNA barcoding and metabarcoding have potential in the context of quality control of both well and poorly regulated supply systems. Standardisation of protocols for DNA barcoding and DNA sequence‐based identification are necessary before DNA‐based biological methods can be implemented as routine analytical approaches and approved by the competent authorities for use in regulated procedures. © 2017 The Authors. Phytochemical Analysis Published by John Wiley & Sons Ltd. PMID:28906059
An optimized rapid bisulfite conversion method with high recovery of cell-free DNA.
Yi, Shaohua; Long, Fei; Cheng, Juanbo; Huang, Daixin
2017-12-19
Methylation analysis of cell-free DNA is a encouraging tool for tumor diagnosis, monitoring and prognosis. Sensitivity of methylation analysis is a very important matter due to the tiny amounts of cell-free DNA available in plasma. Most current methods of DNA methylation analysis are based on the difference of bisulfite-mediated deamination of cytosine between cytosine and 5-methylcytosine. However, the recovery of bisulfite-converted DNA based on current methods is very poor for the methylation analysis of cell-free DNA. We optimized a rapid method for the crucial steps of bisulfite conversion with high recovery of cell-free DNA. A rapid deamination step and alkaline desulfonation was combined with the purification of DNA on a silica column. The conversion efficiency and recovery of bisulfite-treated DNA was investigated by the droplet digital PCR. The optimization of the reaction results in complete cytosine conversion in 30 min at 70 °C and about 65% of recovery of bisulfite-treated cell-free DNA, which is higher than current methods. The method allows high recovery from low levels of bisulfite-treated cell-free DNA, enhancing the analysis sensitivity of methylation detection from cell-free DNA.
Comparisons of non-Gaussian statistical models in DNA methylation analysis.
Ma, Zhanyu; Teschendorff, Andrew E; Yu, Hong; Taghia, Jalil; Guo, Jun
2014-06-16
As a key regulatory mechanism of gene expression, DNA methylation patterns are widely altered in many complex genetic diseases, including cancer. DNA methylation is naturally quantified by bounded support data; therefore, it is non-Gaussian distributed. In order to capture such properties, we introduce some non-Gaussian statistical models to perform dimension reduction on DNA methylation data. Afterwards, non-Gaussian statistical model-based unsupervised clustering strategies are applied to cluster the data. Comparisons and analysis of different dimension reduction strategies and unsupervised clustering methods are presented. Experimental results show that the non-Gaussian statistical model-based methods are superior to the conventional Gaussian distribution-based method. They are meaningful tools for DNA methylation analysis. Moreover, among several non-Gaussian methods, the one that captures the bounded nature of DNA methylation data reveals the best clustering performance.
Comparisons of Non-Gaussian Statistical Models in DNA Methylation Analysis
Ma, Zhanyu; Teschendorff, Andrew E.; Yu, Hong; Taghia, Jalil; Guo, Jun
2014-01-01
As a key regulatory mechanism of gene expression, DNA methylation patterns are widely altered in many complex genetic diseases, including cancer. DNA methylation is naturally quantified by bounded support data; therefore, it is non-Gaussian distributed. In order to capture such properties, we introduce some non-Gaussian statistical models to perform dimension reduction on DNA methylation data. Afterwards, non-Gaussian statistical model-based unsupervised clustering strategies are applied to cluster the data. Comparisons and analysis of different dimension reduction strategies and unsupervised clustering methods are presented. Experimental results show that the non-Gaussian statistical model-based methods are superior to the conventional Gaussian distribution-based method. They are meaningful tools for DNA methylation analysis. Moreover, among several non-Gaussian methods, the one that captures the bounded nature of DNA methylation data reveals the best clustering performance. PMID:24937687
Jing, Rong-Rong; Wang, Hui-Min; Cui, Ming; Fang, Meng-Kang; Qiu, Xiao-Jun; Wu, Xin-Hua; Qi, Jin; Wang, Yue-Guo; Zhang, Lu-Rong; Zhu, Jian-Hua; Ju, Shao-Qing
2011-09-01
Human cell-free circulating DNA (cf-DNA) derived mainly from cell apoptosis and necrosis can be measured by a variety of laboratory techniques, but almost all of these methods require sample preparation. We have developed a branched DNA (bDNA)-based Alu assay for quantifying cf-DNA in myocardial infarction (MI) patients. A total of 82 individuals were included in the study; 22 MI and 60 normal controls. cf-DNA was quantified using a bDNA-based Alu assay. cf-DNA was higher in serum compared to plasma and there was a difference between genders. cf-DNA was significantly higher in MI patients compared to the controls. There was no correlation between cf-DNA and creatine kinase-MB (CK-MB), troponin I (cTnI) or myoglobin (MYO). In serial specimens, cf-DNA was sensitive and peaked earlier than cTnI. The bDNA-based Alu assay is a novel method for quantifying human cf-DNA. Increased cf-DNA in MI patients might complement cTnI, CK-MB and MYO in a multiple marker format. Copyright © 2011 The Canadian Society of Clinical Chemists. All rights reserved.
[Synthesis of Circular DNA Templates with T4 RNA Ligase for Rolling Circle Amplification].
Sakhabutdinova, A R; Maksimova, M A; Garafutdinov, R R
2017-01-01
Currently, isothermal methods of nucleic acid amplification have been well established; in particular, rolling circle amplification is of great interest. In this approach, circular ssDNA molecules have been used as a target that can be obtained by the intramolecular template-dependent ligation of an oligonucleotide C-probe. Here, a new method of synthesizing small circular DNA molecules via the cyclization of ssDNA based on T4 RNA ligase has been proposed. Circular ssDNA is further used as the template for the rolling circle amplification. The maximum yield of the cyclization products was observed in the presence of 5-10% polyethylene glycol 4000, and the optimum DNA length for the cyclization constituted 50 nucleotides. This highly sensitive method was shown to detect less than 10^(2) circular DNA molecules. The method reliability was proved based on artificially destroyed dsDNA, which suggests its implementation for analyzing any significantly fragmented dsDNA.
Lee, Ping-Shin; Gan, Han Ming; Clements, Gopalasamy Reuben; Wilson, John-James
2016-11-01
Mammal diversity assessments based on DNA derived from invertebrates have been suggested as alternatives to assessments based on traditional methods; however, no study has field-tested both approaches simultaneously. In Peninsular Malaysia, we calibrated the performance of mammal DNA derived from blowflies (Diptera: Calliphoridae) against traditional methods used to detect species. We first compared five methods (cage trapping, mist netting, hair trapping, scat collection, and blowfly-derived DNA) in a forest reserve with no recent reports of megafauna. Blowfly-derived DNA and mist netting detected the joint highest number of species (n = 6). Only one species was detected by multiple methods. Compared to the other methods, blowfly-derived DNA detected both volant and non-volant species. In another forest reserve, rich in megafauna, we calibrated blowfly-derived DNA against camera traps. Blowfly-derived DNA detected more species (n = 11) than camera traps (n = 9), with only one species detected by both methods. The rarefaction curve indicated that blowfly-derived DNA would continue to detect more species with greater sampling effort. With further calibration, blowfly-derived DNA may join the list of traditional field methods. Areas for further investigation include blowfly feeding and dispersal biology, primer biases, and the assembly of a comprehensive and taxonomically-consistent DNA barcode reference library.
Kim, Joo-Hwan; Kim, Jin Ho; Wang, Pengbin; Park, Bum Soo; Han, Myung-Soo
2016-01-01
The identification and quantification of Heterosigma akashiwo cysts in sediments by light microscopy can be difficult due to the small size and morphology of the cysts, which are often indistinguishable from those of other types of algae. Quantitative real-time PCR (qPCR) based assays represent a potentially efficient method for quantifying the abundance of H. akashiwo cysts, although standard curves must be based on cyst DNA rather than on vegetative cell DNA due to differences in gene copy number and DNA extraction yield between these two cell types. Furthermore, qPCR on sediment samples can be complicated by the presence of extracellular DNA debris. To solve these problems, we constructed a cyst-based standard curve and developed a simple method for removing DNA debris from sediment samples. This cyst-based standard curve was compared with a standard curve based on vegetative cells, as vegetative cells may have twice the gene copy number of cysts. To remove DNA debris from the sediment, we developed a simple method involving dilution with distilled water and heating at 75°C. A total of 18 sediment samples were used to evaluate this method. Cyst abundance determined using the qPCR assay without DNA debris removal yielded results up to 51-fold greater than with direct counting. By contrast, a highly significant correlation was observed between cyst abundance determined by direct counting and the qPCR assay in conjunction with DNA debris removal (r2 = 0.72, slope = 1.07, p < 0.001). Therefore, this improved qPCR method should be a powerful tool for the accurate quantification of H. akashiwo cysts in sediment samples.
A two-step electrodialysis method for DNA purification from polluted metallic environmental samples.
Rodríguez-Mejía, José Luis; Martínez-Anaya, Claudia; Folch-Mallol, Jorge Luis; Dantán-González, Edgar
2008-08-01
Extracting DNA from samples of polluted environments using standard methods often results in low yields of poor-quality material unsuited to subsequent manipulation and analysis by molecular biological techniques. Here, we report a novel two-step electrodialysis-based method for the extraction of DNA from environmental samples. This technique permits the rapid and efficient isolation of high-quality DNA based on its acidic nature, and without the requirement for phenol-chloroform-isoamyl alcohol cleanup and ethanol precipitation steps. Subsequent PCR, endonuclease restriction, and cloning reactions were successfully performed utilizing DNA obtained by electrodialysis, whereas some or all of these techniques failed using DNA extracted with two alternative methods. We also show that his technique is applicable to purify DNA from a range of polluted and nonpolluted samples.
Investigation of a Sybr-Green-Based Method to Validate DNA Sequences for DNA Computing
2005-05-01
OF A SYBR-GREEN-BASED METHOD TO VALIDATE DNA SEQUENCES FOR DNA COMPUTING 6. AUTHOR(S) Wendy Pogozelski, Salvatore Priore, Matthew Bernard ...simulated annealing. Biochemistry, 35, 14077-14089. 15 Pogozelski, W.K., Bernard , M.P. and Macula, A. (2004) DNA code validation using...and Clark, B.F.C. (eds) In RNA Biochemistry and Biotechnology, NATO ASI Series, Kluwer Academic Publishers. Zucker, M. and Stiegler , P. (1981
Assessment of DNA Contamination in RNA Samples Based on Ribosomal DNA
Hashemipetroudi, Seyyed Hamidreza; Nematzadeh, Ghorbanali; Ahmadian, Gholamreza; Yamchi, Ahad; Kuhlmann, Markus
2018-01-01
One method extensively used for the quantification of gene expression changes and transcript abundances is reverse-transcription quantitative real-time PCR (RT-qPCR). It provides accurate, sensitive, reliable, and reproducible results. Several factors can affect the sensitivity and specificity of RT-qPCR. Residual genomic DNA (gDNA) contaminating RNA samples is one of them. In gene expression analysis, non-specific amplification due to gDNA contamination will overestimate the abundance of transcript levels and can affect the RT-qPCR results. Generally, gDNA is detected by qRT-PCR using primer pairs annealing to intergenic regions or an intron of the gene of interest. Unfortunately, intron/exon annotations are not yet known for all genes from vertebrate, bacteria, protist, fungi, plant, and invertebrate metazoan species. Here we present a protocol for detection of gDNA contamination in RNA samples by using ribosomal DNA (rDNA)-based primers. The method is based on the unique features of rDNA: their multigene nature, highly conserved sequences, and high frequency in the genome. Also as a case study, a unique set of primers were designed based on the conserved region of ribosomal DNA (rDNA) in the Poaceae family. The universality of these primer pairs was tested by melt curve analysis and agarose gel electrophoresis. Although our method explains how rDNA-based primers can be applied for the gDNA contamination assay in the Poaceae family, it could be easily used to other prokaryote and eukaryote species PMID:29443017
Sengüven, Burcu; Baris, Emre; Oygur, Tulin; Berktas, Mehmet
2014-01-01
Discussing a protocol involving xylene-ethanol deparaffinization on slides followed by a kit-based extraction that allows for the extraction of high quality DNA from FFPE tissues. DNA was extracted from the FFPE tissues of 16 randomly selected blocks. Methods involving deparaffinization on slides or tubes, enzyme digestion overnight or for 72 hours and isolation using phenol chloroform method or a silica-based commercial kit were compared in terms of yields, concentrations and the amplifiability. The highest yield of DNA was produced from the samples that were deparaffinized on slides, digested for 72 hours and isolated with a commercial kit. Samples isolated with the phenol-chloroform method produced DNA of lower purity than the samples that were purified with kit. The samples isolated with the commercial kit resulted in better PCR amplification. Silica-based commercial kits and deparaffinized on slides should be considered for DNA extraction from FFPE.
Detection of dopamine in dopaminergic cell using nanoparticles-based barcode DNA analysis.
An, Jeung Hee; Kim, Tae-Hyung; Oh, Byung-Keun; Choi, Jeong Woo
2012-01-01
Nanotechnology-based bio-barcode-amplification analysis may be an innovative approach to dopamine detection. In this study, we evaluated the efficacy of this bio-barcode DNA method in detecting dopamine from dopaminergic cells. Herein, a combination DNA barcode and bead-based immunoassay for neurotransmitter detection with PCR-like sensitivity is described. This method relies on magnetic nanoparticles with antibodies and nanoparticles that are encoded with DNA, and antibodies that can sandwich the target protein captured by the nanoparticle-bound antibodies. The aggregate sandwich structures are magnetically separated from solution, and treated in order to remove the conjugated barcode DNA. The DNA barcodes were then identified via PCR analysis. The dopamine concentration in dopaminergic cells can be readily and rapidly detected via the bio-barcode assay method. The bio-barcode assay method is, therefore, a rapid and high-throughput screening tool for the detection of neurotransmitters such as dopamine.
Xu, Xue-tao; Liang, Kai-yi; Zeng, Jia-ying
2015-02-15
A portable and sensitive quantitative DNA detection method based on personal glucose meters and isothermal circular strand-displacement polymerization reaction was developed. The target DNA triggered target recycling process, which opened capture DNA. The released target then found another capture DNA to trigger another polymerization cycle, which was repeated for many rounds, resulting in the multiplication of the DNA-invertase conjugation on the surface of Streptavidin-MNBs. The DNA-invertase was used to catalyze the hydrolysis of sucrose into glucose for PGM readout. There was a liner relationship between the signal of PGM and the concentration of target DNA in the range of 5.0 to 1000 fM, which is lower than some DNA detection method. In addition, the method exhibited excellent sequence selectivity and there was almost no effect of biological complex to the detection performance, which suggested our method can be successfully applied to DNA detection in real biological samples. Copyright © 2014 Elsevier B.V. All rights reserved.
Jun, Goo; Flickinger, Matthew; Hetrick, Kurt N.; Romm, Jane M.; Doheny, Kimberly F.; Abecasis, Gonçalo R.; Boehnke, Michael; Kang, Hyun Min
2012-01-01
DNA sample contamination is a serious problem in DNA sequencing studies and may result in systematic genotype misclassification and false positive associations. Although methods exist to detect and filter out cross-species contamination, few methods to detect within-species sample contamination are available. In this paper, we describe methods to identify within-species DNA sample contamination based on (1) a combination of sequencing reads and array-based genotype data, (2) sequence reads alone, and (3) array-based genotype data alone. Analysis of sequencing reads allows contamination detection after sequence data is generated but prior to variant calling; analysis of array-based genotype data allows contamination detection prior to generation of costly sequence data. Through a combination of analysis of in silico and experimentally contaminated samples, we show that our methods can reliably detect and estimate levels of contamination as low as 1%. We evaluate the impact of DNA contamination on genotype accuracy and propose effective strategies to screen for and prevent DNA contamination in sequencing studies. PMID:23103226
Sengüven, Burcu; Baris, Emre; Oygur, Tulin; Berktas, Mehmet
2014-01-01
Aim: Discussing a protocol involving xylene-ethanol deparaffinization on slides followed by a kit-based extraction that allows for the extraction of high quality DNA from FFPE tissues. Methods: DNA was extracted from the FFPE tissues of 16 randomly selected blocks. Methods involving deparaffinization on slides or tubes, enzyme digestion overnight or for 72 hours and isolation using phenol chloroform method or a silica-based commercial kit were compared in terms of yields, concentrations and the amplifiability. Results: The highest yield of DNA was produced from the samples that were deparaffinized on slides, digested for 72 hours and isolated with a commercial kit. Samples isolated with the phenol-chloroform method produced DNA of lower purity than the samples that were purified with kit. The samples isolated with the commercial kit resulted in better PCR amplification. Conclusion: Silica-based commercial kits and deparaffinized on slides should be considered for DNA extraction from FFPE. PMID:24688314
The Ins and Outs of DNA Fingerprinting the Infectious Fungi
Soll, David R.
2000-01-01
DNA fingerprinting methods have evolved as major tools in fungal epidemiology. However, no single method has emerged as the method of choice, and some methods perform better than others at different levels of resolution. In this review, requirements for an effective DNA fingerprinting method are proposed and procedures are described for testing the efficacy of a method. In light of the proposed requirements, the most common methods now being used to DNA fingerprint the infectious fungi are described and assessed. These methods include restriction fragment length polymorphisms (RFLP), RFLP with hybridization probes, randomly amplified polymorphic DNA and other PCR-based methods, electrophoretic karyotyping, and sequencing-based methods. Procedures for computing similarity coefficients, generating phylogenetic trees, and testing the stability of clusters are then described. To facilitate the analysis of DNA fingerprinting data, computer-assisted methods are described. Finally, the problems inherent in the collection of test and control isolates are considered, and DNA fingerprinting studies of strain maintenance during persistent or recurrent infections, microevolution in infecting strains, and the origin of nosocomial infections are assessed in light of the preceding discussion of the ins and outs of DNA fingerprinting. The intent of this review is to generate an awareness of the need to verify the efficacy of each DNA fingerprinting method for the level of genetic relatedness necessary to answer the epidemiological question posed, to use quantitative methods to analyze DNA fingerprint data, to use computer-assisted DNA fingerprint analysis systems to analyze data, and to file data in a form that can be used in the future for retrospective and comparative studies. PMID:10756003
Wysoczynski, Christina L.; Roemer, Sarah C.; Dostal, Vishantie; Barkley, Robert M.; Churchill, Mair E. A.; Malarkey, Christopher S.
2013-01-01
Obtaining quantities of highly pure duplex DNA is a bottleneck in the biophysical analysis of protein–DNA complexes. In traditional DNA purification methods, the individual cognate DNA strands are purified separately before annealing to form DNA duplexes. This approach works well for palindromic sequences, in which top and bottom strands are identical and duplex formation is typically complete. However, in cases where the DNA is non-palindromic, excess of single-stranded DNA must be removed through additional purification steps to prevent it from interfering in further experiments. Here we describe and apply a novel reversed-phase ion-pair liquid chromatography purification method for double-stranded DNA ranging in lengths from 17 to 51 bp. Both palindromic and non-palindromic DNA can be readily purified. This method has the unique ability to separate blunt double-stranded DNA from pre-attenuated (n-1, n-2, etc) synthesis products, and from DNA duplexes with single base pair overhangs. Additionally, palindromic DNA sequences with only minor differences in the central spacer sequence of the DNA can be separated, and the purified DNA is suitable for co-crystallization of protein–DNA complexes. Thus, double-stranded ion-pair liquid chromatography is a useful approach for duplex DNA purification for many applications. PMID:24013567
Li, Zhen; Zhu, Wenping; Zhang, Jinwen; Jiang, Jianhui; Shen, Guoli; Yu, Ruqin
2013-07-07
A label-free fluorescent DNA biosensor has been presented based on isothermal circular strand-displacement polymerization reaction (ICSDPR) combined with graphene oxide (GO) binding. The proposed method is simple and cost-effective with a low detection limit of 4 pM, which compares favorably with other GO-based homogenous DNA detection methods.
Method for rapid base sequencing in DNA and RNA with two base labeling
Jett, J.H.; Keller, R.A.; Martin, J.C.; Posner, R.G.; Marrone, B.L.; Hammond, M.L.; Simpson, D.J.
1995-04-11
A method is described for rapid-base sequencing in DNA and RNA with two-base labeling and employing fluorescent detection of single molecules at two wavelengths. Bases modified to accept fluorescent labels are used to replicate a single DNA or RNA strand to be sequenced. The bases are then sequentially cleaved from the replicated strand, excited with a chosen spectrum of electromagnetic radiation, and the fluorescence from individual, tagged bases detected in the order of cleavage from the strand. 4 figures.
Method for rapid base sequencing in DNA and RNA with two base labeling
Jett, James H.; Keller, Richard A.; Martin, John C.; Posner, Richard G.; Marrone, Babetta L.; Hammond, Mark L.; Simpson, Daniel J.
1995-01-01
Method for rapid-base sequencing in DNA and RNA with two-base labeling and employing fluorescent detection of single molecules at two wavelengths. Bases modified to accept fluorescent labels are used to replicate a single DNA or RNA strand to be sequenced. The bases are then sequentially cleaved from the replicated strand, excited with a chosen spectrum of electromagnetic radiation, and the fluorescence from individual, tagged bases detected in the order of cleavage from the strand.
DNA Base-Calling from a Nanopore Using a Viterbi Algorithm
Timp, Winston; Comer, Jeffrey; Aksimentiev, Aleksei
2012-01-01
Nanopore-based DNA sequencing is the most promising third-generation sequencing method. It has superior read length, speed, and sample requirements compared with state-of-the-art second-generation methods. However, base-calling still presents substantial difficulty because the resolution of the technique is limited compared with the measured signal/noise ratio. Here we demonstrate a method to decode 3-bp-resolution nanopore electrical measurements into a DNA sequence using a Hidden Markov model. This method shows tremendous potential for accuracy (∼98%), even with a poor signal/noise ratio. PMID:22677395
NASA Astrophysics Data System (ADS)
Drozd, Marcin; Pietrzak, Mariusz D.; Malinowska, Elżbieta
2018-05-01
The framework of presented study covers the development and examination of the analytical performance of surface plasmon resonance-based (SPR) DNA biosensors dedicated for a detection of model target oligonucleotide sequence. For this aim, various strategies of immobilization of DNA probes on gold transducers were tested. Besides the typical approaches: chemisorption of thiolated ssDNA (DNA-thiol) and physisorption of non-functionalized oligonucleotides, relatively new method based on chemisorption of dithiocarbamate-functionalized ssDNA (DNA-DTC) was applied for the first time for preparation of DNA-based SPR biosensor. The special emphasis was put on the correlation between the method of DNA immobilization and the composition of obtained receptor layer. The carried out studies focused on the examination of the capability of developed receptors layers to interact with both target DNA and DNA-functionalized AuNPs. It was found, that the detection limit of target DNA sequence (27 nb length) depends on the strategy of probe immobilization and backfilling method, and in the best case it amounted to 0,66 nM. Moreover, the application of ssDNA-functionalized gold nanoparticles (AuNPs) as plasmonic labels for secondary enhancement of SPR response is presented. The influence of spatial organization and surface density of a receptor layer on the ability to interact with DNA-functionalized AuNPs is discussed. Due to the best compatibility of receptors immobilized via DTC chemisorption: 1.47 ± 0.4 ·1012 molecules • cm-2 (with the calculated area occupied by single nanoparticle label of 132.7 nm2), DNA chemisorption based on DTCs is pointed as especially promising for DNA biosensors utilizing indirect detection in competitive assays.
Drozd, Marcin; Pietrzak, Mariusz D; Malinowska, Elżbieta
2018-01-01
The framework of presented study covers the development and examination of the analytical performance of surface plasmon resonance-based (SPR) DNA biosensors dedicated for a detection of model target oligonucleotide sequence. For this aim, various strategies of immobilization of DNA probes on gold transducers were tested. Besides the typical approaches: chemisorption of thiolated ssDNA (DNA-thiol) and physisorption of non-functionalized oligonucleotides, relatively new method based on chemisorption of dithiocarbamate-functionalized ssDNA (DNA-DTC) was applied for the first time for preparation of DNA-based SPR biosensor. The special emphasis was put on the correlation between the method of DNA immobilization and the composition of obtained receptor layer. The carried out studies focused on the examination of the capability of developed receptors layers to interact with both target DNA and DNA-functionalized AuNPs. It was found, that the detection limit of target DNA sequence (27 nb length) depends on the strategy of probe immobilization and backfilling method, and in the best case it amounted to 0.66 nM. Moreover, the application of ssDNA-functionalized gold nanoparticles (AuNPs) as plasmonic labels for secondary enhancement of SPR response is presented. The influence of spatial organization and surface density of a receptor layer on the ability to interact with DNA-functionalized AuNPs is discussed. Due to the best compatibility of receptors immobilized via DTC chemisorption: 1.47 ± 0.4 · 10 12 molecules · cm -2 (with the calculated area occupied by single nanoparticle label of ~132.7 nm 2 ), DNA chemisorption based on DTCs is pointed as especially promising for DNA biosensors utilizing indirect detection in competitive assays.
Thierry, Alain R
2016-01-01
Circulating cell-free DNA (cfDNA) is a valuable source of tumor material available with a simple blood sampling enabling a noninvasive quantitative and qualitative analysis of the tumor genome. cfDNA is released by tumor cells and exhibits the genetic and epigenetic alterations of the tumor of origin. Circulating cell-free DNA (cfDNA) analysis constitutes a hopeful approach to provide a noninvasive tumor molecular test for cancer patients. Based upon basic research on the origin and structure of cfDNA, new information on circulating cell-free DNA (cfDNA) structure, and specific determination of cfDNA fragmentation and size, we revisited Q-PCR-based method and recently developed a the allele-specific-Q-PCR-based method with blocker (termed as Intplex) which is the first multiplexed test for cfDNA. This technique, named Intplex(®) and based on a refined Q-PCR method, derived from critical observations made on the specific structure and size of cfDNA. It enables the simultaneous determination of five parameters: the cfDNA total concentration, the presence of a previously known point mutation, the mutant (tumor) cfDNA concentration (ctDNA), the proportion of mutant cfDNA, and the cfDNA fragmentation index. Intplex(®) has enabled the first clinical validation of ctDNA analysis in oncology by detecting KRAS and BRAF point mutations in mCRC patients and has demonstrated that a blood test could replace tumor section analysis for the detection of KRAS and BRAF mutations. The Intplex(®) test can be adapted to all mutations, genes, or cancers and enables rapid, highly sensitive, cost-effective, and repetitive analysis. As regards to the determination of mutations on cfDNA Intplex(®) is limited to the mutational status of known hotspot mutation; it is a "targeted approach." However, it offers the opportunity in detecting quantitatively and dynamically mutation and could constitute a noninvasive attractive tool potentially allowing diagnosis, prognosis, theranostics, therapeutic monitoring, and follow-up of cancer patients expanding the scope of personalized cancer medicine.
UV-Visible Spectroscopy-Based Quantification of Unlabeled DNA Bound to Gold Nanoparticles.
Baldock, Brandi L; Hutchison, James E
2016-12-20
DNA-functionalized gold nanoparticles have been increasingly applied as sensitive and selective analytical probes and biosensors. The DNA ligands bound to a nanoparticle dictate its reactivity, making it essential to know the type and number of DNA strands bound to the nanoparticle surface. Existing methods used to determine the number of DNA strands per gold nanoparticle (AuNP) require that the sequences be fluorophore-labeled, which may affect the DNA surface coverage and reactivity of the nanoparticle and/or require specialized equipment and other fluorophore-containing reagents. We report a UV-visible-based method to conveniently and inexpensively determine the number of DNA strands attached to AuNPs of different core sizes. When this method is used in tandem with a fluorescence dye assay, it is possible to determine the ratio of two unlabeled sequences of different lengths bound to AuNPs. Two sizes of citrate-stabilized AuNPs (5 and 12 nm) were functionalized with mixtures of short (5 base) and long (32 base) disulfide-terminated DNA sequences, and the ratios of sequences bound to the AuNPs were determined using the new method. The long DNA sequence was present as a lower proportion of the ligand shell than in the ligand exchange mixture, suggesting it had a lower propensity to bind the AuNPs than the short DNA sequence. The ratio of DNA sequences bound to the AuNPs was not the same for the large and small AuNPs, which suggests that the radius of curvature had a significant influence on the assembly of DNA strands onto the AuNPs.
Liu, Xia; Xu, Yongdong; Li, Zhi; Jiang, Shengwei; Yao, Shuo; Wu, Rina; An, Yingfeng
2018-04-21
A silica sands-based method has been developed to isolate high quality genomic DNAs from cells of animals, plants and microorganisms, such as Hemisalanx prognathus, Spinacia oleracea, Pichia pastoris, Bacillus licheniformis and Escherichia coli. To the best of our knowledge, no DNA isolation method has so wide application until now. In addition, this method and a commercially available kit were compared in analysis of microbial communities using high-throughput 16s rDNA sequencing. As a result, the silica sands-based method was found to be even more efficient in isolating genomic DNA from gram-positive bacteria than the kit, indicating that it would become a very valuable choice to faithfully reflect the composition of microbial communities.
DNA Barcoding of Recently Diverged Species: Relative Performance of Matching Methods
van Velzen, Robin; Weitschek, Emanuel; Felici, Giovanni; Bakker, Freek T.
2012-01-01
Recently diverged species are challenging for identification, yet they are frequently of special interest scientifically as well as from a regulatory perspective. DNA barcoding has proven instrumental in species identification, especially in insects and vertebrates, but for the identification of recently diverged species it has been reported to be problematic in some cases. Problems are mostly due to incomplete lineage sorting or simply lack of a ‘barcode gap’ and probably related to large effective population size and/or low mutation rate. Our objective was to compare six methods in their ability to correctly identify recently diverged species with DNA barcodes: neighbor joining and parsimony (both tree-based), nearest neighbor and BLAST (similarity-based), and the diagnostic methods DNA-BAR, and BLOG. We analyzed simulated data assuming three different effective population sizes as well as three selected empirical data sets from published studies. Results show, as expected, that success rates are significantly lower for recently diverged species (∼75%) than for older species (∼97%) (P<0.00001). Similarity-based and diagnostic methods significantly outperform tree-based methods, when applied to simulated DNA barcode data (P<0.00001). The diagnostic method BLOG had highest correct query identification rate based on simulated (86.2%) as well as empirical data (93.1%), indicating that it is a consistently better method overall. Another advantage of BLOG is that it offers species-level information that can be used outside the realm of DNA barcoding, for instance in species description or molecular detection assays. Even though we can confirm that identification success based on DNA barcoding is generally high in our data, recently diverged species remain difficult to identify. Nevertheless, our results contribute to improved solutions for their accurate identification. PMID:22272356
DNA barcoding of recently diverged species: relative performance of matching methods.
van Velzen, Robin; Weitschek, Emanuel; Felici, Giovanni; Bakker, Freek T
2012-01-01
Recently diverged species are challenging for identification, yet they are frequently of special interest scientifically as well as from a regulatory perspective. DNA barcoding has proven instrumental in species identification, especially in insects and vertebrates, but for the identification of recently diverged species it has been reported to be problematic in some cases. Problems are mostly due to incomplete lineage sorting or simply lack of a 'barcode gap' and probably related to large effective population size and/or low mutation rate. Our objective was to compare six methods in their ability to correctly identify recently diverged species with DNA barcodes: neighbor joining and parsimony (both tree-based), nearest neighbor and BLAST (similarity-based), and the diagnostic methods DNA-BAR, and BLOG. We analyzed simulated data assuming three different effective population sizes as well as three selected empirical data sets from published studies. Results show, as expected, that success rates are significantly lower for recently diverged species (∼75%) than for older species (∼97%) (P<0.00001). Similarity-based and diagnostic methods significantly outperform tree-based methods, when applied to simulated DNA barcode data (P<0.00001). The diagnostic method BLOG had highest correct query identification rate based on simulated (86.2%) as well as empirical data (93.1%), indicating that it is a consistently better method overall. Another advantage of BLOG is that it offers species-level information that can be used outside the realm of DNA barcoding, for instance in species description or molecular detection assays. Even though we can confirm that identification success based on DNA barcoding is generally high in our data, recently diverged species remain difficult to identify. Nevertheless, our results contribute to improved solutions for their accurate identification.
Alkaline Comet Assay for Assessing DNA Damage in Individual Cells.
Pu, Xinzhu; Wang, Zemin; Klaunig, James E
2015-08-06
Single-cell gel electrophoresis, commonly called a comet assay, is a simple and sensitive method for assessing DNA damage at the single-cell level. It is an important technique in genetic toxicological studies. The comet assay performed under alkaline conditions (pH >13) is considered the optimal version for identifying agents with genotoxic activity. The alkaline comet assay is capable of detecting DNA double-strand breaks, single-strand breaks, alkali-labile sites, DNA-DNA/DNA-protein cross-linking, and incomplete excision repair sites. The inclusion of digestion of lesion-specific DNA repair enzymes in the procedure allows the detection of various DNA base alterations, such as oxidative base damage. This unit describes alkaline comet assay procedures for assessing DNA strand breaks and oxidative base alterations. These methods can be applied in a variety of cells from in vitro and in vivo experiments, as well as human studies. Copyright © 2015 John Wiley & Sons, Inc.
An Optimal Seed Based Compression Algorithm for DNA Sequences
Gopalakrishnan, Gopakumar; Karunakaran, Muralikrishnan
2016-01-01
This paper proposes a seed based lossless compression algorithm to compress a DNA sequence which uses a substitution method that is similar to the LempelZiv compression scheme. The proposed method exploits the repetition structures that are inherent in DNA sequences by creating an offline dictionary which contains all such repeats along with the details of mismatches. By ensuring that only promising mismatches are allowed, the method achieves a compression ratio that is at par or better than the existing lossless DNA sequence compression algorithms. PMID:27555868
Evaluation and comparison of FTA card and CTAB DNA extraction methods for non-agricultural taxa.
Siegel, Chloe S; Stevenson, Florence O; Zimmer, Elizabeth A
2017-02-01
An efficient, effective DNA extraction method is necessary for comprehensive analysis of plant genomes. This study analyzed the quality of DNA obtained using paper FTA cards prepared directly in the field when compared to the more traditional cetyltrimethylammonium bromide (CTAB)-based extraction methods from silica-dried samples. DNA was extracted using FTA cards according to the manufacturer's protocol. In parallel, CTAB-based extractions were done using the automated AutoGen DNA isolation system. DNA quality for both methods was determined for 15 non-agricultural species collected in situ, by gel separation, spectrophotometry, fluorometry, and successful amplification and sequencing of nuclear and chloroplast gene markers. The FTA card extraction method yielded less concentrated, but also less fragmented samples than the CTAB-based technique. The card-extracted samples provided DNA that could be successfully amplified and sequenced. The FTA cards are also useful because the collected samples do not require refrigeration, extensive laboratory expertise, or as many hazardous chemicals as extractions using the CTAB-based technique. The relative success of the FTA card method in our study suggested that this method could be a valuable tool for studies in plant population genetics and conservation biology that may involve screening of hundreds of individual plants. The FTA cards, like the silica gel samples, do not contain plant material capable of propagation, and therefore do not require permits from the U.S. Department of Agriculture (USDA) Animal and Plant Health Inspection Service (APHIS) for transportation.
Wagner Mackenzie, Brett; Waite, David W; Taylor, Michael W
2015-01-01
The human gut contains dense and diverse microbial communities which have profound influences on human health. Gaining meaningful insights into these communities requires provision of high quality microbial nucleic acids from human fecal samples, as well as an understanding of the sources of variation and their impacts on the experimental model. We present here a systematic analysis of commonly used microbial DNA extraction methods, and identify significant sources of variation. Five extraction methods (Human Microbiome Project protocol, MoBio PowerSoil DNA Isolation Kit, QIAamp DNA Stool Mini Kit, ZR Fecal DNA MiniPrep, phenol:chloroform-based DNA isolation) were evaluated based on the following criteria: DNA yield, quality and integrity, and microbial community structure based on Illumina amplicon sequencing of the V4 region of bacterial and archaeal 16S rRNA genes. Our results indicate that the largest portion of variation within the model was attributed to differences between subjects (biological variation), with a smaller proportion of variation associated with DNA extraction method (technical variation) and intra-subject variation. A comprehensive understanding of the potential impact of technical variation on the human gut microbiota will help limit preventable bias, enabling more accurate diversity estimates.
Díaz-Cano, S J; Brady, S P
1997-12-01
Several DNA extraction methods have been used for formalin-fixed, paraffin-embedded tissues, with variable results being reported regarding the suitability of DNA obtained from such sources to serve as template in polymerase chain reaction (PCR)-based genetic analyses. We present a method routinely used for archival material in our laboratory that reliably yields DNA of sufficient quality for PCR studies. This method is based on extended proteinase K digestion (250 micrograms/ml in an EDTA-free calcium-containing buffer supplemented with mussel glycogen) followed by phenol-chloroform extraction. Agarose gel electrophoresis of both digestion buffer aliquots and PCR amplification of the beta-globin gene tested the suitability of the retrieved DNA for PCR amplification.
Sina, Abu Ali Ibn; Howell, Sidney; Carrascosa, Laura G; Rauf, Sakandar; Shiddiky, Muhammad J A; Trau, Matt
2014-11-07
We report a simple electrochemical method referred to as "eMethylsorb" for the detection of DNA methylation. The method relies on the base dependent affinity interaction of DNA with gold. The methylation status of DNA is quantified by monitoring the electrochemical current as a function of the relative adsorption level of bisulphite treated DNA samples onto a bare gold electrode. This method can successfully distinguish methylated and unmethylated epigenotypes at single CpG resolution.
Xiong, Ai-Sheng; Yao, Quan-Hong; Peng, Ri-He; Li, Xian; Fan, Hui-Qin; Cheng, Zong-Ming; Li, Yi
2004-07-07
Chemical synthesis of DNA sequences provides a powerful tool for modifying genes and for studying gene function, structure and expression. Here, we report a simple, high-fidelity and cost-effective PCR-based two-step DNA synthesis (PTDS) method for synthesis of long segments of DNA. The method involves two steps. (i) Synthesis of individual fragments of the DNA of interest: ten to twelve 60mer oligonucleotides with 20 bp overlap are mixed and a PCR reaction is carried out with high-fidelity DNA polymerase Pfu to produce DNA fragments that are approximately 500 bp in length. (ii) Synthesis of the entire sequence of the DNA of interest: five to ten PCR products from the first step are combined and used as the template for a second PCR reaction using high-fidelity DNA polymerase pyrobest, with the two outermost oligonucleotides as primers. Compared with the previously published methods, the PTDS method is rapid (5-7 days) and suitable for synthesizing long segments of DNA (5-6 kb) with high G + C contents, repetitive sequences or complex secondary structures. Thus, the PTDS method provides an alternative tool for synthesizing and assembling long genes with complex structures. Using the newly developed PTDS method, we have successfully obtained several genes of interest with sizes ranging from 1.0 to 5.4 kb.
Visualization of DNA in highly processed botanical materials.
Lu, Zhengfei; Rubinsky, Maria; Babajanian, Silva; Zhang, Yanjun; Chang, Peter; Swanson, Gary
2018-04-15
DNA-based methods have been gaining recognition as a tool for botanical authentication in herbal medicine; however, their application in processed botanical materials is challenging due to the low quality and quantity of DNA left after extensive manufacturing processes. The low amount of DNA recovered from processed materials, especially extracts, is "invisible" by current technology, which has casted doubt on the presence of amplifiable botanical DNA. A method using adapter-ligation and PCR amplification was successfully applied to visualize the "invisible" DNA in botanical extracts. The size of the "invisible" DNA fragments in botanical extracts was around 20-220 bp compared to fragments of around 600 bp for the more easily visualized DNA in botanical powders. This technique is the first to allow characterization and visualization of small fragments of DNA in processed botanical materials and will provide key information to guide the development of appropriate DNA-based botanical authentication methods in the future. Copyright © 2017 Elsevier Ltd. All rights reserved.
Manlig, Erika; Wahlberg, Per
2017-01-01
Abstract Sodium bisulphite treatment of DNA combined with next generation sequencing (NGS) is a powerful combination for the interrogation of genome-wide DNA methylation profiles. Library preparation for whole genome bisulphite sequencing (WGBS) is challenging due to side effects of the bisulphite treatment, which leads to extensive DNA damage. Recently, a new generation of methods for bisulphite sequencing library preparation have been devised. They are based on initial bisulphite treatment of the DNA, followed by adaptor tagging of single stranded DNA fragments, and enable WGBS using low quantities of input DNA. In this study, we present a novel approach for quick and cost effective WGBS library preparation that is based on splinted adaptor tagging (SPLAT) of bisulphite-converted single-stranded DNA. Moreover, we validate SPLAT against three commercially available WGBS library preparation techniques, two of which are based on bisulphite treatment prior to adaptor tagging and one is a conventional WGBS method. PMID:27899585
Evaluation and comparison of FTA card and CTAB DNA extraction methods for non-agricultural taxa1
Siegel, Chloe S.; Stevenson, Florence O.; Zimmer, Elizabeth A.
2017-01-01
Premise of the study: An efficient, effective DNA extraction method is necessary for comprehensive analysis of plant genomes. This study analyzed the quality of DNA obtained using paper FTA cards prepared directly in the field when compared to the more traditional cetyltrimethylammonium bromide (CTAB)–based extraction methods from silica-dried samples. Methods: DNA was extracted using FTA cards according to the manufacturer’s protocol. In parallel, CTAB-based extractions were done using the automated AutoGen DNA isolation system. DNA quality for both methods was determined for 15 non-agricultural species collected in situ, by gel separation, spectrophotometry, fluorometry, and successful amplification and sequencing of nuclear and chloroplast gene markers. Results: The FTA card extraction method yielded less concentrated, but also less fragmented samples than the CTAB-based technique. The card-extracted samples provided DNA that could be successfully amplified and sequenced. The FTA cards are also useful because the collected samples do not require refrigeration, extensive laboratory expertise, or as many hazardous chemicals as extractions using the CTAB-based technique. Discussion: The relative success of the FTA card method in our study suggested that this method could be a valuable tool for studies in plant population genetics and conservation biology that may involve screening of hundreds of individual plants. The FTA cards, like the silica gel samples, do not contain plant material capable of propagation, and therefore do not require permits from the U.S. Department of Agriculture (USDA) Animal and Plant Health Inspection Service (APHIS) for transportation. PMID:28224056
DNA base-calling from a nanopore using a Viterbi algorithm.
Timp, Winston; Comer, Jeffrey; Aksimentiev, Aleksei
2012-05-16
Nanopore-based DNA sequencing is the most promising third-generation sequencing method. It has superior read length, speed, and sample requirements compared with state-of-the-art second-generation methods. However, base-calling still presents substantial difficulty because the resolution of the technique is limited compared with the measured signal/noise ratio. Here we demonstrate a method to decode 3-bp-resolution nanopore electrical measurements into a DNA sequence using a Hidden Markov model. This method shows tremendous potential for accuracy (~98%), even with a poor signal/noise ratio. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Detection of regional DNA methylation using DNA-graphene affinity interactions.
Haque, Md Hakimul; Gopalan, Vinod; Yadav, Sharda; Islam, Md Nazmul; Eftekhari, Ehsan; Li, Qin; Carrascosa, Laura G; Nguyen, Nam-Trung; Lam, Alfred K; Shiddiky, Muhammad J A
2017-01-15
We report a new method for the detection of regional DNA methylation using base-dependent affinity interaction (i.e., adsorption) of DNA with graphene. Due to the strongest adsorption affinity of guanine bases towards graphene, bisulfite-treated guanine-enriched methylated DNA leads to a larger amount of the adsorbed DNA on the graphene-modified electrodes in comparison to the adenine-enriched unmethylated DNA. The level of the methylation is quantified by monitoring the differential pulse voltammetric current as a function of the adsorbed DNA. The assay is sensitive to distinguish methylated and unmethylated DNA sequences at single CpG resolution by differentiating changes in DNA methylation as low as 5%. Furthermore, this method has been used to detect methylation levels in a collection of DNA samples taken from oesophageal cancer tissues. Copyright © 2016 Elsevier B.V. All rights reserved.
A method suitable for DNA extraction from humus-rich soil.
Miao, Tianjin; Gao, Song; Jiang, Shengwei; Kan, Guoshi; Liu, Pengju; Wu, Xianming; An, Yingfeng; Yao, Shuo
2014-11-01
A rapid and convenient method for extracting DNA from soil is presented. Soil DNA is extracted by direct cell lysis in the presence of EDTA, SDS, phenol, chloroform and isoamyl alcohol (3-methyl-1-butanol) followed by precipitation with 2-propanol. The extracted DNA is purified by modified DNA purification kit and DNA gel extraction kit. With this method, DNA extracted from humus-rich dark brown forest soil was free from humic substances and, therefore, could be used for efficient PCR amplification and restriction digestion. In contrast, DNA sample extracted with the traditional CTAB-based method had lower yield and purity, and no DNA could be extracted from the same soil sample with a commonly-used commercial soil DNA isolation kit. In addition, this method is time-saving and convenient, providing an efficient choice especially for DNA extraction from humus-rich soils.
Delineating Species with DNA Barcodes: A Case of Taxon Dependent Method Performance in Moths
Kekkonen, Mari; Mutanen, Marko; Kaila, Lauri; Nieminen, Marko; Hebert, Paul D. N.
2015-01-01
The accelerating loss of biodiversity has created a need for more effective ways to discover species. Novel algorithmic approaches for analyzing sequence data combined with rapidly expanding DNA barcode libraries provide a potential solution. While several analytical methods are available for the delineation of operational taxonomic units (OTUs), few studies have compared their performance. This study compares the performance of one morphology-based and four DNA-based (BIN, parsimony networks, ABGD, GMYC) methods on two groups of gelechioid moths. It examines 92 species of Finnish Gelechiinae and 103 species of Australian Elachistinae which were delineated by traditional taxonomy. The results reveal a striking difference in performance between the two taxa with all four DNA-based methods. OTU counts in the Elachistinae showed a wider range and a relatively low (ca. 65%) OTU match with reference species while OTU counts were more congruent and performance was higher (ca. 90%) in the Gelechiinae. Performance rose when only monophyletic species were compared, but the taxon-dependence remained. None of the DNA-based methods produced a correct match with non-monophyletic species, but singletons were handled well. A simulated test of morphospecies-grouping performed very poorly in revealing taxon diversity in these small, dull-colored moths. Despite the strong performance of analyses based on DNA barcodes, species delineated using single-locus mtDNA data are best viewed as OTUs that require validation by subsequent integrative taxonomic work. PMID:25849083
Supervised DNA Barcodes species classification: analysis, comparisons and results
2014-01-01
Background Specific fragments, coming from short portions of DNA (e.g., mitochondrial, nuclear, and plastid sequences), have been defined as DNA Barcode and can be used as markers for organisms of the main life kingdoms. Species classification with DNA Barcode sequences has been proven effective on different organisms. Indeed, specific gene regions have been identified as Barcode: COI in animals, rbcL and matK in plants, and ITS in fungi. The classification problem assigns an unknown specimen to a known species by analyzing its Barcode. This task has to be supported with reliable methods and algorithms. Methods In this work the efficacy of supervised machine learning methods to classify species with DNA Barcode sequences is shown. The Weka software suite, which includes a collection of supervised classification methods, is adopted to address the task of DNA Barcode analysis. Classifier families are tested on synthetic and empirical datasets belonging to the animal, fungus, and plant kingdoms. In particular, the function-based method Support Vector Machines (SVM), the rule-based RIPPER, the decision tree C4.5, and the Naïve Bayes method are considered. Additionally, the classification results are compared with respect to ad-hoc and well-established DNA Barcode classification methods. Results A software that converts the DNA Barcode FASTA sequences to the Weka format is released, to adapt different input formats and to allow the execution of the classification procedure. The analysis of results on synthetic and real datasets shows that SVM and Naïve Bayes outperform on average the other considered classifiers, although they do not provide a human interpretable classification model. Rule-based methods have slightly inferior classification performances, but deliver the species specific positions and nucleotide assignments. On synthetic data the supervised machine learning methods obtain superior classification performances with respect to the traditional DNA Barcode classification methods. On empirical data their classification performances are at a comparable level to the other methods. Conclusions The classification analysis shows that supervised machine learning methods are promising candidates for handling with success the DNA Barcoding species classification problem, obtaining excellent performances. To conclude, a powerful tool to perform species identification is now available to the DNA Barcoding community. PMID:24721333
Paz, Andrea; Crawford, Andrew J
2012-11-01
Molecular markers offer a universal source of data for quantifying biodiversity. DNA barcoding uses a standardized genetic marker and a curated reference database to identify known species and to reveal cryptic diversity within wellsampled clades. Rapid biological inventories, e.g. rapid assessment programs (RAPs), unlike most barcoding campaigns, are focused on particular geographic localities rather than on clades. Because of the potentially sparse phylogenetic sampling, the addition of DNA barcoding to RAPs may present a greater challenge for the identification of named species or for revealing cryptic diversity. In this article we evaluate the use of DNA barcoding for quantifying lineage diversity within a single sampling site as compared to clade-based sampling, and present examples from amphibians. We compared algorithms for identifying DNA barcode clusters (e.g. species, cryptic species or Evolutionary Significant Units) using previously published DNA barcode data obtained from geography-based sampling at a site in Central Panama, and from clade-based sampling in Madagascar. We found that clustering algorithms based on genetic distance performed similarly on sympatric as well as clade-based barcode data, while a promising coalescent-based method performed poorly on sympatric data. The various clustering algorithms were also compared in terms of speed and software implementation. Although each method has its shortcomings in certain contexts, we recommend the use of the ABGD method, which not only performs fairly well under either sampling method, but does so in a few seconds and with a user-friendly Web interface.
Extraction of genomic DNA from yeasts for PCR-based applications.
Lõoke, Marko; Kristjuhan, Kersti; Kristjuhan, Arnold
2011-05-01
We have developed a quick and low-cost genomic DNA extraction protocol from yeast cells for PCR-based applications. This method does not require any enzymes, hazardous chemicals, or extreme temperatures, and is especially powerful for simultaneous analysis of a large number of samples. DNA can be efficiently extracted from different yeast species (Kluyveromyces lactis, Hansenula polymorpha, Schizosaccharomyces pombe, Candida albicans, Pichia pastoris, and Saccharomyces cerevisiae). The protocol involves lysis of yeast colonies or cells from liquid culture in a lithium acetate (LiOAc)-SDS solution and subsequent precipitation of DNA with ethanol. Approximately 100 nanograms of total genomic DNA can be extracted from 1 × 10(7) cells. DNA extracted by this method is suitable for a variety of PCR-based applications (including colony PCR, real-time qPCR, and DNA sequencing) for amplification of DNA fragments of ≤ 3500 bp.
Molecular methods, such as DNA barcoding, have the potential in enhance biomonitoring programs worldwide. Altering routinely used sample preservation methods to protect DNA from degradation may pose a potential impediment to application of DNA barcoding and metagenomics for biom...
Loukanov, Alexandre; Filipov, Chavdar; Mladenova, Polina; Toshev, Svetlin; Emin, Saim
2016-04-01
The object of the present report is to provide a method for a visualization of DNA in TEM by complementary labeling of cytosine with guanine derivative, which contains platinum as contrast-enhanced heavy element. The stretched single-chain DNA was obtained by modifying double-stranded DNA. The labeling method comprises the following steps: (i) stretching and adsorption of DNA on the support film of an electron microscope grid (the hydrophobic carbon film holding negative charged DNA); (ii) complementary labeling of the cytosine bases from the stretched single-stranded DNA pieces on the support film with platinum containing guanine derivative to form base-specific hydrogen bond; and (iii) producing a magnified image of the base-specific labeled DNA. Stretched single-stranded DNA on a support film is obtained by a rapid elongation of DNA pieces on the surface between air and aqueous buffer solution. The attached platinum-containing guanine derivative serves as a high-dense marker and it can be discriminated from the surrounding background of support carbon film and visualized by use of conventional TEM observation at 100 kV accelerated voltage. This method allows examination of specific nucleic macromolecules through atom-by-atom analysis and it is promising way toward future DNA-sequencing or molecular diagnostics of nucleic acids by electron microscopic observation. © 2016 Wiley Periodicals, Inc.
Wu, Zheng; Zeng, Li-bo; Wu, Qiong-shui
2016-02-01
The conventional cervical cancer screening methods mainly include TBS (the bethesda system) classification method and cellular DNA quantitative analysis, however, by using multiple staining method in one cell slide, which is staining the cytoplasm with Papanicolaou reagent and the nucleus with Feulgen reagent, the study of achieving both two methods in the cervical cancer screening at the same time is still blank. Because the difficulty of this multiple staining method is that the absorbance of the non-DNA material may interfere with the absorbance of DNA, so that this paper has set up a multi-spectral imaging system, and established an absorbance unmixing model by using multiple linear regression method based on absorbance's linear superposition character, and successfully stripped out the absorbance of DNA to run the DNA quantitative analysis, and achieved the perfect combination of those two kinds of conventional screening method. Through a series of experiment we have proved that between the absorbance of DNA which is calculated by the absorbance unmixxing model and the absorbance of DNA which is measured there is no significant difference in statistics when the test level is 1%, also the result of actual application has shown that there is no intersection between the confidence interval of the DNA index of the tetraploid cells which are screened by using this paper's analysis method when the confidence level is 99% and the DNA index's judging interval of cancer cells, so that the accuracy and feasibility of the quantitative DNA analysis with multiple staining method expounded by this paper have been verified, therefore this analytical method has a broad application prospect and considerable market potential in early diagnosis of cervical cancer and other cancers.
Nanofluidic Device with Embedded Nanopore
NASA Astrophysics Data System (ADS)
Zhang, Yuning; Reisner, Walter
2014-03-01
Nanofluidic based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with nanpore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a nanopore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We demonstrate that we can detect - using fluorescent microscopy - successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. We also show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore until a certain voltage bias is added.
Fang, Xin-Yu; Li, Wen-Bo; Zhang, Chao-Fan; Huang, Zi-da; Zeng, Hui-Yi; Dong, Zheng; Zhang, Wen-Ming
2018-02-01
To explore the diagnostic efficiency of DNA-based and RNA-based quantitative polymerase chain reaction (qPCR) analyses for periprosthetic joint infection (PJI). To determine the detection limit of DNA-based and RNA-based qPCR in vitro, Staphylococcus aureus and Escherichia coli strains were added to sterile synovial fluid obtained from a patient with knee osteoarthritis. Serial dilutions of samples were analyzed by DNA-based and RNA-based qPCR. Clinically, patients who were suspected of having PJI and eventually underwent revision arthroplasty in our hospital from July 2014 to December 2016 were screened. Preoperative puncture or intraoperative collection was performed on patients who met the inclusion and exclusion criteria to obtain synovial fluid. DNA-based and RNA-based PCR analyses and culture were performed on each synovial fluid sample. The patients' demographic characteristics, medical history, and laboratory test results were recorded. The diagnostic efficiency of both PCR assays was compared with culture methods. The in vitro analysis demonstrated that DNA-based qPCR assay was highly sensitive, with the detection limit being 1200 colony forming units (CFU)/mL of S. aureus and 3200 CFU/mL of E. coli. Meanwhile, The RNA-based qPCR assay could detect 2300 CFU/mL of S. aureus and 11 000 CFU/mL of E. coli. Clinically, the sensitivity, specificity, and accuracy were 65.7%, 100%, and 81.6%, respectively, for the culture method; 81.5%, 84.8%, and 83.1%, respectively, for DNA-based qPCR; and 73.6%, 100%, and 85.9%, respectively, for RNA-based qPCR. DNA-based qPCR could detect suspected PJI with high sensitivity after antibiotic therapy. RNA-based qPCR could reduce the false positive rates of DNA-based assays. qPCR-based methods could improve the efficiency of PJI diagnosis. © 2018 Chinese Orthopaedic Association and John Wiley & Sons Australia, Ltd.
Vandersall, Jennifer A.; Gardner, Shea N.; Clague, David S.
2010-05-04
A computational method and computer-based system of modeling DNA synthesis for the design and interpretation of PCR amplification, parallel DNA synthesis, and microarray chip analysis. The method and system include modules that address the bioinformatics, kinetics, and thermodynamics of DNA amplification and synthesis. Specifically, the steps of DNA selection, as well as the kinetics and thermodynamics of DNA hybridization and extensions, are addressed, which enable the optimization of the processing and the prediction of the products as a function of DNA sequence, mixing protocol, time, temperature and concentration of species.
Multiplex cDNA quantification method that facilitates the standardization of gene expression data
Gotoh, Osamu; Murakami, Yasufumi; Suyama, Akira
2011-01-01
Microarray-based gene expression measurement is one of the major methods for transcriptome analysis. However, current microarray data are substantially affected by microarray platforms and RNA references because of the microarray method can provide merely the relative amounts of gene expression levels. Therefore, valid comparisons of the microarray data require standardized platforms, internal and/or external controls and complicated normalizations. These requirements impose limitations on the extensive comparison of gene expression data. Here, we report an effective approach to removing the unfavorable limitations by measuring the absolute amounts of gene expression levels on common DNA microarrays. We have developed a multiplex cDNA quantification method called GEP-DEAN (Gene expression profiling by DCN-encoding-based analysis). The method was validated by using chemically synthesized DNA strands of known quantities and cDNA samples prepared from mouse liver, demonstrating that the absolute amounts of cDNA strands were successfully measured with a sensitivity of 18 zmol in a highly multiplexed manner in 7 h. PMID:21415008
Shinozuka, Hiroshi; Cogan, Noel O I; Shinozuka, Maiko; Marshall, Alexis; Kay, Pippa; Lin, Yi-Han; Spangenberg, German C; Forster, John W
2015-04-11
Fragmentation at random nucleotide locations is an essential process for preparation of DNA libraries to be used on massively parallel short-read DNA sequencing platforms. Although instruments for physical shearing, such as the Covaris S2 focused-ultrasonicator system, and products for enzymatic shearing, such as the Nextera technology and NEBNext dsDNA Fragmentase kit, are commercially available, a simple and inexpensive method is desirable for high-throughput sequencing library preparation. MspJI is a recently characterised restriction enzyme which recognises the sequence motif CNNR (where R = G or A) when the first base is modified to 5-methylcytosine or 5-hydroxymethylcytosine. A semi-random enzymatic DNA amplicon fragmentation method was developed based on the unique cleavage properties of MspJI. In this method, random incorporation of 5-methyl-2'-deoxycytidine-5'-triphosphate is achieved through DNA amplification with DNA polymerase, followed by DNA digestion with MspJI. Due to the recognition sequence of the enzyme, DNA amplicons are fragmented in a relatively sequence-independent manner. The size range of the resulting fragments was capable of control through optimisation of 5-methyl-2'-deoxycytidine-5'-triphosphate concentration in the reaction mixture. A library suitable for sequencing using the Illumina MiSeq platform was prepared and processed using the proposed method. Alignment of generated short reads to a reference sequence demonstrated a relatively high level of random fragmentation. The proposed method may be performed with standard laboratory equipment. Although the uniformity of coverage was slightly inferior to the Covaris physical shearing procedure, due to efficiencies of cost and labour, the method may be more suitable than existing approaches for implementation in large-scale sequencing activities, such as bacterial artificial chromosome (BAC)-based genome sequence assembly, pan-genomic studies and locus-targeted genotyping-by-sequencing.
An Investigative Graduate Laboratory Course for Teaching Modern DNA Techniques
ERIC Educational Resources Information Center
de Lencastre, Alexandre; Torello, A. Thomas; Keller, Lani C.
2017-01-01
This graduate-level DNA methods laboratory course is designed to model a discovery-based research project and engages students in both traditional DNA analysis methods and modern recombinant DNA cloning techniques. In the first part of the course, students clone the "Drosophila" ortholog of a human disease gene of their choosing using…
Trujillo-Esquivel, Elías; Franco, Bernardo; Flores-Martínez, Alberto; Ponce-Noyola, Patricia; Mora-Montes, Héctor M
2016-08-02
Analysis of gene expression is a common research tool to study networks controlling gene expression, the role of genes with unknown function, and environmentally induced responses of organisms. Most of the analytical tools used to analyze gene expression rely on accurate cDNA synthesis and quantification to obtain reproducible and quantifiable results. Thus far, most commercial kits for isolation and purification of cDNA target double-stranded molecules, which do not accurately represent the abundance of transcripts. In the present report, we provide a simple and fast method to purify single-stranded cDNA, exhibiting high purity and yield. This method is based on the treatment with RNase H and RNase A after cDNA synthesis, followed by separation in silica spin-columns and ethanol precipitation. In addition, our method avoids the use of DNase I to eliminate genomic DNA from RNA preparations, which improves cDNA yield. As a case report, our method proved to be useful in the purification of single-stranded cDNA from the pathogenic fungus Sporothrix schenckii.
Identifying species of moths (Lepidoptera) from Baihua Mountain, Beijing, China, using DNA barcodes
Liu, Xiao F; Yang, Cong H; Han, Hui L; Ward, Robert D; Zhang, Ai-bing
2014-01-01
DNA barcoding has become a promising means for the identification of organisms of all life-history stages. Currently, distance-based and tree-based methods are most widely used to define species boundaries and uncover cryptic species. However, there is no universal threshold of genetic distance values that can be used to distinguish taxonomic groups. Alternatively, DNA barcoding can deploy a “character-based” method, whereby species are identified through the discrete nucleotide substitutions. Our research focuses on the delimitation of moth species using DNA-barcoding methods. We analyzed 393 Lepidopteran specimens belonging to 80 morphologically recognized species with a standard cytochrome c oxidase subunit I (COI) sequencing approach, and deployed tree-based, distance-based, and diagnostic character-based methods to identify the taxa. The tree-based method divided the 393 specimens into 79 taxa (species), and the distance-based method divided them into 84 taxa (species). Although the diagnostic character-based method found only 39 so-identifiable species in the 80 species, with a reduction in sample size the accuracy rate substantially improved. For example, in the Arctiidae subset, all 12 species had diagnostics characteristics. Compared with traditional morphological method, molecular taxonomy performed well. All three methods enable the rapid delimitation of species, although they have different characteristics and different strengths. The tree-based and distance-based methods can be used for accurate species identification and biodiversity studies in large data sets, while the character-based method performs well in small data sets and can also be used as the foundation of species-specific biochips. PMID:25360280
Structural DNA nanotechnology: from design to applications.
Zadegan, Reza M; Norton, Michael L
2012-01-01
The exploitation of DNA for the production of nanoscale architectures presents a young yet paradigm breaking approach, which addresses many of the barriers to the self-assembly of small molecules into highly-ordered nanostructures via construct addressability. There are two major methods to construct DNA nanostructures, and in the current review we will discuss the principles and some examples of applications of both the tile-based and DNA origami methods. The tile-based approach is an older method that provides a good tool to construct small and simple structures, usually with multiply repeated domains. In contrast, the origami method, at this time, would appear to be more appropriate for the construction of bigger, more sophisticated and exactly defined structures.
A Comparison of DNA Extraction Methods using Petunia hybrida Tissues
Tamari, Farshad; Hinkley, Craig S.; Ramprashad, Naderia
2013-01-01
Extraction of DNA from plant tissue is often problematic, as many plants contain high levels of secondary metabolites that can interfere with downstream applications, such as the PCR. Removal of these secondary metabolites usually requires further purification of the DNA using organic solvents or other toxic substances. In this study, we have compared two methods of DNA purification: the cetyltrimethylammonium bromide (CTAB) method that uses the ionic detergent hexadecyltrimethylammonium bromide and chloroform-isoamyl alcohol and the Edwards method that uses the anionic detergent SDS and isopropyl alcohol. Our results show that the Edwards method works better than the CTAB method for extracting DNA from tissues of Petunia hybrida. For six of the eight tissues, the Edwards method yielded more DNA than the CTAB method. In four of the tissues, this difference was statistically significant, and the Edwards method yielded 27–80% more DNA than the CTAB method. Among the different tissues tested, we found that buds, 4 days before anthesis, had the highest DNA concentrations and that buds and reproductive tissue, in general, yielded higher DNA concentrations than other tissues. In addition, DNA extracted using the Edwards method was more consistently PCR-amplified than that of CTAB-extracted DNA. Based on these results, we recommend using the Edwards method to extract DNA from plant tissues and to use buds and reproductive structures for highest DNA yields. PMID:23997658
Flow cytometric detection method for DNA samples
Nasarabadi, Shanavaz [Livermore, CA; Langlois, Richard G [Livermore, CA; Venkateswaran, Kodumudi S [Round Rock, TX
2011-07-05
Disclosed herein are two methods for rapid multiplex analysis to determine the presence and identity of target DNA sequences within a DNA sample. Both methods use reporting DNA sequences, e.g., modified conventional Taqman.RTM. probes, to combine multiplex PCR amplification with microsphere-based hybridization using flow cytometry means of detection. Real-time PCR detection can also be incorporated. The first method uses a cyanine dye, such as, Cy3.TM., as the reporter linked to the 5' end of a reporting DNA sequence. The second method positions a reporter dye, e.g., FAM.TM. on the 3' end of the reporting DNA sequence and a quencher dye, e.g., TAMRA.TM., on the 5' end.
Flow cytometric detection method for DNA samples
Nasarabadi, Shanavaz [Livermore, CA; Langlois, Richard G [Livermore, CA; Venkateswaran, Kodumudi S [Livermore, CA
2006-08-01
Disclosed herein are two methods for rapid multiplex analysis to determine the presence and identity of target DNA sequences within a DNA sample. Both methods use reporting DNA sequences, e.g., modified conventional Taqman.RTM. probes, to combine multiplex PCR amplification with microsphere-based hybridization using flow cytometry means of detection. Real-time PCR detection can also be incorporated. The first method uses a cyanine dye, such as, Cy3.TM., as the reporter linked to the 5' end of a reporting DNA sequence. The second method positions a reporter dye, e.g., FAM, on the 3' end of the reporting DNA sequence and a quencher dye, e.g., TAMRA, on the 5' end.
Pilliod, David S.; Goldberg, Caren S.; Arkle, Robert S.; Waits, Lisette P.
2013-01-01
Environmental DNA (eDNA) methods for detecting aquatic species are advancing rapidly, but with little evaluation of field protocols or precision of resulting estimates. We compared sampling results from traditional field methods with eDNA methods for two amphibians in 13 streams in central Idaho, USA. We also evaluated three water collection protocols and the influence of sampling location, time of day, and distance from animals on eDNA concentration in the water. We found no difference in detection or amount of eDNA among water collection protocols. eDNA methods had slightly higher detection rates than traditional field methods, particularly when species occurred at low densities. eDNA concentration was positively related to field-measured density, biomass, and proportion of transects occupied. Precision of eDNA-based abundance estimates increased with the amount of eDNA in the water and the number of replicate subsamples collected. eDNA concentration did not vary significantly with sample location in the stream, time of day, or distance downstream from animals. Our results further advance the implementation of eDNA methods for monitoring aquatic vertebrates in stream habitats.
Traditional environmental mold analysis is based-on microscopic observations and counting of mold structures collected from the air on a sticky surface or culturing of molds on growth media for identification and quantification. A DNA-based method of mold analysis called mol...
The integration of DNA-based identification methods into bioassessments could result in more accurate representations of species distributions and species-habitat relationships. DNA-based approaches may be particularly informative for tracking the distributions of rare and/or inv...
Googling DNA sequences on the World Wide Web.
Hajibabaei, Mehrdad; Singer, Gregory A C
2009-11-10
New web-based technologies provide an excellent opportunity for sharing and accessing information and using web as a platform for interaction and collaboration. Although several specialized tools are available for analyzing DNA sequence information, conventional web-based tools have not been utilized for bioinformatics applications. We have developed a novel algorithm and implemented it for searching species-specific genomic sequences, DNA barcodes, by using popular web-based methods such as Google. We developed an alignment independent character based algorithm based on dividing a sequence library (DNA barcodes) and query sequence to words. The actual search is conducted by conventional search tools such as freely available Google Desktop Search. We implemented our algorithm in two exemplar packages. We developed pre and post-processing software to provide customized input and output services, respectively. Our analysis of all publicly available DNA barcode sequences shows a high accuracy as well as rapid results. Our method makes use of conventional web-based technologies for specialized genetic data. It provides a robust and efficient solution for sequence search on the web. The integration of our search method for large-scale sequence libraries such as DNA barcodes provides an excellent web-based tool for accessing this information and linking it to other available categories of information on the web.
Jia, Zhaofeng; Liang, Yujie; Ma, Bin; Xu, Xiao; Xiong, Jianyi; Duan, Li; Wang, Daping
2017-05-17
The dedifferentiation of hyaline chondrocytes into fibroblastic chondrocytes often accompanies monolayer expansion of chondrocytes in vitro. The global DNA methylation level of chondrocytes is considered to be a suitable biomarker for the loss of the chondrocyte phenotype. However, results based on different experimental methods can be inconsistent. Therefore, it is important to establish a precise, simple, and rapid method to quantify global DNA methylation levels during chondrocyte dedifferentiation. Current genome-wide methylation analysis techniques largely rely on bisulfite genomic sequencing. Due to DNA degradation during bisulfite conversion, these methods typically require a large sample volume. Other methods used to quantify global DNA methylation levels include high-performance liquid chromatography (HPLC). However, HPLC requires complete digestion of genomic DNA. Additionally, the prohibitively high cost of HPLC instruments limits HPLC's wider application. In this study, genomic DNA (gDNA) was extracted from human chondrocytes cultured with varying number of passages. The gDNA methylation level was detected using a methylation-specific dot blot assay. In this dot blot approach, a gDNA mixture containing the methylated DNA to be detected was spotted directly onto an N + membrane as a dot inside a previously drawn circular template pattern. Compared with other gel electrophoresis-based blotting approaches and other complex blotting procedures, the dot blot method saves significant time. In addition, dot blots can detect overall DNA methylation level using a commercially available 5-mC antibody. We found that the DNA methylation level differed between the monolayer subcultures, and therefore could play a key role in chondrocyte dedifferentiation. The 5-mC dot blot is a reliable, simple, and rapid method to detect the general DNA methylation level to evaluate chondrocyte phenotype.
Double stranded nucleic acid biochips
Chernov, Boris; Golova, Julia
2006-05-23
This invention describes a new method of constructing double-stranded DNA (dsDNA) microarrays based on the use of pre-synthesized or natural DNA duplexes without a stem-loop structure. The complementary oligonucleotide chains are bonded together by a novel connector that includes a linker for immobilization on a matrix. A non-enzymatic method for synthesizing double-stranded nucleic acids with this novel connector enables the construction of inexpensive and robust dsDNA/dsRNA microarrays. DNA-DNA and DNA-protein interactions are investigated using the microarrays.
Feasibility study of molecular memory device based on DNA using methylation to store information
NASA Astrophysics Data System (ADS)
Jiang, Liming; Qiu, Wanzhi; Al-Dirini, Feras; Hossain, Faruque M.; Evans, Robin; Skafidas, Efstratios
2016-07-01
DNA, because of its robustness and dense information storage capability, has been proposed as a potential candidate for next-generation storage media. However, encoding information into the DNA sequence requires molecular synthesis technology, which to date is costly and prone to synthesis errors. Reading the DNA strand information is also complex. Ideally, DNA storage will provide methods for modifying stored information. Here, we conduct a feasibility study investigating the use of the DNA 5-methylcytosine (5mC) methylation state as a molecular memory to store information. We propose a new 1-bit memory device and study, based on the density functional theory and non-equilibrium Green's function method, the feasibility of electrically reading the information. Our results show that changes to methylation states lead to changes in the peak of negative differential resistance which can be used to interrogate memory state. Our work demonstrates a new memory concept based on methylation state which can be beneficial in the design of next generation DNA based molecular electronic memory devices.
Takasaki, Shigeru
2012-01-01
This paper first explains how the relations between Japanese Alzheimer's disease (AD) patients and their mitochondrial SNP frequencies at individual mtDNA positions examined using the radial basis function (RBF) network and a method based on RBF network predictions and that Japanese AD patients are associated with the haplogroups G2a and N9b1. It then describes a method for the initial diagnosis of Alzheimer's disease that is based on the mtSNP haplogroups of the AD patients. The method examines the relations between someone's mtDNA mutations and the mtSNPs of AD patients. As the mtSNP haplogroups thus obtained indicate which nucleotides of mtDNA loci are changed in the Alzheimer's patients, a person's probability of becoming an AD patient can be predicted by comparing those mtDNA mutations with that person's mtDNA mutations. The proposed method can also be used to diagnose diseases such as Parkinson's disease and type 2 diabetes and to identify people likely to become centenarians. PMID:22848858
Lee, James W.; Thundat, Thomas G.
2005-06-14
An apparatus and method for performing nucleic acid (DNA and/or RNA) sequencing on a single molecule. The genetic sequence information is obtained by probing through a DNA or RNA molecule base by base at nanometer scale as though looking through a strip of movie film. This DNA sequencing nanotechnology has the theoretical capability of performing DNA sequencing at a maximal rate of about 1,000,000 bases per second. This enhanced performance is made possible by a series of innovations including: novel applications of a fine-tuned nanometer gap for passage of a single DNA or RNA molecule; thin layer microfluidics for sample loading and delivery; and programmable electric fields for precise control of DNA or RNA movement. Detection methods include nanoelectrode-gated tunneling current measurements, dielectric molecular characterization, and atomic force microscopy/electrostatic force microscopy (AFM/EFM) probing for nanoscale reading of the nucleic acid sequences.
Kumar Khanna, Vinod
2007-01-01
The current status and research trends of detection techniques for DNA-based analysis such as DNA finger printing, sequencing, biochips and allied fields are examined. An overview of main detectors is presented vis-à-vis these DNA operations. The biochip method is explained, the role of micro- and nanoelectronic technologies in biochip realization is highlighted, various optical and electrical detection principles employed in biochips are indicated, and the operational mechanisms of these detection devices are described. Although a diversity of biochips for diagnostic and therapeutic applications has been demonstrated in research laboratories worldwide, only some of these chips have entered the clinical market, and more chips are awaiting commercialization. The necessity of tagging is eliminated in refractive-index change based devices, but the basic flaw of indirect nature of most detection methodologies can only be overcome by generic and/or reagentless DNA sensors such as the conductance-based approach and the DNA-single electron transistor (DNA-SET) structure. Devices of the electrical detection-based category are expected to pave the pathway for the next-generation DNA chips. The review provides a comprehensive coverage of the detection technologies for DNA finger printing, sequencing and related techniques, encompassing a variety of methods from the primitive art to the state-of-the-art scenario as well as promising methods for the future.
Absolute quantification of DNA methylation using microfluidic chip-based digital PCR.
Wu, Zhenhua; Bai, Yanan; Cheng, Zule; Liu, Fangming; Wang, Ping; Yang, Dawei; Li, Gang; Jin, Qinghui; Mao, Hongju; Zhao, Jianlong
2017-10-15
Hypermethylation of CpG islands in the promoter region of many tumor suppressor genes downregulates their expression and in a result promotes tumorigenesis. Therefore, detection of DNA methylation status is a convenient diagnostic tool for cancer detection. Here, we reported a novel method for the integrative detection of methylation by the microfluidic chip-based digital PCR. This method relies on methylation-sensitive restriction enzyme HpaII, which cleaves the unmethylated DNA strands while keeping the methylated ones intact. After HpaII treatment, the DNA methylation level is determined quantitatively by the microfluidic chip-based digital PCR with the lower limit of detection equal to 0.52%. To validate the applicability of this method, promoter methylation of two tumor suppressor genes (PCDHGB6 and HOXA9) was tested in 10 samples of early stage lung adenocarcinoma and their adjacent non-tumorous tissues. The consistency was observed in the analysis of these samples using our method and a conventional bisulfite pyrosequencing. Combining high sensitivity and low cost, the microfluidic chip-based digital PCR method might provide a promising alternative for the detection of DNA methylation and early diagnosis of epigenetics-related diseases. Copyright © 2017 Elsevier B.V. All rights reserved.
Prado, Marta; Boix, Ana; von Holst, Christoph
2012-07-01
The development of DNA-based methods for the identification and quantification of fish in food and feed samples is frequently focused on a specific fish species and/or on the detection of mitochondrial DNA of fish origin. However, a quantitative method for the most common fish species used by the food and feed industry is needed for official control purposes, and such a method should rely on the use of a single-copy nuclear DNA target owing to its more stable copy number in different tissues. In this article, we report on the development of a real-time PCR method based on the use of a nuclear gene as a target for the simultaneous detection of fish DNA from different species and on the evaluation of its quantification potential. The method was tested in 22 different fish species, including those most commonly used by the food and feed industry, and in negative control samples, which included 15 animal species and nine feed ingredients. The results show that the method reported here complies with the requirements concerning specificity and with the criteria required for real-time PCR methods with high sensitivity.
Leclercq, L; Laurent, C; De Pauw, E
1997-05-15
A method was developed for the analysis of 7-(2-hydroxyethyl)guanine (7HEG), the major DNA adduct formed after exposure to ethylene oxide (EO). The method is based on DNA neutral thermal hydrolysis, adduct micro-concentration, and final characterization and quantification by HPLC coupled to single-ion monitoring electrospray mass spectrometry (HPLC/SIR-ESMS). The method was found to be selective, sensitive, and easy to handle with no need for enzymatic digestion or previous sample derivatization. Detection limit was found to be close to 1 fmol of adduct injected (10(-10) M), thus allowing the detection of approximately three modified bases on 10(8) intact nucleotides in blood sample analysis. Quantification results are shown for 7HEG after calf thymus DNA and blood exposure to various doses of EO, in both cases obtaining clear dose-response relationships.
A novel single-stranded DNA detection method based on organic semiconductor heterojunction
NASA Astrophysics Data System (ADS)
Gu, Wen; Liu, Hongbo; Zhang, Xia; Zhang, Hao; Chen, Xiong; Wang, Jun
2016-12-01
We demonstrate a novel DNA detection method with low-cost and disposable advantages by utilizing F16CuPc/CuPc planar organic heterojunction device. Single-stranded DNA (ssDNA) molecules have been well immobilized on the surface of CuPc film observed by atomic force microscopy, producing an obvious electrical response of the device. The conductivity of the organic heterojunction film was significantly increased by ssDNA immobilization because ssDNA molecules brought additional positive charges at heterojunction interface. Furthermore, the thickness dependence of CuPc upper layer on the electrical response was studied to optimize the sensitivity. This study will be helpful for the development of organic heterojunction based biosensors.
Method for sequencing DNA base pairs
Sessler, Andrew M.; Dawson, John
1993-01-01
The base pairs of a DNA structure are sequenced with the use of a scanning tunneling microscope (STM). The DNA structure is scanned by the STM probe tip, and, as it is being scanned, the DNA structure is separately subjected to a sequence of infrared radiation from four different sources, each source being selected to preferentially excite one of the four different bases in the DNA structure. Each particular base being scanned is subjected to such sequence of infrared radiation from the four different sources as that particular base is being scanned. The DNA structure as a whole is separately imaged for each subjection thereof to radiation from one only of each source.
Gene sequence analyses and other DNA-based methods for yeast species recognition
USDA-ARS?s Scientific Manuscript database
DNA sequence analyses, as well as other DNA-based methodologies, have transformed the way in which yeasts are identified. The focus of this chapter will be on the resolution of species using various types of DNA comparisons. In other chapters in this book, Rozpedowska, Piškur and Wolfe discuss mul...
Development of DNA-based Identification methods to track the ...
The ability to track the identity and abundance of larval fish, which are ubiquitous during spawning season, may lead to a greater understanding of fish species distributions in Great Lakes nearshore areas including early-detection of invasive fish species before they become established. However, larval fish are notoriously hard to identify using traditional morphological techniques. While DNA-based identification methods could increase the ability of aquatic resource managers to determine larval fish composition, use of these methods in aquatic surveys is still uncommon and presents many challenges. In response to this need, we have been working with the U. S. Fish and Wildlife Service to develop field and laboratory methods to facilitate the identification of larval fish using DNA-meta-barcoding. In 2012, we initiated a pilot-project to develop a workflow for conducting DNA-based identification, and compared the species composition at sites within the St. Louis River Estuary of Lake Superior using traditional identification versus DNA meta-barcoding. In 2013, we extended this research to conduct DNA-identification of fish larvae collected from multiple nearshore areas of the Great Lakes by the USFWS. The species composition of larval fish generally mirrored that of fish species known from the same areas, but was influenced by the timing and intensity of sampling. Results indicate that DNA-based identification needs only very low levels of biomass to detect pre
Comparative analysis of protocols for DNA extraction from soybean caterpillars.
Palma, J; Valmorbida, I; da Costa, I F D; Guedes, J V C
2016-04-07
Genomic DNA extraction is crucial for molecular research, including diagnostic and genome characterization of different organisms. The aim of this study was to comparatively analyze protocols of DNA extraction based on cell lysis by sarcosyl, cetyltrimethylammonium bromide, and sodium dodecyl sulfate, and to determine the most efficient method applicable to soybean caterpillars. DNA was extracted from specimens of Chrysodeixis includens and Spodoptera eridania using the aforementioned three methods. DNA quantification was performed using spectrophotometry and high molecular weight DNA ladders. The purity of the extracted DNA was determined by calculating the A260/A280 ratio. Cost and time for each DNA extraction method were estimated and analyzed statistically. The amount of DNA extracted by these three methods was sufficient for PCR amplification. The sarcosyl method yielded DNA of higher purity, because it generated a clearer pellet without viscosity, and yielded high quality amplification products of the COI gene I. The sarcosyl method showed lower cost per extraction and did not differ from the other methods with respect to preparation times. Cell lysis by sarcosyl represents the best method for DNA extraction in terms of yield, quality, and cost effectiveness.
Rohrman, Brittany; Richards-Kortum, Rebecca
2015-02-03
Recombinase polymerase amplification (RPA) may be used to detect a variety of pathogens, often after minimal sample preparation. However, previous work has shown that whole blood inhibits RPA. In this paper, we show that the concentrations of background DNA found in whole blood prevent the amplification of target DNA by RPA. First, using an HIV-1 RPA assay with known concentrations of nonspecific background DNA, we show that RPA tolerates more background DNA when higher HIV-1 target concentrations are present. Then, using three additional assays, we demonstrate that the maximum amount of background DNA that may be tolerated in RPA reactions depends on the DNA sequences used in the assay. We also show that changing the RPA reaction conditions, such as incubation time and primer concentration, has little effect on the ability of RPA to function when high concentrations of background DNA are present. Finally, we develop and characterize a lateral flow-based method for enriching the target DNA concentration relative to the background DNA concentration. This sample processing method enables RPA of 10(4) copies of HIV-1 DNA in a background of 0-14 μg of background DNA. Without lateral flow sample enrichment, the maximum amount of background DNA tolerated is 2 μg when 10(6) copies of HIV-1 DNA are present. This method requires no heating or other external equipment, may be integrated with upstream DNA extraction and purification processes, is compatible with the components of lysed blood, and has the potential to detect HIV-1 DNA in infant whole blood with high proviral loads.
Focke, Felix; Haase, Ilka; Fischer, Markus
2011-01-26
Usually spices are identified morphologically using simple methods like magnifying glasses or microscopic instruments. On the other hand, molecular biological methods like the polymerase chain reaction (PCR) enable an accurate and specific detection also in complex matrices. Generally, the origins of spices are plants with diverse genetic backgrounds and relationships. The processing methods used for the production of spices are complex and individual. Consequently, the development of a reliable DNA-based method for spice analysis is a challenging intention. However, once established, this method will be easily adapted to less difficult food matrices. In the current study, several alternative methods for the isolation of DNA from spices have been developed and evaluated in detail with regard to (i) its purity (photometric), (ii) yield (fluorimetric methods), and (iii) its amplifiability (PCR). Whole genome amplification methods were used to preamplify isolates to improve the ratio between amplifiable DNA and inhibiting substances. Specific primer sets were designed, and the PCR conditions were optimized to detect 18 spices selectively. Assays of self-made spice mixtures were performed to proof the applicability of the developed methods.
NASA Astrophysics Data System (ADS)
Zhang, Yuning; Reisner, Walter
2013-03-01
Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with embedded pore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a pore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We demonstrate that we can optically detect successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule. Furthermore, electrical measurements through the nanopore are performed, indicating that DNA sensing is feasible using the nanochannel-nanopore device.
Hering, Daniel; Borja, Angel; Jones, J Iwan; Pont, Didier; Boets, Pieter; Bouchez, Agnes; Bruce, Kat; Drakare, Stina; Hänfling, Bernd; Kahlert, Maria; Leese, Florian; Meissner, Kristian; Mergen, Patricia; Reyjol, Yorick; Segurado, Pedro; Vogler, Alfried; Kelly, Martyn
2018-07-01
Assessment of ecological status for the European Water Framework Directive (WFD) is based on "Biological Quality Elements" (BQEs), namely phytoplankton, benthic flora, benthic invertebrates and fish. Morphological identification of these organisms is a time-consuming and expensive procedure. Here, we assess the options for complementing and, perhaps, replacing morphological identification with procedures using eDNA, metabarcoding or similar approaches. We rate the applicability of DNA-based identification for the individual BQEs and water categories (rivers, lakes, transitional and coastal waters) against eleven criteria, summarised under the headlines representativeness (for example suitability of current sampling methods for DNA-based identification, errors from DNA-based species detection), sensitivity (for example capability to detect sensitive taxa, unassigned reads), precision of DNA-based identification (knowledge about uncertainty), comparability with conventional approaches (for example sensitivity of metrics to differences in DNA-based identification), cost effectiveness and environmental impact. Overall, suitability of DNA-based identification is particularly high for fish, as eDNA is a well-suited sampling approach which can replace expensive and potentially harmful methods such as gill-netting, trawling or electrofishing. Furthermore, there are attempts to replace absolute by relative abundance in metric calculations. For invertebrates and phytobenthos, the main challenges include the modification of indices and completing barcode libraries. For phytoplankton, the barcode libraries are even more problematic, due to the high taxonomic diversity in plankton samples. If current assessment concepts are kept, DNA-based identification is least appropriate for macrophytes (rivers, lakes) and angiosperms/macroalgae (transitional and coastal waters), which are surveyed rather than sampled. We discuss general implications of implementing DNA-based identification into standard ecological assessment, in particular considering any adaptations to the WFD that may be required to facilitate the transition to molecular data. Copyright © 2018 Elsevier Ltd. All rights reserved.
A Bayesian deconvolution strategy for immunoprecipitation-based DNA methylome analysis
Down, Thomas A.; Rakyan, Vardhman K.; Turner, Daniel J.; Flicek, Paul; Li, Heng; Kulesha, Eugene; Gräf, Stefan; Johnson, Nathan; Herrero, Javier; Tomazou, Eleni M.; Thorne, Natalie P.; Bäckdahl, Liselotte; Herberth, Marlis; Howe, Kevin L.; Jackson, David K.; Miretti, Marcos M.; Marioni, John C.; Birney, Ewan; Hubbard, Tim J. P.; Durbin, Richard; Tavaré, Simon; Beck, Stephan
2009-01-01
DNA methylation is an indispensible epigenetic modification of mammalian genomes. Consequently there is great interest in strategies for genome-wide/whole-genome DNA methylation analysis, and immunoprecipitation-based methods have proven to be a powerful option. Such methods are rapidly shifting the bottleneck from data generation to data analysis, necessitating the development of better analytical tools. Until now, a major analytical difficulty associated with immunoprecipitation-based DNA methylation profiling has been the inability to estimate absolute methylation levels. Here we report the development of a novel cross-platform algorithm – Bayesian Tool for Methylation Analysis (Batman) – for analyzing Methylated DNA Immunoprecipitation (MeDIP) profiles generated using arrays (MeDIP-chip) or next-generation sequencing (MeDIP-seq). The latter is an approach we have developed to elucidate the first high-resolution whole-genome DNA methylation profile (DNA methylome) of any mammalian genome. MeDIP-seq/MeDIP-chip combined with Batman represent robust, quantitative, and cost-effective functional genomic strategies for elucidating the function of DNA methylation. PMID:18612301
Church, George M.; Kieffer-Higgins, Stephen
1992-01-01
This invention features vectors and a method for sequencing DNA. The method includes the steps of: a) ligating the DNA into a vector comprising a tag sequence, the tag sequence includes at least 15 bases, wherein the tag sequence will not hybridize to the DNA under stringent hybridization conditions and is unique in the vector, to form a hybrid vector, b) treating the hybrid vector in a plurality of vessels to produce fragments comprising the tag sequence, wherein the fragments differ in length and terminate at a fixed known base or bases, wherein the fixed known base or bases differs in each vessel, c) separating the fragments from each vessel according to their size, d) hybridizing the fragments with an oligonucleotide able to hybridize specifically with the tag sequence, and e) detecting the pattern of hybridization of the tag sequence, wherein the pattern reflects the nucleotide sequence of the DNA.
DNA melting profiles from a matrix method.
Poland, Douglas
2004-02-05
In this article we give a new method for the calculation of DNA melting profiles. Based on the matrix formulation of the DNA partition function, the method relies for its efficiency on the fact that the required matrices are very sparse, essentially reducing matrix multiplication to vector multiplication and thus making the computer time required to treat a DNA molecule containing N base pairs proportional to N(2). A key ingredient in the method is the result that multiplication by the inverse matrix can also be reduced to vector multiplication. The task of calculating the melting profile for the entire genome is further reduced by treating regions of the molecule between helix-plateaus, thus breaking the molecule up into independent parts that can each be treated individually. The method is easily modified to incorporate changes in the assignment of statistical weights to the different structural features of DNA. We illustrate the method using the genome of Haemophilus influenzae. Copyright 2003 Wiley Periodicals, Inc.
Methods of DNA methylation detection
NASA Technical Reports Server (NTRS)
Maki, Wusi Chen (Inventor); Filanoski, Brian John (Inventor); Mishra, Nirankar (Inventor); Rastogi, Shiva (Inventor)
2010-01-01
The present invention provides for methods of DNA methylation detection. The present invention provides for methods of generating and detecting specific electronic signals that report the methylation status of targeted DNA molecules in biological samples.Two methods are described, direct and indirect detection of methylated DNA molecules in a nano transistor based device. In the direct detection, methylated target DNA molecules are captured on the sensing surface resulting in changes in the electrical properties of a nano transistor. These changes generate detectable electronic signals. In the indirect detection, antibody-DNA conjugates are used to identify methylated DNA molecules. RNA signal molecules are generated through an in vitro transcription process. These RNA molecules are captured on the sensing surface change the electrical properties of nano transistor thereby generating detectable electronic signals.
Recent technological advances have driven rapid development of DNA-based methods designed to facilitate detection and monitoring of invasive species in aquatic environments. These tools promise to significantly alleviate difficulties associated with traditional monitoring approac...
Mass Spectrometry Based Ultrasensitive DNA Methylation Profiling Using Target Fragmentation Assay.
Lin, Xiang-Cheng; Zhang, Ting; Liu, Lan; Tang, Hao; Yu, Ru-Qin; Jiang, Jian-Hui
2016-01-19
Efficient tools for profiling DNA methylation in specific genes are essential for epigenetics and clinical diagnostics. Current DNA methylation profiling techniques have been limited by inconvenient implementation, requirements of specific reagents, and inferior accuracy in quantifying methylation degree. We develop a novel mass spectrometry method, target fragmentation assay (TFA), which enable to profile methylation in specific sequences. This method combines selective capture of DNA target from restricted cleavage of genomic DNA using magnetic separation with MS detection of the nonenzymatic hydrolysates of target DNA. This method is shown to be highly sensitive with a detection limit as low as 0.056 amol, allowing direct profiling of methylation using genome DNA without preamplification. Moreover, this method offers a unique advantage in accurately determining DNA methylation level. The clinical applicability was demonstrated by DNA methylation analysis using prostate tissue samples, implying the potential of this method as a useful tool for DNA methylation profiling in early detection of related diseases.
Structural DNA Nanotechnology: From Design to Applications
Zadegan, Reza M.; Norton, Michael L.
2012-01-01
The exploitation of DNA for the production of nanoscale architectures presents a young yet paradigm breaking approach, which addresses many of the barriers to the self-assembly of small molecules into highly-ordered nanostructures via construct addressability. There are two major methods to construct DNA nanostructures, and in the current review we will discuss the principles and some examples of applications of both the tile-based and DNA origami methods. The tile-based approach is an older method that provides a good tool to construct small and simple structures, usually with multiply repeated domains. In contrast, the origami method, at this time, would appear to be more appropriate for the construction of bigger, more sophisticated and exactly defined structures. PMID:22837684
HMMBinder: DNA-Binding Protein Prediction Using HMM Profile Based Features.
Zaman, Rianon; Chowdhury, Shahana Yasmin; Rashid, Mahmood A; Sharma, Alok; Dehzangi, Abdollah; Shatabda, Swakkhar
2017-01-01
DNA-binding proteins often play important role in various processes within the cell. Over the last decade, a wide range of classification algorithms and feature extraction techniques have been used to solve this problem. In this paper, we propose a novel DNA-binding protein prediction method called HMMBinder. HMMBinder uses monogram and bigram features extracted from the HMM profiles of the protein sequences. To the best of our knowledge, this is the first application of HMM profile based features for the DNA-binding protein prediction problem. We applied Support Vector Machines (SVM) as a classification technique in HMMBinder. Our method was tested on standard benchmark datasets. We experimentally show that our method outperforms the state-of-the-art methods found in the literature.
A Simple and Efficient Method of Extracting DNA from Aged Bones and Teeth.
Liu, Qiqi; Liu, Liyan; Zhang, Minli; Zhang, Qingzhen; Wang, Qiong; Ding, Xiaoran; Shao, Liting; Zhou, Zhe; Wang, Shengqi
2018-05-01
DNA is often difficult to extract from old bones and teeth due to low levels of DNA and high levels of degradation. This study established a simple yet efficient method for extracting DNA from 20 aged bones and teeth (approximately 60 years old). Based on the concentration and STR typing results, the new method of DNA extraction (OM) developed in this study was compared with the PrepFiler™ BTA Forensic DNA Extraction Kit (BM). The total amount of DNA extracted using the OM method was not significantly different from that extracted using the commercial kit (p > 0.05). However, the number of STR loci detected was significantly higher in the samples processed using the OM method than using the BM method (p < 0.05). This study aimed to establish a DNA extraction method for aged bones and teeth to improve the detection rate of STR typing and reduce costs compared to the BM technique. © 2017 American Academy of Forensic Sciences.
Woo, Nain; Kim, Su-Kang; Sun, Yucheng; Kang, Seong Ho
2018-01-01
Human apolipoprotein E (ApoE) is associated with high cholesterol levels, coronary artery disease, and especially Alzheimer's disease. In this study, we developed an ApoE genotyping and one-step multiplex polymerase chain reaction (PCR) based-capillary electrophoresis (CE) method for the enhanced diagnosis of Alzheimer's. The primer mixture of ApoE genes enabled the performance of direct one-step multiplex PCR from whole blood without DNA purification. The combination of direct ApoE genotyping and one-step multiplex PCR minimized the risk of DNA loss or contamination due to the process of DNA purification. All amplified PCR products with different DNA lengths (112-, 253-, 308-, 444-, and 514-bp DNA) of the ApoE genes were analyzed within 2min by an extended voltage programming (VP)-based CE under the optimal conditions. The extended VP-based CE method was at least 120-180 times faster than conventional slab gel electrophoresis methods In particular, all amplified DNA fragments were detected in less than 10 PCR cycles using a laser-induced fluorescence detector. The detection limits of the ApoE genes were 6.4-62.0pM, which were approximately 100-100,000 times more sensitive than previous Alzheimer's diagnosis methods In addition, the combined one-step multiplex PCR and extended VP-based CE method was also successfully applied to the analysis of ApoE genotypes in Alzheimer's patients and normal samples and confirmed the distribution probability of allele frequencies. This combination of direct one-step multiplex PCR and an extended VP-based CE method should increase the diagnostic reliability of Alzheimer's with high sensitivity and short analysis time even with direct use of whole blood. Copyright © 2017 Elsevier B.V. All rights reserved.
Integrating DNA-based data into bioassessments improves ...
The integration of DNA-based identification methods into bioassessments could result in more accurate representations of species distributions and species-habitat relationships. DNA-based approaches may be particularly informative for tracking the distributions of rare and/or invasive species that can comprise a small proportion of samples or are difficult to identify morphologically. In 2012 and 2013, we used a combination of morphological and DNA-based methods (meta-barcoding) to identify fish eggs and larvae collected in the St. Louis River estuary area, Minnesota. We found a large proportion of cases where a lack of agreement occurred between species identified at a site using morphological versus DNA identification, prompting a discussion of how to best reconcile these differences. Choices made during sampling collection, DNA amplification/extraction, and bioinformatics processing influence the DNA-morphology match. The distribution of some species (including several invasives) and their relationships to habitat changed after DNA-data was incorporated. Results highlight how incorporating of DNA-data may get us closer to the “truth”, which has large ramifications in the search for rare species and when understanding the environmental drivers of species distributions is important for management. not applicable
NASA Astrophysics Data System (ADS)
Xiong, Yanxiang; Wei, Min; Wei, Wei; Yin, Lihong; Pu, Yuepu; Liu, Songqin
2014-01-01
DNA hairpin structure probes are usually designed by forming intra-molecular duplex based on Watson-Crick hydrogen bonds. In this paper, a molecular beacon based on silver ions-mediated cytosine-Ag+-cytosine base pairs was used to detect DNA. The inherent characteristic of the metal ligation facilitated the design of functional probe and the adjustment of its binding strength compared to traditional DNA hairpin structure probes, which make it be used to detect DNA in a simple, rapid and easy way with the help of DNA strands displacement reaction. The method was sensitive and also possesses the good specificity to differentiate the single base mismatched DNA from the complementary DNA. It was also successfully applied to study the damage effect of classic genotoxicity chemicals such as styrene oxide and sodium arsenite on DNA, which was significant in food science, environmental science and pharmaceutical science.
Gonzalez, E; Lino, J; Deriabina, A; Herrera, J N F; Poltev, V I
2013-01-01
To elucidate details of the DNA-water interactions we performed the calculations and systemaitic search for minima of interaction energy of the systems consisting of one of DNA bases and one or two water molecules. The results of calculations using two force fields of molecular mechanics (MM) and correlated ab initio method MP2/6-31G(d, p) of quantum mechanics (QM) have been compared with one another and with experimental data. The calculations demonstrated a qualitative agreement between geometry characteristics of the most of local energy minima obtained via different methods. The deepest minima revealed by MM and QM methods correspond to water molecule position between two neighbor hydrophilic centers of the base and to the formation by water molecule of hydrogen bonds with them. Nevertheless, the relative depth of some minima and peculiarities of mutual water-base positions in' these minima depend on the method used. The analysis revealed insignificance of some differences in the results of calculations performed via different methods and the importance of other ones for the description of DNA hydration. The calculations via MM methods enable us to reproduce quantitatively all the experimental data on the enthalpies of complex formation of single water molecule with the set of mono-, di-, and trimethylated bases, as well as on water molecule locations near base hydrophilic atoms in the crystals of DNA duplex fragments, while some of these data cannot be rationalized by QM calculations.
Energetics of protein-DNA interactions.
Donald, Jason E; Chen, William W; Shakhnovich, Eugene I
2007-01-01
Protein-DNA interactions are vital for many processes in living cells, especially transcriptional regulation and DNA modification. To further our understanding of these important processes on the microscopic level, it is necessary that theoretical models describe the macromolecular interaction energetics accurately. While several methods have been proposed, there has not been a careful comparison of how well the different methods are able to predict biologically important quantities such as the correct DNA binding sequence, total binding free energy and free energy changes caused by DNA mutation. In addition to carrying out the comparison, we present two important theoretical models developed initially in protein folding that have not yet been tried on protein-DNA interactions. In the process, we find that the results of these knowledge-based potentials show a strong dependence on the interaction distance and the derivation method. Finally, we present a knowledge-based potential that gives comparable or superior results to the best of the other methods, including the molecular mechanics force field AMBER99.
2012-01-01
Background Detecting the borders between coding and non-coding regions is an essential step in the genome annotation. And information entropy measures are useful for describing the signals in genome sequence. However, the accuracies of previous methods of finding borders based on entropy segmentation method still need to be improved. Methods In this study, we first applied a new recursive entropic segmentation method on DNA sequences to get preliminary significant cuts. A 22-symbol alphabet is used to capture the differential composition of nucleotide doublets and stop codon patterns along three phases in both DNA strands. This process requires no prior training datasets. Results Comparing with the previous segmentation methods, the experimental results on three bacteria genomes, Rickettsia prowazekii, Borrelia burgdorferi and E.coli, show that our approach improves the accuracy for finding the borders between coding and non-coding regions in DNA sequences. Conclusions This paper presents a new segmentation method in prokaryotes based on Jensen-Rényi divergence with a 22-symbol alphabet. For three bacteria genomes, comparing to A12_JR method, our method raised the accuracy of finding the borders between protein coding and non-coding regions in DNA sequences. PMID:23282225
Efficiency of ITS Sequences for DNA Barcoding in Passiflora (Passifloraceae)
Giudicelli, Giovanna Câmara; Mäder, Geraldo; de Freitas, Loreta Brandão
2015-01-01
DNA barcoding is a technique for discriminating and identifying species using short, variable, and standardized DNA regions. Here, we tested for the first time the performance of plastid and nuclear regions as DNA barcodes in Passiflora. This genus is a largely variable, with more than 900 species of high ecological, commercial, and ornamental importance. We analyzed 1034 accessions of 222 species representing the four subgenera of Passiflora and evaluated the effectiveness of five plastid regions and three nuclear datasets currently employed as DNA barcodes in plants using barcoding gap, applied similarity-, and tree-based methods. The plastid regions were able to identify less than 45% of species, whereas the nuclear datasets were efficient for more than 50% using “best match” and “best close match” methods of TaxonDNA software. All subgenera presented higher interspecific pairwise distances and did not fully overlap with the intraspecific distance, and similarity-based methods showed better results than tree-based methods. The nuclear ribosomal internal transcribed spacer 1 (ITS1) region presented a higher discrimination power than the other datasets and also showed other desirable characteristics as a DNA barcode for this genus. Therefore, we suggest that this region should be used as a starting point to identify Passiflora species. PMID:25837628
Biswas, C; Dey, P; Satpathy, S; Sarkar, S K; Bera, A; Mahapatra, B S
2013-02-01
A simple method was developed for isolating DNA from jute seed, which contains high amounts of mucilage and secondary metabolites, and a PCR protocol was standardized for detecting the seedborne pathogen Macrophomina phaseolina. The cetyl trimethyl ammonium bromide method was modified with increased salt concentration and a simple sodium acetate treatment to extract genomic as well as fungal DNA directly from infected jute seed. The Miniprep was evaluated along with five other methods of DNA isolation in terms of yield and quality of DNA and number of PCR positive samples. The Miniprep consistently recovered high amounts of DNA with good spectral qualities at A260/A280. The DNA isolated from jute seed was found suitable for PCR amplification. Macrophomina phaseolina could be detected by PCR from artificially inoculated as well as naturally infected jute seeds. The limit of PCR-based detection of M. phaseolina in jute seed was determined to be 0·62 × 10(-7) CFU g(-1) seed. © 2012 The Society for Applied Microbiology.
Ayoib, Adilah; Hashim, Uda; Gopinath, Subash C B; Md Arshad, M K
2017-11-01
This review covers a developmental progression on early to modern taxonomy at cellular level following the advent of electron microscopy and the advancement in deoxyribonucleic acid (DNA) extraction for expatiation of biological classification at DNA level. Here, we discuss the fundamental values of conventional chemical methods of DNA extraction using liquid/liquid extraction (LLE) followed by development of solid-phase extraction (SPE) methods, as well as recent advances in microfluidics device-based system for DNA extraction on-chip. We also discuss the importance of DNA extraction as well as the advantages over conventional chemical methods, and how Lab-on-a-Chip (LOC) system plays a crucial role for the future achievements.
Determination of mutated genes in the presence of wild-type DNA by using molecular beacons as probe
NASA Astrophysics Data System (ADS)
Zhang, Yonghua; Ai, Junjie; Gu, Qiaorong; Gao, Qiang; Qi, Honglan; Zhang, Chengxiao
2017-03-01
Low-abundance mutations in the presence of wild-type DNA can be determined using molecular beacon (MB) as probe. A MB is generally used as DNA probe because it can distinguish single-base mismatched target DNA from fully matched target DNA. However, the probe can not determine low-abundance mutations in the presence of wild-type DNA. In this study, this limitation is addressed by enhancing the stability of unpaired base-containing dsDNA with a hydrogen-bonding ligand, which was added after hybridization of the MB to the target DNA. The ligand formed hydrogen bonds with unpaired bases and stabilized the unpaired base-containing dsDNA if target DNA is mutated one. As a result, more MBs were opened by the mutant genes in the presence of the ligand and a further increase in the fluorescence intensity was obtained. By contrast, fluorescence intensity did not change if target DNA is wild-type one. Consequent increase in the fluorescence intensity of the MB was regarded as a signal derived from mutant genes. The proposed method was applied in synthetic template systems to determine point mutation in DNA obtained from PCR analysis. The method also allows rapid and simple discrimination of a signal if it is originated in the presence of mutant gene or alternatively by a lower concentration of wild gene.
Fiannaca, Antonino; La Rosa, Massimo; Rizzo, Riccardo; Urso, Alfonso
2015-07-01
In this paper, an alignment-free method for DNA barcode classification that is based on both a spectral representation and a neural gas network for unsupervised clustering is proposed. In the proposed methodology, distinctive words are identified from a spectral representation of DNA sequences. A taxonomic classification of the DNA sequence is then performed using the sequence signature, i.e., the smallest set of k-mers that can assign a DNA sequence to its proper taxonomic category. Experiments were then performed to compare our method with other supervised machine learning classification algorithms, such as support vector machine, random forest, ripper, naïve Bayes, ridor, and classification tree, which also consider short DNA sequence fragments of 200 and 300 base pairs (bp). The experimental tests were conducted over 10 real barcode datasets belonging to different animal species, which were provided by the on-line resource "Barcode of Life Database". The experimental results showed that our k-mer-based approach is directly comparable, in terms of accuracy, recall and precision metrics, with the other classifiers when considering full-length sequences. In addition, we demonstrate the robustness of our method when a classification is performed task with a set of short DNA sequences that were randomly extracted from the original data. For example, the proposed method can reach the accuracy of 64.8% at the species level with 200-bp fragments. Under the same conditions, the best other classifier (random forest) reaches the accuracy of 20.9%. Our results indicate that we obtained a clear improvement over the other classifiers for the study of short DNA barcode sequence fragments. Copyright © 2015 Elsevier B.V. All rights reserved.
Banasiak, Anna; Cassidy, John; Colleran, John
2018-06-01
To date, DNA cleavage, caused by cleavage agents, has been monitored mainly by gel and capillary electrophoresis. However, these techniques are time-consuming, non-quantitative and require gel stains. In this work, a novel, simple and, importantly, a quantitative method for monitoring the DNA nuclease activity of potential anti-cancer drugs, at a DNA electrochemical sensor, is presented. The DNA sensors were prepared using thiol-modified oligonucleotides that self-assembled to create a DNA monolayer at gold electrode surfaces. The quantification of DNA double-strand breaks is based on calculating the DNA surface coverage, before and after exposure to a DNA cleavage agent. The nuclease properties of a model DNA cleavage agent, copper bis-phenanthroline ([Cu II (phen) 2 ] 2+ ), that can cleave DNA in a Fenton-type reaction, were quantified electrochemically. The DNA surface coverage decreased on average by 21% after subjecting the DNA sensor to a nuclease assay containing [Cu II (phen) 2 ] 2+ , a reductant and an oxidant. This percentage indicates that 6 base pairs were cleaved in the nuclease assay from the immobilised 30 base pair strands. The DNA cleavage can be also induced electrochemically in the absence of a chemical reductant. [Cu II (phen) 2 ] 2+ intercalates between DNA base pairs and, on application of a suitable potential, can be reduced to [Cu I (phen) 2 ] + , with dissolved oxygen acting as the required oxidant. This reduction process is facilitated through DNA strands via long-range electron transfer, resulting in DNA cleavage of 23%. The control measurements for both chemically and electrochemically induced cleavage revealed that DNA strand breaks did not occur under experimental conditions in the absence of [Cu II (phen) 2 ] 2+ . Copyright © 2018 Elsevier B.V. All rights reserved.
Hot-Alkaline DNA Extraction Method for Deep-Subseafloor Archaeal Communities
Terada, Takeshi; Hoshino, Tatsuhiko; Inagaki, Fumio
2014-01-01
A prerequisite for DNA-based microbial community analysis is even and effective cell disruption for DNA extraction. With a commonly used DNA extraction kit, roughly two-thirds of subseafloor sediment microbial cells remain intact on average (i.e., the cells are not disrupted), indicating that microbial community analyses may be biased at the DNA extraction step, prior to subsequent molecular analyses. To address this issue, we standardized a new DNA extraction method using alkaline treatment and heating. Upon treatment with 1 M NaOH at 98°C for 20 min, over 98% of microbial cells in subseafloor sediment samples collected at different depths were disrupted. However, DNA integrity tests showed that such strong alkaline and heat treatment also cleaved DNA molecules into short fragments that could not be amplified by PCR. Subsequently, we optimized the alkaline and temperature conditions to minimize DNA fragmentation and retain high cell disruption efficiency. The best conditions produced a cell disruption rate of 50 to 80% in subseafloor sediment samples from various depths and retained sufficient DNA integrity for amplification of the complete 16S rRNA gene (i.e., ∼1,500 bp). The optimized method also yielded higher DNA concentrations in all samples tested compared with extractions using a conventional kit-based approach. Comparative molecular analysis using real-time PCR and pyrosequencing of bacterial and archaeal 16S rRNA genes showed that the new method produced an increase in archaeal DNA and its diversity, suggesting that it provides better analytical coverage of subseafloor microbial communities than conventional methods. PMID:24441163
Method for sequencing DNA base pairs
Sessler, A.M.; Dawson, J.
1993-12-14
The base pairs of a DNA structure are sequenced with the use of a scanning tunneling microscope (STM). The DNA structure is scanned by the STM probe tip, and, as it is being scanned, the DNA structure is separately subjected to a sequence of infrared radiation from four different sources, each source being selected to preferentially excite one of the four different bases in the DNA structure. Each particular base being scanned is subjected to such sequence of infrared radiation from the four different sources as that particular base is being scanned. The DNA structure as a whole is separately imaged for each subjection thereof to radiation from one only of each source. 6 figures.
NASA Astrophysics Data System (ADS)
Zhang, Yuning; Reisner, Walter
2012-02-01
Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with nanpore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a nanopore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We will discuss our recent progress on device fabrication and characterization. In particular, we demonstrate that we can detect - using fluorescent microscopy - successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the embedded pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule.
Chwialkowska, Karolina; Korotko, Urszula; Kosinska, Joanna; Szarejko, Iwona; Kwasniewski, Miroslaw
2017-01-01
Epigenetic mechanisms, including histone modifications and DNA methylation, mutually regulate chromatin structure, maintain genome integrity, and affect gene expression and transposon mobility. Variations in DNA methylation within plant populations, as well as methylation in response to internal and external factors, are of increasing interest, especially in the crop research field. Methylation Sensitive Amplification Polymorphism (MSAP) is one of the most commonly used methods for assessing DNA methylation changes in plants. This method involves gel-based visualization of PCR fragments from selectively amplified DNA that are cleaved using methylation-sensitive restriction enzymes. In this study, we developed and validated a new method based on the conventional MSAP approach called Methylation Sensitive Amplification Polymorphism Sequencing (MSAP-Seq). We improved the MSAP-based approach by replacing the conventional separation of amplicons on polyacrylamide gels with direct, high-throughput sequencing using Next Generation Sequencing (NGS) and automated data analysis. MSAP-Seq allows for global sequence-based identification of changes in DNA methylation. This technique was validated in Hordeum vulgare . However, MSAP-Seq can be straightforwardly implemented in different plant species, including crops with large, complex and highly repetitive genomes. The incorporation of high-throughput sequencing into MSAP-Seq enables parallel and direct analysis of DNA methylation in hundreds of thousands of sites across the genome. MSAP-Seq provides direct genomic localization of changes and enables quantitative evaluation. We have shown that the MSAP-Seq method specifically targets gene-containing regions and that a single analysis can cover three-quarters of all genes in large genomes. Moreover, MSAP-Seq's simplicity, cost effectiveness, and high-multiplexing capability make this method highly affordable. Therefore, MSAP-Seq can be used for DNA methylation analysis in crop plants with large and complex genomes.
Chwialkowska, Karolina; Korotko, Urszula; Kosinska, Joanna; Szarejko, Iwona; Kwasniewski, Miroslaw
2017-01-01
Epigenetic mechanisms, including histone modifications and DNA methylation, mutually regulate chromatin structure, maintain genome integrity, and affect gene expression and transposon mobility. Variations in DNA methylation within plant populations, as well as methylation in response to internal and external factors, are of increasing interest, especially in the crop research field. Methylation Sensitive Amplification Polymorphism (MSAP) is one of the most commonly used methods for assessing DNA methylation changes in plants. This method involves gel-based visualization of PCR fragments from selectively amplified DNA that are cleaved using methylation-sensitive restriction enzymes. In this study, we developed and validated a new method based on the conventional MSAP approach called Methylation Sensitive Amplification Polymorphism Sequencing (MSAP-Seq). We improved the MSAP-based approach by replacing the conventional separation of amplicons on polyacrylamide gels with direct, high-throughput sequencing using Next Generation Sequencing (NGS) and automated data analysis. MSAP-Seq allows for global sequence-based identification of changes in DNA methylation. This technique was validated in Hordeum vulgare. However, MSAP-Seq can be straightforwardly implemented in different plant species, including crops with large, complex and highly repetitive genomes. The incorporation of high-throughput sequencing into MSAP-Seq enables parallel and direct analysis of DNA methylation in hundreds of thousands of sites across the genome. MSAP-Seq provides direct genomic localization of changes and enables quantitative evaluation. We have shown that the MSAP-Seq method specifically targets gene-containing regions and that a single analysis can cover three-quarters of all genes in large genomes. Moreover, MSAP-Seq's simplicity, cost effectiveness, and high-multiplexing capability make this method highly affordable. Therefore, MSAP-Seq can be used for DNA methylation analysis in crop plants with large and complex genomes. PMID:29250096
Solving traveling salesman problems with DNA molecules encoding numerical values.
Lee, Ji Youn; Shin, Soo-Yong; Park, Tai Hyun; Zhang, Byoung-Tak
2004-12-01
We introduce a DNA encoding method to represent numerical values and a biased molecular algorithm based on the thermodynamic properties of DNA. DNA strands are designed to encode real values by variation of their melting temperatures. The thermodynamic properties of DNA are used for effective local search of optimal solutions using biochemical techniques, such as denaturation temperature gradient polymerase chain reaction and temperature gradient gel electrophoresis. The proposed method was successfully applied to the traveling salesman problem, an instance of optimization problems on weighted graphs. This work extends the capability of DNA computing to solving numerical optimization problems, which is contrasted with other DNA computing methods focusing on logical problem solving.
Rutty, Guy N; Barber, Jade; Amoroso, Jasmin; Morgan, Bruno; Graham, Eleanor A M
2013-12-01
Post-mortem computed tomography angiography (PMCTA) involves the injection of contrast agents. This could have both a dilution effect on biological fluid samples and could affect subsequent post-contrast analytical laboratory processes. We undertook a small sample study of 10 targeted and 10 whole body PMCTA cases to consider whether or not these two methods of PMCTA could affect post-PMCTA cadaver blood based DNA identification. We used standard methodology to examine DNA from blood samples obtained before and after the PMCTA procedure. We illustrate that neither of these PMCTA methods had an effect on the alleles called following short tandem repeat based DNA profiling, and therefore the ability to undertake post-PMCTA blood based DNA identification.
Chen, Jinyuan; Liu, Zhoujie; Peng, Huaping; Zheng, Yanjie; Lin, Zhen; Liu, Ailin; Chen, Wei; Lin, Xinhua
2017-12-15
Previously reported electrochemical DNA biosensors based on in-situ polymerization approach reveal that terminal deoxynucleoside transferase (TdTase) has good amplifying performance and promising application in the design of electrochemical DNA biosensor. However, this method, in which the background is significantly affected by the amount of TdTase, suffers from being easy to produce false positive result and poor stability. Herein, we firstly present a novel electrochemical DNA biosensor based on grafting-to mode of TdTase-mediated extension, in which DNA targets are polymerized in homogeneous solution and then hybridized with DNA probes on BSA-based DNA carrier platform. It is surprising to find that the background in the grafting-to mode of TdTase-based electrochemical DNA biosensor have little interference from the employed TdTase. Most importantly, the proposed electrochemical DNA biosensor shows greatly improved detection performance over the in-situ polymerization approach-based electrochemical DNA biosensor. Copyright © 2017 Elsevier B.V. All rights reserved.
Correcting for Sample Contamination in Genotype Calling of DNA Sequence Data
Flickinger, Matthew; Jun, Goo; Abecasis, Gonçalo R.; Boehnke, Michael; Kang, Hyun Min
2015-01-01
DNA sample contamination is a frequent problem in DNA sequencing studies and can result in genotyping errors and reduced power for association testing. We recently described methods to identify within-species DNA sample contamination based on sequencing read data, showed that our methods can reliably detect and estimate contamination levels as low as 1%, and suggested strategies to identify and remove contaminated samples from sequencing studies. Here we propose methods to model contamination during genotype calling as an alternative to removal of contaminated samples from further analyses. We compare our contamination-adjusted calls to calls that ignore contamination and to calls based on uncontaminated data. We demonstrate that, for moderate contamination levels (5%–20%), contamination-adjusted calls eliminate 48%–77% of the genotyping errors. For lower levels of contamination, our contamination correction methods produce genotypes nearly as accurate as those based on uncontaminated data. Our contamination correction methods are useful generally, but are particularly helpful for sample contamination levels from 2% to 20%. PMID:26235984
NGS-based likelihood ratio for identifying contributors in two- and three-person DNA mixtures.
Chan Mun Wei, Joshua; Zhao, Zicheng; Li, Shuai Cheng; Ng, Yen Kaow
2018-06-01
DNA fingerprinting, also known as DNA profiling, serves as a standard procedure in forensics to identify a person by the short tandem repeat (STR) loci in their DNA. By comparing the STR loci between DNA samples, practitioners can calculate a probability of match to identity the contributors of a DNA mixture. Most existing methods are based on 13 core STR loci which were identified by the Federal Bureau of Investigation (FBI). Analyses based on these loci of DNA mixture for forensic purposes are highly variable in procedures, and suffer from subjectivity as well as bias in complex mixture interpretation. With the emergence of next-generation sequencing (NGS) technologies, the sequencing of billions of DNA molecules can be parallelized, thus greatly increasing throughput and reducing the associated costs. This allows the creation of new techniques that incorporate more loci to enable complex mixture interpretation. In this paper, we propose a computation for likelihood ratio that uses NGS (next generation sequencing) data for DNA testing on mixed samples. We have applied the method to 4480 simulated DNA mixtures, which consist of various mixture proportions of 8 unrelated whole-genome sequencing data. The results confirm the feasibility of utilizing NGS data in DNA mixture interpretations. We observed an average likelihood ratio as high as 285,978 for two-person mixtures. Using our method, all 224 identity tests for two-person mixtures and three-person mixtures were correctly identified. Copyright © 2018 Elsevier Ltd. All rights reserved.
Alchemical Free Energy Calculations for Nucleotide Mutations in Protein-DNA Complexes.
Gapsys, Vytautas; de Groot, Bert L
2017-12-12
Nucleotide-sequence-dependent interactions between proteins and DNA are responsible for a wide range of gene regulatory functions. Accurate and generalizable methods to evaluate the strength of protein-DNA binding have long been sought. While numerous computational approaches have been developed, most of them require fitting parameters to experimental data to a certain degree, e.g., machine learning algorithms or knowledge-based statistical potentials. Molecular-dynamics-based free energy calculations offer a robust, system-independent, first-principles-based method to calculate free energy differences upon nucleotide mutation. We present an automated procedure to set up alchemical MD-based calculations to evaluate free energy changes occurring as the result of a nucleotide mutation in DNA. We used these methods to perform a large-scale mutation scan comprising 397 nucleotide mutation cases in 16 protein-DNA complexes. The obtained prediction accuracy reaches 5.6 kJ/mol average unsigned deviation from experiment with a correlation coefficient of 0.57 with respect to the experimentally measured free energies. Overall, the first-principles-based approach performed on par with the molecular modeling approaches Rosetta and FoldX. Subsequently, we utilized the MD-based free energy calculations to construct protein-DNA binding profiles for the zinc finger protein Zif268. The calculation results compare remarkably well with the experimentally determined binding profiles. The software automating the structure and topology setup for alchemical calculations is a part of the pmx package; the utilities have also been made available online at http://pmx.mpibpc.mpg.de/dna_webserver.html .
Li, Cuiping; Wang, Hailin
2015-08-07
Oxidatively generated DNA damage is considered to be a significant contributing factor to cancer, aging, and age-related human diseases. It is important to detect oxidatively generated DNA damage to understand and clinically diagnosis diseases caused by oxidative damage. In this study, using selective enzymatic cleavage and quantum dot (QD) labeling, we developed a novel capillary electrophoresis-laser induced fluorescence method for the sensitive detection of oxidized DNA bases. First, oxidized DNA bases are recognized and removed by one DNA base excision repair glycosylase, leaving apurinic and apyrimidinic sites (AP sites) at the oxidized positions. The AP sites are further excised by the AP nicking activity of the chosen glycosylase, generating a nucleotide gap with 5'- and 3'- phosphate groups. After dephosphorylation with one alkaline phosphatase, a biotinylated ddNTP is introduced into the nucleotide space within the DNA strand by DNA polymerase I. The biotin-tagged DNA is further labeled with a QD-streptavidin conjugate via non-covalent interactions. The DNA-bound QD is well-separated from excess DNA-unbound QD by highly efficient capillary electrophoresis and is sensitively detected by online coupled laser-induced fluorescence analysis. Using this method, we can assess the trace levels of oxidized DNA bases induced by the Fenton reaction and UV irradiation. Interestingly, the use of the formamidopyrimidine glycosylase (FPG) protein and endonuclease VIII enables the detection of oxidized purine and pyrimidine bases, respectively. Using the synthesized standard DNA, the approach has low limits of detection of 1.1×10(-19)mol in mass and 2.9pM in concentration. Copyright © 2015 Elsevier B.V. All rights reserved.
Colorimetric Detection of Ehrlichia Canis via Nucleic Acid Hybridization in Gold Nano-Colloids
Muangchuen, Ajima; Chaumpluk, Piyasak; Suriyasomboon, Annop; Ekgasit, Sanong
2014-01-01
Canine monocytic ehrlichiosis (CME) is a major thick-bone disease of dog caused by Ehrlichia canis. Detection of this causal agent outside the laboratory using conventional methods is not effective enough. Thus an assay for E. canis detection based on the p30 outer membrane protein gene was developed. It was based on the p30 gene amplification using loop-mediated isothermal DNA amplification (LAMP). The primer set specific to six areas within the target gene were designed and tested for their sensitivity and specificity. Detection of DNA signals was based on modulation of gold nanoparticles' surface properties and performing DNA/DNA hybridization using an oligonucleotide probe. Presence of target DNA affected the gold colloid nanoparticles in terms of particle aggregation with a plasmonic color change of the gold colloids from ruby red to purple, visible by the naked eye. All the assay steps were completed within 90 min including DNA extraction without relying on standard laboratory facilities. This method was very specific to target bacteria. Its sensitivity with probe hybridization was sufficient to detect 50 copies of target DNA. This method should provide an alternative choice for point of care control and management of the disease. PMID:25111239
Colorimetric detection of Ehrlichia canis via nucleic acid hybridization in gold nano-colloids.
Muangchuen, Ajima; Chaumpluk, Piyasak; Suriyasomboon, Annop; Ekgasit, Sanong
2014-08-08
Canine monocytic ehrlichiosis (CME) is a major thick-bone disease of dog caused by Ehrlichia canis. Detection of this causal agent outside the laboratory using conventional methods is not effective enough. Thus an assay for E. canis detection based on the p30 outer membrane protein gene was developed. It was based on the p30 gene amplification using loop-mediated isothermal DNA amplification (LAMP). The primer set specific to six areas within the target gene were designed and tested for their sensitivity and specificity. Detection of DNA signals was based on modulation of gold nanoparticles' surface properties and performing DNA/DNA hybridization using an oligonucleotide probe. Presence of target DNA affected the gold colloid nanoparticles in terms of particle aggregation with a plasmonic color change of the gold colloids from ruby red to purple, visible by the naked eye. All the assay steps were completed within 90 min including DNA extraction without relying on standard laboratory facilities. This method was very specific to target bacteria. Its sensitivity with probe hybridization was sufficient to detect 50 copies of target DNA. This method should provide an alternative choice for point of care control and management of the disease.
Feasibility study of molecular memory device based on DNA using methylation to store information
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jiang, Liming; Al-Dirini, Feras; Center for Neural Engineering
DNA, because of its robustness and dense information storage capability, has been proposed as a potential candidate for next-generation storage media. However, encoding information into the DNA sequence requires molecular synthesis technology, which to date is costly and prone to synthesis errors. Reading the DNA strand information is also complex. Ideally, DNA storage will provide methods for modifying stored information. Here, we conduct a feasibility study investigating the use of the DNA 5-methylcytosine (5mC) methylation state as a molecular memory to store information. We propose a new 1-bit memory device and study, based on the density functional theory and non-equilibriummore » Green's function method, the feasibility of electrically reading the information. Our results show that changes to methylation states lead to changes in the peak of negative differential resistance which can be used to interrogate memory state. Our work demonstrates a new memory concept based on methylation state which can be beneficial in the design of next generation DNA based molecular electronic memory devices.« less
Bannwarth, Sylvie; Procaccio, Vincent; Paquis-Flucklinger, Veronique
2005-06-01
Molecular analysis of mitochondrial DNA (mtDNA) is a critical step in diagnosis and genetic counseling of respiratory chain defects. No fast method is currently available for the identification of unknown mtDNA point mutations. We have developed a new strategy based on complete mtDNA PCR amplification followed by digestion with a mismatch-specific DNA endonuclease, Surveyor Nuclease. This enzyme, a member of the CEL nuclease family of plant DNA endonucleases, cleaves double-strand DNA at any mismatch site including base substitutions and small insertions/deletions. After digestion, cleavage products are separated and analyzed by agarose gel electrophoresis. The size of the digestion products indicates the location of the mutation, which is then confirmed and characterized by sequencing. Although this method allows the analysis of 2 kb mtDNA amplicons and the detection of multiple mutations within the same fragment, it does not lead to the identification of homoplasmic base substitutions. Homoplasmic pathogenic mutations have been described. Nevertheless, most homoplasmic base substitutions are neutral polymorphisms while deleterious mutations are typically heteroplasmic. Here, we report that this method can be used to detect mtDNA mutations such as m.3243A>G tRNA(Leu) and m.14709T>C tRNA(Glu) even when they are present at levels as low as 3% in DNA samples derived from patients with respiratory chain defects. Then, we tested five patients suffering from a mitochondrial respiratory chain defect and we identified a variant (m.16189T>C) in two of them, which was previously associated with susceptibility to diabetes and cardiomyopathy. In conclusion, this method can be effectively used to rapidly and completely screen the entire human mitochondrial genome for heteroplasmic mutations and in this context represents an important advance for the diagnosis of mitochondrial diseases.
NASA Astrophysics Data System (ADS)
Yoshikazu, Kawata; Shin-Ichi, Yano; Hiroyuki, Kojima
1998-03-01
An efficient and simple method for constructing a genomic DNA library using a TA cloning vector is presented. It is based on the sonicative cleavage of genomic DNA and modification of fragment ends with Taq DNA polymerase, followed by ligation using a TA vector. This method was applied for cloning of the phytoene synthase gene crt B from Spirulina platensis. This method is useful when genomic DNA cannot be efficiently digested with restriction enzymes, a problem often encountered during the construction of a genomic DNA library of cyanobacteria.
2017-01-01
Amplicon (targeted) sequencing by massively parallel sequencing (PCR-MPS) is a potential method for use in forensic DNA analyses. In this application, PCR-MPS may supplement or replace other instrumental analysis methods such as capillary electrophoresis and Sanger sequencing for STR and mitochondrial DNA typing, respectively. PCR-MPS also may enable the expansion of forensic DNA analysis methods to include new marker systems such as single nucleotide polymorphisms (SNPs) and insertion/deletions (indels) that currently are assayable using various instrumental analysis methods including microarray and quantitative PCR. Acceptance of PCR-MPS as a forensic method will depend in part upon developing protocols and criteria that define the limitations of a method, including a defensible analytical threshold or method detection limit. This paper describes an approach to establish objective analytical thresholds suitable for multiplexed PCR-MPS methods. A definition is proposed for PCR-MPS method background noise, and an analytical threshold based on background noise is described. PMID:28542338
Young, Brian; King, Jonathan L; Budowle, Bruce; Armogida, Luigi
2017-01-01
Amplicon (targeted) sequencing by massively parallel sequencing (PCR-MPS) is a potential method for use in forensic DNA analyses. In this application, PCR-MPS may supplement or replace other instrumental analysis methods such as capillary electrophoresis and Sanger sequencing for STR and mitochondrial DNA typing, respectively. PCR-MPS also may enable the expansion of forensic DNA analysis methods to include new marker systems such as single nucleotide polymorphisms (SNPs) and insertion/deletions (indels) that currently are assayable using various instrumental analysis methods including microarray and quantitative PCR. Acceptance of PCR-MPS as a forensic method will depend in part upon developing protocols and criteria that define the limitations of a method, including a defensible analytical threshold or method detection limit. This paper describes an approach to establish objective analytical thresholds suitable for multiplexed PCR-MPS methods. A definition is proposed for PCR-MPS method background noise, and an analytical threshold based on background noise is described.
Methods for sequencing GC-rich and CCT repeat DNA templates
Robinson, Donna L.
2007-02-20
The present invention is directed to a PCR-based method of cycle sequencing DNA and other polynucleotide sequences having high CG content and regions of high GC content, and includes for example DNA strands with a high Cytosine and/or Guanosine content and repeated motifs such as CCT repeats.
Gel Electrophoresis of Gold-DNA Nanoconjugates
Pellegrino, T.; Sperling, R. A.; Alivisatos, A. P.; ...
2007-01-01
Gold-DNA conjugates were investigated in detail by a comprehensive gel electrophoresis study based on 1200 gels. A controlled number of single-stranded DNA of different length was attached specifically via thiol-Au bonds to phosphine-stabilized colloidal gold nanoparticles. Alternatively, the surface of the gold particles was saturated with single stranded DNA of different length either specifically via thiol-Au bonds or by nonspecific adsorption. From the experimentally determined electrophoretic mobilities, estimates for the effective diameters of the gold-DNA conjugates were derived by applying two different data treatment approaches. The first method is based on making a calibration curve for the relation between effectivemore » diameters and mobilities with gold nanoparticles of known diameter. The second method is based on Ferguson analysis which uses gold nanoparticles of known diameter as reference database. Our study shows that effective diameters derived from gel electrophoresis measurements are affected with a high error bar as the determined values strongly depend on the method of evaluation, though relative changes in size upon binding of molecules can be detected with high precision. Furthermore, in this study, the specific attachment of DNA via gold-thiol bonds to Au nanoparticles is compared to nonspecific adsorption of DNA. Also, the maximum number of DNA molecules that can be bound per particle was determined.« less
Assessment of circulating copy number variant detection for cancer screening.
Molparia, Bhuvan; Nichani, Eshaan; Torkamani, Ali
2017-01-01
Current high-sensitivity cancer screening methods, largely utilizing correlative biomarkers, suffer from false positive rates that lead to unnecessary medical procedures and debatable public health benefit overall. Detection of circulating tumor DNA (ctDNA), a causal biomarker, has the potential to revolutionize cancer screening. Thus far, the majority of ctDNA studies have focused on detection of tumor-specific point mutations after cancer diagnosis for the purpose of post-treatment surveillance. However, ctDNA point mutation detection methods developed to date likely lack either the scope or analytical sensitivity necessary to be useful for cancer screening, due to the low (<1%) ctDNA fraction derived from early stage tumors. On the other hand, tumor-derived copy number variant (CNV) detection is hypothetically a superior means of ctDNA-based cancer screening for many tumor types, given that, relative to point mutations, each individual tumor CNV contributes a much larger number of ctDNA fragments to the overall pool of circulating free DNA (cfDNA). A small number of studies have demonstrated the potential of ctDNA CNV-based screening in select cancer types. Here we perform an in silico assessment of the potential for ctDNA CNV-based cancer screening across many common cancers, and suggest ctDNA CNV detection shows promise as a broad cancer screening methodology.
Siqueira, José F; Rôças, Isabela N; De Uzeda, Milton; Colombo, Ana P; Santos, Kátia R N
2002-12-01
Molecular methods have been used recently to investigate the bacteria encountered in human endodontic infections. The aim of the present study was to compare the ability of a 16S rDNA-based PCR assay and checkerboard DNA-DNA hybridisation in detecting Actinobacillus actinomycetemcomitans, Bacteroides forsythus, Peptostreptococcus micros, Porphyromonas endodontalis, Por. gingivalis and Treponema denticola directly from clinical samples. Specimens were obtained from 50 cases of endodontic infections and the presence of the target species was investigated by whole genomic DNA probes and checkerboard DNA-DNA hybridisation or taxon-specific oligonucleotides with PCR assay. Prevalence of the target species was based on data obtained by each method. The sensitivity and specificity of each molecular method was compared with the data generated by the other method as the reference--a value of 1.0 representing total agreement with the chosen standard. The methods were also compared with regard to the prevalence values for each target species. Regardless of the detection method used, T. denticola, Por. gingivalis, Por. endodontalis and B. forsythus were the most prevalent species. If the checkerboard data for these four species were used as the reference, PCR detection sensitivities ranged from 0.53 to 1.0, and specificities from 0.5 to 0.88, depending on the target bacterial species. When PCR data for the same species were used as the reference, the detection sensitivities for the checkerboard method ranged from 0.17 to 0.73, and specificities from 0.75 to 1.0. Accuracy values ranged from 0.6 to 0.74. On the whole, matching results between the two molecular methods ranged from 60% to 97.5%, depending on the target species. The major discrepancies between the methods comprised a number of PCR-positive but checkerboard-negative results. Significantly higher prevalence figures for Por. endodontalis and T. denticola were observed after PCR assessment. There was no further significant difference between the methods with regard to detection of the other target species.
A novel model for DNA sequence similarity analysis based on graph theory.
Qi, Xingqin; Wu, Qin; Zhang, Yusen; Fuller, Eddie; Zhang, Cun-Quan
2011-01-01
Determination of sequence similarity is one of the major steps in computational phylogenetic studies. As we know, during evolutionary history, not only DNA mutations for individual nucleotide but also subsequent rearrangements occurred. It has been one of major tasks of computational biologists to develop novel mathematical descriptors for similarity analysis such that various mutation phenomena information would be involved simultaneously. In this paper, different from traditional methods (eg, nucleotide frequency, geometric representations) as bases for construction of mathematical descriptors, we construct novel mathematical descriptors based on graph theory. In particular, for each DNA sequence, we will set up a weighted directed graph. The adjacency matrix of the directed graph will be used to induce a representative vector for DNA sequence. This new approach measures similarity based on both ordering and frequency of nucleotides so that much more information is involved. As an application, the method is tested on a set of 0.9-kb mtDNA sequences of twelve different primate species. All output phylogenetic trees with various distance estimations have the same topology, and are generally consistent with the reported results from early studies, which proves the new method's efficiency; we also test the new method on a simulated data set, which shows our new method performs better than traditional global alignment method when subsequent rearrangements happen frequently during evolutionary history.
Methylsorb: a simple method for quantifying DNA methylation using DNA-gold affinity interactions.
Sina, Abu Ali Ibn; Carrascosa, Laura G; Palanisamy, Ramkumar; Rauf, Sakandar; Shiddiky, Muhammad J A; Trau, Matt
2014-10-21
The analysis of DNA methylation is becoming increasingly important both in the clinic and also as a research tool to unravel key epigenetic molecular mechanisms in biology. Current methodologies for the quantification of regional DNA methylation (i.e., the average methylation over a region of DNA in the genome) are largely affected by comprehensive DNA sequencing methodologies which tend to be expensive, tedious, and time-consuming for many applications. Herein, we report an alternative DNA methylation detection method referred to as "Methylsorb", which is based on the inherent affinity of DNA bases to the gold surface (i.e., the trend of the affinity interactions is adenine > cytosine ≥ guanine > thymine).1 Since the degree of gold-DNA affinity interaction is highly sequence dependent, it provides a new capability to detect DNA methylation by simply monitoring the relative adsorption of bisulfite treated DNA sequences onto a gold chip. Because the selective physical adsorption of DNA fragments to gold enable a direct read-out of regional DNA methylation, the current requirement for DNA sequencing is obviated. To demonstrate the utility of this method, we present data on the regional methylation status of two CpG clusters located in the EN1 and MIR200B genes in MCF7 and MDA-MB-231 cells. The methylation status of these regions was obtained from the change in relative mass on gold surface with respect to relative adsorption of an unmethylated DNA source and this was detected using surface plasmon resonance (SPR) in a label-free and real-time manner. We anticipate that the simplicity of this method, combined with the high level of accuracy for identifying the methylation status of cytosines in DNA, could find broad application in biology and diagnostics.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Elkin, Christopher; Kapur, Hitesh; Smith, Troy
2001-09-15
We have developed an automated purification method for terminator sequencing products based on a magnetic bead technology. This 384-well protocol generates labeled DNA fragments that are essentially free of contaminates for less than $0.005 per reaction. In comparison to laborious ethanol precipitation protocols, this method increases the phred20 read length by forty bases with various DNA templates such as PCR fragments, Plasmids, Cosmids and RCA products. Our method eliminates centrifugation and is compatible with both the MegaBACE 1000 and ABIPrism 3700 capillary instruments. As of September 2001, this method has produced over 1.6 million samples with 93 percent averaging 620more » phred20 bases as part of Joint Genome Institutes Production Process.« less
Ngo, Hoan T; Gandra, Naveen; Fales, Andrew M; Taylor, Steve M; Vo-Dinh, Tuan
2016-07-15
One of the major obstacles to implement nucleic acid-based molecular diagnostics at the point-of-care (POC) and in resource-limited settings is the lack of sensitive and practical DNA detection methods that can be seamlessly integrated into portable platforms. Herein we present a sensitive yet simple DNA detection method using a surface-enhanced Raman scattering (SERS) nanoplatform: the ultrabright SERS nanorattle. The method, referred to as the nanorattle-based method, involves sandwich hybridization of magnetic beads that are loaded with capture probes, target sequences, and ultrabright SERS nanorattles that are loaded with reporter probes. Upon hybridization, a magnet was applied to concentrate the hybridization sandwiches at a detection spot for SERS measurements. The ultrabright SERS nanorattles, composed of a core and a shell with resonance Raman reporters loaded in the gap space between the core and the shell, serve as SERS tags for signal detection. Using this method, a specific DNA sequence of the malaria parasite Plasmodium falciparum could be detected with a detection limit of approximately 100 attomoles. Single nucleotide polymorphism (SNP) discrimination of wild type malaria DNA and mutant malaria DNA, which confers resistance to artemisinin drugs, was also demonstrated. These test models demonstrate the molecular diagnostic potential of the nanorattle-based method to both detect and genotype infectious pathogens. Furthermore, the method's simplicity makes it a suitable candidate for integration into portable platforms for POC and in resource-limited settings applications. Copyright © 2016. Published by Elsevier B.V.
Macroscopic modeling and simulations of supercoiled DNA with bound proteins
NASA Astrophysics Data System (ADS)
Huang, Jing; Schlick, Tamar
2002-11-01
General methods are presented for modeling and simulating DNA molecules with bound proteins on the macromolecular level. These new approaches are motivated by the need for accurate and affordable methods to simulate slow processes (on the millisecond time scale) in DNA/protein systems, such as the large-scale motions involved in the Hin-mediated inversion process. Our approaches, based on the wormlike chain model of long DNA molecules, introduce inhomogeneous potentials for DNA/protein complexes based on available atomic-level structures. Electrostatically, treat those DNA/protein complexes as sets of effective charges, optimized by our discrete surface charge optimization package, in which the charges are distributed on an excluded-volume surface that represents the macromolecular complex. We also introduce directional bending potentials as well as non-identical bead hydrodynamics algorithm to further mimic the inhomogeneous effects caused by protein binding. These models thus account for basic elements of protein binding effects on DNA local structure but remain computational tractable. To validate these models and methods, we reproduce various properties measured by both Monte Carlo methods and experiments. We then apply the developed models to study the Hin-mediated inversion system in long DNA. By simulating supercoiled, circular DNA with or without bound proteins, we observe significant effects of protein binding on global conformations and long-time dynamics of the DNA on the kilo basepair length.
Dobbs, Larry J; Madigan, Merle N; Carter, Alexis B; Earls, Lori
2002-01-01
Efficient methods of storing tumor specimens for molecular testing are needed in the modern surgical pathology laboratory. The FTA Gene Guard system is a novel method for the collection and room temperature storage of blood samples for DNA testing. The method uses index card-sized filter papers that provide an ideal medium on which to store tumor specimens for DNA testing. To determine whether FTA filter paper can be used in the surgical pathology laboratory to store tumor cells for DNA testing. Cell suspensions were prepared from 60 surgical specimens, and DNA was extracted either immediately or after storage on FTA paper. The DNA extracted by each method was tested by polymerase chain reaction (PCR) for the beta-globin and interferon gamma genes, and the results were compared. Fifteen lymph node specimens stored on FTA paper were then tested for immunoglobulin heavy chain (IgH) gene rearrangement by PCR, and these results were compared with those obtained for immediately extracted DNA. University medical center. The DNA extracted from cells stored on FTA paper performed as well in the PCR as the freshly extracted DNA in nearly all cases (>95%). The results of tests for IgH gene rearrangements showed 100% concordance between the 2 methods of DNA extraction.Conclusion.-Cells from surgical specimens can be stored on FTA paper for extended lengths of time, and DNA can be extracted from these cells for PCR-based testing. FTA filter paper is a reliable medium for the storage and/or transport of tumor cells for PCR-based DNA analysis.
Fukunaga, Kenji; Ichitani, Katsuyuki; Taura, Satoru; Sato, Muneharu; Kawase, Makoto
2005-02-01
We determined the sequence of ribosomal DNA (rDNA) intergenic spacer (IGS) of foxtail millet isolated in our previous study, and identified subrepeats in the polymorphic region. We also developed a PCR-based method for identifying rDNA types based on sequence information and assessed 153 accessions of foxtail millet. Results were congruent with our previous works. This study provides new findings regarding the geographical distribution of rDNA variants. This new method facilitates analyses of numerous foxtail millet accessions. It is helpful for typing of foxtail millet germplasms and elucidating the evolution of this millet.
Song, Chao; Wang, Qian; Zhang, Ruilei; Sun, Bingjiao; Wang, Xinhua
2016-02-16
In this study, we tested the utility of the mitochondrial gene cytochrome c oxidase subunit 1 (CO1) as the barcode region to deal with taxonomical problems of Polypedilum (Tripodura) non-biting midges (Diptera: Chironomidae). The 114 DNA barcodes representing 27 morphospecies are divided into 33 well separated clusters based on both Neighbor Joining and Maximum Likelihood methods. DNA barcodes revealed an 82% success rate in matching with morphospecies. The selected DNA barcode data support 37-64 operational taxonomic units (OTUs) based on the methods of Automatic Barcode Gap Discovery (ABGD) and Poisson Tree Process (PTP). Furthermore, a priori species based on consistent phenotypic variations were attested by molecular analysis, and a taxonomical misidentification of barcode sequences from GenBank was found. We could not observe a distinct barcode gap but an overlap ranged from 9-12%. Our results supported DNA barcoding as an ideal method to detect cryptic species, delimit sibling species, and associate different life stages in non-biting midges.
Khrapko, Konstantin R [Moscow, RU; Khorlin, Alexandr A [Moscow, RU; Ivanov, Igor B [Moskovskaya, RU; Ershov, Gennady M [Moscow, RU; Lysov, Jury P [Moscow, RU; Florentiev, Vladimir L [Moscow, RU; Mirzabekov, Andrei D [Moscow, RU
1996-09-03
A method for sequencing DNA by hybridization that includes the following steps: forming an array of oligonucleotides at such concentrations that either ensure the same dissociation temperature for all fully complementary duplexes or allows hybridization and washing of such duplexes to be conducted at the same temperature; hybridizing said oligonucleotide array with labeled test DNA; washing in duplex dissociation conditions; identifying single-base substitutions in the test DNA by analyzing the distribution of the dissociation temperatures and reconstructing the DNA nucleotide sequence based on the above analysis. A device for carrying out the method comprises a solid substrate and a matrix rigidly bound to the substrate. The matrix contains the oligonucleotide array and consists of a multiplicity of gel portions. Each gel portion contains one oligonucleotide of desired length. The gel portions are separated from one another by interstices and have a thickness not exceeding 30 .mu.m.
Zur, G; Hallerman, E M; Sharf, R; Kashi, Y
1999-10-01
Alternaria sp. are important fungal contaminants of vegetable, fruit, and grain products, including Alternaria alternata, a contaminant of tomato products. To date, the Howard method, based on microscopic observation of fungal filaments, has been the standard examination for inspection of tomato products. We report development of a polymerase chain reaction (PCR)-based method for detection of Alternaria DNA. PCR primers were designed to anneal to the internal transcribed regions ITS1 and ITS2 of the 5.8S rRNA gene of Alternaria but not to other microbial or tomato DNA. We demonstrate use of the PCR assay to detect Alternaria DNA in experimentally infested and commercially obtained tomato sauce and tomato powder. Use of the PCR method offers a rapid and sensitive assay for the presence of Alternaria DNA in tomato products. The apparent breakdown of DNA in tomato sauce may limit the utility of the assay to freshly prepared products. The assay for tomato powder is not affected by storage time.
Detection of proteins using a colorimetric bio-barcode assay.
Nam, Jwa-Min; Jang, Kyung-Jin; Groves, Jay T
2007-01-01
The colorimetric bio-barcode assay is a red-to-blue color change-based protein detection method with ultrahigh sensitivity. This assay is based on both the bio-barcode amplification method that allows for detecting miniscule amount of targets with attomolar sensitivity and gold nanoparticle-based colorimetric DNA detection method that allows for a simple and straightforward detection of biomolecules of interest (here we detect interleukin-2, an important biomarker (cytokine) for many immunodeficiency-related diseases and cancers). The protocol is composed of the following steps: (i) conjugation of target capture molecules and barcode DNA strands onto silica microparticles, (ii) target capture with probes, (iii) separation and release of barcode DNA strands from the separated probes, (iv) detection of released barcode DNA using DNA-modified gold nanoparticle probes and (v) red-to-blue color change analysis with a graphic software. Actual target detection and quantification steps with premade probes take approximately 3 h (whole protocol including probe preparations takes approximately 3 days).
Polski, J M; Kimzey, S; Percival, R W; Grosso, L E
1998-01-01
AIM: To provide a more efficient method for isolating DNA from peripheral blood for use in diagnostic DNA mutation analysis. METHODS: The use of blood impregnated filter paper and Chelex-100 in DNA isolation was evaluated and compared with standard DNA isolation techniques. RESULTS: In polymerase chain reaction (PCR) based assays of five point mutations, identical results were obtained with DNA isolated routinely from peripheral blood and isolated using the filter paper and Chelex-100 method. CONCLUSION: In the clinical setting, this method provides a useful alternative to conventional DNA isolation. It is easily implemented and inexpensive, and provides sufficient, stable DNA for multiple assays. The potential for specimen contamination is reduced because most of the steps are performed in a single microcentrifuge tube. In addition, this method provides for easy storage and transport of samples from the point of acquisition. PMID:9893748
Fan, Long; Hui, Jerome H L; Yu, Zu Guo; Chu, Ka Hou
2014-07-01
Species identification based on short sequences of DNA markers, that is, DNA barcoding, has emerged as an integral part of modern taxonomy. However, software for the analysis of large and multilocus barcoding data sets is scarce. The Basic Local Alignment Search Tool (BLAST) is currently the fastest tool capable of handling large databases (e.g. >5000 sequences), but its accuracy is a concern and has been criticized for its local optimization. However, current more accurate software requires sequence alignment or complex calculations, which are time-consuming when dealing with large data sets during data preprocessing or during the search stage. Therefore, it is imperative to develop a practical program for both accurate and scalable species identification for DNA barcoding. In this context, we present VIP Barcoding: a user-friendly software in graphical user interface for rapid DNA barcoding. It adopts a hybrid, two-stage algorithm. First, an alignment-free composition vector (CV) method is utilized to reduce searching space by screening a reference database. The alignment-based K2P distance nearest-neighbour method is then employed to analyse the smaller data set generated in the first stage. In comparison with other software, we demonstrate that VIP Barcoding has (i) higher accuracy than Blastn and several alignment-free methods and (ii) higher scalability than alignment-based distance methods and character-based methods. These results suggest that this platform is able to deal with both large-scale and multilocus barcoding data with accuracy and can contribute to DNA barcoding for modern taxonomy. VIP Barcoding is free and available at http://msl.sls.cuhk.edu.hk/vipbarcoding/. © 2014 John Wiley & Sons Ltd.
Vojkovska, H; Kubikova, I; Kralik, P
2015-03-01
Epidemiological data indicate that raw vegetables are associated with outbreaks of Listeria monocytogenes. Therefore, there is a demand for the availability of rapid and sensitive methods, such as PCR assays, for the detection and accurate discrimination of L. monocytogenes. However, the efficiency of PCR methods can be negatively affected by inhibitory compounds commonly found in vegetable matrices that may cause false-negative results. Therefore, the sample processing and DNA isolation steps must be carefully evaluated prior to the introduction of such methods into routine practice. In this study, we compared the ability of three column-based and four magnetic bead-based commercial DNA isolation kits to extract DNA of the model micro-organism L. monocytogenes from raw vegetables. The DNA isolation efficiency of all isolation kits was determined using a triplex real-time qPCR assay designed to specifically detect L. monocytogenes. The kit with best performance, the PowerSoil(™) Microbial DNA Isolation Kit, is suitable for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. Coupled with the triplex real-time qPCR assay, this DNA isolation kit is applicable to the samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. Several recent outbreaks of Listeria monocytogenes have been associated with the consumption of fruits and vegetables. Real-time PCR assays allow fast detection and accurate quantification of microbes. However, the success of real-time PCR is dependent on the success with which template DNA can be extracted. The results of this study suggest that the PowerSoil(™) Microbial DNA Isolation Kit can be used for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. This method is applicable to samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. © 2014 The Society for Applied Microbiology.
Recovery Based Nanowire Field-Effect Transistor Detection of Pathogenic Avian Influenza DNA
NASA Astrophysics Data System (ADS)
Lin, Chih-Heng; Chu, Chia-Jung; Teng, Kang-Ning; Su, Yi-Jr; Chen, Chii-Dong; Tsai, Li-Chu; Yang, Yuh-Shyong
2012-02-01
Fast and accurate diagnosis is critical in infectious disease surveillance and management. We proposed a DNA recovery system that can easily be adapted to DNA chip or DNA biosensor for fast identification and confirmation of target DNA. This method was based on the re-hybridization of DNA target with a recovery DNA to free the DNA probe. Functionalized silicon nanowire field-effect transistor (SiNW FET) was demonstrated to monitor such specific DNA-DNA interaction using high pathogenic strain virus hemagglutinin 1 (H1) DNA of avian influenza (AI) as target. Specific electric changes were observed in real-time for AI virus DNA sensing and device recovery when nanowire surface of SiNW FET was modified with complementary captured DNA probe. The recovery based SiNW FET biosensor can be further developed for fast identification and further confirmation of a variety of influenza virus strains and other infectious diseases.
Melendez, Johan H.; Santaus, Tonya M.; Brinsley, Gregory; Kiang, Daniel; Mali, Buddha; Hardick, Justin; Gaydos, Charlotte A.; Geddes, Chris D.
2016-01-01
Nucleic acid-based detection of gonorrhea infections typically require a two-step process involving isolation of the nucleic acid, followed by the detection of the genomic target often involving PCR-based approaches. In an effort to improve on current detection approaches, we have developed a unique two-step microwave-accelerated approach for rapid extraction and detection of Neisseria gonorrhoeae (GC) DNA. Our approach is based on the use of highly-focused microwave radiation to rapidly lyse bacterial cells, release, and subsequently fragment microbial DNA. The DNA target is then detected by a process known as microwave-accelerated metal-enhanced fluorescence (MAMEF), an ultra-sensitive direct DNA detection analytical technique. In the present study, we show that highly focused microwaves at 2.45 GHz, using 12.3 mm gold film equilateral triangles, are able to rapidly lyse both bacteria cells and fragment DNA in a time- and microwave power-dependent manner. Detection of the extracted DNA can be performed by MAMEF, without the need for DNA amplification in less than 10 minutes total time or by other PCR-based approaches. Collectively, the use of a microwave-accelerated method for the release and detection of DNA represents a significant step forward towards the development of a point-of-care (POC) platform for detection of gonorrhea infections. PMID:27325503
Xiong, Yanxiang; Wei, Min; Wei, Wei; Yin, Lihong; Pu, Yuepu; Liu, Songqin
2014-01-24
DNA hairpin structure probes are usually designed by forming intra-molecular duplex based on Watson-Crick hydrogen bonds. In this paper, a molecular beacon based on silver ions-mediated cytosine-Ag(+)-cytosine base pairs was used to detect DNA. The inherent characteristic of the metal ligation facilitated the design of functional probe and the adjustment of its binding strength compared to traditional DNA hairpin structure probes, which make it be used to detect DNA in a simple, rapid and easy way with the help of DNA strands displacement reaction. The method was sensitive and also possesses the good specificity to differentiate the single base mismatched DNA from the complementary DNA. It was also successfully applied to study the damage effect of classic genotoxicity chemicals such as styrene oxide and sodium arsenite on DNA, which was significant in food science, environmental science and pharmaceutical science. Copyright © 2013 Elsevier B.V. All rights reserved.
Triple-helix molecular switch-based aptasensors and DNA sensors.
Bagheri, Elnaz; Abnous, Khalil; Alibolandi, Mona; Ramezani, Mohammad; Taghdisi, Seyed Mohammad
2018-07-15
Utilization of traditional analytical techniques is limited because they are generally time-consuming and require high consumption of reagents, complicated sample preparation and expensive equipment. Therefore, it is of great interest to achieve sensitive, rapid and simple detection methods. It is believed that nucleic acids assays, especially aptamers, are very important in modern life sciences for target detection and biological analysis. Aptamers and DNA-based sensors have been widely used for the design of various sensors owing to their unique features. In recent years, triple-helix molecular switch (THMS)-based aptasensors and DNA sensors have been broadly utilized for the detection and analysis of different targets. The THMS relies on the formation of DNA triplex via Watson-Crick and Hoogsteen base pairings under optimal conditions. This review focuses on recent progresses in the development and applications of electrochemical, colorimetric, fluorescence and SERS aptasensors and DNA sensors, which are based on THMS. Also, the advantages and drawbacks of these methods are discussed. Copyright © 2018 Elsevier B.V. All rights reserved.
2013-01-01
Background Mitochondrial DNA (mtDNA) typing can be a useful aid for identifying people from compromised samples when nuclear DNA is too damaged, degraded or below detection thresholds for routine short tandem repeat (STR)-based analysis. Standard mtDNA typing, focused on PCR amplicon sequencing of the control region (HVS I and HVS II), is limited by the resolving power of this short sequence, which misses up to 70% of the variation present in the mtDNA genome. Methods We used in-solution hybridisation-based DNA capture (using DNA capture probes prepared from modern human mtDNA) to recover mtDNA from post-mortem human remains in which the majority of DNA is both highly fragmented (<100 base pairs in length) and chemically damaged. The method ‘immortalises’ the finite quantities of DNA in valuable extracts as DNA libraries, which is followed by the targeted enrichment of endogenous mtDNA sequences and characterisation by next-generation sequencing (NGS). Results We sequenced whole mitochondrial genomes for human identification from samples where standard nuclear STR typing produced only partial profiles or demonstrably failed and/or where standard mtDNA hypervariable region sequences lacked resolving power. Multiple rounds of enrichment can substantially improve coverage and sequencing depth of mtDNA genomes from highly degraded samples. The application of this method has led to the reliable mitochondrial sequencing of human skeletal remains from unidentified World War Two (WWII) casualties approximately 70 years old and from archaeological remains (up to 2,500 years old). Conclusions This approach has potential applications in forensic science, historical human identification cases, archived medical samples, kinship analysis and population studies. In particular the methodology can be applied to any case, involving human or non-human species, where whole mitochondrial genome sequences are required to provide the highest level of maternal lineage discrimination. Multiple rounds of in-solution hybridisation-based DNA capture can retrieve whole mitochondrial genome sequences from even the most challenging samples. PMID:24289217
A Rewritable, Random-Access DNA-Based Storage System.
Yazdi, S M Hossein Tabatabaei; Yuan, Yongbo; Ma, Jian; Zhao, Huimin; Milenkovic, Olgica
2015-09-18
We describe the first DNA-based storage architecture that enables random access to data blocks and rewriting of information stored at arbitrary locations within the blocks. The newly developed architecture overcomes drawbacks of existing read-only methods that require decoding the whole file in order to read one data fragment. Our system is based on new constrained coding techniques and accompanying DNA editing methods that ensure data reliability, specificity and sensitivity of access, and at the same time provide exceptionally high data storage capacity. As a proof of concept, we encoded parts of the Wikipedia pages of six universities in the USA, and selected and edited parts of the text written in DNA corresponding to three of these schools. The results suggest that DNA is a versatile media suitable for both ultrahigh density archival and rewritable storage applications.
A Rewritable, Random-Access DNA-Based Storage System
NASA Astrophysics Data System (ADS)
Tabatabaei Yazdi, S. M. Hossein; Yuan, Yongbo; Ma, Jian; Zhao, Huimin; Milenkovic, Olgica
2015-09-01
We describe the first DNA-based storage architecture that enables random access to data blocks and rewriting of information stored at arbitrary locations within the blocks. The newly developed architecture overcomes drawbacks of existing read-only methods that require decoding the whole file in order to read one data fragment. Our system is based on new constrained coding techniques and accompanying DNA editing methods that ensure data reliability, specificity and sensitivity of access, and at the same time provide exceptionally high data storage capacity. As a proof of concept, we encoded parts of the Wikipedia pages of six universities in the USA, and selected and edited parts of the text written in DNA corresponding to three of these schools. The results suggest that DNA is a versatile media suitable for both ultrahigh density archival and rewritable storage applications.
Ding, Yuan; Zhang, Xiaojun; Tham, Kenneth W.; Qin, Peter Z.
2014-01-01
Sequence-dependent variation in structure and dynamics of a DNA duplex, collectively referred to as ‘DNA shape’, critically impacts interactions between DNA and proteins. Here, a method based on the technique of site-directed spin labeling was developed to experimentally map shapes of two DNA duplexes that contain response elements of the p53 tumor suppressor. An R5a nitroxide spin label, which was covalently attached at a specific phosphate group, was scanned consecutively through the DNA duplex. X-band continuous-wave electron paramagnetic resonance spectroscopy was used to monitor rotational motions of R5a, which report on DNA structure and dynamics at the labeling site. An approach based on Pearson's coefficient analysis was developed to collectively examine the degree of similarity among the ensemble of R5a spectra. The resulting Pearson's coefficients were used to generate maps representing variation of R5a mobility along the DNA duplex. The R5a mobility maps were found to correlate with maps of certain DNA helical parameters, and were capable of revealing similarity and deviation in the shape of the two closely related DNA duplexes. Collectively, the R5a probe and the Pearson's coefficient-based lineshape analysis scheme yielded a generalizable method for examining sequence-dependent DNA shapes. PMID:25092920
Effect of food processing on plant DNA degradation and PCR-based GMO analysis: a review.
Gryson, Nicolas
2010-03-01
The applicability of a DNA-based method for GMO detection and quantification depends on the quality and quantity of the DNA. Important food-processing conditions, for example temperature and pH, may lead to degradation of the DNA, rendering PCR analysis impossible or GMO quantification unreliable. This review discusses the effect of several food processes on DNA degradation and subsequent GMO detection and quantification. The data show that, although many of these processes do indeed lead to the fragmentation of DNA, amplification of the DNA may still be possible. Length and composition of the amplicon may, however, affect the result, as also may the method of extraction used. Also, many techniques are used to describe the behaviour of DNA in food processing, which occasionally makes it difficult to compare research results. Further research should be aimed at defining ingredients in terms of their DNA quality and PCR amplification ability, and elaboration of matrix-specific certified reference materials.
Hammerly, Susan C; Morrow, Michael E; Johnson, Jeff A
2013-11-01
The primary goal of captive breeding programmes for endangered species is to prevent extinction, a component of which includes the preservation of genetic diversity and avoidance of inbreeding. This is typically accomplished by minimizing mean kinship in the population, thereby maintaining equal representation of the genetic founders used to initiate the captive population. If errors in the pedigree do exist, such an approach becomes less effective for minimizing inbreeding depression. In this study, both pedigree- and DNA-based methods were used to assess whether inbreeding depression existed in the captive population of the critically endangered Attwater's Prairie-chicken (Tympanuchus cupido attwateri), a subspecies of prairie grouse that has experienced a significant decline in abundance and concurrent reduction in neutral genetic diversity. When examining the captive population for signs of inbreeding, variation in pedigree-based inbreeding coefficients (f(pedigree)) was less than that obtained from DNA-based methods (f(DNA)). Mortality of chicks and adults in captivity were also positively correlated with parental relatedness (r(DNA)) and f(DNA), respectively, while no correlation was observed with pedigree-based measures when controlling for additional variables such as age, breeding facility, gender and captive/release status. Further, individual homozygosity by loci (HL) and parental rDNA values were positively correlated with adult mortality in captivity and the occurrence of a lethal congenital defect in chicks, respectively, suggesting that inbreeding may be a contributing factor increasing the frequency of this condition among Attwater's Prairie-chickens. This study highlights the importance of using DNA-based methods to better inform management decisions when pedigrees are incomplete or errors may exist due to uncertainty in pairings. © 2013 John Wiley & Sons Ltd.
Neish, G A; Green, B R
1977-12-14
Saprolegnia diclina DNA has been fractionated using preparative AgNO3/Cs2SO4 and CsCl density gradients. In addition to the previously identified major satellite DNA, there are two minor DNA components banding at 1.682 and 1.701 g - cm(-3) in CsCl. Purified major satellite DNA bands at 1.707 g - cm(-3) giving a base composition of 48% G + C in good agreement with 47% G + C calculated from its Tm value. The nuclear DNA base composition is 58% G + C by both methods. The base composition of the major satellite DNA suggests that it may represent ribosomal DNA cistrons.
NASA Astrophysics Data System (ADS)
Urban, Matthias; Möller, Robert; Fritzsche, Wolfgang
2003-02-01
DNA analytics is a growing field based on the increasing knowledge about the genome with special implications for the understanding of molecular bases for diseases. Driven by the need for cost-effective and high-throughput methods for molecular detection, DNA chips are an interesting alternative to more traditional analytical methods in this field. The standard readout principle for DNA chips is fluorescence based. Fluorescence is highly sensitive and broadly established, but shows limitations regarding quantification (due to signal and/or dye instability) and the need for sophisticated (and therefore high-cost) equipment. This article introduces a readout system for an alternative detection scheme based on electrical detection of nanoparticle-labeled DNA. If labeled DNA is present in the analyte solution, it will bind on complementary capture DNA immobilized in a microelectrode gap. A subsequent metal enhancement step leads to a deposition of conductive material on the nanoparticles, and finally an electrical contact between the electrodes. This detection scheme offers the potential for a simple (low-cost as well as robust) and highly miniaturizable method, which could be well-suited for point-of-care applications in the context of lab-on-a-chip technologies. The demonstrated apparatus allows a parallel readout of an entire array of microstructured measurement sites. The readout is combined with data-processing by an embedded personal computer, resulting in an autonomous instrument that measures and presents the results. The design and realization of such a system is described, and first measurements are presented.
Rock, Cassandra; Shamlou, Parviz Ayazi; Levy, M. Susana
2003-01-01
A method is described for high-throughput monitoring of DNA backbone integrity in plasmids and artificial chromosomes in solution. The method is based on the denaturation properties of double-stranded DNA in alkaline conditions and uses PicoGreen fluorochrome to monitor denaturation. In the present method, fluorescence enhancement of PicoGreen at pH 12.4 is normalised by its value at pH 8 to give a ratio that is proportional to the average backbone integrity of the DNA molecules in the sample. A good regression fit (r2 > 0.98) was obtained when results derived from the present method and those derived from agarose gel electrophoresis were compared. Spiking experiments indicated that the method is sensitive enough to detect a proportion of 6% (v/v) molecules with an average of less than two breaks per molecule. Under manual operation, validation parameters such as inter-assay and intra-assay variation gave values of <5% coefficient of variation. Automation of the method showed equivalence to the manual procedure with high reproducibility and low variability within wells. The method described requires as little as 0.5 ng of DNA per well and a 96-well microplate can be analysed in 12 min providing an attractive option for analysis of high molecular weight vectors. A preparation of a 116 kb bacterial artificial chromosome was subjected to chemical and shear degradation and DNA integrity was tested using the method. Good correlation was obtained between time of chemical degradation and shear rate with fluorescence response. Results obtained from pulsed- field electrophoresis of sheared samples were in agreement with those obtained using the microplate-based method. PMID:12771229
The identification of fecal pollution sources is commonly performed using DNA-based methods. However, there is evidence that DNA can be associated with dead cells or present as “naked DNA” in the environment. To this end, we compared the detection frequency of host specific marke...
Miao, Yanming; Zhang, Zhifeng; Gong, Yan; Yan, Guiqin
2014-09-15
MPA-capped Mn-doped ZnS QDs/DXR nanohybrids (MPA: 3-mercaptopropionic acid; QDs: quantum dots; DXR: cetyltrimethyl ammonium bromide) were constructed via photoinduced electron transfer (PIET) and then used as a room-temperature phosphorescence (RTP) probe for detection of DNA. DXR as a quencher will quench the RTP of Mn-doped ZnS QDs via PIET, thereby forming Mn-doped ZnS QDs/DXR nanohybrids and storing RTP. With the addition of DNA, it will be inserted into DXR and thus DXR will be competitively desorbed from the surface of Mn-doped ZnS QDs, thereby releasing the RTP of Mn-doped ZnS QDs. Based on this, a new method for DNA detection was built. The sensor for DNA has a detection limit of 0.039 mg L(-1) and a linear range from 0.1 to 14 mg L(-1). The present QDs-based RTP method does not need deoxidants or other inducers as required by conventional RTP detection methods, and avoids interference from autofluorescence and the scattering light of the matrix that are encountered in spectrofluorometry. Therefore, this method can be used to detect the DNA content in body fluid. Copyright © 2014 Elsevier B.V. All rights reserved.
Rasheed, P Abdul; Sandhyarani, N
2017-11-15
Development of a sensitive, specific and cost-effective DNA detection method is motivated by increasing demand for the early stage diagnosis of genetic diseases. Recent developments in the design and fabrication of efficient sensor platforms based on nanostructures make the highly sensitive sensors which could indicate very low detection limit to the level of few molecules, a realistic possibility. Electrochemical detection methods are widely used in DNA diagnostics as it provide simple, accurate and inexpensive platform for DNA detection. In addition, the electrochemical DNA sensors provide direct electronic signal without the use of expensive signal transduction equipment and facilitates the immobilization of single stranded DNA (ssDNA) probe sequences on a wide variety of electrode substrates. It has been found that a range of nanomaterials such as metal nanoparticles (MNPs), carbon based nanomaterials, quantum dots (QDs), magnetic nanoparticles and polymeric NPs have been introduced in the sensor design to enhance the sensing performance of electrochemical DNA sensor. In this review, we discuss recent progress in the design and fabrication of efficient electrochemical genosensors based on carbon nanostructures such as carbon nanotubes, graphene, graphene oxide and nanodiamonds. Copyright © 2017 Elsevier B.V. All rights reserved.
DNA Extraction from Soils: Old Bias for New Microbial Diversity Analysis Methods
Martin-Laurent, F.; Philippot, L.; Hallet, S.; Chaussod, R.; Germon, J. C.; Soulas, G.; Catroux, G.
2001-01-01
The impact of three different soil DNA extraction methods on bacterial diversity was evaluated using PCR-based 16S ribosomal DNA analysis. DNA extracted directly from three soils showing contrasting physicochemical properties was subjected to amplified ribosomal DNA restriction analysis and ribosomal intergenic spacer analysis (RISA). The obtained RISA patterns revealed clearly that both the phylotype abundance and the composition of the indigenous bacterial community are dependent on the DNA recovery method used. In addition, this effect was also shown in the context of an experimental study aiming to estimate the impact on soil biodiversity of the application of farmyard manure or sewage sludge onto a monoculture of maize for 15 years. PMID:11319122
Ma, Jin-Liang; Yin, Bin-Cheng; Le, Huynh-Nhu; Ye, Bang-Ce
2015-06-17
We have developed a label-free method for sequence-specific DNA detection based on surface plasmon enhanced energy transfer (SPEET) process between fluorescent DNA/AgNC string and gold nanoparticles (AuNPs). DNA/AgNC string, prepared by a single-stranded DNA template encoded two emitter-nucleation sequences at its termini and an oligo spacer in the middle, was rationally designed to produce bright fluorescence emission. The proposed method takes advantage of two strategies. The first one is the difference in binding properties of single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) toward AuNPs. The second one is SPEET process between fluorescent DNA/AgNC string and AuNPs, in which fluorescent DNA/AgNC string can be spontaneously adsorbed onto the surface of AuNPs and correspondingly AuNPs serve as "nanoquencher" to quench the fluorescence of DNA/AgNC string. In the presence of target DNA, the sensing probe hybridized with target DNA to form duplex DNA, leading to a salt-induced AuNP aggregation and subsequently weakened SPEET process between fluorescent DNA/AgNC string and AuNPs. A red-to-blue color change of AuNPs and a concomitant fluorescence increase were clearly observed in the sensing system, which had a concentration dependent manner with specific DNA. The proposed method achieved a detection limit of ∼2.5 nM, offering the following merits of simple design, convenient operation, and low experimental cost because of no chemical modification, organic dye, enzymatic reaction, or separation procedure involved.
GLC analysis of base composition of RNA and DNA hydrolysates
NASA Technical Reports Server (NTRS)
Lakings, D. B.; Gehreke, C. W.
1971-01-01
Various methods used for the analysis of the base composition of RNA and DNA hydrolysates are presented. The methods discussed are: (1) ion-exchange chromatography, (2) paper chromatography, (3) paper electrophoresis, (4) thin layer chromatography, (5) paper chromatography and time of flight mass spectrometry, and (6) gas-liquid chromatography. The equipment required and the conditions for obtaining the best results with each method are described.
Huanca-Mamani, W; Rivera-Cabello, D; Maita-Maita, J
2015-07-17
In this study, we report a modified CTAB-PVP method combined with silicon dioxide (silica) treatment for the extraction of high quality genomic DNA from a single larva or pupa. This method efficiently obtains DNA from small specimens, which is difficult and challenging because of the small amount of starting tissue. Maceration with liquid nitrogen, phenol treatment, and the ethanol precipitation step are eliminated using this methodology. The A260/A280 absorbance ratios of the isolated DNA were approximately 1.8, suggesting that the DNA is pure and can be used for further molecular analysis. The quality of the isolated DNA permits molecular applications and represents a fast, cheap, and effective alternative method for laboratories with low budgets.
An Alu-based, MGB Eclipse real-time PCR method for quantitation of human DNA in forensic samples.
Nicklas, Janice A; Buel, Eric
2005-09-01
The forensic community needs quick, reliable methods to quantitate human DNA in crime scene samples to replace the laborious and imprecise slot blot method. A real-time PCR based method has the possibility of allowing development of a faster and more quantitative assay. Alu sequences are primate-specific and are found in many copies in the human genome, making these sequences an excellent target or marker for human DNA. This paper describes the development of a real-time Alu sequence-based assay using MGB Eclipse primers and probes. The advantages of this assay are simplicity, speed, less hands-on-time and automated quantitation, as well as a large dynamic range (128 ng/microL to 0.5 pg/microL).
Pros and cons of methylation-based enrichment methods for ancient DNA.
Seguin-Orlando, Andaine; Gamba, Cristina; Der Sarkissian, Clio; Ermini, Luca; Louvel, Guillaume; Boulygina, Eugenia; Sokolov, Alexey; Nedoluzhko, Artem; Lorenzen, Eline D; Lopez, Patricio; McDonald, H Gregory; Scott, Eric; Tikhonov, Alexei; Stafford, Thomas W; Alfarhan, Ahmed H; Alquraishi, Saleh A; Al-Rasheid, Khaled A S; Shapiro, Beth; Willerslev, Eske; Prokhortchouk, Egor; Orlando, Ludovic
2015-07-02
The recent discovery that DNA methylation survives in fossil material provides an opportunity for novel molecular approaches in palaeogenomics. Here, we apply to ancient DNA extracts the probe-independent Methylated Binding Domains (MBD)-based enrichment method, which targets DNA molecules containing methylated CpGs. Using remains of a Palaeo-Eskimo Saqqaq individual, woolly mammoths, polar bears and two equine species, we confirm that DNA methylation survives in a variety of tissues, environmental contexts and over a large temporal range (4,000 to over 45,000 years before present). MBD enrichment, however, appears principally biased towards the recovery of CpG-rich and long DNA templates and is limited by the fast post-mortem cytosine deamination rates of methylated epialleles. This method, thus, appears only appropriate for the analysis of ancient methylomes from very well preserved samples, where both DNA fragmentation and deamination have been limited. This work represents an essential step toward the characterization of ancient methylation signatures, which will help understanding the role of epigenetic changes in past environmental and cultural transitions.
Pros and cons of methylation-based enrichment methods for ancient DNA
Seguin-Orlando, Andaine; Gamba, Cristina; Sarkissian, Clio Der; Ermini, Luca; Louvel, Guillaume; Boulygina, Eugenia; Sokolov, Alexey; Nedoluzhko, Artem; Lorenzen, Eline D.; Lopez, Patricio; McDonald, H. Gregory; Scott, Eric; Tikhonov, Alexei; Stafford,, Thomas W.; Alfarhan, Ahmed H.; Alquraishi, Saleh A.; Al-Rasheid, Khaled A. S.; Shapiro, Beth; Willerslev, Eske; Prokhortchouk, Egor; Orlando, Ludovic
2015-01-01
The recent discovery that DNA methylation survives in fossil material provides an opportunity for novel molecular approaches in palaeogenomics. Here, we apply to ancient DNA extracts the probe-independent Methylated Binding Domains (MBD)-based enrichment method, which targets DNA molecules containing methylated CpGs. Using remains of a Palaeo-Eskimo Saqqaq individual, woolly mammoths, polar bears and two equine species, we confirm that DNA methylation survives in a variety of tissues, environmental contexts and over a large temporal range (4,000 to over 45,000 years before present). MBD enrichment, however, appears principally biased towards the recovery of CpG-rich and long DNA templates and is limited by the fast post-mortem cytosine deamination rates of methylated epialleles. This method, thus, appears only appropriate for the analysis of ancient methylomes from very well preserved samples, where both DNA fragmentation and deamination have been limited. This work represents an essential step toward the characterization of ancient methylation signatures, which will help understanding the role of epigenetic changes in past environmental and cultural transitions. PMID:26134828
Guo, Qiuping; Yang, Xiaohai; Wang, Kemin; Tan, Weihong; Li, Wei; Tang, Hongxing; Li, Huimin
2009-02-01
Here we have developed a sensitive DNA amplified detection method based on isothermal strand-displacement polymerization reaction. This method takes advantage of both the hybridization property of DNA and the strand-displacement property of polymerase. Importantly, we demonstrate that our method produces a circular polymerization reaction activated by the target, which essentially allows it to self-detect. Functionally, this DNA system consists of a hairpin fluorescence probe, a short primer and polymerase. Upon recognition and hybridization with the target ssDNA, the stem of the hairpin probe is opened, after which the opened probe anneals with the primer and triggers the polymerization reaction. During this process of the polymerization reaction, a complementary DNA is synthesized and the hybridized target is displaced. Finally, the displaced target recognizes and hybridizes with another probe, triggering the next round of polymerization reaction, reaching a target detection limit of 6.4 x 10(-15) M.
Application of DNA-based methods in forensic entomology.
Wells, Jeffrey D; Stevens, Jamie R
2008-01-01
A forensic entomological investigation can benefit from a variety of widely practiced molecular genotyping methods. The most commonly used is DNA-based specimen identification. Other applications include the identification of insect gut contents and the characterization of the population genetic structure of a forensically important insect species. The proper application of these procedures demands that the analyst be technically expert. However, one must also be aware of the extensive list of standards and expectations that many legal systems have developed for forensic DNA analysis. We summarize the DNA techniques that are currently used in, or have been proposed for, forensic entomology and review established genetic analyses from other scientific fields that address questions similar to those in forensic entomology. We describe how accepted standards for forensic DNA practice and method validation are likely to apply to insect evidence used in a death or other forensic entomological investigation.
DNA Cryptography and Deep Learning using Genetic Algorithm with NW algorithm for Key Generation.
Kalsi, Shruti; Kaur, Harleen; Chang, Victor
2017-12-05
Cryptography is not only a science of applying complex mathematics and logic to design strong methods to hide data called as encryption, but also to retrieve the original data back, called decryption. The purpose of cryptography is to transmit a message between a sender and receiver such that an eavesdropper is unable to comprehend it. To accomplish this, not only we need a strong algorithm, but a strong key and a strong concept for encryption and decryption process. We have introduced a concept of DNA Deep Learning Cryptography which is defined as a technique of concealing data in terms of DNA sequence and deep learning. In the cryptographic technique, each alphabet of a letter is converted into a different combination of the four bases, namely; Adenine (A), Cytosine (C), Guanine (G) and Thymine (T), which make up the human deoxyribonucleic acid (DNA). Actual implementations with the DNA don't exceed laboratory level and are expensive. To bring DNA computing on a digital level, easy and effective algorithms are proposed in this paper. In proposed work we have introduced firstly, a method and its implementation for key generation based on the theory of natural selection using Genetic Algorithm with Needleman-Wunsch (NW) algorithm and Secondly, a method for implementation of encryption and decryption based on DNA computing using biological operations Transcription, Translation, DNA Sequencing and Deep Learning.
Liu, Xingti; Xue, Qingwang; Ding, Yongshun; Zhu, Jing; Wang, Lei; Jiang, Wei
2014-06-07
A sensitive and label-free fluorescence assay for DNA detection has been developed based on cascade signal amplification combining exonuclease III (Exo III)-catalyzed recycling with rolling circle amplification. In this assay, probe DNA hybridized with template DNA was coupled onto magnetic nanoparticles to prepare a magnetic bead-probe (MNB-probe)-template complex. The complex could hybridize with the target DNA, which transformed the protruding 3' terminus of template DNA into a blunt end. Exo III could then digest template DNA, liberating the MNB-probe and target DNA. The intact target DNA then hybridized with other templates and released more MNB-probes. The liberated MNB-probe captured the primer, circular DNA and then initiated the rolling circle amplification (RCA) reaction, realizing a cascade signal amplification. Using this cascade amplification strategy, a sensitive DNA detection method was developed which was superior to many existing Exo III-based signal amplification methods. Moreover, N-methyl mesoporphyrin IX, which had a pronounced structural selectivity for the G-quadruplex, was used to combine with the G-quadruplex RCA products and generate a fluorescence signal, avoiding the need for any fluorophore-label probes. The spike and recovery experiments in a human serum sample indicated that our assay also had great potential for DNA detection in real biological samples.
Extracting DNA words based on the sequence features: non-uniform distribution and integrity.
Li, Zhi; Cao, Hongyan; Cui, Yuehua; Zhang, Yanbo
2016-01-25
DNA sequence can be viewed as an unknown language with words as its functional units. Given that most sequence alignment algorithms such as the motif discovery algorithms depend on the quality of background information about sequences, it is necessary to develop an ab initio algorithm for extracting the "words" based only on the DNA sequences. We considered that non-uniform distribution and integrity were two important features of a word, based on which we developed an ab initio algorithm to extract "DNA words" that have potential functional meaning. A Kolmogorov-Smirnov test was used for consistency test of uniform distribution of DNA sequences, and the integrity was judged by the sequence and position alignment. Two random base sequences were adopted as negative control, and an English book was used as positive control to verify our algorithm. We applied our algorithm to the genomes of Saccharomyces cerevisiae and 10 strains of Escherichia coli to show the utility of the methods. The results provide strong evidences that the algorithm is a promising tool for ab initio building a DNA dictionary. Our method provides a fast way for large scale screening of important DNA elements and offers potential insights into the understanding of a genome.
Wang, Yong-Chun; Lin, Cong-Bin; Su, Jian-Jia; Ru, Ying-Ming; Wu, Qiao; Chen, Zhao-Bin; Mao, Bing-Wei; Tian, Zhao-Wu
2011-06-15
In this paper, we present an electrochemically driven large amplitude pH alteration method based on a serial electrolytic cell involving a hydrogen permeable bifacial working electrode such as Pd thin foil. The method allows solution pH to be changed periodically up to ±4~5 units without additional alteration of concentration and/or composition of the system. Application to the acid-base driven cyclic denaturation and renaturation of 290 bp DNA fragments is successfully demonstrated with in situ real-time UV spectroscopic characterization. Electrophoretic analysis confirms that the denaturation and renaturation processes are reversible without degradation of the DNA. The serial electrolytic cell based electrochemical pH alteration method presented in this work would promote investigations of a wide variety of potential-dependent processes and techniques.
Quantitative PCR detection of Batrachochytrium dendrobatidis DNA from sediments and water
Kirshtein, Julie D.; Anderson, Chauncey W.; Wood, J.S.; Longcore, Joyce E.; Voytek, Mary A.
2007-01-01
The fungal pathogen Batrachochytrium dendrobatidis (Bd) causes chytridiomycosis, a disease implicated in amphibian declines on 5 continents. Polymerase chain reaction (PCR) primer sets exist with which amphibians can be tested for this disease, and advances in sampling techniques allow non-invasive testing of animals. We developed filtering and PCR based quantitative methods by modifying existing PCR assays to detect Bd DNA in water and sediments, without the need for testing amphibians; we tested the methods at 4 field sites. The SYBR based assay using Boyle primers (SYBR/Boyle assay) and the Taqman based assay using Wood primers performed similarly with samples generated in the laboratory (Bd spiked filters), but the SYBR/Boyle assay detected Bd DNA in more field samples. We detected Bd DNA in water from 3 of 4 sites tested, including one pond historically negative for chytridiomycosis. Zoospore equivalents in sampled water ranged from 19 to 454 l-1 (nominal detection limit is 10 DNA copies, or about 0.06 zoospore). We did not detect DNA of Bd from sediments collected at any sites. Our filtering and amplification methods provide a new tool to investigate critical aspects of Bd in the environment. ?? Inter-Research 2007.
An improved method for large-scale preparation of negatively and positively supercoiled plasmid DNA.
Barth, Marita; Dederich, Debra; Dedon, Peter
2009-07-01
A rigorous understanding of the biological function of superhelical tension in cellular DNA requires the development of new tools and model systems for study. To this end, an ethidium bromide[#x02013]free method has been developed to prepare large quantities of either negatively or positively super-coiled plasmid DNA. The method is based upon the known effects of ionic strength on the direction of binding of DNA to an archaeal histone, rHMfB, with low and high salt concentrations leading to positive and negative DNA supercoiling, respectively. In addition to fully optimized conditions for large-scale (>500 microg) supercoiling reactions, the method is advantageous in that it avoids the use of mutagenic ethidium bromide, is applicable to chemically modified plasmid DNA substrates, and produces both positively and negatively supercoiled DNA using a single set of reagents.
Polski, J M; Kimzey, S; Percival, R W; Grosso, L E
1998-08-01
To provide a more efficient method for isolating DNA from peripheral blood for use in diagnostic DNA mutation analysis. The use of blood impregnated filter paper and Chelex-100 in DNA isolation was evaluated and compared with standard DNA isolation techniques. In polymerase chain reaction (PCR) based assays of five point mutations, identical results were obtained with DNA isolated routinely from peripheral blood and isolated using the filter paper and Chelex-100 method. In the clinical setting, this method provides a useful alternative to conventional DNA isolation. It is easily implemented and inexpensive, and provides sufficient, stable DNA for multiple assays. The potential for specimen contamination is reduced because most of the steps are performed in a single microcentrifuge tube. In addition, this method provides for easy storage and transport of samples from the point of acquisition.
Direct LAMP Assay without Prior DNA Purification for Sex Determination of Papaya.
Tsai, Chi-Chu; Shih, Huei-Chuan; Ko, Ya-Zhu; Wang, Ren-Huang; Li, Shu-Ju; Chiang, Yu-Chung
2016-09-24
Papaya (Carica papaya L.) is an economically important tropical fruit tree with hermaphrodite, male and female sex types. Hermaphroditic plants are the major type used for papaya production because their fruits have more commercial advantages than those of female plants. Sex determination of the seedlings, or during the early growth stages, is very important for the papaya seedling industry. Thus far, the only method for determining the sex type of a papaya at the seedling stage has been DNA analysis. In this study, a molecular technique-based on DNA analysis-was developed for detecting male-hermaphrodite-specific markers to examine the papaya's sex type. This method is based on the loop-mediated isothermal amplification (LAMP) and does not require prior DNA purification. The results show that the method is an easy, efficient, and inexpensive way to determine a papaya's sex. This is the first report on the LAMP assay, using intact plant materials-without DNA purification-as samples for the analysis of sex determination of papaya. We found that using high-efficiency DNA polymerase was essential for successful DNA amplification, using trace intact plant material as a template DNA source.
Direct LAMP Assay without Prior DNA Purification for Sex Determination of Papaya
Tsai, Chi-Chu; Shih, Huei-Chuan; Ko, Ya-Zhu; Wang, Ren-Huang; Li, Shu-Ju; Chiang, Yu-Chung
2016-01-01
Papaya (Carica papaya L.) is an economically important tropical fruit tree with hermaphrodite, male and female sex types. Hermaphroditic plants are the major type used for papaya production because their fruits have more commercial advantages than those of female plants. Sex determination of the seedlings, or during the early growth stages, is very important for the papaya seedling industry. Thus far, the only method for determining the sex type of a papaya at the seedling stage has been DNA analysis. In this study, a molecular technique—based on DNA analysis—was developed for detecting male-hermaphrodite-specific markers to examine the papaya’s sex type. This method is based on the loop-mediated isothermal amplification (LAMP) and does not require prior DNA purification. The results show that the method is an easy, efficient, and inexpensive way to determine a papaya’s sex. This is the first report on the LAMP assay, using intact plant materials-without DNA purification-as samples for the analysis of sex determination of papaya. We found that using high-efficiency DNA polymerase was essential for successful DNA amplification, using trace intact plant material as a template DNA source. PMID:27669237
Microchip-based cell lysis and DNA extraction from sperm cells for application to forensic analysis.
Bienvenue, Joan M; Duncalf, Natalie; Marchiarullo, Daniel; Ferrance, Jerome P; Landers, James P
2006-03-01
The current backlog of casework is among the most significant challenges facing crime laboratories at this time. While the development of next-generation microchip-based technology for expedited forensic casework analysis offers one solution to this problem, this will require the adaptation of manual, large-volume, benchtop chemistry to small volume microfluidic devices. Analysis of evidentiary materials from rape kits where semen or sperm cells are commonly found represents a unique set of challenges for on-chip cell lysis and DNA extraction that must be addressed for successful application. The work presented here details the development of a microdevice capable of DNA extraction directly from sperm cells for application to the analysis of sexual assault evidence. A variety of chemical lysing agents are assessed for inclusion in the extraction protocol and a method for DNA purification from sperm cells is described. Suitability of the extracted DNA for short tandem repeat (STR) analysis is assessed and genetic profiles shown. Finally, on-chip cell lysis methods are evaluated, with results from fluorescence visualization of cell rupture and DNA extraction from an integrated cell lysis and purification with subsequent STR amplification presented. A method for on-chip cell lysis and DNA purification is described, with considerations toward inclusion in an integrated microdevice capable of both differential cell sorting and DNA extraction. The results of this work demonstrate the feasibility of incorporating microchip-based cell lysis and DNA extraction into forensic casework analysis.
Yin, Huan-Shun; Li, Bing-Chen; Zhou, Yun-Lei; Wang, Hai-Yan; Wang, Ming-Hui; Ai, Shi-Yun
2017-10-15
MicroRNAs have been involved into many biological processes and are regarded as disease biomarkers. Simple, rapid, sensitive and selective method for microRNA detection is crucial for early diagnosis and therapy of diseases. In this work, sensitive fluorescence assay was developed for microRNA-21 detection based on DNA polymerase induced strand displacement amplification reaction, Mg 2+ -dependent DNAzyme catalysis reaction, and magnetic separation. In the presence of target microRNA-21, amounts of trigger DNA could be produced with DNA polymerase induced strand displacement amplification reaction, and the trigger DNA could be further hybridized with signal DNA, which was labeled with biotin and AMCA dye. After introduction of Mg 2+ , trigger DNA could form DNAzyme to cleave signal DNA. After magnetic separation, the DNA fragment with AMCA dye could give fluorescence signal, which was related to microRNA-21 concentration. Based on the two efficient signal amplifications, the developed method showed high detection sensitivity with low detection limit of 0.27fM (3σ). In addition, this fluorescence strategy also possessed excellent detection specificity, and could be applied to analyze microRNA-21 expression level in serum of cancer patient. According to the obtained results, the developed fluorescence method might be a promising detection platform for microRNA-21 quantitative analysis in biomedical research and clinical diagnosis. Copyright © 2017 Elsevier B.V. All rights reserved.
Structural Organization and Strain Variation in the Genome of Varicella Zoster Virus
1984-10-23
Zoster 6 Growth of VZV in tissue culture 9 Structure and proteins of VZV 15 Structure of HSV DNA 20 Classification of herpesviruses based on DNA...structure 28 Strain variation in herpesvirus DNA 31 VZV DNA 33 Specific aims 36 II. MATERIALS AND METHODS 38 Cells and viruses 38 Isolation of virus...endonuclease fragments by colony hybridization 106 21. Selected methods of restriction endonuclease mapping .... 109 22. Identification of
A quantitative evaluation of two methods for preserving hair samples
Roon, David A.; Waits, L.P.; Kendall, K.C.
2003-01-01
Hair samples are an increasingly important DNA source for wildlife studies, yet optimal storage methods and DNA degradation rates have not been rigorously evaluated. We tested amplification success rates over a one-year storage period for DNA extracted from brown bear (Ursus arctos) hair samples preserved using silica desiccation and -20C freezing. For three nuclear DNA microsatellites, success rates decreased significantly after a six-month time point, regardless of storage method. For a 1000 bp mitochondrial fragment, a similar decrease occurred after a two-week time point. Minimizing delays between collection and DNA extraction will maximize success rates for hair-based noninvasive genetic sampling projects.
NMR-based investigations into target DNA search processes of proteins.
Iwahara, Junji; Zandarashvili, Levani; Kemme, Catherine A; Esadze, Alexandre
2018-05-10
To perform their function, transcription factors and DNA-repair/modifying enzymes must first locate their targets in the vast presence of nonspecific, but structurally similar sites on genomic DNA. Before reaching their targets, these proteins stochastically scan DNA and dynamically move from one site to another on DNA. Solution NMR spectroscopy provides unique atomic-level insights into the dynamic DNA-scanning processes, which are difficult to gain by any other experimental means. In this review, we provide an introductory overview on the NMR methods for the structural, dynamic, and kinetic investigations of target DNA search by proteins. We also discuss advantages and disadvantages of these NMR methods over other methods such as single-molecule techniques and biochemical approaches. Copyright © 2018 Elsevier Inc. All rights reserved.
DNA recovery from soils of diverse composition.
Zhou, J; Bruns, M A; Tiedje, J M
1996-02-01
A simple, rapid method for bacterial lysis and direct extraction of DNA from soils with minimal shearing was developed to address the risk of chimera formation from small template DNA during subsequent PCR. The method was based on lysis with a high-salt extraction buffer (1.5 M NaCl) and extended heating (2 to 3 h) of the soil suspension in the presence of sodium dodecyl sulfate (SDS), hexadecyltrimethylammonium bromide, and proteinase K. The extraction method required 6 h and was tested on eight soils differing in organic carbon, clay content, and pH, including ones from which DNA extraction is difficult. The DNA fragment size in crude extracts from all soils was > 23 kb. Preliminary trials indicated that DNA recovery from two soils seeded with gram-negative bacteria was 92 to 99%. When the method was tested on all eight unseeded soils, microscopic examination of indigenous bacteria in soil pellets before and after extraction showed variable cell lysis efficiency (26 to 92%). Crude DNA yields from the eight soils ranged from 2.5 to 26.9 micrograms of DNA g-1, and these were positively correlated with the organic carbon content in the soil (r = 0.73). DNA yields from gram-positive bacteria from pure cultures were two to six times higher when the high-salt-SDS-heat method was combined with mortar-and-pestle grinding and freeze-thawing, and most DNA recovered was of high molecular weight. Four methods for purifying crude DNA were also evaluated for percent recovery, fragment size, speed, enzyme restriction, PCR amplification, and DNA-DNA hybridization. In general, all methods produced DNA pure enough for PCR amplification. Since soil type and microbial community characteristics will influence DNA recovery, this study provides guidance for choosing appropriate extraction and purification methods on the basis of experimental goals.
Real-time Tracking of DNA Fragment Separation by Smartphone.
Tao, Chunxian; Yang, Bo; Li, Zhenqing; Zhang, Dawei; Yamaguchi, Yoshinori
2017-06-01
Slab gel electrophoresis (SGE) is the most common method for the separation of DNA fragments; thus, it is broadly applied to the field of biology and others. However, the traditional SGE protocol is quite tedious, and the experiment takes a long time. Moreover, the chemical consumption in SGE experiments is very high. This work proposes a simple method for the separation of DNA fragments based on an SGE chip. The chip is made by an engraving machine. Two plastic sheets are used for the excitation and emission wavelengths of the optical signal. The fluorescence signal of the DNA bands is collected by smartphone. To validate this method, 50, 100, and 1,000 bp DNA ladders were separated. The results demonstrate that a DNA ladder smaller than 5,000 bp can be resolved within 12 min and with high resolution when using this method, indicating that it is an ideal substitute for the traditional SGE method.
A novel image encryption algorithm based on the chaotic system and DNA computing
NASA Astrophysics Data System (ADS)
Chai, Xiuli; Gan, Zhihua; Lu, Yang; Chen, Yiran; Han, Daojun
A novel image encryption algorithm using the chaotic system and deoxyribonucleic acid (DNA) computing is presented. Different from the traditional encryption methods, the permutation and diffusion of our method are manipulated on the 3D DNA matrix. Firstly, a 3D DNA matrix is obtained through bit plane splitting, bit plane recombination, DNA encoding of the plain image. Secondly, 3D DNA level permutation based on position sequence group (3DDNALPBPSG) is introduced, and chaotic sequences generated from the chaotic system are employed to permutate the positions of the elements of the 3D DNA matrix. Thirdly, 3D DNA level diffusion (3DDNALD) is given, the confused 3D DNA matrix is split into sub-blocks, and XOR operation by block is manipulated to the sub-DNA matrix and the key DNA matrix from the chaotic system. At last, by decoding the diffused DNA matrix, we get the cipher image. SHA 256 hash of the plain image is employed to calculate the initial values of the chaotic system to avoid chosen plaintext attack. Experimental results and security analyses show that our scheme is secure against several known attacks, and it can effectively protect the security of the images.
Melendez, Johan H; Santaus, Tonya M; Brinsley, Gregory; Kiang, Daniel; Mali, Buddha; Hardick, Justin; Gaydos, Charlotte A; Geddes, Chris D
2016-10-01
Nucleic acid-based detection of gonorrhea infections typically require a two-step process involving isolation of the nucleic acid, followed by detection of the genomic target often involving polymerase chain reaction (PCR)-based approaches. In an effort to improve on current detection approaches, we have developed a unique two-step microwave-accelerated approach for rapid extraction and detection of Neisseria gonorrhoeae (gonorrhea, GC) DNA. Our approach is based on the use of highly focused microwave radiation to rapidly lyse bacterial cells, release, and subsequently fragment microbial DNA. The DNA target is then detected by a process known as microwave-accelerated metal-enhanced fluorescence (MAMEF), an ultra-sensitive direct DNA detection analytical technique. In the current study, we show that highly focused microwaves at 2.45 GHz, using 12.3-mm gold film equilateral triangles, are able to rapidly lyse both bacteria cells and fragment DNA in a time- and microwave power-dependent manner. Detection of the extracted DNA can be performed by MAMEF, without the need for DNA amplification, in less than 10 min total time or by other PCR-based approaches. Collectively, the use of a microwave-accelerated method for the release and detection of DNA represents a significant step forward toward the development of a point-of-care (POC) platform for detection of gonorrhea infections. Copyright © 2016 Elsevier Inc. All rights reserved.
Structure solution of DNA-binding proteins and complexes with ARCIMBOLDO libraries
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pröpper, Kevin; Instituto de Biologia Molecular de Barcelona; Meindl, Kathrin
2014-06-01
The structure solution of DNA-binding protein structures and complexes based on the combination of location of DNA-binding protein motif fragments with density modification in a multi-solution frame is described. Protein–DNA interactions play a major role in all aspects of genetic activity within an organism, such as transcription, packaging, rearrangement, replication and repair. The molecular detail of protein–DNA interactions can be best visualized through crystallography, and structures emphasizing insight into the principles of binding and base-sequence recognition are essential to understanding the subtleties of the underlying mechanisms. An increasing number of high-quality DNA-binding protein structure determinations have been witnessed despite themore » fact that the crystallographic particularities of nucleic acids tend to pose specific challenges to methods primarily developed for proteins. Crystallographic structure solution of protein–DNA complexes therefore remains a challenging area that is in need of optimized experimental and computational methods. The potential of the structure-solution program ARCIMBOLDO for the solution of protein–DNA complexes has therefore been assessed. The method is based on the combination of locating small, very accurate fragments using the program Phaser and density modification with the program SHELXE. Whereas for typical proteins main-chain α-helices provide the ideal, almost ubiquitous, small fragments to start searches, in the case of DNA complexes the binding motifs and DNA double helix constitute suitable search fragments. The aim of this work is to provide an effective library of search fragments as well as to determine the optimal ARCIMBOLDO strategy for the solution of this class of structures.« less
Exact method for numerically analyzing a model of local denaturation in superhelically stressed DNA
NASA Astrophysics Data System (ADS)
Fye, Richard M.; Benham, Craig J.
1999-03-01
Local denaturation, the separation at specific sites of the two strands comprising the DNA double helix, is one of the most fundamental processes in biology, required to allow the base sequence to be read both in DNA transcription and in replication. In living organisms this process can be mediated by enzymes which regulate the amount of superhelical stress imposed on the DNA. We present a numerically exact technique for analyzing a model of denaturation in superhelically stressed DNA. This approach is capable of predicting the locations and extents of transition in circular superhelical DNA molecules of kilobase lengths and specified base pair sequences. It can also be used for closed loops of DNA which are typically found in vivo to be kilobases long. The analytic method consists of an integration over the DNA twist degrees of freedom followed by the introduction of auxiliary variables to decouple the remaining degrees of freedom, which allows the use of the transfer matrix method. The algorithm implementing our technique requires O(N2) operations and O(N) memory to analyze a DNA domain containing N base pairs. However, to analyze kilobase length DNA molecules it must be implemented in high precision floating point arithmetic. An accelerated algorithm is constructed by imposing an upper bound M on the number of base pairs that can simultaneously denature in a state. This accelerated algorithm requires O(MN) operations, and has an analytically bounded error. Sample calculations show that it achieves high accuracy (greater than 15 decimal digits) with relatively small values of M (M<0.05N) for kilobase length molecules under physiologically relevant conditions. Calculations are performed on the superhelical pBR322 DNA sequence to test the accuracy of the method. With no free parameters in the model, the locations and extents of local denaturation predicted by this analysis are in quantitatively precise agreement with in vitro experimental measurements. Calculations performed on the fructose-1,6-bisphosphatase gene sequence from yeast show that this approach can also accurately treat in vivo denaturation.
Guard, Jean; Sanchez-Ingunza, Roxana; Morales, Cesar; Stewart, Tod; Liljebjelke, Karen; Kessel, JoAnn; Ingram, Kim; Jones, Deana; Jackson, Charlene; Fedorka-Cray, Paula; Frye, Jonathan; Gast, Richard; Hinton, Arthur
2012-01-01
Two DNA-based methods were compared for the ability to assign serotype to 139 isolates of Salmonella enterica ssp. I. Intergenic sequence ribotyping (ISR) evaluated single nucleotide polymorphisms occurring in a 5S ribosomal gene region and flanking sequences bordering the gene dkgB. A DNA microarray hybridization method that assessed the presence and the absence of sets of genes was the second method. Serotype was assigned for 128 (92.1%) of submissions by the two DNA methods. ISR detected mixtures of serotypes within single colonies and it cost substantially less than Kauffmann–White serotyping and DNA microarray hybridization. Decreasing the cost of serotyping S. enterica while maintaining reliability may encourage routine testing and research. PMID:22998607
Preliminary assessment for DNA extraction on microfluidic channel
NASA Astrophysics Data System (ADS)
Gopinath, Subash C. B.; Hashim, Uda; Uda, M. N. A.
2017-03-01
The aim of this research is to extract, purify and yield DNA in mushroom from solid state mushroom sample by using fabricated continuous high-capacity sample delivery microfluidic through integrated solid state extraction based amino-coated silica bead. This device is made to specifically extract DNA in mushroom sample in continuous inflow process with energy and cost consumption. In this project, we present two methods of DNA extraction and purification which are by using centrifuge (complex and conventional method) and by using microfluidic biosensor (new and fast method). DNA extracted can be determined by using ultraviolet-visible spectroscopy (UV-VIS). The peak obtained at wavelength 260nm after measuring the absorbance of sample proves that DNA is successfully extracted from the mushroom.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Benasutti, M.; Ejadi, S.; Whitlow, M.D.
The mutagenic and carcinogenic chemical aflatoxin B/sub 1/ (AFB/sub 1/) reacts almost exclusively at the N(7)-position of guanine following activation to its reactive form, the 8,9-epoxide (AFB/sub 1/ oxide). In general N(7)-guanine adducts yield DNA strand breaks when heated in base, a property that serves as the basis for the Maxam-Gilbert DNA sequencing reaction specific for guanine. Using DNA sequencing methods, other workers have shown that AFB/sub 1/ oxide gives strand breaks at positions of guanines; however, the guanine bands varied in intensity. This phenomenon has been used to infer that AFB/sub 1/ oxide prefers to react with guanines inmore » some sequence contexts more than in others and has been referred to as sequence specificity of binding. Herein, data on the reaction of AFB/sub 1/ oxide with several synthetic DNA polymers with different sequences are presented, and (following hydrolysis) adduct levels are determine by high-pressure liquid chromatography. These results reveal that for AFB/sub 1/ oxide (1) the N(7)-guanine adduct is the major adduct found in all of the DNA polymers, (2) adduct levels vary in different sequences, and, thus, sequence specificity is also observed by this more direct method, and (3) the intensity of bands in DNA sequencing gels is likely to reflect adduct levels formed at the N(7)-position of guanine. Knowing this, a reinvestigation of the reactivity of guanines in different DNA sequences using DNA sequencing methods was undertaken. Methods are developed to determine the X (5'-side) base and the Y (3'-side) base are most influential in determining guanine reactivity. These rules in conjunction with molecular modeling studies were used to assess the binding sites that might be utilized by AFB/sub 1/ oxide in its reaction with DNA.« less
Chen, Xiang
2013-09-01
A benzamide molecule is used as a "reader" molecule to form hydrogen bonds with five single DNA bases, i.e., four normal single DNA bases A,T,C,G and one for 5methylC. The whole molecule is then attached to the gold surface so that a meta-molecule junction is formed. We calculate the transmission function and conductance for the five metal-molecule systems, with the implementation of density functional theory-based non-equilibrium Green function method. Our results show that each DNA base exhibits a unique conductance and most of them are on the pS level. The distinguishable conductance of each DNA base provides a way for the fast sequencing of DNA. We also investigate the dependence of conductivity of such a metal-molecule system on the hydrogen bond length between the "reader" molecule and DNA base, which shows that conductance follows an exponential decay as the hydrogen bond length increases, i.e., the conductivity is highly sensitive to the change in hydrogen bond length.
Ávila-Arcos, María C.; Cappellini, Enrico; Romero-Navarro, J. Alberto; Wales, Nathan; Moreno-Mayar, J. Víctor; Rasmussen, Morten; Fordyce, Sarah L.; Montiel, Rafael; Vielle-Calzada, Jean-Philippe; Willerslev, Eske; Gilbert, M. Thomas P.
2011-01-01
The development of second-generation sequencing technologies has greatly benefitted the field of ancient DNA (aDNA). Its application can be further exploited by the use of targeted capture-enrichment methods to overcome restrictions posed by low endogenous and contaminating DNA in ancient samples. We tested the performance of Agilent's SureSelect and Mycroarray's MySelect in-solution capture systems on Illumina sequencing libraries built from ancient maize to identify key factors influencing aDNA capture experiments. High levels of clonality as well as the presence of multiple-copy sequences in the capture targets led to biases in the data regardless of the capture method. Neither method consistently outperformed the other in terms of average target enrichment, and no obvious difference was observed either when two tiling designs were compared. In addition to demonstrating the plausibility of capturing aDNA from ancient plant material, our results also enable us to provide useful recommendations for those planning targeted-sequencing on aDNA. PMID:22355593
An analytical framework for estimating aquatic species density from environmental DNA
Chambert, Thierry; Pilliod, David S.; Goldberg, Caren S.; Doi, Hideyuki; Takahara, Teruhiko
2018-01-01
Environmental DNA (eDNA) analysis of water samples is on the brink of becoming a standard monitoring method for aquatic species. This method has improved detection rates over conventional survey methods and thus has demonstrated effectiveness for estimation of site occupancy and species distribution. The frontier of eDNA applications, however, is to infer species density. Building upon previous studies, we present and assess a modeling approach that aims at inferring animal density from eDNA. The modeling combines eDNA and animal count data from a subset of sites to estimate species density (and associated uncertainties) at other sites where only eDNA data are available. As a proof of concept, we first perform a cross-validation study using experimental data on carp in mesocosms. In these data, fish densities are known without error, which allows us to test the performance of the method with known data. We then evaluate the model using field data from a study on a stream salamander species to assess the potential of this method to work in natural settings, where density can never be known with absolute certainty. Two alternative distributions (Normal and Negative Binomial) to model variability in eDNA concentration data are assessed. Assessment based on the proof of concept data (carp) revealed that the Negative Binomial model provided much more accurate estimates than the model based on a Normal distribution, likely because eDNA data tend to be overdispersed. Greater imprecision was found when we applied the method to the field data, but the Negative Binomial model still provided useful density estimates. We call for further model development in this direction, as well as further research targeted at sampling design optimization. It will be important to assess these approaches on a broad range of study systems.
Mohamad, Nurhidayatul Asma; Mustafa, Shuhaimi; Khairil Mokhtar, Nur Fadhilah; El Sheikha, Aly Farag
2018-03-05
The pharmaceutical industry has boosted gelatin consumption worldwide. This is supported by the availability of cost-effective gelatin production from porcine by-products. However, cross-contamination of gelatin materials, where porcine gelatin was unintentionally included in the other animal sources of gelatin, has caused significant concerns about halal authenticity. The real-time polymerase chain reaction (PCR) has enabled a highly specific and sensitive animal species detection method in various food products. Hence, such a technique was employed in the present study to detect and quantify porcine DNA in gelatin using a molecular beacon probe, with differences in performance between mitochondrial (cytochrome b gene) and chromosomal DNA-(MPRE42 repetitive element) based porcine-specific PCR assays being compared. A higher sensitivity was observed in chromosomal DNA (MPRE-PCR assay), where this assay allows the detection of gelatin DNA at amounts as as low as 1 pg, whereas mitochondrial DNA (CBH-PCR assay) can only detect at levels down to 10 pg of gelatin DNA. When an analysis with commercial gelatin and gelatin capsule samples was conducted, the same result was observed, with a significantly more sensitive detection being provided by the repetitive element of chromosomal DNA. The present study has established highly sensitive DNA-based porcine detection systems derived from chromosomal DNA that are feasible for highly processed products such as gelatin and gelatin capsules containing a minute amount of DNA. This sensitive detection method can also be implemented to assist the halal authentication process of various food products available on the market. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.
A novel method for sex determination by detecting the number of X chromosomes.
Nakanishi, Hiroaki; Shojo, Hideki; Ohmori, Takeshi; Hara, Masaaki; Takada, Aya; Adachi, Noboru; Saito, Kazuyuki
2015-01-01
A novel method for sex determination, based on the detection of the number of X chromosomes, was established. Current methods, based on the detection of the Y chromosome, can directly identify an unknown sample as male, but female gender is determined indirectly, by not detecting the Y chromosome. Thus, a direct determination of female gender is important because the quality (e.g., fragmentation and amelogenin-Y null allele) of the Y chromosome DNA may lead to a false result. Thus, we developed a novel sex determination method by analyzing the number of X chromosomes using a copy number variation (CNV) detection technique (the comparative Ct method). In this study, we designed a primer set using the amelogenin-X gene without the CNV region as the target to determine the X chromosome copy number, to exclude the influence of the CNV region from the comparative Ct value. The number of X chromosomes was determined statistically using the CopyCaller software with real-time PCR. All DNA samples from participants (20 males, 20 females) were evaluated correctly using this method with 1-ng template DNA. A minimum of 0.2-ng template DNA was found to be necessary for accurate sex determination with this method. When using ultraviolet-irradiated template DNA, as mock forensic samples, the sex of the samples could not be determined by short tandem repeat (STR) analysis but was correctly determined using our method. Thus, we successfully developed a method of sex determination based on the number of X chromosomes. Our novel method will be useful in forensic practice for sex determination.
Jagielski, Tomasz; Gawor, Jan; Bakuła, Zofia; Zuchniewicz, Karolina; Żak, Iwona; Gromadka, Robert
2017-01-01
The complex cell wall structure of algae often precludes efficient extraction of their genetic material. The purpose of this study was to design a next-generation sequencing-suitable DNA isolation method for unicellular, achlorophyllous, yeast-like microalgae of the genus Prototheca , the only known plant pathogens of both humans and animals. The effectiveness of the newly proposed scheme was compared with five other, previously described methods, commonly used for DNA isolation from plants and/or yeasts, available either as laboratory-developed, in-house assays, based on liquid nitrogen grinding or different enzymatic digestion, or as commercially manufactured kits. All five, previously described, isolation assays yielded DNA concentrations lower than those obtained with the new method, averaging 16.15 ± 25.39 vs 74.2 ± 0.56 ng/µL, respectively. The new method was also superior in terms of DNA purity, as measured by A260/A280 (-0.41 ± 4.26 vs 2.02 ± 0.03), and A260/A230 (1.20 ± 1.12 vs 1.97 ± 0.07) ratios. Only the liquid nitrogen-based method yielded DNA of comparable quantity (60.96 ± 0.16 ng/µL) and quality (A260/A280 = 2.08 ± 0.02; A260/A230 = 2.23 ± 0.26). Still, the new method showed higher integrity, which was best illustrated upon electrophoretic analysis. Genomic DNA of Prototheca wickerhamii POL-1 strain isolated with the protocol herein proposed was successfully sequenced on the Illumina MiSeq platform. A new method for DNA isolation from Prototheca algae is described. The method, whose protocol involves glass beads pulverization and cesium chloride (CsCl) density gradient centrifugation, was demonstrated superior over the other common assays in terms of DNA quantity and quality. The method is also the first to offer the possibility of preparation of DNA template suitable for whole genome sequencing of Prototheca spp.
Silicon Dioxide Thin Film Mediated Single Cell Nucleic Acid Isolation
Bogdanov, Evgeny; Dominova, Irina; Shusharina, Natalia; Botman, Stepan; Kasymov, Vitaliy; Patrushev, Maksim
2013-01-01
A limited amount of DNA extracted from single cells, and the development of single cell diagnostics make it necessary to create a new highly effective method for the single cells nucleic acids isolation. In this paper, we propose the DNA isolation method from biomaterials with limited DNA quantity in sample, and from samples with degradable DNA based on the use of solid-phase adsorbent silicon dioxide nanofilm deposited on the inner surface of PCR tube. PMID:23874571
The deoxyribonucleic acid of Micrococcus radiodurans
Schein, Arnold H.
1966-01-01
The DNA of Micrococcus radiodurans was prepared by three methods. Although the recovery of DNA varied considerably, the percentage molar base ratios of the DNA from the three preparations were essentially the same: guanine, 33±2; adenine, 18±1; cytosine, 33±2; thymine, 17±1. Base compositions calculated from Tm values and from density in caesium chloride gradients also yielded guanine+cytosine contents of 66 and 68% of total bases respectively. No unusual bases were observed. The S20,w values were characteristic of high-molecular-weight DNA. Electron microscopy showed the purified DNA in long strands; occasionally these were coiled. Images(a)(b)(c)(d)(e)Fig. 1. PMID:16742439
Witt, Sebastian; Neumann, Jan; Zierdt, Holger; Gébel, Gabriella; Röscheisen, Christiane
2012-09-01
Automated systems have been increasingly utilized for DNA extraction by many forensic laboratories to handle growing numbers of forensic casework samples while minimizing the risk of human errors and assuring high reproducibility. The step towards automation however is not easy: The automated extraction method has to be very versatile to reliably prepare high yields of pure genomic DNA from a broad variety of sample types on different carrier materials. To prevent possible cross-contamination of samples or the loss of DNA, the components of the kit have to be designed in a way that allows for the automated handling of the samples with no manual intervention necessary. DNA extraction using paramagnetic particles coated with a DNA-binding surface is predestined for an automated approach. For this study, we tested different DNA extraction kits using DNA-binding paramagnetic particles with regard to DNA yield and handling by a Freedom EVO(®)150 extraction robot (Tecan) equipped with a Te-MagS magnetic separator. Among others, the extraction kits tested were the ChargeSwitch(®)Forensic DNA Purification Kit (Invitrogen), the PrepFiler™Automated Forensic DNA Extraction Kit (Applied Biosystems) and NucleoMag™96 Trace (Macherey-Nagel). After an extensive test phase, we established a novel magnetic bead extraction method based upon the NucleoMag™ extraction kit (Macherey-Nagel). The new method is readily automatable and produces high yields of DNA from different sample types (blood, saliva, sperm, contact stains) on various substrates (filter paper, swabs, cigarette butts) with no evidence of a loss of magnetic beads or sample cross-contamination. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Improved DNA hybridization parameters by Twisted Intercalating Nucleic Acid (TINA).
Schneider, Uffe Vest
2012-01-01
This thesis establishes oligonucleotide design rules and applications of a novel group of DNA stabilizing molecules collectively called Twisted Intercalating Nucleic Acid - TINA. Three peer-reviewed publications form the basis for the thesis. One publication describes an improved and rapid method for determination of DNA melting points and two publications describe the effects of positioning TINA molecules in parallel triplex helix and antiparallel duplex helix forming DNA structures. The third publication establishes that TINA molecules containing oligonucleotides improve an antiparallel duplex hybridization based capture assay's analytical sensitivity compared to conventionel DNA oligonucleotides. Clinical microbiology is traditionally based on pathogenic microorganisms' culture and serological tests. The introduction of DNA target amplification methods like PCR has improved the analytical sensitivity and total turn around time involved in clinical diagnostics of infections. Due to the relatively weak hybridization between the two strands of double stranded DNA, a number of nucleic acid stabilizing molecules have been developed to improve the sensitivity of DNA based diagnostics through superior binding properties. A short introduction is given to Watson-Crick and Hoogsteen based DNA binding and the derived DNA structures. A number of other nucleic acid stabilizing molecules are described. The stabilizing effect of TINA molecules on different DNA structures is discussed and considered in relation to other nucleic acid stabilizing molecules and in relation to future use of TINA containing oligonucleotides in clinical diagnostics and therapy. In conclusion, design of TINA modified oligonucleotides for antiparallel duplex helixes and parallel triplex helixes follows simple purpose dependent rules. TINA molecules are well suited for improving multiplex PCR assays and can be used as part of novel technologies. Future research should test whether combinations of TINA molecules and other nucleic acid stabilizing molecules can increase analytical sensitivity whilst maintaining nucleobase mismatch discrimination in triplex helix based diagnostic assays.
Schiffels, Daniel; Szalai, Veronika A; Liddle, J Alexander
2017-07-25
Robust self-assembly across length scales is a ubiquitous feature of biological systems but remains challenging for synthetic structures. Taking a cue from biology-where disparate molecules work together to produce large, functional assemblies-we demonstrate how to engineer microscale structures with nanoscale features: Our self-assembly approach begins by using DNA polymerase to controllably create double-stranded DNA (dsDNA) sections on a single-stranded template. The single-stranded DNA (ssDNA) sections are then folded into a mechanically flexible skeleton by the origami method. This process simultaneously shapes the structure at the nanoscale and directs the large-scale geometry. The DNA skeleton guides the assembly of RecA protein filaments, which provides rigidity at the micrometer scale. We use our modular design strategy to assemble tetrahedral, rectangular, and linear shapes of defined dimensions. This method enables the robust construction of complex assemblies, greatly extending the range of DNA-based self-assembly methods.
Repair of DNA damage caused by cytosine deamination in mitochondrial DNA of forensic case samples.
Gorden, Erin M; Sturk-Andreaggi, Kimberly; Marshall, Charla
2018-05-01
DNA sequence damage from cytosine deamination is well documented in degraded samples, such as those from ancient and forensic contexts. This study examined the effect of a DNA repair treatment on mitochondrial DNA (mtDNA) from aged and degraded skeletal samples. DNA extracts from 21 non-probative, degraded skeletal samples (aged 50-70 years) were utilized for the analysis. A portion of each sample extract was subjected to DNA repair using a commercial repair kit, the New England BioLabs' NEBNext FFPE DNA Repair Kit (Ipswich, MA). MtDNA was enriched using PCR and targeted capture in a side-by-side experiment of untreated and repaired DNA. Sequencing was performed using both traditional (Sanger-type; STS) and next-generation sequencing (NGS) methods Although cytosine deamination was evident in the mtDNA sequence data, the observed level of damaged bases varied by sequencing method as well as by enrichment type. The STS PCR amplicon data did not show evidence of cytosine deamination that could be distinguished from background signal in either the untreated or repaired sample set. However, the same PCR amplicons showed 850 C → T/G → A substitutions consistent with cytosine deamination with variant frequencies (VFs) of up to 25% when sequenced using NGS methods The occurrence of base misincorporation due to cytosine deamination was reduced by 98% (to 10) in the NGS amplicon data after repair. The NGS capture data indicated low levels (1-2%) of cytosine deamination in mtDNA fragments that was effectively mitigated by DNA repair. The observed difference in the level of cytosine deamination between the PCR and capture enrichment methods can be attributed to the greater propensity for stochastic effects from the PCR enrichment technique employed (e.g., low template input, increased PCR cycles). Altogether these results indicate that DNA repair may be required when sequencing PCR-amplified DNA from degraded forensic case samples with NGS methods. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
Thibault, Thomas; Degrouard, Jeril; Baril, Patrick; Pichon, Chantal; Midoux, Patrick
2017-01-01
Abstract Double-stranded DNA minicircles of less than 1000 bp in length have great interest in both fundamental research and therapeutic applications. Although minicircles have shown promising activity in gene therapy thanks to their good biostability and better intracellular trafficking, minicircles down to 250 bp in size have not yet been investigated from the test tube to the cell for lack of an efficient production method. Herein, we report a novel versatile plasmid-free method for the production of DNA minicircles comprising fewer than 250 bp. We designed a linear nicked DNA double-stranded oligonucleotide blunt-ended substrate for efficient minicircle production in a ligase-mediated and bending protein-assisted circularization reaction at high DNA concentration of 2 μM. This one pot multi-step reaction based-method yields hundreds of micrograms of minicircle with sequences of any base composition and position and containing or not a variety of site-specifically chemical modifications or physiological supercoiling. Biochemical and cellular studies were then conducted to design a 95 bp minicircle capable of binding in vitro two NF-κB transcription factors per minicircle and to efficiently inhibiting NF-κB-dependent transcriptional activity in human cells. Therefore, our production method could pave the way for the design of minicircles as new decoy nucleic acids. PMID:27899652
Systematic evaluation of bias in microbial community profiles induced by whole genome amplification.
Direito, Susana O L; Zaura, Egija; Little, Miranda; Ehrenfreund, Pascale; Röling, Wilfred F M
2014-03-01
Whole genome amplification methods facilitate the detection and characterization of microbial communities in low biomass environments. We examined the extent to which the actual community structure is reliably revealed and factors contributing to bias. One widely used [multiple displacement amplification (MDA)] and one new primer-free method [primase-based whole genome amplification (pWGA)] were compared using a polymerase chain reaction (PCR)-based method as control. Pyrosequencing of an environmental sample and principal component analysis revealed that MDA impacted community profiles more strongly than pWGA and indicated that this related to species GC content, although an influence of DNA integrity could not be excluded. Subsequently, biases by species GC content, DNA integrity and fragment size were separately analysed using defined mixtures of DNA from various species. We found significantly less amplification of species with the highest GC content for MDA-based templates and, to a lesser extent, for pWGA. DNA fragmentation also interfered severely: species with more fragmented DNA were less amplified with MDA and pWGA. pWGA was unable to amplify low molecular weight DNA (< 1.5 kb), whereas MDA was inefficient. We conclude that pWGA is the most promising method for characterization of microbial communities in low-biomass environments and for currently planned astrobiological missions to Mars. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.
Optimized pH method for DNA elution from buccal cells collected in Whatman FTA cards.
Lema, Carolina; Kohl-White, Kendra; Lewis, Laurie R; Dao, Dat D
2006-01-01
DNA is the most accessible biologic material for obtaining information from the human genome because of its molecular stability and its presence in every nucleated cell. Currently, single nucleotide polymorphism genotyping and DNA methylation are the main DNA-based approaches to deriving genomic and epigenomic disease biomarkers. Upon the discontinuation of the Schleicher & Schuell IsoCode product (Dassel, Germany), which was a treated paper system to elute DNA from several biologic sources for polymerase chain reaction (PCR) analysis, a high-yielding DNA elution method was imperative. We describe here an improved procedure of the not fully validated Whatman pH-based elution protocol. Our DNA elution procedure from buccal cells collected in Whatman FTA cards (Whatman Inc., Florham Park, NJ) yielded approximately 4 microg of DNA from a 6-mm FTA card punch and was successfully applied for HLA-DQB1 genotyping. The genotypes showed complete concordance with data obtained from blood of the same subjects. The achieved high DNA yield from buccal cells suggests a potential cost-effective tool for genomic and epigenomic disease biomarkers development.
NASA Astrophysics Data System (ADS)
Zhang, Yepeng; Zhang, Guowen; Fu, Peng; Ma, Yadi; Zhou, Jia
2012-10-01
The binding mechanism of triadimenol (NOL) to calf thymus DNA (ctDNA) in physiological buffer (pH 7.4) was investigated by multispectroscopic methods including UV-vis absorption, fluorescence, circular dichroism (CD), Fourier transform infrared (FT-IR), and nuclear magnetic resonance (1H NMR) spectroscopy, coupled with viscosity measurements and atomic force microscopy (AFM) technique. The results suggested that NOL interacted with ctDNA by intercalation mode. CD and AFM assays showed that NOL can damage the base stacking of ctDNA and result in regional cleavage of the two DNA strands. FT-IR and 1H NMR spectra coupled with molecular docking revealed that a specific binding mainly exists between NOL and G-C base pairs of the ctDNA where two hydrogen bonds form. Moreover, the association constants of NOL with DNA at three different temperatures were determined to be in the 103 L mol-1 range. The calculated thermodynamic parameters suggested that the binding of NOL to ctDNA was driven mainly by hydrogen bond and van der Waals.
Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.
Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant
2017-11-28
Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.
Highly Conductive Thin Uniform Gold-Coated DNA Nanowires.
Stern, Avigail; Eidelshtein, Gennady; Zhuravel, Roman; Livshits, Gideon I; Rotem, Dvir; Kotlyar, Alexander; Porath, Danny
2018-06-01
Over the past decades, DNA, the carrier of genetic information, has been used by researchers as a structural template material. Watson-Crick base pairing enables the formation of complex 2D and 3D structures from DNA through self-assembly. Various methods have been developed to functionalize these structures for numerous utilities. Metallization of DNA has attracted much attention as a means of forming conductive nanostructures. Nevertheless, most of the metallized DNA wires reported so far suffer from irregularity and lack of end-to-end electrical connectivity. An effective technique for formation of thin gold-coated DNA wires that overcomes these drawbacks is developed and presented here. A conductive atomic force microscopy setup, which is suitable for measuring tens to thousands of nanometer long molecules and wires, is used to characterize these DNA-based nanowires. The wires reported here are the narrowest gold-coated DNA wires that display long-range conductivity. The measurements presented show that the conductivity is limited by defects, and that thicker gold coating reduces the number of defects and increases the conductive length. This preparation method enables the formation of molecular wires with dimensions and uniformity that are much more suitable for DNA-based molecular electronics. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Primer Extension Mutagenesis Powered by Selective Rolling Circle Amplification
Huovinen, Tuomas; Brockmann, Eeva-Christine; Akter, Sultana; Perez-Gamarra, Susan; Ylä-Pelto, Jani; Liu, Yuan; Lamminmäki, Urpo
2012-01-01
Primer extension mutagenesis is a popular tool to create libraries for in vitro evolution experiments. Here we describe a further improvement of the method described by T.A. Kunkel using uracil-containing single-stranded DNA as the template for the primer extension by additional uracil-DNA glycosylase treatment and rolling circle amplification (RCA) steps. It is shown that removal of uracil bases from the template leads to selective amplification of the nascently synthesized circular DNA strand carrying the desired mutations by phi29 DNA polymerase. Selective RCA (sRCA) of the DNA heteroduplex formed in Kunkel's mutagenesis increases the mutagenesis efficiency from 50% close to 100% and the number of transformants 300-fold without notable diversity bias. We also observed that both the mutated and the wild-type DNA were present in at least one third of the cells transformed directly with Kunkel's heteroduplex. In contrast, the cells transformed with sRCA product contained only mutated DNA. In sRCA, the complex cell-based selection for the mutant strand is replaced with the more controllable enzyme-based selection and less DNA is needed for library creation. Construction of a gene library of ten billion members is demonstrated with the described method with 240 nanograms of DNA as starting material. PMID:22355397
Protocol Improvements for Low Concentration DNA-Based Bioaerosol Sampling and Analysis
Ng, Chun Kiat; Miller, Dana; Cao, Bin
2015-01-01
Introduction As bioaerosol research attracts increasing attention, there is a need for additional efforts that focus on method development to deal with different environmental samples. Bioaerosol environmental samples typically have very low biomass concentrations in the air, which often leaves researchers with limited options in choosing the downstream analysis steps, especially when culture-independent methods are intended. Objectives This study investigates the impacts of three important factors that can influence the performance of culture-independent DNA-based analysis in dealing with bioaerosol environmental samples engaged in this study. The factors are: 1) enhanced high temperature sonication during DNA extraction; 2) effect of sampling duration on DNA recoverability; and 3) an alternative method for concentrating composite samples. In this study, DNA extracted from samples was analysed using the Qubit fluorometer (for direct total DNA measurement) and quantitative polymerase chain reaction (qPCR). Results and Findings The findings suggest that additional lysis from high temperature sonication is crucial: DNA yields from both high and low biomass samples increased up to 600% when the protocol included 30-min sonication at 65°C. Long air sampling duration on a filter media was shown to have a negative impact on DNA recoverability with up to 98% of DNA lost over a 20-h sampling period. Pooling DNA from separate samples during extraction was proven to be feasible with margins of error below 30%. PMID:26619279
Schwartz, Alanna; Baidjoe, Amrish; Rosenthal, Philip J; Dorsey, Grant; Bousema, Teun; Greenhouse, Bryan
2015-05-01
Extraction and amplification of DNA from dried blood spots (DBS) collected in field studies is commonly used for detection of Plasmodium falciparum. However, there have been few systematic efforts to determine the effects of storage and extraction methods on the sensitivity of DNA amplification. We investigated the effects of storage conditions, length of storage, and DNA extraction methods on amplification via three PCR-based assays using field samples and laboratory controls. Samples stored as DBS for 2 or more years at ambient temperature showed a significant loss of sensitivity that increased with time; after 10 years only 10% samples with parasite densities > 1,000 parasites/μL were detectable by nested polymerase chain reaction (PCR). Conversely, DBS and extracted DNA stored at -20°C showed no loss of sensitivity with time. Samples with low parasite densities amplified more successfully with saponin/Chelex compared with spin-column-based extraction, though the latter method performed better on samples with higher parasite densities stored for 2 years at ambient temperature. DNA extracted via both methods was stable after 20 freeze-thaw cycles. Our results suggest that DBS should be stored at -20°C or extracted immediately, especially if anticipating 2 or more years of storage. © The American Society of Tropical Medicine and Hygiene.
Schwartz, Alanna; Baidjoe, Amrish; Rosenthal, Philip J.; Dorsey, Grant; Bousema, Teun; Greenhouse, Bryan
2015-01-01
Extraction and amplification of DNA from dried blood spots (DBS) collected in field studies is commonly used for detection of Plasmodium falciparum. However, there have been few systematic efforts to determine the effects of storage and extraction methods on the sensitivity of DNA amplification. We investigated the effects of storage conditions, length of storage, and DNA extraction methods on amplification via three PCR-based assays using field samples and laboratory controls. Samples stored as DBS for 2 or more years at ambient temperature showed a significant loss of sensitivity that increased with time; after 10 years only 10% samples with parasite densities > 1,000 parasites/μL were detectable by nested polymerase chain reaction (PCR). Conversely, DBS and extracted DNA stored at −20°C showed no loss of sensitivity with time. Samples with low parasite densities amplified more successfully with saponin/Chelex compared with spin-column-based extraction, though the latter method performed better on samples with higher parasite densities stored for 2 years at ambient temperature. DNA extracted via both methods was stable after 20 freeze-thaw cycles. Our results suggest that DBS should be stored at −20°C or extracted immediately, especially if anticipating 2 or more years of storage. PMID:25758652
Immunofluorescence-based methods to monitor DNA end resection
Mukherjee, Bipasha; Tomimatsu, Nozomi; Burma, Sandeep
2017-01-01
Summary Double-strand breaks (DSBs) are the most deleterious amongst all types of DNA damage that can occur in the cell. These breaks arise from both endogenous (for example, DNA replication stress) as well as exogenous insults (for example, ionizing radiation). DSBs are principally repaired by one of two major pathways: non-homologous end joining (NHEJ) or homologous recombination (HR). NHEJ is an error-prone process that can occur in all phases of the cell cycle, while HR is limited to the S and G2 phases of the cell cycle when a sister chromatid is available as a template for error-free repair. The first step in HR is “DNA end resection”, a process during which the broken DNA end is converted into a long stretch of 3′-ended single-stranded DNA (ssDNA). In recent years, DNA end resection has been identified as a pivotal step that controls “repair pathway choice” i.e., the appropriate choice between NHEJ and HR for DSB repair. Therefore, methods to quantitatively or semi-quantitatively assess DNA end resection have gained importance in laboratories working on DNA repair. In this chapter, we describe two simple immunofluorescence-based techniques to monitor DNA end resection in mammalian cells. The first technique involves immuno-detection of Replication Protein A (RPA), a ssDNA-binding protein that binds to resected DNA. The second technique involves labeling of genomic DNA with 5-bromo-2′-deoxyuridine (BrdU) that can be detected by anti-BrdU antibody only after the DNA becomes single stranded due to resection. These methods are not complicated, do not involve sophisticated instrumentation or reporter constructs, and can be applied to most mammalian cell lines, and therefore, should be of broad utility as simple ways of monitoring DNA end resection in vivo. PMID:25804748
Implementation of digital image encryption algorithm using logistic function and DNA encoding
NASA Astrophysics Data System (ADS)
Suryadi, MT; Satria, Yudi; Fauzi, Muhammad
2018-03-01
Cryptography is a method to secure information that might be in form of digital image. Based on past research, in order to increase security level of chaos based encryption algorithm and DNA based encryption algorithm, encryption algorithm using logistic function and DNA encoding was proposed. Digital image encryption algorithm using logistic function and DNA encoding use DNA encoding to scramble the pixel values into DNA base and scramble it in DNA addition, DNA complement, and XOR operation. The logistic function in this algorithm used as random number generator needed in DNA complement and XOR operation. The result of the test show that the PSNR values of cipher images are 7.98-7.99 bits, the entropy values are close to 8, the histogram of cipher images are uniformly distributed and the correlation coefficient of cipher images are near 0. Thus, the cipher image can be decrypted perfectly and the encryption algorithm has good resistance to entropy attack and statistical attack.
DNA purification by triplex-affinity capture and affinity capture electrophoresis
Cantor, Charles R.; Ito, Takashi; Smith, Cassandra L.
1996-01-01
The invention provides a method for purifying or isolating double stranded DNA intact using triple helix formation. The method includes the steps of complexing an oligonucleotide and double stranded DNA to generate a triple helix and immobilization of the triple helix on a solid phase by means of a molecular recognition system such as avidin/biotin. The purified DNA is then recovered intact by treating the solid phase with a reagent that breaks the bonds between the oligonucleotide and the intact double stranded DNA while not affecting the Watson-Crick base pairs of the double helix. The present invention also provides a method for purifying or isolating double stranded DNA intact by complexing the double stranded DNA with a specific binding partner and recovering the complex during electrophoresis by immobilizing it on a solid phase trap imbedded in an electrophoretic gel.
Mu, Di; Yan, Liang; Tang, Hui; Liao, Yong
2015-10-01
To develop a sensitive and accurate assay system for the quantification of covalently closed circular HBV DNA (cccDNA) for future clinical monitoring of cccDNA fluctuation during antiviral therapy in the liver of infected patients. A droplet digital PCR (ddPCR)-based assay system detected template DNA input at the single copy level (or ~10(-5) pg of plasmid HBV DNA) by using serially diluted plasmid HBV DNA samples. Compared with the conventional quantitative PCR assay in the detection of cccDNA, which required at least 50 ng of template DNA input, a parallel experiment applying a ddPCR system demonstrates that the lowest detection limit of cccDNA from HepG2.215 cellular DNA samples is around 1 ng, which is equivalent to 0.54 ± 0.94 copies of cccDNA. In addition, we demonstrated that the addition of cccDNA-safe exonuclease and utilization of cccDNA-specific primers in the ddPCR assay system significantly improved the detection accuracy of HBV cccDNA from HepG2.215 cellular DNA samples. The ddPCR-based cccDNA detection system is a sensitive and accurate assay for the quantification of cccDNA in HBV-transfected HepG2.215 cellular DNA samples and may represent an important method for future application in monitoring cccDNA fluctuation during antiviral therapy.
Size and Base Composition of RNA in Supercoiled Plasmid DNA
Williams, Peter H.; Boyer, Herbert W.; Helinski, Donald R.
1973-01-01
The average size and base composition of the covalently integrated RNA segment in supercoiled ColE1 DNA synthesized in Escherichia coli in the presence of chloramphenicol (CM-ColE1 DNA) have been determined by two independent methods. The two approaches yielded similar results, indicating that the RNA segment in CM-ColE1 DNA contains GMP at the 5′ end and comprises on the average 25 to 26 ribonucleotides with a base composition of 10-11 G, 3 A, 5-6 C, and 6-7 U. PMID:4359488
Zhao, Jing; Zhang, Ting; Liu, Yongfeng; Wang, Xingyu; Zhang, Lan; Ku, Ting; Quek, Siew Young
2018-09-15
Freezing is a practical method for meat preservation but the quality of frozen meat can deteriorate with storage time. This research investigated the effect of frozen storage time (up to 66 months) on changes in DNA yield, purity and integrity in beef, and further analyzed the correlation between beef quality (moisture content, protein content, TVB-N value and pH value) and DNA quality in an attempt to establish a reliable, high-throughput method for meat quality control. Results showed that frozen storage time influenced the yield and integrity of DNA significantly (p < 0.05). The DNA yield decreased as frozen storage time increased due to DNA degradation. The half-life (t 1/2 = ln2/0.015) was calculated as 46 months. The DNA quality degraded dramatically with the increased storage time based on gel electrophoresis results. Polymerase chain reaction (PCR) products from both mitochondrial DNA (mtDNA) and nuclear DNA (nDNA) were observed in all frozen beef samples. Using real-time PCR for quantitative assessment of DNA and meat quality revealed that correlations could be established successfully with mathematical models to evaluate frozen beef quality. Copyright © 2018 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Yunfang, Jia; Cheng, Ju
2016-01-01
The graphene field effect transistor (GFET) has been widely studied and developed as sensors and functional devices. The first report about GFET sensing simulation on the device level is proposed. The GFET's characteristics, its responding for single strand DNA (ssDNA) and hybridization with the complimentary DNA (cDNA) are simulated based on Sentaurus, a popular CAD tool for electronic devices. The agreement between the simulated blank GFET feature and the reported experimental data suggests the feasibility of the presented simulation method. Then the simulations of ssDNA immobilization on GFET and hybridization with its cDNA are performed, the results are discussed based on the electron transfer (ET) mechanism between DNA and graphene. Project supported by the National Natural Science Foundation of China (No. 61371028) and the Tianjin Natural Science Foundation (No. 12JCZDJC22400).
Fluorescence turn-on detection of target sequence DNA based on silicon nanodot-mediated quenching.
Zhang, Yanan; Ning, Xinping; Mao, Guobin; Ji, Xinghu; He, Zhike
2018-05-01
We have developed a new enzyme-free method for target sequence DNA detection based on the dynamic quenching of fluorescent silicon nanodots (SiNDs) toward Cy5-tagged DNA probe. Fascinatingly, the water-soluble SiNDs can quench the fluorescence of cyanine (Cy5) in Cy5-tagged DNA probe in homogeneous solution, and the fluorescence of Cy5-tagged DNA probe can be restored in the presence of target sequence DNA (the synthetic target miRNA-27a). Based on this phenomenon, a SiND-featured fluorescent sensor has been constructed for "turn-on" detection of the synthetic target miRNA-27a for the first time. This newly developed approach possesses the merits of low cost, simple design, and convenient operation since no enzymatic reaction, toxic reagents, or separation procedures are involved. The established method achieves a detection limit of 0.16 nM, and the relative standard deviation of this method is 9% (1 nM, n = 5). The linear range is 0.5-20 nM, and the recoveries in spiked human fluids are in the range of 90-122%. This protocol provides a new tactic in the development of the nonenzymic miRNA biosensors and opens a promising avenue for early diagnosis of miRNA-associated disease. Graphical abstract The SiND-based fluorescent sensor for detection of S-miR-27a.
Development of an optical biosensor based on surface-enhanced Raman scattering for DNA analysis
NASA Astrophysics Data System (ADS)
Yigit, Tugce; Akdogan, Ebru; Karagoz, Isık. Didem; Kahraman, Mehmet
2016-03-01
Rapid, accurate and sensitive DNA analysis is critically important for the diagnostic of genetic diseases. The most common method preferred in practice is fluorescence based microarrays to analyze the DNA. However, there exist some disadvantages related to the above-mentioned method such as the overlapping of the fluorescence emission wavelengths that can diminish in the performance of multiplexing, needed to obtain fluorescence spectra from each dye and photo degradation. In this study, a novel SERS based DNA analysis approach, which is Raman active dye-free and independent of SERS substrate properties, is developed. First, the single strand DNA probe is attached to the SERS substrate and half of the complimentary DNA is attached to gold nanoparticles, as well. We hypothesize that in the presence of target DNA, the complimentary DNA coupled colloids will bind to the SERS substrate surface via hybridization of single strand target DNA. To test this hypothesis, we used UV/Vis spectroscopy, atomic for microscopy (AFM) and dynamic light scattering (DLS). DNA analysis is demonstrated by a peak shift of the certain peak of the small molecules attached to the SERS substrate surface instead of SERS spectrum obtained in the presence of target DNA from the Raman reporter molecules. The degree of peak shifting will be used for the quantification of the target DNA in the sample. Plasmonic properties of SERS substrates and reproducibility issues will not be considerable due to the use of peak shifting instead of peak intensity for the qualitative analysis.
End-to-end distance and contour length distribution functions of DNA helices
NASA Astrophysics Data System (ADS)
Zoli, Marco
2018-06-01
I present a computational method to evaluate the end-to-end and the contour length distribution functions of short DNA molecules described by a mesoscopic Hamiltonian. The method generates a large statistical ensemble of possible configurations for each dimer in the sequence, selects the global equilibrium twist conformation for the molecule, and determines the average base pair distances along the molecule backbone. Integrating over the base pair radial and angular fluctuations, I derive the room temperature distribution functions as a function of the sequence length. The obtained values for the most probable end-to-end distance and contour length distance, providing a measure of the global molecule size, are used to examine the DNA flexibility at short length scales. It is found that, also in molecules with less than ˜60 base pairs, coiled configurations maintain a large statistical weight and, consistently, the persistence lengths may be much smaller than in kilo-base DNA.
A universal DNA-based protein detection system.
Tran, Thua N N; Cui, Jinhui; Hartman, Mark R; Peng, Songming; Funabashi, Hisakage; Duan, Faping; Yang, Dayong; March, John C; Lis, John T; Cui, Haixin; Luo, Dan
2013-09-25
Protein immune detection requires secondary antibodies which must be carefully selected in order to avoid interspecies cross-reactivity, and is therefore restricted by the limited availability of primary/secondary antibody pairs. Here we present a versatile DNA-based protein detection system using a universal adapter to interface between IgG antibodies and DNA-modified reporter molecules. As a demonstration of this capability, we successfully used DNA nano-barcodes, quantum dots, and horseradish peroxidase enzyme to detect multiple proteins using our DNA-based labeling system. Our system not only eliminates secondary antibodies but also serves as a novel method platform for protein detection with modularity, high capacity, and multiplexed capability.
A Universal DNA-Based Protein Detection System
Tran, Thua N. N.; Cui, Jinhui; Hartman, Mark R.; Peng, Songming; Funabashi, Hisakage; Duan, Faping; Yang, Dayong; March, John C.; Lis, John T.; Cui, Haixin; Luo, Dan
2014-01-01
Protein immune detection requires secondary antibodies which must be carefully selected in order to avoid interspecies cross-reactivity, and is therefore restricted by the limited availability of primary/secondary antibody pairs. Here we present a versatile DNA-based protein detection system using a universal adapter to interface between IgG antibodies and DNA-modified reporter molecules. As a demonstration of this capability, we successfully used DNA nano-barcodes, quantum dots, and horseradish peroxidase enzyme to detect multiple proteins using our DNA-based labeling system. Our system not only eliminates secondary antibodies but also serves as a novel method platform for protein detection with modularity, high capacity, and multiplexed capability. PMID:23978265
Ivankin, A V; Kolesnikova, T D; Demakov, S A; Andreenkov, O V; Bil'danova, E R; Andreenkova, N G; Zhimulev, I F
2011-01-01
Methods of physical DNA mapping and direct visualization of replication and transcription in specific regions of genome play crucial role in the researches of structural and functional organization of eukaryotic genomes. Since DNA strands in the cells are organized into high-fold structure and present as highly compacted chromosomes, the majority of these methods have lower resolution at chromosomal level. One of the approaches to enhance the resolution and mapping accuracy is the method of molecular combing. The method is based on the process of stretching and alignment of DNA molecules that are covalently attached with one of the ends to the cover glass surface. In this article we describe the major methodological steps of molecular combing and their adaptation for researches of DNA replication parameters in polyploidy and diploid tissues of Drosophyla larvae.
Ultra-low background DNA cloning system.
Goto, Kenta; Nagano, Yukio
2013-01-01
Yeast-based in vivo cloning is useful for cloning DNA fragments into plasmid vectors and is based on the ability of yeast to recombine the DNA fragments by homologous recombination. Although this method is efficient, it produces some by-products. We have developed an "ultra-low background DNA cloning system" on the basis of yeast-based in vivo cloning, by almost completely eliminating the generation of by-products and applying the method to commonly used Escherichia coli vectors, particularly those lacking yeast replication origins and carrying an ampicillin resistance gene (Amp(r)). First, we constructed a conversion cassette containing the DNA sequences in the following order: an Amp(r) 5' UTR (untranslated region) and coding region, an autonomous replication sequence and a centromere sequence from yeast, a TRP1 yeast selectable marker, and an Amp(r) 3' UTR. This cassette allowed conversion of the Amp(r)-containing vector into the yeast/E. coli shuttle vector through use of the Amp(r) sequence by homologous recombination. Furthermore, simultaneous transformation of the desired DNA fragment into yeast allowed cloning of this DNA fragment into the same vector. We rescued the plasmid vectors from all yeast transformants, and by-products containing the E. coli replication origin disappeared. Next, the rescued vectors were transformed into E. coli and the by-products containing the yeast replication origin disappeared. Thus, our method used yeast- and E. coli-specific "origins of replication" to eliminate the generation of by-products. Finally, we successfully cloned the DNA fragment into the vector with almost 100% efficiency.
Using a bead-based method for multiplexed analysis of community DNA, the dynamics of aquatic microbial communities can be assessed. Capture probes, specific for a genus or species of bacteria, are attached to the surface of uniquely labeled, microscopic polystyrene beads. Primers...
Microwave-Induced Inactivation of DNA-Based Hybrid Catalyst in Asymmetric Catalysis
Zhao, Hua; Shen, Kai
2015-01-01
DNA-based hybrid catalysts have gained strong interests in asymmetric reactions. However, to maintain the high enantioselectivity, these reactions are usually conducted at relatively low temperatures (e.g. < 5 °C) for 2–3 days. Aiming to improve the reaction’s turnover rate, we evaluated microwave irradiation with simultaneous cooling as potential energy source since this method has been widely used to accelerate various chemical and enzymatic reactions. However, our data indicated that microwave irradiation induced an inactivation of DNA-based hybrid catalyst even at low temperatures (such as 5 °C). Circular dichroism (CD) spectra and gel electrophoresis of DNA suggest that microwave exposure degrades DNA molecules and disrupts DNA double-stranded structures, causing changes of DNA–metal ligand binding properties and thus poor DNA catalytic performance. PMID:26712696
Wu, Qingqing; Xiang, Shengnan; Wang, Wenjun; Zhao, Jinyan; Xia, Jinhua; Zhen, Yueran; Liu, Bang
2018-05-01
Various detection methods have been developed to date for identification of animal species. New techniques based on PCR approach have raised the hope of developing better identification methods, which can overcome the limitations of the existing methods. PCR-based methods used the mitochondrial DNA (mtDNA) as well as nuclear DNA sequences. In this study, by targeting nuclear DNA, multiplex PCR and real-time PCR methods were developed to assist with qualitative and quantitative analysis. The multiplex PCR was found to simultaneously and effectively distinguish four species (fox, dog, mink, and rabbit) ingredients by the different sizes of electrophoretic bands: 480, 317, 220, and 209 bp. Real-time fluorescent PCR's amplification profiles and standard curves showed good quantitative measurement responses and linearity, as indicated by good repeatability and coefficient of determination R 2 > 0.99. The quantitative results of quaternary DNA mixtures including mink, fox, dog, and rabbit DNA are in line with our expectations: R.D. (relative deviation) varied between 1.98 and 12.23% and R.S.D. (relative standard deviation) varied between 3.06 and 11.51%, both of which are well within the acceptance criterion of ≤ 25%. Combining the two methods is suitable for the rapid identification and accurate quantification of fox-, dog-, mink-, and rabbit-derived ingredients in the animal products.
Analytical Devices Based on Direct Synthesis of DNA on Paper.
Glavan, Ana C; Niu, Jia; Chen, Zhen; Güder, Firat; Cheng, Chao-Min; Liu, David; Whitesides, George M
2016-01-05
This paper addresses a growing need in clinical diagnostics for parallel, multiplex analysis of biomarkers from small biological samples. It describes a new procedure for assembling arrays of ssDNA and proteins on paper. This method starts with the synthesis of DNA oligonucleotides covalently linked to paper and proceeds to assemble microzones of DNA-conjugated paper into arrays capable of simultaneously capturing DNA, DNA-conjugated protein antigens, and DNA-conjugated antibodies. The synthesis of ssDNA oligonucleotides on paper is convenient and effective with 32% of the oligonucleotides cleaved and eluted from the paper substrate being full-length by HPLC for a 32-mer. These ssDNA arrays can be used to detect fluorophore-linked DNA oligonucleotides in solution, and as the basis for DNA-directed assembly of arrays of DNA-conjugated capture antibodies on paper, detect protein antigens by sandwich ELISAs. Paper-anchored ssDNA arrays with different sequences can be used to assemble paper-based devices capable of detecting DNA and antibodies in the same device and enable simple microfluidic paper-based devices.
van Grinsven, Bart; Vanden Bon, Natalie; Strauven, Hannelore; Grieten, Lars; Murib, Mohammed; Monroy, Kathia L Jiménez; Janssens, Stoffel D; Haenen, Ken; Schöning, Michael J; Vermeeren, Veronique; Ameloot, Marcel; Michiels, Luc; Thoelen, Ronald; De Ceuninck, Ward; Wagner, Patrick
2012-03-27
In this article, we report on the heat-transfer resistance at interfaces as a novel, denaturation-based method to detect single-nucleotide polymorphisms in DNA. We observed that a molecular brush of double-stranded DNA grafted onto synthetic diamond surfaces does not notably affect the heat-transfer resistance at the solid-to-liquid interface. In contrast to this, molecular brushes of single-stranded DNA cause, surprisingly, a substantially higher heat-transfer resistance and behave like a thermally insulating layer. This effect can be utilized to identify ds-DNA melting temperatures via the switching from low- to high heat-transfer resistance. The melting temperatures identified with this method for different DNA duplexes (29 base pairs without and with built-in mutations) correlate nicely with data calculated by modeling. The method is fast, label-free (without the need for fluorescent or radioactive markers), allows for repetitive measurements, and can also be extended toward array formats. Reference measurements by confocal fluorescence microscopy and impedance spectroscopy confirm that the switching of heat-transfer resistance upon denaturation is indeed related to the thermal on-chip denaturation of DNA. © 2012 American Chemical Society
Dieltjes, Patrick; Mieremet, René; Zuniga, Sofia; Kraaijenbrink, Thirsa; Pijpe, Jeroen; de Knijff, Peter
2011-07-01
Exploring technological limits is a common practice in forensic DNA research. Reliable genetic profiling based on only a few cells isolated from trace material retrieved from a crime scene is nowadays more and more the rule rather than the exception. On many crime scenes, cartridges, bullets, and casings (jointly abbreviated as CBCs) are regularly found, and even after firing, these potentially carry trace amounts of biological material. Since 2003, the Forensic Laboratory for DNA Research is routinely involved in the forensic investigation of CBCs in the Netherlands. Reliable DNA profiles were frequently obtained from CBCs and used to match suspects, victims, or other crime scene-related DNA traces. In this paper, we describe the sensitive method developed by us to extract DNA from CBCs. Using PCR-based genotyping of autosomal short tandem repeats, we were able to obtain reliable and reproducible DNA profiles in 163 out of 616 criminal cases (26.5%) and in 283 out of 4,085 individual CBC items (6.9%) during the period January 2003-December 2009. We discuss practical aspects of the method and the sometimes unexpected effects of using cell lysis buffer on the subsequent investigation of striation patterns on CBCs.
Single-Molecule Electrical Random Resequencing of DNA and RNA
NASA Astrophysics Data System (ADS)
Ohshiro, Takahito; Matsubara, Kazuki; Tsutsui, Makusu; Furuhashi, Masayuki; Taniguchi, Masateru; Kawai, Tomoji
2012-07-01
Two paradigm shifts in DNA sequencing technologies--from bulk to single molecules and from optical to electrical detection--are expected to realize label-free, low-cost DNA sequencing that does not require PCR amplification. It will lead to development of high-throughput third-generation sequencing technologies for personalized medicine. Although nanopore devices have been proposed as third-generation DNA-sequencing devices, a significant milestone in these technologies has been attained by demonstrating a novel technique for resequencing DNA using electrical signals. Here we report single-molecule electrical resequencing of DNA and RNA using a hybrid method of identifying single-base molecules via tunneling currents and random sequencing. Our method reads sequences of nine types of DNA oligomers. The complete sequence of 5'-UGAGGUA-3' from the let-7 microRNA family was also identified by creating a composite of overlapping fragment sequences, which was randomly determined using tunneling current conducted by single-base molecules as they passed between a pair of nanoelectrodes.
McCarthy, David; Pulverer, Walter; Weinhaeusel, Andreas; Diago, Oscar R; Hogan, Daniel J; Ostertag, Derek; Hanna, Michelle M
2016-01-01
Aim: Development of a sensitive method for DNA methylation profiling and associated mutation detection in clinical samples. Materials & methods: Formalin-fixed and paraffin-embedded tumors received by clinical laboratories often contain insufficient DNA for analysis with bisulfite or methylation sensitive restriction enzymes-based methods. To increase sensitivity, methyl-CpG DNA capture and Coupled Abscription PCR Signaling detection were combined in a new assay, MethylMeter®. Gliomas were analyzed for MGMT methylation, glioma CpG island methylator phenotype and IDH1 R132H. Results: MethylMeter had 100% assay success rate measuring all five biomarkers in formalin-fixed and paraffin-embedded tissue. MGMT methylation results were supported by survival and mRNA expression data. Conclusion: MethylMeter is a sensitive and quantitative method for multitarget DNA methylation profiling and associated mutation detection. The MethylMeter-based GliomaSTRAT assay measures methylation of four targets and one mutation to simultaneously grade gliomas and predict their response to temozolomide. This information is clinically valuable in management of gliomas. PMID:27337298
Ludgate, Jackie L; Wright, James; Stockwell, Peter A; Morison, Ian M; Eccles, Michael R; Chatterjee, Aniruddha
2017-08-31
Formalin fixed paraffin embedded (FFPE) tumor samples are a major source of DNA from patients in cancer research. However, FFPE is a challenging material to work with due to macromolecular fragmentation and nucleic acid crosslinking. FFPE tissue particularly possesses challenges for methylation analysis and for preparing sequencing-based libraries relying on bisulfite conversion. Successful bisulfite conversion is a key requirement for sequencing-based methylation analysis. Here we describe a complete and streamlined workflow for preparing next generation sequencing libraries for methylation analysis from FFPE tissues. This includes, counting cells from FFPE blocks and extracting DNA from FFPE slides, testing bisulfite conversion efficiency with a polymerase chain reaction (PCR) based test, preparing reduced representation bisulfite sequencing libraries and massively parallel sequencing. The main features and advantages of this protocol are: An optimized method for extracting good quality DNA from FFPE tissues. An efficient bisulfite conversion and next generation sequencing library preparation protocol that uses 50 ng DNA from FFPE tissue. Incorporation of a PCR-based test to assess bisulfite conversion efficiency prior to sequencing. We provide a complete workflow and an integrated protocol for performing DNA methylation analysis at the genome-scale and we believe this will facilitate clinical epigenetic research that involves the use of FFPE tissue.
Nie, Y C; Yu, L J; Guan, H; Zhao, Y; Rong, H B; Jiang, B W; Zhang, T
2017-06-01
As an important part of epigenetic marker, DNA methylation involves in the gene regulation and attracts a wide spread attention in biological auxology, geratology and oncology fields. In forensic science, because of the relative stable, heritable, abundant, and age-related characteristics, DNA methylation is considered to be a useful complement to the classic genetic markers for age-prediction, tissue-identification, and monozygotic twins' discrimination. Various methods for DNA methylation detection have been validated based on methylation sensitive restriction endonuclease, bisulfite modification and methylation-CpG binding protein. In recent years, it is reported that the third generation sequencing method can be used to detect DNA methylation. This paper aims to make a review on the detection method of DNA methylation and its applications in forensic science. Copyright© by the Editorial Department of Journal of Forensic Medicine.
Long-term room temperature preservation of corpse soft tissue: an approach for tissue sample storage
2011-01-01
Background Disaster victim identification (DVI) represents one of the most difficult challenges in forensic sciences, and subsequent DNA typing is essential. Collected samples for DNA-based human identification are usually stored at low temperature to halt the degradation processes of human remains. We have developed a simple and reliable procedure for soft tissue storage and preservation for DNA extraction. It ensures high quality DNA suitable for PCR-based DNA typing after at least 1 year of room temperature storage. Methods Fragments of human psoas muscle were exposed to three different environmental conditions for diverse time periods at room temperature. Storage conditions included: (a) a preserving medium consisting of solid sodium chloride (salt), (b) no additional substances and (c) garden soil. DNA was extracted with proteinase K/SDS followed by organic solvent treatment and concentration by centrifugal filter devices. Quantification was carried out by real-time PCR using commercial kits. Short tandem repeat (STR) typing profiles were analysed with 'expert software'. Results DNA quantities recovered from samples stored in salt were similar up to the complete storage time and underscored the effectiveness of the preservation method. It was possible to reliably and accurately type different genetic systems including autosomal STRs and mitochondrial and Y-chromosome haplogroups. Autosomal STR typing quality was evaluated by expert software, denoting high quality profiles from DNA samples obtained from corpse tissue stored in salt for up to 365 days. Conclusions The procedure proposed herein is a cost efficient alternative for storage of human remains in challenging environmental areas, such as mass disaster locations, mass graves and exhumations. This technique should be considered as an additional method for sample storage when preservation of DNA integrity is required for PCR-based DNA typing. PMID:21846338
Mitochondrial DNA diagnosis for taeniasis and cysticercosis.
Yamasaki, Hiroshi; Nakao, Minoru; Sako, Yasuhito; Nakaya, Kazuhiro; Sato, Marcello Otake; Ito, Akira
2006-01-01
Molecular diagnosis for taeniasis and cysticercosis in humans on the basis of mitochondrial DNA analysis was reviewed. Development and application of three different methods, including restriction fragment length polymorphism analysis, base excision sequence scanning thymine-base analysis and multiplex PCR, were described. Moreover, molecular diagnosis of cysticerci found in specimens submitted for histopathology and the molecular detection of taeniasis using copro-DNA were discussed.
Strand displacement activated peroxidase activity of hemin for fluorescent DNA sensing.
Wang, Quanbo; Xu, Nan; Gui, Zhen; Lei, Jianping; Ju, Huangxian; Yan, Feng
2015-10-07
To efficiently regulate the catalytic activity of the peroxidase mimic hemin, this work designs a double-stranded DNA probe containing an intermolecular dimer of hemin, whose peroxidase activity can be activated by a DNA strand displacement reaction. The double-stranded probe is prepared by annealing two strands of hemin labelled DNA oligonucleotides. Using the fluorescent oxidation product of tyramine by H2O2 as a tracing molecule, the low peroxidase activity of the hemin dimer ensures a low fluorescence background. The strand displacement reaction of the target DNA dissociates the hemin dimer and thus significantly increases the catalytic activity of hemin to produce a large amount of dityramine for fluorescence signal readout. Based on the strand displacement regulated peroxidase activity, a simple and sensitive homogeneous fluorescent DNA sensing method is proposed. The detection can conveniently be carried out in a 96-well plate within 20 min with a detection limit of 0.18 nM. This method shows high specificity, which can effectively distinguish single-base mismatched DNA from perfectly matched target DNA. The DNA strand displacement regulated catalytic activity of hemin has promising application in the determination of various DNA analytes.
Park, Jung Hun; Jang, Hyowon; Jung, Yun Kyung; Jung, Ye Lim; Shin, Inkyung; Cho, Dae-Yeon; Park, Hyun Gyu
2017-05-15
We herein describe a new mass spectrometry-based method for multiplex SNP genotyping by utilizing allele-specific ligation and strand displacement amplification (SDA) reaction. In this method, allele-specific ligation is first performed to discriminate base sequence variations at the SNP site within the PCR-amplified target DNA. The primary ligation probe is extended by a universal primer annealing site while the secondary ligation probe has base sequences as an overhang with a nicking enzyme recognition site and complementary mass marker sequence. The ligation probe pairs are ligated by DNA ligase only at specific allele in the target DNA and the resulting ligated product serves as a template to promote the SDA reaction using a universal primer. This process isothermally amplifies short DNA fragments, called mass markers, to be analyzed by mass spectrometry. By varying the sizes of the mass markers, we successfully demonstrated the multiplex SNP genotyping capability of this method by reliably identifying several BRCA mutations in a multiplex manner with mass spectrometry. Copyright © 2016 Elsevier B.V. All rights reserved.
Wu, Zining; Graybill, Todd L; Zeng, Xin; Platchek, Michael; Zhang, Jean; Bodmer, Vera Q; Wisnoski, David D; Deng, Jianghe; Coppo, Frank T; Yao, Gang; Tamburino, Alex; Scavello, Genaro; Franklin, G Joseph; Mataruse, Sibongile; Bedard, Katie L; Ding, Yun; Chai, Jing; Summerfield, Jennifer; Centrella, Paolo A; Messer, Jeffrey A; Pope, Andrew J; Israel, David I
2015-12-14
DNA-encoded small-molecule library technology has recently emerged as a new paradigm for identifying ligands against drug targets. To date, this technology has been used with soluble protein targets that are produced and used in a purified state. Here, we describe a cell-based method for identifying small-molecule ligands from DNA-encoded libraries against integral membrane protein targets. We use this method to identify novel, potent, and specific inhibitors of NK3, a member of the tachykinin family of G-protein coupled receptors (GPCRs). The method is simple and broadly applicable to other GPCRs and integral membrane proteins. We have extended the application of DNA-encoded library technology to membrane-associated targets and demonstrate the feasibility of selecting DNA-tagged, small-molecule ligands from complex combinatorial libraries against targets in a heterogeneous milieu, such as the surface of a cell.
Fan, Jing; Yang, Haowen; Liu, Ming; Wu, Dan; Jiang, Hongrong; Zeng, Xin; Elingarami, Sauli; Ll, Zhiyang; Li, Song; Liu, Hongna; He, Nongyue
2015-02-01
In this research, a novel method for relative fluorescent quantification of DNA based on Fe3O4@SiO2@Au gold-coated magnetic nanocomposites (GMNPs) and multiplex ligation- dependent probe amplification (MLPA) has been developed. With the help of self-assembly, seed-mediated growth and chemical reduction method, core-shell Fe3O4@SiO2@Au GMNPs were synthesized. Through modified streptavidin on the GMNPs surface, we obtained a bead chip which can capture the biotinylated probes. Then we designed MLPA probes which were tagged with biotin or Cy3 and target DNA on the basis of human APP gene sequence. The products from the thermostable DNA ligase induced ligation reactions and PCR amplifications were incubated with SA-GMNPs. After washing, magnetic separation, spotting, the fluorescent scanning results showed our method can be used for the relative quantitative analysis of the target DNA in the concentration range of 03004~0.5 µM.
McCarthy, David; Pulverer, Walter; Weinhaeusel, Andreas; Diago, Oscar R; Hogan, Daniel J; Ostertag, Derek; Hanna, Michelle M
2016-06-01
Development of a sensitive method for DNA methylation profiling and associated mutation detection in clinical samples. Formalin-fixed and paraffin-embedded tumors received by clinical laboratories often contain insufficient DNA for analysis with bisulfite or methylation sensitive restriction enzymes-based methods. To increase sensitivity, methyl-CpG DNA capture and Coupled Abscription PCR Signaling detection were combined in a new assay, MethylMeter(®). Gliomas were analyzed for MGMT methylation, glioma CpG island methylator phenotype and IDH1 R132H. MethylMeter had 100% assay success rate measuring all five biomarkers in formalin-fixed and paraffin-embedded tissue. MGMT methylation results were supported by survival and mRNA expression data. MethylMeter is a sensitive and quantitative method for multitarget DNA methylation profiling and associated mutation detection. The MethylMeter-based GliomaSTRAT assay measures methylation of four targets and one mutation to simultaneously grade gliomas and predict their response to temozolomide. This information is clinically valuable in management of gliomas.
Li, Junting; Zhao, Qi; Tang, Yanli
2016-06-13
We developed a new method for detecting S1 nuclease and hydroxyl radicals based on the use of water-soluble conjugated poly[9,9-bis(6,6-(N,N,N-trimethylammonium)-fluorene)-2,7-ylenevinylene-co-alt-2,5-dicyano-1,4-phenylene)] (PFVCN) and tungsten disulfide (WS₂) nanosheets. Cationic PFVCN is used as a signal reporter, and single-layer WS₂ is used as a quencher with a negatively charged surface. The ssDNA forms complexes with PFVCN due to much stronger electrostatic interactions between cationic PFVCN and anionic ssDNA, whereas PFVCN emits yellow fluorescence. When ssDNA is hydrolyzed by S1 nuclease or hydroxyl radicals into small fragments, the interactions between the fragmented DNA and PFVCN become weaker, resulting in PFVCN being adsorbed on the surface of WS₂ and the fluorescence being quenched through fluorescence resonance energy transfer. The new method based on PFVCN and WS₂ can sense S1 nuclease with a low detection limit of 5 × 10(-6) U/mL. Additionally, this method is cost-effective by using affordable WS₂ as an energy acceptor without the need for dye-labeled ssDNA. Furthermore, the method provides a new platform for the nuclease assay and reactive oxygen species, and provides promising applications for drug screening.
Molecular DNA-based detection of ionising radiation in meat.
Şakalar, Ergün
2017-05-01
Ionising radiation induces molecular alterations, such as formation of ions, free radicals, and new stable molecules, and cleavage of the chemical bonds of the molecules present in food. Irradiation-treated meat should be labelled to control the process and to ensure free consumer choice. Therefore, sensitive analytical methods are required to detect the irradiation dose. Meat samples were exposed to radiation doses of 0, 0.272, 0.497, 1.063, 3.64, 8.82 and 17.42 kGy in an industrial 60 Co gamma cell. Primers were designed to amplify 998, 498 and 250-base pair (bp) regions of the 18S rRNA gene of nuclear DNA from the irradiated samples. A new DNA-based method was developed to quantify the radiation exposed to the unstored meat and the meat stored at -20 °C for 3 and 6 months. The method was able to detect meat samples stored and unstored with dose limits of 1.063 and 3.64 kGy, respectively. The level of irradiation can be detected using primer pairs that target particularly different-sized sequences for DNA amplification by PCR. This method can be widely used for the analysis of not only meat samples, but also all biological materials containing DNA. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.
Lou, Wangchao; Wang, Xiaoqing; Chen, Fan; Chen, Yixiao; Jiang, Bo; Zhang, Hua
2014-01-01
Developing an efficient method for determination of the DNA-binding proteins, due to their vital roles in gene regulation, is becoming highly desired since it would be invaluable to advance our understanding of protein functions. In this study, we proposed a new method for the prediction of the DNA-binding proteins, by performing the feature rank using random forest and the wrapper-based feature selection using forward best-first search strategy. The features comprise information from primary sequence, predicted secondary structure, predicted relative solvent accessibility, and position specific scoring matrix. The proposed method, called DBPPred, used Gaussian naïve Bayes as the underlying classifier since it outperformed five other classifiers, including decision tree, logistic regression, k-nearest neighbor, support vector machine with polynomial kernel, and support vector machine with radial basis function. As a result, the proposed DBPPred yields the highest average accuracy of 0.791 and average MCC of 0.583 according to the five-fold cross validation with ten runs on the training benchmark dataset PDB594. Subsequently, blind tests on the independent dataset PDB186 by the proposed model trained on the entire PDB594 dataset and by other five existing methods (including iDNA-Prot, DNA-Prot, DNAbinder, DNABIND and DBD-Threader) were performed, resulting in that the proposed DBPPred yielded the highest accuracy of 0.769, MCC of 0.538, and AUC of 0.790. The independent tests performed by the proposed DBPPred on completely a large non-DNA binding protein dataset and two RNA binding protein datasets also showed improved or comparable quality when compared with the relevant prediction methods. Moreover, we observed that majority of the selected features by the proposed method are statistically significantly different between the mean feature values of the DNA-binding and the non DNA-binding proteins. All of the experimental results indicate that the proposed DBPPred can be an alternative perspective predictor for large-scale determination of DNA-binding proteins. PMID:24475169
[Detection of KRAS mutation in colorectal cancer patients' cfDNA with droplet digital PCR].
Luo, Yuwen; Li, Yao
2018-03-25
This study aims to develop a new method for the detection of KRAS mutations related to colorectal cancer in cfDNA, and to evaluate the sensitivity and accuracy of the detection. We designed a method of cfDNA based KRAS detection by droplets digital PCR (ddPCR). The theoretical performance of the method is evaluated by reference standard and compared to the ARMS PCR method. Two methods, ddPCR and qPCR, were successfully established to detect KRAS wild type and 7 mutants. Both methods were validated using plasmid standards and actual samples. The results were evaluated by false positive rate, linearity, and limit of detection. Finally, 52 plasma cfDNA samples from patients and 20 samples from healthy people were tested, the clinical sensitivity is 97.64%, clinical specificity is 81.43%. ddPCR method shows higher performance than qPCR. The LOD of ddPCR method reached single digits of cfDNA copies, it can detect as low as 0.01% to 0.04% mutation abundance.
Antibody-controlled actuation of DNA-based molecular circuits.
Engelen, Wouter; Meijer, Lenny H H; Somers, Bram; de Greef, Tom F A; Merkx, Maarten
2017-02-17
DNA-based molecular circuits allow autonomous signal processing, but their actuation has relied mostly on RNA/DNA-based inputs, limiting their application in synthetic biology, biomedicine and molecular diagnostics. Here we introduce a generic method to translate the presence of an antibody into a unique DNA strand, enabling the use of antibodies as specific inputs for DNA-based molecular computing. Our approach, antibody-templated strand exchange (ATSE), uses the characteristic bivalent architecture of antibodies to promote DNA-strand exchange reactions both thermodynamically and kinetically. Detailed characterization of the ATSE reaction allowed the establishment of a comprehensive model that describes the kinetics and thermodynamics of ATSE as a function of toehold length, antibody-epitope affinity and concentration. ATSE enables the introduction of complex signal processing in antibody-based diagnostics, as demonstrated here by constructing molecular circuits for multiplex antibody detection, integration of multiple antibody inputs using logic gates and actuation of enzymes and DNAzymes for signal amplification.
Antibody-controlled actuation of DNA-based molecular circuits
NASA Astrophysics Data System (ADS)
Engelen, Wouter; Meijer, Lenny H. H.; Somers, Bram; de Greef, Tom F. A.; Merkx, Maarten
2017-02-01
DNA-based molecular circuits allow autonomous signal processing, but their actuation has relied mostly on RNA/DNA-based inputs, limiting their application in synthetic biology, biomedicine and molecular diagnostics. Here we introduce a generic method to translate the presence of an antibody into a unique DNA strand, enabling the use of antibodies as specific inputs for DNA-based molecular computing. Our approach, antibody-templated strand exchange (ATSE), uses the characteristic bivalent architecture of antibodies to promote DNA-strand exchange reactions both thermodynamically and kinetically. Detailed characterization of the ATSE reaction allowed the establishment of a comprehensive model that describes the kinetics and thermodynamics of ATSE as a function of toehold length, antibody-epitope affinity and concentration. ATSE enables the introduction of complex signal processing in antibody-based diagnostics, as demonstrated here by constructing molecular circuits for multiplex antibody detection, integration of multiple antibody inputs using logic gates and actuation of enzymes and DNAzymes for signal amplification.
Chikira, Makoto; Ng, Chew Hee; Palaniandavar, Mallayan
2015-01-01
The interaction of simple and ternary Cu(II) complexes of 1,10-phenanthrolines with DNA has been studied extensively because of their various interesting and important functions such as DNA cleavage activity, cytotoxicity towards cancer cells, and DNA based asymmetric catalysis. Such functions are closely related to the DNA binding modes of the complexes such as intercalation, groove binding, and electrostatic surface binding. A variety of spectroscopic methods have been used to study the DNA binding mode of the Cu(II) complexes. Of all these methods, DNA-fiber electron paramagnetic resonance (EPR) spectroscopy affords unique information on the DNA binding structures of the complexes. In this review we summarize the results of our DNA-fiber EPR studies on the DNA binding structure of the complexes and discuss them together with the data accumulated by using other measurements. PMID:26402668
DOE Office of Scientific and Technical Information (OSTI.GOV)
Torella, JP; Lienert, F; Boehm, CR
2014-08-07
Recombination-based DNA construction methods, such as Gibson assembly, have made it possible to easily and simultaneously assemble multiple DNA parts, and they hold promise for the development and optimization of metabolic pathways and functional genetic circuits. Over time, however, these pathways and circuits have become more complex, and the increasing need for standardization and insulation of genetic parts has resulted in sequence redundancies-for example, repeated terminator and insulator sequences-that complicate recombination-based assembly. We and others have recently developed DNA assembly methods, which we refer to collectively as unique nucleotide sequence (UNS)-guided assembly, in which individual DNA parts are flanked withmore » UNSs to facilitate the ordered, recombination-based assembly of repetitive sequences. Here we present a detailed protocol for UNS-guided assembly that enables researchers to convert multiple DNA parts into sequenced, correctly assembled constructs, or into high-quality combinatorial libraries in only 2-3 d. If the DNA parts must be generated from scratch, an additional 2-5 d are necessary. This protocol requires no specialized equipment and can easily be implemented by a student with experience in basic cloning techniques.« less
Torella, Joseph P.; Lienert, Florian; Boehm, Christian R.; Chen, Jan-Hung; Way, Jeffrey C.; Silver, Pamela A.
2016-01-01
Recombination-based DNA construction methods, such as Gibson assembly, have made it possible to easily and simultaneously assemble multiple DNA parts and hold promise for the development and optimization of metabolic pathways and functional genetic circuits. Over time, however, these pathways and circuits have become more complex, and the increasing need for standardization and insulation of genetic parts has resulted in sequence redundancies — for example repeated terminator and insulator sequences — that complicate recombination-based assembly. We and others have recently developed DNA assembly methods that we refer to collectively as unique nucleotide sequence (UNS)-guided assembly, in which individual DNA parts are flanked with UNSs to facilitate the ordered, recombination-based assembly of repetitive sequences. Here we present a detailed protocol for UNS-guided assembly that enables researchers to convert multiple DNA parts into sequenced, correctly-assembled constructs, or into high-quality combinatorial libraries in only 2–3 days. If the DNA parts must be generated from scratch, an additional 2–5 days are necessary. This protocol requires no specialized equipment and can easily be implemented by a student with experience in basic cloning techniques. PMID:25101822
NASA Astrophysics Data System (ADS)
Bustamam, A.; Aldila, D.; Fatimah, Arimbi, M. D.
2017-07-01
One of the most widely used clustering method, since it has advantage on its robustness, is Self-Organizing Maps (SOM) method. This paper discusses the application of SOM method on Human Papillomavirus (HPV) DNA which is the main cause of cervical cancer disease, the most dangerous cancer in developing countries. We use 18 types of HPV DNA-based on the newest complete genome. By using open-source-based program R, clustering process can separate 18 types of HPV into two different clusters. There are two types of HPV in the first cluster while 16 others in the second cluster. The analyzing result of 18 types HPV based on the malignancy of the virus (the difficultness to cure). Two of HPV types the first cluster can be classified as tame HPV, while 16 others in the second cluster are classified as vicious HPV.
DNA attachment to support structures
Balhorn, Rodney L.; Barry, Christopher H.
2002-01-01
Microscopic beads or other structures are attached to nucleic acids (DNA) using a terminal transferase. The transferase adds labeled dideoxy nucleotide bases to the ends of linear strands of DNA. The labels, such as the antigens digoxigenin and biotin, bind to the antibody compounds or other appropriate complementary ligands, which are bound to the microscopic beads or other support structures. The method does not require the synthesis of a synthetic oligonucleotide probe. The method can be used to tag or label DNA even when the DNA has an unknown sequence, has blunt ends, or is a very large fragment (e.g., >500 kilobase pairs).
A method for detecting genetic toxicity using the RNA synthesis response to DNA damage.
Morita, Yoko; Iwai, Shigenori; Kuraoka, Isao
2011-10-01
To date, biological risk assessment studies of chemicals that induce DNA lesions have been primarily based on the action of DNA polymerases during replication. However, DNA lesions interfere not only with replication but also with transcription. Therefore, detecting the damaging effects of DNA lesions during transcription might be important for estimating the safety of chemical mutagens and carcinogens. However, methods to address these effects have not been developed. Here, we report a simple, non-isotopic method for determining the toxicity of chemical agents by visualizing transcription in a mammalian cell system. The method is based on the measurement of the incorporation of bromouridine (as the uridine analogue) into the nascent RNA during RNA synthesis inhibition (RSI) induced by the stalling of RNA polymerases at DNA lesions on the transcribed DNA strand, which triggers transcription-coupled nucleotide excision repair (TC-NER). When we tested chemical agents (camptothecin, etoposide, 4-nitroquinoline-1-oxide, mitomycin C, methyl methanesulfonate, and cisplatin) in HeLa cells by the method, RSI indicative of genomic toxicity was observed in the nucleoli of the tested cells. This procedure provides the following advantages: 1) it uses common, affordable mammalian cells (HeLa cells, WI38VA13 cells, human dermal fibroblasts, or Chinese hamster ovary cells) rather than genetically modified microorganisms; 2) it can be completed within approximately 8 hr after the cells are prepared because RNA polymerase responses during TC-NER are faster than other DNA damage responses (replication, recombination, and apoptosis); and 3) it is safe because it uses non-radioactive bromouridine and antibodies to detect RNA synthesis on undamaged transcribed DNA strands.
Periasamy, Vengadesh; Rizan, Nastaran; Al-Ta’ii, Hassan Maktuff Jaber; Tan, Yee Shin; Tajuddin, Hairul Annuar; Iwamoto, Mitsumasa
2016-01-01
The discovery of semiconducting behavior of deoxyribonucleic acid (DNA) has resulted in a large number of literatures in the study of DNA electronics. Sequence-specific electronic response provides a platform towards understanding charge transfer mechanism and therefore the electronic properties of DNA. It is possible to utilize these characteristic properties to identify/detect DNA. In this current work, we demonstrate a novel method of DNA-based identification of basidiomycetes using current-voltage (I-V) profiles obtained from DNA-specific Schottky barrier diodes. Electronic properties such as ideality factor, barrier height, shunt resistance, series resistance, turn-on voltage, knee-voltage, breakdown voltage and breakdown current were calculated and used to quantify the identification process as compared to morphological and molecular characterization techniques. The use of these techniques is necessary in order to study biodiversity, but sometimes it can be misleading and unreliable and is not sufficiently useful for the identification of fungi genera. Many of these methods have failed when it comes to identification of closely related species of certain genus like Pleurotus. Our electronics profiles, both in the negative and positive bias regions were however found to be highly characteristic according to the base-pair sequences. We believe that this simple, low-cost and practical method could be useful towards identifying and detecting DNA in biotechnology and pathology. PMID:27435636
NASA Astrophysics Data System (ADS)
Periasamy, Vengadesh; Rizan, Nastaran; Al-Ta'Ii, Hassan Maktuff Jaber; Tan, Yee Shin; Tajuddin, Hairul Annuar; Iwamoto, Mitsumasa
2016-07-01
The discovery of semiconducting behavior of deoxyribonucleic acid (DNA) has resulted in a large number of literatures in the study of DNA electronics. Sequence-specific electronic response provides a platform towards understanding charge transfer mechanism and therefore the electronic properties of DNA. It is possible to utilize these characteristic properties to identify/detect DNA. In this current work, we demonstrate a novel method of DNA-based identification of basidiomycetes using current-voltage (I-V) profiles obtained from DNA-specific Schottky barrier diodes. Electronic properties such as ideality factor, barrier height, shunt resistance, series resistance, turn-on voltage, knee-voltage, breakdown voltage and breakdown current were calculated and used to quantify the identification process as compared to morphological and molecular characterization techniques. The use of these techniques is necessary in order to study biodiversity, but sometimes it can be misleading and unreliable and is not sufficiently useful for the identification of fungi genera. Many of these methods have failed when it comes to identification of closely related species of certain genus like Pleurotus. Our electronics profiles, both in the negative and positive bias regions were however found to be highly characteristic according to the base-pair sequences. We believe that this simple, low-cost and practical method could be useful towards identifying and detecting DNA in biotechnology and pathology.
NASA Astrophysics Data System (ADS)
Bordbar, Maryam; Tavoosi, Fariba; Yeganeh-Faal, Ali; Zebarjadian, Mohammad Hasan
2018-01-01
The interaction of Cd(II), Zn(II) and Mn(II)-L (4,8-bis(2-pyridylmethyl)-4,8-diazaundecane-1,11-diamine) transition metal complexes with calf thymus DNA (CT-DNA) has been investigated using electronic, fluorescence and circular dichroism (CD) spectroscopy, thermal denaturation and cyclic voltammetry (CV). Based on the UV-Vis study, binding constants of the complexes with CT-DNA were calculated. Changes in the band of the CD spectrum, DNA melting temperature and in the ipa and ipc of the complexes in the presenceCT-DNA, overall, showed that the studied complex exhibited good DNA interaction ability with partial intercalation mode.
Arulandhu, Alfred J.; Staats, Martijn; Hagelaar, Rico; Voorhuijzen, Marleen M.; Prins, Theo W.; Scholtens, Ingrid; Costessi, Adalberto; Duijsings, Danny; Rechenmann, François; Gaspar, Frédéric B.; Barreto Crespo, Maria Teresa; Holst-Jensen, Arne; Birck, Matthew; Burns, Malcolm; Haynes, Edward; Hochegger, Rupert; Klingl, Alexander; Lundberg, Lisa; Natale, Chiara; Niekamp, Hauke; Perri, Elena; Barbante, Alessandra; Rosec, Jean-Philippe; Seyfarth, Ralf; Sovová, Tereza; Van Moorleghem, Christoff; van Ruth, Saskia; Peelen, Tamara
2017-01-01
Abstract DNA metabarcoding provides great potential for species identification in complex samples such as food supplements and traditional medicines. Such a method would aid Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES) enforcement officers to combat wildlife crime by preventing illegal trade of endangered plant and animal species. The objective of this research was to develop a multi-locus DNA metabarcoding method for forensic wildlife species identification and to evaluate the applicability and reproducibility of this approach across different laboratories. A DNA metabarcoding method was developed that makes use of 12 DNA barcode markers that have demonstrated universal applicability across a wide range of plant and animal taxa and that facilitate the identification of species in samples containing degraded DNA. The DNA metabarcoding method was developed based on Illumina MiSeq amplicon sequencing of well-defined experimental mixtures, for which a bioinformatics pipeline with user-friendly web-interface was developed. The performance of the DNA metabarcoding method was assessed in an international validation trial by 16 laboratories, in which the method was found to be highly reproducible and sensitive enough to identify species present in a mixture at 1% dry weight content. The advanced multi-locus DNA metabarcoding method assessed in this study provides reliable and detailed data on the composition of complex food products, including information on the presence of CITES-listed species. The method can provide improved resolution for species identification, while verifying species with multiple DNA barcodes contributes to an enhanced quality assurance. PMID:29020743
Arulandhu, Alfred J; Staats, Martijn; Hagelaar, Rico; Voorhuijzen, Marleen M; Prins, Theo W; Scholtens, Ingrid; Costessi, Adalberto; Duijsings, Danny; Rechenmann, François; Gaspar, Frédéric B; Barreto Crespo, Maria Teresa; Holst-Jensen, Arne; Birck, Matthew; Burns, Malcolm; Haynes, Edward; Hochegger, Rupert; Klingl, Alexander; Lundberg, Lisa; Natale, Chiara; Niekamp, Hauke; Perri, Elena; Barbante, Alessandra; Rosec, Jean-Philippe; Seyfarth, Ralf; Sovová, Tereza; Van Moorleghem, Christoff; van Ruth, Saskia; Peelen, Tamara; Kok, Esther
2017-10-01
DNA metabarcoding provides great potential for species identification in complex samples such as food supplements and traditional medicines. Such a method would aid Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES) enforcement officers to combat wildlife crime by preventing illegal trade of endangered plant and animal species. The objective of this research was to develop a multi-locus DNA metabarcoding method for forensic wildlife species identification and to evaluate the applicability and reproducibility of this approach across different laboratories. A DNA metabarcoding method was developed that makes use of 12 DNA barcode markers that have demonstrated universal applicability across a wide range of plant and animal taxa and that facilitate the identification of species in samples containing degraded DNA. The DNA metabarcoding method was developed based on Illumina MiSeq amplicon sequencing of well-defined experimental mixtures, for which a bioinformatics pipeline with user-friendly web-interface was developed. The performance of the DNA metabarcoding method was assessed in an international validation trial by 16 laboratories, in which the method was found to be highly reproducible and sensitive enough to identify species present in a mixture at 1% dry weight content. The advanced multi-locus DNA metabarcoding method assessed in this study provides reliable and detailed data on the composition of complex food products, including information on the presence of CITES-listed species. The method can provide improved resolution for species identification, while verifying species with multiple DNA barcodes contributes to an enhanced quality assurance. © The Authors 2017. Published by Oxford University Press.
High performance transcription factor-DNA docking with GPU computing
2012-01-01
Background Protein-DNA docking is a very challenging problem in structural bioinformatics and has important implications in a number of applications, such as structure-based prediction of transcription factor binding sites and rational drug design. Protein-DNA docking is very computational demanding due to the high cost of energy calculation and the statistical nature of conformational sampling algorithms. More importantly, experiments show that the docking quality depends on the coverage of the conformational sampling space. It is therefore desirable to accelerate the computation of the docking algorithm, not only to reduce computing time, but also to improve docking quality. Methods In an attempt to accelerate the sampling process and to improve the docking performance, we developed a graphics processing unit (GPU)-based protein-DNA docking algorithm. The algorithm employs a potential-based energy function to describe the binding affinity of a protein-DNA pair, and integrates Monte-Carlo simulation and a simulated annealing method to search through the conformational space. Algorithmic techniques were developed to improve the computation efficiency and scalability on GPU-based high performance computing systems. Results The effectiveness of our approach is tested on a non-redundant set of 75 TF-DNA complexes and a newly developed TF-DNA docking benchmark. We demonstrated that the GPU-based docking algorithm can significantly accelerate the simulation process and thereby improving the chance of finding near-native TF-DNA complex structures. This study also suggests that further improvement in protein-DNA docking research would require efforts from two integral aspects: improvement in computation efficiency and energy function design. Conclusions We present a high performance computing approach for improving the prediction accuracy of protein-DNA docking. The GPU-based docking algorithm accelerates the search of the conformational space and thus increases the chance of finding more near-native structures. To the best of our knowledge, this is the first ad hoc effort of applying GPU or GPU clusters to the protein-DNA docking problem. PMID:22759575
Direct observation of single flexible polymers using single stranded DNA†
Brockman, Christopher; Kim, Sun Ju
2012-01-01
Over the last 15 years, double stranded DNA (dsDNA) has been used as a model polymeric system for nearly all single polymer dynamics studies. However, dsDNA is a semiflexible polymer with markedly different molecular properties compared to flexible chains, including synthetic organic polymers. In this work, we report a new system for single polymer studies of flexible chains based on single stranded DNA (ssDNA). We developed a method to synthesize ssDNA for fluorescence microscopy based on rolling circle replication, which generates long strands (>65 kb) of ssDNA containing “designer” sequences, thereby preventing intramolecular base pair interactions. Polymers are synthesized to contain amine-modified bases randomly distributed along the backbone, which enables uniform labelling of polymer chains with a fluorescent dye to facilitate fluorescence microscopy and imaging. Using this approach, we synthesized ssDNA chains with long contour lengths (>30 μm) and relatively low dye loading ratios (~1 dye per 100 bases). In addition, we used epifluorescence microscopy to image single ssDNA polymer molecules stretching in flow in a microfluidic device. Overall, we anticipate that ssDNA will serve as a useful model system to probe the dynamics of polymeric materials at the molecular level. PMID:22956981
DNA purification by triplex-affinity capture and affinity capture electrophoresis
Cantor, C.R.; Ito, Takashi; Smith, C.L.
1996-01-09
The invention provides a method for purifying or isolating double stranded DNA intact using triple helix formation. The method includes the steps of complexing an oligonucleotide and double stranded DNA to generate a triple helix and immobilization of the triple helix on a solid phase by means of a molecular recognition system such as avidin/biotin. The purified DNA is then recovered intact by treating the solid phase with a reagent that breaks the bonds between the oligonucleotide and the intact double stranded DNA while not affecting the Watson-Crick base pairs of the double helix. The present invention also provides a method for purifying or isolating double stranded DNA intact by complexing the double stranded DNA with a specific binding partner and recovering the complex during electrophoresis by immobilizing it on a solid phase trap imbedded in an electrophoretic gel. 6 figs.
Diverse Applications of Environmental DNA Methods in Parasitology.
Bass, David; Stentiford, Grant D; Littlewood, D T J; Hartikainen, Hanna
2015-10-01
Nucleic acid extraction and sequencing of genes from organisms within environmental samples encompasses a variety of techniques collectively referred to as environmental DNA or 'eDNA'. The key advantages of eDNA analysis include the detection of cryptic or otherwise elusive organisms, large-scale sampling with fewer biases than specimen-based methods, and generation of data for molecular systematics. These are particularly relevant for parasitology because parasites can be difficult to locate and are morphologically intractable and genetically divergent. However, parasites have rarely been the focus of eDNA studies. Focusing on eukaryote parasites, we review the increasing diversity of the 'eDNA toolbox'. Combining eDNA methods with complementary tools offers much potential to understand parasite communities, disease risk, and parasite roles in broader ecosystem processes such as food web structuring and community assembly. Crown Copyright © 2015. Published by Elsevier Ltd. All rights reserved.
Electrochemical DNA sensor for anthrax toxin activator gene atxA-detection of PCR amplicons.
Das, Ritu; Goel, Ajay K; Sharma, Mukesh K; Upadhyay, Sanjay
2015-12-15
We report the DNA probe functionalized electrochemical genosensor for the detection of Bacillus anthracis, specific towards the regulatory gene atxA. The DNA sensor is fabricated on electrochemically deposited gold nanoparticle on self assembled layer of (3-Mercaptopropyl) trimethoxysilane (MPTS) on GC electrode. DNA hybridization is monitored by differential pulse voltammogram (DPV). The modified GC electrode is characterized by atomic force microscopy (AFM), cyclic voltammetry (CV), and electrochemical impedance spectroscopy (EIS) method. We also quantified the DNA probe density on electrode surface by the chronocoulometric method. The detection is specific and selective for atxA gene by DNA probe on the electrode surface. No report is available for the detection of B. anthracis by using atxA an anthrax toxin activator gene. In the light of real and complex sample, we have studied the PCR amplicons of 303, 361 and 568 base pairs by using symmetric and asymmetric PCR approaches. The DNA probe of atxA gene efficiently hybridizes with different base pairs of PCR amplicons. The detection limit is found to be 1.0 pM (S/N ratio=3). The results indicate that the DNA sensor is able to detect synthetic target as well as PCR amplicons of different base pairs. Copyright © 2015 Elsevier B.V. All rights reserved.
A Method for Preparing DNA Sequencing Templates Using a DNA-Binding Microplate
Yang, Yu; Hebron, Haroun R.; Hang, Jun
2009-01-01
A DNA-binding matrix was immobilized on the surface of a 96-well microplate and used for plasmid DNA preparation for DNA sequencing. The same DNA-binding plate was used for bacterial growth, cell lysis, DNA purification, and storage. In a single step using one buffer, bacterial cells were lysed by enzymes, and released DNA was captured on the plate simultaneously. After two wash steps, DNA was eluted and stored in the same plate. Inclusion of phosphates in the culture medium was found to enhance the yield of plasmid significantly. Purified DNA samples were used successfully in DNA sequencing with high consistency and reproducibility. Eleven vectors and nine libraries were tested using this method. In 10 μl sequencing reactions using 3 μl sample and 0.25 μl BigDye Terminator v3.1, the results from a 3730xl sequencer gave a success rate of 90–95% and read-lengths of 700 bases or more. The method is fully automatable and convenient for manual operation as well. It enables reproducible, high-throughput, rapid production of DNA with purity and yields sufficient for high-quality DNA sequencing at a substantially reduced cost. PMID:19568455
DNA-based identification of Brassica vegetable species for the juice industry.
Etoh, Kazumi; Niijima, Noritaka; Yokoshita, Masahiko; Fukuoka, Shin-Ichi
2003-10-01
Since kale (Brassica oleracea var. acephala), a cruciferous vegetable with a high level of vitamins and functional compounds beneficial to health and wellness, has become widely used in the juice industry, a precise method for quality control of vegetable species is necessary. We describe here a DNA-based identification method to distinguish kale from cabbage (Brassica oleracea var. capitata), a closely related species, which can be inadvertently mixed with kale during the manufacturing process. Using genomic DNA from these vegetables and combinatory sets of nucleotide primers, we screened for random amplified polymorphic DNA (RAPD) fragments and found three cabbage-specific fragments. These RAPD fragments, with lengths of 1.4, 0.5, and 1.5 kb, were purified, subcloned, and sequenced. Based on sequence-tagged sites (STS), we designed sets of primers to detect cabbage-specific identification (CAI) DNA markers. Utilizing the CAI markers, we successfully distinguished more than 10 different local cabbage accessions from 20 kale accessions, and identified kale juices experimentally spiked with different amounts of cabbage.
Wang, Ting; Zheng, Zhenhua; Zhang, Xian-En; Wang, Hanzhong
2016-09-01
Ectromelia virus (ECTV) is an pathogen that can lead to a lethal, acute toxic disease known as mousepox in mice. Prevention and control of ECTV infection requires the establishment of a rapid and sensitive diagnostic system for detecting the virus. In the present study, we developed a method of quantum-dot-fluorescence based in situ hybridisation for detecting ECTV genome DNA. Using biotin-dUTP to replace dTTP, biotin was incorporated into a DNA probe during polymerase chain reaction. High sensitivity and specificity of ECTV DNA detection were displayed by fluorescent quantum dots based on biotin-streptavidin interactions. ECTV DNA was then detected by streptavidin-conjugated quantum dots that bound the biotin-labelled probe. Results indicated that the established method can visualise ECTV genomic DNA in both infected cells and mouse tissues. To our knowledge, this is the first study reporting quantum-dot-fluorescence based in situ hybridisation for the detection of viral nucleic acids, providing a reference for the identification and detection of other viruses. Copyright © 2016. Published by Elsevier B.V.
Boyer, Stephane; Brown, Samuel D. J.; Collins, Rupert A.; Cruickshank, Robert H.; Lefort, Marie-Caroline; Malumbres-Olarte, Jagoba; Wratten, Stephen D.
2012-01-01
DNA barcoding remains a challenge when applied to diet analyses, ancient DNA studies, environmental DNA samples and, more generally, in any cases where DNA samples have not been adequately preserved. Because the size of the commonly used barcoding marker (COI) is over 600 base pairs (bp), amplification fails when the DNA molecule is degraded into smaller fragments. However, relevant information for specimen identification may not be evenly distributed along the barcoding region, and a shorter target can be sufficient for identification purposes. This study proposes a new, widely applicable, method to compare the performance of all potential ‘mini-barcodes’ for a given molecular marker and to objectively select the shortest and most informative one. Our method is based on a sliding window analysis implemented in the new R package SPIDER (Species IDentity and Evolution in R). This method is applicable to any taxon and any molecular marker. Here, it was tested on earthworm DNA that had been degraded through digestion by carnivorous landsnails. A 100 bp region of 16 S rDNA was selected as the shortest informative fragment (mini-barcode) required for accurate specimen identification. Corresponding primers were designed and used to amplify degraded earthworm (prey) DNA from 46 landsnail (predator) faeces using 454-pyrosequencing. This led to the detection of 18 earthworm species in the diet of the snail. We encourage molecular ecologists to use this method to objectively select the most informative region of the gene they aim to amplify from degraded DNA. The method and tools provided here, can be particularly useful (1) when dealing with degraded DNA for which only small fragments can be amplified, (2) for cases where no consensus has yet been reached on the appropriate barcode gene, or (3) to allow direct analysis of short reads derived from massively parallel sequencing without the need for bioinformatic consolidation. PMID:22666489
Karakousis, A; Tan, L; Ellis, D; Alexiou, H; Wormald, P J
2006-04-01
To date, no single reported DNA extraction method is suitable for the efficient extraction of DNA from all fungal species. The efficiency of extraction is of particular importance in PCR-based medical diagnostic applications where the quantity of fungus in a tissue biopsy may be limited. We subjected 16 medically relevant fungi to physical, chemical and enzymatic cell wall disruption methods which constitutes the first step in extracting DNA. Examination by light microscopy showed that grinding with mortar and pestle was the most efficient means of disrupting the rigid fungal cell walls of hyphae and conidia. We then trialled several published DNA isolation protocols to ascertain the most efficient method of extraction. Optimal extraction was achieved by incorporating a lyticase and proteinase K enzymatic digestion step and adapting a DNA extraction procedure from a commercial kit (MO BIO) to generate high yields of high quality DNA from all 16 species. DNA quality was confirmed by the successful PCR amplification of the conserved region of the fungal 18S small-subunit rRNA multicopy gene.
Yin, Changchuan
2015-04-01
To apply digital signal processing (DSP) methods to analyze DNA sequences, the sequences first must be specially mapped into numerical sequences. Thus, effective numerical mappings of DNA sequences play key roles in the effectiveness of DSP-based methods such as exon prediction. Despite numerous mappings of symbolic DNA sequences to numerical series, the existing mapping methods do not include the genetic coding features of DNA sequences. We present a novel numerical representation of DNA sequences using genetic codon context (GCC) in which the numerical values are optimized by simulation annealing to maximize the 3-periodicity signal to noise ratio (SNR). The optimized GCC representation is then applied in exon and intron prediction by Short-Time Fourier Transform (STFT) approach. The results show the GCC method enhances the SNR values of exon sequences and thus increases the accuracy of predicting protein coding regions in genomes compared with the commonly used 4D binary representation. In addition, this study offers a novel way to reveal specific features of DNA sequences by optimizing numerical mappings of symbolic DNA sequences.
Chiral pathways in DNA dinucleotides using gradient optimized refinement along metastable borders
NASA Astrophysics Data System (ADS)
Romano, Pablo; Guenza, Marina
We present a study of DNA breathing fluctuations using Markov state models (MSM) with our novel refinement procedure. MSM have become a favored method of building kinetic models, however their accuracy has always depended on using a significant number of microstates, making the method costly. We present a method which optimizes macrostates by refining borders with respect to the gradient along the free energy surface. As the separation between macrostates contains highest discretization errors, this method corrects for any errors produced by limited microstate sampling. Using our refined MSM methods, we investigate DNA breathing fluctuations, thermally induced conformational changes in native B-form DNA. Running several microsecond MD simulations of DNA dinucleotides of varying sequences, to include sequence and polarity effects, we've analyzed using our refined MSM to investigate conformational pathways inherent in the unstacking of DNA bases. Our kinetic analysis has shown preferential chirality in unstacking pathways that may be critical in how proteins interact with single stranded regions of DNA. These breathing dynamics can help elucidate the connection between conformational changes and key mechanisms within protein-DNA recognition. NSF Chemistry Division (Theoretical Chemistry), the Division of Physics (Condensed Matter: Material Theory), XSEDE.
Quantitative analysis of pork and chicken products by droplet digital PCR.
Cai, Yicun; Li, Xiang; Lv, Rong; Yang, Jielin; Li, Jian; He, Yuping; Pan, Liangwen
2014-01-01
In this project, a highly precise quantitative method based on the digital polymerase chain reaction (dPCR) technique was developed to determine the weight of pork and chicken in meat products. Real-time quantitative polymerase chain reaction (qPCR) is currently used for quantitative molecular analysis of the presence of species-specific DNAs in meat products. However, it is limited in amplification efficiency and relies on standard curves based Ct values, detecting and quantifying low copy number target DNA, as in some complex mixture meat products. By using the dPCR method, we find the relationships between the raw meat weight and DNA weight and between the DNA weight and DNA copy number were both close to linear. This enabled us to establish formulae to calculate the raw meat weight based on the DNA copy number. The accuracy and applicability of this method were tested and verified using samples of pork and chicken powder mixed in known proportions. Quantitative analysis indicated that dPCR is highly precise in quantifying pork and chicken in meat products and therefore has the potential to be used in routine analysis by government regulators and quality control departments of commercial food and feed enterprises.
Inkinen, J; Jayaprakash, B; Santo Domingo, J W; Keinänen-Toivola, M M; Ryu, H; Pitkänen, T
2016-06-01
Next-generation sequencing of 16S ribosomal RNA genes (rDNA) and ribosomal RNA (rRNA) was used to characterize water and biofilm microbiome collected from a drinking water distribution system of an office building after its first year of operation. The total bacterial community (rDNA) and active bacterial members (rRNA) sequencing databases were generated by Illumina MiSeq PE250 platform. As estimated by Chao1 index, species richness in cold water system was lower (180-260) in biofilms (Sphingomonas spp., Methylobacterium spp., Limnohabitans spp., Rhizobiales order) than in waters (250-580), (also Methylotenera spp.) (P = 0·005, n = 20). Similarly species richness (Chao1) was slightly higher (210-580) in rDNA libraries compared to rRNA libraries (150-400; P = 0·054, n = 24). Active Mycobacterium spp. was found in cross-linked polyethylene (PEX), but not in corresponding copper pipeline biofilm. Nonpathogenic Legionella spp. was found in rDNA libraries but not in rRNA libraries. Microbial communities differed between water and biofilms, between cold and hot water systems, locations in the building and between water rRNA and rDNA libraries, as shown by clear clusters in principal component analysis (PcoA). By using the rRNA method, we found that not all bacterial community members were active (e.g. Legionella spp.), whereas other members showed increased activity in some locations; for example, Pseudomonas spp. in hot water circulations' biofilm and order Rhizobiales and Limnohabitans spp. in stagnated locations' water and biofilm. rRNA-based methods may be better than rDNA-based methods for evaluating human health implications as rRNA methods can be used to describe the active bacterial fraction. This study indicates that copper as a pipeline material might have an adverse impact on the occurrence of Mycobacterium spp. The activity of Legionella spp. maybe questionable when detected solely by using DNA-based methods. © 2016 The Society for Applied Microbiology.
Mao, Huihui; Luo, Guanghua; Zhan, Yuxia; Zhang, Jun; Yao, Shuang; Yu, Yang
2018-04-30
The base-quenched probe method for detecting single nucleotide polymorphisms (SNPs) relies on real-time PCR and melting-curve analysis, which might require only one pair of primers and one probe. At present, it has been successfully applied to detect SNPs of multiple genes. However, the mechanism of the base-quenched probe method remains unclear. Therefore, we investigated the possible mechanism of fluorescence quenching by DNA bases in aqueous solution using spectroscopic techniques. It showed that the possible mechanism might be photo-induced electron transfer. We next analyzed electron transfer or transmission between DNA bases and fluorophores. The data suggested that in single-stranded DNA, the electrons of the fluorophore are transferred to the orbital of pyrimidine bases (thymine (T) and cytosine (C)), or that the electron orbitals of the fluorophore are occupied by electrons from purine bases (guanine (G) and adenine (A)), which lead to fluorescence quenching. In addition, the electrons of a fluorophore excited by light can be transmitted along double-stranded DNA, which gives rise to stronger fluorescence quenching. Furthermore, we demonstrated that the quenching efficiency of bases is in the order of G > C ≥ A ≥ T and the capability of electron transmission of base-pairs in double-stranded DNA is in the order of CG[combining low line] ≥ GC[combining low line] > TA[combining low line] ≥ AT[combining low line] (letters representing bases on the complementary strand of the probe are bold and underlined), and the most common commercial fluorophores including FAM, HEX, TET, JOE, and TAMRA could be influenced by bases and are in line with this mechanism and regularity.
Structural features based genome-wide characterization and prediction of nucleosome organization
2012-01-01
Background Nucleosome distribution along chromatin dictates genomic DNA accessibility and thus profoundly influences gene expression. However, the underlying mechanism of nucleosome formation remains elusive. Here, taking a structural perspective, we systematically explored nucleosome formation potential of genomic sequences and the effect on chromatin organization and gene expression in S. cerevisiae. Results We analyzed twelve structural features related to flexibility, curvature and energy of DNA sequences. The results showed that some structural features such as DNA denaturation, DNA-bending stiffness, Stacking energy, Z-DNA, Propeller twist and free energy, were highly correlated with in vitro and in vivo nucleosome occupancy. Specifically, they can be classified into two classes, one positively and the other negatively correlated with nucleosome occupancy. These two kinds of structural features facilitated nucleosome binding in centromere regions and repressed nucleosome formation in the promoter regions of protein-coding genes to mediate transcriptional regulation. Based on these analyses, we integrated all twelve structural features in a model to predict more accurately nucleosome occupancy in vivo than the existing methods that mainly depend on sequence compositional features. Furthermore, we developed a novel approach, named DLaNe, that located nucleosomes by detecting peaks of structural profiles, and built a meta predictor to integrate information from different structural features. As a comparison, we also constructed a hidden Markov model (HMM) to locate nucleosomes based on the profiles of these structural features. The result showed that the meta DLaNe and HMM-based method performed better than the existing methods, demonstrating the power of these structural features in predicting nucleosome positions. Conclusions Our analysis revealed that DNA structures significantly contribute to nucleosome organization and influence chromatin structure and gene expression regulation. The results indicated that our proposed methods are effective in predicting nucleosome occupancy and positions and that these structural features are highly predictive of nucleosome organization. The implementation of our DLaNe method based on structural features is available online. PMID:22449207
Thibault, Thomas; Degrouard, Jeril; Baril, Patrick; Pichon, Chantal; Midoux, Patrick; Malinge, Jean-Marc
2017-03-17
Double-stranded DNA minicircles of less than 1000 bp in length have great interest in both fundamental research and therapeutic applications. Although minicircles have shown promising activity in gene therapy thanks to their good biostability and better intracellular trafficking, minicircles down to 250 bp in size have not yet been investigated from the test tube to the cell for lack of an efficient production method. Herein, we report a novel versatile plasmid-free method for the production of DNA minicircles comprising fewer than 250 bp. We designed a linear nicked DNA double-stranded oligonucleotide blunt-ended substrate for efficient minicircle production in a ligase-mediated and bending protein-assisted circularization reaction at high DNA concentration of 2 μM. This one pot multi-step reaction based-method yields hundreds of micrograms of minicircle with sequences of any base composition and position and containing or not a variety of site-specifically chemical modifications or physiological supercoiling. Biochemical and cellular studies were then conducted to design a 95 bp minicircle capable of binding in vitro two NF-κB transcription factors per minicircle and to efficiently inhibiting NF-κB-dependent transcriptional activity in human cells. Therefore, our production method could pave the way for the design of minicircles as new decoy nucleic acids. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Friis, Thor Einar; Stephenson, Sally; Xiao, Yin; Whitehead, Jon
2014-01-01
The sheep (Ovis aries) is favored by many musculoskeletal tissue engineering groups as a large animal model because of its docile temperament and ease of husbandry. The size and weight of sheep are comparable to humans, which allows for the use of implants and fixation devices used in human clinical practice. The construction of a complimentary DNA (cDNA) library can capture the expression of genes in both a tissue- and time-specific manner. cDNA libraries have been a consistent source of gene discovery ever since the technology became commonplace more than three decades ago. Here, we describe the construction of a cDNA library using cells derived from sheep bones based on the pBluescript cDNA kit. Thirty clones were picked at random and sequenced. This led to the identification of a novel gene, C12orf29, which our initial experiments indicate is involved in skeletal biology. We also describe a polymerase chain reaction-based cDNA clone isolation method that allows the isolation of genes of interest from a cDNA library pool. The techniques outlined here can be applied in-house by smaller tissue engineering groups to generate tools for biomolecular research for large preclinical animal studies and highlights the power of standard cDNA library protocols to uncover novel genes. PMID:24447069
Mapping Base Modifications in DNA by Transverse-Current Sequencing
NASA Astrophysics Data System (ADS)
Alvarez, Jose R.; Skachkov, Dmitry; Massey, Steven E.; Kalitsov, Alan; Velev, Julian P.
2018-02-01
Sequencing DNA modifications and lesions, such as methylation of cytosine and oxidation of guanine, is even more important and challenging than sequencing the genome itself. The traditional methods for detecting DNA modifications are either insensitive to these modifications or require additional processing steps to identify a particular type of modification. Transverse-current sequencing in nanopores can potentially identify the canonical bases and base modifications in the same run. In this work, we demonstrate that the most common DNA epigenetic modifications and lesions can be detected with any predefined accuracy based on their tunneling current signature. Our results are based on simulations of the nanopore tunneling current through DNA molecules, calculated using nonequilibrium electron-transport methodology within an effective multiorbital model derived from first-principles calculations, followed by a base-calling algorithm accounting for neighbor current-current correlations. This methodology can be integrated with existing experimental techniques to improve base-calling fidelity.
NASA Astrophysics Data System (ADS)
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
Toward Applications for DNA Nanotechnology-More Bricks To Build With.
Dietz, Hendrik
2016-06-16
Another brick in the wall: DNA nanotechnology has come a long way since its initial beginnings. This would not be possible without the continued development of methods for DNA assembly and new uses for DNA as a material. This Special Issue highlights some of the newest building blocks for nanodevices based on DNA. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Zhang, Yuqin; Lin, Fanbo; Zhang, Youyu; Li, Haitao; Zeng, Yue; Tang, Hao; Yao, Shouzhuo
2011-01-01
A new method for the detection of point mutation in DNA based on the monobase-coded cadmium tellurium nanoprobes and the quartz crystal microbalance (QCM) technique was reported. A point mutation (single-base, adenine, thymine, cytosine, and guanine, namely, A, T, C and G, mutation in DNA strand, respectively) DNA QCM sensor was fabricated by immobilizing single-base mutation DNA modified magnetic beads onto the electrode surface with an external magnetic field near the electrode. The DNA-modified magnetic beads were obtained from the biotin-avidin affinity reaction of biotinylated DNA and streptavidin-functionalized core/shell Fe(3)O(4)/Au magnetic nanoparticles, followed by a DNA hybridization reaction. Single-base coded CdTe nanoprobes (A-CdTe, T-CdTe, C-CdTe and G-CdTe, respectively) were used as the detection probes. The mutation site in DNA was distinguished by detecting the decreases of the resonance frequency of the piezoelectric quartz crystal when the coded nanoprobe was added to the test system. This proposed detection strategy for point mutation in DNA is proved to be sensitive, simple, repeatable and low-cost, consequently, it has a great potential for single nucleotide polymorphism (SNP) detection. 2011 © The Japan Society for Analytical Chemistry
Chandra, Madhavaiah; Keller, Sascha; Gloeckner, Christian; Bornemann, Benjamin; Marx, Andreas
2007-01-01
The Watson-Crick base pairing of DNA is an advantageous phenomenon that can be exploited when using DNA as a scaffold for directed self-organization of nanometer-sized objects. Several reports have appeared in the literature that describe the generation of branched DNA (bDNA) with variable numbers of arms that self-assembles into predesigned architectures. These bDNA units are generated by using cleverly designed rigid crossover DNA molecules. Alternatively, bDNA can be generated by using synthetic branch points derived from either nucleoside or non-nucleoside building blocks. Branched DNA has scarcely been explored for use in nanotechnology or from self-assembling perspectives. Herein, we wish to report our results for the synthesis, characterization, and assembling properties of asymmetrical bDNA molecules that are able to generate linear and circular bDNA constructs. Our strategy for the generation of bDNA is based on a branching point that makes use of a novel protecting-group strategy. The bDNA units were generated by means of automated DNA synthesis methods and were used to generate novel objects by employing chemical and biological techniques. The entities generated might be useful building blocks for DNA-based nanobiotechnology.
Enzyme-free detection and quantification of double-stranded nucleic acids.
Feuillie, Cécile; Merheb, Maxime Mohamad; Gillet, Benjamin; Montagnac, Gilles; Hänni, Catherine; Daniel, Isabelle
2012-08-01
We have developed a fully enzyme-free SERRS hybridization assay for specific detection of double-stranded DNA sequences. Although all DNA detection methods ranging from PCR to high-throughput sequencing rely on enzymes, this method is unique for being totally non-enzymatic. The efficiency of enzymatic processes is affected by alterations, modifications, and/or quality of DNA. For instance, a limitation of most DNA polymerases is their inability to process DNA damaged by blocking lesions. As a result, enzymatic amplification and sequencing of degraded DNA often fail. In this study we succeeded in detecting and quantifying, within a mixture, relative amounts of closely related double-stranded DNA sequences from Rupicapra rupicapra (chamois) and Capra hircus (goat). The non-enzymatic SERRS assay presented here is the corner stone of a promising approach to overcome the failure of DNA polymerase when DNA is too degraded or when the concentration of polymerase inhibitors is too high. It is the first time double-stranded DNA has been detected with a truly non-enzymatic SERRS-based method. This non-enzymatic, inexpensive, rapid assay is therefore a breakthrough in nucleic acid detection.
End-specific strategies of attachment of long double stranded DNA onto gold-coated nanofiber arrays
NASA Astrophysics Data System (ADS)
Peckys, Diana B.; de Jonge, Niels; Simpson, Michael L.; McKnight, Timothy E.
2008-10-01
We report the effective and site-specific binding of long double stranded (ds)DNA to high aspect ratio carbon nanofiber arrays. The carbon nanofibers were first coated with a thin gold layer to provide anchorage for two controllable binding methods. One method was based on the direct binding of thiol end-labeled dsDNA. The second and enhanced method used amine end-labeled dsDNA bound with crosslinkers to a carboxyl-terminated self-assembled monolayer. The bound dsDNA was first visualized with a fluorescent, dsDNA-intercalating dye. The specific binding onto the carbon nanofiber was verified by a high resolution detection method using scanning electron microscopy in combination with the binding of neutravidin-coated fluorescent microspheres to the immobilized and biotinylated dsDNA. Functional activity of thiol end-labeled dsDNA on gold-coated nanofiber arrays was verified with a transcriptional assay, whereby Chinese hamster lung cells (V79) were impaled upon the DNA-modified nanofibers and scored for transgene expression of the tethered template. Thiol end-labeled dsDNA demonstrated significantly higher expression levels than nanofibers prepared with control dsDNA that lacked a gold-binding end-label. Employing these site-specific and robust techniques of immobilization of dsDNA onto nanodevices can be of advantage for the study of DNA/protein interactions and for gene delivery applications.
Agreda, Patricia M.; Beitman, Gerard H.; Gutierrez, Erin C.; Harris, James M.; Koch, Kristopher R.; LaViers, William D.; Leitch, Sharon V.; Maus, Courtney E.; McMillian, Ray A.; Nussbaumer, William A.; Palmer, Marcus L. R.; Porter, Michael J.; Richart, Gregory A.; Schwab, Ryan J.
2013-01-01
We evaluated the effect of storage at 2 to 8°C on the stability of human genomic and human papillomavirus (HPV) DNA stored in BD SurePath and Hologic PreservCyt liquid-based cytology media. DNA retained the ability to be extracted and PCR amplified for more than 2.5 years in both medium types. Prior inability to detect DNA in archived specimens may have been due to failure of the extraction method to isolate DNA from fixed cells. PMID:23678069
Analysis of Cellular DNA Content by Flow Cytometry.
Darzynkiewicz, Zbigniew; Huang, Xuan; Zhao, Hong
2017-10-02
Cellular DNA content can be measured by flow cytometry with the aim of : (1) revealing cell distribution within the major phases of the cell cycle, (2) estimating frequency of apoptotic cells with fractional DNA content, and/or (3) disclosing DNA ploidy of the measured cell population. In this unit, simple and universally applicable methods for staining fixed cells are presented, as are methods that utilize detergents and/or proteolytic treatment to permeabilize cells and make DNA accessible to fluorochrome. Additionally, supravital cell staining with Hoechst 33342, which is primarily used for sorting live cells based on DNA-content differences for their subsequent culturing, is described. Also presented are methods for staining cell nuclei isolated from paraffin-embedded tissues. Available algorithms are listed for deconvolution of DNA-content-frequency histograms to estimate percentage of cells in major phases of the cell cycle and frequency of apoptotic cells with fractional DNA content. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley and Sons, Inc.
Ni, Yongnian; Wei, Min; Kokot, Serge
2011-11-01
Interaction of isoprenaline (ISO) with calf-thymus DNA was studied by spectroscopic and electrochemical methods. The behavior of ISO was investigated at a glassy carbon electrode (GCE) by cyclic voltammetry (CV) and differential pulse stripping voltammetry (DPSV); ISO was oxidized and an irreversible oxidation peak was observed. The binding constant K and the stoichiometric coefficient m of ISO with DNA were evaluated. Also, with the addition of DNA, hyperchromicity of the UV-vis absorption spectra of ISO was noted, while the fluorescence intensity decreased significantly. Multivariate curve resolution-alternating least squares (MCR-ALS) chemometrics method was applied to resolve the combined spectroscopic data matrix, which was obtained by the UV-vis and fluorescence methods. Pure spectra of ISO, DNA and ISO-DNA complex, and their concentration profiles were then successfully obtained. The results indicated that the ISO molecule intercalated into the base-pairs of DNA, and the complex of ISO-DNA was formed. Copyright © 2011 Elsevier B.V. All rights reserved.
Analysis of Cellular DNA Content by Flow Cytometry.
Darzynkiewicz, Zbigniew; Huang, Xuan; Zhao, Hong
2017-11-01
Cellular DNA content can be measured by flow cytometry with the aim of : (1) revealing cell distribution within the major phases of the cell cycle, (2) estimating frequency of apoptotic cells with fractional DNA content, and/or (3) disclosing DNA ploidy of the measured cell population. In this unit, simple and universally applicable methods for staining fixed cells are presented, as are methods that utilize detergents and/or proteolytic treatment to permeabilize cells and make DNA accessible to fluorochrome. Additionally, supravital cell staining with Hoechst 33342, which is primarily used for sorting live cells based on DNA-content differences for their subsequent culturing, is described. Also presented are methods for staining cell nuclei isolated from paraffin-embedded tissues. Available algorithms are listed for deconvolution of DNA-content-frequency histograms to estimate percentage of cells in major phases of the cell cycle and frequency of apoptotic cells with fractional DNA content. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley and Sons, Inc.
DNABIT Compress - Genome compression algorithm.
Rajarajeswari, Pothuraju; Apparao, Allam
2011-01-22
Data compression is concerned with how information is organized in data. Efficient storage means removal of redundancy from the data being stored in the DNA molecule. Data compression algorithms remove redundancy and are used to understand biologically important molecules. We present a compression algorithm, "DNABIT Compress" for DNA sequences based on a novel algorithm of assigning binary bits for smaller segments of DNA bases to compress both repetitive and non repetitive DNA sequence. Our proposed algorithm achieves the best compression ratio for DNA sequences for larger genome. Significantly better compression results show that "DNABIT Compress" algorithm is the best among the remaining compression algorithms. While achieving the best compression ratios for DNA sequences (Genomes),our new DNABIT Compress algorithm significantly improves the running time of all previous DNA compression programs. Assigning binary bits (Unique BIT CODE) for (Exact Repeats, Reverse Repeats) fragments of DNA sequence is also a unique concept introduced in this algorithm for the first time in DNA compression. This proposed new algorithm could achieve the best compression ratio as much as 1.58 bits/bases where the existing best methods could not achieve a ratio less than 1.72 bits/bases.
Validated method for quantification of genetically modified organisms in samples of maize flour.
Kunert, Renate; Gach, Johannes S; Vorauer-Uhl, Karola; Engel, Edwin; Katinger, Hermann
2006-02-08
Sensitive and accurate testing for trace amounts of biotechnology-derived DNA from plant material is the prerequisite for detection of 1% or 0.5% genetically modified ingredients in food products or raw materials thereof. Compared to ELISA detection of expressed proteins, real-time PCR (RT-PCR) amplification has easier sample preparation and detection limits are lower. Of the different methods of DNA preparation CTAB method with high flexibility in starting material and generation of sufficient DNA with relevant quality was chosen. Previous RT-PCR data generated with the SYBR green detection method showed that the method is highly sensitive to sample matrices and genomic DNA content influencing the interpretation of results. Therefore, this paper describes a real-time DNA quantification based on the TaqMan probe method, indicating high accuracy and sensitivity with detection limits of lower than 18 copies per sample applicable and comparable to highly purified plasmid standards as well as complex matrices of genomic DNA samples. The results were evaluated with ValiData for homology of variance, linearity, accuracy of the standard curve, and standard deviation.
Belmonte, Frances R; Martin, James L; Frescura, Kristin; Damas, Joana; Pereira, Filipe; Tarnopolsky, Mark A; Kaufman, Brett A
2016-04-28
Mitochondrial DNA (mtDNA) mutations are a common cause of primary mitochondrial disorders, and have also been implicated in a broad collection of conditions, including aging, neurodegeneration, and cancer. Prevalent among these pathogenic variants are mtDNA deletions, which show a strong bias for the loss of sequence in the major arc between, but not including, the heavy and light strand origins of replication. Because individual mtDNA deletions can accumulate focally, occur with multiple mixed breakpoints, and in the presence of normal mtDNA sequences, methods that detect broad-spectrum mutations with enhanced sensitivity and limited costs have both research and clinical applications. In this study, we evaluated semi-quantitative and digital PCR-based methods of mtDNA deletion detection using double-stranded reference templates or biological samples. Our aim was to describe key experimental assay parameters that will enable the analysis of low levels or small differences in mtDNA deletion load during disease progression, with limited false-positive detection. We determined that the digital PCR method significantly improved mtDNA deletion detection sensitivity through absolute quantitation, improved precision and reduced assay standard error.
Belmonte, Frances R.; Martin, James L.; Frescura, Kristin; Damas, Joana; Pereira, Filipe; Tarnopolsky, Mark A.; Kaufman, Brett A.
2016-01-01
Mitochondrial DNA (mtDNA) mutations are a common cause of primary mitochondrial disorders, and have also been implicated in a broad collection of conditions, including aging, neurodegeneration, and cancer. Prevalent among these pathogenic variants are mtDNA deletions, which show a strong bias for the loss of sequence in the major arc between, but not including, the heavy and light strand origins of replication. Because individual mtDNA deletions can accumulate focally, occur with multiple mixed breakpoints, and in the presence of normal mtDNA sequences, methods that detect broad-spectrum mutations with enhanced sensitivity and limited costs have both research and clinical applications. In this study, we evaluated semi-quantitative and digital PCR-based methods of mtDNA deletion detection using double-stranded reference templates or biological samples. Our aim was to describe key experimental assay parameters that will enable the analysis of low levels or small differences in mtDNA deletion load during disease progression, with limited false-positive detection. We determined that the digital PCR method significantly improved mtDNA deletion detection sensitivity through absolute quantitation, improved precision and reduced assay standard error. PMID:27122135
DNA-BASED METHODS FOR MONITORING INVASIVE SPECIES: A REVIEW AND PROSPECTUS
The recent explosion of interest in DNA-based tools for species identification has prompted widespread speculation on the future availability of inexpensive, rapid and accurate means of identifying specimens and assessing biodiversity. One applied field that may benefit dramatic...
Mckee, Anna; Calhoun, Daniel L.; Barichivich, William J.; Spear, Stephen F.; Goldberg, Caren S.; Glenn, Travis C
2015-01-01
Environmental DNA (eDNA) is an emerging tool that allows low-impact sampling for aquatic species by isolating DNA from water samples and screening for DNA sequences specific to species of interest. However, researchers have not tested this method in naturally acidic wetlands that provide breeding habitat for a number of imperiled species, including the frosted salamander (Ambystoma cingulatum), reticulated flatwoods salamanders (Ambystoma bishopi), striped newt (Notophthalmus perstriatus), and gopher frog (Lithobates capito). Our objectives for this study were to develop and optimize eDNA survey protocols and assays to complement and enhance capture-based survey methods for these amphibian species. We collected three or more water samples, dipnetted or trapped larval and adult amphibians, and conducted visual encounter surveys for egg masses for target species at 40 sites on 12 different longleaf pine (Pinus palustris) tracts. We used quantitative PCRs to screen eDNA from each site for target species presence. We detected flatwoods salamanders at three sites with eDNA but did not detect them during physical surveys. Based on the sample location we assumed these eDNA detections to indicate the presence of frosted flatwoods salamanders. We did not detect reticulated flatwoods salamanders. We detected striped newts with physical and eDNA surveys at two wetlands. We detected gopher frogs at 12 sites total, three with eDNA alone, two with physical surveys alone, and seven with physical and eDNA surveys. We detected our target species with eDNA at 9 of 11 sites where they were present as indicated from traditional surveys and at six sites where they were not detected with traditional surveys. It was, however, critical to use at least three water samples per site for eDNA. Our results demonstrate eDNA surveys can be a useful complement to traditional survey methods for detecting imperiled pond-breeding amphibians. Environmental DNA may be particularly useful in situations where detection probability using traditional survey methods is low or access by trained personnel is limited.
Rudi, Knut; Flateland, Signe L; Hanssen, Jon Fredrik; Bengtsson, Gunnar; Nissen, Hilde
2002-03-01
There is a clear need for new approaches in the field of microbial community analyses, since the methods used can be severely biased. We have developed a DNA array-based method that targets 16S ribosomal DNA (rDNA), enabling the direct detection and quantification of microorganisms from complex communities without cultivation. The approach is based on the construction of specific probes from the 16S rDNA sequence data retrieved directly from the communities. The specificity of the assay is obtained through a combination of DNA array hybridization and enzymatic labeling of the constructed probes. Cultivation-dependent assays (enrichment and plating) and cultivation-independent assays (direct fluorescence microscopy and scanning electron microscopy) were used as reference methods in the development and evaluation of the method. The description of microbial communities in ready-to-eat vegetable salads in a modified atmosphere was used as the experimental model. Comparisons were made with respect to the effect of storage at different temperatures for up to 12 days and with respect to the geographic origin of the crisphead lettuce (Spanish or Norwegian), the main salad component. The conclusion drawn from the method comparison was that the DNA array-based method gave an accurate description of the microbial communities. Pseudomonas spp. dominated both of the salad batches, containing either Norwegian or Spanish lettuce, before storage and after storage at 4 degrees C. The Pseudomonas population also dominated the batch containing Norwegian lettuce after storage at 10 degrees C. On the contrary, Enterobacteriaceae and lactic acid bacteria dominated the microbial community of the batch containing Spanish lettuce after storage at 10 degrees C. In that batch, the Enterobacteriaceae also were abundant after storage at 4 degrees C as well as before storage. The practical implications of these results are that microbial communities in ready-to-eat vegetable salads can be diverse and that microbial composition is dependent both on the origin of the raw material and on the storage conditions.
Rudi, Knut; Flateland, Signe L.; Hanssen, Jon Fredrik; Bengtsson, Gunnar; Nissen, Hilde
2002-01-01
There is a clear need for new approaches in the field of microbial community analyses, since the methods used can be severely biased. We have developed a DNA array-based method that targets16S ribosomal DNA (rDNA), enabling the direct detection and quantification of microorganisms from complex communities without cultivation. The approach is based on the construction of specific probes from the 16S rDNA sequence data retrieved directly from the communities. The specificity of the assay is obtained through a combination of DNA array hybridization and enzymatic labeling of the constructed probes. Cultivation-dependent assays (enrichment and plating) and cultivation-independent assays (direct fluorescence microscopy and scanning electron microscopy) were used as reference methods in the development and evaluation of the method. The description of microbial communities in ready-to-eat vegetable salads in a modified atmosphere was used as the experimental model. Comparisons were made with respect to the effect of storage at different temperatures for up to 12 days and with respect to the geographic origin of the crisphead lettuce (Spanish or Norwegian), the main salad component. The conclusion drawn from the method comparison was that the DNA array-based method gave an accurate description of the microbial communities. Pseudomonas spp. dominated both of the salad batches, containing either Norwegian or Spanish lettuce, before storage and after storage at 4°C. The Pseudomonas population also dominated the batch containing Norwegian lettuce after storage at 10°C. On the contrary, Enterobacteriaceae and lactic acid bacteria dominated the microbial community of the batch containing Spanish lettuce after storage at 10°C. In that batch, the Enterobacteriaceae also were abundant after storage at 4°C as well as before storage. The practical implications of these results are that microbial communities in ready-to-eat vegetable salads can be diverse and that microbial composition is dependent both on the origin of the raw material and on the storage conditions. PMID:11872462
DNA Based Molecular Scale Nanofabrication
2015-12-04
structure. We developed a method to produce nanoscale patterns on SAM. (d) Studied the molecular imprinting of DNA origami structure using polymer...to produce nanoscale patterns on SAM. (d) Studied the molecular imprinting of DNA origami structure using polymer substrates. Developed a high... imprinting using DNA nanostructure templates. Soft lithography uses polymeric stamps with certain features to transfer the pattern for printing
Hou, Sen; Sun, Lili; Wieczorek, Stefan A; Kalwarczyk, Tomasz; Kaminski, Tomasz S; Holyst, Robert
2014-01-15
Fluorescent double-stranded DNA (dsDNA) molecules labeled at both ends are commonly produced by annealing of complementary single-stranded DNA (ssDNA) molecules, labeled with fluorescent dyes at the same (3' or 5') end. Because the labeling efficiency of ssDNA is smaller than 100%, the resulting dsDNA have two, one or are without a dye. Existing methods are insufficient to measure the percentage of the doubly-labeled dsDNA component in the fluorescent DNA sample and it is even difficult to distinguish the doubly-labeled DNA component from the singly-labeled component. Accurate measurement of the percentage of such doubly labeled dsDNA component is a critical prerequisite for quantitative biochemical measurements, which has puzzled scientists for decades. We established a fluorescence correlation spectroscopy (FCS) system to measure the percentage of doubly labeled dsDNA (PDL) in the total fluorescent dsDNA pool. The method is based on comparative analysis of the given sample and a reference dsDNA sample prepared by adding certain amount of unlabeled ssDNA into the original ssDNA solution. From FCS autocorrelation functions, we obtain the number of fluorescent dsDNA molecules in the focal volume of the confocal microscope and PDL. We also calculate the labeling efficiency of ssDNA. The method requires minimal amount of material. The samples have the concentration of DNA in the nano-molar/L range and the volume of tens of microliters. We verify our method by using restriction enzyme Hind III to cleave the fluorescent dsDNA. The kinetics of the reaction depends strongly on PDL, a critical parameter for quantitative biochemical measurements. Copyright © 2013 Elsevier B.V. All rights reserved.
Zhang, Xianxia; Xiao, Kunyi; Cheng, Liwei; Chen, Hui; Liu, Baohong; Zhang, Song; Kong, Jilie
2014-06-03
Rapid and efficient detection of cancer cells at their earliest stages is one of the central challenges in cancer diagnostics. We developed a simple, cost-effective, and highly sensitive colorimetric method for visually detecting rare cancer cells based on cell-triggered cyclic enzymatic signal amplification (CTCESA). In the absence of target cells, hairpin aptamer probes (HAPs) and linker DNAs stably coexist in solution, and the linker DNA assembles DNA-AuNPs, producing a purple solution. In the presence of target cells, the specific binding of HAPs to the target cells triggers a conformational switch that results in linker DNA hybridization and cleavage by nicking endonuclease-strand scission cycles. Consequently, the cleaved fragments of linker DNA can no longer assemble into DNA-AuNPs, resulting in a red color. UV-vis spectrometry and photograph analyses demonstrated that this CTCESA-based method exhibited selective and sensitive colorimetric responses to the presence of target CCRF-CEM cells, which could be detected by the naked eye. The linear response for CCRF-CEM cells in a concentration range from 10(2) to 10(4) cells was obtained with a detection limit of 40 cells, which is approximately 20 times lower than the detection limit of normal AuNP-based methods without amplification. Given the high specificity and sensitivity of CTCESA, this colorimetric method provides a sensitive, label-free, and cost-effective approach for early cancer diagnosis and point-to-care applications.
Shrink-induced silica multiscale structures for enhanced fluorescence from DNA microarrays.
Sharma, Himanshu; Wood, Jennifer B; Lin, Sophia; Corn, Robert M; Khine, Michelle
2014-09-23
We describe a manufacturable and scalable method for fabrication of multiscale wrinkled silica (SiO2) structures on shrink-wrap film to enhance fluorescence signals in DNA fluorescence microarrays. We are able to enhance the fluorescence signal of hybridized DNA by more than 120 fold relative to a planar glass slide. Notably, our substrate has improved detection sensitivity (280 pM) relative to planar glass slide (11 nM). Furthermore, this is accompanied by a 30-45 times improvement in the signal-to-noise ratio (SNR). Unlike metal enhanced fluorescence (MEF) based enhancements, this is a far-field and uniform effect based on surface concentration and photophysical effects from the nano- to microscale SiO2 structures. Notably, the photophysical effects contribute an almost 2.5 fold enhancement over the concentration effects alone. Therefore, this simple and robust method offers an efficient technique to enhance the detection capabilities of fluorescence based DNA microarrays.
Shrink-Induced Silica Multiscale Structures for Enhanced Fluorescence from DNA Microarrays
2015-01-01
We describe a manufacturable and scalable method for fabrication of multiscale wrinkled silica (SiO2) structures on shrink-wrap film to enhance fluorescence signals in DNA fluorescence microarrays. We are able to enhance the fluorescence signal of hybridized DNA by more than 120 fold relative to a planar glass slide. Notably, our substrate has improved detection sensitivity (280 pM) relative to planar glass slide (11 nM). Furthermore, this is accompanied by a 30–45 times improvement in the signal-to-noise ratio (SNR). Unlike metal enhanced fluorescence (MEF) based enhancements, this is a far-field and uniform effect based on surface concentration and photophysical effects from the nano- to microscale SiO2 structures. Notably, the photophysical effects contribute an almost 2.5 fold enhancement over the concentration effects alone. Therefore, this simple and robust method offers an efficient technique to enhance the detection capabilities of fluorescence based DNA microarrays. PMID:25191785
Gold Nanoparticles-Based Barcode Analysis for Detection of Norepinephrine.
An, Jeung Hee; Lee, Kwon-Jai; Choi, Jeong-Woo
2016-02-01
Nanotechnology-based bio-barcode amplification analysis offers an innovative approach for detecting neurotransmitters. We evaluated the efficacy of this method for detecting norepinephrine in normal and oxidative-stress damaged dopaminergic cells. Our approach use a combination of DNA barcodes and bead-based immunoassays for detecting neurotransmitters with surface-enhanced Raman spectroscopy (SERS), and provides polymerase chain reaction (PCR)-like sensitivity. This method relies on magnetic Dynabeads containing antibodies and nanoparticles that are loaded both with DNA barcords and with antibodies that can sandwich the target protein captured by the Dynabead-bound antibodies. The aggregate sandwich structures are magnetically separated from the solution and treated to remove the conjugated barcode DNA. The DNA barcodes are then identified by SERS and PCR analysis. The concentration of norepinephrine in dopaminergic cells can be readily detected using the bio-barcode assay, which is a rapid, high-throughput screening tool for detecting neurotransmitters.
Energy barriers and rates of tautomeric transitions in DNA bases: ab initio quantum chemical study.
Basu, Soumalee; Majumdar, Rabi; Das, Gourab K; Bhattacharyya, Dhananjay
2005-12-01
Tautomeric transitions of DNA bases are proton transfer reactions, which are important in biology. These reactions are involved in spontaneous point mutations of the genetic material. In the present study, intrinsic reaction coordinates (IRC) analyses through ab initio quantum chemical calculations have been carried out for the individual DNA bases A, T, G, C and also A:T and G:C base pairs to estimate the kinetic and thermodynamic barriers using MP2/6-31G** method for tautomeric transitions. Relatively higher values of kinetic barriers (about 50-60 kcal/mol) have been observed for the single bases, indicating that tautomeric alterations of isolated single bases are quite unlikely. On the other hand, relatively lower values of the kinetic barriers (about 20-25 kcal/mol) for the DNA base pairs A:T and G:C clearly suggest that the tautomeric shifts are much more favorable in DNA base pairs than in isolated single bases. The unusual base pairing A':C, T':G, C':A or G':T in the daughter DNA molecule, resulting from a parent DNA molecule with tautomeric shifts, is found to be stable enough to result in a mutation. The transition rate constants for the single DNA bases in addition to the base pairs are also calculated by computing the free energy differences between the transition states and the reactants.
Development of a molecular method for testing the effectiveness of UV systems on-site.
Nizri, Limor; Vaizel-Ohayon, Dalit; Ben-Amram, Hila; Sharaby, Yehonatan; Halpern, Malka; Mamane, Hadas
2017-12-15
We established a molecular method for quantifying ultraviolet (UV) disinfection efficacy using total bacterial DNA in a water sample. To evaluate UV damage to the DNA, we developed the "DNA damage" factor, which is a novel cultivation-independent approach that reveals UV-exposure efficiency by applying a simple PCR amplification method. The study's goal was to prove the feasibility of this method for demonstrating the efficiency of UV systems in the field using flow-through UV reactors. In laboratory-based experiments using seeded bacteria, the DNA damage tests demonstrated a good correlation between PCR products and UV dose. In the field, natural groundwater sampled before and after being subjected to the full-scale UV reactors was filtered, and the DNA extracted from the filtrate was subjected to PCR amplification for a 900-bp fragment of the 16S rRNA gene with initial DNA concentrations of 0.1 and 1 ng/μL. In both cases, the UV dose predicted and explained a significant proportion of the variance in the log inactivation ratio and DNA damage factor. Log inactivation ratio was very low, as expected in groundwater due to low initial bacterial counts, whereas the DNA damage factor was within the range of values obtained in the laboratory-based experiments. Consequently, the DNA damage factor reflected the true performance of the full-scale UV system during operational water flow by using the indigenous bacterial array present in a water sample. By applying this method, we were able to predict with high confidence, the UV reactor inactivation potential. For method validation, laboratory and field iterations are required to create a practical field calibration curve that can be used to determine the expected efficiency of the full-scale UV system in the field under actual operation. Copyright © 2017 Elsevier Ltd. All rights reserved.
Noise reduction in single time frame optical DNA maps
Müller, Vilhelm; Westerlund, Fredrik
2017-01-01
In optical DNA mapping technologies sequence-specific intensity variations (DNA barcodes) along stretched and stained DNA molecules are produced. These “fingerprints” of the underlying DNA sequence have a resolution of the order one kilobasepairs and the stretching of the DNA molecules are performed by surface adsorption or nano-channel setups. A post-processing challenge for nano-channel based methods, due to local and global random movement of the DNA molecule during imaging, is how to align different time frames in order to produce reproducible time-averaged DNA barcodes. The current solutions to this challenge are computationally rather slow. With high-throughput applications in mind, we here introduce a parameter-free method for filtering a single time frame noisy barcode (snap-shot optical map), measured in a fraction of a second. By using only a single time frame barcode we circumvent the need for post-processing alignment. We demonstrate that our method is successful at providing filtered barcodes which are less noisy and more similar to time averaged barcodes. The method is based on the application of a low-pass filter on a single noisy barcode using the width of the Point Spread Function of the system as a unique, and known, filtering parameter. We find that after applying our method, the Pearson correlation coefficient (a real number in the range from -1 to 1) between the single time-frame barcode and the time average of the aligned kymograph increases significantly, roughly by 0.2 on average. By comparing to a database of more than 3000 theoretical plasmid barcodes we show that the capabilities to identify plasmids is improved by filtering single time-frame barcodes compared to the unfiltered analogues. Since snap-shot experiments and computational time using our method both are less than a second, this study opens up for high throughput optical DNA mapping with improved reproducibility. PMID:28640821
Fernández-Soto, Pedro; Velasco Tirado, Virginia; Carranza Rodríguez, Cristina; Pérez-Arellano, José Luis; Muro, Antonio
2013-01-01
Background Human schistosomiasis remains a serious worldwide public health problem. At present, a sensitive and specific assay for routine diagnosis of schistosome infection is not yet available. The potential for detecting schistosome-derived DNA by PCR-based methods in human clinical samples is currently being investigated as a diagnostic tool with potential application in routine schistosomiasis diagnosis. Collection of diagnostic samples such as stool or blood is usually difficult in some populations. However, urine is a biological sample that can be collected in a non-invasive method, easy to get from people of all ages and easy in management, but as a sample for PCR diagnosis is still not widely used. This could be due to the high variability in the reported efficiency of detection as a result of the high variation in urine samples’ storage or conditions for handling and DNA preservation and extraction methods. Methodology/Principal Findings We evaluate different commercial DNA extraction methods from a series of long-term frozen storage human urine samples from patients with parasitological confirmed schistosomiasis in order to assess the PCR effectiveness for Schistosoma spp. detection. Patientś urine samples were frozen for 18 months up to 7 years until use. Results were compared with those obtained in PCR assays using fresh healthy human urine artificially contaminated with Schistosoma mansoni DNA and urine samples from mice experimentally infected with S. mansoni cercariae stored frozen for at least 12 months before use. PCR results in fresh human artificial urine samples using different DNA based extraction methods were much more effective than those obtained when long-term frozen human urine samples were used as the source of DNA template. Conclusions/Significance Long-term frozen human urine samples are probably not a good source for DNA extraction for use as a template in PCR detection of Schistosoma spp., regardless of the DNA method of extraction used. PMID:23613907
Fernández-Soto, Pedro; Velasco Tirado, Virginia; Carranza Rodríguez, Cristina; Pérez-Arellano, José Luis; Muro, Antonio
2013-01-01
Human schistosomiasis remains a serious worldwide public health problem. At present, a sensitive and specific assay for routine diagnosis of schistosome infection is not yet available. The potential for detecting schistosome-derived DNA by PCR-based methods in human clinical samples is currently being investigated as a diagnostic tool with potential application in routine schistosomiasis diagnosis. Collection of diagnostic samples such as stool or blood is usually difficult in some populations. However, urine is a biological sample that can be collected in a non-invasive method, easy to get from people of all ages and easy in management, but as a sample for PCR diagnosis is still not widely used. This could be due to the high variability in the reported efficiency of detection as a result of the high variation in urine samples' storage or conditions for handling and DNA preservation and extraction methods. We evaluate different commercial DNA extraction methods from a series of long-term frozen storage human urine samples from patients with parasitological confirmed schistosomiasis in order to assess the PCR effectiveness for Schistosoma spp. detection. Patients urine samples were frozen for 18 months up to 7 years until use. Results were compared with those obtained in PCR assays using fresh healthy human urine artificially contaminated with Schistosoma mansoni DNA and urine samples from mice experimentally infected with S. mansoni cercariae stored frozen for at least 12 months before use. PCR results in fresh human artificial urine samples using different DNA based extraction methods were much more effective than those obtained when long-term frozen human urine samples were used as the source of DNA template. Long-term frozen human urine samples are probably not a good source for DNA extraction for use as a template in PCR detection of Schistosoma spp., regardless of the DNA method of extraction used.
Electrochemical DNA hybridization sensors based on conducting polymers.
Rahman, Md Mahbubur; Li, Xiao-Bo; Lopa, Nasrin Siraj; Ahn, Sang Jung; Lee, Jae-Joon
2015-02-05
Conducting polymers (CPs) are a group of polymeric materials that have attracted considerable attention because of their unique electronic, chemical, and biochemical properties. This is reflected in their use in a wide range of potential applications, including light-emitting diodes, anti-static coating, electrochromic materials, solar cells, chemical sensors, biosensors, and drug-release systems. Electrochemical DNA sensors based on CPs can be used in numerous areas related to human health. This review summarizes the recent progress made in the development and use of CP-based electrochemical DNA hybridization sensors. We discuss the distinct properties of CPs with respect to their use in the immobilization of probe DNA on electrode surfaces, and we describe the immobilization techniques used for developing DNA hybridization sensors together with the various transduction methods employed. In the concluding part of this review, we present some of the challenges faced in the use of CP-based DNA hybridization sensors, as well as a future perspective.
Bi, Lin; Yu, Yuan-Hua
2015-04-05
Mercaptopropionic acid-capped Mn-doped ZnS quantum dots/ethidium bromide (EB) nanohybrids were constructed for photoinduced electron transfer (PIET) and then used as a room-temperature phosphorescence (RTP) probe for DNA detection. EB could quench the RTP of Mn-doped ZnS QDs by PIET, thereby forming Mn-doped ZnS QDs/EB nanohybrids and storing RTP. Meanwhile, EB could be inserted into DNA and EB could be competitively desorbed from the surface of Mn-doped ZnS QDs by DNA, thereby releasing the RTP of Mn-doped ZnS QDs. Based on this mechanism, a RTP sensor for DNA detection was developed. Under optimal conditions, the detection limit for DNA was 0.045 mg L(-1), the relative standard deviation was 1.7%, and the method linear ranged from 0.2 to 20 mg L(-1). The proposed method was applied to biological fluids, in which satisfactory results were obtained. Copyright © 2015 Elsevier B.V. All rights reserved.
Zhao, Yuancun; Chen, Xiaogang; Yang, Yiwen; Zhao, Xiaohong; Zhang, Shu; Gao, Zehua; Fang, Ting; Wang, Yufang; Zhang, Ji
2018-05-07
Diatom examination has always been used for the diagnosis of drowning in forensic practice. However, traditional examination of the microscopic features of diatom frustules is time-consuming and requires taxonomic expertise. In this study, we demonstrate a potential DNA-based method of inferring suspected drowning site using pyrosequencing (PSQ) of the V7 region of 18S ribosome DNA (18S rDNA) as a diatom DNA barcode. By employing a sparse representation-based AdvISER-M-PYRO algorithm, the original PSQ signals of diatom DNA mixtures were deciphered to determine the corresponding taxa of the composite diatoms. Additionally, we evaluated the possibility of correlating water samples to collection sites by analyzing the PSQ signal profiles of diatom mixtures contained in the water samples via multidimensional scaling. The results suggest that diatomaceous PSQ profile analysis could be used as a cost-effective method to deduce the geographical origin of an environmental bio-sample.
Direct on-chip DNA synthesis using electrochemically modified gold electrodes as solid support
NASA Astrophysics Data System (ADS)
Levrie, Karen; Jans, Karolien; Schepers, Guy; Vos, Rita; Van Dorpe, Pol; Lagae, Liesbet; Van Hoof, Chris; Van Aerschot, Arthur; Stakenborg, Tim
2018-04-01
DNA microarrays have propelled important advancements in the field of genomic research by enabling the monitoring of thousands of genes in parallel. The throughput can be increased even further by scaling down the microarray feature size. In this respect, microelectronics-based DNA arrays are promising as they can leverage semiconductor processing techniques with lithographic resolutions. We propose a method that enables the use of metal electrodes for de novo DNA synthesis without the need for an insulating support. By electrochemically functionalizing gold electrodes, these electrodes can act as solid support for phosphoramidite-based synthesis. The proposed method relies on the electrochemical reduction of diazonium salts, enabling site-specific incorporation of hydroxyl groups onto the metal electrodes. An automated DNA synthesizer was used to couple phosphoramidite moieties directly onto the OH-modified electrodes to obtain the desired oligonucleotide sequence. Characterization was done via cyclic voltammetry and fluorescence microscopy. Our results present a valuable proof-of-concept for the integration of solid-phase DNA synthesis with microelectronics.
Cui, Shaohua; Zhang, Wei; Xiong, Liwen; Pan, Feng; Niu, Yanjie; Chu, Tianqing; Wang, Huimin; Zhao, Yizhuo; Jiang, Liyan
2017-01-10
Capture-based next-generation sequencing (NGS) is a potentially useful diagnostic method to measure tumor tissue DNA in blood as it can identify concordant mutations between cell-free DNA (cfDNA) and primary tumor DNA in lung cancer patients. In this study, the sensitivity, specificity and accuracy of capture-based NGS for detecting ALK fusion in plasma cfDNA was assessed. 24 patients with tissue ALK-positivity and 15 who did not harbor ALK fusion were enrolled. 13 ALK-positive samples were identified by capture-based NGS among the 24 samples with tissue ALK-positivity. In addition to EML4-ALK, 2 rare fusion types (FAM179A-ALK and COL25A1-ALK) were also identified. The overall sensitivity, specificity and accuracy for all cases were 54.2%, 100% and 71.8%, respectively. For patients without distant metastasis (M0-M1a) and patients with distant metastasis (M1b), the sensitivities were 28.6% and 64.7%, respectively. In the 15 patients who received crizotinib, the estimated median PFS was 9.93 months. Thus, captured-based NGS has acceptable sensitivity and excellent specificity for the detection of ALK fusion in plasma cfDNA, especially for patients with distant metastasis. This non-invasive method is clinically feasible for detecting ALK fusion in patients with advanced-stage NSCLC who cannot undergo traumatic examinations or have insufficient tissue samples for molecular tests.
Wang, Xiaolong; Li, Lin; Zhao, Jiaxin; Li, Fangliang; Guo, Wei; Chen, Xia
2017-04-01
To evaluate the effects of different preservation methods (stored in a -20°C ice chest, preserved in liquid nitrogen and dried in silica gel) on inter simple sequence repeat (ISSR) or random amplified polymorphic DNA (RAPD) analyses in various botanical specimens (including broad-leaved plants, needle-leaved plants and succulent plants) for different times (three weeks and three years), we used a statistical analysis based on the number of bands, genetic index and cluster analysis. The results demonstrate that methods used to preserve samples can provide sufficient amounts of genomic DNA for ISSR and RAPD analyses; however, the effect of different preservation methods on these analyses vary significantly, and the preservation time has little effect on these analyses. Our results provide a reference for researchers to select the most suitable preservation method depending on their study subject for the analysis of molecular markers based on genomic DNA. Copyright © 2017 Académie des sciences. Published by Elsevier Masson SAS. All rights reserved.
Structural DNA Nanotechnology: State of the Art and Future Perspective
2015-01-01
Over the past three decades DNA has emerged as an exceptional molecular building block for nanoconstruction due to its predictable conformation and programmable intra- and intermolecular Watson–Crick base-pairing interactions. A variety of convenient design rules and reliable assembly methods have been developed to engineer DNA nanostructures of increasing complexity. The ability to create designer DNA architectures with accurate spatial control has allowed researchers to explore novel applications in many directions, such as directed material assembly, structural biology, biocatalysis, DNA computing, nanorobotics, disease diagnosis, and drug delivery. This Perspective discusses the state of the art in the field of structural DNA nanotechnology and presents some of the challenges and opportunities that exist in DNA-based molecular design and programming. PMID:25029570
Thin film DNA-complex-based dye lasers fabricated by immersion and conventional processes
NASA Astrophysics Data System (ADS)
Kawabe, Yutaka; Suzuki, Yuki
2017-08-01
DNA based thin film dye laser is one of promising optical devices for future technology. Laser oscillation and amplified spontaneous emission (ASE) were demonstrated by hemicyanine-doped DNA complex films prepared with `immersion method' as well as those made by a conventional way. In the immersion process, DNA-surfactant complex films were stained by immersion into an acetone solution including the dyes. In this study, three types of hemicyanines were incorporated with both methods, and laser oscillation was achieved with optically induced population grating formed in all of the complex films. The laser threshold values for six cases ranged in 0.07 - 0.18 mJ/cm2 , which was close to the best values made in DNA complex matrices. Continual pumping showed that laser oscillation persisted for 4 - 10 minutes. Immersion process gave superior laser capability especially for output efficiency over the conventional counterparts.
Antibody-Mediated Small Molecule Detection Using Programmable DNA-Switches.
Rossetti, Marianna; Ippodrino, Rudy; Marini, Bruna; Palleschi, Giuseppe; Porchetta, Alessandro
2018-06-13
The development of rapid, cost-effective, and single-step methods for the detection of small molecules is crucial for improving the quality and efficiency of many applications ranging from life science to environmental analysis. Unfortunately, current methodologies still require multiple complex, time-consuming washing and incubation steps, which limit their applicability. In this work we present a competitive DNA-based platform that makes use of both programmable DNA-switches and antibodies to detect small target molecules. The strategy exploits both the advantages of proximity-based methods and structure-switching DNA-probes. The platform is modular and versatile and it can potentially be applied for the detection of any small target molecule that can be conjugated to a nucleic acid sequence. Here the rational design of programmable DNA-switches is discussed, and the sensitive, rapid, and single-step detection of different environmentally relevant small target molecules is demonstrated.
Pre-Analytical Conditions in Non-Invasive Prenatal Testing of Cell-Free Fetal RHD
Rieneck, Klaus; Krog, Grethe Risum; Nielsen, Leif Kofoed; Tabor, Ann; Dziegiel, Morten Hanefeld
2013-01-01
Background Non-invasive prenatal testing of cell-free fetal DNA (cffDNA) in maternal plasma can predict the fetal RhD type in D negative pregnant women. In Denmark, routine antenatal screening for the fetal RhD gene (RHD) directs the administration of antenatal anti-D prophylaxis only to women who carry an RhD positive fetus. Prophylaxis reduces the risk of immunization that may lead to hemolytic disease of the fetus and the newborn. The reliability of predicting the fetal RhD type depends on pre-analytical factors and assay sensitivity. We evaluated the testing setup in the Capital Region of Denmark, based on data from routine antenatal RHD screening. Methods Blood samples were drawn at gestational age 25 weeks. DNA extracted from 1 mL of plasma was analyzed for fetal RHD using a duplex method for exon 7/10. We investigated the effect of blood sample transportation time (n = 110) and ambient outdoor temperatures (n = 1539) on the levels of cffDNA and total DNA. We compared two different quantification methods, the delta Ct method and a universal standard curve. PCR pipetting was compared on two systems (n = 104). Results The cffDNA level was unaffected by blood sample transportation for up to 9 days and by ambient outdoor temperatures ranging from -10°C to 28°C during transport. The universal standard curve was applicable for cffDNA quantification. Identical levels of cffDNA were observed using the two automated PCR pipetting systems. We detected a mean of 100 fetal DNA copies/mL at a median gestational age of 25 weeks (range 10–39, n = 1317). Conclusion The setup for real-time PCR-based, non-invasive prenatal testing of cffDNA in the Capital Region of Denmark is very robust. Our findings regarding the transportation of blood samples demonstrate the high stability of cffDNA. The applicability of a universal standard curve facilitates easy cffDNA quantification. PMID:24204719
Diffusion modulation of DNA by toehold exchange
NASA Astrophysics Data System (ADS)
Rodjanapanyakul, Thanapop; Takabatake, Fumi; Abe, Keita; Kawamata, Ibuki; Nomura, Shinichiro M.; Murata, Satoshi
2018-05-01
We propose a method to control the diffusion speed of DNA molecules with a target sequence in a polymer solution. The interaction between solute DNA and diffusion-suppressing DNA that has been anchored to a polymer matrix is modulated by the concentration of the third DNA molecule called the competitor by a mechanism called toehold exchange. Experimental results show that the sequence-specific modulation of the diffusion coefficient is successfully achieved. The diffusion coefficient can be modulated up to sixfold by changing the concentration of the competitor. The specificity of the modulation is also verified under the coexistence of a set of DNA with noninteracting base sequences. With this mechanism, we are able to control the diffusion coefficient of individual DNA species by the concentration of another DNA species. This methodology introduces a programmability to a DNA-based reaction-diffusion system.
Song, Weiling; Yin, Wenshuo; Sun, Wenbo; Guo, Xiaoyan; He, Peng; Yang, Xiaoyan; Zhang, Xiaoru
2018-04-24
Detection of ultralow concentrations of nucleic acid sequences is a central challenge in the early diagnosis of genetic diseases. Herein, we developed a target-triggering cascade multiple cycle amplification for ultrasensitive DNA detection using quartz crystal microbalance (QCM) and surface plasmon resonance (SPR). It was based on the exonuclease Ⅲ (Exo Ⅲ)-assisted signal amplification and the hybridization chain reaction (HCR). The streptavidin-coated Au-NPs (Au-NPs-SA) were assembled on the HCR products as recognition element. Upon sensing of target DNA, the duplex DNA probe triggered the Exo Ⅲ cleavage process, accompanied by generating a new secondary target DNA and releasing target DNA. The released target DNA and the secondary target DNA were recycled. Simultaneously, numerous single strands were liberated and acted as the trigger of HCR to generate further signal amplification, resulting in the immobilization of abundant Au-NPs-SA on the gold substrate. The QCM sensor results were found to be comparable to that achieved using a SPR sensor platform. This method exhibited a high sensitivity toward target DNA with a detection limit of 0.70 fM. The high sensitivity and specificity make this method a great potential for detecting DNA with trace amounts in bioanalysis and clinical biomedicine. Copyright © 2018 Elsevier Inc. All rights reserved.
The application of biotechnological methods in authenticity testing.
Popping, Bert
2002-09-11
By counterfeiting brand names in the food and drink industry as well as fraudulently labelling and selling low quality products as premium products, this sector of the industry has lost significant amounts of money and the consumer has been deceived. While it was difficult to establish certain types of fraud before the advent of modern biotechnology, DNA-based methods make an important contribution to protect high-quality brand names and protect the consumer. Several years ago, DNA technologies were considered as methods used in universities, primarily for research purpose, not so much for 'real-life' applications. However, this has changed and a number of laboratories have specialised in offering such services to the industry. This article will review DNA-based techniques commonly used for authenticity testing.
Schijman, Alejandro G.; Bisio, Margarita; Orellana, Liliana; Sued, Mariela; Duffy, Tomás; Mejia Jaramillo, Ana M.; Cura, Carolina; Auter, Frederic; Veron, Vincent; Qvarnstrom, Yvonne; Deborggraeve, Stijn; Hijar, Gisely; Zulantay, Inés; Lucero, Raúl Horacio; Velazquez, Elsa; Tellez, Tatiana; Sanchez Leon, Zunilda; Galvão, Lucia; Nolder, Debbie; Monje Rumi, María; Levi, José E.; Ramirez, Juan D.; Zorrilla, Pilar; Flores, María; Jercic, Maria I.; Crisante, Gladys; Añez, Néstor; De Castro, Ana M.; Gonzalez, Clara I.; Acosta Viana, Karla; Yachelini, Pedro; Torrico, Faustino; Robello, Carlos; Diosque, Patricio; Triana Chavez, Omar; Aznar, Christine; Russomando, Graciela; Büscher, Philippe; Assal, Azzedine; Guhl, Felipe; Sosa Estani, Sergio; DaSilva, Alexandre; Britto, Constança; Luquetti, Alejandro; Ladzins, Janis
2011-01-01
Background A century after its discovery, Chagas disease still represents a major neglected tropical threat. Accurate diagnostics tools as well as surrogate markers of parasitological response to treatment are research priorities in the field. The purpose of this study was to evaluate the performance of PCR methods in detection of Trypanosoma cruzi DNA by an external quality evaluation. Methodology/Findings An international collaborative study was launched by expert PCR laboratories from 16 countries. Currently used strategies were challenged against serial dilutions of purified DNA from stocks representing T. cruzi discrete typing units (DTU) I, IV and VI (set A), human blood spiked with parasite cells (set B) and Guanidine Hidrochloride-EDTA blood samples from 32 seropositive and 10 seronegative patients from Southern Cone countries (set C). Forty eight PCR tests were reported for set A and 44 for sets B and C; 28 targeted minicircle DNA (kDNA), 13 satellite DNA (Sat-DNA) and the remainder low copy number sequences. In set A, commercial master mixes and Sat-DNA Real Time PCR showed better specificity, but kDNA-PCR was more sensitive to detect DTU I DNA. In set B, commercial DNA extraction kits presented better specificity than solvent extraction protocols. Sat-DNA PCR tests had higher specificity, with sensitivities of 0.05–0.5 parasites/mL whereas specific kDNA tests detected 5.10−3 par/mL. Sixteen specific and coherent methods had a Good Performance in both sets A and B (10 fg/µl of DNA from all stocks, 5 par/mL spiked blood). The median values of sensitivities, specificities and accuracies obtained in testing the Set C samples with the 16 tests determined to be good performing by analyzing Sets A and B samples varied considerably. Out of them, four methods depicted the best performing parameters in all three sets of samples, detecting at least 10 fg/µl for each DNA stock, 0.5 par/mL and a sensitivity between 83.3–94.4%, specificity of 85–95%, accuracy of 86.8–89.5% and kappa index of 0.7–0.8 compared to consensus PCR reports of the 16 good performing tests and 63–69%, 100%, 71.4–76.2% and 0.4–0.5, respectively compared to serodiagnosis. Method LbD2 used solvent extraction followed by Sybr-Green based Real time PCR targeted to Sat-DNA; method LbD3 used solvent DNA extraction followed by conventional PCR targeted to Sat-DNA. The third method (LbF1) used glass fiber column based DNA extraction followed by TaqMan Real Time PCR targeted to Sat-DNA (cruzi 1/cruzi 2 and cruzi 3 TaqMan probe) and the fourth method (LbQ) used solvent DNA extraction followed by conventional hot-start PCR targeted to kDNA (primer pairs 121/122). These four methods were further evaluated at the coordinating laboratory in a subset of human blood samples, confirming the performance obtained by the participating laboratories. Conclusion/Significance This study represents a first crucial step towards international validation of PCR procedures for detection of T. cruzi in human blood samples. PMID:21264349
Rapid Detection and Identification of a Pathogen's DNA Using Phi29 DNA Polymerase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xu, Y.; Dunn, J.; Gao, S.
2008-10-31
Zoonotic pathogens including those transmitted by insect vectors are some of the most deadly of all infectious diseases known to mankind. A number of these agents have been further weaponized and are widely recognized as being potentially significant biothreat agents. We describe a novel method based on multiply-primed rolling circle in vitro amplification for profiling genomic DNAs to permit rapid, cultivation-free differential detection and identification of circular plasmids in infectious agents. Using Phi29 DNA polymerase and a two-step priming reaction we could reproducibly detect and characterize by DNA sequencing circular DNA from Borrelia burgdorferi B31 in DNA samples containing asmore » little as 25 pg of Borrelia DNA amongst a vast excess of human DNA. This simple technology can ultimately be adapted as a sensitive method to detect specific DNA from both known and unknown pathogens in a wide variety of complex environments.« less
Research on Image Encryption Based on DNA Sequence and Chaos Theory
NASA Astrophysics Data System (ADS)
Tian Zhang, Tian; Yan, Shan Jun; Gu, Cheng Yan; Ren, Ran; Liao, Kai Xin
2018-04-01
Nowadays encryption is a common technique to protect image data from unauthorized access. In recent years, many scientists have proposed various encryption algorithms based on DNA sequence to provide a new idea for the design of image encryption algorithm. Therefore, a new method of image encryption based on DNA computing technology is proposed in this paper, whose original image is encrypted by DNA coding and 1-D logistic chaotic mapping. First, the algorithm uses two modules as the encryption key. The first module uses the real DNA sequence, and the second module is made by one-dimensional logistic chaos mapping. Secondly, the algorithm uses DNA complementary rules to encode original image, and uses the key and DNA computing technology to compute each pixel value of the original image, so as to realize the encryption of the whole image. Simulation results show that the algorithm has good encryption effect and security.
DNA methylation-based age prediction from various tissues and body fluids
Jung, Sang-Eun; Shin, Kyoung-Jin; Lee, Hwan Young
2017-01-01
Aging is a natural and gradual process in human life. It is influenced by heredity, environment, lifestyle, and disease. DNA methylation varies with age, and the ability to predict the age of donor using DNA from evidence materials at a crime scene is of considerable value in forensic investigations. Recently, many studies have reported age prediction models based on DNA methylation from various tissues and body fluids. Those models seem to be very promising because of their high prediction accuracies. In this review, the changes of age-associated DNA methylation and the age prediction models for various tissues and body fluids were examined, and then the applicability of the DNA methylation-based age prediction method to the forensic investigations was discussed. This will improve the understandings about DNA methylation markers and their potential to be used as biomarkers in the forensic field, as well as the clinical field. PMID:28946940
Jones, Peter A.; Gevers, Wieland; Hawtrey, Arthur O.
1973-01-01
The binding of [3H]3-methylcholanthrene to the DNA of hamster fibroblasts was studied by using chemical methods for DNA degradation. DNA depurinated by mild acid hydrolysis released approximately half of the radioactivity at the same rate as the purine bases, but the resulting apurinic acid still contained radioactive carcinogen. PMID:4797167
Kereszturya, László; Rajczya, Katalin; Lászikb, András; Gyódia, Eva; Pénzes, Mária; Falus, András; Petrányia, Gyõzõ G
2002-03-01
In cases of disputed paternity, the scientific goal is to promote either the exclusion of a falsely accused man or the affiliation of the alleged father. Until now, in addition to anthropologic characteristics, the determination of genetic markers included human leukocyte antigen gene variants; erythrocyte antigens and serum proteins were used for that reason. Recombinant DNA techniques provided a new set of highly variable genetic markers based on DNA nucleotide sequence polymorphism. From the practical standpoint, the application of these techniques to paternity testing provides greater versatility than do conventional genetic marker systems. The use of methods to detect the polymorphism of human leukocyte antigen loci significantly increases the chance of validation of ambiguous results in paternity testing. The outcome of 2384 paternity cases investigated by serologic and/or DNA-based human leukocyte antigen typing was statistically analyzed. Different cases solved by DNA typing are presented involving cases with one or two accused men, exclusions and nonexclusions, and tests of the paternity of a deceased man. The results provide evidence for the advantage of the combined application of various techniques in forensic diagnostics and emphasizes the outstanding possibilities of DNA-based assays. Representative examples demonstrate the strength of combined techniques in paternity testing.
Pfrender, M.E.; Ferrington, L.C.; Hawkins, C.P.; Hartzell, P.L.; Bagley, M.; Jackson, S.; Courtney, G.W.; Larsen, D.P.; Creutzburg, B.R.; Levesque, C.A.; Epler, J.H.; Morse, J.C.; Fend, S.; Petersen, M.J.; Ruiter, D.; Schindel, D.; Whiting, M.
2010-01-01
Assessing the biodiversity of macroinvertebrate fauna in freshwater ecosystems is an essential component of both basic ecological inquiry and applied ecological assessments. Aspects of taxonomic diversity and composition in freshwater communities are widely used to quantify water quality and measure the efficacy of remediation and restoration efforts. The accuracy and precision of biodiversity assessments based on standard morphological identifications are often limited by taxonomic resolution and sample size. Morphologically based identifications are laborious and costly, significantly constraining the sample sizes that can be processed. We suggest that the development of an assay platform based on DNA signatures will increase the precision and ease of quantifying biodiversity in freshwater ecosystems. Advances in this area will be particularly relevant for benthic and planktonic invertebrates, which are often monitored by regulatory agencies. Adopting a genetic assessment platform will alleviate some of the current limitations to biodiversity assessment strategies. We discuss the benefits and challenges associated with DNA-based assessments and the methods that are currently available. As recent advances in microarray and next-generation sequencing technologies will facilitate a transition to DNA-based assessment approaches, future research efforts should focus on methods for data collection, assay platform development, establishing linkages between DNA signatures and well-resolved taxonomies, and bioinformatics. ?? 2010 by The University of Chicago Press.
Method for performing site-specific affinity fractionation for use in DNA sequencing
Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.
1999-01-01
A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.
Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.
2000-01-01
A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.
Characterization of the geometry and topology of DNA pictured as a discrete collection of atoms
Olson, Wilma K.
2014-01-01
The structural and physical properties of DNA are closely related to its geometry and topology. The classical mathematical treatment of DNA geometry and topology in terms of ideal smooth space curves was not designed to characterize the spatial arrangements of atoms found in high-resolution and simulated double-helical structures. We present here new and rigorous numerical methods for the rapid and accurate assessment of the geometry and topology of double-helical DNA structures in terms of the constituent atoms. These methods are well designed for large DNA datasets obtained in detailed numerical simulations or determined experimentally at high-resolution. We illustrate the usefulness of our methodology by applying it to the analysis of three canonical double-helical DNA chains, a 65-bp minicircle obtained in recent molecular dynamics simulations, and a crystallographic array of protein-bound DNA duplexes. Although we focus on fully base-paired DNA structures, our methods can be extended to treat the geometry and topology of melted DNA structures as well as to characterize the folding of arbitrary molecules such as RNA and cyclic peptides. PMID:24791158
Method for performing site-specific affinity fractionation for use in DNA sequencing
Mirzabekov, A.D.; Lysov, Y.P.; Dubley, S.A.
1999-05-18
A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between the cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting the extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to the extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from the array. 14 figs.
Identification of DNA-Binding Proteins Using Mixed Feature Representation Methods.
Qu, Kaiyang; Han, Ke; Wu, Song; Wang, Guohua; Wei, Leyi
2017-09-22
DNA-binding proteins play vital roles in cellular processes, such as DNA packaging, replication, transcription, regulation, and other DNA-associated activities. The current main prediction method is based on machine learning, and its accuracy mainly depends on the features extraction method. Therefore, using an efficient feature representation method is important to enhance the classification accuracy. However, existing feature representation methods cannot efficiently distinguish DNA-binding proteins from non-DNA-binding proteins. In this paper, a multi-feature representation method, which combines three feature representation methods, namely, K-Skip-N-Grams, Information theory, and Sequential and structural features (SSF), is used to represent the protein sequences and improve feature representation ability. In addition, the classifier is a support vector machine. The mixed-feature representation method is evaluated using 10-fold cross-validation and a test set. Feature vectors, which are obtained from a combination of three feature extractions, show the best performance in 10-fold cross-validation both under non-dimensional reduction and dimensional reduction by max-relevance-max-distance. Moreover, the reduced mixed feature method performs better than the non-reduced mixed feature technique. The feature vectors, which are a combination of SSF and K-Skip-N-Grams, show the best performance in the test set. Among these methods, mixed features exhibit superiority over the single features.
Verma, Digvijay; Satyanarayana, T
2011-09-01
An improved single-step protocol has been developed for extracting pure community humic substance-free DNA from alkaline soils and sediments. The method is based on direct cell lysis in the presence of powdered activated charcoal and polyvinylpolypyrrolidone followed by precipitation with polyethyleneglycol and isopropanol. The strategy allows simultaneous isolation and purification of DNA while minimizing the loss of DNA with respect to other available protocols for metagenomic DNA extraction. Moreover, the purity levels are significant, which are difficult to attain with any of the methods reported in the literature for DNA extraction from soils. The DNA thus extracted was free from humic substances and, therefore, could be processed for restriction digestion, PCR amplification as well as for the construction of metagenomic libraries.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Orimoto, Yuuichi, E-mail: orimoto.yuuichi.888@m.kyushu-u.ac.jp; Aoki, Yuriko; Japan Science and Technology Agency, CREST, 4-1-8 Hon-chou, Kawaguchi, Saitama 332-0012
An automated property optimization method was developed based on the ab initio O(N) elongation (ELG) method and applied to the optimization of nonlinear optical (NLO) properties in DNA as a first test. The ELG method mimics a polymerization reaction on a computer, and the reaction terminal of a starting cluster is attacked by monomers sequentially to elongate the electronic structure of the system by solving in each step a limited space including the terminal (localized molecular orbitals at the terminal) and monomer. The ELG-finite field (ELG-FF) method for calculating (hyper-)polarizabilities was used as the engine program of the optimization method,more » and it was found to show linear scaling efficiency while maintaining high computational accuracy for a random sequenced DNA model. Furthermore, the self-consistent field convergence was significantly improved by using the ELG-FF method compared with a conventional method, and it can lead to more feasible NLO property values in the FF treatment. The automated optimization method successfully chose an appropriate base pair from four base pairs (A, T, G, and C) for each elongation step according to an evaluation function. From test optimizations for the first order hyper-polarizability (β) in DNA, a substantial difference was observed depending on optimization conditions between “choose-maximum” (choose a base pair giving the maximum β for each step) and “choose-minimum” (choose a base pair giving the minimum β). In contrast, there was an ambiguous difference between these conditions for optimizing the second order hyper-polarizability (γ) because of the small absolute value of γ and the limitation of numerical differential calculations in the FF method. It can be concluded that the ab initio level property optimization method introduced here can be an effective step towards an advanced computer aided material design method as long as the numerical limitation of the FF method is taken into account.« less
Orimoto, Yuuichi; Aoki, Yuriko
2016-07-14
An automated property optimization method was developed based on the ab initio O(N) elongation (ELG) method and applied to the optimization of nonlinear optical (NLO) properties in DNA as a first test. The ELG method mimics a polymerization reaction on a computer, and the reaction terminal of a starting cluster is attacked by monomers sequentially to elongate the electronic structure of the system by solving in each step a limited space including the terminal (localized molecular orbitals at the terminal) and monomer. The ELG-finite field (ELG-FF) method for calculating (hyper-)polarizabilities was used as the engine program of the optimization method, and it was found to show linear scaling efficiency while maintaining high computational accuracy for a random sequenced DNA model. Furthermore, the self-consistent field convergence was significantly improved by using the ELG-FF method compared with a conventional method, and it can lead to more feasible NLO property values in the FF treatment. The automated optimization method successfully chose an appropriate base pair from four base pairs (A, T, G, and C) for each elongation step according to an evaluation function. From test optimizations for the first order hyper-polarizability (β) in DNA, a substantial difference was observed depending on optimization conditions between "choose-maximum" (choose a base pair giving the maximum β for each step) and "choose-minimum" (choose a base pair giving the minimum β). In contrast, there was an ambiguous difference between these conditions for optimizing the second order hyper-polarizability (γ) because of the small absolute value of γ and the limitation of numerical differential calculations in the FF method. It can be concluded that the ab initio level property optimization method introduced here can be an effective step towards an advanced computer aided material design method as long as the numerical limitation of the FF method is taken into account.
Prediction of TF target sites based on atomistic models of protein-DNA complexes
Angarica, Vladimir Espinosa; Pérez, Abel González; Vasconcelos, Ana T; Collado-Vides, Julio; Contreras-Moreira, Bruno
2008-01-01
Background The specific recognition of genomic cis-regulatory elements by transcription factors (TFs) plays an essential role in the regulation of coordinated gene expression. Studying the mechanisms determining binding specificity in protein-DNA interactions is thus an important goal. Most current approaches for modeling TF specific recognition rely on the knowledge of large sets of cognate target sites and consider only the information contained in their primary sequence. Results Here we describe a structure-based methodology for predicting sequence motifs starting from the coordinates of a TF-DNA complex. Our algorithm combines information regarding the direct and indirect readout of DNA into an atomistic statistical model, which is used to estimate the interaction potential. We first measure the ability of our method to correctly estimate the binding specificities of eight prokaryotic and eukaryotic TFs that belong to different structural superfamilies. Secondly, the method is applied to two homology models, finding that sampling of interface side-chain rotamers remarkably improves the results. Thirdly, the algorithm is compared with a reference structural method based on contact counts, obtaining comparable predictions for the experimental complexes and more accurate sequence motifs for the homology models. Conclusion Our results demonstrate that atomic-detail structural information can be feasibly used to predict TF binding sites. The computational method presented here is universal and might be applied to other systems involving protein-DNA recognition. PMID:18922190
Zhang, Xirui; Daaboul, George G; Spuhler, Philipp S; Dröge, Peter; Ünlü, M Selim
2016-03-14
DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are not fully understood. Recently, it was discovered that DNA-binding proteins recognize specific binding sites to carry out their functions through an indirect readout mechanism by recognizing and capturing DNA conformational flexibility and deformation. High-throughput DNA microarray-based methods that provide large-scale protein-DNA binding information have shown effective and comprehensive analysis of protein-DNA binding affinities, but do not provide information of DNA conformational changes in specific protein-DNA complexes. Building on the high-throughput capability of DNA microarrays, we demonstrate a quantitative approach that simultaneously measures the amount of protein binding to DNA and nanometer-scale DNA conformational change induced by protein binding in a microarray format. Both measurements rely on spectral interferometry on a layered substrate using a single optical instrument in two distinct modalities. In the first modality, we quantitate the amount of binding of protein to surface-immobilized DNA in each DNA spot using a label-free spectral reflectivity technique that accurately measures the surface densities of protein and DNA accumulated on the substrate. In the second modality, for each DNA spot, we simultaneously measure DNA conformational change using a fluorescence vertical sectioning technique that determines average axial height of fluorophores tagged to specific nucleotides of the surface-immobilized DNA. The approach presented in this paper, when combined with current high-throughput DNA microarray-based technologies, has the potential to serve as a rapid and simple method for quantitative and large-scale characterization of conformational specific protein-DNA interactions.
Fantin, Yuri S.; Neverov, Alexey D.; Favorov, Alexander V.; Alvarez-Figueroa, Maria V.; Braslavskaya, Svetlana I.; Gordukova, Maria A.; Karandashova, Inga V.; Kuleshov, Konstantin V.; Myznikova, Anna I.; Polishchuk, Maya S.; Reshetov, Denis A.; Voiciehovskaya, Yana A.; Mironov, Andrei A.; Chulanov, Vladimir P.
2013-01-01
Sanger sequencing is a common method of reading DNA sequences. It is less expensive than high-throughput methods, and it is appropriate for numerous applications including molecular diagnostics. However, sequencing mixtures of similar DNA of pathogens with this method is challenging. This is important because most clinical samples contain such mixtures, rather than pure single strains. The traditional solution is to sequence selected clones of PCR products, a complicated, time-consuming, and expensive procedure. Here, we propose the base-calling with vocabulary (BCV) method that computationally deciphers Sanger chromatograms obtained from mixed DNA samples. The inputs to the BCV algorithm are a chromatogram and a dictionary of sequences that are similar to those we expect to obtain. We apply the base-calling function on a test dataset of chromatograms without ambiguous positions, as well as one with 3–14% sequence degeneracy. Furthermore, we use BCV to assemble a consensus sequence for an HIV genome fragment in a sample containing a mixture of viral DNA variants and to determine the positions of the indels. Finally, we detect drug-resistant Mycobacterium tuberculosis strains carrying frameshift mutations mixed with wild-type bacteria in the pncA gene, and roughly characterize bacterial communities in clinical samples by direct 16S rRNA sequencing. PMID:23382983
Ganareal, Thenor Aristotile Charles S; Balbin, Michelle M; Monserate, Juvy J; Salazar, Joel R; Mingala, Claro N
2018-02-12
Gold nanoparticle (AuNP) is considered to be the most stable metal nanoparticle having the ability to be functionalized with biomolecules. Recently, AuNP-based DNA detection methods captured the interest of researchers worldwide. Paratuberculosis or Johne's disease, a chronic gastroenteritis in ruminants caused by Mycobacterium avium subsp. paratuberculosis (MAP), was found to have negative effect in the livestock industry. In this study, AuNP-based probes were evaluated for the specific and sensitive detection of MAP DNA. AuNP-based probe was produced by functionalization of AuNPs with thiol-modified oligonucleotide and was confirmed by Fourier-Transform Infrared (FTIR) spectroscopy. UV-Vis spectroscopy and Scanning Electron Microscopy (SEM) were used to characterize AuNPs. DNA detection was done by hybridization of 10 μL of DNA with 5 μL of probe at 63 °C for 10 min and addition of 3 μL salt solution. The method was specific to MAP with detection limit of 103 ng. UV-Vis and SEM showed dispersion and aggregation of the AuNPs for the positive and negative results, respectively, with no observed particle growth. This study therefore reports an AuNP-based probes which can be used for the specific and sensitive detection of MAP DNA. Copyright © 2018 Elsevier Inc. All rights reserved.
Zhang, Hongyan; Lv, Jie; Jia, Zhenhong
2017-05-10
A novel assembled biosensor was prepared for detecting 16S rRNA, a small-size persistent specific for Actinobacteria. The mechanism of the porous silicon (PS) photonic crystal biosensor is based on the fluorescence resonance energy transfer (FRET) between quantum dots (QDs) and gold nanoparticles (AuNPs) through DNA hybridization, where QDs act as an emission donor and AuNPs serve as a fluorescence quencher. Results showed that the photoluminescence (PL) intensity of PS photonic crystal was drastically increased when the QDs-conjugated probe DNA was adhered to the PS layer by surface modification using a standard cross-link chemistry method. The PL intensity of QDs was decreased when the addition of AuNPs-conjugated complementary 16S rRNA was dropped onto QDs-conjugated PS. Based on the analysis of different target DNA concentration, it was found that the decrease of the PL intensity showed a good linear relationship with complementary DNA concentration in a range from 0.25 to 10 μM, and the detection limit was 328.7 nM. Such an optical FRET biosensor functions on PS-based photonic crystal for DNA detection that differs from the traditional FRET, which is used only in liquid. This method will benefit the development of a new optical FRET label-free biosensor on Si substrate and has great potential in biochips based on integrated optical devices.
Stadler, Julia; Eder, Johanna; Pratscher, Barbara; Brandt, Sabine; Schneller, Doris; Müllegger, Robert; Vogl, Claus; Trautinger, Franz; Brem, Gottfried; Burgstaller, Joerg P.
2015-01-01
Cell-free circulating tumor DNA in the plasma of cancer patients has become a common point of interest as indicator of therapy options and treatment response in clinical cancer research. Especially patient- and tumor-specific single nucleotide variants that accurately distinguish tumor DNA from wild type DNA are promising targets. The reliable detection and quantification of these single-base DNA variants is technically challenging. Currently, a variety of techniques is applied, with no apparent “gold standard”. Here we present a novel qPCR protocol that meets the conditions of extreme sensitivity and specificity that are required for detection and quantification of tumor DNA. By consecutive application of two polymerases, one of them designed for extreme base-specificity, the method reaches unprecedented sensitivity and specificity. Three qPCR assays were tested with spike-in experiments, specific for point mutations BRAF V600E, PTEN T167A and NRAS Q61L of melanoma cell lines. It was possible to detect down to one copy of tumor DNA per reaction (Poisson distribution), at a background of up to 200 000 wild type DNAs. To prove its clinical applicability, the method was successfully tested on a small cohort of BRAF V600E positive melanoma patients. PMID:26562020
ERIC Educational Resources Information Center
King, Angela G.
2004-01-01
Nanotechnology are employed by researchers at Northwestern University to develop a method of labeling disease markers present in blood with unique DNA tags they have dubbed "bio-bar-codes". The preparation of nanoparticle and magnetic microparticle probes and a nanoparticle-based PSR-less DNA amplification scheme are involved by the DNA-BCA assay.
Ma, Chuang; Xin, Mingming; Feldmann, Kenneth A.; Wang, Xiangfeng
2014-01-01
Machine learning (ML) is an intelligent data mining technique that builds a prediction model based on the learning of prior knowledge to recognize patterns in large-scale data sets. We present an ML-based methodology for transcriptome analysis via comparison of gene coexpression networks, implemented as an R package called machine learning–based differential network analysis (mlDNA) and apply this method to reanalyze a set of abiotic stress expression data in Arabidopsis thaliana. The mlDNA first used a ML-based filtering process to remove nonexpressed, constitutively expressed, or non-stress-responsive “noninformative” genes prior to network construction, through learning the patterns of 32 expression characteristics of known stress-related genes. The retained “informative” genes were subsequently analyzed by ML-based network comparison to predict candidate stress-related genes showing expression and network differences between control and stress networks, based on 33 network topological characteristics. Comparative evaluation of the network-centric and gene-centric analytic methods showed that mlDNA substantially outperformed traditional statistical testing–based differential expression analysis at identifying stress-related genes, with markedly improved prediction accuracy. To experimentally validate the mlDNA predictions, we selected 89 candidates out of the 1784 predicted salt stress–related genes with available SALK T-DNA mutagenesis lines for phenotypic screening and identified two previously unreported genes, mutants of which showed salt-sensitive phenotypes. PMID:24520154
NASA Astrophysics Data System (ADS)
Yaney, Perry P.; Ouchen, Fahima; Grote, James G.
2009-08-01
DC resistivity studies were carried out on biopolymer films of DNA-CTMA and silk fibroin, and on selected traditional polymer films, including PMMA and APC. Films of DNA-CTMA versus molecular weight and with conductive dopants PCBM, BAYTRON P and ammonium tetrachloroplatinate are reported. The films were spin coated on glass slides configured for measurements of volume dc resistance. The measurements used the alternating polarity method to record the applied voltage-dependent current independent of charging and background currents. The Arrhenius equation plus a constant was fitted to the conductivity versus temperature data of the polymers and the non-doped DNA-based biopolymers with activation energies ranging from 0.8 to 1.4 eV.
Local alignment of two-base encoded DNA sequence
Homer, Nils; Merriman, Barry; Nelson, Stanley F
2009-01-01
Background DNA sequence comparison is based on optimal local alignment of two sequences using a similarity score. However, some new DNA sequencing technologies do not directly measure the base sequence, but rather an encoded form, such as the two-base encoding considered here. In order to compare such data to a reference sequence, the data must be decoded into sequence. The decoding is deterministic, but the possibility of measurement errors requires searching among all possible error modes and resulting alignments to achieve an optimal balance of fewer errors versus greater sequence similarity. Results We present an extension of the standard dynamic programming method for local alignment, which simultaneously decodes the data and performs the alignment, maximizing a similarity score based on a weighted combination of errors and edits, and allowing an affine gap penalty. We also present simulations that demonstrate the performance characteristics of our two base encoded alignment method and contrast those with standard DNA sequence alignment under the same conditions. Conclusion The new local alignment algorithm for two-base encoded data has substantial power to properly detect and correct measurement errors while identifying underlying sequence variants, and facilitating genome re-sequencing efforts based on this form of sequence data. PMID:19508732
Whole-genome multiple displacement amplification from single cells.
Spits, Claudia; Le Caignec, Cédric; De Rycke, Martine; Van Haute, Lindsey; Van Steirteghem, André; Liebaers, Inge; Sermon, Karen
2006-01-01
Multiple displacement amplification (MDA) is a recently described method of whole-genome amplification (WGA) that has proven efficient in the amplification of small amounts of DNA, including DNA from single cells. Compared with PCR-based WGA methods, MDA generates DNA with a higher molecular weight and shows better genome coverage. This protocol was developed for preimplantation genetic diagnosis, and details a method for performing single-cell MDA using the phi29 DNA polymerase. It can also be useful for the amplification of other minute quantities of DNA, such as from forensic material or microdissected tissue. The protocol includes the collection and lysis of single cells, and all materials and steps involved in the MDA reaction. The whole procedure takes 3 h and generates 1-2 microg of DNA from a single cell, which is suitable for multiple downstream applications, such as sequencing, short tandem repeat analysis or array comparative genomic hybridization.
Isalan, M; Klug, A; Choo, Y
2001-07-01
DNA-binding domains with predetermined sequence specificity are engineered by selection of zinc finger modules using phage display, allowing the construction of customized transcription factors. Despite remarkable progress in this field, the available protein-engineering methods are deficient in many respects, thus hampering the applicability of the technique. Here we present a rapid and convenient method that can be used to design zinc finger proteins against a variety of DNA-binding sites. This is based on a pair of pre-made zinc finger phage-display libraries, which are used in parallel to select two DNA-binding domains each of which recognizes given 5 base pair sequences, and whose products are recombined to produce a single protein that recognizes a composite (9 base pair) site of predefined sequence. Engineering using this system can be completed in less than two weeks and yields proteins that bind sequence-specifically to DNA with Kd values in the nanomolar range. To illustrate the technique, we have selected seven different proteins to bind various regions of the human immunodeficiency virus 1 (HIV-1) promoter.
Functional interrogation of non-coding DNA through CRISPR genome editing
Canver, Matthew C.; Bauer, Daniel E.; Orkin, Stuart H.
2017-01-01
Methodologies to interrogate non-coding regions have lagged behind coding regions despite comprising the vast majority of the genome. However, the rapid evolution of clustered regularly interspaced short palindromic repeats (CRISPR)-based genome editing has provided a multitude of novel techniques for laboratory investigation including significant contributions to the toolbox for studying non-coding DNA. CRISPR-mediated loss-of-function strategies rely on direct disruption of the underlying sequence or repression of transcription without modifying the targeted DNA sequence. CRISPR-mediated gain-of-function approaches similarly benefit from methods to alter the targeted sequence through integration of customized sequence into the genome as well as methods to activate transcription. Here we review CRISPR-based loss- and gain-of-function techniques for the interrogation of non-coding DNA. PMID:28288828
DOE Office of Scientific and Technical Information (OSTI.GOV)
Grollman, A.P.; Takeshita, Masaru
1995-12-31
More than twenty oxidatively-damaged bases, including 8-oxoguanine, have been found to occur in genomic DNA. Some of these lesions block DNA replication and are potentially lethal; others generate mutations which can initiate carcinogenesis and promote cellular aging. In this report, the authors focus attention on the mutagenicity and repair of 8-oxoguanine. Kasai and Nishimura`s discovery that hydroxyl radicals react with guanine residues in DNA to form 8-oxoguanine and the development of sensitive methods for the detection and quantitation of this modified base led to the observation that approximately 1 in 10{sup 5} guanine residues in mammalian DNA are oxidized atmore » the C-8 position. DNA containing 8-oxoguanine and synthetic analogs of the abasic site have been used to investigate the miscoding and mutagenic potential of these ubiquitous lesions. Studies in the laboratory were facilitated by the development of solid state synthetic methods by which these lesions could be introduced at defined positions in DNA. In this paper, the authors review studies in which 8-oxoguanine and abasic sites have been used in model systems to explore various early events in the replication of selectively damaged DNA.« less
Recent progress on DNA based walkers.
Pan, Jing; Li, Feiran; Cha, Tae-Gon; Chen, Haorong; Choi, Jong Hyun
2015-08-01
DNA based synthetic molecular walkers are reminiscent of biological protein motors. They are powered by hybridization with fuel strands, environment induced conformational transitions, and covalent chemistry of oligonucleotides. Recent developments in experimental techniques enable direct observation of individual walkers with high temporal and spatial resolution. The functionalities of state-of-the-art DNA walker systems can thus be analyzed for various applications. Herein we review recent progress on DNA walker principles and characterization methods, and evaluate various aspects of their functions for future applications. Copyright © 2014 Elsevier Ltd. All rights reserved.
Excitonic AND Logic Gates on DNA Brick Nanobreadboards.
Cannon, Brittany L; Kellis, Donald L; Davis, Paul H; Lee, Jeunghoon; Kuang, Wan; Hughes, William L; Graugnard, Elton; Yurke, Bernard; Knowlton, William B
2015-03-18
A promising application of DNA self-assembly is the fabrication of chromophore-based excitonic devices. DNA brick assembly is a compelling method for creating programmable nanobreadboards on which chromophores may be rapidly and easily repositioned to prototype new excitonic devices, optimize device operation, and induce reversible switching. Using DNA nanobreadboards, we have demonstrated each of these functions through the construction and operation of two different excitonic AND logic gates. The modularity and high chromophore density achievable via this brick-based approach provide a viable path toward developing information processing and storage systems.
Excitonic AND Logic Gates on DNA Brick Nanobreadboards
2015-01-01
A promising application of DNA self-assembly is the fabrication of chromophore-based excitonic devices. DNA brick assembly is a compelling method for creating programmable nanobreadboards on which chromophores may be rapidly and easily repositioned to prototype new excitonic devices, optimize device operation, and induce reversible switching. Using DNA nanobreadboards, we have demonstrated each of these functions through the construction and operation of two different excitonic AND logic gates. The modularity and high chromophore density achievable via this brick-based approach provide a viable path toward developing information processing and storage systems. PMID:25839049
Real-Time PCR-Based Quantitation Method for the Genetically Modified Soybean Line GTS 40-3-2.
Kitta, Kazumi; Takabatake, Reona; Mano, Junichi
2016-01-01
This chapter describes a real-time PCR-based method for quantitation of the relative amount of genetically modified (GM) soybean line GTS 40-3-2 [Roundup Ready(®) soybean (RRS)] contained in a batch. The method targets a taxon-specific soybean gene (lectin gene, Le1) and the specific DNA construct junction region between the Petunia hybrida chloroplast transit peptide sequence and the Agrobacterium 5-enolpyruvylshikimate-3-phosphate synthase gene (epsps) sequence present in GTS 40-3-2. The method employs plasmid pMulSL2 as a reference material in order to quantify the relative amount of GTS 40-3-2 in soybean samples using a conversion factor (Cf) equal to the ratio of the RRS-specific DNA to the taxon-specific DNA in representative genuine GTS 40-3-2 seeds.
Ota, Hiroyuki; Lim, Tae-Kyu; Tanaka, Tsuyoshi; Yoshino, Tomoko; Harada, Manabu; Matsunaga, Tadashi
2006-09-18
A novel, automated system, PNE-1080, equipped with eight automated pestle units and a spectrophotometer was developed for genomic DNA extraction from maize using aminosilane-modified bacterial magnetic particles (BMPs). The use of aminosilane-modified BMPs allowed highly accurate DNA recovery. The (A(260)-A(320)):(A(280)-A(320)) ratio of the extracted DNA was 1.9+/-0.1. The DNA quality was sufficiently pure for PCR analysis. The PNE-1080 offered rapid assay completion (30 min) with high accuracy. Furthermore, the results of real-time PCR confirmed that our proposed method permitted the accurate determination of genetically modified DNA composition and correlated well with results obtained by conventional cetyltrimethylammonium bromide (CTAB)-based methods.
Winnowing DNA for rare sequences: highly specific sequence and methylation based enrichment.
Thompson, Jason D; Shibahara, Gosuke; Rajan, Sweta; Pel, Joel; Marziali, Andre
2012-01-01
Rare mutations in cell populations are known to be hallmarks of many diseases and cancers. Similarly, differential DNA methylation patterns arise in rare cell populations with diagnostic potential such as fetal cells circulating in maternal blood. Unfortunately, the frequency of alleles with diagnostic potential, relative to wild-type background sequence, is often well below the frequency of errors in currently available methods for sequence analysis, including very high throughput DNA sequencing. We demonstrate a DNA preparation and purification method that through non-linear electrophoretic separation in media containing oligonucleotide probes, achieves 10,000 fold enrichment of target DNA with single nucleotide specificity, and 100 fold enrichment of unmodified methylated DNA differing from the background by the methylation of a single cytosine residue.
A magnetic bead-based method for concentrating DNA from human urine for downstream detection.
Bordelon, Hali; Russ, Patricia K; Wright, David W; Haselton, Frederick R
2013-01-01
Due to the presence of PCR inhibitors, PCR cannot be used directly on most clinical samples, including human urine, without pre-treatment. A magnetic bead-based strategy is one potential method to collect biomarkers from urine samples and separate the biomarkers from PCR inhibitors. In this report, a 1 mL urine sample was mixed within the bulb of a transfer pipette containing lyophilized nucleic acid-silica adsorption buffer and silica-coated magnetic beads. After mixing, the sample was transferred from the pipette bulb to a small diameter tube, and captured biomarkers were concentrated using magnetic entrainment of beads through pre-arrayed wash solutions separated by small air gaps. Feasibility was tested using synthetic segments of the 140 bp tuberculosis IS6110 DNA sequence spiked into pooled human urine samples. DNA recovery was evaluated by qPCR. Despite the presence of spiked DNA, no DNA was detectable in unextracted urine samples, presumably due to the presence of PCR inhibitors. However, following extraction with the magnetic bead-based method, we found that ∼50% of spiked TB DNA was recovered from human urine containing roughly 5×10(3) to 5×10(8) copies of IS6110 DNA. In addition, the DNA was concentrated approximately ten-fold into water. The final concentration of DNA in the eluate was 5×10(6), 14×10(6), and 8×10(6) copies/µL for 1, 3, and 5 mL urine samples, respectively. Lyophilized and freshly prepared reagents within the transfer pipette produced similar results, suggesting that long-term storage without refrigeration is possible. DNA recovery increased with the length of the spiked DNA segments from 10±0.9% for a 75 bp DNA sequence to 42±4% for a 100 bp segment and 58±9% for a 140 bp segment. The estimated LOD was 77 copies of DNA/µL of urine. The strategy presented here provides a simple means to achieve high nucleic acid recovery from easily obtained urine samples, which does not contain inhibitors of PCR.
A Magnetic Bead-Based Method for Concentrating DNA from Human Urine for Downstream Detection
Bordelon, Hali; Russ, Patricia K.; Wright, David W.; Haselton, Frederick R.
2013-01-01
Due to the presence of PCR inhibitors, PCR cannot be used directly on most clinical samples, including human urine, without pre-treatment. A magnetic bead-based strategy is one potential method to collect biomarkers from urine samples and separate the biomarkers from PCR inhibitors. In this report, a 1 mL urine sample was mixed within the bulb of a transfer pipette containing lyophilized nucleic acid-silica adsorption buffer and silica-coated magnetic beads. After mixing, the sample was transferred from the pipette bulb to a small diameter tube, and captured biomarkers were concentrated using magnetic entrainment of beads through pre-arrayed wash solutions separated by small air gaps. Feasibility was tested using synthetic segments of the 140 bp tuberculosis IS6110 DNA sequence spiked into pooled human urine samples. DNA recovery was evaluated by qPCR. Despite the presence of spiked DNA, no DNA was detectable in unextracted urine samples, presumably due to the presence of PCR inhibitors. However, following extraction with the magnetic bead-based method, we found that ∼50% of spiked TB DNA was recovered from human urine containing roughly 5×103 to 5×108 copies of IS6110 DNA. In addition, the DNA was concentrated approximately ten-fold into water. The final concentration of DNA in the eluate was 5×106, 14×106, and 8×106 copies/µL for 1, 3, and 5 mL urine samples, respectively. Lyophilized and freshly prepared reagents within the transfer pipette produced similar results, suggesting that long-term storage without refrigeration is possible. DNA recovery increased with the length of the spiked DNA segments from 10±0.9% for a 75 bp DNA sequence to 42±4% for a 100 bp segment and 58±9% for a 140 bp segment. The estimated LOD was 77 copies of DNA/µL of urine. The strategy presented here provides a simple means to achieve high nucleic acid recovery from easily obtained urine samples, which does not contain inhibitors of PCR. PMID:23861895
Evaluation of mailed pediatric buccal cytobrushes for use in a case-control study of birth defects.
Gallagher, Margaret L; Sturchio, Cynthia; Smith, Ashley; Koontz, Deborah; Jenkins, Mary M; Honein, Margaret A; Rasmussen, Sonja A
2011-07-01
Buccal cell collection is a convenient DNA collection method; however, little attention has been given to the quality of DNA obtained from pediatric populations. The purpose of this study was to determine the effect of a modified cytobrush collection method on the yield and quality of infant buccal DNA collected as part of a population-based case-control study of birth defects. METHODS Cytobrushes were collected from infants, mothers, and fathers using a standard collection method in 1997 to 2003 and a modified protocol that allows air-drying of the cytobrushes after collection from 2003 to the present. Yield and quality of DNA from 1057 cytobrushes was assessed by quantitative PCR and short tandem repeat (STR) genotyping, respectively. RESULTS Air-dried cytobrushes from infants had higher median DNA yields (1300 ng) and STR completion rates (99.5%) than standard collection method cytobrushes (60 ng and 59.5%, respectively). A subset of DNA aliquots was genotyped for six single nucleotide polymorphisms (SNPs). Aliquots from both collection methods that passed the quality protocol (DNA concentration >1 ng/μl, and successful amplification of ≥1 STR) had high genotype completion rates (99-100%). The median DNA yield following whole genome amplification was more than twofold higher for air-dried than standard collection specimens (p < 0.001). CONCLUSION Yield and quality of buccal DNA collected from infants are improved by using a method that incorporates air-drying; however, DNA collected by both methods is suitable for genotyping if stringent quality control procedures are instituted. These findings may be helpful for future epidemiologic studies of birth defects and other adverse pediatric outcomes. Copyright © 2011 Wiley-Liss, Inc.
2010-01-01
Background The vast sequence divergence among different virus groups has presented a great challenge to alignment-based analysis of virus phylogeny. Due to the problems caused by the uncertainty in alignment, existing tools for phylogenetic analysis based on multiple alignment could not be directly applied to the whole-genome comparison and phylogenomic studies of viruses. There has been a growing interest in alignment-free methods for phylogenetic analysis using complete genome data. Among the alignment-free methods, a dynamical language (DL) method proposed by our group has successfully been applied to the phylogenetic analysis of bacteria and chloroplast genomes. Results In this paper, the DL method is used to analyze the whole-proteome phylogeny of 124 large dsDNA viruses and 30 parvoviruses, two data sets with large difference in genome size. The trees from our analyses are in good agreement to the latest classification of large dsDNA viruses and parvoviruses by the International Committee on Taxonomy of Viruses (ICTV). Conclusions The present method provides a new way for recovering the phylogeny of large dsDNA viruses and parvoviruses, and also some insights on the affiliation of a number of unclassified viruses. In comparison, some alignment-free methods such as the CV Tree method can be used for recovering the phylogeny of large dsDNA viruses, but they are not suitable for resolving the phylogeny of parvoviruses with a much smaller genome size. PMID:20565983
NASA Astrophysics Data System (ADS)
Lestari, D.; Bustamam, A.; Novianti, T.; Ardaneswari, G.
2017-07-01
DNA sequence can be defined as a succession of letters, representing the order of nucleotides within DNA, using a permutation of four DNA base codes including adenine (A), guanine (G), cytosine (C), and thymine (T). The precise code of the sequences is determined using DNA sequencing methods and technologies, which have been developed since the 1970s and currently become highly developed, advanced and highly throughput sequencing technologies. So far, DNA sequencing has greatly accelerated biological and medical research and discovery. However, in some cases DNA sequencing could produce any ambiguous and not clear enough sequencing results that make them quite difficult to be determined whether these codes are A, T, G, or C. To solve these problems, in this study we can introduce other representation of DNA codes namely Quaternion Q = (PA, PT, PG, PC), where PA, PT, PG, PC are the probability of A, T, G, C bases that could appear in Q and PA + PT + PG + PC = 1. Furthermore, using Quaternion representations we are able to construct the improved scoring matrix for global sequence alignment processes, by applying a dot product method. Moreover, this scoring matrix produces better and higher quality of the match and mismatch score between two DNA base codes. In implementation, we applied the Needleman-Wunsch global sequence alignment algorithm using Octave, to analyze our target sequence which contains some ambiguous sequence data. The subject sequences are the DNA sequences of Streptococcus pneumoniae families obtained from the Genebank, meanwhile the target DNA sequence are received from our collaborator database. As the results we found the Quaternion representations improve the quality of the sequence alignment score and we can conclude that DNA sequence target has maximum similarity with Streptococcus pneumoniae.
Weiss, Agnes; Jérôme, Valérie; Freitag, Ruth
2007-06-15
The goal of the project was the extraction of PCR-compatible genomic DNA representative of the entire microbial community from municipal biogas plant samples (mash, bioreactor content, process water, liquid fertilizer). For the initial isolation of representative DNA from the respective lysates, methods were used that employed adsorption, extraction, or precipitation to specifically enrich the DNA. Since no dedicated method for biogas plant samples was available, preference was given to kits/methods suited to samples that resembled either the bioreactor feed, e.g. foodstuffs, or those intended for environmental samples including wastewater. None of the methods succeeded in preparing DNA that was directly PCR-compatible. Instead the DNA was found to still contain considerable amounts of difficult-to-remove enzyme inhibitors (presumably humic acids) that hindered the PCR reaction. Based on the isolation method that gave the highest yield/purity for all sample types, subsequent purification was attempted by agarose gel electrophoresis followed by electroelution, spermine precipitation, or dialysis through nitrocellulose membrane. A combination of phenol/chloroform extraction followed by purification via dialysis constituted the most efficient sample treatment. When such DNA preparations were diluted 1:100 they did no longer inhibit PCR reactions, while they still contained sufficient genomic DNA to allow specific amplification of specific target sequences.
A mix-and-read drop-based in vitro two-hybrid method for screening high-affinity peptide binders
Cui, Naiwen; Zhang, Huidan; Schneider, Nils; Tao, Ye; Asahara, Haruichi; Sun, Zhiyi; Cai, Yamei; Koehler, Stephan A.; de Greef, Tom F. A.; Abbaspourrad, Alireza; Weitz, David A.; Chong, Shaorong
2016-01-01
Drop-based microfluidics have recently become a novel tool by providing a stable linkage between phenotype and genotype for high throughput screening. However, use of drop-based microfluidics for screening high-affinity peptide binders has not been demonstrated due to the lack of a sensitive functional assay that can detect single DNA molecules in drops. To address this sensitivity issue, we introduced in vitro two-hybrid system (IVT2H) into microfluidic drops and developed a streamlined mix-and-read drop-IVT2H method to screen a random DNA library. Drop-IVT2H was based on the correlation between the binding affinity of two interacting protein domains and transcriptional activation of a fluorescent reporter. A DNA library encoding potential peptide binders was encapsulated with IVT2H such that single DNA molecules were distributed in individual drops. We validated drop-IVT2H by screening a three-random-residue library derived from a high-affinity MDM2 inhibitor PMI. The current drop-IVT2H platform is ideally suited for affinity screening of small-to-medium-sized libraries (103–106). It can obtain hits within a single day while consuming minimal amounts of reagents. Drop-IVT2H simplifies and accelerates the drop-based microfluidics workflow for screening random DNA libraries, and represents a novel alternative method for protein engineering and in vitro directed protein evolution. PMID:26940078
Liu, Bin; Wang, Shanyi; Dong, Qiwen; Li, Shumin; Liu, Xuan
2016-04-20
DNA-binding proteins play a pivotal role in various intra- and extra-cellular activities ranging from DNA replication to gene expression control. With the rapid development of next generation of sequencing technique, the number of protein sequences is unprecedentedly increasing. Thus it is necessary to develop computational methods to identify the DNA-binding proteins only based on the protein sequence information. In this study, a novel method called iDNA-KACC is presented, which combines the Support Vector Machine (SVM) and the auto-cross covariance transformation. The protein sequences are first converted into profile-based protein representation, and then converted into a series of fixed-length vectors by the auto-cross covariance transformation with Kmer composition. The sequence order effect can be effectively captured by this scheme. These vectors are then fed into Support Vector Machine (SVM) to discriminate the DNA-binding proteins from the non DNA-binding ones. iDNA-KACC achieves an overall accuracy of 75.16% and Matthew correlation coefficient of 0.5 by a rigorous jackknife test. Its performance is further improved by employing an ensemble learning approach, and the improved predictor is called iDNA-KACC-EL. Experimental results on an independent dataset shows that iDNA-KACC-EL outperforms all the other state-of-the-art predictors, indicating that it would be a useful computational tool for DNA binding protein identification. .
DNA nanostructure-directed assembly of metal nanoparticle superlattices
NASA Astrophysics Data System (ADS)
Julin, Sofia; Nummelin, Sami; Kostiainen, Mauri A.; Linko, Veikko
2018-05-01
Structural DNA nanotechnology provides unique, well-controlled, versatile, and highly addressable motifs and templates for assembling materials at the nanoscale. These methods to build from the bottom-up using DNA as a construction material are based on programmable and fully predictable Watson-Crick base pairing. Researchers have adopted these techniques to an increasing extent for creating numerous DNA nanostructures for a variety of uses ranging from nanoelectronics to drug-delivery applications. Recently, an increasing effort has been put into attaching nanoparticles (the size range of 1-20 nm) to the accurate DNA motifs and into creating metallic nanostructures (typically 20-100 nm) using designer DNA nanoshapes as molds or stencils. By combining nanoparticles with the superior addressability of DNA-based scaffolds, it is possible to form well-ordered materials with intriguing and completely new optical, plasmonic, electronic, and magnetic properties. This focused review discusses the DNA structure-directed nanoparticle assemblies covering the wide range of different one-, two-, and three-dimensional systems.
NASA Astrophysics Data System (ADS)
Alvarez, Jose; Massey, Steven; Kalitsov, Alan; Velev, Julian
Nanopore sequencing via transverse current has emerged as a competitive candidate for mapping DNA methylation without needed bisulfite-treatment, fluorescent tag, or PCR amplification. By eliminating the error producing amplification step, long read lengths become feasible, which greatly simplifies the assembly process and reduces the time and the cost inherent in current technologies. However, due to the large error rates of nanopore sequencing, single base resolution has not been reached. A very important source of noise is the intrinsic structural noise in the electric signature of the nucleotide arising from the influence of neighboring nucleotides. In this work we perform calculations of the tunneling current through DNA molecules in nanopores using the non-equilibrium electron transport method within an effective multi-orbital tight-binding model derived from first-principles calculations. We develop a base-calling algorithm accounting for the correlations of the current through neighboring bases, which in principle can reduce the error rate below any desired precision. Using this method we show that we can clearly distinguish DNA methylation and other base modifications based on the reading of the tunneling current.
A noninvasive, direct real-time PCR method for sex determination in multiple avian species
Brubaker, Jessica L.; Karouna-Renier, Natalie K.; Chen, Yu; Jenko, Kathryn; Sprague, Daniel T.; Henry, Paula F.P.
2011-01-01
Polymerase chain reaction (PCR)-based methods to determine the sex of birds are well established and have seen few modifications since they were first introduced in the 1990s. Although these methods allowed for sex determination in species that were previously difficult to analyse, they were not conducive to high-throughput analysis because of the laboriousness of DNA extraction and gel electrophoresis. We developed a high-throughput real-time PCR-based method for analysis of sex in birds, which uses noninvasive sample collection and avoids DNA extraction and gel electrophoresis.
A rapid low-cost high-density DNA-based multi-detection test for routine inspection of meat species.
Lin, Chun Chi; Fung, Lai Ling; Chan, Po Kwok; Lee, Cheuk Man; Chow, Kwok Fai; Cheng, Shuk Han
2014-02-01
The increasing occurrence of food frauds suggests that species identification should be part of food authentication. Current molecular-based species identification methods have their own limitations or drawbacks, such as relatively time-consuming experimental steps, expensive equipment and, in particular, these methods cannot identify mixed species in a single experiment. This project proposes an improved method involving PCR amplification of the COI gene and detection of species-specific sequences by hybridisation. Major innovative breakthrough lies in the detection of multiple species, including pork, beef, lamb, horse, cat, dog and mouse, from a mixed sample within a single experiment. The probes used are species-specific either in sole or mixed species samples. As little as 5 pg of DNA template in the PCR is detectable in the proposed method. By designing species-specific probes and adopting reverse dot blot hybridisation and flow-through hybridisation, a low-cost high-density DNA-based multi-detection test suitable for routine inspection of meat species was developed. © 2013.
Checking of individuality by DNA profiling.
Brdicka, R; Nürnberg, P
1993-08-25
A review of methods of DNA analysis used in forensic medicine for identification, paternity testing, etc. is provided. Among other techniques, DNA fingerprinting using different probes and polymerase chain reaction-based techniques such as amplified sequence polymorphisms and minisatellite variant repeat mapping are thoroughly described and both theoretical and practical aspects are discussed.
Eduardoff, Mayra; Xavier, Catarina; Strobl, Christina; Casas-Vargas, Andrea; Parson, Walther
2017-01-01
The analysis of mitochondrial DNA (mtDNA) has proven useful in forensic genetics and ancient DNA (aDNA) studies, where specimens are often highly compromised and DNA quality and quantity are low. In forensic genetics, the mtDNA control region (CR) is commonly sequenced using established Sanger-type Sequencing (STS) protocols involving fragment sizes down to approximately 150 base pairs (bp). Recent developments include Massively Parallel Sequencing (MPS) of (multiplex) PCR-generated libraries using the same amplicon sizes. Molecular genetic studies on archaeological remains that harbor more degraded aDNA have pioneered alternative approaches to target mtDNA, such as capture hybridization and primer extension capture (PEC) methods followed by MPS. These assays target smaller mtDNA fragment sizes (down to 50 bp or less), and have proven to be substantially more successful in obtaining useful mtDNA sequences from these samples compared to electrophoretic methods. Here, we present the modification and optimization of a PEC method, earlier developed for sequencing the Neanderthal mitochondrial genome, with forensic applications in mind. Our approach was designed for a more sensitive enrichment of the mtDNA CR in a single tube assay and short laboratory turnaround times, thus complying with forensic practices. We characterized the method using sheared, high quantity mtDNA (six samples), and tested challenging forensic samples (n = 2) as well as compromised solid tissue samples (n = 15) up to 8 kyrs of age. The PEC MPS method produced reliable and plausible mtDNA haplotypes that were useful in the forensic context. It yielded plausible data in samples that did not provide results with STS and other MPS techniques. We addressed the issue of contamination by including four generations of negative controls, and discuss the results in the forensic context. We finally offer perspectives for future research to enable the validation and accreditation of the PEC MPS method for final implementation in forensic genetic laboratories. PMID:28934125
Birla, Bhagyashree S; Chou, Hui-Hsien
2015-01-01
Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.
Detection of processed genetically modified food using CIM monolithic columns for DNA isolation.
Jerman, Sergej; Podgornik, Ales; Cankar, Katarina; Cadet, Neza; Skrt, Mihaela; Zel, Jana; Raspor, Peter
2005-02-11
The availability of sufficient quantities of DNA of adequate quality is crucial in polymerase chain reaction (PCR)-based methods for genetically modified food detection. In this work, the suitability of anion-exchange CIM (Convective Interaction Media; BIA Separations, Ljubljana, Slovenia) monolithic columns for isolation of DNA from food was studied. Maize and its derivates corn meal and thermally pretreated corn meal were chosen as model food. Two commercially available CIM disk columns were tested: DEAE (diethylaminoethyl) and QA (quaternary amine). Preliminary separations were performed with standard solution of salmon DNA at different pH values and different NaCl concentrations in mobile phase. DEAE groups and pH 8 were chosen for further isolations of DNA from a complex matrix-food extract. The quality and quantity of isolated DNA were tested on agarose gel electrophoresis, with UV-scanning spectrophotometry, and by amplification with real-time PCR. DNA isolated in this way was of suitable quality for further PCR analyses. The described method is also applicable for DNA isolation from processed foods with decreased DNA content. Furthermore, it is more effective and less time-consuming in comparison with the existing proposed methods for isolation of DNA from plant-derived foods.
What Information is Stored in DNA: Does it Contain Digital Error Correcting Codes?
NASA Astrophysics Data System (ADS)
Liebovitch, Larry
1998-03-01
The longest term correlations in living systems are the information stored in DNA which reflects the evolutionary history of an organism. The 4 bases (A,T,G,C) encode sequences of amino acids as well as locations of binding sites for proteins that regulate DNA. The fidelity of this important information is maintained by ANALOG error check mechanisms. When a single strand of DNA is replicated the complementary base is inserted in the new strand. Sometimes the wrong base is inserted that sticks out disrupting the phosphate backbone. The new base is not yet methylated, so repair enzymes, that slide along the DNA, can tear out the wrong base and replace it with the right one. The bases in DNA form a sequence of 4 different symbols and so the information is encoded in a DIGITAL form. All the digital codes in our society (ISBN book numbers, UPC product codes, bank account numbers, airline ticket numbers) use error checking code, where some digits are functions of other digits to maintain the fidelity of transmitted informaiton. Does DNA also utitlize a DIGITAL error chekcing code to maintain the fidelity of its information and increase the accuracy of replication? That is, are some bases in DNA functions of other bases upstream or downstream? This raises the interesting mathematical problem: How does one determine whether some symbols in a sequence of symbols are a function of other symbols. It also bears on the issue of determining algorithmic complexity: What is the function that generates the shortest algorithm for reproducing the symbol sequence. The error checking codes most used in our technology are linear block codes. We developed an efficient method to test for the presence of such codes in DNA. We coded the 4 bases as (0,1,2,3) and used Gaussian elimination, modified for modulus 4, to test if some bases are linear combinations of other bases. We used this method to analyze the base sequence in the genes from the lac operon and cytochrome C. We did not find evidence for such error correcting codes in these genes. However, we analyzed only a small amount of DNA and if digitial error correcting schemes are present in DNA, they may be more subtle than such simple linear block codes. The basic issue we raise here, is how information is stored in DNA and an appreciation that digital symbol sequences, such as DNA, admit of interesting schemes to store and protect the fidelity of their information content. Liebovitch, Tao, Todorov, Levine. 1996. Biophys. J. 71:1539-1544. Supported by NIH grant EY6234.
One-electron oxidation of individual DNA bases and DNA base stacks.
Close, David M
2010-02-04
In calculations performed with DFT there is a tendency of the purine cation to be delocalized over several bases in the stack. Attempts have been made to see if methods other than DFT can be used to calculate localized cations in stacks of purines, and to relate the calculated hyperfine couplings with known experimental results. To calculate reliable hyperfine couplings it is necessary to have an adequate description of spin polarization which means that electron correlation must be treated properly. UMP2 theory has been shown to be unreliable in estimating spin densities due to overestimates of the doubles correction. Therefore attempts have been made to use quadratic configuration interaction (UQCISD) methods to treat electron correlation. Calculations on the individual DNA bases are presented to show that with UQCISD methods it is possible to calculate hyperfine couplings in good agreement with the experimental results. However these UQCISD calculations are far more time-consuming than DFT calculations. Calculations are then extended to two stacked guanine bases. Preliminary calculations with UMP2 or UQCISD theory on two stacked guanines lead to a cation localized on a single guanine base.
Continuous Production of Discrete Plasmid DNA-Polycation Nanoparticles Using Flash Nanocomplexation.
Santos, Jose Luis; Ren, Yong; Vandermark, John; Archang, Maani M; Williford, John-Michael; Liu, Heng-Wen; Lee, Jason; Wang, Tza-Huei; Mao, Hai-Quan
2016-12-01
Despite successful demonstration of linear polyethyleneimine (lPEI) as an effective carrier for a wide range of gene medicine, including DNA plasmids, small interfering RNAs, mRNAs, etc., and continuous improvement of the physical properties and biological performance of the polyelectrolyte complex nanoparticles prepared from lPEI and nucleic acids, there still exist major challenges to produce these nanocomplexes in a scalable manner, particularly for lPEI/DNA nanoparticles. This has significantly hindered the progress toward clinical translation of these nanoparticle-based gene medicine. Here the authors report a flash nanocomplexation (FNC) method that achieves continuous production of lPEI/plasmid DNA nanoparticles with narrow size distribution using a confined impinging jet device. The method involves the complex coacervation of negatively charged DNA plasmid and positive charged lPEI under rapid, highly dynamic, and homogeneous mixing conditions, producing polyelectrolyte complex nanoparticles with narrow distribution of particle size and shape. The average number of plasmid DNA packaged per nanoparticles and its distribution are similar between the FNC method and the small-scale batch mixing method. In addition, the nanoparticles prepared by these two methods exhibit similar cell transfection efficiency. These results confirm that FNC is an effective and scalable method that can produce well-controlled lPEI/plasmid DNA nanoparticles. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Continuous Production of Discrete Plasmid DNA-Polycation Nanoparticles Using Flash Nanocomplexation
Santos, Jose Luis; Ren, Yong; Vandermark, John; Archang, Maani M.; Williford, John-Michael; Liu, Heng-wen; Lee, Jason; Wang, Tza-Huei; Mao, Hai-Quan
2016-01-01
Despite successful demonstration of linear polyethyleneimine (lPEI) as an effective carrier for a wide range of gene medicine, including DNA plasmids, small interfering RNAs, mRNAs, etc., and continuous improvement of the physical properties and biological performance of the polyelectrolyte complex nanoparticles prepared from lPEI and nucleic acids, there still exist major challenges to produce these nanocomplexes in a scalable manner, particularly for lPEI/DNA nanoparticles. This has significantly hindered the progress towards clinical translation of these nanoparticle-based gene medicine. Here we report a flash nanocomplexation (FNC) method that achieves continuous production of lPEI/plasmid DNA nanoparticles with narrow size distribution using a confined impinging jet device. The method involves the complex coacervation of negatively charged DNA plasmid and positive charged lPEI under rapid, highly dynamic, and homogeneous mixing conditions, producing polyelectrolyte complex nanoparticles with narrow distribution of particle size and shape. The average number of plasmid DNA packaged per nanoparticles and its distribution are similar between the FNC method and the small-scale batch mixing method. In addition, the nanoparticles prepared by these two methods exhibit similar cell transfection efficiency. These results confirm that FNC is an effective and scalable method that can produce well-controlled lPEI/plasmid DNA nanoparticles. PMID:27717227
Darzynkiewicz, Zbigniew; Traganos, Frank; Zhao, Hong; Halicka, H. Dorota; Li, Jiangwei
2011-01-01
This review covers progress in the development of cytometric methodologies designed to assess DNA replication and RNA synthesis. The early approaches utilizing autoradiography to detect incorporation of 3H- or 14C-labeled thymidine were able to identify the four fundamental phases of the cell cycle G1, S, G2, and M, and by analysis of the fraction of labeled mitosis (FLM), to precisely define the kinetics of cell progression through these phases. Analysis of 3H-uridine incorporation and RNA content provided the means to distinguish quiescent G0 from cycling G1 cells. Subsequent progress in analysis of DNA replication was based on the use of BrdU as a DNA precursor and its detection by the quenching of the fluorescence intensity of DNA-bound fluorochromes such as Hoechst 33358 or acridine orange as measured by flow cytometry. Several variants of this methodology have been designed and used in studies to detect anticancer drug-induced perturbations of cell cycle kinetics. The next phase of method development, which was particularly useful in studies of the cell cycle in vivo, including clinical applications, relied on immunocytochemical detection of incorporated halogenated DNA or RNA precursors. This approach however was hampered by the need for DNA denaturation, which made it difficult to concurrently detect other cell constituents for multiparametric analysis. The recently introduced “click chemistry” approach has no such limitation and is the method of choice for analysis of DNA replication and RNA synthesis. This method is based on the use of 5-ethynyl-2′deoxyuridine (EdU) as a DNA precursor or 5-ethynyluridine (EU) as an RNA precursor and their detection with fluorochrome-tagged azides utilizing a copper (I) catalyzed [3+2] cycloaddition. Several examples are presented that illustrate incorporation of EdU or EU in cells subjected to DNA damage detected as histone H2AX phosphorylation that have been analyzed by flow or laser scanning cytometry. PMID:21425239
NASA Astrophysics Data System (ADS)
Smith, Jarrod Anson
2D homonuclear 1H NMR methods and restrained molecular dynamics (rMD) calculations have been applied to determining the three-dimensional structures of DNA and minor groove-binding ligand-DNA complexes in solution. The structure of the DNA decamer sequence d(GCGTTAACGC)2 has been solved both with a distance-based rMD protocol and an NOE relaxation matrix backcalculation-based protocol in order to probe the relative merits of the different refinement methods. In addition, three minor groove binding ligand-DNA complexes have been examined. The solution structure of the oligosaccharide moiety of the antitumor DNA scission agent calicheamicin γ1I has been determined in complex with a decamer duplex containing its high affinity 5'-TCCT- 3' binding sequence. The structure of the complex reinforces the belief that the oligosaccharide moiety is responsible for the sequence selective minor-groove binding activity of the agent, and critical intermolecular contacts are revealed. The solution structures of both the (+) and (-) enantiomers of the minor groove binding DNA alkylating agent duocarmycin SA have been determined in covalent complex with the undecamer DNA duplex d(GACTAATTGTC).d(GAC AATTAGTC). The results support the proposal that the alkylation activity of the duocarmycin antitumor antibiotics is catalyzed by a binding-induced conformational change in the ligand which activates the cyclopropyl group for reaction with the DNA. Comparisons between the structures of the two enantiomers covalently bound to the same DNA sequence at the same 5'-AATTA-3 ' site have provided insight into the binding orientation and site selectivity, as well as the relative rates of reactivity of these two agents.
Improvement in the amine glass platform by bubbling method for a DNA microarray
Jee, Seung Hyun; Kim, Jong Won; Lee, Ji Hyeong; Yoon, Young Soo
2015-01-01
A glass platform with high sensitivity for sexually transmitted diseases microarray is described here. An amino-silane-based self-assembled monolayer was coated on the surface of a glass platform using a novel bubbling method. The optimized surface of the glass platform had highly uniform surface modifications using this method, as well as improved hybridization properties with capture probes in the DNA microarray. On the basis of these results, the improved glass platform serves as a highly reliable and optimal material for the DNA microarray. Moreover, in this study, we demonstrated that our glass platform, manufactured by utilizing the bubbling method, had higher uniformity, shorter processing time, lower background signal, and higher spot signal than the platforms manufactured by the general dipping method. The DNA microarray manufactured with a glass platform prepared using bubbling method can be used as a clinical diagnostic tool. PMID:26468293
Improvement in the amine glass platform by bubbling method for a DNA microarray.
Jee, Seung Hyun; Kim, Jong Won; Lee, Ji Hyeong; Yoon, Young Soo
2015-01-01
A glass platform with high sensitivity for sexually transmitted diseases microarray is described here. An amino-silane-based self-assembled monolayer was coated on the surface of a glass platform using a novel bubbling method. The optimized surface of the glass platform had highly uniform surface modifications using this method, as well as improved hybridization properties with capture probes in the DNA microarray. On the basis of these results, the improved glass platform serves as a highly reliable and optimal material for the DNA microarray. Moreover, in this study, we demonstrated that our glass platform, manufactured by utilizing the bubbling method, had higher uniformity, shorter processing time, lower background signal, and higher spot signal than the platforms manufactured by the general dipping method. The DNA microarray manufactured with a glass platform prepared using bubbling method can be used as a clinical diagnostic tool.
Ren, Jun; Lee, Haram; Yoo, Seung Min; Yu, Myeong-Sang; Park, Hansoo; Na, Dokyun
2017-04-01
DNA transformation that delivers plasmid DNAs into bacterial cells is fundamental in genetic manipulation to engineer and study bacteria. Developed transformation methods to date are optimized to specific bacterial species for high efficiency. Thus, there is always a demand for simple and species-independent transformation methods. We herein describe the development of a chemico-physical transformation method that combines a rubidium chloride (RbCl)-based chemical method and sepiolite-based physical method, and report its use for the simple and efficient delivery of DNA into various bacterial species. Using this method, the best transformation efficiency for Escherichia coli DH5α was 4.3×10 6 CFU/μg of pUC19 plasmid, which is higher than or comparable to the reported transformation efficiencies to date. This method also allowed the introduction of plasmid DNAs into Bacillus subtilis (5.7×10 3 CFU/μg of pSEVA3b67Rb), Bacillus megaterium (2.5×10 3 CFU/μg of pSPAsp-hp), Lactococcus lactis subsp. lactis (1.0×10 2 CFU/μg of pTRKH3-ermGFP), and Lactococcus lactis subsp. cremoris (2.2×10 2 CFU/μg of pMSP3535VA). Remarkably, even when the conventional chemical and physical methods failed to generate transformed cells in Bacillus sp. and Enterococcus faecalis, E. malodoratus and E. mundtii, our combined method showed a significant transformation efficiency (2.4×10 4 , 4.5×10 2 , 2×10 1 , and 0.5×10 1 CFU/μg of plasmid DNA). Based on our results, we anticipate that our simple and efficient transformation method should prove usefulness for introducing DNA into various bacterial species without complicated optimization of parameters affecting DNA entry into the cell. Copyright © 2017. Published by Elsevier B.V.
Chemical mapping of cytosines enzymatically flipped out of the DNA helix
Liutkevičiūtė, Zita; Tamulaitis, Gintautas; Klimašauskas, Saulius
2008-01-01
Haloacetaldehydes can be employed for probing unpaired DNA structures involving cytosine and adenine residues. Using an enzyme that was structurally proven to flip its target cytosine out of the DNA helix, the HhaI DNA methyltransferase (M.HhaI), we demonstrate the suitability of the chloroacetaldehyde modification for mapping extrahelical (flipped-out) cytosine bases in protein–DNA complexes. The generality of this method was verified with two other DNA cytosine-5 methyltransferases, M.AluI and M.SssI, as well as with two restriction endonucleases, R.Ecl18kI and R.PspGI, which represent a novel class of base-flipping enzymes. Our results thus offer a simple and convenient laboratory tool for detection and mapping of flipped-out cytosines in protein–DNA complexes. PMID:18450817
A Colorimetric Microplate Assay for DNA-Binding Activity of His-Tagged MutS Protein.
Banasik, Michał; Sachadyn, Paweł
2016-09-01
A simple microplate method was designed for rapid testing DNA-binding activity of proteins. The principle of the assay involves binding of tested DNA by his-tagged protein immobilized on a nickel-coated ELISA plate, following colorimetric detection of biotinylated DNA with avidin conjugated to horseradish peroxidase. The method was used to compare DNA mismatch binding activities of MutS proteins from three bacterial species. The assay required relatively low amounts of tested protein (approximately 0.5-10 pmol) and DNA (0.1-10 pmol) and a relatively short time of analysis (up to 60 min). The method is very simple to apply and convenient to test different buffer conditions of DNA-protein binding. Sensitive colorimetric detection enables naked eye observations and quantitation with an ELISA reader. The performance of the assay, which we believe is a distinguishing trait of the method, is based on two strong and specific molecular interactions: binding of a his-tagged protein to a nickel-coated microplate and binding of biotinylated DNA to avidin. In the reported experiments, the solution was used to optimize the conditions for DNA mismatch binding by MutS protein; however, the approach could be implemented to test nucleic acids interactions with any protein of interest.
The future of human DNA vaccines
Li, Lei; Saade, Fadi; Petrovsky, Nikolai
2012-01-01
DNA vaccines have evolved greatly over the last 20 years since their invention, but have yet to become a competitive alternative to conventional protein or carbohydrate based human vaccines. Whilst safety concerns were an initial barrier, the Achilles heel of DNA vaccines remains their poor immunogenicity when compared to protein vaccines. A wide variety of strategies have been developed to optimize DNA vaccine immunogenicity, including codon optimization, genetic adjuvants, electroporation and sophisticated prime-boost regimens, with each of these methods having its advantages and limitations. Whilst each of these methods has contributed to incremental improvements in DNA vaccine efficacy, more is still needed if human DNA vaccines are to succeed commercially. This review foresees a final breakthrough in human DNA vaccines will come from application of the latest cutting-edge technologies, including “epigenetics” and “omics” approaches, alongside traditional techniques to improve immunogenicity such as adjuvants and electroporation, thereby overcoming the current limitations of DNA vaccines in humans PMID:22981627
Determination of sex origin of meat and meat products on the DNA basis: a review.
Gokulakrishnan, Palanisamy; Kumar, Rajiv Ranjan; Sharma, Brahm Deo; Mendiratta, Sanjod Kumar; Malav, Omprakash; Sharma, Deepak
2015-01-01
Sex determination of domestic animal's meat is of potential value in meat authentication and quality control studies. Methods aiming at determining the sex origin of meat may be based either on the analysis of hormone or on the analysis of nucleic acids. At the present time, sex determination of meat and meat products based on hormone analysis employ gas chromatography-mass spectrometry (GC-MS), high-performance liquid chromatography-mass spectrometry/mass spectrometry (HPLC-MS/MS), and enzyme-linked immunosorbent assay (ELISA). Most of the hormone-based methods proved to be highly specific and sensitive but were not performed on a regular basis for meat sexing due to the technical limitations or the expensive equipments required. On the other hand, the most common methodology to determine the sex of meat is unquestionably traditional polymerase chain reaction (PCR) that involves gel electrophoresis of DNA amplicons. This review is intended to provide an overview of the DNA-based methods for sex determination of meat and meat products.
Enhanced Detection of Bacteria in Environmental Waters: an RNA-based Approach
Molecular assays (i.e., PCR and qPCR) used in microbial water quality studies often target ribosomal RNA genes (rDNA). However, using DNA as the PCR template does not discriminate between active and dead cells. The use of RNA-based detection methods has recently been proposed as ...
DNABIT Compress – Genome compression algorithm
Rajarajeswari, Pothuraju; Apparao, Allam
2011-01-01
Data compression is concerned with how information is organized in data. Efficient storage means removal of redundancy from the data being stored in the DNA molecule. Data compression algorithms remove redundancy and are used to understand biologically important molecules. We present a compression algorithm, “DNABIT Compress” for DNA sequences based on a novel algorithm of assigning binary bits for smaller segments of DNA bases to compress both repetitive and non repetitive DNA sequence. Our proposed algorithm achieves the best compression ratio for DNA sequences for larger genome. Significantly better compression results show that “DNABIT Compress” algorithm is the best among the remaining compression algorithms. While achieving the best compression ratios for DNA sequences (Genomes),our new DNABIT Compress algorithm significantly improves the running time of all previous DNA compression programs. Assigning binary bits (Unique BIT CODE) for (Exact Repeats, Reverse Repeats) fragments of DNA sequence is also a unique concept introduced in this algorithm for the first time in DNA compression. This proposed new algorithm could achieve the best compression ratio as much as 1.58 bits/bases where the existing best methods could not achieve a ratio less than 1.72 bits/bases. PMID:21383923
Universal DNA-based methods for assessing the diet of grazing livestock and wildlife from feces.
Pegard, Anthony; Miquel, Christian; Valentini, Alice; Coissac, Eric; Bouvier, Frédéric; François, Dominique; Taberlet, Pierre; Engel, Erwan; Pompanon, François
2009-07-08
Because of the demand for controlling livestock diets, two methods that characterize the DNA of plants present in feces were developed. After DNA extraction from fecal samples, a short fragment of the chloroplastic trnL intron was amplified by PCR using a universal primer pair for plants. The first method generates a signature that is the electrophoretic migration pattern of the PCR product. The second method consists of sequencing several hundred DNA fragments from the PCR product through pyrosequencing. These methods were validated with a blind analysis of feces from concentrate- and pasture-fed lambs. The signature method allowed differentiation of the two diets and confirmed the presence of concentrate in one of them. The pyrosequencing method allowed the identification of up to 25 taxa in a diet. These methods are complementary to the chemical methods already used. They could be applied to the control of diets and the study of food preferences.
Use of FTA® classic cards for epigenetic analysis of sperm DNA.
Serra, Olga; Frazzi, Raffaele; Perotti, Alessio; Barusi, Lorenzo; Buschini, Annamaria
2018-02-01
FTA® technologies provide the most reliable method for DNA extraction. Although FTA technologies have been widely used for genetic analysis, there is no literature on their use for epigenetic analysis yet. We present for the first time, a simple method for quantitative methylation assessment based on sperm cells stored on Whatman FTA classic cards. Specifically, elution of seminal DNA from FTA classic cards was successfully tested with an elution buffer and an incubation step in a thermocycler. The eluted DNA was bisulfite converted, amplified by PCR, and a region of interest was pyrosequenced.
Molecule counting with alkanethiol and DNA immobilized on gold microplates for extended gate FET.
Cao, Zhong; Xiao, Zhong-Liang; Zhang, Ling; Luo, Dong-Mei; Kamahori, Masao; Shimoda, Maki
2013-04-01
Several molecule counting methods based on electrochemical characterization of alkanethiol and thiolated single-stranded oligonucleotide (HS-ssDNA) immobilized on gold microplates, which were used as extended gates of field effect transistors (FETs), have been investigated in this paper. The surface density of alkanethiol and DNA monolayers on gold microplates were quantitatively evaluated from the reductive desorption charge by using cyclic voltammetry (CV) and fast CV (FCV) methods in strong alkali solution. Typically, the surface density of 6-hydroxy-1-hexanethiol (6-HHT) was evaluated to be 4.639 molecules/nm(2), and the 28 base-pair dsDNA about 1.226-4.849 molecules/100 nm(2) on Au microplates after post-treatment with 6-HHT. The behaviors on surface potential and capacitance of different aminoalkanethiols on Au microplates were measured in 0.1 mol/L Na2SO4 and 10 mmol/L Tris-HCl (pH=7.4) solutions, indicating that the surface potential increases and the double-layer capacitance decreases with the length of carbon chain increased for the thiol monolayers, which obey a physics relationship for a capacitor. Comparably, a simple sensing method based on the electronic signals of biochemical reaction events on DNA immobilization and hybridization at the Au surface of the extended gate FET (EGFET) was developed, with which the surface density of the hybridized dsDNA on the gold surface of the EGFET was evaluated to be 1.36 molecules per 100 nm(2), showing that the EGFET is a promising sensing biochip for DNA molecule counting. Copyright © 2012 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Zhang, Xirui; Daaboul, George G.; Spuhler, Philipp S.; Dröge, Peter; Ünlü, M. Selim
2016-03-01
DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are not fully understood. Recently, it was discovered that DNA-binding proteins recognize specific binding sites to carry out their functions through an indirect readout mechanism by recognizing and capturing DNA conformational flexibility and deformation. High-throughput DNA microarray-based methods that provide large-scale protein-DNA binding information have shown effective and comprehensive analysis of protein-DNA binding affinities, but do not provide information of DNA conformational changes in specific protein-DNA complexes. Building on the high-throughput capability of DNA microarrays, we demonstrate a quantitative approach that simultaneously measures the amount of protein binding to DNA and nanometer-scale DNA conformational change induced by protein binding in a microarray format. Both measurements rely on spectral interferometry on a layered substrate using a single optical instrument in two distinct modalities. In the first modality, we quantitate the amount of binding of protein to surface-immobilized DNA in each DNA spot using a label-free spectral reflectivity technique that accurately measures the surface densities of protein and DNA accumulated on the substrate. In the second modality, for each DNA spot, we simultaneously measure DNA conformational change using a fluorescence vertical sectioning technique that determines average axial height of fluorophores tagged to specific nucleotides of the surface-immobilized DNA. The approach presented in this paper, when combined with current high-throughput DNA microarray-based technologies, has the potential to serve as a rapid and simple method for quantitative and large-scale characterization of conformational specific protein-DNA interactions.DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are not fully understood. Recently, it was discovered that DNA-binding proteins recognize specific binding sites to carry out their functions through an indirect readout mechanism by recognizing and capturing DNA conformational flexibility and deformation. High-throughput DNA microarray-based methods that provide large-scale protein-DNA binding information have shown effective and comprehensive analysis of protein-DNA binding affinities, but do not provide information of DNA conformational changes in specific protein-DNA complexes. Building on the high-throughput capability of DNA microarrays, we demonstrate a quantitative approach that simultaneously measures the amount of protein binding to DNA and nanometer-scale DNA conformational change induced by protein binding in a microarray format. Both measurements rely on spectral interferometry on a layered substrate using a single optical instrument in two distinct modalities. In the first modality, we quantitate the amount of binding of protein to surface-immobilized DNA in each DNA spot using a label-free spectral reflectivity technique that accurately measures the surface densities of protein and DNA accumulated on the substrate. In the second modality, for each DNA spot, we simultaneously measure DNA conformational change using a fluorescence vertical sectioning technique that determines average axial height of fluorophores tagged to specific nucleotides of the surface-immobilized DNA. The approach presented in this paper, when combined with current high-throughput DNA microarray-based technologies, has the potential to serve as a rapid and simple method for quantitative and large-scale characterization of conformational specific protein-DNA interactions. Electronic supplementary information (ESI) available: DNA sequences and nomenclature (Table 1S); SDS-PAGE assay of IHF stock solution (Fig. 1S); determination of the concentration of IHF stock solution by Bradford assay (Fig. 2S); equilibrium binding isotherm fitting results of other DNA sequences (Table 2S); calculation of dissociation constants (Fig. 3S, 4S; Table 2S); geometric model for quantitation of DNA bending angle induced by specific IHF binding (Fig. 4S); customized flow cell assembly (Fig. 5S); real-time measurement of average fluorophore height change by SSFM (Fig. 6S); summary of binding parameters obtained from additive isotherm model fitting (Table 3S); average surface densities of 10 dsDNA spots and bound IHF at equilibrium (Table 4S); effects of surface densities on the binding and bending of dsDNA (Tables 5S, 6S and Fig. 7S-10S). See DOI: 10.1039/c5nr06785e
Kiesler, Kevin M; Coble, Michael D; Hall, Thomas A; Vallone, Peter M
2014-01-01
A set of 711 samples from four U.S. population groups was analyzed using a novel mass spectrometry based method for mitochondrial DNA (mtDNA) base composition profiling. Comparison of the mass spectrometry results with Sanger sequencing derived data yielded a concordance rate of 99.97%. Length heteroplasmy was identified in 46% of samples and point heteroplasmy was observed in 6.6% of samples in the combined mass spectral and Sanger data set. Using discrimination capacity as a metric, Sanger sequencing of the full control region had the highest discriminatory power, followed by the mass spectrometry base composition method, which was more discriminating than Sanger sequencing of just the hypervariable regions. This trend is in agreement with the number of nucleotides covered by each of the three assays. Published by Elsevier Ireland Ltd.
McKernan, Kevin J.; Spangler, Jessica; Zhang, Lei; Tadigotla, Vasisht; McLaughlin, Stephen; Warner, Jason; Zare, Amir; Boles, Richard G.
2014-01-01
We have developed a PCR method, coined Déjà vu PCR, that utilizes six nucleotides in PCR with two methyl specific restriction enzymes that respectively digest these additional nucleotides. Use of this enzyme-and-nucleotide combination enables what we term a “DNA diode”, where DNA can advance in a laboratory in only one direction and cannot feedback into upstream assays. Here we describe aspects of this method that enable consecutive amplification with the introduction of a 5th and 6th base while simultaneously providing methylation dependent mitochondrial DNA enrichment. These additional nucleotides enable a novel DNA decontamination technique that generates ephemeral and easy to decontaminate DNA. PMID:24788618
Estes, Jacob M; Kirby, Tyler O; Huh, Warner K
2007-01-01
To determine whether autoclave sterilization eradicates human papillomavirus (HPV) DNA on specula and instruments used to treat women with cervical neoplasia. Specula and instruments used in two referral colposcopy clinics were evaluated to determine the PGMY9/11 primer system's ability to amplify residual HPV DNA. Each speculum and instrument was sampled with a Dacron swab and stored in PreservCyt solution (Cytyc Corporation, Marlborough, MA) at 4 degrees C. DNA amplification was performed under standard conditions with appropriate controls followed by HPV typing using the reverse line blot test (Roche Molecular Systems, Alameda, CA). Once validated, the same polymerase chain reaction method was used on autoclave-sterilized specula and biopsy instruments and heated glass bead- and Cidex bath (Johnson & Johnson, New Brunswick, NJ)-sterilized instruments. All results, with appropriate positive and negative controls, were confirmed in triplicate. A total of 140 instruments (70 used and 70 autoclaved) were sampled for residual HPV DNA. Five samples in the contaminated specula arm were excluded from analysis secondary to insufficient sampling. Of the remaining samples, 52.3% (34/65) of contaminated instruments-both specula and biopsy instruments-had detectable HPV DNA. Fifty-five percent of contaminated biopsy instruments (11/20) were positive and 51.1% of contaminated specula (23/45) were positive. All 70 autoclaved samples (50 specula and 20 biopsy instruments) were negative for residual HPV DNA or beta-globin. One instrument in the glass bead and Cidex group that was presumed sterile was positive for HPV 16 DNA. The PGMY9/11 primer system is an effective method to detect residual HPV DNA. Autoclave sterilization appears to eradicate HPV DNA to levels undetectable with this sensitive assay, whereas heated glass beads followed by Cidex bath appears to be inadequate methods. These results suggest that autoclave sterilization is effective when using nondisposable instruments and should be the method of choice in studies using polymerase chain reaction-based amplification of HPV DNA.
Frégeau, Chantal J; Lett, C Marc; Fourney, Ron M
2010-10-01
A semi-automated DNA extraction process for casework samples based on the Promega DNA IQ™ system was optimized and validated on TECAN Genesis 150/8 and Freedom EVO robotic liquid handling stations configured with fixed tips and a TECAN TE-Shake™ unit. The use of an orbital shaker during the extraction process promoted efficiency with respect to DNA capture, magnetic bead/DNA complex washes and DNA elution. Validation studies determined the reliability and limitations of this shaker-based process. Reproducibility with regards to DNA yields for the tested robotic workstations proved to be excellent and not significantly different than that offered by the manual phenol/chloroform extraction. DNA extraction of animal:human blood mixtures contaminated with soil demonstrated that a human profile was detectable even in the presence of abundant animal blood. For exhibits containing small amounts of biological material, concordance studies confirmed that DNA yields for this shaker-based extraction process are equivalent or greater to those observed with phenol/chloroform extraction as well as our original validated automated magnetic bead percolation-based extraction process. Our data further supports the increasing use of robotics for the processing of casework samples. Crown Copyright © 2009. Published by Elsevier Ireland Ltd. All rights reserved.
Dejmek, Annika; Zendehrokh, Nooreldin; Tomaszewska, Malgorzata; Edsjö, Anders
2013-07-01
Personalized oncology requires molecular analysis of tumor cells. Several studies have demonstrated that cytological material is suitable for DNA analysis, but to the authors' knowledge there are no systematic studies comparing how the yield and quality of extracted DNA is affected by the various techniques used for the preparation of cytological material. DNA yield and quality were compared using cultured human lung cancer cells subjected to different preparation techniques used in routine cytology, including fixation, mounting medium, and staining. The results were compared with the outcome of epidermal growth factor receptor (EGFR) genotyping of 66 clinical cytological samples using the same DNA preparation protocol. All tested protocol combinations resulted in fragment lengths of at least 388 base pairs. The mounting agent EcoMount resulted in higher yields than traditional xylene-based medium. Spray and ethanol fixation resulted in both a higher yield and better DNA quality than air drying. In liquid-based cytology (LBC) methods, CytoLyt solution resulted in a 5-fold higher yield than CytoRich Red. Papanicolaou staining provided twice the yield of hematoxylin and eosin staining in both liquid-based preparations. Genotyping outcome and quality control values from the clinical EGFR genotyping demonstrated a sufficient amount and amplifiability of DNA in both spray-fixed and air-dried cytological samples. Reliable clinical genotyping can be performed using all tested methods. However, in the cell line experiments, spray- or ethanol-fixed, Papanicolaou-stained slides provided the best results in terms of yield and fragment length. In LBC, the DNA recovery efficiency of the preserving medium may differ considerably, which should be taken into consideration when introducing LBC. Cancer (Cancer Cytopathol) 2013;121:344-353. © 2013 American Cancer Society. © 2013 American Cancer Society.
Theoretical study on the binding mechanism between N6-methyladenine and natural DNA bases.
Song, Qi-Xia; Ding, Zhen-Dong; Liu, Jian-Hua; Li, Yan; Wang, Hai-Jun
2013-03-01
N6-methyladenine (m(6)A) is a rare base naturally occurring in DNA. It is different from the base adenine due to its N-CH(3). Therefore, the base not only pairs with thymine, but also with other DNA bases (cytosine, adenine and guanine). In this work, Møller-Plesset second-order (MP2) method has been used to investigate the binding mechanism between m(6)A and natural DNA bases in gas phase and in aqueous solution. The results show that N-CH(3) changed the way of N6-methyladenine binding to natural DNA bases. The binding style significantly influences the stability of base pairs. The trans-m(6)A:G and trans-m(6)A:C conformers are the most stable among all the base pairs. The existence of solvent can remarkably reduce the stability of the base pairs, and the DNA bases prefer pairing with trans-m(6)A to cis-m(6)A. Besides, the properties of these hydrogen bonds have been analyzed by atom in molecules (AIM) theory, natural bond orbital (NBO) analysis and Wiberg bond indexes (WBI). In addition, pairing with m(6)A decreases the binding energies compared to the normal Watson-Crick base pairs, it may explain the instability of the N6 site methylated DNA in theory.
Ho, Dominik; Dose, Christian; Albrecht, Christian H.; Severin, Philip; Falter, Katja; Dervan, Peter B.; Gaub, Hermann E.
2009-01-01
Force-based ligand detection is a promising method to characterize molecular complexes label-free at physiological conditions. Because conventional implementations of this technique, e.g., based on atomic force microscopy or optical traps, are low-throughput and require extremely sensitive and sophisticated equipment, this approach has to date found only limited application. We present a low-cost, chip-based assay, which combines high-throughput force-based detection of dsDNA·ligand interactions with the ease of fluorescence detection. Within the comparative unbinding force assay, many duplicates of a target DNA duplex are probed against a defined reference DNA duplex each. The fractions of broken target and reference DNA duplexes are determined via fluorescence. With this assay, we investigated the DNA binding behavior of artificial pyrrole-imidazole polyamides. These small compounds can be programmed to target specific dsDNA sequences and distinguish between D- and L-DNA. We found that titration with polyamides specific for a binding motif, which is present in the target DNA duplex and not in the reference DNA duplex, reliably resulted in a shift toward larger fractions of broken reference bonds. From the concentration dependence nanomolar to picomolar dissociation constants of dsDNA·ligand complexes were determined, agreeing well with prior quantitative DNAase footprinting experiments. This finding corroborates that the forced unbinding of dsDNA in presence of a ligand is a nonequilibrium process that produces a snapshot of the equilibrium distribution between dsDNA and dsDNA·ligand complexes. PMID:19486688
Lee, Ji-Yun; Kim, Chang Jong
2010-01-01
Egg allergy is one of the most common food allergies in both adults and children, and foods including eggs and their byproducts should be declared under food allergen labeling policies in industrial countries. Therefore, to develop and validate a sensitive and specific method to detect hidden egg allergens in foods, we compared immunochemical, DNA-based, and proteomic methods for detecting egg allergens in foods using egg allergen standards such as egg whole protein, egg white protein, egg yolk protein, ovomucoid, ovalbumin, ovotransferrin, lysozyme, and alpha-livetin. Protein-based immunochemical methods, including ELISA as an initial screening quantitative analysis and immunoblotting as a final confirmatory qualitative analysis, were very sensitive and specific in detecting potentially allergenic egg residues in processed foods in trace amounts. In contrast, the proteomics-based, matrix-assisted laser desorption/ionization time-of-flight MS and LC-tandem quadrupole time-of-flight MS methods were not able to detect some egg allergens, such as ovomucoid, because of its nondenaturing property under urea and trypsin. The DNA-based PCR method could not distinguish between egg and chicken meat because it is tissue-nonspecific. In further studies for the feasibility of these immunochemical methods on 100 real raw dietary samples, four food samples without listed egg ingredients produced a positive response by ELISA, but exhibited negative results by immunoblotting.
NASA Astrophysics Data System (ADS)
Pylaev, T. E.; Khanadeev, V. A.; Khlebtsov, B. N.; Dykman, L. A.; Bogatyrev, V. A.; Khlebtsov, N. G.
2011-07-01
We introduce a new genosensing approach employing CTAB (cetyltrimethylammonium bromide)-coated positively charged colloidal gold nanoparticles (GNPs) to detect target DNA sequences by using absorption spectroscopy and dynamic light scattering. The approach is compared with a previously reported method employing unmodified CTAB-coated gold nanorods (GNRs). Both approaches are based on the observation that whereas the addition of probe and target ssDNA to CTAB-coated particles results in particle aggregation, no aggregation is observed after addition of probe and nontarget DNA sequences. Our goal was to compare the feasibility and sensitivity of both methods. A 21-mer ssDNA from the human immunodeficiency virus type 1 HIV-1 U5 long terminal repeat (LTR) sequence and a 23-mer ssDNA from the Bacillus anthracis cryptic protein and protective antigen precursor (pagA) genes were used as ssDNA models. In the case of GNRs, unexpectedly, the colorimetric test failed with perfect cigar-like particles but could be performed with dumbbell and dog-bone rods. By contrast, our approach with cationic CTAB-coated GNPs is easy to implement and possesses excellent feasibility with retention of comparable sensitivity—a 0.1 nM concentration of target cDNA can be detected with the naked eye and 10 pM by dynamic light scattering (DLS) measurements. The specificity of our method is illustrated by successful DLS detection of one-three base mismatches in cDNA sequences for both DNA models. These results suggest that the cationic GNPs and DLS can be used for genosensing under optimal DNA hybridization conditions without any chemical modifications of the particle surface with ssDNA molecules and signal amplification. Finally, we discuss a more than two-three-order difference in the reported estimations of the detection sensitivity of colorimetric methods (0.1 to 10-100 pM) to show that the existing aggregation models are inconsistent with the detection limits of about 0.1-1 pM DNA and that other explanations should be developed.
DNA viewed as an out-of-equilibrium structure
NASA Astrophysics Data System (ADS)
Provata, A.; Nicolis, C.; Nicolis, G.
2014-05-01
The complexity of the primary structure of human DNA is explored using methods from nonequilibrium statistical mechanics, dynamical systems theory, and information theory. A collection of statistical analyses is performed on the DNA data and the results are compared with sequences derived from different stochastic processes. The use of χ2 tests shows that DNA can not be described as a low order Markov chain of order up to r =6. Although detailed balance seems to hold at the level of a binary alphabet, it fails when all four base pairs are considered, suggesting spatial asymmetry and irreversibility. Furthermore, the block entropy does not increase linearly with the block size, reflecting the long-range nature of the correlations in the human genomic sequences. To probe locally the spatial structure of the chain, we study the exit distances from a specific symbol, the distribution of recurrence distances, and the Hurst exponent, all of which show power law tails and long-range characteristics. These results suggest that human DNA can be viewed as a nonequilibrium structure maintained in its state through interactions with a constantly changing environment. Based solely on the exit distance distribution accounting for the nonequilibrium statistics and using the Monte Carlo rejection sampling method, we construct a model DNA sequence. This method allows us to keep both long- and short-range statistical characteristics of the native DNA data. The model sequence presents the same characteristic exponents as the natural DNA but fails to capture spatial correlations and point-to-point details.
DNA viewed as an out-of-equilibrium structure.
Provata, A; Nicolis, C; Nicolis, G
2014-05-01
The complexity of the primary structure of human DNA is explored using methods from nonequilibrium statistical mechanics, dynamical systems theory, and information theory. A collection of statistical analyses is performed on the DNA data and the results are compared with sequences derived from different stochastic processes. The use of χ^{2} tests shows that DNA can not be described as a low order Markov chain of order up to r=6. Although detailed balance seems to hold at the level of a binary alphabet, it fails when all four base pairs are considered, suggesting spatial asymmetry and irreversibility. Furthermore, the block entropy does not increase linearly with the block size, reflecting the long-range nature of the correlations in the human genomic sequences. To probe locally the spatial structure of the chain, we study the exit distances from a specific symbol, the distribution of recurrence distances, and the Hurst exponent, all of which show power law tails and long-range characteristics. These results suggest that human DNA can be viewed as a nonequilibrium structure maintained in its state through interactions with a constantly changing environment. Based solely on the exit distance distribution accounting for the nonequilibrium statistics and using the Monte Carlo rejection sampling method, we construct a model DNA sequence. This method allows us to keep both long- and short-range statistical characteristics of the native DNA data. The model sequence presents the same characteristic exponents as the natural DNA but fails to capture spatial correlations and point-to-point details.
Smart, Adam S; Tingley, Reid; Weeks, Andrew R; van Rooyen, Anthony R; McCarthy, Michael A
2015-10-01
Effective management of alien species requires detecting populations in the early stages of invasion. Environmental DNA (eDNA) sampling can detect aquatic species at relatively low densities, but few studies have directly compared detection probabilities of eDNA sampling with those of traditional sampling methods. We compare the ability of a traditional sampling technique (bottle trapping) and eDNA to detect a recently established invader, the smooth newt Lissotriton vulgaris vulgaris, at seven field sites in Melbourne, Australia. Over a four-month period, per-trap detection probabilities ranged from 0.01 to 0.26 among sites where L. v. vulgaris was detected, whereas per-sample eDNA estimates were much higher (0.29-1.0). Detection probabilities of both methods varied temporally (across days and months), but temporal variation appeared to be uncorrelated between methods. Only estimates of spatial variation were strongly correlated across the two sampling techniques. Environmental variables (water depth, rainfall, ambient temperature) were not clearly correlated with detection probabilities estimated via trapping, whereas eDNA detection probabilities were negatively correlated with water depth, possibly reflecting higher eDNA concentrations at lower water levels. Our findings demonstrate that eDNA sampling can be an order of magnitude more sensitive than traditional methods, and illustrate that traditional- and eDNA-based surveys can provide independent information on species distributions when occupancy surveys are conducted over short timescales.
Chen, Hongjun; Yu, Zicheng; Cao, Zhijuan; Lau, Choiwan
2016-11-01
Magnetic bead (MB)-based chemiluminescence (CL) ELISA can be a sample-thrifty, time-saving tool for evaluation of cigarette smoke-induced DNA single-strand breaks (SSBs) with high specificity. This article describes a novel approach using immobilized oligonucleotide on MBs to determine cigarette smoke-induced DNA SSBs and screen some protective natural compounds. Typically, fluorescein-labeled DNA (FAM-DNA) was immobilized on the MBs and then oxidized by the smoke in the absence or presence of natural compounds, and a part of FAM-DNA was fragmented due to cigarette smoke-induced DNA SSB and then detached from MBs whereas other non-broken FAM-DNA still remained on MBs. Then, any broken FAM-DNA fragments, complex tobacco smoke matrix, and other stuff related with natural compounds were conveniently washed away by a magnetic force, and thus possible interfering substances were completely removed. Finally, those remaining non-broken FAM-DNA on MBs were reacted with HRP-labeled anti-fluorescein antibody and then detected by CL ELISA. CL signal was converted to molar concentrations of the FAM-DNA by interpolation from a pre-determined standard linear calibration curve. The level of DNA SSBs induced by cigarette smoke was thus calculated using the method. A library of 30 natural products was subsequently screened, and two among them were found to protect DNA from oxidative damage and thus may be promising compounds for the development of new drugs. The method developed will be useful for quantitative screening of drug genotoxicity in terms of induction of DNA SSBs. Graphical abstract ᅟ.
Real-Time Analysis of Specific Protein-DNA Interactions with Surface Plasmon Resonance
Ritzefeld, Markus; Sewald, Norbert
2012-01-01
Several proteins, like transcription factors, bind to certain DNA sequences, thereby regulating biochemical pathways that determine the fate of the corresponding cell. Due to these key positions, it is indispensable to analyze protein-DNA interactions and to identify their mode of action. Surface plasmon resonance is a label-free method that facilitates the elucidation of real-time kinetics of biomolecular interactions. In this article, we focus on this biosensor-based method and provide a detailed guide how SPR can be utilized to study binding of proteins to oligonucleotides. After a description of the physical phenomenon and the instrumental realization including fiber-optic-based SPR and SPR imaging, we will continue with a survey of immobilization methods. Subsequently, we will focus on the optimization of the experiment, expose pitfalls, and introduce how data should be analyzed and published. Finally, we summarize several interesting publications of the last decades dealing with protein-DNA and RNA interaction analysis by SPR. PMID:22500214
Welcsh, Piri; Kehrli, Keffy; Lazarchuk, Pavlo; Ladiges, Warren; Sidorova, Julia
2016-10-01
Functional studies of the roles that DNA helicases play in human cells have benefited immensely from DNA fiber (or single molecule) technologies, which enable us to discern minute differences in behaviors of individual replication forks in genomic DNA in vivo. DNA fiber technologies are a group of methods that use different approaches to unravel and stretch genomic DNA to its contour length, and display it on a glass surface in order to immuno-stain nucleoside analog incorporation into DNA to reveal tracks (or tracts) of replication. We have previously adopted a microfluidic approach to DNA stretching and used it to analyze DNA replication. This method was introduced under the moniker maRTA or microfluidic-assisted Replication Track Analysis, and we have since used it to analyze roles of the RECQ helicases WRN and BLM, and other proteins in normal and perturbed replication. Here we describe a novel application of maRTA to detect and measure repair of DNA damage produced by three different agents relevant to etiology or therapy of cancer: methyl-methanesulfonate, UV irradiation, and mitomycin C. Moreover, we demonstrate the utility of this method by analyzing DNA repair in cells with reduced levels of WRN or of the base excision repair protein XRCC1. Copyright © 2016 Elsevier Inc. All rights reserved.
Mechanisms of small molecule–DNA interactions probed by single-molecule force spectroscopy
Almaqwashi, Ali A.; Paramanathan, Thayaparan; Rouzina, Ioulia; Williams, Mark C.
2016-01-01
There is a wide range of applications for non-covalent DNA binding ligands, and optimization of such interactions requires detailed understanding of the binding mechanisms. One important class of these ligands is that of intercalators, which bind DNA by inserting aromatic moieties between adjacent DNA base pairs. Characterizing the dynamic and equilibrium aspects of DNA-intercalator complex assembly may allow optimization of DNA binding for specific functions. Single-molecule force spectroscopy studies have recently revealed new details about the molecular mechanisms governing DNA intercalation. These studies can provide the binding kinetics and affinity as well as determining the magnitude of the double helix structural deformations during the dynamic assembly of DNA–ligand complexes. These results may in turn guide the rational design of intercalators synthesized for DNA-targeted drugs, optical probes, or integrated biological self-assembly processes. Herein, we survey the progress in experimental methods as well as the corresponding analysis framework for understanding single molecule DNA binding mechanisms. We discuss briefly minor and major groove binding ligands, and then focus on intercalators, which have been probed extensively with these methods. Conventional mono-intercalators and bis-intercalators are discussed, followed by unconventional DNA intercalation. We then consider the prospects for using these methods in optimizing conventional and unconventional DNA-intercalating small molecules. PMID:27085806
Gui, Zhen; Wang, Quanbo; Li, Jinchang; Zhu, Mingchen; Yu, Lili; Xun, Tang; Yan, Feng; Ju, Huangxian
2016-07-01
As an emerging noninvasive blood biomarker, circulating free DNA (cfDNA) can be utilized to assess diagnosis, progression and evaluate prognosis of cancer. However, cfDNAs are not "naked", they can be part of complexes, or are bound to the surface of the cells via proteins, which make the detection more challenging. Here, a simple method for the detection of Ubiquitin-like with PHD and ring finger domains 1 (UHRF1) DNA exacted from serum of breast cancer (BC) has been developed using a novel locked nucleic acid molecular beacon (LNA-MB). In order to enhance the stability and detection efficiency of the probe in biofluids, we design a shared-stem molecular beacon containing a 27-mer loop and a 4-mer stem with DNA/LNA alternating bases. The fluorescence is released in the presence of target. The detection procedure is simple and can be completed within 1h. This method shows a sensitive response to UHRF1 DNA with a dynamic range of 3 orders of magnitude. The limit of detection is 11nM (S/N=3) with excellent selectivity. It can discriminate UHRF1 DNA from three-base mismatched DNA with a high specificity. More importantly, this method can distinguish the expression of serum UHRF1 DNA among 5 breast cancer patients and 5 healthy controls. The mentioned superiority may suggest that this assay can be served as a promising noninvasive detection tool for early BC diagnosis and monitoring. Copyright © 2016 Elsevier B.V. All rights reserved.
Functional interrogation of non-coding DNA through CRISPR genome editing.
Canver, Matthew C; Bauer, Daniel E; Orkin, Stuart H
2017-05-15
Methodologies to interrogate non-coding regions have lagged behind coding regions despite comprising the vast majority of the genome. However, the rapid evolution of clustered regularly interspaced short palindromic repeats (CRISPR)-based genome editing has provided a multitude of novel techniques for laboratory investigation including significant contributions to the toolbox for studying non-coding DNA. CRISPR-mediated loss-of-function strategies rely on direct disruption of the underlying sequence or repression of transcription without modifying the targeted DNA sequence. CRISPR-mediated gain-of-function approaches similarly benefit from methods to alter the targeted sequence through integration of customized sequence into the genome as well as methods to activate transcription. Here we review CRISPR-based loss- and gain-of-function techniques for the interrogation of non-coding DNA. Copyright © 2017 Elsevier Inc. All rights reserved.
Winnowing DNA for Rare Sequences: Highly Specific Sequence and Methylation Based Enrichment
Thompson, Jason D.; Shibahara, Gosuke; Rajan, Sweta; Pel, Joel; Marziali, Andre
2012-01-01
Rare mutations in cell populations are known to be hallmarks of many diseases and cancers. Similarly, differential DNA methylation patterns arise in rare cell populations with diagnostic potential such as fetal cells circulating in maternal blood. Unfortunately, the frequency of alleles with diagnostic potential, relative to wild-type background sequence, is often well below the frequency of errors in currently available methods for sequence analysis, including very high throughput DNA sequencing. We demonstrate a DNA preparation and purification method that through non-linear electrophoretic separation in media containing oligonucleotide probes, achieves 10,000 fold enrichment of target DNA with single nucleotide specificity, and 100 fold enrichment of unmodified methylated DNA differing from the background by the methylation of a single cytosine residue. PMID:22355378
Guo, Y C; Wang, H; Wu, H P; Zhang, M Q
2015-12-21
Aimed to address the defects of the large mean square error (MSE), and the slow convergence speed in equalizing the multi-modulus signals of the constant modulus algorithm (CMA), a multi-modulus algorithm (MMA) based on global artificial fish swarm (GAFS) intelligent optimization of DNA encoding sequences (GAFS-DNA-MMA) was proposed. To improve the convergence rate and reduce the MSE, this proposed algorithm adopted an encoding method based on DNA nucleotide chains to provide a possible solution to the problem. Furthermore, the GAFS algorithm, with its fast convergence and global search ability, was used to find the best sequence. The real and imaginary parts of the initial optimal weight vector of MMA were obtained through DNA coding of the best sequence. The simulation results show that the proposed algorithm has a faster convergence speed and smaller MSE in comparison with the CMA, the MMA, and the AFS-DNA-MMA.
Pandey, Gunjan; Pandey, Janmejay; Jain, Rakesh K
2006-05-01
Monitoring of micro-organisms released deliberately into the environment is essential to assess their movement during the bio-remediation process. During the last few years, DNA-based genetic methods have emerged as the preferred method for such monitoring; however, their use is restricted in cases where organisms used for bio-remediation are not well characterized or where the public domain databases do not provide sufficient information regarding their sequence. For monitoring of such micro-organisms, alternate approaches have to be undertaken. In this study, we have specifically monitored a p-nitrophenol (PNP)-degrading organism, Arthrobacter protophormiae RKJ100, using molecular methods during PNP degradation in soil microcosm. Cells were tagged with a transposon-based foreign DNA sequence prior to their introduction into PNP-contaminated microcosms. Later, this artificially introduced DNA sequence was PCR-amplified to distinguish the bio-augmented organism from the indigenous microflora during PNP bio-remediation.
NASA Astrophysics Data System (ADS)
Amini, Bahram; Kamali, Mehdi; Salouti, Mojtaba; Yaghmaei, Parichehreh
2018-06-01
Colorimetric DNA detection is preferred over other methods for clinical molecular diagnosis because it does not require expensive equipment. In the present study, the colorimetric method based on gold nanoparticles (GNPs) and endonuclease enzyme was used for the detection of P. aeruginosa ETA gene. Firstly, the primers and probe for P. aeruginosa exotoxin A (ETA) gene were designed and checked for specificity by the PCR method. Then, GNPs were synthesized using the citrate reduction method and conjugated with the prepared probe to develop the new nano-biosensor. Next, the extracted target DNA of the bacteria was added to GNP-probe complex to check its efficacy for P. aeruginosa ETA gene diagnosis. A decrease in absorbance was seen when GNP-probe-target DNA cleaved into the small fragments of BamHI endonuclease due to the weakened electrostatic interaction between GNPs and the shortened DNA. The right shift of the absorbance peak from 530 to 562 nm occurred after adding the endonuclease. It was measured using a UV-VIS absorption spectroscopy that indicates the existence of the P. aeruginosa ETA gene. Sensitivity was determined in the presence of different concentrations of target DNA of P. aeruginosa. The results obtained from the optimized conditions showed that the absorbance value has linear correlation with concentration of target DNA (R: 0.9850) in the range of 10-50 ng mL-1 with the limit detection of 9.899 ng mL-1. Thus, the specificity of the new method for detection of P. aeruginosa was established in comparison with other bacteria. Additionally, the designed assay was quantitatively applied to detect the P. aeruginosa ETA gene from 103 to 108 CFU mL-1 in real samples with a detection limit of 320 CFU mL-1.
Stein, Eric D; White, Bryan P; Mazor, Raphael D; Miller, Peter E; Pilgrim, Erik M
2013-01-01
Molecular methods, such as DNA barcoding, have the potential to enhance biomonitoring programs worldwide. Altering routinely used sample preservation methods to protect DNA from degradation may pose a potential impediment to application of DNA barcoding and metagenomics for biomonitoring using benthic macroinvertebrates. Using higher volumes or concentrations of ethanol, requirements for shorter holding times, or the need to include additional filtering may increase cost and logistical constraints to existing biomonitoring programs. To address this issue we evaluated the efficacy of various ethanol-based sample preservation methods at maintaining DNA integrity. We evaluated a series of methods that were minimally modified from typical field protocols in order to identify an approach that can be readily incorporated into existing monitoring programs. Benthic macroinvertebrates were collected from a minimally disturbed stream in southern California, USA and subjected to one of six preservation treatments. Ten individuals from five taxa were selected from each treatment and processed to produce DNA barcodes from the mitochondrial gene cytochrome c oxidase I (COI). On average, we obtained successful COI sequences (i.e. either full or partial barcodes) for between 93-99% of all specimens across all six treatments. As long as samples were initially preserved in 95% ethanol, successful sequencing of COI barcodes was not affected by a low dilution ratio of 2∶1, transfer to 70% ethanol, presence of abundant organic matter, or holding times of up to six months. Barcoding success varied by taxa, with Leptohyphidae (Ephemeroptera) producing the lowest barcode success rate, most likely due to poor PCR primer efficiency. Differential barcoding success rates have the potential to introduce spurious results. However, routine preservation methods can largely be used without adverse effects on DNA integrity.
Stein, Eric D.; White, Bryan P.; Mazor, Raphael D.; Miller, Peter E.; Pilgrim, Erik M.
2013-01-01
Molecular methods, such as DNA barcoding, have the potential to enhance biomonitoring programs worldwide. Altering routinely used sample preservation methods to protect DNA from degradation may pose a potential impediment to application of DNA barcoding and metagenomics for biomonitoring using benthic macroinvertebrates. Using higher volumes or concentrations of ethanol, requirements for shorter holding times, or the need to include additional filtering may increase cost and logistical constraints to existing biomonitoring programs. To address this issue we evaluated the efficacy of various ethanol-based sample preservation methods at maintaining DNA integrity. We evaluated a series of methods that were minimally modified from typical field protocols in order to identify an approach that can be readily incorporated into existing monitoring programs. Benthic macroinvertebrates were collected from a minimally disturbed stream in southern California, USA and subjected to one of six preservation treatments. Ten individuals from five taxa were selected from each treatment and processed to produce DNA barcodes from the mitochondrial gene cytochrome c oxidase I (COI). On average, we obtained successful COI sequences (i.e. either full or partial barcodes) for between 93–99% of all specimens across all six treatments. As long as samples were initially preserved in 95% ethanol, successful sequencing of COI barcodes was not affected by a low dilution ratio of 2∶1, transfer to 70% ethanol, presence of abundant organic matter, or holding times of up to six months. Barcoding success varied by taxa, with Leptohyphidae (Ephemeroptera) producing the lowest barcode success rate, most likely due to poor PCR primer efficiency. Differential barcoding success rates have the potential to introduce spurious results. However, routine preservation methods can largely be used without adverse effects on DNA integrity. PMID:23308097
Rapid DNA transformation in Salmonella Typhimurium by the hydrogel exposure method.
Elabed, Hamouda; Hamza, Rim; Bakhrouf, Amina; Gaddour, Kamel
2016-07-01
Even with advances in molecular cloning and DNA transformation, new or alternative methods that permit DNA penetration in Salmonella enterica subspecies enterica serovar Typhimurium are required in order to use this pathogen in biotechnological or medical applications. In this work, an adapted protocol of bacterial transformation with plasmid DNA based on the "Yoshida effect" was applied and optimized on Salmonella enterica serovar Typhimurium LT2 reference strain. The plasmid transference based on the use of sepiolite as acicular materials to promote cell piercing via friction forces produced by spreading on the surface of a hydrogel. The transforming mixture containing sepiolite nanofibers, bacterial cells to be transformed and plasmid DNA were plated directly on selective medium containing 2% agar. In order to improve the procedure, three variables were tested and the transformation of Salmonella cells was accomplished using plasmids pUC19 and pBR322. Using the optimized protocol on Salmonella LT2 strain, the efficiency was about 10(5) transformed cells per 10(9) subjected to transformation with 0.2μg plasmid DNA. In summary, the procedure is fast, offers opportune efficiency and promises to become one of the widely used transformation methods in laboratories. Copyright © 2016 Elsevier B.V. All rights reserved.
RNA-templated single-base mutation detection based on T4 DNA ligase and reverse molecular beacon.
Tang, Hongxing; Yang, Xiaohai; Wang, Kemin; Tan, Weihong; Li, Huimin; He, Lifang; Liu, Bin
2008-06-15
A novel RNA-templated single-base mutation detection method based on T4 DNA ligase and reverse molecular beacon (rMB) has been developed and successfully applied to identification of single-base mutation in codon 273 of the p53 gene. The discrimination was carried out using allele-specific primers, which flanked the variable position in the target RNA and was ligated using T4 DNA ligase only when the primers perfectly matched the RNA template. The allele-specific primers also carried complementary stem structures with end-labels (fluorophore TAMRA, quencher DABCYL), which formed a molecular beacon after RNase H digestion. One-base mismatch can be discriminated by analyzing the change of fluorescence intensity before and after RNase H digestion. This method has several advantages for practical applications, such as direct discrimination of single-base mismatch of the RNA extracted from cell; no requirement of PCR amplification; performance of homogeneous detection; and easily design of detection probes.
Comparison of Methods of Detection of Exceptional Sequences in Prokaryotic Genomes.
Rusinov, I S; Ershova, A S; Karyagina, A S; Spirin, S A; Alexeevski, A V
2018-02-01
Many proteins need recognition of specific DNA sequences for functioning. The number of recognition sites and their distribution along the DNA might be of biological importance. For example, the number of restriction sites is often reduced in prokaryotic and phage genomes to decrease the probability of DNA cleavage by restriction endonucleases. We call a sequence an exceptional one if its frequency in a genome significantly differs from one predicted by some mathematical model. An exceptional sequence could be either under- or over-represented, depending on its frequency in comparison with the predicted one. Exceptional sequences could be considered biologically meaningful, for example, as targets of DNA-binding proteins or as parts of abundant repetitive elements. Several methods to predict frequency of a short sequence in a genome, based on actual frequencies of certain its subsequences, are used. The most popular are methods based on Markov chain models. But any rigorous comparison of the methods has not previously been performed. We compared three methods for the prediction of short sequence frequencies: the maximum-order Markov chain model-based method, the method that uses geometric mean of extended Markovian estimates, and the method that utilizes frequencies of all subsequences including discontiguous ones. We applied them to restriction sites in complete genomes of 2500 prokaryotic species and demonstrated that the results depend greatly on the method used: lists of 5% of the most under-represented sites differed by up to 50%. The method designed by Burge and coauthors in 1992, which utilizes all subsequences of the sequence, showed a higher precision than the other two methods both on prokaryotic genomes and randomly generated sequences after computational imitation of selective pressure. We propose this method as the first choice for detection of exceptional sequences in prokaryotic genomes.
Zhi-Bin Wen; Ming-Li Zhang; Ge-Lin Zhu; Stewart C. Sanderson
2010-01-01
To reconstruct phylogeny and verify the monophyly of major subgroups, a total of 52 species representing almost all species of Salsoleae s.l. in China were sampled, with analysis based on three molecular markers (nrDNA ITS, cpDNA psbB-psbH and rbcL), using maximum parsimony, maximum likelihood, and Bayesian inference methods. Our molecular evidence provides strong...
Yun, Wen; Cai, Dingzhou; Jiang, JiaoLai; Zhao, Pengxiang; Huang, Yu; Sang, Ge
2016-06-15
An enzyme-free and label-free colorimetric Pb(2+) sensor based on DNAzyme and molecular beacon (MB) has been developed and demonstrated by recycle using enzyme strand for signal amplification. The substrate strand DNA (S-DNA) of DNAzyme could be converted into MB structure with base pairs of stem part at the both ends. The MB could hybridize with enzyme strand DNA (E-DNA) to form DNAzyme, and be activated and cleaved in the presence of Pb(2+). The cleaved MB is much less stable, releasing from the DNAzyme as two product pieces. The product pieces of MB are flexible and could bind to unmodified AuNPs to effectively stabilize them against salt-induced aggregation. Then, the E-DNA is liberated to catalyze the next reaction and amplify the response signal. By taking advantage of repeated using of E-DNA, our proposed method exhibited high sensitive for Pb(2+) detection in a linear range from 0.05 to 5 nM with detection limit of 20 pM by UV-vis spectrometer. Moreover, this method was also used for determination of Pb(2+) in river water samples with satisfying results. Importantly, this strategy could reach high sensitivity without any modification and complex enzymatic or hairpins based amplification procedures. Copyright © 2016 Elsevier B.V. All rights reserved.
Electrochemical DNA Hybridization Sensors Based on Conducting Polymers
Rahman, Md. Mahbubur; Li, Xiao-Bo; Lopa, Nasrin Siraj; Ahn, Sang Jung; Lee, Jae-Joon
2015-01-01
Conducting polymers (CPs) are a group of polymeric materials that have attracted considerable attention because of their unique electronic, chemical, and biochemical properties. This is reflected in their use in a wide range of potential applications, including light-emitting diodes, anti-static coating, electrochromic materials, solar cells, chemical sensors, biosensors, and drug-release systems. Electrochemical DNA sensors based on CPs can be used in numerous areas related to human health. This review summarizes the recent progress made in the development and use of CP-based electrochemical DNA hybridization sensors. We discuss the distinct properties of CPs with respect to their use in the immobilization of probe DNA on electrode surfaces, and we describe the immobilization techniques used for developing DNA hybridization sensors together with the various transduction methods employed. In the concluding part of this review, we present some of the challenges faced in the use of CP-based DNA hybridization sensors, as well as a future perspective. PMID:25664436
Ng'endo, R.N.; Osiemo, Z.B.; Brandl, R.
2013-01-01
DNA sequencing is increasingly being used to assist in species identification in order to overcome taxonomic impediment. However, few studies attempt to compare the results of these molecular studies with a more traditional species delineation approach based on morphological characters. Mitochondrial DNA Cytochrome oxidase subunit 1 (CO1) gene was sequenced, measuring 636 base pairs, from 47 ants of the genus Pheidole (Formicidae: Myrmicinae) collected in the Brazilian Atlantic Forest to test whether the morphology-based assignment of individuals into species is supported by DNA-based species delimitation. Twenty morphospecies were identified, whereas the barcoding analysis identified 19 Molecular Operational Taxonomic Units (MOTUs). Fifteen out of the 19 DNA-based clusters allocated, using sequence divergence thresholds of 2% and 3%, matched with morphospecies. Both thresholds yielded the same number of MOTUs. Only one MOTU was successfully identified to species level using the CO1 sequences of Pheidole species already in the Genbank. The average pairwise sequence divergence for all 47 sequences was 19%, ranging between 0–25%. In some cases, however, morphology and molecular based methods differed in their assignment of individuals to morphospecies or MOTUs. The occurrence of distinct mitochondrial lineages within morphological species highlights groups for further detailed genetic and morphological studies, and therefore a pluralistic approach using several methods to understand the taxonomy of difficult lineages is advocated. PMID:23902257
Mathieson, William; Guljar, Nafia; Sanchez, Ignacio; Sroya, Manveer; Thomas, Gerry A
2018-05-03
DNA extracted from formalin-fixed, paraffin-embedded (FFPE) tissue blocks is amenable to analytical techniques, including sequencing. DNA extraction protocols are typically long and complex, often involving an overnight proteinase K digest. Automated platforms that shorten and simplify the process are therefore an attractive proposition for users wanting a faster turn-around or to process large numbers of biospecimens. It is, however, unclear whether automated extraction systems return poorer DNA yields or quality than manual extractions performed by experienced technicians. We extracted DNA from 42 FFPE clinical tissue biospecimens using the QiaCube (Qiagen) and ExScale (ExScale Biospecimen Solutions) automated platforms, comparing DNA yields and integrities with those from manual extractions. The QIAamp DNA FFPE Spin Column Kit was used for manual and QiaCube DNA extractions and the ExScale extractions were performed using two of the manufacturer's magnetic bead kits: one extracting DNA only and the other simultaneously extracting DNA and RNA. In all automated extraction methods, DNA yields and integrities (assayed using DNA Integrity Numbers from a 4200 TapeStation and the qPCR-based Illumina FFPE QC Assay) were poorer than in the manual method, with the QiaCube system performing better than the ExScale system. However, ExScale was fastest, offered the highest reproducibility when extracting DNA only, and required the least intervention or technician experience. Thus, the extraction methods have different strengths and weaknesses, would appeal to different users with different requirements, and therefore, we cannot recommend one method over another.
Yang, Qi; Franco, Christopher M M; Zhang, Wei
2015-10-01
Experiments were designed to validate the two common DNA extraction protocols (CTAB-based method and DNeasy Blood & Tissue Kit) used to effectively recover actinobacterial DNA from sponge samples in order to study the sponge-associated actinobacterial diversity. This was done by artificially spiking sponge samples with actinobacteria (spores, mycelia and a combination of the two). Our results demonstrated that both DNA extraction methods were effective in obtaining DNA from the sponge samples as well as the sponge samples spiked with different amounts of actinobacteria. However, it was noted that in the presence of the sponge, the bacterial 16S rRNA gene could not be amplified unless the combined DNA template was diluted. To test the hypothesis that the extracted sponge DNA contained inhibitors, dilutions of the DNA extracts were tested for six sponge species representing five orders. The results suggested that the inhibitors were co-extracted with the sponge DNA, and a high dilution of this DNA was required for the successful PCR amplification for most of the samples. The optimized PCR conditions, including primer selection, PCR reaction system and program optimization, further improved the PCR performance. However, no single PCR condition was found to be suitable for the diverse sponge samples using various primer sets. These results highlight for the first time that the DNA extraction methods used are effective in obtaining actinobacterial DNA and that the presence of inhibitors in the sponge DNA requires high dilution coupled with fine tuning of the PCR conditions to achieve success in the study of sponge-associated actinobacterial diversity.
DNA barcoding of vouchered xylarium wood specimens of nine endangered Dalbergia species.
Yu, Min; Jiao, Lichao; Guo, Juan; Wiedenhoeft, Alex C; He, Tuo; Jiang, Xiaomei; Yin, Yafang
2017-12-01
ITS2+ trnH - psbA was the best combination of DNA barcode to resolve the Dalbergia wood species studied. We demonstrate the feasibility of building a DNA barcode reference database using xylarium wood specimens. The increase in illegal logging and timber trade of CITES-listed tropical species necessitates the development of unambiguous identification methods at the species level. For these methods to be fully functional and deployable for law enforcement, they must work using wood or wood products. DNA barcoding of wood has been promoted as a promising tool for species identification; however, the main barrier to extensive application of DNA barcoding to wood is the lack of a comprehensive and reliable DNA reference library of barcodes from wood. In this study, xylarium wood specimens of nine Dalbergia species were selected from the Wood Collection of the Chinese Academy of Forestry and DNA was then extracted from them for further PCR amplification of eight potential DNA barcode sequences (ITS2, matK, trnL, trnH-psbA, trnV-trnM1, trnV-trnM2, trnC-petN, and trnS-trnG). The barcodes were tested singly and in combination for species-level discrimination ability by tree-based [neighbor-joining (NJ)] and distance-based (TaxonDNA) methods. We found that the discrimination ability of DNA barcodes in combination was higher than any single DNA marker among the Dalbergia species studied, with the best two-marker combination of ITS2+trnH-psbA analyzed with NJ trees performing the best (100% accuracy). These barcodes are relatively short regions (<350 bp) and amplification reactions were performed with high success (≥90%) using wood as the source material, a necessary factor to apply DNA barcoding to timber trade. The present results demonstrate the feasibility of using vouchered xylarium specimens to build DNA barcoding reference databases.
Molecular analysis of single oocyst of Eimeria by whole genome amplification (WGA) based nested PCR.
Wang, Yunzhou; Tao, Geru; Cui, Yujuan; Lv, Qiyao; Xie, Li; Li, Yuan; Suo, Xun; Qin, Yinghe; Xiao, Lihua; Liu, Xianyong
2014-09-01
PCR-based molecular tools are widely used for the identification and characterization of protozoa. Here we report the molecular analysis of Eimeria species using combined methods of whole genome amplification (WGA) and nested PCR. Single oocyst of Eimeria stiedai or Eimeriamedia was directly used for random amplification of the genomic DNA with either primer extension preamplification (PEP) or multiple displacement amplification (MDA), and then the WGA product was used as template in nested PCR with species-specific primers for ITS-1, 18S rDNA and 23S rDNA of E. stiedai and E. media. WGA-based PCR was successful for the amplification of these genes from single oocyst. For the species identification of single oocyst isolated from mixed E. stiedai or E. media, the results from WGA-based PCR were exactly in accordance with those from morphological identification, suggesting the availability of this method in molecular analysis of eimerian parasites at the single oocyst level. WGA-based PCR method can also be applied for the identification and genetic characterization of other protists. Copyright © 2014 Elsevier Inc. All rights reserved.
Johanson, Helene C; Hyland, Valentine; Wicking, Carol; Sturm, Richard A
2009-04-01
We describe here a method for DNA elution from buccal cells and whole blood both collected onto Whatman FTA technology, using methanol fixation followed by an elution PCR program. Extracted DNA is comparable in quality to published Whatman FTA protocols, as judged by PCR-based genotyping. Elution of DNA from the dried sample is a known rate-limiting step in the published Whatman FTA protocol; this method enables the use of each 3-mm punch of sample for several PCR reactions instead of the standard, one PCR reaction per sample punch. This optimized protocol therefore extends the usefulness and cost effectiveness of each buccal swab sample collected, when used for nucleic acid PCR and genotyping.
Hoshida, Hisashi; Murakami, Nobutada; Suzuki, Ayako; Tamura, Ryoko; Asakawa, Jun; Abdel-Banat, Babiker M A; Nonklang, Sanom; Nakamura, Mikiko; Akada, Rinji
2014-01-01
The cloning of DNA fragments into vectors or host genomes has traditionally been performed using Escherichia coli with restriction enzymes and DNA ligase or homologous recombination-based reactions. We report here a novel DNA cloning method that does not require DNA end processing or homologous recombination, but that ensures highly accurate cloning. The method exploits the efficient non-homologous end-joining (NHEJ) activity of the yeast Kluyveromyces marxianus and consists of a novel functional marker selection system. First, to demonstrate the applicability of NHEJ to DNA cloning, a C-terminal-truncated non-functional ura3 selection marker and the truncated region were PCR-amplified separately, mixed and directly used for the transformation. URA3(+) transformants appeared on the selection plates, indicating that the two DNA fragments were correctly joined by NHEJ to generate a functional URA3 gene that had inserted into the yeast chromosome. To develop the cloning system, the shortest URA3 C-terminal encoding sequence that could restore the function of a truncated non-functional ura3 was determined by deletion analysis, and was included in the primers to amplify target DNAs for cloning. Transformation with PCR-amplified target DNAs and C-terminal truncated ura3 produced numerous transformant colonies, in which a functional URA3 gene was generated and was integrated into the chromosome with the target DNAs. Several K. marxianus circular plasmids with different selection markers were also developed for NHEJ-based cloning and recombinant DNA construction. The one-step DNA cloning method developed here is a relatively simple and reliable procedure among the DNA cloning systems developed to date. Copyright © 2013 John Wiley & Sons, Ltd.
Zhang, Hongyan; Lv, Jie; Jia, Zhenhong
2017-01-01
A novel assembled biosensor was prepared for detecting 16S rRNA, a small-size persistent specific for Actinobacteria. The mechanism of the porous silicon (PS) photonic crystal biosensor is based on the fluorescence resonance energy transfer (FRET) between quantum dots (QDs) and gold nanoparticles (AuNPs) through DNA hybridization, where QDs act as an emission donor and AuNPs serve as a fluorescence quencher. Results showed that the photoluminescence (PL) intensity of PS photonic crystal was drastically increased when the QDs-conjugated probe DNA was adhered to the PS layer by surface modification using a standard cross-link chemistry method. The PL intensity of QDs was decreased when the addition of AuNPs-conjugated complementary 16S rRNA was dropped onto QDs-conjugated PS. Based on the analysis of different target DNA concentration, it was found that the decrease of the PL intensity showed a good linear relationship with complementary DNA concentration in a range from 0.25 to 10 μM, and the detection limit was 328.7 nM. Such an optical FRET biosensor functions on PS-based photonic crystal for DNA detection that differs from the traditional FRET, which is used only in liquid. This method will benefit the development of a new optical FRET label-free biosensor on Si substrate and has great potential in biochips based on integrated optical devices. PMID:28489033
Wang, Yongjie; Kleespies, Regina G; Ramle, Moslim B; Jehle, Johannes A
2008-09-01
The genomic sequence analysis of many large dsDNA viruses is hampered by the lack of enough sample materials. Here, we report a whole genome amplification of the Oryctes rhinoceros nudivirus (OrNV) isolate Ma07 starting from as few as about 10 ng of purified viral DNA by application of phi29 DNA polymerase- and exonuclease-resistant random hexamer-based multiple displacement amplification (MDA) method. About 60 microg of high molecular weight DNA with fragment sizes of up to 25 kbp was amplified. A genomic DNA clone library was generated using the product DNA. After 8-fold sequencing coverage, the 127,615 bp of OrNV whole genome was sequenced successfully. The results demonstrate that the MDA-based whole genome amplification enables rapid access to genomic information from exiguous virus samples.
Sawamura, Kensuke; Hashimoto, Masahiko
2017-01-01
A fluorescence quenching assay based on a ligase detection reaction was developed for facile and rapid detection of point mutations present in a mixed population of non-variant DNA. If the test DNA carried a targeted mutation, then the two allele-specific primers were ligated to form a molecular beacon resulting in the expected fluorescence quenching signatures. Using this method, we successfully detected as low as 5% mutant DNA in a mixture of wild-type DNA (t test at 99% confidence level).
Multivariate Boosting for Integrative Analysis of High-Dimensional Cancer Genomic Data
Xiong, Lie; Kuan, Pei-Fen; Tian, Jianan; Keles, Sunduz; Wang, Sijian
2015-01-01
In this paper, we propose a novel multivariate component-wise boosting method for fitting multivariate response regression models under the high-dimension, low sample size setting. Our method is motivated by modeling the association among different biological molecules based on multiple types of high-dimensional genomic data. Particularly, we are interested in two applications: studying the influence of DNA copy number alterations on RNA transcript levels and investigating the association between DNA methylation and gene expression. For this purpose, we model the dependence of the RNA expression levels on DNA copy number alterations and the dependence of gene expression on DNA methylation through multivariate regression models and utilize boosting-type method to handle the high dimensionality as well as model the possible nonlinear associations. The performance of the proposed method is demonstrated through simulation studies. Finally, our multivariate boosting method is applied to two breast cancer studies. PMID:26609213
Tipu, Hamid Nawaz; Bashir, Muhammad Mukarram; Noman, Muhammad
2016-10-01
Serology and DNA techniques are employed for Human Leukocyte Antigen (HLA) typing in different transplant centers. Results may not always correlate well and may need retyping with different technique. All the patients (with aplastic anemia, thalassemia, and immunodeficiency) and their donors, requiring HLA typing for bone marrow transplant were enrolled in the study. Serological HLA typing was done by complement-dependent lymphocytotoxicity while DNA-based typing was done with sequence specific primers (SSP). Serology identified 167 HLA A and 165 HLA B antigens while SSP in same samples identified 181 HLA A and 184 HLA B alleles. A11 and B51 were the commonest antigens/alleles by both methods. There were a total of 21 misreads and 32 dropouts on serology, for both HLA A and B loci with HLA A32, B52 and B61 being the most ambiguous antigens. Inherent limitations of serological techniques warrant careful interpretation or use of DNA-based methods for resolution of ambiguous typing.
Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions
Gardner, Shea N [San Leandro, CA; Mariella, Jr., Raymond P.; Christian, Allen T [Tracy, CA; Young, Jennifer A [Berkeley, CA; Clague, David S [Livermore, CA
2011-01-18
A method of fabricating a DNA molecule of user-defined sequence. The method comprises the steps of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an even or odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths. In one embodiment starting sequence fragments are of different lengths, n, n+1, n+2, etc.
Hu, Yuhua; Xu, Xueqin; Liu, Qionghua; Wang, Ling; Lin, Zhenyu; Chen, Guonan
2014-09-02
A simple, ultrasensitive, and specific electrochemical biosensor was designed to determine the given DNA sequence of Bacillus subtilis by coupling target-induced strand displacement and nicking endonuclease signal amplification. The target DNA (TD, the DNA sequence from the hypervarient region of 16S rDNA of Bacillus subtilis) could be detected by the differential pulse voltammetry (DPV) in a range from 0.1 fM to 20 fM with the detection limit down to 0.08 fM at the 3s(blank) level. This electrochemical biosensor exhibits high distinction ability to single-base mismatch, double-bases mismatch, and noncomplementary DNA sequence, which may be expected to detect single-base mismatch and single nucleotide polymorphisms (SNPs). Moreover, the applicability of the designed biosensor for detecting the given DNA sequence from Bacillus subtilis was investigated. The result obtained by electrochemical method is approximately consistent with that by a real-time quantitative polymerase chain reaction detecting system (QPCR) with SYBR Green.
Zhang, Chi; Fang, Xin; Qiu, Haopu; Li, Ning
2015-01-01
Real-time PCR amplification of mitochondria gene could not be used for DNA quantification, and that of single copy DNA did not allow an ideal sensitivity. Moreover, cross-reactions among similar species were commonly observed in the published methods amplifying repetitive sequence, which hindered their further application. The purpose of this study was to establish a short interspersed nuclear element (SINE)-based real-time PCR approach having high specificity for species detection that could be used in DNA quantification. After massive screening of candidate Sus scrofa SINEs, one optimal combination of primers and probe was selected, which had no cross-reaction with other common meat species. LOD of the method was 44 fg DNA/reaction. Further, quantification tests showed this approach was practical in DNA estimation without tissue variance. Thus, this study provided a new tool for qualitative detection of porcine component, which could be promising in the QC of meat products.
An, Jeung Hee; Oh, Byung-Keun; Choi, Jeong Woo
2013-04-01
Tyrosine hydroxylase, the rate-limiting enzyme of catecholamine biosysthesis, is predominantly expressed in several cell groups within the brain, including the dopaminergic neurons of the substantia nigra and ventral tegmental area. We evaluated the efficacy of this protein-detection method in detecting tyrosine hydroxylase in normal and oxidative stress damaged dopaminergic cells. In this study, a coupling of DNA barcode and bead-based immnunoassay for detecting tyrosine hydroxylaser with PCR-like sensitivity is reported. The method relies on magnetic nanoparticles with antibodies and nanoparticles that are encoded with DNA and antibodies that can sandwich the target protein captured by the nanoparticle-bound antibodies. The aggregate sandwich structures are magnetically separated from solution, and treated to remove the conjugated barcode DNA. The DNA barcodes were identified by PCR analysis. The concentration of tyrosine hydroxylase in dopaminergic cell can be easily and rapidly detected using bio-barcode assay. The bio-barcode assay is a rapid and high-throughput screening tool to detect of neurotransmitter such as dopamine.
Royle, Thomas C A; Sakhrani, Dionne; Speller, Camilla F; Butler, Virginia L; Devlin, Robert H; Cannon, Aubrey; Yang, Dongya Y
2018-01-01
Pacific salmonid (Oncorhynchus spp.) remains are routinely recovered from archaeological sites in northwestern North America but typically lack sexually dimorphic features, precluding the sex identification of these remains through morphological approaches. Consequently, little is known about the deep history of the sex-selective salmonid fishing strategies practiced by some of the region's Indigenous peoples. Here, we present a DNA-based method for the sex identification of archaeological Pacific salmonid remains that integrates two PCR assays that each co-amplify fragments of the sexually dimorphic on the Y chromosome (sdY) gene and an internal positive control (Clock1a or D-loop). The first assay co-amplifies a 95 bp fragment of sdY and a 108 bp fragment of the autosomal Clock1a gene, whereas the second assay co-amplifies the same sdY fragment and a 249 bp fragment of the mitochondrial D-loop region. This method's reliability, sensitivity, and efficiency, were evaluated by applying it to 72 modern Pacific salmonids from five species and 75 archaeological remains from six Pacific salmonids. The sex identities assigned to each of the modern samples were concordant with their known phenotypic sex, highlighting the method's reliability. Applications of the method to dilutions of modern DNA samples indicate it can correctly identify the sex of samples with as little as ~39 pg of total genomic DNA. The successful sex identification of 70 of the 75 (93%) archaeological samples further demonstrates the method's sensitivity. The method's reliance on two co-amplifications that preferentially amplify sdY helps validate the sex identities assigned to samples and reduce erroneous identifications caused by allelic dropout and contamination. Furthermore, by sequencing the D-loop fragment used as a positive control, species-level and sex identifications can be simultaneously assigned to samples. Overall, our results indicate the DNA-based method reported in this study is a sensitive and reliable sex identification method for ancient salmonid remains.
DNA fingerprinting in forensics: past, present, future
2013-01-01
DNA fingerprinting, one of the great discoveries of the late 20th century, has revolutionized forensic investigations. This review briefly recapitulates 30 years of progress in forensic DNA analysis which helps to convict criminals, exonerate the wrongly accused, and identify victims of crime, disasters, and war. Current standard methods based on short tandem repeats (STRs) as well as lineage markers (Y chromosome, mitochondrial DNA) are covered and applications are illustrated by casework examples. Benefits and risks of expanding forensic DNA databases are discussed and we ask what the future holds for forensic DNA fingerprinting. PMID:24245688
Wang, Po; Chen, Hanbin; Tian, Jiuying; Dai, Zong; Zou, Xiaoyong
2013-07-15
An efficient electrochemical approach for the evaluation of DNA methylation level was proposed according to the oxidation signal of DNA bases at an overoxidized polypyrrole (PPyox) directed multiwalled carbon nanotubes (MWNTs) film modified glassy carbon electrode (GCE). The PPyox/MWNTs/GCE exhibited remarkable electrocatalytic activities towards the oxidation of DNA bases due to the advantages of wide potential window, large effective surface area, and excellent antifouling property. As a result, all purine and pyrimidine bases of guanine (G), adenine (A), thymine (T), cytosine (C) and 5-methylcytosine (5-mC) exhibited well identified oxidation peaks at the PPyox/MWNTs/GCE. The direct potential resolution between 5-mC and C was obtained to be 180 mV, which was large enough for their signal recognition and accurate detection in mixture. In particular, the signal interference from T, a great challenge in exploring DNA methylation, was successfully eliminated by an innovative strategy, which was developed based on the stoichiometric relationship between purine and pyrimidine bases in DNA molecular structure. The proposed method was effectively applied to the rapid detection of DNA methylation status in real sample within 45 min with satisfactory results. Copyright © 2013 Elsevier B.V. All rights reserved.
DNA-based technology helps people solve problems. It can be used to correctly match organ donors with recipients, identify victims of natural and man-made disasters, and detect bacteria and other organisms that may pollute air, soil, food, or water.
DNA-based identification and phylogeny of North American Armillaria species
Amy L. Ross-Davis; John W. Hanna; Ned B. Klopfenstein
2011-01-01
Because Armillaria species display different ecological behaviors across diverse forest ecosystems, it is critical to identify Armillaria species accurately for any assessment of forest health. To further develop DNA-based identification methods, partial sequences of the translation elongation factor-1 alpha (EF-1α) gene were used to examine the phylogenetic...
Durnez, Lies; Stragier, Pieter; Roebben, Karen; Ablordey, Anthony; Leirs, Herwig; Portaels, Françoise
2009-02-01
Mycobacterium ulcerans is the causative agent of Buruli ulcer, the third most common mycobacterial disease in humans after tuberculosis and leprosy. Although the disease is associated with aquatic ecosystems, cultivation of the bacillus from the environment is difficult to achieve. Therefore, at the moment, research is based on the detection by PCR of the insertion sequence IS2404 present in M. ulcerans and some closely related mycobacteria. In the present study, we compared four DNA extraction methods for detection of M. ulcerans DNA, namely the one tube cell lysis and DNA extraction procedure (OT), the FastPrep procedure (FP), the modified Boom procedure (MB), and the Maxwell 16 Procedure (M16). The methods were performed on serial dilutions of M. ulcerans, followed by PCR analysis with different PCR targets in M. ulcerans to determine the detection limit (DL) of each method. The purity of the extracted DNA and the time and effort needed were compared as well. All methods were performed on environmental specimens and the two best methods (MB and M16) were tested on clinical specimens for detection of M. ulcerans DNA. When comparing the DLs of the DNA extraction methods, the MB and M16 had a significantly lower DL than the OT and FP. For the different PCR targets, IS2404 showed a significantly lower DL than mlsA, MIRU1, MIRU5 and VNTR6. The FP and M16 were considerably faster than the MB and OT, while the purity of the DNA extracted with the MB was significantly higher than the DNA extracted with the other methods. The MB performed best on the environmental and clinical specimens. This comparative study shows that the modified Boom procedure, although lengthy, provides a better method of DNA extraction than the other methods tested for detection and identification of M. ulcerans in both clinical and environmental specimens.
DNA sequence+shape kernel enables alignment-free modeling of transcription factor binding.
Ma, Wenxiu; Yang, Lin; Rohs, Remo; Noble, William Stafford
2017-10-01
Transcription factors (TFs) bind to specific DNA sequence motifs. Several lines of evidence suggest that TF-DNA binding is mediated in part by properties of the local DNA shape: the width of the minor groove, the relative orientations of adjacent base pairs, etc. Several methods have been developed to jointly account for DNA sequence and shape properties in predicting TF binding affinity. However, a limitation of these methods is that they typically require a training set of aligned TF binding sites. We describe a sequence + shape kernel that leverages DNA sequence and shape information to better understand protein-DNA binding preference and affinity. This kernel extends an existing class of k-mer based sequence kernels, based on the recently described di-mismatch kernel. Using three in vitro benchmark datasets, derived from universal protein binding microarrays (uPBMs), genomic context PBMs (gcPBMs) and SELEX-seq data, we demonstrate that incorporating DNA shape information improves our ability to predict protein-DNA binding affinity. In particular, we observe that (i) the k-spectrum + shape model performs better than the classical k-spectrum kernel, particularly for small k values; (ii) the di-mismatch kernel performs better than the k-mer kernel, for larger k; and (iii) the di-mismatch + shape kernel performs better than the di-mismatch kernel for intermediate k values. The software is available at https://bitbucket.org/wenxiu/sequence-shape.git. rohs@usc.edu or william-noble@uw.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.
Zur, Gideon; Shimoni, Eyal; Hallerman, Eric; Kashi, Yechezkel
2002-09-01
Alternaria sp. are important fungal contaminants of grain products; they secrete four structural classes of compounds that are toxic or carcinogenic to plants and animals and cause considerable economic losses to growers and the food-processing industry. Alternaria toxins have been detected by high-performance liquid chromatography (HPLC), enzyme-linked immunosorbent assay, and other techniques. Here, we report the development of a polymerase chain reaction (PCR)-based method for the detection of Alternaria DNA. PCR primers were designed to anneal to the ITS1 and ITS2 regions of the 5.8S rDNA gene of Alternaria alternata or Alternaria solani but not to other microbial or plant DNA. We compared the sensitivity of PCR in detecting Alternaria DNA, that of the HPLC method in detecting Alternaria alternariol and alternariol methyl ether toxins, and that of the morphological examination of mycelia and conidia in experimentally infested corn samples. The sensitivity of toxin detection for HPLC was above the level of contamination in a set of commercially obtained grain samples, resulting in negative scores for all samples, while the PCR-based method and mold growth plating followed by morphological identification of Alternaria gave parallel, positive results for 8 of 10 samples. The PCR assay required just 8 h, enabling the rapid and simultaneous testing of many samples at a low cost. PCR-based evidence for the presence of Alternaria DNA followed by positive assay results for Alternaria toxins would support the rejection of a shipment of grain.
Exploring the Limits of DNA Size: Naphtho-homologated DNA Bases and Pairs
Lee, Alex H. F.; Kool, Eric T.
2008-01-01
A new design for DNA bases and base pairs is described in which the pyrimidine bases are widened by naphtho-homologation. Two naphtho-homologated deoxyribosides, dyyT (1) and dyyC (2) were synthesized and could be incorporated into oligonucleotides as suitably protected phosphoramidite derivatives. The deoxyribosides were found to be fluorescent, with emission maxima at 446 and 433 nm, respectively. Studies with single substitutions of 1 and 2 in the natural DNA context revealed exceptionally strong base stacking propensity for both. Sequences containing multiple substitutions of 1 and 2 paired opposite adenine and guanine were subsequently mixed and studied by several analytical methods. Data from UV mixing experiments, FRET measurements, fluorescence quenching experiments, and hybridizations on beads suggest that complementary “doublewide DNA” (yyDNA) strands may self-assemble into helical complexes with 1:1 stoichiometry. Data from thermal denaturation plots and CD spectra were less conclusive. Control experiments in one sequence context gave evidence that yyDNA helices, if formed, are preferentially antiparallel and are sequence selective. Hypothesized base pairing schemes are analogous to Watson-Crick pairing, but with glycosidic C1′-C1′ distances widened by over 45%, to ca. 15.2 Å. The possible self-assembly of the double-wide DNA helix establishes a new limit for the size of information-encoding, DNA-like molecules, and the fluorescence of yyDNA bases suggests uses as reporters in monomeric and oligomeric forms. PMID:16834396
Abras, Alba; Ballart, Cristina; Llovet, Teresa; Roig, Carme; Gutiérrez, Cristina; Tebar, Silvia; Berenguer, Pere; Pinazo, María-Jesús; Posada, Elizabeth; Gascón, Joaquim; Schijman, Alejandro G; Gállego, Montserrat; Muñoz, Carmen
2018-01-01
Polymerase chain reaction (PCR) has become a useful tool for the diagnosis of Trypanosoma cruzi infection. The development of automated DNA extraction methodologies and PCR systems is an important step toward the standardization of protocols in routine diagnosis. To date, there are only two commercially available Real-Time PCR assays for the routine laboratory detection of T. cruzi DNA in clinical samples: TCRUZIDNA.CE (Diagnostic Bioprobes Srl) and RealCycler CHAG (Progenie Molecular). Our aim was to evaluate the RealCycler CHAG assay taking into account the whole process. We assessed the usefulness of an automated DNA extraction system based on magnetic particles (EZ1 Virus Mini Kit v2.0, Qiagen) combined with a commercially available Real-Time PCR assay targeting satellite DNA (SatDNA) of T. cruzi (RealCycler CHAG), a methodology used for routine diagnosis in our hospital. It was compared with a well-known strategy combining a commercial DNA isolation kit based on silica columns (High Pure PCR Template Preparation Kit, Roche Diagnostics) with an in-house Real-Time PCR targeting SatDNA. The results of the two methodologies were in almost perfect agreement, indicating they can be used interchangeably. However, when variations in protocol factors were applied (sample treatment, extraction method and Real-Time PCR), the results were less convincing. A comprehensive fine-tuning of the whole procedure is the key to successful results. Guanidine EDTA-blood (GEB) samples are not suitable for DNA extraction based on magnetic particles due to inhibition, at least when samples are not processed immediately. This is the first study to evaluate the RealCycler CHAG assay taking into account the overall process, including three variables (sample treatment, extraction method and Real-Time PCR). Our findings may contribute to the harmonization of protocols between laboratories and to a wider application of Real-Time PCR in molecular diagnostic laboratories associated with health centers.
Towards robust and repeatable sampling methods in eDNA based studies.
Dickie, Ian A; Boyer, Stephane; Buckley, Hannah; Duncan, Richard P; Gardner, Paul; Hogg, Ian D; Holdaway, Robert J; Lear, Gavin; Makiola, Andreas; Morales, Sergio E; Powell, Jeff R; Weaver, Louise
2018-05-26
DNA based techniques are increasingly used for measuring the biodiversity (species presence, identity, abundance and community composition) of terrestrial and aquatic ecosystems. While there are numerous reviews of molecular methods and bioinformatic steps, there has been little consideration of the methods used to collect samples upon which these later steps are based. This represents a critical knowledge gap, as methodologically sound field sampling is the foundation for subsequent analyses. We reviewed field sampling methods used for metabarcoding studies of both terrestrial and freshwater ecosystem biodiversity over a nearly three-year period (n = 75). We found that 95% (n = 71) of these studies used subjective sampling methods, inappropriate field methods, and/or failed to provide critical methodological information. It would be possible for researchers to replicate only 5% of the metabarcoding studies in our sample, a poorer level of reproducibility than for ecological studies in general. Our findings suggest greater attention to field sampling methods and reporting is necessary in eDNA-based studies of biodiversity to ensure robust outcomes and future reproducibility. Methods must be fully and accurately reported, and protocols developed that minimise subjectivity. Standardisation of sampling protocols would be one way to help to improve reproducibility, and have additional benefits in allowing compilation and comparison of data from across studies. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Xu, Chen; Zhang, Nan; Huo, Qianyu; Chen, Minghui; Wang, Rengfeng; Liu, Zhili; Li, Xue; Liu, Yunde; Bao, Huijing
2016-04-15
In this article, we discuss the polymerase chain reaction (PCR)-hybridization assay that we developed for high-throughput simultaneous detection and differentiation of Ureaplasma urealyticum and Ureaplasma parvum using one set of primers and two specific DNA probes based on urease gene nucleotide sequence differences. First, U. urealyticum and U. parvum DNA samples were specifically amplified using one set of biotin-labeled primers. Furthermore, amine-modified DNA probes, which can specifically react with U. urealyticum or U. parvum DNA, were covalently immobilized to a DNA-BIND plate surface. The plate was then incubated with the PCR products to facilitate sequence-specific DNA binding. Horseradish peroxidase-streptavidin conjugation and a colorimetric assay were used. Based on the results, the PCR-hybridization assay we developed can specifically differentiate U. urealyticum and U. parvum with high sensitivity (95%) compared with cultivation (72.5%). Hence, this study demonstrates a new method for high-throughput simultaneous differentiation and detection of U. urealyticum and U. parvum with high sensitivity. Based on these observations, the PCR-hybridization assay developed in this study is ideal for detecting and discriminating U. urealyticum and U. parvum in clinical applications. Copyright © 2016 Elsevier Inc. All rights reserved.
Schimelman, Jacob B; Dryden, Daniel M; Poudel, Lokendra; Krawiec, Katherine E; Ma, Yingfang; Podgornik, Rudolf; Parsegian, V Adrian; Denoyer, Linda K; Ching, Wai-Yim; Steinmetz, Nicole F; French, Roger H
2015-02-14
The role of base pair composition and stacking sequence in the optical properties and electronic transitions of DNA is of fundamental interest. We present and compare the optical properties of DNA oligonucleotides (AT)10, (AT)5(GC)5, and (AT-GC)5 using both ab initio methods and UV-vis molar absorbance measurements. Our data indicate a strong dependence of both the position and intensity of UV absorbance features on oligonucleotide composition and stacking sequence. The partial densities of states for each oligonucleotide indicate that the valence band edge arises from a feature associated with the PO4(3-) complex anion, and the conduction band edge arises from anti-bonding states in DNA base pairs. The results show a strong correspondence between the ab initio and experimentally determined optical properties. These results highlight the benefit of full spectral analysis of DNA, as opposed to reductive methods that consider only the 260 nm absorbance (A260) or simple purity ratios, such as A260/A230 or A260/A280, and suggest that the slope of the absorption edge onset may provide a useful metric for the degree of base pair stacking in DNA. These insights may prove useful for applications in biology, bioelectronics, and mesoscale self-assembly.
BiRen: predicting enhancers with a deep-learning-based model using the DNA sequence alone.
Yang, Bite; Liu, Feng; Ren, Chao; Ouyang, Zhangyi; Xie, Ziwei; Bo, Xiaochen; Shu, Wenjie
2017-07-01
Enhancer elements are noncoding stretches of DNA that play key roles in controlling gene expression programmes. Despite major efforts to develop accurate enhancer prediction methods, identifying enhancer sequences continues to be a challenge in the annotation of mammalian genomes. One of the major issues is the lack of large, sufficiently comprehensive and experimentally validated enhancers for humans or other species. Thus, the development of computational methods based on limited experimentally validated enhancers and deciphering the transcriptional regulatory code encoded in the enhancer sequences is urgent. We present a deep-learning-based hybrid architecture, BiRen, which predicts enhancers using the DNA sequence alone. Our results demonstrate that BiRen can learn common enhancer patterns directly from the DNA sequence and exhibits superior accuracy, robustness and generalizability in enhancer prediction relative to other state-of-the-art enhancer predictors based on sequence characteristics. Our BiRen will enable researchers to acquire a deeper understanding of the regulatory code of enhancer sequences. Our BiRen method can be freely accessed at https://github.com/wenjiegroup/BiRen . shuwj@bmi.ac.cn or boxc@bmi.ac.cn. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com
New visible and selective DNA staining method in gels with tetrazolium salts.
Paredes, Aaron J; Naranjo-Palma, Tatiana; Alfaro-Valdés, Hilda M; Barriga, Andrés; Babul, Jorge; Wilson, Christian A M
2017-01-15
DNA staining in gels has historically been carried out using silver staining and fluorescent dyes like ethidium bromide and SYBR Green I (SGI). Using fluorescent dyes allows recovery of the analyte, but requires instruments such as a transilluminator or fluorimeter to visualize the DNA. Here we described a new and simple method that allows DNA visualization to the naked eye by generating a colored precipitate. It works by soaking the acrylamide or agarose DNA gel in SGI and nitro blue tetrazolium (NBT) solution that, when exposed to sunlight, produces a purple insoluble formazan precipitate that remains in the gel after exposure to light. A calibration curve made with a DNA standard established a detection limit of approximately 180 pg/band at 500 bp. Selectivity of this assay was determined using different biomolecules, demonstrating a high selectivity for DNA. Integrity and functionality of the DNA recovered from gels was determined by enzymatic cutting with a restriction enzyme and by transforming competent cells after the different staining methods, respectively. Our method showed the best performance among the dyes employed. Based on its specificity, low cost and its adequacy for field work, this new methodology has enormous potential benefits to research and industry. Copyright © 2016 Elsevier Inc. All rights reserved.
Bakhori, Noremylia Mohd; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir
2013-12-12
An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10-9 M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense.
Mohd Bakhori, Noremylia; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir
2013-12-01
An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10(-9) M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Belinsky, Steven A; Palmisano, William A
A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection ofmore » lung and other cancers.« less
Comparison of DNA preservation methods for environmental bacterial community samples
Gray, Michael A.; Pratte, Zoe A.; Kellogg, Christina A.
2013-01-01
Field collections of environmental samples, for example corals, for molecular microbial analyses present distinct challenges. The lack of laboratory facilities in remote locations is common, and preservation of microbial community DNA for later study is critical. A particular challenge is keeping samples frozen in transit. Five nucleic acid preservation methods that do not require cold storage were compared for effectiveness over time and ease of use. Mixed microbial communities of known composition were created and preserved by DNAgard™, RNAlater®, DMSO–EDTA–salt (DESS), FTA® cards, and FTA Elute® cards. Automated ribosomal intergenic spacer analysis and clone libraries were used to detect specific changes in the faux communities over weeks and months of storage. A previously known bias in FTA® cards that results in lower recovery of pure cultures of Gram-positive bacteria was also detected in mixed community samples. There appears to be a uniform bias across all five preservation methods against microorganisms with high G + C DNA. Overall, the liquid-based preservatives (DNAgard™, RNAlater®, and DESS) outperformed the card-based methods. No single liquid method clearly outperformed the others, leaving method choice to be based on experimental design, field facilities, shipping constraints, and allowable cost.
Click nucleic acid ligation: applications in biology and nanotechnology.
El-Sagheer, Afaf H; Brown, Tom
2012-08-21
Biochemical strategies that use a combination of synthetic oligonucleotides, thermostable DNA polymerases, and DNA ligases can produce large DNA constructs up to 1 megabase in length. Although these ambitious targets are feasible biochemically, comparable technologies for the chemical synthesis of long DNA strands lag far behind. The best available chemical approach is the solid-phase phosphoramidite method, which can be used to assemble DNA strands up to 150 bases in length. Beyond this point, deficiencies in the chemistry make it impossible to produce pure DNA. A possible alternative approach to the chemical synthesis of large DNA strands is to join together carefully purified synthetic oligonucleotides by chemical methods. Click ligation by the copper-catalyzed azide-alkyne (CuAAC) reaction could facilitate this process. In this Account, we describe the synthesis, characterization, and applications of oligonucleotides prepared by click ligation. The alkyne and azide oligonucleotide strands can be prepared by standard protocols, and the ligation reaction is compatible with a wide range of chemical modifications to DNA and RNA. We have employed click ligation to synthesize DNA constructs up to 300 bases in length and much longer sequences are feasible. When the resulting triazole linkage is placed in a PCR template, various DNA polymerases correctly copy the entire base sequence. We have also successfully demonstrated both in vitro transcription and rolling circle amplification through the modified linkage. This linkage has shown in vivo biocompatibility: an antibiotic resistance gene containing triazole linkages functions in E. coli . Using click ligation, we have synthesized hairpin ribozymes up to 100 nucleotides in length and a hammerhead ribozyme with the triazole linkage located at the substrate cleavage site. At the opposite end of the length scale, click-ligated, cyclic mini-DNA duplexes have been used as models to study base pairing. Cyclic duplexes have potential therapeutic applications. They have extremely high thermodynamic stability, have increased resistance to enzymatic degradation, and have been investigated as decoys for regulatory proteins. For potential nanotechnology applications, we have synthesized double stranded DNA catenanes by click ligation. Other researchers have studied covalently fixed multistranded DNA constructs including triplexes and quadruplexes.
Photothermal fabrication of microscale patterned DNA hydrogels
NASA Astrophysics Data System (ADS)
Shimomura, Suguru; Nishimura, Takahiro; Ogura, Yusuke; Tanida, Jun
2018-02-01
This paper introduces a method for fabricating microscale DNA hydrogels using irradiation with patterned light. Optical fabrication allows for the flexible and tunable formation of DNA hydrogels without changing the environmental conditions. Our scheme is based on local heat generation via the photothermal effect, which is induced by light irradiation on a quenching species. We demonstrate experimentally that, depending on the power and irradiation time, light irradiation enables the creation of local microscale DNA hydrogels, while the shapes of the DNA hydrogels are controlled by the irradiation patterns.
Yi, Huso; Hallowell, Nina; Griffiths, Sian; Yeung Leung, Tak
2013-01-01
Background A newly introduced cell-free fetal DNA sequencing based non-invasive prenatal testing (DNA-NIPT) detects Down syndrome with sensitivity of 99% at early gestational stage without risk of miscarriage. Attention has been given to its public health implications; little is known from consumer perspectives. This qualitative study aimed to explore women’s motivations for using, and perceptions of, DNA-NIPT in Hong Kong. Methods and Findings In-depth interviews were conducted with 45 women who had undertaken DNA-NIPT recruited by purposive sampling based on socio-demographic and clinical characteristics. The sample included 31 women identified as high-risk from serum and ultrasound based Down syndrome screening (SU-DSS). Thematic narrative analysis examined informed-decision making of the test and identified the benefits and needs. Women outlined a number of reasons for accessing DNA-NIPT: reducing the uncertainty associated with risk probability-based results from SU-DSS, undertaking DNA-NIPT as a comprehensive measure to counteract risk from childbearing especially at advanced age, perceived predictive accuracy and absence of risk of harm to fetus. Accounts of women deemed high-risk or not high-risk are distinctive in a number of respects. High-risk women accessed DNA-NIPT to get a clearer idea of their risk. This group perceived SU-DSS as an unnecessary and confusing procedure because of its varying, protocol-dependent detection rates. Those women not deemed high-risk, in contrast, undertook DNA-NIPT for psychological assurance and to reduce anxiety even after receiving the negative result from SU-DSS. Conclusions DNA-NIPT was regarded positively by women who chose this method of screening over the routine, less expensive testing options. Given its perceived utility, health providers need to consider whether DNA-NIPT should be offered as part of universal routine care to women at high-risk for fetal aneuploidy. If this is the case, then further development of guidelines and quality assurance will be needed to provide a service suited to patients’ needs. PMID:24312358
NASA Technical Reports Server (NTRS)
Sutherland, Betsy M.; Georgakilas, Alexandros G.; Bennett, Paula V.; Laval, Jacques; Sutherland, John C.; Gewirtz, A. M. (Principal Investigator)
2003-01-01
Assessing DNA damage induction, repair and consequences of such damages requires measurement of specific DNA lesions by methods that are independent of biological responses to such lesions. Lesions affecting one DNA strand (altered bases, abasic sites, single strand breaks (SSB)) as well as damages affecting both strands (clustered damages, double strand breaks) can be quantified by direct measurement of DNA using gel electrophoresis, gel imaging and number average length analysis. Damage frequencies as low as a few sites per gigabase pair (10(9)bp) can be quantified by this approach in about 50ng of non-radioactive DNA, and single molecule methods may allow such measurements in DNA from single cells. This review presents the theoretical basis, biochemical requirements and practical aspects of this approach, and shows examples of their applications in identification and quantitation of complex clustered damages.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Youyu; Tang, Zhiwen; Wang, Jun
2010-08-01
A novel DNA detection platform based on a hairpin-DNA switch, nanoparticles, and enzyme signal amplification for ultrasensitive detection of DNA hybridization has been developed in this work. In this DNA assay, a “stem-loop” DNA probe dually labeled with a thiol at its 5’ end and a biotin at its 3’ end, respectively, was used. This probe was immobilized on the gold nanoparticles (AuNPs) anchored by a protein, globulin, on a 96-well microplate. In the absence of target DNA, the immobilized probe with the stem-loop structure shields the biotin from being approached by a bulky horseradish peroxidase linked-avidin (avidin-HRP) conjugate duemore » to the steric hindrance. However, in the presence of target DNA, the hybridization between the hairpin DNA probe and the target DNA causes significant conformational change of the probe, which forces biotin away from the surface of AuNPs. As a result, the biotin becomes accessible by the avidin-HRP, and the target hybridization event can be sensitively detected via the HRP catalyzed substrate 3, 3', 5, 5'-tetramethylbenzidine using spectrophometric method. Some experimental parameters governing the performance of the assay have been optimized. At optimal conditions, this DNA assay can detect DNA at the concentration of femtomolar level by means of a signal amplification strategy based on the combination of enzymes and nanoparticles. This approach also has shown excellent specificity to distinguish single-base mismatches of DNA targets because of the intrinsic high selectivity of the hairpin DNA probe.« less
Nested methylation-specific polymerase chain reaction cancer detection method
Belinsky, Steven A [Albuquerque, NM; Palmisano, William A [Edgewood, NM
2007-05-08
A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.
Payne, Andrew C; Andregg, Michael; Kemmish, Kent; Hamalainen, Mark; Bowell, Charlotte; Bleloch, Andrew; Klejwa, Nathan; Lehrach, Wolfgang; Schatz, Ken; Stark, Heather; Marblestone, Adam; Church, George; Own, Christopher S; Andregg, William
2013-01-01
We present "molecular threading", a surface independent tip-based method for stretching and depositing single and double-stranded DNA molecules. DNA is stretched into air at a liquid-air interface, and can be subsequently deposited onto a dry substrate isolated from solution. The design of an apparatus used for molecular threading is presented, and fluorescence and electron microscopies are used to characterize the angular distribution, straightness, and reproducibility of stretched DNA deposited in arrays onto elastomeric surfaces and thin membranes. Molecular threading demonstrates high straightness and uniformity over length scales from nanometers to micrometers, and represents an alternative to existing DNA deposition and linearization methods. These results point towards scalable and high-throughput precision manipulation of single-molecule polymers.
Efficient preparation of shuffled DNA libraries through recombination (Gateway) cloning.
Lehtonen, Soili I; Taskinen, Barbara; Ojala, Elina; Kukkurainen, Sampo; Rahikainen, Rolle; Riihimäki, Tiina A; Laitinen, Olli H; Kulomaa, Markku S; Hytönen, Vesa P
2015-01-01
Efficient and robust subcloning is essential for the construction of high-diversity DNA libraries in the field of directed evolution. We have developed a more efficient method for the subcloning of DNA-shuffled libraries by employing recombination cloning (Gateway). The Gateway cloning procedure was performed directly after the gene reassembly reaction, without additional purification and amplification steps, thus simplifying the conventional DNA shuffling protocols. Recombination-based cloning, directly from the heterologous reassembly reaction, conserved the high quality of the library and reduced the time required for the library construction. The described method is generally compatible for the construction of DNA-shuffled gene libraries. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won
2014-11-01
Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates heterologous expression of large gene clusters for drug discovery. Copyright © 2014 Elsevier Inc. All rights reserved.
Eboigbodin, Kevin; Filén, Sanna; Ojalehto, Tuomas; Brummer, Mirko; Elf, Sonja; Pousi, Kirsi; Hoser, Mark
2016-06-01
Rapid and accurate diagnosis of influenza viruses plays an important role in infection control, as well as in preventing the misuse of antibiotics. Isothermal nucleic acid amplification methods offer significant advantages over the polymerase chain reaction (PCR), since they are more rapid and do not require the sophisticated instruments needed for thermal cycling. We previously described a novel isothermal nucleic acid amplification method, 'Strand Invasion Based Amplification' (SIBA®), with high analytical sensitivity and specificity, for the detection of DNA. In this study, we describe the development of a variant of the SIBA method, namely, reverse transcription SIBA (RT-SIBA), for the rapid detection of viral RNA targets. The RT-SIBA method includes a reverse transcriptase enzyme that allows one-step reverse transcription of RNA to complementary DNA (cDNA) and simultaneous amplification and detection of the cDNA by SIBA under isothermal reaction conditions. The RT-SIBA method was found to be more sensitive than PCR for the detection of influenza A and B and could detect 100 copies of influenza RNA within 15 min. The development of RT-SIBA will enable rapid and accurate diagnosis of viral RNA targets within point-of-care or central laboratory settings.
High-Throughput Analysis of T-DNA Location and Structure Using Sequence Capture.
Inagaki, Soichi; Henry, Isabelle M; Lieberman, Meric C; Comai, Luca
2015-01-01
Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA-genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously, using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. Our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.
A ranking index for quality assessment of forensic DNA profiles forensic DNA profiles
2010-01-01
Background Assessment of DNA profile quality is vital in forensic DNA analysis, both in order to determine the evidentiary value of DNA results and to compare the performance of different DNA analysis protocols. Generally the quality assessment is performed through manual examination of the DNA profiles based on empirical knowledge, or by comparing the intensities (allelic peak heights) of the capillary electrophoresis electropherograms. Results We recently developed a ranking index for unbiased and quantitative quality assessment of forensic DNA profiles, the forensic DNA profile index (FI) (Hedman et al. Improved forensic DNA analysis through the use of alternative DNA polymerases and statistical modeling of DNA profiles, Biotechniques 47 (2009) 951-958). FI uses electropherogram data to combine the intensities of the allelic peaks with the balances within and between loci, using Principal Components Analysis. Here we present the construction of FI. We explain the mathematical and statistical methodologies used and present details about the applied data reduction method. Thereby we show how to adapt the ranking index for any Short Tandem Repeat-based forensic DNA typing system through validation against a manual grading scale and calibration against a specific set of DNA profiles. Conclusions The developed tool provides unbiased quality assessment of forensic DNA profiles. It can be applied for any DNA profiling system based on Short Tandem Repeat markers. Apart from crime related DNA analysis, FI can therefore be used as a quality tool in paternal or familial testing as well as in disaster victim identification. PMID:21062433
Martinez-Serra, Jordi; Robles, Juan; Nicolàs, Antoni; Gutierrez, Antonio; Ros, Teresa; Amat, Juan Carlos; Alemany, Regina; Vögler, Oliver; Abelló, Aina; Noguera, Aina; Besalduch, Joan
2014-01-01
Blood samples are extensively used for the molecular diagnosis of many hematological diseases. The daily practice in a clinical laboratory of molecular diagnosis in hematology involves using a variety of techniques, based on the amplification of nucleic acids. Current methods for polymerase chain reaction (PCR) use purified genomic DNA, mostly isolated from total peripheral blood cells or white blood cells (WBC). In this paper we describe a real-time fluorescence resonance energy transfer-based method for genotyping directly from blood cells. Our strategy is based on an initial isolation of the WBCs, allowing the removal of PCR inhibitors, such as the heme group, present in the erythrocytes. Once the erythrocytes have been lysed, in the LightCycler(®) 2.0 Instrument, we perform a real-time PCR followed by a melting curve analysis for different genes (Factors 2, 5, 12, MTHFR, and HFE). After testing 34 samples comparing the real-time crossing point (CP) values between WBC (5×10(6) WBC/mL) and purified DNA (20 ng/μL), the results for F5 Leiden were as follows: CP mean value for WBC was 29.26±0.566 versus purified DNA 24.79±0.56. Thus, when PCR was performed from WBC (5×10(6) WBC/mL) instead of DNA (20 ng/μL), we observed a delay of about 4 cycles. These small differences in CP values were similar for all genes tested and did not significantly affect the subsequent analysis by melting curves. In both cases the fluorescence values were high enough, allowing a robust genotyping of all these genes without a previous DNA purification/extraction.
Identifying DNA-binding proteins using structural motifs and the electrostatic potential
Shanahan, Hugh P.; Garcia, Mario A.; Jones, Susan; Thornton, Janet M.
2004-01-01
Robust methods to detect DNA-binding proteins from structures of unknown function are important for structural biology. This paper describes a method for identifying such proteins that (i) have a solvent accessible structural motif necessary for DNA-binding and (ii) a positive electrostatic potential in the region of the binding region. We focus on three structural motifs: helix–turn-helix (HTH), helix–hairpin–helix (HhH) and helix–loop–helix (HLH). We find that the combination of these variables detect 78% of proteins with an HTH motif, which is a substantial improvement over previous work based purely on structural templates and is comparable to more complex methods of identifying DNA-binding proteins. Similar true positive fractions are achieved for the HhH and HLH motifs. We see evidence of wide evolutionary diversity for DNA-binding proteins with an HTH motif, and much smaller diversity for those with an HhH or HLH motif. PMID:15356290
DNA extraction from benthic Cyanobacteria: comparative assessment and optimization.
Gaget, V; Keulen, A; Lau, M; Monis, P; Brookes, J D
2017-01-01
Benthic Cyanobacteria produce toxic and odorous compounds similar to their planktonic counterparts, challenging the quality of drinking water supplies. The biofilm that benthic algae and other micro-organisms produce is a complex and protective matrix. Monitoring to determine the abundance and identification of Cyanobacteria, therefore, relies on molecular techniques, with the choice of DNA isolation technique critical. This study investigated which DNA extraction method is optimal for DNA recovery in order to guarantee the best DNA yield for PCR-based analysis of benthic Cyanobacteria. The conventional phenol-chloroform extraction method was compared with five commercial kits, with the addition of chemical and physical cell-lysis steps also trialled. The efficacy of the various methods was evaluated by measuring the quantity and quality of DNA by UV spectrophotometry and by quantitative PCR (qPCR) using Cyanobacteria-specific primers. The yield and quality of DNA retrieved with the commercial kits was significantly higher than that of DNA obtained with the phenol-chloroform protocol. Kits including a physical cell-lysis step, such as the MO BIO Power Soil and Biofilm kits, were the most efficient for DNA isolation from benthic Cyanobacteria. These commercial kits allow greater recovery and the elimination of dangerous chemicals for DNA extraction, making them the method of choice for the isolation of DNA from benthic mats. They also facilitate the extraction of DNA from benthic Cyanobacteria, which can help to improve the characterization of Cyanobacteria in environmental studies using qPCRs or population composition analysis using next-generation sequencing. © 2016 The Society for Applied Microbiology.
Comparative evaluation of different extraction and quantification methods for forensic RNA analysis.
Grabmüller, Melanie; Madea, Burkhard; Courts, Cornelius
2015-05-01
Since about 2005, there is increasing interest in forensic RNA analysis whose versatility may very favorably complement traditional DNA profiling in forensic casework. There is, however, no method available specifically dedicated for extraction of RNA from forensically relevant sample material. In this study we compared five commercially available and commonly used RNA extraction kits and methods (mirVana™ miRNA Isolation Kit Ambion; Trizol® Reagent, Invitrogen; NucleoSpin® miRNA Kit Macherey-Nagel; AllPrep DNA/RNA Mini Kit and RNeasy® Mini Kit both Qiagen) to assess their relative effectiveness of yielding RNA of good quality and their compatibility with co-extraction of DNA amenable to STR profiling. We set up samples of small amounts of dried blood, liquid saliva, semen and buccal mucosa that were aged for different time intervals for co-extraction of RNA and DNA. RNA quality was assessed by determination of 'RNA integrity number' (RIN) and quantitative PCR based expression analysis. DNA quality was assessed via monitoring STR typing success rates. By comparison, the different methods exhibited considerable differences between RNA and DNA yields, RNA quality values and expression levels, and STR profiling success, with the AllPrep DNA/RNA Mini Kit and the NucleoSpin® miRNA Kit excelling at DNA co-extraction and RNA results, respectively. Overall, there was no 'best' method to satisfy all demands of comprehensible co-analysis of RNA and DNA and it appears that each method has specific merits and flaws. We recommend to cautiously choose from available methods and align its characteristics with the needs of the experimental setting at hand. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.