Sample records for dna binding activity

  1. An immunoassay for the study of DNA-binding activities of herpes simplex virus protein ICP8.

    PubMed

    Lee, C K; Knipe, D M

    1985-06-01

    An immunoassay was used to examine the interaction between a herpes simplex virus protein, ICP8, and various types of DNA. The advantage of this assay is that the protein is not subjected to harsh purification procedures. We characterized the binding of ICP8 to both single-stranded (ss) and double-stranded (ds) DNA. ICP8 bound ss DNA fivefold more efficiently than ds DNA, and both binding activities were most efficient in 150 mM NaCl. Two lines of evidence indicate that the binding activities were not identical: (i) ds DNA failed to complete with ss DNA binding even with a large excess of ds DNA; (ii) Scatchard plots of DNA binding with various amounts of DNA were fundamentally different for ss DNA and ds DNA. However, the two activities were related in that ss DNA efficiently competed with the binding of ds DNA. We conclude that the ds DNA-binding activity of ICP8 is probably distinct from the ss DNA-binding activity. No evidence for sequence-specific ds DNA binding was obtained for either the entire herpes simplex virus genome or cloned viral sequences.

  2. Repeated administration of CGP 46381, a gamma-aminobutyric acidB antagonist, and ethosuximide suppresses seizure-associated cyclic adenosine 3'5' monophosphate response element- and activator protein-1 DNA-binding activities in lethargic (lh/lh) mice.

    PubMed

    Ishige, K; Endo, H; Saito, H; Ito, Y

    2001-01-19

    To characterize seizure-associated increases in cerebral cortical and thalamic cyclic AMP responsive element (CRE)- and activator protein 1 (AP-1) DNA-binding activities in lethargic (lh/lh) mice, a genetic model of absence seizures, we examined the effects of ethosuximide and CGP 46381 on these DNA-binding activities. Repeated administration (twice a day for 5 days) of ethosuximide (200 mg/kg) or CGP 46381 (60 mg/kg) attenuated both seizure behavior and the increased DNA-binding activities, and was more effective than a single administration of these drugs. These treatments did not affect either normal behavior or basal DNA-binding activities in non-epileptic control (+/+) mice. Gel supershift assays revealed that the increased CRE-binding activity was attributable to activation of the binding activity of CREB, and that the c-Fos-c-Jun complex was a component of the increased AP-1 DNA-binding activity.

  3. Chimeric proteins for detection and quantitation of DNA mutations, DNA sequence variations, DNA damage and DNA mismatches

    DOEpatents

    McCutchen-Maloney, Sandra L.

    2002-01-01

    Chimeric proteins having both DNA mutation binding activity and nuclease activity are synthesized by recombinant technology. The proteins are of the general formula A-L-B and B-L-A where A is a peptide having DNA mutation binding activity, L is a linker and B is a peptide having nuclease activity. The chimeric proteins are useful for detection and identification of DNA sequence variations including DNA mutations (including DNA damage and mismatches) by binding to the DNA mutation and cutting the DNA once the DNA mutation is detected.

  4. Site-directed mutagenesis study on DNA binding regions of the mouse homologue of Suppressor of Hairless, RBP-J kappa.

    PubMed Central

    Chung, C N; Hamaguchi, Y; Honjo, T; Kawaichi, M

    1994-01-01

    To map regions important for DNA binding of the mouse homologue of Suppressor of Hairless or RBP-J kappa protein, mutated mouse RBP-J kappa cDNAs were made by insertion of oligonucleotide linkers or base replacement. DNA binding assays using the mutated proteins expressed in COS cells showed that various mutations between 218 Arg and 227 Arg decreased the DNA binding activity drastically. The DNA binding activity was not affected by amino acid replacements within the integrase motif of the RBP-J kappa protein (230His-269His). Replacements between 291Arg and 323Tyr affected the DNA binding activity slightly but reproducibly. These results indicate that the region encompassing 218Arg-227Arg is critical for the DNA binding activity of RBP-J kappa. This region did not show any significant homology to motifs or domains of the previously described DNA binding proteins. Using a truncation mutant protein RBP-J kappa was shown to associate with DNA as a monomer. Images PMID:8065905

  5. DNA Recognition by a σ 54 Transcriptional Activator from Aquifex aeolicus

    DOE PAGES

    Vidangos, Natasha K.; Heideker, Johanna; Lyubimov, Artem; ...

    2014-08-23

    Transcription initiation by bacterial σ 54-polymerase requires the action of a transcriptional activator protein. Activators bind sequence-specifically upstream of the transcription initiation site via a DNA-binding domain. The structurally characterized DNA-binding domains from activators all belong to the Factor for Inversion Stimulation (Fis) family of helix-turn-helix DNA-binding proteins. We report here structures of the free and DNA-bound forms of the DNA-binding domain of NtrC4 (4DBD) from Aquifex aeolicus, a member of the NtrC family of σ 54 activators. Two NtrC4 binding sites were identified upstream (-145 and -85 base pairs) from the start of the lpxC gene, which is responsiblemore » for the first committed step in Lipid A biosynthesis. This is the first experimental evidence for σ 54 regulation in lpxC expression. 4DBD was crystallized both without DNA and in complex with the -145 binding site. The structures, together with biochemical data, indicate that NtrC4 binds to DNA in a manner that is similar to that of its close homologue, Fis. Ultimately, the greater sequence specificity for the binding of 4DBD relative to Fis seems to arise from a larger number of base specific contacts contributing to affinity than for Fis.« less

  6. Resolution of the diadenosine 5',5"'-P1,P4-tetraphosphate binding subunit from a multiprotein form of HeLa cell DNA polymerase alpha.

    PubMed Central

    Baril, E; Bonin, P; Burstein, D; Mara, K; Zamecnik, P

    1983-01-01

    A diadenosine 5',5"'-P1,P4-tetraphosphate (Ap4A) binding subunit has been resolved from a high molecular weight (640,000) multiprotein form of DNA polymerase alpha [deoxynucleoside triphosphate:DNA nucleotidyltransferase (DNA-directed), EC 2.7.7.7] from HeLa cells [DNA polymerase alpha 2 of Lamothe, P., Baril, B., Chi, A., Lee, L. & Baril, E. (1981) Proc. Natl. Acad. Sci. USA 78, 4723-4727]. The Ap4A binding activity copurifies with the DNA polymerizing activity during the course of purification. Hydrophobic chromatography on butylagarose resolves the Ap4A binding activity from the DNA polymerase. The Ap4A binding activity is protein in nature since the binding of Ap4A is abolished by treatment of the isolated binding activity with proteinase K but is insensitive to treatment with DNase or RNase. The molecular weight of the Ap4A binding protein, as determined by polyacrylamide gel electrophoresis under nondenaturing conditions or by NaDodSO4/polyacrylamide gel electrophoresis after photoaffinity labeling of the protein with [32P]Ap4A is 92,000 or 47,000. The binding activity of this protein is highly specific for Ap4A. Images PMID:6576366

  7. Single-molecule imaging of DNA polymerase I (Klenow fragment) activity by atomic force microscopy

    NASA Astrophysics Data System (ADS)

    Chao, J.; Zhang, P.; Wang, Q.; Wu, N.; Zhang, F.; Hu, J.; Fan, C. H.; Li, B.

    2016-03-01

    We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA.We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr06544e

  8. Comparison between TRF2 and TRF1 of their telomeric DNA-bound structures and DNA-binding activities

    PubMed Central

    Hanaoka, Shingo; Nagadoi, Aritaka; Nishimura, Yoshifumi

    2005-01-01

    Mammalian telomeres consist of long tandem arrays of double-stranded telomeric TTAGGG repeats packaged by the telomeric DNA-binding proteins TRF1 and TRF2. Both contain a similar C-terminal Myb domain that mediates sequence-specific binding to telomeric DNA. In a DNA complex of TRF1, only the single Myb-like domain consisting of three helices can bind specifically to double-stranded telomeric DNA. TRF2 also binds to double-stranded telomeric DNA. Although the DNA binding mode of TRF2 is likely identical to that of TRF1, TRF2 plays an important role in the t-loop formation that protects the ends of telomeres. Here, to clarify the details of the double-stranded telomeric DNA-binding modes of TRF1 and TRF2, we determined the solution structure of the DNA-binding domain of human TRF2 bound to telomeric DNA; it consists of three helices, and like TRF1, the third helix recognizes TAGGG sequence in the major groove of DNA with the N-terminal arm locating in the minor groove. However, small but significant differences are observed; in contrast to the minor groove recognition of TRF1, in which an arginine residue recognizes the TT sequence, a lysine residue of TRF2 interacts with the TT part. We examined the telomeric DNA-binding activities of both DNA-binding domains of TRF1 and TRF2 and found that TRF1 binds more strongly than TRF2. Based on the structural differences of both domains, we created several mutants of the DNA-binding domain of TRF2 with stronger binding activities compared to the wild-type TRF2. PMID:15608118

  9. Mutational analyses of Aquifex pyrophilus DNA ligase define essential domains for self-adenylation and DNA binding activity.

    PubMed

    Lim, J H; Choi, J; Kim, W; Ahn, B Y; Han, Y S

    2001-04-15

    We constructed nine deletion mutants of NAD+-dependent DNA ligase from Aquifex pyrophilus to characterize the functional domains. All of DNA ligase deletion mutants were analyzed in biochemical assays for NAD+-dependent self-adenylation, DNA binding, and nick-closing activity. Although the mutant lsub1 (91-362) included the active site lysine (KxDG), self-adenylation was not shown. However, the mutants lsub6 (1-362), lsub7 (1-516), and lsub9 (1-635) showed the same adenylation activity as that of wild type. The lsub5 (91-719), which has the C-terminal domain (487-719) as to lsub4 (91-486), showed minimal adenylation activity. These results suggest that the presence of N-terminal 90 residues is essential for the formation of an enzyme-AMP complex, while C-terminal domain (487-719) appears to play a minimal role in adenylation. It was found that the presence of C-terminal domain (487-719) is indispensable for DNA binding activity of lsub5 (91-719). The mutant lsub9 (1-635) showed reduced DNA binding activity compared to that of wild type, suggesting the contribution of the domain (636-719) for the DNA binding activity. Thus, we concluded that the N-terminal 90 residues and C-terminal domain (487-719) of NAD+-dependent DNA ligase from A. pyrophilus are mutually indispensable for binding of DNA substrate.

  10. DNA-binding activity of TNF-{alpha} inducing protein from Helicobacter pylori

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kuzuhara, T.; Suganuma, M.; Oka, K.

    2007-11-03

    Tumor necrosis factor-{alpha} (TNF-{alpha}) inducing protein (Tip{alpha}) is a carcinogenic factor secreted from Helicobacter pylori (H. pylori), mediated through both enhanced expression of TNF-{alpha} and chemokine genes and activation of nuclear factor-{kappa}B. Since Tip{alpha} enters gastric cancer cells, the Tip{alpha} binding molecules in the cells should be investigated. The direct DNA-binding activity of Tip{alpha} was observed by pull down assay using single- and double-stranded genomic DNA cellulose. The surface plasmon resonance assay, indicating an association between Tip{alpha} and DNA, revealed that the affinity of Tip{alpha} for (dGdC)10 is 2400 times stronger than that of del-Tip{alpha}, an inactive Tip{alpha}. This suggestsmore » a strong correlation between DNA-binding activity and carcinogenic activity of Tip{alpha}. And the DNA-binding activity of Tip{alpha} was first demonstrated with a molecule secreted from H. pylori.« less

  11. The substrate binding interface of alkylpurine DNA glycosylase AlkD.

    PubMed

    Mullins, Elwood A; Rubinson, Emily H; Eichman, Brandt F

    2014-01-01

    Tandem helical repeats have emerged as an important DNA binding architecture. DNA glycosylase AlkD, which excises N3- and N7-alkylated nucleobases, uses repeating helical motifs to bind duplex DNA and to selectively pause at non-Watson-Crick base pairs. Remodeling of the DNA backbone promotes nucleotide flipping of the lesion and the complementary base into the solvent and toward the protein surface, respectively. The important features of this new DNA binding architecture that allow AlkD to distinguish between damaged and normal DNA without contacting the lesion are poorly understood. Here, we show through extensive mutational analysis that DNA binding and N3-methyladenine (3mA) and N7-methylguanine (7mG) excision are dependent upon each residue lining the DNA binding interface. Disrupting electrostatic or hydrophobic interactions with the DNA backbone substantially reduced binding affinity and catalytic activity. These results demonstrate that residues seemingly only involved in general DNA binding are important for catalytic activity and imply that base excision is driven by binding energy provided by the entire substrate interface of this novel DNA binding architecture. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Synthesis, DNA Binding, and Antiproliferative Activity of Novel Acridine-Thiosemicarbazone Derivatives

    PubMed Central

    de Almeida, Sinara Mônica Vitalino; Lafayette, Elizabeth Almeida; Gomes da Silva, Lúcia Patrícia Bezerra; Amorim, Cézar Augusto da Cruz; de Oliveira, Tiago Bento; Gois Ruiz, Ana Lucia Tasca; de Carvalho, João Ernesto; de Moura, Ricardo Olímpio; Beltrão, Eduardo Isidoro Carneiro; de Lima, Maria do Carmo Alves; de Carvalho Júnior, Luiz Bezerra

    2015-01-01

    In this work, the acridine nucleus was used as a lead-compound for structural modification by adding different substituted thiosemicarbazide moieties. Eight new (Z)-2-(acridin-9-ylmethylene)-N-phenylhydrazinecarbothioamide derivatives (3a–h) were synthesized, their antiproliferative activities were evaluated, and DNA binding properties were performed with calf thymus DNA (ctDNA) by electronic absorption and fluorescence spectroscopies. Both hyperchromic and hypochromic effects, as well as red or blue shifts were demonstrated by addition of ctDNA to the derivatives. The calculated binding constants ranged from 1.74 × 104 to 1.0 × 106 M−1 and quenching constants from −0.2 × 104 to 2.18 × 104 M−1 indicating high affinity to ctDNA base pairs. The most efficient compound in binding to ctDNA in vitro was (Z)-2-(acridin-9-ylmethylene)-N-(4-chlorophenyl) hydrazinecarbothioamide (3f), while the most active compound in antiproliferative assay was (Z)-2-(acridin-9-ylmethylene)-N-phenylhydrazinecarbothioamide (3a). There was no correlation between DNA-binding and in vitro antiproliferative activity, but the results suggest that DNA binding can be involved in the biological activity mechanism. This study may guide the choice of the size and shape of the intercalating part of the ligand and the strategic selection of substituents that increase DNA-binding or antiproliferative properties. PMID:26068233

  13. Plasticity of BRCA2 Function in Homologous Recombination: Genetic Interactions of the PALB2 and DNA Binding Domains

    PubMed Central

    Siaud, Nicolas; Lam, Isabel; Christ, Nicole; Schlacher, Katharina; Xia, Bing; Jasin, Maria

    2011-01-01

    The breast cancer suppressor BRCA2 is essential for the maintenance of genomic integrity in mammalian cells through its role in DNA repair by homologous recombination (HR). Human BRCA2 is 3,418 amino acids and is comprised of multiple domains that interact with the RAD51 recombinase and other proteins as well as with DNA. To gain insight into the cellular function of BRCA2 in HR, we created fusions consisting of various BRCA2 domains and also introduced mutations into these domains to disrupt specific protein and DNA interactions. We find that a BRCA2 fusion peptide deleted for the DNA binding domain and active in HR is completely dependent on interaction with the PALB2 tumor suppressor for activity. Conversely, a BRCA2 fusion peptide deleted for the PALB2 binding domain is dependent on an intact DNA binding domain, providing a role for this conserved domain in vivo; mutagenesis suggests that both single-stranded and double-stranded DNA binding activities in the DNA binding domain are required for its activity. Given that PALB2 itself binds DNA, these results suggest alternative mechanisms to deliver RAD51 to DNA. In addition, the BRCA2 C terminus contains both RAD51-dependent and -independent activities which are essential to HR in some contexts. Finally, binding the small peptide DSS1 is essential for activity when its binding domain is present, but not when it is absent. Our results reveal functional redundancy within the BRCA2 protein and emphasize the plasticity of this large protein built for optimal HR function in mammalian cells. The occurrence of disease-causing mutations throughout BRCA2 suggests sub-optimal HR from a variety of domain modulations. PMID:22194698

  14. Analysis of DNA binding by human factor xeroderma pigmentosum complementation group A (XPA) provides insight into its interactions with nucleotide excision repair substrates.

    PubMed

    Sugitani, Norie; Voehler, Markus W; Roh, Michelle S; Topolska-Woś, Agnieszka M; Chazin, Walter J

    2017-10-13

    Xeroderma pigmentosum (XP) complementation group A (XPA) is an essential scaffolding protein in the multiprotein nucleotide excision repair (NER) machinery. The interaction of XPA with DNA is a core function of this protein; a number of mutations in the DNA-binding domain (DBD) are associated with XP disease. Although structures of the central globular domain of human XPA and data on binding of DNA substrates have been reported, the structural basis for XPA's DNA-binding activity remains unknown. X-ray crystal structures of the central globular domain of yeast XPA (Rad14) with lesion-containing DNA duplexes have provided valuable insights, but the DNA substrates used for this study do not correspond to the substrates of XPA as it functions within the NER machinery. To better understand the DNA-binding activity of human XPA in NER, we used NMR to investigate the interaction of its DBD with a range of DNA substrates. We found that XPA binds different single-stranded/double-stranded junction DNA substrates with a common surface. Comparisons of our NMR-based mapping of binding residues with the previously reported Rad14-DNA crystal structures revealed similarities and differences in substrate binding between XPA and Rad14. This includes direct evidence for DNA contacts to the residues extending C-terminally from the globular core, which are lacking in the Rad14 construct. Moreover, mutation of the XPA residue corresponding to Phe-262 in Rad14, previously reported as being critical for DNA binding, had only a moderate effect on the DNA-binding activity of XPA. The DNA-binding properties of several disease-associated mutations in the DBD were investigated. These results suggest that for XPA mutants exhibiting altered DNA-binding properties, a correlation exists between the extent of reduction in DNA-binding affinity and the severity of symptoms in XP patients. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Structure analysis of FAAP24 reveals single-stranded DNA-binding activity and domain functions in DNA damage response

    PubMed Central

    Wang, Yucai; Han, Xiao; Wu, Fangming; Leung, Justin W; Lowery, Megan G; Do, Huong; Chen, Junjie; Shi, Chaowei; Tian, Changlin; Li, Lei; Gong, Weimin

    2013-01-01

    The FANCM/FAAP24 heterodimer has distinct functions in protecting cells from complex DNA lesions such as interstrand crosslinks. These functions rely on the biochemical activity of FANCM/FAAP24 to recognize and bind to damaged DNA or stalled replication forks. However, the DNA-binding activity of this complex was not clearly defined. We investigated how FAAP24 contributes to the DNA-interacting functions of the FANCM/FAAP24 complex by acquiring the N-terminal and C-terminal solution structures of human FAAP24. Modeling of the FAAP24 structure indicates that FAAP24 may possess a high affinity toward single-stranded DNA (ssDNA). Testing of various FAAP24 mutations in vitro and in vivo validated this prediction derived from structural analyses. We found that the DNA-binding and FANCM-interacting functions of FAAP24, although both require the C-terminal (HhH)2 domain, can be distinguished by segregation-of-function mutations. These results demonstrate dual roles of FAAP24 in DNA damage response against crosslinking lesions, one through the formation of FANCM/FAAP24 heterodimer and the other via its ssDNA-binding activity required in optimized checkpoint activation. PMID:23999858

  16. Characterization of the DNA binding properties of polyomavirus capsid protein

    NASA Technical Reports Server (NTRS)

    Chang, D.; Cai, X.; Consigli, R. A.; Spooner, B. S. (Principal Investigator)

    1993-01-01

    The DNA binding properties of the polyomavirus structural proteins VP1, VP2, and VP3 were studied by Southwestern analysis. The major viral structural protein VP1 and host-contributed histone proteins of polyomavirus virions were shown to exhibit DNA binding activity, but the minor capsid proteins VP2 and VP3 failed to bind DNA. The N-terminal first five amino acids (Ala-1 to Lys-5) were identified as the VP1 DNA binding domain by genetic and biochemical approaches. Wild-type VP1 expressed in Escherichia coli (RK1448) exhibited DNA binding activity, but the N-terminal truncated VP1 mutants (lacking Ala-1 to Lys-5 and Ala-1 to Cys-11) failed to bind DNA. The synthetic peptide (Ala-1 to Cys-11) was also shown to have an affinity for DNA binding. Site-directed mutagenesis of the VP1 gene showed that the point mutations at Pro-2, Lys-3, and Arg-4 on the VP1 molecule did not affect DNA binding properties but that the point mutation at Lys-5 drastically reduced DNA binding affinity. The N-terminal (Ala-1 to Lys-5) region of VP1 was found to be essential and specific for DNA binding, while the DNA appears to be non-sequence specific. The DNA binding domain and the nuclear localization signal are located in the same N-terminal region.

  17. The large terminase DNA packaging motor grips DNA with its ATPase domain for cleavage by the flexible nuclease domain

    PubMed Central

    Hilbert, Brendan J.; Hayes, Janelle A.; Stone, Nicholas P.; Xu, Rui-Gang

    2017-01-01

    Abstract Many viruses use a powerful terminase motor to pump their genome inside an empty procapsid shell during virus maturation. The large terminase (TerL) protein contains both enzymatic activities necessary for packaging in such viruses: the adenosine triphosphatase (ATPase) that powers DNA translocation and an endonuclease that cleaves the concatemeric genome at both initiation and completion of genome packaging. However, how TerL binds DNA during translocation and cleavage remains mysterious. Here we investigate DNA binding and cleavage using TerL from the thermophilic phage P74-26. We report the structure of the P74-26 TerL nuclease domain, which allows us to model DNA binding in the nuclease active site. We screened a large panel of TerL variants for defects in binding and DNA cleavage, revealing that the ATPase domain is the primary site for DNA binding, and is required for nuclease activity. The nuclease domain is dispensable for DNA binding but residues lining the active site guide DNA for cleavage. Kinetic analysis of DNA cleavage suggests flexible tethering of the nuclease domains during DNA cleavage. We propose that interactions with the procapsid during DNA translocation conformationally restrict the nuclease domain, inhibiting cleavage; TerL release from the capsid upon completion of packaging unlocks the nuclease domains to cleave DNA. PMID:28082398

  18. The evaluation of anoxia responsive E2F DNA binding activity in the red eared slider turtle, Trachemys scripta elegans.

    PubMed

    Biggar, Kyle K; Storey, Kenneth B

    2018-01-01

    In many cases, the DNA-binding activity of a transcription factor does not change, while its transcriptional activity is greatly influenced by the make-up of bound proteins. In this study, we assessed the protein composition and DNA-binding ability of the E2F transcription factor complex to provide insight into cell cycle control in an anoxia tolerant turtle through the use of a modified ELISA protocol. This modification also permits the use of custom DNA probes that are tailored to a specific DNA binding region, introducing the ability to design capture probes for non-model organisms. Through the use of EMSA and ELISA DNA binding assays, we have successfully determined the in vitro DNA binding activity and complex dynamics of the Rb/E2F cell cycle regulatory mechanisms in an anoxic turtle, Trachemys scripta elegans . Repressive cell cycle proteins (E2F4, Rb, HDAC4 and Suv39H1) were found to significantly increase at E2F DNA-binding sites upon anoxic exposure in anoxic turtle liver. The lack of p130 involvement in the E2F DNA-bound complex indicates that anoxic turtle liver may maintain G 1 arrest for the duration of stress survival.

  19. The evaluation of anoxia responsive E2F DNA binding activity in the red eared slider turtle, Trachemys scripta elegans

    PubMed Central

    Biggar, Kyle K.

    2018-01-01

    In many cases, the DNA-binding activity of a transcription factor does not change, while its transcriptional activity is greatly influenced by the make-up of bound proteins. In this study, we assessed the protein composition and DNA-binding ability of the E2F transcription factor complex to provide insight into cell cycle control in an anoxia tolerant turtle through the use of a modified ELISA protocol. This modification also permits the use of custom DNA probes that are tailored to a specific DNA binding region, introducing the ability to design capture probes for non-model organisms. Through the use of EMSA and ELISA DNA binding assays, we have successfully determined the in vitro DNA binding activity and complex dynamics of the Rb/E2F cell cycle regulatory mechanisms in an anoxic turtle, Trachemys scripta elegans. Repressive cell cycle proteins (E2F4, Rb, HDAC4 and Suv39H1) were found to significantly increase at E2F DNA-binding sites upon anoxic exposure in anoxic turtle liver. The lack of p130 involvement in the E2F DNA-bound complex indicates that anoxic turtle liver may maintain G1 arrest for the duration of stress survival. PMID:29770276

  20. Identification of Nucleic Acid Binding Sites on Translin-Associated Factor X (TRAX) Protein

    PubMed Central

    Gupta, Gagan Deep; Kumar, Vinay

    2012-01-01

    Translin and TRAX proteins play roles in very important cellular processes such as DNA recombination, spatial and temporal expression of mRNA, and in siRNA processing. Translin forms a homomeric nucleic acid binding complex and binds to ssDNA and RNA. However, a mutant translin construct that forms homomeric complex lacking nucleic acid binding activity is able to form fully active heteromeric translin-TRAX complex when co-expressed with TRAX. A substantial progress has been made in identifying translin sites that mediate its binding activity, while TRAX was thought not to bind DNA or RNA on its own. We here for the first time demonstrate nucleic acid binding to TRAX by crosslinking radiolabeled ssDNA to heteromeric translin-TRAX complex using UV-laser. The TRAX and translin, photochemically crosslinked with ssDNA, were individually detected on SDS-PAGE. We mutated two motifs in TRAX and translin, designated B2 and B3, to help define the nucleic acid binding sites in the TRAX sequence. The most pronounced effect was observed in the mutants of B3 motif that impaired nucleic acid binding activity of the heteromeric complexes. We suggest that both translin and TRAX are binding competent and contribute to the nucleic acid binding activity. PMID:22427937

  1. A Colorimetric Microplate Assay for DNA-Binding Activity of His-Tagged MutS Protein.

    PubMed

    Banasik, Michał; Sachadyn, Paweł

    2016-09-01

    A simple microplate method was designed for rapid testing DNA-binding activity of proteins. The principle of the assay involves binding of tested DNA by his-tagged protein immobilized on a nickel-coated ELISA plate, following colorimetric detection of biotinylated DNA with avidin conjugated to horseradish peroxidase. The method was used to compare DNA mismatch binding activities of MutS proteins from three bacterial species. The assay required relatively low amounts of tested protein (approximately 0.5-10 pmol) and DNA (0.1-10 pmol) and a relatively short time of analysis (up to 60 min). The method is very simple to apply and convenient to test different buffer conditions of DNA-protein binding. Sensitive colorimetric detection enables naked eye observations and quantitation with an ELISA reader. The performance of the assay, which we believe is a distinguishing trait of the method, is based on two strong and specific molecular interactions: binding of a his-tagged protein to a nickel-coated microplate and binding of biotinylated DNA to avidin. In the reported experiments, the solution was used to optimize the conditions for DNA mismatch binding by MutS protein; however, the approach could be implemented to test nucleic acids interactions with any protein of interest.

  2. Propensity for HBZ-SP1 isoform of HTLV-I to inhibit c-Jun activity correlates with sequestration of c-Jun into nuclear bodies rather than inhibition of its DNA-binding activity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Clerc, Isabelle, E-mail: isabelle.clerc@univ-montp1.f; CNRS, UM5236, CPBS, F-34965 Montpellier; Universite Montpellier 2, CPBS, F-34095 Montpellier

    2009-09-01

    HTLV-I bZIP factor (HBZ) contains a C-terminal zipper domain involved in its interaction with c-Jun. This interaction leads to a reduction of c-Jun DNA-binding activity and prevents the protein from activating transcription of AP-1-dependent promoters. However, it remained unclear whether the negative effect of HBZ-SP1 was due to its weak DNA-binding activity or to its capacity to target cellular factors to transcriptionally-inactive nuclear bodies. To answer this question, we produced a mutant in which specific residues present in the modulatory and DNA-binding domain of HBZ-SP1 were substituted for the corresponding c-Fos amino acids to improve the DNA-binding activity of themore » c-Jun/HBZ-SP1 heterodimer. The stability of the mutant, its interaction with c-Jun, DNA-binding activity of the resulting heterodimer, and its effect on the c-Jun activity were tested. In conclusion, we demonstrate that the repression of c-Jun activity in vivo is mainly due to the HBZ-SP1-mediated sequestration of c-Jun to the HBZ-NBs.« less

  3. Protein Cofactors Are Essential for High-Affinity DNA Binding by the Nuclear Factor κB RelA Subunit.

    PubMed

    Mulero, Maria Carmen; Shahabi, Shandy; Ko, Myung Soo; Schiffer, Jamie M; Huang, De-Bin; Wang, Vivien Ya-Fan; Amaro, Rommie E; Huxford, Tom; Ghosh, Gourisankar

    2018-05-22

    Transcription activator proteins typically contain two functional domains: a DNA binding domain (DBD) that binds to DNA with sequence specificity and an activation domain (AD) whose established function is to recruit RNA polymerase. In this report, we show that purified recombinant nuclear factor κB (NF-κB) RelA dimers bind specific κB DNA sites with an affinity significantly lower than that of the same dimers from nuclear extracts of activated cells, suggesting that additional nuclear cofactors might facilitate DNA binding by the RelA dimers. Additionally, recombinant RelA binds DNA with relatively low affinity at a physiological salt concentration in vitro. The addition of p53 or RPS3 (ribosomal protein S3) increases RelA:DNA binding affinity 2- to >50-fold depending on the protein and ionic conditions. These cofactor proteins do not form stable ternary complexes, suggesting that they stabilize the RelA:DNA complex through dynamic interactions. Surprisingly, the RelA-DBD alone fails to bind DNA under the same solution conditions even in the presence of cofactors, suggesting an important role of the RelA-AD in DNA binding. Reduced RelA:DNA binding at a physiological ionic strength suggests that multiple cofactors might be acting simultaneously to mitigate the electrolyte effect and stabilize the RelA:DNA complex in vivo. Overall, our observations suggest that the RelA-AD and multiple cofactor proteins function cooperatively to prime the RelA-DBD and stabilize the RelA:DNA complex in cells. Our study provides a mechanism for nuclear cofactor proteins in NF-κB-dependent gene regulation.

  4. Chlorella virus DNA ligase: nick recognition and mutational analysis.

    PubMed

    Sriskanda, V; Shuman, S

    1998-01-15

    Chlorella virus PBCV-1 DNA ligase seals nicked DNA substrates consisting of a 5'-phosphate-terminated strand and a 3'-hydroxyl-terminated strand annealed to a bridging DNA template strand. The enzyme discriminates at the DNA binding step between substrates containing a 5'-phosphate versus a 5'-hydroxyl at the nick. Mutational analysis of the active site motif KxDGxR (residues 27-32) illuminates essential roles for the conserved Lys, Asp and Arg moieties at different steps of the ligase reaction. Mutant K27A is unable to form the covalent ligase-(Lys-straightepsilonN-P)-adenylate intermediate and hence cannot activate a nicked DNA substrate via formation of the DNA-adenylate intermediate. Nonetheless, K27A catalyzes phosphodiester bond formation at a pre-adenylated nick. This shows that the active site lysine is not required for the strand closure reaction. K27A binds to nicked DNA-adenylate, but not to a standard DNA nick. This suggests that occupancy of the AMP binding pocket of DNA ligase is important for nick recognition. Mutant D29A is active in enzyme-adenylate formation and binds readily to nicked DNA, but is inert in DNA-adenylate formation. R32A is unable to catalyze any of the three reactions of the ligation pathway and does not bind to nicked DNA.

  5. JAB1 regulates unphosphorylated STAT3 DNA-binding activity through protein–protein interaction in human colon cancer cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nishimoto, Arata, E-mail: anishimo@yamaguchi-u.ac.jp; Kugimiya, Naruji; Hosoyama, Toru

    2013-08-30

    Highlights: •JAB1 interacted with unphosphorylated STAT3 in the nucleus. •JAB1 knockdown tended to increase nuclear STAT3 expression. •JAB1 knockdown significantly decreased unphosphorylated STAT3 DNA-binding activity. •JAB1 knockdown significantly decreased MDR1, NANOG, and VEGF expressions. •Nuclear JAB1, but not nuclear STAT3, correlated with STAT3 DNA-binding activity. -- Abstract: Recent studies have revealed that unphosphorylated STAT3 forms a dimer, translocates to the nucleus, binds to the STAT3 binding site, and activates the transcription of STAT3 target genes, thereby playing an important role in oncogenesis in addition to phosphorylated STAT3. Among signaling steps of unphosphorylated STAT3, nuclear translocation and target DNA-binding are themore » critical steps for its activation. Therefore, elucidating the regulatory mechanism of these signaling steps of unphosphorylated STAT3 is a potential step in the discovery of a novel cancer drug. However, the mechanism of unphosphorylated STAT3 binding to the promoter of target genes remains unclear. In this study, we focused on Jun activation domain-binding protein 1 (JAB1) as a candidate protein that regulates unphosphorylated STAT3 DNA-binding activity. Initially, we observed that both unphosphorylated STAT3 and JAB1 existed in the nucleus of human colon cancer cell line COLO205 at the basal state (no cytokine stimulation). On the other hand, phosphorylated STAT3 did not exist in the nucleus of COLO205 cells at the basal state. Immunoprecipitation using nuclear extract of COLO205 cells revealed that JAB1 interacted with unphosphorylated STAT3. To investigate the effect of JAB1 on unphosphorylated STAT3 activity, RNAi studies were performed. Although JAB1 knockdown tended to increase nuclear STAT3 expression, it significantly decreased unphosphorylated STAT3 DNA-binding activity. Subsequently, JAB1 knockdown significantly decreased the expression levels of MDR1, NANOG, and VEGF, which are STAT3 target genes. Furthermore, the expression level of nuclear JAB1, but not nuclear STAT3, correlated with unphosphorylated STAT3 DNA-binding activity between COLO205 and LoVo cells. Taken together, these results suggest that nuclear JAB1 positively regulates unphosphorylated STAT3 DNA-binding activity through protein–protein interaction in human colon cancer cell line COLO205.« less

  6. Genome-wide survey of DNA-binding proteins in Arabidopsis thaliana: analysis of distribution and functions.

    PubMed

    Malhotra, Sony; Sowdhamini, Ramanathan

    2013-08-01

    The interaction of proteins with their respective DNA targets is known to control many high-fidelity cellular processes. Performing a comprehensive survey of the sequenced genomes for DNA-binding proteins (DBPs) will help in understanding their distribution and the associated functions in a particular genome. Availability of fully sequenced genome of Arabidopsis thaliana enables the review of distribution of DBPs in this model plant genome. We used profiles of both structure and sequence-based DNA-binding families, derived from PDB and PFam databases, to perform the survey. This resulted in 4471 proteins, identified as DNA-binding in Arabidopsis genome, which are distributed across 300 different PFam families. Apart from several plant-specific DNA-binding families, certain RING fingers and leucine zippers also had high representation. Our search protocol helped to assign DNA-binding property to several proteins that were previously marked as unknown, putative or hypothetical in function. The distribution of Arabidopsis genes having a role in plant DNA repair were particularly studied and noted for their functional mapping. The functions observed to be overrepresented in the plant genome harbour DNA-3-methyladenine glycosylase activity, alkylbase DNA N-glycosylase activity and DNA-(apurinic or apyrimidinic site) lyase activity, suggesting their role in specialized functions such as gene regulation and DNA repair.

  7. Novel DNA Motif Binding Activity Observed In Vivo With an Estrogen Receptor α Mutant Mouse

    PubMed Central

    Li, Leping; Grimm, Sara A.; Winuthayanon, Wipawee; Hamilton, Katherine J.; Pockette, Brianna; Rubel, Cory A.; Pedersen, Lars C.; Fargo, David; Lanz, Rainer B.; DeMayo, Francesco J.; Schütz, Günther; Korach, Kenneth S.

    2014-01-01

    Estrogen receptor α (ERα) interacts with DNA directly or indirectly via other transcription factors, referred to as “tethering.” Evidence for tethering is based on in vitro studies and a widely used “KIKO” mouse model containing mutations that prevent direct estrogen response element DNA- binding. KIKO mice are infertile, due in part to the inability of estradiol (E2) to induce uterine epithelial proliferation. To elucidate the molecular events that prevent KIKO uterine growth, regulation of the pro-proliferative E2 target gene Klf4 and of Klf15, a progesterone (P4) target gene that opposes the pro-proliferative activity of KLF4, was evaluated. Klf4 induction was impaired in KIKO uteri; however, Klf15 was induced by E2 rather than by P4. Whole uterine chromatin immunoprecipitation-sequencing revealed enrichment of KIKO ERα binding to hormone response elements (HREs) motifs. KIKO binding to HRE motifs was verified using reporter gene and DNA-binding assays. Because the KIKO ERα has HRE DNA-binding activity, we evaluated the “EAAE” ERα, which has more severe DNA-binding domain mutations, and demonstrated a lack of estrogen response element or HRE reporter gene induction or DNA-binding. The EAAE mouse has an ERα null–like phenotype, with impaired uterine growth and transcriptional activity. Our findings demonstrate that the KIKO mouse model, which has been used by numerous investigators, cannot be used to establish biological functions for ERα tethering, because KIKO ERα effectively stimulates transcription using HRE motifs. The EAAE-ERα DNA-binding domain mutant mouse demonstrates that ERα DNA-binding is crucial for biological and transcriptional processes in reproductive tissues and that ERα tethering may not contribute to estrogen responsiveness in vivo. PMID:24713037

  8. Unique structural modulation of a non-native substrate by cochaperone DnaJ.

    PubMed

    Tiwari, Satyam; Kumar, Vignesh; Jayaraj, Gopal Gunanathan; Maiti, Souvik; Mapa, Koyeli

    2013-02-12

    The role of bacterial DnaJ protein as a cochaperone of DnaK is strongly appreciated. Although DnaJ unaccompanied by DnaK can bind unfolded as well as native substrate proteins, its role as an individual chaperone remains elusive. In this study, we demonstrate that DnaJ binds a model non-native substrate with a low nanomolar dissociation constant and, more importantly, modulates the structure of its non-native state. The structural modulation achieved by DnaJ is different compared to that achieved by the DnaK-DnaJ complex. The nature of structural modulation exerted by DnaJ is suggestive of a unique unfolding activity on the non-native substrate by the chaperone. Furthermore, we demonstrate that the zinc binding motif along with the C-terminal substrate binding domain of DnaJ is necessary and sufficient for binding and the subsequent binding-induced structural alterations of the non-native substrate. We hypothesize that this hitherto unknown structural alteration of non-native states by DnaJ might be important for its chaperoning activity by removing kinetic traps of the folding intermediates.

  9. Hemi-methylated DNA regulates DNA methylation inheritance through allosteric activation of H3 ubiquitylation by UHRF1.

    PubMed

    Harrison, Joseph S; Cornett, Evan M; Goldfarb, Dennis; DaRosa, Paul A; Li, Zimeng M; Yan, Feng; Dickson, Bradley M; Guo, Angela H; Cantu, Daniel V; Kaustov, Lilia; Brown, Peter J; Arrowsmith, Cheryl H; Erie, Dorothy A; Major, Michael B; Klevit, Rachel E; Krajewski, Krzysztof; Kuhlman, Brian; Strahl, Brian D; Rothbart, Scott B

    2016-09-06

    The epigenetic inheritance of DNA methylation requires UHRF1, a histone- and DNA-binding RING E3 ubiquitin ligase that recruits DNMT1 to sites of newly replicated DNA through ubiquitylation of histone H3. UHRF1 binds DNA with selectivity towards hemi-methylated CpGs (HeDNA); however, the contribution of HeDNA sensing to UHRF1 function remains elusive. Here, we reveal that the interaction of UHRF1 with HeDNA is required for DNA methylation but is dispensable for chromatin interaction, which is governed by reciprocal positive cooperativity between the UHRF1 histone- and DNA-binding domains. HeDNA recognition activates UHRF1 ubiquitylation towards multiple lysines on the H3 tail adjacent to the UHRF1 histone-binding site. Collectively, our studies are the first demonstrations of a DNA-protein interaction and an epigenetic modification directly regulating E3 ubiquitin ligase activity. They also define an orchestrated epigenetic control mechanism involving modifications both to histones and DNA that facilitate UHRF1 chromatin targeting, H3 ubiquitylation, and DNA methylation inheritance.

  10. Titration of DnaA protein by oriC DnaA-boxes increases dnaA gene expression in Escherichia coli.

    PubMed Central

    Hansen, F G; Koefoed, S; Sørensen, L; Atlung, T

    1987-01-01

    Binding of the DnaA protein to its binding sites, the DnaA-boxes (TTATCCACA), was measured by a simple physiological approach. The presence of extra DnaA-boxes in growing cells leads to a derepression of dnaA gene expression, measured as beta-galactosidase activity of a dnaA-lacZ fusion polypeptide. Different DnaA-boxes caused different degrees of derepression indicating that the DnaA protein requires sequences in addition to the DnaA-box for efficient binding. The DnaA-boxes in oriC might act cooperatively in binding of the DnaA protein. The derepressed levels of DnaA protein obtained in a strain carrying an oriC+-pBR322 chimera were very high and sufficient to activate oriC on the chimeric plasmid, which was maintained at a copy number more than three times that of pBR322. PMID:3034578

  11. DNA mutagenic activity and capacity for HIV-1 restriction of the cytidine deaminase APOBEC3G depend on whether DNA or RNA binds to tyrosine 315

    PubMed Central

    Polevoda, Bogdan; Joseph, Rebecca; Friedman, Alan E.; Bennett, Ryan P.; Greiner, Rebecca; De Zoysa, Thareendra; Stewart, Ryan A.; Smith, Harold C.

    2017-01-01

    APOBEC3G (A3G) belongs to the AID/APOBEC protein family of cytidine deaminases (CDA) that bind to nucleic acids. A3G mutates the HIV genome by deamination of dC to dU, leading to accumulation of virus-inactivating mutations. Binding to cellular RNAs inhibits A3G binding to substrate single-stranded (ss) DNA and CDA activity. Bulk RNA and substrate ssDNA bind to the same three A3G tryptic peptides (amino acids 181–194, 314–320, and 345–374) that form parts of a continuously exposed protein surface extending from the catalytic domain in the C terminus of A3G to its N terminus. We show here that the A3G tyrosines 181 and 315 directly cross-linked ssDNA. Binding experiments showed that a Y315A mutation alone significantly reduced A3G binding to both ssDNA and RNA, whereas Y181A and Y182A mutations only moderately affected A3G nucleic acid binding. Consistent with these findings, the Y315A mutant exhibited little to no deaminase activity in an Escherichia coli DNA mutator reporter, whereas Y181A and Y182A mutants retained ∼50% of wild-type A3G activity. The Y315A mutant also showed a markedly reduced ability to assemble into viral particles and had reduced antiviral activity. In uninfected cells, the impaired RNA-binding capacity of Y315A was evident by a shift of A3G from high-molecular-mass ribonucleoprotein complexes to low-molecular-mass complexes. We conclude that Tyr-315 is essential for coordinating ssDNA interaction with or entry to the deaminase domain and hypothesize that RNA bound to Tyr-315 may be sufficient to competitively inhibit ssDNA deaminase-dependent antiviral activity. PMID:28381554

  12. Two phenylalanines in the C-terminus of Epstein-Barr virus Rta protein reciprocally modulate its DNA binding and transactivation function

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, L.-W.; Department of Molecular Biophysics and Biochemistry, Yale University School of Medicine, New Haven, CT 06520; Raghavan, Vineetha

    The Rta (R transactivator) protein plays an essential role in the Epstein-Barr viral (EBV) lytic cascade. Rta activates viral gene expression by several mechanisms including direct and indirect binding to target viral promoters, synergy with EBV ZEBRA protein, and stimulation of cellular signaling pathways. We previously found that Rta proteins with C-terminal truncations of 30 aa were markedly enhanced in their capacity to bind DNA (Chen, L.W., Chang, P.J., Delecluse, H.J., and Miller, G., (2005). Marked variation in response of consensus binding elements for the Rta protein of Epstein-Barr virus. J. Virol. 79(15), 9635-9650.). Here we show that two phenylalaninesmore » (F600 and F605) in the C-terminus of Rta play a crucial role in mediating this DNA binding inhibitory function. Amino acids 555 to 605 of Rta constitute a functional DNA binding inhibitory sequence (DBIS) that markedly decreased DNA binding when transferred to a minimal DNA binding domain of Rta (aa 1-350). Alanine substitution mutants, F600A/F605A, abolished activity of the DBIS. F600 and F605 are located in the transcriptional activation domain of Rta. Alanine substitutions, F600A/F605A, decreased transcriptional activation by Rta protein, whereas aromatic substitutions, such as F600Y/F605Y or F600W/F605W, partially restored transcriptional activation. Full-length Rta protein with F600A/F605A mutations were enhanced in DNA binding compared to wild-type, whereas Rta proteins with F600Y/F605Y or F600W/F605W substitutions were, like wild-type Rta, relatively poor DNA binders. GAL4 (1-147)/Rta (416-605) fusion proteins with F600A/F605A mutations were diminished in transcriptional activation, relative to GAL4/Rta chimeras without such mutations. The results suggest that, in the context of a larger DBIS, F600 and F605 play a role in the reciprocal regulation of DNA binding and transcriptional activation by Rta. Regulation of DNA binding by Rta is likely to be important in controlling its different modes of action.« less

  13. The key DNA-binding residues in the C-terminal domain of Mycobacterium tuberculosis DNA gyrase A subunit (GyrA)

    PubMed Central

    Huang, You-Yi; Deng, Jiao-Yu; Gu, Jing; Zhang, Zhi-Ping; Maxwell, Anthony; Bi, Li-Jun; Chen, Yuan-Yuan; Zhou, Ya-Feng; Yu, Zi-Niu; Zhang, Xian-En

    2006-01-01

    As only the type II topoisomerase is capable of introducing negative supercoiling, DNA gyrase is involved in crucial cellular processes. Although the other domains of DNA gyrase are better understood, the mechanism of DNA binding by the C-terminal domain of the DNA gyrase A subunit (GyrA-CTD) is less clear. Here, we investigated the DNA-binding sites in the GyrA-CTD of Mycobacterium tuberculosis gyrase through site-directed mutagenesis. The results show that Y577, R691 and R745 are among the key DNA-binding residues in M.tuberculosis GyrA-CTD, and that the third blade of the GyrA-CTD is the main DNA-binding region in M.tuberculosis DNA gyrase. The substitutions of Y577A, D669A, R691A, R745A and G729W led to the loss of supercoiling and relaxation activities, although they had a little effect on the drug-dependent DNA cleavage and decatenation activities, and had no effect on the ATPase activity. Taken together, these results showed that the GyrA-CTD is essential to DNA gyrase of M.tuberculosis, and promote the idea that the M.tuberculosis GyrA-CTD is a new potential target for drug design. It is the first time that the DNA-binding sites in GyrA-CTD have been identified. PMID:17038336

  14. Deep-sea vent phage DNA polymerase specifically initiates DNA synthesis in the absence of primers.

    PubMed

    Zhu, Bin; Wang, Longfei; Mitsunobu, Hitoshi; Lu, Xueling; Hernandez, Alfredo J; Yoshida-Takashima, Yukari; Nunoura, Takuro; Tabor, Stanley; Richardson, Charles C

    2017-03-21

    A DNA polymerase is encoded by the deep-sea vent phage NrS-1. NrS-1 has a unique genome organization containing genes that are predicted to encode a helicase and a single-stranded DNA (ssDNA)-binding protein. The gene for an unknown protein shares weak homology with the bifunctional primase-polymerases (prim-pols) from archaeal plasmids but is missing the zinc-binding domain typically found in primases. We show that this gene product has efficient DNA polymerase activity and is processive in DNA synthesis in the presence of the NrS-1 helicase and ssDNA-binding protein. Remarkably, this NrS-1 DNA polymerase initiates DNA synthesis from a specific template DNA sequence in the absence of any primer. The de novo DNA polymerase activity resides in the N-terminal domain of the protein, whereas the C-terminal domain enhances DNA binding.

  15. Actinomycin D binding mode reveals the basis for its potent HIV-1 and cancer activity

    NASA Astrophysics Data System (ADS)

    Paramanathan, Thayaparan; Vladescu, Ioana D.; McCauley, Micah J.; Rouzina, Ioulia; Williams, Mark C.

    2011-03-01

    Actinomycin D (ActD) is one of the most studied antibiotics, which has been used as an anti-cancer agent and also shown to inhibit HIV reverse transcription. Initial studies with ActD established that it intercalates double stranded DNA (dsDNA). However, recent studies have shown that ActD binds with even higher affinity to single stranded DNA (ssDNA). In our studies we use optical tweezers to stretch and hold single dsDNA molecule at constant force in the presence of varying ActD concentrations until the binding reaches equilibrium. The change in dsDNA length upon ActD binding measured as a function of time yields the rate of binding in addition to the equilibrium lengthening of DNA. The results suggest extremely slow kinetics, on the order of several minutes and 0.52 +/- 0.06 μ M binding affinity. Holding DNA at constant force while stretching and relaxing suggests that ActD binds to two single strands that are close to each other rather than to pure dsDNA or ssDNA. This suggests that biological activity of ActD that contributes towards the inhibition of cellular replication is due to its ability to bind at DNA bubbles during RNA transcription, thereby stalling the transcription process.

  16. Determination of DNA Binding Behavior of FoxA1 Constructs Using a Gold Nanoparticle-Based High Throughput Assay

    NASA Astrophysics Data System (ADS)

    Aung, Khin Moh Moh; Lim, Michelle Gek Liang; Hong, Shuzhen; Cheung, Edwin; Su, Xiaodi

    Forkhead box protein 1 (FoxA1) is a member of the forkhead family of winged-helix transcription factors. It plays crucial roles in the development and differentiation of multiple organs and in the regulation of estrogen-stimulated genes. In this study, in order to determine the regions of FoxA1 necessary for efficient Deoxyribonucleic Acid (DNA) binding, we cloned, expressed and purified a series of FoxA1 constructs that contain either the DNA Binding Domain (DBD), the Transcription Activation Domain (TAD), or both. We determined the DNA binding behavior of these constructs using traditional electrophoretic mobility shift assay (EMSA) and a recently developed gold nanoparticles (AuNPs)-based fast screening method. We conclude that just the DBD region alone is not sufficient for protein-DNA binding activity. Amino acids flanking the upstream of the DBD region are required for maximal DNA binding activity. Through this study, we have also further validated the AuNPs assay for its generality and expanded the existing protocol for comparing the DNA binding behavior of multiple proteins of different charge properties and molecular weights.

  17. Multiple conformational states of DnaA protein regulate its interaction with DnaA boxes in the initiation of DNA replication.

    PubMed

    Patel, Meera J; Bhatia, Lavesh; Yilmaz, Gulden; Biswas-Fiss, Esther E; Biswas, Subhasis B

    2017-09-01

    DnaA protein is the initiator of genomic DNA replication in prokaryotes. It binds to specific DNA sequences in the origin of DNA replication and unwinds small AT-rich sequences downstream for the assembly of the replisome. The mechanism of activation of DnaA that enables it to bind and organize the origin DNA and leads to replication initiation remains unclear. In this study, we have developed double-labeled fluorescent DnaA probes to analyze conformational states of DnaA protein upon binding DNA, nucleotide, and Soj sporulation protein using Fluorescence Resonance Energy Transfer (FRET). Our studies demonstrate that DnaA protein undergoes large conformational changes upon binding to substrates and there are multiple distinct conformational states that enable it to initiate DNA replication. DnaA protein adopted a relaxed conformation by expanding ~15Å upon binding ATP and DNA to form the ATP·DnaA·DNA complex. Hydrolysis of bound ATP to ADP led to a contraction of DnaA within the complex. The relaxed conformation of DnaA is likely required for the formation of the multi-protein ATP·DnaA·DNA complex. In the initiation of sporulation, Soj binding to DnaA prevented relaxation of its conformation. Soj·ADP appeared to block the activation of DnaA, suggesting a mechanism for Soj·ADP in switching initiation of DNA replication to sporulation. Our studies demonstrate that multiple conformational states of DnaA protein regulate its binding to DNA in the initiation of DNA replication. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Chiral halogenated Schiff base compounds: green synthesis, anticancer activity and DNA-binding study

    NASA Astrophysics Data System (ADS)

    Ariyaeifar, Mahnaz; Amiri Rudbari, Hadi; Sahihi, Mehdi; Kazemi, Zahra; Kajani, Abolghasem Abbasi; Zali-Boeini, Hassan; Kordestani, Nazanin; Bruno, Giuseppe; Gharaghani, Sajjad

    2018-06-01

    Eight enantiomerically pure halogenated Schiff base compounds were synthesized by reaction of halogenated salicylaldehydes with 3-Amino-1,2-propanediol (R or S) in water as green solvent at ambient temperature. All compounds were characterized by elemental analyses, NMR (1H and 13C), circular dichroism (CD) and FT-IR spectroscopy. FS-DNA binding studies of these compounds carried out by fluorescence quenching and UV-vis spectroscopy. The obtained results revealed that the ligands bind to DNA as: (Rsbnd ClBr) > (Rsbnd Cl2) > (Rsbnd Br2) > (Rsbnd I2) and (Ssbnd ClBr) > (Ssbnd Cl2) > (Ssbnd Br2) > (Ssbnd I2), indicating the effect of halogen on binding constant. In addition, DNA-binding constant of the Ssbnd and R-enantiomers are different from each other. The ligands can form halogen bonds with DNA that were confirmed by molecular docking. This method was also measured the bond distances and bond angles. The study of obtained data can have concluded that binding affinity of the ligands to DNA depends on strength of halogen bonds. The potential anticancer activity of ligands were also evaluated on MCF-7 and HeLa cancer cell lines by using MTT assay. The results showed that the anticancer activity and FS-DNA interaction is significantly dependent on the stereoisomers of Schiff base compounds as R-enantiomers displayed significantly higher activity than S-enantiomers. The molecular docking was also used to illustrate the specific DNA-binding of synthesized compounds and groove binding mode of DNA interaction was proposed for them. In addition, molecular docking results indicated that there are three types of bonds (Hsbnd and X-bond and hX-bond) between synthesized compounds and base pairs of DNA.

  19. Gly184 of the Escherichia coli cAMP receptor protein provides optimal context for both DNA binding and RNA polymerase interaction.

    PubMed

    Hicks, Matt N; Gunasekara, Sanjiva; Serate, Jose; Park, Jin; Mosharaf, Pegah; Zhou, Yue; Lee, Jin-Won; Youn, Hwan

    2017-10-01

    The Escherichia coli cAMP receptor protein (CRP) utilizes the helix-turn-helix motif for DNA binding. The CRP's recognition helix, termed F-helix, includes a stretch of six amino acids (Arg180, Glu181, Thr182, Val183, Gly184, and Arg185) for direct DNA contacts. Arg180, Glu181 and Arg185 are known as important residues for DNA binding and specificity, but little has been studied for the other residues. Here we show that Gly184 is another F-helix residue critical for the transcriptional activation function of CRP. First, glycine was repeatedly selected at CRP position 184 for its unique ability to provide wild type-level transcriptional activation activity. To dissect the glycine requirement, wild type CRP and mutants G184A, G184F, G184S, and G184Y were purified and their in vitro DNA-binding activity was measured. G184A and G184F displayed reduced DNA binding, which may explain their low transcriptional activation activity. However, G184S and G184Y displayed apparently normal DNA affinity. Therefore, an additional factor is needed to account for the diminished transcriptional activation function in G184S and G184Y, and the best explanation is perturbations in their interaction with RNA polymerase. The fact that glycine is the smallest amino acid could not fully warrant its suitability, as shown in this study. We hypothesize that Gly184 fulfills the dual functions of DNA binding and RNA polymerase interaction by conferring conformational flexibility to the F-helix.

  20. Modeling the Embrace of a Mutator: APOBEC Selection of Nucleic Acid Ligands.

    PubMed

    Salter, Jason D; Smith, Harold C

    2018-05-23

    The 11-member APOBEC (apolipoprotein B mRNA editing catalytic polypeptide-like) family of zinc-dependent cytidine deaminases bind to RNA and single-stranded DNA (ssDNA) and, in specific contexts, modify select (deoxy)cytidines to (deoxy)uridines. In this review, we describe advances made through high-resolution co-crystal structures of APOBECs bound to mono- or oligonucleotides that reveal potential substrate-specific binding sites at the active site and non-sequence-specific nucleic acid binding sites distal to the active site. We also discuss the effect of APOBEC oligomerization on functionality. Future structural studies will need to address how ssDNA binding away from the active site may enhance catalysis and the mechanism by which RNA binding may modulate catalytic activity on ssDNA. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  1. Crystal structure of the DNA-binding domain of the LysR-type transcriptional regulator CbnR in complex with a DNA fragment of the recognition-binding site in the promoter region.

    PubMed

    Koentjoro, Maharani Pertiwi; Adachi, Naruhiko; Senda, Miki; Ogawa, Naoto; Senda, Toshiya

    2018-03-01

    LysR-type transcriptional regulators (LTTRs) are among the most abundant transcriptional regulators in bacteria. CbnR is an LTTR derived from Cupriavidus necator (formerly Alcaligenes eutrophus or Ralstonia eutropha) NH9 and is involved in transcriptional activation of the cbnABCD genes encoding chlorocatechol degradative enzymes. CbnR interacts with a cbnA promoter region of approximately 60 bp in length that contains the recognition-binding site (RBS) and activation-binding site (ABS). Upon inducer binding, CbnR seems to undergo conformational changes, leading to the activation of the transcription. Since the interaction of an LTTR with RBS is considered to be the first step of the transcriptional activation, the CbnR-RBS interaction is responsible for the selectivity of the promoter to be activated. To understand the sequence selectivity of CbnR, we determined the crystal structure of the DNA-binding domain of CbnR in complex with RBS of the cbnA promoter at 2.55 Å resolution. The crystal structure revealed details of the interactions between the DNA-binding domain and the promoter DNA. A comparison with the previously reported crystal structure of the DNA-binding domain of BenM in complex with its cognate RBS showed several differences in the DNA interactions, despite the structural similarity between CbnR and BenM. These differences explain the observed promoter sequence selectivity between CbnR and BenM. Particularly, the difference between Thr33 in CbnR and Ser33 in BenM appears to affect the conformations of neighboring residues, leading to the selective interactions with DNA. Atomic coordinates and structure factors for the DNA-binding domain of Cupriavidus necatorNH9 CbnR in complex with RBS are available in the Protein Data Bank under the accession code 5XXP. © 2018 Federation of European Biochemical Societies.

  2. Phenazine virulence factor binding to extracellular DNA is important for Pseudomonas aeruginosa biofilm formation.

    PubMed

    Das, Theerthankar; Kutty, Samuel K; Tavallaie, Roya; Ibugo, Amaye I; Panchompoo, Janjira; Sehar, Shama; Aldous, Leigh; Yeung, Amanda W S; Thomas, Shane R; Kumar, Naresh; Gooding, J Justin; Manefield, Mike

    2015-02-11

    Bacterial resistance to conventional antibiotics necessitates the identification of novel leads for infection control. Interference with extracellular phenomena, such as quorum sensing, extracellular DNA integrity and redox active metabolite release, represents a new frontier to control human pathogens such as Pseudomonas aeruginosa and hence reduce mortality. Here we reveal that the extracellular redox active virulence factor pyocyanin produced by P. aeruginosa binds directly to the deoxyribose-phosphate backbone of DNA and intercalates with DNA nitrogenous base pair regions. Binding results in local perturbations of the DNA double helix structure and enhanced electron transfer along the nucleic acid polymer. Pyocyanin binding to DNA also increases DNA solution viscosity. In contrast, antioxidants interacting with DNA and pyocyanin decrease DNA solution viscosity. Biofilms deficient in pyocyanin production and biofilms lacking extracellular DNA show similar architecture indicating the interaction is important in P. aeruginosa biofilm formation.

  3. Phenazine virulence factor binding to extracellular DNA is important for Pseudomonas aeruginosa biofilm formation

    PubMed Central

    Das, Theerthankar; Kutty, Samuel K.; Tavallaie, Roya; Ibugo, Amaye I.; Panchompoo, Janjira; Sehar, Shama; Aldous, Leigh; Yeung, Amanda W. S.; Thomas, Shane R.; Kumar, Naresh; Gooding, J. Justin; Manefield, Mike

    2015-01-01

    Bacterial resistance to conventional antibiotics necessitates the identification of novel leads for infection control. Interference with extracellular phenomena, such as quorum sensing, extracellular DNA integrity and redox active metabolite release, represents a new frontier to control human pathogens such as Pseudomonas aeruginosa and hence reduce mortality. Here we reveal that the extracellular redox active virulence factor pyocyanin produced by P. aeruginosa binds directly to the deoxyribose-phosphate backbone of DNA and intercalates with DNA nitrogenous base pair regions. Binding results in local perturbations of the DNA double helix structure and enhanced electron transfer along the nucleic acid polymer. Pyocyanin binding to DNA also increases DNA solution viscosity. In contrast, antioxidants interacting with DNA and pyocyanin decrease DNA solution viscosity. Biofilms deficient in pyocyanin production and biofilms lacking extracellular DNA show similar architecture indicating the interaction is important in P. aeruginosa biofilm formation. PMID:25669133

  4. DNA binding and unwinding by Hel308 helicase requires dual functions of a winged helix domain.

    PubMed

    Northall, Sarah J; Buckley, Ryan; Jones, Nathan; Penedo, J Carlos; Soultanas, Panos; Bolt, Edward L

    2017-09-01

    Hel308 helicases promote genome stability linked to DNA replication in archaea, and have homologues in metazoans. In the crystal structure of archaeal Hel308 bound to a tailed DNA duplex, core helicase domains encircle single-stranded DNA (ssDNA) in a "ratchet" for directional translocation. A winged helix domain (WHD) is also present, but its function is mysterious. We investigated the WHD in full-length Hel308, identifying that mutations in a solvent exposed α-helix resulted in reduced DNA binding and unwinding activities. When isolated from the rest of Hel308, the WHD protein alone bound to duplex DNA but not ssDNA, and DNA binding by WHD protein was abolished by the same mutations as were analyzed in full-length Hel308. Isolated WHD from a human Hel308 homologue (HelQ) also bound to duplex DNA. By disrupting the interface between the Hel308 WHD and a RecA-like domain, a topology typical of Ski2 helicases, we show that this is crucial for ATPase and helicase activities. The data suggest a model in which the WHD promotes activity of Hel308 directly, through binding to duplex DNA that is distinct from ssDNA binding by core helicase, and indirectly through interaction with the RecA-like domain. We propose how the WHD may contribute to ssDNA translocation, resulting in DNA helicase activity or in removal of other DNA bound proteins by "reeling" ssDNA. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Spermine Attenuates the Action of the DNA Intercalator, Actinomycin D, on DNA Binding and the Inhibition of Transcription and DNA Replication

    PubMed Central

    Chen, Jeremy J. W.; Wu, Wen-Lin; Yuann, Jeu-Ming P.; Su, Wang-Lin; Chuang, Show-Mei; Hou, Ming-Hon

    2012-01-01

    The anticancer activity of DNA intercalators is related to their ability to intercalate into the DNA duplex with high affinity, thereby interfering with DNA replication and transcription. Polyamines (spermine in particular) are almost exclusively bound to nucleic acids and are involved in many cellular processes that require nucleic acids. Until now, the effects of polyamines on DNA intercalator activities have remained unclear because intercalation is the most important mechanism employed by DNA-binding drugs. Herein, using actinomycin D (ACTD) as a model, we have attempted to elucidate the effects of spermine on the action of ACTD, including its DNA-binding ability, RNA and DNA polymerase interference, and its role in the transcription and replication inhibition of ACTD within cells. We found that spermine interfered with the binding and stabilization of ACTD to DNA. The presence of increasing concentrations of spermine enhanced the transcriptional and replication activities of RNA and DNA polymerases, respectively, in vitro treated with ActD. Moreover, a decrease in intracellular polyamine concentrations stimulated by methylglyoxal-bis(guanylhydrazone) (MGBG) enhanced the ACTD-induced inhibition of c-myc transcription and DNA replication in several cancer cell lines. The results indicated that spermine attenuates ACTD binding to DNA and its inhibition of transcription and DNA replication both in vitro and within cells. Finally, a synergistic antiproliferative effect of MGBG and ACTD was observed in a cell viability assay. Our findings will be of significant relevance to future developments in combination with cancer therapy by enhancing the anticancer activity of DNA interactors through polyamine depletion. PMID:23144800

  6. Spermine attenuates the action of the DNA intercalator, actinomycin D, on DNA binding and the inhibition of transcription and DNA replication.

    PubMed

    Wang, Sheng-Yu; Lee, Alan Yueh-Luen; Lee, Yueh-Luen; Lai, Yi-Hua; Chen, Jeremy J W; Wu, Wen-Lin; Yuann, Jeu-Ming P; Su, Wang-Lin; Chuang, Show-Mei; Hou, Ming-Hon

    2012-01-01

    The anticancer activity of DNA intercalators is related to their ability to intercalate into the DNA duplex with high affinity, thereby interfering with DNA replication and transcription. Polyamines (spermine in particular) are almost exclusively bound to nucleic acids and are involved in many cellular processes that require nucleic acids. Until now, the effects of polyamines on DNA intercalator activities have remained unclear because intercalation is the most important mechanism employed by DNA-binding drugs. Herein, using actinomycin D (ACTD) as a model, we have attempted to elucidate the effects of spermine on the action of ACTD, including its DNA-binding ability, RNA and DNA polymerase interference, and its role in the transcription and replication inhibition of ACTD within cells. We found that spermine interfered with the binding and stabilization of ACTD to DNA. The presence of increasing concentrations of spermine enhanced the transcriptional and replication activities of RNA and DNA polymerases, respectively, in vitro treated with ActD. Moreover, a decrease in intracellular polyamine concentrations stimulated by methylglyoxal-bis(guanylhydrazone) (MGBG) enhanced the ACTD-induced inhibition of c-myc transcription and DNA replication in several cancer cell lines. The results indicated that spermine attenuates ACTD binding to DNA and its inhibition of transcription and DNA replication both in vitro and within cells. Finally, a synergistic antiproliferative effect of MGBG and ACTD was observed in a cell viability assay. Our findings will be of significant relevance to future developments in combination with cancer therapy by enhancing the anticancer activity of DNA interactors through polyamine depletion.

  7. DNA-binding mechanism of the Escherichia coli Ada O6-alkylguanine–DNA alkyltransferase

    PubMed Central

    Verdemato, Philip E.; Brannigan, James A.; Damblon, Christian; Zuccotto, Fabio; Moody, Peter C. E.; Lian, Lu-Yun

    2000-01-01

    The C-terminal domain of the Escherichia coli Ada protein (Ada-C) aids in the maintenance of genomic integrity by efficiently repairing pre-mutagenic O6-alkylguanine lesions in DNA. Structural and thermodynamic studies were carried out to obtain a model of the DNA-binding process. Nuclear magnetic resonance (NMR) studies map the DNA-binding site to helix 5, and a loop region (residues 151–160) which form the recognition helix and the ‘wing’ of a helix–turn–wing motif, respectively. The NMR data also suggest the absence of a large conformational change in the protein upon binding to DNA. Hence, an O6-methylguanine (O6meG) lesion would be inaccessible to active site nucleophile Cys146 if the modified base remained stacked within the DNA duplex. The experimentally determined DNA-binding face of Ada-C was used in combination with homology modelling, based on the catabolite activator protein, and the accepted base-flipping mechanism, to construct a model of how Ada-C binds to DNA in a productive manner. To complement the structural studies, thermodynamic data were obtained which demonstrate that binding to unmethylated DNA was entropically driven, whilst the demethylation reaction provoked an exothermic heat change. Methylation of Cys146 leads to a loss of structural integrity of the DNA-binding subdomain. PMID:11000262

  8. Biochemical investigation of yttrium(III) complex containing 1,10-phenanthroline: DNA binding and antibacterial activity.

    PubMed

    Khorasani-Motlagh, Mozhgan; Noroozifar, Meissam; Moodi, Asieh; Niroomand, Sona

    2013-03-05

    Characterization of the interaction between yttrium(III) complex containing 1,10-phenanthroline as ligand, [Y(phen)2Cl(OH2)3]Cl2⋅H2O, and DNA has been carried out by UV absorption, fluorescence spectra and viscosity measurements in order to investigate binding mode. The experimental results indicate that the yttrium(III) complex binds to DNA and absorption is decreasing in charge transfer band with the increase in amount of DNA. The binding constant (Kb) at different temperatures as well as thermodynamic parameters, enthalpy change (ΔH°) and entropy change (ΔS°), were calculated according to relevant fluorescent data and Vant' Hoff equation. The results of interaction mechanism studies, suggested that groove binding plays a major role in the binding of the complex and DNA. The activity of yttrium(III) complex against some bacteria was tested and antimicrobial screening tests shown growth inhibitory activity in the presence of yttrium(III) complex. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Small terminase couples viral DNA-binding to genome-packaging ATPase activity

    PubMed Central

    Roy, Ankoor; Bhardwaj, Anshul; Datta, Pinaki; Lander, Gabriel C.; Cingolani, Gino

    2012-01-01

    SUMMARY Packaging of viral genomes into empty procapsids is powered by a large DNA-packaging motor. In most viruses, this machine is composed of a large (L) and a small (S) terminase subunit complexed with a dodecamer of portal protein. Here, we describe the 1.75 Å crystal structure of the bacteriophage P22 S-terminase in a nonameric conformation. The structure presents a central channel ~23 Å in diameter, sufficiently large to accommodate hydrated B-DNA. The last 23 residues of S-terminase are essential for binding to DNA and assembly to L-terminase. Upon binding to its own DNA, S-terminase functions as a specific activator of L-terminase ATPase activity. The DNA-dependent stimulation of ATPase activity thus rationalizes the exclusive specificity of genome-packaging motors for viral DNA in the crowd of host DNA, ensuring fidelity of packaging and avoiding wasteful ATP hydrolysis. This posits a model for DNA-dependent activation of genome-packaging motors of general interest in virology. PMID:22771211

  10. Extended HSR/CARD domain mediates AIRE binding to DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maslovskaja, Julia, E-mail: julia.maslovskaja@ut.ee; Saare, Mario; Liiv, Ingrid

    Autoimmune regulator (AIRE) activates the transcription of many genes in an unusual promiscuous and stochastic manner. The mechanism by which AIRE binds to the chromatin and DNA is not fully understood, and the regulatory elements that AIRE target genes possess are not delineated. In the current study, we demonstrate that AIRE activates the expression of transiently transfected luciferase reporters that lack defined promoter regions, as well as intron and poly(A) signal sequences. Our protein-DNA interaction experiments with mutated AIRE reveal that the intact homogeneously staining region/caspase recruitment domain (HSR/CARD) and amino acids R113 and K114 are key elements involved inmore » AIRE binding to DNA. - Highlights: • Promoter and mRNA processing elements are not important for AIRE to activate gene expression from reporter plasmids. • AIRE protein fragment aa 1–138 mediates direct binding to DNA. • Integrity of the HSR/CARD domain is needed for AIRE binding to DNA.« less

  11. Isolation and characterization of the DNA-binding protein (DBP) of the Autographa californica multiple nucleopolyhedrovirus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mikhailov, Victor S.; N. K. Koltzov Institute of Developmental Biology, Russian Academy of Sciences, Moscow 117808; Vanarsdall, Adam L.

    2008-01-20

    DNA-binding protein (DBP) of Autographa californica multiple nucleopolyhedrovirus (AcMNPV) was expressed as an N-terminal His{sub 6}-tag fusion using a recombinant baculovirus and purified to near homogeneity. Purified DBP formed oligomers that were crosslinked by redox reagents resulting in predominantly protein dimers and tetramers. In gel retardation assays, DBP showed a high affinity for single-stranded oligonucleotides and was able to compete with another baculovirus SSB protein, LEF-3, for binding sites. DBP binding protected ssDNA against hydrolysis by a baculovirus alkaline nuclease AN/LEF-3 complex. Partial proteolysis by trypsin revealed a domain structure of DBP that is required for interaction with DNA andmore » that can be disrupted by thermal treatment. Binding to ssDNA, but not to dsDNA, changed the pattern of proteolytic fragments of DBP indicating adjustments in protein structure upon interaction with ssDNA. DBP was capable of unwinding short DNA duplexes and also promoted the renaturation of long complementary strands of ssDNA into duplexes. The unwinding and renaturation activities of DBP, as well as the DNA binding activity, were sensitive to sulfhydryl reagents and were inhibited by oxidation of thiol groups with diamide or by alkylation with N-ethylmaleimide. A high affinity of DBP for ssDNA and its unwinding and renaturation activities confirmed identification of DBP as a member of the SSB/recombinase family. These activities and a tight association with subnuclear structures suggests that DBP is a component of the virogenic stroma that is involved in the processing of replicative intermediates.« less

  12. Recognition of Local DNA Structures by p53 Protein

    PubMed Central

    Brázda, Václav; Coufal, Jan

    2017-01-01

    p53 plays critical roles in regulating cell cycle, apoptosis, senescence and metabolism and is commonly mutated in human cancer. These roles are achieved by interaction with other proteins, but particularly by interaction with DNA. As a transcription factor, p53 is well known to bind consensus target sequences in linear B-DNA. Recent findings indicate that p53 binds with higher affinity to target sequences that form cruciform DNA structure. Moreover, p53 binds very tightly to non-B DNA structures and local DNA structures are increasingly recognized to influence the activity of wild-type and mutant p53. Apart from cruciform structures, p53 binds to quadruplex DNA, triplex DNA, DNA loops, bulged DNA and hemicatenane DNA. In this review, we describe local DNA structures and summarize information about interactions of p53 with these structural DNA motifs. These recent data provide important insights into the complexity of the p53 pathway and the functional consequences of wild-type and mutant p53 activation in normal and tumor cells. PMID:28208646

  13. Identification of functional domains of the IR2 protein of equine herpesvirus 1 required for inhibition of viral gene expression and replication

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Seong K., E-mail: skim1@lsuhsc.edu; Kim, Seongman; Dai Gan

    2011-09-01

    The equine herpesvirus 1 (EHV-1) negative regulatory IR2 protein (IR2P), an early 1,165-amino acid (aa) truncated form of the 1487-aa immediate-early protein (IEP), lacks the trans-activation domain essential for IEP activation functions but retains domains for binding DNA, TFIIB, and TBP and the nuclear localization signal. IR2P mutants of the N-terminal region which lack either DNA-binding activity or TFIIB-binding activity were unable to down-regulate EHV-1 promoters. In EHV-1-infected cells expressing full-length IR2P, transcription and protein expression of viral regulatory IE, early EICP0, IR4, and UL5, and late ETIF genes were dramatically inhibited. Viral DNA levels were reduced to 2.1% ofmore » control infected cells, but were vey weakly affected in cells that express the N-terminal 706 residues of IR2P. These results suggest that IR2P function requires the two N-terminal domains for binding DNA and TFIIB as well as the C-terminal residues 707 to 1116 containing the TBP-binding domain. - Highlights: > We examine the functional domains of IR2P that mediates negative regulation. > IR2P inhibits at the transcriptional level. > DNA-binding mutant or TFIIB-binding mutant fails to inhibit. > C-terminal aa 707 to 1116 are required for full inhibition. > Inhibition requires the DNA-binding domain, TFIIB-binding domain, and C-terminus.« less

  14. APOBEC3G Interacts with ssDNA by Two Modes: AFM Studies

    NASA Astrophysics Data System (ADS)

    Shlyakhtenko, Luda S.; Dutta, Samrat; Banga, Jaspreet; Li, Ming; Harris, Reuben S.; Lyubchenko, Yuri L.

    2015-10-01

    APOBEC3G (A3G) protein has antiviral activity against HIV and other pathogenic retroviruses. A3G has two domains: a catalytic C-terminal domain (CTD) that deaminates cytidine, and a N-terminal domain (NTD) that binds to ssDNA. Although abundant information exists about the biological activities of A3G protein, the interplay between sequence specific deaminase activity and A3G binding to ssDNA remains controversial. We used the topographic imaging and force spectroscopy modalities of Atomic Force Spectroscopy (AFM) to characterize the interaction of A3G protein with deaminase specific and nonspecific ssDNA substrates. AFM imaging demonstrated that A3G has elevated affinity for deaminase specific ssDNA than for nonspecific ssDNA. AFM force spectroscopy revealed two distinct binding modes by which A3G interacts with ssDNA. One mode requires sequence specificity, as demonstrated by stronger and more stable complexes with deaminase specific ssDNA than with nonspecific ssDNA. Overall these observations enforce prior studies suggesting that both domains of A3G contribute to the sequence specific binding of ssDNA.

  15. APOBEC3G Interacts with ssDNA by Two Modes: AFM Studies.

    PubMed

    Shlyakhtenko, Luda S; Dutta, Samrat; Banga, Jaspreet; Li, Ming; Harris, Reuben S; Lyubchenko, Yuri L

    2015-10-27

    APOBEC3G (A3G) protein has antiviral activity against HIV and other pathogenic retroviruses. A3G has two domains: a catalytic C-terminal domain (CTD) that deaminates cytidine, and a N-terminal domain (NTD) that binds to ssDNA. Although abundant information exists about the biological activities of A3G protein, the interplay between sequence specific deaminase activity and A3G binding to ssDNA remains controversial. We used the topographic imaging and force spectroscopy modalities of Atomic Force Spectroscopy (AFM) to characterize the interaction of A3G protein with deaminase specific and nonspecific ssDNA substrates. AFM imaging demonstrated that A3G has elevated affinity for deaminase specific ssDNA than for nonspecific ssDNA. AFM force spectroscopy revealed two distinct binding modes by which A3G interacts with ssDNA. One mode requires sequence specificity, as demonstrated by stronger and more stable complexes with deaminase specific ssDNA than with nonspecific ssDNA. Overall these observations enforce prior studies suggesting that both domains of A3G contribute to the sequence specific binding of ssDNA.

  16. Locked and proteolysis-based transcription activator-like effector (TALE) regulation.

    PubMed

    Lonzarić, Jan; Lebar, Tina; Majerle, Andreja; Manček-Keber, Mateja; Jerala, Roman

    2016-02-18

    Development of orthogonal, designable and adjustable transcriptional regulators is an important goal of synthetic biology. Their activity has been typically modulated through stimulus-induced oligomerization or interaction between the DNA-binding and activation/repression domain. We exploited a feature of the designable Transcription activator-like effector (TALE) DNA-binding domain that it winds around the DNA which allows to topologically prevent it from binding by intramolecular cyclization. This new approach was investigated through noncovalent ligand-induced cyclization or through a covalent split intein cyclization strategy, where the topological inhibition of DNA binding by cyclization and its restoration by a proteolytic release of the topologic constraint was expected. We show that locked TALEs indeed have diminished DNA binding and regain full transcriptional activity by stimulation with the rapamycin ligand or site-specific proteolysis of the peptide linker, with much higher level of activation than rapamycin-induced heterodimerization. Additionally, we demonstrated reversibility, activation of genomic targets and implemented logic gates based on combinations of protein cyclization, proteolytic cleavage and ligand-induced dimerization, where the strongest fold induction was achieved by the proteolytic cleavage of a repression domain from a linear TALE. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Aminoglycosylation Can Enhance the G-Quadruplex Binding Activity of Epigallocatechin

    PubMed Central

    Bai, Li-Ping; Ho, Hing-Man; Ma, Dik-Lung; Yang, Hui; Fu, Wai-Chung; Jiang, Zhi-Hong

    2013-01-01

    With the aim of enhancing G-quadruplex binding activity, two new glucosaminosides (16, 18) of penta-methylated epigallocatechin were synthesized by chemical glycosylation. Subsequent ESI-TOF-MS analysis demonstrated that these two glucosaminoside derivatives exhibit much stronger binding activity to human telomeric DNA and RNA G-quadruplexes than their parent structure (i.e., methylated EGC) (14) as well as natural epigallocatechin (EGC, 6). The DNA G-quadruplex binding activity of 16 and 18 is even more potent than strong G-quadruplex binder quercetin, which has a more planar structure. These two synthetic compounds also showed a higher binding strength to human telomeric RNA G-quadruplex than its DNA counterpart. Analysis of the structure-activity relationship revealed that the more basic compound, 16, has a higher binding capacity with DNA and RNA G-quadruplexes than its N-acetyl derivative, 18, suggesting the importance of the basicity of the aminoglycoside for G-quadruplex binding activity. Molecular docking simulation predicted that the aromatic ring of 16 π-stacks with the aromatic ring of guanine nucleotides, with the glucosamine moiety residing in the groove of G-quadruplex. This research indicates that glycosylation of natural products with aminosugar can significantly enhance their G-quadruplex binding activities, thus is an effective way to generate small molecules targeting G-quadruplexes in nucleic acids. In addition, this is the first report that green tea catechin can bind to nucleic acid G-quadruplex structures. PMID:23335983

  18. p48 Activates a UV-Damaged-DNA Binding Factor and Is Defective in Xeroderma Pigmentosum Group E Cells That Lack Binding Activity

    PubMed Central

    Hwang, Byung Joon; Toering, Stephanie; Francke, Uta; Chu, Gilbert

    1998-01-01

    A subset of xeroderma pigmentosum (XP) group E cells lack a factor that binds to DNA damaged by UV radiation. This factor can be purified to homogeneity as p125, a 125-kDa polypeptide. However, when cDNA encoding p125 is translated in vitro, only a small fraction binds to UV-damaged DNA, suggesting that a second factor is required for the activation of p125. We discovered that most hamster cell lines expressed inactive p125, which was activated in somatic cell hybrids containing human chromosome region 11p11.2-11cen. This region excluded p125 but included p48, which encodes a 48-kDa polypeptide known to copurify with p125 under some conditions. Expression of human p48 activated p125 binding in hamster cells and increased p125 binding in human cells. No such effects were observed from expression of p48 containing single amino acid substitutions from XP group E cells that lacked binding activity, demonstrating that the p48 gene is defective in those cells. Activation of p125 occurred by a “hit-and-run” mechanism, since the presence of p48 was not required for subsequent binding. Nevertheless, p48 was capable of forming a complex with p125 either bound to UV-damaged DNA or in free solution. It is notable that hamster cells fail to efficiently repair cyclobutane pyrimidine dimers in nontranscribed DNA and fail to express p48, which contains a WD motif with homology to proteins that reorganize chromatin. We propose that p48 plays a role in repairing lesions that would otherwise remain inaccessible in nontranscribed chromatin. PMID:9632823

  19. DNA residence time is a regulatory factor of transcription repression

    PubMed Central

    Clauß, Karen; Popp, Achim P.; Schulze, Lena; Hettich, Johannes; Reisser, Matthias; Escoter Torres, Laura; Uhlenhaut, N. Henriette

    2017-01-01

    Abstract Transcription comprises a highly regulated sequence of intrinsically stochastic processes, resulting in bursts of transcription intermitted by quiescence. In transcription activation or repression, a transcription factor binds dynamically to DNA, with a residence time unique to each factor. Whether the DNA residence time is important in the transcription process is unclear. Here, we designed a series of transcription repressors differing in their DNA residence time by utilizing the modular DNA binding domain of transcription activator-like effectors (TALEs) and varying the number of nucleotide-recognizing repeat domains. We characterized the DNA residence times of our repressors in living cells using single molecule tracking. The residence times depended non-linearly on the number of repeat domains and differed by more than a factor of six. The factors provoked a residence time-dependent decrease in transcript level of the glucocorticoid receptor-activated gene SGK1. Down regulation of transcription was due to a lower burst frequency in the presence of long binding repressors and is in accordance with a model of competitive inhibition of endogenous activator binding. Our single molecule experiments reveal transcription factor DNA residence time as a regulatory factor controlling transcription repression and establish TALE-DNA binding domains as tools for the temporal dissection of transcription regulation. PMID:28977492

  20. New phthalimide-appended Schiff bases: Studies of DNA binding, molecular docking and antioxidant activities.

    PubMed

    Nayab, Pattan Sirajuddin; Akrema; Ansari, Istikhar A; Shahid, Mohammad; Rahisuddin

    2017-08-01

    Herein, we investigated new phthalimide-based Schiff base molecules as promising DNA-binding and free radical scavenging agents. Physicochemical properties of these molecules were demonstrated on the basis of elemental analysis, ultraviolet-visible (UV-Vis), infra-red (IR), 1 H and 13 C nuclear magnetic resonance (NMR) spectroscopy. All spectral data are agreed well with the proposed Schiff base framework. The DNA-binding potential of synthesized compounds were investigated by means of UV-visible, fluorescence, iodide quenching, circular dichroism, viscosity and thermal denaturation studies. The intrinsic binding constants (K b ) were calculated from absorption studies were found to be 1.1 × 10 4 and 1.0 × 10 4  M -1 for compounds 2a and 2b suggesting that compound 2a binding abilities with DNA were stronger than the compound 2b. Our studies showed that the presented compounds interact with DNA through groove binding. Molecular docking studies were carried out to predict the binding between Ct-DNA and test compounds. Interestingly, in silico predictions were corroborated with in vitro DNA-binding conclusions. Furthermore, the title compounds displayed remarkable antioxidant activity compared with reference standard. Copyright © 2016 John Wiley & Sons, Ltd.

  1. Selective affinity chromatography of DNA polymerases with associated 3' to 5' exonuclease activities.

    PubMed

    Lee, M Y; Whyte, W A

    1984-05-01

    The use of 5'-AMP as a ligand for the affinity chromatography of DNA polymerases with intrinsic 3' to 5' exonuclease activities was investigated. The basis for this is that 5'-AMP would be expected to act as a ligand for the associated 3' to 5' exonuclease. The requirements for binding of Escherichia coli DNA polymerase I, T4 DNA polymerase, and calf thymus DNA polymerase delta, all of which have associated 3' to 5' exonuclease activities, to several commercially available 5'-AMP supports with different linkages of 5'-AMP to either agarose or cellulose were examined. The DNA polymerases which possessed 3' to 5' exonuclease activities were bound to agarose types in which the 5'-phosphoryl group and the 3'-hydroxyl group of the AMP were unsubstituted. Bound enzyme could be eluted by either an increase in ionic strength or competitive binding of nucleoside 5'-monophosphates. Magnesium was found to reinforce the binding of the enzyme to these affinity supports. DNA polymerase alpha, which does not have an associated 3' to 5' exonuclease activity, did not bind to any of these columns. These differences can be used to advantage for the purification of DNA polymerases that have associated 3' to 5' exonuclease activities, as well as a means for establishing the association of 3' to 5' exonuclease activities with DNA polymerases.

  2. Synthesis and crystal structure elucidation of new copper(II)-based chemotherapeutic agent coupled with 1,2-DACH and orthovanillin: Validated by in vitro DNA/HSA binding profile and pBR322 cleavage pathway.

    PubMed

    Zaki, Mehvash; Afzal, Mohd; Ahmad, Musheer; Tabassum, Sartaj

    2016-08-01

    New copper(II)-based complex (1) was synthesized and characterized by analytical, spectroscopic and single crystal X-ray diffraction. The in vitro binding studies of complex 1 with CT DNA and HSA have been investigated by employing biophysical techniques to examine the binding propensity of 1 towards DNA and HSA. The results showed that 1 avidly binds to CT DNA via electrostatic mode along with the hydrogen bonding interaction of NH2 and CN groups of Schiff base ligand with the base pairs of DNA helix, leads to partial unwinding and destabilization of the DNA double helix. Moreover, the CD spectral studies revealed that complex 1 binds through groove binding interaction that stabilizes the right-handed B-form of DNA. Complex 1 showed an impressive photoinduced nuclease activity generating single-strand breaks in comparison with the DNA cleavage activity in presence of visible light. The mechanistic investigation revealed the efficiency of 1 to cleave DNA strands by involving the generation of reactive oxygen species. Furthermore, the time dependent DNA cleavage activity showed that there was gradual increase in the amount of NC DNA on increasing the photoexposure time. However, the interaction of 1 and HSA showed that the change of intrinsic fluorescence intensity of HSA was induced by the microenvironment of Trp residue. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Isolation and characterization of target sequences of the chicken CdxA homeobox gene.

    PubMed Central

    Margalit, Y; Yarus, S; Shapira, E; Gruenbaum, Y; Fainsod, A

    1993-01-01

    The DNA binding specificity of the chicken homeodomain protein CDXA was studied. Using a CDXA-glutathione-S-transferase fusion protein, DNA fragments containing the binding site for this protein were isolated. The sources of DNA were oligonucleotides with random sequence and chicken genomic DNA. The DNA fragments isolated were sequenced and tested in DNA binding assays. Sequencing revealed that most DNA fragments are AT rich which is a common feature of homeodomain binding sites. By electrophoretic mobility shift assays it was shown that the different target sequences isolated bind to the CDXA protein with different affinities. The specific sequences bound by the CDXA protein in the genomic fragments isolated, were determined by DNase I footprinting. From the footprinted sequences, the CDXA consensus binding site was determined. The CDXA protein binds the consensus sequence A, A/T, T, A/T, A, T, A/G. The CAUDAL binding site in the ftz promoter is also included in this consensus sequence. When tested, some of the genomic target sequences were capable of enhancing the transcriptional activity of reporter plasmids when introduced into CDXA expressing cells. This study determined the DNA sequence specificity of the CDXA protein and it also shows that this protein can further activate transcription in cells in culture. Images PMID:7909943

  4. DNA-binding by Haemophilus influenzae and Escherichia coli YbaB, members of a widely-distributed bacterial protein family.

    PubMed

    Cooley, Anne E; Riley, Sean P; Kral, Keith; Miller, M Clarke; DeMoll, Edward; Fried, Michael G; Stevenson, Brian

    2009-07-13

    Genes orthologous to the ybaB loci of Escherichia coli and Haemophilus influenzae are widely distributed among eubacteria. Several years ago, the three-dimensional structures of the YbaB orthologs of both E. coli and H. influenzae were determined, revealing a novel "tweezer"-like structure. However, a function for YbaB had remained elusive, with an early study of the H. influenzae ortholog failing to detect DNA-binding activity. Our group recently determined that the Borrelia burgdorferi YbaB ortholog, EbfC, is a DNA-binding protein. To reconcile those results, we assessed the abilities of both the H. influenzae and E. coli YbaB proteins to bind DNA to which B. burgdorferi EbfC can bind. Both the H. influenzae and the E. coli YbaB proteins bound to tested DNAs. DNA-binding was not well competed with poly-dI-dC, indicating some sequence preferences for those two proteins. Analyses of binding characteristics determined that both YbaB orthologs bind as homodimers. Different DNA sequence preferences were observed between H. influenzae YbaB, E. coli YbaB and B. burgdorferi EbfC, consistent with amino acid differences in the putative DNA-binding domains of these proteins. Three distinct members of the YbaB/EbfC bacterial protein family have now been demonstrated to bind DNA. Members of this protein family are encoded by a broad range of bacteria, including many pathogenic species, and results of our studies suggest that all such proteins have DNA-binding activities. The functions of YbaB/EbfC family members in each bacterial species are as-yet unknown, but given the ubiquity of these DNA-binding proteins among Eubacteria, further investigations are warranted.

  5. Interaction of DNA with Simple and Mixed Ligand Copper(II) Complexes of 1,10-Phenanthrolines as Studied by DNA-Fiber EPR Spectroscopy

    PubMed Central

    Chikira, Makoto; Ng, Chew Hee; Palaniandavar, Mallayan

    2015-01-01

    The interaction of simple and ternary Cu(II) complexes of 1,10-phenanthrolines with DNA has been studied extensively because of their various interesting and important functions such as DNA cleavage activity, cytotoxicity towards cancer cells, and DNA based asymmetric catalysis. Such functions are closely related to the DNA binding modes of the complexes such as intercalation, groove binding, and electrostatic surface binding. A variety of spectroscopic methods have been used to study the DNA binding mode of the Cu(II) complexes. Of all these methods, DNA-fiber electron paramagnetic resonance (EPR) spectroscopy affords unique information on the DNA binding structures of the complexes. In this review we summarize the results of our DNA-fiber EPR studies on the DNA binding structure of the complexes and discuss them together with the data accumulated by using other measurements. PMID:26402668

  6. The Activation Domain of the Bovine Papillomavirus E2 Protein Mediates Association of DNA-Bound Dimers to form DNA Loops

    NASA Astrophysics Data System (ADS)

    Knight, Jonathan D.; Li, Rong; Botchan, Michael

    1991-04-01

    The E2 transactivator protein of bovine papillomavirus binds its specific DNA target sequence as a dimer. We have found that E2 dimers, performed in solution independent of DNA, exhibit substantial cooperativity of DNA binding as detected by both nitrocellulose filter retention and footprint analysis techniques. If the binding sites are widely spaced, E2 forms stable DNA loops visible by electron microscopy. When three widely separated binding sites reside on te DNA, E2 condenses the molecule into a bow-tie structure. This implies that each E2 dimer has at least two independent surfaces for multimerization. Two naturally occurring shorter forms of the protein, E2C and D8/E2, which function in vivo as repressors of transcription, do not form such loops. Thus, the looping function of E2 maps to the 161-amino acid activation domain. These results support the looping model of transcription activation by enhancers.

  7. Combining H/D exchange mass spectroscopy and computational docking reveals extended DNA-binding surface on uracil-DNA glycosylase

    PubMed Central

    Roberts, Victoria A.; Pique, Michael E.; Hsu, Simon; Li, Sheng; Slupphaug, Geir; Rambo, Robert P.; Jamison, Jonathan W.; Liu, Tong; Lee, Jun H.; Tainer, John A.; Ten Eyck, Lynn F.; Woods, Virgil L.

    2012-01-01

    X-ray crystallography provides excellent structural data on protein–DNA interfaces, but crystallographic complexes typically contain only small fragments of large DNA molecules. We present a new approach that can use longer DNA substrates and reveal new protein–DNA interactions even in extensively studied systems. Our approach combines rigid-body computational docking with hydrogen/deuterium exchange mass spectrometry (DXMS). DXMS identifies solvent-exposed protein surfaces; docking is used to create a 3-dimensional model of the protein–DNA interaction. We investigated the enzyme uracil-DNA glycosylase (UNG), which detects and cleaves uracil from DNA. UNG was incubated with a 30 bp DNA fragment containing a single uracil, giving the complex with the abasic DNA product. Compared with free UNG, the UNG–DNA complex showed increased solvent protection at the UNG active site and at two regions outside the active site: residues 210–220 and 251–264. Computational docking also identified these two DNA-binding surfaces, but neither shows DNA contact in UNG–DNA crystallographic structures. Our results can be explained by separation of the two DNA strands on one side of the active site. These non-sequence-specific DNA-binding surfaces may aid local uracil search, contribute to binding the abasic DNA product and help present the DNA product to APE-1, the next enzyme on the DNA-repair pathway. PMID:22492624

  8. Origin recognition is the predominant role for DnaA-ATP in initiation of chromosome replication.

    PubMed

    Grimwade, Julia E; Rozgaja, Tania A; Gupta, Rajat; Dyson, Kyle; Rao, Prassanna; Leonard, Alan C

    2018-05-25

    In all cells, initiation of chromosome replication depends on the activity of AAA+ initiator proteins that form complexes with replication origin DNA. In bacteria, the conserved, adenosine triphosphate (ATP)-regulated initiator protein, DnaA, forms a complex with the origin, oriC, that mediates DNA strand separation and recruitment of replication machinery. Complex assembly and origin activation requires DnaA-ATP, which differs from DnaA-ADP in its ability to cooperatively bind specific low affinity sites and also to oligomerize into helical filaments. The degree to which each of these activities contributes to the DnaA-ATP requirement for initiation is not known. In this study, we compared the DnaA-ATP dependence of initiation from wild-type Escherichia coli oriC and a synthetic origin (oriCallADP), whose multiple low affinity DnaA sites bind DnaA-ATP and DnaA-ADP similarly. OriCallADP was fully occupied and unwound by DnaA-ADP in vitro, and, in vivo, oriCallADP suppressed lethality of DnaA mutants defective in ATP binding and ATP-specific oligomerization. However, loss of preferential DnaA-ATP binding caused over-initiation and increased sensitivity to replicative stress. The findings indicate both DnaA-ATP and DnaA-ADP can perform most of the mechanical functions needed for origin activation, and suggest that a key reason for ATP-regulation of DnaA is to control replication initiation frequency.

  9. The Agrobacterium tumefaciens Transcription Factor BlcR Is Regulated via Oligomerization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pan, Yi; Fiscus, Valena; Meng, Wuyi

    2012-02-08

    The Agrobacterium tumefaciens BlcR is a member of the emerging isocitrate lyase transcription regulators that negatively regulates metabolism of {gamma}-butyrolactone, and its repressing function is relieved by succinate semialdehyde (SSA). Our crystal structure showed that BlcR folded into the DNA- and SSA-binding domains and dimerized via the DNA-binding domains. Mutational analysis identified residues, including Phe{sup 147}, that are important for SSA association; BlcR{sup F147A} existed as tetramer. Two BlcR dimers bound to target DNA and in a cooperative manner, and the distance between the two BlcR-binding sequences in DNA was critical for BlcR-DNA association. Tetrameric BlcR{sup F147A} retained DNA bindingmore » activity, and importantly, this activity was not affected by the distance separating the BlcR-binding sequences in DNA. SSA did not dissociate tetrameric BlcR{sup F147A} or BlcR{sup F147A}-DNA. As well as in the SSA-binding site, Phe{sup 147} is located in a structurally flexible loop that may be involved in BlcR oligomerization. We propose that SSA regulates BlcR DNA-binding function via oligomerization.« less

  10. Synthesis of trimethoprim metal complexes: Spectral, electrochemical, thermal, DNA-binding and surface morphology studies.

    PubMed

    Demirezen, Nihat; Tarınç, Derya; Polat, Duygu; Ceşme, Mustafa; Gölcü, Ayşegül; Tümer, Mehmet

    2012-08-01

    Complexes of trimethoprim (TMP), with Cu(II), Zn(II), Pt(II), Ru(III) and Fe(III) have been synthesized. Then, these complexes have been characterized by spectroscopic techniques involving UV-vis, IR, mass and (1)H NMR. CHN elemental analysis, electrochemical and thermal behavior of complexes have also been investigated. The electrochemical properties of all complexes have been investigated by cyclic voltammetry (CV) using glassy carbon electrode. The biological activity of the complexes has been evaluated by examining their ability to bind to calf-thymus DNA (CT DNA) with UV spectroscopy and cyclic voltammetry. UV studies of the interaction of the complexes with DNA have shown that these compounds can bind to CT DNA. The binding constants of the complexes with CT DNA have also been calculated. The cyclic voltammograms of the complexes in the presence of CT DNA have shown that the complexes can bind to CT DNA by both the intercalative and the electrostatic binding mode. The antimicrobial activity of these complexes has been evaluated against three Gram-positive and four Gram-negative bacteria. Antifungal activity against two different fungi has been evaluated and compared with the reference drug TMP. Almost all types of complexes show excellent activity against all type of bacteria and fungi. The morphology of the CT DNA, TMP, metal ions and metal complexes has been investigated by scanning electron microscopy (SEM). To get the SEM images, the interaction of compounds with CT DNA has been studied by means of differential pulse voltammetry (DPV) at CT DNA modified pencil graphite electrode (PGE). The decrease in intensity of the guanine oxidation signals has been used as an indicator for the interaction mechanism. Copyright © 2012 Elsevier B.V. All rights reserved.

  11. High-Mobility Group Chromatin Proteins 1 and 2 Functionally Interact with Steroid Hormone Receptors To Enhance Their DNA Binding In Vitro and Transcriptional Activity in Mammalian Cells

    PubMed Central

    Boonyaratanakornkit, Viroj; Melvin, Vida; Prendergast, Paul; Altmann, Magda; Ronfani, Lorenza; Bianchi, Marco E.; Taraseviciene, Laima; Nordeen, Steven K.; Allegretto, Elizabeth A.; Edwards, Dean P.

    1998-01-01

    We previously reported that the chromatin high-mobility group protein 1 (HMG-1) enhances the sequence-specific DNA binding activity of progesterone receptor (PR) in vitro, thus providing the first evidence that HMG-1 may have a coregulatory role in steroid receptor-mediated gene transcription. Here we show that HMG-1 and the highly related HMG-2 stimulate DNA binding by other steroid receptors, including estrogen, androgen, and glucocorticoid receptors, but have no effect on DNA binding by several nonsteroid nuclear receptors, including retinoid acid receptor (RAR), retinoic X receptor (RXR), and vitamin D receptor (VDR). As highly purified recombinant full-length proteins, all steroid receptors tested exhibited weak binding affinity for their optimal palindromic hormone response elements (HREs), and the addition of purified HMG-1 or -2 substantially increased their affinity for HREs. Purified RAR, RXR, and VDR also exhibited little to no detectable binding to their cognate direct repeat HREs but, in contrast to results with steroid receptors, the addition of HMG-1 or HMG-2 had no stimulatory effect. Instead, the addition of purified RXR enhanced RAR and VDR DNA binding through a heterodimerization mechanism and HMG-1 or HMG-2 had no further effect on DNA binding by RXR-RAR or RXR-VDR heterodimers. HMG-1 and HMG-2 (HMG-1/-2) themselves do not bind to progesterone response elements, but in the presence of PR they were detected as part of an HMG-PR-DNA ternary complex. HMG-1/-2 can also interact transiently in vitro with PR in the absence of DNA; however, no direct protein interaction was detected with VDR. These results, taken together with the fact that PR can bend its target DNA and that HMG-1/-2 are non-sequence-specific DNA binding proteins that recognize DNA structure, suggest that HMG-1/-2 are recruited to the PR-DNA complex by the combined effect of transient protein interaction and DNA bending. In transient-transfection assays, coexpression of HMG-1 or HMG-2 increased PR-mediated transcription in mammalian cells by as much as 7- to 10-fold without altering the basal promoter activity of target reporter genes. This increase in PR-mediated gene activation by coexpression of HMG-1/-2 was observed in different cell types and with different target promoters, suggesting a generality to the functional interaction between HMG-1/-2 and PR in vivo. Cotransfection of HMG-1 also increased reporter gene activation mediated by other steroid receptors, including glucocorticoid and androgen receptors, but it had a minimal influence on VDR-dependent transcription in vivo. These results support the conclusion that HMG-1/-2 are coregulatory proteins that increase the DNA binding and transcriptional activity of the steroid hormone class of receptors but that do not functionally interact with certain nonsteroid classes of nuclear receptors. PMID:9671457

  12. Exploring DNA-binding Proteins with In Vivo Chemical Cross-linking and Mass Spectrometry

    PubMed Central

    Qiu, Haibo; Wang, Yinsheng

    2009-01-01

    DNA-binding proteins are very important constituents of proteomes of all species and play crucial roles in transcription, DNA replication, recombination, repair and other activities associated with DNA. Although a number of DNA-binding proteins have been identified, many proteins involved in gene regulation and DNA repair are likely still unknown because of their dynamic and/or weak interactions with DNA. In this report, we described an approach for the comprehensive identification of DNA-binding proteins with in vivo formaldehyde cross-linking and LC-MS/MS. DNA-binding proteins could be purified via the isolation of DNA-protein complexes and released from the complexes by reversing the cross-linking. By using this method, we were able to identify more than one hundred DNA-binding proteins, such as proteins involved in transcription, gene regulation, DNA replication and repair, and a large number of proteins which are potentially associated with DNA and DNA-binding proteins. This method should be generally applicable to the investigation of other nucleic acid-binding proteins, and hold great potential in the comprehensive study of gene regulation, DNA damage response and repair, as well as many other critical biological processes at proteomic level. PMID:19714816

  13. Determination of the DNA-binding characteristics of ethidium bromide, proflavine, and cisplatin by flow injection analysis: usefulness in studies on antitumor drugs.

    PubMed

    Alonso, A; Almendral, M J; Curto, Y; Criado, J J; Rodríguez, E; Manzano, J L

    2006-08-15

    Flow injection analysis was used to study the reactions occurring between DNA and certain compounds that bind to its double helix, deforming this and even breaking it, such that some of them (e.g., cisplatin) are endowed with antitumoral activity. Use of this technique in the merging zones and stopped-flow modes afforded data on the binding parameters and the kinetic characteristics of the process. The first compound studied was ethidium bromide (EtdBr), used as a fluorescent marker because its fluorescence is enhanced when it binds to DNA. The DNA-EtdBr binding parameters, the apparent intrinsic binding constant (0.31+/-0.02 microM(-1)), and the maximum number of binding sites per nucleotide (0.327+/-0.009) were determined. The modification introduced in these parameters by the presence of proflavine (Prf), a classic competitive inhibitor of the binding of EtdBr to the DNA double helix, was also studied, determining the value of the intrinsic binding constant of Prf (K(Prf) = 0.119+/-9x10(-3) microM(-1)). Finally, we determined the binding parameters between DNA and EtdBr in the presence of the antitumor agent cisplatin, a noncompetitive inhibitor of such binding. This provided information about the binding mechanism as well as the duration and activity of the binding of the compound in its pharmacological use.

  14. BLM and RMI1 alleviate RPA inhibition of TopoIIIα decatenase activity.

    PubMed

    Yang, Jay; Bachrati, Csanad Z; Hickson, Ian D; Brown, Grant W

    2012-01-01

    RPA is a single-stranded DNA binding protein that physically associates with the BLM complex. RPA stimulates BLM helicase activity as well as the double Holliday junction dissolution activity of the BLM-topoisomerase IIIα complex. We investigated the effect of RPA on the ssDNA decatenase activity of topoisomerase IIIα. We found that RPA and other ssDNA binding proteins inhibit decatenation by topoisomerase IIIα. Complex formation between BLM, TopoIIIα, and RMI1 ablates inhibition of decatenation by ssDNA binding proteins. Together, these data indicate that inhibition by RPA does not involve species-specific interactions between RPA and BLM-TopoIIIα-RMI1, which contrasts with RPA modulation of double Holliday junction dissolution. We propose that topoisomerase IIIα and RPA compete to bind to single-stranded regions of catenanes. Interactions with BLM and RMI1 enhance toposiomerase IIIα activity, promoting decatenation in the presence of RPA.

  15. Studies on the interaction of a synthetic nitro-flavone derivative with DNA: A multi-spectroscopic and molecular docking approach.

    PubMed

    Mitra, A; Saikh, F; Das, J; Ghosh, S; Ghosh, R

    2018-05-22

    Interaction of a ligand with DNA is often the basis of drug action of many molecules. Flavones are important in this regard as their structural features confer them the ability to bind to DNA. 2-(4-Nitrophenyl)-4H-chromen-4-one (4NCO) is an important biologically active synthetic flavone derivative. We are therefore interested in studying its interaction with DNA. Absorption spectroscopy studies included standard and reverse titration, effect of ionic strength on titration, determination of stoichiometry of binding and thermal denaturation. Spectrofluorimetry techniques included fluorimetric titration, quenching studies and fluorescence displacement assay. Assessment of relative viscosity and estimation of thermodynamic parameters from CD spectral studies were also undertaken. Furthermore, molecular docking analyses were also done with different short DNA sequences. The fluorescent flavone 4NCO reversibly interacted with DNA through partial intercalation as well as minor-groove binding. The binding constant and the number of binding sites were of the order 10 4  M -1 and 1 respectively. The binding stoichiometry with DNA was found to be 1:1. The nature of the interaction of 4NCO with DNA was hydrophobic in nature and the process of binding was spontaneous, endothermic and entropy-driven. The flavone also showed a preference for binding to GC rich sequences. The study presents a profile for structural and thermodynamic parameters, for the binding of 4NCO with DNA. DNA is an important target for ligands that are effective against cell proliferative disorders. In this regard, the molecule 4NCO is important since it can exert its biological activity through its DNA binding ability and can be a potential drug candidate. Copyright © 2018 Elsevier B.V. All rights reserved.

  16. NMR and computational methods applied to the 3- dimensional structure determination of DNA and ligand-DNA complexes in solution

    NASA Astrophysics Data System (ADS)

    Smith, Jarrod Anson

    2D homonuclear 1H NMR methods and restrained molecular dynamics (rMD) calculations have been applied to determining the three-dimensional structures of DNA and minor groove-binding ligand-DNA complexes in solution. The structure of the DNA decamer sequence d(GCGTTAACGC)2 has been solved both with a distance-based rMD protocol and an NOE relaxation matrix backcalculation-based protocol in order to probe the relative merits of the different refinement methods. In addition, three minor groove binding ligand-DNA complexes have been examined. The solution structure of the oligosaccharide moiety of the antitumor DNA scission agent calicheamicin γ1I has been determined in complex with a decamer duplex containing its high affinity 5'-TCCT- 3' binding sequence. The structure of the complex reinforces the belief that the oligosaccharide moiety is responsible for the sequence selective minor-groove binding activity of the agent, and critical intermolecular contacts are revealed. The solution structures of both the (+) and (-) enantiomers of the minor groove binding DNA alkylating agent duocarmycin SA have been determined in covalent complex with the undecamer DNA duplex d(GACTAATTGTC).d(GAC AATTAGTC). The results support the proposal that the alkylation activity of the duocarmycin antitumor antibiotics is catalyzed by a binding-induced conformational change in the ligand which activates the cyclopropyl group for reaction with the DNA. Comparisons between the structures of the two enantiomers covalently bound to the same DNA sequence at the same 5'-AATTA-3 ' site have provided insight into the binding orientation and site selectivity, as well as the relative rates of reactivity of these two agents.

  17. DNA Mismatch Binding and Antiproliferative Activity of Rhodium Metalloinsertors

    PubMed Central

    Ernst, Russell J.; Song, Hang; Barton, Jacqueline K.

    2009-01-01

    Deficiencies in mismatch repair (MMR) are associated with carcinogenesis. Rhodium metalloinsertors bind to DNA base mismatches with high specificity and inhibit cellular proliferation preferentially in MMR-deficient cells versus MMR-proficient cells. A family of chrysenequinone diimine complexes of rhodium with varying ancillary ligands that serve as DNA metalloinsertors has been synthesized, and both DNA mismatch binding affinities and antiproliferative activities against the human colorectal carcinoma cell lines HCT116N and HCT116O, an isogenic model system for MMR deficiency, have been determined. DNA photocleavage experiments reveal that all complexes bind to the mismatch sites with high specificities; DNA binding affinities to oligonucleotides containing single base CA and CC mismatches, obtained through photocleavage titration or competition, vary from 104 to 108 M−1 for the series of complexes. Significantly, binding affinities are found to be inversely related to ancillary ligand size and directly related to differential inhibition of the HCT116 cell lines. The observed trend in binding affinity is consistent with the metalloinsertion mode where the complex binds from the minor groove with ejection of mismatched base pairs. The correlation between binding affinity and targeting of the MMR-deficient cell line suggests that rhodium metalloinsertors exert their selective biological effects on MMR-deficient cells through mismatch binding in vivo. PMID:19175313

  18. APOBEC3G Interacts with ssDNA by Two Modes: AFM Studies

    PubMed Central

    Shlyakhtenko, Luda S.; Dutta, Samrat; Banga, Jaspreet; Li, Ming; Harris, Reuben S.; Lyubchenko, Yuri L.

    2015-01-01

    APOBEC3G (A3G) protein has antiviral activity against HIV and other pathogenic retroviruses. A3G has two domains: a catalytic C-terminal domain (CTD) that deaminates cytidine, and a N-terminal domain (NTD) that binds to ssDNA. Although abundant information exists about the biological activities of A3G protein, the interplay between sequence specific deaminase activity and A3G binding to ssDNA remains controversial. We used the topographic imaging and force spectroscopy modalities of Atomic Force Spectroscopy (AFM) to characterize the interaction of A3G protein with deaminase specific and nonspecific ssDNA substrates. AFM imaging demonstrated that A3G has elevated affinity for deaminase specific ssDNA than for nonspecific ssDNA. AFM force spectroscopy revealed two distinct binding modes by which A3G interacts with ssDNA. One mode requires sequence specificity, as demonstrated by stronger and more stable complexes with deaminase specific ssDNA than with nonspecific ssDNA. Overall these observations enforce prior studies suggesting that both domains of A3G contribute to the sequence specific binding of ssDNA. PMID:26503602

  19. The secondary structure of the ets domain of human Fli-1 resembles that of the helix-turn-helix DNA-binding motif of the Escherichia coli catabolite gene activator protein.

    PubMed Central

    Liang, H; Olejniczak, E T; Mao, X; Nettesheim, D G; Yu, L; Thompson, C B; Fesik, S W

    1994-01-01

    The ets family of eukaryotic transcription factors is characterized by a conserved DNA-binding domain of approximately 85 amino acids for which the three-dimensional structure is not known. By using multidimensional NMR spectroscopy, we have determined the secondary structure of the ets domain of one member of this gene family, human Fli-1, both in the free form and in a complex with a 16-bp cognate DNA site. The secondary structure of the Fli-1 ets domain consists of three alpha-helices and a short four-stranded antiparallel beta-sheet. This secondary structure arrangement resembles that of the DNA-binding domain of the catabolite gene activator protein of Escherichia coli, as well as those of several eukaryotic DNA-binding proteins including histone H5, HNF-3/fork head, and the heat shock transcription factor. Differences in chemical shifts of backbone resonances and amide exchange rates between the DNA-bound and free forms of the Fli-1 ets domain suggest that the third helix is the DNA recognition helix, as in the catabolite gene activator protein and other structurally related proteins. These results suggest that the ets domain is structurally similar to the catabolite gene activator protein family of helix-turn-helix DNA-binding proteins. Images PMID:7972119

  20. The DnaK Chaperone Uses Different Mechanisms To Promote and Inhibit Replication of Vibrio cholerae Chromosome 2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jha, Jyoti K.; Li, Mi; Ghirlando, Rodolfo

    Replication of Vibrio cholerae chromosome 2 (Chr2) depends on molecular chaperone DnaK to facilitate binding of the initiator (RctB) to the replication origin. The binding occurs at two kinds of site, 12-mers and 39-mers, which promote and inhibit replication, respectively. Here we show that DnaK employs different mechanisms to enhance the two kinds of binding. We found that mutations inrctBthat reduce DnaK binding also reduce 12-mer binding and initiation. The initiation defect is suppressed by second-site mutations that increase 12-mer binding only marginally. Instead, they reduce replication inhibitory mechanisms: RctB dimerization and 39-mer binding. One suppressing change was in amore » dimerization domain which is folded similarly to the initiator of an iteron plasmid—the presumed progenitor of Chr2. In plasmids, DnaK promotes initiation by reducing dimerization. A different mutation was in the 39-mer binding domain of RctB and inactivated it, indicating an alternative suppression mechanism. Paradoxically, although DnaK increases 39-mer binding, the increase was also achieved by inactivating the DnaK binding site of RctB. This result suggests that the site inhibits the 39-mer binding domain (via autoinhibition) when prevented from binding DnaK. Taken together, our results reveal an important feature of the transition from plasmid to chromosome: the Chr2 initiator retains the plasmid-like dimerization domain and its control by chaperones but uses the chaperones in an unprecedented way to control the inhibitory 39-mer binding. IMPORTANCE The capacity of proteins to undergo remodeling provides opportunities to control their function. However, remodeling remains a poorly understood aspect of the structure-function paradigm due to its dynamic nature. Here we have studied remodeling of the initiator of replication ofVibrio choleraeChr2 by the molecular chaperone, DnaK. We show that DnaK binds to a site on the Chr2 initiator (RctB) that promotes initiation by reducing the initiator’s propensity to dimerize. Dimerization of the initiator of the putative plasmid progenitor of Chr2 is also reduced by DnaK, which promotes initiation. Paradoxically, the DnaK binding also promotes replication inhibition by reducing an autoinhibitory activity of RctB. In the plasmid-to-chromosome transition, it appears that the initiator has acquired an autoinhibitory activity and along with it a new chaperone activity that apparently helps to control replication inhibition independently of replication promotion.« less

  1. Imaging chromatin nanostructure with binding-activated localization microscopy based on DNA structure fluctuations

    PubMed Central

    Szczurek, Aleksander; Klewes, Ludger; Xing, Jun; Gourram, Amine; Birk, Udo; Knecht, Hans; Dobrucki, Jurek W.; Mai, Sabine

    2017-01-01

    Abstract Advanced light microscopy is an important tool for nanostructure analysis of chromatin. In this report we present a general concept for Single Molecule localization Microscopy (SMLM) super-resolved imaging of DNA-binding dyes based on modifying the properties of DNA and the dye. By careful adjustment of the chemical environment leading to local, reversible DNA melting and hybridization control over the fluorescence signal of the DNA-binding dye molecules can be introduced. We postulate a transient binding as the basis for our variation of binding-activated localization microscopy (BALM). We demonstrate that several intercalating and minor-groove binding DNA dyes can be used to register (optically isolate) only a few DNA-binding dye signals at a time. To highlight this DNA structure fluctuation-assisted BALM (fBALM), we applied it to measure, for the first time, nanoscale differences in nuclear architecture in model ischemia with an anticipated structural resolution of approximately 50 nm. Our data suggest that this approach may open an avenue for the enhanced microscopic analysis of chromatin nano-architecture and hence the microscopic analysis of nuclear structure aberrations occurring in various pathological conditions. It may also become possible to analyse nuclear nanostructure differences in different cell types, stages of development or environmental stress conditions. PMID:28082388

  2. Loop L1 governs the DNA-binding specificity and order for RecA-catalyzed reactions in homologous recombination and DNA repair

    PubMed Central

    Shinohara, Takeshi; Ikawa, Shukuko; Iwasaki, Wakana; Hiraki, Toshiki; Hikima, Takaaki; Mikawa, Tsutomu; Arai, Naoto; Kamiya, Nobuo; Shibata, Takehiko

    2015-01-01

    In all organisms, RecA-family recombinases catalyze homologous joint formation in homologous genetic recombination, which is essential for genome stability and diversification. In homologous joint formation, ATP-bound RecA/Rad51-recombinases first bind single-stranded DNA at its primary site and then interact with double-stranded DNA at another site. The underlying reason and the regulatory mechanism for this conserved binding order remain unknown. A comparison of the loop L1 structures in a DNA-free RecA crystal that we originally determined and in the reported DNA-bound active RecA crystals suggested that the aspartate at position 161 in loop L1 in DNA-free RecA prevented double-stranded, but not single-stranded, DNA-binding to the primary site. This was confirmed by the effects of the Ala-replacement of Asp-161 (D161A), analyzed directly by gel-mobility shift assays and indirectly by DNA-dependent ATPase activity and SOS repressor cleavage. When RecA/Rad51-recombinases interact with double-stranded DNA before single-stranded DNA, homologous joint-formation is suppressed, likely by forming a dead-end product. We found that the D161A-replacement reduced this suppression, probably by allowing double-stranded DNA to bind preferentially and reversibly to the primary site. Thus, Asp-161 in the flexible loop L1 of wild-type RecA determines the preference for single-stranded DNA-binding to the primary site and regulates the DNA-binding order in RecA-catalyzed recombinase reactions. PMID:25561575

  3. EMSA Analysis of DNA Binding By Rgg Proteins

    PubMed Central

    LaSarre, Breah; Federle, Michael J.

    2016-01-01

    In bacteria, interaction of various proteins with DNA is essential for the regulation of specific target gene expression. Electrophoretic mobility shift assay (EMSA) is an in vitro approach allowing for the visualization of these protein-DNA interactions. Rgg proteins comprise a family of transcriptional regulators widespread among the Firmicutes. Some of these proteins function independently to regulate target gene expression, while others have now been demonstrated to function as effectors of cell-to-cell communication, having regulatory activities that are modulated via direct interaction with small signaling peptides. EMSA analysis can be used to assess DNA binding of either type of Rgg protein. EMSA analysis of Rgg protein activity has facilitated in vitro confirmation of regulatory targets, identification of precise DNA binding sites via DNA probe mutagenesis, and characterization of the mechanism by which some cognate signaling peptides modulate Rgg protein function (e.g. interruption of DNA-binding in some cases). PMID:27430004

  4. EMSA Analysis of DNA Binding By Rgg Proteins.

    PubMed

    LaSarre, Breah; Federle, Michael J

    2013-08-20

    In bacteria, interaction of various proteins with DNA is essential for the regulation of specific target gene expression. Electrophoretic mobility shift assay (EMSA) is an in vitro approach allowing for the visualization of these protein-DNA interactions. Rgg proteins comprise a family of transcriptional regulators widespread among the Firmicutes. Some of these proteins function independently to regulate target gene expression, while others have now been demonstrated to function as effectors of cell-to-cell communication, having regulatory activities that are modulated via direct interaction with small signaling peptides. EMSA analysis can be used to assess DNA binding of either type of Rgg protein. EMSA analysis of Rgg protein activity has facilitated in vitro confirmation of regulatory targets, identification of precise DNA binding sites via DNA probe mutagenesis, and characterization of the mechanism by which some cognate signaling peptides modulate Rgg protein function ( e.g. interruption of DNA-binding in some cases).

  5. Modulation of DNA binding by gene-specific transcription factors.

    PubMed

    Schleif, Robert F

    2013-10-01

    The transcription of many genes, particularly in prokaryotes, is controlled by transcription factors whose activity can be modulated by controlling their DNA binding affinity. Understanding the molecular mechanisms by which DNA binding affinity is regulated is important, but because forming definitive conclusions usually requires detailed structural information in combination with data from extensive biophysical, biochemical, and sometimes genetic experiments, little is truly understood about this topic. This review describes the biological requirements placed upon DNA binding transcription factors and their consequent properties, particularly the ways that DNA binding affinity can be modulated and methods for its study. What is known and not known about the mechanisms modulating the DNA binding affinity of a number of prokaryotic transcription factors, including CAP and lac repressor, is provided.

  6. A conserved MCM single-stranded DNA binding element is essential for replication initiation.

    PubMed

    Froelich, Clifford A; Kang, Sukhyun; Epling, Leslie B; Bell, Stephen P; Enemark, Eric J

    2014-04-01

    The ring-shaped MCM helicase is essential to all phases of DNA replication. The complex loads at replication origins as an inactive double-hexamer encircling duplex DNA. Helicase activation converts this species to two active single hexamers that encircle single-stranded DNA (ssDNA). The molecular details of MCM DNA interactions during these events are unknown. We determined the crystal structure of the Pyrococcus furiosus MCM N-terminal domain hexamer bound to ssDNA and define a conserved MCM-ssDNA binding motif (MSSB). Intriguingly, ssDNA binds the MCM ring interior perpendicular to the central channel with defined polarity. In eukaryotes, the MSSB is conserved in several Mcm2-7 subunits, and MSSB mutant combinations in S. cerevisiae Mcm2-7 are not viable. Mutant Mcm2-7 complexes assemble and are recruited to replication origins, but are defective in helicase loading and activation. Our findings identify an important MCM-ssDNA interaction and suggest it functions during helicase activation to select the strand for translocation. DOI: http://dx.doi.org/10.7554/eLife.01993.001.

  7. A conserved MCM single-stranded DNA binding element is essential for replication initiation

    PubMed Central

    Froelich, Clifford A; Kang, Sukhyun; Epling, Leslie B; Bell, Stephen P; Enemark, Eric J

    2014-01-01

    The ring-shaped MCM helicase is essential to all phases of DNA replication. The complex loads at replication origins as an inactive double-hexamer encircling duplex DNA. Helicase activation converts this species to two active single hexamers that encircle single-stranded DNA (ssDNA). The molecular details of MCM DNA interactions during these events are unknown. We determined the crystal structure of the Pyrococcus furiosus MCM N-terminal domain hexamer bound to ssDNA and define a conserved MCM-ssDNA binding motif (MSSB). Intriguingly, ssDNA binds the MCM ring interior perpendicular to the central channel with defined polarity. In eukaryotes, the MSSB is conserved in several Mcm2-7 subunits, and MSSB mutant combinations in S. cerevisiae Mcm2-7 are not viable. Mutant Mcm2-7 complexes assemble and are recruited to replication origins, but are defective in helicase loading and activation. Our findings identify an important MCM-ssDNA interaction and suggest it functions during helicase activation to select the strand for translocation. DOI: http://dx.doi.org/10.7554/eLife.01993.001 PMID:24692448

  8. Arsenite-induced ROS/RNS generation causes zinc loss and inhibits the activity of poly(ADP-ribose) polymerase-1.

    PubMed

    Wang, Feng; Zhou, Xixi; Liu, Wenlan; Sun, Xi; Chen, Chen; Hudson, Laurie G; Jian Liu, Ke

    2013-08-01

    Arsenic enhances the genotoxicity of other carcinogenic agents such as ultraviolet radiation and benzo[a]pyrene. Recent reports suggest that inhibition of DNA repair is an important aspect of arsenic cocarcinogenesis, and DNA repair proteins such as poly(ADP ribose) polymerase (PARP)-1 are direct molecular targets of arsenic. Although arsenic has been shown to generate reactive oxygen/nitrogen species (ROS/RNS), little is known about the role of arsenic-induced ROS/RNS in the mechanism underlying arsenic inhibition of DNA repair. We report herein that arsenite-generated ROS/RNS inhibits PARP-1 activity in cells. Cellular exposure to arsenite, as well as hydrogen peroxide and NONOate (nitric oxide donor), decreased PARP-1 zinc content, enzymatic activity, and PARP-1 DNA binding. Furthermore, the effects of arsenite on PARP-1 activity, DNA binding, and zinc content were partially reversed by the antioxidant ascorbic acid, catalase, and the NOS inhibitor, aminoguanidine. Most importantly, arsenite incubation with purified PARP-1 protein in vitro did not alter PARP-1 activity or DNA-binding ability, whereas hydrogen peroxide or NONOate retained PARP-1 inhibitory activity. These results strongly suggest that cellular generation of ROS/RNS plays an important role in arsenite inhibition of PARP-1 activity, leading to the loss of PARP-1 DNA-binding ability and enzymatic activity. Copyright © 2013 Elsevier Inc. All rights reserved.

  9. Context influences on TALE–DNA binding revealed by quantitative profiling

    PubMed Central

    Rogers, Julia M.; Barrera, Luis A.; Reyon, Deepak; Sander, Jeffry D.; Kellis, Manolis; Joung, J Keith; Bulyk, Martha L.

    2015-01-01

    Transcription activator-like effector (TALE) proteins recognize DNA using a seemingly simple DNA-binding code, which makes them attractive for use in genome engineering technologies that require precise targeting. Although this code is used successfully to design TALEs to target specific sequences, off-target binding has been observed and is difficult to predict. Here we explore TALE–DNA interactions comprehensively by quantitatively assaying the DNA-binding specificities of 21 representative TALEs to ∼5,000–20,000 unique DNA sequences per protein using custom-designed protein-binding microarrays (PBMs). We find that protein context features exert significant influences on binding. Thus, the canonical recognition code does not fully capture the complexity of TALE–DNA binding. We used the PBM data to develop a computational model, Specificity Inference For TAL-Effector Design (SIFTED), to predict the DNA-binding specificity of any TALE. We provide SIFTED as a publicly available web tool that predicts potential genomic off-target sites for improved TALE design. PMID:26067805

  10. Context influences on TALE-DNA binding revealed by quantitative profiling.

    PubMed

    Rogers, Julia M; Barrera, Luis A; Reyon, Deepak; Sander, Jeffry D; Kellis, Manolis; Joung, J Keith; Bulyk, Martha L

    2015-06-11

    Transcription activator-like effector (TALE) proteins recognize DNA using a seemingly simple DNA-binding code, which makes them attractive for use in genome engineering technologies that require precise targeting. Although this code is used successfully to design TALEs to target specific sequences, off-target binding has been observed and is difficult to predict. Here we explore TALE-DNA interactions comprehensively by quantitatively assaying the DNA-binding specificities of 21 representative TALEs to ∼5,000-20,000 unique DNA sequences per protein using custom-designed protein-binding microarrays (PBMs). We find that protein context features exert significant influences on binding. Thus, the canonical recognition code does not fully capture the complexity of TALE-DNA binding. We used the PBM data to develop a computational model, Specificity Inference For TAL-Effector Design (SIFTED), to predict the DNA-binding specificity of any TALE. We provide SIFTED as a publicly available web tool that predicts potential genomic off-target sites for improved TALE design.

  11. The Replication Focus Targeting Sequence (RFTS) Domain Is a DNA-competitive Inhibitor of Dnmt1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Syeda, Farisa; Fagan, Rebecca L.; Wean, Matthew

    Dnmt1 (DNA methyltransferase 1) is the principal enzyme responsible for maintenance of cytosine methylation at CpG dinucleotides in the mammalian genome. The N-terminal replication focus targeting sequence (RFTS) domain of Dnmt1 has been implicated in subcellular localization, protein association, and catalytic function. However, progress in understanding its function has been limited by the lack of assays for and a structure of this domain. Here, we show that the naked DNA- and polynucleosome-binding activities of Dnmt1 are inhibited by the RFTS domain, which functions by virtue of binding the catalytic domain to the exclusion of DNA. Kinetic analysis with a fluorogenicmore » DNA substrate established the RFTS domain as a 600-fold inhibitor of Dnmt1 enzymatic activity. The crystal structure of the RFTS domain reveals a novel fold and supports a mechanism in which an RFTS-targeted Dnmt1-binding protein, such as Uhrf1, may activate Dnmt1 for DNA binding.« less

  12. Dual Role of DNA in Regulating ATP Hydrolysis by the SopA Partition Protein*

    PubMed Central

    Ah-Seng, Yoan; Lopez, Frederic; Pasta, Franck; Lane, David; Bouet, Jean-Yves

    2009-01-01

    In bacteria, mitotic stability of plasmids and many chromosomes depends on replicon-specific systems, which comprise a centromere, a centromere-binding protein and an ATPase. Dynamic self-assembly of the ATPase appears to enable active partition of replicon copies into cell-halves, but for Walker-box partition ATPases the molecular mechanism is unknown. ATPase activity appears to be essential for this process. DNA and centromere-binding proteins are known to stimulate the ATPase activity but molecular details of the stimulation mechanism have not been reported. We have investigated the interactions which stimulate ATP hydrolysis by the SopA partition ATPase of plasmid F. By using SopA and SopB proteins deficient in DNA binding, we have found that the intrinsic ability of SopA to hydrolyze ATP requires direct DNA binding by SopA but not by SopB. Our results show that two independent interactions of SopA act in synergy to stimulate its ATPase. SopA must interact with (i) DNA, through its ATP-dependent nonspecific DNA binding domain and (ii) SopB, which we show here to provide an arginine-finger motif. In addition, the latter interaction stimulates ATPase maximally when SopB is part of the partition complex. Hence, our data demonstrate that DNA acts on SopA in two ways, directly as nonspecific DNA and through SopB as centromeric DNA, to fully activate SopA ATP hydrolysis. PMID:19740757

  13. Direct DNA binding by Brca1.

    PubMed

    Paull, T T; Cortez, D; Bowers, B; Elledge, S J; Gellert, M

    2001-05-22

    The tumor suppressor Brca1 plays an important role in protecting mammalian cells against genomic instability, but little is known about its modes of action. In this work we demonstrate that recombinant human Brca1 protein binds strongly to DNA, an activity conferred by a domain in the center of the Brca1 polypeptide. As a result of this binding, Brca1 inhibits the nucleolytic activities of the Mre11/Rad50/Nbs1 complex, an enzyme implicated in numerous aspects of double-strand break repair. Brca1 displays a preference for branched DNA structures and forms protein-DNA complexes cooperatively between multiple DNA strands, but without DNA sequence specificity. This fundamental property of Brca1 may be an important part of its role in DNA repair and transcription.

  14. Metabolic activation and nucleic acid binding of acetaminophen and related arylamine substrates by the respiratory burst of human granulocytes.

    PubMed

    Corbett, M D; Corbett, B R; Hannothiaux, M H; Quintana, S J

    1989-01-01

    Following stimulation with phorbol myristate acetate, human granulocytes were found to incorporate acetaminophen, p-phenetidine, p-aminophenol, and p-chloroaniline into cellular DNA and RNA. Phenacetin was not incorporated into nucleic acid or metabolized by such activated granulocytes. None of the substrates gave nucleic acid binding if the granulocyte cultures were not induced to undergo the respiratory burst. Additional studies on the binding of acetaminophen to DNA and RNA were made by use of both ring-14C-labeled and carbonyl-14C-labeled forms of this substrate. The finding that equivalent amounts of these two labeled acetaminophen substrates were bound to cellular DNA demonstrated that the intact acetaminophen molecule was incorporated into DNA. On the other hand, the finding that excess ring-14C-labeled acetaminophen was incorporated into cellular RNA implies partial hydrolysis of the acetaminophen substrate prior to RNA binding. Evidence was presented which strongly indicates that the nucleic acid binding of the substrates was covalent in nature. The inability of the respiratory burst to result in the binding of phenacetin to nucleic acid suggests that arylamides are not normally activated or metabolized by activated granulocytes. Acetaminophen is an exception to the recalcitrance of arylamides to such bioactivation processes because it also possesses the phenolic functional group, which, like the arylamine group, is oxidized by certain reactive oxygen species. Myeloperoxidase appears to be much more important in the binding of acetaminophen to DNA than it is in the DNA binding of arylamines in general. The role of the respiratory burst in causing the bioactivation of certain arylamines, which are not normally genotoxic via the more usual microsomal activation pathways, was extended to include certain amide substrates such as acetaminophen.

  15. Genomic Heat Shock Element Sequences Drive Cooperative Human Heat Shock Factor 1 DNA Binding and Selectivity*

    PubMed Central

    Jaeger, Alex M.; Makley, Leah N.; Gestwicki, Jason E.; Thiele, Dennis J.

    2014-01-01

    The heat shock transcription factor 1 (HSF1) activates expression of a variety of genes involved in cell survival, including protein chaperones, the protein degradation machinery, anti-apoptotic proteins, and transcription factors. Although HSF1 activation has been linked to amelioration of neurodegenerative disease, cancer cells exhibit a dependence on HSF1 for survival. Indeed, HSF1 drives a program of gene expression in cancer cells that is distinct from that activated in response to proteotoxic stress, and HSF1 DNA binding activity is elevated in cycling cells as compared with arrested cells. Active HSF1 homotrimerizes and binds to a DNA sequence consisting of inverted repeats of the pentameric sequence nGAAn, known as heat shock elements (HSEs). Recent comprehensive ChIP-seq experiments demonstrated that the architecture of HSEs is very diverse in the human genome, with deviations from the consensus sequence in the spacing, orientation, and extent of HSE repeats that could influence HSF1 DNA binding efficacy and the kinetics and magnitude of target gene expression. To understand the mechanisms that dictate binding specificity, HSF1 was purified as either a monomer or trimer and used to evaluate DNA-binding site preferences in vitro using fluorescence polarization and thermal denaturation profiling. These results were compared with quantitative chromatin immunoprecipitation assays in vivo. We demonstrate a role for specific orientations of extended HSE sequences in driving preferential HSF1 DNA binding to target loci in vivo. These studies provide a biochemical basis for understanding differential HSF1 target gene recognition and transcription in neurodegenerative disease and in cancer. PMID:25204655

  16. Cell- and virus-mediated regulation of the barrier-to-autointegration factor's phosphorylation state controls its DNA binding, dimerization, subcellular localization, and antipoxviral activity.

    PubMed

    Jamin, Augusta; Wicklund, April; Wiebe, Matthew S

    2014-05-01

    Barrier-to-autointegration factor (BAF) is a DNA binding protein with multiple cellular functions, including the ability to act as a potent defense against vaccinia virus infection. This antiviral function involves BAF's ability to condense double-stranded DNA and subsequently prevent viral DNA replication. In recent years, it has become increasingly evident that dynamic phosphorylation involving the vaccinia virus B1 kinase and cellular enzymes is likely a key regulator of multiple BAF functions; however, the precise mechanisms are poorly understood. Here we analyzed how phosphorylation impacts BAF's DNA binding, subcellular localization, dimerization, and antipoxviral activity through the characterization of BAF phosphomimetic and unphosphorylatable mutants. Our studies demonstrate that increased phosphorylation enhances BAF's mobilization from the nucleus to the cytosol, while dephosphorylation restricts BAF to the nucleus. Phosphorylation also impairs both BAF's dimerization and its DNA binding activity. Furthermore, our studies of BAF's antiviral activity revealed that hyperphosphorylated BAF is unable to suppress viral DNA replication or virus production. Interestingly, the unphosphorylatable BAF mutant, which is capable of binding DNA but localizes predominantly to the nucleus, was also incapable of suppressing viral replication. Thus, both DNA binding and localization are important determinants of BAF's antiviral function. Finally, our examination of how phosphatases are involved in regulating BAF revealed that PP2A dephosphorylates BAF during vaccinia infection, thus counterbalancing the activity of the B1 kinase. Altogether, these data demonstrate that phosphoregulation of BAF by viral and cellular enzymes modulates this protein at multiple molecular levels, thus determining its effectiveness as an antiviral factor and likely other functions as well. The barrier-to-autointegration factor (BAF) contributes to cellular genomic integrity in multiple ways, the best characterized of which are as a host defense against cytoplasmic DNA and as a regulator of mitotic nuclear reassembly. Although dynamic phosphorylation involving both viral and cellular enzymes is likely a key regulator of multiple BAF functions, the precise mechanisms involved are poorly understood. Here we demonstrate that phosphorylation coordinately regulates BAF's DNA binding, subcellular localization, dimerization, and antipoxviral activity. Overall, our findings provide new insights into how phosphoregulation of BAF modulates this protein at multiple levels and governs its effectiveness as an antiviral factor against foreign DNA.

  17. Impact of cadmium, cobalt and nickel on sequence-specific DNA binding of p63 and p73 in vitro and in cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Adámik, Matej; Bažantová, Pavla; Department of Biology and Ecology, Faculty of Science, University of Ostrava, Chittussiho 10, 701 03 Ostrava

    Highlights: • DNA binding of p53 family core domains is inhibited by cadmium, cobalt and nickel. • Binding to DNA protects p53 family core domains from metal induced inhibition. • Cadmium, cobalt and nickel induced inhibition was reverted by EDTA in vitro. - Abstract: Site-specific DNA recognition and binding activity belong to common attributes of all three members of tumor suppressor p53 family proteins: p53, p63 and p73. It was previously shown that heavy metals can affect p53 conformation, sequence-specific binding and suppress p53 response to DNA damage. Here we report for the first time that cadmium, nickel and cobalt,more » which have already been shown to disturb various DNA repair mechanisms, can also influence p63 and p73 sequence-specific DNA binding activity and transactivation of p53 family target genes. Based on results of electrophoretic mobility shift assay and luciferase reporter assay, we conclude that cadmium inhibits sequence-specific binding of all three core domains to p53 consensus sequences and abolishes transactivation of several promoters (e.g. BAX and MDM2) by 50 μM concentrations. In the presence of specific DNA, all p53 family core domains were partially protected against loss of DNA binding activity due to cadmium treatment. Effective cadmium concentration to abolish DNA–protein interactions was about two times higher for p63 and p73 proteins than for p53. Furthermore, we detected partial reversibility of cadmium inhibition for all p53 family members by EDTA. DTT was able to reverse cadmium inhibition only for p53 and p73. Nickel and cobalt abolished DNA–p53 interaction at sub-millimolar concentrations while inhibition of p63 and p73 DNA binding was observed at millimolar concentrations. In summary, cadmium strongly inhibits p53, p63 and p73 DNA binding in vitro and in cells in comparison to nickel and cobalt. The role of cadmium inhibition of p53 tumor suppressor family in carcinogenesis is discussed.« less

  18. Engineering and Application of Zinc Finger Proteins and TALEs for Biomedical Research.

    PubMed

    Kim, Moon-Soo; Kini, Anu Ganesh

    2017-08-01

    Engineered DNA-binding domains provide a powerful technology for numerous biomedical studies due to their ability to recognize specific DNA sequences. Zinc fingers (ZF) are one of the most common DNA-binding domains and have been extensively studied for a variety of applications, such as gene regulation, genome engineering and diagnostics. Another novel DNA-binding domain known as a transcriptional activator-like effector (TALE) has been more recently discovered, which has a previously undescribed DNA-binding mode. Due to their modular architecture and flexibility, TALEs have been rapidly developed into artificial gene targeting reagents. Here, we describe the methods used to design these DNA-binding proteins and their key applications in biomedical research.

  19. Anti-DNA antibodies--quintessential biomarkers of SLE.

    PubMed

    Pisetsky, David S

    2016-02-01

    Antibodies that recognize and bind to DNA (anti-DNA antibodies) are serological hallmarks of systemic lupus erythematosus (SLE) and key markers for diagnosis and disease activity. In addition to common use in the clinic, anti-DNA antibody testing now also determines eligibility for clinical trials, raising important questions about the nature of the antibody-antigen interaction. At present, no 'gold standard' for serological assessment exists, and anti-DNA antibody binding can be measured with a variety of assay formats, which differ in the nature of the DNA substrates and in the conditions for binding and detection of antibodies. A mechanism called monogamous bivalency--in which high avidity results from simultaneous interaction of IgG Fab sites with a single polynucleotide chain--determines anti-DNA antibody binding; this mechanism might affect antibody detection in different assay formats. Although anti-DNA antibodies can promote pathogenesis by depositing in the kidney or driving cytokine production, they are not all alike, pathologically, and anti-DNA antibody expression does not necessarily correlate with active disease. Levels of anti-DNA antibodies in patients with SLE can vary over time, distinguishing anti-DNA antibodies from other pathogenic antinuclear antibodies. Elucidation of the binding specificities and the pathogenic roles of anti-DNA antibodies in SLE should enable improvements in the design of informative assays for both clinical and research purposes.

  20. Cell-Selective Biological Activity of Rhodium Metalloinsertors Correlates with Subcellular Localization

    PubMed Central

    Komor, Alexis C.; Schneider, Curtis J.; Weidmann, Alyson G.; Barton, Jacqueline K.

    2013-01-01

    Deficiencies in the mismatch repair (MMR) pathway are associated with several types of cancers, as well as resistance to commonly used chemotherapeutics. Rhodium metalloinsertors have been found to bind DNA mismatches with high affinity and specificity in vitro, and also exhibit cell-selective cytotoxicity, targeting MMR-deficient cells over MMR-proficient cells. Ten distinct metalloinsertors with varying lipophilicities have been synthesized and their mismatch binding affinities and biological activities determined. Although DNA photocleavage experiments demonstrate that their binding affinities are quite similar, their cell-selective antiproliferative and cytotoxic activities vary significantly. Inductively coupled plasma mass spectrometry (ICP-MS) experiments have uncovered a relationship between the subcellular distribution of these metalloinsertors and their biological activities. Specifically, we find that all of our metalloinsertors localize in the nucleus at sufficient concentrations for binding to DNA mismatches. However, the metalloinsertors with high rhodium localization in the mitochondria show toxicity that is not selective for MMR-deficient cells, whereas metalloinsertors with less mitochondrial rhodium show activity that is highly selective for MMR-deficient versus proficient cells. This work supports the notion that specific targeting of the metalloinsertors to nuclear DNA gives rise to their cell-selective cytotoxic and antiproliferative activities. The selectivity in cellular targeting depends upon binding to mismatches in genomic DNA. PMID:23137296

  1. Antimalarial, antimicrobial, cytotoxic, DNA interaction and SOD like activities of tetrahedral copper(II) complexes

    NASA Astrophysics Data System (ADS)

    Mehta, Jugal V.; Gajera, Sanjay B.; Patel, Mohan N.

    2015-02-01

    The mononuclear copper(II) complexes with P, O-donor ligand and different fluoroquinolones have been synthesized and characterized by elemental analysis, electronic spectra, TGA, EPR, FT-IR and LC-MS spectroscopy. An antimicrobial efficiency of the complexes has been tested against five different microorganisms in terms of minimum inhibitory concentration (MIC) and displays very good antimicrobial activity. The binding strength and binding mode of the complexes with Herring Sperm DNA (HS DNA) have been investigated by absorption titration and viscosity measurement studies. The studies suggest the classical intercalative mode of DNA binding. Gel electrophoresis assay determines the ability of the complexes to cleave the supercoiled form of pUC19 DNA. Synthesized complexes have been tested for their SOD mimic activity using nonenzymatic NBT/NADH/PMS system and found to have good antioxidant activity. All the complexes show good cytotoxic and in vitro antimalarial activities.

  2. Identification of a Hydrophobic Cleft in the LytTR Domain of AgrA as a Locus for Small Molecule Interactions that Inhibit DNA Binding

    PubMed Central

    Leonard, Paul G.; Bezar, Ian F.; Sidote, David J.; Stock, Ann M.

    2012-01-01

    The AgrA transcription factor regulates the quorum-sensing response in Staphylococcus aureus, controlling the production of hemolysins and other virulence factors. AgrA binds to DNA via its C-terminal LytTR domain, a domain not found in humans but common in many pathogenic bacteria, making it a potential target for antimicrobial development. We have determined the crystal structure of the apo AgrA LytTR domain and screened a library of 500 fragment compounds to find inhibitors of AgrA DNA-binding activity. Using NMR, the binding site for five compounds has been mapped to a common locus at the C-terminal end of the LytTR domain, a site known to be important for DNA-binding activity. Three of these compounds inhibit AgrA DNA binding. These results provide the first evidence that LytTR domains can be targeted by small organic compounds. PMID:23181972

  3. Activator Protein-1: redox switch controlling structure and DNA-binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yin, Zhou; Machius, Mischa; Nestler, Eric J.

    The transcription factor, activator protein-1 (AP-1), binds to cognate DNA under redox control; yet, the underlying mechanism has remained enigmatic. A series of crystal structures of the AP-1 FosB/JunD bZIP domains reveal ordered DNA-binding regions in both FosB and JunD even in absence DNA. However, while JunD is competent to bind DNA, the FosB bZIP domain must undergo a large conformational rearrangement that is controlled by a ‘redox switch’ centered on an inter-molecular disulfide bond. Solution studies confirm that FosB/JunD cannot undergo structural transition and bind DNA when the redox-switch is in the ‘OFF’ state, and show that the mid-pointmore » redox potential of the redox switch affords it sensitivity to cellular redox homeostasis. The molecular and structural studies presented here thus reveal the mechanism underlying redox-regulation of AP-1 Fos/Jun transcription factors and provide structural insight for therapeutic interventions targeting AP-1 proteins.« less

  4. Regulation of TCF ETS-domain transcription factors by helix-loop-helix motifs.

    PubMed

    Stinson, Julie; Inoue, Toshiaki; Yates, Paula; Clancy, Anne; Norton, John D; Sharrocks, Andrew D

    2003-08-15

    DNA binding by the ternary complex factor (TCF) subfamily of ETS-domain transcription factors is tightly regulated by intramolecular and intermolecular interactions. The helix-loop-helix (HLH)-containing Id proteins are trans-acting negative regulators of DNA binding by the TCFs. In the TCF, SAP-2/Net/ERP, intramolecular inhibition of DNA binding is promoted by the cis-acting NID region that also contains an HLH-like motif. The NID also acts as a transcriptional repression domain. Here, we have studied the role of HLH motifs in regulating DNA binding and transcription by the TCF protein SAP-1 and how Cdk-mediated phosphorylation affects the inhibitory activity of the Id proteins towards the TCFs. We demonstrate that the NID region of SAP-1 is an autoinhibitory motif that acts to inhibit DNA binding and also functions as a transcription repression domain. This region can be functionally replaced by fusion of Id proteins to SAP-1, whereby the Id moiety then acts to repress DNA binding in cis. Phosphorylation of the Ids by cyclin-Cdk complexes results in reduction in protein-protein interactions between the Ids and TCFs and relief of their DNA-binding inhibitory activity. In revealing distinct mechanisms through which HLH motifs modulate the activity of TCFs, our results therefore provide further insight into the role of HLH motifs in regulating TCF function and how the inhibitory properties of the trans-acting Id HLH proteins are themselves regulated by phosphorylation.

  5. Effect of point substitutions within the minimal DNA-binding domain of xeroderma pigmentosum group A protein on interaction with DNA intermediates of nucleotide excision repair.

    PubMed

    Maltseva, E A; Krasikova, Y S; Naegeli, H; Lavrik, O I; Rechkunova, N I

    2014-06-01

    Xeroderma pigmentosum factor A (XPA) is one of the key proteins in the nucleotide excision repair (NER) process. The effects of point substitutions in the DNA-binding domain of XPA (positively charged lysine residues replaced by negatively charged glutamate residues: XPA K204E, K179E, K141E, and tandem mutant K141E/K179E) on the interaction of the protein with DNA structures modeling intermediates of the damage recognition and pre-incision stages in NER were analyzed. All these mutations decreased the affinity of the protein to DNA, the effect depending on the substitution and the DNA structure. The mutant as well as wild-type proteins bind with highest efficiency partly open damaged DNA duplex, and the affinity of the mutants to this DNA is reduced in the order: K204E > K179E > K141E = K141/179E. For all the mutants, decrease in DNA binding efficiency was more pronounced in the case of full duplex and single-stranded DNA than with bubble-DNA structure, the difference between protein affinities to different DNA structures increasing as DNA binding activity of the mutant decreased. No effect of the studied XPA mutations on the location of the protein on the partially open DNA duplex was observed using photoinduced crosslinking with 5-I-dUMP in different positions of the damaged DNA strand. These results combined with earlier published data suggest no direct correlation between DNA binding and activity in NER for these XPA mutants.

  6. Characterization of two mosquito STATs, AaSTAT and CtSTAT. Differential regulation of tyrosine phosphorylation and DNA binding activity by lipopolysaccharide treatment and by Japanese encephalitis virus infection.

    PubMed

    Lin, Chang-Chi; Chou, Chih-Ming; Hsu, Ya-Li; Lien, Jih-Ching; Wang, Yu-Ming; Chen, Shui-Tsung; Tsai, Shu-Chuan; Hsiao, Pei-Wen; Huang, Chang-Jen

    2004-01-30

    Two mosquito STATs, AaSTAT and CtSTAT, have been cloned from Aedes albopictus and Culex tritaeniorhynchus mosquitoes, respectively. These two STATs are more similar to those of Drosophila, Anopheles, and mammalian STAT5 in the DNA binding and Src homology 2 domains. The mRNA transcripts are expressed at all developmental stages, and the proteins are present predominantly at the pupal and adult stages in both mosquitoes. Stimulation with lipopolysaccharide resulted in an increase of tyrosine phosphorylation and DNA binding activity of AaSTAT and CtSTAT as well as an increase of luciferase activity of a reporter gene containing Drosophila STAT binding motif in mosquito C6/36 cells. After being infected with Japanese encephalitis virus, nuclear extracts of C6/36 cells revealed a decrease of tyrosine phosphorylation and DNA binding activity of AaSTAT which could be restored by sodium orthovanadate treatment. Taking all of the data together, this is the first report to clone and characterize two mosquito STATs with 81% identity and to demonstrate a different response of tyrosine phosphorylation and DNA binding of these two STATs by lipopolysaccharide treatment and by Japanese encephalitis virus infection.

  7. The ATPase domain of the large terminase protein, gp17, from bacteriophage T4 binds DNA: implications to the DNA packaging mechanism.

    PubMed

    Alam, Tanfis I; Rao, Venigalla B

    2008-03-07

    Translocation of double-stranded DNA into a preformed capsid by tailed bacteriophages is driven by powerful motors assembled at the special portal vertex. The motor is thought to drive processive cycles of DNA binding, movement, and release to package the viral genome. In phage T4, there is evidence that the large terminase protein, gene product 17 (gp17), assembles into a multisubunit motor and translocates DNA by an inchworm mechanism. gp17 consists of two domains; an N-terminal ATPase domain (amino acids 1-360) that powers translocation of DNA, and a C-terminal nuclease domain (amino acids 361-610) that cuts concatemeric DNA to generate a headful-size viral genome. While the functional motifs of ATPase and nuclease have been well defined and the ATPase atomic structure has been solved, the DNA binding motif(s) responsible for viral DNA recognition, cutting, and translocation are unknown. Here we report the first evidence for the presence of a double-stranded DNA binding activity in the gp17 ATPase domain. Binding to DNA is sensitive to Mg(2+) and salt, but not the type of DNA used. DNA fragments as short as 20 bp can bind to the ATPase but preferential binding was observed to DNA greater than 1 kb. A high molecular weight ATPase-DNA complex was isolated by gel filtration, suggesting oligomerization of ATPase following DNA interaction. DNA binding was not observed with the full-length gp17, or the C-terminal nuclease domain. The small terminase protein, gp16, inhibited DNA binding, which was further accentuated by ATP. The presence of a DNA binding site in the ATPase domain and its binding properties implicate a role in the DNA packaging mechanism.

  8. Preferential Binding of Hot Spot Mutant p53 Proteins to Supercoiled DNA In Vitro and in Cells

    PubMed Central

    Brázdová, Marie; Navrátilová, Lucie; Tichý, Vlastimil; Němcová, Kateřina; Lexa, Matej; Hrstka, Roman; Pečinka, Petr; Adámik, Matej; Vojtesek, Borivoj; Paleček, Emil; Deppert, Wolfgang; Fojta, Miroslav

    2013-01-01

    Hot spot mutant p53 (mutp53) proteins exert oncogenic gain-of-function activities. Binding of mutp53 to DNA is assumed to be involved in mutp53-mediated repression or activation of several mutp53 target genes. To investigate the importance of DNA topology on mutp53-DNA recognition in vitro and in cells, we analyzed the interaction of seven hot spot mutp53 proteins with topologically different DNA substrates (supercoiled, linear and relaxed) containing and/or lacking mutp53 binding sites (mutp53BS) using a variety of electrophoresis and immunoprecipitation based techniques. All seven hot spot mutp53 proteins (R175H, G245S, R248W, R249S, R273C, R273H and R282W) were found to have retained the ability of wild-type p53 to preferentially bind circular DNA at native negative superhelix density, while linear or relaxed circular DNA was a poor substrate. The preference of mutp53 proteins for supercoiled DNA (supercoil-selective binding) was further substantiated by competition experiments with linear DNA or relaxed DNA in vitro and ex vivo. Using chromatin immunoprecipitation, the preferential binding of mutp53 to a sc mutp53BS was detected also in cells. Furthermore, we have shown by luciferase reporter assay that the DNA topology influences p53 regulation of BAX and MSP/MST1 promoters. Possible modes of mutp53 binding to topologically constrained DNA substrates and their biological consequences are discussed. PMID:23555710

  9. Studies on DNA-binding selectivity of WRKY transcription factors lend structural clues into WRKY-domain function.

    PubMed

    Ciolkowski, Ingo; Wanke, Dierk; Birkenbihl, Rainer P; Somssich, Imre E

    2008-09-01

    WRKY transcription factors have been shown to play a major role in regulating, both positively and negatively, the plant defense transcriptome. Nearly all studied WRKY factors appear to have a stereotypic binding preference to one DNA element termed the W-box. How specificity for certain promoters is accomplished therefore remains completely unknown. In this study, we tested five distinct Arabidopsis WRKY transcription factor subfamily members for their DNA binding selectivity towards variants of the W-box embedded in neighboring DNA sequences. These studies revealed for the first time differences in their binding site preferences, which are partly dependent on additional adjacent DNA sequences outside of the TTGACY-core motif. A consensus WRKY binding site derived from these studies was used for in silico analysis to identify potential target genes within the Arabidopsis genome. Furthermore, we show that even subtle amino acid substitutions within the DNA binding region of AtWRKY11 strongly impinge on its binding activity. Additionally, all five factors were found localized exclusively to the plant cell nucleus and to be capable of trans-activating expression of a reporter gene construct in vivo.

  10. Electrostatic interactions during acidic phospholipid reactivation of DnaA protein, the Escherichia coli initiator of chromosomal replication.

    PubMed

    Kitchen, J L; Li, Z; Crooke, E

    1999-05-11

    The initiation of Escherichia coli chromosomal replication by DnaA protein is strongly influenced by the tight binding of the nucleotides ATP and ADP. Anionic phospholipids in a fluid bilayer promote the conversion of inactive ADP-DnaA protein to replicatively active ATP-DnaA protein in vitro, and thus likely play a key role in regulating DnaA activity. Previous studies have revealed that, during this reactivation, a specific region of DnaA protein inserts into the hydrophobic portion of the lipid bilayer in an acidic phospholipid-dependent manner. To elucidate the requirement for acidic phospholipids in the reactivation process, the contribution of electrostatic forces in the interaction of DnaA and lipid was examined. DnaA-lipid binding required anionic phospholipids, and DnaA-lipid binding as well as lipid-mediated release of DnaA-bound nucleotide were inhibited by increased ionic strength, suggesting the involvement of electrostatic interactions in these processes. As the vesicular content of acidic phospholipids was increased, both nucleotide release and DnaA-lipid binding increased in a linear, parallel manner. Given that DnaA-membrane binding, the insertion of DnaA into the membrane, and the consequent nucleotide release all require anionic phospholipids, the acidic headgroup may be necessary to recruit DnaA protein to the membrane for insertion and subsequent reactivation for replication.

  11. Two distinct modes of metal ion binding in the nuclease active site of a viral DNA-packaging terminase: insight into the two-metal-ion catalytic mechanism

    PubMed Central

    Zhao, Haiyan; Lin, Zihan; Lynn, Anna Y.; Varnado, Brittany; Beutler, John A.; Murelli, Ryan P.; Le Grice, Stuart F. J.; Tang, Liang

    2015-01-01

    Many dsDNA viruses encode DNA-packaging terminases, each containing a nuclease domain that resolves concatemeric DNA into genome-length units. Terminase nucleases resemble the RNase H-superfamily nucleotidyltransferases in folds, and share a two-metal-ion catalytic mechanism. Here we show that residue K428 of a bacteriophage terminase gp2 nuclease domain mediates binding of the metal cofactor Mg2+. A K428A mutation allows visualization, at high resolution, of a metal ion binding mode with a coupled-octahedral configuration at the active site, exhibiting an unusually short metal-metal distance of 2.42 Å. Such proximity of the two metal ions may play an essential role in catalysis by generating a highly positive electrostatic niche to enable formation of the negatively charged pentacovalent phosphate transition state, and provides the structural basis for distinguishing Mg2+ from Ca2+. Using a metal ion chelator β-thujaplicinol as a molecular probe, we observed a second mode of metal ion binding at the active site, mimicking the DNA binding state. Arrangement of the active site residues differs drastically from those in RNase H-like nucleases, suggesting a drifting of the active site configuration during evolution. The two distinct metal ion binding modes unveiled mechanistic details of the two-metal-ion catalysis at atomic resolution. PMID:26450964

  12. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity*

    PubMed Central

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L.

    2015-01-01

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. PMID:25903123

  13. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Changela, Anita; DiGate, Russell J.; Mondragon, Alfonso

    Escherichia coli DNA topoisomerase III belongs to the type IA family of DNA topoisomerases, which transiently cleave single-stranded DNA (ssDNA) via a 5{prime} phosphotyrosine intermediate. We have solved crystal structures of wild-type E. coli topoisomerase III bound to an eight-base ssDNA molecule in three different pH environments. The structures reveal the enzyme in three distinct conformational states while bound to DNA. One conformation resembles the one observed previously with a DNA-bound, catalytically inactive mutant of topoisomerase III where DNA binding realigns catalytic residues to form a functional active site. Another conformation represents a novel intermediate in which DNA is boundmore » along the ssDNA-binding groove but does not enter the active site, which remains in a catalytically inactive, closed state. A third conformation shows an intermediate state where the enzyme is still in a closed state, but the ssDNA is starting to invade the active site. For the first time, the active site region in the presence of both the catalytic tyrosine and ssDNA substrate is revealed for a type IA DNA topoisomerase, although there is no evidence of ssDNA cleavage. Comparative analysis of the various conformational states suggests a sequence of domain movements undertaken by the enzyme upon substrate binding.« less

  14. Regulation of a Viral Proteinase by a Peptide and DNA in One-dimensional Space

    PubMed Central

    Graziano, Vito; Luo, Guobin; Blainey, Paul C.; Pérez-Berná, Ana J.; McGrath, William J.; Flint, S. Jane; San Martín, Carmen; Xie, X. Sunney; Mangel, Walter F.

    2013-01-01

    Late in an adenovirus infection, the viral proteinase (AVP) becomes activated to process virion precursor proteins used in virus assembly. AVP is activated by two cofactors, the viral DNA and pVIc, an 11-amino acid peptide originating from the C terminus of the precursor protein pVI. There is a conundrum in the activation of AVP in that AVP and pVI are sequence-independent DNA-binding proteins with nm equilibrium dissociation constants such that in the virus particle, they are predicted to be essentially irreversibly bound to the viral DNA. Here, we resolve that conundrum by showing that activation of AVP takes place on the one-dimensional contour of DNA. In vitro, pVI, a substrate, slides on DNA via one-dimensional diffusion, D1 = 1.45 × 106 bp2/s, until it binds to AVP also on the same DNA molecule. AVP, partially activated by being bound to DNA, excises pVIc, which binds to the AVP molecule that cut it out. pVIc then forms a disulfide bond with AVP forming the fully active AVP-pVIc complex bound to DNA. In vivo, in heat-disrupted immature virus, AVP was also activated by pVI in DNA-dependent reactions. This activation mechanism illustrates a new paradigm for virion maturation and a new way, by sliding on DNA, for bimolecular complexes to form among proteins not involved in DNA metabolism. PMID:23043137

  15. The prokaryotic enhancer binding protein NTRC has an ATPase activity which is phosphorylation and DNA dependent.

    PubMed Central

    Austin, S; Dixon, R

    1992-01-01

    The prokaryotic activator protein NTRC binds to enhancer-like elements and activates transcription in response to nitrogen limitation by catalysing open complex formation by sigma 54 RNA polymerase holoenzyme. Formation of open complexes requires the phosphorylated form of NTRC and the reaction is ATP dependent. We find that NTRC has an ATPase activity which is activated by phosphorylation and is strongly stimulated by the presence of DNA containing specific NTRC binding sites. Images PMID:1534752

  16. Differences in DNA Binding Specificity of Floral Homeotic Protein Complexes Predict Organ-Specific Target Genes.

    PubMed

    Smaczniak, Cezary; Muiño, Jose M; Chen, Dijun; Angenent, Gerco C; Kaufmann, Kerstin

    2017-08-01

    Floral organ identities in plants are specified by the combinatorial action of homeotic master regulatory transcription factors. However, how these factors achieve their regulatory specificities is still largely unclear. Genome-wide in vivo DNA binding data show that homeotic MADS domain proteins recognize partly distinct genomic regions, suggesting that DNA binding specificity contributes to functional differences of homeotic protein complexes. We used in vitro systematic evolution of ligands by exponential enrichment followed by high-throughput DNA sequencing (SELEX-seq) on several floral MADS domain protein homo- and heterodimers to measure their DNA binding specificities. We show that specification of reproductive organs is associated with distinct binding preferences of a complex formed by SEPALLATA3 and AGAMOUS. Binding specificity is further modulated by different binding site spacing preferences. Combination of SELEX-seq and genome-wide DNA binding data allows differentiation between targets in specification of reproductive versus perianth organs in the flower. We validate the importance of DNA binding specificity for organ-specific gene regulation by modulating promoter activity through targeted mutagenesis. Our study shows that intrafamily protein interactions affect DNA binding specificity of floral MADS domain proteins. Differential DNA binding of MADS domain protein complexes plays a role in the specificity of target gene regulation. © 2017 American Society of Plant Biologists. All rights reserved.

  17. NF-κB DNA-binding activity in embryos responding to a teratogen, cyclophosphamide

    PubMed Central

    Torchinsky, Arkady; Lishanski, Lucy; Wolstein, Orit; Shepshelovich, Jeanne; Orenstein, Hasida; Savion, Shoshana; Zaslavsky, Zeev; Carp, Howard; Brill, Alexander; Dikstein, Rivka; Toder, Vladimir; Fein, Amos

    2002-01-01

    Background The Rel/NF-κB transcription factors have been shown to regulate apoptosis in different cell types, acting as inducers or blockers in a stimuli- and cell type-dependent fashion. One of the Rel/NF-κB subunits, RelA, has been shown to be crucial for normal embryonic development, in which it functions in the embryonic liver as a protector against TNFα-induced physiological apoptosis. This study assesses whether NF-κB may be involved in the embryo's response to teratogens. Fot this, we evaluated how NF-KappaB DNA binding activity in embryonic organs demonstraiting differential sensitivity to a reference teratogen, cyclophosphamide, correlates with dysmorphic events induced by the teratogen at the cellular level (excessive apoptosis) and at the organ level (structural anomalies). Results The embryonic brain and liver were used as target organs. We observed that the Cyclophosphamide-induced excessive apoptosis in the brain, followed by the formation of severe craniofacial structural anomalies, was accompanied by suppression of NF-κB DNA-binding activity as well as by a significant and lasting increase in the activity of caspases 3 and 8. However, in the liver, in which cyclophosphamide induced transient apoptosis was not followed by dysmorphogenesis, no suppression of NF-κB DNA-binding activity was registered and the level of active caspases 3 and 8 was significantly lower than in the brain. It has also been observed that both the brain and liver became much more sensitive to the CP-induced teratogenic insult if the embryos were exposed to a combined treatment with the teratogen and sodium salicylate that suppressed NF-κB DNA-binding activity in these organs. Conclusion The results of this study demonstrate that suppression of NF-κB DNA-binding activity in embryos responding to the teratogenic insult may be associated with their decreased resistance to this insult. They also suggest that teratogens may suppress NF-κB DNA-binding activity in the embryonic tissues in an organ type- and dose-dependent fashion. PMID:11893254

  18. The C terminus of Ku80 activates the DNA-dependent protein kinase catalytic subunit.

    PubMed

    Singleton, B K; Torres-Arzayus, M I; Rottinghaus, S T; Taccioli, G E; Jeggo, P A

    1999-05-01

    Ku is a heterodimeric protein with double-stranded DNA end-binding activity that operates in the process of nonhomologous end joining. Ku is thought to target the DNA-dependent protein kinase (DNA-PK) complex to the DNA and, when DNA bound, can interact and activate the DNA-PK catalytic subunit (DNA-PKcs). We have carried out a 3' deletion analysis of Ku80, the larger subunit of Ku, and shown that the C-terminal 178 amino acid residues are dispensable for DNA end-binding activity but are required for efficient interaction of Ku with DNA-PKcs. Cells expressing Ku80 proteins that lack the terminal 178 residues have low DNA-PK activity, are radiation sensitive, and can recombine the signal junctions but not the coding junctions during V(D)J recombination. These cells have therefore acquired the phenotype of mouse SCID cells despite expressing DNA-PKcs protein, suggesting that an interaction between DNA-PKcs and Ku, involving the C-terminal region of Ku80, is required for DNA double-strand break rejoining and coding but not signal joint formation. To gain further insight into important domains in Ku80, we report a point mutational change in Ku80 in the defective xrs-2 cell line. This residue is conserved among species and lies outside of the previously reported Ku70-Ku80 interaction domain. The mutational change nonetheless abrogates the Ku70-Ku80 interaction and DNA end-binding activity.

  19. Arsenite binding-induced zinc loss from PARP-1 is equivalent to zinc deficiency in reducing PARP-1 activity, leading to inhibition of DNA repair

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sun, Xi; Zhou, Xixi; Du, Libo

    2014-01-15

    Inhibition of DNA repair is a recognized mechanism for arsenic enhancement of ultraviolet radiation-induced DNA damage and carcinogenesis. Poly(ADP-ribose) polymerase-1 (PARP-1), a zinc finger DNA repair protein, has been identified as a sensitive molecular target for arsenic. The zinc finger domains of PARP-1 protein function as a critical structure in DNA recognition and binding. Since cellular poly(ADP-ribosyl)ation capacity has been positively correlated with zinc status in cells, we hypothesize that arsenite binding-induced zinc loss from PARP-1 is equivalent to zinc deficiency in reducing PARP-1 activity, leading to inhibition of DNA repair. To test this hypothesis, we compared the effects ofmore » arsenite exposure with zinc deficiency, created by using the membrane-permeable zinc chelator TPEN, on 8-OHdG formation, PARP-1 activity and zinc binding to PARP-1 in HaCat cells. Our results show that arsenite exposure and zinc deficiency had similar effects on PARP-1 protein, whereas supplemental zinc reversed these effects. To investigate the molecular mechanism of zinc loss induced by arsenite, ICP-AES, near UV spectroscopy, fluorescence, and circular dichroism spectroscopy were utilized to examine arsenite binding and occupation of a peptide representing the first zinc finger of PARP-1. We found that arsenite binding as well as zinc loss altered the conformation of zinc finger structure which functionally leads to PARP-1 inhibition. These findings suggest that arsenite binding to PARP-1 protein created similar adverse biological effects as zinc deficiency, which establishes the molecular mechanism for zinc supplementation as a potentially effective treatment to reverse the detrimental outcomes of arsenic exposure. - Highlights: • Arsenite binding is equivalent to zinc deficiency in reducing PARP-1 function. • Zinc reverses arsenic inhibition of PARP-1 activity and enhancement of DNA damage. • Arsenite binding and zinc loss alter the conformation of zinc finger structure.« less

  20. Functional interaction of the DNA-binding transcription factor Sp1 through its DNA-binding domain with the histone chaperone TAF-I.

    PubMed

    Suzuki, Toru; Muto, Shinsuke; Miyamoto, Saku; Aizawa, Kenichi; Horikoshi, Masami; Nagai, Ryozo

    2003-08-01

    Transcription involves molecular interactions between general and regulatory transcription factors with further regulation by protein-protein interactions (e.g. transcriptional cofactors). Here we describe functional interaction between DNA-binding transcription factor and histone chaperone. Affinity purification of factors interacting with the DNA-binding domain of the transcription factor Sp1 showed Sp1 to interact with the histone chaperone TAF-I, both alpha and beta isoforms. This interaction was specific as Sp1 did not interact with another histone chaperone CIA nor did other tested DNA-binding regulatory factors (MyoD, NFkappaB, p53) interact with TAF-I. Interaction of Sp1 and TAF-I occurs both in vitro and in vivo. Interaction with TAF-I results in inhibition of DNA-binding, and also likely as a result of such, inhibition of promoter activation by Sp1. Collectively, we describe interaction between DNA-binding transcription factor and histone chaperone which results in negative regulation of the former. This novel regulatory interaction advances our understanding of the mechanisms of eukaryotic transcription through DNA-binding regulatory transcription factors by protein-protein interactions, and also shows the DNA-binding domain to mediate important regulatory interactions.

  1. Role of the DNA Damage Response in Human Papillomavirus RNA Splicing and Polyadenylation.

    PubMed

    Nilsson, Kersti; Wu, Chengjun; Schwartz, Stefan

    2018-06-12

    Human papillomaviruses (HPVs) have evolved to use the DNA repair machinery to replicate its DNA genome in differentiated cells. HPV activates the DNA damage response (DDR) in infected cells. Cellular DDR factors are recruited to the HPV DNA genome and position the cellular DNA polymerase on the HPV DNA and progeny genomes are synthesized. Following HPV DNA replication, HPV late gene expression is activated. Recent research has shown that the DDR factors also interact with RNA binding proteins and affects RNA processing. DDR factors activated by DNA damage and that associate with HPV DNA can recruit splicing factors and RNA binding proteins to the HPV DNA and induce HPV late gene expression. This induction is the result of altered alternative polyadenylation and splicing of HPV messenger RNA (mRNA). HPV uses the DDR machinery to replicate its DNA genome and to activate HPV late gene expression at the level of RNA processing.

  2. Structure of Escherichia coli dGTP Triphosphohydrolase: A Hexameric Enzyme with DNA Effector Molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Singh, Deepa; Gawel, Damian; Itsko, Mark

    The Escherichia coli dgt gene encodes a dGTP triphosphohydrolase whose detailed role still remains to be determined. Deletion of dgt creates a mutator phenotype, indicating that the dGTPase has a fidelity role, possibly by affecting the cellular dNTP pool. In the present paper, we have investigated the structure of the Dgt protein at 3.1-Å resolution. One of the obtained structures revealed a protein hexamer that contained two molecules of single-stranded DNA. The presence of DNA caused significant conformational changes in the enzyme, including in the catalytic site of the enzyme. Dgt preparations lacking DNA were able to bind single-stranded DNAmore » with high affinity (K d ~ 50 nM). DNA binding positively affected the activity of the enzyme: dGTPase activity displayed sigmoidal (cooperative) behavior without DNA but hyperbolic (Michaelis-Menten) kinetics in its presence, consistent with a specific lowering of the apparent K m for dGTP. A mutant Dgt enzyme was also created containing residue changes in the DNA binding cleft. This mutant enzyme, whereas still active, was incapable of DNA binding and could no longer be stimulated by addition of DNA. We also created an E. coli strain containing the mutant dgt gene on the chromosome replacing the wild-type gene. The mutant also displayed a mutator phenotype. Finally, our results provide insight into the allosteric regulation of the enzyme and support a physiologically important role of DNA binding.« less

  3. Structure of Escherichia coli dGTP Triphosphohydrolase: A Hexameric Enzyme with DNA Effector Molecules

    DOE PAGES

    Singh, Deepa; Gawel, Damian; Itsko, Mark; ...

    2015-02-18

    The Escherichia coli dgt gene encodes a dGTP triphosphohydrolase whose detailed role still remains to be determined. Deletion of dgt creates a mutator phenotype, indicating that the dGTPase has a fidelity role, possibly by affecting the cellular dNTP pool. In the present paper, we have investigated the structure of the Dgt protein at 3.1-Å resolution. One of the obtained structures revealed a protein hexamer that contained two molecules of single-stranded DNA. The presence of DNA caused significant conformational changes in the enzyme, including in the catalytic site of the enzyme. Dgt preparations lacking DNA were able to bind single-stranded DNAmore » with high affinity (K d ~ 50 nM). DNA binding positively affected the activity of the enzyme: dGTPase activity displayed sigmoidal (cooperative) behavior without DNA but hyperbolic (Michaelis-Menten) kinetics in its presence, consistent with a specific lowering of the apparent K m for dGTP. A mutant Dgt enzyme was also created containing residue changes in the DNA binding cleft. This mutant enzyme, whereas still active, was incapable of DNA binding and could no longer be stimulated by addition of DNA. We also created an E. coli strain containing the mutant dgt gene on the chromosome replacing the wild-type gene. The mutant also displayed a mutator phenotype. Finally, our results provide insight into the allosteric regulation of the enzyme and support a physiologically important role of DNA binding.« less

  4. RNA binding to APOBEC3G induces the disassembly of functional deaminase complexes by displacing single-stranded DNA substrates

    PubMed Central

    Polevoda, Bogdan; McDougall, William M.; Tun, Bradley N.; Cheung, Michael; Salter, Jason D.; Friedman, Alan E.; Smith, Harold C.

    2015-01-01

    APOBEC3G (A3G) DNA deaminase activity requires a holoenzyme complex whose assembly on nascent viral reverse transcripts initiates with A3G dimers binding to ssDNA followed by formation of higher-order A3G homo oligomers. Catalytic activity is inhibited when A3G binds to RNA. Our prior studies suggested that RNA inhibited A3G binding to ssDNA. In this report, near equilibrium binding and gel shift analyses showed that A3G assembly and disassembly on ssDNA was an ordered process involving A3G dimers and multimers thereof. Although, fluorescence anisotropy showed that A3G had similar nanomolar affinity for RNA and ssDNA, RNA stochastically dissociated A3G dimers and higher-order oligomers from ssDNA, suggesting a different modality for RNA binding. Mass spectrometry mapping of A3G peptides cross-linked to nucleic acid suggested ssDNA only bound to three peptides, amino acids (aa) 181–194 in the N-terminus and aa 314–320 and 345–374 in the C-terminus that were part of a continuous exposed surface. RNA bound to these peptides and uniquely associated with three additional peptides in the N- terminus, aa 15–29, 41–52 and 83–99, that formed a continuous surface area adjacent to the ssDNA binding surface. The data predict a mechanistic model of RNA inhibition of ssDNA binding to A3G in which competitive and allosteric interactions determine RNA-bound versus ssDNA-bound conformational states. PMID:26424853

  5. Reduced DNA repair in mouse satellite DNA after treatment with methylmethanesulfonate, and N-methyl-N-nitrosourea.

    PubMed Central

    Bodell, W J; Banerjee, M R

    1976-01-01

    We have measured DNA repair in mouse satellite and main band DNA as resolved by Ag+-Cs2SO4 centrifugation in response to treatment with the alkylating agents, methyl methanesulfonate, and N-methyl-N-nitrosourea. We find that there is a statistically significant lower incorporation of 3H-Tdr into the satellite DNA as compared to the main band at varying periods after treatment with the alkylating agents. This suggests a reduced repair activity in the satellite DNA. We have measured the extent of binding of 14C-methyl methanesulfonate to the satellite, and main band DNA, and no difference in binding was observed, indicating that the reduced repair activity of satellite DNA is not due to a difference in binding of alkylating agents. We believe that the reduced incorporation of 3H-Tdr into satellite DNA may be due to its location in the condensed chromatin fraction. PMID:184436

  6. Analysis of the DNA-Binding Activities of the Arabidopsis R2R3-MYB Transcription Factor Family by One-Hybrid Experiments in Yeast

    PubMed Central

    Kelemen, Zsolt; Sebastian, Alvaro; Xu, Wenjia; Grain, Damaris; Salsac, Fabien; Avon, Alexandra; Berger, Nathalie; Tran, Joseph; Dubreucq, Bertrand; Lurin, Claire; Lepiniec, Loïc; Contreras-Moreira, Bruno; Dubos, Christian

    2015-01-01

    The control of growth and development of all living organisms is a complex and dynamic process that requires the harmonious expression of numerous genes. Gene expression is mainly controlled by the activity of sequence-specific DNA binding proteins called transcription factors (TFs). Amongst the various classes of eukaryotic TFs, the MYB superfamily is one of the largest and most diverse, and it has considerably expanded in the plant kingdom. R2R3-MYBs have been extensively studied over the last 15 years. However, DNA-binding specificity has been characterized for only a small subset of these proteins. Therefore, one of the remaining challenges is the exhaustive characterization of the DNA-binding specificity of all R2R3-MYB proteins. In this study, we have developed a library of Arabidopsis thaliana R2R3-MYB open reading frames, whose DNA-binding activities were assayed in vivo (yeast one-hybrid experiments) with a pool of selected cis-regulatory elements. Altogether 1904 interactions were assayed leading to the discovery of specific patterns of interactions between the various R2R3-MYB subgroups and their DNA target sequences and to the identification of key features that govern these interactions. The present work provides a comprehensive in vivo analysis of R2R3-MYB binding activities that should help in predicting new DNA motifs and identifying new putative target genes for each member of this very large family of TFs. In a broader perspective, the generated data will help to better understand how TF interact with their target DNA sequences. PMID:26484765

  7. Hairpin-shaped tetranuclear palladium(II) complex: synthesis, crystal structure, DNA binding and cytotoxicity activity studies.

    PubMed

    Gao, En-Jun; Wang, Ke-Hua; Zhu, Ming-Chang; Liu, Lei

    2010-07-01

    A novel tetranuclear palladium(II) complex [Pd(4)(phen)(4) (micro-pydc)(4)].10H(2)O (phen = 1,10-phenanthroline, pydc = pyridine-3,4-dicarboxylate) has been synthesized and characterized. In the tetranuclear complex, two pairs of dipalladated [Pd(phen)] moieties are bridged together by four pydc, presenting a hairpin molecular shape. The binding of the title complex with fish sperm DNA (FS-DNA) has been investigated by UV spectrum and fluorescence spectrum. All the results indicate that the complex bind to DNA in an intercalative mode and considerating the molecular shape and size, the dipalladated phenanthroline moieties bisintercalate to the base pairs of DNA. Agarose gel electrophoresis assay demonstrates the ability of the complex to cleave the pBR322 plasmid DNA. Cytotoxic activity studies show the complex exhibited good cytotoxic activity against four different cancer cell lines. Crown Copyright (c) 2010. Published by Elsevier Masson SAS. All rights reserved.

  8. Tetrameric Ctp1 coordinates DNA binding and DNA bridging in DNA double-strand-break repair

    DOE PAGES

    Andres, Sara N.; Appel, C. Denise; Westmoreland, James W.; ...

    2015-01-12

    Ctp1 (also known as CtIP or Sae2) collaborates with Mre11-Rad50-Nbs1 to initiate repair of DNA double-strand breaks (DSBs), but its functions remain enigmatic. In this paper, we report that tetrameric Schizosaccharomyces pombe Ctp1 contains multivalent DNA-binding and DNA-bridging activities. Through structural and biophysical analyses of the Ctp1 tetramer, we define the salient features of Ctp1 architecture: an N-terminal interlocking tetrameric helical dimer-of-dimers (THDD) domain and a central intrinsically disordered region (IDR) linked to C-terminal 'RHR' DNA-interaction motifs. The THDD, IDR and RHR are required for Ctp1 DNA-bridging activity in vitro, and both the THDD and RHR are required for efficientmore » DSB repair in S. pombe. Finally, our results establish non-nucleolytic roles of Ctp1 in binding and coordination of DSB-repair intermediates and suggest that ablation of human CtIP DNA binding by truncating mutations underlie the CtIP-linked Seckel and Jawad syndromes.« less

  9. Expression of simian virus 40 T antigen in Escherichia coli: localization of T-antigen origin DNA-binding domain to within 129 amino acids.

    PubMed Central

    Arthur, A K; Höss, A; Fanning, E

    1988-01-01

    The genomic coding sequence of the large T antigen of simian virus 40 (SV40) was cloned into an Escherichia coli expression vector by joining new restriction sites, BglII and BamHI, introduced at the intron boundaries of the gene. Full-length large T antigen, as well as deletion and amino acid substitution mutants, were inducibly expressed from the lac promoter of pUC9, albeit with different efficiencies and protein stabilities. Specific interaction with SV40 origin DNA was detected for full-length T antigen and certain mutants. Deletion mutants lacking T-antigen residues 1 to 130 and 260 to 708 retained specific origin-binding activity, demonstrating that the region between residues 131 and 259 must carry the essential binding domain for DNA-binding sites I and II. A sequence between residues 302 and 320 homologous to a metal-binding "finger" motif is therefore not required for origin-specific binding. However, substitution of serine for either of two cysteine residues in this motif caused a dramatic decrease in origin DNA-binding activity. This region, as well as other regions of the full-length protein, may thus be involved in stabilizing the DNA-binding domain and altering its preference for binding to site I or site II DNA. Images PMID:2835505

  10. Porcine bocavirus NP1 negatively regulates interferon signaling pathway by targeting the DNA-binding domain of IRF9

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Ruoxi; The Cooperative Innovation Center for Sustainable Pig Production, Wuhan 430070; Fang, Liurong, E-mail: fanglr@mail.hzau.edu.cn

    2015-11-15

    To subvert host antiviral immune responses, many viruses have evolved countermeasures to inhibit IFN signaling pathway. Porcine bocavirus (PBoV), a newly identified porcine parvovirus, has received attention because it shows clinically high co-infection prevalence with other pathogens in post-weaning multisystemic wasting syndrome (PWMS) and diarrheic piglets. In this study, we screened the structural and non-structural proteins encoded by PBoV and found that the non-structural protein NP1 significantly suppressed IFN-stimulated response element (ISRE) activity and subsequent IFN-stimulated gene (ISG) expression. However, NP1 affected neither the activation and translocation of STAT1/STAT2, nor the formation of the heterotrimeric transcription factor complex ISGF3 (STAT1/STAT2/IRF9).more » Detailed analysis demonstrated that PBoV NP1 blocked the ISGF3 DNA-binding activity by combining with the DNA-binding domain (DBD) of IRF9. In summary, these results indicate that PBoV NP1 interferes with type I IFN signaling pathway by blocking DNA binding of ISGF3 to attenuate innate immune responses. - Highlights: • Porcine bocavirus (PBoV) NP1 interferes with the IFN α/β signaling pathway. • PBoV NP1 does not prevent STAT1/STAT2 phosphorylation and nuclear translocation. • PBoV NP1 inhibits the DNA-binding activity of ISGF3. • PBoV NP1 interacts with the DNA-binding domain of IRF9.« less

  11. A new method for the construction of a mutant library with a predictable occurrence rate using Poisson distribution.

    PubMed

    Seong, Ki Moon; Park, Hweon; Kim, Seong Jung; Ha, Hyo Nam; Lee, Jae Yung; Kim, Joon

    2007-06-01

    A yeast transcriptional activator, Gcn4p, induces the expression of genes that are involved in amino acid and purine biosynthetic pathways under amino acid starvation. Gcn4p has an acidic activation domain in the central region and a bZIP domain in the C-terminus that is divided into the DNA-binding motif and dimerization leucine zipper motif. In order to identify amino acids in the DNA-binding motif of Gcn4p which are involved in transcriptional activation, we constructed mutant libraries in the DNA-binding motif through an innovative application of random mutagenesis. Mutant library made by oligonucleotides which were mutated randomly using the Poisson distribution showed that the actual mutation frequency was in good agreement with expected values. This method could save the time and effort to create a mutant library with a predictable mutation frequency. Based on the studies using the mutant libraries constructed by the new method, the specific residues of the DNA-binding domain in Gcn4p appear to be involved in the transcriptional activities on a conserved binding site.

  12. DNA breathing dynamics distinguish binding from nonbinding consensus sites for transcription factor YY1 in cells.

    PubMed

    Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny

    2012-11-01

    The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.

  13. Timely binding of IHF and Fis to DARS2 regulates ATP–DnaA production and replication initiation

    PubMed Central

    Kasho, Kazutoshi; Fujimitsu, Kazuyuki; Matoba, Toshihiro; Oshima, Taku; Katayama, Tsutomu

    2014-01-01

    In Escherichia coli, the ATP-bound form of DnaA (ATP–DnaA) promotes replication initiation. During replication, the bound ATP is hydrolyzed to ADP to yield the ADP-bound form (ADP–DnaA), which is inactive for initiation. The chromosomal site DARS2 facilitates the regeneration of ATP–DnaA by catalyzing nucleotide exchange between free ATP and ADP bound to DnaA. However, the regulatory mechanisms governing this exchange reaction are unclear. Here, using in vitro reconstituted experiments, we show that two nucleoid-associated proteins, IHF and Fis, bind site-specifically to DARS2 to activate coordinately the exchange reaction. The regenerated ATP–DnaA was fully active in replication initiation and underwent DnaA–ATP hydrolysis. ADP–DnaA formed heteromultimeric complexes with IHF and Fis on DARS2, and underwent nucleotide dissociation more efficiently than ATP–DnaA. Consistently, mutant analyses demonstrated that specific binding of IHF and Fis to DARS2 stimulates the formation of ATP–DnaA production, thereby promoting timely initiation. Moreover, we show that IHF–DARS2 binding is temporally regulated during the cell cycle, whereas Fis only binds to DARS2 in exponentially growing cells. These results elucidate the regulation of ATP–DnaA and replication initiation in coordination with the cell cycle and growth phase. PMID:25378325

  14. Structural Studies of E. coli Topoisomerase III-DNA Complexes Reveal A Novel Type IA Topoisomerase-DNA Conformational Intermediate

    PubMed Central

    Changela, Anita; DiGate, Russell J.; Mondragón, Alfonso

    2007-01-01

    Summary E. coli DNA topoisomerase III belongs to the type IA family of DNA topoisomerases, which transiently cleave single-stranded DNA (ssDNA) via a 5′ phosphotyrosine intermediate. We have solved crystal structures of wild-type E. coli topoisomerase III bound to an 8-base ssDNA molecule in three different pH environments. The structures reveal the enzyme in three distinct conformational states while bound to DNA. One conformation resembles the one observed previously with a DNA-bound, catalytically inactive mutant of topoisomerase III where DNA binding realigns catalytic residues to form a functional active site. Another conformation represents a novel intermediate in which DNA is bound along the ssDNA-binding groove but does not enter the active site, which remains in a catalytically inactive, closed state. A third conformation shows an intermediate state where the enzyme is still in a closed state, but the ssDNA is starting to invade the active site. For the first time, the active site region in the presence of both the catalytic tyrosine and ssDNA substrate is revealed for a type IA DNA topoisomerase, although there is no evidence of ssDNA cleavage. Comparative analysis of the various conformational states suggests a sequence of domain movements undertaken by the enzyme upon substrate binding. PMID:17331537

  15. Isohelical DNA-Binding Oligomers: Antiviral Activity and Application for the Design of Nanostructured Devices

    NASA Astrophysics Data System (ADS)

    Gursky, Georgy; Nikitin, Alexei; Surovaya, Anna; Grokhovsky, Sergey; Andronova, Valeria; Galegov, Georgy

    We performed a systematic search for new structural motifs isohelical to double-stranded DNA and found five motifs that can be used for the design and synthesis of new DNA-binding oligomers. Some of the DNA-binding oligomers can be equipped with fluorescence chromophores and metal-chelating groups and may serve as conductive wires in nano-scaled electric circuits. A series of new DNA-binding ligands were synthesized by a modular assembly of pyrrole carboxamides and novel pseudopeptides of the form (XY)n. Here, Y is a glycine residue; n is the degree of polymerization. X is an unusual amino acid residue containing a five-membered aromatic ring. Antiviral activity of bis-linked netropsin derivatives is studied. Bis-netropsins containing 15 and 31 lysine residues at the N-termini inhibit most effectively reproduction of the herpes virus type 1 in the Vero cell culture, including virus variants resistant to acyclovir and its analogues. Antiviral activity of bis-linked netropsin derivatives is correlated with their ability to interact with long clusters of AT-base pairs in the origin of replication of the viral DNA.

  16. CHD3 and CHD4 recruitment and chromatin remodeling activity at DNA breaks is promoted by early poly(ADP-ribose)-dependent chromatin relaxation.

    PubMed

    Smith, Rebecca; Sellou, Hafida; Chapuis, Catherine; Huet, Sébastien; Timinszky, Gyula

    2018-05-04

    One of the first events to occur upon DNA damage is the local opening of the compact chromatin architecture, facilitating access of repair proteins to DNA lesions. This early relaxation is triggered by poly(ADP-ribosyl)ation by PARP1 in addition to ATP-dependent chromatin remodeling. CHD4 recruits to DNA breaks in a PAR-dependent manner, although it lacks any recognizable PAR-binding domain, and has the ability to relax chromatin structure. However, its role in chromatin relaxation at the site of DNA damage has not been explored. Using a live cell fluorescence three-hybrid assay, we demonstrate that the recruitment of CHD4 to DNA damage, while being poly(ADP-ribosyl)ation-dependent, is not through binding poly(ADP-ribose). Additionally, we show that CHD3 is recruited to DNA breaks in the same manner as CHD4 and that both CHD3 and CHD4 play active roles in chromatin remodeling at DNA breaks. Together, our findings reveal a two-step mechanism for DNA damage induced chromatin relaxation in which PARP1 and the PAR-binding remodeler activities of Alc1/CHD1L induce an initial chromatin relaxation phase that promotes the subsequent recruitment of CHD3 and CHD4 via binding to DNA for further chromatin remodeling at DNA breaks.

  17. A Link between ORC-Origin Binding Mechanisms and Origin Activation Time Revealed in Budding Yeast

    PubMed Central

    Hoggard, Timothy; Shor, Erika; Müller, Carolin A.; Nieduszynski, Conrad A.; Fox, Catherine A.

    2013-01-01

    Eukaryotic DNA replication origins are selected in G1-phase when the origin recognition complex (ORC) binds chromosomal positions and triggers molecular events culminating in the initiation of DNA replication (a.k.a. origin firing) during S-phase. Each chromosome uses multiple origins for its duplication, and each origin fires at a characteristic time during S-phase, creating a cell-type specific genome replication pattern relevant to differentiation and genome stability. It is unclear whether ORC-origin interactions are relevant to origin activation time. We applied a novel genome-wide strategy to classify origins in the model eukaryote Saccharomyces cerevisiae based on the types of molecular interactions used for ORC-origin binding. Specifically, origins were classified as DNA-dependent when the strength of ORC-origin binding in vivo could be explained by the affinity of ORC for origin DNA in vitro, and, conversely, as ‘chromatin-dependent’ when the ORC-DNA interaction in vitro was insufficient to explain the strength of ORC-origin binding in vivo. These two origin classes differed in terms of nucleosome architecture and dependence on origin-flanking sequences in plasmid replication assays, consistent with local features of chromatin promoting ORC binding at ‘chromatin-dependent’ origins. Finally, the ‘chromatin-dependent’ class was enriched for origins that fire early in S-phase, while the DNA-dependent class was enriched for later firing origins. Conversely, the latest firing origins showed a positive association with the ORC-origin DNA paradigm for normal levels of ORC binding, whereas the earliest firing origins did not. These data reveal a novel association between ORC-origin binding mechanisms and the regulation of origin activation time. PMID:24068963

  18. The UL5 and UL52 subunits of the herpes simplex virus type 1 helicase-primase subcomplex exhibit a complex interdependence for DNA binding.

    PubMed

    Biswas, N; Weller, S K

    2001-05-18

    Herpes simplex virus type 1 encodes a heterotrimeric helicase-primase complex composed of the products of the UL5, UL52, and UL8 genes. The UL5 protein contains seven motifs found in all members of helicase Superfamily 1 (SF1), and the UL52 protein contains several conserved motifs found in primases; however, the contributions of each subunit to the biochemical activities of the subcomplex are not clear. In this work, the DNA binding properties of wild type and mutant subcomplexes were examined using single-stranded, duplex, and forked substrates. A gel mobility shift assay indicated that the UL5-UL52 subcomplex binds more efficiently to the forked substrate than to either single strand or duplex DNA. Although nucleotides are not absolutely required for DNA binding, ADP stimulated the binding of UL5-UL52 to single strand DNA whereas ATP, ADP, and adenosine 5'-O-(thiotriphosphate) stimulated the binding to a forked substrate. We have previously shown that both subunits contact single-stranded DNA in a photocross-linking assay (Biswas, N., and Weller, S. K. (1999) J. Biol. Chem. 274, 8068-8076). In this study, photocross-linking assays with forked substrates indicate that the UL5 and UL52 subunits contact the forked substrates at different positions, UL52 at the single-stranded DNA tail and UL5 near the junction between single-stranded and double-stranded DNA. Neither subunit was able to cross-link a forked substrate when 5-iododeoxyuridine was located within the duplex portion. Photocross-linking experiments with subcomplexes containing mutant versions of UL5 and wild type UL52 indicated that the integrity of the ATP binding region is important for DNA binding of both subunits. These results support our previous proposal that UL5 and UL52 exhibit a complex interdependence for DNA binding (Biswas, N., and Weller, S. K. (1999) J. Biol. Chem. 274, 8068-8076) and indicate that the UL52 subunit may play a more active role in helicase activity than had previously been thought.

  19. Conformational control and DNA-binding mechanism of the metazoan origin recognition complex.

    PubMed

    Bleichert, Franziska; Leitner, Alexander; Aebersold, Ruedi; Botchan, Michael R; Berger, James M

    2018-06-26

    In eukaryotes, the heterohexameric origin recognition complex (ORC) coordinates replication onset by facilitating the recruitment and loading of the minichromosome maintenance 2-7 (Mcm2-7) replicative helicase onto DNA to license origins. Drosophila ORC can adopt an autoinhibited configuration that is predicted to prevent Mcm2-7 loading; how the complex is activated and whether other ORC homologs can assume this state are not known. Using chemical cross-linking and mass spectrometry, biochemical assays, and electron microscopy (EM), we show that the autoinhibited state of Drosophila ORC is populated in solution, and that human ORC can also adopt this form. ATP binding to ORC supports a transition from the autoinhibited state to an active configuration, enabling the nucleotide-dependent association of ORC with both DNA and Cdc6. An unstructured N-terminal region adjacent to the conserved ATPase domain of Orc1 is shown to be required for high-affinity ORC-DNA interactions, but not for activation. ORC optimally binds DNA duplexes longer than the predicted footprint of the ORC ATPases associated with a variety of cellular activities (AAA + ) and winged-helix (WH) folds; cryo-EM analysis of Drosophila ORC bound to DNA and Cdc6 indicates that ORC contacts DNA outside of its central core region, bending the DNA away from its central DNA-binding channel. Our findings indicate that ORC autoinhibition may be common to metazoans and that ORC-Cdc6 remodels origin DNA before Mcm2-7 recruitment and loading.

  20. MMPP Attenuates Non-Small Cell Lung Cancer Growth by Inhibiting the STAT3 DNA-Binding Activity via Direct Binding to the STAT3 DNA-Binding Domain.

    PubMed

    Son, Dong Ju; Zheng, Jie; Jung, Yu Yeon; Hwang, Chul Ju; Lee, Hee Pom; Woo, Ju Rang; Baek, Song Yi; Ham, Young Wan; Kang, Min Woong; Shong, Minho; Kweon, Gi Ryang; Song, Min Jong; Jung, Jae Kyung; Han, Sang-Bae; Kim, Bo Yeon; Yoon, Do Young; Choi, Bu Young; Hong, Jin Tae

    2017-01-01

    Rationale: Signal transducer and activator of transcription-3 (STAT3) plays a pivotal role in cancer biology. Many small-molecule inhibitors that target STAT3 have been developed as potential anticancer drugs. While designing small-molecule inhibitors that target the SH2 domain of STAT3 remains the leading focus for drug discovery, there has been a growing interest in targeting the DNA-binding domain (DBD) of the protein. Methods: We demonstrated the potential antitumor activity of a novel, small-molecule (E)-2-methoxy-4-(3-(4-methoxyphenyl)prop-1-en-1-yl)phenol (MMPP) that directly binds to the DBD of STAT3, in patient-derived non-small cell lung cancer (NSCLC) xenograft model as well as in NCI-H460 cell xenograft model in nude mice. Results: MMPP effectively inhibited the phosphorylation of STAT3 and its DNA binding activity in vitro and in vivo . It induced G1-phase cell cycle arrest and apoptosis through the regulation of cell cycle- and apoptosis-regulating genes by directly binding to the hydroxyl residue of threonine 456 in the DBD of STAT3. Furthermore, MMPP showed a similar or better antitumor activity than that of docetaxel or cisplatin. Conclusion: MMPP is suggested to be a potential candidate for further development as an anticancer drug that targets the DBD of STAT3.

  1. Anti-dsDNA Antibodies Bind to Mesangial Annexin II in Lupus Nephritis

    PubMed Central

    Yung, Susan; Cheung, Kwok Fan; Zhang, Qing

    2010-01-01

    Production of anti-dsDNA antibodies is a hallmark of lupus nephritis, but how these antibodies deposit in organs and elicit inflammatory damage remains unknown. In this study, we sought to identify antigens on the surface of human mesangial cells (HMC) that mediate the binding of human anti-dsDNA antibodies and the subsequent pathogenic processes. We isolated anti-dsDNA antibodies from patients with lupus nephritis by affinity chromatography. We used multiple methods to identify and characterize antigens from the plasma membrane fraction of mesangial cells that crossreacted with the anti-dsDNA antibodies. We found that annexin II mediated the binding of anti-dsDNA antibodies to HMC. After binding to the mesangial cell surface, anti-dsDNA antibodies were internalized into the cytoplasm and nucleus. This also led to induction of IL-6 secretion and annexin II synthesis, mediated through activation of p38 MAPK, JNK, and AKT. Binding of anti-dsDNA antibodies to annexin II correlated with disease activity in human lupus nephritis. Glomerular expression of annexin II correlated with the severity of nephritis, and annexin II colocalized with IgG and C3 deposits in both human and murine lupus nephritis. Gene silencing of annexin II in HMC reduced binding of anti-dsDNA antibody and partially decreased IL-6 secretion. In summary, our data demonstrate that annexin II mediates the binding of anti-dsDNA antibodies to mesangial cells, contributing to the pathogenesis of lupus nephritis. This interaction provides a potential target for therapeutic intervention. PMID:20847146

  2. Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

    DOEpatents

    McCutchen-Maloney, Sandra L.

    2002-01-01

    DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

  3. Mutations in the Putative Zinc-Binding Motif of UL52 Demonstrate a Complex Interdependence between the UL5 and UL52 Subunits of the Human Herpes Simplex Virus Type 1 Helicase/Primase Complex

    PubMed Central

    Chen, Yan; Carrington-Lawrence, Stacy D.; Bai, Ping; Weller, Sandra K.

    2005-01-01

    Herpes simplex virus type 1 (HSV-1) encodes a heterotrimeric helicase-primase (UL5/8/52) complex. UL5 contains seven motifs found in helicase superfamily 1, and UL52 contains conserved motifs found in primases. The contributions of each subunit to the biochemical activities of the complex, however, remain unclear. We have previously demonstrated that a mutation in the putative zinc finger at UL52 C terminus abrogates not only primase but also ATPase, helicase, and DNA-binding activities of a UL5/UL52 subcomplex, indicating a complex interdependence between the two subunits. To test this hypothesis and to further investigate the role of the zinc finger in the enzymatic activities of the helicase-primase, a series of mutations were constructed in this motif. They differed in their ability to complement a UL52 null virus: totally defective, partial complementation, and potentiating. In this study, four of these mutants were studied biochemically after expression and purification from insect cells infected with recombinant baculoviruses. All mutants show greatly reduced primase activity. Complementation-defective mutants exhibited severe defects in ATPase, helicase, and DNA-binding activities. Partially complementing mutants displayed intermediate levels of these activities, except that one showed a wild-type level of helicase activity. These data suggest that the UL52 zinc finger motif plays an important role in the activities of the helicase-primase complex. The observation that mutations in UL52 affected helicase, ATPase, and DNA-binding activities indicates that UL52 binding to DNA via the zinc finger may be necessary for loading UL5. Alternatively, UL5 and UL52 may share a DNA-binding interface. PMID:15994803

  4. Mutations in the putative zinc-binding motif of UL52 demonstrate a complex interdependence between the UL5 and UL52 subunits of the human herpes simplex virus type 1 helicase/primase complex.

    PubMed

    Chen, Yan; Carrington-Lawrence, Stacy D; Bai, Ping; Weller, Sandra K

    2005-07-01

    Herpes simplex virus type 1 (HSV-1) encodes a heterotrimeric helicase-primase (UL5/8/52) complex. UL5 contains seven motifs found in helicase superfamily 1, and UL52 contains conserved motifs found in primases. The contributions of each subunit to the biochemical activities of the complex, however, remain unclear. We have previously demonstrated that a mutation in the putative zinc finger at UL52 C terminus abrogates not only primase but also ATPase, helicase, and DNA-binding activities of a UL5/UL52 subcomplex, indicating a complex interdependence between the two subunits. To test this hypothesis and to further investigate the role of the zinc finger in the enzymatic activities of the helicase-primase, a series of mutations were constructed in this motif. They differed in their ability to complement a UL52 null virus: totally defective, partial complementation, and potentiating. In this study, four of these mutants were studied biochemically after expression and purification from insect cells infected with recombinant baculoviruses. All mutants show greatly reduced primase activity. Complementation-defective mutants exhibited severe defects in ATPase, helicase, and DNA-binding activities. Partially complementing mutants displayed intermediate levels of these activities, except that one showed a wild-type level of helicase activity. These data suggest that the UL52 zinc finger motif plays an important role in the activities of the helicase-primase complex. The observation that mutations in UL52 affected helicase, ATPase, and DNA-binding activities indicates that UL52 binding to DNA via the zinc finger may be necessary for loading UL5. Alternatively, UL5 and UL52 may share a DNA-binding interface.

  5. A comprehensive approach to ascertain the binding mode of curcumin with DNA

    NASA Astrophysics Data System (ADS)

    Haris, P.; Mary, Varughese; Aparna, P.; Dileep, K. V.; Sudarsanakumar, C.

    2017-03-01

    Curcumin is a natural phytochemical from the rhizoma of Curcuma longa, the popular Indian spice that exhibits a wide range of pharmacological properties like antioxidant, anticancer, anti-inflammatory, antitumor, and antiviral activities. In the published literatures we can see different studies and arguments on the interaction of curcumin with DNA. The intercalative binding, groove binding and no binding of curcumin with DNA were reported. In this context, we conducted a detailed study to understand the mechanism of recognition of dimethylsulfoxide-solubilized curcumin by DNA. The interaction of curcumin with calf thymus DNA (ctDNA) was confirmed by agarose gel electrophoresis. The nature of binding and energetics of interaction were studied by Isothermal Titration Calorimetry (ITC), Differential Scanning Calorimetry (DSC), UV-visible, fluorescence and melting temperature (Tm) analysis. The experimental data were compared with molecular modeling studies. Our investigation confirmed that dimethylsulfoxide-solubilized curcumin binds in the minor groove of the ctDNA without causing significant structural alteration to the DNA.

  6. Tunable regulation of CREB DNA binding activity couples genotoxic stress response and metabolism

    PubMed Central

    Kim, Sang Hwa; Trinh, Anthony T.; Larsen, Michele Campaigne; Mastrocola, Adam S.; Jefcoate, Colin R.; Bushel, Pierre R.; Tibbetts, Randal S.

    2016-01-01

    cAMP response element binding protein (CREB) is a key regulator of glucose metabolism and synaptic plasticity that is canonically regulated through recruitment of transcriptional coactivators. Here we show that phosphorylation of CREB on a conserved cluster of Ser residues (the ATM/CK cluster) by the DNA damage-activated protein kinase ataxia-telangiectasia-mutated (ATM) and casein kinase1 (CK1) and casein kinase2 (CK2) positively and negatively regulates CREB-mediated transcription in a signal dependent manner. In response to genotoxic stress, phosphorylation of the ATM/CK cluster inhibited CREB-mediated gene expression, DNA binding activity and chromatin occupancy proportional to the number of modified Ser residues. Paradoxically, substoichiometric, ATM-independent, phosphorylation of the ATM/CK cluster potentiated bursts in CREB-mediated transcription by promoting recruitment of the CREB coactivator, cAMP-regulated transcriptional coactivators (CRTC2). Livers from mice expressing a non-phosphorylatable CREB allele failed to attenuate gluconeogenic genes in response to DNA damage or fully activate the same genes in response to glucagon. We propose that phosphorylation-dependent regulation of DNA binding activity evolved as a tunable mechanism to control CREB transcriptional output and promote metabolic homeostasis in response to rapidly changing environmental conditions. PMID:27431323

  7. Activator Protein-1: redox switch controlling structure and DNA-binding.

    PubMed

    Yin, Zhou; Machius, Mischa; Nestler, Eric J; Rudenko, Gabby

    2017-11-02

    The transcription factor, activator protein-1 (AP-1), binds to cognate DNA under redox control; yet, the underlying mechanism has remained enigmatic. A series of crystal structures of the AP-1 FosB/JunD bZIP domains reveal ordered DNA-binding regions in both FosB and JunD even in absence DNA. However, while JunD is competent to bind DNA, the FosB bZIP domain must undergo a large conformational rearrangement that is controlled by a 'redox switch' centered on an inter-molecular disulfide bond. Solution studies confirm that FosB/JunD cannot undergo structural transition and bind DNA when the redox-switch is in the 'OFF' state, and show that the mid-point redox potential of the redox switch affords it sensitivity to cellular redox homeostasis. The molecular and structural studies presented here thus reveal the mechanism underlying redox-regulation of AP-1 Fos/Jun transcription factors and provide structural insight for therapeutic interventions targeting AP-1 proteins. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. Gadd45a Is an RNA Binding Protein and Is Localized in Nuclear Speckles

    PubMed Central

    Sytnikova, Yuliya A.; Kubarenko, Andriy V.; Schäfer, Andrea; Weber, Alexander N. R.; Niehrs, Christof

    2011-01-01

    Background The Gadd45 proteins play important roles in growth control, maintenance of genomic stability, DNA repair, and apoptosis. Recently, Gadd45 proteins have also been implicated in epigenetic gene regulation by promoting active DNA demethylation. Gadd45 proteins have sequence homology with the L7Ae/L30e/S12e RNA binding superfamily of ribosomal proteins, which raises the question if they may interact directly with nucleic acids. Principal Findings Here we show that Gadd45a binds RNA but not single- or double stranded DNA or methylated DNA in vitro. Sucrose density gradient centrifugation experiments demonstrate that Gadd45a is present in high molecular weight particles, which are RNase sensitive. Gadd45a displays RNase-sensitive colocalization in nuclear speckles with the RNA helicase p68 and the RNA binding protein SC35. A K45A point mutation defective in RNA binding was still active in DNA demethylation. This suggests that RNA binding is not absolutely essential for demethylation of an artificial substrate. A point mutation at G39 impared RNA binding, nuclear speckle localization and DNA demethylation, emphasizing its relevance for Gadd45a function. Significance The results implicate RNA in Gadd45a function and suggest that Gadd45a is associated with a ribonucleoprotein particle. PMID:21249130

  9. Structures of minute virus of mice replication initiator protein N-terminal domain: Insights into DNA nicking and origin binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tewary, Sunil K.; Liang, Lingfei; Lin, Zihan

    Members of the Parvoviridae family all encode a non-structural protein 1 (NS1) that directs replication of single-stranded viral DNA, packages viral DNA into capsid, and serves as a potent transcriptional activator. Here we report the X-ray structure of the minute virus of mice (MVM) NS1 N-terminal domain at 1.45 Å resolution, showing that sites for dsDNA binding, ssDNA binding and cleavage, nuclear localization, and other functions are integrated on a canonical fold of the histidine-hydrophobic-histidine superfamily of nucleases, including elements specific for this Protoparvovirus but distinct from its Bocaparvovirus or Dependoparvovirus orthologs. High resolution structural analysis reveals a nickase activemore » site with an architecture that allows highly versatile metal ligand binding. The structures support a unified mechanism of replication origin recognition for homotelomeric and heterotelomeric parvoviruses, mediated by a basic-residue-rich hairpin and an adjacent helix in the initiator proteins and by tandem tetranucleotide motifs in the replication origins. - Highlights: • The structure of a parvovirus replication initiator protein has been determined; • The structure sheds light on mechanisms of ssDNA binding and cleavage; • The nickase active site is preconfigured for versatile metal ligand binding; • The binding site for the double-stranded replication origin DNA is identified; • A single domain integrates multiple functions in virus replication.« less

  10. A new structural framework for integrating replication protein A into DNA processing machinery

    PubMed Central

    Brosey, Chris A.; Yan, Chunli; Tsutakawa, Susan E.; Heller, William T.; Rambo, Robert P.; Tainer, John A.; Ivanov, Ivaylo; Chazin, Walter J.

    2013-01-01

    By coupling the protection and organization of single-stranded DNA (ssDNA) with recruitment and alignment of DNA processing factors, replication protein A (RPA) lies at the heart of dynamic multi-protein DNA processing machinery. Nevertheless, how RPA coordinates biochemical functions of its eight domains remains unknown. We examined the structural biochemistry of RPA’s DNA-binding activity, combining small-angle X-ray and neutron scattering with all-atom molecular dynamics simulations to investigate the architecture of RPA’s DNA-binding core. The scattering data reveal compaction promoted by DNA binding; DNA-free RPA exists in an ensemble of states with inter-domain mobility and becomes progressively more condensed and less dynamic on binding ssDNA. Our results contrast with previous models proposing RPA initially binds ssDNA in a condensed state and becomes more extended as it fully engages the substrate. Moreover, the consensus view that RPA engages ssDNA in initial, intermediate and final stages conflicts with our data revealing that RPA undergoes two (not three) transitions as it binds ssDNA with no evidence for a discrete intermediate state. These results form a framework for understanding how RPA integrates the ssDNA substrate into DNA processing machinery, provides substrate access to its binding partners and promotes the progression and selection of DNA processing pathways. PMID:23303776

  11. A new structural framework for integrating replication protein A into DNA processing machinery

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brosey, Chris; Yan, Chunli; Tsutakawa, Susan

    2013-01-17

    By coupling the protection and organization of single-stranded DNA (ssDNA) with recruitment and alignment of DNA processing factors, replication protein A (RPA) lies at the heart of dynamic multi-protein DNA processing machinery. Nevertheless, how RPA coordinates biochemical functions of its eight domains remains unknown. We examined the structural biochemistry of RPA's DNA-binding activity, combining small-angle X-ray and neutron scattering with all-atom molecular dynamics simulations to investigate the architecture of RPA's DNA-binding core. The scattering data reveal compaction promoted by DNA binding; DNA-free RPA exists in an ensemble of states with inter-domain mobility and becomes progressively more condensed and less dynamicmore » on binding ssDNA. Our results contrast with previous models proposing RPA initially binds ssDNA in a condensed state and becomes more extended as it fully engages the substrate. Moreover, the consensus view that RPA engages ssDNA in initial, intermediate and final stages conflicts with our data revealing that RPA undergoes two (not three) transitions as it binds ssDNA with no evidence for a discrete intermediate state. These results form a framework for understanding how RPA integrates the ssDNA substrate into DNA processing machinery, provides substrate access to its binding partners and promotes the progression and selection of DNA processing pathways.« less

  12. Structural basis for DNA binding by replication initiator Mcm10

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Warren, Eric M.; Vaithiyalingam, Sivaraja; Haworth, Justin

    2009-06-30

    Mcm10 is an essential eukaryotic DNA replication protein required for assembly and progression of the replication fork. The highly conserved internal domain (Mcm10-ID) has been shown to physically interact with single-stranded (ss) DNA, DNA polymerase alpha, and proliferating cell nuclear antigen (PCNA). The crystal structure of Xenopus laevis Mcm10-ID presented here reveals a DNA binding architecture composed of an oligonucleotide/oligosaccharide-fold followed in tandem by a variant and highly basic zinc finger. NMR chemical shift perturbation and mutational studies of DNA binding activity in vitro reveal how Mcm10 uses this unique surface to engage ssDNA. Corresponding mutations in Saccharomyces cerevisiae resultmore » in increased sensitivity to replication stress, demonstrating the functional importance of DNA binding by this region of Mcm10 to replication. In addition, mapping Mcm10 mutations known to disrupt PCNA, polymerase alpha, and DNA interactions onto the crystal structure provides insight into how Mcm10 might coordinate protein and DNA binding within the replisome.« less

  13. Non-B-Form DNA Is Enriched at Centromeres

    PubMed Central

    Henikoff, Steven

    2018-01-01

    Abstract Animal and plant centromeres are embedded in repetitive “satellite” DNA, but are thought to be epigenetically specified. To define genetic characteristics of centromeres, we surveyed satellite DNA from diverse eukaryotes and identified variation in <10-bp dyad symmetries predicted to adopt non-B-form conformations. Organisms lacking centromeric dyad symmetries had binding sites for sequence-specific DNA-binding proteins with DNA-bending activity. For example, human and mouse centromeres are depleted for dyad symmetries, but are enriched for non-B-form DNA and are associated with binding sites for the conserved DNA-binding protein CENP-B, which is required for artificial centromere function but is paradoxically nonessential. We also detected dyad symmetries and predicted non-B-form DNA structures at neocentromeres, which form at ectopic loci. We propose that centromeres form at non-B-form DNA because of dyad symmetries or are strengthened by sequence-specific DNA binding proteins. This may resolve the CENP-B paradox and provide a general basis for centromere specification. PMID:29365169

  14. Cdc45-induced loading of human RPA onto single-stranded DNA

    PubMed Central

    Tessmer, Ingrid; Prus, Piotr; Schlott, Bernhard; Pospiech, Helmut

    2017-01-01

    Abstract Cell division cycle protein 45 (Cdc45) is an essential component of the eukaryotic replicative DNA helicase. We found that human Cdc45 forms a complex with the single-stranded DNA (ssDNA) binding protein RPA. Moreover, it actively loads RPA onto nascent ssDNA. Pull-down assays and surface plasmon resonance studies revealed that Cdc45-bound RPA complexed with ssDNA in the 8–10 nucleotide binding mode, but dissociated when RPA covered a 30-mer. Real-time analysis of RPA-ssDNA binding demonstrated that Cdc45 catalytically loaded RPA onto ssDNA. This placement reaction required physical contacts of Cdc45 with the RPA70A subdomain. Our results imply that Cdc45 controlled stabilization of the 8-nt RPA binding mode, the subsequent RPA transition into 30-mer mode and facilitated an ordered binding to ssDNA. We propose that a Cdc45-mediated loading guarantees a seamless deposition of RPA on newly emerging ssDNA at the nascent replication fork. PMID:28100698

  15. Human immunodeficiency virus type 1 LTR TATA and TAR region sequences required for transcriptional regulation.

    PubMed Central

    Garcia, J A; Harrich, D; Soultanakis, E; Wu, F; Mitsuyasu, R; Gaynor, R B

    1989-01-01

    The human immunodeficiency virus (HIV) type 1 LTR is regulated at the transcriptional level by both cellular and viral proteins. Using HeLa cell extracts, multiple regions of the HIV LTR were found to serve as binding sites for cellular proteins. An untranslated region binding protein UBP-1 has been purified and fractions containing this protein bind to both the TAR and TATA regions. To investigate the role of cellular proteins binding to both the TATA and TAR regions and their potential interaction with other HIV DNA binding proteins, oligonucleotide-directed mutagenesis of both these regions was performed followed by DNase I footprinting and transient expression assays. In the TATA region, two direct repeats TC/AAGC/AT/AGCTGC surround the TATA sequence. Mutagenesis of both of these direct repeats or of the TATA sequence interrupted binding over the TATA region on the coding strand, but only a mutation of the TATA sequence affected in vivo assays for tat-activation. In addition to TAR serving as the site of binding of cellular proteins, RNA transcribed from TAR is capable of forming a stable stem-loop structure. To determine the relative importance of DNA binding proteins as compared to secondary structure, oligonucleotide-directed mutations in the TAR region were studied. Local mutations that disrupted either the stem or loop structure were defective in gene expression. However, compensatory mutations which restored base pairing in the stem resulted in complete tat-activation. This indicated a significant role for the stem-loop structure in HIV gene expression. To determine the role of TAR binding proteins, mutations were constructed which extensively changed the primary structure of the TAR region, yet left stem base pairing, stem energy and the loop sequence intact. These mutations resulted in decreased protein binding to TAR DNA and defects in tat-activation, and revealed factor binding specifically to the loop DNA sequence. Further mutagenesis which inverted this stem and loop mutation relative to the HIV LTR mRNA start site resulted in even larger decreases in tat-activation. This suggests that multiple determinants, including protein binding, the loop sequence, and RNA or DNA secondary structure, are important in tat-activation and suggests that tat may interact with cellular proteins binding to DNA to increase HIV gene expression. Images PMID:2721501

  16. Identification of Specific DNA Binding Residues in the TCP Family of Transcription Factors in Arabidopsis[W

    PubMed Central

    Aggarwal, Pooja; Das Gupta, Mainak; Joseph, Agnel Praveen; Chatterjee, Nirmalya; Srinivasan, N.; Nath, Utpal

    2010-01-01

    The TCP transcription factors control multiple developmental traits in diverse plant species. Members of this family share an ∼60-residue-long TCP domain that binds to DNA. The TCP domain is predicted to form a basic helix-loop-helix (bHLH) structure but shares little sequence similarity with canonical bHLH domain. This classifies the TCP domain as a novel class of DNA binding domain specific to the plant kingdom. Little is known about how the TCP domain interacts with its target DNA. We report biochemical characterization and DNA binding properties of a TCP member in Arabidopsis thaliana, TCP4. We have shown that the 58-residue domain of TCP4 is essential and sufficient for binding to DNA and possesses DNA binding parameters comparable to canonical bHLH proteins. Using a yeast-based random mutagenesis screen and site-directed mutants, we identified the residues important for DNA binding and dimer formation. Mutants defective in binding and dimerization failed to rescue the phenotype of an Arabidopsis line lacking the endogenous TCP4 activity. By combining structure prediction, functional characterization of the mutants, and molecular modeling, we suggest a possible DNA binding mechanism for this class of transcription factors. PMID:20363772

  17. Variola virus E3L Zα domain, but not its Z-DNA binding activity, is required for PKR inhibition.

    PubMed

    Thakur, Meghna; Seo, Eun Joo; Dever, Thomas E

    2014-02-01

    Responding to viral infection, the interferon-induced, double-stranded RNA (dsRNA)-activated protein kinase PKR phosphorylates translation initiation factor eIF2α to inhibit cellular and viral protein synthesis. To overcome this host defense mechanism, many poxviruses express the protein E3L, containing an N-terminal Z-DNA binding (Zα) domain and a C-terminal dsRNA-binding domain (dsRBD). While E3L is thought to inhibit PKR activation by sequestering dsRNA activators and by directly binding the kinase, the role of the Zα domain in PKR inhibition remains unclear. Here, we show that the E3L Zα domain is required to suppress the growth-inhibitory properties associated with expression of human PKR in yeast, to inhibit PKR kinase activity in vitro, and to reverse the inhibitory effects of PKR on reporter gene expression in mammalian cells treated with dsRNA. Whereas previous studies revealed that the Z-DNA binding activity of E3L is critical for viral pathogenesis, we identified point mutations in E3L that functionally uncouple Z-DNA binding and PKR inhibition. Thus, our studies reveal a molecular distinction between the nucleic acid binding and PKR inhibitory functions of the E3L Zα domain, and they support the notion that E3L contributes to viral pathogenesis by targeting PKR and other components of the cellular anti-viral defense pathway.

  18. Identification of natural and artificial DNA substrates for the light-activated LOV-HTH transcription factor EL222

    PubMed Central

    Rivera-Cancel, Giomar; Motta-Mena, Laura B.; Gardner, Kevin H.

    2012-01-01

    Light-oxygen-voltage (LOV) domains serve as the photosensory modules for a wide range of plant and bacterial proteins, conferring blue light dependent regulation to effector activities as diverse as enzymes and DNA binding. LOV domains can also be engineered into a variety of exogenous targets, enabling similar regulation for new protein-based reagents. Common to these proteins is the ability for LOV domains to reversibly form a photochemical adduct between an internal flavin chromophore and the surrounding protein, using this to trigger conformational changes that affect output activity. Using the Erythrobacter litoralis protein EL222 model system which links LOV regulation to a helix-turn-helix (HTH) DNA binding domain, we demonstrated that the LOV domain binds and inhibits the HTH domain in the dark, releasing these interactions upon illumination [Nash et al. (2011) Proc. Natl. Acad. Sci. USA 108, 9449–9454]. Here we combine genomic and in vitro selection approaches to identify optimal DNA binding sites for EL222. Within the bacterial host, we observe binding several genomic sites using a 12 bp sequence consensus that is also found by in vitro selection methods. Sequence-specific alterations in the DNA consensus reduce EL222-binding affinity in a manner consistent with the expected binding mode: a protein dimer binding to two repeats. Finally, we demonstrate the light-dependent activation of transcription of two genes adjacent to an EL222 binding site. Taken together, these results shed light on the native function of EL222 and provide useful reagents for further basic and applications research of this versatile protein. PMID:23205774

  19. Molecular characterization of the host defense activity of the barrier to autointegration factor against vaccinia virus.

    PubMed

    Ibrahim, Nouhou; Wicklund, April; Wiebe, Matthew S

    2011-11-01

    The barrier to autointegration factor (BAF) is an essential cellular protein with functions in mitotic nuclear reassembly, retroviral preintegration complex stability, and transcriptional regulation. Molecular properties of BAF include the ability to bind double-stranded DNA in a sequence-independent manner, homodimerize, and bind proteins containing a LEM domain. These capabilities allow BAF to compact DNA and assemble higher-order nucleoprotein complexes, the nature of which is poorly understood. Recently, it was revealed that BAF also acts as a potent host defense against poxviral DNA replication in the cytoplasm. Here, we extend these observations by examining the molecular mechanism through which BAF acts as a host defense against vaccinia virus replication and cytoplasmic DNA in general. Interestingly, BAF rapidly relocalizes to transfected DNA from a variety of sources, demonstrating that BAF's activity as a host defense factor is not limited to poxviral infection. BAF's relocalization to cytoplasmic foreign DNA is highly dependent upon its DNA binding and dimerization properties but does not appear to require its LEM domain binding activity. However, the LEM domain protein emerin is recruited to cytoplasmic DNA in a BAF-dependent manner during both transfection and vaccinia virus infection. Finally, we demonstrate that the DNA binding and dimerization capabilities of BAF are essential for its function as an antipoxviral effector, while the presence of emerin is not required. Together, these data provide further mechanistic insight into which of BAF's molecular properties are employed by cells to impair the replication of poxviruses or respond to foreign DNA in general.

  20. Photochemical and DFT studies on DNA-binding ability and antibacterial activity of lanthanum(III)-phenanthroline complex

    NASA Astrophysics Data System (ADS)

    Niroomand, Sona; Khorasani-Motlagh, Mozhgan; Noroozifar, Meissam; Jahani, Shohreh; Moodi, Asieh

    2017-02-01

    The binding of the lanthanum(III) complex containing 1,10-phenanthroline (phen), [La(phen)3Cl3·OH2], to DNA is investigated by absorption and emission methods. This complex shows absorption decreasing in a charge transfer band, and fluorescence decrement when it binds to DNA. Electronic absorption spectroscopy (UV-Vis), fluorescence spectra, iodide quenching experiments, salt effect and viscosity measurements, ethidium bromide (EB) competition test, circular dichroism (CD) spectra as well as variable temperature experiments indicate that the La(III) complex binds to fish salmon (FS) DNA, presumably via groove binding mode. The binding constants (Kb) of the La(III) complex with DNA is (2.55 ± 0.02) × 106 M-1. Furthermore, the binding site size, n, the Stern-Volmer constant KSV and thermodynamic parameters; enthalpy change (ΔH0) and entropy change (ΔS0) and Gibb's free energy (ΔG0), are calculated according to relevant fluorescent data and the Van't Hoff equation. The La(III) complex has been screened for its antibacterial activities by the disc diffusion method. Also, in order to supplement the experimental findings, DFT computation and NBO analysis are carried out.

  1. Preparation and DNA-binding properties of substituted triostin antibiotics.

    PubMed

    Cornish, A; Fox, K R; Waring, M J

    1983-02-01

    Novel derivatives of the triostin group of antibiotics were prepared by supplementing cultures of the producing organism Streptomyces triostinicus with a variety of aromatic carboxylic acids. Five new antibiotics, each having both the natural quinoxaline chromophores replaced by a substituted ring system, were purified to homogeneity and characterized by high-pressure liquid chromatography and nuclear magnetic resonance. Their antibacterial activities and DNA-binding properties were investigated. Addition of a halogen atom at position 6 of the quinoxaline ring or an amino group at position 3 had little effect on either the biological activity or the DNA-binding characteristics. The bis-3-amino derivative is fluorescent, and its fluorescence is strongly quenched by calf thymus DNA and polydeoxyguanylate-polydeoxycytidylate but not by polydeoxyadenylate-polydeoxythymidylate, suggesting that it binds preferentially to guanosine-cytosine-rich sequences in natural DNA. Binding constants for the bis-6-chloro and bis-3-amino derivatives do not differ greatly from those of unsubstituted triostin A. The analogs having two quinoline chromophores or a chlorine atom in position 7 of the quinoxaline ring display little or no detectable antibacterial activity, in marked contrast to the other congeners. Bis-7-chloro-triostin A binds conspicuously more tightly to polydeoxyadenylate-polydeoxythymidylate than to any other polynucleotide tested.

  2. Activation of both acfA and acfD transcription by Vibrio cholerae ToxT requires binding to two centrally located DNA sites in an inverted repeat conformation.

    PubMed

    Withey, Jeffrey H; DiRita, Victor J

    2005-05-01

    The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.

  3. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding sitemore » are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome.« less

  4. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity.

    PubMed

    Petzold, Christine; Marceau, Aimee H; Miller, Katherine H; Marqusee, Susan; Keck, James L

    2015-06-05

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. Interaction of Sulforaphane with DNA and RNA

    PubMed Central

    Abassi Joozdani, Farzaneh; Yari, Faramarz; Abassi Joozdani, Parvaneh; Nafisi, Shohreh

    2015-01-01

    Sulforaphane (SFN) is an isothiocyanate found in cruciferous vegetables with anti-inflammatory, anti-oxidant and anti-cancer activities. However, the antioxidant and anticancer mechanism of sulforaphane is not well understood. In the present research, we reported binding modes, binding constants and stability of SFN–DNA and -RNA complexes by Fourier transform infrared (FTIR) and UV–Visible spectroscopic methods. Spectroscopic evidence showed DNA intercalation with some degree of groove binding. SFN binds minor and major grooves of DNA and backbone phosphate (PO2), while RNA binding is through G, U, A bases with some degree of SFN–phosphate (PO2) interaction. Overall binding constants were estimated to be K(SFN–DNA)=3.01 (± 0.035)×104 M-1 and K(SFN–RNA)= 6.63 (±0.042)×103 M-1. At high SFN concentration (SFN/RNA = 1/1), DNA conformation changed from B to A occurred, while RNA remained in A-family structure. PMID:26030290

  6. In vitro DNA binding studies of Aspartame, an artificial sweetener.

    PubMed

    Kashanian, Soheila; Khodaei, Mohammad Mehdi; Kheirdoosh, Fahimeh

    2013-03-05

    A number of small molecules bind directly and selectively to DNA, by inhibiting replication, transcription or topoisomerase activity. In this work the interaction of native calf thymus DNA (CT-DNA) with Aspartame (APM), an artificial sweeteners was studied at physiological pH. DNA binding study of APM is useful to understand APM-DNA interaction mechanism and to provide guidance for the application and design of new and safer artificial sweeteners. The interaction was investigated using spectrophotometric, spectrofluorometric competition experiment and circular dichroism (CD). Hypochromism and red shift are shown in UV absorption band of APM. A strong fluorescence quenching reaction of DNA to APM was observed and the binding constants (Kf) of DNA with APM and corresponding number of binding sites (n) were calculated at different temperatures. Thermodynamic parameters, enthalpy changes (ΔH) and entropy changes (ΔS) were calculated to be +181kJmol(-1) and +681Jmol(-1)K(-1) according to Van't Hoff equation, which indicated that reaction is predominantly entropically driven. Moreover, spectrofluorometric competition experiment and circular dichroism (CD) results are indicative of non-intercalative DNA binding nature of APM. We suggest that APM interacts with calf thymus DNA via groove binding mode with an intrinsic binding constant of 5×10(+4)M(-1). Copyright © 2013 Elsevier B.V. All rights reserved.

  7. TERRA and hnRNPA1 orchestrate an RPA-to-POT1 switch on telomeric single-stranded DNA.

    PubMed

    Flynn, Rachel Litman; Centore, Richard C; O'Sullivan, Roderick J; Rai, Rekha; Tse, Alice; Songyang, Zhou; Chang, Sandy; Karlseder, Jan; Zou, Lee

    2011-03-24

    Maintenance of telomeres requires both DNA replication and telomere 'capping' by shelterin. These two processes use two single-stranded DNA (ssDNA)-binding proteins, replication protein A (RPA) and protection of telomeres 1 (POT1). Although RPA and POT1 each have a critical role at telomeres, how they function in concert is not clear. POT1 ablation leads to activation of the ataxia telangiectasia and Rad3-related (ATR) checkpoint kinase at telomeres, suggesting that POT1 antagonizes RPA binding to telomeric ssDNA. Unexpectedly, we found that purified POT1 and its functional partner TPP1 are unable to prevent RPA binding to telomeric ssDNA efficiently. In cell extracts, we identified a novel activity that specifically displaces RPA, but not POT1, from telomeric ssDNA. Using purified protein, here we show that the heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1) recapitulates the RPA displacing activity. The RPA displacing activity is inhibited by the telomeric repeat-containing RNA (TERRA) in early S phase, but is then unleashed in late S phase when TERRA levels decline at telomeres. Interestingly, TERRA also promotes POT1 binding to telomeric ssDNA by removing hnRNPA1, suggesting that the re-accumulation of TERRA after S phase helps to complete the RPA-to-POT1 switch on telomeric ssDNA. Together, our data suggest that hnRNPA1, TERRA and POT1 act in concert to displace RPA from telomeric ssDNA after DNA replication, and promote telomere capping to preserve genomic integrity.

  8. Thermodynamics-Based Models of Transcriptional Regulation by Enhancers: The Roles of Synergistic Activation, Cooperative Binding and Short-Range Repression

    PubMed Central

    He, Xin; Samee, Md. Abul Hassan; Blatti, Charles; Sinha, Saurabh

    2010-01-01

    Quantitative models of cis-regulatory activity have the potential to improve our mechanistic understanding of transcriptional regulation. However, the few models available today have been based on simplistic assumptions about the sequences being modeled, or heuristic approximations of the underlying regulatory mechanisms. We have developed a thermodynamics-based model to predict gene expression driven by any DNA sequence, as a function of transcription factor concentrations and their DNA-binding specificities. It uses statistical thermodynamics theory to model not only protein-DNA interaction, but also the effect of DNA-bound activators and repressors on gene expression. In addition, the model incorporates mechanistic features such as synergistic effect of multiple activators, short range repression, and cooperativity in transcription factor-DNA binding, allowing us to systematically evaluate the significance of these features in the context of available expression data. Using this model on segmentation-related enhancers in Drosophila, we find that transcriptional synergy due to simultaneous action of multiple activators helps explain the data beyond what can be explained by cooperative DNA-binding alone. We find clear support for the phenomenon of short-range repression, where repressors do not directly interact with the basal transcriptional machinery. We also find that the binding sites contributing to an enhancer's function may not be conserved during evolution, and a noticeable fraction of these undergo lineage-specific changes. Our implementation of the model, called GEMSTAT, is the first publicly available program for simultaneously modeling the regulatory activities of a given set of sequences. PMID:20862354

  9. Bacillus subtilis glutamine synthetase regulates its own synthesis by acting as a chaperone to stabilize GlnR-DNA complexes.

    PubMed

    Fisher, Susan H; Wray, Lewis V

    2008-01-22

    The Bacillus subtilis GlnR repressor controls gene expression in response to nitrogen availability. Because all GlnR-regulated genes are expressed constitutively in mutants lacking glutamine synthetase (GS), GS is required for repression by GlnR. Feedback-inhibited GS (FBI-GS) was shown to activate GlnR DNA binding with an in vitro electophoretic mobility shift assay (EMSA). The activation of GlnR DNA binding by GS in these experiments depended on the feedback inhibitor glutamine and did not occur with mutant GS proteins defective in regulating GlnR activity in vivo. Although stable GS-GlnR-DNA ternary complexes were not observed in the EMSA experiments, cross-linking experiments showed that a protein-protein interaction occurs between GlnR and FBI-GS. This interaction was reduced in the absence of the feedback inhibitor glutamine and with mutant GS proteins. Because FBI-GS significantly reduced the dissociation rate of the GlnR-DNA complexes, the stability of these complexes is enhanced by FBI-GS. These results argue that FBI-GS acts as a chaperone that activates GlnR DNA binding through a transient protein-protein interaction that stabilizes GlnR-DNA complexes. GS was shown to control the activity of the B. subtilis nitrogen transcription factor TnrA by forming a stable complex between FBI-GS and TnrA that inhibits TnrA DNA binding. Thus, B. subtilis GS is an enzyme with dual catalytic and regulatory functions that uses distinct mechanisms to control the activity of two different transcription factors.

  10. A calmodulin binding protein from Arabidopsis is induced by ethylene and contains a DNA-binding motif

    NASA Technical Reports Server (NTRS)

    Reddy, A. S.; Reddy, V. S.; Golovkin, M.

    2000-01-01

    Calmodulin (CaM), a key calcium sensor in all eukaryotes, regulates diverse cellular processes by interacting with other proteins. To isolate CaM binding proteins involved in ethylene signal transduction, we screened an expression library prepared from ethylene-treated Arabidopsis seedlings with 35S-labeled CaM. A cDNA clone, EICBP (Ethylene-Induced CaM Binding Protein), encoding a protein that interacts with activated CaM was isolated in this screening. The CaM binding domain in EICBP was mapped to the C-terminus of the protein. These results indicate that calcium, through CaM, could regulate the activity of EICBP. The EICBP is expressed in different tissues and its expression in seedlings is induced by ethylene. The EICBP contains, in addition to a CaM binding domain, several features that are typical of transcription factors. These include a DNA-binding domain at the N terminus, an acidic region at the C terminus, and nuclear localization signals. In database searches a partial cDNA (CG-1) encoding a DNA-binding motif from parsley and an ethylene up-regulated partial cDNA from tomato (ER66) showed significant similarity to EICBP. In addition, five hypothetical proteins in the Arabidopsis genome also showed a very high sequence similarity with EICBP, indicating that there are several EICBP-related proteins in Arabidopsis. The structural features of EICBP are conserved in all EICBP-related proteins in Arabidopsis, suggesting that they may constitute a new family of DNA binding proteins and are likely to be involved in modulating gene expression in the presence of ethylene.

  11. Specific DNA binding activity of T antigen subclasses varies among different SV40-transformed cell lines.

    PubMed

    Burger, C; Fanning, E

    1983-04-15

    Large tumor antigen (T antigen) occurs in at least three different oligomeric subclasses in cells infected or transformed by simian virus 40 (SV40): 5-7 S, 14-16 S, and 23-25 S. The 23-25 S form is complexed with a host phosphoprotein (p53). The DNA binding properties of these three subclasses of T antigen from nine different cell lines and free p53 protein were compared using an immunoprecipitation assay. All three subclasses of T antigen bound specifically to SV40 DNA sequences near the origin of replication. However, the DNA binding activity varied between different cell lines over a 40- to 50-fold range. The 23-25 S and 14-16 S forms from most of the cell lines tested bound much less SV40 origin DNA than 5-7 S T antigen. The free p53 phosphoprotein did not bind specifically to any SV40 DNA sequences.

  12. Antiviral and Anticancer Optimization Studies of the DNA-binding Marine Natural Product Aaptamine

    PubMed Central

    Bowling, John J.; Pennaka, Hari K.; Ivey, Kelly; Wahyuono, Subagus; Kelly, Michelle; Schinazi, Raymond F.; Valeriote, Frederick A.; Graves, David E.; Hamann, Mark T.

    2016-01-01

    Aaptamine has potent cytotoxicity that may be explained by its ability to intercalate DNA. Aaptamine was evaluated for its ability to bind to DNA to validate DNA binding as the primary mechanism of cytotoxicity. Based on UV–vis absorbance titration data, the Kobs for aaptamine was 4.0 (±0.2) × 103 which was essentially equivalent to the known DNA intercalator N-[2-(diethylamino)ethyl]-9-aminoacridine-4-carboxamide. Semi-synthetic core modifications were performed to improve the general structural diversity of known aaptamine analogs and vary its absorption characteristics. Overall, 26 aaptamine derivatives were synthesized which consisted of a simple homologous range of mono and di-N-alkylations as well as some 9-O-sulfonylation and bis-O-isoaaptamine dimer products. Each product was evaluated for activity in a variety of whole cell and viral assays including a unique solid tumor disk diffusion assay. Details of aaptamine's DNA-binding activity and its derivatives’ whole cell and viral assay results are discussed. PMID:18251774

  13. Mcm10 regulates DNA replication elongation by stimulating the CMG replicative helicase.

    PubMed

    Lõoke, Marko; Maloney, Michael F; Bell, Stephen P

    2017-02-01

    Activation of the Mcm2-7 replicative DNA helicase is the committed step in eukaryotic DNA replication initiation. Although Mcm2-7 activation requires binding of the helicase-activating proteins Cdc45 and GINS (forming the CMG complex), an additional protein, Mcm10, drives initial origin DNA unwinding by an unknown mechanism. We show that Mcm10 binds a conserved motif located between the oligonucleotide/oligosaccharide fold (OB-fold) and A subdomain of Mcm2. Although buried in the interface between these domains in Mcm2-7 structures, mutations predicted to separate the domains and expose this motif restore growth to conditional-lethal MCM10 mutant cells. We found that, in addition to stimulating initial DNA unwinding, Mcm10 stabilizes Cdc45 and GINS association with Mcm2-7 and stimulates replication elongation in vivo and in vitro. Furthermore, we identified a lethal allele of MCM10 that stimulates initial DNA unwinding but is defective in replication elongation and CMG binding. Our findings expand the roles of Mcm10 during DNA replication and suggest a new model for Mcm10 function as an activator of the CMG complex throughout DNA replication. © 2017 Lõoke et al.; Published by Cold Spring Harbor Laboratory Press.

  14. High-resolution physical and functional mapping of the template adjacent DNA binding site in catalytically active telomerase.

    PubMed

    Romi, Erez; Baran, Nava; Gantman, Marina; Shmoish, Michael; Min, Bosun; Collins, Kathleen; Manor, Haim

    2007-05-22

    Telomerase is a cellular reverse transcriptase, which utilizes an integral RNA template to extend single-stranded telomeric DNA. We used site-specific photocrosslinking to map interactions between DNA primers and the catalytic protein subunit (tTERT) of Tetrahymena thermophila telomerase in functional enzyme complexes. Our assays reveal contact of the single-stranded DNA adjacent to the primer-template hybrid and tTERT residue W187 at the periphery of the N-terminal domain. This contact was detected in complexes with three different registers of template in the active site, suggesting that it is maintained throughout synthesis of a complete telomeric repeat. Substitution of nearby residue Q168, but not W187, alters the K(m) for primer elongation, implying that it plays a role in the DNA recognition. These findings are the first to directly demonstrate the physical location of TERT-DNA contacts in catalytically active telomerase and to identify amino acid determinants of DNA binding affinity. Our data also suggest a movement of the TERT active site relative to the template-adjacent single-stranded DNA binding site within a cycle of repeat synthesis.

  15. (CAG)(n)-hairpin DNA binds to Msh2-Msh3 and changes properties of mismatch recognition.

    PubMed

    Owen, Barbara A L; Yang, Zungyoon; Lai, Maoyi; Gajec, Maciej; Gajek, Maciez; Badger, John D; Hayes, Jeffrey J; Edelmann, Winfried; Kucherlapati, Raju; Wilson, Teresa M; McMurray, Cynthia T

    2005-08-01

    Cells have evolved sophisticated DNA repair systems to correct damaged DNA. However, the human DNA mismatch repair protein Msh2-Msh3 is involved in the process of trinucleotide (CNG) DNA expansion rather than repair. Using purified protein and synthetic DNA substrates, we show that Msh2-Msh3 binds to CAG-hairpin DNA, a prime candidate for an expansion intermediate. CAG-hairpin binding inhibits the ATPase activity of Msh2-Msh3 and alters both nucleotide (ADP and ATP) affinity and binding interfaces between protein and DNA. These changes in Msh2-Msh3 function depend on the presence of A.A mispaired bases in the stem of the hairpin and on the hairpin DNA structure per se. These studies identify critical functional defects in the Msh2-Msh3-CAG hairpin complex that could misdirect the DNA repair process.

  16. Substitutional impact on biological activity of new water soluble Ni(II) complexes: Preparation, spectral characterization, X-ray crystallography, DNA/protein binding, antibacterial activity and in vitro cytotoxicity.

    PubMed

    Umadevi, C; Kalaivani, P; Puschmann, H; Murugan, S; Mohan, P S; Prabhakaran, R

    2017-02-01

    A series of new water soluble nickel(II) complexes containing triphenylphosphine and 4-methoxysalicylaldehyde-4(N)-substituted thiosemicarbazones were synthesized and characterized. Crystallographic investigations confirmed the structure of the complexes (1-4) having the general structure [Ni(4-Msal-Rtsc)(PPh 3 )] (Where R=H (1); CH 3 (2); C 2 H 5 (3); C 6 H 5 (4)) which showed that thiosemicarbazone ligands coordinated to nickel(II) ion as ONS tridentate bibasic donor. DNA/BSA protein binding ability of the ligands and their new complexes were studied by taking calf-thymus DNA (CT-DNA) and Bovine serum albumin (BSA) through absorption and emission titrations. Ethidium bromide (EB) displacement study showed the intercalative binding trend of the complexes to DNA. From the albumin binding studies, the mechanism of quenching was found as static and the alterations in the secondary structure of BSA by the compounds were confirmed with synchronous spectral studies. The binding affinity of the complexes to CT-DNA and BSA has the order of [Ni(4-Msal-etsc)(PPh 3 )] (3) >[Ni(4-Msal-mtsc)(PPh 3 )] (2) >[Ni(4-Msal-tsc)(PPh 3 )] (1) >[Ni(4-Msal-ptsc)(PPh 3 )] (4). In vitro cytotoxicity of the complexes was tested on human lung cancer cells (A549), human cervical cancer cells (HeLa), human liver carcinoma cells (Hep G2). All the complexes exhibited significant activity against three cancer cells. Among them, complex 4 exhibited almost 2.5 fold activity than cisplatin in A549 and HepG2 cell lines. In HeLa cell line, the complexes exhibited significant activity which is less than cisplatin. While comparing the activity of the complexes in A549 and HepG2 cell lines it falls in the order 4>1>2>3>cisplatin. The results obtained from DNA, protein binding and cytotoxicity studies, it is concluded that the cytotoxicity of the complexes as determined by MTT assay were not unduly influenced by the complexes having different binding efficiency with DNA and protein. The complexes exhibited good spectrum of antibacterial activity against four pathogenic bacteria such as E. faecalis (gram +ve), S. aureus (gram +ve), E. coli (gram -ve) and P. aeruginosa (gram -ve). Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Timely binding of IHF and Fis to DARS2 regulates ATP-DnaA production and replication initiation.

    PubMed

    Kasho, Kazutoshi; Fujimitsu, Kazuyuki; Matoba, Toshihiro; Oshima, Taku; Katayama, Tsutomu

    2014-12-01

    In Escherichia coli, the ATP-bound form of DnaA (ATP-DnaA) promotes replication initiation. During replication, the bound ATP is hydrolyzed to ADP to yield the ADP-bound form (ADP-DnaA), which is inactive for initiation. The chromosomal site DARS2 facilitates the regeneration of ATP-DnaA by catalyzing nucleotide exchange between free ATP and ADP bound to DnaA. However, the regulatory mechanisms governing this exchange reaction are unclear. Here, using in vitro reconstituted experiments, we show that two nucleoid-associated proteins, IHF and Fis, bind site-specifically to DARS2 to activate coordinately the exchange reaction. The regenerated ATP-DnaA was fully active in replication initiation and underwent DnaA-ATP hydrolysis. ADP-DnaA formed heteromultimeric complexes with IHF and Fis on DARS2, and underwent nucleotide dissociation more efficiently than ATP-DnaA. Consistently, mutant analyses demonstrated that specific binding of IHF and Fis to DARS2 stimulates the formation of ATP-DnaA production, thereby promoting timely initiation. Moreover, we show that IHF-DARS2 binding is temporally regulated during the cell cycle, whereas Fis only binds to DARS2 in exponentially growing cells. These results elucidate the regulation of ATP-DnaA and replication initiation in coordination with the cell cycle and growth phase. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Monitoring conformational heterogeneity of the lid of DnaK substrate-binding domain during its chaperone cycle.

    PubMed

    Banerjee, Rupa; Jayaraj, Gopal Gunanathan; Peter, Joshua Jebakumar; Kumar, Vignesh; Mapa, Koyeli

    2016-08-01

    DnaK or Hsp70 of Escherichia coli is a master regulator of the bacterial proteostasis network. Allosteric communication between the two functional domains of DnaK, the N-terminal nucleotide-binding domain (NBD) and the C-terminal substrate- or peptide-binding domain (SBD) regulate its activity. X-ray crystallography and NMR studies have provided snapshots of distinct conformations of Hsp70 proteins in various physiological states; however, the conformational heterogeneity and dynamics of allostery-driven Hsp70 activity remains underexplored. In this work, we employed single-molecule Förster resonance energy transfer (sm-FRET) measurements to capture distinct intradomain conformational states of a region within the DnaK-SBD known as the lid. Our data conclusively demonstrate prominent conformational heterogeneity of the DnaK lid in ADP-bound states; in contrast, the ATP-bound open conformations are homogeneous. Interestingly, a nonhydrolysable ATP analogue, AMP-PNP, imparts heterogeneity to the lid conformations mimicking the ADP-bound state. The cochaperone DnaJ confers ADP-like heterogeneous lid conformations to DnaK, although the presence of the cochaperone accelerates the substrate-binding rate by a hitherto unknown mechanism. Irrespective of the presence of DnaJ, binding of a peptide substrate to the DnaK-SBD leads to prominent lid closure. Lid closure is only partial upon binding to molten globule-like authentic cellular substrates, probably to accommodate non-native substrate proteins of varied structures. © 2016 Federation of European Biochemical Societies.

  19. Acetaminophen-induced hepatotoxicity is associated with early changes in NF-kB and NF-IL6 DNA binding activity.

    PubMed

    Blazka, M E; Germolec, D R; Simeonova, P; Bruccoleri, A; Pennypacker, K R; Luster, M I

    Nuclear transcription factors, such as NF-kB and NF-IL6, are believed to play an important role in regulating the expression of genes that encode for products involved in tissue damage and inflammation and, thus, may represent early biomarkers for chemical toxicities. In the present study changes in DNA binding activity of these factors were examined in livers of mice administered hepatotoxic doses of acetaminophen (APAP). NF-kB and NF-IL6 DNA binding occurred constitutively in control mouse liver. However, within 4 hr following administration of hepatotoxic doses of APAP, their binding activities were transiently lost and is in contrast to AP-1 transcription factor where activation occurs under similar conditions. These changes corresponded with increased release of inflammatory mediators (IL-6, serum amyloid A) and increased levels of enzymatic markers of hepatocyte damage. Similarly, treatment of mice with gadolinium chloride, an inhibitor of Kupffer cell activation and known to protect against APAP-induced hepatotoxicity, reduced the observed pathophysiological response in the liver while altering the APAP-associated changes in NF-kB DNA binding activity. NF-kB was found predominantly in parenchymal and endothelial cells and was composed primarily of relatively inactive p50 homodimer subunits in control liver. Taken together, these studies suggest that hepatotoxicity is associated with early and complex changes in DNA binding activities of specific transcription factors. In particular, NF-kB and NF-IL6 may serve as negative regulators of hepatocyte-derived inflammatory mediators and is analogous to that previously observed in certain other cell systems such as B lymphocytes.

  20. Drug-DNA interactions at single molecule level: A view with optical tweezers

    NASA Astrophysics Data System (ADS)

    Paramanathan, Thayaparan

    Studies of small molecule--DNA interactions are essential for developing new drugs for challenging diseases like cancer and HIV. The main idea behind developing these molecules is to target and inhibit the reproduction of the tumor cells and infected cells. We mechanically manipulate single DNA molecule using optical tweezers to investigate two molecules that have complex and multiple binding modes. Mononuclear ruthenium complexes have been extensively studied as a test for rational drug design. Potential drug candidates should have high affinity to DNA and slow dissociation kinetics. To achieve this, motifs of the ruthenium complexes are altered. Our collaborators designed a dumb-bell shaped binuclear ruthenium complex that can only intercalate DNA by threading through its bases. Studying the binding properties of this complex in bulk studies took hours. By mechanically manipulating a single DNA molecule held with optical tweezers, we lower the barrier to thread and make it fast compared to the bulk experiments. Stretching single DNA molecules with different concentration of drug molecules and holding it at a constant force allows the binding to reach equilibrium. By this we can obtain the equilibrium fractional ligand binding and length of DNA at saturated binding. Fitting these results yields quantitative measurements of the binding thermodynamics and kinetics of this complex process. The second complex discussed in this study is Actinomycin D (ActD), a well studied anti-cancer agent that is used as a prototype for developing new generations of drugs. However, the biophysical basis of its activity is still unclear. Because ActD is known to intercalate double stranded DNA (dsDNA), it was assumed to block replication by stabilizing dsDNA in front of the replication fork. However, recent studies have shown that ActD binds with even higher affinity to imperfect duplexes and some sequences of single stranded DNA (ssDNA). We directly measure the on and off rates by stretching the DNA molecule to a certain force and holding it at constant force while adding the drug and then while washing off the drug. Our finding resolves the long lasting controversy of ActD binding modes, clearly showing that both the dsDNA binding and ssDNA binding converge to the same single mode. The result supports the hypothesis that the primary characteristic of ActD that contributes to its biological activity is its ability to inhibit cellular replication by binding to transcription bubbles and causing cell death.

  1. Structure and DNA-binding of meiosis-specific protein Hop2

    NASA Astrophysics Data System (ADS)

    Zhou, Donghua; Moktan, Hem; Pezza, Roberto

    2014-03-01

    Here we report structure elucidation of the DNA binding domain of homologous pairing protein 2 (Hop2), which is important to gene diversity when sperms and eggs are produced. Together with another protein Mnd1, Hop2 enhances the strand invasion activity of recombinase Dmc1 by over 30 times, facilitating proper synapsis of homologous chromosomes. However, the structural and biochemical bases for the function of Hop2 and Mnd1 have not been well understood. As a first step toward such understanding, we recently solved the structure for the N-terminus of Hop2 (1-84) using solution NMR. This fragment shows a typical winged-head conformation with recognized DNA binding activity. DNA interacting sites were then investigated by chemical shift perturbations in a titration experiment. Information of these sites was used to guide protein-DNA docking with MD simulation, revealing that helix 3 is stably lodged in the DNA major groove and that wing 1 (connecting strands 2 and 3) transiently comes in contact with the minor groove in nanosecond time scale. Mutagenesis analysis further confirmed the DNA binding sites in this fragment of the protein.

  2. Identification of functional domains of the IR2 protein of equine herpesvirus 1 required for inhibition of viral gene expression and replication

    PubMed Central

    Kim, Seong K.; Kim, Seongman; Dai, Gan; Zhang, Yunfei; Ahn, Byung C.; O'Callaghan, Dennis J.

    2012-01-01

    The equine herpesvirus 1 (EHV-1) negative regulatory IR2 protein (IR2P), an early 1,165-amino acid (aa) truncated form of the 1,487-aa immediate-early protein (IEP), lacks the trans-activation domain essential for IEP activation functions but retains domains for binding DNA, TFIIB, and TBP and the nuclear localization signal. IR2P mutants of the N-terminal region which lack either DNA-binding activity or TFIIB-binding activity were unable to down-regulate EHV-1 promoters. In EHV-1-infected cells expressing full-length IR2P, transcription and protein expression of viral regulatory IE, early EICP0, IR4, and UL5, and late ETIF genes were dramatically inhibited. Viral DNA levels were reduced to 2.1% of control infected cells, but were vey weakly affected in cells that express the N-terminal 706 residues of IR2P. These results suggest that IR2P function requires the two N-terminal domains for binding DNA and TFIIB as well as the C-terminal residues 707 to 1116 containing the TBP-binding domain. PMID:21794889

  3. Analysis of the NuRD subunits reveals a histone deacetylase core complex and a connection with DNA methylation

    PubMed Central

    Zhang, Yi; Ng, Huck-Hui; Erdjument-Bromage, Hediye; Tempst, Paul; Bird, Adrian; Reinberg, Danny

    1999-01-01

    ATP-dependent nucleosome remodeling and core histone acetylation and deacetylation represent mechanisms to alter nucleosome structure. NuRD is a multisubunit complex containing nucleosome remodeling and histone deacetylase activities. The histone deacetylases HDAC1 and HDAC2 and the histone binding proteins RbAp48 and RbAp46 form a core complex shared between NuRD and Sin3-histone deacetylase complexes. The histone deacetylase activity of the core complex is severely compromised. A novel polypeptide highly related to the metastasis-associated protein 1, MTA2, and the methyl-CpG-binding domain-containing protein, MBD3, were found to be subunits of the NuRD complex. MTA2 modulates the enzymatic activity of the histone deacetylase core complex. MBD3 mediates the association of MTA2 with the core histone deacetylase complex. MBD3 does not directly bind methylated DNA but is highly related to MBD2, a polypeptide that binds to methylated DNA and has been reported to possess demethylase activity. MBD2 interacts with the NuRD complex and directs the complex to methylated DNA. NuRD may provide a means of gene silencing by DNA methylation. PMID:10444591

  4. Polymerase/DNA interactions and enzymatic activity: multi-parameter analysis with electro-switchable biosurfaces

    NASA Astrophysics Data System (ADS)

    Langer, Andreas; Schräml, Michael; Strasser, Ralf; Daub, Herwin; Myers, Thomas; Heindl, Dieter; Rant, Ulrich

    2015-07-01

    The engineering of high-performance enzymes for future sequencing and PCR technologies as well as the development of many anticancer drugs requires a detailed analysis of DNA/RNA synthesis processes. However, due to the complex molecular interplay involved, real-time methodologies have not been available to obtain comprehensive information on both binding parameters and enzymatic activities. Here we introduce a chip-based method to investigate polymerases and their interactions with nucleic acids, which employs an electrical actuation of DNA templates on microelectrodes. Two measurement modes track both the dynamics of the induced switching process and the DNA extension simultaneously to quantitate binding kinetics, dissociation constants and thermodynamic energies. The high sensitivity of the method reveals previously unidentified tight binding states for Taq and Pol I (KF) DNA polymerases. Furthermore, the incorporation of label-free nucleotides can be followed in real-time and changes in the DNA polymerase conformation (finger closing) during enzymatic activity are observable.

  5. Sumoylation activates the transcriptional activity of Pax-6, an important transcription factor for eye and brain development

    PubMed Central

    Yan, Qin; Gong, Lili; Deng, Mi; Zhang, Lan; Sun, Shuming; Liu, Jiao; Ma, Haili; Yuan, Dan; Chen, Pei-Chao; Hu, Xiaohui; Liu, Jinping; Qin, Jichao; Xiao, Ling; Huang, Xiao-Qin; Zhang, Jian; Wan-Cheng Li, David

    2010-01-01

    Pax-6 is an evolutionarily conserved transcription factor regulating brain and eye development. Four Pax-6 isoforms have been reported previously. Although the longer Pax-6 isoforms (p46 and p48) bear two DNA-binding domains, the paired domain (PD) and the homeodomain (HD), the shorter Pax-6 isoform p32 contains only the HD for DNA binding. Although a third domain, the proline-, serine- and threonine-enriched activation (PST) domain, in the C termini of all Pax-6 isoforms mediates their transcriptional modulation via phosphorylation, how p32 Pax-6 could regulate target genes remains to be elucidated. In the present study, we show that sumoylation at K91 is required for p32 Pax-6 to bind to a HD-specific site and regulate expression of target genes. First, in vitro-synthesized p32 Pax-6 alone cannot bind the P3 sequence, which contains the HD recognition site, unless it is preincubated with nuclear extracts precleared by anti–Pax-6 but not by anti-small ubiquitin-related modifier 1 (anti-SUMO1) antibody. Second, in vitro-synthesized p32 Pax-6 can be sumoylated by SUMO1, and the sumoylated p32 Pax-6 then can bind to the P3 sequence. Third, Pax-6 and SUMO1 are colocalized in the embryonic optic and lens vesicles and can be coimmunoprecipitated. Finally, SUMO1-conjugated p32 Pax-6 exists in both the nucleus and cytoplasm, and sumoylation significantly enhances the DNA-binding ability of p32 Pax-6 and positively regulates gene expression. Together, our results demonstrate that sumoylation activates p32 Pax-6 in both DNA-binding and transcriptional activities. In addition, our studies demonstrate that p32 and p46 Pax-6 possess differential DNA-binding and regulatory activities. PMID:21084637

  6. Differential sensitivities of cellular XPA and PARP-1 to arsenite inhibition and zinc rescue.

    PubMed

    Ding, Xiaofeng; Zhou, Xixi; Cooper, Karen L; Huestis, Juliana; Hudson, Laurie G; Liu, Ke Jian

    2017-09-15

    Arsenite directly binds to the zinc finger domains of the DNA repair protein poly (ADP ribose) polymerase (PARP)-1, and inhibits PARP-1 activity in the base excision repair (BER) pathway. PARP inhibition by arsenite enhances ultraviolet radiation (UVR)-induced DNA damage in keratinocytes, and the increase in DNA damage is reduced by zinc supplementation. However, little is known about the effects of arsenite and zinc on the zinc finger nucleotide excision repair (NER) protein xeroderma pigmentosum group A (XPA). In this study, we investigated the difference in response to arsenite exposure between XPA and PARP-1, and the differential effectiveness of zinc supplementation in restoring protein DNA binding and DNA damage repair. Arsenite targeted both XPA and PARP-1 in human keratinocytes, resulting in zinc loss from each protein and a pronounced decrease in XPA and PARP-1 binding to chromatin as demonstrated by Chip-on-Western assays. Zinc effectively restored DNA binding of PARP-1 and XPA to chromatin when zinc concentrations were equal to those of arsenite. In contrast, zinc was more effective in rescuing arsenite-augmented direct UVR-induced DNA damage than oxidative DNA damage. Taken together, our findings indicate that arsenite interferes with PARP-1 and XPA binding to chromatin, and that zinc supplementation fully restores DNA binding activity to both proteins in the cellular context. Interestingly, rescue of arsenite-inhibited DNA damage repair by supplemental zinc was more sensitive for DNA damage repaired by the XPA-associated NER pathway than for the PARP-1-dependent BER pathway. This study expands our understanding of arsenite's role in DNA repair inhibition and co-carcinogenesis. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Correction of the DNA repair defect in xeroderma pigmentosum group E by injection of a DNA damage-binding protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Keeney, S.; Brody, T.; Linn, S.

    1994-04-26

    Cells from a subset of patients with the DNA-repair-defective disease xeroderma pigmentosum complementation group E (XP-E) are known to lack a DNA damage-binding (DDB) activity. Purified human DDB protein was injected into XP-E cells to test whether the DNA-repair defect in these cells is caused by a defect in DDB activity. Injected DDB protein stimulated DNA repair to normal levels in those strains that lack the DDB activity but did not stimulate repair in cells from other xeroderma pigmentosum groups or in XP-E cells that contain the activity. These results provide direct evidence that defective DDB activity causes the repairmore » defect in a subset of XP-E patients, which in turn establishes a role for this activity in nucleotide-excision repair in vivo.« less

  8. Water-soluble Manganese and Iron Mesotetrakis(carboxyl)porphyrin: DNA Binding, Oxidative Cleavage, and Cytotoxic Activities.

    PubMed

    Shi, Lei; Jiang, Yi-Yu; Jiang, Tao; Yin, Wei; Yang, Jian-Ping; Cao, Man-Li; Fang, Yu-Qi; Liu, Hai-Yang

    2017-06-29

    Two new water-soluble metal carboxyl porphyrins, manganese (III) meso -tetrakis (carboxyl) porphyrin and iron (III) meso -tetrakis (carboxyl) porphyrin, were synthesized and characterized. Their interactions with ct-DNA were investigated by UV-Vis titration, fluorescence spectra, viscosity measurement and CD spectra. The results showed they can strongly bind to ct-DNA via outside binding mode. Electrophoresis experiments revealed that both complexes can cleave pBR322 DNA efficiently in the presence of hydrogen peroxide, albeit 2-Mn exhibited a little higher efficiency. The inhibitor tests suggest the oxidative DNA cleavage by these two complexes may involve hydroxyl radical active intermediates. Notably, 2-Mn exhibited considerable photocytotoxicity against Hep G2 cell via triggering a significant generation of ROS and causing disruption of MMP after irradiation.

  9. Cryptic MCAT enhancer regulation in fibroblasts and smooth muscle cells. Suppression of TEF-1 mediated activation by the single-stranded DNA-binding proteins, Pur alpha, Pur beta, and MSY1.

    PubMed

    Carlini, Leslie E; Getz, Michael J; Strauch, Arthur R; Kelm, Robert J

    2002-03-08

    An asymmetric polypurine-polypyrimidine cis-element located in the 5' region of the mouse vascular smooth muscle alpha-actin gene serves as a binding site for multiple proteins with specific affinity for either single- or double-stranded DNA. Here, we test the hypothesis that single-stranded DNA-binding proteins are responsible for preventing a cryptic MCAT enhancer centered within this element from cooperating with a nearby serum response factor-interacting CArG motif to trans-activate the minimal promoter in fibroblasts and smooth muscle cells. DNA binding studies revealed that the core MCAT sequence mediates binding of transcription enhancer factor-1 to the double-stranded polypurine-polypyrimidine element while flanking nucleotides account for interaction of Pur alpha and Pur beta with the purine-rich strand and MSY1 with the complementary pyrimidine-rich strand. Mutations that selectively impaired high affinity single-stranded DNA binding by fibroblast or smooth muscle cell-derived Pur alpha, Pur beta, and MSY1 in vitro, released the cryptic MCAT enhancer from repression in transfected cells. Additional experiments indicated that Pur alpha, Pur beta, and MSY1 also interact specifically, albeit weakly, with double-stranded DNA and with transcription enhancer factor-1. These results are consistent with two plausible models of cryptic MCAT enhancer regulation by Pur alpha, Pur beta, and MSY1 involving either competitive single-stranded DNA binding or masking of MCAT-bound transcription enhancer factor-1.

  10. Structure of the Response Regulator PhoP from Mycobacterium tuberculosis Reveals a Dimer Through the Receiver Domain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    S Menon; S Wang

    The PhoP protein from Mycobacterium tuberculosis is a response regulator of the OmpR/PhoB subfamily, whose structure consists of an N-terminal receiver domain and a C-terminal DNA-binding domain. How the DNA-binding activities are regulated by phosphorylation of the receiver domain remains unclear due to a lack of structural information on the full-length proteins. Here we report the crystal structure of the full-length PhoP of M. tuberculosis. Unlike other known structures of full-length proteins of the same subfamily, PhoP forms a dimer through its receiver domain with the dimer interface involving {alpha}4-{beta}5-{alpha}5, a common interface for activated receiver domain dimers. However, themore » switch residues, Thr99 and Tyr118, are in a conformation resembling those of nonactivated receiver domains. The Tyr118 side chain is involved in the dimer interface interactions. The receiver domain is tethered to the DNA-binding domain through a flexible linker and does not impose structural constraints on the DNA-binding domain. This structure suggests that phosphorylation likely facilitates/stabilizes receiver domain dimerization, bringing the DNA-binding domains to close proximity, thereby increasing their binding affinity for direct repeat DNA sequences.« less

  11. Discrimination against RNA Backbones by a ssDNA Binding Protein.

    PubMed

    Lloyd, Neil R; Wuttke, Deborah S

    2018-05-01

    Pot1 is the shelterin component responsible for the protection of the single-stranded DNA (ssDNA) overhang at telomeres in nearly all eukaryotic organisms. The C-terminal domain of the DNA-binding domain, Pot1pC, exhibits non-specific ssDNA recognition, achieved through thermodynamically equivalent alternative binding conformations. Given this flexibility, it is unclear how specificity for ssDNA over RNA, an activity required for biological function, is achieved. Examination of the ribose-position specificity of Pot1pC shows that ssDNA specificity is additive but not uniformly distributed across the ligand. High-resolution structures of several Pot1pC complexes with RNA-DNA chimeric ligands reveal Pot1pC discriminates against RNA by utilizing non-compensatory binding modes that feature significant rearrangement of the binding interface. These alternative conformations, accessed through both ligand and protein flexibility, recover much, but not all, of the binding energy, leading to the observed reduction in affinities. These findings suggest that intermolecular interfaces are remarkably sophisticated in their tuning of specificity toward flexible ligands. Copyright © 2018 Elsevier Ltd. All rights reserved.

  12. Mammalian transcription factor LSF is a target of ERK signaling

    PubMed Central

    Pagon, Zrinka; Volker, Janet; Cooper, Geoffrey M.; Hansen, Ulla

    2012-01-01

    LSF is a mammalian transcription factor that is rapidly and quantitatively phosphorylated upon growth induction of resting, peripheral human T cells, as assayed by a reduction in its electrophoretic mobility. The DNA-binding activity of LSF in primary T cells is greatly increased after this phosphorylation event [Volker et al., 1997]. We demonstrate here that LSF is also rapidly and quantitatively phosphorylated upon growth induction in NIH 3T3 cells, although its DNA-binding activity is not significantly altered. Three lines of experimentation established that ERK is responsible for phosphorylating LSF upon growth induction in both cell types. First, phosphorylation of LSF by ERK is sufficient to cause the reduced electrophoretic mobility of LSF. Second, the amount of ERK activity correlates with the extent of LSF phosphorylation in both primary human T cells and NIH 3T3 cells. Finally, specific inhibitors of the Ras/Raf/MEK/ERK pathway inhibit LSF modification in vivo. This phosphorylation by ERK is not sufficient for activation of LSF DNA-binding activity, as evidenced both in vitro and in mouse fibroblasts. Nonetheless, activation of ERK is a prerequisite for the substantial increase in LSF DNA-binding activity upon activation of resting T cells, indicating that ERK phosphorylation is necessary but not sufficient for activation of LSF in this cell type. PMID:12858339

  13. Dpb11 may function with RPA and DNA to initiate DNA replication.

    PubMed

    Bruck, Irina; Dhingra, Nalini; Martinez, Matthew P; Kaplan, Daniel L

    2017-01-01

    Dpb11 is required for the initiation of DNA replication in budding yeast. We found that Dpb11 binds tightly to single-stranded DNA (ssDNA) or branched DNA structures, while its human homolog, TopBP1, binds tightly to branched-DNA structures. We also found that Dpb11 binds stably to CDK-phosphorylated RPA, the eukaryotic ssDNA binding protein, in the presence of branched DNA. A Dpb11 mutant specifically defective for DNA binding did not exhibit tight binding to RPA in the presence of DNA, suggesting that Dpb11-interaction with DNA may promote the recruitment of RPA to melted DNA. We then characterized a mutant of Dpb11 that is specifically defective in DNA binding in budding yeast cells. Expression of dpb11-m1,2,3,5,ΔC results in a substantial decrease in RPA recruitment to origins, suggesting that Dpb11 interaction with DNA may be required for RPA recruitment to origins. Expression of dpb11-m1,2,3,5,ΔC also results in diminished GINS interaction with Mcm2-7 during S phase, while Cdc45 interaction with Mcm2-7 is like wild-type. The reduced GINS interaction with Mcm2-7 may be an indirect consequence of diminished origin melting. We propose that the tight interaction between Dpb11, CDK-phosphorylated RPA, and branched-DNA may be required for the essential function of stabilizing melted origin DNA in vivo. We also propose an alternative model, wherein Dpb11-DNA interaction is required for some other function in DNA replication initiation, such as helicase activation.

  14. Trimeric association of Hox and TALE homeodomain proteins mediates Hoxb2 hindbrain enhancer activity.

    PubMed

    Jacobs, Y; Schnabel, C A; Cleary, M L

    1999-07-01

    Pbx/exd proteins modulate the DNA binding affinities and specificities of Hox proteins and contribute to the execution of Hox-dependent developmental programs in arthropods and vertebrates. Pbx proteins also stably heterodimerize and bind DNA with Meis and Pknox1-Prep1, additional members of the TALE (three-amino-acid loop extension) superclass of homeodomain proteins that function on common genetic pathways with a subset of Hox proteins. In this study, we demonstrated that Pbx and Meis bind DNA as heterotrimeric complexes with Hoxb1 on a genetically defined Hoxb2 enhancer, r4, that mediates the cross-regulatory transcriptional effects of Hoxb1 in vivo. The DNA binding specificity of the heterotrimeric complex for r4 is mediated by a Pbx-Hox site in conjunction with a distal Meis site, which we showed to be required for ternary complex formation and Meis-enhanced transcription. Formation of heterotrimeric complexes in which all three homeodomains bind their cognate DNA sites is topologically facilitated by the ability of Pbx and Meis to interact through their amino termini and bind DNA without stringent half-site orientation and spacing requirements. Furthermore, Meis site mutation in the Hoxb2 enhancer phenocopies Pbx-Hox site mutation to abrogate enhancer-directed expression of a reporter transgene in the murine embryonic hindbrain, demonstrating that DNA binding by all three proteins is required for trimer function in vivo. Our data provide in vitro and in vivo evidence for the combinatorial regulation of Hox and TALE protein functions that are mediated, in part, by their interdependent DNA binding activities as ternary complexes. As a consequence, Hoxb1 employs Pbx and Meis-related proteins, as a pair of essential cofactors in a higher-order molecular complex, to mediate its transcriptional effects on an endogenous Hox response element.

  15. The Reach of Linear Protein-DNA Dimerizers

    PubMed Central

    Stafford, Ryan L.; Dervan, Peter B.

    2008-01-01

    A protein-DNA dimerizer constructed from a DNA-binding pyrrole-imidazole polyamide and the peptide FYPWMK facilitates binding of the natural transcription factor Exd to an adjacent DNA site. Previous dimerizers have been constructed with the peptide attached to an internal pyrrole monomer in an overall branched oligomer. Linear oligomers constructed by attaching the peptide to the polyamide C-terminus expand the range of protein-DNA dimerization to six additional DNA sites. Replacing the FYPWMK hexapeptide with a WM dipeptide, which was previously functional in branched compounds, does not lead to a functional linear dimerizer. Instead, inserting an additional lysine generates a minimal, linear WMK tripeptide conjugate that maintains the activity of the larger FYPWMK dimerizers in a single DNA-binding site orientation. These studies provide insight into the importance of linker length and composition, binding site spacing and orientation, and the protein-binding domain content that are important for the optimization of protein DNA-dimerizers suitable for biological experiments. PMID:17949089

  16. Cr(3+) Binding to DNA Backbone Phosphate and Bases: Slow Ligand Exchange Rates and Metal Hydrolysis.

    PubMed

    Zhou, Wenhu; Yu, Tianmeng; Vazin, Mahsa; Ding, Jinsong; Liu, Juewen

    2016-08-15

    The interaction between chromium ions and DNA is of great interest in inorganic chemistry, toxicology, and analytical chemistry. Most previous studies focused on in situ reduction of Cr(VI), producing Cr(3+) for DNA binding. Recently, Cr(3+) was reported to activate the Ce13d DNAzyme for RNA cleavage. Herein, the Ce13d is used to study two types of Cr(3+) and DNA interactions. First, Cr(3+) binds to the DNA phosphate backbone weakly through reversible electrostatic interactions, which is weakened by adding competing inorganic phosphate. However, Cr(3+) coordinates with DNA nucleobases forming stable cross-links that can survive denaturing gel electrophoresis condition. The binding of Cr(3+) to different nucleobases was further studied in terms of binding kinetics and affinity by exploiting carboxyfluorescein-labeled DNA homopolymers. Once binding takes place, the stable Cr(3+)/DNA complex cannot be dissociated by EDTA, attributable to the ultraslow ligand exchange rate of Cr(3+). The binding rate follows the order of G > C > T ≈ A. Finally, Cr(3+) gradually loses its DNA binding ability after being stored at neutral or high pH, attributable to hydrolysis. This hydrolysis can be reversed by lowering the pH. This work provides a deeper insight into the bioinorganic chemistry of Cr(3+) coordination with DNA, clarifies some inconsistency in the previous literature, and offers practically useful information for generating reproducible results.

  17. DNA binding properties and biological evaluation of dihydropyrimidinones derivatives as potential antitumor agents.

    PubMed

    Wang, Gongke; Li, Xiangrong; Gou, Yaping; Chen, Yuhan; Yan, Changling; Lu, Yan

    2013-10-01

    The binding properties of two medicinally important dihydropyrimidinones derivatives 5-(Ethoxycarbonyl)-6-methyl-4-phenyl-3,4-dihydropyrimidin-2(1H)-one (EMPD) and 5-(Ethoxycarbonyl)-6-methyl-4-(4-chlorophenyl)-3,4-dihydropyrimidin-2(1H)-one (EMCD) with calf-thymus DNA (ctDNA) were investigated by spectroscopy, viscosity, isothermal titration calorimetry (ITC) and molecular modeling techniques. Simultaneously, their biological activities were evaluated with MTT assay method. The binding constants determined with spectroscopic titration and ITC were found to be in the same order of 10(4)M(-1). According to the results of viscosity studies, fluorescence competitive binding experiment and ITC investigations, intercalative binding was evaluated as the dominant binding modes between the two compounds and ctDNA. Furthermore, the results of molecular modeling corroborated those obtained from spectroscopic, viscosimetric and ITC investigations. Evaluation of the antitumor activities of the two derivatives against different tumor cell lines proved that they exhibited significant tumor cell inhibition rate, accordingly blocking DNA transcription and replication. The present results favor the development of potential drugs related with dihydropyrimidinones derivatives in the treatment of some diseases. Copyright © 2013 Elsevier B.V. All rights reserved.

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Akabayov, B.; Akabayov, S; Lee , S

    Gene 5 of bacteriophage T7 encodes a DNA polymerase (gp5) responsible for the replication of the phage DNA. Gp5 polymerizes nucleotides with low processivity, dissociating after the incorporation of 1 to 50 nucleotides. Thioredoxin (trx) of Escherichia coli binds tightly (Kd = 5 nM) to a unique segment in the thumb subdomain of gp5 and increases processivity. We have probed the molecular basis for the increase in processivity. A single-molecule experiment reveals differences in rates of enzymatic activity and processivity between gp5 and gp5/trx. Small angle X-ray scattering studies combined with nuclease footprinting reveal two conformations of gp5, one inmore » the free state and one upon binding to trx. Comparative analysis of the DNA binding clefts of DNA polymerases and DNA binding proteins show that the binding surface contains more hydrophobic residues than other DNA binding proteins. The balanced composition between hydrophobic and charged residues of the binding site allows for efficient sliding of gp5/trx on the DNA. We propose a model for trx-induced conformational changes in gp5 that enhance the processivity by increasing the interaction of gp5 with DNA.« less

  19. Genome-wide specificity of DNA binding, gene regulation, and chromatin remodeling by TALE- and CRISPR/Cas9-based transcriptional activators

    PubMed Central

    Polstein, Lauren R.; Perez-Pinera, Pablo; Kocak, D. Dewran; Vockley, Christopher M.; Bledsoe, Peggy; Song, Lingyun; Safi, Alexias; Crawford, Gregory E.; Reddy, Timothy E.; Gersbach, Charles A.

    2015-01-01

    Genome engineering technologies based on the CRISPR/Cas9 and TALE systems are enabling new approaches in science and biotechnology. However, the specificity of these tools in complex genomes and the role of chromatin structure in determining DNA binding are not well understood. We analyzed the genome-wide effects of TALE- and CRISPR-based transcriptional activators in human cells using ChIP-seq to assess DNA-binding specificity and RNA-seq to measure the specificity of perturbing the transcriptome. Additionally, DNase-seq was used to assess genome-wide chromatin remodeling that occurs as a result of their action. Our results show that these transcription factors are highly specific in both DNA binding and gene regulation and are able to open targeted regions of closed chromatin independent of gene activation. Collectively, these results underscore the potential for these technologies to make precise changes to gene expression for gene and cell therapies or fundamental studies of gene function. PMID:26025803

  20. Oxidized mitochondrial DNA activates the NLRP3 inflammasome during apoptosis.

    PubMed

    Shimada, Kenichi; Crother, Timothy R; Karlin, Justin; Dagvadorj, Jargalsaikhan; Chiba, Norika; Chen, Shuang; Ramanujan, V Krishnan; Wolf, Andrea J; Vergnes, Laurent; Ojcius, David M; Rentsendorj, Altan; Vargas, Mario; Guerrero, Candace; Wang, Yinsheng; Fitzgerald, Katherine A; Underhill, David M; Town, Terrence; Arditi, Moshe

    2012-03-23

    We report that in the presence of signal 1 (NF-κB), the NLRP3 inflammasome was activated by mitochondrial apoptotic signaling that licensed production of interleukin-1β (IL-1β). NLRP3 secondary signal activators such as ATP induced mitochondrial dysfunction and apoptosis, resulting in release of oxidized mitochondrial DNA (mtDNA) into the cytosol, where it bound to and activated the NLRP3 inflammasome. The antiapoptotic protein Bcl-2 inversely regulated mitochondrial dysfunction and NLRP3 inflammasome activation. Mitochondrial DNA directly induced NLRP3 inflammasome activation, because macrophages lacking mtDNA had severely attenuated IL-1β production, yet still underwent apoptosis. Both binding of oxidized mtDNA to the NLRP3 inflammasome and IL-1β secretion could be competitively inhibited by the oxidized nucleoside 8-OH-dG. Thus, our data reveal that oxidized mtDNA released during programmed cell death causes activation of the NLRP3 inflammasome. These results provide a missing link between apoptosis and inflammasome activation, via binding of cytosolic oxidized mtDNA to the NLRP3 inflammasome. Copyright © 2012 Elsevier Inc. All rights reserved.

  1. Oxidized Mitochondrial DNA Activates the NLRP3 Inflammasome During Apoptosis

    PubMed Central

    Shimada, Kenichi; Crother, Timothy R.; Karlin, Justin; Dagvadorj, Jargalsaikhan; Chiba, Norika; Chen, Shuang; Ramanujan, V. Krishnan; Wolf, Andrea J.; Vergnes, Laurent; Ojcius, David M.; Rentsendorj, Altan; Vargas, Mario; Guerrero, Candace; Wang, Yinsheng; Fitzgerald, Katherine A.; Underhill, David M.; Town, Terrence; Arditi, Moshe

    2012-01-01

    SUMMARY We report that in the presence of signal 1 (NF-κB), the NLRP3 inflammasome was activated by mitochondrial apoptotic signaling that licensed production of interleukin-1β (IL-1β). NLRP3 secondary signal activators such as ATP induced mitochondrial dysfunction and apoptosis, resulting in release of oxidized mitochondrial DNA (mtDNA) into the cytosol, where it bound to and activated the NLRP3 inflammasome. The anti-apoptotic protein Bcl-2 inversely regulated mitochondrial dysfunction and NLRP3 inflammasome activation. Mitochondrial DNA directly induced NLRP3 inflammasome activation, because macrophages lacking mtDNA had severely attenuated IL-1β production, yet still underwent apoptosis. Both binding of oxidized mtDNA to the NLRP3 inflammasome and IL-1β secretion could be competitively inhibited by the oxidized nucleoside, 8-OH-dG. Thus, our data reveal that oxidized mtDNA released during programmed cell death causes activation of the NLRP3 inflammasome. These results provide a missing link between apoptosis and inflammasome activation, via binding of cytosolic oxidized mtDNA to the NLRP3 inflammasome. PMID:22342844

  2. Mononuclear Pd(II) complex as a new therapeutic agent: Synthesis, characterization, biological activity, spectral and DNA binding approaches

    NASA Astrophysics Data System (ADS)

    Saeidifar, Maryam; Mirzaei, Hamidreza; Ahmadi Nasab, Navid; Mansouri-Torshizi, Hassan

    2017-11-01

    The binding ability between a new water-soluble palladium(II) complex [Pd(bpy)(bez-dtc)]Cl (where bpy is 2,2‧-bipyridine and bez-dtc is benzyl dithiocarbamate), as an antitumor agent, and calf thymus DNA was evaluated using various physicochemical methods, such as UV-Vis absorption, Competitive fluorescence studies, viscosity measurement, zeta potential and circular dichroism (CD) spectroscopy. The Pd(II) complex was synthesized and characterized using elemental analysis, molar conductivity measurements, FT-IR, 1H NMR, 13C NMR and electronic spectra studies. The anticancer activity against HeLa cell lines demonstrated lower cytotoxicity than cisplatin. The binding constants and the thermodynamic parameters were determined at different temperatures (300 K, 310 K and 320 K) and shown that the complex can bind to DNA via electrostatic forces. Furthermore, this result was confirmed by the viscosity and zeta potential measurements. The CD spectral results demonstrated that the binding of Pd(II) complex to DNA induced conformational changes in DNA. We hope that these results will provide a basis for further studies and practical clinical use of anticancer drugs.

  3. Molecular beacons for DNA binding proteins: an emerging technology for detection of DNA binding proteins and their ligands.

    PubMed

    Dummitt, Benjamin; Chang, Yie-Hwa

    2006-06-01

    Quantitation of the level or activity of specific proteins is one of the most commonly performed experiments in biomedical research. Protein detection has historically been difficult to adapt to high throughput platforms because of heavy reliance upon antibodies for protein detection. Molecular beacons for DNA binding proteins is a recently developed technology that attempts to overcome such limitations. Protein detection is accomplished using inexpensive, easy-to-synthesize oligonucleotides, accompanied by a fluorescence readout. Importantly, detection of the protein and reporting of the signal occur simultaneously, allowing for one-step protocols and increased potential for use in high throughput analysis. While the initial iteration of the technology allowed only for the detection of sequence-specific DNA binding proteins, more recent adaptations allow for the possibility of development of beacons for any protein, independent of native DNA binding activity. Here, we discuss the development of the technology, the mechanism of the reaction, and recent improvements and modifications made to improve the assay in terms of sensitivity, potential for multiplexing, and broad applicability.

  4. Cdc45-induced loading of human RPA onto single-stranded DNA.

    PubMed

    Szambowska, Anna; Tessmer, Ingrid; Prus, Piotr; Schlott, Bernhard; Pospiech, Helmut; Grosse, Frank

    2017-04-07

    Cell division cycle protein 45 (Cdc45) is an essential component of the eukaryotic replicative DNA helicase. We found that human Cdc45 forms a complex with the single-stranded DNA (ssDNA) binding protein RPA. Moreover, it actively loads RPA onto nascent ssDNA. Pull-down assays and surface plasmon resonance studies revealed that Cdc45-bound RPA complexed with ssDNA in the 8-10 nucleotide binding mode, but dissociated when RPA covered a 30-mer. Real-time analysis of RPA-ssDNA binding demonstrated that Cdc45 catalytically loaded RPA onto ssDNA. This placement reaction required physical contacts of Cdc45 with the RPA70A subdomain. Our results imply that Cdc45 controlled stabilization of the 8-nt RPA binding mode, the subsequent RPA transition into 30-mer mode and facilitated an ordered binding to ssDNA. We propose that a Cdc45-mediated loading guarantees a seamless deposition of RPA on newly emerging ssDNA at the nascent replication fork. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Chemosensitization of Breast Cancer Cells to Chemotherapeutic Agents by 3,3’-Diindolylmethane (DIM)

    DTIC Science & Technology

    2007-08-01

    activity (Fig. 4A). More importantly, our animal studies showed that dietary B-DIM in combination with Taxotere also inhibited NF-κB DNA binding...κB DNA-binding activity (Fig. 4C). Importantly, our animal studies showed that dietary B-DIM in combination with Taxotere inhibited NF-κB DNA...Rahman et al 15 DISCUSSION Current reports have shown that plant-derived dietary compounds provide protection against the

  6. Imidazolium tagged acridines: Synthesis, characterization and applications in DNA binding and anti-microbial activities

    NASA Astrophysics Data System (ADS)

    Raju, Gembali; Vishwanath, S.; Prasad, Archana; Patel, Basant K.; Prabusankar, Ganesan

    2016-03-01

    New water soluble 4,5-bis imidazolium tagged acridines have been synthesized and structurally characterized by multinuclear NMR and single crystal X-ray diffraction techniques. The DNA binding and anti-microbial activities of these acridine derivatives were investigated by fluorescence and far-UV circular dichroism studies.

  7. Libraries of Synthetic TALE-Activated Promoters: Methods and Applications.

    PubMed

    Schreiber, T; Tissier, A

    2016-01-01

    The discovery of proteins with programmable DNA-binding specificities triggered a whole array of applications in synthetic biology, including genome editing, regulation of transcription, and epigenetic modifications. Among those, transcription activator-like effectors (TALEs) due to their natural function as transcription regulators, are especially well-suited for the development of orthogonal systems for the control of gene expression. We describe here the construction and testing of libraries of synthetic TALE-activated promoters which are under the control of a single TALE with a given DNA-binding specificity. These libraries consist of a fixed DNA-binding element for the TALE, a TATA box, and variable sequences of 19 bases upstream and 43 bases downstream of the DNA-binding element. These libraries were cloned using a Golden Gate cloning strategy making them usable as standard parts in a modular cloning system. The broad range of promoter activities detected and the versatility of these promoter libraries make them valuable tools for applications in the fine-tuning of expression in metabolic engineering projects or in the design and implementation of regulatory circuits. © 2016 Elsevier Inc. All rights reserved.

  8. Binding of the Zn2+ ion to ferric uptake regulation protein from E. coli and the competition with Fe2+ binding: a molecular modeling study of the effect on DNA binding and conformational changes of Fur

    NASA Astrophysics Data System (ADS)

    Jabour, Salih; Hamed, Mazen Y.

    2009-04-01

    The three dimensional structure of Ferric uptake regulation protein dimer from E. coli, determined by molecular modeling, was docked on a DNA fragment (iron box) and Zn2+ ions were added in two steps. The first step involved the binding of one Zn2+ ion to what is known as the zinc site which consists of the residues Cys 92, Cys 95, Asp 137, Asp141, Arg139, Glu 140, His 145 and His 143 with an average metal-Nitrogen distance of 2.5 Å and metal-oxygen distance of 3.1-3.2 Å. The second Zn2+ ion is bound to the iron activating site formed from the residues Ile 50, His 71, Asn 72, Gly 97, Asp 105 and Ala 109. The binding of the second Zn2+ ion strengthened the binding of the first ion as indicated by the shortening of the zinc-residue distances. Fe2+, when added to the complex consisting of 2Zn2+/Fur dimer/DNA, replaced the Zn2+ ion in the zinc site and when a second Fe2+ was added, it replaced the second zinc ion in the iron activating site. The binding of both zinc and iron ions induced a similar change in Fur conformations, but shifted residues closer to DNA in a different manner. This is discussed along with a possible role for the Zn2+ ion in the Fur dimer binding of DNA in its repressor activity.

  9. Recombinant DHX33 Protein Possesses Dual DNA/RNA Helicase Activity.

    PubMed

    Wang, Xingshun; Ge, Wei; Zhang, Yandong

    2018-06-13

    RNA helicase DHX33 has been shown to participate in a variety of cellular activities, including ribosome biogenesis, protein translation, and gene transcription. We and others further discovered that DHX33 is strongly expressed in several types of human cancers and plays important roles in promoting cancer cell proliferation. To better understand the molecular mechanism for DHX33 in exerting its biological functions, we purified recombinant DHX33 and performed biochemical studies in vitro. DHX33 protein was found to have ATPase activity that is dependent on DNA or RNA duplexes. The ATPase activity of DHX33 is coupled with its RNA/DNA unwinding activity. If a key residue in the ATP binding site were mutated, the mutant DHX33 could not unwind DNA/RNA duplexes. Furthermore, a deletion mutant of a RKK motif previously identified to be involved in ribosome DNA binding could still unwind DNA duplexes, albeit with reduced efficiency. In summary, our study reveals that purified DHX33 protein possesses unwinding activity toward DNA and RNA duplexes.

  10. A DNA-binding protein from Candida albicans that binds to the RPG box of Saccharomyces cerevisiae and the telomeric repeat sequence of C. albicans.

    PubMed

    Ishii, N; Yamamoto, M; Lahm, H W; Iizumi, S; Yoshihara, F; Nakayama, H; Arisawa, M; Aoki, Y

    1997-02-01

    Electromobility shift assays with a DNA probe containing the Saccharomyces cerevisiae ENO1 RPG box identified a specific DNA-binding protein in total protein extracts of Candida albicans. The protein, named Rbf1p (RPG-box-binding protein 1), bound to other S. cerevisiae RPG boxes, although the nucleotide recognition profile was not completely the same as that of S. cerevisiae Rap 1p (repressor-activator protein 1), an RPG-box-binding protein. The repetitive sequence of the C. albicans chromosomal telomere also competed with RPG-box binding to Rbf1p. For further analysis, we purified Rbf1p 57,600-fold from C. albicans total protein extracts, raised mAbs against the purified protein and immunologically cloned the gene, whose ORF specified a protein of 527 aa. The bacterially expressed protein showed RPG-box-binding activity with the same profile as that of the purified one. The Rbf1p, containing two glutamine-rich regions that are found in many transcription factors, showed transcriptional activation capability in S. cerevisiae and was predominantly observed in nuclei. These results suggest that Rbf1p is a transcription factor with telomere-binding activity in C. albicans.

  11. Targeted DNA demethylation in human cells by fusion of a plant 5-methylcytosine DNA glycosylase to a sequence-specific DNA binding domain

    PubMed Central

    Parrilla-Doblas, Jara Teresa; Ariza, Rafael R.; Roldán-Arjona, Teresa

    2017-01-01

    ABSTRACT DNA methylation is a crucial epigenetic mark associated to gene silencing, and its targeted removal is a major goal of epigenetic editing. In animal cells, DNA demethylation involves iterative 5mC oxidation by TET enzymes followed by replication-dependent dilution and/or replication-independent DNA repair of its oxidized derivatives. In contrast, plants use specific DNA glycosylases that directly excise 5mC and initiate its substitution for unmethylated C in a base excision repair process. In this work, we have fused the catalytic domain of Arabidopsis ROS1 5mC DNA glycosylase (ROS1_CD) to the DNA binding domain of yeast GAL4 (GBD). We show that the resultant GBD-ROS1_CD fusion protein binds specifically a GBD-targeted DNA sequence in vitro. We also found that transient in vivo expression of GBD-ROS1_CD in human cells specifically reactivates transcription of a methylation-silenced reporter gene, and that such reactivation requires both ROS1_CD catalytic activity and GBD binding capacity. Finally, we show that reactivation induced by GBD-ROS1_CD is accompanied by decreased methylation levels at several CpG sites of the targeted promoter. All together, these results show that plant 5mC DNA glycosylases can be used for targeted active DNA demethylation in human cells. PMID:28277978

  12. Novel structural features drive DNA binding properties of Cmr, a CRP family protein in TB complex mycobacteria.

    PubMed

    Ranganathan, Sridevi; Cheung, Jonah; Cassidy, Michael; Ginter, Christopher; Pata, Janice D; McDonough, Kathleen A

    2018-01-09

    Mycobacterium tuberculosis (Mtb) encodes two CRP/FNR family transcription factors (TF) that contribute to virulence, Cmr (Rv1675c) and CRPMt (Rv3676). Prior studies identified distinct chromosomal binding profiles for each TF despite their recognizing overlapping DNA motifs. The present study shows that Cmr binding specificity is determined by discriminator nucleotides at motif positions 4 and 13. X-ray crystallography and targeted mutational analyses identified an arginine-rich loop that expands Cmr's DNA interactions beyond the classical helix-turn-helix contacts common to all CRP/FNR family members and facilitates binding to imperfect DNA sequences. Cmr binding to DNA results in a pronounced asymmetric bending of the DNA and its high level of cooperativity is consistent with DNA-facilitated dimerization. A unique N-terminal extension inserts between the DNA binding and dimerization domains, partially occluding the site where the canonical cAMP binding pocket is found. However, an unstructured region of this N-terminus may help modulate Cmr activity in response to cellular signals. Cmr's multiple levels of DNA interaction likely enhance its ability to integrate diverse gene regulatory signals, while its novel structural features establish Cmr as an atypical CRP/FNR family member. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. The identification of FANCD2 DNA binding domains reveals nuclear localization sequences.

    PubMed

    Niraj, Joshi; Caron, Marie-Christine; Drapeau, Karine; Bérubé, Stéphanie; Guitton-Sert, Laure; Coulombe, Yan; Couturier, Anthony M; Masson, Jean-Yves

    2017-08-21

    Fanconi anemia (FA) is a recessive genetic disorder characterized by congenital abnormalities, progressive bone-marrow failure, and cancer susceptibility. The FA pathway consists of at least 21 FANC genes (FANCA-FANCV), and the encoded protein products interact in a common cellular pathway to gain resistance against DNA interstrand crosslinks. After DNA damage, FANCD2 is monoubiquitinated and accumulates on chromatin. FANCD2 plays a central role in the FA pathway, using yet unidentified DNA binding regions. By using synthetic peptide mapping and DNA binding screen by electromobility shift assays, we found that FANCD2 bears two major DNA binding domains predominantly consisting of evolutionary conserved lysine residues. Furthermore, one domain at the N-terminus of FANCD2 bears also nuclear localization sequences for the protein. Mutations in the bifunctional DNA binding/NLS domain lead to a reduction in FANCD2 monoubiquitination and increase in mitomycin C sensitivity. Such phenotypes are not fully rescued by fusion with an heterologous NLS, which enable separation of DNA binding and nuclear import functions within this domain that are necessary for FANCD2 functions. Collectively, our results enlighten the importance of DNA binding and NLS residues in FANCD2 to activate an efficient FA pathway. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. A new structural framework for integrating replication protein A into DNA processing machinery

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brosey, Chris A; Yan, Chunli; Tsutakawa, Susan E

    2013-01-01

    By coupling the protection and organization of ssDNA with the recruitment and alignment of DNA processing factors, Replication Protein A (RPA) lies at the heart of dynamic multi-protein DNA processing machinery. Nevertheless, how RPA manages to coordinate the biochemical functions of its eight domains remains unknown. We examined the structural biochemistry of RPA s DNA binding activity, combining small-angle x-ray and neutron scattering with all-atom molecular dynamics simulations to investigate the architecture of RPA s DNA-binding core. It has been long held that RPA engages ssDNA in three stages, but our data reveal that RPA undergoes two rather than threemore » transitions as it binds ssDNA. In contrast to previous models, RPA is more compact when fully engaged on 20-30 nucleotides of ssDNA than when DNA-free, and there is no evidence for significant population of a highly compacted structure in the initial 8-10 nucleotide binding mode. These results provide a new framework for understanding the integration of ssDNA into DNA processing machinery and how binding partners may manipulate RPA architecture to gain access to the substrate.« less

  15. DNA binding by the ribosomal DNA transcription factor rrn3 is essential for ribosomal DNA transcription.

    PubMed

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I

    2013-03-29

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.

  16. DNA Binding by the Ribosomal DNA Transcription Factor Rrn3 Is Essential for Ribosomal DNA Transcription*

    PubMed Central

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.

    2013-01-01

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135

  17. The role of Ca²⁺ in the activity of Mycobacterium tuberculosis DNA gyrase.

    PubMed

    Karkare, Shantanu; Yousafzai, Faridoon; Mitchenall, Lesley A; Maxwell, Anthony

    2012-10-01

    DNA gyrase is the only type II topoisomerase in Mycobacterium tuberculosis and needs to catalyse DNA supercoiling, relaxation and decatenation reactions in order to fulfil the functions normally carried out by gyrase and DNA topoisomerase IV in other bacteria. We have obtained evidence for the existence of a Ca(2+)-binding site in the GyrA subunit of M. tuberculosis gyrase. Ca(2+) cannot support topoisomerase reactions in the absence of Mg(2+), but partial removal of Ca(2+) from GyrA by dialysis against EGTA leads to a modest loss in relaxation activity that can be restored by adding back Ca(2+). More extensive removal of Ca(2+) by denaturation of GyrA and dialysis against EGTA results in an enzyme with greatly reduced enzyme activities. Mutation of the proposed Ca(2+)-binding residues also leads to loss of activity. We propose that Ca(2+) has a regulatory role in M. tuberculosis gyrase and suggest a model for the modulation of gyrase activity by Ca(2+) binding.

  18. The role of Ca2+ in the activity of Mycobacterium tuberculosis DNA gyrase

    PubMed Central

    Karkare, Shantanu; Yousafzai, Faridoon; Mitchenall, Lesley A.; Maxwell, Anthony

    2012-01-01

    DNA gyrase is the only type II topoisomerase in Mycobacterium tuberculosis and needs to catalyse DNA supercoiling, relaxation and decatenation reactions in order to fulfil the functions normally carried out by gyrase and DNA topoisomerase IV in other bacteria. We have obtained evidence for the existence of a Ca2+-binding site in the GyrA subunit of M. tuberculosis gyrase. Ca2+ cannot support topoisomerase reactions in the absence of Mg2+, but partial removal of Ca2+ from GyrA by dialysis against EGTA leads to a modest loss in relaxation activity that can be restored by adding back Ca2+. More extensive removal of Ca2+ by denaturation of GyrA and dialysis against EGTA results in an enzyme with greatly reduced enzyme activities. Mutation of the proposed Ca2+-binding residues also leads to loss of activity. We propose that Ca2+ has a regulatory role in M. tuberculosis gyrase and suggest a model for the modulation of gyrase activity by Ca2+ binding. PMID:22844097

  19. Multiple Intrinsically Disordered Sequences Alter DNA Binding by the Homeodomain of the Drosophila Hox Protein Ultrabithorax*S⃞

    PubMed Central

    Liu, Ying; Matthews, Kathleen S.; Bondos, Sarah E.

    2008-01-01

    During animal development, distinct tissues, organs, and appendages are specified through differential gene transcription by Hox transcription factors. However, the conserved Hox homeodomains bind DNA with high affinity yet low specificity. We have therefore explored the structure of the Drosophila melanogaster Hox protein Ultrabithorax and the impact of its nonhomeodomain regions on DNA binding properties. Computational and experimental approaches identified several conserved, intrinsically disordered regions outside the homeodomain of Ultrabithorax that impact DNA binding by the homeodomain. Full-length Ultrabithorax bound to target DNA 2.5-fold weaker than its isolated homeodomain. Using N-terminal and C-terminal deletion mutants, we demonstrate that the YPWM region and the disordered microexons (termed the I1 region) inhibit DNA binding ∼2-fold, whereas the disordered I2 region inhibits homeodomain-DNA interaction a further ∼40-fold. Binding is restored almost to homeodomain affinity by the mostly disordered N-terminal 174 amino acids (R region) in a length-dependent manner. Both the I2 and R regions contain portions of the activation domain, functionally linking DNA binding and transcription regulation. Given that (i) the I1 region and a portion of the R region alter homeodomain-DNA binding as a function of pH and (ii) an internal deletion within I1 increases Ultrabithorax-DNA affinity, I1 must directly impact homeodomain-DNA interaction energetics. However, I2 appears to indirectly affect DNA binding in a manner countered by the N terminus. The amino acid sequences of I2 and much of the I1 and R regions vary significantly among Ultrabithorax orthologues, potentially diversifying Hox-DNA interactions. PMID:18508761

  20. New modulated design and synthesis of chiral CuII/SnIV bimetallic potential anticancer drug entity: In vitro DNA binding and pBR322 DNA cleavage activity

    NASA Astrophysics Data System (ADS)

    Tabassum, Sartaj; Sharma, Girish Chandra; Arjmand, Farukh

    2012-05-01

    A new chiral ligand scaffold L derived from (R)-2-amino-2-phenyl ethanol and diethyl oxalate was isolated and thoroughly characterized by various spectroscopic methods. The ligand L was allowed to react with CuCl2·2H2O and NiCl2·6H2O to achieve monometallic complexes 1 and 2, respectively. Subsequently modulation of 1 and 2 was carried out in the presence of SnCl4·5H2O to obtain heterobimetallic potential drug candidates 3 and 4 possessing (CuII/SnIV and NiII/SnIV) metallic cores, respectively and characterized by elemental analysis and spectroscopic data including 1H, 13C and 119Sn NMR in case of 3 and 4. In vitro DNA binding studies revealed that complex 3 avidly binds to DNA as quantified by Kb and Ksv values. Complex 3 exhibits a remarkable DNA cleavage activity (concentration dependent) with pBR322 DNA and the cleavage activity of 3 was significantly enhanced in the presence of activators and follows the order H2O2 > Asc > MPA > GSH. Complex 3 cleave pBR322 DNA via hydrolytic pathway and accessible to major groove of DNA.

  1. Structures of apo IRF-3 and IRF-7 DNA binding domains: effect of loop L1 on DNA binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    De Ioannes, Pablo; Escalante, Carlos R.; Aggarwal, Aneel K.

    2013-11-20

    Interferon regulatory factors IRF-3 and IRF-7 are transcription factors essential in the activation of interferon-{beta} (IFN-{beta}) gene in response to viral infections. Although, both proteins recognize the same consensus IRF binding site AANNGAAA, they have distinct DNA binding preferences for sites in vivo. The X-ray structures of IRF-3 and IRF-7 DNA binding domains (DBDs) bound to IFN-{beta} promoter elements revealed flexibility in the loops (L1-L3) and the residues that make contacts with the target sequence. To characterize the conformational changes that occur on DNA binding and how they differ between IRF family members, we have solved the X-ray structures ofmore » IRF-3 and IRF-7 DBDs in the absence of DNA. We found that loop L1, carrying the conserved histidine that interacts with the DNA minor groove, is disordered in apo IRF-3 but is ordered in apo IRF-7. This is reflected in differences in DNA binding affinities when the conserved histidine in loop L1 is mutated to alanine in the two proteins. The stability of loop L1 in IRF-7 derives from a unique combination of hydrophobic residues that pack against the protein core. Together, our data show that differences in flexibility of loop L1 are an important determinant of differential IRF-DNA binding.« less

  2. An SRY mutation causing human sex reversal resolves a general mechanism of structure-specific DNA recognition: application to the four-way DNA junction.

    PubMed

    Peters, R; King, C Y; Ukiyama, E; Falsafi, S; Donahoe, P K; Weiss, M A

    1995-04-11

    SRY, a genetic "master switch" for male development in mammals, exhibits two biochemical activities: sequence-specific recognition of duplex DNA and sequence-independent binding to the sharp angles of four-way DNA junctions. Here, we distinguish between these activities by analysis of a mutant SRY associated with human sex reversal (46, XY female with pure gonadal dysgenesis). The substitution (168T in human SRY) alters a nonpolar side chain in the minor-groove DNA recognition alpha-helix of the HMG box [Haqq, C.M., King, C.-Y., Ukiyama, E., Haqq, T.N., Falsalfi, S., Donahoe, P.K., & Weiss, M.A. (1994) Science 266, 1494-1500]. The native (but not mutant) side chain inserts between specific base pairs in duplex DNA, interrupting base stacking at a site of induced DNA bending. Isotope-aided 1H-NMR spectroscopy demonstrates that analogous side-chain insertion occurs on binding of SRY to a four-way junction, establishing a shared mechanism of sequence- and structure-specific DNA binding. Although the mutant DNA-binding domain exhibits > 50-fold reduction in sequence-specific DNA recognition, near wild-type affinity for four-way junctions is retained. Our results (i) identify a shared SRY-DNA contact at a site of either induced or intrinsic DNA bending, (ii) demonstrate that this contact is not required to bind an intrinsically bent DNA target, and (iii) rationalize patterns of sequence conservation or diversity among HMG boxes. Clinical association of the I68T mutation with human sex reversal supports the hypothesis that specific DNA recognition by SRY is required for male sex determination.

  3. Human mRNA polyadenylate binding protein: evolutionary conservation of a nucleic acid binding motif.

    PubMed Central

    Grange, T; de Sa, C M; Oddos, J; Pictet, R

    1987-01-01

    We have isolated a full length cDNA (cDNA) coding for the human poly(A) binding protein. The cDNA derived 73 kd basic translation product has the same Mr, isoelectric point and peptidic map as the poly(A) binding protein. DNA sequence analysis reveals a 70,244 dalton protein. The N terminal part, highly homologous to the yeast poly(A) binding protein, is sufficient for poly(A) binding activity. This domain consists of a four-fold repeated unit of approximately 80 amino acids present in other nucleic acid binding proteins. In the C terminal part there is, as in the yeast protein, a sequence of approximately 150 amino acids, rich in proline, alanine and glutamine which together account for 48% of the residues. A 2,9 kb mRNA corresponding to this cDNA has been detected in several vertebrate cell types and in Drosophila melanogaster at every developmental stage including oogenesis. Images PMID:2885805

  4. ATM activation and its recruitment to damaged DNA require binding to the C terminus of Nbs1.

    PubMed

    You, Zhongsheng; Chahwan, Charly; Bailis, Julie; Hunter, Tony; Russell, Paul

    2005-07-01

    ATM has a central role in controlling the cellular responses to DNA damage. It and other phosphoinositide 3-kinase-related kinases (PIKKs) have giant helical HEAT repeat domains in their amino-terminal regions. The functions of these domains in PIKKs are not well understood. ATM activation in response to DNA damage appears to be regulated by the Mre11-Rad50-Nbs1 (MRN) complex, although the exact functional relationship between the MRN complex and ATM is uncertain. Here we show that two pairs of HEAT repeats in fission yeast ATM (Tel1) interact with an FXF/Y motif at the C terminus of Nbs1. This interaction resembles nucleoporin FXFG motif binding to HEAT repeats in importin-beta. Budding yeast Nbs1 (Xrs2) appears to have two FXF/Y motifs that interact with Tel1 (ATM). In Xenopus egg extracts, the C terminus of Nbs1 recruits ATM to damaged DNA, where it is subsequently autophosphorylated. This interaction is essential for ATM activation. A C-terminal 147-amino-acid fragment of Nbs1 that has the Mre11- and ATM-binding domains can restore ATM activation in an Nbs1-depleted extract. We conclude that an interaction between specific HEAT repeats in ATM and the C-terminal FXF/Y domain of Nbs1 is essential for ATM activation. We propose that conformational changes in the MRN complex that occur upon binding to damaged DNA are transmitted through the FXF/Y-HEAT interface to activate ATM. This interaction also retains active ATM at sites of DNA damage.

  5. Design, synthesis, molecular modeling and anti-proliferative evaluation of novel quinoxaline derivatives as potential DNA intercalators and topoisomerase II inhibitors.

    PubMed

    Ibrahim, M K; Taghour, M S; Metwaly, A M; Belal, A; Mehany, A B M; Elhendawy, M A; Radwan, M M; Yassin, A M; El-Deeb, N M; Hafez, E E; ElSohly, M A; Eissa, I H

    2018-06-04

    New series of [1,2,4]triazolo [4,3-a]quinoxaline and bis([1,2,4]triazolo)[4,3-a:3',4'-c]quinoxaline derivatives have been designed, synthesized and biologically evaluated for their cytotoxic activities against three tumor cell lines (HePG-2, Hep-2 and Caco-2). Compounds 16 e , 21, 25 a and 25 b exhibited the highest activities against the examined cell lines with IC 50 values ranging from 0.29 to 0.90 μM comparable to that of doxorubicin (IC 50 ranging from 0.51 to 0.73 μM). The most active members were further evaluated for their topoisomerase II (Topo II) inhibitory activities and DNA intercalating affinities as potential mechanisms for their anti-proliferative activities. Interestingly, the results of Topo II inhibition and DNA binding assays were consistent with that of the cytotoxicity data, where the most potent anti-proliferative derivatives exhibited good Topo II inhibitory activities and DNA binding affinities, comparable to that of doxorubicin. Moreover, the most active compound 25 a caused cell cycle arrest at G2/M phase and induced apoptosis in Caco-2 cells. In addition, Furthermore, molecular docking studies were performed for the novel compounds against DNA-Topo II complex to investigate their binding patterns. Based on these studies, it was concluded that DNA binding and/or Topo II inhibition may contribute to the observed cytotoxicity of the synthesized compounds. Copyright © 2018. Published by Elsevier Masson SAS.

  6. DNA mimic proteins: functions, structures, and bioinformatic analysis.

    PubMed

    Wang, Hao-Ching; Ho, Chun-Han; Hsu, Kai-Cheng; Yang, Jinn-Moon; Wang, Andrew H-J

    2014-05-13

    DNA mimic proteins have DNA-like negative surface charge distributions, and they function by occupying the DNA binding sites of DNA binding proteins to prevent these sites from being accessed by DNA. DNA mimic proteins control the activities of a variety of DNA binding proteins and are involved in a wide range of cellular mechanisms such as chromatin assembly, DNA repair, transcription regulation, and gene recombination. However, the sequences and structures of DNA mimic proteins are diverse, making them difficult to predict by bioinformatic search. To date, only a few DNA mimic proteins have been reported. These DNA mimics were not found by searching for functional motifs in their sequences but were revealed only by structural analysis of their charge distribution. This review highlights the biological roles and structures of 16 reported DNA mimic proteins. We also discuss approaches that might be used to discover new DNA mimic proteins.

  7. TALE-PvuII fusion proteins--novel tools for gene targeting.

    PubMed

    Yanik, Mert; Alzubi, Jamal; Lahaye, Thomas; Cathomen, Toni; Pingoud, Alfred; Wende, Wolfgang

    2013-01-01

    Zinc finger nucleases (ZFNs) consist of zinc fingers as DNA-binding module and the non-specific DNA-cleavage domain of the restriction endonuclease FokI as DNA-cleavage module. This architecture is also used by TALE nucleases (TALENs), in which the DNA-binding modules of the ZFNs have been replaced by DNA-binding domains based on transcription activator like effector (TALE) proteins. Both TALENs and ZFNs are programmable nucleases which rely on the dimerization of FokI to induce double-strand DNA cleavage at the target site after recognition of the target DNA by the respective DNA-binding module. TALENs seem to have an advantage over ZFNs, as the assembly of TALE proteins is easier than that of ZFNs. Here, we present evidence that variant TALENs can be produced by replacing the catalytic domain of FokI with the restriction endonuclease PvuII. These fusion proteins recognize only the composite recognition site consisting of the target site of the TALE protein and the PvuII recognition sequence (addressed site), but not isolated TALE or PvuII recognition sites (unaddressed sites), even at high excess of protein over DNA and long incubation times. In vitro, their preference for an addressed over an unaddressed site is > 34,000-fold. Moreover, TALE-PvuII fusion proteins are active in cellula with minimal cytotoxicity.

  8. MFP1 is a thylakoid-associated, nucleoid-binding protein with a coiled-coil structure

    PubMed Central

    Jeong, Sun Yong; Rose, Annkatrin; Meier, Iris

    2003-01-01

    Plastid DNA, like bacterial and mitochondrial DNA, is organized into protein–DNA complexes called nucleoids. Plastid nucleoids are believed to be associated with the inner envelope in developing plastids and the thylakoid membranes in mature chloroplasts, but the mechanism for this re-localization is unknown. Here, we present the further characterization of the coiled-coil DNA-binding protein MFP1 as a protein associated with nucleoids and with the thylakoid membranes in mature chloroplasts. MFP1 is located in plastids in both suspension culture cells and leaves and is attached to the thylakoid membranes with its C-terminal DNA-binding domain oriented towards the stroma. It has a major DNA-binding activity in mature Arabidopsis chloroplasts and binds to all tested chloroplast DNA fragments without detectable sequence specificity. Its expression is tightly correlated with the accumulation of thylakoid membranes. Importantly, it is associated in vivo with nucleoids, suggesting a function for MFP1 at the interface between chloroplast nucleoids and the developing thylakoid membrane system. PMID:12930969

  9. DIRECT BINDING OF GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE TO TELOMERIC DNA PROTECTS TELOMERES AGAINST CHEMOTHERAPY-INDUCED RAPID DEGRADATION

    PubMed Central

    Demarse, Neil A.; Ponnusamy, Suriyan; Spicer, Eleanor K.; Apohan, Elif; Baatz, John E.; Ogretmen, Besim; Davies, Christopher

    2009-01-01

    GAPDH (glyceraldehyde 3-phosphate dehydrogenase) is a glycolytic enzyme that displays several non-glycolytic activities, including the maintenance and/or protection of telomeres. In this study, we determined the molecular mechanism and biological role of the interaction between GAPDH and human telomeric DNA. Using gel shift assays, we show that recombinant GAPDH binds directly with high affinity (Kd = 45 nM) to a single-stranded oligonucleotide comprising three telomeric DNA repeats and that nucleotides T1, G5 and G6 of the TTAGGG repeat are essential for binding. The stoichiometry of the interaction is 2:1 (DNA: GAPDH), and GAPDH appears to form a high-molecular weight complex when bound to the oligonucleotide. Mutation of Asp32 and Cys149, which are localized to the NAD-binding site and the active site center of GAPDH, respectively, produced mutants that almost completely lost their telomere-binding functions both in vitro and in situ (in A549 human lung cancer cells). Treatment of A549 cells with the chemotherapeutic agents gemcitabine and doxorubicin resulted in increased nuclear localization of expressed wild-type GAPDH, where it protected telomeres against rapid degradation, concomitant with increased resistance to the growth inhibitory effects of these drugs. The non-DNA-binding mutants of GAPDH also localized to the nucleus when expressed in A549 cells, but did not confer any significant protection of telomeres against chemotherapy-induced degradation or growth inhibition, and this occurred without the involvement of caspase activation or apoptosis regulation. Overall, these data demonstrate that GAPDH binds telomeric DNA directly in vitro and may have a biological role in the protection of telomeres against rapid degradation in response to chemotherapeutic agents in A549 human lung cancer cells. PMID:19800890

  10. p53 Specifically Binds Triplex DNA In Vitro and in Cells

    PubMed Central

    Brázdová, Marie; Tichý, Vlastimil; Helma, Robert; Bažantová, Pavla; Polášková, Alena; Krejčí, Aneta; Petr, Marek; Navrátilová, Lucie; Tichá, Olga; Nejedlý, Karel; Bennink, Martin L.; Subramaniam, Vinod; Bábková, Zuzana; Martínek, Tomáš; Lexa, Matej; Adámik, Matej

    2016-01-01

    Triplex DNA is implicated in a wide range of biological activities, including regulation of gene expression and genomic instability leading to cancer. The tumor suppressor p53 is a central regulator of cell fate in response to different type of insults. Sequence and structure specific modes of DNA recognition are core attributes of the p53 protein. The focus of this work is the structure-specific binding of p53 to DNA containing triplex-forming sequences in vitro and in cells and the effect on p53-driven transcription. This is the first DNA binding study of full-length p53 and its deletion variants to both intermolecular and intramolecular T.A.T triplexes. We demonstrate that the interaction of p53 with intermolecular T.A.T triplex is comparable to the recognition of CTG-hairpin non-B DNA structure. Using deletion mutants we determined the C-terminal DNA binding domain of p53 to be crucial for triplex recognition. Furthermore, strong p53 recognition of intramolecular T.A.T triplexes (H-DNA), stabilized by negative superhelicity in plasmid DNA, was detected by competition and immunoprecipitation experiments, and visualized by AFM. Moreover, chromatin immunoprecipitation revealed p53 binding T.A.T forming sequence in vivo. Enhanced reporter transactivation by p53 on insertion of triplex forming sequence into plasmid with p53 consensus sequence was observed by luciferase reporter assays. In-silico scan of human regulatory regions for the simultaneous presence of both consensus sequence and T.A.T motifs identified a set of candidate p53 target genes and p53-dependent activation of several of them (ABCG5, ENOX1, INSR, MCC, NFAT5) was confirmed by RT-qPCR. Our results show that T.A.T triplex comprises a new class of p53 binding sites targeted by p53 in a DNA structure-dependent mode in vitro and in cells. The contribution of p53 DNA structure-dependent binding to the regulation of transcription is discussed. PMID:27907175

  11. Dpb11 may function with RPA and DNA to initiate DNA replication

    PubMed Central

    Bruck, Irina; Dhingra, Nalini; Martinez, Matthew P.

    2017-01-01

    Dpb11 is required for the initiation of DNA replication in budding yeast. We found that Dpb11 binds tightly to single-stranded DNA (ssDNA) or branched DNA structures, while its human homolog, TopBP1, binds tightly to branched-DNA structures. We also found that Dpb11 binds stably to CDK-phosphorylated RPA, the eukaryotic ssDNA binding protein, in the presence of branched DNA. A Dpb11 mutant specifically defective for DNA binding did not exhibit tight binding to RPA in the presence of DNA, suggesting that Dpb11-interaction with DNA may promote the recruitment of RPA to melted DNA. We then characterized a mutant of Dpb11 that is specifically defective in DNA binding in budding yeast cells. Expression of dpb11-m1,2,3,5,ΔC results in a substantial decrease in RPA recruitment to origins, suggesting that Dpb11 interaction with DNA may be required for RPA recruitment to origins. Expression of dpb11-m1,2,3,5,ΔC also results in diminished GINS interaction with Mcm2-7 during S phase, while Cdc45 interaction with Mcm2-7 is like wild-type. The reduced GINS interaction with Mcm2-7 may be an indirect consequence of diminished origin melting. We propose that the tight interaction between Dpb11, CDK-phosphorylated RPA, and branched-DNA may be required for the essential function of stabilizing melted origin DNA in vivo. We also propose an alternative model, wherein Dpb11-DNA interaction is required for some other function in DNA replication initiation, such as helicase activation. PMID:28467467

  12. End-specific strategies of attachment of long double stranded DNA onto gold-coated nanofiber arrays

    NASA Astrophysics Data System (ADS)

    Peckys, Diana B.; de Jonge, Niels; Simpson, Michael L.; McKnight, Timothy E.

    2008-10-01

    We report the effective and site-specific binding of long double stranded (ds)DNA to high aspect ratio carbon nanofiber arrays. The carbon nanofibers were first coated with a thin gold layer to provide anchorage for two controllable binding methods. One method was based on the direct binding of thiol end-labeled dsDNA. The second and enhanced method used amine end-labeled dsDNA bound with crosslinkers to a carboxyl-terminated self-assembled monolayer. The bound dsDNA was first visualized with a fluorescent, dsDNA-intercalating dye. The specific binding onto the carbon nanofiber was verified by a high resolution detection method using scanning electron microscopy in combination with the binding of neutravidin-coated fluorescent microspheres to the immobilized and biotinylated dsDNA. Functional activity of thiol end-labeled dsDNA on gold-coated nanofiber arrays was verified with a transcriptional assay, whereby Chinese hamster lung cells (V79) were impaled upon the DNA-modified nanofibers and scored for transgene expression of the tethered template. Thiol end-labeled dsDNA demonstrated significantly higher expression levels than nanofibers prepared with control dsDNA that lacked a gold-binding end-label. Employing these site-specific and robust techniques of immobilization of dsDNA onto nanodevices can be of advantage for the study of DNA/protein interactions and for gene delivery applications.

  13. Comprehensive Interrogation of Natural TALE DNA Binding Modules and Transcriptional Repressor Domains

    PubMed Central

    Cong, Le; Zhou, Ruhong; Kuo, Yu-chi; Cunniff, Margaret; Zhang, Feng

    2012-01-01

    Transcription activator-like effectors (TALE) are sequence-specific DNA binding proteins that harbor modular, repetitive DNA binding domains. TALEs have enabled the creation of customizable designer transcriptional factors and sequence-specific nucleases for genome engineering. Here we report two improvements of the TALE toolbox for achieving efficient activation and repression of endogenous gene expression in mammalian cells. We show that the naturally occurring repeat variable diresidue (RVD) Asn-His (NH) has high biological activity and specificity for guanine, a highly prevalent base in mammalian genomes. We also report an effective TALE transcriptional repressor architecture for targeted inhibition of transcription in mammalian cells. These findings will improve the precision and effectiveness of genome engineering that can be achieved using TALEs. PMID:22828628

  14. Anti-nucleosome antibodies complexed to nucleosomal antigens show anti-DNA reactivity and bind to rat glomerular basement membrane in vivo.

    PubMed Central

    Kramers, C; Hylkema, M N; van Bruggen, M C; van de Lagemaat, R; Dijkman, H B; Assmann, K J; Smeenk, R J; Berden, J H

    1994-01-01

    Histones can mediate the binding of DNA and anti-DNA to the glomerular basement membrane (GBM). In ELISA histone/DNA/anti-DNA complexes are able to bind to heparan sulfate (HS), an intrinsic constituent of the GBM. We questioned whether histone containing immune complexes are able to bind to the GBM, and if so, whether the ligand in the GBM is HS. Monoclonal antibodies (mAbs) complexed to nucleosomal antigens and noncomplexed mAbs were isolated from culture supernatants of four IgG anti-nuclear mAbs. All noncomplexed mAbs showed strong anti-nucleosome reactivity in ELISA. One of them showed in addition anti-DNA reactivity in noncomplexed form. The other three mAbs only showed anti-DNA reactivity when they were complexed to nucleosomal antigens. After renal perfusion a fine granular binding of complexed mAbs to the glomerular capillary wall and activation of complement was observed in immunofluorescence, whereas noncomplexed mAbs did not bind. Immuno-electron microscopy showed binding of complexes to the whole width of the GBM. When HS in the GBM was removed by renal heparinase perfusion the binding of complexed mAb decreased, but did not disappear completely. We conclude that anti-nucleosome mAbs, which do not bind DNA, become DNA reactive once complexed to nucleosomal antigens. These complexed mAbs can bind to the GBM. The binding ligand in the GBM is partly, but not solely, HS. Binding to the GBM of immune complexes containing nucleosomal material might be an important event in the pathogenesis of lupus nephritis. Images PMID:8040312

  15. Chemical Screens Against A Reconstituted Multi-Protein Complex: Myricetin Blocks DnaJ Regulation of DnaK through an Allosteric Mechanism

    PubMed Central

    Chang, Lyra; Miyata, Yoshinari; Ung, Peter M. U.; Bertelsen, Eric B.; McQuade, Thomas J.; Carlson, Heather A.; Zuiderweg, Erik R. P.; Gestwicki, Jason E.

    2011-01-01

    SUMMARY DnaK is a molecular chaperone responsible for multiple aspects of proteostasis. The intrinsically slow ATPase activity of DnaK is stimulated by its co-chaperone, DnaJ, and these proteins often work in concert. To identify inhibitors, we screened plant-derived extracts against a re-constituted mixture of DnaK and DnaJ. This approach resulted in the identification of flavonoids, including myricetin, which inhibited activity by up to 75%. Interestingly, myricetin prevented DnaJ-mediated stimulation of ATPase activity, with minimal impact on either DnaK’s intrinsic turnover rate or its stimulation by another co-chaperone, GrpE. Using NMR, we found that myricetin binds DnaK at an unanticipated site between the IB and IIB subdomains and that it allosterically blocked binding of DnaJ. Together, these results highlight a “gray box” screening approach, which approximates a limited amount of the complexity expected in physiological, multi-protein systems. PMID:21338918

  16. Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively.

    PubMed

    Clifford, Jacob; Adami, Christoph

    2015-09-02

    Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

  17. Interactive Roles of DNA Helicases and Translocases with the Single-Stranded DNA Binding Protein RPA in Nucleic Acid Metabolism.

    PubMed

    Awate, Sanket; Brosh, Robert M

    2017-06-08

    Helicases and translocases use the energy of nucleoside triphosphate binding and hydrolysis to unwind/resolve structured nucleic acids or move along a single-stranded or double-stranded polynucleotide chain, respectively. These molecular motors facilitate a variety of transactions including replication, DNA repair, recombination, and transcription. A key partner of eukaryotic DNA helicases/translocases is the single-stranded DNA binding protein Replication Protein A (RPA). Biochemical, genetic, and cell biological assays have demonstrated that RPA interacts with these human molecular motors physically and functionally, and their association is enriched in cells undergoing replication stress. The roles of DNA helicases/translocases are orchestrated with RPA in pathways of nucleic acid metabolism. RPA stimulates helicase-catalyzed DNA unwinding, enlists translocases to sites of action, and modulates their activities in DNA repair, fork remodeling, checkpoint activation, and telomere maintenance. The dynamic interplay between DNA helicases/translocases and RPA is just beginning to be understood at the molecular and cellular levels, and there is still much to be learned, which may inform potential therapeutic strategies.

  18. Interactive Roles of DNA Helicases and Translocases with the Single-Stranded DNA Binding Protein RPA in Nucleic Acid Metabolism

    PubMed Central

    Awate, Sanket; Brosh, Robert M.

    2017-01-01

    Helicases and translocases use the energy of nucleoside triphosphate binding and hydrolysis to unwind/resolve structured nucleic acids or move along a single-stranded or double-stranded polynucleotide chain, respectively. These molecular motors facilitate a variety of transactions including replication, DNA repair, recombination, and transcription. A key partner of eukaryotic DNA helicases/translocases is the single-stranded DNA binding protein Replication Protein A (RPA). Biochemical, genetic, and cell biological assays have demonstrated that RPA interacts with these human molecular motors physically and functionally, and their association is enriched in cells undergoing replication stress. The roles of DNA helicases/translocases are orchestrated with RPA in pathways of nucleic acid metabolism. RPA stimulates helicase-catalyzed DNA unwinding, enlists translocases to sites of action, and modulates their activities in DNA repair, fork remodeling, checkpoint activation, and telomere maintenance. The dynamic interplay between DNA helicases/translocases and RPA is just beginning to be understood at the molecular and cellular levels, and there is still much to be learned, which may inform potential therapeutic strategies. PMID:28594346

  19. Stimulation of ribosomal RNA gene promoter by transcription factor Sp1 involves active DNA demethylation by Gadd45-NER pathway.

    PubMed

    Rajput, Pallavi; Pandey, Vijaya; Kumar, Vijay

    2016-08-01

    The well-studied Pol II transcription factor Sp1 has not been investigated for its regulatory role in rDNA transcription. Here, we show that Sp1 bound to specific sites on rDNA and localized into the nucleoli during the G1 phase of cell cycle to activate rDNA transcription. It facilitated the recruitment of Pol I pre-initiation complex and impeded the binding of nucleolar remodeling complex (NoRC) to rDNA resulting in the formation of euchromatin active state. More importantly, Sp1 also orchestrated the site-specific binding of Gadd45a-nucleotide excision repair (NER) complex resulting in active demethylation and transcriptional activation of rDNA. Interestingly, knockdown of Sp1 impaired rDNA transcription due to reduced engagement of the Gadd45a-NER complex and hypermethylation of rDNA. Thus, the present study unveils a novel role of Sp1 in rDNA transcription involving promoter demethylation. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hood, Iris V.; Berger, James M.

    Replisome assembly requires the loading of replicative hexameric helicases onto origins by AAA+ ATPases. How loader activity is appropriately controlled remains unclear. Here, we use structural and biochemical analyses to establish how an antimicrobial phage protein interferes with the function of theStaphylococcus aureusreplicative helicase loader, DnaI. The viral protein binds to the loader’s AAA+ ATPase domain, allowing binding of the host replicative helicase but impeding loader self-assembly and ATPase activity. Close inspection of the complex highlights an unexpected locus for the binding of an interdomain linker element in DnaI/DnaC-family proteins. We find that the inhibitor protein is genetically coupled tomore » a phage-encoded homolog of the bacterial helicase loader, which we show binds to the host helicase but not to the inhibitor itself. These findings establish a new approach by which viruses can hijack host replication processes and explain how loader activity is internally regulated to prevent aberrant auto-association.« less

  1. DNA-Damage Response RNA-Binding Proteins (DDRBPs): Perspectives from a New Class of Proteins and Their RNA Targets.

    PubMed

    Dutertre, Martin; Vagner, Stéphan

    2017-10-27

    Upon DNA damage, cells trigger an early DNA-damage response (DDR) involving DNA repair and cell cycle checkpoints, and late responses involving gene expression regulation that determine cell fate. Screens for genes involved in the DDR have found many RNA-binding proteins (RBPs), while screens for novel RBPs have identified DDR proteins. An increasing number of RBPs are involved in early and/or late DDR. We propose to call this new class of actors of the DDR, which contain an RNA-binding activity, DNA-damage response RNA-binding proteins (DDRBPs). We then discuss how DDRBPs contribute not only to gene expression regulation in the late DDR but also to early DDR signaling, DNA repair, and chromatin modifications at DNA-damage sites through interactions with both long and short noncoding RNAs. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Effects of polyamines on the DNA-reactive properties of dimeric mithramycin complexed with cobalt(II): implications for anticancer therapy.

    PubMed

    Hou, Ming-Hon; Lu, Wen-Je; Huang, Chun-Yu; Fan, Ruey-Jane; Yuann, Jeu-Ming P

    2009-06-09

    Few studies have examined the effects of polyamines on the action of DNA-binding anticancer drugs. Here, a Co(II)-mediated dimeric mithramycin (Mith) complex, (Mith)(2)-Co(II), was shown to be resistant to polyamine competition toward the divalent metal ion when compared to the Fe(II)-mediated drug complexes. Surface plasmon resonance experiments demonstrated that polyamines interfered with the binding capacity and association rates of (Mith)(2)-Co(II) binding to DNA duplexes, while the dissociation rates were not affected. Although (Mith)(2)-Co(II) exhibited the highest oxidative activity under physiological conditions (pH 7.3 and 37 degrees C), polyamines (spermine in particular) inhibited the DNA cleavage activity of the (Mith)(2)-Co(II) in a concentration-dependent manner. Depletion of intracellular polyamines by methylglyoxal bis(guanylhydrazone) (MGBG) enhanced the sensitivity of A549 lung cancer cells to (Mith)(2)-Co(II), most likely due to the decreased intracellular effect of polyamines on the action of (Mith)(2)-Co(II). Our study suggests a novel method for enhancing the anticancer activity of DNA-binding metalloantibiotics through polyamine depletion.

  3. FACT is a sensor of DNA torsional stress in eukaryotic cells

    PubMed Central

    Safina, Alfiya; Cheney, Peter; Pal, Mahadeb; Brodsky, Leonid; Ivanov, Alexander; Kirsanov, Kirill; Lesovaya, Ekaterina; Naberezhnov, Denis; Nesher, Elimelech; Koman, Igor; Wang, Dan; Wang, Jianming; Yakubovskaya, Marianna; Winkler, Duane

    2017-01-01

    Abstract Transitions of B-DNA to alternative DNA structures (ADS) can be triggered by negative torsional strain, which occurs during replication and transcription, and may lead to genomic instability. However, how ADS are recognized in cells is unclear. We found that the binding of candidate anticancer drug, curaxin, to cellular DNA results in uncoiling of nucleosomal DNA, accumulation of negative supercoiling and conversion of multiple regions of genomic DNA into left-handed Z-form. Histone chaperone FACT binds rapidly to the same regions via the SSRP1 subunit in curaxin-treated cells. In vitro binding of purified SSRP1 or its isolated CID domain to a methylated DNA fragment containing alternating purine/pyrimidines, which is prone to Z-DNA transition, is much stronger than to other types of DNA. We propose that FACT can recognize and bind Z-DNA or DNA in transition from a B to Z form. Binding of FACT to these genomic regions triggers a p53 response. Furthermore, FACT has been shown to bind to other types of ADS through a different structural domain, which also leads to p53 activation. Thus, we propose that FACT acts as a sensor of ADS formation in cells. Recognition of ADS by FACT followed by a p53 response may explain the role of FACT in DNA damage prevention. PMID:28082391

  4. Replication of damaged DNA in vitro is blocked by p53

    PubMed Central

    Zhou, Jianmin; Prives, Carol

    2003-01-01

    The tumor suppressor protein p53 may have other roles and functions in addition to its well-documented ability to serve as a sequence-specific transcriptional activator in response to DNA damage. We showed previously that p53 can block the replication of polyomavirus origin-containing DNA (Py ori-DNA) in vitro when p53 binding sites are present on the late side of the Py ori. Here we have both further extended these observations and have also examined whether p53 might be able to bind directly to and inhibit the replication of damaged DNA. We found that p53 strongly inhibits replication of γ-irradiated Py ori-DNA and such inhibition requires both the central DNA binding domain and the extreme C-terminus of the p53 protein. An endogenous p53 binding site lies within the Py origin and is required for the ability of p53 to block initiation of replication from γ-irradiated Py ori-DNA, suggesting the possibility of DNA looping caused by p53 binding both non-specifically to sites of DNA damage and specifically to the endogenous site in the polyomavirus origin. Our results thus suggest the possibility that under some circumstances p53 might serve as a direct regulator of DNA replication and suggest as well an additional function for cooperation between its two autonomous DNA binding domains. PMID:12853603

  5. Optical tweezers reveal how proteins alter replication

    NASA Astrophysics Data System (ADS)

    Chaurasiya, Kathy

    Single molecule force spectroscopy is a powerful method that explores the DNA interaction properties of proteins involved in a wide range of fundamental biological processes such as DNA replication, transcription, and repair. We use optical tweezers to capture and stretch a single DNA molecule in the presence of proteins that bind DNA and alter its mechanical properties. We quantitatively characterize the DNA binding mechanisms of proteins in order to provide a detailed understanding of their function. In this work, we focus on proteins involved in replication of Escherichia coli (E. coli ), endogenous eukaryotic retrotransposons Ty3 and LINE-1, and human immunodeficiency virus (HIV). DNA polymerases replicate the entire genome of the cell, and bind both double-stranded DNA (dsDNA) and single-stranded DNA (ssDNA) during DNA replication. The replicative DNA polymerase in the widely-studied model system E. coli is the DNA polymerase III subunit alpha (DNA pol III alpha). We use optical tweezers to determine that UmuD, a protein that regulates bacterial mutagenesis through its interactions with DNA polymerases, specifically disrupts alpha binding to ssDNA. This suggests that UmuD removes alpha from its ssDNA template to allow DNA repair proteins access to the damaged DNA, and to facilitate exchange of the replicative polymerase for an error-prone translesion synthesis (TLS) polymerase that inserts nucleotides opposite the lesions, so that bacterial DNA replication may proceed. This work demonstrates a biophysical mechanism by which E. coli cells tolerate DNA damage. Retroviruses and retrotransposons reproduce by copying their RNA genome into the nuclear DNA of their eukaryotic hosts. Retroelements encode proteins called nucleic acid chaperones, which rearrange nucleic acid secondary structure and are therefore required for successful replication. The chaperone activity of these proteins requires strong binding affinity for both single- and double-stranded nucleic acids. We use single molecule DNA stretching to show that the nucleocapsid protein (NC) of the yeast retrotransposon Ty3, which is likely to be an ancestor of HIV NC, has optimal nucleic acid chaperone activity with only a single zinc finger. We also show that the chaperone activity of the ORF1 protein is responsible for successful replication of the mouse LINE-1 retrotransposon. LINE-1 is also 17% of the human genome, where it generates insertion mutations and alters gene expression. Retrotransposons such as LINE-1 and Ty3 are likely to be ancestors of retroviruses such as HIV. Human APOBEC3G (A3G) inhibits HIV-1 replication via cytidine deamination of the viral ssDNA genome, as well as via a distinct deamination-independent mechanism. Efficient deamination requires rapid on-off binding kinetics, but a slow dissociation rate is required for the proposed deaminase-independent mechanism. We resolve this apparent contradiction with a new quantitative single molecule method, which shows that A3G initially binds ssDNA with fast on-off rates and subsequently converts to a slow binding mode. This suggests that oligomerization transforms A3G from a fast enzyme to a slow binding protein, which is the biophysical mechanism that allows A3G to inhibit HIV replication. A complete understanding of the mechanism of A3G-mediated antiviral activity is required to design drugs that disrupt the viral response to A3G, enhance A3G packaging inside the viral core, and other potential strategies for long-term treatment of HIV infection. We use single molecule biophysics to explore the function of proteins involved in bacterial DNA replication, endogenous retrotransposition of retroelements in eukaryotic hosts such yeast and mice, and HIV replication in human cells. Our quantitative results provide insight into protein function in a range of complex biological systems and have wide-ranging implications for human health.

  6. Directed evolution of the TALE N-terminal domain for recognition of all 5' bases.

    PubMed

    Lamb, Brian M; Mercer, Andrew C; Barbas, Carlos F

    2013-11-01

    Transcription activator-like effector (TALE) proteins can be designed to bind virtually any DNA sequence. General guidelines for design of TALE DNA-binding domains suggest that the 5'-most base of the DNA sequence bound by the TALE (the N0 base) should be a thymine. We quantified the N0 requirement by analysis of the activities of TALE transcription factors (TALE-TF), TALE recombinases (TALE-R) and TALE nucleases (TALENs) with each DNA base at this position. In the absence of a 5' T, we observed decreases in TALE activity up to >1000-fold in TALE-TF activity, up to 100-fold in TALE-R activity and up to 10-fold reduction in TALEN activity compared with target sequences containing a 5' T. To develop TALE architectures that recognize all possible N0 bases, we used structure-guided library design coupled with TALE-R activity selections to evolve novel TALE N-terminal domains to accommodate any N0 base. A G-selective domain and broadly reactive domains were isolated and characterized. The engineered TALE domains selected in the TALE-R format demonstrated modularity and were active in TALE-TF and TALEN architectures. Evolved N-terminal domains provide effective and unconstrained TALE-based targeting of any DNA sequence as TALE binding proteins and designer enzymes.

  7. pH-Dependent DNA Distortion and Repression of Gene Expression by Pectobacterium atrosepticum PecS.

    PubMed

    Deochand, Dinesh K; Meariman, Jacob K; Grove, Anne

    2016-07-15

    Transcriptional activity is exquisitely sensitive to changes in promoter DNA topology. Transcription factors may therefore control gene activity by modulating the relative positioning of -10 and -35 promoter elements. The plant pathogen Pectobacterium atrosepticum, which causes soft rot in potatoes, must alter gene expression patterns to ensure growth in planta. In the related soft-rot enterobacterium Dickeya dadantii, PecS functions as a master regulator of virulence gene expression. Here, we report that P. atrosepticum PecS controls gene activity by altering promoter DNA topology in response to pH. While PecS binds the pecS promoter with high affinity regardless of pH, it induces significant DNA distortion only at neutral pH, the pH at which the pecS promoter is repressed in vivo. At pH ∼8, DNA distortions are attenuated, and PecS no longer represses the pecS promoter. A specific histidine (H142) located in a crevice between the dimerization- and DNA-binding regions is required for pH-dependent changes in DNA distortion and repression of gene activity, and mutation of this histidine renders the mutant protein incapable of repressing the pecS promoter. We propose that protonated PecS induces a DNA conformation at neutral pH in which -10 and -35 promoter elements are suboptimally positioned for RNA polymerase binding; on deprotonation of PecS, binding is no longer associated with significant changes in DNA conformation, allowing gene expression. We suggest that this mode of gene regulation leads to differential expression of the PecS regulon in response to alkalinization of the plant apoplast.

  8. The DNA Maturation Domain of gpA, the DNA Packaging Motor Protein of Bacteriophage Lambda, Contains an ATPase Site Associated with Endonuclease Activity

    PubMed Central

    Ortega, Marcos E.; Gaussier, Helene; Catalano, Carlos E.

    2007-01-01

    Summary Terminase enzymes are common to double-stranded DNA (dsDNA) viruses and are responsible for packaging viral DNA into the confines of an empty capsid shell. In bacteriophage lambda the catalytic terminase subunit is gpA, which is responsible for maturation of the genome end prior to packaging and subsequent translocation of the matured DNA into the capsid. DNA packaging requires an ATPase catalytic site situated in the N-terminus of the protein. A second ATPase catalytic site associated with the DNA maturation activities of the protein has been proposed; however, direct demonstration of this putative second site is lacking. Here we describe biochemical studies that define protease-resistant peptides of gpA and expression of these putative domains in E. coli. Biochemical characterization of gpA-ΔN179, a construct in which the N-terminal 179 residues of gpA have been deleted, indicates that this protein encompasses the DNA maturation domain of gpA. The construct is folded, soluble and possesses an ATP-dependent nuclease activity. Moreover, the construct binds and hydrolyzes ATP despite the fact that the DNA packaging ATPase site in the N-terminus of gpA has been deleted. Mutation of lysine 497, which alters the conserved lysine in a predicted Walker A “P-loop” sequence, does not affect ATP binding but severely impairs ATP hydrolysis. Further, this mutation abrogates the ATP-dependent nuclease activity of the protein. These studies provide direct evidence for the elusive nucleotide-binding site in gpA that is directly associated with the DNA maturation activity of the protein. The implications of these results with respect to the two roles of the terminase holoenzyme – DNA maturation and DNA packaging – are discussed. PMID:17870092

  9. Ferrate oxidation of Escherichia coli DNA polymerase-I. Identification of a methionine residue that is essential for DNA binding.

    PubMed

    Basu, A; Williams, K R; Modak, M J

    1987-07-15

    Treatment of Escherichia coli DNA polymerase-I with potassium ferrate (K2FeO4), a site-specific oxidizing agent for the phosphate group-binding sites of proteins, results in the irreversible inactivation of enzyme activity as judged by the loss of polymerization as well as 3'-5' exonuclease activity. A significant protection from ferrate-mediated inactivation is observed in the presence of DNA but not by substrate deoxynucleoside triphosphates. Furthermore, ferrate-treated enzyme also exhibits loss of template-primer binding activity, whereas its ability to bind substrate triphosphates is unaffected. In addition, comparative high pressure liquid chromatography tryptic peptide maps obtained before and after ferrate oxidation demonstrated that only five peptides of the more than 60 peptide peaks present in the tryptic digest underwent a major change in either peak position or intensity as a result of ferrate treatment. Amino acid analyses and/or sequencing identified four of these affected peaks as corresponding to peptides that span residues 324-340, 437-455, 456-464, and 512-518, respectively. However, only the last peptide, which has the sequence: Met-Trp-Pro-Asp-Leu-Gln-Lys, was significantly protected in the presence of DNA. This latter peptide was also the only peptide whose degree of oxidation correlated directly with the extent of inactivation of the enzyme. Amino acid analysis indicated that methionine 512 is the target site in this peptide for ferrate oxidation. Methionine 512, therefore, appears to be essential for the DNA-binding function of DNA polymerase-I from E. coli.

  10. Evaluation of DNA, BSA binding, and antimicrobial activity of new synthesized neodymium complex containing 29-dimethyl 110-phenanthroline.

    PubMed

    Moradi, Zohreh; Khorasani-Motlagh, Mozhgan; Rezvani, Ali Reza; Noroozifar, Meissam

    2018-02-01

    In order to evaluate biological potential of a novel synthesized complex [Nd(dmp) 2 Cl 3 .OH 2 ] where dmp is 29-dimethyl 110-phenanthroline, the DNA-binding, cleavage, BSA binding, and antimicrobial activity properties of the complex are investigated by multispectroscopic techniques study in physiological buffer (pH 7.2).The intrinsic binding constant (K b ) for interaction of Nd(III) complex and FS-DNA is calculated by UV-Vis (K b  = 2.7 ± 0.07 × 10 5 ) and fluorescence spectroscopy (K b  = 1.13 ± 0.03 × 10 5 ). The Stern-Volmer constant (K SV ), thermodynamic parameters including free energy change (ΔG°), enthalpy change (∆H°), and entropy change (∆S°), are calculated by fluorescent data and Vant' Hoff equation. The experimental results show that the complex can bind to FS-DNA and the major binding mode is groove binding. Meanwhile, the interaction of Nd(III) complex with protein, bovine serum albumin (BSA), has also been studied by using absorption and emission spectroscopic tools. The experimental results show that the complex exhibits good binding propensity to BSA. The positive ΔH° and ∆S° values indicate that the hydrophobic interaction is main force in the binding of the Nd(III) complex to BSA, and the complex can quench the intrinsic fluorescence of BSA remarkably through a static quenching process. Also, DNA cleavage was investigated by agarose gel electrophoresis that according to the results cleavage of DNA increased with increasing of concentration of the complex. Antimicrobial screening test gives good results in the presence of Nd(III) complex system.

  11. Spectroscopic, molecular docking and structural activity studies of (E)-N‧-(substituted benzylidene/methylene) isonicotinohydrazide derivatives for DNA binding and their biological screening

    NASA Astrophysics Data System (ADS)

    Arshad, Nasima; Perveen, Fouzia; Saeed, Aamer; Channar, Pervaiz Ali; Farooqi, Shahid Iqbal; Larik, Fayaz Ali; Ismail, Hammad; Mirza, Bushra

    2017-07-01

    Acid catalyzed condensation of isoniazid with a number of suitably substituted aromatic and heterocyclic aldehydes was carried out in dry ethanol to afford the title (E)-N‧-(substituted benzylidene/methylene) isonicotinohydrazides (SF 1 - SF 4) in good yields. These compounds were characterized and further investigated for their binding with ds.DNA using UV- spectroscopy and molecular docking and for antitumor and antimicrobial potentials. A good correlation was found among spectroscopic, theoretical and biological results. UV- spectra in the presence of DNA concentrations and their data interpretation in terms binding constant "Kb" and free energy change (ΔG) provided evidences for the significant and spontaneous binding of the compounds with DNA. Molecular docking studies and structural analysis further supported the UV-findings and indicated that the modes of interactions between bromo- (SF 1) and flouro- (SF 4) substituted isonicotinohydrazides is intercalation while methoxy- (SF 2) and hydroxy- (SF 3) substituted isonicotinohydrazides interact with DNA helix via groove binding. SF 1 exhibited comparatively higher Kb value (UV-; 8.07 × 103 M-1, docking; 8.11 × 103 M-1) which inferred that the respective compound muddles to DNA most powerfully. SF 1 has shown the lowest IC50 (345.3 μg/mL) value among all the compounds indicating its comparatively highest activity towards tumor inhibition. None of the compound has shown perceptible antibacterial and antifungal activities.

  12. The N-terminal Region of the DNA-dependent Protein Kinase Catalytic Subunit Is Required for Its DNA Double-stranded Break-mediated Activation*

    PubMed Central

    Davis, Anthony J.; Lee, Kyung-Jong; Chen, David J.

    2013-01-01

    DNA-dependent protein kinase (DNA-PK) plays an essential role in the repair of DNA double-stranded breaks (DSBs) mediated by the nonhomologous end-joining pathway. DNA-PK is a holoenzyme consisting of a DNA-binding (Ku70/Ku80) and catalytic (DNA-PKcs) subunit. DNA-PKcs is a serine/threonine protein kinase that is recruited to DSBs via Ku70/80 and is activated once the kinase is bound to the DSB ends. In this study, two large, distinct fragments of DNA-PKcs, consisting of the N terminus (amino acids 1–2713), termed N-PKcs, and the C terminus (amino acids 2714–4128), termed C-PKcs, were produced to determine the role of each terminal region in regulating the activity of DNA-PKcs. N-PKcs but not C-PKcs interacts with the Ku-DNA complex and is required for the ability of DNA-PKcs to localize to DSBs. C-PKcs has increased basal kinase activity compared with DNA-PKcs, suggesting that the N-terminal region of DNA-PKcs keeps basal activity low. The kinase activity of C-PKcs is not stimulated by Ku70/80 and DNA, further supporting that the N-terminal region is required for binding to the Ku-DNA complex and full activation of kinase activity. Collectively, the results show the N-terminal region mediates the interaction between DNA-PKcs and the Ku-DNA complex and is required for its DSB-induced enzymatic activity. PMID:23322783

  13. Computational characterization of DNA/peptide/nanotube self assembly for bioenergy applications

    NASA Astrophysics Data System (ADS)

    Ortiz, Vanessa; Araki, Ruriko; Collier, Galen

    2012-02-01

    Multi-enzyme pathways have become a subject of increasing interest for their role in the engineering of biomimetic systems for applications including biosensors, bioelectronics, and bioenergy. The efficiencies found in natural metabolic pathways partially arise from biomolecular self-assembly of the component enzymes in an effort to avoid transport limitations. The ultimate goal of this effort is to design and build biofuel cells with efficiencies similar to those of native systems by introducing biomimetic structures that immobilize multiple enzymes in specific orientations on a bioelectrode. To achieve site-specific immobilization, the specificity of DNA-binding domains is exploited with an approach that allows any redox enzyme to be modified to site-specifically bind to double stranded (ds) DNA while retaining activity. Because of its many desirable properties, the bioelectrode of choice is single-wall carbon nanotubes (SWNTs), but little is known about dsDNA/SWNT assembly and how this might affect the activity of the DNA-binding domains. Here we evaluate the feasibility of the proposed assembly by performing atomistic molecular dynamics simulations to look at the stability and conformations adopted by dsDNA when bound to a SWNT. We also evaluate the effects of the presence of a SWNT on the stability of the complex formed by a DNA-binding domain and DNA.

  14. Molecular cloning of MSSP-2, a c-myc gene single-strand binding protein: characterization of binding specificity and DNA replication activity.

    PubMed Central

    Takai, T; Nishita, Y; Iguchi-Ariga, S M; Ariga, H

    1994-01-01

    We have previously reported the human cDNA encoding MSSP-1, a sequence-specific double- and single-stranded DNA binding protein [Negishi, Nishita, Saëgusa, Kakizaki, Galli, Kihara, Tamai, Miyajima, Iguchi-Ariga and Ariga (1994) Oncogene, 9, 1133-1143]. MSSP-1 binds to a DNA replication origin/transcriptional enhancer of the human c-myc gene and has turned out to be identical with Scr2, a human protein which complements the defect of cdc2 kinase in S.pombe [Kataoka and Nojima (1994) Nucleic Acid Res., 22, 2687-2693]. We have cloned the cDNA for MSSP-2, another member of the MSSP family of proteins. The MSSP-2 cDNA shares highly homologous sequences with MSSP-1 cDNA, except for the insertion of 48 bp coding 16 amino acids near the C-terminus. Like MSSP-1, MSSP-2 has RNP-1 consensus sequences. The results of the experiments using bacterially expressed MSSP-2, and its deletion mutants, as histidine fusion proteins suggested that the binding specificity of MSSP-2 to double- and single-stranded DNA is the same as that of MSSP-1, and that the RNP consensus sequences are required for the DNA binding of the protein. MSSP-2 stimulated the DNA replication of an SV40-derived plasmid containing the binding sequence for MSSP-1 or -2. MSSP-2 is hence suggested to play an important role in regulation of DNA replication. Images PMID:7838710

  15. Structure of apo-CAP reveals that large conformational changes are necessary for DNA binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sharma, Hitesh; Yu, Shaoning; Kong, Jilie

    2009-10-21

    The binding of cAMP to the Escherichia coli catabolite gene activator protein (CAP) produces a conformational change that enables it to bind specific DNA sequences and regulate transcription, which it cannot do in the absence of the nucleotide. The crystal structures of the unliganded CAP containing a D138L mutation and the unliganded WT CAP were determined at 2.3 and 3.6 {angstrom} resolution, respectively, and reveal that the two DNA binding domains have dimerized into one rigid body and their two DNA recognition helices become buried. The WT structure shows multiple orientations of this rigid body relative to the nucleotide bindingmore » domain supporting earlier biochemical data suggesting that the inactive form exists in an equilibrium among different conformations. Comparison of the structures of the liganded and unliganded CAP suggests that cAMP stabilizes the active DNA binding conformation of CAP through the interactions that the N{sup 6} of the adenosine makes with the C-helices. These interactions are associated with the reorientation and elongation of the C-helices that precludes the formation of the inactive structure.« less

  16. Identification of Critical Residues for the Tight Binding of Both Correct and Incorrect Nucleotides to Human DNA Polymerase λ

    PubMed Central

    Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai

    2010-01-01

    DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705

  17. Biochemistry of homologous recombination in Escherichia coli.

    PubMed Central

    Kowalczykowski, S C; Dixon, D A; Eggleston, A K; Lauder, S D; Rehrauer, W M

    1994-01-01

    Homologous recombination is a fundamental biological process. Biochemical understanding of this process is most advanced for Escherichia coli. At least 25 gene products are involved in promoting genetic exchange. At present, this includes the RecA, RecBCD (exonuclease V), RecE (exonuclease VIII), RecF, RecG, RecJ, RecN, RecOR, RecQ, RecT, RuvAB, RuvC, SbcCD, and SSB proteins, as well as DNA polymerase I, DNA gyrase, DNA topoisomerase I, DNA ligase, and DNA helicases. The activities displayed by these enzymes include homologous DNA pairing and strand exchange, helicase, branch migration, Holliday junction binding and cleavage, nuclease, ATPase, topoisomerase, DNA binding, ATP binding, polymerase, and ligase, and, collectively, they define biochemical events that are essential for efficient recombination. In addition to these needed proteins, a cis-acting recombination hot spot known as Chi (chi: 5'-GCTGGTGG-3') plays a crucial regulatory function. The biochemical steps that comprise homologous recombination can be formally divided into four parts: (i) processing of DNA molecules into suitable recombination substrates, (ii) homologous pairing of the DNA partners and the exchange of DNA strands, (iii) extension of the nascent DNA heteroduplex; and (iv) resolution of the resulting crossover structure. This review focuses on the biochemical mechanisms underlying these steps, with particular emphases on the activities of the proteins involved and on the integration of these activities into likely biochemical pathways for recombination. Images PMID:7968921

  18. The intervening domain from MeCP2 enhances the DNA affinity of the methyl binding domain and provides an independent DNA interaction site.

    PubMed

    Claveria-Gimeno, Rafael; Lanuza, Pilar M; Morales-Chueca, Ignacio; Jorge-Torres, Olga C; Vega, Sonia; Abian, Olga; Esteller, Manel; Velazquez-Campoy, Adrian

    2017-01-31

    Methyl-CpG binding protein 2 (MeCP2) preferentially interacts with methylated DNA and it is involved in epigenetic regulation and chromatin remodelling. Mutations in MeCP2 are linked to Rett syndrome, the leading cause of intellectual retardation in girls and causing mental, motor and growth impairment. Unstructured regions in MeCP2 provide the plasticity for establishing interactions with multiple binding partners. We present a biophysical characterization of the methyl binding domain (MBD) from MeCP2 reporting the contribution of flanking domains to its structural stability and dsDNA interaction. The flanking disordered intervening domain (ID) increased the structural stability of MBD, modified its dsDNA binding profile from an entropically-driven moderate-affinity binding to an overwhelmingly enthalpically-driven high-affinity binding. Additionally, ID provided an additional site for simultaneously and autonomously binding an independent dsDNA molecule, which is a key feature linked to the chromatin remodelling and looping activity of MeCP2, as well as its ability to interact with nucleosomes replacing histone H1. The dsDNA interaction is characterized by an unusually large heat capacity linked to a cluster of water molecules trapped within the binding interface. The dynamics of disordered regions together with extrinsic factors are key determinants of MeCP2 global structural properties and functional capabilities.

  19. The intervening domain from MeCP2 enhances the DNA affinity of the methyl binding domain and provides an independent DNA interaction site

    PubMed Central

    Claveria-Gimeno, Rafael; Lanuza, Pilar M.; Morales-Chueca, Ignacio; Jorge-Torres, Olga C.; Vega, Sonia; Abian, Olga; Esteller, Manel; Velazquez-Campoy, Adrian

    2017-01-01

    Methyl-CpG binding protein 2 (MeCP2) preferentially interacts with methylated DNA and it is involved in epigenetic regulation and chromatin remodelling. Mutations in MeCP2 are linked to Rett syndrome, the leading cause of intellectual retardation in girls and causing mental, motor and growth impairment. Unstructured regions in MeCP2 provide the plasticity for establishing interactions with multiple binding partners. We present a biophysical characterization of the methyl binding domain (MBD) from MeCP2 reporting the contribution of flanking domains to its structural stability and dsDNA interaction. The flanking disordered intervening domain (ID) increased the structural stability of MBD, modified its dsDNA binding profile from an entropically-driven moderate-affinity binding to an overwhelmingly enthalpically-driven high-affinity binding. Additionally, ID provided an additional site for simultaneously and autonomously binding an independent dsDNA molecule, which is a key feature linked to the chromatin remodelling and looping activity of MeCP2, as well as its ability to interact with nucleosomes replacing histone H1. The dsDNA interaction is characterized by an unusually large heat capacity linked to a cluster of water molecules trapped within the binding interface. The dynamics of disordered regions together with extrinsic factors are key determinants of MeCP2 global structural properties and functional capabilities. PMID:28139759

  20. TF1, the bacteriophage SPO1-encoded type II DNA-binding protein, is essential for viral multiplication.

    PubMed

    Sayre, M H; Geiduschek, E P

    1988-09-01

    The lytic Bacillus subtilis bacteriophage SPO1 encodes an abundant, 99-amino-acid type II DNA-binding protein, transcription factor 1 (TF1). TF1 is special in this family of procaryotic chromatin-forming proteins in its preference for hydroxymethyluracil-containing DNA, such as SPO1 DNA, and in binding with high affinity to specific sites in the SPO1 chromosome. We constructed recessive null alleles of the TF1 gene and introduced them into SPO1 chromosomes. Segregation analysis with partially diploid phage heterozygous for TF1 showed that phage bearing only these null alleles was inviable. Deletion of the nine C-proximal amino acids of TF1 prohibited phage multiplication in vivo and abolished its site-specific DNA-binding activity in vitro.

  1. Genome-wide specificity of DNA binding, gene regulation, and chromatin remodeling by TALE- and CRISPR/Cas9-based transcriptional activators.

    PubMed

    Polstein, Lauren R; Perez-Pinera, Pablo; Kocak, D Dewran; Vockley, Christopher M; Bledsoe, Peggy; Song, Lingyun; Safi, Alexias; Crawford, Gregory E; Reddy, Timothy E; Gersbach, Charles A

    2015-08-01

    Genome engineering technologies based on the CRISPR/Cas9 and TALE systems are enabling new approaches in science and biotechnology. However, the specificity of these tools in complex genomes and the role of chromatin structure in determining DNA binding are not well understood. We analyzed the genome-wide effects of TALE- and CRISPR-based transcriptional activators in human cells using ChIP-seq to assess DNA-binding specificity and RNA-seq to measure the specificity of perturbing the transcriptome. Additionally, DNase-seq was used to assess genome-wide chromatin remodeling that occurs as a result of their action. Our results show that these transcription factors are highly specific in both DNA binding and gene regulation and are able to open targeted regions of closed chromatin independent of gene activation. Collectively, these results underscore the potential for these technologies to make precise changes to gene expression for gene and cell therapies or fundamental studies of gene function. © 2015 Polstein et al.; Published by Cold Spring Harbor Laboratory Press.

  2. Identification of DNA-binding proteins by combining auto-cross covariance transformation and ensemble learning.

    PubMed

    Liu, Bin; Wang, Shanyi; Dong, Qiwen; Li, Shumin; Liu, Xuan

    2016-04-20

    DNA-binding proteins play a pivotal role in various intra- and extra-cellular activities ranging from DNA replication to gene expression control. With the rapid development of next generation of sequencing technique, the number of protein sequences is unprecedentedly increasing. Thus it is necessary to develop computational methods to identify the DNA-binding proteins only based on the protein sequence information. In this study, a novel method called iDNA-KACC is presented, which combines the Support Vector Machine (SVM) and the auto-cross covariance transformation. The protein sequences are first converted into profile-based protein representation, and then converted into a series of fixed-length vectors by the auto-cross covariance transformation with Kmer composition. The sequence order effect can be effectively captured by this scheme. These vectors are then fed into Support Vector Machine (SVM) to discriminate the DNA-binding proteins from the non DNA-binding ones. iDNA-KACC achieves an overall accuracy of 75.16% and Matthew correlation coefficient of 0.5 by a rigorous jackknife test. Its performance is further improved by employing an ensemble learning approach, and the improved predictor is called iDNA-KACC-EL. Experimental results on an independent dataset shows that iDNA-KACC-EL outperforms all the other state-of-the-art predictors, indicating that it would be a useful computational tool for DNA binding protein identification. .

  3. Regulation of yeast DNA polymerase δ-mediated strand displacement synthesis by 5′-flaps

    PubMed Central

    Koc, Katrina N.; Stodola, Joseph L.; Burgers, Peter M.; Galletto, Roberto

    2015-01-01

    The strand displacement activity of DNA polymerase δ is strongly stimulated by its interaction with proliferating cell nuclear antigen (PCNA). However, inactivation of the 3′–5′ exonuclease activity is sufficient to allow the polymerase to carry out strand displacement even in the absence of PCNA. We have examined in vitro the basic biochemical properties that allow Pol δ-exo− to carry out strand displacement synthesis and discovered that it is regulated by the 5′-flaps in the DNA strand to be displaced. Under conditions where Pol δ carries out strand displacement synthesis, the presence of long 5′-flaps or addition in trans of ssDNA suppress this activity. This suggests the presence of a secondary DNA binding site on the enzyme that is responsible for modulation of strand displacement activity. The inhibitory effect of a long 5′-flap can be suppressed by its interaction with single-stranded DNA binding proteins. However, this relief of flap-inhibition does not simply originate from binding of Replication Protein A to the flap and sequestering it. Interaction of Pol δ with PCNA eliminates flap-mediated inhibition of strand displacement synthesis by masking the secondary DNA site on the polymerase. These data suggest that in addition to enhancing the processivity of the polymerase PCNA is an allosteric modulator of other Pol δ activities. PMID:25813050

  4. NFκB- and AP-1-mediated DNA looping regulates matrix metalloproteinase-9 transcription in TNF-α-treated human leukemia U937 cells.

    PubMed

    Chen, Ying-Jung; Chang, Long-Sen

    2015-10-01

    The aim of this study is to explore the spatial association of critical genomic elements in the effect of TNF-α on matrix metalloproteinase-9 (MMP-9) expression in human leukemia U937 cells. TNF-α up-regulated MMP-9 protein expression and mRNA level in U937 cells, and Akt-mediated-NFκB/p65 activation and JNK-mediated c-Jun activation were proven to be involved in TNF-α-induced MMP-9 up-regulation. Promoter luciferase activity assay revealed that NFκB (nt-600) and AP-1 (nt-79) binding sites were crucial for TNF-α-induced transcription of MMP-9 gene. The results of a chromatin immunoprecipitation assay indicated that TNF-α reduced histone deacetylase-1 (HDAC-1) recruitment but increased p300 (a histone acetyltransferase) recruitment to MMP-9 promoter regions surrounding NFκB and AP-1 binding sites. Consistently, TNF-α increased enrichment of the acetylated histone H3 mark on MMP-9 promoter regions. DNA affinity purification assay revealed that p300 and HDAC1 could bind oligonucleotides containing AP-1/c-Jun and NFκB/p65 binding sites. Chromosome conformation capture assay showed that TNF-α stimulated chromosomal loops in the MMP-9 promoter via NFκB/p65 and AP-1/c-Jun. The p300-associated acetyltransferase activity was crucial for p65/c-Jun-mediated DNA looping, and inhibition of HDAC activity increased the level of DNA looping. Reduction in the level of DNA looping eliminated all TNF-α-stimulated MMP-9 up-regulation. Taken together, our data suggest that p65/c-Jun-mediated DNA looping is involved in TNF-α-induced MMP-9 up-regulation and that the recruitment of p300 or HDAC1 to NFκB and AP-1 binding sites modifies the level of DNA looping. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Helix–hairpin–helix motifs confer salt resistance and processivity on chimeric DNA polymerases

    PubMed Central

    Pavlov, Andrey R.; Belova, Galina I.; Kozyavkin, Sergei A.; Slesarev, Alexei I.

    2002-01-01

    Helix–hairpin–helix (HhH) is a widespread motif involved in sequence-nonspecific DNA binding. The majority of HhH motifs function as DNA-binding modules with typical occurrence of one HhH motif or one or two (HhH)2 domains in proteins. We recently identified 24 HhH motifs in DNA topoisomerase V (Topo V). Although these motifs are dispensable for the topoisomerase activity of Topo V, their removal narrows the salt concentration range for topoisomerase activity tenfold. Here, we demonstrate the utility of Topo V's HhH motifs for modulating DNA-binding properties of the Stoffel fragment of TaqDNA polymerase and Pfu DNA polymerase. Different HhH cassettes fused with either NH2 terminus or COOH terminus of DNA polymerases broaden the salt concentration range of the polymerase activity significantly (up to 0.5 M NaCl or 1.8 M potassium glutamate). We found that anions play a major role in the inhibition of DNA polymerase activity. The resistance of initial extension rates and the processivity of chimeric polymerases to salts depend on the structure of added HhH motifs. Regardless of the type of the construct, the thermal stability of chimeric Taq polymerases increases under the optimal ionic conditions, as compared with that of TaqDNA polymerase or its Stoffel fragment. Our approach to raise the salt tolerance, processivity, and thermostability of Taq and Pfu DNA polymerases may be applied to all pol1- and polB-type polymerases, as well as to other DNA processing enzymes. PMID:12368475

  6. Direct Binding to Replication Protein A (RPA)-coated Single-stranded DNA Allows Recruitment of the ATR Activator TopBP1 to Sites of DNA Damage*

    PubMed Central

    Acevedo, Julyana; Yan, Shan; Michael, W. Matthew

    2016-01-01

    A critical event for the ability of cells to tolerate DNA damage and replication stress is activation of the ATR kinase. ATR activation is dependent on the BRCT (BRCA1 C terminus) repeat-containing protein TopBP1. Previous work has shown that recruitment of TopBP1 to sites of DNA damage and stalled replication forks is necessary for downstream events in ATR activation; however, the mechanism for this recruitment was not known. Here, we use protein binding assays and functional studies in Xenopus egg extracts to show that TopBP1 makes a direct interaction, via its BRCT2 domain, with RPA-coated single-stranded DNA. We identify a point mutant that abrogates this interaction and show that this mutant fails to accumulate at sites of DNA damage and that the mutant cannot activate ATR. These data thus supply a mechanism for how the critical ATR activator, TopBP1, senses DNA damage and stalled replication forks to initiate assembly of checkpoint signaling complexes. PMID:27129245

  7. Rad51 and RecA juxtapose dsDNA ends ready for DNA ligase-catalyzed end-joining under recombinase-suppressive conditions

    PubMed Central

    Konomura, Naoto; Arai, Naoto; Shinohara, Takeshi; Kobayashi, Jun; Iwasaki, Wakana; Ikawa, Shukuko; Kusano, Kohji; Shibata, Takehiko

    2017-01-01

    RecA-family recombinase-catalyzed ATP-dependent homologous joint formation is critical for homologous recombination, in which RecA or Rad51 binds first to single-stranded (ss)DNA and then interacts with double-stranded (ds)DNA. However, when RecA or Rad51 interacts with dsDNA before binding to ssDNA, the homologous joint-forming activity of RecA or Rad51 is quickly suppressed. We found that under these and adenosine diphosphate (ADP)-generating suppressive conditions for the recombinase activity, RecA or Rad51 at similar optimal concentrations enhances the DNA ligase-catalyzed dsDNA end-joining (DNA ligation) about 30- to 40-fold. The DNA ligation enhancement by RecA or Rad51 transforms most of the substrate DNA into multimers within 2–5 min, and for this enhancement, ADP is the common and best cofactor. Adenosine triphosphate (ATP) is effective for RecA, but not for Rad51. Rad51/RecA-enhanced DNA ligation depends on dsDNA-binding, as shown by a mutant, and is independent of physical interactions with the DNA ligase. These observations demonstrate the common and unique activities of RecA and Rad51 to juxtapose dsDNA-ends in preparation for covalent joining by a DNA ligase. This new in vitro function of Rad51 provides a simple explanation for our genetic observation that Rad51 plays a role in the fidelity of the end-joining of a reporter plasmid DNA, by yeast canonical non-homologous end-joining (NHEJ) in vivo. PMID:27794044

  8. UV-induced DNA damage is an intermediate step in UV-induced expression of human immunodeficiency virus type 1, collagenase, c-fos, and metallothionein.

    PubMed Central

    Stein, B; Rahmsdorf, H J; Steffen, A; Litfin, M; Herrlich, P

    1989-01-01

    UV irradiation of human and murine cells enhances the transcription of several genes. Here we report on the primary target of relevant UV absorption, on pathways leading to gene activation, and on the elements receiving the UV-induced signal in the human immunodeficiency virus type 1 (HIV-1) long terminal repeat, in the gene coding for collagenase, and in the cellular oncogene fos. In order to induce the expression of genes. UV radiation needs to be absorbed by DNA and to cause DNA damage of the kind that cannot be repaired by cells from patients with xeroderma pigmentosum group A. UV-induced activation of the three genes is mediated by the major enhancer elements (located between nucleotide positions -105 and -79 of HIV-1, between positions -72 and -65 of the collagenase gene, and between positions -320 and -299 of fos). These elements share no apparent sequence motif and bind different trans-acting proteins; a member of the NF kappa B family binds to the HIV-1 enhancer, the heterodimer of Jun and Fos (AP-1) binds to the collagenase enhancer, and the serum response factors p67 and p62 bind to fos. DNA-binding activities of the factors recognizing the HIV-1 and collagenase enhancers are augmented in extracts from UV-treated cells. The increase in activity is due to posttranslational modification. While AP-1 resides in the nucleus and must be modulated there, NF kappa B is activated in the cytoplasm, indicating the existence of a cytoplasmic signal transduction pathway triggered by UV-induced DNA damage. In addition to activation, new synthesis of AP-1 is induced by UV radiation. Images PMID:2557547

  9. Template-directed covalent conjugation of DNA to native antibodies, transferrin and other metal-binding proteins

    NASA Astrophysics Data System (ADS)

    Rosen, Christian B.; Kodal, Anne L. B.; Nielsen, Jesper S.; Schaffert, David H.; Scavenius, Carsten; Okholm, Anders H.; Voigt, Niels V.; Enghild, Jan J.; Kjems, Jørgen; Tørring, Thomas; Gothelf, Kurt V.

    2014-09-01

    DNA-protein conjugates are important in bioanalytical chemistry, molecular diagnostics and bionanotechnology, as the DNA provides a unique handle to identify, functionalize or otherwise manipulate proteins. To maintain protein activity, conjugation of a single DNA handle to a specific location on the protein is often needed. However, preparing such high-quality site-specific conjugates often requires genetically engineered proteins, which is a laborious and technically challenging approach. Here we demonstrate a simpler method to create site-selective DNA-protein conjugates. Using a guiding DNA strand modified with a metal-binding functionality, we directed a second DNA strand to the vicinity of a metal-binding site of His6-tagged or wild-type metal-binding proteins, such as serotransferrin, where it subsequently reacted with lysine residues at that site. This method, DNA-templated protein conjugation, facilitates the production of site-selective protein conjugates, and also conjugation to IgG1 antibodies via a histidine cluster in the constant domain.

  10. Trimeric Association of Hox and TALE Homeodomain Proteins Mediates Hoxb2 Hindbrain Enhancer Activity

    PubMed Central

    Jacobs, Yakop; Schnabel, Catherine A.; Cleary, Michael L.

    1999-01-01

    Pbx/exd proteins modulate the DNA binding affinities and specificities of Hox proteins and contribute to the execution of Hox-dependent developmental programs in arthropods and vertebrates. Pbx proteins also stably heterodimerize and bind DNA with Meis and Pknox1-Prep1, additional members of the TALE (three-amino-acid loop extension) superclass of homeodomain proteins that function on common genetic pathways with a subset of Hox proteins. In this study, we demonstrated that Pbx and Meis bind DNA as heterotrimeric complexes with Hoxb1 on a genetically defined Hoxb2 enhancer, r4, that mediates the cross-regulatory transcriptional effects of Hoxb1 in vivo. The DNA binding specificity of the heterotrimeric complex for r4 is mediated by a Pbx-Hox site in conjunction with a distal Meis site, which we showed to be required for ternary complex formation and Meis-enhanced transcription. Formation of heterotrimeric complexes in which all three homeodomains bind their cognate DNA sites is topologically facilitated by the ability of Pbx and Meis to interact through their amino termini and bind DNA without stringent half-site orientation and spacing requirements. Furthermore, Meis site mutation in the Hoxb2 enhancer phenocopies Pbx-Hox site mutation to abrogate enhancer-directed expression of a reporter transgene in the murine embryonic hindbrain, demonstrating that DNA binding by all three proteins is required for trimer function in vivo. Our data provide in vitro and in vivo evidence for the combinatorial regulation of Hox and TALE protein functions that are mediated, in part, by their interdependent DNA binding activities as ternary complexes. As a consequence, Hoxb1 employs Pbx and Meis-related proteins, as a pair of essential cofactors in a higher-order molecular complex, to mediate its transcriptional effects on an endogenous Hox response element. PMID:10373562

  11. Synthesis, structure, DNA/protein binding, and cytotoxic activity of a rhodium(III) complex with 2,6-bis(2-benzimidazolyl)pyridine.

    PubMed

    Esteghamat-Panah, Roya; Hadadzadeh, Hassan; Farrokhpour, Hossein; Simpson, Jim; Abdolmaleki, Amir; Abyar, Fatemeh

    2017-02-15

    A new mononuclear rhodium(III) complex, [Rh(bzimpy)Cl 3 ] (bzimpy = 2,6-bis(2-benzimidazolyl)pyridine), was synthesized and characterized by elemental analysis and spectroscopic methods. The molecular structure of the complex was confirmed by single-crystal X-ray crystallography. The interaction of the complex with fish sperm DNA (FS-DNA) was investigated by UV spectroscopy, emission titration, and viscosity measurement in order to evaluate the possible DNA-binding mode and to calculate the corresponding DNA-binding constant. The results reveal that the Rh(III) complex interacts with DNA through groove binding mode with a binding affinity on the order of 10 4 . In addition, the binding of the Rh(III) complex to bovine serum albumin (BSA) was monitored by UV-Vis and fluorescence emission spectroscopy at different temperatures. The mechanism of the complex interaction was found to be static quenching. The thermodynamic parameters (ΔH, ΔS, and ΔG) obtained from the fluorescence spectroscopy data show that van der Waals interactions and hydrogen bonds play a major role in the binding of the Rh(III) complex to BSA. For the comparison of the DNA- and BSA-binding affinities of the free bzimpy ligand with its Rh(III) complex, the absorbance titration and fluorescence quenching experiments of the free bzimpy ligand with DNA and BSA were carried out. Competitive experiments using eosin Y and ibuprofen as site markers indicated that the complex was mainly located in the hydrophobic cavity of site I of the protein. These experimental results were confirmed by the results of molecular docking. Finally, the in vitro cytotoxicity properties of the Rh(III) complex against the MCF-7, K562, and HT-29 cell lines were evaluated and compared with those of the free ligand (bzimpy). It was found that the complexation process improved the anticancer activity significantly. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  12. Non-equilibrium repressor binding kinetics link DNA damage dose to transcriptional timing within the SOS gene network.

    PubMed

    Culyba, Matthew J; Kubiak, Jeffrey M; Mo, Charlie Y; Goulian, Mark; Kohli, Rahul M

    2018-06-01

    Biochemical pathways are often genetically encoded as simple transcription regulation networks, where one transcription factor regulates the expression of multiple genes in a pathway. The relative timing of each promoter's activation and shut-off within the network can impact physiology. In the DNA damage repair pathway (known as the SOS response) of Escherichia coli, approximately 40 genes are regulated by the LexA repressor. After a DNA damaging event, LexA degradation triggers SOS gene transcription, which is temporally separated into subsets of 'early', 'middle', and 'late' genes. Although this feature plays an important role in regulating the SOS response, both the range of this separation and its underlying mechanism are not experimentally defined. Here we show that, at low doses of DNA damage, the timing of promoter activities is not separated. Instead, timing differences only emerge at higher levels of DNA damage and increase as a function of DNA damage dose. To understand mechanism, we derived a series of synthetic SOS gene promoters which vary in LexA-operator binding kinetics, but are otherwise identical, and then studied their activity over a large dose-range of DNA damage. In distinction to established models based on rapid equilibrium assumptions, the data best fit a kinetic model of repressor occupancy at promoters, where the drop in cellular LexA levels associated with higher doses of DNA damage leads to non-equilibrium binding kinetics of LexA at operators. Operators with slow LexA binding kinetics achieve their minimal occupancy state at later times than operators with fast binding kinetics, resulting in a time separation of peak promoter activity between genes. These data provide insight into this remarkable feature of the SOS pathway by demonstrating how a single transcription factor can be employed to control the relative timing of each gene's transcription as a function of stimulus dose.

  13. Formononetin, a phyto-oestrogen, and its metabolites up-regulate interleukin-4 production in activated T cells via increased AP-1 DNA binding activity

    PubMed Central

    Park, Jin; Kim, Seung H; Cho, Daeho; Kim, Tae S

    2005-01-01

    Phyto-oestrogens are polyphenolic non-steroidal plant compounds with oestrogen-like biological activity. Phyto-oestrogens have many biological effects including oestrogen agonist/antagonist properties. However, the effect of phyto-oestrogens on allergic responses remains unclear. In this study we investigated whether formononetin, a phyto-oestrogen, and its metabolites, daidzein and equol, affect production of interleukin-4 (IL-4), a pro-inflammatory cytokine closely associated with allergic immune response, in primary CD4+ T cells and EL4 T lymphoma cells. Formononetin, daidzein and equol significantly enhanced IL-4 production from both CD4+ T cells and EL4 cells in a dose-dependent manner. Formononetin, daidzein and equol also enhanced IL-4 gene promoter activity in EL4 cells transiently transfected with IL-4 gene promoter constructs, but this effect was impaired in EL4 cells transfected with an IL-4 promoter construct deleted of P4 site carrying nuclear factor of activated T cells (NF-AT) and activator protein-1 (AP-1) binding sites. In addition, formononetin, daidzein and equol increased AP-1 DNA binding activities while did not affect NF-AT DNA binding activities. The enhancing effects on IL-4 production and AP-1 DNA binding activities were abrogated by specific inhibitors for phosphatidylinositol-3-kinase (PI3K), protein kinase C (PKC) and p38 mitogen-activated protein kinase (MAPK), indicating that formononetin, daidzein and equol might enhance IL-4 production by increased activation of AP-1 through the PI3-K/PKC/p38 MAPK signalling pathway. These results suggest that phyto-oestrogens and some of their metabolites may increase allergic responses via the enhancement of IL-4 production in T cells. PMID:16108819

  14. Replication initiator protein RepE of mini-F plasmid: functional differentiation between monomers (initiator) and dimers (autogenous repressor).

    PubMed Central

    Ishiai, M; Wada, C; Kawasaki, Y; Yura, T

    1994-01-01

    Replication of mini-F plasmid requires the plasmid-encoded RepE initiator protein and several host factors including DnaJ, DnaK, and GrpE, heat shock proteins of Escherichia coli. The RepE protein plays a crucial role in replication and exhibits two major functions: initiation of replication from the origin, ori2, and autogenous repression of repE transcription. One of the mini-F plasmid mutants that can replicate in the dnaJ-defective host produces an altered RepE (RepE54) with a markedly enhanced initiator activity but little or no repressor activity. RepE54 has been purified from cell extracts primarily in monomeric form, unlike the wild-type RepE that is recovered in dimeric form. Gel-retardation assays revealed that RepE54 monomers bind to ori2 (direct repeats) with a very high efficiency but hardly bind to the repE operator (inverted repeat), in accordance with the properties of RepE54 in vivo. Furthermore, the treatment of wild-type RepE dimers with protein denaturants enhanced their binding to ori2 but reduced binding to the operator: RepE dimers were partially converted to monomers, and the ori2 binding activity was uniquely associated with monomers. These results strongly suggest that RepE monomers represent an active form by binding to ori2 to initiate replication, whereas dimers act as an autogenous repressor by binding to the operator. We propose that RepE is structurally and functionally differentiated and that monomerization of RepE dimers, presumably mediated by heat shock protein(s), activates the initiator function and participates in regulation of mini-F DNA replication. Images PMID:8170998

  15. A domain of the Klenow fragment of Escherichia coli DNA polymerase I has polymerase but no exonuclease activity.

    PubMed

    Freemont, P S; Ollis, D L; Steitz, T A; Joyce, C M

    1986-09-01

    The Klenow fragment of DNA polymerase I from Escherichia coli has two enzymatic activities: DNA polymerase and 3'-5' exonuclease. The crystal structure showed that the fragment is folded into two distinct domains. The smaller domain has a binding site for deoxynucleoside monophosphate and a divalent metal ion that is thought to identify the 3'-5' exonuclease active site. The larger C-terminal domain contains a deep cleft that is believed to bind duplex DNA. Several lines of evidence suggested that the large domain also contains the polymerase active site. To test this hypothesis, we have cloned the DNA coding for the large domain into an expression system and purified the protein product. We find that the C-terminal domain has polymerase activity (albeit at a lower specific activity than the native Klenow fragment) but no measurable 3'-5' exonuclease activity. These data are consistent with the hypothesis that each of the three enzymatic activities of DNA polymerase I from E. coli resides on a separate protein structural domain.

  16. Protein complexes formed during the incision reaction catalyzed by the Escherichia coli UvrABC endonuclease.

    PubMed Central

    Yeung, A T; Mattes, W B; Grossman, L

    1986-01-01

    An examination has been made into the nature of the nucleoprotein complexes formed during the incision reaction catalyzed by the Escherichia coli UvrABC endonuclease when acting on a pyrimidine dimer-containing fd RF-I DNA species. The complexes of proteins and DNA form in unique stages. The first stage of binding involves an ATP-stimulated interaction of the UvrA protein with duplex DNA containing pyrimidine dimer sites. The UvrB protein significantly stabilizes the UvrA-pyrimidine dimer containing DNA complex which, in turn, provides a foundation for the binding of UvrC to activate the UvrABC endonuclease. The binding of one molecule of UvrC to each UvrAB-damaged DNA complex is needed to catalyze incision in the vicinity of pyrimidine dimer sites. The UvrABC-DNA complex persists after the incision event suggesting that the lack of UvrABC turnover may be linked to other activities in the excision-repair pathway beyond the initial incision reaction. PMID:3960727

  17. Structural Analysis of HMGD-DNA Complexes Reveal Influence of Intercalation on Sequence Selectivity and DNA Bending

    PubMed Central

    Churchill, Mair E.A.; Klass, Janet; Zoetewey, David L.

    2010-01-01

    The ubiquitous eukaryotic High-Mobility-Group-Box (HMGB) chromosomal proteins promote many chromatin-mediated cellular activities through their non-sequence-specific binding and bending of DNA. Minor groove DNA binding by the HMG box results in substantial DNA bending toward the major groove owing to electrostatic interactions, shape complementarity and DNA intercalation that occurs at two sites. Here, the structures of the complexes formed with DNA by a partially DNA intercalation-deficient mutant of Drosophila melanogaster HMGD have been determined by X-ray crystallography at a resolution of 2.85 Å. The six proteins and fifty base pairs of DNA in the crystal structure revealed a variety of bound conformations. All of the proteins bound in the minor groove, bridging DNA molecules, presumably because these DNA regions are easily deformed. The loss of the primary site of DNA intercalation decreased overall DNA bending and shape complementarity. However, DNA bending at the secondary site of intercalation was retained and most protein-DNA contacts were preserved. The mode of binding resembles the HMGB1-boxA-cisplatin-DNA complex, which also lacks a primary intercalating residue. This study provides new insights into the binding mechanisms used by HMG boxes to recognize varied DNA structures and sequences as well as modulate DNA structure and DNA bending. PMID:20800069

  18. TALE-PvuII Fusion Proteins – Novel Tools for Gene Targeting

    PubMed Central

    Yanik, Mert; Alzubi, Jamal; Lahaye, Thomas; Cathomen, Toni; Pingoud, Alfred; Wende, Wolfgang

    2013-01-01

    Zinc finger nucleases (ZFNs) consist of zinc fingers as DNA-binding module and the non-specific DNA-cleavage domain of the restriction endonuclease FokI as DNA-cleavage module. This architecture is also used by TALE nucleases (TALENs), in which the DNA-binding modules of the ZFNs have been replaced by DNA-binding domains based on transcription activator like effector (TALE) proteins. Both TALENs and ZFNs are programmable nucleases which rely on the dimerization of FokI to induce double-strand DNA cleavage at the target site after recognition of the target DNA by the respective DNA-binding module. TALENs seem to have an advantage over ZFNs, as the assembly of TALE proteins is easier than that of ZFNs. Here, we present evidence that variant TALENs can be produced by replacing the catalytic domain of FokI with the restriction endonuclease PvuII. These fusion proteins recognize only the composite recognition site consisting of the target site of the TALE protein and the PvuII recognition sequence (addressed site), but not isolated TALE or PvuII recognition sites (unaddressed sites), even at high excess of protein over DNA and long incubation times. In vitro, their preference for an addressed over an unaddressed site is > 34,000-fold. Moreover, TALE-PvuII fusion proteins are active in cellula with minimal cytotoxicity. PMID:24349308

  19. Probing the interaction of the phytochemical 6-gingerol from the spice ginger with DNA.

    PubMed

    Haris, Poovvathingal; Mary, Varughese; Sudarsanakumar, Chellappanpillai

    2018-07-01

    6-Gingerol [5-hydroxy-1-(4-hydroxy-3-methoxyphenyl) decan-3-one], the bio-active ingredient of the popular Indian spice ginger (Zingiber officinale Roscoe), is well-known for its pharmacological and physiological actions. The potent antioxidant, antiemetic, antiulcer, antimicrobial, analgesic, hypoglycemic, antihypertensive, antihyperlipidemic, immunostimulant, anti-inflammatory, cardiotonic, and cancer prevention activities of 6-Gingerol has been investigated and explored. 6-Gingerol is a good candidate for the treatment of various cancers including prostrate, pancreatic, breast, skin, gastrointestinal, pulmonary, and renal cancer. In this study we report for the first time the molecular recognition of 6-Gingerol with calf thymus DNA (ctDNA) through experimental and molecular modeling techniques confirming a minor groove binding mode of 6-Gingerol with ctDNA. Fluorescence and UV-vis spectroscopic studies confirm the complex formation of 6-gingerol with ctDNA. The energetics and thermodynamics of the interaction of 6-Gingerol with ctDNA was explored by Isothermal Titration Calorimetry (ITC) and Differential Scanning Calorimetry (DSC). The ctDNA helix melting upon 6-Gingerol binding was examined by melting temperature T m analysis. Further the electrophoretic mobility shift assay confirms a possible groove binding of 6-Gingerol with ctDNA. Molecular docking and Molecular dynamics (MD) studies provide a detailed understanding on the interaction of 6-Gingerol binding in the minor groove of DNA which supports experimental results. Copyright © 2018. Published by Elsevier B.V.

  20. GCR1, a transcriptional activator in Saccharomyces cerevisiae, complexes with RAP1 and can function without its DNA binding domain.

    PubMed Central

    Tornow, J; Zeng, X; Gao, W; Santangelo, G M

    1993-01-01

    In Saccharomyces cerevisiae, efficient expression of glycolytic and translational component genes requires two DNA binding proteins, RAP1 (which binds to UASRPG) and GCR1 (which binds to the CT box). We generated deletions in GCR1 to test the validity of several different models for GCR1 function. We report here that the C-terminal half of GCR1, which includes the domain required for DNA binding to the CT box in vitro, can be removed without affecting GCR1-dependent transcription of either the glycolytic gene ADH1 or the translational component genes TEF1 and TEF2. We have also identified an activation domain within a segment of the GCR1 protein (the N-terminal third) that is essential for in vivo function. RAP1 and GCR1 can be co-immunoprecipitated from whole cell extracts, suggesting that they form a complex in vivo. The data are most consistent with a model in which GCR1 is attracted to DNA through contact with RAP1. Images PMID:8508768

  1. Cyclosporin A and FK-506 both affect DNA binding of regulatory nuclear proteins to the human interleukin-2 promoter.

    PubMed

    Baumann, G; Geisse, S; Sullivan, M

    1991-03-01

    The structurally unrelated immunosuppressive drugs cyclosporin A (Sandimmun) and FK-506 both interfere with the process of T-cell proliferation by blocking the transcription of the T-cell growth factor interleukin-2 (IL-2). Here we demonstrate that the transcriptional activation of this gene requires the binding of regulatory nuclear proteins to a promoter element with sequence similarity to the consensus binding site for NF-kappa B-related transcription factors. We present evidence that the binding by regulatory nuclear proteins to the kappa B element of the IL-2 promoter is affected negatively by cyclosporin A and FK-506 at concentrations paralleling their immunosuppressive activity in vivo. The decrease in DNA-protein complex formation induced by the immunosuppressive drugs correlates with a decrease in IL-2 production. FK-506 is 10 to 100 times more potent than cyclosporin A in its ability to inhibit sequence-specific DNA binding and IL-2 production. Our findings suggest that the actions of both drugs converge at the level of DNA-protein interaction.

  2. Differences in the Mechanism of the Allosteric L-Rhamnose Responses of the AraC/XylS Family Transcription Activators RhaS and RhaR

    PubMed Central

    Kolin, Ana; Balasubramaniam, Vinitha; Skredenske, Jeff; Wickstrum, Jason; Egan, Susan M.

    2008-01-01

    SUMMARY Proteins in the largest subset of AraC/XylS family transcription activators, including RhaS and RhaR, have C-terminal domains (CTDs) that mediate DNA-binding and transcription activation, and N-terminal domains (NTDs) that mediate dimerization and effector binding. The mechanism of the allosteric effector response in this family has been identified only for AraC. Here, we investigated the mechanism by which RhaS and RhaR respond to their effector, L-rhamnose. Unlike AraC, N-terminal truncations suggested that RhaS and RhaR don’t use an N-terminal arm to inhibit activity in the absence of effector. We used random mutagenesis to isolate RhaS and RhaR variants with enhanced activation in the absence of L-rhamnose. NTD substitutions largely clustered around the predicted L-rhamnose-binding pockets, suggesting that they mimic the structural outcome of effector binding to the wild-type proteins. RhaS-CTD substitutions clustered in the first HTH motif, and suggested that L-rhamnose induces improved DNA binding. In contrast, RhaR-CTD substitutions clustered at a single residue in the second HTH motif, at a position consistent with improved RNAP contacts. We propose separate allosteric mechanisms for the two proteins: Without L-rhamnose, RhaS doesn’t effectively bind DNA while RhaR doesn’t effectively contact RNAP. Upon L-rhamnose binding, both proteins undergo structural changes that enable transcription activation. PMID:18366439

  3. c-Jun binds the N terminus of human TAF(II)250 to derepress RNA polymerase II transcription in vitro.

    PubMed

    Lively, T N; Ferguson, H A; Galasinski, S K; Seto, A G; Goodrich, J A

    2001-07-06

    c-Jun is an oncoprotein that activates transcription of many genes involved in cell growth and proliferation. We studied the mechanism of transcriptional activation by human c-Jun in a human RNA polymerase II transcription system composed of highly purified recombinant and native transcription factors. Transcriptional activation by c-Jun depends on the TATA-binding protein (TBP)-associated factor (TAF) subunits of transcription factor IID (TFIID). Protein-protein interaction assays revealed that c-Jun binds with high specificity to the largest subunit of human TFIID, TAF(II)250. The region of TAF(II)250 bound by c-Jun lies in the N-terminal 163 amino acids. This same region of TAF(II)250 binds to TBP and represses its interaction with TATA boxes, thereby decreasing DNA binding by TFIID. We hypothesized that c-Jun is capable of derepressing the effect of the TAF(II)250 N terminus on TFIID-driven transcription. In support of this hypothesis, we found that c-Jun increased levels of TFIID-driven transcription in vitro when added at high concentrations to a DNA template lacking activator protein 1 (AP-1) sites. Moreover, c-Jun blocked the repression of TBP DNA binding caused by the N terminus of TAF(II)250. In addition to revealing a mechanism by which c-Jun activates transcription, our studies provide the first evidence that an activator can bind directly to the N terminus of TAF(II)250 to derepress RNA polymerase II transcription in vitro.

  4. DNA-binding regulates site-specific ubiquitination of IRF-1.

    PubMed

    Landré, Vivien; Pion, Emmanuelle; Narayan, Vikram; Xirodimas, Dimitris P; Ball, Kathryn L

    2013-02-01

    Understanding the determinants for site-specific ubiquitination by E3 ligase components of the ubiquitin machinery is proving to be a challenge. In the present study we investigate the role of an E3 ligase docking site (Mf2 domain) in an intrinsically disordered domain of IRF-1 [IFN (interferon) regulatory factor-1], a short-lived IFNγ-regulated transcription factor, in ubiquitination of the protein. Ubiquitin modification of full-length IRF-1 by E3 ligases such as CHIP [C-terminus of the Hsc (heat-shock cognate) 70-interacting protein] and MDM2 (murine double minute 2), which dock to the Mf2 domain, was specific for lysine residues found predominantly in loop structures that extend from the DNA-binding domain, whereas no modification was detected in the more conformationally flexible C-terminal half of the protein. The E3 docking site was not available when IRF-1 was in its DNA-bound conformation and cognate DNA-binding sequences strongly suppressed ubiquitination, highlighting a strict relationship between ligase binding and site-specific modification at residues in the DNA-binding domain. Hyperubiquitination of a non-DNA-binding mutant supports a mechanism where an active DNA-bound pool of IRF-1 is protected from polyubiquitination and degradation.

  5. HMGB1 Protein Binds to Influenza Virus Nucleoprotein and Promotes Viral Replication

    PubMed Central

    Moisy, Dorothée; Avilov, Sergiy V.; Jacob, Yves; Laoide, Brid M.; Ge, Xingyi; Baudin, Florence; Jestin, Jean-Luc

    2012-01-01

    Influenza virus has evolved replication strategies that hijack host cell pathways. To uncover interactions between viral macromolecules and host proteins, we applied a phage display strategy. A library of human cDNA expression products displayed on filamentous phages was submitted to affinity selection for influenza viral ribonucleoproteins (vRNPs). High-mobility-group box (HMGB) proteins were found to bind to the nucleoprotein (NP) component of vRNPs. HMGB1 and HMGB2 bind directly to the purified NP in the absence of viral RNA, and the HMG box A domain is sufficient to bind the NP. We show that HMGB1 associates with the viral NP in the nuclei of infected cells, promotes viral growth, and enhances the activity of the viral polymerase. The presence of a functional HMGB1 DNA-binding site is required to enhance influenza virus replication. Glycyrrhizin, which reduces HMGB1 binding to DNA, inhibits influenza virus polymerase activity. Our data show that the HMGB1 protein can play a significant role in intranuclear replication of influenza viruses, thus extending previous findings on the bornavirus and on a number of DNA viruses. PMID:22696656

  6. Distinct DNA-binding surfaces in the ATPase and linker domains of MutLγ determine its substrate specificities and exert separable functions in meiotic recombination and mismatch repair

    PubMed Central

    2017-01-01

    Mlh1-Mlh3 (MutLγ) is a mismatch repair factor with a central role in formation of meiotic crossovers, presumably through resolution of double Holliday junctions. MutLγ has DNA-binding, nuclease, and ATPase activities, but how these relate to one another and to in vivo functions are unclear. Here, we combine biochemical and genetic analyses to characterize Saccharomyces cerevisiae MutLγ. Limited proteolysis and atomic force microscopy showed that purified recombinant MutLγ undergoes ATP-driven conformational changes. In vitro, MutLγ displayed separable DNA-binding activities toward Holliday junctions (HJ) and, surprisingly, single-stranded DNA (ssDNA), which was not predicted from current models. MutLγ bound DNA cooperatively, could bind multiple substrates simultaneously, and formed higher-order complexes. FeBABE hydroxyl radical footprinting indicated that the DNA-binding interfaces of MutLγ for ssDNA and HJ substrates only partially overlap. Most contacts with HJ substrates were located in the linker regions of MutLγ, whereas ssDNA contacts mapped within linker regions as well as the N-terminal ATPase domains. Using yeast genetic assays for mismatch repair and meiotic recombination, we found that mutations within different DNA-binding surfaces exert separable effects in vivo. For example, mutations within the Mlh1 linker conferred little or no meiotic phenotype but led to mismatch repair deficiency. Interestingly, mutations in the N-terminal domain of Mlh1 caused a stronger meiotic defect than mlh1Δ, suggesting that the mutant proteins retain an activity that interferes with alternative recombination pathways. Furthermore, mlh3Δ caused more chromosome missegregation than mlh1Δ, whereas mlh1Δ but not mlh3Δ partially alleviated meiotic defects of msh5Δ mutants. These findings illustrate functional differences between Mlh1 and Mlh3 during meiosis and suggest that their absence impinges on chromosome segregation not only via reduced formation of crossovers. Taken together, our results offer insights into the structure-function relationships of the MutLγ complex and reveal unanticipated genetic relationships between components of the meiotic recombination machinery. PMID:28505149

  7. A method to identify and characterize Z-DNA binding proteins using a linear oligodeoxynucleotide

    NASA Technical Reports Server (NTRS)

    Herbert, A. G.; Rich, A.

    1993-01-01

    An oligodeoxynucleotide that readily flips to the Z-DNA conformation in 10mM MgCl2 was produced by using Klenow enzyme to incorporate 5-bromodeoxycytosine and deoxyguanosine into a (dC-dG)22 template. During synthesis the oligomer can be labeled with 32P to high specific activity. The labeled oligodeoxynucleotide can be used in bandshift experiment to detect proteins that bind Z-DNA. This allows the binding specificity of such proteins to be determined with high reliability using unlabeled linear and supercoiled DNA competitors. In addition, because the radioactive oligodeoxynucleotide contains bromine atoms, DNA-protein complexes can be readily crosslinked using UV light. This allows an estimate to be made of the molecular weight of the proteins that bind to the radioactive probe. Both techniques are demonstrated using a goat polyclonal anti-Z-DNA antiserum.

  8. DNA stabilization at the Bacillus subtilis PolX core—a binding model to coordinate polymerase, AP-endonuclease and 3′-5′ exonuclease activities

    PubMed Central

    Baños, Benito; Villar, Laurentino; Salas, Margarita; de Vega, Miguel

    2012-01-01

    Family X DNA polymerases (PolXs) are involved in DNA repair. Their binding to gapped DNAs relies on two conserved helix-hairpin-helix motifs, one located at the 8-kDa domain and the other at the fingers subdomain. Bacterial/archaeal PolXs have a specifically conserved third helix-hairpin-helix motif (GFGxK) at the fingers subdomain whose putative role in DNA binding had not been established. Here, mutagenesis at the corresponding residues of Bacillus subtilis PolX (PolXBs), Gly130, Gly132 and Lys134 produced enzymes with altered DNA binding properties affecting the three enzymatic activities of the protein: polymerization, located at the PolX core, 3′-5′ exonucleolysis and apurinic/apyrimidinic (AP)-endonucleolysis, placed at the so-called polymerase and histidinol phosphatase domain. Furthermore, we have changed Lys192 of PolXBs, a residue moderately conserved in the palm subdomain of bacterial PolXs and immediately preceding two catalytic aspartates of the polymerization reaction. The results point to a function of residue Lys192 in guaranteeing the right orientation of the DNA substrates at the polymerization and histidinol phosphatase active sites. The results presented here and the recently solved structures of other bacterial PolX ternary complexes lead us to propose a structural model to account for the appropriate coordination of the different catalytic activities of bacterial PolXs. PMID:22844091

  9. Conjugation of Benzylvanillin and Benzimidazole Structure Improves DNA Binding with Enhanced Antileukemic Properties

    PubMed Central

    Al-Mudarris, Ban A.; Chen, Shih-Hsun; Liang, Po-Huang; Osman, Hasnah; Jamal Din, Shah Kamal Khan; Abdul Majid, Amin M. S.

    2013-01-01

    Benzyl-o-vanillin and benzimidazole nucleus serve as important pharmacophore in drug discovery. The benzyl vanillin (2-(benzyloxy)-3-methoxybenzaldehyde) compound shows anti-proliferative activity in HL60 leukemia cancer cells and can effect cell cycle progression at G2/M phase. Its apoptosis activity was due to disruption of mitochondrial functioning. In this study, we have studied a series of compounds consisting of benzyl vanillin and benzimidazole structures. We hypothesize that by fusing these two structures we can produce compounds that have better anticancer activity with improved specificity particularly towards the leukemia cell line. Here we explored the anticancer activity of three compounds namely 2-(2-benzyloxy-3-methoxyphenyl)-1H-benzimidazole, 2MP, N-1-(2-benzyloxy-3-methoxybenzyl)-2-(2-benzyloxy-3-methoxyphenyl)-1H-benzimidazole, 2XP, and (R) and (S)-1-(2-benzyloxy-3-methoxyphenyl)-2, 2, 2-trichloroethyl benzenesulfonate, 3BS and compared their activity to 2-benzyloxy-3-methoxybenzaldehyde, (Bn1), the parent compound. 2XP and 3BS induces cell death of U937 leukemic cell line through DNA fragmentation that lead to the intrinsic caspase 9 activation. DNA binding study primarily by the equilibrium binding titration assay followed by the Viscosity study reveal the DNA binding through groove region with intrinsic binding constant 7.39 µM/bp and 6.86 µM/bp for 3BS and 2XP respectively. 2XP and 3BS showed strong DNA binding activity by the UV titration method with the computational drug modeling showed that both 2XP and 3BS failed to form any electrostatic linkages except via hydrophobic interaction through the minor groove region of the nucleic acid. The benzylvanillin alone (Bn1) has weak anticancer activity even after it was combined with the benzimidazole (2MP), but after addition of another benzylvanillin structure (2XP), stronger activity was observed. Also, the combination of benzylvanillin with benzenesulfonate (3BS) significantly improved the anticancer activity of Bn1. The present study provides a new insight of benzyl vanillin derivatives as potential anti-leukemic agent. PMID:24260527

  10. DNA/RNA hybrid substrates modulate the catalytic activity of purified AID.

    PubMed

    Abdouni, Hala S; King, Justin J; Ghorbani, Atefeh; Fifield, Heather; Berghuis, Lesley; Larijani, Mani

    2018-01-01

    Activation-induced cytidine deaminase (AID) converts cytidine to uridine at Immunoglobulin (Ig) loci, initiating somatic hypermutation and class switching of antibodies. In vitro, AID acts on single stranded DNA (ssDNA), but neither double-stranded DNA (dsDNA) oligonucleotides nor RNA, and it is believed that transcription is the in vivo generator of ssDNA targeted by AID. It is also known that the Ig loci, particularly the switch (S) regions targeted by AID are rich in transcription-generated DNA/RNA hybrids. Here, we examined the binding and catalytic behavior of purified AID on DNA/RNA hybrid substrates bearing either random sequences or GC-rich sequences simulating Ig S regions. If substrates were made up of a random sequence, AID preferred substrates composed entirely of DNA over DNA/RNA hybrids. In contrast, if substrates were composed of S region sequences, AID preferred to mutate DNA/RNA hybrids over substrates composed entirely of DNA. Accordingly, AID exhibited a significantly higher affinity for binding DNA/RNA hybrid substrates composed specifically of S region sequences, than any other substrates composed of DNA. Thus, in the absence of any other cellular processes or factors, AID itself favors binding and mutating DNA/RNA hybrids composed of S region sequences. AID:DNA/RNA complex formation and supporting mutational analyses suggest that recognition of DNA/RNA hybrids is an inherent structural property of AID. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Pseudomonas aeruginosa AmrZ Binds to Four Sites in the algD Promoter, Inducing DNA-AmrZ Complex Formation and Transcriptional Activation.

    PubMed

    Xu, Binjie; Soukup, Randal J; Jones, Christopher J; Fishel, Richard; Wozniak, Daniel J

    2016-10-01

    During late stages of cystic fibrosis pulmonary infections, Pseudomonas aeruginosa often overproduces the exopolysaccharide alginate, protecting the bacterial community from host immunity and antimicrobials. The transcription of the alginate biosynthesis operon is under tight control by a number of factors, including AmrZ, the focus of this study. Interestingly, multiple transcription factors interact with the far-upstream region of this promoter (PalgD), in which one AmrZ binding site has been identified previously. The mechanisms of AmrZ binding and subsequent activation remain unclear and require more-detailed investigation. In this study, in-depth examinations elucidated four AmrZ binding sites, and their disruption eliminated AmrZ binding and promoter activation. Furthermore, our in vitro fluorescence resonance energy transfer experiments suggest that AmrZ holds together multiple binding sites in PalgD and thereafter induces the formation of higher-order DNA-AmrZ complexes. To determine the importance of interactions between those AmrZ oligomers in the cell, a DNA phasing experiment was performed. PalgD transcription was significantly impaired when the relative phase between AmrZ binding sites was reversed (5 bp), while a full-DNA-turn insertion (10 bp) restored promoter activity. Taken together, the investigations presented here provide a deeper mechanistic understanding of AmrZ-mediated binding to PalgD IMPORTANCE: Overproduction of the exopolysaccharide alginate provides protection to Pseudomonas aeruginosa against antimicrobial treatments and is associated with chronic P. aeruginosa infections in the lungs of cystic fibrosis patients. In this study, we combined a variety of microbiological, genetic, biochemical, and biophysical approaches to investigate the activation of the alginate biosynthesis operon promoter by a key transcription factor named AmrZ. This study has provided important new information on the mechanism of activation of this extremely complex promoter. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  12. Viral interference with DNA repair by targeting of the single-stranded DNA binding protein RPA.

    PubMed

    Banerjee, Pubali; DeJesus, Rowena; Gjoerup, Ole; Schaffhausen, Brian S

    2013-10-01

    Correct repair of damaged DNA is critical for genomic integrity. Deficiencies in DNA repair are linked with human cancer. Here we report a novel mechanism by which a virus manipulates DNA damage responses. Infection with murine polyomavirus sensitizes cells to DNA damage by UV and etoposide. Polyomavirus large T antigen (LT) alone is sufficient to sensitize cells 100 fold to UV and other kinds of DNA damage. This results in activated stress responses and apoptosis. Genetic analysis shows that LT sensitizes via the binding of its origin-binding domain (OBD) to the single-stranded DNA binding protein replication protein A (RPA). Overexpression of RPA protects cells expressing OBD from damage, and knockdown of RPA mimics the LT phenotype. LT prevents recruitment of RPA to nuclear foci after DNA damage. This leads to failure to recruit repair proteins such as Rad51 or Rad9, explaining why LT prevents repair of double strand DNA breaks by homologous recombination. A targeted intervention directed at RPA based on this viral mechanism could be useful in circumventing the resistance of cancer cells to therapy.

  13. Max-E47, a Designed Minimalist Protein that Targets the E-Box DNA Site In Vivo and In Vitro

    PubMed Central

    Xu, Jing; Chen, Gang; De Jong, Antonia T.; Shahravan, S. Hesam; Shin, Jumi A.

    2009-01-01

    Max-E47 is a designed hybrid protein comprising the Max DNA-binding basic region and E47 HLH dimerization subdomain. In the yeast one-hybrid system (Y1H), Max-E47 shows strong transcriptional activation from the E-box site, 5'-CACGTG, targeted by the Myc/Max/Mad network of transcription factors; two mutants, Max-E47Y and Max-E47YF, activate more weakly from the E-box in the Y1H. Quantitative fluorescence anisotropy titrations to gain free energies of protein:DNA binding gave low nM Kd values for the native MaxbHLHZ, Max-E47, and the Y and YF mutants binding to the E-box site (14 nM, 15 nM, 9 nM, and 6 nM, respectively), with no detectable binding to a nonspecific control duplex. Because these minimalist, E-box-binding hybrids have no activation domain and no interactions with the c-MycbHLHZ, as shown by the yeast two-hybrid assay, they can potentially serve as dominant-negative inhibitors that suppress activation of E-box-responsive genes targeted by transcription factors including the c-Myc/Max complex. As proof-of-principle, we used our modified Y1H, which allows direct competition between two proteins vying for a DNA target, to show that Max-E47 effectively outcompetes the native MaxbHLHZ for the E-box; weaker competition is observed from the two mutants, consistent with Y1H results. These hybrids provide a minimalist scaffold for further exploration of the relationship between protein structure and DNA-binding function and may have applications as protein therapeutics or biochemical probes capable of targeting the E-box site. PMID:19449889

  14. Characterization of the interaction of yeast enolase with polynucleotides.

    PubMed

    al-Giery, A G; Brewer, J M

    1992-09-23

    Yeast enolase is inhibited under certain conditions by DNA. The enzyme binds to single-stranded DNA-cellulose. Inhibition was used for routine characterization of the interaction. The presence of the substrate 2-phospho-D-glycerate reduces inhibition and binding. Both yeast enolase isozymes behave similarly. Impure yeast enolase was purified by adsorption onto a single-stranded DNA-cellulose column followed by elution with substrate. Interaction with RNA, double-stranded DNA, or degraded DNA results in less inhibition, suggesting that yeast enolase preferentially binds single-stranded DNA. However, yeast enolase is not a DNA-unwinding protein. The enzyme is inhibited by the short synthetic oligodeoxynucleotides G6, G8 and G10 but not T8 or T6, suggesting some base specificity in the interaction. The interaction is stronger at more acid pH values, with an apparent pK of 5.6. The interaction is prevented by 0.3 M KCl, suggesting that electrostatic factors are important. Histidine or lysine reverse the inhibition at lower concentrations, while phosphate is still more effective. Binding of single-stranded DNA to enolase reduces the reaction of protein histidyl residues with diethylpyrocarbonate. The inhibition of yeast enolase by single-stranded DNA is not total, and suggests the active site is not directly involved in the interaction. Binding of substrate may induce a conformational change in the enzyme that interferes with DNA binding and vice versa.

  15. MGMT DNA repair gene promoter/enhancer haplotypes alter transcription factor binding and gene expression.

    PubMed

    Xu, Meixiang; Cross, Courtney E; Speidel, Jordan T; Abdel-Rahman, Sherif Z

    2016-10-01

    The O 6 -methylguanine-DNA methyltransferase (MGMT) protein removes O 6 -alkyl-guanine adducts from DNA. MGMT expression can thus alter the sensitivity of cells and tissues to environmental and chemotherapeutic alkylating agents. Previously, we defined the haplotype structure encompassing single nucleotide polymorphisms (SNPs) in the MGMT promoter/enhancer (P/E) region and found that haplotypes, rather than individual SNPs, alter MGMT promoter activity. The exact mechanism(s) by which these haplotypes exert their effect on MGMT promoter activity is currently unknown, but we noted that many of the SNPs comprising the MGMT P/E haplotypes are located within or in close proximity to putative transcription factor binding sites. Thus, these haplotypes could potentially affect transcription factor binding and, subsequently, alter MGMT promoter activity. In this study, we test the hypothesis that MGMT P/E haplotypes affect MGMT promoter activity by altering transcription factor (TF) binding to the P/E region. We used a promoter binding TF profiling array and a reporter assay to evaluate the effect of different P/E haplotypes on TF binding and MGMT expression, respectively. Our data revealed a significant difference in TF binding profiles between the different haplotypes evaluated. We identified TFs that consistently showed significant haplotype-dependent binding alterations (p ≤ 0.01) and revealed their role in regulating MGMT expression using siRNAs and a dual-luciferase reporter assay system. The data generated support our hypothesis that promoter haplotypes alter the binding of TFs to the MGMT P/E and, subsequently, affect their regulatory function on MGMT promoter activity and expression level.

  16. AmrZ Beta-Sheet Residues Are Essential for DNA Binding and Transcriptional Control of Pseudomonas aeruginosa Virulence Genes ▿ †

    PubMed Central

    Waligora, Elizabeth A.; Ramsey, Deborah M.; Pryor, Edward E.; Lu, Haiping; Hollis, Thomas; Sloan, Gina P.; Deora, Rajendar; Wozniak, Daniel J.

    2010-01-01

    AmrZ is a putative ribbon-helix-helix (RHH) transcriptional regulator. RHH proteins utilize residues within the β-sheet for DNA binding, while the α-helices promote oligomerization. AmrZ is of interest due to its dual roles as a transcriptional activator and as a repressor, regulating genes encoding virulence factors associated with both chronic and acute Pseudomonas aeruginosa infection. In this study, cross-linking revealed that AmrZ forms oligomers in solution but that the amino terminus, containing an unordered region and a β-sheet, were not required for oligomerization. The first 12 unordered residues (extended amino terminus) contributed minimally to DNA binding. Mutagenesis of the AmrZ β-sheet demonstrated that residues 18, 20, and 22 were essential for DNA binding at both activation and repressor sites, suggesting that AmrZ utilizes a similar mechanism for binding to these sites. Mice infected with amrZ mutants exhibited reduced bacterial burden, morbidity, and mortality. Direct in vivo competition assays showed a 5-fold competitive advantage for the wild type over an isogenic amrZ mutant. Finally, the reduced infection phenotype of the amrZ-null strain was similar to that of a strain expressing a DNA-binding-deficient AmrZ variant, indicating that DNA binding and transcriptional regulation by AmrZ is responsible for the in vivo virulence defect. These recent infection data, along with previously identified AmrZ-regulated virulence factors, suggest the necessity of AmrZ transcriptional regulation for optimal virulence during acute infection. PMID:20709902

  17. The Staphylococcus aureus group II biotin protein ligase BirA is an effective regulator of biotin operon transcription and requires the DNA binding domain for full enzymatic activity.

    PubMed

    Henke, Sarah K; Cronan, John E

    2016-11-01

    Group II biotin protein ligases (BPLs) are characterized by the presence of an N-terminal DNA binding domain that functions in transcriptional regulation of the genes of biotin biosynthesis and transport. The Staphylococcus aureus Group II BPL which is called BirA has been reported to bind an imperfect inverted repeat located upstream of the biotin synthesis operon. DNA binding by other Group II BPLs requires dimerization of the protein which is triggered by synthesis of biotinoyl-AMP (biotinoyl-adenylate), the intermediate in the ligation of biotin to its cognate target proteins. However, the S. aureus BirA was reported to dimerize and bind DNA in the absence of biotin or biotinoyl-AMP (Soares da Costa et al. (2014) Mol Microbiol 91: 110-120). These in vitro results argued that the protein would be unable to respond to the levels of biotin or acceptor proteins and thus would lack the regulatory properties of the other characterized BirA proteins. We tested the regulatory function of the protein using an in vivo model system and examined its DNA binding properties in vitro using electrophoretic mobility shift and fluorescence anisotropy analyses. We report that the S. aureus BirA is an effective regulator of biotin operon transcription and that the prior data can be attributed to artifacts of mobility shift analyses. We also report that deletion of the DNA binding domain of the S. aureus BirA results in loss of virtually all of its ligation activity. © 2016 John Wiley & Sons Ltd.

  18. Changes in pH and NADPH regulate the DNA binding activity of neuronal PAS domain protein 2, a mammalian circadian transcription factor.

    PubMed

    Yoshii, Katsuhiro; Tajima, Fumihisa; Ishijima, Sumio; Sagami, Ikuko

    2015-01-20

    Neuronal PAS domain protein 2 (NPAS2) is a core clock transcription factor that forms a heterodimer with BMAL1 to bind the E-box in the promoter of clock genes and is regulated by various environmental stimuli such as heme, carbon monoxide, and NAD(P)H. In this study, we investigated the effects of pH and NADPH on the DNA binding activity of NPAS2. In an electrophoretic mobility shift (EMS) assay, the pH of the reaction mixture affected the DNA binding activity of the NPAS2/BMAL1 heterodimer but not that of the BMAL1/BMAL1 homodimer. A change in pH from 7.0 to 7.5 resulted in a 1.7-fold increase in activity in the absence of NADPH, and NADPH additively enhanced the activity up to 2.7-fold at pH 7.5. The experiments using truncated mutants revealed that N-terminal amino acids 1-61 of NPAS2 were sufficient to sense the change in both pH and NADPH. We further analyzed the kinetics of formation and DNA binding of the NPAS2/BMAL1 heterodimer at various pH values. In the absence of NADPH, a change in pH from 6.5 to 8.0 decreased the KD(app) value of the E-box from 125 to 22 nM, with an 8-fold increase in the maximal level of DNA binding for the NPAS2/BMAL1 heterodimer. The addition of NADPH resulted in a further decrease in KD(app) to 9 nM at pH 8.0. Furthermore, NPAS2-dependent transcriptional activity in a luciferase assay using NIH3T3 cells also increased with the pH of the culture medium. These results suggest that NPAS2 has a role as a pH and metabolite sensor in regulating circadian rhythms.

  19. Identification of the target DNA sequence and characterization of DNA binding features of HlyU, and suggestion of a redox switch for hlyA expression in the human pathogen Vibrio cholerae from in silico studies.

    PubMed

    Mukherjee, Debadrita; Pal, Aritrika; Chakravarty, Devlina; Chakrabarti, Pinak

    2015-02-18

    HlyU, a transcriptional regulator common in many Vibrio species, activates the hemolysin gene hlyA in Vibrio cholerae, the rtxA1 operon in Vibrio vulnificus and the genes of plp-vah1 and rtxACHBDE gene clusters in Vibrio anguillarum. The protein is also proposed to be a potential global virulence regulator for V. cholerae and V. vulnificus. Mechanisms of gene control by HlyU in V. vulnificus and V. anguillarum are reported. However, detailed elucidation of the interaction of HlyU in V. cholerae with its target DNA at the molecular level is not available. Here we report a 17-bp imperfect palindrome sequence, 5'-TAATTCAGACTAAATTA-3', 173 bp upstream of hlyA promoter, as the binding site of HlyU. This winged helix-turn-helix protein binds necessarily as a dimer with the recognition helices contacting the major grooves and the β-sheet wings, the minor grooves. Such interactions enhance hlyA promoter activity in vivo. Mutations affecting dimerization as well as those in the DNA-protein interface hamper DNA binding and transcription regulation. Molecular dynamic simulations show hydrogen bonding patterns involving residues at the mutation sites and confirmed their importance in DNA binding. On binding to HlyU, DNA deviates by ∼68º from linearity. Dynamics also suggest a possible redox control in HlyU. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. DnaA protein DNA-binding domain binds to Hda protein to promote inter-AAA+ domain interaction involved in regulatory inactivation of DnaA.

    PubMed

    Keyamura, Kenji; Katayama, Tsutomu

    2011-08-19

    Chromosomal replication is initiated from the replication origin oriC in Escherichia coli by the active ATP-bound form of DnaA protein. The regulatory inactivation of DnaA (RIDA) system, a complex of the ADP-bound Hda and the DNA-loaded replicase clamp, represses extra initiations by facilitating DnaA-bound ATP hydrolysis, yielding the inactive ADP-bound form of DnaA. However, the mechanisms involved in promoting the DnaA-Hda interaction have not been determined except for the involvement of an interaction between the AAA+ domains of the two. This study revealed that DnaA Leu-422 and Pro-423 residues within DnaA domain IV, including a typical DNA-binding HTH motif, are specifically required for RIDA-dependent ATP hydrolysis in vitro and that these residues support efficient interaction with the DNA-loaded clamp·Hda complex and with Hda in vitro. Consistently, substitutions of these residues caused accumulation of ATP-bound DnaA in vivo and oriC-dependent inhibition of cell growth. Leu-422 plays a more important role in these activities than Pro-423. By contrast, neither of these residues is crucial for DNA replication from oriC, although they are highly conserved in DnaA orthologues. Structural analysis of a DnaA·Hda complex model suggested that these residues make contact with residues in the vicinity of the Hda AAA+ sensor I that participates in formation of a nucleotide-interacting surface. Together, the results show that functional DnaA-Hda interactions require a second interaction site within DnaA domain IV in addition to the AAA+ domain and suggest that these interactions are crucial for the formation of RIDA complexes that are active for DnaA-ATP hydrolysis.

  1. DnaA Protein DNA-binding Domain Binds to Hda Protein to Promote Inter-AAA+ Domain Interaction Involved in Regulatory Inactivation of DnaA*

    PubMed Central

    Keyamura, Kenji; Katayama, Tsutomu

    2011-01-01

    Chromosomal replication is initiated from the replication origin oriC in Escherichia coli by the active ATP-bound form of DnaA protein. The regulatory inactivation of DnaA (RIDA) system, a complex of the ADP-bound Hda and the DNA-loaded replicase clamp, represses extra initiations by facilitating DnaA-bound ATP hydrolysis, yielding the inactive ADP-bound form of DnaA. However, the mechanisms involved in promoting the DnaA-Hda interaction have not been determined except for the involvement of an interaction between the AAA+ domains of the two. This study revealed that DnaA Leu-422 and Pro-423 residues within DnaA domain IV, including a typical DNA-binding HTH motif, are specifically required for RIDA-dependent ATP hydrolysis in vitro and that these residues support efficient interaction with the DNA-loaded clamp·Hda complex and with Hda in vitro. Consistently, substitutions of these residues caused accumulation of ATP-bound DnaA in vivo and oriC-dependent inhibition of cell growth. Leu-422 plays a more important role in these activities than Pro-423. By contrast, neither of these residues is crucial for DNA replication from oriC, although they are highly conserved in DnaA orthologues. Structural analysis of a DnaA·Hda complex model suggested that these residues make contact with residues in the vicinity of the Hda AAA+ sensor I that participates in formation of a nucleotide-interacting surface. Together, the results show that functional DnaA-Hda interactions require a second interaction site within DnaA domain IV in addition to the AAA+ domain and suggest that these interactions are crucial for the formation of RIDA complexes that are active for DnaA-ATP hydrolysis. PMID:21708944

  2. Transcriptional activation is a conserved feature of the early embryonic factor Zelda that requires a cluster of four zinc fingers for DNA binding and a low-complexity activation domain.

    PubMed

    Hamm, Danielle C; Bondra, Eliana R; Harrison, Melissa M

    2015-02-06

    Delayed transcriptional activation of the zygotic genome is a nearly universal phenomenon in metazoans. Immediately following fertilization, development is controlled by maternally deposited products, and it is not until later stages that widespread activation of the zygotic genome occurs. Although the mechanisms driving this genome activation are currently unknown, the transcriptional activator Zelda (ZLD) has been shown to be instrumental in driving this process in Drosophila melanogaster. Here we define functional domains of ZLD required for both DNA binding and transcriptional activation. We show that the C-terminal cluster of four zinc fingers mediates binding to TAGteam DNA elements in the promoters of early expressed genes. All four zinc fingers are required for this activity, and splice isoforms lacking three of the four zinc fingers fail to activate transcription. These truncated splice isoforms dominantly suppress activation by the full-length, embryonically expressed isoform. We map the transcriptional activation domain of ZLD to a central region characterized by low complexity. Despite relatively little sequence conservation within this domain, ZLD orthologs from Drosophila virilis, Anopheles gambiae, and Nasonia vitripennis activate transcription in D. melanogaster cells. Transcriptional activation by these ZLD orthologs suggests that ZLD functions through conserved interactions with a protein cofactor(s). We have identified distinct DNA-binding and activation domains within the critical transcription factor ZLD that controls the initial activation of the zygotic genome. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Molecular Mechanism Underlying the Action of Substituted Pro-Gly Dipeptide Noopept.

    PubMed

    Vakhitova, Y V; Sadovnikov, S V; Borisevich, S S; Ostrovskaya, R U; A Gudasheva, T; Seredenin, S B

    2016-01-01

    This study was performed in order to reveal the effect of Noopept (ethyl ester of N-phenylacetyl-Lprolylglycine, GVS-111) on the DNA-binding activity of transcriptional factors (TF) in HEK293 cells transiently transfected with luciferase reporter constructs containing sequences for CREB, NFAT, NF-κB, p53, STAT1, GAS, VDR, HSF1, and HIF-1. Noopept (10 μM) was shown to increase the DNA-binding activity of HIF-1 only, while lacking the ability to affect that of CREB, NFAT, NF-κB, p53, STAT1, GAS, VDR, and HSF1. Noopept provoked an additional increase in the DNA-binding activity of HIF-1 when applied in conditions of CoCl2-induced HIF- 1 stabilization. The degree of this HIF-positive effect of Noopept was shown to be concentration-dependent. Piracetam (1 mM) failed to affect significantly any of the TF under study. The results of molecular docking showed that Noopept (L-isomer), as well as its metabolite, L-isomer of N-phenyl-acetylprolyl, unlike its pharmacologically ineffective D-isomer, is able to bind to the active site of prolyl hydroxylase 2. Taking into account the important role of the genes activated by HIF-1 in the formation of an adaptive response to hypoxia, data on the ability of Noopept to provoke a selective increase in the DNA-binding activity of HIF-1 explain the wide spectrum of neurochemical and pharmacological effects of Noopept revealed before. The obtained data allow one to propose the HIF-positive effect as the primary mechanism of the activity of this Pro-Gly-containing dipeptide.

  4. Acrolein preferentially damages nucleolus eliciting ribosomal stress and apoptosis in human cancer cells.

    PubMed

    Wang, Hsiang-Tsui; Chen, Tzu-Ying; Weng, Ching-Wen; Yang, Chun-Hsiang; Tang, Moon-Shong

    2016-12-06

    Acrolein (Acr) is a potent cytotoxic and DNA damaging agent which is ubiquitous in the environment and abundant in tobacco smoke. Acr is also an active cytotoxic metabolite of the anti-cancer drugs cyclophosphamide and ifosfamide. The mechanisms via which Acr exerts its anti-cancer activity and cytotoxicity are not clear. In this study, we found that Acr induces cytotoxicity and cell death in human cancer cells with different activities of p53. Acr preferentially binds nucleolar ribosomal DNA (rDNA) to form Acr-deoxyguanosine adducts, and induces oxidative damage to both rDNA and ribosomal RNA (rRNA). Acr triggers ribosomal stress responses, inhibits rRNA synthesis, reduces RNA polymerase I binding to the promoter of rRNA gene, disrupts nucleolar integrity, and impairs ribosome biogenesis and polysome formation. Acr causes an increase in MDM2 levels and phosphorylation of MDM2 in A549 and HeLa cells which are p53 active and p53 inactive, respectively. It enhances the binding of ribosomal protein RPL11 to MDM2 and reduces the binding of p53 and E2F-1 to MDM2 resulting in stabilization/activation of p53 in A549 cells and degradation of E2F-1 in A549 and HeLa cells. We propose that Acr induces ribosomal stress which leads to activation of MDM2 and RPL11-MDM2 binding, consequently, activates p53 and enhances E2F-1 degradation, and that taken together these two processes induce apoptosis and cell death.

  5. Interaction of antitumor drug Sn(CH 3) 2Cl 2 with DNA and RNA

    NASA Astrophysics Data System (ADS)

    Nafisi, Shohreh; Sobhanmanesh, Amir; Esm-Hosseini, Majid; Alimoghaddam, Kamran; Tajmir-Riahi, Heidar Ali

    2005-08-01

    Sn(CH3)2Cl2 exerts its antitumor activity in a specific way. Unlike anticancer cis-Pt(NH3)2Cl2 drug which binds strongly to the nitrogen atoms of DNA bases, Sn(CH3)2Cl2 shows no major affinity towards base binding. Thus, the mechanism of action by which tinorganometallic compounds exert antitumor activity would be different from that of the cisplatin drug. The aim of this study was to examine the binding of Sn(CH3)2Cl2 with calf thymus DNA and yeast RNA in aqueous solutions at pH 7.1-6.6 with constant concentrations of DNA and RNA and various molar ratios of Sn(CH3)2Cl2/DNA (phosphate) and Sn(CH3)2Cl2/RNA of 1/40, 1/20, 1/10, 1/5. Fourier transform infrared (FTIR) and UV-visible difference spectroscopic methods were used to determine the Sn(CH3)2Cl2 binding mode, binding constant, sequence selectivity and structural variations of Sn(CH3)2Cl2/DNA and Sn(CH3)2Cl2/RNA complexes in aqueous solution. Sn(CH3)2Cl2 hydrolyzes in water to give Sn(CH3)2(OH)2 and [Sn(CH3)2(OH)(H2O)n]+ species. Spectroscopic evidence showed that interaction occurred mainly through (CH3)2Sn(IV) hydroxide and polynucleotide backbone phosphate group with overall binding constant of K(Sn(CH3)2Cl2-DNA)=1.47×105 M-1 and K(Sn(CH3)2Cl2-RNA)=7.33×105 M-1. Sn(CH3)2Cl2 induced no biopolymer conformational changes with DNA remaining in the B-family structure and RNA in A-conformation upon drug complexation.

  6. A novel class of plant-specific zinc-dependent DNA-binding protein that binds to A/T-rich DNA sequences

    PubMed Central

    Nagano, Yukio; Furuhashi, Hirofumi; Inaba, Takehito; Sasaki, Yukiko

    2001-01-01

    Complementary DNA encoding a DNA-binding protein, designated PLATZ1 (plant AT-rich sequence- and zinc-binding protein 1), was isolated from peas. The amino acid sequence of the protein is similar to those of other uncharacterized proteins predicted from the genome sequences of higher plants. However, no paralogous sequences have been found outside the plant kingdom. Multiple alignments among these paralogous proteins show that several cysteine and histidine residues are invariant, suggesting that these proteins are a novel class of zinc-dependent DNA-binding proteins with two distantly located regions, C-x2-H-x11-C-x2-C-x(4–5)-C-x2-C-x(3–7)-H-x2-H and C-x2-C-x(10–11)-C-x3-C. In an electrophoretic mobility shift assay, the zinc chelator 1,10-o-phenanthroline inhibited DNA binding, and two distant zinc-binding regions were required for DNA binding. A protein blot with 65ZnCl2 showed that both regions are required for zinc-binding activity. The PLATZ1 protein non-specifically binds to A/T-rich sequences, including the upstream region of the pea GTPase pra2 and plastocyanin petE genes. Expression of the PLATZ1 repressed those of the reporter constructs containing the coding sequence of luciferase gene driven by the cauliflower mosaic virus (CaMV) 35S90 promoter fused to the tandem repeat of the A/T-rich sequences. These results indicate that PLATZ1 is a novel class of plant-specific zinc-dependent DNA-binding protein responsible for A/T-rich sequence-mediated transcriptional repression. PMID:11600698

  7. Molecular Insights into the Impact of Oxidative Stress on the Quorum-Sensing Regulator Protein LasR*

    PubMed Central

    Kafle, Prapti; Amoh, Amanda N.; Reaves, Jocelyn M.; Suneby, Emma G.; Tutunjian, Kathryn A.; Tyson, Reed L.; Schneider, Tanya L.

    2016-01-01

    The LasR regulator protein functions at the top of the Pseudomonas aeruginosa quorum-sensing hierarchy and is implicated in promoting bacterial virulence. Of note is recent evidence that this transcription factor may also respond to oxidative stress. Here, all cysteines in LasR were inspected to deduce their redox sensitivity and to probe the connection between stress response and LasR activity using purified LasR and individual LasR domains. Cys79 in the ligand binding domain of LasR appears to be important for ligand recognition and folding of this domain to potentiate DNA binding but does not seem to be sensitive to oxidative stress when bound to its native ligand. Two cysteines in the DNA binding domain of LasR do form a disulfide bond when treated with hydrogen peroxide, and formation of this Cys201-Cys203 disulfide bond appears to disrupt the DNA binding activity of the transcription factor. Mutagenesis of either of these cysteines leads to expression of a protein that no longer binds DNA. A cell-based reporter assay linking LasR function with β-galactosidase activity gave results consistent with those obtained with purified LasR. This work provides a possible mechanism for oxidative stress response by LasR and indicates that multiple cysteines within the protein may prove to be useful targets for disabling its activity. PMID:27053110

  8. Competition between histone and transcription factor binding regulates the onset of transcription in zebrafish embryos

    PubMed Central

    Joseph, Shai R; Pálfy, Máté; Hilbert, Lennart; Kumar, Mukesh; Karschau, Jens; Zaburdaev, Vasily; Shevchenko, Andrej; Vastenhouw, Nadine L

    2017-01-01

    Upon fertilization, the genome of animal embryos remains transcriptionally inactive until the maternal-to-zygotic transition. At this time, the embryo takes control of its development and transcription begins. How the onset of zygotic transcription is regulated remains unclear. Here, we show that a dynamic competition for DNA binding between nucleosome-forming histones and transcription factors regulates zebrafish genome activation. Taking a quantitative approach, we found that the concentration of non-DNA-bound core histones sets the time for the onset of transcription. The reduction in nuclear histone concentration that coincides with genome activation does not affect nucleosome density on DNA, but allows transcription factors to compete successfully for DNA binding. In agreement with this, transcription factor binding is sensitive to histone levels and the concentration of transcription factors also affects the time of transcription. Our results demonstrate that the relative levels of histones and transcription factors regulate the onset of transcription in the embryo. DOI: http://dx.doi.org/10.7554/eLife.23326.001 PMID:28425915

  9. Competition between histone and transcription factor binding regulates the onset of transcription in zebrafish embryos.

    PubMed

    Joseph, Shai R; Pálfy, Máté; Hilbert, Lennart; Kumar, Mukesh; Karschau, Jens; Zaburdaev, Vasily; Shevchenko, Andrej; Vastenhouw, Nadine L

    2017-04-20

    Upon fertilization, the genome of animal embryos remains transcriptionally inactive until the maternal-to-zygotic transition. At this time, the embryo takes control of its development and transcription begins. How the onset of zygotic transcription is regulated remains unclear. Here, we show that a dynamic competition for DNA binding between nucleosome-forming histones and transcription factors regulates zebrafish genome activation. Taking a quantitative approach, we found that the concentration of non-DNA-bound core histones sets the time for the onset of transcription. The reduction in nuclear histone concentration that coincides with genome activation does not affect nucleosome density on DNA, but allows transcription factors to compete successfully for DNA binding. In agreement with this, transcription factor binding is sensitive to histone levels and the concentration of transcription factors also affects the time of transcription. Our results demonstrate that the relative levels of histones and transcription factors regulate the onset of transcription in the embryo.

  10. New insight into multifunctional role of peroxiredoxin family protein: Determination of DNA protection properties of bacterioferritin comigratory protein under hyperthermal and oxidative stresses

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Sangmin, E-mail: taeinlee2011@kangwon.ac.kr; Chung, Jeong Min; Yun, Hyung Joong

    Bacterioferritin comigratory protein (BCP) is a monomeric conformer acting as a putative thiol-dependent bacterial peroxidase, however molecular basis of DNA-protection via DNA-binding has not been clearly understood. In this study, we characterized the DNA binding properties of BCP using various lengths and differently shaped architectures of DNA. An electrophoretic mobility shift assay and electron microscopy analysis showed that recombinant TkBCP bound to DNA of a circular shape (double-stranded DNA and single-stranded DNA) and a linear shape (16–1000 bp) as well as various architectures of DNA. In addition, DNA protection experiments indicated that TkBCP can protect DNA against hyperthermal and oxidative stressmore » by removing highly reactive oxygen species (ROS) or by protecting DNA from thermal degradation. Based on these results, we suggest that TkBCP is a multi-functional DNA-binding protein which has DNA chaperon and antioxidant functions. - Highlights: • Bacterioferritin comigratory protein (BCP) protects DNA from oxidative stress by reducing ROS. • TkBCP does not only scavenge ROS, but also protect DNA from hyperthermal stress. • BCP potentially adopts the multi-functional role in DNA binding activities and anti-oxidant functions.« less

  11. A Comparison of Two Single-Stranded DNA Binding Models by Mutational Analysis of APOBEC3G

    PubMed Central

    Shindo, Keisuke; Li, Ming; Gross, Phillip J.; Brown, William L.; Harjes, Elena; Lu, Yongjian; Matsuo, Hiroshi; Harris, Reuben S.

    2012-01-01

    APOBEC3G is the best known of several DNA cytosine deaminases that function to inhibit the replication of parasitic genetic elements including the lentivirus HIV. Several high-resolution structures of the APOBEC3G catalytic domain have been generated, but none reveal how this enzyme binds to substrate single-stranded DNA. Here, we constructed a panel of APOBEC3G amino acid substitution mutants and performed a series of biochemical, genetic, and structural assays to distinguish between “Brim” and “Kink” models for single-strand DNA binding. Each model predicts distinct sets of interactions between surface arginines and negatively charged phosphates in the DNA backbone. Concordant with both models, changing the conserved arginine at position 313 to glutamate abolished both catalytic and restriction activities. In support of the Brim model, arginine to glutamate substitutions at positions 213, 215, and 320 also compromised these APOBEC3G activities. Arginine to glutamate substitutions at Kink model residues 374 and 376 had smaller effects. These observations were supported by A3G catalytic domain-ssDNA chemical shift perturbation experiments. The overall data set is most consistent with the Brim model for single-stranded DNA binding by APOBEC3G. PMID:24832226

  12. USF-related transcription factor, HIV-TF1, stimulates transcription of human immunodeficiency virus-1.

    PubMed

    Maekawa, T; Sudo, T; Kurimoto, M; Ishii, S

    1991-09-11

    The transcription factor HIV-TF1, which binds to a region about 60 bp upstream from the enhancer of the human immunodeficiency virus-1 (HIV-1), was purified from human B cells. HIV-TF1 had a molecular weight of 39,000. Binding of HIV-TF1 to the HIV long terminal repeat (LTR) activated transcription from the HIV promoter in vitro. The HIV-TF1-binding site in HIV LTR was similar to the site recognized by upstream stimulatory factor (USF) in the adenovirus major late promoter. DNA-binding properties of HIV-TF1 suggested that HIV-TF1 might be identical or related to USF. Interestingly, treatment of purified HIV-TF1 by phosphatase greatly reduced its DNA-binding activity, suggesting that phosphorylation of HIV-TF1 was essential for DNA binding. The disruption of HIV-TF1-binding site induced a 60% decrease in the level of transcription from the HIV promoter in vivo. These results suggest that HIV-TF1 is involved in transcriptional regulation of HIV-1.

  13. Heterodimerization of Msx and Dlx homeoproteins results in functional antagonism.

    PubMed

    Zhang, H; Hu, G; Wang, H; Sciavolino, P; Iler, N; Shen, M M; Abate-Shen, C

    1997-05-01

    Protein-protein interactions are known to be essential for specifying the transcriptional activities of homeoproteins. Here we show that representative members of the Msx and Dlx homeoprotein families form homo- and heterodimeric complexes. We demonstrate that dimerization by Msx and Dlx proteins is mediated through their homeodomains and that the residues required for this interaction correspond to those necessary for DNA binding. Unlike most other known examples of homeoprotein interactions, association of Msx and Dlx proteins does not promote cooperative DNA binding; instead, dimerization and DNA binding are mutually exclusive activities. In particular, we show that Msx and Dlx proteins interact independently and noncooperatively with homeodomain DNA binding sites and that dimerization is specifically blocked by the presence of such DNA sites. We further demonstrate that the transcriptional properties of Msx and Dlx proteins display reciprocal inhibition. Specifically, Msx proteins act as transcriptional repressors and Dlx proteins act as activators, while in combination, Msx and Dlx proteins counteract each other's transcriptional activities. Finally, we show that the expression patterns of representative Msx and Dlx genes (Msx1, Msx2, Dlx2, and Dlx5) overlap in mouse embryogenesis during limb bud and craniofacial development, consistent with the potential for their protein products to interact in vivo. Based on these observations, we propose that functional antagonism through heterodimer formation provides a mechanism for regulating the transcriptional actions of Msx and Dlx homeoproteins in vivo.

  14. Uncoupling metallonuclease metal ion binding sites via nudge mutagenesis.

    PubMed

    Papadakos, Grigorios A; Nastri, Horacio; Riggs, Paul; Dupureur, Cynthia M

    2007-05-01

    The hydrolysis of phosphodiester bonds by nucleases is critical to nucleic acid processing. Many nucleases utilize metal ion cofactors, and for a number of these enzymes two active-site metal ions have been detected. Testing proposed mechanistic roles for individual bound metal ions has been hampered by the similarity between the sites and cooperative behavior. In the homodimeric PvuII restriction endonuclease, the metal ion dependence of DNA binding is sigmoidal and consistent with two classes of coupled metal ion binding sites. We reasoned that a conservative active-site mutation would perturb the ligand field sufficiently to observe the titration of individual metal ion binding sites without significantly disturbing enzyme function. Indeed, mutation of a Tyr residue 5.5 A from both metal ions in the enzyme-substrate crystal structure (Y94F) renders the metal ion dependence of DNA binding biphasic: two classes of metal ion binding sites become distinct in the presence of DNA. The perturbation in metal ion coordination is supported by 1H-15N heteronuclear single quantum coherence spectra of enzyme-Ca(II) and enzyme-Ca(II)-DNA complexes. Metal ion binding by free Y94F is basically unperturbed: through multiple experiments with different metal ions, the data are consistent with two alkaline earth metal ion binding sites per subunit of low millimolar affinity, behavior which is very similar to that of the wild type. The results presented here indicate a role for the hydroxyl group of Tyr94 in the coupling of metal ion binding sites in the presence of DNA. Its removal causes the affinities for the two metal ion binding sites to be resolved in the presence of substrate. Such tuning of metal ion affinities will be invaluable to efforts to ascertain the contributions of individual bound metal ions to metallonuclease function.

  15. Saccharomyces cerevisiae MSH2-MSH3 and MSH2-MSH6 complexes display distinct requirements for DNA binding Domain I in mismatch recognition.

    PubMed Central

    Lee, Susan D.; Surtees, Jennifer A.; Alani, Eric

    2007-01-01

    In eukaryotic mismatch repair (MMR) MSH2-MSH6 initiates the repair of base-base and small insertion/deletion mismatches while MSH2-MSH3 repairs larger insertion/deletion mismatches. In this study we showed that the msh2Δ1 mutation, containing a complete deletion of the conserved mismatch recognition Domain I of MSH2, conferred a separation of function phenotype with respect to MSH2-MSH3 and MSH2-MSH6 functions. Strains bearing the msh2Δ1 mutation were nearly wild-type in MSH2-MSH6-mediated MMR and in suppressing recombination between DNA sequences predicted to form mismatches recognized by MSH2-MSH6. However, these strains were completely defective in MSH2-MSH3-mediated MMR and recombination functions. This information encouraged us to analyze the contributions of Domain I to the mismatch binding specificity of MSH2-MSH3 in genetic and biochemical assays. We found that Domain I in MSH2 contributed a non-specific DNA binding activity while Domain I of MSH3 appeared important for mismatch binding specificity and for suppressing non-specific DNA-binding. These observations reveal distinct requirements for the MSH2 DNA binding Domain I in the repair of DNA mismatches and suggest that the binding of MSH2-MSH3 to mismatch DNA involves protein-DNA contacts that appear very different from those required for MSH2-MSH6 mismatch binding. PMID:17157869

  16. Saccharomyces cerevisiae MSH2-MSH3 and MSH2-MSH6 complexes display distinct requirements for DNA binding domain I in mismatch recognition.

    PubMed

    Lee, Susan D; Surtees, Jennifer A; Alani, Eric

    2007-02-09

    In eukaryotic mismatch repair (MMR) MSH2-MSH6 initiates the repair of base-base and small insertion/deletion mismatches while MSH2-MSH3 repairs larger insertion/deletion mismatches. Here, we show that the msh2Delta1 mutation, containing a complete deletion of the conserved mismatch recognition domain I of MSH2, conferred a separation of function phenotype with respect to MSH2-MSH3 and MSH2-MSH6 functions. Strains bearing the msh2Delta1 mutation were nearly wild-type in MSH2-MSH6-mediated MMR and in suppressing recombination between DNA sequences predicted to form mismatches recognized by MSH2-MSH6. However, these strains were completely defective in MSH2-MSH3-mediated MMR and recombination functions. This information encouraged us to analyze the contributions of domain I to the mismatch binding specificity of MSH2-MSH3 in genetic and biochemical assays. We found that domain I in MSH2 contributed a non-specific DNA binding activity while domain I of MSH3 appeared important for mismatch binding specificity and for suppressing non-specific DNA binding. These observations reveal distinct requirements for the MSH2 DNA binding domain I in the repair of DNA mismatches and suggest that the binding of MSH2-MSH3 to mismatch DNA involves protein-DNA contacts that appear very different from those required for MSH2-MSH6 mismatch binding.

  17. Structure, mechanics, and binding mode heterogeneity of LEDGF/p75-DNA nucleoprotein complexes revealed by scanning force microscopy

    NASA Astrophysics Data System (ADS)

    Vanderlinden, Willem; Lipfert, Jan; Demeulemeester, Jonas; Debyser, Zeger; de Feyter, Steven

    2014-04-01

    LEDGF/p75 is a transcriptional coactivator implicated in the pathogenesis of AIDS and leukemia. In these contexts, LEDGF/p75 acts as a cofactor by tethering protein cargo to transcriptionally active regions in the human genome. Our study - based on scanning force microscopy (SFM) imaging - is the first to provide structural information on the interaction of LEDGF/p75 with DNA. Two novel approaches that allow obtaining insights into the DNA conformation inside nucleoprotein complexes revealed (1) that LEDGF/p75 can bind at least in three different binding modes, (2) how DNA topology and protein dimerization affect these binding modes, and (3) geometrical and mechanical aspects of the nucleoprotein complexes. These structural and mechanical details will help us to better understand the cellular mechanisms of LEDGF/p75 as a transcriptional coactivator and as a cofactor in disease.LEDGF/p75 is a transcriptional coactivator implicated in the pathogenesis of AIDS and leukemia. In these contexts, LEDGF/p75 acts as a cofactor by tethering protein cargo to transcriptionally active regions in the human genome. Our study - based on scanning force microscopy (SFM) imaging - is the first to provide structural information on the interaction of LEDGF/p75 with DNA. Two novel approaches that allow obtaining insights into the DNA conformation inside nucleoprotein complexes revealed (1) that LEDGF/p75 can bind at least in three different binding modes, (2) how DNA topology and protein dimerization affect these binding modes, and (3) geometrical and mechanical aspects of the nucleoprotein complexes. These structural and mechanical details will help us to better understand the cellular mechanisms of LEDGF/p75 as a transcriptional coactivator and as a cofactor in disease. Electronic supplementary information (ESI) available: SFM topographs of phage lambda DNA in situ, in the absence and presence of LEDGF/p75; model-independent tests for DNA chain equilibration in 2D; SFM topographs of plasmid DNA substrates I-IV in the absence of LEDGF/p75; proof-of-principle of bend angle determination on supercoiled plasmid DNA-EcoRV binding to cognate and non-cognate sites in pBR322 plasmid DNA. See DOI: 10.1039/c4nr00022f

  18. BPF-1, a pathogen-induced DNA-binding protein involved in the plant defense response.

    PubMed

    da Costa e Silva, O; Klein, L; Schmelzer, E; Trezzini, G F; Hahlbrock, K

    1993-07-01

    The mechanisms by which plants restrict the growth of pathogens include transient activation of numerous defense-related genes. Box P is a putative cis-acting element of a distinct group of such genes, including those encoding the enzyme phenylalanine ammonialyase (PAL). A DNA-binding activity to Box P was identified in nuclear extracts from cultured parsley cells and a cDNA encoding the protein BPF-1 (Box P-binding Factor) partially characterized. BPF-1 binds to this element with specificity similar to that of the binding activity in nuclear extracts. BPF-1 mRNA accumulates rapidly in elicitor-treated parsley cells and around fungal infection sites on parsley leaves. This accumulation is, at least partly, due to a rapid and transient increase in the transcription rate of BPF-1. Moreover, tight correlation between the relative amounts of BPF-1 and PAL mRNAs was observed in different organs of a parsley plant. These results are consistent with the hypothesis that BPF-1 is involved in disease resistance by modulating plant defense gene expression.

  19. A phosphorylation-and-ubiquitylation circuitry driving ATR activation and homologous recombination

    PubMed Central

    Dubois, Jean-Christophe; Yates, Maïlyn; Gaudreau-Lapierre, Antoine; Clément, Geneviève; Cappadocia, Laurent; Gaudreau, Luc

    2017-01-01

    Abstract RPA-coated single-stranded DNA (RPA–ssDNA), a nucleoprotein structure induced by DNA damage, promotes ATR activation and homologous recombination (HR). RPA is hyper-phosphorylated and ubiquitylated after DNA damage. The ubiquitylation of RPA by PRP19 and RFWD3 facilitates ATR activation and HR, but how it is stimulated by DNA damage is still unclear. Here, we show that RFWD3 binds RPA constitutively, whereas PRP19 recognizes RPA after DNA damage. The recruitment of PRP19 by RPA depends on PIKK-mediated RPA phosphorylation and a positively charged pocket in PRP19. An RPA32 mutant lacking phosphorylation sites fails to recruit PRP19 and support RPA ubiquitylation. PRP19 mutants unable to bind RPA or lacking ubiquitin ligase activity also fail to support RPA ubiquitylation and HR. These results suggest that RPA phosphorylation enhances the recruitment of PRP19 to RPA–ssDNA and stimulates RPA ubiquitylation through a process requiring both PRP19 and RFWD3, thereby triggering a phosphorylation-ubiquitylation circuitry that promotes ATR activation and HR. PMID:28666352

  20. Xeroderma pigmentosum complementation group C protein (XPC) serves as a general sensor of damaged DNA

    PubMed Central

    Shell, Steven M.; Hawkins, Edward K.; Tsai, Miaw-Sheue; Hlaing, Aye Su; Rizzo, Carmelo J.; Chazin, Walter J.

    2013-01-01

    The xeroderma pigmentosum complementation group C protein (XPC) serves as the primary initiating factor in the global genome nucleotide excision repair pathway (GG-NER). Recent reports suggest XPC also stimulates repair of oxidative lesions by base excision repair. However, whether XPC distinguishes among various types of DNA lesions remains unclear. Although the DNA binding properties of XPC have been studied by several groups, there is a lack of consensus over whether XPC discriminates between DNA damaged by lesions associated with NER activity versus those that are not. In this study we report a high-throughput fluorescence anisotropy assay used to measure the DNA binding affinity of XPC for a panel of DNA substrates containing a range of chemical lesions in a common sequence. Our results demonstrate that while XPC displays a preference for binding damaged DNA, the identity of the lesion has little effect on the binding affinity of XPC. Moreover, XPC was equally capable of binding to DNA substrates containing lesions not repaired by GG-NER. Our results support an indirect read-out model for sensing the presence of lesions by human XPC and suggest XPC may act as a general sensor of damaged DNA capable of recognizing DNA containing lesions not repaired by NER. PMID:24051049

  1. On binding specificity of (6-4) photolyase to a T(6-4)T DNA photoproduct*

    NASA Astrophysics Data System (ADS)

    Jepsen, Katrine Aalbæk; Solov'yov, Ilia A.

    2017-06-01

    Different factors lead to DNA damage and if it is not repaired in due time, the damaged DNA could initiate mutagenesis and cancer. To avoid this deadly scenario, specific enzymes can scavenge and repair the DNA, but the enzymes have to bind first to the damaged sites. We have investigated this binding for a specific enzyme called (6-4) photolyase, which is capable of repairing certain UV-induced damage in DNA. Through molecular dynamics simulations we describe the binding between photolyase and the DNA and reveal that several charged amino acid residues in the enzyme, such as arginines and lysines turn out to be important. Especially R421 is crucial, as it keeps the DNA strands at the damaged site inside the repair pocket of the enzyme separated. DNA photolyase is structurally highly homologous to a protein called cryptochrome. Both proteins are biologically activated similarly, namely through flavin co-factor photoexcitation. It is, however, striking that cryptochrome cannot repair UV-damaged DNA. The present investigation allowed us to conclude on the small but, apparently, critical differences between photolyase and cryptochrome. The performed analysis gives insight into important factors that govern the binding of UV-damaged DNA and reveal why cryptochrome cannot have this functionality.

  2. Decreased complement mediated binding of antibody//sup 3/-dsDNA immune complexes to the red blood cells of patients with systemic lupus erythematosus, rheumatoid arthritis, and hematologic malignancies

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Taylor, R.P.; Horgan, C.; Buschbacher, R.

    1983-06-01

    The complement mediated binding of prepared antibody//sup 3/H-dsDNA immune complexes to the red blood cells obtained from a number of patient populations has been investigated. Patients with solid tumors have binding activity similar to that seen in a normal group of individuals. However, a significant fraction of patients with systemic lupus erythematosus, rheumatoid arthritis, and hematologic malignancies have lowered binding activity compared with normal subjects. Quantitative studies indicate the lowered activity probably arises due to a decrease in complement receptors on the respective red blood cells. The potential importance and implications of these findings are briefly discussed.

  3. The water soluble peripherally tetra-substituted zinc(ii), manganese(iii) and copper(ii) phthalocyanines as new potential anticancer agents.

    PubMed

    Barut, Burak; Sofuoğlu, Ayşenur; Biyiklioglu, Zekeriya; Özel, Arzu

    2016-09-28

    In this study, [2-(2-morpholin-4-ylethoxy)ethoxy] group substituted zinc(ii), manganese(iii) and copper(ii) phthalocyanines 2-4 and their water soluble derivatives 2a, 3a and 4a were synthesized and the interactions of compounds 2a, 3a and 4a with CT-DNA and supercoiled pBR322 plasmid DNA were investigated. The results of binding experiments showed that these compounds were able to interact with CT-DNA via intercalative mode with a strong binding affinity in the order 3a > 2a > 4a. DNA-photocleavage activities of compounds 2a, 3a and 4a were determined. These compounds cleaved supercoiled pBR322 plasmid DNA efficiently under irradiation at 650 nm for 2a and 4a, and at 750 nm for 3a. These compounds displayed remarkable inhibitory activities against topoisomerase I enzyme in a dose-dependent manner. All of these results suggest that these phthalocyanines might be suitable anticancer agents due to their strong binding affinities, significant cleavage activities and effective topoisomerase I inhibition.

  4. Directed evolution of the TALE N-terminal domain for recognition of all 5′ bases

    PubMed Central

    Lamb, Brian M.; Mercer, Andrew C.; Barbas, Carlos F.

    2013-01-01

    Transcription activator-like effector (TALE) proteins can be designed to bind virtually any DNA sequence. General guidelines for design of TALE DNA-binding domains suggest that the 5′-most base of the DNA sequence bound by the TALE (the N0 base) should be a thymine. We quantified the N0 requirement by analysis of the activities of TALE transcription factors (TALE-TF), TALE recombinases (TALE-R) and TALE nucleases (TALENs) with each DNA base at this position. In the absence of a 5′ T, we observed decreases in TALE activity up to >1000-fold in TALE-TF activity, up to 100-fold in TALE-R activity and up to 10-fold reduction in TALEN activity compared with target sequences containing a 5′ T. To develop TALE architectures that recognize all possible N0 bases, we used structure-guided library design coupled with TALE-R activity selections to evolve novel TALE N-terminal domains to accommodate any N0 base. A G-selective domain and broadly reactive domains were isolated and characterized. The engineered TALE domains selected in the TALE-R format demonstrated modularity and were active in TALE-TF and TALEN architectures. Evolved N-terminal domains provide effective and unconstrained TALE-based targeting of any DNA sequence as TALE binding proteins and designer enzymes. PMID:23980031

  5. Circadian clock protein KaiC forms ATP-dependent hexameric rings and binds DNA

    PubMed Central

    Mori, Tetsuya; Saveliev, Sergei V.; Xu, Yao; Stafford, Walter F.; Cox, Michael M.; Inman, Ross B.; Johnson, Carl H.

    2002-01-01

    KaiC from Synechococcus elongatus PCC 7942 (KaiC) is an essential circadian clock protein in cyanobacteria. Previous sequence analyses suggested its inclusion in the RecA/DnaB superfamily. A characteristic of the proteins of this superfamily is that they form homohexameric complexes that bind DNA. We show here that KaiC also forms ring complexes with a central pore that can be visualized by electron microscopy. A combination of analytical ultracentrifugation and chromatographic analyses demonstrates that these complexes are hexameric. The association of KaiC molecules into hexamers depends on the presence of ATP. The KaiC sequence does not include the obvious DNA-binding motifs found in RecA or DnaB. Nevertheless, KaiC binds forked DNA substrates. These data support the inclusion of KaiC into the RecA/DnaB superfamily and have important implications for enzymatic activity of KaiC in the circadian clock mechanism that regulates global changes in gene expression patterns. PMID:12477935

  6. Genetic dissection of the consensus sequence for the class 2 and class 3 flagellar promoters

    PubMed Central

    Wozniak, Christopher E.; Hughes, Kelly T.

    2008-01-01

    Summary Computational searches for DNA binding sites often utilize consensus sequences. These search models make assumptions that the frequency of a base pair in an alignment relates to the base pair’s importance in binding and presume that base pairs contribute independently to the overall interaction with the DNA binding protein. These two assumptions have generally been found to be accurate for DNA binding sites. However, these assumptions are often not satisfied for promoters, which are involved in additional steps in transcription initiation after RNA polymerase has bound to the DNA. To test these assumptions for the flagellar regulatory hierarchy, class 2 and class 3 flagellar promoters were randomly mutagenized in Salmonella. Important positions were then saturated for mutagenesis and compared to scores calculated from the consensus sequence. Double mutants were constructed to determine how mutations combined for each promoter type. Mutations in the binding site for FlhD4C2, the activator of class 2 promoters, better satisfied the assumptions for the binding model than did mutations in the class 3 promoter, which is recognized by the σ28 transcription factor. These in vivo results indicate that the activator sites within flagellar promoters can be modeled using simple assumptions but that the DNA sequences recognized by the flagellar sigma factor require more complex models. PMID:18486950

  7. The mCpG-binding domain of human MBD3 does not bind to mCpG but interacts with NuRD/Mi2 components HDAC1 and MTA2.

    PubMed

    Saito, Motoki; Ishikawa, Fuyuki

    2002-09-20

    Although mammalian MBD3 contains the mCpG-binding domain (MBD) and is highly homologous with the authentic mCpG-binding protein MBD2, it was reported that the protein does not bind to mCpG specifically. Using recombinant human wild type and mutant MBD3 proteins, we demonstrated that atypical amino acids found in MBD3 MBD, namely, His-30 and Phe-34, are responsible for the inability of MBD3 to bind to mCpG. Interestingly, although H30K/F34Y MBD3 mutant protein binds to mCpG efficiently in vitro, it was not localized at the mCpG-rich pericentromeric regions in mouse cells. We also showed that Y34F MBD2b MBD, which possesses not the mCpG-specific DNA-binding activity but the nonspecific DNA-binding activity, was localized at the pericentromeric regions. These results suggested that the mCpG-specific DNA-binding activity is largely dispensable, and another factor(s) is required for the localization of MBD proteins in vivo. MBD3 was identified as a component of the NuRD/Mi2 complex that shows chromatin remodeling and histone deacetylase activities. We demonstrated that MBD3 MBD is necessary and sufficient for binding to HDAC1 and MTA2, two components of the NuRD/Mi2 complex. It was therefore suggested that mCpG-binding-defective MBD3 has evolutionarily conserved its MBD because of the secondary role played by the MBD in protein-protein interactions.

  8. DNA wrapping and distortion by an oligomeric homeodomain protein.

    PubMed

    Williams, Hannah; Jayaraman, Padma-Sheela; Gaston, Kevin

    2008-10-31

    Many transcription factors alter DNA or chromatin structure. Changes in chromatin structure are often brought about by the recruitment of chromatin-binding proteins, chromatin-modifying proteins, or other transcription co-activator or co-repressor proteins. However, some transcription factors form oligomeric assemblies that may themselves induce changes in DNA conformation and chromatin structure. The proline-rich homeodomain (PRH/Hex) protein is a transcription factor that regulates cell differentiation and cell proliferation, and has multiple roles in embryonic development. Earlier, we showed that PRH can repress transcription by multiple mechanisms, including the recruitment of co-repressor proteins belonging to the TLE family of chromatin-binding proteins. Our in vivo crosslinking studies have shown that PRH forms oligomeric complexes in cells and a variety of biophysical techniques suggest that the protein forms octamers. However, as yet we have little knowledge of the role played by PRH oligomerisation in the regulation of promoter activity or of the architecture of promoters that are regulated directly by PRH in cells. Here, we compare the binding of PRH and the isolated PRH homeodomain to DNA fragments with single and multiple PRH sites, using gel retardation assays and DNase I and chemical footprinting. We show that the PRH oligomer binds to multiple sites within the human Goosecoid promoter with high affinity and that the binding of PRH brings about DNA distortion. We suggest that PRH octamers wrap DNA in order to bring about transcriptional repression.

  9. A Novel RNA Polymerase I Transcription Initiation Factor, TIF-IE, Commits rRNA Genes by Interaction with TIF-IB, Not by DNA Binding

    PubMed Central

    Al-Khouri, Anna Maria; Paule, Marvin R.

    2002-01-01

    In the small, free-living amoeba Acanthamoeba castellanii, rRNA transcription requires, in addition to RNA polymerase I, a single DNA-binding factor, transcription initiation factor IB (TIF-IB). TIF-IB is a multimeric protein that contains TATA-binding protein (TBP) and four TBP-associated factors that are specific for polymerase I transcription. TIF-IB is required for accurate and promoter-specific initiation of rRNA transcription, recruiting and positioning the polymerase on the start site by protein-protein interaction. In A. castellanii, partially purified TIF-IB can form a persistent complex with the ribosomal DNA (rDNA) promoter while homogeneous TIF-IB cannot. An additional factor, TIF-IE, is required along with homogeneous TIF-IB for the formation of a stable complex on the rDNA core promoter. We show that TIF-IE by itself, however, does not bind to the rDNA promoter and thus differs in its mechanism from the upstream binding factor and upstream activating factor, which carry out similar complex-stabilizing functions in vertebrates and yeast, respectively. In addition to its presence in impure TIF-IB, TIF-IE is found in highly purified fractions of polymerase I, with which it associates. Renaturation of polypeptides excised from sodium dodecyl sulfate-polyacrylamide gels showed that a 141-kDa polypeptide possesses all the known activities of TIF-IE. PMID:11784852

  10. A novel RNA polymerase I transcription initiation factor, TIF-IE, commits rRNA genes by interaction with TIF-IB, not by DNA binding.

    PubMed

    Al-Khouri, Anna Maria; Paule, Marvin R

    2002-02-01

    In the small, free-living amoeba Acanthamoeba castellanii, rRNA transcription requires, in addition to RNA polymerase I, a single DNA-binding factor, transcription initiation factor IB (TIF-IB). TIF-IB is a multimeric protein that contains TATA-binding protein (TBP) and four TBP-associated factors that are specific for polymerase I transcription. TIF-IB is required for accurate and promoter-specific initiation of rRNA transcription, recruiting and positioning the polymerase on the start site by protein-protein interaction. In A. castellanii, partially purified TIF-IB can form a persistent complex with the ribosomal DNA (rDNA) promoter while homogeneous TIF-IB cannot. An additional factor, TIF-IE, is required along with homogeneous TIF-IB for the formation of a stable complex on the rDNA core promoter. We show that TIF-IE by itself, however, does not bind to the rDNA promoter and thus differs in its mechanism from the upstream binding factor and upstream activating factor, which carry out similar complex-stabilizing functions in vertebrates and yeast, respectively. In addition to its presence in impure TIF-IB, TIF-IE is found in highly purified fractions of polymerase I, with which it associates. Renaturation of polypeptides excised from sodium dodecyl sulfate-polyacrylamide gels showed that a 141-kDa polypeptide possesses all the known activities of TIF-IE.

  11. Information analysis of sequences that bind the replication initiator RepA | Center for Cancer Research

    Cancer.gov

    The tall letters represent the highly conserved bases in DNA binding sites of several prokaryotic repressors and activators. Conservation is strongest where major grooves of the double helical DNA (represented by crests of a cosine wave) face the protein. This shows that conservation analysis alone can be used to predict the face of DNA that contacts the proteins.

  12. Regulation of transcriptional activators by DNA-binding domain ubiquitination

    PubMed Central

    Landré, Vivien; Revi, Bhindu; Mir, Maria Gil; Verma, Chandra; Hupp, Ted R; Gilbert, Nick; Ball, Kathryn L

    2017-01-01

    Ubiquitin is a key component of the regulatory network that maintains gene expression in eukaryotes, yet the molecular mechanism(s) by which non-degradative ubiquitination modulates transcriptional activator (TA) function is unknown. Here endogenous p53, a stress-activated transcription factor required to maintain health, is stably monoubiquitinated, following pathway activation by IR or Nutlin-3 and localized to the nucleus where it becomes tightly associated with chromatin. Comparative structure–function analysis and in silico modelling demonstrate a direct role for DNA-binding domain (DBD) monoubiquitination in TA activation. When attached to the DBD of either p53, or a second TA IRF-1, ubiquitin is orientated towards, and makes contact with, the DNA. The contact is made between a predominantly cationic surface on ubiquitin and the anionic DNA. Our data demonstrate an unexpected role for ubiquitin in the mechanism of TA-activity enhancement and provides insight into a new level of transcriptional regulation. PMID:28362432

  13. Fanconi Anemia Complementation Group A (FANCA) Protein Has Intrinsic Affinity for Nucleic Acids with Preference for Single-stranded Forms*

    PubMed Central

    Yuan, Fenghua; Qian, Liangyue; Zhao, Xinliang; Liu, Jesse Y.; Song, Limin; D'Urso, Gennaro; Jain, Chaitanya; Zhang, Yanbin

    2012-01-01

    The Fanconi anemia complementation group A (FANCA) gene is one of 15 disease-causing genes and has been found to be mutated in ∼60% of Fanconi anemia patients. Using purified protein, we report that human FANCA has intrinsic affinity for nucleic acids. FANCA binds to both single-stranded (ssDNA) and double-stranded (dsDNA) DNAs; however, its affinity for ssDNA is significantly higher than for dsDNA in an electrophoretic mobility shift assay. FANCA also binds to RNA with an intriguingly higher affinity than its DNA counterpart. FANCA requires a certain length of nucleic acids for optimal binding. Using DNA and RNA ladders, we determined that the minimum number of nucleotides required for FANCA recognition is ∼30 for both DNA and RNA. By testing the affinity between FANCA and a variety of DNA structures, we found that a 5′-flap or 5′-tail on DNA facilitates its interaction with FANCA. A patient-derived FANCA truncation mutant (Q772X) has diminished affinity for both DNA and RNA. In contrast, the complementing C-terminal fragment of Q772X, C772–1455, retains the differentiated nucleic acid-binding activity (RNA > ssDNA > dsDNA), indicating that the nucleic acid-binding domain of FANCA is located primarily at its C terminus, where most disease-causing mutations are found. PMID:22194614

  14. Fanconi anemia complementation group A (FANCA) protein has intrinsic affinity for nucleic acids with preference for single-stranded forms.

    PubMed

    Yuan, Fenghua; Qian, Liangyue; Zhao, Xinliang; Liu, Jesse Y; Song, Limin; D'Urso, Gennaro; Jain, Chaitanya; Zhang, Yanbin

    2012-02-10

    The Fanconi anemia complementation group A (FANCA) gene is one of 15 disease-causing genes and has been found to be mutated in ∼60% of Fanconi anemia patients. Using purified protein, we report that human FANCA has intrinsic affinity for nucleic acids. FANCA binds to both single-stranded (ssDNA) and double-stranded (dsDNA) DNAs; however, its affinity for ssDNA is significantly higher than for dsDNA in an electrophoretic mobility shift assay. FANCA also binds to RNA with an intriguingly higher affinity than its DNA counterpart. FANCA requires a certain length of nucleic acids for optimal binding. Using DNA and RNA ladders, we determined that the minimum number of nucleotides required for FANCA recognition is ∼30 for both DNA and RNA. By testing the affinity between FANCA and a variety of DNA structures, we found that a 5'-flap or 5'-tail on DNA facilitates its interaction with FANCA. A patient-derived FANCA truncation mutant (Q772X) has diminished affinity for both DNA and RNA. In contrast, the complementing C-terminal fragment of Q772X, C772-1455, retains the differentiated nucleic acid-binding activity (RNA > ssDNA > dsDNA), indicating that the nucleic acid-binding domain of FANCA is located primarily at its C terminus, where most disease-causing mutations are found.

  15. Specialized nucleoprotein structures at the origin of replication of bacteriophage lambda: localized unwinding of duplex DNA by a six-protein reaction.

    PubMed Central

    Dodson, M; Echols, H; Wickner, S; Alfano, C; Mensa-Wilmot, K; Gomes, B; LeBowitz, J; Roberts, J D; McMacken, R

    1986-01-01

    The O protein of bacteriophage lambda localizes the initiation of DNA replication to a unique site on the lambda genome, ori lambda. By means of electron microscopy, we infer that the binding of O to ori lambda initiates a series of protein addition and transfer reactions that culminate in localized unwinding of the origin DNA, generating a prepriming structure for the initiation of DNA replication. We can define three stages of this prepriming reaction, the first two of which we have characterized previously. First, dimeric O protein binds to multiple DNA binding sites and self-associates to form a nucleoprotein structure, the O-some. Second, lambda P and host DnaB proteins interact with the O-some to generate a larger complex that includes additional DNA from an A + T-rich region adjacent to the O binding sites. Third, the addition of the DnaJ, DnaK, and Ssb proteins and ATP results in an origin-specific unwinding reaction, probably catalyzed by the helicase activity of DnaB. The unwinding reaction is unidirectional, proceeding "rightward" from the origin. The minimal DNA sequence competent for unwinding consists of two O binding sites and the adjacent A + T-rich region to the right of the binding sites. We conclude that the lambda O protein localizes and initiates a six-protein sequential reaction responsible for but preceding the precise initiation of DNA replication. Specialized nucleoprotein structures similar to the O-some may be a general feature of DNA transactions requiring extraordinary precision in localization and control. Images PMID:3020552

  16. Triplex DNA-binding proteins are associated with clinical outcomes revealed by proteomic measurements in patients with colorectal cancer

    PubMed Central

    2012-01-01

    Background Tri- and tetra-nucleotide repeats in mammalian genomes can induce formation of alternative non-B DNA structures such as triplexes and guanine (G)-quadruplexes. These structures can induce mutagenesis, chromosomal translocations and genomic instability. We wanted to determine if proteins that bind triplex DNA structures are quantitatively or qualitatively different between colorectal tumor and adjacent normal tissue and if this binding activity correlates with patient clinical characteristics. Methods Extracts from 63 human colorectal tumor and adjacent normal tissues were examined by gel shifts (EMSA) for triplex DNA-binding proteins, which were correlated with clinicopathological tumor characteristics using the Mann-Whitney U, Spearman’s rho, Kaplan-Meier and Mantel-Cox log-rank tests. Biotinylated triplex DNA and streptavidin agarose affinity binding were used to purify triplex-binding proteins in RKO cells. Western blotting and reverse-phase protein array were used to measure protein expression in tissue extracts. Results Increased triplex DNA-binding activity in tumor extracts correlated significantly with lymphatic disease, metastasis, and reduced overall survival. We identified three multifunctional splicing factors with biotinylated triplex DNA affinity: U2AF65 in cytoplasmic extracts, and PSF and p54nrb in nuclear extracts. Super-shift EMSA with anti-U2AF65 antibodies produced a shifted band of the major EMSA H3 complex, identifying U2AF65 as the protein present in the major EMSA band. U2AF65 expression correlated significantly with EMSA H3 values in all extracts and was higher in extracts from Stage III/IV vs. Stage I/II colon tumors (p = 0.024). EMSA H3 values and U2AF65 expression also correlated significantly with GSK3 beta, beta-catenin, and NF- B p65 expression, whereas p54nrb and PSF expression correlated with c-Myc, cyclin D1, and CDK4. EMSA values and expression of all three splicing factors correlated with ErbB1, mTOR, PTEN, and Stat5. Western blots confirmed that full-length and truncated beta-catenin expression correlated with U2AF65 expression in tumor extracts. Conclusions Increased triplex DNA-binding activity in vitro correlates with lymph node disease, metastasis, and reduced overall survival in colorectal cancer, and increased U2AF65 expression is associated with total and truncated beta-catenin expression in high-stage colorectal tumors. PMID:22682314

  17. Structural and Functional Analysis of DDX41: a bispecific immune receptor for DNA and cyclic dinucleotide

    PubMed Central

    Omura, Hiroki; Oikawa, Daisuke; Nakane, Takanori; Kato, Megumi; Ishii, Ryohei; Ishitani, Ryuichiro; Tokunaga, Fuminori; Nureki, Osamu

    2016-01-01

    In the innate immune system, pattern recognition receptors (PRRs) specifically recognize ligands derived from bacteria or viruses, to trigger the responsible downstream pathways. DEAD box protein 41 (DDX41) is an intracellular PRR that triggers the downstream pathway involving the adapter STING, the kinase TBK1, and the transcription factor IRF3, to activate the type I interferon response. DDX41 is unique in that it recognizes two different ligands; i.e., double-stranded DNA (dsDNA) and cyclic dinucleotides (CDN), via its DEAD domain. However, the structural basis for the ligand recognition by the DDX41 DEAD domain has remained elusive. Here, we report two crystal structures of the DDX41 DEAD domain in apo forms, at 1.5 and 2.2 Å resolutions. A comparison of the two crystal structures revealed the flexibility in the ATP binding site, suggesting its formation upon ATP binding. Structure-guided functional analyses in vitro and in vivo demonstrated the overlapped binding surface for dsDNA and CDN, which is distinct from the ATP-binding site. We propose that the structural rearrangement of the ATP binding site is crucial for the release of ADP, enabling the fast turnover of DDX41 for the dsDNA/CDN-induced STING activation pathway. PMID:27721487

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    B Akabayov; C Richardson

    Divalent metal ions are crucial as cofactors for a variety of intracellular enzymatic activities. Mg{sup 2+}, as an example, mediates binding of deoxyribonucleoside 5'-triphosphates followed by their hydrolysis in the active site of DNA polymerase. It is difficult to study the binding of Mg{sup 2+} to an active site because Mg{sup 2+} is spectroscopically silent and Mg{sup 2+} binds with low affinity to the active site of an enzyme. Therefore, we substituted Mg{sup 2+} with Mn{sup 2+}:Mn{sup 2+} that is not only visible spectroscopically but also provides full activity of the DNA polymerase of bacteriophage T7. In order to demonstratemore » that the majority of Mn{sup 2+} is bound to the enzyme, we have applied site-directed titration analysis of T7 DNA polymerase using X-ray near edge spectroscopy. Here we show how X-ray near edge spectroscopy can be used to distinguish between signal originating from Mn{sup 2+} that is free in solution and Mn{sup 2+} bound to the active site of T7 DNA polymerase. This method can be applied to other enzymes that use divalent metal ions as a cofactor.« less

  19. Role of conserved cysteine residues in Herbaspirillum seropedicae NifA activity.

    PubMed

    Oliveira, Marco A S; Baura, Valter A; Aquino, Bruno; Huergo, Luciano F; Kadowaki, Marco A S; Chubatsu, Leda S; Souza, Emanuel M; Dixon, Ray; Pedrosa, Fábio O; Wassem, Roseli; Monteiro, Rose A

    2009-01-01

    Herbaspirillum seropedicae is an endophytic diazotrophic bacterium that associates with economically important crops. NifA protein, the transcriptional activator of nif genes in H. seropedicae, binds to nif promoters and, together with RNA polymerase-sigma(54) holoenzyme, catalyzes the formation of open complexes to allow transcription initiation. The activity of H. seropedicae NifA is controlled by ammonium and oxygen levels, but the mechanisms of such control are unknown. Oxygen sensitivity is attributed to a conserved motif of cysteine residues in NifA that spans the central AAA+ domain and the interdomain linker that connects the AAA+ domain to the C-terminal DNA binding domain. Here we mutagenized this conserved motif of cysteines and assayed the activity of mutant proteins in vivo. We also purified the mutant variants of NifA and tested their capacity to bind to the nifB promoter region. Chimeric proteins between H. seropedicae NifA, an oxygen-sensitive protein, and Azotobacter vinelandii NifA, an oxygen-tolerant protein, were constructed and showed that the oxygen response is conferred by the central AAA+ and C-terminal DNA binding domains of H. seropedicae NifA. We conclude that the conserved cysteine motif is essential for NifA activity, although single cysteine-to-serine mutants are still competent at binding DNA.

  20. Expression, purification, and DNA-binding activity of the Herbaspirillum seropedicae RecX protein.

    PubMed

    Galvão, Carolina W; Pedrosa, Fábio O; Souza, Emanuel M; Yates, M Geoffrey; Chubatsu, Leda S; Steffens, Maria Berenice R

    2004-06-01

    The Herbaspirillum seropedicae RecX protein participates in the SOS response: a process in which the RecA protein plays a central role. The RecX protein of the H. seropedicae, fused to a His-tag sequence (RecX His-tagged), was over-expressed in Escherichia coli and purified by metal-affinity chromatography to yield a highly purified and active protein. DNA band-shift assays showed that the RecX His-tagged protein bound to both circular and linear double-stranded DNA and also to circular single-stranded DNA. The apparent affinity of RecX for DNA decreased in the presence of Mg(2+) ions. The ability of RecX to bind DNA may be relevant to its function in the SOS response.

  1. Fungal mediator tail subunits contain classical transcriptional activation domains.

    PubMed

    Liu, Zhongle; Myers, Lawrence C

    2015-04-01

    Classical activation domains within DNA-bound eukaryotic transcription factors make weak interactions with coactivator complexes, such as Mediator, to stimulate transcription. How these interactions stimulate transcription, however, is unknown. The activation of reporter genes by artificial fusion of Mediator subunits to DNA binding domains that bind to their promoters has been cited as evidence that the primary role of activators is simply to recruit Mediator. We have identified potent classical transcriptional activation domains in the C termini of several tail module subunits of Saccharomyces cerevisiae, Candida albicans, and Candida dubliniensis Mediator, while their N-terminal domains are necessary and sufficient for their incorporation into Mediator but do not possess the ability to activate transcription when fused to a DNA binding domain. This suggests that Mediator fusion proteins actually are functioning in a manner similar to that of a classical DNA-bound activator rather than just recruiting Mediator. Our finding that deletion of the activation domains of S. cerevisiae Med2 and Med3, as well as C. dubliniensis Tlo1 (a Med2 ortholog), impairs the induction of certain genes shows these domains function at native promoters. Activation domains within coactivators are likely an important feature of these complexes and one that may have been uniquely leveraged by a common fungal pathogen. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  2. Inhibition mechanisms of hemoglobin, immunoglobulin G, and whole blood in digital and real-time PCR.

    PubMed

    Sidstedt, Maja; Hedman, Johannes; Romsos, Erica L; Waitara, Leticia; Wadsö, Lars; Steffen, Carolyn R; Vallone, Peter M; Rådström, Peter

    2018-04-01

    Blood samples are widely used for PCR-based DNA analysis in fields such as diagnosis of infectious diseases, cancer diagnostics, and forensic genetics. In this study, the mechanisms behind blood-induced PCR inhibition were evaluated by use of whole blood as well as known PCR-inhibitory molecules in both digital PCR and real-time PCR. Also, electrophoretic mobility shift assay was applied to investigate interactions between inhibitory proteins and DNA, and isothermal titration calorimetry was used to directly measure effects on DNA polymerase activity. Whole blood caused a decrease in the number of positive digital PCR reactions, lowered amplification efficiency, and caused severe quenching of the fluorescence of the passive reference dye 6-carboxy-X-rhodamine as well as the double-stranded DNA binding dye EvaGreen. Immunoglobulin G was found to bind to single-stranded genomic DNA, leading to increased quantification cycle values. Hemoglobin affected the DNA polymerase activity and thus lowered the amplification efficiency. Hemoglobin and hematin were shown to be the molecules in blood responsible for the fluorescence quenching. In conclusion, hemoglobin and immunoglobulin G are the two major PCR inhibitors in blood, where the first affects amplification through a direct effect on the DNA polymerase activity and quenches the fluorescence of free dye molecules, and the latter binds to single-stranded genomic DNA, hindering DNA polymerization in the first few PCR cycles. Graphical abstract PCR inhibition mechanisms of hemoglobin and immunoglobulin G (IgG). Cq quantification cycle, dsDNA double-stranded DNA, ssDNA single-stranded DNA.

  3. The basic leucine zipper domain of c-Jun functions in transcriptional activation through interaction with the N terminus of human TATA-binding protein-associated factor-1 (human TAF(II)250).

    PubMed

    Lively, Tricia N; Nguyen, Tuan N; Galasinski, Shelly K; Goodrich, James A

    2004-06-18

    We previously reported that c-Jun binds directly to the N-terminal 163 amino acids of Homo sapiens TATA-binding protein-associated factor-1 (hsTAF1), causing a derepression of transcription factor IID (TFIID)-driven transcription (Lively, T. N., Ferguson, H. A., Galasinski, S. K., Seto, A. G., and Goodrich, J. A. (2001) J. Biol. Chem. 276, 25582-25588). This region of hsTAF1 binds TATA-binding protein to repress TFIID DNA binding and transcription. Here we show that the basic leucine zipper domain of c-Jun, which allows for DNA binding and homodimerization, is necessary and sufficient for interaction with hsTAF1. Interestingly, the isolated basic leucine zipper domain of c-Jun was able to derepress TFIID-directed basal transcription in vitro. Moreover, when the N-terminal region of hsTAF1 was added to in vitro transcription reactions and overexpressed in cells, it blocked c-Jun activation. c-Fos, another basic leucine zipper protein, did not interact with hsTAF1, but c-Fos/c-Jun heterodimers did bind the N terminus of hsTAF1. Our studies show that, in addition to dimerization and DNA binding, the well characterized basic leucine zipper domain of c-Jun functions in transcriptional activation by binding to the N terminus of hsTAF1 to derepress transcription.

  4. DNA-modified electrodes fabricated using copper-free click chemistry for enhanced protein detection.

    PubMed

    Furst, Ariel L; Hill, Michael G; Barton, Jacqueline K

    2013-12-31

    A method of DNA monolayer formation has been developed using copper-free click chemistry that yields enhanced surface homogeneity and enables variation in the amount of DNA assembled; extremely low-density DNA monolayers, with as little as 5% of the monolayer being DNA, have been formed. These DNA-modified electrodes (DMEs) were characterized visually, with AFM, and electrochemically, and were found to facilitate DNA-mediated reduction of a distally bound redox probe. These low-density monolayers were found to be more homogeneous than traditional thiol-modified DNA monolayers, with greater helix accessibility through an increased surface area-to-volume ratio. Protein binding efficiency of the transcriptional activator TATA-binding protein (TBP) was also investigated on these surfaces and compared to that on DNA monolayers formed with standard thiol-modified DNA. Our low-density monolayers were found to be extremely sensitive to TBP binding, with a signal decrease in excess of 75% for 150 nM protein. This protein was detectable at 4 nM, on the order of its dissociation constant, with our low-density monolayers. The improved DNA helix accessibility and sensitivity of our low-density DNA monolayers to TBP binding reflects the general utility of this method of DNA monolayer formation for DNA-based electrochemical sensor development.

  5. Mitochondrial telomerase reverse transcriptase binds to and protects mitochondrial DNA and function from damage.

    PubMed

    Haendeler, Judith; Dröse, Stefan; Büchner, Nicole; Jakob, Sascha; Altschmied, Joachim; Goy, Christine; Spyridopoulos, Ioakim; Zeiher, Andreas M; Brandt, Ulrich; Dimmeler, Stefanie

    2009-06-01

    The enzyme telomerase and its catalytic subunit the telomerase reverse transcriptase (TERT) are important for maintenance of telomere length in the nucleus. Recent studies provided evidence for a mitochondrial localization of TERT. Therefore, we investigated the exact localization of TERT within the mitochondria and its function. Here, we demonstrate that TERT is localized in the matrix of the mitochondria. TERT binds to mitochondrial DNA at the coding regions for ND1 and ND2. Binding of TERT to mitochondrial DNA protects against ethidium bromide-induced damage. TERT increases overall respiratory chain activity, which is most pronounced at complex I and dependent on the reverse transcriptase activity of the enzyme. Moreover, mitochondrial reactive oxygen species are increased after genetic ablation of TERT by shRNA. Mitochondrially targeted TERT and not wild-type TERT revealed the most prominent protective effect on H(2)O(2)-induced apoptosis. Lung fibroblasts from 6-month-old TERT(-/-) mice (F2 generation) showed increased sensitivity toward UVB radiation and heart mitochondria exhibited significantly reduced respiratory chain activity already under basal conditions, demonstrating the protective function of TERT in vivo. Mitochondrial TERT exerts a novel protective function by binding to mitochondrial DNA, increasing respiratory chain activity and protecting against oxidative stress-induced damage.

  6. A high-resolution structure of the DNA-binding domain of AhrC, the arginine repressor/activator protein from Bacillus subtilis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Garnett, James A.; Baumberg, Simon; Stockley, Peter G.

    2007-11-01

    The structure of the winged helix–turn–helix DNA-binding domain of AhrC has been determined at 1.0 Å resolution. The largely hydrophobic β-wing shows high B factors and may mediate the dimer interface in operator complexes. In Bacillus subtilis the concentration of l-arginine is controlled by the transcriptional regulator AhrC, which interacts with 18 bp DNA operator sites called ARG boxes in the promoters of arginine biosynthetic and catabolic operons. AhrC is a 100 kDa homohexamer, with each subunit having two domains. The C-terminal domains form the core, mediating intersubunit interactions and binding of the co-repressor l-arginine, whilst the N-terminal domains containmore » a winged helix–turn–helix DNA-binding motif and are arranged around the periphery. The N-terminal domain of AhrC has been expressed, purified and characterized and it has been shown that the fragment still binds DNA operators as a recombinant monomer. The DNA-binding domain has also been crystallized and the crystal structure refined to 1.0 Å resolution is presented.« less

  7. Synthesis, characterization and DNA-binding studies of mono and heterobimetallic complexes Cu sbnd Sn 2/Zn sbnd Sn 2 and their DNA cleavage activity

    NASA Astrophysics Data System (ADS)

    Arjmand, Farukh; Sayeed, Fatima

    2010-02-01

    Heterobimetallic complexes C 6H 24N 4O 6CuSn 2Cl 63, C 6H 24N 4O 6ZnSn 2Cl 64 have been synthesized from their monometallic analogs C 6H 16N 4O 2CuCl 21, C 6H 16N 4O 2ZnCl 22, and were characterized by various spectroscopic and analytical methods. The complexes 1-4 reveal an octahedral geometry for both central metal ions Cu/Zn as well as for Sn metal ion. The interaction of complexes 1-4 with CT-DNA, were investigated by using absorption, emission, cyclic voltammetry, viscometry and DNA cleavage studies. The emission quenching of 3 and 4 by [Fe(CN) 6] 4- depressed greatly when bound to CT-DNA. The results of spectroscopic, viscometric and cyclic voltammetry of complexes 3 and 4 revealed electrostatic mode of binding of the complexes with CT-DNA. These results revealed that 4 bind more avidly in comparison to 3 with CT-DNA. Gel electrophoresis of DNA with complexes 3 and 4 demonstrated that the complexes exhibit excellent cleavage activity under physiological conditions.

  8. N-acyl homoserine lactone binding to the CarR receptor determines quorum-sensing specificity in Erwinia.

    PubMed

    Welch, M; Todd, D E; Whitehead, N A; McGowan, S J; Bycroft, B W; Salmond, G P

    2000-02-15

    Quorum sensing via an N-acyl homoserine lactone (HSL) pheromone controls the biosynthesis of a carbapenem antibiotic in Erwinia carotovora. Transcription of the carbapenem biosynthetic genes is dependent on the LuxR-type activator protein, CarR. Equilibrium binding of a range of HSL molecules, which are thought to activate CarR to bind to its DNA target sequence, was examined using fluorescence quenching, DNA bandshift analysis, limited proteolysis and reporter gene assays. CarR bound the most physiologically relevant ligand, N-(3-oxohexanoyl)-L-homoserine lactone, with a stoichiometry of two molecules of ligand per dimer of protein and a dissociation constant of 1.8 microM, in good agreement with the concentration of HSL required to activate carbapenem production in vivo. In the presence of HSL, CarR formed a very high molecular weight complex with its target DNA, indicating that the ligand causes the protein to multimerize. Chemical cross-linking analysis supported this interpretation. Our data show that the ability of a given HSL to facilitate CarR binding to its target DNA sequence is directly proportional to the affinity of the HSL for the protein.

  9. Structures of BmrR-Drug Complexes Reveal a Rigid Multidrug Binding Pocket And Transcription Activation Through Tyrosine Expulsion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Newberry, K.J.; Huffman, J.L.; Miller, M.C.

    2009-05-22

    BmrR is a member of the MerR family and a multidrug binding transcription factor that up-regulates the expression of the bmr multidrug efflux transporter gene in response to myriad lipophilic cationic compounds. The structural mechanism by which BmrR binds these chemically and structurally different drugs and subsequently activates transcription is poorly understood. Here, we describe the crystal structures of BmrR bound to rhodamine 6G (R6G) or berberine (Ber) and cognate DNA. These structures reveal each drug stacks against multiple aromatic residues with their positive charges most proximal to the carboxylate group of Glu-253 and that, unlike other multidrug binding pockets,more » that of BmrR is rigid. Substitution of Glu-253 with either alanine (E253A) or glutamine (E253Q) results in unpredictable binding affinities for R6G, Ber, and tetraphenylphosphonium. Moreover, these drug binding studies reveal that the negative charge of Glu-253 is not important for high affinity binding to Ber and tetraphenylphosphonium but plays a more significant, but unpredictable, role in R6G binding. In vitro transcription data show that E253A and E253Q are constitutively active, and structures of the drug-free E253A-DNA and E253Q-DNA complexes support a transcription activation mechanism requiring the expulsion of Tyr-152 from the multidrug binding pocket. In sum, these data delineate the mechanism by which BmrR binds lipophilic, monovalent cationic compounds and suggest the importance of the redundant negative electrostatic nature of this rigid drug binding pocket that can be used to discriminate against molecules that are not substrates of the Bmr multidrug efflux pump.« less

  10. Inhibition of HMGA2 binding to DNA by netropsin

    PubMed Central

    Miao, Yi; Cui, Tengjiao; Leng, Fenfei; Wilson, W. David

    2008-01-01

    The design of small synthetic molecules that can be used to affect gene expression is an area of active interest for development of agents in therapeutic and biotechnology applications. Many compounds that target the minor groove in AT sequences in DNA are well characterized and are promising reagents for use as modulators of protein-DNA complexes. The mammalian high mobility group transcriptional factor, HMGA2, also targets the DNA minor groove and plays critical roles in disease processes from cancer to obesity. Biosensor-surface plasmon resonance methods were used to monitor HMGA2 binding to target sites on immobilized DNA and a competition assay for inhibition of the HMGA2-DNA complex was designed. HMGA2 binds strongly to the DNA through AT hook domains with KD values of 20 - 30 nM depending on the DNA sequence. The well-characterized minor groove binder, netropsin, was used to develop and test the assay. The compound has two binding sites in the protein-DNA interaction sequence and this provides an advantage for inhibition. An equation for analysis of results when the inhibitor has two binding sites in the biopolymer recognition surface is presented with the results. The assay provides a platform for discovery of HMGA2 inhibitors. PMID:18023407

  11. Synthesis, DNA binding, topoisomerase inhibition and cytotoxic properties of 2-chloroethylnitrosourea derivatives of hoechst 33258.

    PubMed

    Bielawski, Krzysztof; Bielawska, Anna; Anchim, Tomasz; Wołczyński, Sławomir

    2005-06-01

    A number of novel 2-chloroethylnitrosourea derivatives of Hoechst 33258 were synthesized and examined for cytotoxicity in breast cancer cell cultures and for inhibition of topoisomerases I and II. Evaluation of the cytotoxicity of these compounds employing a MTT assay and inhibition of [3H]thymidine incorporation into DNA in both MDA-MB-231 and MCF-7 breast cancer cells demonstrated that these compounds were more active than Hoechst 33258. The DNA-binding ability of these compounds was evaluated by an ultrafiltration method using calf thymus DNA, poly(dA-dT)2 and poly(dG-dC)2, indicated that these compounds as well as Hoechst 33258 well interact with AT base pair compared with GC pair. Binding studies indicate that these compounds bind more tightly to double-stranded DNA than the parent compound Hoechst 33258. The degree to which these compounds inhibited cell growth breast cancer cells was generally consistent with their relative DNA binding affinity. Mechanistic studies revealed that these compounds act as topoisomerase I (topo I) or topoisomerase II (topo II) inhibitors in plasmid relaxation assays.

  12. Strand displacement by DNA polymerase III occurs through a tau-psi-chi link to single-stranded DNA-binding protein coating the lagging strand template.

    PubMed

    Yuan, Quan; McHenry, Charles S

    2009-11-13

    In addition to the well characterized processive replication reaction catalyzed by the DNA polymerase III holoenzyme on single-stranded DNA templates, the enzyme possesses an intrinsic strand displacement activity on flapped templates. The strand displacement activity is distinguished from the single-stranded DNA-templated reaction by a high dependence upon single-stranded DNA binding protein and an inability of gamma-complex to support the reaction in the absence of tau. However, if gamma-complex is present to load beta(2), a truncated tau protein containing only domains III-V will suffice. This truncated protein is sufficient to bind both the alpha subunit of DNA polymerase (Pol) III and chipsi. This is reminiscent of the minimal requirements for Pol III to replicate short single-stranded DNA-binding protein (SSB)-coated templates where tau is only required to serve as a scaffold to hold Pol III and chi in the same complex (Glover, B., and McHenry, C. (1998) J. Biol. Chem. 273, 23476-23484). We propose a model in which strand displacement by DNA polymerase III holoenzyme depends upon a Pol III-tau-psi-chi-SSB binding network, where SSB is bound to the displaced strand, stabilizing the Pol III-template interaction. The same interaction network is probably important for stabilizing the leading strand polymerase interactions with authentic replication forks. The specificity constant (k(cat)/K(m)) for the strand displacement reaction is approximately 300-fold less favorable than reactions on single-stranded templates and proceeds with a slower rate (150 nucleotides/s) and only moderate processivity (approximately 300 nucleotides). PriA, the initiator of replication restart on collapsed or misassembled replication forks, blocks the strand displacement reaction, even if added to an ongoing reaction.

  13. Prospects of nanoparticle-DNA binding and its implications in medical biotechnology.

    PubMed

    An, Hongjie; Jin, Bo

    2012-01-01

    Bio-nanotechnology is a new interdisciplinary R&D area that integrates engineering and physical science with biology through the development of multifunctional devices and systems, focusing biology inspired processes or their applications, in particular in medical biotechnology. DNA based nanotechnology, in many ways, has been one of the most intensively studied fields in recent years that involves the use and the creation of bio-inspired materials and their technologies for highly selective biosensing, nanoarchitecture engineering and nanoelectronics. Increasing researches have been offered to a fundamental understanding how the interactions between the nanoparticles and DNA molecules could alter DNA molecular structure and its biochemical activities. This minor review describes the mechanisms of the nanoparticle-DNA binding and molecular interactions. We present recent discoveries and research progresses how the nanoparticle-DNA binding could vary DNA molecular structure, DNA detection, and gene therapy. We report a few case studies associated with the application of the nanoparticle-DNA binding devices in medical detection and biotechnology. The potential impacts of the nanoparticles via DNA binding on toxicity of the microorganisms are briefly discussed. The nanoparticle-DNA interactions and their impact on molecular and microbial functionalities have only drown attention in recent a few years. The information presented in this review can provide useful references for further studies on biomedical science and technology. Copyright © 2012 Elsevier Inc. All rights reserved.

  14. Transcription and DNA Damage: Holding Hands or Crossing Swords?

    PubMed

    D'Alessandro, Giuseppina; d'Adda di Fagagna, Fabrizio

    2017-10-27

    Transcription has classically been considered a potential threat to genome integrity. Collision between transcription and DNA replication machinery, and retention of DNA:RNA hybrids, may result in genome instability. On the other hand, it has been proposed that active genes repair faster and preferentially via homologous recombination. Moreover, while canonical transcription is inhibited in the proximity of DNA double-strand breaks, a growing body of evidence supports active non-canonical transcription at DNA damage sites. Small non-coding RNAs accumulate at DNA double-strand break sites in mammals and other organisms, and are involved in DNA damage signaling and repair. Furthermore, RNA binding proteins are recruited to DNA damage sites and participate in the DNA damage response. Here, we discuss the impact of transcription on genome stability, the role of RNA binding proteins at DNA damage sites, and the function of small non-coding RNAs generated upon damage in the signaling and repair of DNA lesions. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. A maximum entropy model for chromatin structure

    NASA Astrophysics Data System (ADS)

    Farre, Pau; Emberly, Eldon; Emberly Group Team

    The DNA inside the nucleus of eukaryotic cells shows a variety of conserved structures at different length scales These structures are formed by interactions between protein complexes that bind to the DNA and regulate gene activity. Recent high throughput sequencing techniques allow for the measurement both of the genome wide contact map of the folded DNA within a cell (HiC) and where various proteins are bound to the DNA (ChIP-seq). In this talk I will present a maximum-entropy method capable of both predicting HiC contact maps from binding data, and binding data from HiC contact maps. This method results in an intuitive Ising-type model that is able to predict how altering the presence of binding factors can modify chromosome conformation, without the need of polymer simulations.

  16. Role for a region of helically unstable DNA within the Epstein-Barr virus latent cycle origin of DNA replication oriP in origin function

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Polonskaya, Zhanna; Benham, Craig J.; Hearing, Janet

    The minimal replicator of the Epstein-Barr virus (EBV) latent cycle origin of DNA replication oriP is composed of two binding sites for the Epstein-Barr virus nuclear antigen-1 (EBNA-1) and flanking inverted repeats that bind the telomere repeat binding factor TRF2. Although not required for minimal replicator activity, additional binding sites for EBNA-1 and TRF2 and one or more auxiliary elements located to the right of the EBNA-1/TRF2 sites are required for the efficient replication of oriP plasmids. Another region of oriP that is predicted to be destabilized by DNA supercoiling is shown here to be an important functional component ofmore » oriP. The ability of DNA fragments of unrelated sequence and possessing supercoiled-induced DNA duplex destabilized (SIDD) structures, but not fragments characterized by helically stable DNA, to substitute for this component of oriP demonstrates a role for the SIDD region in the initiation of oriP-plasmid DNA replication.« less

  17. An ‘environment to nucleus’ signaling system operates in B lymphocytes: redox status modulates BSAP/Pax-5 activation through Ref-1 nuclear translocation

    PubMed Central

    Tell, Gianluca; Zecca, Alessandro; Pellizzari, Lucia; Spessotto, Paola; Colombatti, Alfonso; Kelley, Mark R.; Damante, Giuseppe; Pucillo, Carlo

    2000-01-01

    The Ref-1 (also called APE or HAP1) protein is a bifunctional enzyme impacting on a wide variety of important cellular functions. It acts as a major member of the DNA base excision repair pathway. Moreover, Ref-1 stimulates the DNA-binding activity of several transcription factors (TFs) through the reduction of highly reactive cysteine residues. Therefore, it represents a mechanism that regulates eukaryotic gene expression in a fast way. However, it has been demonstrated that external stimuli directly act on Ref-1 by increasing its expression levels, a time-consuming mechanism representing a paradox in terms of rapidity of TF regulation. In this paper we demonstrate that this is only an apparent paradox. Exposure of B lymphocytes to H2O2 induced a rapid and sustained increase in Ref-1 protein levels in the nucleus as evaluated by both western blot analysis and by pulse–chase experiments. A time course, two color in situ immunocytochemistry indicated that the up-regulation of Ref-1 in the nucleus at <30 min was primarily the consequence of translocation of its cytoplasmic form. This early nuclear accumulation is effective in modulating the DNA-binding activity of the B cell-specific activator protein BSAP/Pax-5. In fact, EMSA experiments demonstrate that a transient interaction with Ref-1 up-regulates the DNA-binding activity of BSAP/Pax-5. Moreover, in a co-transfection experiment, Ref-1 increased the BSAP/Pax-5 activating effect on an oligomerized BSAP/Pax-5 binding site of the CD19 promoter by 5- to 8-fold. Thus, Ref-1 mediates its effect by up-regulating the DNA-binding activity of BSAP/Pax-5, accounting for a new and fast outside/inside pathway of signaling in B cells. PMID:10666449

  18. Enhancement of DNaseI Salt Tolerance by Mimicking the Domain Structure of DNase from an Extremely Halotolerant Bacterium Thioalkalivibrio sp. K90mix

    PubMed Central

    Alzbutas, Gediminas; Kaniusaite, Milda; Lagunavicius, Arunas

    2016-01-01

    In our previous work we showed that DNaseI-like protein from an extremely halotolerant bacterium Thioalkalivibrio sp. K90mix retained its activity at salt concentrations as high as 4 M NaCl and the key factor allowing this was the C-terminal DNA-binding domain, which comprised two HhH (helix-hairpin-helix) motifs. The further investigations revealed that this domain originated from proteins related to bacterial competence ComEA/ComE proteins. It is likely that in the course of evolution the DNA-binding domain from these proteins was fused to a metallo-β-lactamase superfamily domain. Very likely such domain organization having proteins subsequently “donated” the DNA-binding domain to bacterial DNases. In this study we have mimicked this evolutionary step by fusing bovine DNaseI and DNA-binding domains. We have created two fusions: one harboring the DNA-binding domain of DNaseI-like protein from Thioalkalivibrio sp. K90mix and the second one harboring the DNA-binding domain of bacterial competence protein ComEA from Bacillus subtilis. Both domains enhanced salt tolerance of DNaseI, albeit to different extent. Molecular modeling revealed the essential differences between their interaction with DNA shedding some light on the differences in salt tolerance. In this study we have enhanced salt tolerance of bovine DNaseI; thus, we successfully mimicked the Nature’s evolutionary engineering that created the extremely halotolerant bacterial DNase. We have demonstrated that the newly engineered DNaseI variants can be successfully used in applications where activity of the wild type bovine DNaseI is impeded by buffers used. PMID:26939122

  19. Metal Ion Binding at the Catalytic Site Induces Widely Distributed Changes in a Sequence Specific Protein–DNA Complex

    PubMed Central

    2016-01-01

    Metal ion cofactors can alter the energetics and specificity of sequence specific protein–DNA interactions, but it is unknown if the underlying effects on structure and dynamics are local or dispersed throughout the protein–DNA complex. This work uses EcoRV endonuclease as a model, and catalytically inactive lanthanide ions, which replace the Mg2+ cofactor. Nuclear magnetic resonance (NMR) titrations indicate that four Lu3+ or two La3+ cations bind, and two new crystal structures confirm that Lu3+ binding is confined to the active sites. NMR spectra show that the metal-free EcoRV complex with cognate (GATATC) DNA is structurally distinct from the nonspecific complex, and that metal ion binding sites are not assembled in the nonspecific complex. NMR chemical shift perturbations were determined for 1H–15N amide resonances, for 1H–13C Ile-δ-CH3 resonances, and for stereospecifically assigned Leu-δ-CH3 and Val-γ-CH3 resonances. Many chemical shifts throughout the cognate complex are unperturbed, so metal binding does not induce major conformational changes. However, some large perturbations of amide and side chain methyl resonances occur as far as 34 Å from the metal ions. Concerted changes in specific residues imply that local effects of metal binding are propagated via a β-sheet and an α-helix. Both amide and methyl resonance perturbations indicate changes in the interface between subunits of the EcoRV homodimer. Bound metal ions also affect amide hydrogen exchange rates for distant residues, including a distant subdomain that contacts DNA phosphates and promotes DNA bending, showing that metal ions in the active sites, which relieve electrostatic repulsion between protein and DNA, cause changes in slow dynamics throughout the complex. PMID:27786446

  20. Molecular mechanisms of immunosuppression by cyclosporins.

    PubMed

    Zenke, G; Baumann, G; Wenger, R; Hiestand, P; Quesniaux, V; Andersen, E; Schreier, M H

    1993-06-23

    Despite the successful clinical application of the immunosuppressive drug cyclosporin A (CsA, Sandimmun), its precise mechanism of action in the process of T cell activation remains elusive. CsA binds to the high-affinity cytosolic receptor cyclophilin whose peptidyl-prolyl cis-trans isomerase activity is inhibited upon binding. The linkage of this effect with the inhibition of the T cell receptor-mediated signal transduction pathway, which leads to a suppression of lymphokine gene transcription, is still unclear. We analyzed the relationship between cyclophilin-binding and immunosuppressive activity (e.g., effect on IL-2 transcription) of cyclosporin derivatives in vitro. The results show that binding to cyclophilin is required, but not sufficient for immunosuppression. Cyclosporin analogues which completely lack immunosuppressive activity but fully retained their cyclophilin-binding capacity antagonize the immunosuppressive activity of CsA. These derivatives inhibit the isomerase activity of cyclophilin, which clearly demonstrates that inhibition of the cyclophilin isomerase activity does not lead to immunosuppression. In analogy to the other immunosuppressants of microbial origin, FK-506 and rapamycin, a specific structure of the "effector" domain of CsA, which is unrelated to the cyclophilin-binding domain, determines the biological activity. In the nucleus, CsA interferes with the DNA-binding of inducible transcription factors to their respective DNA motifs within lymphokine promoters by affecting intracellular translocation of transcription factor subunits.

  1. Cloning of a heavy-metal-binding protein derived from activated-sludge microorganisms.

    PubMed

    Sano, Daisuke; Myojo, Ken; Omura, Tatsuo

    2006-09-01

    A gene of the heavy-metal-binding protein (HMBP) was newly isolated from a genetic DNA library of activated-sludge microorganisms. HMBP was produced by transformed Escherichia coli, and the copper-binding ability of HMBP was confirmed. HMBP derived from activated sludge could be available as heavy metal adsorbents in water and wastewater treatments.

  2. Cytotoxic activity of proflavine diureas: synthesis, antitumor, evaluation and DNA binding properties of 1',1''-(acridin-3,6-diyl)-3',3''-dialkyldiureas.

    PubMed

    Kozurková, Mária; Sabolová, Danica; Janovec, Ladislav; Mikes, Jaromír; Koval', Ján; Ungvarský, Ján; Stefanisinová, Miroslava; Fedorocko, Peter; Kristian, Pavol; Imrich, Ján

    2008-04-01

    The synthesis of novel 1',1''-(acridin-3,6-diyl)-3',3''-dialkyldiureas was reported. Their biological activity to inhibit cell proliferation was assessed by a MTT assay on two cell lines, HeLa and HCT-116, at micromolar concentration. 1',1''-(Acridin-3,6-diyl)-3',3''-dihexyldiurea hydrochloride was active on a HCT-116 cell line with an IC(50) value of 3.1 microM. The interaction of these compounds with calf thymus DNA was investigated by a variety of spectroscopic techniques including UV-vis, fluorescence and CD spectroscopy. From spectrofluorimetric titrations, binding constants for the DNA-drug complexes were determined (K=0.9-4.2x10(5) M(-1)). Antiproliferative activity of synthesized derivatives might be related to their intercalation into DNA.

  3. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  4. Identification of DNA-dependent protein kinase catalytic subunit (DNA-PKcs) as a novel target of bisphenol A.

    PubMed

    Ito, Yuki; Ito, Takumi; Karasawa, Satoki; Enomoto, Teruya; Nashimoto, Akihiro; Hase, Yasuyoshi; Sakamoto, Satoshi; Mimori, Tsuneyo; Matsumoto, Yoshihisa; Yamaguchi, Yuki; Handa, Hiroshi

    2012-01-01

    Bisphenol A (BPA) forms the backbone of plastics and epoxy resins used to produce packaging for various foods and beverages. BPA is also an estrogenic disruptor, interacting with human estrogen receptors (ER) and other related nuclear receptors. Nevertheless, the effects of BPA on human health remain unclear. The present study identified DNA-dependent protein kinase catalytic subunit (DNA-PKcs) as a novel BPA-binding protein. DNA-PKcs, in association with the Ku heterodimer (Ku70/80), is a critical enzyme involved in the repair of DNA double-strand breaks. Low levels of DNA-PK activity are previously reported to be associated with an increased risk of certain types of cancer. Although the Kd for the interaction between BPA and a drug-binding mutant of DNA-PKcs was comparatively low (137 nM), high doses of BPA were required before cellular effects were observed (100-300 μM). The results of an in vitro kinase assay showed that BPA inhibited DNA-PK kinase activity in a concentration-dependent manner. In M059K cells, BPA inhibited the phosphorylation of DNA-PKcs at Ser2056 and H2AX at Ser139 in response to ionizing radiation (IR)-irradiation. BPA also disrupted DNA-PKcs binding to Ku70/80 and increased the radiosensitivity of M059K cells, but not M059J cells (which are DNA-PKcs-deficient). Taken together, these results provide new evidence of the effects of BPA on DNA repair in mammalian cells, which are mediated via inhibition of DNA-PK activity. This study may warrant the consideration of the possible carcinogenic effects of high doses of BPA, which are mediated through its action on DNA-PK.

  5. Identification of DNA-Dependent Protein Kinase Catalytic Subunit (DNA-PKcs) as a Novel Target of Bisphenol A

    PubMed Central

    Nashimoto, Akihiro; Hase, Yasuyoshi; Sakamoto, Satoshi; Mimori, Tsuneyo; Matsumoto, Yoshihisa; Yamaguchi, Yuki; Handa, Hiroshi

    2012-01-01

    Bisphenol A (BPA) forms the backbone of plastics and epoxy resins used to produce packaging for various foods and beverages. BPA is also an estrogenic disruptor, interacting with human estrogen receptors (ER) and other related nuclear receptors. Nevertheless, the effects of BPA on human health remain unclear. The present study identified DNA-dependent protein kinase catalytic subunit (DNA-PKcs) as a novel BPA-binding protein. DNA-PKcs, in association with the Ku heterodimer (Ku70/80), is a critical enzyme involved in the repair of DNA double-strand breaks. Low levels of DNA-PK activity are previously reported to be associated with an increased risk of certain types of cancer. Although the Kd for the interaction between BPA and a drug-binding mutant of DNA-PKcs was comparatively low (137 nM), high doses of BPA were required before cellular effects were observed (100–300 μM). The results of an in vitro kinase assay showed that BPA inhibited DNA-PK kinase activity in a concentration-dependent manner. In M059K cells, BPA inhibited the phosphorylation of DNA-PKcs at Ser2056 and H2AX at Ser139 in response to ionizing radiation (IR)-irradiation. BPA also disrupted DNA-PKcs binding to Ku70/80 and increased the radiosensitivity of M059K cells, but not M059J cells (which are DNA-PKcs-deficient). Taken together, these results provide new evidence of the effects of BPA on DNA repair in mammalian cells, which are mediated via inhibition of DNA-PK activity. This study may warrant the consideration of the possible carcinogenic effects of high doses of BPA, which are mediated through its action on DNA-PK. PMID:23227178

  6. Molecular Mechanism Underlying the Action of Substituted Pro-Gly Dipeptide Noopept

    PubMed Central

    Vakhitova, Y. V.; Sadovnikov, S. V.; Borisevich, S. S.; Ostrovskaya, R. U.; A.Gudasheva, T.; Seredenin, S. B.

    2016-01-01

    This study was performed in order to reveal the effect of Noopept (ethyl ester of N-phenylacetyl-Lprolylglycine, GVS-111) on the DNA-binding activity of transcriptional factors (TF) in HEK293 cells transiently transfected with luciferase reporter constructs containing sequences for CREB, NFAT, NF-κB, p53, STAT1, GAS, VDR, HSF1, and HIF-1. Noopept (10 μM) was shown to increase the DNA-binding activity of HIF-1 only, while lacking the ability to affect that of CREB, NFAT, NF-κB, p53, STAT1, GAS, VDR, and HSF1. Noopept provoked an additional increase in the DNA-binding activity of HIF-1 when applied in conditions of CoCl2-induced HIF- 1 stabilization. The degree of this HIF-positive effect of Noopept was shown to be concentration-dependent. Piracetam (1 mM) failed to affect significantly any of the TF under study. The results of molecular docking showed that Noopept (L-isomer), as well as its metabolite, L-isomer of N-phenyl-acetylprolyl, unlike its pharmacologically ineffective D-isomer, is able to bind to the active site of prolyl hydroxylase 2. Taking into account the important role of the genes activated by HIF-1 in the formation of an adaptive response to hypoxia, data on the ability of Noopept to provoke a selective increase in the DNA-binding activity of HIF-1 explain the wide spectrum of neurochemical and pharmacological effects of Noopept revealed before. The obtained data allow one to propose the HIF-positive effect as the primary mechanism of the activity of this Pro-Gly-containing dipeptide. PMID:27099787

  7. The interaction of DiaA and DnaA regulates the replication cycle in E. coli by directly promoting ATP–DnaA-specific initiation complexes

    PubMed Central

    Keyamura, Kenji; Fujikawa, Norie; Ishida, Takuma; Ozaki, Shogo; Su’etsugu, Masayuki; Fujimitsu, Kazuyuki; Kagawa, Wataru; Yokoyama, Shigeyuki; Kurumizaka, Hitoshi; Katayama, Tsutomu

    2007-01-01

    Escherichia coli DiaA is a DnaA-binding protein that is required for the timely initiation of chromosomal replication during the cell cycle. In this study, we determined the crystal structure of DiaA at 1.8 Å resolution. DiaA forms a homotetramer consisting of a symmetrical pair of homodimers. Mutational analysis revealed that the DnaA-binding activity and formation of homotetramers are required for the stimulation of initiation by DiaA. DiaA tetramers can bind multiple DnaA molecules simultaneously. DiaA stimulated the assembly of multiple DnaA molecules on oriC, conformational changes in ATP–DnaA-specific initiation complexes, and unwinding of oriC duplex DNA. The mutant DiaA proteins are defective in these stimulations. DiaA associated also with ADP–DnaA, and stimulated the assembly of inactive ADP–DnaA–oriC complexes. Specific residues in the putative phosphosugar-binding motif of DiaA were required for the stimulation of initiation and formation of ATP–DnaA-specific–oriC complexes. Our data indicate that DiaA regulates initiation by a novel mechanism, in which DiaA tetramers most likely bind to multiple DnaA molecules and stimulate the assembly of specific ATP–DnaA–oriC complexes. These results suggest an essential role for DiaA in the promotion of replication initiation in a cell cycle coordinated manner. PMID:17699754

  8. Xeroderma pigmentosum complementation group E and UV-damaged DNA-binding protein

    PubMed Central

    Tang, Jean; Chu, Gilbert

    2010-01-01

    UV-damaged DNA-binding protein (UV-DDB) is composed of two subunits, DDB1 (p127) and DDB2 (p48). Mutations in the DDB2 gene inactivate UV-DDB in individuals from complementation group E of xeroderma pigmentosum (XP-E), an autosomal recessive disease characterized by sun sensitivity, severe risk for skin cancer and defective nucleotide excision repair. UV-DDB is also deficient in many rodent tissues, exposing a shortcoming in rodent models for cancer. In vitro, UV-DDB binds to cyclobutane pyrimidine dimers (CPDs), 6–4 photoproducts and other DNA lesions, stimulating the excision of CPDs, and to a lesser extent, of 6–4 photoproducts. In vivo, UV-DDB plays an important role in the p53-dependent response of mammalian cells to DNA damage. When cells are exposed to UV, the resulting accumulation of p53 activates DDB2 transcription, which leads to increased levels of UV-DDB. Binding of UV-DDB to CPDs targets these lesions for global genomic repair, suppressing mutations without affecting UV survival. Apparently, cells are able to survive with unrepaired CPDs because of the activity of bypass DNA polymerases. Finally, there is evidence that UV-DDB may have roles in the cell that are distinct from DNA repair. PMID:12509284

  9. Synthesis, characterization, crystal structure, DNA/BSA binding ability and antibacterial activity of asymmetric europium complex based on 1,10- phenanthroline

    NASA Astrophysics Data System (ADS)

    Alfi, Nafiseh; Khorasani-Motlagh, Mozhgan; Rezvani, Ali Reza; Noroozifar, Meissam; Molčanov, Krešimir

    2017-06-01

    A heteroleptic europium coordination compound formulated as [Eu(phen)2(OH2)2(Cl)2](Cl)(H2O) (phen = 1,10-phenanthroline), has been synthesized and characterized by elemental analysis, FT-IR spectroscopy, and single-crystal X-ray diffractometer. Crystal structure analysis reveals the complex is crystallized in orthorhombic system with Pca21 space group. Electronic absorption and various emission methods for investigation of the binding system of europium(III) complex to Fish Salmon deoxyribonucleic acid (FS-DNA) and Bovamin Serum Albumin (BSA) have been explored. Furthermore, the binding constants, binding sites and the corresponding thermodynamic parameters of the interaction system based on the van't Hoff equation for FS-DNA and BSA were calculated. The thermodynamic parameters reflect the exothermic nature of emission process (ΔH°<0 and ΔS°<0). The experimental results seem to indicate that the [Eu(phen)2(OH2)2(Cl)2](Cl)(H2O) bound to FS-DNA by non-intercalative mode which the groove binding is preferable mode. Also, the complex exhibits a brilliant antimicrobial activity in vitro against standard bacterial strains.

  10. DNA as a Target for Anticancer Phen-Imidazole Pd(II) Complexes.

    PubMed

    Heydari, Maryam; Moghadam, Mahboube Eslami; Tarlani, AliAkbar; Farhangian, Hossein

    2017-05-01

    Imidazole ring is a known structure in many natural or synthetic drug molecules and its metal complexes can interact with DNA and do the cleavage. Hence, to study the influence of the structure and size of the ligand on biological behavior of metal complexes, two water-soluble Pd(II) complexes of phen and FIP ligands (where phen is 1,10-phenanthroline and FIP is 2-(Furan-2-yl)-1H-Imidazo[4,5-f][1, 10]phenanthroline) with the formula of [Pd(phen)(FIP)](NO 3 ) 2 and [Pd(FIP) 2 ]Cl 2 , that were activated against chronic myelogenous leukemia cell line, K562, were selected. Also, the interaction of these anticancer Pd(II) complexes with highly polymerized calf thymus DNA was extensively studied by means of electronic absorption, fluorescence, and circular dichroism in Tris-buffer. The results showed that the binding was positive cooperation and [Pd(phen)(FIP)](NO 3 ) 2 (K f  = 127 M -1 G = 1.2) exhibited higher binding constant and number of binding sites than [Pd(FIP) 2 ]Cl 2 (K f  = 13 M -1 G = 1.03) upon binding to DNA. The fluorescence data indicates that quenching effect for [Pd(phen)(FIP)](NO 3 ) 2 (K SV  = 58 mM -1 ) was higher than [Pd(FIP) 2 ]Cl 2 (K SV  = 12 mM -1 ). Also, [Pd(FIP) 2 ]Cl 2 interacts with ethidium bromide-DNA, as non-competitive inhibition, and can bind to DNA via groove binding and [Pd(phen)(FIP)](NO 3 ) 2 can intercalate in DNA. These results were confirmed by circular dichroism spectra. Docking data revealed that longer complexes have higher interaction energy and bind to DNA via groove binding. Graphical Abstract Two anticancer Pd(II) complexes of imidazole derivative have been synthesized and interacted with calf thymus DNA. Modes of binding have been studied by electronic absorption, fluorescence, and CD measurements. [Pd(FIP) 2 ]Cl 2 can bind to DNA via groove binding while intercalation mode of binding is observed for [Pd(phen)(FIP)](NO 3 ) 2 .

  11. HARP preferentially co-purifies with RPA bound to DNA-PK and blocks RPA phosphorylation.

    PubMed

    Quan, Jinhua; Yusufzai, Timur

    2014-05-01

    The HepA-related protein (HARP/SMARCAL1) is an ATP-dependent annealing helicase that is capable of rewinding DNA structures that are stably unwound due to binding of the single-stranded DNA (ssDNA)-binding protein Replication Protein A (RPA). HARP has been implicated in maintaining genome integrity through its role in DNA replication and repair, two processes that generate RPA-coated ssDNA. In addition, mutations in HARP cause a rare disease known as Schimke immuno-osseous dysplasia. In this study, we purified HARP containing complexes with the goal of identifying the predominant factors that stably associate with HARP. We found that HARP preferentially interacts with RPA molecules that are bound to the DNA-dependent protein kinase (DNA-PK). We also found that RPA is phosphorylated by DNA-PK in vitro, while the RPA-HARP complexes are not. Our results suggest that, in addition to its annealing helicase activity, which eliminates the natural binding substrate for RPA, HARP blocks the phosphorylation of RPA by DNA-PK.

  12. Two new insulator proteins, Pita and ZIPIC, target CP190 to chromatin

    PubMed Central

    Maksimenko, Oksana; Bartkuhn, Marek; Stakhov, Viacheslav; Herold, Martin; Zolotarev, Nickolay; Jox, Theresa; Buxa, Melanie K.; Kirsch, Ramona; Bonchuk, Artem; Fedotova, Anna; Kyrchanova, Olga

    2015-01-01

    Insulators are multiprotein–DNA complexes that regulate the nuclear architecture. The Drosophila CP190 protein is a cofactor for the DNA-binding insulator proteins Su(Hw), CTCF, and BEAF-32. The fact that CP190 has been found at genomic sites devoid of either of the known insulator factors has until now been unexplained. We have identified two DNA-binding zinc-finger proteins, Pita, and a new factor named ZIPIC, that interact with CP190 in vivo and in vitro at specific interaction domains. Genomic binding sites for these proteins are clustered with CP190 as well as with CTCF and BEAF-32. Model binding sites for Pita or ZIPIC demonstrate a partial enhancer-blocking activity and protect gene expression from PRE-mediated silencing. The function of the CTCF-bound MCP insulator sequence requires binding of Pita. These results identify two new insulator proteins and emphasize the unifying function of CP190, which can be recruited by many DNA-binding insulator proteins. PMID:25342723

  13. Zn(II) stimulation of Fe(II)-activated repression in the iron-dependent repressor from Mycobacterium tuberculosis.

    PubMed

    Stapleton, Brian; Walker, Lawrence R; Logan, Timothy M

    2013-03-19

    Thermodynamic measurements of Fe(II) binding and activation of repressor function in the iron-dependent repressor from Mycobacterium tuberculosis (IdeR) are reported. IdeR, a member of the diphtheria toxin repressor family of proteins, regulates iron homeostasis and contributes to the virulence response in M. tuberculosis. Although iron is the physiological ligand, this is the first detailed analysis of iron binding and activation in this protein. The results showed that IdeR binds 2 equiv of Fe(II) with dissociation constants that differ by a factor of 25. The high- and low-affinity iron binding sites were assigned to physical binding sites I and II, respectively, using metal binding site mutants. IdeR was also found to contain a high-affinity Zn(II) binding site that was assigned to physical metal binding site II through the use of binding site mutants and metal competition assays. Fe(II) binding was modestly weaker in the presence of Zn(II), but the coupled metal binding-DNA binding affinity was significantly stronger, requiring 30-fold less Fe(II) to activate DNA binding compared to Fe(II) alone. Together, these results suggest that IdeR is a mixed-metal repressor, where Zn(II) acts as a structural metal and Fe(II) acts to trigger the physiologically relevant promoter binding. This new model for IdeR activation provides a better understanding of IdeR and the biology of iron homeostasis in M. tuberculosis.

  14. Novel coumarins and related copper complexes with biological activity: DNA binding, molecular docking and in vitro antiproliferative activity.

    PubMed

    Pivetta, Tiziana; Valletta, Elisa; Ferino, Giulio; Isaia, Francesco; Pani, Alessandra; Vascellari, Sarah; Castellano, Carlo; Demartin, Francesco; Cabiddu, Maria Grazia; Cadoni, Enzo

    2017-12-01

    Coumarins show biological activity and are widely exploited for their therapeutic effects. Although a great number of coumarins substituted by heterocyclic moieties have been prepared, few studies have been carried out on coumarins containing pyridine heterocycle, which is known to modulate their physiological activities. We prepared and characterized three novel 3-(pyridin-2-yl)coumarins and their corresponding copper(II) complexes. We extended our investigations also to three known similar coumarins, since no data about their biochemical activity was previously been reported. The antiproliferative activity of the studied compounds was tested against human derived tumor cell lines and one human normal cell line. The DNA binding constants were determined and docking studies with DNA carried out. Selected Quantitative Structure-Activity Relationship (QSAR) descriptors were calculated in order to relate a set of structural and topological descriptors of the studied compounds to their DNA interaction and cytotoxic activity. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Synthesis, structure, DNA/BSA binding and antibacterial studies of NNO tridentate Schiff base metal complexes

    NASA Astrophysics Data System (ADS)

    Sakthi, Marimuthu; Ramu, Andy

    2017-12-01

    A new salicylaldehyde derived 2,4-diiodo-6-((2-phenylaminoethylimino)methyl)phenol Schiff base(L) and its transition metal complexes of the type MLCl where, M = Cu(II), Ni(II), Co(II), Mn(II) and Zn(II) have been synthesized. The coordination mode of Schiff base holding NNO donor atoms with metal ions was well investigated by elemental analysis, ESI-mass as well as IR, UV-vis, CV and NMR spectral studies. The binding efficiency and mode of these complexes with biological macromolecules viz., herring sperm DNA (HS- DNA) and bovine serum albumin (BSA) have been explored through various spectroscopic techniques. The characteristic changes in absorption, emission and, circular dichroism spectra of the complexes with DNA indicate the noticeable interaction between them. From the all spectral information complexes could interact with DNA via non-intercalation mode of binding. The hyperchromisim in absorption band and hypochromisim in emission intensity of BSA with different complex concentrations shown significant information, and the binding affinity value has been predicted from Stern-Volmer plots. Further, all the complexes could cleave the circular plasmid pUC19 DNA efficiently by using an activator H2O2. The ligand and all metal(II) complexes showed good antibacterial activities. The molecular docking studies of the complexes with DNA were performed in order to make a comparison and conclusion with spectral technic results.

  16. Biochemical activity of a fluorescent dye rhodamine 6G: Molecular modeling, electrochemical, spectroscopic and thermodynamic studies.

    PubMed

    Al Masum, Abdulla; Chakraborty, Maharudra; Ghosh, Soumen; Laha, Dipranjan; Karmakar, Parimal; Islam, Md Maidul; Mukhopadhyay, Subrata

    2016-11-01

    Interaction of CT DNA with Rhodamine 6G (R6G) has been studied using molecular docking, electrochemical, spectroscopic and thermodynamic methods. From the study, it was illustrated that Rhodamine 6G binds to the minor groove of CT DNA. The binding was cooperative in nature. Circular voltametric study showed significant change in peak current and peak potential due to complexation. All the studies showed that the binding constant was in the order of 10 6 M -1 . Circular dichroic spectra showed significant conformational change on binding and DNA unwind during binding. Thermodynamic study showed that binding was favored by negative enthalpy and positive entropy change. From thermodynamic study it was also observed that several positive and negative free energies played significant role during binding and the unfavorable conformational free energy change was overcame by highly negative hydrophobic and salt dependent free energy changes. The experimental results were further validated using molecular docking study and the effect of structure on binding has been studied theoretically. From docking study it was found that the hydrophobic interaction and hydrogen bonds played a significant role during binding. The dye was absorbed by cell and this phenomenon was studied using fluorescent microscope. Cell survivability test showed that the dye active against Human Breast Cancer cells MDA-MB 468. ROS study showed that the activity is due to the production of reactive oxygen. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Characterization of differential ripening pattern in association with ethylene biosynthesis in the fruits of five naturally occurring banana cultivars and detection of a GCC-box-specific DNA-binding protein.

    PubMed

    Choudhury, Swarup Roy; Roy, Sujit; Saha, Progya Paramita; Singh, Sanjay Kumar; Sengupta, Dibyendu N

    2008-07-01

    MA-ACS1 and MA-ACO1 are the two major ripening genes in banana and play crucial role in the regulation of ethylene production during ripening. Here, we report a comparative ripening pattern in five different naturally occurring banana cultivars namely Cavendish (AAA), Rasthali (AAB), Kanthali (AB), Poovan (AAB) and Monthan (ABB), which have distinct genome composition. We found a distinct variation in the climacteric ethylene production and in-vivo ACC oxidase activity level during the ripening stages in the five cultivars. We identified the cDNAs for MA-ACS1 and MA-ACO1 from the five cultivars and studied the transcript accumulation patterns of the two genes, which correlated well with the differential timing in the expression of these two genes during ripening. The GCC-box is one of the ethylene-responsive elements (EREs) found in the promoters of many ethylene-inducible genes. We have identified a GCC-box motif (putative ERE) in the promoters of MA-ACS1 and MA-ACO1 in banana cultivars. DNA-protein interaction studies revealed the presence of a GCC-box-specific DNA-binding activity in the fruit nuclear extract and such DNA-binding activity was enhanced following ethylene treatment. South-Western blotting revealed a 25-kDa nuclear protein that binds specifically to GCC-box DNA in the climacteric banana fruit. Together, these results indicate the probable involvement of the GCC-box motif as the cis-acting ERE in the regulation of MA-ACS1 and MA-ACO1 during ripening in banana fruits via binding of specific ERE-binding protein.

  18. Histone-like DNA binding protein of Streptococcus intermedius induces the expression of pro-inflammatory cytokines in human monocytes via activation of ERK1/2 and JNK pathways.

    PubMed

    Liu, Dali; Yumoto, Hiromichi; Hirota, Katsuhiko; Murakami, Keiji; Takahashi, Kanako; Hirao, Kouji; Matsuo, Takashi; Ohkura, Kazuto; Nagamune, Hideaki; Miyake, Yoichiro

    2008-01-01

    Streptococcus intermedius is a commensal associated with serious, deep-seated purulent infections in major organs, such as the brain and liver. Histone-like DNA binding protein (HLP) is an accessory architectural protein in a variety of bacterial cellular processes. In this study, we investigated the mechanisms of pro-inflammatory cytokine inductions in THP-1 cells by stimulation with recombinant HLP of S. intermedius (rSi-HLP). rSi-HLP stimulation-induced production of pro-inflammatory cytokines (IL-8, IL-1 beta and TNF-alpha) occurred in a time- and dose-dependent manner. In contrast with the heat-stable activity of DNA binding, the induction activity of rSi-HLP was heat-unstable. In subsequent studies, rSi-HLP acted cooperatively with lipoteichoic acid, the synthetic Toll-like receptor 2 agonist, Pam3CSK4, and the cytosolic nucleotide binding oligomerization domain 2 receptor agonist, muramyldipeptide. Furthermore, Western blot and blocking assays with specific inhibitors showed that rSi-HLP stimulation induced the activation of cell signal transduction pathways, extracellular signal-regulated kinase 1/2 (ERK1/2) and c-Jun N-terminal kinase (JNK). In addition to its physiological role in bacterial growth through DNA binding, these results indicate that Si-HLP can trigger a cascade of events that induce pro-inflammatory responses via ERK1/2 and JNK signal pathways, and suggest that bacterial HLP may contribute to the activation of host innate immunity during bacterial infection.

  19. Small molecule and peptide-mediated inhibition of Epstein-Barr virus nuclear antigen 1 dimerization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Sun Young; Song, Kyung-A; Samsung Biomedical Research Institute

    Highlights: Black-Right-Pointing-Pointer Evidence that targeting EBNA1 dimer, an EBV onco-antigen, can be achievable. Black-Right-Pointing-Pointer A small molecule and a peptide as EBNA1 dimerization inhibitors identified. Black-Right-Pointing-Pointer Both inhibitors associated with EBNA1 and blocked EBNA1 DNA binding activity. Black-Right-Pointing-Pointer Also, prevented its dimerization, and repressed viral gene transcription. -- Abstract: Latent Epstein-Barr virus (EBV) infection is associated with human B cell lymphomas and certain carcinomas. EBV episome persistence, replication, and gene expression are dependent on EBV-encoded nuclear antigen 1 (EBNA1)'s DNA binding domain (DBD)/dimerization domain (DD)-mediated sequence-specific DNA binding activity. Homodimerization of EBNA1 is essential for EBNA1 DNA binding and transactivation.more » In this study, we characterized a novel small molecule EBNA1 inhibitor EiK1, screened from the previous high throughput screening (HTS). The EiK1 compound specifically inhibited the EBNA1-dependent, OriP-enhanced transcription, but not EBNA1-independent transcription. A Surface Plasmon Resonance Biacore assay revealed that EiK1 associates with EBNA1 amino acid 459-607 DBD/DD. Consistent with the SPR data, in vitro gel shift assays showed that EiK1 suppressed the activity of EBNA1 binding to the cognate familial repeats (FR) sequence, but not control RBP-J{kappa} binding to the J{kappa} site. Subsequently, a cross-linker-mediated in vitro multimerization assay and EBNA1 homodimerization-dependent yeast two-hybrid assay showed that EiK1 significantly inhibited EBNA1 dimerization. In an attempt to identify more highly specific peptide inhibitors, small peptides encompassing the EBNA1 DBD/DD were screened for inhibition of EBNA1 DBD-mediated DNA binding function. The small peptide P85, covering EBNA1 a.a. 560-574, significantly blocked EBNA1 DNA binding activity in vitro, prevented dimerization in vitro and in vivo, associated with EBNA1 in vitro, and repressed EBNA1-dependent transcription in vivo. Collectively, this study describes two novel inhibitors of EBNA1 dimerization. This study demonstrates that EBNA1 homodimerization can be effectively targeted by a small molecule or peptide.« less

  20. SOS response in bacteria: Inhibitory activity of lichen secondary metabolites against Escherichia coli RecA protein.

    PubMed

    Bellio, Pierangelo; Di Pietro, Letizia; Mancini, Alisia; Piovano, Marisa; Nicoletti, Marcello; Brisdelli, Fabrizia; Tondi, Donatella; Cendron, Laura; Franceschini, Nicola; Amicosante, Gianfranco; Perilli, Mariagrazia; Celenza, Giuseppe

    2017-06-15

    RecA is a bacterial multifunctional protein essential to genetic recombination, error-prone replicative bypass of DNA damages and regulation of SOS response. The activation of bacterial SOS response is directly related to the development of intrinsic and/or acquired resistance to antimicrobials. Although recent studies directed towards RecA inactivation via ATP binding inhibition described a variety of micromolar affinity ligands, inhibitors of the DNA binding site are still unknown. Twenty-seven secondary metabolites classified as anthraquinones, depsides, depsidones, dibenzofurans, diphenyl-butenolides, paraconic acids, pseudo-depsidones, triterpenes and xanthones, were investigated for their ability to inhibit RecA from Escherichia coli. They were isolated in various Chilean regions from 14 families and 19 genera of lichens. The ATP hydrolytic activity of RecA was quantified detecting the generation of free phosphate in solution. The percentage of inhibition was calculated fixing at 100µM the concentration of the compounds. Deeper investigations were reserved to those compounds showing an inhibition higher than 80%. To clarify the mechanism of inhibition, the semi-log plot of the percentage of inhibition vs. ATP and vs. ssDNA, was evaluated. Only nine compounds showed a percentage of RecA inhibition higher than 80% (divaricatic, perlatolic, alpha-collatolic, lobaric, lichesterinic, protolichesterinic, epiphorellic acids, sphaerophorin and tumidulin). The half-inhibitory concentrations (IC 50 ) calculated for these compounds were ranging from 14.2µM for protolichesterinic acid to 42.6µM for sphaerophorin. Investigations on the mechanism of inhibition showed that all compounds behaved as uncompetitive inhibitors for ATP binding site, with the exception of epiphorellic acid which clearly acted as non-competitive inhibitor of the ATP site. Further investigations demonstrated that epiphorellic acid competitively binds the ssDNA binding site. Kinetic data were confirmed by molecular modelling binding predictions which shows that epiphorellic acid is expected to bind the ssDNA site into the L2 loop of RecA protein. In this paper the first RecA ssDNA binding site ligand is described. Our study sets epiphorellic acid as a promising hit for the development of more effective RecA inhibitors. In our drug discovery approach, natural products in general and lichen in particular, represent a successful source of active ligands and structural diversity. Copyright © 2017 Elsevier GmbH. All rights reserved.

  1. Cytosolic sensing of immuno-stimulatory DNA, the enemy within.

    PubMed

    Dhanwani, Rekha; Takahashi, Mariko; Sharma, Sonia

    2018-02-01

    In the cytoplasm, DNA is sensed as a universal danger signal by the innate immune system. Cyclic GMP-AMP synthase (cGAS) is a cytosolic DNA sensor/enzyme that catalyzes formation of 2'-5'-cGAMP, an atypical cyclic di-nucleotide second messenger that binds and activates the Stimulator of Interferon Genes (STING), resulting in recruitment of Tank Binding Kinase 1 (TBK1), activation of the transcription factor Interferon Regulatory Factor 3 (IRF3), and trans-activation of innate immune response genes, including type I Interferon cytokines (IFN-I). Activation of the pro-inflammatory cGAS-STING-IRF3 response is triggered by direct recognition of the DNA genomes of bacteria and viruses, but also during RNA virus infection, neoplastic transformation, tumor immunotherapy and systemic auto-inflammatory diseases. In these circumstances, the source of immuno-stimulatory DNA has often represented a fundamental yet poorly understood aspect of the response. This review focuses on recent findings related to cGAS activation by an array of self-derived DNA substrates, including endogenous retroviral elements, mitochondrial DNA (mtDNA) and micronuclei generated as a result of genotoxic stress and DNA damage. These findings emphasize the role of the cGAS axis as a cell-intrinsic innate immune response to a wide variety of genomic insults. Copyright © 2017. Published by Elsevier Ltd.

  2. The catalytic activity of a recombinant single chain variable fragment nucleic acid-hydrolysing antibody varies with fusion tag and expression host.

    PubMed

    Lee, Joungmin; Kim, Minjae; Seo, Youngsil; Lee, Yeonjin; Park, Hyunjoon; Byun, Sung June; Kwon, Myung-Hee

    2017-11-01

    The antigen-binding properties of single chain Fv antibodies (scFvs) can vary depending on the position and type of fusion tag used, as well as the host cells used for expression. The issue is even more complicated with a catalytic scFv antibody that binds and hydrolyses a specific antigen. Herein, we investigated the antigen-binding and -hydrolysing activities of the catalytic anti-nucleic acid antibody 3D8 scFv expressed in Escherichia coli or HEK293f cells with or without additional amino acid residues at the N- and C-termini. DNA-binding activity was retained in all recombinant forms. However, the DNA-hydrolysing activity varied drastically between forms. The DNA-hydrolysing activity of E. coli-derived 3D8 scFvs was not affected by the presence of a C-terminal human influenza haemagglutinin (HA) or His tag. By contrast, the activity of HEK293f-derived 3D8 scFvs was completely lost when additional residues were included at the N-terminus and/or when a His tag was incorporated at the C-terminus, whereas a HA tag at the C-terminus did not diminish activity. Thus, we demonstrate that the antigen-binding and catalytic activities of a catalytic antibody can be separately affected by the presence of additional residues at the N- and C-termini, and by the host cell type. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  3. The single-strand DNA binding activity of human PC4 preventsmutagenesis and killing by oxidative DNA damage

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Jen-Yeu; Sarker, Altaf Hossain; Cooper, Priscilla K.

    Human positive cofactor 4 (PC4) is a transcriptional coactivator with a highly conserved single-strand DNA (ssDNA) binding domain of unknown function. We identified PC4 as a suppressor of the oxidative mutator phenotype of the Escherichia coli fpg mutY mutant and demonstrate that this suppression requires its ssDNA binding activity. Yeast mutants lacking their PC4 ortholog Sub1 are sensitive to hydrogen peroxide and exhibit spontaneous and peroxide induced hypermutability. PC4 expression suppresses the peroxide sensitivity of the yeast sub l{Delta} mutant, suggesting that the human protein has a similar function. A role for yeast and human proteins in DNA repair ismore » suggested by the demonstration that Sub1 acts in a peroxide-resistance pathway involving Rad2 and by the physical interaction of PC4 with the human Rad2 homolog XPG. We show XPG recruits PC4 to a bubble-containing DNA substrate with resulting displacement of XPG and formation of a PC4-DNA complex. We discuss the possible requirement for PC4 in either global or transcription-coupled repair of oxidative DNA damage to mediate the release of XPG bound to its substrate.« less

  4. Conserved RNA binding activity of a Yin-Yang 1 homologue in the ova of the purple sea urchin Strongylocentrotus purpuratus.

    PubMed

    Belak, Zachery R; Ovsenek, Nicholas; Eskiw, Christopher H

    2018-05-23

    Yin-Yang 1 (YY1) is a highly conserved transcription factor possessing RNA-binding activity. A putative YY1 homologue was previously identified in the developmental model organism Strongylocentrotus purpuratus (the purple sea urchin) by genomic sequencing. We identified a high degree of sequence similarity with YY1 homologues of vertebrate origin which shared 100% protein sequence identity over the DNA- and RNA-binding zinc-finger region with high similarity in the N-terminal transcriptional activation domain. SpYY1 demonstrated identical DNA- and RNA-binding characteristics between Xenopus laevis and S. purpuratus indicating that it maintains similar functional and biochemical properties across widely divergent deuterostome species. SpYY1 binds to the consensus YY1 DNA element, and also to U-rich RNA sequences. Although we detected SpYY1 RNA-binding activity in ova lysates and observed cytoplasmic localization, SpYY1 was not associated with maternal mRNA in ova. SpYY1 expressed in Xenopus oocytes was excluded from the nucleus and associated with maternally expressed cytoplasmic mRNA molecules. These data demonstrate the existence of an YY1 homologue in S. purpuratus with similar structural and biochemical features to those of the well-studied vertebrate YY1; however, the data reveal major differences in the biological role of YY1 in the regulation of maternally expressed mRNA in the two species.

  5. Cloning of an SNF2/SWI2-related protein that binds specifically to the SPH motifs of the SV40 enhancer and to the HIV-1 promoter.

    PubMed

    Sheridan, P L; Schorpp, M; Voz, M L; Jones, K A

    1995-03-03

    We have isolated a human cDNA clone encoding HIP116, a protein that binds to the SPH repeats of the SV40 enhancer and to the TATA/inhibitor region of the human immunodeficiency virus (HIV)-1 promoter. The predicted HIP116 protein is related to the yeast SNF2/SWI2 transcription factor and to other members of this extended family and contains seven domains similar to those found in the vaccinia NTP1 ATPase. Interestingly, HIP116 also contains a C3HC4 zinc-binding motif (RING finger) interspersed between the ATPase motifs in an arrangement similar to that found in the yeast RAD5 and RAD16 proteins. The HIP116 amino terminus is unique among the members of this family, and houses a specific DNA-binding domain. Antiserum raised against HIP116 recognizes a 116-kDa nuclear protein in Western blots and specifically supershifts SV40 and HIV-1 protein-DNA complexes in gel shift experiments. The binding site for HIP116 on the SV40 enhancer directly overlaps the site for TEF-1, and like TEF-1, binding of HIP116 to the SV40 enhancer is destroyed by mutations that inhibit SPH enhancer activity in vivo. Purified fractions of HIP116 display strong ATPase activity that is preferentially stimulated by SPH DNA and can be inhibited specifically by antibodies to HIP116. These findings suggest that HIP116 might affect transcription, directly or indirectly, by acting as a DNA binding site-specific ATPase.

  6. DNA condensing effects and sequence selectivity of DNA binding of antitumor noncovalent polynuclear platinum complexes.

    PubMed

    Malina, Jaroslav; Farrell, Nicholas P; Brabec, Viktor

    2014-02-03

    The noncovalent analogues of antitumor polynuclear platinum complexes represent a structurally discrete class of platinum drugs. Their chemical and biological properties differ significantly from those of most platinum chemotherapeutics, which bind to DNA in a covalent manner by formation of Pt-DNA adducts. In spite of the fact that these noncovalent polynuclear platinum complexes contain no leaving groups, they have been shown to bind to DNA with high affinity. We report here on the DNA condensation properties of a series of noncovalent analogues of antitumor polynuclear platinum complexes described by biophysical and biochemical methods. The results demonstrate that these polynuclear platinum compounds are capable of inducing DNA condensation at more than 1 order of magnitude lower concentrations than conventional spermine. Atomic force microscopy studies of DNA condensation confined to a mica substrate have revealed that the DNA morphologies become more compact with increasing concentration of the platinum complexes. Moreover, we also found that the noncovalent polynuclear platinum complex [{Pt(NH3)3}2-μ-{trans-Pt(NH3)2(NH2(CH2)6NH2)2}](6+) (TriplatinNC-A) binds to DNA in a sequence-dependent manner, namely, to A/T-rich sequences and A-tract regions, and that noncovalent polynuclear platinum complexes protect DNA from enzymatic cleavage by DNase I. The results suggest that mechanisms of antitumor and cytotoxic activities of these complexes may be associated with their unique ability to condense DNA along with their sequence-specific DNA binding. Owing to their high cellular accumulation, it is also reasonable to suggest that their mechanism of action is based on the competition with naturally occurring DNA condensing agents, such as polyamines spermine, spermidine, and putrescine, for intracellular binding sites, resulting in the disturbance of the correct binding of regulatory proteins initiating the onset of apoptosis.

  7. Drosophila Uri, a PP1α binding protein, is essential for viability, maintenance of DNA integrity and normal transcriptional activity

    PubMed Central

    Kirchner, Jasmin; Vissi, Emese; Gross, Sascha; Szoor, Balazs; Rudenko, Andrey; Alphey, Luke; White-Cooper, Helen

    2008-01-01

    Background Protein phosphatase 1 (PP1) is involved in diverse cellular processes, and is targeted to substrates via interaction with many different protein binding partners. PP1 catalytic subunits (PP1c) fall into PP1α and PP1β subfamilies based on sequence analysis, however very few PP1c binding proteins have been demonstrated to discriminate between PP1α and PP1β. Results URI (unconventional prefoldin RPB5 interactor) is a conserved molecular chaperone implicated in a variety of cellular processes, including the transcriptional response to nutrient signalling and maintenance of DNA integrity. We show that Drosophila Uri binds PP1α with much higher affinity than PP1β, and that this ability to discriminate between PP1c forms is conserved to humans. Most Uri is cytoplasmic, however we found some protein associated with active RNAPII on chromatin. We generated a uri loss of function allele, and show that uri is essential for viability in Drosophila. uri mutants have transcriptional defects, reduced cell viability and differentiation in the germline, and accumulate DNA damage in their nuclei. Conclusion Uri is the first PP1α specific binding protein to be described in Drosophila. Uri protein plays a role in transcriptional regulation. Activity of uri is required to maintain DNA integrity and cell survival in normal development. PMID:18412953

  8. The Drosophila telomere-capping protein Verrocchio binds single-stranded DNA and protects telomeres from DNA damage response

    PubMed Central

    Cicconi, Alessandro; Micheli, Emanuela; Vernì, Fiammetta; Jackson, Alison; Gradilla, Ana Citlali; Cipressa, Francesca; Raimondo, Domenico; Bosso, Giuseppe; Wakefield, James G.; Ciapponi, Laura; Cenci, Giovanni; Gatti, Maurizio

    2017-01-01

    Abstract Drosophila telomeres are sequence-independent structures maintained by transposition to chromosome ends of three specialized retroelements rather than by telomerase activity. Fly telomeres are protected by the terminin complex that includes the HOAP, HipHop, Moi and Ver proteins. These are fast evolving, non-conserved proteins that localize and function exclusively at telomeres, protecting them from fusion events. We have previously suggested that terminin is the functional analogue of shelterin, the multi-protein complex that protects human telomeres. Here, we use electrophoretic mobility shift assay (EMSA) and atomic force microscopy (AFM) to show that Ver preferentially binds single-stranded DNA (ssDNA) with no sequence specificity. We also show that Moi and Ver form a complex in vivo. Although these two proteins are mutually dependent for their localization at telomeres, Moi neither binds ssDNA nor facilitates Ver binding to ssDNA. Consistent with these results, we found that Ver-depleted telomeres form RPA and γH2AX foci, like the human telomeres lacking the ssDNA-binding POT1 protein. Collectively, our findings suggest that Drosophila telomeres possess a ssDNA overhang like the other eukaryotes, and that the terminin complex is architecturally and functionally similar to shelterin. PMID:27940556

  9. Assays for the determination of the activity of DNA nucleases based on the fluorometric properties of the YOYO dye.

    PubMed

    Fernández-Sierra, Mónica; Quiñones, Edwin

    2015-03-15

    Here we characterize the fluorescence of the YOYO dye as a tool for studying DNA-protein interactions in real time and present two continuous YOYO-based assays for sensitively monitoring the kinetics of DNA digestion by λ-exonuclease and the endonuclease EcoRV. The described assays rely on the different fluorescence intensities between single- and double-stranded DNA-YOYO complexes, allowing straightforward determination of nuclease activity and quantitative determination of reaction products. The assays were also employed to assess the effect of single-stranded DNA-binding proteins on the λ-exonuclease reaction kinetics, showing that the extreme thermostable single-stranded DNA-binding protein (ET-SSB) significantly reduced the reaction rate, while the recombination protein A (RecA) displayed no effect. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Assembly Architecture and DNA Binding of the Bacteriophage P22 Terminase Small Subunit

    PubMed Central

    Němeček, Daniel; Lander, Gabriel C.; Johnson, John E.; Casjens, Sherwood R.; Thomas, George J.

    2008-01-01

    Summary Morphogenesis of bacteriophage P22 involves the packaging of double-stranded DNA into a preassembled procapsid. DNA is translocated by a powerful virally-encoded molecular motor called terminase, which comprises large (gp2, 499 residues) and small (gp3, 162 residues) subunits. While gp2 contains the phosphohydrolase and endonuclease activities of terminase, the function of gp3 may be to regulate specific and nonspecific modes of DNA recognition as well as the enzymatic activities of gp2. Electron microscopy shows that wildtype gp3 self-assembles into a stable and monodisperse nonameric ring. A three-dimensional reconstruction at 18 Å resolution provides the first glimpse of P22 terminase architecture and implies two distinct modes of interaction with DNA – involving a central channel of 20 Å diameter and radial spikes separated by 34 Å. Electromobility shift assays indicate that the gp3 ring binds dsDNA nonspecifically in vitro via electrostatic interactions between the positively charged C-terminus of gp3 (residues 143–152) and phosphates of the DNA backbone. Raman spectra show that nonameric rings formed by subunits truncated at residue 142 retain the subunit fold, despite the loss of DNA-binding activity. Difference density maps between gp3 rings containing full-length and C-terminally truncated subunits are consistent with localization of residues 143–152 along the central channel of the nonameric ring. The results suggest a plausible molecular mechanism for gp3 function in DNA recognition and translocation. PMID:18775728

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Caberoy, Nora B.; Zhou, Yixiong; Alvarado, Gabriela

    To efficiently elucidate the biological roles of phosphatidylserine (PS), we developed open-reading-frame (ORF) phage display to identify PS-binding proteins. The procedure of phage panning was optimized with a phage clone expressing MFG-E8, a well-known PS-binding protein. Three rounds of phage panning with ORF phage display cDNA library resulted in {approx}300-fold enrichment in PS-binding activity. A total of 17 PS-binding phage clones were identified. Unlike phage display with conventional cDNA libraries, all 17 PS-binding clones were ORFs encoding 13 real proteins. Sequence analysis revealed that all identified PS-specific phage clones had dimeric basic amino acid residues. GST fusion proteins were expressedmore » for 3 PS-binding proteins and verified for their binding activity to PS liposomes, but not phosphatidylcholine liposomes. These results elucidated previously unknown PS-binding proteins and demonstrated that ORF phage display is a versatile technology capable of efficiently identifying binding proteins for non-protein molecules like PS.« less

  12. Comparison of Iron-Binding Ability Between Thr70-NapA and Ser70-NapA of Helicobacter pylori.

    PubMed

    Shan, Weiran; Kung, Hsiang-Fu; Ge, Ruiguang

    2016-06-01

    The neutrophil-activating protein (NapA) of Helicobacter pylori (H. pylori), with DNA-binding and iron seizing properties, is a fundamental virulence factor involved in H. pylori-related diseases. Compared with Ser70-NapA strain, Thr70-NapA strain is more intimately correlated with iron-deficiency anemia. To investigate whether two types of proteins differ in iron-binding ability, mutated Thr70-NapA and Ser70-NapA strains were established. Isothermal titration calorimetry (ITC) method was conducted to measure the binding between the NapA protein and Fe(2+) . The structural changes of NapA protein were also tested during iron interaction by fast protein liquid chromatography (FPLC) and circular dichroism (CD) methods. DNA-binding assay was performed for evaluate the affinity of both mutated and wild types of NapA with DNA. Mutated Thr70-NapA had higher iron-binding ability than wild Ser70-NapA. The structural stability of Thr70-NapA was disrupted and became more active along with the rising concentration of Fe(2+) , whereas no similar association was observed between Ser70-NapA and Fe(2+) level. When the iron/protein molar ratio ranged from 10 to 20, both Ser70-NapA and Thr70-NapA displayed weaker DNA-binding ability. Thr70-NapA has much stronger ability to sequester ferrous ion compared with Ser70-NapA in H. pylori. In addition, the DNA-binding property of NapA is dependent upon the Fe(2+) concentration. © 2015 John Wiley & Sons Ltd.

  13. PEROXISOME PROLIFERATOR-ACTIVATED RECEPTORα (PPARα) AGONISTS DIFFERENTIALLY REGULATE INHIBITOR OF DNA BINDING (ID2) EXPRESSION IN RODENTS AND HUMAN CELLS

    EPA Science Inventory

    Abstract Inhibitor of DNA binding (Id2) is a member of the helix-loop-helix (HLH) transcription factor family whose members play important roles in cell differentiation and proliferation. Id2 has been linked to the development of cardiovascular diseases since thiazolidinediones,...

  14. Cooperation between Catalytic and DNA-binding Domains Enhances Thermostability and Supports DNA Synthesis at Higher Temperatures by Thermostable DNA Polymerases

    PubMed Central

    Pavlov, Andrey R.; Pavlova, Nadejda V.; Kozyavkin, Sergei A.; Slesarev, Alexei I.

    2012-01-01

    We have previously introduced a general kinetic approach for comparative study of processivity, thermostability, and resistance to inhibitors of DNA polymerases (Pavlov et. al., (2002) Proc. Natl. Acad. Sci. USA 99, 13510–13515). The proposed method was successfully applied to characterize hybrid DNA polymerases created by fusing catalytic DNA polymerase domains with various non-specific DNA binding domains. Here we use the developed kinetic analysis to assess basic parameters of DNA elongation by DNA polymerases and to further study the interdomain interactions in both previously constructed and new chimeric DNA polymerases. We show that connecting Helix-hairpin-Helix (HhH) domains to catalytic polymerase domains can increase thermostability, not only of DNA polymerases from extremely thermophilic species, but also of the enzyme from a faculatative thermophilic bacterium Bacillus stearothermophilus. We also demonstrate that addition of TopoV HhH domains extends efficient DNA synthesis by chimerical polymerases up to 105°C by maintaining processivity of DNA synthesis at high temperatures. We also found that reversible high-temperature structural transitions in DNA polymerases decrease the rates of binding of these enzymes to the templates. Furthermore, activation energies and pre-exponential factors of the Arrhenius equation suggest that the mechanism of electrostatic enhancement of diffusion-controlled association plays a minor role in binding templates to DNA polymerases. PMID:22320201

  15. High-affinity DNA-binding Domains of Replication Protein A (RPA) Direct SMARCAL1-dependent Replication Fork Remodeling*

    PubMed Central

    Bhat, Kamakoti P.; Bétous, Rémy; Cortez, David

    2015-01-01

    SMARCAL1 catalyzes replication fork remodeling to maintain genome stability. It is recruited to replication forks via an interaction with replication protein A (RPA), the major ssDNA-binding protein in eukaryotic cells. In addition to directing its localization, RPA also activates SMARCAL1 on some fork substrates but inhibits it on others, thereby conferring substrate specificity to SMARCAL1 fork-remodeling reactions. We investigated the mechanism by which RPA regulates SMARCAL1. Our results indicate that although an interaction between SMARCAL1 and RPA is essential for SMARCAL1 activation, the location of the interacting surface on RPA is not. Counterintuitively, high-affinity DNA binding of RPA DNA-binding domain (DBD) A and DBD-B near the fork junction makes it easier for SMARCAL1 to remodel the fork, which requires removing RPA. We also found that RPA DBD-C and DBD-D are not required for SMARCAL1 regulation. Thus, the orientation of the high-affinity RPA DBDs at forks dictates SMARCAL1 substrate specificity. PMID:25552480

  16. High-affinity DNA-binding domains of replication protein A (RPA) direct SMARCAL1-dependent replication fork remodeling.

    PubMed

    Bhat, Kamakoti P; Bétous, Rémy; Cortez, David

    2015-02-13

    SMARCAL1 catalyzes replication fork remodeling to maintain genome stability. It is recruited to replication forks via an interaction with replication protein A (RPA), the major ssDNA-binding protein in eukaryotic cells. In addition to directing its localization, RPA also activates SMARCAL1 on some fork substrates but inhibits it on others, thereby conferring substrate specificity to SMARCAL1 fork-remodeling reactions. We investigated the mechanism by which RPA regulates SMARCAL1. Our results indicate that although an interaction between SMARCAL1 and RPA is essential for SMARCAL1 activation, the location of the interacting surface on RPA is not. Counterintuitively, high-affinity DNA binding of RPA DNA-binding domain (DBD) A and DBD-B near the fork junction makes it easier for SMARCAL1 to remodel the fork, which requires removing RPA. We also found that RPA DBD-C and DBD-D are not required for SMARCAL1 regulation. Thus, the orientation of the high-affinity RPA DBDs at forks dictates SMARCAL1 substrate specificity. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Presynaptic Filament Dynamics in Homologous Recombination and DNA Repair

    PubMed Central

    Liu, Jie; Ehmsen, Kirk T.; Heyer, Wolf-Dietrich; Morrical, Scott W.

    2014-01-01

    Homologous Recombination (HR) is an essential genome stability mechanism used for high-fidelity repair of DNA double-strand breaks and for the recovery of stalled or collapsed DNA replication forks. The crucial homology search and DNA strand exchange steps of HR are catalyzed by presynaptic filaments—helical filaments of a recombinase enzyme bound to single-stranded DNA. Presynaptic filaments are fundamentally dynamic structures, the assembly, catalytic turnover, and disassembly of which must be closely coordinated with other elements of the DNA recombination, repair, and replication machinery in order for genome maintenance functions to be effective. Here, we review the major dynamic elements controlling the assembly, activity, and disassembly of presynaptic filaments: some intrinsic such as recombinase ATP binding and hydrolytic activities, others extrinsic such as ssDNA-binding proteins, mediator proteins, and DNA motor proteins. We examine dynamic behavior on multiple levels, including atomic- and filament-level structural changes associated with ATP binding and hydrolysis as evidenced in crystal structures, as well as subunit binding and dissociation events driven by intrinsic and extrinsic factors. We examine the biochemical properties of recombination proteins from four model systems (T4 phage, E. coli, S. cerevisiae, and H. sapiens), demonstrating how their properties are tailored for the context-specific requirements in these diverse species. We propose that the presynaptic filament has evolved to rely on multiple external factors for increased multi-level regulation of HR processes in genomes with greater structural and sequence complexity. PMID:21599536

  18. Z-DNA binding protein from chicken blood nuclei

    NASA Technical Reports Server (NTRS)

    Herbert, A. G.; Spitzner, J. R.; Lowenhaupt, K.; Rich, A.

    1993-01-01

    A protein (Z alpha) that appears to be highly specific for the left-handed Z-DNA conformer has been identified in chicken blood nuclear extracts. Z alpha activity is measured in a band-shift assay by using a radioactive probe consisting of a (dC-dG)35 oligomer that has 50% of the deoxycytosines replaced with 5-bromodeoxycytosine. In the presence of 10 mM Mg2+, the probe converts to the Z-DNA conformation and is bound by Z alpha. The binding of Z alpha to the radioactive probe is specifically blocked by competition with linear poly(dC-dG) stabilized in the Z-DNA form by chemical bromination but not by B-form poly(dC-dG) or boiled salmon-sperm DNA. In addition, the binding activity of Z alpha is competitively blocked by supercoiled plasmids containing a Z-DNA insert but not by either the linearized plasmid or by an equivalent amount of the parental supercoiled plasmid without the Z-DNA-forming insert. Z alpha can be crosslinked to the 32P-labeled brominated probe with UV light, allowing us to estimate that the minimal molecular mass of Z alpha is 39 kDa.

  19. DNA cytosine methylation in the bovine leukemia virus promoter is associated with latency in a lymphoma-derived B-cell line: potential involvement of direct inhibition of cAMP-responsive element (CRE)-binding protein/CRE modulator/activation transcription factor binding.

    PubMed

    Pierard, Valérie; Guiguen, Allan; Colin, Laurence; Wijmeersch, Gaëlle; Vanhulle, Caroline; Van Driessche, Benoît; Dekoninck, Ann; Blazkova, Jana; Cardona, Christelle; Merimi, Makram; Vierendeel, Valérie; Calomme, Claire; Nguyên, Thi Liên-Anh; Nuttinck, Michèle; Twizere, Jean-Claude; Kettmann, Richard; Portetelle, Daniel; Burny, Arsène; Hirsch, Ivan; Rohr, Olivier; Van Lint, Carine

    2010-06-18

    Bovine leukemia virus (BLV) proviral latency represents a viral strategy to escape the host immune system and allow tumor development. Besides the previously demonstrated role of histone deacetylation in the epigenetic repression of BLV expression, we showed here that BLV promoter activity was induced by several DNA methylation inhibitors (such as 5-aza-2'-deoxycytidine) and that overexpressed DNMT1 and DNMT3A, but not DNMT3B, down-regulated BLV promoter activity. Importantly, cytosine hypermethylation in the 5'-long terminal repeat (LTR) U3 and R regions was associated with true latency in the lymphoma-derived B-cell line L267 but not with defective latency in YR2 cells. Moreover, the virus-encoded transactivator Tax(BLV) decreased DNA methyltransferase expression levels, which could explain the lower level of cytosine methylation observed in the L267(LTaxSN) 5'-LTR compared with the L267 5'-LTR. Interestingly, DNA methylation inhibitors and Tax(BLV) synergistically activated BLV promoter transcriptional activity in a cAMP-responsive element (CRE)-dependent manner. Mechanistically, methylation at the -154 or -129 CpG position (relative to the transcription start site) impaired in vitro binding of CRE-binding protein (CREB) transcription factors to their respective CRE sites. Methylation at -129 CpG alone was sufficient to decrease BLV promoter-driven reporter gene expression by 2-fold. We demonstrated in vivo the recruitment of CREB/CRE modulator (CREM) and to a lesser extent activating transcription factor-1 (ATF-1) to the hypomethylated CRE region of the YR2 5'-LTR, whereas we detected no CREB/CREM/ATF recruitment to the hypermethylated corresponding region in the L267 cells. Altogether, these findings suggest that site-specific DNA methylation of the BLV promoter represses viral transcription by directly inhibiting transcription factor binding, thereby contributing to true proviral latency.

  20. FANCI-FANCD2 stabilizes the RAD51-DNA complex by binding RAD51 and protects the 5′-DNA end

    PubMed Central

    Sato, Koichi; Shimomuki, Mayo; Katsuki, Yoko; Takahashi, Daisuke; Kobayashi, Wataru; Ishiai, Masamichi; Miyoshi, Hiroyuki; Takata, Minoru; Kurumizaka, Hitoshi

    2016-01-01

    The FANCI-FANCD2 (I-D) complex is considered to work with RAD51 to protect the damaged DNA in the stalled replication fork. However, the means by which this DNA protection is accomplished have remained elusive. In the present study, we found that the I-D complex directly binds to RAD51, and stabilizes the RAD51-DNA filament. Unexpectedly, the DNA binding activity of FANCI, but not FANCD2, is explicitly required for the I-D complex-mediated RAD51-DNA filament stabilization. The RAD51 filament stabilized by the I-D complex actually protects the DNA end from nucleolytic degradation by an FA-associated nuclease, FAN1. This DNA end protection is not observed with the RAD51 mutant from FANCR patient cells. These results clearly answer the currently enigmatic question of how RAD51 functions with the I-D complex to prevent genomic instability at the stalled replication fork. PMID:27694619

  1. The RecX protein interacts with the RecA protein and modulates its activity in Herbaspirillum seropedicae

    PubMed Central

    Galvão, C.W.; Souza, E.M.; Etto, R.M.; Pedrosa, F.O.; Chubatsu, L.S.; Yates, M.G.; Schumacher, J.; Buck, M.; Steffens, M.B.R.

    2012-01-01

    DNA repair is crucial to the survival of all organisms. The bacterial RecA protein is a central component in the SOS response and in recombinational and SOS DNA repairs. The RecX protein has been characterized as a negative modulator of RecA activity in many bacteria. The recA and recX genes of Herbaspirillum seropedicae constitute a single operon, and evidence suggests that RecX participates in SOS repair. In the present study, we show that the H. seropedicae RecX protein (RecXHs) can interact with the H. seropedicae RecA protein (RecAHs) and that RecAHs possesses ATP binding, ATP hydrolyzing and DNA strand exchange activities. RecXHs inhibited 90% of the RecAHs DNA strand exchange activity even when present in a 50-fold lower molar concentration than RecAHs. RecAHs ATP binding was not affected by the addition of RecX, but the ATPase activity was reduced. When RecXHs was present before the formation of RecA filaments (RecA-ssDNA), inhibition of ATPase activity was substantially reduced and excess ssDNA also partially suppressed this inhibition. The results suggest that the RecXHs protein negatively modulates the RecAHs activities by protein-protein interactions and also by DNA-protein interactions. PMID:23044625

  2. Molecular mechanisms by which oxidative DNA damage promotes telomerase activity.

    PubMed

    Lee, Hui-Ting; Bose, Arindam; Lee, Chun-Ying; Opresko, Patricia L; Myong, Sua

    2017-11-16

    Telomeres are highly susceptible to oxidative DNA damage, which if left unrepaired can lead to dysregulation of telomere length homeostasis. Here we employed single molecule FRET, single molecule pull-down and biochemical analysis to investigate how the most common oxidative DNA lesions, 8-oxoguanine (8oxoG) and thymine glycol (Tg), regulate the structural properties of telomeric DNA and telomerase extension activity. In contrast to 8oxoG which disrupts the telomeric DNA structure, Tg exhibits substantially reduced perturbation of G-quadruplex folding. As a result, 8oxoG induces high accessibility, whereas Tg retains limited accessibility, of telomeric G-quadruplex DNA to complementary single stranded DNA and to telomere binding protein POT1. Surprisingly, the Tg lesion stimulates telomerase loading and activity to a similar degree as an 8oxoG lesion. We demonstrate that this unexpected stimulation arises from Tg-induced conformational alterations and dynamics in telomeric DNA. Despite impacting structure by different mechanisms, both 8oxoG and Tg enhance telomerase binding and extension activity to the same degree, potentially contributing to oncogenesis. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. NOTCH1 Inhibits Activation of ATM by Impairing the Formation of an ATM-FOXO3a-KAT5/Tip60 Complex.

    PubMed

    Adamowicz, Marek; Vermezovic, Jelena; d'Adda di Fagagna, Fabrizio

    2016-08-23

    The DNA damage response (DDR) signal transduction pathway is responsible for sensing DNA damage and further relaying this signal into the cell. ATM is an apical DDR kinase that orchestrates the activation and the recruitment of downstream DDR factors to induce cell-cycle arrest and repair. We have previously shown that NOTCH1 inhibits ATM activation upon DNA damage, but the underlying mechanism remains unclear. Here, we show that NOTCH1 does not impair ATM recruitment to DNA double-strand breaks (DSBs). Rather, NOTCH1 prevents binding of FOXO3a and KAT5/Tip60 to ATM through a mechanism in which NOTCH1 competes with FOXO3a for ATM binding. Lack of FOXO3a binding to ATM leads to the loss of KAT5/Tip60 association with ATM. Moreover, expression of NOTCH1 or depletion of ATM impairs the formation of the FOXO3a-KAT5/Tip60 protein complex. Finally, we show that pharmacological induction of FOXO3a nuclear localization sensitizes NOTCH1-driven cancers to DNA-damage-induced cell death. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  4. Preliminary crystallographic analysis of mouse Elf3 C-terminal DNA-binding domain in complex with type II TGF-[beta] receptor promoter DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Agarkar, Vinod B.; Babayeva, Nigar D.; Rizzino, Angie

    2010-10-08

    Ets proteins are transcription factors that activate or repress the expression of genes that are involved in various biological processes, including cellular proliferation, differentiation, development, transformation and apoptosis. Like other Ets-family members, Elf3 functions as a sequence-specific DNA-binding transcriptional factor. A mouse Elf3 C-terminal fragment (amino-acid residues 269-371) containing the DNA-binding domain has been crystallized in complex with mouse type II TGF-{beta} receptor promoter (TR-II) DNA. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 42.66, b = 52, c = 99.78 {angstrom}, and diffracted to a resolution of 2.2 {angstrom}.

  5. Paradoxical Role of DNA Methylation in Activation of FoxA2 Gene Expression during Endoderm Development*

    PubMed Central

    Bahar Halpern, Keren; Vana, Tal; Walker, Michael D.

    2014-01-01

    The transcription factor FoxA2 is a master regulator of endoderm development and pancreatic beta cell gene expression. To elucidate the mechanisms underlying the activation of the FoxA2 gene during differentiation, we have compared the epigenetic status of undifferentiated human embryonic stem cells (hESCs), hESC-derived early endoderm stage cells (CXCR4+ cells), and pancreatic islet cells. Unexpectedly, a CpG island in the promoter region of the FoxA2 gene displayed paradoxically high levels of DNA methylation in expressing tissues (CXCR4+, islets) and low levels in nonexpressing tissues. This CpG island region was found to repress reporter gene expression and bind the Polycomb group protein SUZ12 and the DNA methyltransferase (DNMT)3b preferentially in undifferentiated hESCs as compared with CXCR4+ or islets cells. Consistent with this, activation of FoxA2 gene expression, but not CXCR4 or SOX17, was strongly inhibited by 5-aza-2′-deoxycytidine and by knockdown of DNMT3b. We hypothesize that in nonexpressing tissues, the lack of DNA methylation allows the binding of DNA methyltransferases and repressing proteins, such as Polycomb group proteins; upon differentiation, DNMT activation leads to CpG island methylation, causing loss of repressor protein binding. These results suggest a novel and unexpected role for DNA methylation in the activation of FoxA2 gene expression during differentiation. PMID:25016019

  6. The artificial zinc finger coding gene 'Jazz' binds the utrophin promoter and activates transcription.

    PubMed

    Corbi, N; Libri, V; Fanciulli, M; Tinsley, J M; Davies, K E; Passananti, C

    2000-06-01

    Up-regulation of utrophin gene expression is recognized as a plausible therapeutic approach in the treatment of Duchenne muscular dystrophy (DMD). We have designed and engineered new zinc finger-based transcription factors capable of binding and activating transcription from the promoter of the dystrophin-related gene, utrophin. Using the recognition 'code' that proposes specific rules between zinc finger primary structure and potential DNA binding sites, we engineered a new gene named 'Jazz' that encodes for a three-zinc finger peptide. Jazz belongs to the Cys2-His2 zinc finger type and was engineered to target the nine base pair DNA sequence: 5'-GCT-GCT-GCG-3', present in the promoter region of both the human and mouse utrophin gene. The entire zinc finger alpha-helix region, containing the amino acid positions that are crucial for DNA binding, was specifically chosen on the basis of the contacts more frequently represented in the available list of the 'code'. Here we demonstrate that Jazz protein binds specifically to the double-stranded DNA target, with a dissociation constant of about 32 nM. Band shift and super-shift experiments confirmed the high affinity and specificity of Jazz protein for its DNA target. Moreover, we show that chimeric proteins, named Gal4-Jazz and Sp1-Jazz, are able to drive the transcription of a test gene from the human utrophin promoter.

  7. MeDReaders: a database for transcription factors that bind to methylated DNA.

    PubMed

    Wang, Guohua; Luo, Ximei; Wang, Jianan; Wan, Jun; Xia, Shuli; Zhu, Heng; Qian, Jiang; Wang, Yadong

    2018-01-04

    Understanding the molecular principles governing interactions between transcription factors (TFs) and DNA targets is one of the main subjects for transcriptional regulation. Recently, emerging evidence demonstrated that some TFs could bind to DNA motifs containing highly methylated CpGs both in vitro and in vivo. Identification of such TFs and elucidation of their physiological roles now become an important stepping-stone toward understanding the mechanisms underlying the methylation-mediated biological processes, which have crucial implications for human disease and disease development. Hence, we constructed a database, named as MeDReaders, to collect information about methylated DNA binding activities. A total of 731 TFs, which could bind to methylated DNA sequences, were manually curated in human and mouse studies reported in the literature. In silico approaches were applied to predict methylated and unmethylated motifs of 292 TFs by integrating whole genome bisulfite sequencing (WGBS) and ChIP-Seq datasets in six human cell lines and one mouse cell line extracted from ENCODE and GEO database. MeDReaders database will provide a comprehensive resource for further studies and aid related experiment designs. The database implemented unified access for users to most TFs involved in such methylation-associated binding actives. The website is available at http://medreader.org/. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. Effective Design of Multifunctional Peptides by Combining Compatible Functions

    PubMed Central

    Diener, Christian; Garza Ramos Martínez, Georgina; Moreno Blas, Daniel; Castillo González, David A.; Corzo, Gerardo; Castro-Obregon, Susana; Del Rio, Gabriel

    2016-01-01

    Multifunctionality is a common trait of many natural proteins and peptides, yet the rules to generate such multifunctionality remain unclear. We propose that the rules defining some protein/peptide functions are compatible. To explore this hypothesis, we trained a computational method to predict cell-penetrating peptides at the sequence level and learned that antimicrobial peptides and DNA-binding proteins are compatible with the rules of our predictor. Based on this finding, we expected that designing peptides for CPP activity may render AMP and DNA-binding activities. To test this prediction, we designed peptides that embedded two independent functional domains (nuclear localization and yeast pheromone activity), linked by optimizing their composition to fit the rules characterizing cell-penetrating peptides. These peptides presented effective cell penetration, DNA-binding, pheromone and antimicrobial activities, thus confirming the effectiveness of our computational approach to design multifunctional peptides with potential therapeutic uses. Our computational implementation is available at http://bis.ifc.unam.mx/en/software/dcf. PMID:27096600

  9. RSK2 represses HSF1 activation during heat shock

    PubMed Central

    Wang, Xiaozhe; Asea, Alexzander; Xie, Yue; Kabingu, Edith; Stevenson, Mary Ann; Calderwood, Stuart K.

    2000-01-01

    Heat shock transcription factor 1(HSF1) activation is a multistep process. The conversion of a latent cytoplasmic form to a nuclear, DNA binding state appears to be activated by nonsteroidal anti-inflammatory drugs. In previous studies, we showed that HSF 1 is phosphorylated by the protein kinase RSK2 in vitro and that this effect is inhibited by nonsteroidal anti-inflammatory drugs at the concentration that leads to the activation of HSF1 in vivo (Stevenson et al 1999). In the present study, using cells from a patient with Coffin-Lowry syndrome (deficient in RSK2), we demonstrate that RSK2 slightly represses activation of HSF1 in vivo at 37°C. In Coffin-Lowry syndrome cells, HSF1-HSE DNA binding activity after treatment with sodium salicylate was slightly higher than that in untreated cells, indicating that although RSK2 is involved in HSF1 regulation, it is not the unique protein kinase that suppresses HSF1-HSE binding activity at 37°C. However, heat shock treatment resulted in significantly higher HSF1-HSE binding activity in Coffin-Lowry syndrome cells as compared with normal controls, suggesting that RSK2 represses HSF1-HSE binding activity during heat shock. PMID:11189448

  10. RSK2 represses HSF1 activation during heat shock.

    PubMed

    Wang, X; Asea, A; Xie, Y; Kabingu, E; Stevenson, M A; Calderwood, S K

    2000-11-01

    Heat shock transcription factor 1(HSF1) activation is a multistep process. The conversion of a latent cytoplasmic form to a nuclear, DNA binding state appears to be activated by nonsteroidal anti-inflammatory drugs. In previous studies, we showed that HSF 1 is phosphorylated by the protein kinase RSK2 in vitro and that this effect is inhibited by nonsteroidal anti-inflammatory drugs at the concentration that leads to the activation of HSF1 in vivo (Stevenson et al 1999). In the present study, using cells from a patient with Coffin-Lowry syndrome (deficient in RSK2), we demonstrate that RSK2 slightly represses activation of HSF1 in vivo at 37 degrees C. In Coffin-Lowry syndrome cells, HSF1-HSE DNA binding activity after treatment with sodium salicylate was slightly higher than that in untreated cells, indicating that although RSK2 is involved in HSF1 regulation, it is not the unique protein kinase that suppresses HSF1-HSE binding activity at 37 degrees C. However, heat shock treatment resulted in significantly higher HSF1-HSE binding activity in Coffin-Lowry syndrome cells as compared with normal controls, suggesting that RSK2 represses HSF1-HSE binding activity during heat shock.

  11. Molecular and functional characterization of single-box high-mobility group B (HMGB) chromosomal protein from Aedes aegypti.

    PubMed

    de Abreu da Silva, Isabel Caetano; Vicentino, Amanda Roberta Revoredo; Dos Santos, Renata Coutinho; da Fonseca, Rodrigo Nunes; de Mendonça Amarante, Anderson; Carneiro, Vitor Coutinho; de Amorim Pinto, Marcia; Aguilera, Estefania Anahi; Mohana-Borges, Ronaldo; Bisch, Paulo Mascarello; da Silva-Neto, Mario Alberto Cardoso; Fantappié, Marcelo Rosado

    2018-05-30

    High-mobility group B (HMGB) proteins have highly conserved, unique DNA-binding domains, HMG boxes, that can bind non-B-type DNA structures, such as bent, kinked and unwound structures, with high affinity. HMGB proteins also promote DNA bending, looping and unwinding. In this study, we determined the role of the Aedes aegypti single HMG-box domain protein AaHMGB; characterized its structure, spatiotemporal expression levels, subcellular localization, and nucleic acid binding activities; and compared these properties with those of its double-HMG-box counterpart protein, AaHMGB1. Via qRT-PCR, we showed that AaHMGB is expressed at much higher levels than AaHMGB1 throughout mosquito development. In situ hybridization results suggested a role for AaHMGB and AaHMGB1 during embryogenesis. Immunolocalization in the midgut revealed that AaHMGB is exclusively nuclear. Circular dichroism and fluorescence spectroscopy analyses showed that AaHMGB exhibits common features of α-helical structures and is more stably folded than AaHMGB1, likely due to the presence of one or two HMG boxes. Using several DNA substrates or single-stranded RNAs as probes, we observed significant differences between AaHMGB and AaHMGB1 in terms of their binding patterns, activity and/or specificity. Importantly, we showed that the phosphorylation of AaHMGB plays a critical role in its DNA-binding activity. Our study provides additional insight into the roles of single- versus double-HMG-box-containing proteins in nucleic acid interactions for better understanding of mosquito development, physiology and homeostasis. Copyright © 2017. Published by Elsevier B.V.

  12. Structure solution of DNA-binding proteins and complexes with ARCIMBOLDO libraries

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pröpper, Kevin; Instituto de Biologia Molecular de Barcelona; Meindl, Kathrin

    2014-06-01

    The structure solution of DNA-binding protein structures and complexes based on the combination of location of DNA-binding protein motif fragments with density modification in a multi-solution frame is described. Protein–DNA interactions play a major role in all aspects of genetic activity within an organism, such as transcription, packaging, rearrangement, replication and repair. The molecular detail of protein–DNA interactions can be best visualized through crystallography, and structures emphasizing insight into the principles of binding and base-sequence recognition are essential to understanding the subtleties of the underlying mechanisms. An increasing number of high-quality DNA-binding protein structure determinations have been witnessed despite themore » fact that the crystallographic particularities of nucleic acids tend to pose specific challenges to methods primarily developed for proteins. Crystallographic structure solution of protein–DNA complexes therefore remains a challenging area that is in need of optimized experimental and computational methods. The potential of the structure-solution program ARCIMBOLDO for the solution of protein–DNA complexes has therefore been assessed. The method is based on the combination of locating small, very accurate fragments using the program Phaser and density modification with the program SHELXE. Whereas for typical proteins main-chain α-helices provide the ideal, almost ubiquitous, small fragments to start searches, in the case of DNA complexes the binding motifs and DNA double helix constitute suitable search fragments. The aim of this work is to provide an effective library of search fragments as well as to determine the optimal ARCIMBOLDO strategy for the solution of this class of structures.« less

  13. Switching bonds in a DNA gel: an all-DNA vitrimer.

    PubMed

    Romano, Flavio; Sciortino, Francesco

    2015-02-20

    We design an all-DNA system that behaves like vitrimers, innovative plastics with self-healing and stress-releasing properties. The DNA sequences are engineered to self-assemble first into tetra- and bifunctional units which, upon further cooling, bind to each other forming a fully bonded network gel. An innovative design of the binding regions of the DNA sequences, exploiting a double toehold-mediated strand displacement, generates a network gel which is able to reshuffle its bonds, retaining at all times full bonding. As in vitrimers, the rate of bond switching can be controlled via a thermally activated catalyst, which in the present design is very short DNA strands.

  14. Human PrimPol activity is enhanced by RPA.

    PubMed

    Martínez-Jiménez, María I; Lahera, Antonio; Blanco, Luis

    2017-04-10

    Human PrimPol is a primase belonging to the AEP superfamily with the unique ability to synthesize DNA primers de novo, and a non-processive DNA polymerase able to bypass certain DNA lesions. PrimPol facilitates both mitochondrial and nuclear replication fork progression either acting as a conventional TLS polymerase, or repriming downstream of blocking lesions. In vivo assays have shown that PrimPol is rapidly recruited to sites of DNA damage by interaction with the human replication protein A (RPA). In agreement with previous findings, we show here that the higher affinity of RPA for ssDNA inhibits PrimPol activities in short ssDNA templates. In contrast, once the amount of ssDNA increases up to a length in which both proteins can simultaneously bind ssDNA, as expected during replicative stress conditions, PrimPol and RPA functionally interact, and their binding capacities are mutually enhanced. When using M13 ssDNA as template, RPA stimulated both the primase and polymerase activities of PrimPol, either alone or in synergy with Polε. These new findings supports the existence of a functional PrimPol/RPA association that allows repriming at the exposed ssDNA regions formed in the leading strand upon replicase stalling.

  15. Structure of the E2 DNA-binding domain from human papillomavirus serotype 31 at 2.4 A.

    PubMed

    Bussiere, D E; Kong, X; Egan, D A; Walter, K; Holzman, T F; Lindh, F; Robins, T; Giranda, V L

    1998-11-01

    The papillomaviruses are a family of small double-stranded DNA viruses which exclusively infect epithelial cells and stimulate the proliferation of those cells. A key protein within the papillomavirus life-cycle is known as the E2 (Early 2) protein and is responsible for regulating viral transcription from all viral promoters as well as for replication of the papillomavirus genome in tandem with another protein known as E1. The E2 protein itself consists of three functional domains: an N-terminal trans-activation domain, a proline-rich linker, and a C-terminal DNA-binding domain. The first crystal structure of the human papillomavirus, serotype 31 (HPV-31), E2 DNA-binding domain has been determined at 2.4 A resolution. The HPV DNA-binding domain monomer consists of two beta-alpha-beta repeats of approximately equal length and is arranged as to have an anti-parallel beta-sheet flanked by the two alpha-helices. The monomers form the functional in vivo dimer by association of the beta-sheets of each monomer so as to form an eight-stranded anti-parallel beta-barrel at the center of the dimer, with the alpha-helices lining the outside of the barrel. The overall structure of HVP-31 E2 DNA-binding domain is similar to both the bovine papillomavirus E2-binding domain and the Epstein-Barr nuclear antigen-1 DNA-binding domain.

  16. Selective Inhibition of the Human tie-1 Promoter with Triplex-Forming Oligonucleotides Targeted to Ets Binding Sites

    PubMed Central

    Hewett, Peter W; Daft, Emma L; Laughton, Charles A; Ahmad, Shakil; Ahmed, Asif; Murray, J Clifford

    2006-01-01

    The Tie receptors (Tie-1 and Tie-2/Tek) are essential for angiogenesis and vascular remodeling/integrity. Tie receptors are up-regulated in tumor-associated endothelium, and their inhibition disrupts angiogenesis and can prevent tumor growth as a consequence. To investigate the potential of anti-gene approaches to inhibit tie gene expression for anti-angiogenic therapy, we have examined triple-helical (triplex) DNA formation at 2 tandem Ets transcription factor binding motifs (designated E-1 and E-2) in the human tie-1 promoter. Various tie-1 promoter deletion/mutation luciferase reporter constructs were generated and transfected into endothelial cells to examine the relative activities of E-1 and E-2. The binding of antiparallel and parallel (control) purine motif oligonucleotides (21–22 bp) targeted to E-1 and E-2 was assessed by plasmid DNA fragment binding and electrophoretic mobility shift assays. Triplex-forming oligonucleotides were incubated with tie-1 reporter constructs and transfected into endothelial cells to determine their activity. The Ets binding motifs in the E-1 sequence were essential for human tie-1 promoter activity in endothelial cells, whereas the deletion of E-2 had no effect. Antiparallel purine motif oligonucleotides targeted at E-1 or E-2 selectively formed strong triplex DNA (Kd ~10−7 M) at 37 °C. Transfection of tie-1 reporter constructs with triplex DNA at E-1, but not E-2, specifically inhibited tie-1 promoter activity by up to 75% compared with control oligonucleotides in endothelial cells. As similar multiple Ets binding sites are important for the regulation of several endothelial-restricted genes, this approach may have broad therapeutic potential for cancer and other pathologies involving endothelial proliferation/dysfunction. PMID:16838069

  17. Selective inhibition of the human tie-1 promoter with triplex-forming oligonucleotides targeted to Ets binding sites.

    PubMed

    Hewett, Peter W; Daft, Emma L; Laughton, Charles A; Ahmad, Shakil; Ahmed, Asif; Murray, J Clifford

    2006-01-01

    The Tie receptors (Tie-1 and Tie-2/Tek) are essential for angiogenesis and vascular remodeling/integrity. Tie receptors are up-regulated in tumor-associated endothelium, and their inhibition disrupts angiogenesis and can prevent tumor growth as a consequence. To investigate the potential of anti-gene approaches to inhibit tie gene expression for anti-angiogenic therapy, we have examined triple-helical (triplex) DNA formation at 2 tandem Ets transcription factor binding motifs (designated E-1 and E-2) in the human tie-1 promoter. Various tie-1 promoter deletion/mutation luciferase reporter constructs were generated and transfected into endothelial cells to examine the relative activities of E-1 and E-2. The binding of antiparallel and parallel (control) purine motif oligonucleotides (21-22 bp) targeted to E-1 and E-2 was assessed by plasmid DNA fragment binding and electrophoretic mobility shift assays. Triplex-forming oligonucleotides were incubated with tie-1 reporter constructs and transfected into endothelial cells to determine their activity. The Ets binding motifs in the E-1 sequence were essential for human tie-1 promoter activity in endothelial cells, whereas the deletion of E-2 had no effect. Antiparallel purine motif oligonucleotides targeted at E-1 or E-2 selectively formed strong triplex DNA (K(d) approximately 10(-7) M) at 37 degrees C. Transfection of tie-1 reporter constructs with triplex DNA at E-1, but not E-2, specifically inhibited tie-1 promoter activity by up to 75% compared with control oligonucleotides in endothelial cells. As similar multiple Ets binding sites are important for the regulation of several endothelial-restricted genes, this approach may have broad therapeutic potential for cancer and other pathologies involving endothelial proliferation/dysfunction.

  18. RPA and Rad51 constitute a cell intrinsic mechanism to protect the cytosol from self DNA.

    PubMed

    Wolf, Christine; Rapp, Alexander; Berndt, Nicole; Staroske, Wolfgang; Schuster, Max; Dobrick-Mattheuer, Manuela; Kretschmer, Stefanie; König, Nadja; Kurth, Thomas; Wieczorek, Dagmar; Kast, Karin; Cardoso, M Cristina; Günther, Claudia; Lee-Kirsch, Min Ae

    2016-05-27

    Immune recognition of cytosolic DNA represents a central antiviral defence mechanism. Within the host, short single-stranded DNA (ssDNA) continuously arises during the repair of DNA damage induced by endogenous and environmental genotoxic stress. Here we show that short ssDNA traverses the nuclear membrane, but is drawn into the nucleus by binding to the DNA replication and repair factors RPA and Rad51. Knockdown of RPA and Rad51 enhances cytosolic leakage of ssDNA resulting in cGAS-dependent type I IFN activation. Mutations in the exonuclease TREX1 cause type I IFN-dependent autoinflammation and autoimmunity. We demonstrate that TREX1 is anchored within the outer nuclear membrane to ensure immediate degradation of ssDNA leaking into the cytosol. In TREX1-deficient fibroblasts, accumulating ssDNA causes exhaustion of RPA and Rad51 resulting in replication stress and activation of p53 and type I IFN. Thus, the ssDNA-binding capacity of RPA and Rad51 constitutes a cell intrinsic mechanism to protect the cytosol from self DNA.

  19. Chk1 Promotes DNA Damage Response Bypass following Oxidative Stress in a Model of Hydrogen Peroxide-Associated Ulcerative Colitis through JNK Inactivation and Chromatin Binding.

    PubMed

    Reissig, Kathrin; Silver, Andrew; Hartig, Roland; Schinlauer, Antje; Walluscheck, Diana; Guenther, Thomas; Siedentopf, Sandra; Ross, Jochen; Vo, Diep-Khanh; Roessner, Albert; Poehlmann-Nitsche, Angela

    2017-01-01

    Dysregulation of c-Jun N -terminal kinase (JNK) activation promoted DNA damage response bypass and tumorigenesis in our model of hydrogen peroxide-associated ulcerative colitis (UC) and in patients with quiescent UC (QUC), UC-related dysplasia, and UC-related carcinoma (UC-CRC), thereby adapting to oxidative stress. In the UC model, we have observed features of oncogenic transformation: increased proliferation, undetected DNA damage, and apoptosis resistance. Here, we show that Chk1 was downregulated but activated in the acute and quiescent chronic phases. In both phases, Chk1 was linked to DNA damage response bypass by suppressing JNK activation following oxidative stress, promoting cell cycle progression despite DNA damage. Simultaneously, activated Chk1 was bound to chromatin. This triggered histone acetylation and the binding of histone acetyltransferases and transcription factors to chromatin. Thus, chromatin-immobilized activated Chk1 executed a dual function by suppressing DNA damage response and simultaneously inducing chromatin modulation. This caused undetected DNA damage and increased cellular proliferation through failure to transmit the appropriate DNA damage signal. Findings in vitro were corroborated by chromatin accumulation of activated Chk1, Ac-H3, Ac-H4, and c-Jun in active UC (AUC) in vivo. Targeting chromatin-bound Chk1, GCN5, PCAF, and p300/CBP could be a novel therapeutic strategy to prevent UC-related tumor progression.

  20. Novobiocin: redesigning a DNA gyrase inhibitor for selective inhibition of hsp90.

    PubMed

    Burlison, Joseph A; Neckers, Len; Smith, Andrew B; Maxwell, Anthony; Blagg, Brian S J

    2006-12-06

    Novobiocin is a member of the coumermycin family of antibiotics and is a well-established inhibitor of DNA gyrase. Recent studies have shown that novobiocin binds to a previously unrecognized ATP-binding site at the C-terminus of Hsp90 and induces degradation of Hsp90-dependent client proteins at approximately 700 microM. In an effort to develop more efficacious inhibitors of the C-terminal binding site, a library of novobiocin analogues was prepared and initial structure-activity relationships revealed. These data suggested that the 4-hydroxy moiety of the coumarin ring and the 3'-carbamate of the noviose appendage were detrimental to Hsp90 inhibitory activity. In an effort to confirm these findings, 4-deshydroxy novobiocin (DHN1) and 3'-descarbamoyl-4-deshydroxynovobiocin (DHN2) were prepared and evaluated against Hsp90. Both compounds were significantly more potent than the natural product, and DHN2 proved to be more active than DHN1. In an effort to determine whether these moieties are important for DNA gyrase inhibition, these compounds were tested for their ability to inhibit DNA gyrase and found to exhibit significant reduction in gyrase activity. Thus, we have established the first set of compounds that clearly differentiate between the C-terminus of Hsp90 and DNA gyrase, converted a well-established gyrase inhibitor into a selective Hsp90 inhibitor, and confirmed essential structure-activity relationships for the coumermycin family of antibiotics.

  1. Azadirachtin interacts with retinoic acid receptors and inhibits retinoic acid-mediated biological responses.

    PubMed

    Thoh, Maikho; Babajan, Banaganapalli; Raghavendra, Pongali B; Sureshkumar, Chitta; Manna, Sunil K

    2011-02-11

    Considering the role of retinoids in regulation of more than 500 genes involved in cell cycle and growth arrest, a detailed understanding of the mechanism and its regulation is useful for therapy. The extract of the medicinal plant Neem (Azadirachta indica) is used against several ailments especially for anti-inflammatory, anti-itching, spermicidal, anticancer, and insecticidal activities. In this report we prove the detailed mechanism on the regulation of retinoic acid-mediated cell signaling by azadirachtin, active components of neem extract. Azadirachtin repressed all trans-retinoic acid (ATRA)-mediated nuclear transcription factor κB (NF-κB) activation, not the DNA binding but the NF-κB-dependent gene expression. It did not inhibit IκBα degradation, IκBα kinase activity, or p65 phosphorylation and its nuclear translocation but inhibited NF-κB-dependent reporter gene expression. Azadirachtin inhibited TRAF6-mediated, but not TRAF2-mediated NF-κB activation. It inhibited ATRA-induced Sp1 and CREB (cAMP-response element-binding protein) DNA binding. Azadirachtin inhibited ATRA binding with retinoid receptors, which is supported by biochemical and in silico evidences. Azadirachtin showed strong interaction with retinoid receptors. It suppressed ATRA-mediated removal of retinoid receptors, bound with DNA by inhibiting ATRA binding to its receptors. Overall, our data suggest that azadirachtin interacts with retinoic acid receptors and suppresses ATRA binding, inhibits falling off the receptors, and activates transcription factors like CREB, Sp1, NF-κB, etc. Thus, azadirachtin exerts anti-inflammatory and anti-metastatic responses by a novel pathway that would be beneficial for further anti-inflammatory and anti-cancer therapies.

  2. Requirement for transient metal ions revealed through computational analysis for DNA polymerase going in reverse

    PubMed Central

    Perera, Lalith; Freudenthal, Bret D.; Beard, William A.; Shock, David D.; Pedersen, Lee G.; Wilson, Samuel H.

    2015-01-01

    DNA polymerases facilitate faithful insertion of nucleotides, a central reaction occurring during DNA replication and repair. DNA synthesis (forward reaction) is “balanced,” as dictated by the chemical equilibrium by the reverse reaction of pyrophosphorolysis. Two closely spaced divalent metal ions (catalytic and nucleotide-binding metals) provide the scaffold for these reactions. The catalytic metal lowers the pKa of O3′ of the growing primer terminus, and the nucleotide-binding metal facilitates substrate binding. Recent time-lapse crystallographic studies of DNA polymerases have identified an additional metal ion (product metal) associated with pyrophosphate formation, leading to the suggestion of its possible involvement in the reverse reaction. Here, we establish a rationale for a role of the product metal using quantum mechanical/molecular mechanical calculations of the reverse reaction in the confines of the DNA polymerase β active site. Additionally, site-directed mutagenesis identifies essential residues and metal-binding sites necessary for pyrophosphorolysis. The results indicate that the catalytic metal site must be occupied by a magnesium ion for pyrophosphorolysis to occur. Critically, the product metal site is occupied by a magnesium ion early in the pyrophosphorolysis reaction path but must be removed later. The proposed dynamic nature of the active site metal ions is consistent with crystallographic structures. The transition barrier for pyrophosphorolysis was estimated to be significantly higher than that for the forward reaction, consistent with kinetic activity measurements of the respective reactions. These observations provide a framework to understand how ions and active site changes could modulate the internal chemical equilibrium of a reaction that is central to genome stability. PMID:26351676

  3. The activity of CouR, a MarR family transcriptional regulator, is modulated through a novel molecular mechanism

    DOE PAGES

    Otani, Hiroshi; Stogios, Peter J.; Xu, Xiaohui; ...

    2015-09-22

    CouR, a MarR-type transcriptional repressor, regulates the cou genes, encoding p-hydroxycinnamate catabolism in the soil bacterium Rhodococcus jostii RHA1. The CouR dimer bound two molecules of the catabolite p-coumaroyl–CoA (K d = 11 ± 1 μM). The presence of p-coumaroyl–CoA, but neither p-coumarate nor CoASH, abrogated CouR's binding to its operator DNA in vitro. The crystal structures of ligand-free CouR and its p-coumaroyl–CoA-bound form showed no significant conformational differences, in contrast to other MarR regulators. The CouR– p-coumaroyl–CoA structure revealed two ligand molecules bound to the CouR dimer with their phenolic moieties occupying equivalent hydrophobic pockets in each protomer andmore » their CoA moieties adopting non-equivalent positions to mask the regulator's predicted DNA-binding surface. More specifically, the CoA phosphates formed salt bridges with predicted DNA-binding residues Arg36 and Arg38, changing the overall charge of the DNA-binding surface. The substitution of either arginine with alanine completely abrogated the ability of CouR to bind DNA. By contrast, the R36A/R38A double variant retained a relatively high affinity for p-coumaroyl–CoA (K d = 89 ± 6 μM). Altogether, our data point to a novel mechanism of action in which the ligand abrogates the repressor's ability to bind DNA by steric occlusion of key DNA-binding residues and charge repulsion of the DNA backbone.« less

  4. Autoinhibition of ETV6 DNA Binding Is Established by the Stability of Its Inhibitory Helix

    PubMed Central

    De, Soumya; Okon, Mark; Graves, Barbara J.; McIntosh, Lawrence P.

    2017-01-01

    The ETS transcriptional repressor ETV6 (or TEL) is autoinhibited by an α-helix that sterically blocks its DNA-binding ETS domain. The inhibitory helix is marginally stable and unfolds when ETV6 binds to either specific or non-specific DNA. Using NMR spectroscopy, we show that folding of the inhibitory helix requires a buried charge–dipole interaction with helix H1 of the ETS domain. This interaction also contributes directly to autoinhibition by precluding a highly conserved dipole-enhanced hydrogen bond between the phosphodiester backbone of bound DNA and the N terminus of helix H1. To probe further the thermodynamic basis of autoinhibition, ETV6 variants were generated with amino acid substitutions introduced along the solvent exposed surface of the inhibitory helix. These changes were designed to increase the intrinsic helical propensity of the inhibitory helix without perturbing its packing interactions with the ETS domain. NMR-monitored amide hydrogen exchange measurements confirmed that the stability of the folded inhibitory helix increases progressively with added helix-promoting substitutions. This also results in progressively reinforced autoinhibition and decreased DNA-binding affinity. Surprisingly, locking the inhibitory helix onto the ETS domain by a disulfide bridge severely impairs, but does not abolish DNA binding. Weak interactions still occur via an interface displaced from the canonical ETS domain DNA-binding surface. Collectively, these studies establish a direct thermodynamic linkage between inhibitory helix stability and ETV6 autoinhibition, and demonstrate that helix unfolding does not strictly precede DNA binding. Modulating inhibitory helix stability provides a potential route for the in vivo regulation of ETV6 activity. PMID:26920109

  5. The N-Terminal Domain of Human DNA Helicase Rtel1 Contains a Redox Active Iron-Sulfur Cluster

    PubMed Central

    Landry, Aaron P.

    2014-01-01

    Human telomere length regulator Rtel1 is a superfamily II DNA helicase and is essential for maintaining proper length of telomeres in chromosomes. Here we report that the N-terminal domain of human Rtel1 (RtelN) expressed in Escherichia coli cells produces a protein that contains a redox active iron-sulfur cluster with the redox midpoint potential of −248 ± 10 mV (pH 8.0). The iron-sulfur cluster in RtelN is sensitive to hydrogen peroxide and nitric oxide, indicating that reactive oxygen/nitrogen species may modulate the DNA helicase activity of Rtel1 via modification of its iron-sulfur cluster. Purified RtelN retains a weak binding affinity for the single-stranded (ss) and double-stranded (ds) DNA in vitro. However, modification of the iron-sulfur cluster by hydrogen peroxide or nitric oxide does not significantly affect the DNA binding activity of RtelN, suggesting that the iron-sulfur cluster is not directly involved in the DNA interaction in the N-terminal domain of Rtel1. PMID:25147792

  6. The N-terminal domain of human DNA helicase Rtel1 contains a redox active iron-sulfur cluster.

    PubMed

    Landry, Aaron P; Ding, Huangen

    2014-01-01

    Human telomere length regulator Rtel1 is a superfamily II DNA helicase and is essential for maintaining proper length of telomeres in chromosomes. Here we report that the N-terminal domain of human Rtel1 (RtelN) expressed in Escherichia coli cells produces a protein that contains a redox active iron-sulfur cluster with the redox midpoint potential of -248 ± 10 mV (pH 8.0). The iron-sulfur cluster in RtelN is sensitive to hydrogen peroxide and nitric oxide, indicating that reactive oxygen/nitrogen species may modulate the DNA helicase activity of Rtel1 via modification of its iron-sulfur cluster. Purified RtelN retains a weak binding affinity for the single-stranded (ss) and double-stranded (ds) DNA in vitro. However, modification of the iron-sulfur cluster by hydrogen peroxide or nitric oxide does not significantly affect the DNA binding activity of RtelN, suggesting that the iron-sulfur cluster is not directly involved in the DNA interaction in the N-terminal domain of Rtel1.

  7. Mapping the Structural and Dynamical Features of Multiple p53 DNA Binding Domains: Insights into Loop 1 Intrinsic Dynamics

    PubMed Central

    Lukman, Suryani; Lane, David P.; Verma, Chandra S.

    2013-01-01

    The transcription factor p53 regulates cellular integrity in response to stress. p53 is mutated in more than half of cancerous cells, with a majority of the mutations localized to the DNA binding domain (DBD). In order to map the structural and dynamical features of the DBD, we carried out multiple copy molecular dynamics simulations (totaling 0.8 μs). Simulations show the loop 1 to be the most dynamic element among the DNA-contacting loops (loops 1-3). Loop 1 occupies two major conformational states: extended and recessed; the former but not the latter displays correlations in atomic fluctuations with those of loop 2 (~24 Å apart). Since loop 1 binds to the major groove whereas loop 2 binds to the minor groove of DNA, our results begin to provide some insight into the possible mechanism underpinning the cooperative nature of DBD binding to DNA. We propose (1) a novel mechanism underlying the dynamics of loop 1 and the possible tread-milling of p53 on DNA and (2) possible mutations on loop 1 residues to restore the transcriptional activity of an oncogenic mutation at a distant site. PMID:24324553

  8. SMAD3 augments FoxO3-induced MuRF-1 promoter activity in a DNA-binding-dependent manner

    PubMed Central

    Bollinger, Lance M.; Witczak, Carol A.; Houmard, Joseph A.

    2014-01-01

    Muscle-specific RING finger-1 (MuRF-1), a ubiquitin ligase and key regulator of proteasome-dependent protein degradation, is highly expressed during skeletal muscle atrophy. The transcription factor forkhead box O3 (FoxO3) induces MuRF-1 expression, but the direct role of other major atrophy-related transcription factors, such as SMAD3, is largely unknown. The goal of this study was to determine whether SMAD3 individually regulates, or with FoxO3 coordinately regulates, MuRF-1 expression. In cultured myotubes or human embryonic kidney cells, MuRF-1 mRNA content and promoter activity were increased by FoxO3 but not by SMAD3 overexpression. However, FoxO3 and SMAD3 coexpression synergistically increased MuRF-1 mRNA and promoter activity. Mutation of the SMAD-binding element (SBE) in the proximal MuRF-1 promoter or overexpression of a SMAD3 DNA-binding mutant attenuated FoxO3-dependent MuRF-1 promoter activation, showing that SMAD binding to DNA is required for optimal activation of FoxO3-induced transcription of MuRF-1. Using chromatin immunoprecipitation, SMAD3 DNA binding increased FoxO3 abundance and SBE mutation reduced FoxO3 abundance on the MuRF-1 promoter. Furthermore, SMAD3 overexpression dose-dependently increased FoxO3 protein content, and coexpression of FoxO3 and SMAD3 synergistically increased FoxO-dependent gene transcription [assessed with a FoxO response element (FRE)-driven reporter]. Collectively, these results show that SMAD3 regulates transcription of MuRF-1 by increasing FoxO3 binding at a conserved FRE-SBE motif within the proximal promoter region, and by increasing FoxO3 protein content and transcriptional activity. These data are the first to indicate that two major transcription factors regulating protein degradation, FoxO3 and SMAD3, converge to coordinately and directly regulate transcription of MuRF-1. PMID:24920680

  9. c-Abl-Mediated Tyrosine Phosphorylation of the T-bet DNA-Binding Domain Regulates CD4+ T-Cell Differentiation and Allergic Lung Inflammation ▿

    PubMed Central

    Chen, An; Lee, Sang-Myeong; Gao, Beixue; Shannon, Stephen; Zhu, Zhou; Fang, Deyu

    2011-01-01

    The tyrosine kinase c-Abl is required for full activation of T cells, while its role in T-cell differentiation has not been characterized. We report that c-Abl deficiency skews CD4+ T cells to type 2 helper T cell (Th2) differentiation, and c-Abl−/− mice are more susceptible to allergic lung inflammation. c-Abl interacts with and phosphorylates T-bet, a Th1 lineage transcription factor. c-Abl-mediated phosphorylation enhances the transcriptional activation of T-bet. Interestingly, three tyrosine residues within the T-bet DNA-binding domain are the predominant sites of phosphorylation by c-Abl. Mutation of these tyrosine residues inhibits the promoter DNA-binding activity of T-bet. c-Abl regulates Th cell differentiation in a T-bet-dependent manner because genetic deletion of T-bet in CD4+ T cells abolishes c-Abl-deficiency-mediated enhancement of Th2 differentiation. Reintroduction of T-bet-null CD4+ T cells with wild-type T-bet, but not its tyrosine mutant, rescues gamma interferon (IFN-γ) production and inhibits Th2 cytokine production. Therefore, c-Abl catalyzes tyrosine phosphorylation of the DNA-binding domain of T-bet to regulate CD4+ T cell differentiation. PMID:21690296

  10. Structure-activity studies of dicationically substituted bis-benzimidazoles against Giardia lamblia: correlation of antigiardial activity with DNA binding affinity and giardial topoisomerase II inhibition.

    PubMed Central

    Bell, C A; Dykstra, C C; Naiman, N A; Cory, M; Fairley, T A; Tidwell, R R

    1993-01-01

    Nine dicationically substituted bis-benzimidazoles were examined for their in vitro activities against Giardia lamblia WB (ATCC 30957). The potential mechanisms of action of these compounds were evaluated by investigating the relationship among in vitro antigiardial activity and the affinity of the molecules for DNA and their ability to inhibit the activity of giardial topoisomerase II. Each compound demonstrated antigiardial activity, as measured by assessing the incorporation of [methyl-3H]thymidine by giardial trophozoites exposed to the test agents. Three compounds exhibited excellent in vitro antigiardial activities, with 50% inhibitory concentrations which compared very favorably with those of two currently used drugs, quinacrine HCl and metronidazole. Putative mechanisms of action for these compounds were suggested by the strong correlation observed among in vitro antigiardial activity and the affinity of the molecules for natural and synthetic DNA and their ability to inhibit the relaxation activity of giardial topoisomerase II. A strong correlation between the DNA binding affinity of these compounds and their inhibition of giardial topoisomerase II activity was also observed. Images PMID:8109934

  11. DNA Binding, Cleavage and Antibacterial Activity of Mononuclear Cu(II), Ni(II) and Co(II) Complexes Derived from Novel Benzothiazole Schiff Bases.

    PubMed

    Vamsikrishna, Narendrula; Kumar, Marri Pradeep; Tejaswi, Somapangu; Rambabu, Aveli; Shivaraj

    2016-07-01

    A series of novel bivalent metal complexes M(L1)2 and M(L2)2 where M = Cu(II), Ni(II), Co(II) and L1 = 2-((benzo [d] thiazol-6-ylimino)methyl)-4-bromophenol [BTEMBP], L2 = 1-((benzo [d] thiazol-6-ylimino)methyl) naphthalen-2-ol [BTEMNAPP] were synthesized. All the compounds have been characterized by elemental analysis, SEM, Mass, (1)H NMR, (13)C NMR, UV-Vis, IR, ESR, spectral data and magnetic susceptibility measurements. Based on the analytical and spectral data four-coordinated square planar geometry is assigned to all the complexes. DNA binding properties of these complexes have been investigated by electronic absorption spectroscopy, fluorescence and viscosity measurements. It is observed that these binary complexes strongly bind to calf thymus DNA by an intercalation mode. DNA cleavage efficacy of these complexes was tested in presence of H2O2 and UV light by gel electrophoresis and found that all the complexes showed better nuclease activity. Finally the compounds were screened for antibacterial activity against few pathogens and found that the complexes have potent biocidal activity than their free ligands.

  12. Direct interaction of SRY-related protein SOX9 and steroidogenic factor 1 regulates transcription of the human anti-Müllerian hormone gene.

    PubMed

    De Santa Barbara, P; Bonneaud, N; Boizet, B; Desclozeaux, M; Moniot, B; Sudbeck, P; Scherer, G; Poulat, F; Berta, P

    1998-11-01

    For proper male sexual differentiation, anti-Müllerian hormone (AMH) must be tightly regulated during embryonic development to promote regression of the Müllerian duct. However, the molecular mechanisms specifying the onset of AMH in male mammals are not yet clearly defined. A DNA-binding element for the steroidogenic factor 1 (SF-1), a member of the orphan nuclear receptor family, located in the AMH proximal promoter has recently been characterized and demonstrated as being essential for AMH gene activation. However, the requirement for a specific promoter environment for SF-1 activation as well as the presence of conserved cis DNA-binding elements in the AMH promoter suggest that SF-1 is a member of a combinatorial protein-protein and protein-DNA complex. In this study, we demonstrate that the canonical SOX-binding site within the human AMH proximal promoter can bind the transcription factor SOX9, a Sertoli cell factor closely associated with Sertoli cell differentiation and AMH expression. Transfection studies with COS-7 cells revealed that SOX9 can cooperate with SF-1 in this activation process. In vitro and in vivo protein-binding studies indicate that SOX9 and SF-1 interact directly via the SOX9 DNA-binding domain and the SF-1 C-terminal region, respectively. We propose that the two transcription factors SOX9 and SF-1 could both be involved in the expression of the AMH gene, in part as a result of their respective binding to the AMH promoter and in part because of their ability to interact with each other. Our work thus identifies SOX9 as an interaction partner of SF-1 that could be involved in the Sertoli cell-specific expression of AMH during embryogenesis.

  13. Direct Interaction of SRY-Related Protein SOX9 and Steroidogenic Factor 1 Regulates Transcription of the Human Anti-Müllerian Hormone Gene

    PubMed Central

    De Santa Barbara, Pascal; Bonneaud, Nathalie; Boizet, Brigitte; Desclozeaux, Marion; Moniot, Brigitte; Sudbeck, Peter; Scherer, Gerd; Poulat, Francis; Berta, Philippe

    1998-01-01

    For proper male sexual differentiation, anti-Müllerian hormone (AMH) must be tightly regulated during embryonic development to promote regression of the Müllerian duct. However, the molecular mechanisms specifying the onset of AMH in male mammals are not yet clearly defined. A DNA-binding element for the steroidogenic factor 1 (SF-1), a member of the orphan nuclear receptor family, located in the AMH proximal promoter has recently been characterized and demonstrated as being essential for AMH gene activation. However, the requirement for a specific promoter environment for SF-1 activation as well as the presence of conserved cis DNA-binding elements in the AMH promoter suggest that SF-1 is a member of a combinatorial protein-protein and protein-DNA complex. In this study, we demonstrate that the canonical SOX-binding site within the human AMH proximal promoter can bind the transcription factor SOX9, a Sertoli cell factor closely associated with Sertoli cell differentiation and AMH expression. Transfection studies with COS-7 cells revealed that SOX9 can cooperate with SF-1 in this activation process. In vitro and in vivo protein-binding studies indicate that SOX9 and SF-1 interact directly via the SOX9 DNA-binding domain and the SF-1 C-terminal region, respectively. We propose that the two transcription factors SOX9 and SF-1 could both be involved in the expression of the AMH gene, in part as a result of their respective binding to the AMH promoter and in part because of their ability to interact with each other. Our work thus identifies SOX9 as an interaction partner of SF-1 that could be involved in the Sertoli cell-specific expression of AMH during embryogenesis. PMID:9774680

  14. ATP binding and hydrolysis by Saccharomyces cerevisiae Msh2-Msh3 are differentially modulated by mismatch and double-strand break repair DNA substrates.

    PubMed

    Kumar, Charanya; Eichmiller, Robin; Wang, Bangchen; Williams, Gregory M; Bianco, Piero R; Surtees, Jennifer A

    2014-06-01

    In Saccharomyces cerevisiae, Msh2-Msh3-mediated mismatch repair (MMR) recognizes and targets insertion/deletion loops for repair. Msh2-Msh3 is also required for 3' non-homologous tail removal (3'NHTR) in double-strand break repair. In both pathways, Msh2-Msh3 binds double-strand/single-strand junctions and initiates repair in an ATP-dependent manner. However, we recently demonstrated that the two pathways have distinct requirements with respect to Msh2-Msh3 activities. We identified a set of aromatic residues in the nucleotide binding pocket (FLY motif) of Msh3 that, when mutated, disrupted MMR, but left 3'NHTR largely intact. One of these mutations, msh3Y942A, was predicted to disrupt the nucleotide sandwich and allow altered positioning of ATP within the pocket. To develop a mechanistic understanding of the differential requirements for ATP binding and/or hydrolysis in the two pathways, we characterized Msh2-Msh3 and Msh2-msh3Y942A ATP binding and hydrolysis activities in the presence of MMR and 3'NHTR DNA substrates. We observed distinct, substrate-dependent ATP hydrolysis and nucleotide turnover by Msh2-Msh3, indicating that the MMR and 3'NHTR DNA substrates differentially modify the ATP binding/hydrolysis activities of Msh2-Msh3. Msh2-msh3Y942A retained the ability to bind DNA and ATP but exhibited altered ATP hydrolysis and nucleotide turnover. We propose that both ATP and structure-specific repair substrates cooperate to direct Msh2-Msh3-mediated repair and suggest an explanation for the msh3Y942A separation-of-function phenotype. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. ATP binding and hydrolysis by Saccharomyces cerevisiae Msh2-Msh3 are differentially modulated by Mismatch and Double-strand Break Repair DNA substrates

    PubMed Central

    Kumar, Charanya; Eichmiller, Robin; Wang, Bangchen; Williams, Gregory M.; Bianco, Piero R.; Surtees, Jennifer A.

    2014-01-01

    In Saccharomyces cerevisiae, Msh2-Msh3-mediated mismatch repair (MMR) recognizes and targets insertion/deletion loops for repair. Msh2-Msh3 is also required for 3′ non-homologous tail removal (3′NHTR) in double-strand break repair. In both pathways, Msh2-Msh3 binds double-strand/single-strand junctions and initiates repair in an ATP-dependent manner. However, we recently demonstrated that the two pathways have distinct requirements with respect to Msh2-Msh3 activities. We identified a set of aromatic residues in the nucleotide binding pocket (FLY motif) of Msh3 that, when mutated, disrupted MMR, but left 3′ NHTR largely intact. One of these mutations, msh3Y942A, was predicted to disrupt the nucleotide sandwich and allow altered positioning of ATP within the pocket. To develop a mechanistic understanding of the differential requirements for ATP binding and/or hydrolysis in the two pathways, we characterized Msh2-Msh3 and Msh2-msh3Y942A ATP binding and hydrolysis activities in the presence of MMR and 3′ NHTR DNA substrates. We observed distinct, substrate-dependent ATP hydrolysis and nucleotide turnover by Msh2-Msh3, indicating that the MMR and 3′ NHTR DNA substrates differentially modify the ATP binding/hydrolysis activities of Msh2-Msh3. Msh2-msh3Y942A retained the ability to bind DNA and ATP but exhibited altered ATP hydrolysis and nucleotide turnover. We propose that both ATP and structure-specific repair substrates cooperate to direct Msh2-Msh3-mediated repair and suggest an explanation for the msh3Y942A separation-of-function phenotype. PMID:24746922

  16. Mutations on the DNA Binding Surface of TBP Discriminate between Yeast TATA and TATA-Less Gene Transcription

    PubMed Central

    Kamenova, Ivanka; Warfield, Linda

    2014-01-01

    Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. PMID:24865972

  17. Mutations on the DNA binding surface of TBP discriminate between yeast TATA and TATA-less gene transcription.

    PubMed

    Kamenova, Ivanka; Warfield, Linda; Hahn, Steven

    2014-08-01

    Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  18. Insights into the effects of mutations on Cren7-DNA binding using molecular dynamics simulations and free energy calculations.

    PubMed

    Chen, Lin; Zheng, Qing-Chuan; Zhang, Hong-Xing

    2015-02-28

    A novel, highly conserved chromatin protein, Cren7 is involved in regulating essential cellular processes such as transcription, replication and repair. Although mutations in the DNA-binding loop of Cren7 destabilize the structure and reduce DNA-binding activity, the details are not very clear. Focusing on the specific Cren7-dsDNA complex (PDB code ), we applied molecular dynamics (MD) simulations and the molecular mechanics Poisson-Boltzmann surface area (MM-PBSA) free energy calculations to explore the structural and dynamic effects of W26A, L28A, and K53A mutations in comparison to the wild-type protein. The energetic analysis indicated that the intermolecular van der Waals interaction and nonpolar solvation energy play an important role in the binding process of Cren7 and dsDNA. Compared with the wild type Cren7, all the studied mutants W26A, L28A, and K53A have obviously reduced binding free energies with dsDNA in the reduction of the polar and/or nonpolar interactions. These results further elucidated the previous experiments to understand the Cren7-DNA interaction comprehensively. Our work also would provide support for an understanding of the interactions of proteins with nucleic acids.

  19. Xenopus origin recognition complex (ORC) initiates DNA replication preferentially at sequences targeted by Schizosaccharomyces pombe ORC

    PubMed Central

    Kong, Daochun; Coleman, Thomas R.; DePamphilis, Melvin L.

    2003-01-01

    Budding yeast (Saccharomyces cerevisiae) origin recognition complex (ORC) requires ATP to bind specific DNA sequences, whereas fission yeast (Schizosaccharomyces pombe) ORC binds to specific, asymmetric A:T-rich sites within replication origins, independently of ATP, and frog (Xenopus laevis) ORC seems to bind DNA non-specifically. Here we show that despite these differences, ORCs are functionally conserved. Firstly, SpOrc1, SpOrc4 and SpOrc5, like those from other eukaryotes, bound ATP and exhibited ATPase activity, suggesting that ATP is required for pre-replication complex (pre-RC) assembly rather than origin specificity. Secondly, SpOrc4, which is solely responsible for binding SpORC to DNA, inhibited up to 70% of XlORC-dependent DNA replication in Xenopus egg extract by preventing XlORC from binding to chromatin and assembling pre-RCs. Chromatin-bound SpOrc4 was located at AT-rich sequences. XlORC in egg extract bound preferentially to asymmetric A:T-sequences in either bare DNA or in sperm chromatin, and it recruited XlCdc6 and XlMcm proteins to these sequences. These results reveal that XlORC initiates DNA replication preferentially at the same or similar sites to those targeted in S.pombe. PMID:12840006

  20. PRP19 Transforms into a Sensor of RPA-ssDNA after DNA Damage and Drives ATR Activation via a Ubiquitin-Mediated Circuitry

    PubMed Central

    Maréchal, Alexandre; Wu, Ching-Shyi; Yazinski, Stephanie A.; Nguyen, Hai Dang; Liu, Shizhou; Jiménez, Amanda E.; Jin, Jianping; Zou, Lee

    2014-01-01

    Summary PRP19 is a ubiquitin ligase involved in pre-mRNA splicing and the DNA damage response (DDR). While the role for PRP19 in splicing is well characterized, its role in the DDR remains elusive. Through a proteomic screen for proteins that interact with RPA-coated single-stranded DNA (RPA-ssDNA), we identified PRP19 as a sensor of DNA damage. PRP19 binds RPA directly and localizes to DNA damage sites via RPA, promoting RPA ubiquitylation in a DNA damage-induced manner. PRP19 facilitates the accumulation of ATRIP, the regulatory partner of the ATR kinase, at DNA damage sites. Depletion of PRP19 compromised the phosphorylation of ATR substrates, the recovery of stalled replication forks, and the progression of replication forks on damaged DNA. Importantly, PRP19 mutants that cannot bind RPA or function as an E3 ligase failed to support the ATR response, revealing that PRP19 drives ATR activation by acting as an RPA-ssDNA-sensing ubiquitin ligase during the DDR. PMID:24332808

  1. Interaction of cholinesterase modulators with DNA and their cytotoxic activity.

    PubMed

    Janockova, Jana; Gulasova, Zuzana; Plsikova, Jana; Musilek, Kamil; Kuca, Kamil; Mikes, Jaromir; Culka, Lubomir; Fedorocko, Peter; Kozurkova, Maria

    2014-03-01

    This research was focused on a study of the binding properties of a series of cholinesterase reactivators compounds K075 (1), K027 (2) and inhibitors compounds K524, K009 and 7-MEOTA (3-5) with calf thymus DNA. The nature of the interactions between compounds 1-5 and DNA were studied using spectroscopic techniques (UV-vis, fluorescence spectroscopy and circular dichroism). The binding constants for complexes of cholinesterase modulators with DNA were determined from UV-vis spectroscopic titrations (K=0.5 × 10(4)-8.9 × 10(5)M(-1)). The ability of the prepared analogues to relax topoisomerase I was studied with electrophoretic techniques and it was proved that ligands 4 and 5 inhibited this enzyme at a concentration of 30 μM. The biological activity of the novel compounds was assessed through an examination of changes in cell cycle distribution, mitochondrial membrane potential and cellular viability. Inhibitors 3-5 exhibited a cytotoxic effect on HL-60 (human acute promyelocytic leukaemia) cell culture, demonstrated a tendency to affect mitochondrial physiology and viability, and also forced cells to accumulate in the G1/G0-phase of the cell cycle. The cholinesterase reactivators 1 and 2 were found relatively save from the point of view of DNA binding, whereas cholinesterase inhibitors 3-5 resulted as strong DNA binding agents that limit their plausible use. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. Synthesis and characterization of new unsymmetrical Schiff base Zn (II) and Co (II) complexes and study of their interactions with bovin serum albumin and DNA by spectroscopic techniques.

    PubMed

    Sedighipoor, Maryam; Kianfar, Ali Hossein; Sabzalian, Mohammad R; Abyar, Fatemeh

    2018-06-05

    Two novel tetra-coordinated Cobalt(II) and Zinc (II) chelate series with the general formula of [Co (L)·2H 2 O] (1) and [Zn (L)] (2) [L=N-2-hydroxyacetophenon-N'-2-hydroxynaphthaldehyde-1,2 phenylenediimine)] with biologically active Schiff base ligands were synthesized and recognized by elemental analysis and multi-nuclear spectroscopy (IR and 1 H and 13 C NMR); then, their biological activities including DNA and protein interactions were studied. The interaction of the synthesized compounds with bovine serum albumin (BSA) was investigated via fluorescence spectroscopy, showing the affinity of the complexes for these proteins with relatively high binding constant values and the changed secondary BSA structure in the presence of the complexes. The interaction of these compounds with CT-DNA was considered by UV-Vis technique, emission titration, viscosity measurements, helix melting methods, and circular dichroism (CD) spectroscopy, confirming that the complexes were bound to CT-DNA by the intercalation binding mode. Furthermore, the complexes had the capability to displace the DNA-bound MB, as shown by the competitive studies of these complexes with methylene blue (MB), thereby suggesting the intercalation mode for the competition. Finally, the theoretical studies carried out by the docking method were performed to calculate the binding constants and recognize the binding site of the BSA and DNA by the complexes. In addition, in vitro and in silico studies showed that the compounds were degradable by bacterial and fungal biodegradation activities. Copyright © 2018 Elsevier B.V. All rights reserved.

  3. Synthesis and characterization of new unsymmetrical Schiff base Zn (II) and Co (II) complexes and study of their interactions with bovin serum albumin and DNA by spectroscopic techniques

    NASA Astrophysics Data System (ADS)

    Sedighipoor, Maryam; Kianfar, Ali Hossein; Sabzalian, Mohammad R.; Abyar, Fatemeh

    2018-06-01

    Two novel tetra-coordinated Cobalt(II) and Zinc (II) chelate series with the general formula of [Co (L)·2H2O] (1) and [Zn (L)] (2) [L = N-2-hydroxyacetophenon-N‧-2-hydroxynaphthaldehyde-1,2 phenylenediimine)] with biologically active Schiff base ligands were synthesized and recognized by elemental analysis and multi-nuclear spectroscopy (IR and 1H and 13C NMR); then, their biological activities including DNA and protein interactions were studied. The interaction of the synthesized compounds with bovine serum albumin (BSA) was investigated via fluorescence spectroscopy, showing the affinity of the complexes for these proteins with relatively high binding constant values and the changed secondary BSA structure in the presence of the complexes. The interaction of these compounds with CT-DNA was considered by UV-Vis technique, emission titration, viscosity measurements, helix melting methods, and circular dichroism (CD) spectroscopy, confirming that the complexes were bound to CT-DNA by the intercalation binding mode. Furthermore, the complexes had the capability to displace the DNA-bound MB, as shown by the competitive studies of these complexes with methylene blue (MB), thereby suggesting the intercalation mode for the competition. Finally, the theoretical studies carried out by the docking method were performed to calculate the binding constants and recognize the binding site of the BSA and DNA by the complexes. In addition, in vitro and in silico studies showed that the compounds were degradable by bacterial and fungal biodegradation activities.

  4. Structure of p73 DNA-binding domain tetramer modulates p73 transactivation

    PubMed Central

    Ethayathulla, Abdul S.; Tse, Pui-Wah; Monti, Paola; Nguyen, Sonha; Inga, Alberto; Fronza, Gilberto; Viadiu, Hector

    2012-01-01

    The transcription factor p73 triggers developmental pathways and overlaps stress-induced p53 transcriptional pathways. How p53-family response elements determine and regulate transcriptional specificity remains an unsolved problem. In this work, we have determined the first crystal structures of p73 DNA-binding domain tetramer bound to response elements with spacers of different length. The structure and function of the adaptable tetramer are determined by the distance between two half-sites. The structures with zero and one base-pair spacers show compact p73 DNA-binding domain tetramers with large tetramerization interfaces; a two base-pair spacer results in DNA unwinding and a smaller tetramerization interface, whereas a four base-pair spacer hinders tetramerization. Functionally, p73 is more sensitive to spacer length than p53, with one base-pair spacer reducing 90% of transactivation activity and longer spacers reducing transactivation to basal levels. Our results establish the quaternary structure of the p73 DNA-binding domain required as a scaffold to promote transactivation. PMID:22474346

  5. Circadian clock protein KaiC forms ATP-dependent hexameric rings and binds DNA.

    PubMed

    Mori, Tetsuya; Saveliev, Sergei V; Xu, Yao; Stafford, Walter F; Cox, Michael M; Inman, Ross B; Johnson, Carl H

    2002-12-24

    KaiC from Synechococcus elongatus PCC 7942 (KaiC) is an essential circadian clock protein in cyanobacteria. Previous sequence analyses suggested its inclusion in the RecADnaB superfamily. A characteristic of the proteins of this superfamily is that they form homohexameric complexes that bind DNA. We show here that KaiC also forms ring complexes with a central pore that can be visualized by electron microscopy. A combination of analytical ultracentrifugation and chromatographic analyses demonstrates that these complexes are hexameric. The association of KaiC molecules into hexamers depends on the presence of ATP. The KaiC sequence does not include the obvious DNA-binding motifs found in RecA or DnaB. Nevertheless, KaiC binds forked DNA substrates. These data support the inclusion of KaiC into the RecADnaB superfamily and have important implications for enzymatic activity of KaiC in the circadian clock mechanism that regulates global changes in gene expression patterns.

  6. Intramolecular control of transcriptional activity by the NK2-specific domain in NK-2 homeodomain proteins

    PubMed Central

    Watada, Hirotaka; Mirmira, Raghavendra G.; Kalamaras, Julie; German, Michael S.

    2000-01-01

    The developmentally important homeodomain transcription factors of the NK-2 class contain a highly conserved region, the NK2-specific domain (NK2-SD). The function of this domain, however, remains unknown. The primary structure of the NK2-SD suggests that it might function as an accessory DNA-binding domain or as a protein–protein interaction interface. To assess the possibility that the NK2-SD may contribute to DNA-binding specificity, we used a PCR-based approach to identify a consensus DNA-binding sequences for Nkx2.2, an NK-2 family member involved in pancreas and central nervous system development. The consensus sequence (TCTAAGTGAGCTT) is similar to the known binding sequences for other NK-2 homeodomain proteins, but we show that the NK2-SD does not contribute significantly to specific DNA binding to this sequence. To determine whether the NK2-SD contributes to transactivation, we used GAL4-Nkx2.2 fusion constructs to map a powerful transcriptional activation domain in the C-terminal region beyond the conserved NK2-SD. Interestingly, this C-terminal region functions as a transcriptional activator only in the absence of an intact NK2-SD. The NK2-SD also can mask transactivation from the paired homeodomain transcription factor Pax6, but it has no effect on transcription by itself. These results demonstrate that the NK2-SD functions as an intramolecular regulator of the C-terminal activation domain in Nkx2.2 and support a model in which interactions through the NK2-SD regulate the ability of NK-2-class proteins to activate specific genes during development. PMID:10944215

  7. Mononuclear zinc(II) complexes of 2-((2-(piperazin-1-yl)ethylimino)methyl)-4-substituted phenols: Synthesis, structural characterization, DNA binding and cheminuclease activities

    NASA Astrophysics Data System (ADS)

    Ravichandran, J.; Gurumoorthy, P.; Karthick, C.; Kalilur Rahiman, A.

    2014-03-01

    Four new zinc(II) complexes [Zn(HL1-4)Cl2] (1-4), where HL1-4 = 2-((2-(piperazin-1-yl)ethylimino)methyl)-4-substituted phenols, have been isolated and fully characterized using various spectro-analytical techniques. The X-ray crystal structure of complex 4 shows the distorted trigonal-bipyramidal coordination geometry around zinc(II) ion. The crystal packing is stabilized by intermolecular NH⋯O hydrogen bonding interaction. The complexes display no d-d electronic band in the visible region due to d10 electronic configuration of zinc(II) ion. The electrochemical properties of the synthesized ligands and their complexes exhibit similar voltammogram at reduction potential due to electrochemically innocent Zn(II) ion, which evidenced that the electron transfer is due to the nature of the ligand. Binding interaction of complexes with calf thymus DNA was studied by UV-Vis absorption titration, viscometric titration and cyclic voltammetry. All complexes bind with CT DNA by intercalation, giving the binding affinity in the order of 2 > 1 ≫ 3 > 4. The prominent cheminuclease activity of complexes on plasmid DNA (pBR322 DNA) was observed in the absence and presence of H2O2. Oxidative pathway reveals that the underlying mechanism involves hydroxyl radical.

  8. Non-Watson–Crick interactions between PNA and DNA inhibit the ATPase activity of bacteriophage T4 Dda helicase

    PubMed Central

    Tackett, Alan J.; Corey, David R.; Raney, Kevin D.

    2002-01-01

    Peptide nucleic acid (PNA) is a DNA mimic in which the nucleobases are linked by an N-(2-aminoethyl) glycine backbone. Here we report that PNA can interact with single-stranded DNA (ssDNA) in a non-sequence-specific fashion. We observed that a 15mer PNA inhibited the ssDNA-stimulated ATPase activity of a bacteriophage T4 helicase, Dda. Surprisingly, when a fluorescein-labeled 15mer PNA was used in binding studies no interaction was observed between PNA and Dda. However, fluorescence polarization did reveal non-sequence-specific interactions between PNA and ssDNA. Thus, the inhibition of ATPase activity of Dda appears to result from depletion of the available ssDNA due to non-Watson–Crick binding of PNA to ssDNA. Inhibition of the ssDNA-stimulated ATPase activity was observed for several PNAs of varying length and sequence. To study the basis for this phenomenon, we examined self-aggregation by PNAs. The 15mer PNA readily self-aggregates to the point of precipitation. Since PNAs are hydrophobic, they aggregate more than DNA or RNA, making the study of this phenomenon essential for understanding the properties of PNA. Non-sequence-specific interactions between PNA and ssDNA were observed at moderate concentrations of PNA, suggesting that such interactions should be considered for antisense and antigene applications. PMID:11842106

  9. Metal complexes as DNA intercalators.

    PubMed

    Liu, Hong-Ke; Sadler, Peter J

    2011-05-17

    DNA has a strong affinity for many heterocyclic aromatic dyes, such as acridine and its derivatives. Lerman in 1961 first proposed intercalation as the source of this affinity, and this mode of DNA binding has since attracted considerable research scrutiny. Organic intercalators can inhibit nucleic acid synthesis in vivo, and they are now common anticancer drugs in clinical therapy. The covalent attachment of organic intercalators to transition metal coordination complexes, yielding metallointercalators, can lead to novel DNA interactions that influence biological activity. Metal complexes with σ-bonded aromatic side arms can act as dual-function complexes: they bind to DNA both by metal coordination and through intercalation of the attached aromatic ligand. These aromatic side arms introduce new modes of DNA binding, involving mutual interactions of functional groups held in close proximity. The biological activity of both cis- and trans-diamine Pt(II) complexes is dramatically enhanced by the addition of σ-bonded intercalators. We have explored a new class of organometallic "piano-stool" Ru(II) and Os(II) arene anticancer complexes of the type [(η(6)-arene)Ru/Os(XY)Cl](+). Here XY is, for example, ethylenediamine (en), and the arene ligand can take many forms, including tetrahydroanthracene, biphenyl, or p-cymene. Arene-nucleobase stacking interactions can have a significant influence on both the kinetics and thermodynamics of DNA binding. In particular, the cytotoxic activity, conformational distortions, recognition by DNA-binding proteins, and repair mechanisms are dependent on the arene. A major difficulty in developing anticancer drugs is cross-resistance, a phenomenon whereby a cell that is resistant to one drug is also resistant to another drug in the same class. These new complexes are non-cross-resistant with cisplatin towards cancer cells: they constitute a new class of anticancer agents, with a mechanism of action that differs from the anticancer drug cisplatin and its analogs. The Ru-arene complexes with dual functions are more potent towards cancer cells than their nonintercalating analogs. In this Account, we focus on recent studies of dual-function organometallic Ru(II)- and Os(II)-arene complexes and the methods used to detect arene-DNA intercalation. We relate these interactions to the mechanism of anticancer activity and to structure-activity relationships. The interactions between these complexes and DNA show close similarities to those of covalent polycyclic aromatic carcinogens, especially to N7-alkylating intercalation compounds. However, Ru-arene complexes exhibit some new features. Classical intercalation and base extrusion next to the metallated base is observed for {(η(6)-biphenyl)Ru(ethylenediamine)}(2+) adducts of a 14-mer duplex, while penetrating arene intercalation occurs for adducts of the nonaromatic bulky intercalator {(η(6)-tetrahydroanthracene)Ru(ethylenediamine)}(2+) with a 6-mer duplex. The introduction of dual-function Ru-arene complexes introduces new mechanisms of antitumor activity, novel mechanisms for attack on DNA, and new concepts for developing structure- activity relationships. We hope this discussion will stimulate thoughtful and focused research on the design of anticancer chemotherapeutic agents using these unique approaches.

  10. TAF(II)170 interacts with the concave surface of TATA-binding protein to inhibit its DNA binding activity.

    PubMed

    Pereira, L A; van der Knaap, J A; van den Boom, V; van den Heuvel, F A; Timmers, H T

    2001-11-01

    The human RNA polymerase II transcription factor B-TFIID consists of TATA-binding protein (TBP) and the TBP-associated factor (TAF) TAF(II)170 and can rapidly redistribute over promoter DNA. Here we report the identification of human TBP-binding regions in human TAF(II)170. We have defined the TBP interaction domain of TAF(II)170 within three amino-terminal regions: residues 2 to 137, 290 to 381, and 380 to 460. Each region contains a pair of Huntington-elongation-A subunit-Tor repeats and exhibits species-specific interactions with TBP family members. Remarkably, the altered-specificity TBP mutant (TBP(AS)) containing a triple mutation in the concave surface is defective for binding the TAF(II)170 amino-terminal region of residues 1 to 504. Furthermore, within this region the TAF(II)170 residues 290 to 381 can inhibit the interaction between Drosophila TAF(II)230 (residues 2 to 81) and TBP through competition for the concave surface of TBP. Biochemical analyses of TBP binding to the TATA box indicated that TAF(II)170 region 290-381 inhibits TBP-DNA complex formation. Importantly, the TBP(AS) mutant is less sensitive to TAF(II)170 inhibition. Collectively, our results support a mechanism in which TAF(II)170 induces high-mobility DNA binding by TBP through reversible interactions with its concave DNA binding surface.

  11. Regulatory Phosphorylation of Ikaros by Bruton's Tyrosine Kinase

    PubMed Central

    Zhang, Jian; Ishkhanian, Rita; Uckun, Fatih M.

    2013-01-01

    Diminished Ikaros function has been implicated in the pathogenesis of acute lymphoblastic leukemia (ALL), the most common form of childhood cancer. Therefore, a stringent regulation of Ikaros is of paramount importance for normal lymphocyte ontogeny. Here we provide genetic and biochemical evidence for a previously unknown function of Bruton's tyrosine kinase (BTK) as a partner and posttranslational regulator of Ikaros, a zinc finger-containing DNA-binding protein that plays a pivotal role in immune homeostasis. We demonstrate that BTK phosphorylates Ikaros at unique phosphorylation sites S214 and S215 in the close vicinity of its zinc finger 4 (ZF4) within the DNA binding domain, thereby augmenting its nuclear localization and sequence-specific DNA binding activity. Our results further demonstrate that BTK-induced activating phosphorylation is critical for the optimal transcription factor function of Ikaros. PMID:23977012

  12. A Novel Rrm3 Function in Restricting DNA Replication via an Orc5-Binding Domain Is Genetically Separable from Rrm3 Function as an ATPase/Helicase in Facilitating Fork Progression.

    PubMed

    Syed, Salahuddin; Desler, Claus; Rasmussen, Lene J; Schmidt, Kristina H

    2016-12-01

    In response to replication stress cells activate the intra-S checkpoint, induce DNA repair pathways, increase nucleotide levels, and inhibit origin firing. Here, we report that Rrm3 associates with a subset of replication origins and controls DNA synthesis during replication stress. The N-terminal domain required for control of DNA synthesis maps to residues 186-212 that are also critical for binding Orc5 of the origin recognition complex. Deletion of this domain is lethal to cells lacking the replication checkpoint mediator Mrc1 and leads to mutations upon exposure to the replication stressor hydroxyurea. This novel Rrm3 function is independent of its established role as an ATPase/helicase in facilitating replication fork progression through polymerase blocking obstacles. Using quantitative mass spectrometry and genetic analyses, we find that the homologous recombination factor Rdh54 and Rad5-dependent error-free DNA damage bypass act as independent mechanisms on DNA lesions that arise when Rrm3 catalytic activity is disrupted whereas these mechanisms are dispensable for DNA damage tolerance when the replication function is disrupted, indicating that the DNA lesions generated by the loss of each Rrm3 function are distinct. Although both lesion types activate the DNA-damage checkpoint, we find that the resultant increase in nucleotide levels is not sufficient for continued DNA synthesis under replication stress. Together, our findings suggest a role of Rrm3, via its Orc5-binding domain, in restricting DNA synthesis that is genetically and physically separable from its established catalytic role in facilitating fork progression through replication blocks.

  13. A Novel Rrm3 Function in Restricting DNA Replication via an Orc5-Binding Domain Is Genetically Separable from Rrm3 Function as an ATPase/Helicase in Facilitating Fork Progression

    PubMed Central

    Syed, Salahuddin; Desler, Claus; Rasmussen, Lene J.; Schmidt, Kristina H.

    2016-01-01

    In response to replication stress cells activate the intra-S checkpoint, induce DNA repair pathways, increase nucleotide levels, and inhibit origin firing. Here, we report that Rrm3 associates with a subset of replication origins and controls DNA synthesis during replication stress. The N-terminal domain required for control of DNA synthesis maps to residues 186–212 that are also critical for binding Orc5 of the origin recognition complex. Deletion of this domain is lethal to cells lacking the replication checkpoint mediator Mrc1 and leads to mutations upon exposure to the replication stressor hydroxyurea. This novel Rrm3 function is independent of its established role as an ATPase/helicase in facilitating replication fork progression through polymerase blocking obstacles. Using quantitative mass spectrometry and genetic analyses, we find that the homologous recombination factor Rdh54 and Rad5-dependent error-free DNA damage bypass act as independent mechanisms on DNA lesions that arise when Rrm3 catalytic activity is disrupted whereas these mechanisms are dispensable for DNA damage tolerance when the replication function is disrupted, indicating that the DNA lesions generated by the loss of each Rrm3 function are distinct. Although both lesion types activate the DNA-damage checkpoint, we find that the resultant increase in nucleotide levels is not sufficient for continued DNA synthesis under replication stress. Together, our findings suggest a role of Rrm3, via its Orc5-binding domain, in restricting DNA synthesis that is genetically and physically separable from its established catalytic role in facilitating fork progression through replication blocks. PMID:27923055

  14. 1,8-Naphthalimide: A Potent DNA Intercalator and Target for Cancer Therapy.

    PubMed

    Tandon, Runjhun; Luxami, Vijay; Kaur, Harsovin; Tandon, Nitin; Paul, Kamaldeep

    2017-10-01

    The poor pharmacokinetics, side effects and particularly the rapid emergence of drug resistance compromise the efficiency of clinically used anticancer drugs. Therefore, the discovery of novel and effective drugs is still an extremely primary mission. Naphthalimide family is one of the highly active anticancer drug based upon effective intercalator with DNA. In this article, we review the discovery and development of 1,8-naphthalimide moiety, and, especially, pay much attention to the structural modifications and structure activity relationships. The review demonstrates how modulation of the moiety affecting naphthalimide compound for DNA binding that is achieved to afford a profile of antitumor activity. The DNA binding of imide and ring substitution at naphthalimide, bisnaphthalimide, naphthalimide-metal complexes is achieved by molecular recognition through intercalation mode. Thus, this synthetic/natural small molecule can act as a drug when activation or inhibition of DNA function, is required to cure or control the cancer disease. The present study is a review of the advances in 1,8-naphthalimide-related research, with a focus on how such derivatives are intercalated into DNA for their anticancer activities. © 2017 The Chemical Society of Japan & Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. An electrochemical sensing platform based on local repression of electrolyte diffusion for single-step, reagentless, sensitive detection of a sequence-specific DNA-binding protein.

    PubMed

    Zhang, Yun; Liu, Fang; Nie, Jinfang; Jiang, Fuyang; Zhou, Caibin; Yang, Jiani; Fan, Jinlong; Li, Jianping

    2014-05-07

    In this paper, we report for the first time an electrochemical biosensor for single-step, reagentless, and picomolar detection of a sequence-specific DNA-binding protein using a double-stranded, electrode-bound DNA probe terminally modified with a redox active label close to the electrode surface. This new methodology is based upon local repression of electrolyte diffusion associated with protein-DNA binding that leads to reduction of the electrochemical response of the label. In the proof-of-concept study, the resulting electrochemical biosensor was quantitatively sensitive to the concentrations of the TATA binding protein (TBP, a model analyte) ranging from 40 pM to 25.4 nM with an estimated detection limit of ∼10.6 pM (∼80 to 400-fold improvement on the detection limit over previous electrochemical analytical systems).

  16. Two new insulator proteins, Pita and ZIPIC, target CP190 to chromatin.

    PubMed

    Maksimenko, Oksana; Bartkuhn, Marek; Stakhov, Viacheslav; Herold, Martin; Zolotarev, Nickolay; Jox, Theresa; Buxa, Melanie K; Kirsch, Ramona; Bonchuk, Artem; Fedotova, Anna; Kyrchanova, Olga; Renkawitz, Rainer; Georgiev, Pavel

    2015-01-01

    Insulators are multiprotein-DNA complexes that regulate the nuclear architecture. The Drosophila CP190 protein is a cofactor for the DNA-binding insulator proteins Su(Hw), CTCF, and BEAF-32. The fact that CP190 has been found at genomic sites devoid of either of the known insulator factors has until now been unexplained. We have identified two DNA-binding zinc-finger proteins, Pita, and a new factor named ZIPIC, that interact with CP190 in vivo and in vitro at specific interaction domains. Genomic binding sites for these proteins are clustered with CP190 as well as with CTCF and BEAF-32. Model binding sites for Pita or ZIPIC demonstrate a partial enhancer-blocking activity and protect gene expression from PRE-mediated silencing. The function of the CTCF-bound MCP insulator sequence requires binding of Pita. These results identify two new insulator proteins and emphasize the unifying function of CP190, which can be recruited by many DNA-binding insulator proteins. © 2015 Maksimenko et al.; Published by Cold Spring Harbor Laboratory Press.

  17. DNA/RNA binding and anticancer/antimicrobial activities of polymer-copper(II) complexes

    NASA Astrophysics Data System (ADS)

    Lakshmipraba, Jagadeesan; Arunachalam, Sankaralingam; Riyasdeen, Anvarbatcha; Dhivya, Rajakumar; Vignesh, Sivanandham; Akbarsha, Mohammad Abdulkader; James, Rathinam Arthur

    2013-05-01

    Water soluble polymer-copper(II) complexes with various degrees of coordination in the polymer chain were synthesized and characterized by elemental analysis, IR, UV-visible and EPR spectra. The DNA/RNA binding behavior of these polymer-copper(II) complexes was examined by UV-visible absorption, emission and circular dichroism spectroscopic methods, and cyclic voltammetry techniques. The binding of the polymer-copper(II) complexes with DNA/RNA was mainly through intercalation but some amount of electrostatic interaction was also observed. This binding capacity increased with the degree of coordination of the complexes. The polymer-copper(II) complex having the highest degree of coordination was subjected to analysis of cytotoxic and antimicrobial properties. The cytotoxicity study indicated that the polymer-copper(II) complexes affected the viability of MCF-7 mammary carcinoma cells, and the cells responded to the treatment with mostly through apoptosis although a few cells succumbed to necrosis. The antimicrobial screening showed activity against some human pathogens.

  18. Mechanistic insights into metal ion activation and operator recognition by the ferric uptake regulator

    NASA Astrophysics Data System (ADS)

    Deng, Zengqin; Wang, Qing; Liu, Zhao; Zhang, Manfeng; Machado, Ana Carolina Dantas; Chiu, Tsu-Pei; Feng, Chong; Zhang, Qi; Yu, Lin; Qi, Lei; Zheng, Jiangge; Wang, Xu; Huo, Xinmei; Qi, Xiaoxuan; Li, Xiaorong; Wu, Wei; Rohs, Remo; Li, Ying; Chen, Zhongzhou

    2015-07-01

    Ferric uptake regulator (Fur) plays a key role in the iron homeostasis of prokaryotes, such as bacterial pathogens, but the molecular mechanisms and structural basis of Fur-DNA binding remain incompletely understood. Here, we report high-resolution structures of Magnetospirillum gryphiswaldense MSR-1 Fur in four different states: apo-Fur, holo-Fur, the Fur-feoAB1 operator complex and the Fur-Pseudomonas aeruginosa Fur box complex. Apo-Fur is a transition metal ion-independent dimer whose binding induces profound conformational changes and confers DNA-binding ability. Structural characterization, mutagenesis, biochemistry and in vivo data reveal that Fur recognizes DNA by using a combination of base readout through direct contacts in the major groove and shape readout through recognition of the minor-groove electrostatic potential by lysine. The resulting conformational plasticity enables Fur binding to diverse substrates. Our results provide insights into metal ion activation and substrate recognition by Fur that suggest pathways to engineer magnetotactic bacteria and antipathogenic drugs.

  19. Cyclic perylene diimide: Selective ligand for tetraplex DNA binding over double stranded DNA.

    PubMed

    Vasimalla, Suresh; Sato, Shinobu; Takenaka, Fuminori; Kurose, Yui; Takenaka, Shigeori

    2017-12-15

    Synthesized cyclic perylene diimide, cPDI, showed the binding constant of 6.3 × 10 6  M -1 with binding number of n = 2 with TA-core as a tetraplex DNA in 50 mM Tris-HCl buffer (pH = 7.4) containing 100 mM KCl using Schatchard analysis and showed a higher preference for tetraplex DNA than for double stranded DNA with over 10 3 times. CD spectra showed that TA-core induced its antiparallel conformation upon addition of cPDI in the absence or presence of K + or Na + ions. The cPDI inhibits the telomerase activity with IC 50 of 0.3 µM using TRAP assay which is potential anti-cancer drug with low side effect. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Genetic variations in the DNA replication origins of human papillomavirus family correlate with their oncogenic potential.

    PubMed

    Yilmaz, Gulden; Biswas-Fiss, Esther E; Biswas, Subhasis B

    2018-04-01

    Human papillomaviruses (HPVs) encompass a large family of viruses that range from benign to highly carcinogenic. The crucial differences between benign and carcinogenic types of HPV remain unknown, except that the two HPV types differ in the frequency of DNA replication. We have systematically analyzed the mechanism of HPV DNA replication initiation in low-risk and high-risk HPVs. Our results demonstrate that HPV-encoded E2 initiator protein and its four binding sites in the replication origin play pivotal roles in determining the destiny of the HPV-infected cell. We have identified strain-specific single nucleotide variations in E2 binding sites found only in the high-risk HPVs. We have demonstrated that these variations result in attenuated formation of the E2-DNA complex. E2 binding to these sites is linked to the activation of the DNA replication origin as well as initiation of DNA replication. Both electrophoretic mobility shift assay and atomic force microscopy studies demonstrated that binding of E2 from either low- or high-risk HPVs with variant binding sequences lacked multimeric E2-DNA complex formation in vitro. These results provided a molecular basis of differential DNA replication in the two types of HPVs and pointed to a correlation with the development of cancer. Copyright © 2017. Published by Elsevier B.V.

  1. Yeast Sub1 and human PC4 are G-quadruplex binding proteins that suppress genome instability at co-transcriptionally formed G4 DNA.

    PubMed

    Lopez, Christopher R; Singh, Shivani; Hambarde, Shashank; Griffin, Wezley C; Gao, Jun; Chib, Shubeena; Yu, Yang; Ira, Grzegorz; Raney, Kevin D; Kim, Nayun

    2017-06-02

    G-quadruplex or G4 DNA is a non-B secondary DNA structure consisting of a stacked array of guanine-quartets that can disrupt critical cellular functions such as replication and transcription. When sequences that can adopt Non-B structures including G4 DNA are located within actively transcribed genes, the reshaping of DNA topology necessary for transcription process stimulates secondary structure-formation thereby amplifying the potential for genome instability. Using a reporter assay designed to study G4-induced recombination in the context of an actively transcribed locus in Saccharomyces cerevisiae, we tested whether co-transcriptional activator Sub1, recently identified as a G4-binding factor, contributes to genome maintenance at G4-forming sequences. Our data indicate that, upon Sub1-disruption, genome instability linked to co-transcriptionally formed G4 DNA in Top1-deficient cells is significantly augmented and that its highly conserved DNA binding domain or the human homolog PC4 is sufficient to suppress G4-associated genome instability. We also show that Sub1 interacts specifically with co-transcriptionally formed G4 DNA in vivo and that yeast cells become highly sensitivity to G4-stabilizing chemical ligands by the loss of Sub1. Finally, we demonstrate the physical and genetic interaction of Sub1 with the G4-resolving helicase Pif1, suggesting a possible mechanism by which Sub1 suppresses instability at G4 DNA. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Defective membrane expression of human growth hormone (GH) receptor causes Laron-type GH insensitivity syndrome.

    PubMed Central

    Duquesnoy, P; Sobrier, M L; Amselem, S; Goossens, M

    1991-01-01

    Mutations in the growth hormone receptor (GHR) gene can cause growth hormone (GH) resistance. Given the sequence homology between the extracellular domain of the GHR and a soluble GH-binding protein (GH-BP), it is remarkable that GH-BP binding activity is absent from the serum of patients with Laron-type GH insensitivity, a hereditary form of severe dwarfism. We have previously identified a mutation within the extracellular domain of this receptor, replacing phenylalanine by serine at position 96 of the mature protein, in a patient with Laron syndrome. We have now investigated the effect of this Phe----Ser substitution on hormone binding activity by expressing the total human GHR cDNA and mutant form in eukaryotic cells. The wild-type protein expressed was able to bind GH but no plasma membrane binding was detectable on cells transfected with the mutant cDNA; this was also the case of cells transfected with a Phe96----Ala mutant cDNA, suggesting that the lack of binding activity is not due to a posttranslational modification of serine. Examination of the variant proteins in subcellular fractions revealed the presence of specific GH binding activity in the lysosomal fraction, whereas immunofluorescence studies located mutant proteins in the cytosol. Our findings suggest that these mutant GHRs fail to follow the correct intracellular transport pathway and underline the potential importance of this phenylalanine residue, which is conserved among the GH, prolactin, and erythropoietin receptors that belong to the same cytokine receptor superfamily. Images PMID:1719554

  3. Structure and decoy-mediated inhibition of the SOX18/Prox1-DNA interaction

    PubMed Central

    Klaus, Miriam; Prokoph, Nina; Girbig, Mathias; Wang, Xuecong; Huang, Yong-Heng; Srivastava, Yogesh; Hou, Linlin; Narasimhan, Kamesh; Kolatkar, Prasanna R.; Francois, Mathias; Jauch, Ralf

    2016-01-01

    The transcription factor (TF) SOX18 drives lymphatic vessel development in both embryogenesis and tumour-induced neo-lymphangiogenesis. Genetic disruption of Sox18 in a mouse model protects from tumour metastasis and established the SOX18 protein as a molecular target. Here, we report the crystal structure of the SOX18 DNA binding high-mobility group (HMG) box bound to a DNA element regulating Prox1 transcription. The crystals diffracted to 1.75Å presenting the highest resolution structure of a SOX/DNA complex presently available revealing water structure, structural adjustments at the DNA contact interface and non-canonical conformations of the DNA backbone. To explore alternatives to challenging small molecule approaches for targeting the DNA-binding activity of SOX18, we designed a set of five decoys based on modified Prox1-DNA. Four decoys potently inhibited DNA binding of SOX18 in vitro and did not interact with non-SOX TFs. Serum stability, nuclease resistance and thermal denaturation assays demonstrated that a decoy circularized with a hexaethylene glycol linker and terminal phosphorothioate modifications is most stable. This SOX decoy also interfered with the expression of a luciferase reporter under control of a SOX18-dependent VCAM1 promoter in COS7 cells. Collectively, we propose SOX decoys as potential strategy for inhibiting SOX18 activity to disrupt tumour-induced neo-lymphangiogenesis. PMID:26939885

  4. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element against the Pesticide Fipronil and Sensitive Detection in River Water

    PubMed Central

    Sooter, Letha J.

    2017-01-01

    Fipronil is a commonly used insecticide that has been shown to have environmental and human health risks. The current standard methods of detection for fipronil and its metabolites, such as GC-MS, are time consuming and labor intensive. In this study, a variant of systematic evolution of ligands by exponential enrichment (SELEX), was utilized to identify the first single-stranded DNA (ssDNA) molecular recognition element (MRE) that binds to fipronil with high affinity (Kd = 48 ± 8 nM). The selected MRE displayed low cross binding activity on various environmentally relevant, structurally unrelated herbicides and pesticides, in addition to broad-spectrum binding activity on major metabolites of fipronil and a structurally similar pesticide in prepared river samples. Additionally, a proof-of-principle fluorescent detection assay was developed by using the selected ssDNA MRE as a signal-reporting element, with a limit of detection of 105 nM in a prepared river water sample. PMID:29283416

  5. Immobilization of proteins onto microbeads using a DNA binding tag for enzymatic assays.

    PubMed

    Kojima, Takaaki; Mizoguchi, Takuro; Ota, Eri; Hata, Jumpei; Homma, Keisuke; Zhu, Bo; Hitomi, Kiyotaka; Nakano, Hideo

    2016-02-01

    A novel DNA-binding protein tag, scCro-tag, which is a single-chain derivative of the bacteriophage lambda Cro repressor, has been developed to immobilize proteins of interest (POI) on a solid support through binding OR consensus DNA (ORC) that is tightly bound by the scCro protein. The scCro-tag successfully bound a transglutaminase 2 (TGase 2) substrate and manganese peroxidase (MnP) to microbeads via scaffolding DNA. The resulting protein-coated microbeads can be utilized for functional analysis of the enzymatic activity using flow cytometry. The quantity of bead-bound proteins can be enhanced by increasing the number of ORCs. In addition, proteins with the scCro-tag that were synthesized using a cell-free protein synthesis system were also immobilized onto the beads, thus indicating that this bead-based system would be applicable to high-throughput analysis of various enzymatic activities. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  6. A Broad-Spectrum Inhibitor of CRISPR-Cas9.

    PubMed

    Harrington, Lucas B; Doxzen, Kevin W; Ma, Enbo; Liu, Jun-Jie; Knott, Gavin J; Edraki, Alireza; Garcia, Bianca; Amrani, Nadia; Chen, Janice S; Cofsky, Joshua C; Kranzusch, Philip J; Sontheimer, Erik J; Davidson, Alan R; Maxwell, Karen L; Doudna, Jennifer A

    2017-09-07

    CRISPR-Cas9 proteins function within bacterial immune systems to target and destroy invasive DNA and have been harnessed as a robust technology for genome editing. Small bacteriophage-encoded anti-CRISPR proteins (Acrs) can inactivate Cas9, providing an efficient off switch for Cas9-based applications. Here, we show that two Acrs, AcrIIC1 and AcrIIC3, inhibit Cas9 by distinct strategies. AcrIIC1 is a broad-spectrum Cas9 inhibitor that prevents DNA cutting by multiple divergent Cas9 orthologs through direct binding to the conserved HNH catalytic domain of Cas9. A crystal structure of an AcrIIC1-Cas9 HNH domain complex shows how AcrIIC1 traps Cas9 in a DNA-bound but catalytically inactive state. By contrast, AcrIIC3 blocks activity of a single Cas9 ortholog and induces Cas9 dimerization while preventing binding to the target DNA. These two orthogonal mechanisms allow for separate control of Cas9 target binding and cleavage and suggest applications to allow DNA binding while preventing DNA cutting by Cas9. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Molecular sled sequences are common in mammalian proteins.

    PubMed

    Xiong, Kan; Blainey, Paul C

    2016-03-18

    Recent work revealed a new class of molecular machines called molecular sleds, which are small basic molecules that bind and slide along DNA with the ability to carry cargo along DNA. Here, we performed biochemical and single-molecule flow stretching assays to investigate the basis of sliding activity in molecular sleds. In particular, we identified the functional core of pVIc, the first molecular sled characterized; peptide functional groups that control sliding activity; and propose a model for the sliding activity of molecular sleds. We also observed widespread DNA binding and sliding activity among basic polypeptide sequences that implicate mammalian nuclear localization sequences and many cell penetrating peptides as molecular sleds. These basic protein motifs exhibit weak but physiologically relevant sequence-nonspecific DNA affinity. Our findings indicate that many mammalian proteins contain molecular sled sequences and suggest the possibility that substantial undiscovered sliding activity exists among nuclear mammalian proteins. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. Isolation of a cDNA for a Growth Factor of Vascular Endothelial Cells from Human Lung Cancer Cells: Its Identity with Insulin‐like Growth Factor II

    PubMed Central

    Hagiwara, Koichi; Kobayashi, Tatsuo; Tobita, Masato; Kikyo, Nobuaki; Yazaki, Yoshio

    1995-01-01

    We have found growth‐promoting activity for vascular endothelial cells in the conditioned medium of a human lung cancer cell line, T3M‐11. Purification and characterization of the growth‐promoting activity have been carried out using ammonium sulfate precipitation and gel‐exclusion chromatography. The activity migrated as a single peak just after ribonuclease. It did not bind to a heparin affinity column. These results suggest that the activity is not a heparin‐binding growth factor (including fibroblast growth factors) or a vascular endothelial growth factor. To identify the molecule exhibiting the growth‐promoting activity, a cDNA encoding the growth factor was isolated through functional expression cloning in COS‐1 cells from a cDNA library prepared from T3M‐11 cells. The nucleotide sequence encoded by the cDNA proved to be identical with that of insulin‐like growth factor II. PMID:7730145

  9. Human DNA ligase III recognizes DNA ends by dynamic switching between two DNA-bound states.

    PubMed

    Cotner-Gohara, Elizabeth; Kim, In-Kwon; Hammel, Michal; Tainer, John A; Tomkinson, Alan E; Ellenberger, Tom

    2010-07-27

    Human DNA ligase III has essential functions in nuclear and mitochondrial DNA replication and repair and contains a PARP-like zinc finger (ZnF) that increases the extent of DNA nick joining and intermolecular DNA ligation, yet the bases for ligase III specificity and structural variation among human ligases are not understood. Here combined crystal structure and small-angle X-ray scattering results reveal dynamic switching between two nick-binding components of ligase III: the ZnF-DNA binding domain (DBD) forms a crescent-shaped surface used for DNA end recognition which switches to a ring formed by the nucleotidyl transferase (NTase) and OB-fold (OBD) domains for catalysis. Structural and mutational analyses indicate that high flexibility and distinct DNA binding domain features in ligase III assist both nick sensing and the transition from nick sensing by the ZnF to nick joining by the catalytic core. The collective results support a "jackknife model" in which the ZnF loads ligase III onto nicked DNA and conformational changes deliver DNA into the active site. This work has implications for the biological specificity of DNA ligases and functions of PARP-like zinc fingers.

  10. A DNA aptamer recognising a malaria protein biomarker can function as part of a DNA origami assembly

    PubMed Central

    Godonoga, Maia; Lin, Ting-Yu; Oshima, Azusa; Sumitomo, Koji; Tang, Marco S. L.; Cheung, Yee-Wai; Kinghorn, Andrew B.; Dirkzwager, Roderick M.; Zhou, Cunshan; Kuzuya, Akinori; Tanner, Julian A.; Heddle, Jonathan G.

    2016-01-01

    DNA aptamers have potential for disease diagnosis and as therapeutics, particularly when interfaced with programmable molecular technology. Here we have combined DNA aptamers specific for the malaria biomarker Plasmodium falciparum lactate dehydrogenase (PfLDH) with a DNA origami scaffold. Twelve aptamers that recognise PfLDH were integrated into a rectangular DNA origami and atomic force microscopy demonstrated that the incorporated aptamers preserve their ability to specifically bind target protein. Captured PfLDH retained enzymatic activity and protein-aptamer binding was observed dynamically using high-speed AFM. This work demonstrates the ability of DNA aptamers to recognise a malaria biomarker whilst being integrated within a supramolecular DNA scaffold, opening new possibilities for malaria diagnostic approaches based on DNA nanotechnology. PMID:26891622

  11. Synthesis and structure-activity relationship of amidine derivatives of 3,4-ethylenedioxythiophene as novel antibacterial agents.

    PubMed

    Stolić, Ivana; Čipčić Paljetak, Hana; Perić, Mihaela; Matijašić, Mario; Stepanić, Višnja; Verbanac, Donatella; Bajić, Miroslav

    2015-01-27

    Current antibacterial chemotherapeutics are facing an alarming increase in bacterial resistance pressuring the search for novel agents that would expand the available therapeutic arsenal against resistant bacterial pathogens. In line with these efforts, a series of 9 amidine derivatives of 3,4-ethylenedioxythiophene were synthesized and, together with 18 previously synthesized analogs, evaluated for their relative DNA binding affinity, in vitro antibacterial activities and preliminary in vitro safety profile. Encouraging antibacterial activity of several subclasses of tested amidine derivatives against Gram-positive (including resistant MRSA, MRSE, VRE strains) and Gram-negative bacterial strains was observed. The bis-phenyl derivatives were the most antibacterially active, while compound 19 from bis-benzimidazole class exhibited the widest spectrum of activity (with MIC of 4, 2, 0.5 and ≤0.25 μg/ml against laboratory strains of Staphyloccocus aureus, Streptococcus pneumoniae, Streptococcus pyogenes, Moraxella catarrhalis, respectively and 4-32 μg/ml against clinical isolates of sensitive and resistant S. aureus, Staphylococcus epidermidis and Enterococcus faecium) and also demonstrated the strongest DNA binding affinity (ΔTm of 15.4 °C). Asymmetrically designed compounds and carboxamide-amidines were, in general, less active. Molecular docking indicated that the shape of the 3,4-ethylenedioxythiophene derivatives and their ability to form multiple electrostatic and hydrogen bonds with DNA, corresponds to the binding modes of other minor-groove binders. Herein reported results encourage further investigation of this class of compounds as novel antibacterial DNA binding agents. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  12. DNA interaction with naturally occurring antioxidant flavonoids quercetin, kaempferol, and delphinidin.

    PubMed

    Kanakis, C D; Tarantilis, P A; Polissiou, M G; Diamantoglou, S; Tajmir-Riahi, H A

    2005-06-01

    Flavonoids are strong antioxidants that prevent DNA damage. The anticancer and antiviral activities of these natural products are implicated in their mechanism of actions. However, there has been no information on the interactions of these antioxidants with individual DNA at molecular level. This study was designed to examine the interaction of quercetin (que), kaempferol (kae), and delphinidin (del) with calf-thymus DNA in aqueous solution at physiological conditions, using constant DNA concentration (6.5 mmol) and various drug/DNA(phosphate) ratios of 1/65 to 1. FTIR and UV-Visible difference spectroscopic methods are used to determine the drug binding sites, the binding constants and the effects of drug complexation on the stability and conformation of DNA duplex. Structural analysis showed quercetin, kaempferol, and delphinidin bind weakly to adenine, guanine (major groove), and thymine (minor groove) bases, as well as to the backbone phosphate group with overall binding constants K(que) = 7.25 x 10(4)M(-1), K(kae) = 3.60 x 10(4)M(-1), and K(del) = 1.66 x 10(4)M(-1). The stability of adduct formation is in the order of que>kae>del. Delphinidin with a positive charge induces more stabilizing effect on DNA duplex than quercetin and kaempferol. A partial B to A-DNA transition occurs at high drug concentrations.

  13. Time-dependent modulation of thioredoxin reductase activity might contribute to sulforaphane-mediated inhibition of NF-kappaB binding to DNA.

    PubMed

    Heiss, Elke; Gerhäuser, Clarissa

    2005-01-01

    The chemopreventive agent sulforaphane (SFN) exerts anti-inflammatory activity by thiol-dependent inhibition of nuclear factor kappaB (NF-kappaB) DNA binding. To further analyze the underlying mechanisms, we focused on the thioredoxin/thioredoxin reductase (TrxR) system as a key redox mechanism regulating NF-kappaB DNA binding. Using cultured Raw 264.7 mouse macrophages as a model, 1-chloro-2,4-dinitrobenzene (CDNB), a known inhibitor of TrxR, was identified as an inhibitor of lipopolysaccharide (LPS)-mediated nitric oxide (NO) production and of NF-kappaB DNA binding. CDNB and SFN acted synergistically with respect to inhibition of LPS-induced NO release, and we consequently identified SFN as a novel inhibitor of TrxR enzymatic activity in vitro. Short-term treatment of Raw macrophages with SFN or CDNB resulted in the inhibition of TrxR activity in vivo with half-maximal inhibitory concentration of 25.0 +/- 3.5 microM and 9.4 +/- 3.7 microM, respectively, whereas after a 24-h treatment with 25 microM SFN, TrxR activity was >1.5-fold elevated. In additional experiments, we could exclude that inhibition of trans-activating activity of NF-kappaB contributed to the reduced expression of pro-inflammatory proteins by SFN, based on transient transfection experiments with a (kappaB)(2)- chloramphenicol acetyltransferase construct and a lack of inhibition of protein kinase A activity. These findings further emphasize the importance of redox modulation or thiol reactivity for the regulation of NF-kappaB-dependent transcription by SFN. Antioxid. Redox Signal. 7, 1601-1611. Antioxid. Redox Signal. 7, 1601-1611.

  14. A calmodulin-binding/CGCG box DNA-binding protein family involved in multiple signaling pathways in plants

    NASA Technical Reports Server (NTRS)

    Yang, Tianbao; Poovaiah, B. W.

    2002-01-01

    We reported earlier that the tobacco early ethylene-responsive gene NtER1 encodes a calmodulin-binding protein (Yang, T., and Poovaiah, B. W. (2000) J. Biol. Chem. 275, 38467-38473). Here we demonstrate that there is one NtER1 homolog as well as five related genes in Arabidopsis. These six genes are rapidly and differentially induced by environmental signals such as temperature extremes, UVB, salt, and wounding; hormones such as ethylene and abscisic acid; and signal molecules such as methyl jasmonate, H(2)O(2), and salicylic acid. Hence, they were designated as AtSR1-6 (Arabidopsis thaliana signal-responsive genes). Ca(2+)/calmodulin binds to all AtSRs, and their calmodulin-binding regions are located on a conserved basic amphiphilic alpha-helical motif in the C terminus. AtSR1 targets the nucleus and specifically recognizes a novel 6-bp CGCG box (A/C/G)CGCG(G/T/C). The multiple CGCG cis-elements are found in promoters of genes such as those involved in ethylene signaling, abscisic acid signaling, and light signal perception. The DNA-binding domain in AtSR1 is located on the N-terminal 146 bp where all AtSR1-related proteins share high similarity but have no similarity to other known DNA-binding proteins. The calmodulin-binding nuclear proteins isolated from wounded leaves exhibit specific CGCG box DNA binding activities. These results suggest that the AtSR gene family encodes a family of calmodulin-binding/DNA-binding proteins involved in multiple signal transduction pathways in plants.

  15. Redox-dependent regulation of hepatocyte AIM2 inflammasome activation in sterile liver injury in mice

    PubMed Central

    Sun, Qian; Loughran, Patricia; Shapiro, Richard; Shrivastava, Indira H.; Antoine, Daniel J.; Li, Tunliang; Yan, Zhengzheng; Fan, Jie; Billiar, Timothy R.; Scott, Melanie J.

    2016-01-01

    Sterile liver inflammation, such as liver ischemia reperfusion, hemorrhagic shock after trauma and drug-induced liver injury is initiated and regulated by endogenous mediators including DNA and reactive oxygen species. Here we identify a novel mechanism for redox-mediated regulation of AIM2-inflammasome activation in hepatocytes after redox stress in mice, which occurs via interaction with cytosolic HMGB1. We show that in liver during hemorrhagic shock in mice, and in hepatocytes after hypoxia with reoxygenation, cytosolic HMGB1 associates with AIM2 and is required for activation of caspase-1 in response to cytosolic DNA. Activation of caspase-1 via AIM2 leads to subsequent hepatoprotective responses such as autophagy. HMGB1 binds to AIM2 at a non-DNA-binding site on the HIN-domain of AIM2 to facilitate inflammasome and caspase-1 activation in hepatocytes. Furthermore, binding of HMGB1 to AIM2 is stronger with fully-reduced all-thiol HMGB1 than with partially oxidized disulfide-HMGB1, and binding strength corresponds to caspase-1 activation. These data suggest HMGB1 redox status regulates AIM2 inflammasome activation. Conclusion Our findings suggest a novel and important mechanism for regulation of AIM2 inflammasome activation in hepatocytes during redox stress. Our study may suggest broader implications for how this and other inflammasomes are activated and how their activation is regulated during cell stress, as well as the mechanisms of inflammasome regulation in non-immune cell types. PMID:27774630

  16. Regulation of Active DNA Demethylation by a Methyl-CpG-Binding Domain Protein in Arabidopsis thaliana

    PubMed Central

    Sun, Han; Zeng, Jun; Cao, Zhendong; Li, Yan; Qian, Weiqiang

    2015-01-01

    Active DNA demethylation plays crucial roles in the regulation of gene expression in both plants and animals. In Arabidopsis thaliana, active DNA demethylation is initiated by the ROS1 subfamily of 5-methylcytosine-specific DNA glycosylases via a base excision repair mechanism. Recently, IDM1 and IDM2 were shown to be required for the recruitment of ROS1 to some of its target loci. However, the mechanism(s) by which IDM1 is targeted to specific genomic loci remains to be determined. Affinity purification of IDM1- and IDM2- associating proteins demonstrated that IDM1 and IDM2 copurify together with two novel components, methyl-CpG-binding domain protein 7 (MBD7) and IDM2-like protein 1 (IDL1). IDL1 encodes an α-crystallin domain protein that shows high sequence similarity with IDM2. MBD7 interacts with IDM2 and IDL1 in vitro and in vivo and they form a protein complex associating with IDM1 in vivo. MBD7 directly binds to the target loci and is required for the H3K18 and H3K23 acetylation in planta. MBD7 dysfunction causes DNA hypermethylation and silencing of reporter genes and a subset of endogenous genes. Our results suggest that a histone acetyltransferase complex functions in active DNA demethylation and in suppression of gene silencing at some loci in Arabidopsis. PMID:25933434

  17. Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

    PubMed Central

    Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

    1998-01-01

    The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery. PMID:9811800

  18. Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

    PubMed

    Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

    1998-11-01

    The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery.

  19. APE2 Zf-GRF facilitates 3'-5' resection of DNA damage following oxidative stress

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wallace, Bret D.; Berman, Zachary; Mueller, Geoffrey A.

    The Xenopus laevis APE2 (apurinic/apyrimidinic endonuclease 2) nuclease participates in 3'-5' nucleolytic resection of oxidative DNA damage and activation of the ATR-Chk1 DNA damage response (DDR) pathway via ill-defined mechanisms. Here we report that APE2 resection activity is regulated by DNA interactions in its Zf-GRF domain, a region sharing high homology with DDR proteins Topoisomerase 3α (TOP3α) and NEIL3 (Nei-like DNA glycosylase 3), as well as transcription and RNA regulatory proteins, such as TTF2 (transcription termination factor 2), TFIIS, and RPB9. Biochemical and NMR results establish the nucleic acid-binding activity of the Zf-GRF domain. Moreover, an APE2 Zf-GRF X-ray structuremore » and small-angle X-ray scattering analyses show that the Zf-GRF fold is typified by a crescent-shaped ssDNA binding claw that is flexibly appended to an APE2 endonuclease/exonuclease/phosphatase (EEP) catalytic core. Structure-guided Zf-GRF mutations impact APE2 DNA binding and 3'-5' exonuclease processing, and also prevent efficient APE2-dependent RPA recruitment to damaged chromatin and activation of the ATR-Chk1 DDR pathway in response to oxidative stress in Xenopus egg extracts. Collectively, our data unveil the APE2 Zf-GRF domain as a nucleic acid interaction module in the regulation of a key single-strand break resection function of APE2, and also reveal topologic similarity of the Zf-GRF to the zinc ribbon domains of TFIIS and RPB9.« less

  20. Role of the hydrophilic channels of simian virus 40 T-antigen helicase in DNA replication.

    PubMed

    Wang, Weiping; Manna, David; Simmons, Daniel T

    2007-05-01

    The simian virus 40 (SV40) hexameric helicase consists of a central channel and six hydrophilic channels located between adjacent large tier domains within each hexamer. To study the function of the hydrophilic channels in SV40 DNA replication, a series of single-point substitutions were introduced at sites not directly involved in protein-protein contacts. The mutants were characterized biochemically in various ways. All mutants oligomerized normally in the absence of DNA. Interestingly, 8 of the 10 mutants failed to unwind an origin-containing DNA fragment and nine of them were totally unable to support SV40 DNA replication in vitro. The mutants fell into four classes based on their biochemical properties. Class A mutants bound DNA normally and had normal ATPase and helicase activities but failed to unwind origin DNA and support SV40 DNA replication. Class B mutants were compromised in single-stranded DNA and origin DNA binding at low protein concentrations. They were defective in helicase activity and unwinding of the origin and in supporting DNA replication. Class C and D mutants possessed higher-than-normal single-stranded DNA binding activity at low protein concentrations. The class C mutants failed to separate origin DNA and support DNA replication. The class D mutants unwound origin DNA normally but were compromised in their ability to support DNA replication. Taken together, these results suggest that the hydrophilic channels have an active role in the unwinding of SV40 DNA from the origin and the placement of the resulting single strands within the helicase.

  1. The RecX protein interacts with the RecA protein and modulates its activity in Herbaspirillum seropedicae.

    PubMed

    Galvão, C W; Souza, E M; Etto, R M; Pedrosa, F O; Chubatsu, L S; Yates, M G; Schumacher, J; Buck, M; Steffens, M B R

    2012-12-01

    DNA repair is crucial to the survival of all organisms. The bacterial RecA protein is a central component in the SOS response and in recombinational and SOS DNA repairs. The RecX protein has been characterized as a negative modulator of RecA activity in many bacteria. The recA and recX genes of Herbaspirillum seropedicae constitute a single operon, and evidence suggests that RecX participates in SOS repair. In the present study, we show that the H. seropedicae RecX protein (RecX Hs) can interact with the H. seropedicaeRecA protein (RecA Hs) and that RecA Hs possesses ATP binding, ATP hydrolyzing and DNA strand exchange activities. RecX Hs inhibited 90% of the RecA Hs DNA strand exchange activity even when present in a 50-fold lower molar concentration than RecA Hs. RecA Hs ATP binding was not affected by the addition of RecX, but the ATPase activity was reduced. When RecX Hs was present before the formation of RecA filaments (RecA-ssDNA), inhibition of ATPase activity was substantially reduced and excess ssDNA also partially suppressed this inhibition. The results suggest that the RecX Hs protein negatively modulates the RecA Hs activities by protein-protein interactions and also by DNA-protein interactions.

  2. DBC1 promotes castration-resistant prostate cancer by positively regulating DNA binding and stability of AR-V7.

    PubMed

    Moon, Sue Jin; Jeong, Byong Chang; Kim, Hwa Jin; Lim, Joung Eun; Kwon, Ghee Young; Kim, Jeong Hoon

    2018-03-01

    Constitutively active AR-V7, one of the major androgen receptor (AR) splice variants lacking the ligand-binding domain, plays a key role in the development of castration-resistant prostate cancer (CRPC) and anti-androgen resistance. However, our understanding of the regulatory mechanisms of AR-V7-driven transcription is limited. Here we report DBC1 as a key regulator of AR-V7 transcriptional activity and stability in CRPC cells. DBC1 functions as a coactivator for AR-V7 and is required for the expression of AR-V7 target genes including CDH2, a mesenchymal marker linked to CRPC progression. DBC1 is required for recruitment of AR-V7 to its target enhancers and for long-range chromatin looping between the CDH2 enhancer and promoter. Mechanistically, DBC1 enhances DNA-binding activity of AR-V7 by direct interaction and inhibits CHIP E3 ligase-mediated ubiquitination and degradation of AR-V7 by competing with CHIP for AR-V7 binding, thereby stabilizing and activating AR-V7. Importantly, DBC1 depletion suppresses the tumorigenic and metastatic properties of CRPC cells. Our results firmly establish DBC1 as a critical AR-V7 coactivator that plays a key role in the regulation of DNA binding and stability of AR-V7 and has an important physiological role in CRPC progression.

  3. Concentration-Dependent Exchange of Replication Protein A on Single-Stranded DNA Revealed by Single-Molecule Imaging

    PubMed Central

    Gibb, Bryan; Ye, Ling F.; Gergoudis, Stephanie C.; Kwon, YoungHo; Niu, Hengyao; Sung, Patrick; Greene, Eric C.

    2014-01-01

    Replication protein A (RPA) is a ubiquitous eukaryotic single-stranded DNA (ssDNA) binding protein necessary for all aspects of DNA metabolism involving an ssDNA intermediate, including DNA replication, repair, recombination, DNA damage response and checkpoint activation, and telomere maintenance [1], [2], [3]. The role of RPA in most of these reactions is to protect the ssDNA until it can be delivered to downstream enzymes. Therefore a crucial feature of RPA is that it must bind very tightly to ssDNA, but must also be easily displaced from ssDNA to allow other proteins to gain access to the substrate. Here we use total internal reflection fluorescence microscopy and nanofabricated DNA curtains to visualize the behavior of Saccharomyces cerevisiae RPA on individual strands of ssDNA in real-time. Our results show that RPA remains bound to ssDNA for long periods of time when free protein is absent from solution. In contrast, RPA rapidly dissociates from ssDNA when free RPA is present in solution allowing rapid exchange between the free and bound states. In addition, the S. cerevisiae DNA recombinase Rad51 and E. coli single-stranded binding protein (SSB) also promote removal of RPA from ssDNA. These results reveal an unanticipated exchange between bound and free RPA suggesting a binding mechanism that can confer exceptionally slow off rates, yet also enables rapid displacement through a direct exchange mechanism that is reliant upon the presence of free ssDNA-binding proteins in solution. Our results indicate that RPA undergoes constant microscopic dissociation under all conditions, but this is only manifested as macroscopic dissociation (i.e. exchange) when free proteins are present in solution, and this effect is due to mass action. We propose that the dissociation of RPA from ssDNA involves a partially dissociated intermediate, which exposes a small section of ssDNA allowing other proteins to access to the DNA. PMID:24498402

  4. Functional interaction of CCAAT/enhancer-binding-protein-α basic region mutants with E2F transcription factors and DNA.

    PubMed

    Kowenz-Leutz, Elisabeth; Schuetz, Anja; Liu, Qingbin; Knoblich, Maria; Heinemann, Udo; Leutz, Achim

    2016-07-01

    The transcription factor CCAAT/enhancer-binding protein α (C/EBPα) regulates cell cycle arrest and terminal differentiation of neutrophils and adipocytes. Mutations in the basic leucine zipper domain (bZip) of C/EBPα are associated with acute myeloid leukemia. A widely used murine transforming C/EBPα basic region mutant (BRM2) entails two bZip point mutations (I294A/R297A). BRM2 has been discordantly described as defective for DNA binding or defective for interaction with E2F. We have separated the two BRM2 mutations to shed light on the intertwined reciprocity between C/EBPα-E2F-DNA interactions. Both, C/EBPα I294A and R297A retain transactivation capacity and interaction with E2F-DP. The C/EBPα R297A mutation destabilized DNA binding, whereas the C/EBPα I294A mutation enhanced binding to DNA. The C/EBPα R297A mutant, like BRM2, displayed enhanced interaction with E2F-DP but failed to repress E2F-dependent transactivation although both mutants were readily suppressed by E2F1 for transcription through C/EBP cis-regulatory sites. In contrast, the DNA binding enhanced C/EBPα I294A mutant displayed increased repression of E2F-DP mediated transactivation and resisted E2F-DP mediated repression. Thus, the efficient repression of E2F dependent S-phase genes and the activation of differentiation genes reside in the balanced DNA binding capacity of C/EBPα. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Complex formation by the human Rad51B and Rad51C DNA repair proteins and their activities in vitro

    NASA Technical Reports Server (NTRS)

    Lio, Yi-Ching; Mazin, Alexander V.; Kowalczykowski, Stephen C.; Chen, David J.

    2003-01-01

    The human Rad51 protein is essential for DNA repair by homologous recombination. In addition to Rad51 protein, five paralogs have been identified: Rad51B/Rad51L1, Rad51C/Rad51L2, Rad51D/Rad51L3, XRCC2, and XRCC3. To further characterize a subset of these proteins, recombinant Rad51, Rad51B-(His)(6), and Rad51C proteins were individually expressed employing the baculovirus system, and each was purified from Sf9 insect cells. Evidence from nickel-nitrilotriacetic acid pull-down experiments demonstrates a highly stable Rad51B.Rad51C heterodimer, which interacts weakly with Rad51. Rad51B and Rad51C proteins were found to bind single- and double-stranded DNA and to preferentially bind 3'-end-tailed double-stranded DNA. The ability to bind DNA was elevated with mixed Rad51 and Rad51C, as well as with mixed Rad51B and Rad51C, compared with that of the individual protein. In addition, both Rad51B and Rad51C exhibit DNA-stimulated ATPase activity. Rad51C displays an ATP-independent apparent DNA strand exchange activity, whereas Rad51B shows no such activity; this apparent strand exchange ability results actually from a duplex DNA destabilization capability of Rad51C. By analogy to the yeast Rad55 and Rad57, our results suggest that Rad51B and Rad51C function through interactions with the human Rad51 recombinase and play a crucial role in the homologous recombinational repair pathway.

  6. Effect of DNA Binding on Geminate CO Recombination Kinetics in CO-sensing Transcription Factor CooA*

    PubMed Central

    Benabbas, Abdelkrim; Karunakaran, Venugopal; Youn, Hwan; Poulos, Thomas L.; Champion, Paul M.

    2012-01-01

    Carbon monoxide oxidation activator (CooA) proteins are heme-based CO-sensing transcription factors. Here we study the ultrafast dynamics of geminate CO rebinding in two CooA homologues, Rhodospirillum rubrum (RrCooA) and Carboxydothermus hydrogenoformans (ChCooA). The effects of DNA binding and the truncation of the DNA-binding domain on the CO geminate recombination kinetics were specifically investigated. The CO rebinding kinetics in these CooA complexes take place on ultrafast time scales but remain non-exponential over many decades in time. We show that this non-exponential kinetic response is due to a quenched enthalpic barrier distribution resulting from a distribution of heme geometries that is frozen or slowly evolving on the time scale of CO rebinding. We also show that, upon CO binding, the distal pocket of the heme in the CooA proteins relaxes to form a very efficient hydrophobic trap for CO. DNA binding further tightens the narrow distal pocket and slightly weakens the iron-proximal histidine bond. Comparison of the CO rebinding kinetics of RrCooA, truncated RrCooA, and DNA-bound RrCooA proteins reveals that the uncomplexed and inherently flexible DNA-binding domain adds additional structural heterogeneity to the heme doming coordinate. When CooA forms a complex with DNA, the flexibility of the DNA-binding domain decreases, and the distribution of the conformations available in the heme domain becomes restricted. The kinetic studies also offer insights into how the architecture of the heme environment can tune entropic barriers in order to control the geminate recombination of CO in heme proteins, whereas spin selection rules play a minor or non-existent role. PMID:22544803

  7. Effect of DNA binding on geminate CO recombination kinetics in CO-sensing transcription factor CooA.

    PubMed

    Benabbas, Abdelkrim; Karunakaran, Venugopal; Youn, Hwan; Poulos, Thomas L; Champion, Paul M

    2012-06-22

    Carbon monoxide oxidation activator (CooA) proteins are heme-based CO-sensing transcription factors. Here we study the ultrafast dynamics of geminate CO rebinding in two CooA homologues, Rhodospirillum rubrum (RrCooA) and Carboxydothermus hydrogenoformans (ChCooA). The effects of DNA binding and the truncation of the DNA-binding domain on the CO geminate recombination kinetics were specifically investigated. The CO rebinding kinetics in these CooA complexes take place on ultrafast time scales but remain non-exponential over many decades in time. We show that this non-exponential kinetic response is due to a quenched enthalpic barrier distribution resulting from a distribution of heme geometries that is frozen or slowly evolving on the time scale of CO rebinding. We also show that, upon CO binding, the distal pocket of the heme in the CooA proteins relaxes to form a very efficient hydrophobic trap for CO. DNA binding further tightens the narrow distal pocket and slightly weakens the iron-proximal histidine bond. Comparison of the CO rebinding kinetics of RrCooA, truncated RrCooA, and DNA-bound RrCooA proteins reveals that the uncomplexed and inherently flexible DNA-binding domain adds additional structural heterogeneity to the heme doming coordinate. When CooA forms a complex with DNA, the flexibility of the DNA-binding domain decreases, and the distribution of the conformations available in the heme domain becomes restricted. The kinetic studies also offer insights into how the architecture of the heme environment can tune entropic barriers in order to control the geminate recombination of CO in heme proteins, whereas spin selection rules play a minor or non-existent role.

  8. Activation of p53 Transcriptional Activity by SMRT: a Histone Deacetylase 3-Independent Function of a Transcriptional Corepressor

    PubMed Central

    Adikesavan, Anbu Karani; Karmakar, Sudipan; Pardo, Patricia; Wang, Liguo; Liu, Shuang; Li, Wei

    2014-01-01

    The silencing mediator of retinoic acid and thyroid hormone receptors (SMRT) is an established histone deacetylase 3 (HDAC3)-dependent transcriptional corepressor. Microarray analyses of MCF-7 cells transfected with control or SMRT small interfering RNA revealed SMRT regulation of genes involved in DNA damage responses, and the levels of the DNA damage marker γH2AX as well as poly(ADP-ribose) polymerase cleavage were elevated in SMRT-depleted cells treated with doxorubicin. A number of these genes are established p53 targets. SMRT knockdown decreased the activity of two p53-dependent reporter genes as well as the expression of p53 target genes, such as CDKN1A (which encodes p21). SMRT bound directly to p53 and was recruited to p53 binding sites within the p21 promoter. Depletion of GPS2 and TBL1, components of the SMRT corepressor complex, but not histone deacetylase 3 (HDAC3) decreased p21-luciferase activity. p53 bound to the SMRT deacetylase activation domain (DAD), which mediates HDAC3 binding and activation, and HDAC3 could attenuate p53 binding to the DAD region of SMRT. Moreover, an HDAC3 binding-deficient SMRT DAD mutant coactivated p53 transcriptional activity. Collectively, these data highlight a biological role for SMRT in mediating DNA damage responses and suggest a model where p53 binding to the DAD limits HDAC3 interaction with this coregulator, thereby facilitating SMRT coactivation of p53-dependent gene expression. PMID:24449765

  9. Promoter selection in human mitochondria involves binding of a transcription factor to orientation-independent upstream regulatory elements.

    PubMed

    Fisher, R P; Topper, J N; Clayton, D A

    1987-07-17

    Selective transcription of human mitochondrial DNA requires a transcription factor (mtTF) in addition to an essentially nonselective RNA polymerase. Partially purified mtTF is able to sequester promoter-containing DNA in preinitiation complexes in the absence of mitochondrial RNA polymerase, suggesting a DNA-binding mechanism for factor activity. Functional domains, required for positive transcriptional regulation by mtTF, are identified within both major promoters of human mtDNA through transcription of mutant promoter templates in a reconstituted in vitro system. These domains are essentially coextensive with DNA sequences protected from nuclease digestion by mtTF-binding. Comparison of the sequences of the two mtTF-responsive elements reveals significant homology only when one sequence is inverted; the binding sites are in opposite orientations with respect to the predominant direction of transcription. Thus mtTF may function bidirectionally, requiring additional protein-DNA interactions to dictate transcriptional polarity. The mtTF-responsive elements are arrayed as direct repeats, separated by approximately 80 bp within the displacement-loop region of human mitochondrial DNA; this arrangement may reflect duplication of an ancestral bidirectional promoter, giving rise to separate, unidirectional promoters for each strand.

  10. POZ domain transcription factor, FBI-1, represses transcription of ADH5/FDH by interacting with the zinc finger and interfering with DNA binding activity of Sp1.

    PubMed

    Lee, Dong-Kee; Suh, Dongchul; Edenberg, Howard J; Hur, Man-Wook

    2002-07-26

    The POZ domain is a protein-protein interaction motif that is found in many transcription factors, which are important for development, oncogenesis, apoptosis, and transcription repression. We cloned the POZ domain transcription factor, FBI-1, that recognizes the cis-element (bp -38 to -22) located just upstream of the core Sp1 binding sites (bp -22 to +22) of the ADH5/FDH minimal promoter (bp -38 to +61) in vitro and in vivo, as revealed by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. The ADH5/FDH minimal promoter is potently repressed by the FBI-1. Glutathione S-transferase fusion protein pull-down showed that the POZ domains of FBI-1, Plzf, and Bcl-6 directly interact with the zinc finger DNA binding domain of Sp1. DNase I footprinting assays showed that the interaction prevents binding of Sp1 to the GC boxes of the ADH5/FDH promoter. Gal4-POZ domain fusions targeted proximal to the GC boxes repress transcription of the Gal4 upstream activator sequence-Sp1-adenovirus major late promoter. Our data suggest that POZ domain represses transcription by interacting with Sp1 zinc fingers and by interfering with the DNA binding activity of Sp1.

  11. Vsx2 Controls Eye Organogenesis and Retinal Progenitor Identity Via Homeodomain and Non-Homeodomain Residues Required for High Affinity DNA Binding

    PubMed Central

    Zou, Changjiang; Levine, Edward M.

    2012-01-01

    The homeodomain and adjacent CVC domain in the visual system homeobox (VSX) proteins are conserved from nematodes to humans. Humans with missense mutations in these regions of VSX2 have microphthalmia, suggesting both regions are critical for function. To assess this, we generated the corresponding mutations in mouse Vsx2. The homeodomain mutant protein lacked DNA binding activity and the knock-in mutant phenocopied the null mutant, ocular retardation J. The CVC mutant protein exhibited weakened DNA binding; and, although the corresponding knock-in allele was recessive, it unexpectedly caused the strongest phenotype, as indicated by severe microphthalmia and hyperpigmentation of the neural retina. This occurred through a cryptic transcriptional feedback loop involving the transcription factors Mitf and Otx1 and the Cdk inhibitor p27Kip1. Our data suggest that the phenotypic severity of the CVC mutant depends on the weakened DNA binding activity elicited by the CVC mutation and a previously unknown protein interaction between Vsx2 and its regulatory target Mitf. Our data also suggest that an essential function of the CVC domain is to assist the homeodomain in high-affinity DNA binding, which is required for eye organogenesis and unhindered execution of the retinal progenitor program in mammals. Finally, the genetic and phenotypic behaviors of the CVC mutation suggest it has the characteristics of a recessive neomorph, a rare type of genetic allele. PMID:23028343

  12. Distribution of cytotoxic and DNA ADP-ribosylating activity in crude extracts from butterflies among the family Pieridae

    PubMed Central

    Matsumoto, Yasuko; Nakano, Tsuyoshi; Yamamoto, Masafumi; Matsushima-Hibiya, Yuko; Odagiri, Ken-Ichi; Yata, Osamu; Koyama, Kotaro; Sugimura, Takashi; Wakabayashi, Keiji

    2008-01-01

    Cabbage butterflies, Pieris rapae and Pieris brassicae, contain strong cytotoxic proteins, designated as pierisin-1 and -2, against cancer cell lines. These proteins exhibit DNA ADP-ribosylating activity. To determine the distribution of substances with cytotoxicity and DNA ADP-ribosylating activity among other species, crude extracts from 20 species of the family Pieridae were examined for cytotoxicity in HeLa cells and DNA ADP-ribosylating activity. Both activities were detected in extracts from 13 species: subtribes Pierina (Pieris rapae, Pieris canidia, Pieris napi, Pieris melete, Pieris brassicae, Pontia daplidice, and Talbotia naganum), Aporiina (Aporia gigantea, Aporia crataegi, Aporia hippia, and Delias pasithoe), and Appiadina (Appias nero and Appias paulina). All of these extracts contained substances recognized by anti-pierisin-1 antibodies, with a molecular mass of ≈100 kDa established earlier for pierisin-1. Moreover, sequences containing NAD-binding sites, conserved in ADP-ribosyltransferases, were amplified from genomic DNA from 13 species of butterflies with cytotoxicity and DNA ADP-ribosylating activity by PCR. Extracts from seven species, Appias lyncida, Leptosia nina, Anthocharis scolymus, Eurema hecabe, Catopsilia pomona, Catopsilia scylla, and Colias erate, showed neither cytotoxicity nor DNA ADP-ribosylating activity, and did not contain substances recognized by anti-pierisin-1 antibodies. Sequences containing NAD-binding sites were not amplified from genomic DNA from these seven species. Thus, pierisin-like proteins, showing cytotoxicity and DNA ADP-ribosylating activity, are suggested to be present in the extracts from butterflies not only among the subtribe Pierina, but also among the subtribes Aporiina and Appiadina. These findings offer insight to understanding the nature of DNA ADP-ribosylating activity in the butterfly. PMID:18256183

  13. Modulating the DNA affinity of Elk-1 with computationally selected mutations.

    PubMed

    Park, Sheldon; Boder, Eric T; Saven, Jeffery G

    2005-04-22

    In order to regulate gene expression, transcription factors must first bind their target DNA sequences. The affinity of this binding is determined by both the network of interactions at the interface and the entropy change associated with the complex formation. To study the role of structural fluctuation in fine-tuning DNA affinity, we performed molecular dynamics simulations of two highly homologous proteins, Elk-1 and SAP-1, that exhibit different sequence specificity. Simulation studies show that several residues in Elk have significantly higher main-chain root-mean-square deviations than their counterparts in SAP. In particular, a single residue, D69, may contribute to Elk's lower DNA affinity for P(c-fos) by structurally destabilizing the carboxy terminus of the recognition helix. While D69 does not contact DNA directly, the increased mobility in the region may contribute to its weaker binding. We measured the ability of single point mutants of Elk to bind P(c-fos) in a reporter assay, in which D69 of wild-type Elk has been mutated to other residues with higher helix propensity in order to stabilize the local conformation. The gains in transcriptional activity and the free energy of binding suggested from these measurements correlate well with stability gains computed from helix propensity and charge-macrodipole interactions. The study suggests that residues that are distal to the binding interface may indirectly modulate the binding affinity by stabilizing the protein scaffold required for efficient DNA interaction.

  14. Alternative Use of DNA Binding Domains by the Neurospora White Collar Complex Dictates Circadian Regulation and Light Responses

    PubMed Central

    Wang, Bin; Zhou, Xiaoying; Loros, Jennifer J.

    2015-01-01

    In the Neurospora circadian system, the White Collar complex (WCC) of WC-1 and WC-2 drives transcription of the circadian pacemaker gene frequency (frq), whose gene product, FRQ, as a part of the FRQ-FRH complex (FFC), inhibits its own expression. The WCC is also the principal Neurospora photoreceptor; WCC-mediated light induction of frq resets the clock, and all acute light induction is triggered by WCC binding to promoters of light-induced genes. However, not all acutely light-induced genes are also clock regulated, and conversely, not all clock-regulated direct targets of WCC are light induced; the structural determinants governing the shift from WCC's dark circadian role to its light activation role are poorly described. We report that the DBD region (named for being defective in binding DNA), a basic region in WC-1 proximal to the DNA-binding zinc finger (ZnF) whose function was previously ascribed to nuclear localization, instead plays multiple essential roles assisting in DNA binding and mediating interactions with the FFC. DNA binding for light induction by the WCC requires only WC-2, whereas DNA binding for circadian functions requires WC-2 as well as the ZnF and DBD motif of WC-1. The data suggest a means by which alterations in the tertiary and quaternary structures of the WCC can lead to its distinct functions in the dark and in the light. PMID:26711258

  15. Molecular Dynamics Simulations of DNA-Free and DNA-Bound TAL Effectors

    PubMed Central

    Wan, Hua; Hu, Jian-ping; Li, Kang-shun; Tian, Xu-hong; Chang, Shan

    2013-01-01

    TAL (transcriptional activator-like) effectors (TALEs) are DNA-binding proteins, containing a modular central domain that recognizes specific DNA sequences. Recently, the crystallographic studies of TALEs revealed the structure of DNA-recognition domain. In this article, molecular dynamics (MD) simulations are employed to study two crystal structures of an 11.5-repeat TALE, in the presence and absence of DNA, respectively. The simulated results indicate that the specific binding of RVDs (repeat-variable diresidues) with DNA leads to the markedly reduced fluctuations of tandem repeats, especially at the two ends. In the DNA-bound TALE system, the base-specific interaction is formed mainly by the residue at position 13 within a TAL repeat. Tandem repeats with weak RVDs are unfavorable for the TALE-DNA binding. These observations are consistent with experimental studies. By using principal component analysis (PCA), the dominant motions are open-close movements between the two ends of the superhelical structure in both DNA-free and DNA-bound TALE systems. The open-close movements are found to be critical for the recognition and binding of TALE-DNA based on the analysis of free energy landscape (FEL). The conformational analysis of DNA indicates that the 5′ end of DNA target sequence has more remarkable structural deformability than the other sites. Meanwhile, the conformational change of DNA is likely associated with the specific interaction of TALE-DNA. We further suggest that the arrangement of N-terminal repeats with strong RVDs may help in the design of efficient TALEs. This study provides some new insights into the understanding of the TALE-DNA recognition mechanism. PMID:24130757

  16. Reconstitution of the yeast RNA polymerase III transcription system with all recombinant factors.

    PubMed

    Ducrot, Cécile; Lefebvre, Olivier; Landrieux, Emilie; Guirouilh-Barbat, Josée; Sentenac, André; Acker, Joel

    2006-04-28

    Transcription factor TFIIIC is a multisubunit complex required for promoter recognition and transcriptional activation of class III genes. We describe here the reconstitution of complete recombinant yeast TFIIIC and the molecular characterization of its two DNA-binding domains, tauA and tauB, using the baculovirus expression system. The B block-binding module, rtauB, was reconstituted with rtau138, rtau91, and rtau60 subunits. rtau131, rtau95, and rtau55 formed also a stable complex, rtauA, that displayed nonspecific DNA binding activity. Recombinant rTFIIIC was functionally equivalent to purified yeast TFIIIC, suggesting that the six recombinant subunits are necessary and sufficient to reconstitute a transcriptionally active TFIIIC complex. The formation and the properties of rTFIIIC-DNA complexes were affected by dephosphorylation treatments. The combination of complete recombinant rTFIIIC and rTFIIIB directed a low level of basal transcription, much weaker than with the crude B'' fraction, suggesting the existence of auxiliary factors that could modulate the yeast RNA polymerase III transcription system.

  17. Spectroscopic, electrochemical DNA binding and in vivo anti-inflammatory studies on newly synthesized Schiff bases of 4-aminophenazone.

    PubMed

    Arshad, Nasima; Ahmad, Mukhtar; Ashraf, Muhammad Zaman; Nadeem, Humaira

    2014-09-05

    4-Aminophenazone (Ap-1) Schiff bases i.e., 4-{(3,4,5-trimethoxybenzylidine) amino}phenazone (Ap-2), 4-{(2-chlorobenzylidine) amino}phenazone (Ap-3) and 4-{(4-chlorobenzylidine)amino} phenazone (Ap-4) were synthesized and characterized by different spectroscopic techniques. Interaction of these compounds with ds.DNA was investigated through UV-Visible spectroscopy, fluorescence spectroscopy and cyclic voltammetry at stomach (4.7) and blood (7.4) pH under 37 °C (human body temperature). Instrumental findings were further quantified both kinetically and thermodynamically. Results obtained through these techniques inferred intercalative mode of binding of all the compounds with DNA. The binding constant data, "Kb", and free energy change, ΔG, indicated comparatively greater binding affinity and more spontaneity of binding of compounds with DNA at stomach pH (4.7), respectively. However, among these compounds, Ap-4 showed comparatively greater binding at both the pH. Formation of compound-DNA complex was further confirmed through the decrease in diffusion rates after the addition of DNA. The in vivo anti-inflammatory activity of the compounds was evaluated using the carrageenan-induced hind paw edema method. The results revealed that among all the compounds, Ap-4 showed greater percentage of edema inhibition compared to standard drug. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Cold-inducible RNA-binding protein through TLR4 signaling induces mitochondrial DNA fragmentation and regulates macrophage cell death after trauma.

    PubMed

    Li, Zhigang; Fan, Erica K; Liu, Jinghua; Scott, Melanie J; Li, Yuehua; Li, Song; Xie, Wen; Billiar, Timothy R; Wilson, Mark A; Jiang, Yong; Wang, Ping; Fan, Jie

    2017-05-11

    Trauma is a major cause of systemic inflammatory response syndrome and multiple organ dysfunction syndrome. Macrophages (Mφ) direct trauma-induced inflammation, and Mφ death critically influences the progression of the inflammatory response. In the current study, we explored an important role of trauma in inducing mitochondrial DNA (mtDNA) damage in Mφ and the subsequent regulation of Mφ death. Using an animal pseudo-fracture trauma model, we demonstrated that tissue damage induced NADPH oxidase activation and increased the release of reactive oxygen species via cold-inducible RNA-binding protein (CIRP)-TLR4-MyD88 signaling. This in turn, activates endonuclease G, which serves as an executor for the fragmentation of mtDNA in Mφ. We further showed that fragmented mtDNA triggered both p62-related autophagy and necroptosis in Mφ. However, autophagy activation also suppressed Mφ necroptosis and pro-inflammatory responses. This study demonstrates a previously unidentified intracellular regulation of Mφ homeostasis in response to trauma.

  19. Cold-inducible RNA-binding protein through TLR4 signaling induces mitochondrial DNA fragmentation and regulates macrophage cell death after trauma

    PubMed Central

    Li, Zhigang; Fan, Erica K; Liu, Jinghua; Scott, Melanie J; Li, Yuehua; Li, Song; Xie, Wen; Billiar, Timothy R; Wilson, Mark A; Jiang, Yong; Wang, Ping; Fan, Jie

    2017-01-01

    Trauma is a major cause of systemic inflammatory response syndrome and multiple organ dysfunction syndrome. Macrophages (Mϕ) direct trauma-induced inflammation, and Mϕ death critically influences the progression of the inflammatory response. In the current study, we explored an important role of trauma in inducing mitochondrial DNA (mtDNA) damage in Mϕ and the subsequent regulation of Mϕ death. Using an animal pseudo-fracture trauma model, we demonstrated that tissue damage induced NADPH oxidase activation and increased the release of reactive oxygen species via cold-inducible RNA-binding protein (CIRP)–TLR4–MyD88 signaling. This in turn, activates endonuclease G, which serves as an executor for the fragmentation of mtDNA in Mϕ. We further showed that fragmented mtDNA triggered both p62-related autophagy and necroptosis in Mϕ. However, autophagy activation also suppressed Mϕ necroptosis and pro-inflammatory responses. This study demonstrates a previously unidentified intracellular regulation of Mϕ homeostasis in response to trauma. PMID:28492546

  20. Srs2 prevents Rad51 filament formation by repetitive motion on DNA.

    PubMed

    Qiu, Yupeng; Antony, Edwin; Doganay, Sultan; Koh, Hye Ran; Lohman, Timothy M; Myong, Sua

    2013-01-01

    Srs2 dismantles presynaptic Rad51 filaments and prevents its re-formation as an anti-recombinase. However, the molecular mechanism by which Srs2 accomplishes these tasks remains unclear. Here we report a single-molecule fluorescence study of the dynamics of Rad51 filament formation and its disruption by Srs2. Rad51 forms filaments on single-stranded DNA by sequential binding of primarily monomers and dimers in a 5'-3' direction. One Rad51 molecule binds to three nucleotides, and six monomers are required to achieve a stable nucleation cluster. Srs2 exhibits ATP-dependent repetitive motion on single-stranded DNA and this activity prevents re-formation of the Rad51 filament. The same activity of Srs2 cannot prevent RecA filament formation, indicating its specificity for Rad51. Srs2's DNA-unwinding activity is greatly suppressed when Rad51 filaments form on duplex DNA. Taken together, our results reveal an exquisite and highly specific mechanism by which Srs2 regulates the Rad51 filament formation.

Top