Sample records for dna binding characteristics

  1. Binding characteristics and protective capacity of cyanidin-3-glucoside and its aglycon to calf thymus DNA.

    PubMed

    Zhang, Chao; Guo, Xiaofei; Cai, Wenqian; Ma, Yue; Zhao, Xiaoyan

    2015-04-01

    The binding characteristics and protective capacity of cyanidin (Cy) and cyanidin-3-glucoside (C3G) to calf thymus DNA were explored for the first time. The Cy and C3G gave a bathochromic shift to the ultraviolet-visible spectra of the DNA, indicating the formation of the DNA-Cy and DNA-C3G complexes. The complexes were formed by an intercalative binding mode based on the results of the fluorescence spectra and competitive binding analysis. Meanwhile, the Cy and C3G protected the DNA from the damage induced by the hydroxyl radical. The binding capacity and protective capacity of the C3G were stronger than that of the Cy. Furthermore, the formation of the DNA-anthocyanin complexes was spontaneous when the hydrogen bond and hydrophobic force played a key role. Hence, the Cy and C3G could protect the DNA automatically from the damage induced by the hydroxyl radical. © 2015 Institute of Food Technologists®

  2. Determination of the DNA-binding characteristics of ethidium bromide, proflavine, and cisplatin by flow injection analysis: usefulness in studies on antitumor drugs.

    PubMed

    Alonso, A; Almendral, M J; Curto, Y; Criado, J J; Rodríguez, E; Manzano, J L

    2006-08-15

    Flow injection analysis was used to study the reactions occurring between DNA and certain compounds that bind to its double helix, deforming this and even breaking it, such that some of them (e.g., cisplatin) are endowed with antitumoral activity. Use of this technique in the merging zones and stopped-flow modes afforded data on the binding parameters and the kinetic characteristics of the process. The first compound studied was ethidium bromide (EtdBr), used as a fluorescent marker because its fluorescence is enhanced when it binds to DNA. The DNA-EtdBr binding parameters, the apparent intrinsic binding constant (0.31+/-0.02 microM(-1)), and the maximum number of binding sites per nucleotide (0.327+/-0.009) were determined. The modification introduced in these parameters by the presence of proflavine (Prf), a classic competitive inhibitor of the binding of EtdBr to the DNA double helix, was also studied, determining the value of the intrinsic binding constant of Prf (K(Prf) = 0.119+/-9x10(-3) microM(-1)). Finally, we determined the binding parameters between DNA and EtdBr in the presence of the antitumor agent cisplatin, a noncompetitive inhibitor of such binding. This provided information about the binding mechanism as well as the duration and activity of the binding of the compound in its pharmacological use.

  3. Reshaping the Energy Landscape Transforms the Mechanism and Binding Kinetics of DNA Threading Intercalation.

    PubMed

    Clark, Andrew G; Naufer, M Nabuan; Westerlund, Fredrik; Lincoln, Per; Rouzina, Ioulia; Paramanathan, Thayaparan; Williams, Mark C

    2018-02-06

    Molecules that bind DNA via threading intercalation show high binding affinity as well as slow dissociation kinetics, properties ideal for the development of anticancer drugs. To this end, it is critical to identify the specific molecular characteristics of threading intercalators that result in optimal DNA interactions. Using single-molecule techniques, we quantify the binding of a small metal-organic ruthenium threading intercalator (Δ,Δ-B) and compare its binding characteristics to a similar molecule with significantly larger threading moieties (Δ,Δ-P). The binding affinities of the two molecules are the same, while comparison of the binding kinetics reveals significantly faster kinetics for Δ,Δ-B. However, the kinetics is still much slower than that observed for conventional intercalators. Comparison of the two threading intercalators shows that the binding affinity is modulated independently by the intercalating section and the binding kinetics is modulated by the threading moiety. In order to thread DNA, Δ,Δ-P requires a "lock mechanism", in which a large length increase of the DNA duplex is required for both association and dissociation. In contrast, measurements of the force-dependent binding kinetics show that Δ,Δ-B requires a large DNA length increase for association but no length increase for dissociation from DNA. This contrasts strongly with conventional intercalators, for which almost no DNA length change is required for association but a large DNA length change must occur for dissociation. This result illustrates the fundamentally different mechanism of threading intercalation compared with conventional intercalation and will pave the way for the rational design of therapeutic drugs based on DNA threading intercalation.

  4. Non-B-Form DNA Is Enriched at Centromeres

    PubMed Central

    Henikoff, Steven

    2018-01-01

    Abstract Animal and plant centromeres are embedded in repetitive “satellite” DNA, but are thought to be epigenetically specified. To define genetic characteristics of centromeres, we surveyed satellite DNA from diverse eukaryotes and identified variation in <10-bp dyad symmetries predicted to adopt non-B-form conformations. Organisms lacking centromeric dyad symmetries had binding sites for sequence-specific DNA-binding proteins with DNA-bending activity. For example, human and mouse centromeres are depleted for dyad symmetries, but are enriched for non-B-form DNA and are associated with binding sites for the conserved DNA-binding protein CENP-B, which is required for artificial centromere function but is paradoxically nonessential. We also detected dyad symmetries and predicted non-B-form DNA structures at neocentromeres, which form at ectopic loci. We propose that centromeres form at non-B-form DNA because of dyad symmetries or are strengthened by sequence-specific DNA binding proteins. This may resolve the CENP-B paradox and provide a general basis for centromere specification. PMID:29365169

  5. DNA Binding of Centromere Protein C (CENPC) Is Stabilized by Single-Stranded RNA

    PubMed Central

    Du, Yaqing; Topp, Christopher N.; Dawe, R. Kelly

    2010-01-01

    Centromeres are the attachment points between the genome and the cytoskeleton: centromeres bind to kinetochores, which in turn bind to spindles and move chromosomes. Paradoxically, the DNA sequence of centromeres has little or no role in perpetuating kinetochores. As such they are striking examples of genetic information being transmitted in a manner that is independent of DNA sequence (epigenetically). It has been found that RNA transcribed from centromeres remains bound within the kinetochore region, and this local population of RNA is thought to be part of the epigenetic marking system. Here we carried out a genetic and biochemical study of maize CENPC, a key inner kinetochore protein. We show that DNA binding is conferred by a localized region 122 amino acids long, and that the DNA-binding reaction is exquisitely sensitive to single-stranded RNA. Long, single-stranded nucleic acids strongly promote the binding of CENPC to DNA, and the types of RNAs that stabilize DNA binding match in size and character the RNAs present on kinetochores in vivo. Removal or replacement of the binding module with HIV integrase binding domain causes a partial delocalization of CENPC in vivo. The data suggest that centromeric RNA helps to recruit CENPC to the inner kinetochore by altering its DNA binding characteristics. PMID:20140237

  6. Studies on interaction of an intramolecular charge transfer fluorescence probe: 4'-dimethylamino-2,5-dihydroxychalcone with DNA.

    PubMed

    Xu, Zhicheng; Bai, Guan; Dong, Chuan

    2005-10-15

    The interaction of a new intramolecular charge transfer probe, namely 4'-dimethylamino-2,5-dihydroxychalcone (DMADHC), with calf thymus DNA has been studied. Compared to the spectral characteristics of the free form in aqueous solution, the fluorescence of DMADHC enhanced dramatically accompanying a blueshift of the emission maxima in the presence of DNA. The absorption and fluorescence spectra, salt concentration effect, KI quenching, fluorescence polarization, and DNA denaturation experiments were given. These results give evidence that the DMADHC molecule is inserted into the base-stacking domain of the DNA double helix. The intrinsic binding constant and the binding site number were estimated. The analytical characteristics were also given.

  7. Theoretical modeling of masking DNA application in aptamer-facilitated biomarker discovery.

    PubMed

    Cherney, Leonid T; Obrecht, Natalia M; Krylov, Sergey N

    2013-04-16

    In aptamer-facilitated biomarker discovery (AptaBiD), aptamers are selected from a library of random DNA (or RNA) sequences for their ability to specifically bind cell-surface biomarkers. The library is incubated with intact cells, and cell-bound DNA molecules are separated from those unbound and amplified by the polymerase chain reaction (PCR). The partitioning/amplification cycle is repeated multiple times while alternating target cells and control cells. Efficient aptamer selection in AptaBiD relies on the inclusion of masking DNA within the cell and library mixture. Masking DNA lacks primer regions for PCR amplification and is typically taken in excess to the library. The role of masking DNA within the selection mixture is to outcompete any nonspecific binding sequences within the initial library, thus allowing specific DNA sequences (i.e., aptamers) to be selected more efficiently. Efficient AptaBiD requires an optimum ratio of masking DNA to library DNA, at which aptamers still bind specific binding sites but nonaptamers within the library do not bind nonspecific binding sites. Here, we have developed a mathematical model that describes the binding processes taking place within the equilibrium mixture of masking DNA, library DNA, and target cells. An obtained mathematical solution allows one to estimate the concentration of masking DNA that is required to outcompete the library DNA at a desirable ratio of bound masking DNA to bound library DNA. The required concentration depends on concentrations of the library and cells as well as on unknown cell characteristics. These characteristics include the concentration of total binding sites on the cell surface, N, and equilibrium dissociation constants, K(nsL) and K(nsM), for nonspecific binding of the library DNA and masking DNA, respectively. We developed a theory that allows the determination of N, K(nsL), and K(nsM) based on measurements of EC50 values for cells mixed separately with the library and masking DNA (EC50 is the concentration of fluorescently labeled DNA at which half of the maximum fluorescence signal from DNA-bound cells is reached). We also obtained expressions for signals from bound DNA (measured by flow cytometry) in terms of N, K(nsL), and K(nsM). These expressions can be used for the verification of N, K(nsL), and K(nsM) values found from EC50 measurements. The developed procedure was applied to MCF-7 breast cancer cells, and corresponding values of N, K(nsL), and K(nsM) were established for the first time. The concentration of masking DNA required for AptaBiD with MCF-7 breast cancer cells was also estimated.

  8. DNA-binding by Haemophilus influenzae and Escherichia coli YbaB, members of a widely-distributed bacterial protein family.

    PubMed

    Cooley, Anne E; Riley, Sean P; Kral, Keith; Miller, M Clarke; DeMoll, Edward; Fried, Michael G; Stevenson, Brian

    2009-07-13

    Genes orthologous to the ybaB loci of Escherichia coli and Haemophilus influenzae are widely distributed among eubacteria. Several years ago, the three-dimensional structures of the YbaB orthologs of both E. coli and H. influenzae were determined, revealing a novel "tweezer"-like structure. However, a function for YbaB had remained elusive, with an early study of the H. influenzae ortholog failing to detect DNA-binding activity. Our group recently determined that the Borrelia burgdorferi YbaB ortholog, EbfC, is a DNA-binding protein. To reconcile those results, we assessed the abilities of both the H. influenzae and E. coli YbaB proteins to bind DNA to which B. burgdorferi EbfC can bind. Both the H. influenzae and the E. coli YbaB proteins bound to tested DNAs. DNA-binding was not well competed with poly-dI-dC, indicating some sequence preferences for those two proteins. Analyses of binding characteristics determined that both YbaB orthologs bind as homodimers. Different DNA sequence preferences were observed between H. influenzae YbaB, E. coli YbaB and B. burgdorferi EbfC, consistent with amino acid differences in the putative DNA-binding domains of these proteins. Three distinct members of the YbaB/EbfC bacterial protein family have now been demonstrated to bind DNA. Members of this protein family are encoded by a broad range of bacteria, including many pathogenic species, and results of our studies suggest that all such proteins have DNA-binding activities. The functions of YbaB/EbfC family members in each bacterial species are as-yet unknown, but given the ubiquity of these DNA-binding proteins among Eubacteria, further investigations are warranted.

  9. hPDI: a database of experimental human protein-DNA interactions.

    PubMed

    Xie, Zhi; Hu, Shaohui; Blackshaw, Seth; Zhu, Heng; Qian, Jiang

    2010-01-15

    The human protein DNA Interactome (hPDI) database holds experimental protein-DNA interaction data for humans identified by protein microarray assays. The unique characteristics of hPDI are that it contains consensus DNA-binding sequences not only for nearly 500 human transcription factors but also for >500 unconventional DNA-binding proteins, which are completely uncharacterized previously. Users can browse, search and download a subset or the entire data via a web interface. This database is freely accessible for any academic purposes. http://bioinfo.wilmer.jhu.edu/PDI/.

  10. ATM Protein Physically and Functionally Interacts with Proliferating Cell Nuclear Antigen to Regulate DNA Synthesis*

    PubMed Central

    Gamper, Armin M.; Choi, Serah; Matsumoto, Yoshihiro; Banerjee, Dibyendu; Tomkinson, Alan E.; Bakkenist, Christopher J.

    2012-01-01

    Ataxia telangiectasia (A-T) is a pleiotropic disease, with a characteristic hypersensitivity to ionizing radiation that is caused by biallelic mutations in A-T mutated (ATM), a gene encoding a protein kinase critical for the induction of cellular responses to DNA damage, particularly to DNA double strand breaks. A long known characteristic of A-T cells is their ability to synthesize DNA even in the presence of ionizing radiation-induced DNA damage, a phenomenon termed radioresistant DNA synthesis. We previously reported that ATM kinase inhibition, but not ATM protein disruption, blocks sister chromatid exchange following DNA damage. We now show that ATM kinase inhibition, but not ATM protein disruption, also inhibits DNA synthesis. Investigating a potential physical interaction of ATM with the DNA replication machinery, we found that ATM co-precipitates with proliferating cell nuclear antigen (PCNA) from cellular extracts. Using bacterially purified ATM truncation mutants and in vitro translated PCNA, we showed that the interaction is direct and mediated by the C terminus of ATM. Indeed, a 20-amino acid region close to the kinase domain is sufficient for strong binding to PCNA. This binding is specific to ATM, because the homologous regions of other PIKK members, including the closely related kinase A-T and Rad3-related (ATR), did not bind PCNA. ATM was found to bind two regions in PCNA. To examine the functional significance of the interaction between ATM and PCNA, we tested the ability of ATM to stimulate DNA synthesis by DNA polymerase δ, which is implicated in both DNA replication and DNA repair processes. ATM was observed to stimulate DNA polymerase activity in a PCNA-dependent manner. PMID:22362778

  11. Circadian clock protein KaiC forms ATP-dependent hexameric rings and binds DNA

    PubMed Central

    Mori, Tetsuya; Saveliev, Sergei V.; Xu, Yao; Stafford, Walter F.; Cox, Michael M.; Inman, Ross B.; Johnson, Carl H.

    2002-01-01

    KaiC from Synechococcus elongatus PCC 7942 (KaiC) is an essential circadian clock protein in cyanobacteria. Previous sequence analyses suggested its inclusion in the RecA/DnaB superfamily. A characteristic of the proteins of this superfamily is that they form homohexameric complexes that bind DNA. We show here that KaiC also forms ring complexes with a central pore that can be visualized by electron microscopy. A combination of analytical ultracentrifugation and chromatographic analyses demonstrates that these complexes are hexameric. The association of KaiC molecules into hexamers depends on the presence of ATP. The KaiC sequence does not include the obvious DNA-binding motifs found in RecA or DnaB. Nevertheless, KaiC binds forked DNA substrates. These data support the inclusion of KaiC into the RecA/DnaB superfamily and have important implications for enzymatic activity of KaiC in the circadian clock mechanism that regulates global changes in gene expression patterns. PMID:12477935

  12. Unusual Characteristics of the DNA Binding Domain of Epigenetic Regulatory Protein MeCP2 Determine Its Binding Specificity

    PubMed Central

    2015-01-01

    The protein MeCP2 mediates epigenetic regulation by binding methyl-CpG (mCpG) sites on chromatin. MeCP2 consists of six domains of which one, the methyl binding domain (MBD), binds mCpG sites in duplex DNA. We show that solution conditions with physiological or greater salt concentrations or the presence of nonspecific competitor DNA is necessary for the MBD to discriminate mCpG from CpG with high specificity. The specificity for mCpG over CpG is >100-fold under these solution conditions. In contrast, the MBD does not discriminate hydroxymethyl-CpG from CpG. The MBD is unusual among site-specific DNA binding proteins in that (i) specificity is not conferred by the enhanced affinity for the specific site but rather by suppression of its affinity for generic DNA, (ii) its specific binding to mCpG is highly electrostatic, and (iii) it takes up as well as displaces monovalent cations upon DNA binding. The MBD displays an unusually high affinity for single-stranded DNA independent of modification or sequence. In addition, the MBD forms a discrete dimer on DNA via a noncooperative binding pathway. Because the affinity of the second monomer is 1 order of magnitude greater than that of nonspecific binding, the MBD dimer is a unique molecular complex. The significance of these results in the context of neuronal function and development and MeCP2-related developmental disorders such as Rett syndrome is discussed. PMID:24828757

  13. Interactions of Ku70/80 with Double-Strand DNA: Energetic, Dynamics, and Functional Implications

    NASA Technical Reports Server (NTRS)

    Hu, Shaowen; Cucinotta, Francis A.

    2010-01-01

    Space radiation is a proficient inducer of DNA damage leading to mutation, aberrant cell signaling, and cancer formation. Ku is among the first responding proteins in nucleus to recognize and bind the DNA double strand breaks (DSBs) whenever they are introduced. Once loaded Ku works as a scaffold to recruit other repair factors of non-homologous end joining and facilitates the following repair processes. The crystallographic study of the Ku70/80 heterodimer indicate the core structure of this protein shows virtually no conformational change after binding with DNA. To investigate the dynamical features as well as the energetic characteristics of Ku-DNA binding, we conduct multi-nanosecond molecular dynamics simulations of a modeled Ku70/80 structure and several complexes with two 24-bp DNA duplexes. Free energy calculations show significant energy differences between the complexes with Ku bound at DSBs and those with Ku associated at an internal site of a chromosome. The results also reveal detailed interactions between different nucleotides and the amino acids along the DNA-binding cradle of Ku, indicating subtle binding preference of Ku at specific DNA sequences. The covariance matrix analyses along the trajectories demonstrate the protein is stimulated to undergo correlated motions of different domains once bound to DNA ends. Additionally, principle component analyses identify these low frequency collective motions suitable for binding with and translocation along duplex DNA. It is proposed that the modification of dynamical properties of Ku upon binding with DSBs may provide a signal for the further recruitment of other repair factors such as DNA-PKcs, XLF, and XRCC4.

  14. Antiviral and Anticancer Optimization Studies of the DNA-binding Marine Natural Product Aaptamine

    PubMed Central

    Bowling, John J.; Pennaka, Hari K.; Ivey, Kelly; Wahyuono, Subagus; Kelly, Michelle; Schinazi, Raymond F.; Valeriote, Frederick A.; Graves, David E.; Hamann, Mark T.

    2016-01-01

    Aaptamine has potent cytotoxicity that may be explained by its ability to intercalate DNA. Aaptamine was evaluated for its ability to bind to DNA to validate DNA binding as the primary mechanism of cytotoxicity. Based on UV–vis absorbance titration data, the Kobs for aaptamine was 4.0 (±0.2) × 103 which was essentially equivalent to the known DNA intercalator N-[2-(diethylamino)ethyl]-9-aminoacridine-4-carboxamide. Semi-synthetic core modifications were performed to improve the general structural diversity of known aaptamine analogs and vary its absorption characteristics. Overall, 26 aaptamine derivatives were synthesized which consisted of a simple homologous range of mono and di-N-alkylations as well as some 9-O-sulfonylation and bis-O-isoaaptamine dimer products. Each product was evaluated for activity in a variety of whole cell and viral assays including a unique solid tumor disk diffusion assay. Details of aaptamine's DNA-binding activity and its derivatives’ whole cell and viral assay results are discussed. PMID:18251774

  15. Saccharomyces cerevisiae SSB1 protein and its relationship to nucleolar RNA-binding proteins.

    PubMed

    Jong, A Y; Clark, M W; Gilbert, M; Oehm, A; Campbell, J L

    1987-08-01

    To better define the function of Saccharomyces cerevisiae SSB1, an abundant single-stranded nucleic acid-binding protein, we determined the nucleotide sequence of the SSB1 gene and compared it with those of other proteins of known function. The amino acid sequence contains 293 amino acid residues and has an Mr of 32,853. There are several stretches of sequence characteristic of other eucaryotic single-stranded nucleic acid-binding proteins. At the amino terminus, residues 39 to 54 are highly homologous to a peptide in calf thymus UP1 and UP2 and a human heterogeneous nuclear ribonucleoprotein. Residues 125 to 162 constitute a fivefold tandem repeat of the sequence RGGFRG, the composition of which suggests a nucleic acid-binding site. Near the C terminus, residues 233 to 245 are homologous to several RNA-binding proteins. Of 18 C-terminal residues, 10 are acidic, a characteristic of the procaryotic single-stranded DNA-binding proteins and eucaryotic DNA- and RNA-binding proteins. In addition, examination of the subcellular distribution of SSB1 by immunofluorescence microscopy indicated that SSB1 is a nuclear protein, predominantly located in the nucleolus. Sequence homologies and the nucleolar localization make it likely that SSB1 functions in RNA metabolism in vivo, although an additional role in DNA metabolism cannot be excluded.

  16. The DNA-recognition mode shared by archaeal feast/famine-regulatory proteins revealed by the DNA-binding specificities of TvFL3, FL10, FL11 and Ss-LrpB

    PubMed Central

    Yokoyama, Katsushi; Nogami, Hideki; Kabasawa, Mamiko; Ebihara, Sonomi; Shimowasa, Ai; Hashimoto, Keiko; Kawashima, Tsuyoshi; Ishijima, Sanae A.; Suzuki, Masashi

    2009-01-01

    The DNA-binding mode of archaeal feast/famine-regulatory proteins (FFRPs), i.e. paralogs of the Esherichia coli leucine-responsive regulatory protein (Lrp), was studied. Using the method of systematic evolution of ligands by exponential enrichment (SELEX), optimal DNA duplexes for interacting with TvFL3, FL10, FL11 and Ss-LrpB were identified as TACGA[AAT/ATT]TCGTA, GTTCGA[AAT/ATT]TCGAAC, CCGAAA[AAT/ATT]TTTCGG and TTGCAA[AAT/ATT]TTGCAA, respectively, all fitting into the form abcdeWWWedcba. Here W is A or T, and e.g. a and a are bases complementary to each other. Apparent equilibrium binding constants of the FFRPs and various DNA duplexes were determined, thereby confirming the DNA-binding specificities of the FFRPs. It is likely that these FFRPs recognize DNA in essentially the same way, since their DNA-binding specificities were all explained by the same pattern of relationship between amino-acid positions and base positions to form chemical interactions. As predicted from this relationship, when Gly36 of TvFL3 was replaced by Thr, the b base in the optimal DNA duplex changed from A to T, and, when Thr36 of FL10 was replaced by Ser, the b base changed from T to G/A. DNA-binding characteristics of other archaeal FFRPs, Ptr1, Ptr2, Ss-Lrp and LysM, are also consistent with the relationship. PMID:19468044

  17. Biochemical analyses indicate that binding and cleavage specificities define the ordered processing of human Okazaki fragments by Dna2 and FEN1.

    PubMed

    Gloor, Jason W; Balakrishnan, Lata; Campbell, Judith L; Bambara, Robert A

    2012-08-01

    In eukaryotic Okazaki fragment processing, the RNA primer is displaced into a single-stranded flap prior to removal. Evidence suggests that some flaps become long before they are cleaved, and that this cleavage involves the sequential action of two nucleases. Strand displacement characteristics of the polymerase show that a short gap precedes the flap during synthesis. Using biochemical techniques, binding and cleavage assays presented here indicate that when the flap is ∼ 30 nt long the nuclease Dna2 can bind with high affinity to the flap and downstream double strand and begin cleavage. When the polymerase idles or dissociates the Dna2 can reorient for additional contacts with the upstream primer region, allowing the nuclease to remain stably bound as the flap is further shortened. The DNA can then equilibrate to a double flap that can bind Dna2 and flap endonuclease (FEN1) simultaneously. When Dna2 shortens the flap even more, FEN1 can displace the Dna2 and cleave at the flap base to make a nick for ligation.

  18. Single-Molecule Interactions of a Monoclonal Anti-DNA Antibody with DNA

    PubMed Central

    Nevzorova, Tatiana A.; Zhao, Qingze; Lomakin, Yakov A.; Ponomareva, Anastasia A.; Mukhitov, Alexander R.; Purohit, Prashant K.; Weisel, John W.; Litvinov, Rustem I.

    2017-01-01

    Interactions of DNA with proteins are essential for key biological processes and have both a fundamental and practical significance. In particular, DNA binding to anti-DNA antibodies is a pathogenic mechanism in autoimmune pathology, such as systemic lupus erythematosus. Here we measured at the single-molecule level binding and forced unbinding of surface-attached DNA and a monoclonal anti-DNA antibody MRL4 from a lupus erythematosus mouse. In optical trap-based force spectroscopy, a microscopic antibodycoated latex bead is trapped by a focused laser beam and repeatedly brought into contact with a DNA-coated surface. After careful discrimination of non-specific interactions, we showed that the DNA-antibody rupture force spectra had two regimes, reflecting formation of weaker (20–40 pN) and stronger (>40 pN) immune complexes that implies the existence of at least two bound states with different mechanical stability. The two-dimensional force-free off-rate for the DNA-antibody complexes was ~2.2 × 10−3 s−1, the transition state distance was ~0.94 nm, the apparent on-rate was ~5.26 s−1, and the stiffness of the DNA-antibody complex was characterized by a spring constant of 0.0021 pN/nm, suggesting that the DNA-antibody complex is a relatively stable, but soft and deformable macromolecular structure. The stretching elasticity of the DNA molecules was characteristic of single-stranded DNA, suggesting preferential binding of the MRL4 antibody to one strand of DNA. Collectively, the results provide fundamental characteristics of formation and forced dissociation of DNA-antibody complexes that help to understand principles of DNA-protein interactions and shed light on the molecular basis of autoimmune diseases accompanied by formation of anti-DNA antibodies. PMID:29104846

  19. Synthetic oligonucleotide antigens modified with locked nucleic acids detect disease specific antibodies

    NASA Astrophysics Data System (ADS)

    Samuelsen, Simone V.; Solov'Yov, Ilia A.; Balboni, Imelda M.; Mellins, Elizabeth; Nielsen, Christoffer Tandrup; Heegaard, Niels H. H.; Astakhova, Kira

    2016-10-01

    New techniques to detect and quantify antibodies to nucleic acids would provide a significant advance over current methods, which often lack specificity. We investigate the potential of novel antigens containing locked nucleic acids (LNAs) as targets for antibodies. Particularly, employing molecular dynamics we predict optimal nucleotide composition for targeting DNA-binding antibodies. As a proof of concept, we address a problem of detecting anti-DNA antibodies that are characteristic of systemic lupus erythematosus, a chronic autoimmune disease with multiple manifestations. We test the best oligonucleotide binders in surface plasmon resonance studies to analyze binding and kinetic aspects of interactions between antigens and target DNA. These DNA and LNA/DNA sequences showed improved binding in enzyme-linked immunosorbent assay using human samples of pediatric lupus patients. Our results suggest that the novel method is a promising tool to create antigens for research and point-of-care monitoring of anti-DNA antibodies.

  20. Analytical methods to determine the comparative DNA binding studies of curcumin-Cu(II) complexes

    NASA Astrophysics Data System (ADS)

    Rajesh, Jegathalaprathaban; Rajasekaran, Marichamy; Rajagopal, Gurusamy; Athappan, Periakaruppan

    2012-11-01

    DNA interaction studies of two mononuclear [1:1(1); 1:2(2)] copper(II) complexes of curcumin have been studied. The interaction of these complexes with CT-DNA has been explored by physical methods to propose modes of DNA binding of the complexes. Absorption spectral titrations of complex 1 with CT-DNA shows a red-shift of 3 nm with the DNA binding affinity of Kb, 5.21 × 104 M-1 that are higher than that obtained for 2 (red-shift, 2 nm; Kb, 1.73 × 104 M-1) reveal that the binding occurs in grooves as a result of the interaction is via exterior phosphates. The CD spectra of these Cu(II) complexes show a red shift of 3-10 nm in the positive band with increase in intensities. This spectral change of induced CD due to the hydrophobic interaction of copper complexes with DNA is the characteristic of B to A conformational change. The EB displacement assay also reveals the same trend as observed in UV-Vis spectral titration. The addition of complexes 1 and 2 to the DNA bound ethidium bromide (EB) solutions causes an obvious reduction in emission intensities indicating that these complexes competitively bind to DNA with EB. The positive shift of both the Epc and E0' accompanied by reduction of peak currents in differential pulse voltammogram (DPV), upon adding different concentrations of DNA to the metal complexes, are obviously in favor of strong binding to DNA. The super coiled plasmid pUC18 DNA cleavage ability of Cu(II) complexes in the presence of reducing agent reveals the single strand DNA cleavage (ssDNA) is observed. The hydroxyl radical (HOrad ) and the singlet oxygen are believed to be the reactive species responsible for the cleavage.

  1. Intercalation of a Zn(II) complex containing ciprofloxacin drug between DNA base pairs.

    PubMed

    Shahabadi, Nahid; Asadian, Ali Ashraf; Mahdavi, Mryam

    2017-11-02

    In this study, an attempt has been made to study the interaction of a Zn(II) complex containing an antibiotic drug, ciprofloxacin, with calf thymus DNA using spectroscopic methods. It was found that Zn(II) complex could bind with DNA via intercalation mode as evidenced by: hyperchromism in UV-Vis spectrum; these spectral characteristics suggest that the Zn(II) complex interacts with DNA most likely through a mode that involves a stacking interaction between the aromatic chromophore and the base pairs of DNA. DNA binding constant (K b = 1.4 × 10 4 M -1 ) from spectrophotometric studies of the interaction of Zn(II) complex with DNA is comparable to those of some DNA intercalative polypyridyl Ru(II) complexes 1.0 -4.8 × 10 4 M -1 . CD study showed stabilization of the right-handed B form of DNA in the presence of Zn(II) complex as observed for the classical intercalator methylene blue. Thermodynamic parameters (ΔH < 0 and ΔS < 0) indicated that hydrogen bond and Van der Waals play main roles in this binding prose. Competitive fluorimetric studies with methylene blue (MB) dye have shown that Zn(II) complex exhibits the ability of this complex to displace with DNA-MB, indicating that it binds to DNA in strong competition with MB for the intercalation.

  2. Insights into finding a mismatch through the structure of a mispaired DNA bound by a rhodium intercalator

    PubMed Central

    Pierre, Valérie C.; Kaiser, Jens T.; Barton, Jacqueline K.

    2007-01-01

    We report the 1.1-Å resolution crystal structure of a bulky rhodium complex bound to two different DNA sites, mismatched and matched in the oligonucleotide 5′-(dCGGAAATTCCCG)2-3′. At the AC mismatch site, the structure reveals ligand insertion from the minor groove with ejection of both mismatched bases and elucidates how destabilized mispairs in DNA may be recognized. This unique binding mode contrasts with major groove intercalation, observed at a matched site, where doubling of the base pair rise accommodates stacking of the intercalator. Mass spectral analysis reveals different photocleavage products associated with the two binding modes in the crystal, with only products characteristic of mismatch binding in solution. This structure, illustrating two clearly distinct binding modes for a molecule with DNA, provides a rationale for the interrogation and detection of mismatches. PMID:17194756

  3. Switchable DNA interfaces for the highly sensitive detection of label-free DNA targets.

    PubMed

    Rant, Ulrich; Arinaga, Kenji; Scherer, Simon; Pringsheim, Erika; Fujita, Shozo; Yokoyama, Naoki; Tornow, Marc; Abstreiter, Gerhard

    2007-10-30

    We report a method to detect label-free oligonucleotide targets. The conformation of surface-tethered probe nucleic acids is modulated by alternating electric fields, which cause the molecules to extend away from or fold onto the biased surface. Binding (hybridization) of targets to the single-stranded probes results in a pronounced enhancement of the layer-height modulation amplitude, monitored optically in real time. The method features an exceptional detection limit of <3 x 10(8) bound targets per cm(2) sensor area. Single base-pair mismatches in the sequences of DNA complements may readily be identified; moreover, binding kinetics and binding affinities can be determined with high accuracy. When driving the DNA to oscillate at frequencies in the kHz regime, distinct switching kinetics are revealed for single- and double-stranded DNA. Molecular dynamics are used to identify the binding state of molecules according to their characteristic kinetic fingerprints by using a chip-compatible detection format.

  4. Switchable DNA interfaces for the highly sensitive detection of label-free DNA targets

    PubMed Central

    Rant, Ulrich; Arinaga, Kenji; Scherer, Simon; Pringsheim, Erika; Fujita, Shozo; Yokoyama, Naoki; Tornow, Marc; Abstreiter, Gerhard

    2007-01-01

    We report a method to detect label-free oligonucleotide targets. The conformation of surface-tethered probe nucleic acids is modulated by alternating electric fields, which cause the molecules to extend away from or fold onto the biased surface. Binding (hybridization) of targets to the single-stranded probes results in a pronounced enhancement of the layer-height modulation amplitude, monitored optically in real time. The method features an exceptional detection limit of <3 × 108 bound targets per cm2 sensor area. Single base-pair mismatches in the sequences of DNA complements may readily be identified; moreover, binding kinetics and binding affinities can be determined with high accuracy. When driving the DNA to oscillate at frequencies in the kHz regime, distinct switching kinetics are revealed for single- and double-stranded DNA. Molecular dynamics are used to identify the binding state of molecules according to their characteristic kinetic fingerprints by using a chip-compatible detection format. PMID:17951434

  5. Circadian clock protein KaiC forms ATP-dependent hexameric rings and binds DNA.

    PubMed

    Mori, Tetsuya; Saveliev, Sergei V; Xu, Yao; Stafford, Walter F; Cox, Michael M; Inman, Ross B; Johnson, Carl H

    2002-12-24

    KaiC from Synechococcus elongatus PCC 7942 (KaiC) is an essential circadian clock protein in cyanobacteria. Previous sequence analyses suggested its inclusion in the RecADnaB superfamily. A characteristic of the proteins of this superfamily is that they form homohexameric complexes that bind DNA. We show here that KaiC also forms ring complexes with a central pore that can be visualized by electron microscopy. A combination of analytical ultracentrifugation and chromatographic analyses demonstrates that these complexes are hexameric. The association of KaiC molecules into hexamers depends on the presence of ATP. The KaiC sequence does not include the obvious DNA-binding motifs found in RecA or DnaB. Nevertheless, KaiC binds forked DNA substrates. These data support the inclusion of KaiC into the RecADnaB superfamily and have important implications for enzymatic activity of KaiC in the circadian clock mechanism that regulates global changes in gene expression patterns.

  6. Dynamics of bleomycin interaction with a strongly bound hairpin DNA substrate, and implications for cleavage of the bound DNA.

    PubMed

    Bozeman, Trevor C; Nanjunda, Rupesh; Tang, Chenhong; Liu, Yang; Segerman, Zachary J; Zaleski, Paul A; Wilson, W David; Hecht, Sidney M

    2012-10-31

    Recent studies involving DNAs bound strongly by bleomycins have documented that such DNAs are degraded by the antitumor antibiotic with characteristics different from those observed when studying the cleavage of randomly chosen DNAs in the presence of excess Fe·BLM. In the present study, surface plasmon resonance has been used to characterize the dynamics of BLM B(2) binding to a strongly bound hairpin DNA, to define the effects of Fe(3+), salt, and temperature on BLM-DNA interaction. One strong primary DNA binding site, and at least one much weaker site, were documented. In contrast, more than one strong cleavage site was found, an observation also made for two other hairpin DNAs. Evidence is presented for BLM equilibration between the stronger and weaker binding sites in a way that renders BLM unavailable to other, less strongly bound DNAs. Thus, enhanced binding to a given site does not necessarily result in increased DNA degradation at that site; i.e., for strongly bound DNAs, the facility of DNA cleavage must involve other parameters in addition to the intrinsic rate of C-4' H atom abstraction from DNA sugars.

  7. Binding and thermodynamics of REV peptide-ctDNA interaction.

    PubMed

    Upadhyay, Santosh Kumar

    2017-03-01

    The thermodynamics of DNA-ligand binding is important as it provides useful information to understand the details of binding processes. HIV-1 REV response element (RRE) located in the env coding region of the viral genome is reported to be well conserved across different HIV-1 isolates. In this study, the binding characteristics of Calf thymus DNA (ctDNA) and REV peptide from HIV-1 were investigated using spectroscopic (UV-visible, fluorescence, and circular dichroism (CD)) and isothermal titration calorimetric (ITC) techniques. Thermal stability and ligand binding properties of the ctDNA revealed that native ctDNA had a T m of 75.5 °C, whereas the ctDNA-REV peptide complex exhibited an incremental shift in the T m by 8 °C, indicating thermal stability of the complex. CD data indicated increased ellipticity due to large conformational changes in ctDNA molecule upon binding with REV peptide and two binding stoichiometric modes are apparent. The ctDNA experienced condensation due to large conformational changes in the presence of REV peptide and positive B→Ψ transition was observed at higher molar charge ratios. Fluorescence studies performed at several ligand concentrations revealed a gradual decrease in the fluorescence intensity of EtBr-bound ctDNA in response to increasing ligand concentrations. The fluorescence data further confirmed two stoichiometric modes of binding for ctDNA-REV peptide complex as previously observed with CD studies. The binding enthalpies were determined using ITC in the temperature range of 293 K-308 K. The ITC binding isotherm was exothermic at all temperatures examined, with low ΔH values indicating that the ctDNA-REV peptide interaction is driven largely by entropy. The heat capacity change (ΔC p ) was insignificant, an unusual finding in the area of DNA-peptide interaction studies. The variation in the values obtained for ΔH, ΔS, and ΔG with temperature further suggests that ctDNA-REV peptide interaction is entropically driven. ITC based analysis of salt dependence of binding constant gave a charge value (Z) = +4.01, as determined for the δlnK/δln[Na + ] parameter, suggesting the participation of only 3-4 Arg out of 11 Arg charge from REV peptide. The stoichiometry observed for the complex was three molar charge of REV peptide binding per molar charge of ctDNA. ITC based analysis further confirmed that the binding between ctDNA and REV peptide is governed by electrostatic interaction. Molecular interactions including H-bonding, van der Waals forces, and solvent molecules rearrangement, underlie the binding of REV peptide to ctDNA. © 2016 Wiley Periodicals, Inc.

  8. Exploration of intermolecular interaction of calf thymus DNA with sulfosulfuron using multi-spectroscopic and molecular docking techniques.

    PubMed

    Shi, Jie-Hua; Lou, Yan-Yue; Zhou, Kai-Li; Pan, Dong-Qi

    2018-06-18

    As a sulfonylurea herbicide, sulfosulfuron is extensively applied in controlling broad-leaves and weeds in agriculture. It may cause a potential risk for human and herbivores health due to its widely application and residue in crops and fruits. The study of the binding characteristics of calf thymus DNA (ct-DNA) with sulfosulfuron was performed through a series of spectroscopic techniques and computer simulation. The experimental results showed sulfosulfuron interacted with ct-DNA through the groove binding. The negative values of thermodynamic parameter (ΔH 0 , ΔS 0 and ΔG 0 ) revealed that the reaction of sulfosulfuron with DNA could proceed spontaneously, and the hydrogen bonding and van der Waals forces were essential to sulfosulfuron-ct-DNA binding, which was further verified by molecular docking study. Meanwhile, the electrostatic and hydrophobic interactions also played a supporting function for the interaction of sulfosulfuron with ct-DNA. The circular dichroism (CD) results exhibited a minor change in the secondary structure of ct-DNA during interaction process. Moreover, the conformation of sulfosulfuron had the obvious change after binding to DNA, which suggested that the flexibility of sulfosulfuron contributed to stabilizing the sulfosulfuron-ct-DNA complex. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. Binding mode and thermodynamic studies on the interaction of the anticancer drug dacarbazine and dacarbazine-Cu(II) complex with single and double stranded DNA.

    PubMed

    Temerk, Yassien; Ibrahim, Hossieny

    2014-07-01

    The binding mode and thermodynamic characteristics of the anticancer drug dacarbazine (Dac) with double and single stranded DNA were investigated in the absence and presence of Cu(II) using cyclic voltammetry, square wave voltammetry and fluorescence spectroscopy. The interaction of Dac and Dac-Cu(II) complex with dsDNA indicated their intercalation into the base stacking domain of dsDNA double helix and the strength of interaction is independent on the ionic strength. The interaction of Dac with dsDNA in the presence of Cu(II) leads to a much stronger intercalation. The interaction mode of Dac molecules with ssDNA is electrostatic attraction via negative phosphate on the exterior of the ssDNA with Dac. The binding constants, stoichiometric coefficients and thermodynamic parameters of Dac and Dac-Cu(II) complex with dsDNA and ssDNA were evaluated. Comparison of the mode interaction of Dac with dsDNA and ssDNA was discussed. The decrease of peak current of Dac was proportional to DNA concentration, which was applied for determination of dsDNA and ssDNA concentration. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Saccharomyces cerevisiae SSB1 protein and its relationship to nucleolar RNA-binding proteins.

    PubMed Central

    Jong, A Y; Clark, M W; Gilbert, M; Oehm, A; Campbell, J L

    1987-01-01

    To better define the function of Saccharomyces cerevisiae SSB1, an abundant single-stranded nucleic acid-binding protein, we determined the nucleotide sequence of the SSB1 gene and compared it with those of other proteins of known function. The amino acid sequence contains 293 amino acid residues and has an Mr of 32,853. There are several stretches of sequence characteristic of other eucaryotic single-stranded nucleic acid-binding proteins. At the amino terminus, residues 39 to 54 are highly homologous to a peptide in calf thymus UP1 and UP2 and a human heterogeneous nuclear ribonucleoprotein. Residues 125 to 162 constitute a fivefold tandem repeat of the sequence RGGFRG, the composition of which suggests a nucleic acid-binding site. Near the C terminus, residues 233 to 245 are homologous to several RNA-binding proteins. Of 18 C-terminal residues, 10 are acidic, a characteristic of the procaryotic single-stranded DNA-binding proteins and eucaryotic DNA- and RNA-binding proteins. In addition, examination of the subcellular distribution of SSB1 by immunofluorescence microscopy indicated that SSB1 is a nuclear protein, predominantly located in the nucleolus. Sequence homologies and the nucleolar localization make it likely that SSB1 functions in RNA metabolism in vivo, although an additional role in DNA metabolism cannot be excluded. Images PMID:2823109

  11. Triplex DNA-binding proteins are associated with clinical outcomes revealed by proteomic measurements in patients with colorectal cancer

    PubMed Central

    2012-01-01

    Background Tri- and tetra-nucleotide repeats in mammalian genomes can induce formation of alternative non-B DNA structures such as triplexes and guanine (G)-quadruplexes. These structures can induce mutagenesis, chromosomal translocations and genomic instability. We wanted to determine if proteins that bind triplex DNA structures are quantitatively or qualitatively different between colorectal tumor and adjacent normal tissue and if this binding activity correlates with patient clinical characteristics. Methods Extracts from 63 human colorectal tumor and adjacent normal tissues were examined by gel shifts (EMSA) for triplex DNA-binding proteins, which were correlated with clinicopathological tumor characteristics using the Mann-Whitney U, Spearman’s rho, Kaplan-Meier and Mantel-Cox log-rank tests. Biotinylated triplex DNA and streptavidin agarose affinity binding were used to purify triplex-binding proteins in RKO cells. Western blotting and reverse-phase protein array were used to measure protein expression in tissue extracts. Results Increased triplex DNA-binding activity in tumor extracts correlated significantly with lymphatic disease, metastasis, and reduced overall survival. We identified three multifunctional splicing factors with biotinylated triplex DNA affinity: U2AF65 in cytoplasmic extracts, and PSF and p54nrb in nuclear extracts. Super-shift EMSA with anti-U2AF65 antibodies produced a shifted band of the major EMSA H3 complex, identifying U2AF65 as the protein present in the major EMSA band. U2AF65 expression correlated significantly with EMSA H3 values in all extracts and was higher in extracts from Stage III/IV vs. Stage I/II colon tumors (p = 0.024). EMSA H3 values and U2AF65 expression also correlated significantly with GSK3 beta, beta-catenin, and NF- B p65 expression, whereas p54nrb and PSF expression correlated with c-Myc, cyclin D1, and CDK4. EMSA values and expression of all three splicing factors correlated with ErbB1, mTOR, PTEN, and Stat5. Western blots confirmed that full-length and truncated beta-catenin expression correlated with U2AF65 expression in tumor extracts. Conclusions Increased triplex DNA-binding activity in vitro correlates with lymph node disease, metastasis, and reduced overall survival in colorectal cancer, and increased U2AF65 expression is associated with total and truncated beta-catenin expression in high-stage colorectal tumors. PMID:22682314

  12. Spectroscopic and viscometric elucidation of the interaction between a potential chloride channel blocker and calf-thymus DNA: the effect of medium ionic strength on the binding mode.

    PubMed

    Ganguly, Aniruddha; Ghosh, Soumen; Guchhait, Nikhil

    2015-01-07

    The present study demonstrates a detailed characterization of the binding interaction of a potential chloride channel blocker 9-methyl anthroate (9-MA) with calf-thymus DNA. The modulated photophysical properties of the emissive molecule within the microheterogeneous bio-assembly have been spectroscopically exploited to monitor the drug-DNA binding interaction. Experimental results based on fluorescence and absorption spectroscopy aided with DNA-melting, viscometric and circular dichroism studies unambiguously establish the binding mode between the drug and DNA to be principally intercalative. Concomitantly, a discernible dependence of the mode of binding between the concerned moieties on the ionic strength of the medium is noteworthy. A dip-and-rise characteristic of the rotational relaxation profile of the drug within the DNA environment has been argued to be originating from a substantial difference in the lifetime as well as amplitude of the free and DNA bound drug molecule. In view of the prospective biological applications of the drug, the issue of facile dissociation of the intercalated drug from the DNA helix via a simple detergent-sequestration technique has also been unveiled. The utility of the present work resides in exploring the potential applicability of the fluorescence properties of 9-MA for studying its interactions with other relevant biological or biomimicking targets.

  13. Drug-DNA interactions at single molecule level: A view with optical tweezers

    NASA Astrophysics Data System (ADS)

    Paramanathan, Thayaparan

    Studies of small molecule--DNA interactions are essential for developing new drugs for challenging diseases like cancer and HIV. The main idea behind developing these molecules is to target and inhibit the reproduction of the tumor cells and infected cells. We mechanically manipulate single DNA molecule using optical tweezers to investigate two molecules that have complex and multiple binding modes. Mononuclear ruthenium complexes have been extensively studied as a test for rational drug design. Potential drug candidates should have high affinity to DNA and slow dissociation kinetics. To achieve this, motifs of the ruthenium complexes are altered. Our collaborators designed a dumb-bell shaped binuclear ruthenium complex that can only intercalate DNA by threading through its bases. Studying the binding properties of this complex in bulk studies took hours. By mechanically manipulating a single DNA molecule held with optical tweezers, we lower the barrier to thread and make it fast compared to the bulk experiments. Stretching single DNA molecules with different concentration of drug molecules and holding it at a constant force allows the binding to reach equilibrium. By this we can obtain the equilibrium fractional ligand binding and length of DNA at saturated binding. Fitting these results yields quantitative measurements of the binding thermodynamics and kinetics of this complex process. The second complex discussed in this study is Actinomycin D (ActD), a well studied anti-cancer agent that is used as a prototype for developing new generations of drugs. However, the biophysical basis of its activity is still unclear. Because ActD is known to intercalate double stranded DNA (dsDNA), it was assumed to block replication by stabilizing dsDNA in front of the replication fork. However, recent studies have shown that ActD binds with even higher affinity to imperfect duplexes and some sequences of single stranded DNA (ssDNA). We directly measure the on and off rates by stretching the DNA molecule to a certain force and holding it at constant force while adding the drug and then while washing off the drug. Our finding resolves the long lasting controversy of ActD binding modes, clearly showing that both the dsDNA binding and ssDNA binding converge to the same single mode. The result supports the hypothesis that the primary characteristic of ActD that contributes to its biological activity is its ability to inhibit cellular replication by binding to transcription bubbles and causing cell death.

  14. Preparation and DNA-binding properties of substituted triostin antibiotics.

    PubMed

    Cornish, A; Fox, K R; Waring, M J

    1983-02-01

    Novel derivatives of the triostin group of antibiotics were prepared by supplementing cultures of the producing organism Streptomyces triostinicus with a variety of aromatic carboxylic acids. Five new antibiotics, each having both the natural quinoxaline chromophores replaced by a substituted ring system, were purified to homogeneity and characterized by high-pressure liquid chromatography and nuclear magnetic resonance. Their antibacterial activities and DNA-binding properties were investigated. Addition of a halogen atom at position 6 of the quinoxaline ring or an amino group at position 3 had little effect on either the biological activity or the DNA-binding characteristics. The bis-3-amino derivative is fluorescent, and its fluorescence is strongly quenched by calf thymus DNA and polydeoxyguanylate-polydeoxycytidylate but not by polydeoxyadenylate-polydeoxythymidylate, suggesting that it binds preferentially to guanosine-cytosine-rich sequences in natural DNA. Binding constants for the bis-6-chloro and bis-3-amino derivatives do not differ greatly from those of unsubstituted triostin A. The analogs having two quinoline chromophores or a chlorine atom in position 7 of the quinoxaline ring display little or no detectable antibacterial activity, in marked contrast to the other congeners. Bis-7-chloro-triostin A binds conspicuously more tightly to polydeoxyadenylate-polydeoxythymidylate than to any other polynucleotide tested.

  15. A Link between ORC-Origin Binding Mechanisms and Origin Activation Time Revealed in Budding Yeast

    PubMed Central

    Hoggard, Timothy; Shor, Erika; Müller, Carolin A.; Nieduszynski, Conrad A.; Fox, Catherine A.

    2013-01-01

    Eukaryotic DNA replication origins are selected in G1-phase when the origin recognition complex (ORC) binds chromosomal positions and triggers molecular events culminating in the initiation of DNA replication (a.k.a. origin firing) during S-phase. Each chromosome uses multiple origins for its duplication, and each origin fires at a characteristic time during S-phase, creating a cell-type specific genome replication pattern relevant to differentiation and genome stability. It is unclear whether ORC-origin interactions are relevant to origin activation time. We applied a novel genome-wide strategy to classify origins in the model eukaryote Saccharomyces cerevisiae based on the types of molecular interactions used for ORC-origin binding. Specifically, origins were classified as DNA-dependent when the strength of ORC-origin binding in vivo could be explained by the affinity of ORC for origin DNA in vitro, and, conversely, as ‘chromatin-dependent’ when the ORC-DNA interaction in vitro was insufficient to explain the strength of ORC-origin binding in vivo. These two origin classes differed in terms of nucleosome architecture and dependence on origin-flanking sequences in plasmid replication assays, consistent with local features of chromatin promoting ORC binding at ‘chromatin-dependent’ origins. Finally, the ‘chromatin-dependent’ class was enriched for origins that fire early in S-phase, while the DNA-dependent class was enriched for later firing origins. Conversely, the latest firing origins showed a positive association with the ORC-origin DNA paradigm for normal levels of ORC binding, whereas the earliest firing origins did not. These data reveal a novel association between ORC-origin binding mechanisms and the regulation of origin activation time. PMID:24068963

  16. Spectroscopic studies of the interaction of aspirin and its important metabolite, salicylate ion, with DNA, A·T and G·C rich sequences

    NASA Astrophysics Data System (ADS)

    Bathaie, S. Z.; Nikfarjam, L.; Rahmanpour, R.; Moosavi-Movahedi, A. A.

    2010-12-01

    Among different biological effects of acetylsalicylic acid (ASA), its anticancer property is controversial. Since ASA hydrolyzes rapidly to salicylic acid (SA), especially in the blood, interaction of both ASA and SA (as the small molecules) with ctDNA, oligo(dA·dT) 15 and oligo(dG·dC) 15, as a possible mechanism of their action, is investigated here. The results show that the rate of ASA hydrolysis in the absence and presence of ctDNA is similar. The spectrophotometric results indicate that both ASA and SA cooperatively bind to ctDNA. The binding constants ( K) are (1.7 ± 0.7) × 10 3 M -1 and (6.7 ± 0.2) × 10 3 M -1 for ASA and SA, respectively. Both ligands quench the fluorescence emission of ethidium bromide (Et)-ctDNA complex. The Scatchard plots indicate the non-displacement based quenching (non-intercalative binding). The circular dichroism (CD) spectra of ASA- or SA-ctDsNA complexes show the minor distortion of ctDNA structure, with no characteristic peaks for intercalation of ligands. Tm of ctDNA is decreased up to 3 °C upon ASA binding. The CD results also indicate more distortions on oligo(dG·dC) 15 structure due to the binding of both ASA and SA in comparison with oligo(dA·dT) 15. All data indicate the more affinity for SA binding with DNA minor groove in comparison with ASA which has more hydrophobic character.

  17. Interaction of the alpha-subunit of Escherichia coli RNA polymerase with DNA: rigid body nature of the protein-DNA contact.

    PubMed

    Heyduk, E; Baichoo, N; Heyduk, T

    2001-11-30

    The alpha-subunit of Escherichia coli RNA polymerase plays an important role in the activity of many promoters by providing a direct protein-DNA contact with a specific sequence (UP element) located upstream of the core promoter sequence. To obtain insight into the nature of thermodynamic forces involved in the formation of this protein-DNA contact, the binding of the alpha-subunit of E. coli RNA polymerase to a fluorochrome-labeled DNA fragment containing the rrnB P1 promoter UP element sequence was quantitatively studied using fluorescence polarization. The alpha dimer and DNA formed a 1:1 complex in solution. Complex formation at 25 degrees C was enthalpy-driven, the binding was accompanied by a net release of 1-2 ions, and no significant specific ion effects were observed. The van't Hoff plot of temperature dependence of binding was linear suggesting that the heat capacity change (Deltac(p)) was close to zero. Protein footprinting with hydroxyradicals showed that the protein did not change its conformation upon protein-DNA contact formation. No conformational changes in the DNA molecule were detected by CD spectroscopy upon protein-DNA complex formation. The thermodynamic characteristics of the binding together with the lack of significant conformational changes in the protein and in the DNA suggested that the alpha-subunit formed a rigid body-like contact with the DNA in which a tight complementary recognition interface between alpha-subunit and DNA was not formed.

  18. Adsorption of DNA to mica mediated by divalent counterions: a theoretical and experimental study.

    PubMed

    Pastré, David; Piétrement, Olivier; Fusil, Stéphane; Landousy, Fabrice; Jeusset, Josette; David, Marie-Odile; Hamon, Loïc; Le Cam, Eric; Zozime, Alain

    2003-10-01

    The adsorption of DNA molecules onto a flat mica surface is a necessary step to perform atomic force microscopy studies of DNA conformation and observe DNA-protein interactions in physiological environment. However, the phenomenon that pulls DNA molecules onto the surface is still not understood. This is a crucial issue because the DNA/surface interactions could affect the DNA biological functions. In this paper we develop a model that can explain the mechanism of the DNA adsorption onto mica. This model suggests that DNA attraction is due to the sharing of the DNA and mica counterions. The correlations between divalent counterions on both the negatively charged DNA and the mica surface can generate a net attraction force whereas the correlations between monovalent counterions are ineffective in the DNA attraction. DNA binding is then dependent on the fractional surface densities of the divalent and monovalent cations, which can compete for the mica surface and DNA neutralizations. In addition, the attraction can be enhanced when the mica has been pretreated by transition metal cations (Ni(2+), Zn(2+)). Mica pretreatment simultaneously enhances the DNA attraction and reduces the repulsive contribution due to the electrical double-layer force. We also perform end-to-end distance measurement of DNA chains to study the binding strength. The DNA binding strength appears to be constant for a fixed fractional surface density of the divalent cations at low ionic strength (I < 0.1 M) as predicted by the model. However, at higher ionic strength, the binding is weakened by the screening effect of the ions. Then, some equations were derived to describe the binding of a polyelectrolyte onto a charged surface. The electrostatic attraction due to the sharing of counterions is particularly effective if the polyelectrolyte and the surface have nearly the same surface charge density. This characteristic of the attraction force can explain the success of mica for performing single DNA molecule observation by AFM. In addition, we explain how a reversible binding of the DNA molecules can be obtained with a pretreated mica surface.

  19. Nucleic acids encoding human trithorax protein

    DOEpatents

    Evans, Glen A.; Djabali, Malek; Selleri, Licia; Parry, Pauline

    2001-01-01

    In accordance with the present invention, there is provided an isolated peptide having the characteristics of human trithorax protein (as well as DNA encoding same, antisense DNA derived therefrom and antagonists therefor). The invention peptide is characterized by having a DNA binding domain comprising multiple zinc fingers and at least 40% amino acid identity with respect to the DNA binding domain of Drosophila trithorax protein and at least 70% conserved sequence with respect to the DNA binding domain of Drosophila trithorax protein, and wherein said peptide is encoded by a gene located at chromosome 11 of the human genome at q23. Also provided are methods for the treatment of subject(s) suffering from immunodeficiency, developmental abnormality, inherited disease, or cancer by administering to said subject a therapeutically effective amount of one of the above-described agents (i.e., peptide, antagonist therefor, DNA encoding said peptide or antisense DNA derived therefrom). Also provided is a method for the diagnosis, in a subject, of immunodeficiency, developmental abnormality, inherited disease, or cancer associated with disruption of chromosome 11 at q23.

  20. AgI -Induced Switching of DNA Binding Modes via Formation of a Supramolecular Metallacycle.

    PubMed

    Basak, Shibaji; Léon, J Christian; Ferranco, Annaleizle; Sharma, Renu; Hebenbrock, Marian; Lough, Alan; Müller, Jens; Kraatz, Heinz-Bernhard

    2018-03-12

    The histidine derivative L1 of the DNA intercalator naphthalenediimide (NDI) forms a triangular Ag I complex (C2). The interactions of L1 and of C2 with DNA were studied by circular dichroism (CD) and UV/Vis spectroscopy and by viscosity studies. Different binding modes were observed for L1 and for C2, as the Ag I complex C2 is too large in size to act as an intercalator. If Ag I is added to the NDI molecule that is already intercalated into a duplex, higher order complexes are formed within the DNA duplex and cause disruptions in the helical duplex structure, which leads to a significant decrease in the characteristic CD features of B-DNA. Thus, via addition of a metal we show how a classic and well-known organic intercalator unit can be turned into a partial metallo insertor. We also show how electrochemical impedance spectroscopy (EIS) can be used to probe DNA binding modes on DNA films that are immobilized on gold surfaces. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Sequence-Specific Recognition of DNA by Proteins: Binding Motifs Discovered Using a Novel Statistical/Computational Analysis

    PubMed Central

    Jakubec, David; Laskowski, Roman A.; Vondrasek, Jiri

    2016-01-01

    Decades of intensive experimental studies of the recognition of DNA sequences by proteins have provided us with a view of a diverse and complicated world in which few to no features are shared between individual DNA-binding protein families. The originally conceived direct readout of DNA residue sequences by amino acid side chains offers very limited capacity for sequence recognition, while the effects of the dynamic properties of the interacting partners remain difficult to quantify and almost impossible to generalise. In this work we investigated the energetic characteristics of all DNA residue—amino acid side chain combinations in the conformations found at the interaction interface in a very large set of protein—DNA complexes by the means of empirical potential-based calculations. General specificity-defining criteria were derived and utilised to look beyond the binding motifs considered in previous studies. Linking energetic favourability to the observed geometrical preferences, our approach reveals several additional amino acid motifs which can distinguish between individual DNA bases. Our results remained valid in environments with various dielectric properties. PMID:27384774

  2. Structure of homeodomain-leucine zipper/DNA complexes studied using hydroxyl radical cleavage of DNA and methylation interference.

    PubMed

    Tron, Adriana E; Comelli, Raúl N; Gonzalez, Daniel H

    2005-12-27

    Homeodomain-leucine zipper (HD-Zip) proteins, unlike most homeodomain proteins, bind a pseudopalindromic DNA sequence as dimers. We have investigated the structure of the DNA complexes formed by two HD-Zip proteins with different nucleotide preferences at the central position of the binding site using footprinting and interference methods. The results indicate that the respective complexes are not symmetric, with the strand bearing a central purine (top strand) showing higher protection around the central region and the bottom strand protected toward the 3' end. Binding to a sequence with a nonpreferred central base pair produces a decrease in protection in either the top or the bottom strand, depending upon the protein. Modeling studies derived from the complex formed by the monomeric Antennapedia homeodomain with DNA indicate that in the HD-Zip/DNA complex the recognition helix of one of the monomers is displaced within the major groove respective to the other one. This monomer seems to lose contacts with a part of the recognition sequence upon binding to the nonpreferred site. The results show that the structure of the complex formed by HD-Zip proteins with DNA is dependent upon both protein intrinsic characteristics and the nucleotides present at the central position of the recognition sequence.

  3. DNA binding by a new metallointercalator that contains a proflavine group bearing a hanging chelating unit.

    PubMed

    Bazzicalupi, Carla; Bencini, Andrea; Bianchi, Antonio; Biver, Tarita; Boggioni, Alessia; Bonacchi, Sara; Danesi, Andrea; Giorgi, Claudia; Gratteri, Paola; Ingraín, Antonio Marchal; Secco, Fernando; Sissi, Claudia; Valtancoli, Barbara; Venturini, Marcella

    2008-01-01

    The new bifunctional molecule 3,6-diamine-9-[6,6-bis(2-aminoethyl)-1,6-diaminohexyl]acridine (D), which is characterised by both an aromatic moiety and a separate metal-complexing polyamine centre, has been synthesised. The characteristics of D and its ZnII complex ([ZnD]) (protonation and metal-complexing constants, optical properties and self-aggregation phenomena) have been analysed by means of NMR spectroscopy, potentiometric, spectrophotometric and spectrofluorimetric techniques. The equilibria and kinetics of the binding process of D and [ZnD] to calf thymus DNA have been investigated at I=0.11 M (NaCl) and 298.1 K by using spectroscopic methods and the stopped-flow technique. Static measurements show biphasic behaviour for both D-DNA and [ZnD]-DNA systems; this reveals the occurrence of two different binding processes depending on the polymer-to-dye molar ratio (P/D). The binding mode that occurs at low P/D values is interpreted in terms of external binding with a notable contribution from the polyamine residue. The binding mode at high P/D values corresponds to intercalation of the proflavine residue. Stopped-flow, circular dichroism and supercoiled-DNA unwinding experiments corroborate the proposed mechanism. Molecular-modelling studies support the intercalative process and evidence the influence of NH+...O interactions between the protonated acridine nitrogen atom and the oxygen atoms of the polyanion; these interactions play a key role in determining the conformation of DNA adducts.

  4. Electromagnetic and optical characteristics of Nb5+-doped double-crossover and salmon DNA thin films

    NASA Astrophysics Data System (ADS)

    Babu Mitta, Sekhar; Reddy Dugasani, Sreekantha; Jung, Soon-Gil; Vellampatti, Srivithya; Park, Tuson; Park, Sung Ha

    2017-10-01

    We report the fabrication and physical characteristics of niobium ion (Nb5+)-doped double-crossover DNA (DX-DNA) and salmon DNA (SDNA) thin films. Different concentrations of Nb5+ ([Nb5+]) are coordinated into the DNA molecules, and the thin films are fabricated via substrate-assisted growth (DX-DNA) and drop-casting (SDNA) on oxygen plasma treated substrates. We conducted atomic force microscopy to estimate the optimum concentration of Nb5+ ([Nb5+]O = 0.08 mM) in Nb5+-doped DX-DNA thin films, up to which the DX-DNA lattices maintain their structures without deformation. X-ray photoelectron spectroscopy (XPS) was performed to probe the chemical nature of the intercalated Nb5+ in the SDNA thin films. The change in peak intensities and the shift in binding energy were witnessed in XPS spectra to explicate the binding and charge transfer mechanisms between Nb5+ and SDNA molecules. UV-visible, Raman, and photoluminescence (PL) spectra were measured to determine the optical properties and thus investigate the binding modes, Nb5+ coordination sites in Nb5+-doped SDNA thin films, and energy transfer mechanisms, respectively. As [Nb5+] increases, the absorbance peak intensities monotonically increase until ˜[Nb5+]O and then decrease. However, from the Raman measurements, the peak intensities gradually decrease with an increase in [Nb5+] to reveal the binding mechanism and binding sites of metal ions in the SDNA molecules. From the PL, we observe the emission intensities to reduce them at up to ˜[Nb5+]O and then increase after that, expecting the energy transfer between the Nb5+ and SDNA molecules. The current-voltage measurement shows a significant increase in the current observed as [Nb5+] increases in the SDNA thin films when compared to that of pristine SDNA thin films. Finally, we investigate the temperature dependent magnetization in which the Nb5+-doped SDNA thin films reveal weak ferromagnetism due to the existence of tiny magnetic dipoles in the Nb5+-doped SDNA complex.

  5. The type III effector HsvG of the gall-forming Pantoea agglomerans mediates expression of the host gene HSVGT.

    PubMed

    Nissan, Gal; Manulis-Sasson, Shulamit; Chalupowicz, Laura; Teper, Doron; Yeheskel, Adva; Pasmanik-Chor, Metsada; Sessa, Guido; Barash, Isaac

    2012-02-01

    The type III effector HsvG of the gall-forming Pantoea agglomerans pv. gypsophilae is a DNA-binding protein that is imported to the host nucleus and involved in host specificity. The DNA-binding region of HsvG was delineated to 266 amino acids located within a secondary structure region near the N-terminus of the protein but did not display any homology to canonical DNA-binding motifs. A binding site selection procedure was used to isolate a target gene of HsvG, named HSVGT, in Gypsophila paniculata. HSVGT is a predicted acidic protein of the DnaJ family with 244 amino acids. It harbors characteristic conserved motifs of a eukaryotic transcription factor, including a bipartite nuclear localization signal, zinc finger, and leucine zipper DNA-binding motifs. Quantitative real-time polymerase chain reaction analysis demonstrated that HSVGT transcription is specifically induced in planta within 2 h after inoculation with the wild-type P. agglomerans pv. gypsophilae compared with the hsvG mutant. Induction of HSVGT reached a peak of sixfold at 4 h after inoculation and progressively declined thereafter. Gel-shift assay demonstrated that HsvG binds to the HSVGT promoter, indicating that HSVGT is a direct target of HsvG. Our results support the hypothesis that HsvG functions as a transcription factor in gypsophila.

  6. Multiplexed target detection using DNA-binding dye chemistry in droplet digital PCR.

    PubMed

    McDermott, Geoffrey P; Do, Duc; Litterst, Claudia M; Maar, Dianna; Hindson, Christopher M; Steenblock, Erin R; Legler, Tina C; Jouvenot, Yann; Marrs, Samuel H; Bemis, Adam; Shah, Pallavi; Wong, Josephine; Wang, Shenglong; Sally, David; Javier, Leanne; Dinio, Theresa; Han, Chunxiao; Brackbill, Timothy P; Hodges, Shawn P; Ling, Yunfeng; Klitgord, Niels; Carman, George J; Berman, Jennifer R; Koehler, Ryan T; Hiddessen, Amy L; Walse, Pramod; Bousse, Luc; Tzonev, Svilen; Hefner, Eli; Hindson, Benjamin J; Cauly, Thomas H; Hamby, Keith; Patel, Viresh P; Regan, John F; Wyatt, Paul W; Karlin-Neumann, George A; Stumbo, David P; Lowe, Adam J

    2013-12-03

    Two years ago, we described the first droplet digital PCR (ddPCR) system aimed at empowering all researchers with a tool that removes the substantial uncertainties associated with using the analogue standard, quantitative real-time PCR (qPCR). This system enabled TaqMan hydrolysis probe-based assays for the absolute quantification of nucleic acids. Due to significant advancements in droplet chemistry and buoyed by the multiple benefits associated with dye-based target detection, we have created a "second generation" ddPCR system compatible with both TaqMan-probe and DNA-binding dye detection chemistries. Herein, we describe the operating characteristics of DNA-binding dye based ddPCR and offer a side-by-side comparison to TaqMan probe detection. By partitioning each sample prior to thermal cycling, we demonstrate that it is now possible to use a DNA-binding dye for the quantification of multiple target species from a single reaction. The increased resolution associated with partitioning also made it possible to visualize and account for signals arising from nonspecific amplification products. We expect that the ability to combine the precision of ddPCR with both DNA-binding dye and TaqMan probe detection chemistries will further enable the research community to answer complex and diverse genetic questions.

  7. The role of differing probe and target strand lengths in DNA microarrays investigated via Monte Carlo molecular simulation

    NASA Astrophysics Data System (ADS)

    Rivard, Brea R.; Cooper, Sarah J.; Stubbs, John M.

    2018-02-01

    DNA duplexes consisting of a 25mer together with shorter complementary sequences were studied over a range of temperature and surface binding motifs using a coarse-grained two-site nucleotide model. Results were analyzed in terms of hydrogen bonding interactions and structural characteristics and indicate that hybridization is most stable when furthest from the surface binding site. Strand elongation and straightening near the bound end are found to be correlated to duplex destabilization.

  8. DNA-Mediated Electrochemistry

    PubMed Central

    Gorodetsky, Alon A.; Buzzeo, Marisa C.

    2009-01-01

    The base pair stack of DNA has been demonstrated as a medium for long range charge transport chemistry both in solution and at DNA-modified surfaces. This chemistry is exquisitely sensitive to structural perturbations in the base pair stack as occur with lesions, single base mismatches, and protein binding. We have exploited this sensitivity for the development of reliable electrochemical assays based on DNA charge transport at self-assembled DNA monolayers. Here we discuss the characteristic features, applications, and advantages of DNA-mediated electrochemistry. PMID:18980370

  9. Genome-wide DNA methylation measurements in prostate tissues uncovers novel prostate cancer diagnostic biomarkers and transcription factor binding patterns.

    PubMed

    Kirby, Marie K; Ramaker, Ryne C; Roberts, Brian S; Lasseigne, Brittany N; Gunther, David S; Burwell, Todd C; Davis, Nicholas S; Gulzar, Zulfiqar G; Absher, Devin M; Cooper, Sara J; Brooks, James D; Myers, Richard M

    2017-04-17

    Current diagnostic tools for prostate cancer lack specificity and sensitivity for detecting very early lesions. DNA methylation is a stable genomic modification that is detectable in peripheral patient fluids such as urine and blood plasma that could serve as a non-invasive diagnostic biomarker for prostate cancer. We measured genome-wide DNA methylation patterns in 73 clinically annotated fresh-frozen prostate cancers and 63 benign-adjacent prostate tissues using the Illumina Infinium HumanMethylation450 BeadChip array. We overlaid the most significantly differentially methylated sites in the genome with transcription factor binding sites measured by the Encyclopedia of DNA Elements consortium. We used logistic regression and receiver operating characteristic curves to assess the performance of candidate diagnostic models. We identified methylation patterns that have a high predictive power for distinguishing malignant prostate tissue from benign-adjacent prostate tissue, and these methylation signatures were validated using data from The Cancer Genome Atlas Project. Furthermore, by overlaying ENCODE transcription factor binding data, we observed an enrichment of enhancer of zeste homolog 2 binding in gene regulatory regions with higher DNA methylation in malignant prostate tissues. DNA methylation patterns are greatly altered in prostate cancer tissue in comparison to benign-adjacent tissue. We have discovered patterns of DNA methylation marks that can distinguish prostate cancers with high specificity and sensitivity in multiple patient tissue cohorts, and we have identified transcription factors binding in these differentially methylated regions that may play important roles in prostate cancer development.

  10. Simultaneous binding to the tracking strand, displaced strand and the duplex of a DNA fork enhances unwinding by Dda helicase

    PubMed Central

    Aarattuthodiyil, Suja; Byrd, Alicia K.; Raney, Kevin D.

    2014-01-01

    Interactions between helicases and the tracking strand of a DNA substrate are well-characterized; however, the role of the displaced strand is a less understood characteristic of DNA unwinding. Dda helicase exhibited greater processivity when unwinding a DNA fork compared to a ss/ds DNA junction substrate. The lag phase in the unwinding progress curve was reduced for the forked DNA compared to the ss/ds junction. Fewer kinetic steps were required to unwind the fork compared to the ss/ds junction, suggesting that binding to the fork leads to disruption of the duplex. DNA footprinting confirmed that interaction of Dda with a fork leads to two base pairs being disrupted whereas no disruption of base pairing was observed with the ss/ds junction. Neutralization of the phosphodiester backbone resulted in a DNA-footprinting pattern similar to that observed with the ss/ds junction, consistent with disruption of the interaction between Dda and the displaced strand. Several basic residues in the 1A domain which were previously proposed to bind to the incoming duplex DNA were replaced with alanines, resulting in apparent loss of interaction with the duplex. Taken together, these results suggest that Dda interaction with the tracking strand, displaced strand and duplex coordinates DNA unwinding. PMID:25249618

  11. Copper complexes containing thiosemicarbazones derived from 6-nitropiperonal: Antimicrobial and biophysical properties

    NASA Astrophysics Data System (ADS)

    Beckford, Floyd A.; Webb, Kelsey R.

    2017-08-01

    A series of four thiosemicarbazones from 6-nitropiperonal along with the corresponding copper complexes were synthesized. The biophysical characteristics of the complexes were investigated by the binding to DNA and human serum albumin. The binding to DNA is moderate; the binding constants run from (0.49-7.50) × 104 M- 1. In relation to HSA, the complexes interact strongly with binding constants on the order of 105 M- 1. The complexes also display antioxidant behavior as determined by the ability to scavenge diphenylpicrylhydrazyl (dpph) and nitric oxide radicals. The antimicrobial profiles of the compounds, tested against a panel of microbes including five of the ESKAPE pathogens (Staphylococcus aureus, MRSA, Escherichia coli, Klebsiella pneumoniae, MDR, Acinetobacter baumannii, Pseudomonas aeruginosa) and two yeasts (Candida albicans and Cryptococcus neoformans var. grubii), are also described. The compounds contain a core moiety that is similar to oxolinic acid, a quinolone antibiotic that targets DNA gyrase and topoisomerase (IV). The binding interaction between the complexes and these important antibacterial targets were studied by computational methods, chiefly docking studies. The calculated dissociation constants for the interaction with DNA gyrase B (from Staphylococcus aureus) range from 4.32 to 24.65 μM; the binding was much stronger to topoisomerase IV, with dissociation constants ranging from 0.37 to 1.27 μM.

  12. Synthesis, structure, DNA/BSA binding and antibacterial studies of NNO tridentate Schiff base metal complexes

    NASA Astrophysics Data System (ADS)

    Sakthi, Marimuthu; Ramu, Andy

    2017-12-01

    A new salicylaldehyde derived 2,4-diiodo-6-((2-phenylaminoethylimino)methyl)phenol Schiff base(L) and its transition metal complexes of the type MLCl where, M = Cu(II), Ni(II), Co(II), Mn(II) and Zn(II) have been synthesized. The coordination mode of Schiff base holding NNO donor atoms with metal ions was well investigated by elemental analysis, ESI-mass as well as IR, UV-vis, CV and NMR spectral studies. The binding efficiency and mode of these complexes with biological macromolecules viz., herring sperm DNA (HS- DNA) and bovine serum albumin (BSA) have been explored through various spectroscopic techniques. The characteristic changes in absorption, emission and, circular dichroism spectra of the complexes with DNA indicate the noticeable interaction between them. From the all spectral information complexes could interact with DNA via non-intercalation mode of binding. The hyperchromisim in absorption band and hypochromisim in emission intensity of BSA with different complex concentrations shown significant information, and the binding affinity value has been predicted from Stern-Volmer plots. Further, all the complexes could cleave the circular plasmid pUC19 DNA efficiently by using an activator H2O2. The ligand and all metal(II) complexes showed good antibacterial activities. The molecular docking studies of the complexes with DNA were performed in order to make a comparison and conclusion with spectral technic results.

  13. PNA binding to the non-template DNA strand interferes with transcription, suggesting a blockage mechanism mediated by R-loop formation.

    PubMed

    Belotserkovskii, Boris P; Hanawalt, Philip C

    2015-11-01

    Peptide Nucleic Acids (PNAs) are artificial DNA mimics with superior nucleic acid binding capabilities. T7 RNA polymerase (T7 RNAP) transcription upon encountering PNA bound to the non-template DNA strand was studied in vitro. A characteristic pattern of blockage signals was observed, extending downstream from the PNA binding site, similar to that produced by G-rich homopurine-homopyrimidine (hPu-hPy) sequences and likely caused by R-loop formation. Since blocked transcription complexes in association with stable R-loops may interfere with replication and in some cases trigger apoptosis, targeted R-loop formation might be employed to inactivate selected cells, such as those in tumors, based upon their unique complement of expressed genes. © 2014 The Authors. Molecular Carcinogenesis published by Wiley Periodicals, Inc.

  14. Poxvirus uracil-DNA glycosylase-An unusual member of the family I uracil-DNA glycosylases: Poxvirus Uracil-DNA Glycosylase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schormann, Norbert; Zhukovskaya, Natalia; Bedwell, Gregory

    We report that uracil-DNA glycosylases are ubiquitous enzymes, which play a key role repairing damages in DNA and in maintaining genomic integrity by catalyzing the first step in the base excision repair pathway. Within the superfamily of uracil-DNA glycosylases family I enzymes or UNGs are specific for recognizing and removing uracil from DNA. These enzymes feature conserved structural folds, active site residues and use common motifs for DNA binding, uracil recognition and catalysis. Within this family the enzymes of poxviruses are unique and most remarkable in terms of amino acid sequences, characteristic motifs and more importantly for their novel non-enzymaticmore » function in DNA replication. UNG of vaccinia virus, also known as D4, is the most extensively characterized UNG of the poxvirus family. D4 forms an unusual heterodimeric processivity factor by attaching to a poxvirus-specific protein A20, which also binds to the DNA polymerase E9 and recruits other proteins necessary for replication. D4 is thus integrated in the DNA polymerase complex, and its DNA-binding and DNA scanning abilities couple DNA processivity and DNA base excision repair at the replication fork. In conclusion, the adaptations necessary for taking on the new function are reflected in the amino acid sequence and the three-dimensional structure of D4. We provide an overview of the current state of the knowledge on the structure-function relationship of D4.« less

  15. Electrochemical study of the interaction between dsDNA and copper(I) using carbon paste and hanging mercury drop electrode.

    PubMed

    Stanić, Z; Girousi, S

    2008-06-30

    The interaction of copper(I) with double-stranded (ds) calf thymus DNA was studied in solution and at the electrode surface by means of transfer voltammetry using a carbon paste electrode (CPE) as working electrode in 0.2 M acetate buffer solution (pH 5.0). As a result of the interaction of Cu(I) between the base pairs of the dsDNA, the characteristic peaks of dsDNA, due to the oxidation of guanine and adenine, increased and after a certain concentration of Cu(I) a new peak at +1.37 V appeared, probably due to the formation of a purine-Cu(I) complex (dsDNA-Cu(I) complex). Accordingly, the interaction of copper(I) with calf thymus dsDNA was studied in solution as well as at the electrode surface using hanging mercury drop electrode (HMDE) by means of alternating current voltammetry (AC voltammetry) in 0.3 M NaCl and 50 mM sodium phosphate buffer (pH 8.5) as supporting electrolyte. Its interaction with DNA is shown to be time dependent. Significant changes in the characteristic peaks of dsDNA were observed after addition of higher concentration of Cu(I) to a solution containing dsDNA, as a result of the interaction between Cu(I) and dsDNA. All the experimental results indicate that Cu(I) can bind to DNA by electrostatic binding and form an association complex.

  16. Evolutionary and biophysical relationships among the papillomavirus E2 proteins.

    PubMed

    Blakaj, Dukagjin M; Fernandez-Fuentes, Narcis; Chen, Zigui; Hegde, Rashmi; Fiser, Andras; Burk, Robert D; Brenowitz, Michael

    2009-01-01

    Infection by human papillomavirus (HPV) may result in clinical conditions ranging from benign warts to invasive cancer. The HPV E2 protein represses oncoprotein transcription and is required for viral replication. HPV E2 binds to palindromic DNA sequences of highly conserved four base pair sequences flanking an identical length variable 'spacer'. E2 proteins directly contact the conserved but not the spacer DNA. Variation in naturally occurring spacer sequences results in differential protein affinity that is dependent on their sensitivity to the spacer DNA's unique conformational and/or dynamic properties. This article explores the biophysical character of this core viral protein with the goal of identifying characteristics that associated with risk of virally caused malignancy. The amino acid sequence, 3d structure and electrostatic features of the E2 protein DNA binding domain are highly conserved; specific interactions with DNA binding sites have also been conserved. In contrast, the E2 protein's transactivation domain does not have extensive surfaces of highly conserved residues. Rather, regions of high conservation are localized to small surface patches. Implications to cancer biology are discussed.

  17. Preferential recognition of auto-antibodies against 4-hydroxynonenal modified DNA in the cancer patients.

    PubMed

    Faisal, Mohammad; Shahab, Uzma; Alatar, Abdulrahman A; Ahmad, Saheem

    2017-11-01

    The structural perturbations in DNA molecule may be caused by a break in a strand, a missing base from the backbone, or a chemically changed base. These alterations in DNA that occurs naturally can result from metabolic or hydrolytic processes. DNA damage plays a major role in the mutagenesis, carcinogenesis, aging and various other patho-physiological conditions. DNA damage can be induced through hydrolysis, exposure to reactive oxygen species (ROS) and other reactive carbonyl metabolites including 4-hydroxynonenal (HNE). 4-HNE is an important lipid peroxidation product which has been implicated in the mutagenesis and carcinogenesis processes. The present study examines to probe the presence of auto-antibodies against 4-hydroxynonenal damaged DNA (HNE-DNA) in various cancer subjects. In this study, the purified calf thymus DNA was damaged by the action of 4-HNE. The DNA was incubated with 4-HNE for 24 h at 37°C temperature. The binding characteristics of cancer auto-antibodies were assessed by direct binding and competitive inhibition ELISA. DNA modifications produced hyperchromicity in UV spectrum and decreased fluorescence intensity. Cancer sera exhibited enhanced binding with the 4-HNE modified calf thymus DNA as compared to its native conformer. The 4-HNE modified DNA presents unique epitopes which may be one of the factors for the auto-antibody induction in cancer patients. The HNE modified DNA presents unique epitopes which may be one of the factors for the autoantibody induction in cancer patients. © 2017 Wiley Periodicals, Inc.

  18. Light-modulated abundance of an mRNA encoding a calmodulin-regulated, chromatin-associated NTPase in pea

    NASA Technical Reports Server (NTRS)

    Hsieh, H. L.; Tong, C. G.; Thomas, C.; Roux, S. J.

    1996-01-01

    A CDNA encoding a 47 kDa nucleoside triphosphatase (NTPase) that is associated with the chromatin of pea nuclei has been cloned and sequenced. The translated sequence of the cDNA includes several domains predicted by known biochemical properties of the enzyme, including five motifs characteristic of the ATP-binding domain of many proteins, several potential casein kinase II phosphorylation sites, a helix-turn-helix region characteristic of DNA-binding proteins, and a potential calmodulin-binding domain. The deduced primary structure also includes an N-terminal sequence that is a predicted signal peptide and an internal sequence that could serve as a bipartite-type nuclear localization signal. Both in situ immunocytochemistry of pea plumules and immunoblots of purified cell fractions indicate that most of the immunodetectable NTPase is within the nucleus, a compartment proteins typically reach through nuclear pores rather than through the endoplasmic reticulum pathway. The translated sequence has some similarity to that of human lamin C, but not high enough to account for the earlier observation that IgG against human lamin C binds to the NTPase in immunoblots. Northern blot analysis shows that the NTPase MRNA is strongly expressed in etiolated plumules, but only poorly or not at all in the leaf and stem tissues of light-grown plants. Accumulation of NTPase mRNA in etiolated seedlings is stimulated by brief treatments with both red and far-red light, as is characteristic of very low-fluence phytochrome responses. Southern blotting with pea genomic DNA indicates the NTPase is likely to be encoded by a single gene.

  19. Extracting physical chemistry from mechanics: a new approach to investigate DNA interactions with drugs and proteins in single molecule experiments.

    PubMed

    Rocha, M S

    2015-09-01

    In this review we focus on the idea of establishing connections between the mechanical properties of DNA-ligand complexes and the physical chemistry of DNA-ligand interactions. This type of connection is interesting because it opens the possibility of performing a robust characterization of such interactions by using only one experimental technique: single molecule stretching. Furthermore, it also opens new possibilities in comparing results obtained by very different approaches, in particular when comparing single molecule techniques to ensemble-averaging techniques. We start the manuscript reviewing important concepts of DNA mechanics, from the basic mechanical properties to the Worm-Like Chain model. Next we review the basic concepts of the physical chemistry of DNA-ligand interactions, revisiting the most important models used to analyze the binding data and discussing their binding isotherms. Then, we discuss the basic features of the single molecule techniques most used to stretch DNA-ligand complexes and to obtain "force × extension" data, from which the mechanical properties of the complexes can be determined. We also discuss the characteristics of the main types of interactions that can occur between DNA and ligands, from covalent binding to simple electrostatic driven interactions. Finally, we present a historical survey of the attempts to connect mechanics to physical chemistry for DNA-ligand systems, emphasizing a recently developed fitting approach useful to connect the persistence length of DNA-ligand complexes to the physicochemical properties of the interaction. Such an approach in principle can be used for any type of ligand, from drugs to proteins, even if multiple binding modes are present.

  20. The Gam protein of bacteriophage Mu is an orthologue of eukaryotic Ku

    PubMed Central

    di Fagagna, Fabrizio d'Adda; Weller, Geoffrey R.; Doherty, Aidan J.; Jackson, Stephen P.

    2003-01-01

    Mu bacteriophage inserts its DNA into the genome of host bacteria and is used as a model for DNA transposition events in other systems. The eukaryotic Ku protein has key roles in DNA repair and in certain transposition events. Here we show that the Gam protein of phage Mu is conserved in bacteria, has sequence homology with both subunits of Ku, and has the potential to adopt a similar architecture to the core DNA-binding region of Ku. Through biochemical studies, we demonstrate that Gam and the related protein of Haemophilus influenzae display DNA binding characteristics remarkably similar to those of human Ku. In addition, we show that Gam can interfere with Ty1 retrotransposition in Saccharomyces cerevisiae. These data reveal structural and functional parallels between bacteriophage Gam and eukaryotic Ku and suggest that their functions have been evolutionarily conserved. PMID:12524520

  1. Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

    NASA Astrophysics Data System (ADS)

    Risqi, A. M.; Yudiarsah, E.

    2017-07-01

    Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

  2. iDBPs: a web server for the identification of DNA binding proteins.

    PubMed

    Nimrod, Guy; Schushan, Maya; Szilágyi, András; Leslie, Christina; Ben-Tal, Nir

    2010-03-01

    The iDBPs server uses the three-dimensional (3D) structure of a query protein to predict whether it binds DNA. First, the algorithm predicts the functional region of the protein based on its evolutionary profile; the assumption is that large clusters of conserved residues are good markers of functional regions. Next, various characteristics of the predicted functional region as well as global features of the protein are calculated, such as the average surface electrostatic potential, the dipole moment and cluster-based amino acid conservation patterns. Finally, a random forests classifier is used to predict whether the query protein is likely to bind DNA and to estimate the prediction confidence. We have trained and tested the classifier on various datasets and shown that it outperformed related methods. On a dataset that reflects the fraction of DNA binding proteins (DBPs) in a proteome, the area under the ROC curve was 0.90. The application of the server to an updated version of the N-Func database, which contains proteins of unknown function with solved 3D-structure, suggested new putative DBPs for experimental studies. http://idbps.tau.ac.il/

  3. Polyethyleneimine grafted short halloysite nanotubes for gene delivery.

    PubMed

    Long, Zheru; Zhang, Jun; Shen, Yan; Zhou, Changren; Liu, Mingxian

    2017-12-01

    Inorganic nanoparticles have attracted much attentions in gene delivery because of their desirable characteristics including low toxicity, well-controlled characteristics, high gene delivery efficiency, and multi-functionalities. Here, natural occurred halloysite nanotubes (HNTs) were developed as a novel non-viral gene vector. To increase the efficiency of endocytosis, HNTs were firstly shortened into an appropriate size (~200nm). Then polyethyleneimine (PEI) was grafted onto HNTs to bind green fluorescence protein (GFP) labeled pDNA. The structure and physical-chemical properties of PEI grafted HNTs (PEI-g-HNTs) were characterized by various methods. PEI-g-HNTs show lower cytotoxicity than PEI. PEI-g-HNTs are positively charged and can bind DNA tightly at designed N/P ratio from 5:1 to 40:1. PEI-g-HNTs/pDNA complexes show much higher transfection efficiency towards both 293T and HeLa cells compared with PEI/pDNA complexes at the equivalent N/P ratio. The transfection efficiencies of PEI-g-HNTs/pDNA complex towards HeLa cell can reach to 44.4% at N/P ratio of 20. PEI-g-HNTs/pDNA complexes possess a higher GFP protein expression than PEI/pDNA from simple western immunoblots. So, PEI-g-HNTs are potential gene vectors with good biocompatibility and high transfection efficiency, which have promising applications in cancer gene therapy. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Peroxynitrite modified DNA presents better epitopes for anti-DNA autoantibodies in diabetes type 1 patients.

    PubMed

    Tripathi, Prashant; Moinuddin; Dixit, Kiran; Mir, Abdul Rouf; Habib, Safia; Alam, Khursheed; Ali, Asif

    2014-07-01

    Peroxynitrite (ONOO(-)), formed by the reaction between nitric oxide (NO) and superoxide (O2(-)), has been implicated in the etiology of numerous disease processes. Peroxynitrite interacts with DNA via direct oxidative reactions or via indirect radical-mediated mechanism. It can inflict both oxidative and nitrosative damages on DNA bases, generating abasic sites, resulting in the single strand breaks. Plasmid pUC 18 isolated from Escherichiacoli was modified with peroxynitrite, generated by quenched flow process. Modifications incurred in plasmid DNA were characterized by ultraviolet and fluorescence spectroscopy, circular dichroism, HPLC and melting temperature studies. Binding characteristics and specificity of antibodies from diabetes patients were analyzed by direct binding and inhibition ELISA. Peroxynitrite modification of pUC 18 plasmid resulted in the formation of strand breaks and base modification. The major compound formed when peroxynitrite reacted with DNA was 8-nitroguanine, a specific marker for peroxynitrite induced DNA damage in inflamed tissues. The concentration of 8-nitroguanine was found to be 3.8 μM. Sera from diabetes type 1 patients from different age groups were studied for their binding to native and peroxynitrite modified plasmid. Direct binding and competitive-inhibition ELISA results showed higher recognition of peroxynitrite modified plasmid, as compared to the native form, by auto-antibodies present in diabetes patients. The preferential recognition of modified plasmid by diabetes autoantibodies was further reiterated by gel shift assay. Experimentally induced anti-peroxynitrite-modified plasmid IgG was used as a probe to detect nitrosative lesions in the DNA isolated from diabetes patients. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Vsx2 Controls Eye Organogenesis and Retinal Progenitor Identity Via Homeodomain and Non-Homeodomain Residues Required for High Affinity DNA Binding

    PubMed Central

    Zou, Changjiang; Levine, Edward M.

    2012-01-01

    The homeodomain and adjacent CVC domain in the visual system homeobox (VSX) proteins are conserved from nematodes to humans. Humans with missense mutations in these regions of VSX2 have microphthalmia, suggesting both regions are critical for function. To assess this, we generated the corresponding mutations in mouse Vsx2. The homeodomain mutant protein lacked DNA binding activity and the knock-in mutant phenocopied the null mutant, ocular retardation J. The CVC mutant protein exhibited weakened DNA binding; and, although the corresponding knock-in allele was recessive, it unexpectedly caused the strongest phenotype, as indicated by severe microphthalmia and hyperpigmentation of the neural retina. This occurred through a cryptic transcriptional feedback loop involving the transcription factors Mitf and Otx1 and the Cdk inhibitor p27Kip1. Our data suggest that the phenotypic severity of the CVC mutant depends on the weakened DNA binding activity elicited by the CVC mutation and a previously unknown protein interaction between Vsx2 and its regulatory target Mitf. Our data also suggest that an essential function of the CVC domain is to assist the homeodomain in high-affinity DNA binding, which is required for eye organogenesis and unhindered execution of the retinal progenitor program in mammals. Finally, the genetic and phenotypic behaviors of the CVC mutation suggest it has the characteristics of a recessive neomorph, a rare type of genetic allele. PMID:23028343

  6. Functional interaction of proliferating cell nuclear antigen with MSH2-MSH6 and MSH2-MSH3 complexes.

    PubMed

    Clark, A B; Valle, F; Drotschmann, K; Gary, R K; Kunkel, T A

    2000-11-24

    Eukaryotic DNA mismatch repair requires the concerted action of several proteins, including proliferating cell nuclear antigen (PCNA) and heterodimers of MSH2 complexed with either MSH3 or MSH6. Here we report that MSH3 and MSH6, but not MSH2, contain N-terminal sequence motifs characteristic of proteins that bind to PCNA. MSH3 and MSH6 peptides containing these motifs bound PCNA, as did the intact Msh2-Msh6 complex. This binding was strongly reduced when alanine was substituted for conserved residues in the motif. Yeast strains containing alanine substitutions in the PCNA binding motif of Msh6 or Msh3 had elevated mutation rates, indicating that these interactions are important for genome stability. When human MSH3 or MSH6 peptides containing the PCNA binding motif were added to a human cell extract, mismatch repair activity was inhibited at a step preceding DNA resynthesis. Thus, MSH3 and MSH6 interactions with PCNA may facilitate early steps in DNA mismatch repair and may also be important for other roles of these eukaryotic MutS homologs.

  7. May the Best Molecule Win: Competition ESI Mass Spectrometry

    PubMed Central

    Laughlin, Sarah; Wilson, W. David

    2015-01-01

    Electrospray ionization mass spectrometry has become invaluable in the characterization of macromolecular biological systems such as nucleic acids and proteins. Recent advances in the field of mass spectrometry and the soft conditions characteristic of electrospray ionization allow for the investigation of non-covalent interactions among large biomolecules and ligands. Modulation of genetic processes through the use of small molecule inhibitors with the DNA minor groove is gaining attention as a potential therapeutic approach. In this review, we discuss the development of a competition method using electrospray ionization mass spectrometry to probe the interactions of multiple DNA sequences with libraries of minor groove binding molecules. Such an approach acts as a high-throughput screening method to determine important information including the stoichiometry, binding mode, cooperativity, and relative binding affinity. In addition to small molecule-DNA complexes, we highlight other applications in which competition mass spectrometry has been used. A competitive approach to simultaneously investigate complex interactions promises to be a powerful tool in the discovery of small molecule inhibitors with high specificity and for specific, important DNA sequences. PMID:26501262

  8. A conserved function for pericentromeric satellite DNA

    PubMed Central

    Jagannathan, Madhav; Cummings, Ryan

    2018-01-01

    A universal and unquestioned characteristic of eukaryotic cells is that the genome is divided into multiple chromosomes and encapsulated in a single nucleus. However, the underlying mechanism to ensure such a configuration is unknown. Here, we provide evidence that pericentromeric satellite DNA, which is often regarded as junk, is a critical constituent of the chromosome, allowing the packaging of all chromosomes into a single nucleus. We show that the multi-AT-hook satellite DNA-binding proteins, Drosophila melanogaster D1 and mouse HMGA1, play an evolutionarily conserved role in bundling pericentromeric satellite DNA from heterologous chromosomes into ‘chromocenters’, a cytological association of pericentromeric heterochromatin. Defective chromocenter formation leads to micronuclei formation due to budding from the interphase nucleus, DNA damage and cell death. We propose that chromocenter and satellite DNA serve a fundamental role in encapsulating the full complement of the genome within a single nucleus, the universal characteristic of eukaryotic cells. PMID:29578410

  9. Abnormal expression and functional characteristics of cyclic adenosine monophosphate response element binding protein in postmortem brain of suicide subjects.

    PubMed

    Dwivedi, Yogesh; Rao, Jagadeesh Sridhara; Rizavi, Hooriyah S; Kotowski, Jacek; Conley, Robert R; Roberts, Rosalinda C; Tamminga, Carol A; Pandey, Ghanshyam N

    2003-03-01

    Cyclic adenosine monophosphate response element binding protein (CREB) is a transcription factor that, on phosphorylation by protein kinases, is activated, and in response, regulates the transcription of many neuronally expressed genes. In view of the recent observations that catalytic properties and/or expression of many kinases that mediate their physiological responses through the activation of CREB are altered in the postmortem brain of subjects who commit suicide (hereafter referred to as suicide subjects), we examined the status of CREB in suicidal behavior. These studies were performed in Brodmann area (BA) 9 and hippocampus obtained from 26 suicide subjects and 20 nonpsychiatric healthy control subjects. Messenger RNA levels of CREB and neuron-specific enolase were determined in total RNA by means of quantitative reverse transcriptase-polymerase chain reaction. Protein levels and the functional characteristics of CREB were determined in nuclear fractions by means of Western blot and cyclic adenosine monophosphate response element (CRE)-DNA binding activity, respectively. In the same nuclear fraction, we determined the catalytic activity of cyclic adenosine monophosphate-stimulated protein kinase A by means of enzymatic assay. We observed a significant reduction in messenger RNA and protein levels of CREB, CRE-DNA binding activity, and basal and cyclic adenosine monophosphate-stimulated protein kinase A activity in BA 9 and hippocampus of suicide subjects, without any change in messenger RNA levels of neuron-specific enolase in BA 9. Except for protein kinase A activity, changes in CREB expression and CRE-DNA binding activity were present in all suicide subjects, irrespective of diagnosis. These changes were unrelated to postmortem intervals, age, sex, or antidepressant treatment. Given the significance of CREB in mediating various physiological functions through gene transcription, our results of decreased expression and functional characteristics of CREB in postmortem brain of suicide subjects suggest that CREB may play an important role in suicidal behavior.

  10. An immunoassay for the study of DNA-binding activities of herpes simplex virus protein ICP8.

    PubMed

    Lee, C K; Knipe, D M

    1985-06-01

    An immunoassay was used to examine the interaction between a herpes simplex virus protein, ICP8, and various types of DNA. The advantage of this assay is that the protein is not subjected to harsh purification procedures. We characterized the binding of ICP8 to both single-stranded (ss) and double-stranded (ds) DNA. ICP8 bound ss DNA fivefold more efficiently than ds DNA, and both binding activities were most efficient in 150 mM NaCl. Two lines of evidence indicate that the binding activities were not identical: (i) ds DNA failed to complete with ss DNA binding even with a large excess of ds DNA; (ii) Scatchard plots of DNA binding with various amounts of DNA were fundamentally different for ss DNA and ds DNA. However, the two activities were related in that ss DNA efficiently competed with the binding of ds DNA. We conclude that the ds DNA-binding activity of ICP8 is probably distinct from the ss DNA-binding activity. No evidence for sequence-specific ds DNA binding was obtained for either the entire herpes simplex virus genome or cloned viral sequences.

  11. Analysis of cis and trans Requirements for DNA Replication at the Right-End Hairpin of the Human Bocavirus 1 Genome

    PubMed Central

    Shen, Weiran; Deng, Xuefeng; Zou, Wei; Engelhardt, John F.; Yan, Ziying

    2016-01-01

    ABSTRACT Parvoviruses are single-stranded DNA viruses that use the palindromic structures at the ends of the viral genome for their replication. The mechanism of parvovirus replication has been studied mostly in the dependoparvovirus adeno-associated virus 2 (AAV2) and the protoparvovirus minute virus of mice (MVM). Here, we used human bocavirus 1 (HBoV1) to understand the replication mechanism of bocaparvovirus. HBoV1 is pathogenic to humans, causing acute respiratory tract infections, especially in young children under 2 years old. By using the duplex replicative form of the HBoV1 genome in human embryonic kidney 293 (HEK293) cells, we identified the HBoV1 minimal replication origin at the right-end hairpin (OriR). Mutagenesis analyses confirmed the putative NS1 binding and nicking sites within the OriR. Of note, unlike the large nonstructural protein (Rep78/68 or NS1) of other parvoviruses, HBoV1 NS1 did not specifically bind OriR in vitro, indicating that other viral and cellular components or the oligomerization of NS1 is required for NS1 binding to the OriR. In vivo studies demonstrated that residues responsible for NS1 binding and nicking are within the origin-binding domain. Further analysis identified that the small nonstructural protein NP1 is required for HBoV1 DNA replication at OriR. NP1 and other viral nonstructural proteins (NS1 to NS4) colocalized within the viral DNA replication centers in both OriR-transfected cells and virus-infected cells, highlighting a direct involvement of NP1 in viral DNA replication at OriR. Overall, our study revealed the characteristics of HBoV1 DNA replication at OriR, suggesting novel characteristics of autonomous parvovirus DNA replication. IMPORTANCE Human bocavirus 1 (HBoV1) causes acute respiratory tract infections in young children. The duplex HBoV1 genome replicates in HEK293 cells and produces progeny virions that are infectious in well-differentiated airway epithelial cells. A recombinant AAV2 vector pseudotyped with an HBoV1 capsid has been developed to efficiently deliver the cystic fibrosis transmembrane conductance regulator gene to human airway epithelia. Here, we identified both cis-acting elements and trans-acting proteins that are required for HBoV1 DNA replication at the right-end hairpin in HEK293 cells. We localized the minimal replication origin, which contains both NS1 nicking and binding sites, to a 46-nucleotide sequence in the right-end hairpin. The identification of these essential elements of HBoV1 DNA replication acting both in cis and in trans will provide guidance to develop antiviral strategies targeting viral DNA replication at the right-end hairpin and to design next-generation recombinant HBoV1 vectors, a promising tool for gene therapy of lung diseases. PMID:27334591

  12. Analysis of cis and trans Requirements for DNA Replication at the Right-End Hairpin of the Human Bocavirus 1 Genome.

    PubMed

    Shen, Weiran; Deng, Xuefeng; Zou, Wei; Engelhardt, John F; Yan, Ziying; Qiu, Jianming

    2016-09-01

    Parvoviruses are single-stranded DNA viruses that use the palindromic structures at the ends of the viral genome for their replication. The mechanism of parvovirus replication has been studied mostly in the dependoparvovirus adeno-associated virus 2 (AAV2) and the protoparvovirus minute virus of mice (MVM). Here, we used human bocavirus 1 (HBoV1) to understand the replication mechanism of bocaparvovirus. HBoV1 is pathogenic to humans, causing acute respiratory tract infections, especially in young children under 2 years old. By using the duplex replicative form of the HBoV1 genome in human embryonic kidney 293 (HEK293) cells, we identified the HBoV1 minimal replication origin at the right-end hairpin (OriR). Mutagenesis analyses confirmed the putative NS1 binding and nicking sites within the OriR. Of note, unlike the large nonstructural protein (Rep78/68 or NS1) of other parvoviruses, HBoV1 NS1 did not specifically bind OriR in vitro, indicating that other viral and cellular components or the oligomerization of NS1 is required for NS1 binding to the OriR. In vivo studies demonstrated that residues responsible for NS1 binding and nicking are within the origin-binding domain. Further analysis identified that the small nonstructural protein NP1 is required for HBoV1 DNA replication at OriR. NP1 and other viral nonstructural proteins (NS1 to NS4) colocalized within the viral DNA replication centers in both OriR-transfected cells and virus-infected cells, highlighting a direct involvement of NP1 in viral DNA replication at OriR. Overall, our study revealed the characteristics of HBoV1 DNA replication at OriR, suggesting novel characteristics of autonomous parvovirus DNA replication. Human bocavirus 1 (HBoV1) causes acute respiratory tract infections in young children. The duplex HBoV1 genome replicates in HEK293 cells and produces progeny virions that are infectious in well-differentiated airway epithelial cells. A recombinant AAV2 vector pseudotyped with an HBoV1 capsid has been developed to efficiently deliver the cystic fibrosis transmembrane conductance regulator gene to human airway epithelia. Here, we identified both cis-acting elements and trans-acting proteins that are required for HBoV1 DNA replication at the right-end hairpin in HEK293 cells. We localized the minimal replication origin, which contains both NS1 nicking and binding sites, to a 46-nucleotide sequence in the right-end hairpin. The identification of these essential elements of HBoV1 DNA replication acting both in cis and in trans will provide guidance to develop antiviral strategies targeting viral DNA replication at the right-end hairpin and to design next-generation recombinant HBoV1 vectors, a promising tool for gene therapy of lung diseases. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  13. All-atomic simulations on human telomeric G-quadruplex DNA binding with thioflavin T.

    PubMed

    Luo, Di; Mu, Yuguang

    2015-04-16

    Ligand-stabilized human telomeric G-quadruplex DNA is believed to be an anticancer agent, as it can impede the continuous elongation of telomeres by telomerase in cancer cells. In this study, five well-established human telomeric G-quadruplex DNA models were probed on their binding behaviors with thioflavin T (ThT) via both conventional molecular dynamics (MD) and well-tempered metadynamics (WT-MetaD) simulations. Novel dynamics and characteristic binding patterns were disclosed by the MD simulations. It was observed that the K(+) promoted parallel and hybridized human telomeric G-quadruplex conformations pose higher binding affinities to ThT than the Na(+) and K(+) promoted basket conformations. It is the end, sandwich, and base stacking driven by π-π interactions that are identified as the major binding mechanisms. As the most energy favorable binding mode, the sandwich stacking observed in (3 + 1) hybridized form 1 G-quadruplex conformation is triggered by reversible conformational change of the G-quadruplex. To further examine the free energy landscapes, WT-MetaD simulations were utilized on G-quadruplex-ThT systems. It is found that all of the major binding modes predicted by the MD simulations are confirmed by the WT-MetaD simulations. The results in this work not only accord with existing experimental findings, but also reinforce our understanding on the dynamics of G-quadruplexes and aid future drug developments for G-quadruplex stabilization ligands.

  14. Binding of anticancer drug daunomycin to a TGGGGT G-quadruplex DNA probed by all-atom molecular dynamics simulations: additional pure groove binding mode and implications on designing more selective G-quadruplex ligands.

    PubMed

    Shen, Zhanhang; Mulholland, Kelly A; Zheng, Yujun; Wu, Chun

    2017-09-01

    DNA G-quadruplex structures are emerging cancer-specific targets for chemotherapeutics. Ligands that bind to and stabilize DNA G-quadruplexes have the potential to be anti-cancer drugs. Lack of binding selectivity to DNA G-quadruplex over DNA duplex remains a major challenge when attempting to develop G-quadruplex ligands into successful anti-cancer drugs. Thorough understanding of the binding nature of existing non-selective ligands that bind to both DNA quadruplex and DNA duplex will help to address this challenge. Daunomycin and doxorubicin, two commonly used anticancer drugs, are examples of non-selective DNA ligands. In this study, we extended our early all-atom binding simulation studies between doxorubicin and a DNA duplex (d(CGATCG) 2 ) to probe the binding between daunomycin and a parallel DNA quadruplex (d(TGGGGT) 4 ) and DNA duplex. In addition to the end stacking mode, which mimics the mode in the crystal structure, a pure groove binding mode was observed in our free binding simulations. The dynamic and energetic properties of these two binding modes are thoroughly examined, and a detailed comparison is made between DNA quadruplex binding modes and DNA duplex binding modes. Implications on the design of more selective DNA quadruplex ligands are also discussed. Graphical abstract Top stacking and groov binding modes from the MD simulations.

  15. Salmonella typhimurium PtsJ is a novel MocR-like transcriptional repressor involved in regulating the vitamin B6 salvage pathway.

    PubMed

    Tramonti, Angela; Milano, Teresa; Nardella, Caterina; di Salvo, Martino L; Pascarella, Stefano; Contestabile, Roberto

    2017-02-01

    The vitamin B 6 salvage pathway, involving pyridoxine 5'-phosphate oxidase (PNPOx) and pyridoxal kinase (PLK), recycles B 6 vitamers from nutrients and protein turnover to produce pyridoxal 5'-phosphate (PLP), the catalytically active form of the vitamin. Regulation of this pathway, widespread in living organisms including humans and many bacteria, is very important to vitamin B 6 homeostasis but poorly understood. Although some information is available on the enzymatic regulation of PNPOx and PLK, little is known on their regulation at the transcriptional level. In the present work, we identified a new MocR-like regulator, PtsJ from Salmonella typhimurium, which controls the expression of the pdxK gene encoding one of the two PLKs expressed in this organism (PLK1). Analysis of pdxK expression in a ptsJ knockout strain demonstrated that PtsJ acts as a transcriptional repressor. This is the first case of a MocR-like regulator acting as repressor of its target gene. Expression and purification of PtsJ allowed a detailed characterisation of its effector and DNA-binding properties. PLP is the only B 6 vitamer acting as effector molecule for PtsJ. A DNA-binding region composed of four repeated nucleotide sequences is responsible for binding of PtsJ to its target promoter. Analysis of binding stoichiometry revealed that protein subunits/DNA molar ratio varies from 4 : 1 to 2 : 1, depending on the presence or absence of PLP. Structural characteristics of DNA transcriptional factor-binding sites suggest that PtsJ binds DNA according to a different model with respect to other characterised members of the MocR subgroup. © 2016 Federation of European Biochemical Societies.

  16. The functional landscape bound to the transcription factors of Escherichia coli K-12.

    PubMed

    Pérez-Rueda, Ernesto; Tenorio-Salgado, Silvia; Huerta-Saquero, Alejandro; Balderas-Martínez, Yalbi I; Moreno-Hagelsieb, Gabriel

    2015-10-01

    Motivated by the experimental evidences accumulated in the last ten years and based on information deposited in RegulonDB, literature look up, and sequence analysis, we analyze the repertoire of 304 DNA-binding Transcription factors (TFs) in Escherichia coli K-12. These regulators were grouped in 78 evolutionary families and are regulating almost half of the total genes in this bacterium. In structural terms, 60% of TFs are composed by two-domains, 30% are monodomain, and 10% three- and four-structural domains. As previously noticed, the most abundant DNA-binding domain corresponds to the winged helix-turn-helix, with few alternative DNA-binding structures, resembling the hypothesis of successful protein structures with the emergence of new ones at low scales. In summary, we identified and described the characteristics associated to the DNA-binding TF in E. coli K-12. We also identified twelve functional modules based on a co-regulated gene matrix. Finally, diverse regulons were predicted based on direct associations between the TFs and potential regulated genes. This analysis should increase our knowledge about the gene regulation in the bacterium E. coli K-12, and provide more additional clues for comprehensive modelling of transcriptional regulatory networks in other bacteria. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. iDBPs: a web server for the identification of DNA binding proteins

    PubMed Central

    Nimrod, Guy; Schushan, Maya; Szilágyi, András; Leslie, Christina; Ben-Tal, Nir

    2010-01-01

    Summary: The iDBPs server uses the three-dimensional (3D) structure of a query protein to predict whether it binds DNA. First, the algorithm predicts the functional region of the protein based on its evolutionary profile; the assumption is that large clusters of conserved residues are good markers of functional regions. Next, various characteristics of the predicted functional region as well as global features of the protein are calculated, such as the average surface electrostatic potential, the dipole moment and cluster-based amino acid conservation patterns. Finally, a random forests classifier is used to predict whether the query protein is likely to bind DNA and to estimate the prediction confidence. We have trained and tested the classifier on various datasets and shown that it outperformed related methods. On a dataset that reflects the fraction of DNA binding proteins (DBPs) in a proteome, the area under the ROC curve was 0.90. The application of the server to an updated version of the N-Func database, which contains proteins of unknown function with solved 3D-structure, suggested new putative DBPs for experimental studies. Availability: http://idbps.tau.ac.il/ Contact: NirB@tauex.tau.ac.il Supplementary information: Supplementary data are available at Bioinformatics online. PMID:20089514

  18. Cations Form Sequence Selective Motifs within DNA Grooves via a Combination of Cation-Pi and Ion-Dipole/Hydrogen Bond Interactions

    PubMed Central

    Stewart, Mikaela; Dunlap, Tori; Dourlain, Elizabeth; Grant, Bryce; McFail-Isom, Lori

    2013-01-01

    The fine conformational subtleties of DNA structure modulate many fundamental cellular processes including gene activation/repression, cellular division, and DNA repair. Most of these cellular processes rely on the conformational heterogeneity of specific DNA sequences. Factors including those structural characteristics inherent in the particular base sequence as well as those induced through interaction with solvent components combine to produce fine DNA structural variation including helical flexibility and conformation. Cation-pi interactions between solvent cations or their first hydration shell waters and the faces of DNA bases form sequence selectively and contribute to DNA structural heterogeneity. In this paper, we detect and characterize the binding patterns found in cation-pi interactions between solvent cations and DNA bases in a set of high resolution x-ray crystal structures. Specifically, we found that monovalent cations (Tl+) and the polarized first hydration shell waters of divalent cations (Mg2+, Ca2+) form cation-pi interactions with DNA bases stabilizing unstacked conformations. When these cation-pi interactions are combined with electrostatic interactions a pattern of specific binding motifs is formed within the grooves. PMID:23940752

  19. Cations form sequence selective motifs within DNA grooves via a combination of cation-pi and ion-dipole/hydrogen bond interactions.

    PubMed

    Stewart, Mikaela; Dunlap, Tori; Dourlain, Elizabeth; Grant, Bryce; McFail-Isom, Lori

    2013-01-01

    The fine conformational subtleties of DNA structure modulate many fundamental cellular processes including gene activation/repression, cellular division, and DNA repair. Most of these cellular processes rely on the conformational heterogeneity of specific DNA sequences. Factors including those structural characteristics inherent in the particular base sequence as well as those induced through interaction with solvent components combine to produce fine DNA structural variation including helical flexibility and conformation. Cation-pi interactions between solvent cations or their first hydration shell waters and the faces of DNA bases form sequence selectively and contribute to DNA structural heterogeneity. In this paper, we detect and characterize the binding patterns found in cation-pi interactions between solvent cations and DNA bases in a set of high resolution x-ray crystal structures. Specifically, we found that monovalent cations (Tl⁺) and the polarized first hydration shell waters of divalent cations (Mg²⁺, Ca²⁺) form cation-pi interactions with DNA bases stabilizing unstacked conformations. When these cation-pi interactions are combined with electrostatic interactions a pattern of specific binding motifs is formed within the grooves.

  20. Assessment of amsacrine binding with DNA using UV-visible, circular dichroism and Raman spectroscopic techniques.

    PubMed

    Jangir, Deepak Kumar; Dey, Sanjay Kumar; Kundu, Suman; Mehrotra, Ranjana

    2012-09-03

    Proper understanding of the mechanism of binding of drugs to their targets in cell is a fundamental requirement to develop new drug therapy regimen. Amsacrine is a rationally designed anticancer drug, used to treat leukemia and lymphoma. Binding with cellular DNA is a crucial step in its mechanism of cytotoxicity. Despite numerous studies, DNA binding properties of amsacrine are poorly understood. Its reversible binding with DNA does not permit X-ray crystallography or NMR spectroscopic evaluation of amsacrine-DNA complexes. In the present work, interaction of amsacrine with calf thymus DNA is investigated at physiological conditions. UV-visible, FT-Raman and circular dichroism spectroscopic techniques were employed to determine the binding mode, binding constant, sequence specificity and conformational effects of amsacrine binding to native calf thymus DNA. Our results illustrate that amsacrine interacts with DNA by and large through intercalation between base pairs. Binding constant of the amsacrine-DNA complex was found to be K=1.2±0.1×10(4) M(-1) which is indicative of moderate type of binding of amsacrine to DNA. Raman spectroscopic results suggest that amsacrine has a binding preference of intercalation between AT base pairs of DNA. Minor groove binding is also observed in amsacrine-DNA complexes. These results are in good agreement with in silico investigation of amsacrine binding to DNA and thus provide detailed insight into DNA binding properties of amsacrine, which could ultimately, renders its cytotoxic efficacy. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. Methylation effect on the ohmic resistance of a poly-GC DNA-like chain

    NASA Astrophysics Data System (ADS)

    de Moura, F. A. B. F.; Lyra, M. L.; de Almeida, M. L.; Ourique, G. S.; Fulco, U. L.; Albuquerque, E. L.

    2016-10-01

    We determine, by using a tight-binding model Hamiltonian, the characteristic current-voltage (IxV) curves of a 5-methylated cytosine single strand poly-GC DNA-like finite segment, considering the methyl groups attached laterally to a random fraction of the cytosine basis. Striking, we found that the methylation significantly impacts the ohmic resistance (R) of the DNA-like segments, indicating that measurements of R can be used as a biosensor tool to probe the presence of anomalous methylation.

  2. Single-stranded DNA Binding by the Helix-Hairpin-Helix Domain of XPF Protein Contributes to the Substrate Specificity of the ERCC1-XPF Protein Complex*

    PubMed Central

    Das, Devashish; Faridounnia, Maryam; Kovacic, Lidija; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.

    2017-01-01

    The nucleotide excision repair protein complex ERCC1-XPF is required for incision of DNA upstream of DNA damage. Functional studies have provided insights into the binding of ERCC1-XPF to various DNA substrates. However, because no structure for the ERCC1-XPF-DNA complex has been determined, the mechanism of substrate recognition remains elusive. Here we biochemically characterize the substrate preferences of the helix-hairpin-helix (HhH) domains of XPF and ERCC-XPF and show that the binding to single-stranded DNA (ssDNA)/dsDNA junctions is dependent on joint binding to the DNA binding domain of ERCC1 and XPF. We reveal that the homodimeric XPF is able to bind various ssDNA sequences but with a clear preference for guanine-containing substrates. NMR titration experiments and in vitro DNA binding assays also show that, within the heterodimeric ERCC1-XPF complex, XPF specifically recognizes ssDNA. On the other hand, the HhH domain of ERCC1 preferentially binds dsDNA through the hairpin region. The two separate non-overlapping DNA binding domains in the ERCC1-XPF heterodimer jointly bind to an ssDNA/dsDNA substrate and, thereby, at least partially dictate the incision position during damage removal. Based on structural models, NMR titrations, DNA-binding studies, site-directed mutagenesis, charge distribution, and sequence conservation, we propose that the HhH domain of ERCC1 binds to dsDNA upstream of the damage, and XPF binds to the non-damaged strand within a repair bubble. PMID:28028171

  3. Purification and general properties of the DNA-binding protein (P16) from rat liver mitochondria.

    PubMed

    Pavco, P A; Van Tuyle, G C

    1985-01-01

    The mitochondrial DNA-binding protein P16 was isolated from rat liver mitochondrial lysates by affinity chromatography on single strand DNA agarose and separated from DNA in the preparation by alkaline CsCl isopycnic gradients. The top fraction of the gradients contained a single polypeptide species (Mr approximately equal to 15,200) based upon SDS PAGE. Digestion of single strand DNA-bound P16 with proteinase K produced a protease-insensitive, DNA-binding fragment (Mr approximately equal to 6,000) that has been purified by essentially the same procedures used for intact P16. The partial amino acid compositions for P16 and the DNA-binding fragment were obtained by conventional methods. Analysis of subcellular fractions revealed that nearly all of the cellular P16 was located in the mitochondria and that only trace amounts of protein of comparable electrophoretic mobility could be isolated from the nuclear or cytoplasmic fractions. The labeling of P16 with [35S]methionine in primary rat hepatocyte cultures was inhibited by more than 90% by the cytoplasmic translation inhibitor cycloheximide, but unaffected by the mitochondrial-specific agent chloramphenicol. These results indicate that P16 is synthesized on cytoplasmic ribosomes and imported into the mitochondria. The addition of purified P16 to deproteinized mitochondrial DNA resulted in the complete protection of the labeled nascent strands of displacement loops against branch migrational loss during cleavage of parental DNA with SstI, thus providing strong evidence that P16 is the single entity required for this in vitro function. Incubation of P16 with single strand phi X174 DNA, double strand (RF) phi X174 DNA, or Escherichia coli ribosomal RNA and subsequent analysis of the nucleic acid species for bound protein indicated a strong preference of P16 for single strand DNA and no detectable affinity for RNA or double strand DNA. Examination of P16-single strand phi X174 DNA complexes by direct electron microscopy revealed thickened, irregular fibers characteristic of protein-associated single strand DNA.

  4. Release of specific proteins from nuclei of HL-60 and MOLT-4 cells by antitumor drugs having affinity to nucleic acids.

    PubMed

    Lassota, P; Melamed, M R; Darzynkiewicz, Z

    The binding sites for mitoxantrone (MIT), Ametantrone (AMT), doxorubicin (DOX), actinomycin D (AMD) and ethidium bromide (EB) in nuclei from exponentially growing and differentiating human promyelocytic HL-60 and lymphocytic leukemic MOLT-4 cells were studied by gel electrophoresis of proteins selectively released during titration of these nuclei with the drugs. Each drug at different drug: DNA binding ratios resulted in a characteristic pattern of protein elution and/or retention. For example, in nuclei from exponentially growing HL-60 cells, MIT affected 44 nuclear proteins that were different from those affected by EB; of these 29 were progressively released at increasing MIT:DNA ratios, 11 were transiently released (i.e. only at a low MIT:DNA ratio) and 4 entrapped. Patterns of proteins displaced from nuclei of exponentially growing HL-60 cells differed from those of cells undergoing myeloid differentiation as well as from those of exponentially growing MOLT-4 cells. The first effects were seen at a binding density of approximately one drug molecule per 10-50 base pairs of DNA. The observed selective displacement of proteins may reflect drug-altered affinity of the binding sites for those proteins, for example due to a change of nucleic acid or protein conformation upon binding the ligand. The data show that the binding site(s) for each of the ligands studied is different and the differences correlate with variability in chemical structure between the ligands. The nature of the drug-affected proteins may provide clues regarding antitumor or cytotoxic mechanisms of drug action.

  5. Crystal Structure of the Chromodomain Helicase DNA-binding Protein 1 (Chd1) DNA-binding Domain in Complex with DNA*

    PubMed Central

    Sharma, Amit; Jenkins, Katherine R.; Héroux, Annie; Bowman, Gregory D.

    2011-01-01

    Chromatin remodelers are ATP-dependent machines that dynamically alter the chromatin packaging of eukaryotic genomes by assembling, sliding, and displacing nucleosomes. The Chd1 chromatin remodeler possesses a C-terminal DNA-binding domain that is required for efficient nucleosome sliding and believed to be essential for sensing the length of DNA flanking the nucleosome core. The structure of the Chd1 DNA-binding domain was recently shown to consist of a SANT and SLIDE domain, analogous to the DNA-binding domain of the ISWI family, yet the details of how Chd1 recognized DNA were not known. Here we present the crystal structure of the Saccharomyces cerevisiae Chd1 DNA-binding domain in complex with a DNA duplex. The bound DNA duplex is straight, consistent with the preference exhibited by the Chd1 DNA-binding domain for extranucleosomal DNA. Comparison of this structure with the recently solved ISW1a DNA-binding domain bound to DNA reveals that DNA lays across each protein at a distinct angle, yet contacts similar surfaces on the SANT and SLIDE domains. In contrast to the minor groove binding seen for Isw1 and predicted for Chd1, the SLIDE domain of the Chd1 DNA-binding domain contacts the DNA major groove. The majority of direct contacts with the phosphate backbone occur only on one DNA strand, suggesting that Chd1 may not strongly discriminate between major and minor grooves. PMID:22033927

  6. Characterization of the DNA binding properties of polyomavirus capsid protein

    NASA Technical Reports Server (NTRS)

    Chang, D.; Cai, X.; Consigli, R. A.; Spooner, B. S. (Principal Investigator)

    1993-01-01

    The DNA binding properties of the polyomavirus structural proteins VP1, VP2, and VP3 were studied by Southwestern analysis. The major viral structural protein VP1 and host-contributed histone proteins of polyomavirus virions were shown to exhibit DNA binding activity, but the minor capsid proteins VP2 and VP3 failed to bind DNA. The N-terminal first five amino acids (Ala-1 to Lys-5) were identified as the VP1 DNA binding domain by genetic and biochemical approaches. Wild-type VP1 expressed in Escherichia coli (RK1448) exhibited DNA binding activity, but the N-terminal truncated VP1 mutants (lacking Ala-1 to Lys-5 and Ala-1 to Cys-11) failed to bind DNA. The synthetic peptide (Ala-1 to Cys-11) was also shown to have an affinity for DNA binding. Site-directed mutagenesis of the VP1 gene showed that the point mutations at Pro-2, Lys-3, and Arg-4 on the VP1 molecule did not affect DNA binding properties but that the point mutation at Lys-5 drastically reduced DNA binding affinity. The N-terminal (Ala-1 to Lys-5) region of VP1 was found to be essential and specific for DNA binding, while the DNA appears to be non-sequence specific. The DNA binding domain and the nuclear localization signal are located in the same N-terminal region.

  7. Quantitative characterization of conformational-specific protein-DNA binding using a dual-spectral interferometric imaging biosensor

    NASA Astrophysics Data System (ADS)

    Zhang, Xirui; Daaboul, George G.; Spuhler, Philipp S.; Dröge, Peter; Ünlü, M. Selim

    2016-03-01

    DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are not fully understood. Recently, it was discovered that DNA-binding proteins recognize specific binding sites to carry out their functions through an indirect readout mechanism by recognizing and capturing DNA conformational flexibility and deformation. High-throughput DNA microarray-based methods that provide large-scale protein-DNA binding information have shown effective and comprehensive analysis of protein-DNA binding affinities, but do not provide information of DNA conformational changes in specific protein-DNA complexes. Building on the high-throughput capability of DNA microarrays, we demonstrate a quantitative approach that simultaneously measures the amount of protein binding to DNA and nanometer-scale DNA conformational change induced by protein binding in a microarray format. Both measurements rely on spectral interferometry on a layered substrate using a single optical instrument in two distinct modalities. In the first modality, we quantitate the amount of binding of protein to surface-immobilized DNA in each DNA spot using a label-free spectral reflectivity technique that accurately measures the surface densities of protein and DNA accumulated on the substrate. In the second modality, for each DNA spot, we simultaneously measure DNA conformational change using a fluorescence vertical sectioning technique that determines average axial height of fluorophores tagged to specific nucleotides of the surface-immobilized DNA. The approach presented in this paper, when combined with current high-throughput DNA microarray-based technologies, has the potential to serve as a rapid and simple method for quantitative and large-scale characterization of conformational specific protein-DNA interactions.DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are not fully understood. Recently, it was discovered that DNA-binding proteins recognize specific binding sites to carry out their functions through an indirect readout mechanism by recognizing and capturing DNA conformational flexibility and deformation. High-throughput DNA microarray-based methods that provide large-scale protein-DNA binding information have shown effective and comprehensive analysis of protein-DNA binding affinities, but do not provide information of DNA conformational changes in specific protein-DNA complexes. Building on the high-throughput capability of DNA microarrays, we demonstrate a quantitative approach that simultaneously measures the amount of protein binding to DNA and nanometer-scale DNA conformational change induced by protein binding in a microarray format. Both measurements rely on spectral interferometry on a layered substrate using a single optical instrument in two distinct modalities. In the first modality, we quantitate the amount of binding of protein to surface-immobilized DNA in each DNA spot using a label-free spectral reflectivity technique that accurately measures the surface densities of protein and DNA accumulated on the substrate. In the second modality, for each DNA spot, we simultaneously measure DNA conformational change using a fluorescence vertical sectioning technique that determines average axial height of fluorophores tagged to specific nucleotides of the surface-immobilized DNA. The approach presented in this paper, when combined with current high-throughput DNA microarray-based technologies, has the potential to serve as a rapid and simple method for quantitative and large-scale characterization of conformational specific protein-DNA interactions. Electronic supplementary information (ESI) available: DNA sequences and nomenclature (Table 1S); SDS-PAGE assay of IHF stock solution (Fig. 1S); determination of the concentration of IHF stock solution by Bradford assay (Fig. 2S); equilibrium binding isotherm fitting results of other DNA sequences (Table 2S); calculation of dissociation constants (Fig. 3S, 4S; Table 2S); geometric model for quantitation of DNA bending angle induced by specific IHF binding (Fig. 4S); customized flow cell assembly (Fig. 5S); real-time measurement of average fluorophore height change by SSFM (Fig. 6S); summary of binding parameters obtained from additive isotherm model fitting (Table 3S); average surface densities of 10 dsDNA spots and bound IHF at equilibrium (Table 4S); effects of surface densities on the binding and bending of dsDNA (Tables 5S, 6S and Fig. 7S-10S). See DOI: 10.1039/c5nr06785e

  8. Conserved RNA binding activity of a Yin-Yang 1 homologue in the ova of the purple sea urchin Strongylocentrotus purpuratus.

    PubMed

    Belak, Zachery R; Ovsenek, Nicholas; Eskiw, Christopher H

    2018-05-23

    Yin-Yang 1 (YY1) is a highly conserved transcription factor possessing RNA-binding activity. A putative YY1 homologue was previously identified in the developmental model organism Strongylocentrotus purpuratus (the purple sea urchin) by genomic sequencing. We identified a high degree of sequence similarity with YY1 homologues of vertebrate origin which shared 100% protein sequence identity over the DNA- and RNA-binding zinc-finger region with high similarity in the N-terminal transcriptional activation domain. SpYY1 demonstrated identical DNA- and RNA-binding characteristics between Xenopus laevis and S. purpuratus indicating that it maintains similar functional and biochemical properties across widely divergent deuterostome species. SpYY1 binds to the consensus YY1 DNA element, and also to U-rich RNA sequences. Although we detected SpYY1 RNA-binding activity in ova lysates and observed cytoplasmic localization, SpYY1 was not associated with maternal mRNA in ova. SpYY1 expressed in Xenopus oocytes was excluded from the nucleus and associated with maternally expressed cytoplasmic mRNA molecules. These data demonstrate the existence of an YY1 homologue in S. purpuratus with similar structural and biochemical features to those of the well-studied vertebrate YY1; however, the data reveal major differences in the biological role of YY1 in the regulation of maternally expressed mRNA in the two species.

  9. Novel DNA packaging recognition in the unusual bacteriophage N15

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Feiss, Michael; Geyer, Henriette, E-mail: henriettegeyer@gmail.com; Division of Viral Infections, Robert Koch Institute, Berlin

    Phage lambda's cosB packaging recognition site is tripartite, consisting of 3 TerS binding sites, called R sequences. TerS binding to the critical R3 site positions the TerL endonuclease for nicking cosN to generate cohesive ends. The N15 cos (cos{sup N15}) is closely related to cos{sup λ}, but whereas the cosB{sup N15} subsite has R3, it lacks the R2 and R1 sites and the IHF binding site of cosB{sup λ}. A bioinformatic study of N15-like phages indicates that cosB{sup N15} also has an accessory, remote rR2 site, which is proposed to increase packaging efficiency, like R2 and R1 of lambda. N15more » plus five prophages all have the rR2 sequence, which is located in the TerS-encoding 1 gene, approximately 200 bp distal to R3. An additional set of four highly related prophages, exemplified by Monarch, has R3 sequence, but also has R2 and R1 sequences characteristic of cosB–λ. The DNA binding domain of TerS-N15 is a dimer. - Highlights: • There are two classes of DNA packaging signals in N15-related phages. • Phage N15's TerS binding site: a critical site and a possible remote accessory site. • Viral DNA recognition signals by the λ-like bacteriophages: the odd case of N15.« less

  10. The ATPase domain of the large terminase protein, gp17, from bacteriophage T4 binds DNA: implications to the DNA packaging mechanism.

    PubMed

    Alam, Tanfis I; Rao, Venigalla B

    2008-03-07

    Translocation of double-stranded DNA into a preformed capsid by tailed bacteriophages is driven by powerful motors assembled at the special portal vertex. The motor is thought to drive processive cycles of DNA binding, movement, and release to package the viral genome. In phage T4, there is evidence that the large terminase protein, gene product 17 (gp17), assembles into a multisubunit motor and translocates DNA by an inchworm mechanism. gp17 consists of two domains; an N-terminal ATPase domain (amino acids 1-360) that powers translocation of DNA, and a C-terminal nuclease domain (amino acids 361-610) that cuts concatemeric DNA to generate a headful-size viral genome. While the functional motifs of ATPase and nuclease have been well defined and the ATPase atomic structure has been solved, the DNA binding motif(s) responsible for viral DNA recognition, cutting, and translocation are unknown. Here we report the first evidence for the presence of a double-stranded DNA binding activity in the gp17 ATPase domain. Binding to DNA is sensitive to Mg(2+) and salt, but not the type of DNA used. DNA fragments as short as 20 bp can bind to the ATPase but preferential binding was observed to DNA greater than 1 kb. A high molecular weight ATPase-DNA complex was isolated by gel filtration, suggesting oligomerization of ATPase following DNA interaction. DNA binding was not observed with the full-length gp17, or the C-terminal nuclease domain. The small terminase protein, gp16, inhibited DNA binding, which was further accentuated by ATP. The presence of a DNA binding site in the ATPase domain and its binding properties implicate a role in the DNA packaging mechanism.

  11. Dynamic binding of replication protein a is required for DNA repair

    PubMed Central

    Chen, Ran; Subramanyam, Shyamal; Elcock, Adrian H.; Spies, Maria; Wold, Marc S.

    2016-01-01

    Replication protein A (RPA), the major eukaryotic single-stranded DNA (ssDNA) binding protein, is essential for replication, repair and recombination. High-affinity ssDNA-binding by RPA depends on two DNA binding domains in the large subunit of RPA. Mutation of the evolutionarily conserved aromatic residues in these two domains results in a separation-of-function phenotype: aromatic residue mutants support DNA replication but are defective in DNA repair. We used biochemical and single-molecule analyses, and Brownian Dynamics simulations to determine the molecular basis of this phenotype. Our studies demonstrated that RPA binds to ssDNA in at least two modes characterized by different dissociation kinetics. We also showed that the aromatic residues contribute to the formation of the longer-lived state, are required for stable binding to short ssDNA regions and are needed for RPA melting of partially duplex DNA structures. We conclude that stable binding and/or the melting of secondary DNA structures by RPA is required for DNA repair, including RAD51 mediated DNA strand exchange, but is dispensable for DNA replication. It is likely that the binding modes are in equilibrium and reflect dynamics in the RPA–DNA complex. This suggests that dynamic binding of RPA to DNA is necessary for different cellular functions. PMID:27131385

  12. The substrate binding interface of alkylpurine DNA glycosylase AlkD.

    PubMed

    Mullins, Elwood A; Rubinson, Emily H; Eichman, Brandt F

    2014-01-01

    Tandem helical repeats have emerged as an important DNA binding architecture. DNA glycosylase AlkD, which excises N3- and N7-alkylated nucleobases, uses repeating helical motifs to bind duplex DNA and to selectively pause at non-Watson-Crick base pairs. Remodeling of the DNA backbone promotes nucleotide flipping of the lesion and the complementary base into the solvent and toward the protein surface, respectively. The important features of this new DNA binding architecture that allow AlkD to distinguish between damaged and normal DNA without contacting the lesion are poorly understood. Here, we show through extensive mutational analysis that DNA binding and N3-methyladenine (3mA) and N7-methylguanine (7mG) excision are dependent upon each residue lining the DNA binding interface. Disrupting electrostatic or hydrophobic interactions with the DNA backbone substantially reduced binding affinity and catalytic activity. These results demonstrate that residues seemingly only involved in general DNA binding are important for catalytic activity and imply that base excision is driven by binding energy provided by the entire substrate interface of this novel DNA binding architecture. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. Stoichiometry of DNA binding by the bacteriophage SP01-encoded type II DNA-binding protein TF1.

    PubMed

    Schneider, G J; Geiduschek, E P

    1990-06-25

    The stoichiometry of DNA binding by the bacteriophage SP01-encoded type II DNA-binding protein TF1 has been determined. 3H-Labeled TF1 was allowed to bind to a 32P-labeled DNA fragment containing a TF1 binding site. Multiple TF1-DNA complexes were resolved from each other and from unbound DNA by native gel electrophoresis. DNA-protein complexes were cut from polyacrylamide gels, and the amounts of 3H and 32P contained in each slice were measured. A ratio of 1.12 +/- 0.06 TF1 dimer/DNA molecule was calculated for the fastest-migrating TF1-DNA complex. We conclude that TF1 has a DNA-binding unit of one dimer. More slowly migrating complexes are apparently formed by serial addition of single TF1 dimers.

  14. Topological, chemical and electro-optical characteristics of riboflavin-doped artificial and natural DNA thin films

    NASA Astrophysics Data System (ADS)

    Gnapareddy, Bramaramba; Dugasani, Sreekantha Reddy; Son, Junyoung; Park, Sung Ha

    2018-02-01

    DNA is considered as a useful building bio-material, and it serves as an efficient template to align functionalized nanomaterials. Riboflavin (RF)-doped synthetic double-crossover DNA (DX-DNA) lattices and natural salmon DNA (SDNA) thin films were constructed using substrate-assisted growth and drop-casting methods, respectively, and their topological, chemical and electro-optical characteristics were evaluated. The critical doping concentrations of RF ([RF]C, approx. 5 mM) at given concentrations of DX-DNA and SDNA were obtained by observing the phase transition (from crystalline to amorphous structures) of DX-DNA and precipitation of SDNA in solution above [RF]C. [RF]C are verified by analysing the atomic force microscopy images for DX-DNA and current, absorbance and photoluminescence (PL) for SDNA. We study the physical characteristics of RF-embedded SDNA thin films, using the Fourier transform infrared spectrum to understand the interaction between the RF and DNA molecules, current to evaluate the conductance, absorption to understand the RF binding to the DNA and PL to analyse the energy transfer between the RF and DNA. The current and UV absorption band of SDNA thin films decrease up to [RF]C followed by an increase above [RF]C. By contrast, the PL intensity illustrates the reverse trend, as compared to the current and UV absorption behaviour as a function of the varying [RF]. Owing to the intense PL characteristic of RF, the DNA lattices and thin films with RF might offer immense potential to develop efficient bio-sensors and useful bio-photonic devices.

  15. Topological, chemical and electro-optical characteristics of riboflavin-doped artificial and natural DNA thin films

    PubMed Central

    Gnapareddy, Bramaramba; Son, Junyoung

    2018-01-01

    DNA is considered as a useful building bio-material, and it serves as an efficient template to align functionalized nanomaterials. Riboflavin (RF)-doped synthetic double-crossover DNA (DX-DNA) lattices and natural salmon DNA (SDNA) thin films were constructed using substrate-assisted growth and drop-casting methods, respectively, and their topological, chemical and electro-optical characteristics were evaluated. The critical doping concentrations of RF ([RF]C, approx. 5 mM) at given concentrations of DX-DNA and SDNA were obtained by observing the phase transition (from crystalline to amorphous structures) of DX-DNA and precipitation of SDNA in solution above [RF]C. [RF]C are verified by analysing the atomic force microscopy images for DX-DNA and current, absorbance and photoluminescence (PL) for SDNA. We study the physical characteristics of RF-embedded SDNA thin films, using the Fourier transform infrared spectrum to understand the interaction between the RF and DNA molecules, current to evaluate the conductance, absorption to understand the RF binding to the DNA and PL to analyse the energy transfer between the RF and DNA. The current and UV absorption band of SDNA thin films decrease up to [RF]C followed by an increase above [RF]C. By contrast, the PL intensity illustrates the reverse trend, as compared to the current and UV absorption behaviour as a function of the varying [RF]. Owing to the intense PL characteristic of RF, the DNA lattices and thin films with RF might offer immense potential to develop efficient bio-sensors and useful bio-photonic devices. PMID:29515837

  16. Mapping the interactions of the single-stranded DNA binding protein of bacteriophage T4 (gp32) with DNA lattices at single nucleotide resolution: polynucleotide binding and cooperativity

    PubMed Central

    Jose, Davis; Weitzel, Steven E.; Baase, Walter A.; Michael, Miya M.; von Hippel, Peter H.

    2015-01-01

    We here use our site-specific base analog mapping approach to study the interactions and binding equilibria of cooperatively-bound clusters of the single-stranded DNA binding protein (gp32) of the T4 DNA replication complex with longer ssDNA (and dsDNA) lattices. We show that in cooperatively bound clusters the binding free energy appears to be equi-partitioned between the gp32 monomers of the cluster, so that all bind to the ssDNA lattice with comparable affinity, but also that the outer domains of the gp32 monomers at the ends of the cluster can fluctuate on and off the lattice and that the clusters of gp32 monomers can slide along the ssDNA. We also show that at very low binding densities gp32 monomers bind to the ssDNA lattice at random, but that cooperatively bound gp32 clusters bind preferentially at the 5′-end of the ssDNA lattice. We use these results and the gp32 monomer-binding results of the companion paper to propose a detailed model for how gp32 might bind to and interact with ssDNA lattices in its various binding modes, and also consider how these clusters might interact with other components of the T4 DNA replication complex. PMID:26275774

  17. Comparison between TRF2 and TRF1 of their telomeric DNA-bound structures and DNA-binding activities

    PubMed Central

    Hanaoka, Shingo; Nagadoi, Aritaka; Nishimura, Yoshifumi

    2005-01-01

    Mammalian telomeres consist of long tandem arrays of double-stranded telomeric TTAGGG repeats packaged by the telomeric DNA-binding proteins TRF1 and TRF2. Both contain a similar C-terminal Myb domain that mediates sequence-specific binding to telomeric DNA. In a DNA complex of TRF1, only the single Myb-like domain consisting of three helices can bind specifically to double-stranded telomeric DNA. TRF2 also binds to double-stranded telomeric DNA. Although the DNA binding mode of TRF2 is likely identical to that of TRF1, TRF2 plays an important role in the t-loop formation that protects the ends of telomeres. Here, to clarify the details of the double-stranded telomeric DNA-binding modes of TRF1 and TRF2, we determined the solution structure of the DNA-binding domain of human TRF2 bound to telomeric DNA; it consists of three helices, and like TRF1, the third helix recognizes TAGGG sequence in the major groove of DNA with the N-terminal arm locating in the minor groove. However, small but significant differences are observed; in contrast to the minor groove recognition of TRF1, in which an arginine residue recognizes the TT sequence, a lysine residue of TRF2 interacts with the TT part. We examined the telomeric DNA-binding activities of both DNA-binding domains of TRF1 and TRF2 and found that TRF1 binds more strongly than TRF2. Based on the structural differences of both domains, we created several mutants of the DNA-binding domain of TRF2 with stronger binding activities compared to the wild-type TRF2. PMID:15608118

  18. Determinants for Tight and Selective Binding of a Medicinal Dicarbene Gold(I) Complex to a Telomeric DNA G-Quadruplex: a Joint ESI MS and XRD Investigation.

    PubMed

    Bazzicalupi, Carla; Ferraroni, Marta; Papi, Francesco; Massai, Lara; Bertrand, Benoît; Messori, Luigi; Gratteri, Paola; Casini, Angela

    2016-03-18

    The dicarbene gold(I) complex [Au(9-methylcaffein-8-ylidene)2 ]BF4 is an exceptional organometallic compound of profound interest as a prospective anticancer agent. This gold(I) complex was previously reported to be highly cytotoxic toward various cancer cell lines in vitro and behaves as a selective G-quadruplex stabilizer. Interactions of the gold complex with various telomeric DNA models have been analyzed by a combined ESI MS and X-ray diffraction (XRD) approach. ESI MS measurements confirmed formation of stable adducts between the intact gold(I) complex and Tel 23 DNA sequence. The crystal structure of the adduct formed between [Au(9-methylcaffein-8-ylidene)2 ](+) and Tel 23 DNA G-quadruplex was solved. Tel 23 maintains a characteristic propeller conformation while binding three gold(I) dicarbene moieties at two distinct sites. Stacking interactions appear to drive noncovalent binding of the gold(I) complex. The structural basis for tight gold(I) complex/G-quadruplex recognition and its selectivity are described. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Single molecule tracking of Ace1p in Saccharomyces cerevisiae defines a characteristic residence time for non-specific interactions of transcription factors with chromatin

    PubMed Central

    Ball, David A.; Mehta, Gunjan D.; Salomon-Kent, Ronit; Mazza, Davide; Morisaki, Tatsuya; Mueller, Florian; McNally, James G.; Karpova, Tatiana S.

    2016-01-01

    In vivo single molecule tracking has recently developed into a powerful technique for measuring and understanding the transient interactions of transcription factors (TF) with their chromatin response elements. However, this method still lacks a solid foundation for distinguishing between specific and non-specific interactions. To address this issue, we took advantage of the power of molecular genetics of yeast. Yeast TF Ace1p has only five specific sites in the genome and thus serves as a benchmark to distinguish specific from non-specific binding. Here, we show that the estimated residence time of the short-residence molecules is essentially the same for Hht1p, Ace1p and Hsf1p, equaling 0.12–0.32 s. These three DNA-binding proteins are very different in their structure, function and intracellular concentration. This suggests that (i) short-residence molecules are bound to DNA non-specifically, and (ii) that non-specific binding shares common characteristics between vastly different DNA-bound proteins and thus may have a common underlying mechanism. We develop new and robust procedure for evaluation of adverse effects of labeling, and new quantitative analysis procedures that significantly improve residence time measurements by accounting for fluorophore blinking. Our results provide a framework for the reliable performance and analysis of single molecule TF experiments in yeast. PMID:27566148

  20. Exploring DNA-binding Proteins with In Vivo Chemical Cross-linking and Mass Spectrometry

    PubMed Central

    Qiu, Haibo; Wang, Yinsheng

    2009-01-01

    DNA-binding proteins are very important constituents of proteomes of all species and play crucial roles in transcription, DNA replication, recombination, repair and other activities associated with DNA. Although a number of DNA-binding proteins have been identified, many proteins involved in gene regulation and DNA repair are likely still unknown because of their dynamic and/or weak interactions with DNA. In this report, we described an approach for the comprehensive identification of DNA-binding proteins with in vivo formaldehyde cross-linking and LC-MS/MS. DNA-binding proteins could be purified via the isolation of DNA-protein complexes and released from the complexes by reversing the cross-linking. By using this method, we were able to identify more than one hundred DNA-binding proteins, such as proteins involved in transcription, gene regulation, DNA replication and repair, and a large number of proteins which are potentially associated with DNA and DNA-binding proteins. This method should be generally applicable to the investigation of other nucleic acid-binding proteins, and hold great potential in the comprehensive study of gene regulation, DNA damage response and repair, as well as many other critical biological processes at proteomic level. PMID:19714816

  1. Lipophilic oligonucleotides spontaneously insert into lipid membranes, bind complementary DNA strands, and sequester into lipid-disordered domains.

    PubMed

    Bunge, Andreas; Kurz, Anke; Windeck, Anne-Kathrin; Korte, Thomas; Flasche, Wolfgang; Liebscher, Jürgen; Herrmann, Andreas; Huster, Daniel

    2007-04-10

    For the development of surface functionalized bilayers, we have synthesized lipophilic oligonucleotides to combine the molecular recognition mechanism of nucleic acids and the self-assembly characteristics of lipids in planar membranes. A lipophilic oligonucleotide consisting of 21 thymidine units and two lipophilic nucleotides with an alpha-tocopherol moiety as a lipophilic anchor was synthesized using solid-phase methods with a phosphoramadite strategy. The interaction of the water soluble lipophilic oligonucleotide with vesicular lipid membranes and its capability to bind complementary DNA strands was studied using complementary methods such as NMR, EPR, DSC, fluorescence spectroscopy, and fluorescence microscopy. This oligonucleotide inserted stably into preformed membranes from the aqueous phase. Thereby, no significant perturbation of the lipid bilayer and its stability was observed. However, the non-lipidated end of the oligonucleotide is exposed to the aqueous environment, is relatively mobile, and is free to interact with complementary DNA strands. Binding of the complementary single-stranded DNA molecules is fast and accomplished by the formation of Watson-Crick base pairs, which was confirmed by 1H NMR chemical shift analysis and fluorescence resonance energy transfer. The molecular structure of the membrane bound DNA double helix is very similar to the free double-stranded DNA. Further, the membrane bound DNA double strands also undergo regular melting. Finally, in raft-like membrane mixtures, the lipophilic oligonucleotide was shown to preferentially sequester into liquid-disordered membrane domains.

  2. Effects of nucleoside analog incorporation on DNA binding to the DNA binding domain of the GATA-1 erythroid transcription factor.

    PubMed

    Foti, M; Omichinski, J G; Stahl, S; Maloney, D; West, J; Schweitzer, B I

    1999-02-05

    We investigate here the effects of the incorporation of the nucleoside analogs araC (1-beta-D-arabinofuranosylcytosine) and ganciclovir (9-[(1,3-dihydroxy-2-propoxy)methyl] guanine) into the DNA binding recognition sequence for the GATA-1 erythroid transcription factor. A 10-fold decrease in binding affinity was observed for the ganciclovir-substituted DNA complex in comparison to an unmodified DNA of the same sequence composition. AraC substitution did not result in any changes in binding affinity. 1H-15N HSQC and NOESY NMR experiments revealed a number of chemical shift changes in both DNA and protein in the ganciclovir-modified DNA-protein complex when compared to the unmodified DNA-protein complex. These changes in chemical shift and binding affinity suggest a change in the binding mode of the complex when ganciclovir is incorporated into the GATA DNA binding site.

  3. Analysis of DNA binding by human factor xeroderma pigmentosum complementation group A (XPA) provides insight into its interactions with nucleotide excision repair substrates.

    PubMed

    Sugitani, Norie; Voehler, Markus W; Roh, Michelle S; Topolska-Woś, Agnieszka M; Chazin, Walter J

    2017-10-13

    Xeroderma pigmentosum (XP) complementation group A (XPA) is an essential scaffolding protein in the multiprotein nucleotide excision repair (NER) machinery. The interaction of XPA with DNA is a core function of this protein; a number of mutations in the DNA-binding domain (DBD) are associated with XP disease. Although structures of the central globular domain of human XPA and data on binding of DNA substrates have been reported, the structural basis for XPA's DNA-binding activity remains unknown. X-ray crystal structures of the central globular domain of yeast XPA (Rad14) with lesion-containing DNA duplexes have provided valuable insights, but the DNA substrates used for this study do not correspond to the substrates of XPA as it functions within the NER machinery. To better understand the DNA-binding activity of human XPA in NER, we used NMR to investigate the interaction of its DBD with a range of DNA substrates. We found that XPA binds different single-stranded/double-stranded junction DNA substrates with a common surface. Comparisons of our NMR-based mapping of binding residues with the previously reported Rad14-DNA crystal structures revealed similarities and differences in substrate binding between XPA and Rad14. This includes direct evidence for DNA contacts to the residues extending C-terminally from the globular core, which are lacking in the Rad14 construct. Moreover, mutation of the XPA residue corresponding to Phe-262 in Rad14, previously reported as being critical for DNA binding, had only a moderate effect on the DNA-binding activity of XPA. The DNA-binding properties of several disease-associated mutations in the DBD were investigated. These results suggest that for XPA mutants exhibiting altered DNA-binding properties, a correlation exists between the extent of reduction in DNA-binding affinity and the severity of symptoms in XP patients. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Quantitative characterization of conformational-specific protein-DNA binding using a dual-spectral interferometric imaging biosensor.

    PubMed

    Zhang, Xirui; Daaboul, George G; Spuhler, Philipp S; Dröge, Peter; Ünlü, M Selim

    2016-03-14

    DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are not fully understood. Recently, it was discovered that DNA-binding proteins recognize specific binding sites to carry out their functions through an indirect readout mechanism by recognizing and capturing DNA conformational flexibility and deformation. High-throughput DNA microarray-based methods that provide large-scale protein-DNA binding information have shown effective and comprehensive analysis of protein-DNA binding affinities, but do not provide information of DNA conformational changes in specific protein-DNA complexes. Building on the high-throughput capability of DNA microarrays, we demonstrate a quantitative approach that simultaneously measures the amount of protein binding to DNA and nanometer-scale DNA conformational change induced by protein binding in a microarray format. Both measurements rely on spectral interferometry on a layered substrate using a single optical instrument in two distinct modalities. In the first modality, we quantitate the amount of binding of protein to surface-immobilized DNA in each DNA spot using a label-free spectral reflectivity technique that accurately measures the surface densities of protein and DNA accumulated on the substrate. In the second modality, for each DNA spot, we simultaneously measure DNA conformational change using a fluorescence vertical sectioning technique that determines average axial height of fluorophores tagged to specific nucleotides of the surface-immobilized DNA. The approach presented in this paper, when combined with current high-throughput DNA microarray-based technologies, has the potential to serve as a rapid and simple method for quantitative and large-scale characterization of conformational specific protein-DNA interactions.

  5. Full-length mutation search of the TP53 gene in acute myeloid leukemia has increased significance as a prognostic factor.

    PubMed

    Terada, Kazuki; Yamaguchi, Hiroki; Ueki, Toshimitsu; Usuki, Kensuke; Kobayashi, Yutaka; Tajika, Kenji; Gomi, Seiji; Kurosawa, Saiko; Miyadera, Keiki; Tokura, Taichiro; Omori, Ikuko; Marumo, Atushi; Fujiwara, Yusuke; Yui, Shunsuke; Ryotokuji, Takeshi; Osaki, Yoshiki; Arai, Kunihito; Kitano, Tomoaki; Kosaka, Fumiko; Wakita, Satoshi; Tamai, Hayato; Fukuda, Takahiro; Inokuchi, Koiti

    2018-01-01

    TP53 gene abnormality has been reported to be an unfavorable prognostic factor in acute myeloid leukemia (AML). However, almost all studies of TP53 gene abnormality so far have been limited to mutation searches in the DNA binding domain. As there have been few reports examining both mutation and deletion over the full-length of the TP53 gene, the clinical characteristics of TP53 gene abnormality have not yet been clearly established. In this study, TP53 gene mutation was observed in 7.3% of the total 412 de novo AML cases (33 mutations in 30 cases), with mutation outside the DNA binding domain in eight cases (27%). TP53 gene deletion was observed in 3.1% of 358 cases. All cases had monoallelic deletion with TP53 gene mutation on the opposite allele. Multivariate analysis demonstrated that TP53 gene mutation in the DNA binding domain and outside the DNA binding domain was an independent poor prognostic factor for overall survival and relapse-free survival among the total cohort and it is also an unfavorable prognostic factor in FLT3-ITD-negative AML cases aged 70 years or below with intermediate cytogenetic prognosis. In stratified treatment, full-length search for TP53 gene mutation is therefore very important.

  6. Crucial role of dynamic linker histone binding and divalent ions for DNA accessibility and gene regulation revealed by mesoscale modeling of oligonucleosomes

    PubMed Central

    Collepardo-Guevara, Rosana; Schlick, Tamar

    2012-01-01

    Monte Carlo simulations of a mesoscale model of oligonucleosomes are analyzed to examine the role of dynamic-linker histone (LH) binding/unbinding in high monovalent salt with divalent ions, and to further interpret noted chromatin fiber softening by dynamic LH in monovalent salt conditions. We find that divalent ions produce a fiber stiffening effect that competes with, but does not overshadow, the dramatic softening triggered by dynamic-LH behavior. Indeed, we find that in typical in vivo conditions, dynamic-LH binding/unbinding reduces fiber stiffening dramatically (by a factor of almost 5, as measured by the elasticity modulus) compared with rigidly fixed LH, and also the force needed to initiate chromatin unfolding, making it consistent with those of molecular motors. Our data also show that, during unfolding, divalent ions together with LHs induce linker-DNA bending and DNA–DNA repulsion screening, which guarantee formation of heteromorphic superbeads-on-a-string structures that combine regions of loose and compact fiber independently of the characteristics of the LH–core bond. These structures might be important for gene regulation as they expose regions of the DNA selectively. Dynamic control of LH binding/unbinding, either globally or locally, in the presence of divalent ions, might constitute a mechanism for regulation of gene expression. PMID:22790986

  7. Genotoxic effect and antigen binding characteristics of SLE auto-antibodies to peroxynitrite-modified human DNA.

    PubMed

    Khan, Md Asad; Alam, Khursheed; Mehdi, Syed Hassan; Rizvi, M Moshahid A

    2017-12-01

    Systemic lupus erythematosus (SLE) is an inflammatory autoimmune disease characterized by auto-antibodies against native deoxyribonucleic acid after modification and is one of the reasons for the development of SLE. Here, we have evaluated the structural perturbations in human placental DNA by peroxynitrite using spectroscopy, thermal denaturation and high-performance liquid chromatography (HPLC). Peroxynitrite is a powerful potent bi-functional oxidative/nitrative agent that is produced both endogenously and exogenously. In experimental animals, the peroxynitrite-modified DNA was found to be highly immunogenic. The induced antibodies showed cross-reactions with different types of DNA and nitrogen bases that were modified with peroxynitrite by inhibition ELISA. The antibody activity was inhibited by approximately 89% with its immunogen as the inhibitor. The antigen-antibodies interaction between induced antibodies with peroxynitrite-modified DNA showed retarded mobility as compared to the native form. Furthermore, significantly increased binding was also observed in SLE autoantibodies with peroxynitrite-modified DNA than native form. Moreover, DNA isolated from lymphocyte of SLE patients revealed significant recognition of anti-peroxynitrite-modified DNA immunoglobulin G (IgG). Our data indicates that DNA modified with peroxynitrite presents unique antigenic determinants that may induce autoantibody response in SLE. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Raman microspectroscopic study of effects of Na(I) and Mg(II) ions on low pH induced DNA structural changes.

    PubMed

    Muntean, C M; Segers-Nolten, G M J

    2003-01-01

    In this work a confocal Raman microspectrometer is used to investigate the influence of Na(+) and Mg(2+) ions on the DNA structural changes induced by low pH. Measurements are carried out on calf thymus DNA at neutral pH (7) and pH 3 in the presence of low and high concentrations of Na(+) and Mg(2+) ions, respectively. It is found that low concentrations of Na(+) ions do not protect DNA against binding of H(+). High concentrations of monovalent ions can prevent protonation of the DNA double helix. Our Raman spectra show that low concentrations of Mg(2+) ions partly protect DNA against protonation of cytosine (line at 1262 cm(-1)) but do not protect adenine and guanine N(7) against binding of H(+) (characteristic lines at 1304 and 1488 cm(-1), respectively). High concentrations of Mg(2+) can prevent protonation of cytosine and protonation of adenine (disruption of AT pairs). By analyzing the line at 1488 cm(-1), which obtains most of its intensity from a guanine vibration, high magnesium salt protect the N(7) of guanine against protonation. A high salt concentration can prevent protonation of guanine, cytosine, and adenine in DNA. Higher salt concentrations cause less DNA protonation than lower salt concentrations. Magnesium ions are found to be more effective in protecting DNA against binding of H(+) as compared with calcium ions presented in a previous study. Divalent metal cations (Mg(2+), Ca(2+)) are more effective in protecting DNA against protonation than monovalent ions (Na(+)). Copyright 2003 Wiley Periodicals, Inc. Biopolymers (Biospectroscopy) 72: 000-000, 2003

  9. Isolation from genomic DNA of sequences binding specific regulatory proteins by the acceleration of protein electrophoretic mobility upon DNA binding.

    PubMed

    Subrahmanyam, S; Cronan, J E

    1999-01-21

    We report an efficient and flexible in vitro method for the isolation of genomic DNA sequences that are the binding targets of a given DNA binding protein. This method takes advantage of the fact that binding of a protein to a DNA molecule generally increases the rate of migration of the protein in nondenaturing gel electrophoresis. By the use of a radioactively labeled DNA-binding protein and nonradioactive DNA coupled with PCR amplification from gel slices, we show that specific binding sites can be isolated from Escherichia coli genomic DNA. We have applied this method to isolate a binding site for FadR, a global regulator of fatty acid metabolism in E. coli. We have also isolated a second binding site for BirA, the biotin operon repressor/biotin ligase, from the E. coli genome that has a very low binding efficiency compared with the bio operator region.

  10. The helical structure of DNA facilitates binding

    NASA Astrophysics Data System (ADS)

    Berg, Otto G.; Mahmutovic, Anel; Marklund, Emil; Elf, Johan

    2016-09-01

    The helical structure of DNA imposes constraints on the rate of diffusion-limited protein binding. Here we solve the reaction-diffusion equations for DNA-like geometries and extend with simulations when necessary. We find that the helical structure can make binding to the DNA more than twice as fast compared to a case where DNA would be reactive only along one side. We also find that this rate advantage remains when the contributions from steric constraints and rotational diffusion of the DNA-binding protein are included. Furthermore, we find that the association rate is insensitive to changes in the steric constraints on the DNA in the helix geometry, while it is much more dependent on the steric constraints on the DNA-binding protein. We conclude that the helical structure of DNA facilitates the nonspecific binding of transcription factors and structural DNA-binding proteins in general.

  11. Coupled binding-bending-folding: The complex conformational dynamics of protein-DNA binding studied by atomistic molecular dynamics simulations.

    PubMed

    van der Vaart, Arjan

    2015-05-01

    Protein-DNA binding often involves dramatic conformational changes such as protein folding and DNA bending. While thermodynamic aspects of this behavior are understood, and its biological function is often known, the mechanism by which the conformational changes occur is generally unclear. By providing detailed structural and energetic data, molecular dynamics simulations have been helpful in elucidating and rationalizing protein-DNA binding. This review will summarize recent atomistic molecular dynamics simulations of the conformational dynamics of DNA and protein-DNA binding. A brief overview of recent developments in DNA force fields is given as well. Simulations have been crucial in rationalizing the intrinsic flexibility of DNA, and have been instrumental in identifying the sequence of binding events, the triggers for the conformational motion, and the mechanism of binding for a number of important DNA-binding proteins. Molecular dynamics simulations are an important tool for understanding the complex binding behavior of DNA-binding proteins. With recent advances in force fields and rapid increases in simulation time scales, simulations will become even more important for future studies. This article is part of a Special Issue entitled Recent developments of molecular dynamics. Copyright © 2014. Published by Elsevier B.V.

  12. Quantification of transcription factor-DNA binding affinity in a living cell

    PubMed Central

    Belikov, Sergey; Berg, Otto G.; Wrange, Örjan

    2016-01-01

    The apparent dissociation constant (Kd) for specific binding of glucocorticoid receptor (GR) and androgen receptor (AR) to DNA was determined in vivo in Xenopus oocytes. The total nuclear receptor concentration was quantified as specifically retained [3H]-hormone in manually isolated oocyte nuclei. DNA was introduced by nuclear microinjection of single stranded phagemid DNA, chromatin is then formed during second strand synthesis. The fraction of DNA sites occupied by the expressed receptor was determined by dimethylsulphate in vivo footprinting and used for calculation of the receptor-DNA binding affinity. The forkhead transcription factor FoxA1 enhanced the DNA binding by GR with an apparent Kd of ∼1 μM and dramatically stimulated DNA binding by AR with an apparent Kd of ∼0.13 μM at a composite androgen responsive DNA element containing one FoxA1 binding site and one palindromic hormone receptor binding site known to bind one receptor homodimer. FoxA1 exerted a weak constitutive- and strongly cooperative DNA binding together with AR but had a less prominent effect with GR, the difference reflecting the licensing function of FoxA1 at this androgen responsive DNA element. PMID:26657626

  13. DNA sequence determinants controlling affinity, stability and shape of DNA complexes bound by the nucleoid protein Fis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio

    The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less

  14. DNA sequence determinants controlling affinity, stability and shape of DNA complexes bound by the nucleoid protein Fis

    DOE PAGES

    Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio; ...

    2016-03-09

    The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less

  15. Monitoring ssDNA Binding to the DnaB Helicase from Helicobacter pylori by Solid-State NMR Spectroscopy.

    PubMed

    Wiegand, Thomas; Cadalbert, Riccardo; Gardiennet, Carole; Timmins, Joanna; Terradot, Laurent; Böckmann, Anja; Meier, Beat H

    2016-11-02

    DnaB helicases are bacterial, ATP-driven enzymes that unwind double-stranded DNA during DNA replication. Herein, we study the sequential binding of the "non-hydrolysable" ATP analogue AMP-PNP and of single-stranded (ss) DNA to the dodecameric DnaB helicase from Helicobacter pylori using solid-state NMR. Phosphorus cross-polarization experiments monitor the binding of AMP-PNP and DNA to the helicase. 13 C chemical-shift perturbations (CSPs) are used to detect conformational changes in the protein upon binding. The helicase switches upon AMP-PNP addition into a conformation apt for ssDNA binding, and AMP-PNP is hydrolyzed and released upon binding of ssDNA. Our study sheds light on the conformational changes which are triggered by the interaction with AMP-PNP and are needed for ssDNA binding of H. pylori DnaB in vitro. They also demonstrate the level of detail solid-state NMR can provide for the characterization of protein-DNA interactions and the interplay with ATP or its analogues. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Simocyclinone D8, an inhibitor of DNA gyrase with a novel mode of action.

    PubMed

    Flatman, Ruth H; Howells, Alison J; Heide, Lutz; Fiedler, Hans-Peter; Maxwell, Anthony

    2005-03-01

    We have characterized the interaction of a new class of antibiotics, simocyclinones, with bacterial DNA gyrase. Even though their structures include an aminocoumarin moiety, a key feature of novobiocin, coumermycin A(1), and clorobiocin, which also target gyrase, simocyclinones behave strikingly differently from these compounds. Simocyclinone D8 is a potent inhibitor of gyrase supercoiling, with a 50% inhibitory concentration lower than that of novobiocin. However, it does not competitively inhibit the DNA-independent ATPase reaction of GyrB, which is characteristic of other aminocoumarins. Simocyclinone D8 also inhibits DNA relaxation by gyrase but does not stimulate cleavage complex formation, unlike quinolones, the other major class of gyrase inhibitors; instead, it abrogates both Ca(2+)- and quinolone-induced cleavage complex formation. Binding studies suggest that simocyclinone D8 interacts with the N-terminal domain of GyrA. Taken together, our results demonstrate that simocyclinones inhibit an early step of the gyrase catalytic cycle by preventing binding of the enzyme to DNA. This is a novel mechanism for a gyrase inhibitor and presents new possibilities for antibacterial drug development.

  17. Molecular basis of CENP-C association with the CENP-A nucleosome at yeast centromeres

    PubMed Central

    Xiao, Hua; Wang, Feng; Wisniewski, Jan; Shaytan, Alexey K.; Ghirlando, Rodolfo; FitzGerald, Peter C.; Huang, Yingzi; Wei, Debbie; Li, Shipeng; Landsman, David; Panchenko, Anna R.; Wu, Carl

    2017-01-01

    Histone CENP-A-containing nucleosomes play an important role in nucleating kinetochores at centromeres for chromosome segregation. However, the molecular mechanisms by which CENP-A nucleosomes engage with kinetochore proteins are not well understood. Here, we report the finding of a new function for the budding yeast Cse4/CENP-A histone-fold domain interacting with inner kinetochore protein Mif2/CENP-C. Strikingly, we also discovered that AT-rich centromere DNA has an important role for Mif2 recruitment. Mif2 contacts one side of the nucleosome dyad, engaging with both Cse4 residues and AT-rich nucleosomal DNA. Both interactions are directed by a contiguous DNA- and histone-binding domain (DHBD) harboring the conserved CENP-C motif, an AT hook, and RK clusters (clusters enriched for arginine–lysine residues). Human CENP-C has two related DHBDs that bind preferentially to DNA sequences of higher AT content. Our findings suggest that a DNA composition-based mechanism together with residues characteristic for the CENP-A histone variant contribute to the specification of centromere identity. PMID:29074736

  18. Binding of undamaged double stranded DNA to vaccinia virus uracil-DNA glycosylase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schormann, Norbert; Banerjee, Surajit; Ricciardi, Robert

    Background: Uracil-DNA glycosylases are evolutionarily conserved DNA repair enzymes. However, vaccinia virus uracil-DNA glycosylase (known as D4), also serves as an intrinsic and essential component of the processive DNA polymerase complex during DNA replication. In this complex D4 binds to a unique poxvirus specific protein A20 which tethers it to the DNA polymerase. At the replication fork the DNA scanning and repair function of D4 is coupled with DNA replication. So far, DNA-binding to D4 has not been structurally characterized. Results: This manuscript describes the first structure of a DNA-complex of a uracil-DNA glycosylase from the poxvirus family. This alsomore » represents the first structure of a uracil DNA glycosylase in complex with an undamaged DNA. In the asymmetric unit two D4 subunits bind simultaneously to complementary strands of the DNA double helix. Each D4 subunit interacts mainly with the central region of one strand. DNA binds to the opposite side of the A20-binding surface on D4. In comparison of the present structure with the structure of uracil-containing DNA-bound human uracil-DNA glycosylase suggests that for DNA binding and uracil removal D4 employs a unique set of residues and motifs that are highly conserved within the poxvirus family but different in other organisms. Conclusion: The first structure of D4 bound to a truly non-specific undamaged double-stranded DNA suggests that initial binding of DNA may involve multiple non-specific interactions between the protein and the phosphate backbone.« less

  19. Binding of undamaged double stranded DNA to vaccinia virus uracil-DNA glycosylase

    DOE PAGES

    Schormann, Norbert; Banerjee, Surajit; Ricciardi, Robert; ...

    2015-06-02

    Background: Uracil-DNA glycosylases are evolutionarily conserved DNA repair enzymes. However, vaccinia virus uracil-DNA glycosylase (known as D4), also serves as an intrinsic and essential component of the processive DNA polymerase complex during DNA replication. In this complex D4 binds to a unique poxvirus specific protein A20 which tethers it to the DNA polymerase. At the replication fork the DNA scanning and repair function of D4 is coupled with DNA replication. So far, DNA-binding to D4 has not been structurally characterized. Results: This manuscript describes the first structure of a DNA-complex of a uracil-DNA glycosylase from the poxvirus family. This alsomore » represents the first structure of a uracil DNA glycosylase in complex with an undamaged DNA. In the asymmetric unit two D4 subunits bind simultaneously to complementary strands of the DNA double helix. Each D4 subunit interacts mainly with the central region of one strand. DNA binds to the opposite side of the A20-binding surface on D4. In comparison of the present structure with the structure of uracil-containing DNA-bound human uracil-DNA glycosylase suggests that for DNA binding and uracil removal D4 employs a unique set of residues and motifs that are highly conserved within the poxvirus family but different in other organisms. Conclusion: The first structure of D4 bound to a truly non-specific undamaged double-stranded DNA suggests that initial binding of DNA may involve multiple non-specific interactions between the protein and the phosphate backbone.« less

  20. Curated collection of yeast transcription factor DNA binding specificity data reveals novel structural and gene regulatory insights

    PubMed Central

    2011-01-01

    Background Transcription factors (TFs) play a central role in regulating gene expression by interacting with cis-regulatory DNA elements associated with their target genes. Recent surveys have examined the DNA binding specificities of most Saccharomyces cerevisiae TFs, but a comprehensive evaluation of their data has been lacking. Results We analyzed in vitro and in vivo TF-DNA binding data reported in previous large-scale studies to generate a comprehensive, curated resource of DNA binding specificity data for all characterized S. cerevisiae TFs. Our collection comprises DNA binding site motifs and comprehensive in vitro DNA binding specificity data for all possible 8-bp sequences. Investigation of the DNA binding specificities within the basic leucine zipper (bZIP) and VHT1 regulator (VHR) TF families revealed unexpected plasticity in TF-DNA recognition: intriguingly, the VHR TFs, newly characterized by protein binding microarrays in this study, recognize bZIP-like DNA motifs, while the bZIP TF Hac1 recognizes a motif highly similar to the canonical E-box motif of basic helix-loop-helix (bHLH) TFs. We identified several TFs with distinct primary and secondary motifs, which might be associated with different regulatory functions. Finally, integrated analysis of in vivo TF binding data with protein binding microarray data lends further support for indirect DNA binding in vivo by sequence-specific TFs. Conclusions The comprehensive data in this curated collection allow for more accurate analyses of regulatory TF-DNA interactions, in-depth structural studies of TF-DNA specificity determinants, and future experimental investigations of the TFs' predicted target genes and regulatory roles. PMID:22189060

  1. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    NASA Astrophysics Data System (ADS)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  2. Specificity of the weak binding between the phage SPO1 transcription-inhibitory protein, TF1, and SPO1 DNA.

    PubMed

    Johnson, G G; Geiduschek, E P

    1977-04-05

    The interaction of the phage SPO1 protein transcription factor 1 (TF1), with DNA has been analyzed by membrane filter binding and by sedimentation methods. Substantially specific binding of TF1 to helical SPO1 DNA can be demonstrated by nitrocellulose filter-binding assays at relatively low ionic strength (0.08). However, TF1-DNA complexes dissociate and reequilibrate relatively rapidly and this makes filter-binding assays unsuitable for quantitative measurements of binding equilibra. Accordingly, the sedimentation properties of TF1-DNA complexes have been explored and a short-column centrifugation assay has been elaborated for quantitative measurements. Preferential binding of TF1 to the hydroxymethyluracil-containing SPO1 DNA has also been demonstrated by short-column centrifugation. TF1 binds relatively weakly and somewhat cooperatively to SPO1 DNA at many sites; TF1-DNA complexes dissociate and reequilibrate rapidly. At 20 degrees C in 0.01 M phosphate, pH 7.5, 0.15 KC1, one molecule of TF1 can bind to approximately every 60 nucleotide pairs of SPO1 DNA.

  3. Interaction of DNA with Simple and Mixed Ligand Copper(II) Complexes of 1,10-Phenanthrolines as Studied by DNA-Fiber EPR Spectroscopy

    PubMed Central

    Chikira, Makoto; Ng, Chew Hee; Palaniandavar, Mallayan

    2015-01-01

    The interaction of simple and ternary Cu(II) complexes of 1,10-phenanthrolines with DNA has been studied extensively because of their various interesting and important functions such as DNA cleavage activity, cytotoxicity towards cancer cells, and DNA based asymmetric catalysis. Such functions are closely related to the DNA binding modes of the complexes such as intercalation, groove binding, and electrostatic surface binding. A variety of spectroscopic methods have been used to study the DNA binding mode of the Cu(II) complexes. Of all these methods, DNA-fiber electron paramagnetic resonance (EPR) spectroscopy affords unique information on the DNA binding structures of the complexes. In this review we summarize the results of our DNA-fiber EPR studies on the DNA binding structure of the complexes and discuss them together with the data accumulated by using other measurements. PMID:26402668

  4. Changes in conformational dynamics of basic side chains upon protein–DNA association

    PubMed Central

    Esadze, Alexandre; Chen, Chuanying; Zandarashvili, Levani; Roy, Sourav; Pettitt, B. Montgometry; Iwahara, Junji

    2016-01-01

    Basic side chains play major roles in recognition of nucleic acids by proteins. However, dynamic properties of these positively charged side chains are not well understood. In this work, we studied changes in conformational dynamics of basic side chains upon protein–DNA association for the zinc-finger protein Egr-1. By nuclear magnetic resonance (NMR) spectroscopy, we characterized the dynamics of all side-chain cationic groups in the free protein and in the complex with target DNA. Our NMR order parameters indicate that the arginine guanidino groups interacting with DNA bases are strongly immobilized, forming rigid interfaces. Despite the strong short-range electrostatic interactions, the majority of the basic side chains interacting with the DNA phosphates exhibited high mobility, forming dynamic interfaces. In particular, the lysine side-chain amino groups exhibited only small changes in the order parameters upon DNA-binding. We found a similar trend in the molecular dynamics (MD) simulations for the free Egr-1 and the Egr-1–DNA complex. Using the MD trajectories, we also analyzed side-chain conformational entropy. The interfacial arginine side chains exhibited substantial entropic loss upon binding to DNA, whereas the interfacial lysine side chains showed relatively small changes in conformational entropy. These data illustrate different dynamic characteristics of the interfacial arginine and lysine side chains. PMID:27288446

  5. MCM ring hexamerization is a prerequisite for DNA-binding

    DOE PAGES

    Froelich, Clifford A.; Nourse, Amanda; Enemark, Eric J.

    2015-09-13

    The hexameric Minichromosome Maintenance (MCM) protein complex forms a ring that unwinds DNA at the replication fork in eukaryotes and archaea. Our recent crystal structure of an archaeal MCM N-terminal domain bound to single-stranded DNA (ssDNA) revealed ssDNA associating across tight subunit interfaces but not at the loose interfaces, indicating that DNA-binding is governed not only by the DNA-binding residues of the subunits (MCM ssDNA-binding motif, MSSB) but also by the relative orientation of the subunits. We now extend these findings to show that DNA-binding by the MCM N-terminal domain of the archaeal organism Pyrococcus furiosus occurs specifically in themore » hexameric oligomeric form. We show that mutants defective for hexamerization are defective in binding ssDNA despite retaining all the residues observed to interact with ssDNA in the crystal structure. One mutation that exhibits severely defective hexamerization and ssDNA-binding is at a conserved phenylalanine that aligns with the mouse Mcm4(Chaos3) mutation associated with chromosomal instability, cancer, and decreased intersubunit association.« less

  6. Investigations on the Interactions of 5-Fluorouracil with Herring Sperm DNA: Steady State/Time Resolved and Molecular Modeling Studies

    NASA Astrophysics Data System (ADS)

    Chinnathambi, Shanmugavel; Karthikeyan, Subramani; Velmurugan, Devadasan; Hanagata, Nobutaka; Aruna, Prakasarao; Ganesan, Singaravelu

    2015-04-01

    In the present study, the interaction of 5-Fluorouracil with herring sperm DNA is reported using spectroscopic and molecular modeling techniques. This binding study of 5-FU with hs-DNA is of paramount importance in understanding chemico-biological interactions for drug design, pharmacy and biochemistry without altering the original structure. The challenge of the study was to find the exact binding mode of the drug 5-Fluorouracil with hs-DNA. From the absorption studies, a hyperchromic effect was observed for the herring sperm DNA in the presence of 5-Fluorouracil and a binding constant of 6.153 × 103 M-1 for 5-Fluorouracil reveals the existence of weak interaction between the 5-Fluorouracil and herring sperm DNA. Ethidium bromide loaded herring sperm DNA showed a quenching in the fluorescence intensity after the addition of 5-Fluorouracil. The binding constants for 5-Fluorouracil stranded DNA and competitive bindings of 5-FU interacting with DNA-EB systems were examined by fluorescence spectra. The Stern-Volmer plots and fluorescence lifetime results confirm the static quenching nature of the drug-DNA complex. The binding constant Kb was 2.5 × 104 L mol-1 and the number of binding sites are 1.17. The 5-FU on DNA system was calculated using double logarithmic plot. From the Forster nonradiative energy transfer study it has been found that the distance of 5-FU from DNA was 4.24 nm. In addition to the spectroscopic results, the molecular modeling studies also revealed the major groove binding as well as the partial intercalation mode of binding between the 5-Fluorouracil and herring sperm DNA. The binding energy and major groove binding as -6.04 kcal mol-1 and -6.31 kcal mol-1 were calculated from the modeling studies. All the testimonies manifested that binding modes between 5-Fluorouracil and DNA were evidenced to be groove binding and in partial intercalative mode.

  7. Multiple conformational states of DnaA protein regulate its interaction with DnaA boxes in the initiation of DNA replication.

    PubMed

    Patel, Meera J; Bhatia, Lavesh; Yilmaz, Gulden; Biswas-Fiss, Esther E; Biswas, Subhasis B

    2017-09-01

    DnaA protein is the initiator of genomic DNA replication in prokaryotes. It binds to specific DNA sequences in the origin of DNA replication and unwinds small AT-rich sequences downstream for the assembly of the replisome. The mechanism of activation of DnaA that enables it to bind and organize the origin DNA and leads to replication initiation remains unclear. In this study, we have developed double-labeled fluorescent DnaA probes to analyze conformational states of DnaA protein upon binding DNA, nucleotide, and Soj sporulation protein using Fluorescence Resonance Energy Transfer (FRET). Our studies demonstrate that DnaA protein undergoes large conformational changes upon binding to substrates and there are multiple distinct conformational states that enable it to initiate DNA replication. DnaA protein adopted a relaxed conformation by expanding ~15Å upon binding ATP and DNA to form the ATP·DnaA·DNA complex. Hydrolysis of bound ATP to ADP led to a contraction of DnaA within the complex. The relaxed conformation of DnaA is likely required for the formation of the multi-protein ATP·DnaA·DNA complex. In the initiation of sporulation, Soj binding to DnaA prevented relaxation of its conformation. Soj·ADP appeared to block the activation of DnaA, suggesting a mechanism for Soj·ADP in switching initiation of DNA replication to sporulation. Our studies demonstrate that multiple conformational states of DnaA protein regulate its binding to DNA in the initiation of DNA replication. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Differences in DNA Binding Specificity of Floral Homeotic Protein Complexes Predict Organ-Specific Target Genes.

    PubMed

    Smaczniak, Cezary; Muiño, Jose M; Chen, Dijun; Angenent, Gerco C; Kaufmann, Kerstin

    2017-08-01

    Floral organ identities in plants are specified by the combinatorial action of homeotic master regulatory transcription factors. However, how these factors achieve their regulatory specificities is still largely unclear. Genome-wide in vivo DNA binding data show that homeotic MADS domain proteins recognize partly distinct genomic regions, suggesting that DNA binding specificity contributes to functional differences of homeotic protein complexes. We used in vitro systematic evolution of ligands by exponential enrichment followed by high-throughput DNA sequencing (SELEX-seq) on several floral MADS domain protein homo- and heterodimers to measure their DNA binding specificities. We show that specification of reproductive organs is associated with distinct binding preferences of a complex formed by SEPALLATA3 and AGAMOUS. Binding specificity is further modulated by different binding site spacing preferences. Combination of SELEX-seq and genome-wide DNA binding data allows differentiation between targets in specification of reproductive versus perianth organs in the flower. We validate the importance of DNA binding specificity for organ-specific gene regulation by modulating promoter activity through targeted mutagenesis. Our study shows that intrafamily protein interactions affect DNA binding specificity of floral MADS domain proteins. Differential DNA binding of MADS domain protein complexes plays a role in the specificity of target gene regulation. © 2017 American Society of Plant Biologists. All rights reserved.

  9. Investigation of arc repressor DNA-binding specificity by comparative molecular dynamics simulations.

    PubMed

    Song, Wei; Guo, Jun-Tao

    2015-01-01

    Transcription factors regulate gene expression through binding to specific DNA sequences. How transcription factors achieve high binding specificity is still not well understood. In this paper, we investigated the role of protein flexibility in protein-DNA-binding specificity by comparative molecular dynamics (MD) simulations. Protein flexibility has been considered as a key factor in molecular recognition, which is intrinsically a dynamic process involving fine structural fitting between binding components. In this study, we performed comparative MD simulations on wild-type and F10V mutant P22 Arc repressor in both free and complex conformations. The F10V mutant has lower DNA-binding specificity though both the bound and unbound main-chain structures between the wild-type and F10V mutant Arc are highly similar. We found that the DNA-binding motif of wild-type Arc is structurally more flexible than the F10V mutant in the unbound state, especially for the six DNA base-contacting residues in each dimer. We demonstrated that the flexible side chains of wild-type Arc lead to a higher DNA-binding specificity through forming more hydrogen bonds with DNA bases upon binding. Our simulations also showed a possible conformational selection mechanism for Arc-DNA binding. These results indicate the important roles of protein flexibility and dynamic properties in protein-DNA-binding specificity.

  10. Single-molecule FRET studies of the cooperative and non-cooperative binding kinetics of the bacteriophage T4 single-stranded DNA binding protein (gp32) to ssDNA lattices at replication fork junctions

    PubMed Central

    Lee, Wonbae; Gillies, John P.; Jose, Davis; Israels, Brett A.; von Hippel, Peter H.; Marcus, Andrew H.

    2016-01-01

    Gene 32 protein (gp32) is the single-stranded (ss) DNA binding protein of the bacteriophage T4. It binds transiently and cooperatively to ssDNA sequences exposed during the DNA replication process and regulates the interactions of the other sub-assemblies of the replication complex during the replication cycle. We here use single-molecule FRET techniques to build on previous thermodynamic studies of gp32 binding to initiate studies of the dynamics of the isolated and cooperative binding of gp32 molecules within the replication complex. DNA primer/template (p/t) constructs are used as models to determine the effects of ssDNA lattice length, gp32 concentration, salt concentration, binding cooperativity and binding polarity at p/t junctions. Hidden Markov models (HMMs) and transition density plots (TDPs) are used to characterize the dynamics of the multi-step assembly pathway of gp32 at p/t junctions of differing polarity, and show that isolated gp32 molecules bind to their ssDNA targets weakly and dissociate quickly, while cooperatively bound dimeric or trimeric clusters of gp32 bind much more tightly, can ‘slide’ on ssDNA sequences, and exhibit binding dynamics that depend on p/t junction polarities. The potential relationships of these binding dynamics to interactions with other components of the T4 DNA replication complex are discussed. PMID:27694621

  11. Context influences on TALE–DNA binding revealed by quantitative profiling

    PubMed Central

    Rogers, Julia M.; Barrera, Luis A.; Reyon, Deepak; Sander, Jeffry D.; Kellis, Manolis; Joung, J Keith; Bulyk, Martha L.

    2015-01-01

    Transcription activator-like effector (TALE) proteins recognize DNA using a seemingly simple DNA-binding code, which makes them attractive for use in genome engineering technologies that require precise targeting. Although this code is used successfully to design TALEs to target specific sequences, off-target binding has been observed and is difficult to predict. Here we explore TALE–DNA interactions comprehensively by quantitatively assaying the DNA-binding specificities of 21 representative TALEs to ∼5,000–20,000 unique DNA sequences per protein using custom-designed protein-binding microarrays (PBMs). We find that protein context features exert significant influences on binding. Thus, the canonical recognition code does not fully capture the complexity of TALE–DNA binding. We used the PBM data to develop a computational model, Specificity Inference For TAL-Effector Design (SIFTED), to predict the DNA-binding specificity of any TALE. We provide SIFTED as a publicly available web tool that predicts potential genomic off-target sites for improved TALE design. PMID:26067805

  12. Context influences on TALE-DNA binding revealed by quantitative profiling.

    PubMed

    Rogers, Julia M; Barrera, Luis A; Reyon, Deepak; Sander, Jeffry D; Kellis, Manolis; Joung, J Keith; Bulyk, Martha L

    2015-06-11

    Transcription activator-like effector (TALE) proteins recognize DNA using a seemingly simple DNA-binding code, which makes them attractive for use in genome engineering technologies that require precise targeting. Although this code is used successfully to design TALEs to target specific sequences, off-target binding has been observed and is difficult to predict. Here we explore TALE-DNA interactions comprehensively by quantitatively assaying the DNA-binding specificities of 21 representative TALEs to ∼5,000-20,000 unique DNA sequences per protein using custom-designed protein-binding microarrays (PBMs). We find that protein context features exert significant influences on binding. Thus, the canonical recognition code does not fully capture the complexity of TALE-DNA binding. We used the PBM data to develop a computational model, Specificity Inference For TAL-Effector Design (SIFTED), to predict the DNA-binding specificity of any TALE. We provide SIFTED as a publicly available web tool that predicts potential genomic off-target sites for improved TALE design.

  13. TFBSshape: a motif database for DNA shape features of transcription factor binding sites.

    PubMed

    Yang, Lin; Zhou, Tianyin; Dror, Iris; Mathelier, Anthony; Wasserman, Wyeth W; Gordân, Raluca; Rohs, Remo

    2014-01-01

    Transcription factor binding sites (TFBSs) are most commonly characterized by the nucleotide preferences at each position of the DNA target. Whereas these sequence motifs are quite accurate descriptions of DNA binding specificities of transcription factors (TFs), proteins recognize DNA as a three-dimensional object. DNA structural features refine the description of TF binding specificities and provide mechanistic insights into protein-DNA recognition. Existing motif databases contain extensive nucleotide sequences identified in binding experiments based on their selection by a TF. To utilize DNA shape information when analysing the DNA binding specificities of TFs, we developed a new tool, the TFBSshape database (available at http://rohslab.cmb.usc.edu/TFBSshape/), for calculating DNA structural features from nucleotide sequences provided by motif databases. The TFBSshape database can be used to generate heat maps and quantitative data for DNA structural features (i.e., minor groove width, roll, propeller twist and helix twist) for 739 TF datasets from 23 different species derived from the motif databases JASPAR and UniPROBE. As demonstrated for the basic helix-loop-helix and homeodomain TF families, our TFBSshape database can be used to compare, qualitatively and quantitatively, the DNA binding specificities of closely related TFs and, thus, uncover differential DNA binding specificities that are not apparent from nucleotide sequence alone.

  14. TFBSshape: a motif database for DNA shape features of transcription factor binding sites

    PubMed Central

    Yang, Lin; Zhou, Tianyin; Dror, Iris; Mathelier, Anthony; Wasserman, Wyeth W.; Gordân, Raluca; Rohs, Remo

    2014-01-01

    Transcription factor binding sites (TFBSs) are most commonly characterized by the nucleotide preferences at each position of the DNA target. Whereas these sequence motifs are quite accurate descriptions of DNA binding specificities of transcription factors (TFs), proteins recognize DNA as a three-dimensional object. DNA structural features refine the description of TF binding specificities and provide mechanistic insights into protein–DNA recognition. Existing motif databases contain extensive nucleotide sequences identified in binding experiments based on their selection by a TF. To utilize DNA shape information when analysing the DNA binding specificities of TFs, we developed a new tool, the TFBSshape database (available at http://rohslab.cmb.usc.edu/TFBSshape/), for calculating DNA structural features from nucleotide sequences provided by motif databases. The TFBSshape database can be used to generate heat maps and quantitative data for DNA structural features (i.e., minor groove width, roll, propeller twist and helix twist) for 739 TF datasets from 23 different species derived from the motif databases JASPAR and UniPROBE. As demonstrated for the basic helix-loop-helix and homeodomain TF families, our TFBSshape database can be used to compare, qualitatively and quantitatively, the DNA binding specificities of closely related TFs and, thus, uncover differential DNA binding specificities that are not apparent from nucleotide sequence alone. PMID:24214955

  15. Identification of the DNA-Binding Domains of Human Replication Protein A That Recognize G-Quadruplex DNA

    PubMed Central

    Prakash, Aishwarya; Natarajan, Amarnath; Marky, Luis A.; Ouellette, Michel M.; Borgstahl, Gloria E. O.

    2011-01-01

    Replication protein A (RPA), a key player in DNA metabolism, has 6 single-stranded DNA-(ssDNA-) binding domains (DBDs) A-F. SELEX experiments with the DBDs-C, -D, and -E retrieve a 20-nt G-quadruplex forming sequence. Binding studies show that RPA-DE binds preferentially to the G-quadruplex DNA, a unique preference not observed with other RPA constructs. Circular dichroism experiments show that RPA-CDE-core can unfold the G-quadruplex while RPA-DE stabilizes it. Binding studies show that RPA-C binds pyrimidine- and purine-rich sequences similarly. This difference between RPA-C and RPA-DE binding was also indicated by the inability of RPA-CDE-core to unfold an oligonucleotide containing a TC-region 5′ to the G-quadruplex. Molecular modeling studies of RPA-DE and telomere-binding proteins Pot1 and Stn1 reveal structural similarities between the proteins and illuminate potential DNA-binding sites for RPA-DE and Stn1. These data indicate that DBDs of RPA have different ssDNA recognition properties. PMID:21772997

  16. Screening for Protein-DNA Interactions by Automatable DNA-Protein Interaction ELISA

    PubMed Central

    Schüssler, Axel; Kolukisaoglu, H. Üner; Koch, Grit; Wallmeroth, Niklas; Hecker, Andreas; Thurow, Kerstin; Zell, Andreas; Harter, Klaus; Wanke, Dierk

    2013-01-01

    DNA-binding proteins (DBPs), such as transcription factors, constitute about 10% of the protein-coding genes in eukaryotic genomes and play pivotal roles in the regulation of chromatin structure and gene expression by binding to short stretches of DNA. Despite their number and importance, only for a minor portion of DBPs the binding sequence had been disclosed. Methods that allow the de novo identification of DNA-binding motifs of known DBPs, such as protein binding microarray technology or SELEX, are not yet suited for high-throughput and automation. To close this gap, we report an automatable DNA-protein-interaction (DPI)-ELISA screen of an optimized double-stranded DNA (dsDNA) probe library that allows the high-throughput identification of hexanucleotide DNA-binding motifs. In contrast to other methods, this DPI-ELISA screen can be performed manually or with standard laboratory automation. Furthermore, output evaluation does not require extensive computational analysis to derive a binding consensus. We could show that the DPI-ELISA screen disclosed the full spectrum of binding preferences for a given DBP. As an example, AtWRKY11 was used to demonstrate that the automated DPI-ELISA screen revealed the entire range of in vitro binding preferences. In addition, protein extracts of AtbZIP63 and the DNA-binding domain of AtWRKY33 were analyzed, which led to a refinement of their known DNA-binding consensi. Finally, we performed a DPI-ELISA screen to disclose the DNA-binding consensus of a yet uncharacterized putative DBP, AtTIFY1. A palindromic TGATCA-consensus was uncovered and we could show that the GATC-core is compulsory for AtTIFY1 binding. This specific interaction between AtTIFY1 and its DNA-binding motif was confirmed by in vivo plant one-hybrid assays in protoplasts. Thus, the value and applicability of the DPI-ELISA screen for de novo binding site identification of DBPs, also under automatized conditions, is a promising approach for a deeper understanding of gene regulation in any organism of choice. PMID:24146751

  17. Site-directed mutagenesis study on DNA binding regions of the mouse homologue of Suppressor of Hairless, RBP-J kappa.

    PubMed Central

    Chung, C N; Hamaguchi, Y; Honjo, T; Kawaichi, M

    1994-01-01

    To map regions important for DNA binding of the mouse homologue of Suppressor of Hairless or RBP-J kappa protein, mutated mouse RBP-J kappa cDNAs were made by insertion of oligonucleotide linkers or base replacement. DNA binding assays using the mutated proteins expressed in COS cells showed that various mutations between 218 Arg and 227 Arg decreased the DNA binding activity drastically. The DNA binding activity was not affected by amino acid replacements within the integrase motif of the RBP-J kappa protein (230His-269His). Replacements between 291Arg and 323Tyr affected the DNA binding activity slightly but reproducibly. These results indicate that the region encompassing 218Arg-227Arg is critical for the DNA binding activity of RBP-J kappa. This region did not show any significant homology to motifs or domains of the previously described DNA binding proteins. Using a truncation mutant protein RBP-J kappa was shown to associate with DNA as a monomer. Images PMID:8065905

  18. Determinants of affinity and mode of DNA binding at the carboxy terminus of the bacteriophage SPO1-encoded type II DNA-binding protein, TF1.

    PubMed

    Andera, L; Geiduschek, E P

    1994-03-01

    The role of the carboxy-terminal amino acids of the bacteriophage SPO1-encoded type II DNA-binding protein, TF1, in DNA binding was analyzed. Chain-terminating mutations truncating the normally 99-amino-acid TF1 at amino acids 96, 97, and 98 were constructed, as were missense mutations substituting cysteine, arginine, and serine for phenylalanine at amino acid 97 and tryptophan for lysine at amino acid 99. The binding of the resulting proteins to a synthetic 44-bp binding site in 5-(hydroxymethyl)uracil DNA, to binding sites in larger SPO1 [5-(hydroxymethyl)uracil-containing] DNA fragments, and to thymine-containing homologous DNA was analyzed by gel retardation and also by DNase I and hydroxy radical footprinting. We conclude that the C tail up to and including phenylalanine at amino acid 97 is essential for DNA binding and that the two C-terminal amino acids, 98 and 99, are involved in protein-protein interactions between TF1 dimers bound to DNA.

  19. Functional interaction of the DNA-binding transcription factor Sp1 through its DNA-binding domain with the histone chaperone TAF-I.

    PubMed

    Suzuki, Toru; Muto, Shinsuke; Miyamoto, Saku; Aizawa, Kenichi; Horikoshi, Masami; Nagai, Ryozo

    2003-08-01

    Transcription involves molecular interactions between general and regulatory transcription factors with further regulation by protein-protein interactions (e.g. transcriptional cofactors). Here we describe functional interaction between DNA-binding transcription factor and histone chaperone. Affinity purification of factors interacting with the DNA-binding domain of the transcription factor Sp1 showed Sp1 to interact with the histone chaperone TAF-I, both alpha and beta isoforms. This interaction was specific as Sp1 did not interact with another histone chaperone CIA nor did other tested DNA-binding regulatory factors (MyoD, NFkappaB, p53) interact with TAF-I. Interaction of Sp1 and TAF-I occurs both in vitro and in vivo. Interaction with TAF-I results in inhibition of DNA-binding, and also likely as a result of such, inhibition of promoter activation by Sp1. Collectively, we describe interaction between DNA-binding transcription factor and histone chaperone which results in negative regulation of the former. This novel regulatory interaction advances our understanding of the mechanisms of eukaryotic transcription through DNA-binding regulatory transcription factors by protein-protein interactions, and also shows the DNA-binding domain to mediate important regulatory interactions.

  20. Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites

    PubMed Central

    Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot

    2013-01-01

    Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958

  1. DNA breathing dynamics distinguish binding from nonbinding consensus sites for transcription factor YY1 in cells.

    PubMed

    Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny

    2012-11-01

    The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.

  2. Detection of DNA damage based on metal-mediated molecular beacon and DNA strands displacement reaction

    NASA Astrophysics Data System (ADS)

    Xiong, Yanxiang; Wei, Min; Wei, Wei; Yin, Lihong; Pu, Yuepu; Liu, Songqin

    2014-01-01

    DNA hairpin structure probes are usually designed by forming intra-molecular duplex based on Watson-Crick hydrogen bonds. In this paper, a molecular beacon based on silver ions-mediated cytosine-Ag+-cytosine base pairs was used to detect DNA. The inherent characteristic of the metal ligation facilitated the design of functional probe and the adjustment of its binding strength compared to traditional DNA hairpin structure probes, which make it be used to detect DNA in a simple, rapid and easy way with the help of DNA strands displacement reaction. The method was sensitive and also possesses the good specificity to differentiate the single base mismatched DNA from the complementary DNA. It was also successfully applied to study the damage effect of classic genotoxicity chemicals such as styrene oxide and sodium arsenite on DNA, which was significant in food science, environmental science and pharmaceutical science.

  3. Nuclear magnetic resonance-based model of a TF1/HmU-DNA complex.

    PubMed

    Silva, M V; Pasternack, L B; Kearns, D R

    1997-12-15

    Transcription factor 1 (TF1), a type II DNA-binding protein encoded by the Bacillus subtilis bacteriophage SPO1, has the capacity for sequence-selective DNA binding and a preference for 5-hydroxymethyl-2'-deoxyuridine (HmU)-containing DNA. In NMR studies of the TF1/HmU-DNA complex, intermolecular NOEs indicate that the flexible beta-ribbon and C-terminal alpha-helix are involved in the DNA-binding site of TF1, placing it in the beta-sheet category of DNA-binding proteins proposed to bind by wrapping two beta-ribbon "arms" around the DNA. Intermolecular and intramolecular NOEs were used to generate an energy-minimized model of the protein-DNA complex in which both DNA bending and protein structure changes are evident.

  4. Acid or erythromycin stress significantly improves transformation efficiency through regulating expression of DNA binding proteins in Lactococcus lactis F44.

    PubMed

    Wang, Binbin; Zhang, Huawei; Liang, Dongmei; Hao, Panlong; Li, Yanni; Qiao, Jianjun

    2017-12-01

    Lactococcus lactis is a gram-positive bacterium used extensively in the dairy industry and food fermentation, and its biological characteristics are usually improved through genetic manipulation. However, poor transformation efficiency was the main restriction factor for the construction of engineered strains. In this study, the transformation efficiency of L. lactis F44 showed a 56.1-fold increase in acid condition (pH 5.0); meanwhile, erythromycin stress (0.04 μg/mL) promoted the transformation efficiency more significantly (76.9-fold). Notably, the transformation efficiency of F44e (L. lactis F44 harboring empty pLEB124) increased up to 149.1-fold under the synergistic stresses of acid and erythromycin. In addition, the gene expression of some DNA binding proteins (DprA, RadA, RadC, RecA, RecQ, and SsbA) changed correspondingly. Especially for radA, 25.1-fold improvement was detected when F44e was exposed to pH 5.0. Overexpression of some DNA binding proteins could improve the transformation efficiency. The results suggested that acid or erythromycin stress could improve the transformation efficiency of L. lactis through regulating gene expression of DNA binding proteins. We have proposed a simple but promising strategy for improving the transformation efficiency of L. lactis and other hard-transformed microorganisms. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  5. On the connection between inherent DNA flexure and preferred binding of hydroxymethyluracil-containing DNA by the type II DNA-binding protein TF1.

    PubMed

    Grove, A; Galeone, A; Mayol, L; Geiduschek, E P

    1996-07-12

    TF1 is a member of the family of type II DNA-binding proteins, which also includes the bacterial HU proteins and the Escherichia coli integration host factor (IHF). Distinctive to TF1, which is encoded by the Bacillus subtilis bacteriophage SPO1, is its preferential binding to DNA in which thymine is replaced by 5-hydroxymethyluracil (hmU), as it is in the phage genome. TF1 binds to preferred sites within the phage genome and generates pronounced DNA bending. The extent to which DNA flexibility contributes to the sequence-specific binding of TF1, and the connection between hmU preference and DNA flexibility has been examined. Model flexible sites, consisting of consecutive mismatches, increase the affinity of thymine-containing DNA for TF1. In particular, tandem mismatches separated by nine base-pairs generate an increase, by orders of magnitude, in the affinity of TF1 for T-containing DNA with the sequence of a preferred TF1 binding site, and fully match the affinity of TF1 for this cognate site in hmU-containing DNA (Kd approximately 3 nM). Other placements of loops generate suboptimal binding. This is consistent with a significant contribution of site-specific DNA flexibility to complex formation. Analysis of complexes with hmU-DNA of decreasing length shows that a major part of the binding affinity is generated within a central 19 bp segment (delta G0 = 41.7 kJ mol-1) with more-distal DNA contributing modestly to the affinity (delta delta G = -0.42 kJ mol-1 bp-1 on increasing duplex length to 37 bp). However, a previously characterised thermostable and more tightly binding mutant TF1, TF1(E15G/T32I), derives most of its extra affinity from interaction with flanking DNA. We propose that inherent but sequence-dependent deformability of hmU-containing DNA underlies the preferential binding of TF1 and that TF1-induced DNA bendings is a result of distortions at two distinct sites separated by 9 bp of duplex DNA.

  6. A Novel DNA Binding Mechanism for maf Basic Region-Leucine Zipper Factors Inferred from a MafA-DNA Complex Structure and Binding Specificities

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lu, Xun; Guanga, Gerald P; Wan, Cheng

    2012-11-13

    MafA is a proto-oncoprotein and is critical for insulin gene expression in pancreatic β-cells. Maf proteins belong to the AP1 superfamily of basic region-leucine zipper (bZIP) transcription factors. Residues in the basic helix and an ancillary N-terminal domain, the Extended Homology Region (EHR), endow maf proteins with unique DNA binding properties: binding a 13 bp consensus site consisting of a core AP1 site (TGACTCA) flanked by TGC sequences and binding DNA stably as monomers. To further characterize maf DNA binding, we determined the structure of a MafA–DNA complex. MafA forms base-specific hydrogen bonds with the flanking G –5C –4 andmore » central C 0/G 0 bases, but not with the core-TGA bases. However, in vitro binding studies utilizing a pulse–chase electrophoretic mobility shift assay protocol revealed that mutating either the core-TGA or flanking-TGC bases dramatically increases the binding off rate. Comparing the known maf structures, we propose that DNA binding specificity results from positioning the basic helix through unique phosphate contacts. The EHR does not contact DNA directly but stabilizes DNA binding by contacting the basic helix. Collectively, these results suggest a novel multistep DNA binding process involving a conformational change from contacting the core-TGA to contacting the flanking-TGC bases.« less

  7. Study on the binding of procaine hydrochloride to DNA/DNA bases and the effect of CdS nanoparticles on the binding behavior.

    PubMed

    Ping, Gang; Lv, Gang; Gutmann, Sebastian; Chen, Chen; Zhang, Renyun; Wang, Xuemei

    2006-01-01

    The interaction between procaine hydrochloride and DNA/DNA bases in the absence and presence of cadmium sulfide (CdS) nanoparticles has been explored in this study by using differential pulse voltammetry, atomic force microscopy (AFM) and so on, which illustrates the different binding behaviors of procaine hydrochloride with different DNA bases. The results clearly indicate that the binding of purines to procaine hydrochloride is stronger than that of pyrimidines and the binding affinity is in the order of G > A > T > C. In addition, it was observed that the presence of CdS nanoparticles could remarkably enhance the probing sensitivity for the interaction between procaine hydrochloride and DNA/DNA bases. Furthermore, AFM study illustrates that procaine hydrochloride can bind to some specific sites of DNA chains, which indicates that procaine hydrochloride may interact with some special sequences of DNA.

  8. Non-intercalative, deoxyribose binding of boric acid to calf thymus DNA.

    PubMed

    Ozdemir, Ayse; Gursaclı, Refiye Tekiner; Tekinay, Turgay

    2014-05-01

    The present study characterizes the effects of the boric acid binding on calf thymus DNA (ct-DNA) by spectroscopic and calorimetric methods. UV-Vis absorbance spectroscopy, circular dichroism (CD) spectroscopy, transmission electron microscopy (TEM), isothermal titration calorimetry (ITC), and Fourier transform infrared (FT-IR) spectroscopy were employed to characterize binding properties. Changes in the secondary structure of ct-DNA were determined by CD spectroscopy. Sizes and morphologies of boric acid-DNA complexes were determined by transmission electron microscopy (TEM). The kinetics of boric acid binding to calf thymus DNA (ct-DNA) was investigated by isothermal titration calorimetry (ITC). ITC results revealed that boric acid exhibits a moderate affinity to ct-DNA with a binding constant (K a) of 9.54 × 10(4) M(-1). FT-IR results revealed that boric acid binds to the deoxyribose sugar of DNA without disrupting the B-conformation at tested concentrations.

  9. A new structural framework for integrating replication protein A into DNA processing machinery

    PubMed Central

    Brosey, Chris A.; Yan, Chunli; Tsutakawa, Susan E.; Heller, William T.; Rambo, Robert P.; Tainer, John A.; Ivanov, Ivaylo; Chazin, Walter J.

    2013-01-01

    By coupling the protection and organization of single-stranded DNA (ssDNA) with recruitment and alignment of DNA processing factors, replication protein A (RPA) lies at the heart of dynamic multi-protein DNA processing machinery. Nevertheless, how RPA coordinates biochemical functions of its eight domains remains unknown. We examined the structural biochemistry of RPA’s DNA-binding activity, combining small-angle X-ray and neutron scattering with all-atom molecular dynamics simulations to investigate the architecture of RPA’s DNA-binding core. The scattering data reveal compaction promoted by DNA binding; DNA-free RPA exists in an ensemble of states with inter-domain mobility and becomes progressively more condensed and less dynamic on binding ssDNA. Our results contrast with previous models proposing RPA initially binds ssDNA in a condensed state and becomes more extended as it fully engages the substrate. Moreover, the consensus view that RPA engages ssDNA in initial, intermediate and final stages conflicts with our data revealing that RPA undergoes two (not three) transitions as it binds ssDNA with no evidence for a discrete intermediate state. These results form a framework for understanding how RPA integrates the ssDNA substrate into DNA processing machinery, provides substrate access to its binding partners and promotes the progression and selection of DNA processing pathways. PMID:23303776

  10. A new structural framework for integrating replication protein A into DNA processing machinery

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brosey, Chris; Yan, Chunli; Tsutakawa, Susan

    2013-01-17

    By coupling the protection and organization of single-stranded DNA (ssDNA) with recruitment and alignment of DNA processing factors, replication protein A (RPA) lies at the heart of dynamic multi-protein DNA processing machinery. Nevertheless, how RPA coordinates biochemical functions of its eight domains remains unknown. We examined the structural biochemistry of RPA's DNA-binding activity, combining small-angle X-ray and neutron scattering with all-atom molecular dynamics simulations to investigate the architecture of RPA's DNA-binding core. The scattering data reveal compaction promoted by DNA binding; DNA-free RPA exists in an ensemble of states with inter-domain mobility and becomes progressively more condensed and less dynamicmore » on binding ssDNA. Our results contrast with previous models proposing RPA initially binds ssDNA in a condensed state and becomes more extended as it fully engages the substrate. Moreover, the consensus view that RPA engages ssDNA in initial, intermediate and final stages conflicts with our data revealing that RPA undergoes two (not three) transitions as it binds ssDNA with no evidence for a discrete intermediate state. These results form a framework for understanding how RPA integrates the ssDNA substrate into DNA processing machinery, provides substrate access to its binding partners and promotes the progression and selection of DNA processing pathways.« less

  11. Position specific variation in the rate of evolution in transcription factor binding sites

    PubMed Central

    Moses, Alan M; Chiang, Derek Y; Kellis, Manolis; Lander, Eric S; Eisen, Michael B

    2003-01-01

    Background The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Results Here we analyse the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikatae to study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artefacts of computational motif finding algorithms. Conclusion As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative sequence data in the identification of transcription factor binding sites and is an important step toward understanding the evolution of functional non-coding DNA. PMID:12946282

  12. Bacteriophage T5 encodes a homolog of the eukaryotic transcription coactivator PC4 implicated in recombination-dependent DNA replication.

    PubMed

    Steigemann, Birthe; Schulz, Annina; Werten, Sebastiaan

    2013-11-15

    The RNA polymerase II cofactor PC4 globally regulates transcription of protein-encoding genes through interactions with unwinding DNA, the basal transcription machinery and transcription activators. Here, we report the surprising identification of PC4 homologs in all sequenced representatives of the T5 family of bacteriophages, as well as in an archaeon and seven phyla of eubacteria. We have solved the crystal structure of the full-length T5 protein at 1.9Å, revealing a striking resemblance to the characteristic single-stranded DNA (ssDNA)-binding core domain of PC4. Intriguing novel structural features include a potential regulatory region at the N-terminus and a C-terminal extension of the homodimerisation interface. The genome organisation of T5-related bacteriophages points at involvement of the PC4 homolog in recombination-dependent DNA replication, strongly suggesting that the protein corresponds to the hitherto elusive replicative ssDNA-binding protein of the T5 family. Our findings imply that PC4-like factors intervene in multiple unwinding-related processes by acting as versatile modifiers of nucleic acid conformation and raise the possibility that the eukaryotic transcription coactivator derives from ancestral DNA replication, recombination and repair factors. © 2013.

  13. The multi-zinc finger protein ZNF217 contacts DNA through a two-finger domain.

    PubMed

    Nunez, Noelia; Clifton, Molly M K; Funnell, Alister P W; Artuz, Crisbel; Hallal, Samantha; Quinlan, Kate G R; Font, Josep; Vandevenne, Marylène; Setiyaputra, Surya; Pearson, Richard C M; Mackay, Joel P; Crossley, Merlin

    2011-11-04

    Classical C2H2 zinc finger proteins are among the most abundant transcription factors found in eukaryotes, and the mechanisms through which they recognize their target genes have been extensively investigated. In general, a tandem array of three fingers separated by characteristic TGERP links is required for sequence-specific DNA recognition. Nevertheless, a significant number of zinc finger proteins do not contain a hallmark three-finger array of this type, raising the question of whether and how they contact DNA. We have examined the multi-finger protein ZNF217, which contains eight classical zinc fingers. ZNF217 is implicated as an oncogene and in repressing the E-cadherin gene. We show that two of its zinc fingers, 6 and 7, can mediate contacts with DNA. We examine its putative recognition site in the E-cadherin promoter and demonstrate that this is a suboptimal site. NMR analysis and mutagenesis is used to define the DNA binding surface of ZNF217, and we examine the specificity of the DNA binding activity using fluorescence anisotropy titrations. Finally, sequence analysis reveals that a variety of multi-finger proteins also contain two-finger units, and our data support the idea that these may constitute a distinct subclass of DNA recognition motif.

  14. The Multi-zinc Finger Protein ZNF217 Contacts DNA through a Two-finger Domain*

    PubMed Central

    Nunez, Noelia; Clifton, Molly M. K.; Funnell, Alister P. W.; Artuz, Crisbel; Hallal, Samantha; Quinlan, Kate G. R.; Font, Josep; Vandevenne, Marylène; Setiyaputra, Surya; Pearson, Richard C. M.; Mackay, Joel P.; Crossley, Merlin

    2011-01-01

    Classical C2H2 zinc finger proteins are among the most abundant transcription factors found in eukaryotes, and the mechanisms through which they recognize their target genes have been extensively investigated. In general, a tandem array of three fingers separated by characteristic TGERP links is required for sequence-specific DNA recognition. Nevertheless, a significant number of zinc finger proteins do not contain a hallmark three-finger array of this type, raising the question of whether and how they contact DNA. We have examined the multi-finger protein ZNF217, which contains eight classical zinc fingers. ZNF217 is implicated as an oncogene and in repressing the E-cadherin gene. We show that two of its zinc fingers, 6 and 7, can mediate contacts with DNA. We examine its putative recognition site in the E-cadherin promoter and demonstrate that this is a suboptimal site. NMR analysis and mutagenesis is used to define the DNA binding surface of ZNF217, and we examine the specificity of the DNA binding activity using fluorescence anisotropy titrations. Finally, sequence analysis reveals that a variety of multi-finger proteins also contain two-finger units, and our data support the idea that these may constitute a distinct subclass of DNA recognition motif. PMID:21908891

  15. Multi-spectroscopic method study the interaction of anti-inflammatory drug ketoprofen and calf thymus DNA and its analytical application.

    PubMed

    Guo, Hongqin; Cai, Changqun; Gong, Hang; Chen, Xiaoming

    2011-06-01

    Interactions of the anti-inflammatory drug ketoprofen with calf thymus DNA (ctDNA) in aqueous solution have been studied by multi-spectroscopic method including resonance light scattering (RLS) technique, ultraviolet spectra (UV), (1)H NMR, etc. The characteristics of RLS spectra, the effective factors and optimum conditions of the reaction have been unequivocally investigated. Mechanism investigations have shown that ketoprofen can bind to ctDNA by groove binding and form large particles, which resulted in the enhancement of RLS intensity. In Critic acid-Na(2)HPO(4) buffer (pH=6.5), ketoprofen has a maximum peak 451.5 nm and the RLS intensity is remarkably enhanced by trace amount of ctDNA due to the interaction between ketoprofen and ctDNA. The enhancement of RLS signal is directly proportional to the concentration of ctDNA in the range of 1.20×10(-6)-1.0×10(-5) mol/L, and its detection limit (3σ) is 1.33×10(-9) mol/L. The method is simple, rapid, practical and relatively free from interference generated by coexisting substance, and was applied to the determination of trace amounts of nucleic acid in synthetic samples with satisfactory results. Copyright © 2011 Elsevier B.V. All rights reserved.

  16. Multi-spectroscopic method study the interaction of anti-inflammatory drug ketoprofen and calf thymus DNA and its analytical application

    NASA Astrophysics Data System (ADS)

    Guo, Hongqin; Cai, Changqun; Gong, Hang; Chen, Xiaoming

    2011-06-01

    Interactions of the anti-inflammatory drug ketoprofen with calf thymus DNA (ctDNA) in aqueous solution have been studied by multi-spectroscopic method including resonance light scattering (RLS) technique, ultraviolet spectra (UV), 1H NMR, etc. The characteristics of RLS spectra, the effective factors and optimum conditions of the reaction have been unequivocally investigated. Mechanism investigations have shown that ketoprofen can bind to ctDNA by groove binding and form large particles, which resulted in the enhancement of RLS intensity. In Critic acid-Na 2HPO 4 buffer (pH = 6.5), ketoprofen has a maximum peak 451.5 nm and the RLS intensity is remarkably enhanced by trace amount of ctDNA due to the interaction between ketoprofen and ctDNA. The enhancement of RLS signal is directly proportional to the concentration of ctDNA in the range of 1.20 × 10 -6-1.0 × 10 -5 mol/L, and its detection limit (3 σ) is 1.33 × 10 -9 mol/L. The method is simple, rapid, practical and relatively free from interference generated by coexisting substance, and was applied to the determination of trace amounts of nucleic acid in synthetic samples with satisfactory results.

  17. Actinomycin D binding mode reveals the basis for its potent HIV-1 and cancer activity

    NASA Astrophysics Data System (ADS)

    Paramanathan, Thayaparan; Vladescu, Ioana D.; McCauley, Micah J.; Rouzina, Ioulia; Williams, Mark C.

    2011-03-01

    Actinomycin D (ActD) is one of the most studied antibiotics, which has been used as an anti-cancer agent and also shown to inhibit HIV reverse transcription. Initial studies with ActD established that it intercalates double stranded DNA (dsDNA). However, recent studies have shown that ActD binds with even higher affinity to single stranded DNA (ssDNA). In our studies we use optical tweezers to stretch and hold single dsDNA molecule at constant force in the presence of varying ActD concentrations until the binding reaches equilibrium. The change in dsDNA length upon ActD binding measured as a function of time yields the rate of binding in addition to the equilibrium lengthening of DNA. The results suggest extremely slow kinetics, on the order of several minutes and 0.52 +/- 0.06 μ M binding affinity. Holding DNA at constant force while stretching and relaxing suggests that ActD binds to two single strands that are close to each other rather than to pure dsDNA or ssDNA. This suggests that biological activity of ActD that contributes towards the inhibition of cellular replication is due to its ability to bind at DNA bubbles during RNA transcription, thereby stalling the transcription process.

  18. Experimental and computational studies on the effects of valganciclovir as an antiviral drug on calf thymus DNA.

    PubMed

    Shahabadi, Nahid; Pourfoulad, Mehdi; Moghadam, Neda Hosseinpour

    2017-01-02

    DNA-binding properties of an antiviral drug, valganciclovir (valcyte) was studied by using emission, absorption, circular dichroism, viscosity, differential pulse voltammetry, fluorescence techniques, and computational studies. The drug bound to calf thymus DNA (ct-DNA) in a groove-binding mode. The calculated binding constant of UV-vis, K a , is comparable to groove-binding drugs. Competitive fluorimetric studies with Hoechst 33258 showed that valcyte could displace the DNA-bound Hoechst 33258. The drug could not displace intercalated methylene blue from DNA double helix. Furthermore, the induced detectable changes in the CD spectrum of ct-DNA as well as changes in its viscosity confirm the groove-binding mode. In addition, an integrated molecular docking was employed to further investigate the binding interactions between valcyte and calf thymus DNA.

  19. MOCCS: Clarifying DNA-binding motif ambiguity using ChIP-Seq data.

    PubMed

    Ozaki, Haruka; Iwasaki, Wataru

    2016-08-01

    As a key mechanism of gene regulation, transcription factors (TFs) bind to DNA by recognizing specific short sequence patterns that are called DNA-binding motifs. A single TF can accept ambiguity within its DNA-binding motifs, which comprise both canonical (typical) and non-canonical motifs. Clarification of such DNA-binding motif ambiguity is crucial for revealing gene regulatory networks and evaluating mutations in cis-regulatory elements. Although chromatin immunoprecipitation sequencing (ChIP-seq) now provides abundant data on the genomic sequences to which a given TF binds, existing motif discovery methods are unable to directly answer whether a given TF can bind to a specific DNA-binding motif. Here, we report a method for clarifying the DNA-binding motif ambiguity, MOCCS. Given ChIP-Seq data of any TF, MOCCS comprehensively analyzes and describes every k-mer to which that TF binds. Analysis of simulated datasets revealed that MOCCS is applicable to various ChIP-Seq datasets, requiring only a few minutes per dataset. Application to the ENCODE ChIP-Seq datasets proved that MOCCS directly evaluates whether a given TF binds to each DNA-binding motif, even if known position weight matrix models do not provide sufficient information on DNA-binding motif ambiguity. Furthermore, users are not required to provide numerous parameters or background genomic sequence models that are typically unavailable. MOCCS is implemented in Perl and R and is freely available via https://github.com/yuifu/moccs. By complementing existing motif-discovery software, MOCCS will contribute to the basic understanding of how the genome controls diverse cellular processes via DNA-protein interactions. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Protein Cofactors Are Essential for High-Affinity DNA Binding by the Nuclear Factor κB RelA Subunit.

    PubMed

    Mulero, Maria Carmen; Shahabi, Shandy; Ko, Myung Soo; Schiffer, Jamie M; Huang, De-Bin; Wang, Vivien Ya-Fan; Amaro, Rommie E; Huxford, Tom; Ghosh, Gourisankar

    2018-05-22

    Transcription activator proteins typically contain two functional domains: a DNA binding domain (DBD) that binds to DNA with sequence specificity and an activation domain (AD) whose established function is to recruit RNA polymerase. In this report, we show that purified recombinant nuclear factor κB (NF-κB) RelA dimers bind specific κB DNA sites with an affinity significantly lower than that of the same dimers from nuclear extracts of activated cells, suggesting that additional nuclear cofactors might facilitate DNA binding by the RelA dimers. Additionally, recombinant RelA binds DNA with relatively low affinity at a physiological salt concentration in vitro. The addition of p53 or RPS3 (ribosomal protein S3) increases RelA:DNA binding affinity 2- to >50-fold depending on the protein and ionic conditions. These cofactor proteins do not form stable ternary complexes, suggesting that they stabilize the RelA:DNA complex through dynamic interactions. Surprisingly, the RelA-DBD alone fails to bind DNA under the same solution conditions even in the presence of cofactors, suggesting an important role of the RelA-AD in DNA binding. Reduced RelA:DNA binding at a physiological ionic strength suggests that multiple cofactors might be acting simultaneously to mitigate the electrolyte effect and stabilize the RelA:DNA complex in vivo. Overall, our observations suggest that the RelA-AD and multiple cofactor proteins function cooperatively to prime the RelA-DBD and stabilize the RelA:DNA complex in cells. Our study provides a mechanism for nuclear cofactor proteins in NF-κB-dependent gene regulation.

  1. Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing.

    PubMed

    Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon

    2010-08-18

    It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

  2. Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales

    NASA Astrophysics Data System (ADS)

    Qian, Long; Kussell, Edo

    The composition of genomes with respect to short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. The underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, which we detect in all species across domains of life. We hypothesize that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Alternative contributions may come from interference of protein-DNA binding with replication and mutational repair processes, which operates with similar rates. We conclude that genome-wide word compositions have been molded by DNA binding proteins through tiny evolutionary steps over timescales spanning millions of generations.

  3. DNA-Binding Interaction Studies of Microwave Assisted Synthesized Sulfonamide Substituted 8-Hydroxyquinoline Derivatives.

    PubMed

    Dixit, Ritu B; Patel, Tarosh S; Vanparia, Satish F; Kunjadiya, Anju P; Keharia, Harish R; Dixit, Bharat C

    2011-01-01

    Sulfonamide substituted 8-hydroxyquinoline derivatives were prepared using a microwave synthesizer. The interaction of sulfonamide substituted 8-hydroxyquinoline derivatives and their transition metal complexes with Plasmid (pUC 19) DNA and Calf Thymus DNA were investigated by UV spectroscopic studies and gel electrophoresis measurements. The interaction between ligand/metal complexes and DNA was carried out by increasing the concentration of DNA from 0 to 12 μl in UV spectroscopic study, while the concentration of DNA in gel electrophoresis remained constant at 10 μl. These studies supported the fact that, the complex binds to DNA by intercalation via ligand into the base pairs of DNA. The relative binding efficacy of the complexes to DNA was much higher than the binding efficacy of ligands, especially the complex of Cu-AHQMBSH had the highest binding ability to DNA. The mobility of the bands decreased as the concentration of the complex was increased, indicating that there was increase in the interaction between the metal ion and DNA. Complexes of AHQMBSH were excellent for DNA binding as compared to HQMABS.

  4. Unique structural modulation of a non-native substrate by cochaperone DnaJ.

    PubMed

    Tiwari, Satyam; Kumar, Vignesh; Jayaraj, Gopal Gunanathan; Maiti, Souvik; Mapa, Koyeli

    2013-02-12

    The role of bacterial DnaJ protein as a cochaperone of DnaK is strongly appreciated. Although DnaJ unaccompanied by DnaK can bind unfolded as well as native substrate proteins, its role as an individual chaperone remains elusive. In this study, we demonstrate that DnaJ binds a model non-native substrate with a low nanomolar dissociation constant and, more importantly, modulates the structure of its non-native state. The structural modulation achieved by DnaJ is different compared to that achieved by the DnaK-DnaJ complex. The nature of structural modulation exerted by DnaJ is suggestive of a unique unfolding activity on the non-native substrate by the chaperone. Furthermore, we demonstrate that the zinc binding motif along with the C-terminal substrate binding domain of DnaJ is necessary and sufficient for binding and the subsequent binding-induced structural alterations of the non-native substrate. We hypothesize that this hitherto unknown structural alteration of non-native states by DnaJ might be important for its chaperoning activity by removing kinetic traps of the folding intermediates.

  5. Deciphering the mechanism of interaction of edifenphos with calf thymus DNA

    NASA Astrophysics Data System (ADS)

    Ahmad, Ajaz; Ahmad, Masood

    2018-01-01

    Edifenphos is an important organophosphate pesticide with many antifungal and anti-insecticidal properties but it may cause potential hazards to human health. In this work, we have tried to explore the binding mode of action and mechanism of edifenphos to calf thymus DNA (CT-DNA). Several experiments such as ultraviolet-visible absorption spectra and emission spectroscopy showed complex formation between edifenphos and CT-DNA and low binding constant values supporting groove binding mode. These results were further confirmed by circular dichroism (CD), CT-DNA melting studies, viscosity measurements, density functional theory and molecular docking. CD study suggests that edifenphos does not alter native structure of CT-DNA. Isothermal calorimetry reveals that binding of edifenphos with CT-DNA is enthalpy driven process. Competitive binding assay and effect of ionic strength showed that edifenphos binds to CT-DNA via groove binding manner. Hence, edifenphos is a minor groove binder preferably interacting with A-T regions with docking score - 6.84 kJ/mol.

  6. Identification of Specific DNA Binding Residues in the TCP Family of Transcription Factors in Arabidopsis[W

    PubMed Central

    Aggarwal, Pooja; Das Gupta, Mainak; Joseph, Agnel Praveen; Chatterjee, Nirmalya; Srinivasan, N.; Nath, Utpal

    2010-01-01

    The TCP transcription factors control multiple developmental traits in diverse plant species. Members of this family share an ∼60-residue-long TCP domain that binds to DNA. The TCP domain is predicted to form a basic helix-loop-helix (bHLH) structure but shares little sequence similarity with canonical bHLH domain. This classifies the TCP domain as a novel class of DNA binding domain specific to the plant kingdom. Little is known about how the TCP domain interacts with its target DNA. We report biochemical characterization and DNA binding properties of a TCP member in Arabidopsis thaliana, TCP4. We have shown that the 58-residue domain of TCP4 is essential and sufficient for binding to DNA and possesses DNA binding parameters comparable to canonical bHLH proteins. Using a yeast-based random mutagenesis screen and site-directed mutants, we identified the residues important for DNA binding and dimer formation. Mutants defective in binding and dimerization failed to rescue the phenotype of an Arabidopsis line lacking the endogenous TCP4 activity. By combining structure prediction, functional characterization of the mutants, and molecular modeling, we suggest a possible DNA binding mechanism for this class of transcription factors. PMID:20363772

  7. 5-Hydroxymethylcytosine in E-box motifs ACAT|GTG and ACAC|GTG increases DNA-binding of the B-HLH transcription factor TCF4.

    PubMed

    Khund-Sayeed, Syed; He, Ximiao; Holzberg, Timothy; Wang, Jun; Rajagopal, Divya; Upadhyay, Shriyash; Durell, Stewart R; Mukherjee, Sanjit; Weirauch, Matthew T; Rose, Robert; Vinson, Charles

    2016-09-12

    We evaluated DNA binding of the B-HLH family members TCF4 and USF1 using protein binding microarrays (PBMs) containing double-stranded DNA probes with cytosine on both strands or 5-methylcytosine (5mC) or 5-hydroxymethylcytosine (5hmC) on one DNA strand and cytosine on the second strand. TCF4 preferentially bound the E-box motif (CAN|NTG) with strongest binding to the 8-mer CAG|GTGGT. 5mC uniformly decreases DNA binding of both TCF4 and USF1. The bulkier 5hmC also inhibited USF1 binding to DNA. In contrast, 5hmC dramatically enhanced TCF4 binding to E-box motifs ACAT|GTG and ACAC|GTG, being better bound than any 8-mer containing cytosine. Examination of X-ray structures of the closely related TCF3 and USF1 bound to DNA suggests TCF3 can undergo a conformational shift to preferentially bind to 5hmC while the USF1 basic region is bulkier and rigid precluding a conformation shift to bind 5hmC. These results greatly expand the regulatory DNA sequence landscape bound by TCF4.

  8. [Features of binding of proflavine to DNA at different DNA-ligand concentration ratios].

    PubMed

    Berezniak, E G; gladkovskaia, N A; Khrebtova, A S; Dukhopel'nikov, E V; Zinchenko, A V

    2009-01-01

    The binding of proflavine to calf thymus DNA has been studied using the methods of differential scanning calorimetry and spectrophotometry. It was shown that proflavine can interact with DNA by at least 3 binding modes. At high DNA-ligand concentration ratios (P/D), proflavine intercalates into both GC- and AT-sites, with a preference to GC-rich sequences. At low P/D ratios proflavine interacts with DNA by the external binding mode. From spectrophotometric concentration dependences, the parameters of complexing of proflavine with DNA were calculated. Thermodynamic parameters of DNA melting were calculated from differential scanning calorimetry data.

  9. Dpb11 may function with RPA and DNA to initiate DNA replication.

    PubMed

    Bruck, Irina; Dhingra, Nalini; Martinez, Matthew P; Kaplan, Daniel L

    2017-01-01

    Dpb11 is required for the initiation of DNA replication in budding yeast. We found that Dpb11 binds tightly to single-stranded DNA (ssDNA) or branched DNA structures, while its human homolog, TopBP1, binds tightly to branched-DNA structures. We also found that Dpb11 binds stably to CDK-phosphorylated RPA, the eukaryotic ssDNA binding protein, in the presence of branched DNA. A Dpb11 mutant specifically defective for DNA binding did not exhibit tight binding to RPA in the presence of DNA, suggesting that Dpb11-interaction with DNA may promote the recruitment of RPA to melted DNA. We then characterized a mutant of Dpb11 that is specifically defective in DNA binding in budding yeast cells. Expression of dpb11-m1,2,3,5,ΔC results in a substantial decrease in RPA recruitment to origins, suggesting that Dpb11 interaction with DNA may be required for RPA recruitment to origins. Expression of dpb11-m1,2,3,5,ΔC also results in diminished GINS interaction with Mcm2-7 during S phase, while Cdc45 interaction with Mcm2-7 is like wild-type. The reduced GINS interaction with Mcm2-7 may be an indirect consequence of diminished origin melting. We propose that the tight interaction between Dpb11, CDK-phosphorylated RPA, and branched-DNA may be required for the essential function of stabilizing melted origin DNA in vivo. We also propose an alternative model, wherein Dpb11-DNA interaction is required for some other function in DNA replication initiation, such as helicase activation.

  10. Concerted formation of macromolecular Suppressor–mutator transposition complexes

    PubMed Central

    Raina, Ramesh; Schläppi, Michael; Karunanandaa, Balasulojini; Elhofy, Adam; Fedoroff, Nina

    1998-01-01

    Transposition of the maize Suppressor–mutator (Spm) transposon requires two element-encoded proteins, TnpA and TnpD. Although there are multiple TnpA binding sites near each element end, binding of TnpA to DNA is not cooperative, and the binding affinity is not markedly affected by the number of binding sites per DNA fragment. However, intermolecular complexes form cooperatively between DNA fragments with three or more TnpA binding sites. TnpD, itself not a sequence-specific DNA-binding protein, binds to TnpA and stabilizes the TnpA–DNA complex. The high redundancy of TnpA binding sites at both element ends and the protein–protein interactions between DNA-bound TnpA complexes and between these and TnpD imply a concerted transition of the element from a linear to a protein crosslinked transposition complex within a very narrow protein concentration range. PMID:9671711

  11. Transcription factors as readers and effectors of DNA methylation.

    PubMed

    Zhu, Heng; Wang, Guohua; Qian, Jiang

    2016-08-01

    Recent technological advances have made it possible to decode DNA methylomes at single-base-pair resolution under various physiological conditions. Many aberrant or differentially methylated sites have been discovered, but the mechanisms by which changes in DNA methylation lead to observed phenotypes, such as cancer, remain elusive. The classical view of methylation-mediated protein-DNA interactions is that only proteins with a methyl-CpG binding domain (MBD) can interact with methylated DNA. However, evidence is emerging to suggest that transcription factors lacking a MBD can also interact with methylated DNA. The identification of these proteins and the elucidation of their characteristics and the biological consequences of methylation-dependent transcription factor-DNA interactions are important stepping stones towards a mechanistic understanding of methylation-mediated biological processes, which have crucial implications for human development and disease.

  12. Transcription factors as readers and effectors of DNA methylation

    PubMed Central

    Zhu, Heng; Wang, Guohua; Qian, Jiang

    2017-01-01

    Recent technological advances have made it possible to decode DNA methylomes at single-base-pair resolution under various physiological conditions. Many aberrant or differentially methylated sites have been discovered, but the mechanisms by which changes in DNA methylation lead to observed phenotypes, such as cancer, remain elusive. The classical view of methylation-mediated protein-DNA interactions is that only proteins with a methyl-CpG binding domain (MBD) can interact with methylated DNA. However, evidence is emerging to suggest that transcription factors lacking a MBD can also interact with methylated DNA. The identification of these proteins and the elucidation of their characteristics and the biological consequences of methylation-dependent transcription factor-DNA interactions are important stepping stones towards a mechanistic understanding of methylation-mediated biological processes, which have crucial implications for human development and disease. PMID:27479905

  13. A Key Evolutionary Mutation Enhances DNA Binding of the FOXP2 Forkhead Domain.

    PubMed

    Morris, Gavin; Fanucchi, Sylvia

    2016-04-05

    Forkhead box (FOX) transcription factors share a conserved forkhead DNA binding domain (FHD) and are key role players in the development of many eukaryotic species. Their involvement in various congenital disorders and cancers makes them clinically relevant targets for novel therapeutic strategies. Among them, the FOXP subfamily of multidomain transcriptional repressors is unique in its ability to form DNA binding homo and heterodimers. The truncated FOXP2 FHD, in the absence of the leucine zipper, exists in equilibrium between monomeric and domain-swapped dimeric states in vitro. As a consequence, determining the DNA binding properties of the FOXP2 FHD becomes inherently difficult. In this work, two FOXP2 FHD hinge loop mutants have been generated to successfully prevent both the formation (A539P) and the dissociation (F541C) of the homodimers. This allows for the separation of the two species for downstream DNA binding studies. Comparison of DNA binding of the different species using electrophoretic mobility shift assay, fluorescence anisotropy and isothermal titration calorimetry indicates that the wild-type FOXP2 FHD binds DNA as a monomer. However, comparison of the DNA-binding energetics of the monomer and wild-type FHD, reveals that there is a difference in the mechanism of binding between the two species. We conclude that the naturally occurring reverse mutation (P539A) seen in the FOXP subfamily increases DNA binding affinity and may increase the potential for nonspecific binding compared to other FOX family members.

  14. Probing the Characterization of the Interaction of Aflatoxins B1 and G1 with Calf Thymus DNA In Vitro

    PubMed Central

    Ma, Liang; Wang, Jiaman; Zhang, Yuhao

    2017-01-01

    The binding characterization of aflatoxins with calf thymus DNA (ctDNA) under physiological conditions was investigated. Multispectroscopic techniques, ctDNA melting, viscosity measurements, and molecular docking techniques were employed to elucidate the binding mechanism of the aflatoxins with DNA. The fluorescence results indicated that both aflatoxin B1 (AFB1) and aflatoxin G1 (AFG1) bound to the ctDNA, forming complexes through hydrogen bonding. The binding constants of AFB1 and AFG1 with ctDNA reached up to 103 L·mol−1 and 104 L·mol−1, respectively, and AFG1 exhibited a higher binding propensity than that of AFB1. Furthermore, both AFB1 and AFG1 bound to the ctDNA through groove binding, as evidenced by the results of the spectroscopic, iodide quenching effect, viscosity, and ctDNA melting measurements. Changes in the circular dichroism signal manifested that both AFB1 and AFG1 induced an increase in the right-handed helicity, but only minimally influenced the base stacking of the DNA. A molecular docking study of the aflatoxin’s binding with the DNA revealed a groove binding mode, which was driven mainly by hydrogen bonding. This study of aflatoxin–ctDNA interaction may provide novel insights into the toxicological effect of the mycotoxins. PMID:28671585

  15. Correlation of Local Effects of DNA Sequence and Position of Beta-Alanine Inserts with Polyamide-DNA Complex Binding Affinities and Kinetics

    PubMed Central

    Wang, Shuo; Nanjunda, Rupesh; Aston, Karl; Bashkin, James K.; Wilson, W. David

    2012-01-01

    In order to better understand the effects of β-alanine (β) substitution and the number of heterocycles on DNA binding affinity and selectivity, the interactions of an eight-ring hairpin polyamide (PA) and two β derivatives as well as a six-heterocycle analog have been investigated with their cognate DNA sequence, 5′-TGGCTT-3′. Binding selectivity and the effects of β have been investigated with the cognate and five mutant DNAs. A set of powerful and complementary methods have been employed for both energetic and structural evaluations: UV-melting, biosensor-surface plasmon resonance, isothermal titration calorimetry, circular dichroism and a DNA ligation ladder global structure assay. The reduced number of heterocycles in the six-ring PA weakens the binding affinity; however, the smaller PA aggregates significantly less than the larger PAs, and allows us to obtain the binding thermodynamics. The PA-DNA binding enthalpy is large and negative with a large negative ΔCp, and is the primary driving component of the Gibbs free energy. The complete SPR binding results clearly show that β substitutions can substantially weaken the binding affinity of hairpin PAs in a position-dependent manner. More importantly, the changes in PA binding to the mutant DNAs further confirm the position-dependent effects on PA-DNA interaction affinity. Comparison of mutant DNA sequences also shows a different effect in recognition of T•A versus A•T base pairs. The effects of DNA mutations on binding of a single PA as well as the effects of the position of β substitution on binding tell a clear and very important story about sequence dependent binding of PAs to DNA. PMID:23167504

  16. Probing the electrostatics and pharmacologic modulation of sequence-specific binding by the DNA-binding domain of the ETS-family transcription factor PU.1: a binding affinity and kinetics investigation

    PubMed Central

    Munde, Manoj; Poon, Gregory M. K.; Wilson, W. David

    2013-01-01

    Members of the ETS family of transcription factors regulate a functionally diverse array of genes. All ETS proteins share a structurally-conserved but sequence-divergent DNA-binding domain, known as the ETS domain. Although the structure and thermodynamics of the ETS-DNA complexes are well known, little is known about the kinetics of sequence recognition, a facet that offers potential insight into its molecular mechanism. We have characterized DNA binding by the ETS domain of PU.1 by biosensor-surface plasmon resonance (SPR). SPR analysis revealed a striking kinetic profile for DNA binding by the PU.1 ETS domain. At low salt concentrations, it binds high-affinity cognate DNA with a very slow association rate constant (≤105 M−1 s−1), compensated by a correspondingly small dissociation rate constant. The kinetics are strongly salt-dependent but mutually balance to produce a relatively weak dependence in the equilibrium constant. This profile contrasts sharply with reported data for other ETS domains (e.g., Ets-1, TEL) for which high-affinity binding is driven by rapid association (>107 M−1 s−1). We interpret this difference in terms of the hydration properties of ETS-DNA binding and propose that at least two mechanisms of sequence recognition are employed by this family of DNA-binding domain. Additionally, we use SPR to demonstrate the potential for pharmacological inhibition of sequence-specific ETS-DNA binding, using the minor groove-binding distamycin as a model compound. Our work establishes SPR as a valuable technique for extending our understanding of the molecular mechanisms of ETS-DNA interactions as well as developing potential small-molecule agents for biotechnological and therapeutic purposes. PMID:23416556

  17. Molecular simulations of polycation-DNA binding exploring the effect of peptide chemistry and sequence in nuclear localization sequence based polycations.

    PubMed

    Elder, Robert M; Jayaraman, Arthi

    2013-10-10

    Gene therapy relies on the delivery of DNA into cells, and polycations are one class of vectors enabling efficient DNA delivery. Nuclear localization sequences (NLS), cationic oligopeptides that target molecules for nuclear entry, can be incorporated into polycations to improve their gene delivery efficiency. We use simulations to study the effect of peptide chemistry and sequence on the DNA-binding behavior of NLS-grafted polycations by systematically mutating the residues in the grafts, which are based on the SV40 NLS (peptide sequence PKKKRKV). Replacing arginine (R) with lysine (K) reduces binding strength by eliminating arginine-DNA interactions, but placing R in a less hindered location (e.g., farther from the grafting point to the polycation backbone) has surprisingly little effect on polycation-DNA binding strength. Changing the positions of the hydrophobic proline (P) and valine (V) residues relative to the polycation backbone changes hydrophobic aggregation within the polycation and, consequently, changes the conformational entropy loss that occurs upon polycation-DNA binding. Since conformational entropy loss affects the free energy of binding, the positions of P and V in the grafts affect DNA binding affinity. The insight from this work guides synthesis of polycations with tailored DNA binding affinity and, in turn, efficient DNA delivery.

  18. In vitro DNA binding studies of Aspartame, an artificial sweetener.

    PubMed

    Kashanian, Soheila; Khodaei, Mohammad Mehdi; Kheirdoosh, Fahimeh

    2013-03-05

    A number of small molecules bind directly and selectively to DNA, by inhibiting replication, transcription or topoisomerase activity. In this work the interaction of native calf thymus DNA (CT-DNA) with Aspartame (APM), an artificial sweeteners was studied at physiological pH. DNA binding study of APM is useful to understand APM-DNA interaction mechanism and to provide guidance for the application and design of new and safer artificial sweeteners. The interaction was investigated using spectrophotometric, spectrofluorometric competition experiment and circular dichroism (CD). Hypochromism and red shift are shown in UV absorption band of APM. A strong fluorescence quenching reaction of DNA to APM was observed and the binding constants (Kf) of DNA with APM and corresponding number of binding sites (n) were calculated at different temperatures. Thermodynamic parameters, enthalpy changes (ΔH) and entropy changes (ΔS) were calculated to be +181kJmol(-1) and +681Jmol(-1)K(-1) according to Van't Hoff equation, which indicated that reaction is predominantly entropically driven. Moreover, spectrofluorometric competition experiment and circular dichroism (CD) results are indicative of non-intercalative DNA binding nature of APM. We suggest that APM interacts with calf thymus DNA via groove binding mode with an intrinsic binding constant of 5×10(+4)M(-1). Copyright © 2013 Elsevier B.V. All rights reserved.

  19. Detection of DNA damage in individual cells by flow cytometric analysis using anti-DNA monoclonal antibody

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Frankfurt, O.S.

    A new method for the measurement of DNA damage in individual cells treated with alkylating agents is described. The method is based on the binding of anti-DNA monoclonal antibody to DNA in situ. Binding of antibody was evaluated by flow cytometry with indirect immunofluorescence. No binding of antibody to DNA in non-treated HeLa S3 cells was detected. Treatment of cells with HN2 or L-phenylalanine mustard induced binding of antibody to DNA in situ. Binding of antibody was observed after treating cells with doses of drugs which reduced the surviving fraction below 20%. Intensity of binding increased in proportion to themore » drug dose. In HN2-treated cells a cell subset with the lowest antibody binding was observed among cells in G1 phase. Binding of antibody to DNA in HN2-treated cells was eliminated by single-strand (ss) specific S1 nuclease. In competition assay, antibody was inhibited by thermally denatured DNA, but not by native double-stranded (ds) DNA, RNA, nucleosides and deoxyribohomopolymers. Immunoreactivity of cells with the monoclonal antibody F7-26 may be a useful probe for the assessment of cell damage induced by alkylating agents, especially in heterogeneous cell populations.« less

  20. Ternary copper(II) complexes with amino acid chains and heterocyclic bases: DNA binding, cytotoxic and cell apoptosis induction properties.

    PubMed

    Ma, Tieliang; Xu, Jun; Wang, Yuan; Yu, Hao; Yang, Yong; Liu, Yang; Ding, Weiliang; Zhu, Wenjiao; Chen, Ruhua; Ge, Zhijun; Tan, Yongfei; Jia, Lei; Zhu, Taofeng

    2015-03-01

    Nowadays, chemotherapy is a common means of oncology. However, it is difficult to find excellent chemotherapy drugs. Here we reported three new ternary copper(II) complexes which have potential chemotherapy characteristics with reduced Schiff base ligand and heterocyclic bases (TBHP), [Cu(phen)(TBHP)]H2O (1), [Cu(dpz)(TBHP)]H2O (2) and [Cu(dppz)(TBHP)]H2O (3) (phen=1,10-phenanthroline, dpz=dipyrido [3,2:2',3'-f]quinoxaline, dppz=dipyrido [3,2-a:2',3'-c]phenazine, H2TBHP=2-(3,5-di-tert-butyl-2-hydroxybenzylamino)-2-benzyl-acetic acid). The DNA-binding properties of the complexes were investigated by spectrometric titrations, ethidium bromide displacement experiments and viscosity measurements. The results indicated that the three complexes, especially the complex 13, can strongly bind to calf-thymus DNA (CT-DNA). The intrinsic binding constants Kb of the ternary copper(II) complexes with CT-DNA were 1.37×10(5), 1.81×10(5) and 3.21×10(5) for 1, 2 and 3 respectively. Comparative cytotoxic activities of the copper(II) complexes were also determined by 3-(4,5-dimethylthiazol-2yl)-2,5-diphenyltetrazolium bromide (MTT) assay. The results showed that the ternary copper(II) complexes had significant cytotoxic activity against the human lung cancer (A549), human esophageal cancer (Eca109) and human gastric cancer (SGC7901) cell lines. Cell apoptosis were detected by AnnexinV/PI flow cytometry and by Western blotting with the protein expression of p53, Bax and Bcl-2. All the three copper complexes can effectively induce apoptosis of the three human tumor cells. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. The human mitochondrial single-stranded DNA-binding protein displays distinct kinetics and thermodynamics of DNA binding and exchange

    PubMed Central

    Qian, Yufeng; Johnson, Kenneth A.

    2017-01-01

    The human mitochondrial ssDNA-binding protein (mtSSB) is a homotetrameric protein, involved in mtDNA replication and maintenance. Although mtSSB is structurally similar to SSB from Escherichia coli (EcoSSB), it lacks the C-terminal disordered domain, and little is known about the biophysics of mtSSB–ssDNA interactions. Here, we characterized the kinetics and thermodynamics of mtSSB binding to ssDNA by equilibrium titrations and stopped-flow kinetic measurements. We show that the mtSSB tetramer can bind to ssDNA in two distinct binding modes: (SSB)30 and (SSB)60, defined by DNA binding site sizes of 30 and 60 nucleotides, respectively. We found that the binding mode is modulated by magnesium ion and NaCl concentration, but unlike EcoSSB, the mtSSB does not show negative intersubunit cooperativity. Global fitting of both the equilibrium and kinetic data afforded estimates for the rate and equilibrium constants governing the formation of (SSB)60 and (SSB)30 complexes and for the transitions between the two binding modes. We found that the mtSSB tetramer binds to ssDNA with a rate constant near the diffusion limit (2 × 109 m−1 s−1) and that longer DNA (≥60 nucleotides) rapidly wraps around all four monomers, as revealed by FRET assays. We also show that the mtSSB tetramer can directly transfer from one ssDNA molecule to another via an intermediate with two DNA molecules bound to the mtSSB. In conclusion, our results indicate that human mtSSB shares many physicochemical properties with EcoSSB and that the differences may be explained by the lack of an acidic, disordered C-terminal tail in human mtSSB protein. PMID:28615444

  2. Sliding of proteins non-specifically bound to DNA: Brownian dynamics studies with coarse-grained protein and DNA models.

    PubMed

    Ando, Tadashi; Skolnick, Jeffrey

    2014-12-01

    DNA binding proteins efficiently search for their cognitive sites on long genomic DNA by combining 3D diffusion and 1D diffusion (sliding) along the DNA. Recent experimental results and theoretical analyses revealed that the proteins show a rotation-coupled sliding along DNA helical pitch. Here, we performed Brownian dynamics simulations using newly developed coarse-grained protein and DNA models for evaluating how hydrodynamic interactions between the protein and DNA molecules, binding affinity of the protein to DNA, and DNA fluctuations affect the one dimensional diffusion of the protein on the DNA. Our results indicate that intermolecular hydrodynamic interactions reduce 1D diffusivity by 30%. On the other hand, structural fluctuations of DNA give rise to steric collisions between the CG-proteins and DNA, resulting in faster 1D sliding of the protein. Proteins with low binding affinities consistent with experimental estimates of non-specific DNA binding show hopping along the CG-DNA. This hopping significantly increases sliding speed. These simulation studies provide additional insights into the mechanism of how DNA binding proteins find their target sites on the genome.

  3. ( sup 3 H)-DOB(4-bromo-2,5-dimethoxyphenylisopropylamine) and ( sup 3 H) ketanserin label two affinity states of the cloned human 5-hydroxytryptamine2 receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Branchek, T.; Adham, N.; Macchi, M.

    1990-11-01

    The binding properties of the 5-hydroxytryptamine2 (5-HT2) receptor have been the subject of much interest and debate in recent years. The hallucinogenic amphetamine derivative 4-bromo-2,5-dimethoxyphenylisopropylamine (DOB) has been shown to bind to a small number of binding sites with properties very similar to (3H)ketanserin-labeled 5-HT2 receptors, but with much higher agonist affinities. Some researchers have interpreted this as evidence for the existence of a new subtype of 5-HT2 receptor (termed 5-HT2A), whereas others have interpreted these data as indicative of agonist high affinity and agonist low affinity states for the 5-HT2 receptor. In this investigation, a cDNA clone encoding themore » serotonin 5-HT2 receptor was transiently transfected into monkey kidney Cos-7 cells and stably transfected into mouse fibroblast L-M(TK-) cells. In both systems, expression of this single serotonin receptor cDNA led to the appearance of both (3H)DOB and (3H)ketanserin binding sites with properties that matched their binding characteristics in mammalian brain homogenates. Addition of guanosine 5'-(beta, gamma-imido) triphosphate (Gpp(NH)p) to this system caused a rightward shift and steepening of agonist competition curves for (3H) ketanserin binding, converting a two-site binding curve to a single low affinity binding state. Gpp(NH)p addition also caused a 50% decrease in the number of high affinity (3H)DOB binding sites, with no change in the dissociation constant of the remaining high affinity states. These data on a single human 5-HT2 receptor cDNA expressed in two different transfection host cells indicate that (3H)DOB and (3H)ketanserin binding reside on the same gene product, apparently interacting with agonist and antagonist conformations of a single human 5-HT2 receptor protein.« less

  4. Detection of Z DNA binding proteins in tissue culture cells.

    PubMed Central

    Leith, I R; Hay, R T; Russell, W C

    1988-01-01

    A gel electrophoresis DNA binding assay to detect Z DNA binding proteins has been developed utilising [32P] labelled poly [d(G-C)] which was converted to the Z form by incubation in 100 microM Co(NH3)6Cl3. The parameters of the assay were established using a Z DNA antibody as a model system and then applied to extracts of Hela and BHK21 cells. Using an anti-Z DNA antibody conditions were established which allowed resolution of antibody-DNA complexes and free DNA in the presence of 100 microM Co(NH3)6Cl3. The inclusion of unlabelled complementary homopolymers eliminated non-specific binding to the labelled Z-DNA probe. Competition experiments demonstrated that the assay was highly specific for double stranded non-B DNA. Application of the technique to extracts of mammalian cells demonstrated that human and hamster cells contain Z-DNA binding proteins; further characterisation by a blotting technique indicated that a 56,000 molecular weight cell protein preferentially binds Z-DNA. Images PMID:3419919

  5. Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales

    NASA Astrophysics Data System (ADS)

    Qian, Long; Kussell, Edo

    2016-10-01

    The composition of a genome with respect to all possible short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional DNA binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. We demonstrate that the underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, a signal that we detect in all species across domains of life. We consider the possibility that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Likewise, we show that evolutionary mechanisms based on interference of protein-DNA binding with replication and mutational repair processes could yield similar results and operate with similar rates. On the basis of these modeling and bioinformatic results, we conclude that genome-wide word compositions have been molded by DNA binding proteins acting through tiny evolutionary steps over time scales spanning millions of generations.

  6. Changes in conformational dynamics of basic side chains upon protein-DNA association.

    PubMed

    Esadze, Alexandre; Chen, Chuanying; Zandarashvili, Levani; Roy, Sourav; Pettitt, B Montgometry; Iwahara, Junji

    2016-08-19

    Basic side chains play major roles in recognition of nucleic acids by proteins. However, dynamic properties of these positively charged side chains are not well understood. In this work, we studied changes in conformational dynamics of basic side chains upon protein-DNA association for the zinc-finger protein Egr-1. By nuclear magnetic resonance (NMR) spectroscopy, we characterized the dynamics of all side-chain cationic groups in the free protein and in the complex with target DNA. Our NMR order parameters indicate that the arginine guanidino groups interacting with DNA bases are strongly immobilized, forming rigid interfaces. Despite the strong short-range electrostatic interactions, the majority of the basic side chains interacting with the DNA phosphates exhibited high mobility, forming dynamic interfaces. In particular, the lysine side-chain amino groups exhibited only small changes in the order parameters upon DNA-binding. We found a similar trend in the molecular dynamics (MD) simulations for the free Egr-1 and the Egr-1-DNA complex. Using the MD trajectories, we also analyzed side-chain conformational entropy. The interfacial arginine side chains exhibited substantial entropic loss upon binding to DNA, whereas the interfacial lysine side chains showed relatively small changes in conformational entropy. These data illustrate different dynamic characteristics of the interfacial arginine and lysine side chains. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. DNA-binding mechanism of the Escherichia coli Ada O6-alkylguanine–DNA alkyltransferase

    PubMed Central

    Verdemato, Philip E.; Brannigan, James A.; Damblon, Christian; Zuccotto, Fabio; Moody, Peter C. E.; Lian, Lu-Yun

    2000-01-01

    The C-terminal domain of the Escherichia coli Ada protein (Ada-C) aids in the maintenance of genomic integrity by efficiently repairing pre-mutagenic O6-alkylguanine lesions in DNA. Structural and thermodynamic studies were carried out to obtain a model of the DNA-binding process. Nuclear magnetic resonance (NMR) studies map the DNA-binding site to helix 5, and a loop region (residues 151–160) which form the recognition helix and the ‘wing’ of a helix–turn–wing motif, respectively. The NMR data also suggest the absence of a large conformational change in the protein upon binding to DNA. Hence, an O6-methylguanine (O6meG) lesion would be inaccessible to active site nucleophile Cys146 if the modified base remained stacked within the DNA duplex. The experimentally determined DNA-binding face of Ada-C was used in combination with homology modelling, based on the catabolite activator protein, and the accepted base-flipping mechanism, to construct a model of how Ada-C binds to DNA in a productive manner. To complement the structural studies, thermodynamic data were obtained which demonstrate that binding to unmethylated DNA was entropically driven, whilst the demethylation reaction provoked an exothermic heat change. Methylation of Cys146 leads to a loss of structural integrity of the DNA-binding subdomain. PMID:11000262

  8. Modulation of DNA binding by gene-specific transcription factors.

    PubMed

    Schleif, Robert F

    2013-10-01

    The transcription of many genes, particularly in prokaryotes, is controlled by transcription factors whose activity can be modulated by controlling their DNA binding affinity. Understanding the molecular mechanisms by which DNA binding affinity is regulated is important, but because forming definitive conclusions usually requires detailed structural information in combination with data from extensive biophysical, biochemical, and sometimes genetic experiments, little is truly understood about this topic. This review describes the biological requirements placed upon DNA binding transcription factors and their consequent properties, particularly the ways that DNA binding affinity can be modulated and methods for its study. What is known and not known about the mechanisms modulating the DNA binding affinity of a number of prokaryotic transcription factors, including CAP and lac repressor, is provided.

  9. Surface shapes and surrounding environment analysis of single- and double-stranded DNA-binding proteins in protein-DNA interface.

    PubMed

    Wang, Wei; Liu, Juan; Sun, Lin

    2016-07-01

    Protein-DNA bindings are critical to many biological processes. However, the structural mechanisms underlying these interactions are not fully understood. Here, we analyzed the residues shape (peak, flat, or valley) and the surrounding environment of double-stranded DNA-binding proteins (DSBs) and single-stranded DNA-binding proteins (SSBs) in protein-DNA interfaces. In the results, we found that the interface shapes, hydrogen bonds, and the surrounding environment present significant differences between the two kinds of proteins. Built on the investigation results, we constructed a random forest (RF) classifier to distinguish DSBs and SSBs with satisfying performance. In conclusion, we present a novel methodology to characterize protein interfaces, which will deepen our understanding of the specificity of proteins binding to ssDNA (single-stranded DNA) or dsDNA (double-stranded DNA). Proteins 2016; 84:979-989. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  10. Binding mechanism of PicoGreen to DNA characterized by magnetic tweezers and fluorescence spectroscopy.

    PubMed

    Wang, Ying; Schellenberg, Helene; Walhorn, Volker; Toensing, Katja; Anselmetti, Dario

    2017-09-01

    Fluorescent dyes are broadly used in many biotechnological applications to detect and visualize DNA molecules. However, their binding to DNA alters the structural and nanomechanical properties of DNA and, thus, interferes with associated biological processes. In this work we employed magnetic tweezers and fluorescence spectroscopy to investigate the binding of PicoGreen to DNA at room temperature in a concentration-dependent manner. PicoGreen is an ultrasensitive quinolinium nucleic acid stain exhibiting hardly any background signal from unbound dye molecules. By means of stretching and overwinding single, torsionally constrained, nick-free double-stranded DNA molecules, we acquired force-extension and supercoiling curves which allow quantifying DNA contour length, persistence length and other thermodynamical binding parameters, respectively. The results of our magnetic tweezers single-molecule binding study were well supported through analyzing the fluorescent spectra of stained DNA. On the basis of our work, we could identify a concentration-dependent bimodal binding behavior, where, apparently, PicoGreen associates to DNA as an intercalator and minor-groove binder simultaneously.

  11. Nonspecific DNA Binding and Bending by HUαβ: Interfaces of the Three Binding Modes Characterized by Salt Dependent Thermodynamics

    PubMed Central

    Koh, Junseock; Shkel, Irina; Saecker, Ruth M.; Record, M. Thomas

    2011-01-01

    Previous ITC and FRET studies demonstrated that Escherichia coli HUαβ binds nonspecifically to duplex DNA in three different binding modes: a tighter-binding 34 bp mode which interacts with DNA in large (>34 bp) gaps between bound proteins, reversibly bending it 140° and thereby increasing its flexibility, and two weaker, modestly cooperative small-site-size modes (10 bp, 6 bp) useful for filling gaps between bound proteins shorter than 34 bp. Here we use ITC to determine the thermodynamics of these binding modes as a function of salt concentration, and deduce that DNA in the 34 bp mode is bent around but not wrapped on the body of HU, in contrast to specific binding of IHF. Analyses of binding isotherms (8, 15, 34 bp DNA) and initial binding heats (34, 38, 160 bp DNA) reveal that all three modes have similar log-log salt concentration derivatives of the binding constants (Ski) even though their binding site sizes differ greatly; most probable values of Ski on 34 bp or larger DNA are − 7.5 ± 0.5. From the similarity of Ski values, we conclude that binding interfaces of all three modes involve the same region of the arms and saddle of HU. All modes are entropy-driven, as expected for nonspecific binding driven by the polyelectrolyte effect. The bent-DNA 34 bp mode is most endothermic, presumably because of the cost of HU-induced DNA bending, while the 6 bp mode is modestly exothermic at all salt concentrations examined. Structural models consistent with the observed Ski values are proposed. PMID:21513716

  12. The Fanconi anemia associated protein FAAP24 uses two substrate specific binding surfaces for DNA recognition

    PubMed Central

    Wienk, Hans; Slootweg, Jack C.; Speerstra, Sietske; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.

    2013-01-01

    To maintain the integrity of the genome, multiple DNA repair systems exist to repair damaged DNA. Recognition of altered DNA, including bulky adducts, pyrimidine dimers and interstrand crosslinks (ICL), partially depends on proteins containing helix-hairpin-helix (HhH) domains. To understand how ICL is specifically recognized by the Fanconi anemia proteins FANCM and FAAP24, we determined the structure of the HhH domain of FAAP24. Although it resembles other HhH domains, the FAAP24 domain contains a canonical hairpin motif followed by distorted motif. The HhH domain can bind various DNA substrates; using nuclear magnetic resonance titration experiments, we demonstrate that the canonical HhH motif is required for double-stranded DNA (dsDNA) binding, whereas the unstructured N-terminus can interact with single-stranded DNA. Both DNA binding surfaces are used for binding to ICL-like single/double-strand junction-containing DNA substrates. A structural model for FAAP24 bound to dsDNA has been made based on homology with the translesion polymerase iota. Site-directed mutagenesis, sequence conservation and charge distribution support the dsDNA-binding model. Analogous to other HhH domain-containing proteins, we suggest that multiple FAAP24 regions together contribute to binding to single/double-strand junction, which could contribute to specificity in ICL DNA recognition. PMID:23661679

  13. DNABP: Identification of DNA-Binding Proteins Based on Feature Selection Using a Random Forest and Predicting Binding Residues.

    PubMed

    Ma, Xin; Guo, Jing; Sun, Xiao

    2016-01-01

    DNA-binding proteins are fundamentally important in cellular processes. Several computational-based methods have been developed to improve the prediction of DNA-binding proteins in previous years. However, insufficient work has been done on the prediction of DNA-binding proteins from protein sequence information. In this paper, a novel predictor, DNABP (DNA-binding proteins), was designed to predict DNA-binding proteins using the random forest (RF) classifier with a hybrid feature. The hybrid feature contains two types of novel sequence features, which reflect information about the conservation of physicochemical properties of the amino acids, and the binding propensity of DNA-binding residues and non-binding propensities of non-binding residues. The comparisons with each feature demonstrated that these two novel features contributed most to the improvement in predictive ability. Furthermore, to improve the prediction performance of the DNABP model, feature selection using the minimum redundancy maximum relevance (mRMR) method combined with incremental feature selection (IFS) was carried out during the model construction. The results showed that the DNABP model could achieve 86.90% accuracy, 83.76% sensitivity, 90.03% specificity and a Matthews correlation coefficient of 0.727. High prediction accuracy and performance comparisons with previous research suggested that DNABP could be a useful approach to identify DNA-binding proteins from sequence information. The DNABP web server system is freely available at http://www.cbi.seu.edu.cn/DNABP/.

  14. Multiple Intrinsically Disordered Sequences Alter DNA Binding by the Homeodomain of the Drosophila Hox Protein Ultrabithorax*S⃞

    PubMed Central

    Liu, Ying; Matthews, Kathleen S.; Bondos, Sarah E.

    2008-01-01

    During animal development, distinct tissues, organs, and appendages are specified through differential gene transcription by Hox transcription factors. However, the conserved Hox homeodomains bind DNA with high affinity yet low specificity. We have therefore explored the structure of the Drosophila melanogaster Hox protein Ultrabithorax and the impact of its nonhomeodomain regions on DNA binding properties. Computational and experimental approaches identified several conserved, intrinsically disordered regions outside the homeodomain of Ultrabithorax that impact DNA binding by the homeodomain. Full-length Ultrabithorax bound to target DNA 2.5-fold weaker than its isolated homeodomain. Using N-terminal and C-terminal deletion mutants, we demonstrate that the YPWM region and the disordered microexons (termed the I1 region) inhibit DNA binding ∼2-fold, whereas the disordered I2 region inhibits homeodomain-DNA interaction a further ∼40-fold. Binding is restored almost to homeodomain affinity by the mostly disordered N-terminal 174 amino acids (R region) in a length-dependent manner. Both the I2 and R regions contain portions of the activation domain, functionally linking DNA binding and transcription regulation. Given that (i) the I1 region and a portion of the R region alter homeodomain-DNA binding as a function of pH and (ii) an internal deletion within I1 increases Ultrabithorax-DNA affinity, I1 must directly impact homeodomain-DNA interaction energetics. However, I2 appears to indirectly affect DNA binding in a manner countered by the N terminus. The amino acid sequences of I2 and much of the I1 and R regions vary significantly among Ultrabithorax orthologues, potentially diversifying Hox-DNA interactions. PMID:18508761

  15. Interaction of cationic surfactants with DNA: a single-molecule study

    PubMed Central

    Husale, Sudhir; Grange, Wilfried; Karle, Marc; Bürgi, Stephan; Hegner, Martin

    2008-01-01

    The interaction of cationic surfactants with single dsDNA molecules has been studied using force-measuring optical tweezers. For hydrophobic chains of length 12 and greater, pulling experiments show characteristic features (e.g. hysteresis between the pulling and relaxation curves, force-plateau along the force curves), typical of a condensed phase (compaction of a long DNA into a micron-sized particle). Depending on the length of the hydrophobic chain of the surfactant, we observe different mechanical behaviours of the complex (DNA-surfactants), which provide evidence for different binding modes. Taken together, our measurements suggest that short-chain surfactants, which do not induce any condensation, could lie down on the DNA surface and directly interact with the DNA grooves through hydrophobic–hydrophobic interactions. In contrast, long-chain surfactants could have their aliphatic tails pointing away from the DNA surface, which could promote inter-molecular interactions between hydrophobic chains and subsequently favour DNA condensation. PMID:18203749

  16. Bisphenol A (BPA) binding on full-length architectures of estrogen receptor.

    PubMed

    Liu, Yaquan; Qu, Kaili; Hai, Ying; Zhao, Chunyan

    2018-08-01

    Previous research has shown that the major toxicity mechanism for many environment chemicals is binding with estrogen receptor (ER) and blocking endogenous estrogen access, including bisphenol A (BPA). However, the molecular level understanding the global consequence of BPA binding on the full-length architectures of ER is largely unknown, which is a necessary stage to evaluate estrogen-like toxicity of BPA. In the present work, the consequence of BPA on full-length architectures of ER was firstly modeled based on molecular dynamics, focusing on the cross communication between multi-domains including ligand binding domain (LBD) and DNA binding domain (DBD). The study proved consequence of BPA upon full-length ER structure was dependent on long-range communications between multiple protein domains. The allosteric effects occurring in LBD units could alter dimerization formation through a crucial change in residue-residue connections, which resulted in relaxation of DBD. It indicated BPA could present consequence on the full-size receptor, not only on the separate domains, but also on the cross communication among LBD, DBD, and DNA molecules. It might provide detailed insight into the knowledge about the structural characteristics of ER and its role in gene regulation, which eventually helped us evaluate the estrogen-like toxicity upon BPA binding with full-length ER. © 2018 Wiley Periodicals, Inc.

  17. Mechanisms of small molecule–DNA interactions probed by single-molecule force spectroscopy

    PubMed Central

    Almaqwashi, Ali A.; Paramanathan, Thayaparan; Rouzina, Ioulia; Williams, Mark C.

    2016-01-01

    There is a wide range of applications for non-covalent DNA binding ligands, and optimization of such interactions requires detailed understanding of the binding mechanisms. One important class of these ligands is that of intercalators, which bind DNA by inserting aromatic moieties between adjacent DNA base pairs. Characterizing the dynamic and equilibrium aspects of DNA-intercalator complex assembly may allow optimization of DNA binding for specific functions. Single-molecule force spectroscopy studies have recently revealed new details about the molecular mechanisms governing DNA intercalation. These studies can provide the binding kinetics and affinity as well as determining the magnitude of the double helix structural deformations during the dynamic assembly of DNA–ligand complexes. These results may in turn guide the rational design of intercalators synthesized for DNA-targeted drugs, optical probes, or integrated biological self-assembly processes. Herein, we survey the progress in experimental methods as well as the corresponding analysis framework for understanding single molecule DNA binding mechanisms. We discuss briefly minor and major groove binding ligands, and then focus on intercalators, which have been probed extensively with these methods. Conventional mono-intercalators and bis-intercalators are discussed, followed by unconventional DNA intercalation. We then consider the prospects for using these methods in optimizing conventional and unconventional DNA-intercalating small molecules. PMID:27085806

  18. Footprinting of Chlorella virus DNA ligase bound at a nick in duplex DNA.

    PubMed

    Odell, M; Shuman, S

    1999-05-14

    The 298-amino acid ATP-dependent DNA ligase of Chlorella virus PBCV-1 is the smallest eukaryotic DNA ligase known. The enzyme has intrinsic specificity for binding to nicked duplex DNA. To delineate the ligase-DNA interface, we have footprinted the enzyme binding site on DNA and the DNA binding site on ligase. The size of the exonuclease III footprint of ligase bound a single nick in duplex DNA is 19-21 nucleotides. The footprint is asymmetric, extending 8-9 nucleotides on the 3'-OH side of the nick and 11-12 nucleotides on the 5'-phosphate side. The 5'-phosphate moiety is essential for the binding of Chlorella virus ligase to nicked DNA. Here we show that the 3'-OH moiety is not required for nick recognition. The Chlorella virus ligase binds to a nicked ligand containing 2',3'-dideoxy and 5'-phosphate termini, but cannot catalyze adenylation of the 5'-end. Hence, the 3'-OH is important for step 2 chemistry even though it is not itself chemically transformed during DNA-adenylate formation. A 2'-OH cannot substitute for the essential 3'-OH in adenylation at a nick or even in strand closure at a preadenylated nick. The protein side of the ligase-DNA interface was probed by limited proteolysis of ligase with trypsin and chymotrypsin in the presence and absence of nicked DNA. Protease accessible sites are clustered within a short segment from amino acids 210-225 located distal to conserved motif V. The ligase is protected from proteolysis by nicked DNA. Protease cleavage of the native enzyme prior to DNA addition results in loss of DNA binding. These results suggest a bipartite domain structure in which the interdomain segment either comprises part of the DNA binding site or undergoes a conformational change upon DNA binding. The domain structure of Chlorella virus ligase inferred from the solution experiments is consistent with the structure of T7 DNA ligase determined by x-ray crystallography.

  19. Dpb11 may function with RPA and DNA to initiate DNA replication

    PubMed Central

    Bruck, Irina; Dhingra, Nalini; Martinez, Matthew P.

    2017-01-01

    Dpb11 is required for the initiation of DNA replication in budding yeast. We found that Dpb11 binds tightly to single-stranded DNA (ssDNA) or branched DNA structures, while its human homolog, TopBP1, binds tightly to branched-DNA structures. We also found that Dpb11 binds stably to CDK-phosphorylated RPA, the eukaryotic ssDNA binding protein, in the presence of branched DNA. A Dpb11 mutant specifically defective for DNA binding did not exhibit tight binding to RPA in the presence of DNA, suggesting that Dpb11-interaction with DNA may promote the recruitment of RPA to melted DNA. We then characterized a mutant of Dpb11 that is specifically defective in DNA binding in budding yeast cells. Expression of dpb11-m1,2,3,5,ΔC results in a substantial decrease in RPA recruitment to origins, suggesting that Dpb11 interaction with DNA may be required for RPA recruitment to origins. Expression of dpb11-m1,2,3,5,ΔC also results in diminished GINS interaction with Mcm2-7 during S phase, while Cdc45 interaction with Mcm2-7 is like wild-type. The reduced GINS interaction with Mcm2-7 may be an indirect consequence of diminished origin melting. We propose that the tight interaction between Dpb11, CDK-phosphorylated RPA, and branched-DNA may be required for the essential function of stabilizing melted origin DNA in vivo. We also propose an alternative model, wherein Dpb11-DNA interaction is required for some other function in DNA replication initiation, such as helicase activation. PMID:28467467

  20. Studies on the interaction of a synthetic nitro-flavone derivative with DNA: A multi-spectroscopic and molecular docking approach.

    PubMed

    Mitra, A; Saikh, F; Das, J; Ghosh, S; Ghosh, R

    2018-05-22

    Interaction of a ligand with DNA is often the basis of drug action of many molecules. Flavones are important in this regard as their structural features confer them the ability to bind to DNA. 2-(4-Nitrophenyl)-4H-chromen-4-one (4NCO) is an important biologically active synthetic flavone derivative. We are therefore interested in studying its interaction with DNA. Absorption spectroscopy studies included standard and reverse titration, effect of ionic strength on titration, determination of stoichiometry of binding and thermal denaturation. Spectrofluorimetry techniques included fluorimetric titration, quenching studies and fluorescence displacement assay. Assessment of relative viscosity and estimation of thermodynamic parameters from CD spectral studies were also undertaken. Furthermore, molecular docking analyses were also done with different short DNA sequences. The fluorescent flavone 4NCO reversibly interacted with DNA through partial intercalation as well as minor-groove binding. The binding constant and the number of binding sites were of the order 10 4  M -1 and 1 respectively. The binding stoichiometry with DNA was found to be 1:1. The nature of the interaction of 4NCO with DNA was hydrophobic in nature and the process of binding was spontaneous, endothermic and entropy-driven. The flavone also showed a preference for binding to GC rich sequences. The study presents a profile for structural and thermodynamic parameters, for the binding of 4NCO with DNA. DNA is an important target for ligands that are effective against cell proliferative disorders. In this regard, the molecule 4NCO is important since it can exert its biological activity through its DNA binding ability and can be a potential drug candidate. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. Chemotherapeutic Drug-Conjugated Microbeads Demonstrate Preferential Binding to Methylated Plasmid DNA.

    PubMed

    Lin, Kevin N; Grandhi, Taraka Sai Pavan; Goklany, Sheba; Rege, Kaushal

    2018-04-10

    Plasmid DNA (pDNA) is an attractive therapeutic biomolecule in several diseases including cancer, AIDS, cystic fibrosis, Parkinson's disease, and Alzheimer's disease. Increasing demand for plasmid DNA as a therapeutic biomolecule for transgene expression or vaccine applications necessitate novel approaches to bioprocessing. The synthesis, characterization and evaluation of aminoglycoside-derived hydrogel microbeads (Amikabeads) for pDNA binding is described previously. Here, the generation and evaluation of novel chemotherapeutic drug-conjugated microbeads for application in pDNA binding and recovery is described. Chemotherapeutic drug-conjugated Amikabeads demonstrate higher binding of methylated pDNA compared to unmethylated pDNA in presence of high salt concentrations. Desorption of plasmids from drug-conjugated microbeads is facilitated by the use of organic modifiers. The observed differences in binding methylated versus unmethylated DNA can make drug-conjugated microbeads useful in diagnostic as well as therapeutic applications. These results demonstrate that anti-cancer drugs represent a diverse set of ligands that may be exploited for molecular engineering of novel DNA binding materials for applications in delivery, diagnostics, and biomanufacturing. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. DNA binding by the ribosomal DNA transcription factor rrn3 is essential for ribosomal DNA transcription.

    PubMed

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I

    2013-03-29

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.

  3. DNA Binding by the Ribosomal DNA Transcription Factor Rrn3 Is Essential for Ribosomal DNA Transcription*

    PubMed Central

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.

    2013-01-01

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135

  4. DNA Recognition by a σ 54 Transcriptional Activator from Aquifex aeolicus

    DOE PAGES

    Vidangos, Natasha K.; Heideker, Johanna; Lyubimov, Artem; ...

    2014-08-23

    Transcription initiation by bacterial σ 54-polymerase requires the action of a transcriptional activator protein. Activators bind sequence-specifically upstream of the transcription initiation site via a DNA-binding domain. The structurally characterized DNA-binding domains from activators all belong to the Factor for Inversion Stimulation (Fis) family of helix-turn-helix DNA-binding proteins. We report here structures of the free and DNA-bound forms of the DNA-binding domain of NtrC4 (4DBD) from Aquifex aeolicus, a member of the NtrC family of σ 54 activators. Two NtrC4 binding sites were identified upstream (-145 and -85 base pairs) from the start of the lpxC gene, which is responsiblemore » for the first committed step in Lipid A biosynthesis. This is the first experimental evidence for σ 54 regulation in lpxC expression. 4DBD was crystallized both without DNA and in complex with the -145 binding site. The structures, together with biochemical data, indicate that NtrC4 binds to DNA in a manner that is similar to that of its close homologue, Fis. Ultimately, the greater sequence specificity for the binding of 4DBD relative to Fis seems to arise from a larger number of base specific contacts contributing to affinity than for Fis.« less

  5. A Colorimetric Microplate Assay for DNA-Binding Activity of His-Tagged MutS Protein.

    PubMed

    Banasik, Michał; Sachadyn, Paweł

    2016-09-01

    A simple microplate method was designed for rapid testing DNA-binding activity of proteins. The principle of the assay involves binding of tested DNA by his-tagged protein immobilized on a nickel-coated ELISA plate, following colorimetric detection of biotinylated DNA with avidin conjugated to horseradish peroxidase. The method was used to compare DNA mismatch binding activities of MutS proteins from three bacterial species. The assay required relatively low amounts of tested protein (approximately 0.5-10 pmol) and DNA (0.1-10 pmol) and a relatively short time of analysis (up to 60 min). The method is very simple to apply and convenient to test different buffer conditions of DNA-protein binding. Sensitive colorimetric detection enables naked eye observations and quantitation with an ELISA reader. The performance of the assay, which we believe is a distinguishing trait of the method, is based on two strong and specific molecular interactions: binding of a his-tagged protein to a nickel-coated microplate and binding of biotinylated DNA to avidin. In the reported experiments, the solution was used to optimize the conditions for DNA mismatch binding by MutS protein; however, the approach could be implemented to test nucleic acids interactions with any protein of interest.

  6. Structural Determinants of DNA Binding by a P. falciparum ApiAP2 Transcriptional Regulator

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lindner, Scott E.; De Silva, Erandi K.; Keck, James L.

    2010-11-05

    Putative transcription factors have only recently been identified in the Plasmodium spp., with the major family of regulators comprising the Apicomplexan Apetala2 (AP2) proteins. To better understand the DNA-binding mechanisms of these transcriptional regulators, we characterized the structure and in vitro function of an AP2 DNA-binding domain from a prototypical Apicomplexan AP2 protein, PF14{_}0633 from Plasmodium falciparum. The X-ray crystal structure of the PF14{_}0633 AP2 domain bound to DNA reveals a {beta}-sheet fold that binds the DNA major groove through base-specific and backbone contacts; a prominent {alpha}-helix supports the {beta}-sheet structure. Substitution of predicted DNA-binding residues with alanine weakened ormore » eliminated DNA binding in solution. In contrast to plant AP2 domains, the PF14{_}0633 AP2 domain dimerizes upon binding to DNA through a domain-swapping mechanism in which the {alpha}-helices of the AP2 domains pack against the {beta}-sheets of the dimer mates. DNA-induced dimerization of PF14{_}0633 may be important for tethering two distal DNA loci together in the nucleus and/or for inducing functional rearrangements of its domains to facilitate transcriptional regulation. Consistent with a multisite binding mode, at least two copies of the consensus sequence recognized by PF14{_}0633 are present upstream of a previously identified group of sporozoite-stage genes. Taken together, these findings illustrate how Plasmodium has adapted the AP2 DNA-binding domain for genome-wide transcriptional regulation.« less

  7. Neisseria conserved protein DMP19 is a DNA mimic protein that prevents DNA binding to a hypothetical nitrogen-response transcription factor

    PubMed Central

    Wang, Hao-Ching; Ko, Tzu-Ping; Wu, Mao-Lun; Ku, Shan-Chi; Wu, Hsing-Ju; Wang, Andrew H.-J.

    2012-01-01

    DNA mimic proteins occupy the DNA binding sites of DNA-binding proteins, and prevent these sites from being accessed by DNA. We show here that the Neisseria conserved hypothetical protein DMP19 acts as a DNA mimic. The crystal structure of DMP19 shows a dsDNA-like negative charge distribution on the surface, suggesting that this protein should be added to the short list of known DNA mimic proteins. The crystal structure of another related protein, NHTF (Neisseria hypothetical transcription factor), provides evidence that it is a member of the xenobiotic-response element (XRE) family of transcriptional factors. NHTF binds to a palindromic DNA sequence containing a 5′-TGTNAN11TNACA-3′ recognition box that controls the expression of an NHTF-related operon in which the conserved nitrogen-response protein [i.e. (Protein-PII) uridylyltransferase] is encoded. The complementary surface charges between DMP19 and NHTF suggest specific charge–charge interaction. In a DNA-binding assay, we found that DMP19 can prevent NHTF from binding to its DNA-binding sites. Finally, we used an in situ gene regulation assay to provide evidence that NHTF is a repressor of its down-stream genes and that DMP19 can neutralize this effect. We therefore conclude that the interaction of DMP19 and NHTF provides a novel gene regulation mechanism in Neisseria spps. PMID:22373915

  8. Cr(3+) Binding to DNA Backbone Phosphate and Bases: Slow Ligand Exchange Rates and Metal Hydrolysis.

    PubMed

    Zhou, Wenhu; Yu, Tianmeng; Vazin, Mahsa; Ding, Jinsong; Liu, Juewen

    2016-08-15

    The interaction between chromium ions and DNA is of great interest in inorganic chemistry, toxicology, and analytical chemistry. Most previous studies focused on in situ reduction of Cr(VI), producing Cr(3+) for DNA binding. Recently, Cr(3+) was reported to activate the Ce13d DNAzyme for RNA cleavage. Herein, the Ce13d is used to study two types of Cr(3+) and DNA interactions. First, Cr(3+) binds to the DNA phosphate backbone weakly through reversible electrostatic interactions, which is weakened by adding competing inorganic phosphate. However, Cr(3+) coordinates with DNA nucleobases forming stable cross-links that can survive denaturing gel electrophoresis condition. The binding of Cr(3+) to different nucleobases was further studied in terms of binding kinetics and affinity by exploiting carboxyfluorescein-labeled DNA homopolymers. Once binding takes place, the stable Cr(3+)/DNA complex cannot be dissociated by EDTA, attributable to the ultraslow ligand exchange rate of Cr(3+). The binding rate follows the order of G > C > T ≈ A. Finally, Cr(3+) gradually loses its DNA binding ability after being stored at neutral or high pH, attributable to hydrolysis. This hydrolysis can be reversed by lowering the pH. This work provides a deeper insight into the bioinorganic chemistry of Cr(3+) coordination with DNA, clarifies some inconsistency in the previous literature, and offers practically useful information for generating reproducible results.

  9. Anti-nucleosome antibodies complexed to nucleosomal antigens show anti-DNA reactivity and bind to rat glomerular basement membrane in vivo.

    PubMed Central

    Kramers, C; Hylkema, M N; van Bruggen, M C; van de Lagemaat, R; Dijkman, H B; Assmann, K J; Smeenk, R J; Berden, J H

    1994-01-01

    Histones can mediate the binding of DNA and anti-DNA to the glomerular basement membrane (GBM). In ELISA histone/DNA/anti-DNA complexes are able to bind to heparan sulfate (HS), an intrinsic constituent of the GBM. We questioned whether histone containing immune complexes are able to bind to the GBM, and if so, whether the ligand in the GBM is HS. Monoclonal antibodies (mAbs) complexed to nucleosomal antigens and noncomplexed mAbs were isolated from culture supernatants of four IgG anti-nuclear mAbs. All noncomplexed mAbs showed strong anti-nucleosome reactivity in ELISA. One of them showed in addition anti-DNA reactivity in noncomplexed form. The other three mAbs only showed anti-DNA reactivity when they were complexed to nucleosomal antigens. After renal perfusion a fine granular binding of complexed mAbs to the glomerular capillary wall and activation of complement was observed in immunofluorescence, whereas noncomplexed mAbs did not bind. Immuno-electron microscopy showed binding of complexes to the whole width of the GBM. When HS in the GBM was removed by renal heparinase perfusion the binding of complexed mAb decreased, but did not disappear completely. We conclude that anti-nucleosome mAbs, which do not bind DNA, become DNA reactive once complexed to nucleosomal antigens. These complexed mAbs can bind to the GBM. The binding ligand in the GBM is partly, but not solely, HS. Binding to the GBM of immune complexes containing nucleosomal material might be an important event in the pathogenesis of lupus nephritis. Images PMID:8040312

  10. Non-B-DNA structures on the interferon-beta promoter?

    PubMed

    Robbe, K; Bonnefoy, E

    1998-01-01

    The high mobility group (HMG) I protein intervenes as an essential factor during the virus induced expression of the interferon-beta (IFN-beta) gene. It is a non-histone chromatine associated protein that has the dual capacity of binding to a non-B-DNA structure such as cruciform-DNA as well as to AT rich B-DNA sequences. In this work we compare the binding affinity of HMGI for a synthetic cruciform-DNA to its binding affinity for the HMGI-binding-site present in the positive regulatory domain II (PRDII) of the IFN-beta promoter. Using gel retardation experiments, we show that HMGI protein binds with at least ten times more affinity to the synthetic cruciform-DNA structure than to the PRDII B-DNA sequence. DNA hairpin sequences are present in both the human and the murine PRDII-DNAs. We discuss in this work the presence of, yet putative, non-B-DNA structures in the IFN-beta promoter.

  11. Enantioselective binding of L, D-phenylalanine to ct DNA

    NASA Astrophysics Data System (ADS)

    Zhang, Lijin; Xu, Jianhua; Huang, Yan; Min, Shungeng

    2009-10-01

    The enantioselective binding of L, D-phenylalanine to calf thymus DNA was studied by absorption, circular dichroism, fluorescence quenching, viscosity, salt effect and emission experiments. The results obtained from absorption, circular dichroism, fluorescence quenching and viscosity experiments excluded the intercalative binding and salt effect experiments did not support electrostatic binding. So the binding of L, D-phenylalanine to ct DNA should be groove binding. Furthermore, the emission spectra revealed that the binding is enantioselective.

  12. Enantioselective binding of L,D-phenylalanine to ct DNA.

    PubMed

    Zhang, Lijin; Xu, Jianhua; Huang, Yan; Min, Shungeng

    2009-10-15

    The enantioselective binding of L,D-phenylalanine to calf thymus DNA was studied by absorption, circular dichroism, fluorescence quenching, viscosity, salt effect and emission experiments. The results obtained from absorption, circular dichroism, fluorescence quenching and viscosity experiments excluded the intercalative binding and salt effect experiments did not support electrostatic binding. So the binding of l,d-phenylalanine to ct DNA should be groove binding. Furthermore, the emission spectra revealed that the binding is enantioselective.

  13. Titration of DnaA protein by oriC DnaA-boxes increases dnaA gene expression in Escherichia coli.

    PubMed Central

    Hansen, F G; Koefoed, S; Sørensen, L; Atlung, T

    1987-01-01

    Binding of the DnaA protein to its binding sites, the DnaA-boxes (TTATCCACA), was measured by a simple physiological approach. The presence of extra DnaA-boxes in growing cells leads to a derepression of dnaA gene expression, measured as beta-galactosidase activity of a dnaA-lacZ fusion polypeptide. Different DnaA-boxes caused different degrees of derepression indicating that the DnaA protein requires sequences in addition to the DnaA-box for efficient binding. The DnaA-boxes in oriC might act cooperatively in binding of the DnaA protein. The derepressed levels of DnaA protein obtained in a strain carrying an oriC+-pBR322 chimera were very high and sufficient to activate oriC on the chimeric plasmid, which was maintained at a copy number more than three times that of pBR322. PMID:3034578

  14. An ancient protein-DNA interaction underlying metazoan sex determination.

    PubMed

    Murphy, Mark W; Lee, John K; Rojo, Sandra; Gearhart, Micah D; Kurahashi, Kayo; Banerjee, Surajit; Loeuille, Guy-André; Bashamboo, Anu; McElreavey, Kenneth; Zarkower, David; Aihara, Hideki; Bardwell, Vivian J

    2015-06-01

    DMRT transcription factors are deeply conserved regulators of metazoan sexual development. They share the DM DNA-binding domain, a unique intertwined double zinc-binding module followed by a C-terminal recognition helix, which binds a pseudopalindromic target DNA. Here we show that DMRT proteins use a unique binding interaction, inserting two adjacent antiparallel recognition helices into a widened DNA major groove to make base-specific contacts. Versatility in how specific base contacts are made allows human DMRT1 to use multiple DNA binding modes (tetramer, trimer and dimer). Chromatin immunoprecipitation with exonuclease treatment (ChIP-exo) indicates that multiple DNA binding modes also are used in vivo. We show that mutations affecting residues crucial for DNA recognition are associated with an intersex phenotype in flies and with male-to-female sex reversal in humans. Our results illuminate an ancient molecular interaction underlying much of metazoan sexual development.

  15. An ancient protein-DNA interaction underlying metazoan sex determination

    DOE PAGES

    Murphy, Mark W.; Lee, John K.; Rojo, Sandra; ...

    2015-05-25

    DMRT transcription factors are deeply conserved regulators of metazoan sexual development. They share the DM DNA-binding domain, a unique intertwined double zinc-binding module followed by a C-terminal recognition helix, which binds a pseudopalindromic target DNA. In this paper, we show that DMRT proteins use a unique binding interaction, inserting two adjacent antiparallel recognition helices into a widened DNA major groove to make base-specific contacts. Versatility in how specific base contacts are made allows human DMRT1 to use multiple DNA binding modes (tetramer, trimer and dimer). Chromatin immunoprecipitation with exonuclease treatment (ChIP-exo) indicates that multiple DNA binding modes also are usedmore » in vivo. We show that mutations affecting residues crucial for DNA recognition are associated with an intersex phenotype in flies and with male-to-female sex reversal in humans. Finally, our results illuminate an ancient molecular interaction underlying much of metazoan sexual development.« less

  16. An ancient protein-DNA interaction underlying metazoan sex determination

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Murphy, Mark W.; Lee, John K.; Rojo, Sandra

    DMRT transcription factors are deeply conserved regulators of metazoan sexual development. They share the DM DNA-binding domain, a unique intertwined double zinc-binding module followed by a C-terminal recognition helix, which binds a pseudopalindromic target DNA. In this paper, we show that DMRT proteins use a unique binding interaction, inserting two adjacent antiparallel recognition helices into a widened DNA major groove to make base-specific contacts. Versatility in how specific base contacts are made allows human DMRT1 to use multiple DNA binding modes (tetramer, trimer and dimer). Chromatin immunoprecipitation with exonuclease treatment (ChIP-exo) indicates that multiple DNA binding modes also are usedmore » in vivo. We show that mutations affecting residues crucial for DNA recognition are associated with an intersex phenotype in flies and with male-to-female sex reversal in humans. Finally, our results illuminate an ancient molecular interaction underlying much of metazoan sexual development.« less

  17. Chimeric proteins for detection and quantitation of DNA mutations, DNA sequence variations, DNA damage and DNA mismatches

    DOEpatents

    McCutchen-Maloney, Sandra L.

    2002-01-01

    Chimeric proteins having both DNA mutation binding activity and nuclease activity are synthesized by recombinant technology. The proteins are of the general formula A-L-B and B-L-A where A is a peptide having DNA mutation binding activity, L is a linker and B is a peptide having nuclease activity. The chimeric proteins are useful for detection and identification of DNA sequence variations including DNA mutations (including DNA damage and mismatches) by binding to the DNA mutation and cutting the DNA once the DNA mutation is detected.

  18. DNA Binding Mode Transitions of Escherichia coli HUαβ: Evidence for Formation of a Bent DNA – Protein Complex on Intact, Linear Duplex DNA

    PubMed Central

    Koh, Junseock; Saecker, Ruth M.; Record, M. Thomas

    2008-01-01

    Escherichia coli HUαβ, a major nucleoid associated protein (NAP), organizes the DNA chromosome and facilitates numerous DNA transactions. Using isothermal titration calorimetry (ITC), fluorescence resonance energy transfer (FRET) and a series of DNA lengths (8, 15, 34, 38 and 160 base pairs) we establish that HUαβ interacts with duplex DNA using three different nonspecific binding modes. Both the HU to DNA mole ratio ([HU]/[DNA]) and DNA length dictate the dominant HU binding mode. On sufficiently long DNA (≥ 34 base pairs), at low [HU]/[DNA], HU populates a noncooperative 34 bp binding mode with a binding constant of 2.1 (± 0.4) × 106 M−1, and a binding enthalpy of +7.7 (± 0.6) kcal/mol at 15 °C and 0.15 M Na+. With increasing [HU]/[DNA], HU bound in the noncooperative 34 bp mode progressively converts to two cooperative (ω ~ 20) modes with site sizes of 10 bp and 6 bp. These latter modes exhibit smaller binding constants (1.1 (± 0.2) × 105 M−1 for the 10 bp mode, 3.5 (± 1.4) × 104 M−1 for the 6 bp mode) and binding enthalpies (4.2 (± 0.3) kcal/mol for the 10 bp mode, −1.6 (±0.3) kcal/mol for the 6 bp mode). As DNA length increases to 34 bp or more at low [HU]/[DNA], the small modes are replaced by the 34 bp binding mode. FRET data demonstrate that the 34 bp mode bends DNA by 143 ± 6° whereas the 6 and 10 bp modes do not. The model proposed in this study provides a novel quantitative and comprehensive framework for reconciling previous structural and solution studies of HU, including single molecule (force extension measurement, AFM), fluorescence, and electrophoretic gel mobility shift assays. In particular, it explains how HU condenses or extends DNA depending on the relative concentrations of HU and DNA. PMID:18657548

  19. Cloning of cDNA sequences encoding cowpea (Vigna unguiculata) vicilins: Computational simulations suggest a binding mode of cowpea vicilins to chitin oligomers.

    PubMed

    Rocha, Antônio J; Sousa, Bruno L; Girão, Matheus S; Barroso-Neto, Ito L; Monteiro-Júnior, José E; Oliveira, José T A; Nagano, Celso S; Carneiro, Rômulo F; Monteiro-Moreira, Ana C O; Rocha, Bruno A M; Freire, Valder N; Grangeiro, Thalles B

    2018-05-27

    Vicilins are 7S globulins which constitute the major seed storage proteins in leguminous species. Variant vicilins showing differential binding affinities for chitin have been implicated in the resistance and susceptibility of cowpea to the bruchid Callosobruchus maculatus. These proteins are members of the cupin superfamily, which includes a wide variety of enzymes and non-catalytic seed storage proteins. The cupin fold does not share similarity with any known chitin-biding domain. Therefore, it is poorly understood how these storage proteins bind to chitin. In this work, partial cDNA sequences encoding β-vignin, the major component of cowpea vicilins, were obtained from developing seeds. Three-dimensional molecular models of β-vignin showed the characteristic cupin fold and computational simulations revealed that each vicilin trimer contained 3 chitin-binding sites. Interaction models showed that chito-oligosaccharides bound to β-vignin were stabilized mainly by hydrogen bonds, a common structural feature of typical carbohydrate-binding proteins. Furthermore, many of the residues involved in the chitin-binding sites of β-vignin are conserved in other 7S globulins. These results support previous experimental evidences on the ability of vicilin-like proteins from cowpea and other leguminous species to bind in vitro to chitin as well as in vivo to chitinous structures of larval C. maculatus midgut. Copyright © 2018. Published by Elsevier B.V.

  20. Multiplexed evaluation of capture agent binding kinetics using arrays of silicon photonic microring resonators.

    PubMed

    Byeon, Ji-Yeon; Bailey, Ryan C

    2011-09-07

    High affinity capture agents recognizing biomolecular targets are essential in the performance of many proteomic detection methods. Herein, we report the application of a label-free silicon photonic biomolecular analysis platform for simultaneously determining kinetic association and dissociation constants for two representative protein capture agents: a thrombin-binding DNA aptamer and an anti-thrombin monoclonal antibody. The scalability and inherent multiplexing capability of the technology make it an attractive platform for simultaneously evaluating the binding characteristics of multiple capture agents recognizing the same target antigen, and thus a tool complementary to emerging high-throughput capture agent generation strategies.

  1. Single molecule tracking of Ace1p in Saccharomyces cerevisiae defines a characteristic residence time for non-specific interactions of transcription factors with chromatin.

    PubMed

    Ball, David A; Mehta, Gunjan D; Salomon-Kent, Ronit; Mazza, Davide; Morisaki, Tatsuya; Mueller, Florian; McNally, James G; Karpova, Tatiana S

    2016-12-01

    In vivo single molecule tracking has recently developed into a powerful technique for measuring and understanding the transient interactions of transcription factors (TF) with their chromatin response elements. However, this method still lacks a solid foundation for distinguishing between specific and non-specific interactions. To address this issue, we took advantage of the power of molecular genetics of yeast. Yeast TF Ace1p has only five specific sites in the genome and thus serves as a benchmark to distinguish specific from non-specific binding. Here, we show that the estimated residence time of the short-residence molecules is essentially the same for Hht1p, Ace1p and Hsf1p, equaling 0.12-0.32 s. These three DNA-binding proteins are very different in their structure, function and intracellular concentration. This suggests that (i) short-residence molecules are bound to DNA non-specifically, and (ii) that non-specific binding shares common characteristics between vastly different DNA-bound proteins and thus may have a common underlying mechanism. We develop new and robust procedure for evaluation of adverse effects of labeling, and new quantitative analysis procedures that significantly improve residence time measurements by accounting for fluorophore blinking. Our results provide a framework for the reliable performance and analysis of single molecule TF experiments in yeast. Published by Oxford University Press on behalf of Nucleic Acids Research 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  2. Repeated administration of CGP 46381, a gamma-aminobutyric acidB antagonist, and ethosuximide suppresses seizure-associated cyclic adenosine 3'5' monophosphate response element- and activator protein-1 DNA-binding activities in lethargic (lh/lh) mice.

    PubMed

    Ishige, K; Endo, H; Saito, H; Ito, Y

    2001-01-19

    To characterize seizure-associated increases in cerebral cortical and thalamic cyclic AMP responsive element (CRE)- and activator protein 1 (AP-1) DNA-binding activities in lethargic (lh/lh) mice, a genetic model of absence seizures, we examined the effects of ethosuximide and CGP 46381 on these DNA-binding activities. Repeated administration (twice a day for 5 days) of ethosuximide (200 mg/kg) or CGP 46381 (60 mg/kg) attenuated both seizure behavior and the increased DNA-binding activities, and was more effective than a single administration of these drugs. These treatments did not affect either normal behavior or basal DNA-binding activities in non-epileptic control (+/+) mice. Gel supershift assays revealed that the increased CRE-binding activity was attributable to activation of the binding activity of CREB, and that the c-Fos-c-Jun complex was a component of the increased AP-1 DNA-binding activity.

  3. Engineering and Application of Zinc Finger Proteins and TALEs for Biomedical Research.

    PubMed

    Kim, Moon-Soo; Kini, Anu Ganesh

    2017-08-01

    Engineered DNA-binding domains provide a powerful technology for numerous biomedical studies due to their ability to recognize specific DNA sequences. Zinc fingers (ZF) are one of the most common DNA-binding domains and have been extensively studied for a variety of applications, such as gene regulation, genome engineering and diagnostics. Another novel DNA-binding domain known as a transcriptional activator-like effector (TALE) has been more recently discovered, which has a previously undescribed DNA-binding mode. Due to their modular architecture and flexibility, TALEs have been rapidly developed into artificial gene targeting reagents. Here, we describe the methods used to design these DNA-binding proteins and their key applications in biomedical research.

  4. Spectroscopic and molecular docking studies on the interaction of antiviral drug nevirapine with calf thymus DNA.

    PubMed

    Moghadam, Neda Hosseinpour; Salehzadeh, Sadegh; Shahabadi, Nahid

    2017-09-02

    The interaction of calf thymus DNA with nevirapine at physiological pH was studied by using absorption, circular dichroism, viscosity, differential pulse voltammetry, fluorescence techniques, salt effect studies and computational methods. The drug binds to ct-DNA in a groove binding mode, as shown by slight variation in the viscosity of ct-DNA. Furthermore, competitive fluorimetric studies with Hoechst 33258 indicate that nevirapine binds to DNA via groove binding. Moreover, the structure of nevirapine was optimized by DFT calculations and was used for the molecular docking calculations. The molecular docking results suggested that nevirapine prefers to bind on the minor groove of ct-DNA.

  5. Engineering a trifunctional proline utilization A chimaera by fusing a DNA-binding domain to a bifunctional PutA.

    PubMed

    Arentson, Benjamin W; Hayes, Erin L; Zhu, Weidong; Singh, Harkewal; Tanner, John J; Becker, Donald F

    2016-12-01

    Proline utilization A (PutA) is a bifunctional flavoenzyme with proline dehydrogenase (PRODH) and Δ 1 -pyrroline-5-carboxylate (P5C) dehydrogenase (P5CDH) domains that catalyses the two-step oxidation of proline to glutamate. Trifunctional PutAs also have an N-terminal ribbon-helix-helix (RHH) DNA-binding domain and moonlight as autogenous transcriptional repressors of the put regulon. A unique property of trifunctional PutA is the ability to switch functions from DNA-bound repressor to membrane-associated enzyme in response to cellular nutritional needs and proline availability. In the present study, we attempt to construct a trifunctional PutA by fusing the RHH domain of Escherichia coli PutA (EcRHH) to the bifunctional Rhodobacter capsulatus PutA (RcPutA) in order to explore the modular design of functional switching in trifunctional PutAs. The EcRHH-RcPutA chimaera retains the catalytic properties of RcPutA while acquiring the oligomeric state, quaternary structure and DNA-binding properties of EcPutA. Furthermore, the EcRHH-RcPutA chimaera exhibits proline-induced lipid association, which is a fundamental characteristic of functional switching. Unexpectedly, RcPutA lipid binding is also activated by proline, which shows for the first time that bifunctional PutAs exhibit a limited form of functional switching. Altogether, these results suggest that the C-terminal domain (CTD), which is conserved by trifunctional PutAs and certain bifunctional PutAs, is essential for functional switching in trifunctional PutAs. © 2016 The Author(s).

  6. Engineering a trifunctional proline utilization A chimaera by fusing a DNA-binding domain to a bifunctional PutA

    PubMed Central

    Arentson, Benjamin W.; Hayes, Erin L.; Zhu, Weidong; Singh, Harkewal; Tanner, John J.; Becker, Donald F.

    2016-01-01

    Proline utilization A (PutA) is a bifunctional flavoenzyme with proline dehydrogenase (PRODH) and Δ1-pyrroline-5-carboxylate (P5C) dehydrogenase (P5CDH) domains that catalyses the two-step oxidation of proline to glutamate. Trifunctional PutAs also have an N-terminal ribbon–helix–helix (RHH) DNA-binding domain and moonlight as autogenous transcriptional repressors of the put regulon. A unique property of trifunctional PutA is the ability to switch functions from DNA-bound repressor to membrane-associated enzyme in response to cellular nutritional needs and proline availability. In the present study, we attempt to construct a trifunctional PutA by fusing the RHH domain of Escherichia coli PutA (EcRHH) to the bifunctional Rhodobacter capsulatus PutA (RcPutA) in order to explore the modular design of functional switching in trifunctional PutAs. The EcRHH–RcPutA chimaera retains the catalytic properties of RcPutA while acquiring the oligomeric state, quaternary structure and DNA-binding properties of EcPutA. Furthermore, the EcRHH–RcPutA chimaera exhibits proline-induced lipid association, which is a fundamental characteristic of functional switching. Unexpectedly, RcPutA lipid binding is also activated by proline, which shows for the first time that bifunctional PutAs exhibit a limited form of functional switching. Altogether, these results suggest that the C-terminal domain (CTD), which is conserved by trifunctional PutAs and certain bifunctional PutAs, is essential for functional switching in trifunctional PutAs. PMID:27742866

  7. A comprehensive approach to ascertain the binding mode of curcumin with DNA

    NASA Astrophysics Data System (ADS)

    Haris, P.; Mary, Varughese; Aparna, P.; Dileep, K. V.; Sudarsanakumar, C.

    2017-03-01

    Curcumin is a natural phytochemical from the rhizoma of Curcuma longa, the popular Indian spice that exhibits a wide range of pharmacological properties like antioxidant, anticancer, anti-inflammatory, antitumor, and antiviral activities. In the published literatures we can see different studies and arguments on the interaction of curcumin with DNA. The intercalative binding, groove binding and no binding of curcumin with DNA were reported. In this context, we conducted a detailed study to understand the mechanism of recognition of dimethylsulfoxide-solubilized curcumin by DNA. The interaction of curcumin with calf thymus DNA (ctDNA) was confirmed by agarose gel electrophoresis. The nature of binding and energetics of interaction were studied by Isothermal Titration Calorimetry (ITC), Differential Scanning Calorimetry (DSC), UV-visible, fluorescence and melting temperature (Tm) analysis. The experimental data were compared with molecular modeling studies. Our investigation confirmed that dimethylsulfoxide-solubilized curcumin binds in the minor groove of the ctDNA without causing significant structural alteration to the DNA.

  8. The role of solitons on the tunneling magnetoresistance through a double-stranded DNA molecule

    NASA Astrophysics Data System (ADS)

    Ashhadi, M.

    2018-07-01

    We have studied the role of solitons on the spin-dependent transport properties of through a double-stranded DNA (dsDNA) molecule attached to two the semi-infinite ferromagnetic (FM) electrodes. The work is based on a tight-binding Hamiltonian model within the framework of a generalized Green's function technique and relies on the Landauer-Bütikker formalism as the basis for studying the current-voltage characteristic of this system. The conductance properties of the spin system are studied for a ladder model for poly (dG)-poly (dC) DNA molecule. Our calculations indicate that the presence of a homogeneous distribution of the solitons along the molecular, as a sublattice of the correlated solitons, gives rise to significant enhancement in the density of states within the bandgap and large enhancement in conductance and the current-voltage characteristic. It is also shown that tunnel magnetoresistance (TMR) decreases in compared with TMR obtained in the absence of solitons.

  9. Reclassification of Lactobacillus kefirgranum Takizawa et al. 1994 as Lactobacillus kefiranofaciens subsp. kefirgranum subsp. nov. and emended description of L. kefiranofaciens Fujisawa et al. 1988.

    PubMed

    Vancanneyt, M; Mengaud, J; Cleenwerck, I; Vanhonacker, K; Hoste, B; Dawyndt, P; Degivry, M C; Ringuet, D; Janssens, D; Swings, J

    2004-03-01

    Fourteen homofermentative lactic acid bacteria that were isolated from kefir grains and kefir fermented milks were assigned to either Lactobacillus kefiranofaciens or Lactobacillus kefirgranum, based on their characteristic morphotypes, phenotypic features and SDS-PAGE profiles of whole-cell proteins. Further genotypic analyses on representative strains from both taxa demonstrated that L. kefiranofaciens and L. kefirgranum share 100 % 16S rDNA sequence similarity and belong phylogenetically to the Lactobacillus acidophilus species group. DNA-DNA binding values of >79 % and analogous DNA G+C contents of 37-38 mol% showed that the strains studied belonged to one species: L. kefirgranum is a later synonym of L. kefiranofaciens. An emended description is proposed for L. kefiranofaciens. Due to the specific morphological and biochemical characteristics of these taxa in kefir grain formation, it is proposed that L. kefirgranum should be reclassified as L. kefiranofaciens subsp. kefirgranum subsp. nov.

  10. Structural and Thermodynamic Signatures of DNA Recognition by Mycobacterium tuberculosis DnaA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tsodikov, Oleg V.; Biswas, Tapan

    An essential protein, DnaA, binds to 9-bp DNA sites within the origin of replication oriC. These binding events are prerequisite to forming an enigmatic nucleoprotein scaffold that initiates replication. The number, sequences, positions, and orientations of these short DNA sites, or DnaA boxes, within the oriCs of different bacteria vary considerably. To investigate features of DnaA boxes that are important for binding Mycobacterium tuberculosis DnaA (MtDnaA), we have determined the crystal structures of the DNA binding domain (DBD) of MtDnaA bound to a cognate MtDnaA-box (at 2.0 {angstrom} resolution) and to a consensus Escherichia coli DnaA-box (at 2.3 {angstrom}). Thesemore » structures, complemented by calorimetric equilibrium binding studies of MtDnaA DBD in a series of DnaA-box variants, reveal the main determinants of DNA recognition and establish the [T/C][T/A][G/A]TCCACA sequence as a high-affinity MtDnaA-box. Bioinformatic and calorimetric analyses indicate that DnaA-box sequences in mycobacterial oriCs generally differ from the optimal binding sequence. This sequence variation occurs commonly at the first 2 bp, making an in vivo mycobacterial DnaA-box effectively a 7-mer and not a 9-mer. We demonstrate that the decrease in the affinity of these MtDnaA-box variants for MtDnaA DBD relative to that of the highest-affinity box TTGTCCACA is less than 10-fold. The understanding of DnaA-box recognition by MtDnaA and E. coli DnaA enables one to map DnaA-box sequences in the genomes of M. tuberculosis and other eubacteria.« less

  11. Comparison of structure, function and regulation of plant cold shock domain proteins to bacterial and animal cold shock domain proteins.

    PubMed

    Chaikam, Vijay; Karlson, Dale T

    2010-01-01

    The cold shock domain (CSD) is among the most ancient and well conserved nucleic acid binding domains from bacteria to higher animals and plants. The CSD facilitates binding to RNA, ssDNA and dsDNA and most functions attributed to cold shock domain proteins are mediated by this nucleic acid binding activity. In prokaryotes, cold shock domain proteins only contain a single CSD and are termed cold shock proteins (Csps). In animal model systems, various auxiliary domains are present in addition to the CSD and are commonly named Y-box proteins. Similar to animal CSPs, plant CSPs contain auxiliary C-terminal domains in addition to their N-terminal CSD. Cold shock domain proteins have been shown to play important roles in development and stress adaptation in wide variety of organisms. In this review, the structure, function and regulation of plant CSPs are compared and contrasted to the characteristics of bacterial and animal CSPs. [BMB reports 2010; 43(1): 1-8].

  12. Binding Linkage in a Telomere DNA–Protein Complex at the Ends of Oxytricha nova Chromosomes

    PubMed Central

    Buczek, Pawel; Orr, Rochelle S.; Pyper, Sean R.; Shum, Mili; Ota, Emily Kimmel Irene; Gerum, Shawn E.; Horvath, Martin P.

    2005-01-01

    Alpha and beta protein subunits of the telomere end binding protein from Oxytricha nova (OnTEBP) combine with telomere single strand DNA to form a protective cap at the ends of chromosomes. We tested how protein–protein interactions seen in the co-crystal structure relate to DNA binding through use of fusion proteins engineered as different combinations of domains and subunits derived from OnTEBP. Joining alpha and beta resulted in a protein that bound single strand telomere DNA with high affinity (KD-DNA=1.4 nM). Another fusion protein, constructed without the C-terminal protein–protein interaction domain of alpha, bound DNA with 200-fold diminished affinity (KD-DNA=290 nM) even though the DNA-binding domains of alpha and beta were joined through a peptide linker. Adding back the alpha C-terminal domain as a separate protein restored high-affinity DNA binding. The binding behaviors of these fusion proteins and the native protein subunits are consistent with cooperative linkage between protein-association and DNA-binding equilibria. Linking DNA–protein stability to protein–protein contacts at a remote site may provide a trigger point for DNA–protein disassembly during telomere replication when the single strand telomere DNA must exchange between a very stable OnTEBP complex and telomerase. PMID:15967465

  13. Deciphering the groove binding modes of tau-fluvalinate and flumethrin with calf thymus DNA

    NASA Astrophysics Data System (ADS)

    Tao, Mo; Zhang, Guowen; Pan, Junhui; Xiong, Chunhong

    2016-02-01

    Tau-fluvalinate (TFL) and flumethrin (FL), widely used in agriculture and a class of synthetic pyrethroid pesticides with a similar structure, may cause a potential security risk. Herein, the modes of binding in vitro of TFL and FL with calf thymus DNA (ctDNA) were characterized by fluorescence, UV-vis absorption, circular dichroism (CD) and Fourier transform infrared (FT-IR) spectroscopy with the aid of viscosity measurements, melting analyses and molecular docking studies. The fluorescence titration indicated that both TFL and FL bound to ctDNA forming complexes through hydrogen bonding and van der Waals forces. The binding constants of TFL and FL with ctDNA were in the range of 104 L mol- 1, and FL exhibited a higher binding propensity than TFL. The iodide quenching effect, single/double-stranded DNA effects, and ctDNA melting and viscosity measurements demonstrated that the binding of both TFL and FL to ctDNA was groove mode. The FT-IR analyses suggested the A-T region of the minor groove of ctDNA as the preferential binding for TFL and FL, which was confirmed by the displacement assays with Hoechst 33258 probe, and the molecular docking visualized the specific binding. The changes in CD spectra indicated that both FL and TFL induced the perturbation on the base stacking and helicity of B-DNA, but the disturbance caused by FL was more obvious. Gel electrophoresis analyses indicated that both TFL and FL did not cause significant DNA cleavage. This study provides novel insights into the binding properties of TFL/FL with ctDNA and its toxic mechanisms.

  14. Deep-sea vent phage DNA polymerase specifically initiates DNA synthesis in the absence of primers.

    PubMed

    Zhu, Bin; Wang, Longfei; Mitsunobu, Hitoshi; Lu, Xueling; Hernandez, Alfredo J; Yoshida-Takashima, Yukari; Nunoura, Takuro; Tabor, Stanley; Richardson, Charles C

    2017-03-21

    A DNA polymerase is encoded by the deep-sea vent phage NrS-1. NrS-1 has a unique genome organization containing genes that are predicted to encode a helicase and a single-stranded DNA (ssDNA)-binding protein. The gene for an unknown protein shares weak homology with the bifunctional primase-polymerases (prim-pols) from archaeal plasmids but is missing the zinc-binding domain typically found in primases. We show that this gene product has efficient DNA polymerase activity and is processive in DNA synthesis in the presence of the NrS-1 helicase and ssDNA-binding protein. Remarkably, this NrS-1 DNA polymerase initiates DNA synthesis from a specific template DNA sequence in the absence of any primer. The de novo DNA polymerase activity resides in the N-terminal domain of the protein, whereas the C-terminal domain enhances DNA binding.

  15. Modeling the interactions of the nucleotide excision repair UvrA(2) dimer with DNA.

    PubMed

    Gantchev, Tsvetan G; Hunting, Darel J

    2010-12-28

    The UvrA protein initiates the DNA damage recognition process by the bacterial nucleotide excision repair (NER) system. Recently, crystallographic structures of holo-UvrA(2) dimers from two different microorganisms have been released (Protein Data Bank entries 2r6f , 2vf7 , and 2vf8 ). However, the details of the DNA binding by UvrA(2) and other peculiarities involved in the damage recognition process remain unknown. We have undertaken a molecular modeling approach to appraise the possible modes of DNA-UvrA(2) interaction using molecular docking and short-scale guided molecular dynamics [continuum field, constrained, and/or unrestricted simulated annealing (SA)], taking into account the three-dimensional location of a series of mutation-identified UvrA residues implicated in DNA binding. The molecular docking was based on the assumptions that the UvrA(2) dimer is preformed prior to DNA binding and that no major protein conformational rearrangements, except moderate domain reorientations, are required for binding of undamaged DNA. As a first approximation, DNA was treated as a rigid ligand. From the electrostatic relief of the ventral surface of UvrA(2), we initially identified three, noncollinear DNA binding paths. Each of the three resulting nucleoprotein complexes (C1, C2, and C3) was analyzed separately, including calculation of binding energies, the number and type of interaction residues (including mutated ones), and the predominant mode of translational and rotational motion of specific protein domains after SA to ensure improved DNA binding. The UvrA(2) dimer can accommodate DNA in all three orientations, albeit with different binding strengths. One of the UvrA(2)-DNA complexes (C1) fulfilled most of the requirements (high interaction energy, proximity of DNA to mutated residues, etc.) expected for a natural, high-affinity DNA binding site. This nucleoprotein presents a structural organization that is designed to clamp and bend double-stranded DNA. We examined the binding site in more detail by docking DNAs of significantly different (AT- vs CG-enriched) sequences and by submitting the complexes to DNA-unrestricted SA. It was found that in a manner independent of the DNA sequence and applied MD protocols, UvrA(2) favors binding of a bent and unwound undamaged DNA, with a kink positioned in the proximity of the Zn3 hairpins, anticollinearly aligned at the bottom of the ventral protein surface. It is further hypothesized that the Zn3 modules play an essential role in the damage recognition process and that the apparent existence of a family of DNA binding sites might be biologically relevant. Our data should prove to be useful in rational (structure-based) mutation studies.

  16. DNA sensing by a Eu-binding peptide containing a proflavine unit.

    PubMed

    Ancel, Laetitia; Gateau, Christelle; Lebrun, Colette; Delangle, Pascale

    2013-01-18

    Synthesis of a lanthanide-binding peptide (LBP) for the detection of double-stranded DNA is presented. A proflavine moiety was introduced into a high affinity LBP involving two unnatural chelating amino acids in the Ln ion coordination. The Eu(3+)-LBP complex is demonstrated to bind to ct-DNA and to sensitize Eu luminescence. The DNA binding process is effectively detected via the Eu-centered luminescence thanks to the intimate coupling between the LBP scaffold and DNA intercalating unit.

  17. Thermodynamic characterization of binding Oxytricha nova single strand telomere DNA with the alpha protein N-terminal domain.

    PubMed

    Buczek, Pawel; Horvath, Martin P

    2006-06-23

    The Oxytricha nova telemere binding protein alpha subunit binds single strand DNA and participates in a nucleoprotein complex that protects the very ends of chromosomes. To understand how the N-terminal, DNA binding domain of alpha interacts with DNA we measured the stoichiometry, enthalpy (DeltaH), entropy (DeltaS), and dissociation constant (K(D-DNA)) for binding telomere DNA fragments at different temperatures and salt concentrations using native gel electrophoresis and isothermal titration calorimetry (ITC). About 85% of the total free energy of binding corresponded with non-electrostatic interactions for all DNAs. Telomere DNA fragments d(T(2)G(4)), d(T(4)G(4)), d(G(3)T(4)G(4)), and d(G(4)T(4)G(4)) each formed monovalent protein complexes. In the case of d(T(4)G(4)T(4)G(4)), which has two tandemly repeated d(TTTTTGGGG) telomere motifs, two binding sites were observed. The high-affinity "A site" has a dissociation constant, K(D-DNA(A)) = 13(+/-4) nM, while the low-affinity "B site" is characterized by K(D-DNA(B)) = 5600(+/-600) nM at 25 degrees C. Nucleotide substitution variants verified that the A site corresponds principally with the 3'-terminal portion of d(T(4)G(4)T(4)G(4)). The relative contributions of entropy (DeltaS) and enthalpy (DeltaH) for binding reactions were DNA length-dependent as was heat capacity (DeltaCp). These trends with respect to DNA length likely reflect structural transitions in the DNA molecule that are coupled with DNA-protein association. Results presented here are important for understanding early intermediates and subsequent stages in the assembly of the full telomere nucleoprotein complex and how binding events can prepare the telomere DNA for extension by telomerase, a critical event in telomere biology.

  18. Effect of magnesium ions on the structure of DNA thin films: an infrared spectroscopy study

    PubMed Central

    Serec, Kristina; Babić, Sanja Dolanski; Podgornik, Rudolf; Tomić, Silvia

    2016-01-01

    Utilizing Fourier transform infrared spectroscopy we have investigated the vibrational spectrum of thin dsDNA films in order to track the structural changes upon addition of magnesium ions. In the range of low magnesium concentration ([magnesium]/[phosphate] = [Mg]/[P] < 0.5), both the red shift and the intensity of asymmetric PO2 stretching band decrease, indicating an increase of magnesium-phosphate binding in the backbone region. Vibration characteristics of the A conformation of the dsDNA vanish, whereas those characterizing the B conformation become fully stabilized. In the crossover range with comparable Mg and intrinsic Na DNA ions ([Mg]/[P] ≈ 1) B conformation remains stable; vibrational spectra show moderate intensity changes and a prominent blue shift, indicating a reinforcement of the bonds and binding in both the phosphate and the base regions. The obtained results reflect the modified screening and local charge neutralization of the dsDNA backbone charge, thus consistently demonstrating that the added Mg ions interact with DNA via long-range electrostatic forces. At high Mg contents ([Mg]/[P] > 10), the vibrational spectra broaden and show a striking intensity rise, while the base stacking remains unaffected. We argue that at these extreme conditions, where a charge compensation by vicinal counterions reaches 92–94%, DNA may undergo a structural transition into a more compact form. PMID:27484473

  19. Structural basis for DNA binding by replication initiator Mcm10

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Warren, Eric M.; Vaithiyalingam, Sivaraja; Haworth, Justin

    2009-06-30

    Mcm10 is an essential eukaryotic DNA replication protein required for assembly and progression of the replication fork. The highly conserved internal domain (Mcm10-ID) has been shown to physically interact with single-stranded (ss) DNA, DNA polymerase alpha, and proliferating cell nuclear antigen (PCNA). The crystal structure of Xenopus laevis Mcm10-ID presented here reveals a DNA binding architecture composed of an oligonucleotide/oligosaccharide-fold followed in tandem by a variant and highly basic zinc finger. NMR chemical shift perturbation and mutational studies of DNA binding activity in vitro reveal how Mcm10 uses this unique surface to engage ssDNA. Corresponding mutations in Saccharomyces cerevisiae resultmore » in increased sensitivity to replication stress, demonstrating the functional importance of DNA binding by this region of Mcm10 to replication. In addition, mapping Mcm10 mutations known to disrupt PCNA, polymerase alpha, and DNA interactions onto the crystal structure provides insight into how Mcm10 might coordinate protein and DNA binding within the replisome.« less

  20. Cdc45-induced loading of human RPA onto single-stranded DNA

    PubMed Central

    Tessmer, Ingrid; Prus, Piotr; Schlott, Bernhard; Pospiech, Helmut

    2017-01-01

    Abstract Cell division cycle protein 45 (Cdc45) is an essential component of the eukaryotic replicative DNA helicase. We found that human Cdc45 forms a complex with the single-stranded DNA (ssDNA) binding protein RPA. Moreover, it actively loads RPA onto nascent ssDNA. Pull-down assays and surface plasmon resonance studies revealed that Cdc45-bound RPA complexed with ssDNA in the 8–10 nucleotide binding mode, but dissociated when RPA covered a 30-mer. Real-time analysis of RPA-ssDNA binding demonstrated that Cdc45 catalytically loaded RPA onto ssDNA. This placement reaction required physical contacts of Cdc45 with the RPA70A subdomain. Our results imply that Cdc45 controlled stabilization of the 8-nt RPA binding mode, the subsequent RPA transition into 30-mer mode and facilitated an ordered binding to ssDNA. We propose that a Cdc45-mediated loading guarantees a seamless deposition of RPA on newly emerging ssDNA at the nascent replication fork. PMID:28100698

  1. Genome-wide survey of DNA-binding proteins in Arabidopsis thaliana: analysis of distribution and functions.

    PubMed

    Malhotra, Sony; Sowdhamini, Ramanathan

    2013-08-01

    The interaction of proteins with their respective DNA targets is known to control many high-fidelity cellular processes. Performing a comprehensive survey of the sequenced genomes for DNA-binding proteins (DBPs) will help in understanding their distribution and the associated functions in a particular genome. Availability of fully sequenced genome of Arabidopsis thaliana enables the review of distribution of DBPs in this model plant genome. We used profiles of both structure and sequence-based DNA-binding families, derived from PDB and PFam databases, to perform the survey. This resulted in 4471 proteins, identified as DNA-binding in Arabidopsis genome, which are distributed across 300 different PFam families. Apart from several plant-specific DNA-binding families, certain RING fingers and leucine zippers also had high representation. Our search protocol helped to assign DNA-binding property to several proteins that were previously marked as unknown, putative or hypothetical in function. The distribution of Arabidopsis genes having a role in plant DNA repair were particularly studied and noted for their functional mapping. The functions observed to be overrepresented in the plant genome harbour DNA-3-methyladenine glycosylase activity, alkylbase DNA N-glycosylase activity and DNA-(apurinic or apyrimidinic site) lyase activity, suggesting their role in specialized functions such as gene regulation and DNA repair.

  2. The large terminase DNA packaging motor grips DNA with its ATPase domain for cleavage by the flexible nuclease domain

    PubMed Central

    Hilbert, Brendan J.; Hayes, Janelle A.; Stone, Nicholas P.; Xu, Rui-Gang

    2017-01-01

    Abstract Many viruses use a powerful terminase motor to pump their genome inside an empty procapsid shell during virus maturation. The large terminase (TerL) protein contains both enzymatic activities necessary for packaging in such viruses: the adenosine triphosphatase (ATPase) that powers DNA translocation and an endonuclease that cleaves the concatemeric genome at both initiation and completion of genome packaging. However, how TerL binds DNA during translocation and cleavage remains mysterious. Here we investigate DNA binding and cleavage using TerL from the thermophilic phage P74-26. We report the structure of the P74-26 TerL nuclease domain, which allows us to model DNA binding in the nuclease active site. We screened a large panel of TerL variants for defects in binding and DNA cleavage, revealing that the ATPase domain is the primary site for DNA binding, and is required for nuclease activity. The nuclease domain is dispensable for DNA binding but residues lining the active site guide DNA for cleavage. Kinetic analysis of DNA cleavage suggests flexible tethering of the nuclease domains during DNA cleavage. We propose that interactions with the procapsid during DNA translocation conformationally restrict the nuclease domain, inhibiting cleavage; TerL release from the capsid upon completion of packaging unlocks the nuclease domains to cleave DNA. PMID:28082398

  3. Effect of Escherichia coli DNA binding protein on the transcription of single-stranded phage M13 DNA by Escherichia coli RNA polymerase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Niyogi, S.K.; Ratrie, H. III; Datta, A.K.

    E. coli DNA binding protein strongly inhibits the transcription of single-stranded rather than double-stranded phage M13 DNA by E. coli RNA polymerase. This inhibition cannot be significantly overcome by increasing the concentration of RNA polymerase. Nor does the order of addition of binding protein affect its inhibitory property: inhibition is evident whether binding protein is added before or after the formation of the RNA polymerase--DNA complex. Inhibition is also observed if binding protein is added at various times after initiation of RNA synthesis. Maximal inhibition occurs at a binding protein-to-DNA ratio (w/w) of about 8:1. This corresponds to one bindingmore » protein molecule covering about 30 nucleotides, in good agreement with values obtained by physical measurements.« less

  4. Binding modes and pathway of RHPS4 to human telomeric G-quadruplex and duplex DNA probed by all-atom molecular dynamics simulations with explicit solvent.

    PubMed

    Mulholland, Kelly; Siddiquei, Farzana; Wu, Chun

    2017-07-19

    RHPS4, a potent binder to human telomeric DNA G-quadruplex, shows high efficacy in tumor cell growth inhibition. However, it's preferential binding to DNA G-quadruplex over DNA duplex (about 10 fold) remains to be improved toward its clinical application. A high resolution structure of the single-stranded telomeric DNA G-quadruplexes, or B-DNA duplex, in complex with RHPS4 is not available yet, and the binding nature of this ligand to these DNA forms remains to be elusive. In this study, we carried out 40 μs molecular dynamics binding simulations with a free ligand to decipher the binding pathway of RHPS4 to a DNA duplex and three G-quadruplex folders (parallel, antiparallel and hybrid) of the human telomeric DNA sequence. The most stable binding mode identified for the duplex, parallel, antiparallel and hybrid G-quadruplexes is an intercalation, bottom stacking, top intercalation and bottom intercalation mode, respectively. The intercalation mode with similar binding strength to both the duplex and the G-quadruplexes, explains the lack of binding selectivity of RHPS4 to the G-quadruplex form. Therefore, a ligand modification that destabilizes the duplex intercalation mode but stabilizes the G-quadruplex intercalation mode will improve the binding selectivity toward G-quadruplex. The intercalation mode of RHPS4 to both the duplex and the antiparallel and the hybrid G-quadruplex follows a base flipping-insertion mechanism rather than an open-insertion mechanism. The groove binding, the side binding and the intercalation with flipping out of base were observed to be intermediate states before the full intercalation state with paired bases.

  5. Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models.

    PubMed

    Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook

    2014-11-01

    As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of our knowledge, this is the first attempt to predict protein-binding nucleotides in a given DNA sequence from the sequence data alone. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  6. Loop L1 governs the DNA-binding specificity and order for RecA-catalyzed reactions in homologous recombination and DNA repair

    PubMed Central

    Shinohara, Takeshi; Ikawa, Shukuko; Iwasaki, Wakana; Hiraki, Toshiki; Hikima, Takaaki; Mikawa, Tsutomu; Arai, Naoto; Kamiya, Nobuo; Shibata, Takehiko

    2015-01-01

    In all organisms, RecA-family recombinases catalyze homologous joint formation in homologous genetic recombination, which is essential for genome stability and diversification. In homologous joint formation, ATP-bound RecA/Rad51-recombinases first bind single-stranded DNA at its primary site and then interact with double-stranded DNA at another site. The underlying reason and the regulatory mechanism for this conserved binding order remain unknown. A comparison of the loop L1 structures in a DNA-free RecA crystal that we originally determined and in the reported DNA-bound active RecA crystals suggested that the aspartate at position 161 in loop L1 in DNA-free RecA prevented double-stranded, but not single-stranded, DNA-binding to the primary site. This was confirmed by the effects of the Ala-replacement of Asp-161 (D161A), analyzed directly by gel-mobility shift assays and indirectly by DNA-dependent ATPase activity and SOS repressor cleavage. When RecA/Rad51-recombinases interact with double-stranded DNA before single-stranded DNA, homologous joint-formation is suppressed, likely by forming a dead-end product. We found that the D161A-replacement reduced this suppression, probably by allowing double-stranded DNA to bind preferentially and reversibly to the primary site. Thus, Asp-161 in the flexible loop L1 of wild-type RecA determines the preference for single-stranded DNA-binding to the primary site and regulates the DNA-binding order in RecA-catalyzed recombinase reactions. PMID:25561575

  7. Detection of DNA damage based on metal-mediated molecular beacon and DNA strands displacement reaction.

    PubMed

    Xiong, Yanxiang; Wei, Min; Wei, Wei; Yin, Lihong; Pu, Yuepu; Liu, Songqin

    2014-01-24

    DNA hairpin structure probes are usually designed by forming intra-molecular duplex based on Watson-Crick hydrogen bonds. In this paper, a molecular beacon based on silver ions-mediated cytosine-Ag(+)-cytosine base pairs was used to detect DNA. The inherent characteristic of the metal ligation facilitated the design of functional probe and the adjustment of its binding strength compared to traditional DNA hairpin structure probes, which make it be used to detect DNA in a simple, rapid and easy way with the help of DNA strands displacement reaction. The method was sensitive and also possesses the good specificity to differentiate the single base mismatched DNA from the complementary DNA. It was also successfully applied to study the damage effect of classic genotoxicity chemicals such as styrene oxide and sodium arsenite on DNA, which was significant in food science, environmental science and pharmaceutical science. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. Structures of apo IRF-3 and IRF-7 DNA binding domains: effect of loop L1 on DNA binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    De Ioannes, Pablo; Escalante, Carlos R.; Aggarwal, Aneel K.

    2013-11-20

    Interferon regulatory factors IRF-3 and IRF-7 are transcription factors essential in the activation of interferon-{beta} (IFN-{beta}) gene in response to viral infections. Although, both proteins recognize the same consensus IRF binding site AANNGAAA, they have distinct DNA binding preferences for sites in vivo. The X-ray structures of IRF-3 and IRF-7 DNA binding domains (DBDs) bound to IFN-{beta} promoter elements revealed flexibility in the loops (L1-L3) and the residues that make contacts with the target sequence. To characterize the conformational changes that occur on DNA binding and how they differ between IRF family members, we have solved the X-ray structures ofmore » IRF-3 and IRF-7 DBDs in the absence of DNA. We found that loop L1, carrying the conserved histidine that interacts with the DNA minor groove, is disordered in apo IRF-3 but is ordered in apo IRF-7. This is reflected in differences in DNA binding affinities when the conserved histidine in loop L1 is mutated to alanine in the two proteins. The stability of loop L1 in IRF-7 derives from a unique combination of hydrophobic residues that pack against the protein core. Together, our data show that differences in flexibility of loop L1 are an important determinant of differential IRF-DNA binding.« less

  9. Isolation and characterization of target sequences of the chicken CdxA homeobox gene.

    PubMed Central

    Margalit, Y; Yarus, S; Shapira, E; Gruenbaum, Y; Fainsod, A

    1993-01-01

    The DNA binding specificity of the chicken homeodomain protein CDXA was studied. Using a CDXA-glutathione-S-transferase fusion protein, DNA fragments containing the binding site for this protein were isolated. The sources of DNA were oligonucleotides with random sequence and chicken genomic DNA. The DNA fragments isolated were sequenced and tested in DNA binding assays. Sequencing revealed that most DNA fragments are AT rich which is a common feature of homeodomain binding sites. By electrophoretic mobility shift assays it was shown that the different target sequences isolated bind to the CDXA protein with different affinities. The specific sequences bound by the CDXA protein in the genomic fragments isolated, were determined by DNase I footprinting. From the footprinted sequences, the CDXA consensus binding site was determined. The CDXA protein binds the consensus sequence A, A/T, T, A/T, A, T, A/G. The CAUDAL binding site in the ftz promoter is also included in this consensus sequence. When tested, some of the genomic target sequences were capable of enhancing the transcriptional activity of reporter plasmids when introduced into CDXA expressing cells. This study determined the DNA sequence specificity of the CDXA protein and it also shows that this protein can further activate transcription in cells in culture. Images PMID:7909943

  10. Interaction of small molecules with double-stranded RNA: spectroscopic, viscometric, and calorimetric study of hoechst and proflavine binding to PolyCG structures.

    PubMed

    Sinha, Rangana; Hossain, Maidul; Kumar, Gopinatha Suresh

    2009-04-01

    Design and synthesis of new small molecules binding to double-stranded RNA necessitate complete understanding of the molecular aspects of the binding of many existing molecules. Toward this goal, in this work we evaluated the biophysical aspects of the interaction of a DNA intercalator (proflavine) and a minor groove binder (hoechst 33258) with two polymorphic forms of polyCG, namely, the right-handed Watson-Crick base paired A-form and the left-handed Hoogsteen base paired H(L)-form, by absorption, fluorescence, and viscometry experiments. The energetics of the interaction of these molecules with the RNA structures has also been elucidated by isothermal titration calorimetry (ITC). Results suggest that proflavine strongly intercalates in both forms of polyCG, whereas hoechst shows mainly groove-binding modes. The binding of both drugs to both forms of RNA resulted in significant conformational change to the RNA structure with the bound molecules being placed in the chiral RNA helix. ITC profiles for both proflavine and hoechst show two binding sites. Binding of proflavine to both forms of RNA is endothermic and entropy driven in the first site and exothermic and enthalpy driven in the second site, whereas hoechst binding to both forms of RNA is exothermic and enthalpy driven in the first site and endothermic and entropy driven in the second site. This study suggests that the binding affinity characteristics and energetics of interaction of these DNA binding molecules with the RNA conformations are significantly different and may serve as data for future development of effective structure-selective RNA-based drugs.

  11. Interrelations of secondary structure stability and DNA-binding affinity in the bacteriophage SPO1-encoded type II DNA-binding protein TF1.

    PubMed

    Andera, L; Spangler, C J; Galeone, A; Mayol, L; Geiduschek, E P

    1994-02-11

    TF1, a homodimeric DNA-binding and -bending protein with a preference for hydroxymethyluracil-containing DNA is the Bacillus subtilis-encoded homolog of the bacterial HU proteins and of the E. coli integration host factor. A temperature-sensitive mutation at amino acid 25 of TF1 (L25-->A) and two intragenic second site revertants at amino acids 15 (E15-->G) and 32 (L32-->I) were previously identified and their effects on virus development were examined. The DNA-binding properties of these proteins and the thermal stability of their secondary structures have now been analyzed. Amino acids 15 and 32 are far removed from the putative DNA-binding domains of TF1 but changes there exert striking effects on DNA affinity that correlate with effects on structure. The double mutant protein TF1-G15I32 binds to a preferred site in hydroxymethyluracil-containing DNA 40 times more tightly, denatures at higher temperature (delta tm = 21 degrees C), and also exchanges subunits much more slowly than does the wild-type protein. The L25-->A mutation makes TF1 secondary structure and DNA-binding highly salt concentration-dependent. The E15-->G mutation partly suppresses this effect: secondary structure of TF1-A25G15 is restored at 21 degrees C by 1 M NaCl or, at low NaCl concentration, by binding to DNA.

  12. Thermodynamic Characterization of Binding Oxytricha nova Single Strand Telomere DNA with the Alpha Protein N-terminal Domain

    PubMed Central

    Buczek, Pawel; Horvath, Martin P.

    2010-01-01

    The Oxytricha nova telomere binding protein alpha subunit binds single strand DNA and participates in a nucleoprotein complex that protects the very ends of chromosomes. To understand how the N-terminal, DNA binding domain of alpha interacts with DNA we measured the stoichiometry, enthalpy (ΔH), entropy (ΔS), and dissociation constant (KD-DNA) for binding telomere DNA fragments at different temperatures and salt concentrations using native gel electrophoresis and isothermal titration calorimetry (ITC). About 85% of the total free energy of binding corresponded with non-electrostatic interactions for all DNAs. Telomere DNA fragments d(T2G4), d(T4G4), d(G3T4G4), and d(G4T4G4) each formed monovalent protein complexes. In the case of d(T4G4T4G4), which has two tandemly repeated d(TTTTTGGGG) telomere motifs, two binding sites were observed. The high-affinity “A site” has a dissociation constant, KD-DNA(A)=13(±4) nM, while the low-affinity “B site” is characterized by KD-DNA(B)=5600(±600) nM at 25 °C. Nucleotide substitution variants verified that the A site corresponds principally with the 3′-terminal portion of d(T4G4T4G4). The relative contributions of entropy (ΔS) and enthalpy (ΔH) for binding reactions were DNA length-dependent as was heat capacity (ΔCp). These trends with respect to DNA length likely reflect structural transitions in the DNA molecule that are coupled with DNA–protein association. Results presented here are important for understanding early intermediates and subsequent stages in the assembly of the full telomere nucleoprotein complex and how binding events can prepare the telomere DNA for extension by telomerase, a critical event in telomere biology. PMID:16678852

  13. The DnaK Chaperone Uses Different Mechanisms To Promote and Inhibit Replication of Vibrio cholerae Chromosome 2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jha, Jyoti K.; Li, Mi; Ghirlando, Rodolfo

    Replication of Vibrio cholerae chromosome 2 (Chr2) depends on molecular chaperone DnaK to facilitate binding of the initiator (RctB) to the replication origin. The binding occurs at two kinds of site, 12-mers and 39-mers, which promote and inhibit replication, respectively. Here we show that DnaK employs different mechanisms to enhance the two kinds of binding. We found that mutations inrctBthat reduce DnaK binding also reduce 12-mer binding and initiation. The initiation defect is suppressed by second-site mutations that increase 12-mer binding only marginally. Instead, they reduce replication inhibitory mechanisms: RctB dimerization and 39-mer binding. One suppressing change was in amore » dimerization domain which is folded similarly to the initiator of an iteron plasmid—the presumed progenitor of Chr2. In plasmids, DnaK promotes initiation by reducing dimerization. A different mutation was in the 39-mer binding domain of RctB and inactivated it, indicating an alternative suppression mechanism. Paradoxically, although DnaK increases 39-mer binding, the increase was also achieved by inactivating the DnaK binding site of RctB. This result suggests that the site inhibits the 39-mer binding domain (via autoinhibition) when prevented from binding DnaK. Taken together, our results reveal an important feature of the transition from plasmid to chromosome: the Chr2 initiator retains the plasmid-like dimerization domain and its control by chaperones but uses the chaperones in an unprecedented way to control the inhibitory 39-mer binding. IMPORTANCE The capacity of proteins to undergo remodeling provides opportunities to control their function. However, remodeling remains a poorly understood aspect of the structure-function paradigm due to its dynamic nature. Here we have studied remodeling of the initiator of replication ofVibrio choleraeChr2 by the molecular chaperone, DnaK. We show that DnaK binds to a site on the Chr2 initiator (RctB) that promotes initiation by reducing the initiator’s propensity to dimerize. Dimerization of the initiator of the putative plasmid progenitor of Chr2 is also reduced by DnaK, which promotes initiation. Paradoxically, the DnaK binding also promotes replication inhibition by reducing an autoinhibitory activity of RctB. In the plasmid-to-chromosome transition, it appears that the initiator has acquired an autoinhibitory activity and along with it a new chaperone activity that apparently helps to control replication inhibition independently of replication promotion.« less

  14. New phthalimide-appended Schiff bases: Studies of DNA binding, molecular docking and antioxidant activities.

    PubMed

    Nayab, Pattan Sirajuddin; Akrema; Ansari, Istikhar A; Shahid, Mohammad; Rahisuddin

    2017-08-01

    Herein, we investigated new phthalimide-based Schiff base molecules as promising DNA-binding and free radical scavenging agents. Physicochemical properties of these molecules were demonstrated on the basis of elemental analysis, ultraviolet-visible (UV-Vis), infra-red (IR), 1 H and 13 C nuclear magnetic resonance (NMR) spectroscopy. All spectral data are agreed well with the proposed Schiff base framework. The DNA-binding potential of synthesized compounds were investigated by means of UV-visible, fluorescence, iodide quenching, circular dichroism, viscosity and thermal denaturation studies. The intrinsic binding constants (K b ) were calculated from absorption studies were found to be 1.1 × 10 4 and 1.0 × 10 4  M -1 for compounds 2a and 2b suggesting that compound 2a binding abilities with DNA were stronger than the compound 2b. Our studies showed that the presented compounds interact with DNA through groove binding. Molecular docking studies were carried out to predict the binding between Ct-DNA and test compounds. Interestingly, in silico predictions were corroborated with in vitro DNA-binding conclusions. Furthermore, the title compounds displayed remarkable antioxidant activity compared with reference standard. Copyright © 2016 John Wiley & Sons, Ltd.

  15. pUL34 binding near the human cytomegalovirus origin of lytic replication enhances DNA replication and viral growth.

    PubMed

    Slayton, Mark; Hossain, Tanvir; Biegalke, Bonita J

    2018-05-01

    The human cytomegalovirus (HCMV) UL34 gene encodes sequence-specific DNA-binding proteins (pUL34) which are required for viral replication. Interactions of pUL34 with DNA binding sites represses transcription of two viral immune evasion genes, US3 and US9. 12 additional predicted pUL34-binding sites are present in the HCMV genome (strain AD169) with three binding sites concentrated near the HCMV origin of lytic replication (oriLyt). We used ChIP-seq analysis of pUL34-DNA interactions to confirm that pUL34 binds to the oriLyt region during infection. Mutagenesis of the UL34-binding sites in an oriLyt-containing plasmid significantly reduced viral-mediated oriLyt-dependent DNA replication. Mutagenesis of these sites in the HCMV genome reduced the replication efficiencies of the resulting viruses. Protein-protein interaction analyses demonstrated that pUL34 interacts with the viral proteins IE2, UL44, and UL84, that are essential for viral DNA replication, suggesting that pUL34-DNA interactions in the oriLyt region are involved in the DNA replication cascade. Copyright © 2018 Elsevier Inc. All rights reserved.

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Akabayov, B.; Akabayov, S; Lee , S

    Gene 5 of bacteriophage T7 encodes a DNA polymerase (gp5) responsible for the replication of the phage DNA. Gp5 polymerizes nucleotides with low processivity, dissociating after the incorporation of 1 to 50 nucleotides. Thioredoxin (trx) of Escherichia coli binds tightly (Kd = 5 nM) to a unique segment in the thumb subdomain of gp5 and increases processivity. We have probed the molecular basis for the increase in processivity. A single-molecule experiment reveals differences in rates of enzymatic activity and processivity between gp5 and gp5/trx. Small angle X-ray scattering studies combined with nuclease footprinting reveal two conformations of gp5, one inmore » the free state and one upon binding to trx. Comparative analysis of the DNA binding clefts of DNA polymerases and DNA binding proteins show that the binding surface contains more hydrophobic residues than other DNA binding proteins. The balanced composition between hydrophobic and charged residues of the binding site allows for efficient sliding of gp5/trx on the DNA. We propose a model for trx-induced conformational changes in gp5 that enhance the processivity by increasing the interaction of gp5 with DNA.« less

  17. Resolution of the diadenosine 5',5"'-P1,P4-tetraphosphate binding subunit from a multiprotein form of HeLa cell DNA polymerase alpha.

    PubMed Central

    Baril, E; Bonin, P; Burstein, D; Mara, K; Zamecnik, P

    1983-01-01

    A diadenosine 5',5"'-P1,P4-tetraphosphate (Ap4A) binding subunit has been resolved from a high molecular weight (640,000) multiprotein form of DNA polymerase alpha [deoxynucleoside triphosphate:DNA nucleotidyltransferase (DNA-directed), EC 2.7.7.7] from HeLa cells [DNA polymerase alpha 2 of Lamothe, P., Baril, B., Chi, A., Lee, L. & Baril, E. (1981) Proc. Natl. Acad. Sci. USA 78, 4723-4727]. The Ap4A binding activity copurifies with the DNA polymerizing activity during the course of purification. Hydrophobic chromatography on butylagarose resolves the Ap4A binding activity from the DNA polymerase. The Ap4A binding activity is protein in nature since the binding of Ap4A is abolished by treatment of the isolated binding activity with proteinase K but is insensitive to treatment with DNase or RNase. The molecular weight of the Ap4A binding protein, as determined by polyacrylamide gel electrophoresis under nondenaturing conditions or by NaDodSO4/polyacrylamide gel electrophoresis after photoaffinity labeling of the protein with [32P]Ap4A is 92,000 or 47,000. The binding activity of this protein is highly specific for Ap4A. Images PMID:6576366

  18. End-specific strategies of attachment of long double stranded DNA onto gold-coated nanofiber arrays

    NASA Astrophysics Data System (ADS)

    Peckys, Diana B.; de Jonge, Niels; Simpson, Michael L.; McKnight, Timothy E.

    2008-10-01

    We report the effective and site-specific binding of long double stranded (ds)DNA to high aspect ratio carbon nanofiber arrays. The carbon nanofibers were first coated with a thin gold layer to provide anchorage for two controllable binding methods. One method was based on the direct binding of thiol end-labeled dsDNA. The second and enhanced method used amine end-labeled dsDNA bound with crosslinkers to a carboxyl-terminated self-assembled monolayer. The bound dsDNA was first visualized with a fluorescent, dsDNA-intercalating dye. The specific binding onto the carbon nanofiber was verified by a high resolution detection method using scanning electron microscopy in combination with the binding of neutravidin-coated fluorescent microspheres to the immobilized and biotinylated dsDNA. Functional activity of thiol end-labeled dsDNA on gold-coated nanofiber arrays was verified with a transcriptional assay, whereby Chinese hamster lung cells (V79) were impaled upon the DNA-modified nanofibers and scored for transgene expression of the tethered template. Thiol end-labeled dsDNA demonstrated significantly higher expression levels than nanofibers prepared with control dsDNA that lacked a gold-binding end-label. Employing these site-specific and robust techniques of immobilization of dsDNA onto nanodevices can be of advantage for the study of DNA/protein interactions and for gene delivery applications.

  19. The key DNA-binding residues in the C-terminal domain of Mycobacterium tuberculosis DNA gyrase A subunit (GyrA)

    PubMed Central

    Huang, You-Yi; Deng, Jiao-Yu; Gu, Jing; Zhang, Zhi-Ping; Maxwell, Anthony; Bi, Li-Jun; Chen, Yuan-Yuan; Zhou, Ya-Feng; Yu, Zi-Niu; Zhang, Xian-En

    2006-01-01

    As only the type II topoisomerase is capable of introducing negative supercoiling, DNA gyrase is involved in crucial cellular processes. Although the other domains of DNA gyrase are better understood, the mechanism of DNA binding by the C-terminal domain of the DNA gyrase A subunit (GyrA-CTD) is less clear. Here, we investigated the DNA-binding sites in the GyrA-CTD of Mycobacterium tuberculosis gyrase through site-directed mutagenesis. The results show that Y577, R691 and R745 are among the key DNA-binding residues in M.tuberculosis GyrA-CTD, and that the third blade of the GyrA-CTD is the main DNA-binding region in M.tuberculosis DNA gyrase. The substitutions of Y577A, D669A, R691A, R745A and G729W led to the loss of supercoiling and relaxation activities, although they had a little effect on the drug-dependent DNA cleavage and decatenation activities, and had no effect on the ATPase activity. Taken together, these results showed that the GyrA-CTD is essential to DNA gyrase of M.tuberculosis, and promote the idea that the M.tuberculosis GyrA-CTD is a new potential target for drug design. It is the first time that the DNA-binding sites in GyrA-CTD have been identified. PMID:17038336

  20. Molecular dynamics studies on the DNA-binding process of ERG.

    PubMed

    Beuerle, Matthias G; Dufton, Neil P; Randi, Anna M; Gould, Ian R

    2016-11-15

    The ETS family of transcription factors regulate gene targets by binding to a core GGAA DNA-sequence. The ETS factor ERG is required for homeostasis and lineage-specific functions in endothelial cells, some subset of haemopoietic cells and chondrocytes; its ectopic expression is linked to oncogenesis in multiple tissues. To date details of the DNA-binding process of ERG including DNA-sequence recognition outside the core GGAA-sequence are largely unknown. We combined available structural and experimental data to perform molecular dynamics simulations to study the DNA-binding process of ERG. In particular we were able to reproduce the ERG DNA-complex with a DNA-binding simulation starting in an unbound configuration with a final root-mean-square-deviation (RMSD) of 2.1 Å to the core ETS domain DNA-complex crystal structure. This allowed us to elucidate the relevance of amino acids involved in the formation of the ERG DNA-complex and to identify Arg385 as a novel key residue in the DNA-binding process. Moreover we were able to show that water-mediated hydrogen bonds are present between ERG and DNA in our simulations and that those interactions have the potential to achieve sequence recognition outside the GGAA core DNA-sequence. The methodology employed in this study shows the promising capabilities of modern molecular dynamics simulations in the field of protein DNA-interactions.

  1. Integrating prior knowledge in multiple testing under dependence with applications to detecting differential DNA methylation.

    PubMed

    Kuan, Pei Fen; Chiang, Derek Y

    2012-09-01

    DNA methylation has emerged as an important hallmark of epigenetics. Numerous platforms including tiling arrays and next generation sequencing, and experimental protocols are available for profiling DNA methylation. Similar to other tiling array data, DNA methylation data shares the characteristics of inherent correlation structure among nearby probes. However, unlike gene expression or protein DNA binding data, the varying CpG density which gives rise to CpG island, shore and shelf definition provides exogenous information in detecting differential methylation. This article aims to introduce a robust testing and probe ranking procedure based on a nonhomogeneous hidden Markov model that incorporates the above-mentioned features for detecting differential methylation. We revisit the seminal work of Sun and Cai (2009, Journal of the Royal Statistical Society: Series B (Statistical Methodology)71, 393-424) and propose modeling the nonnull using a nonparametric symmetric distribution in two-sided hypothesis testing. We show that this model improves probe ranking and is robust to model misspecification based on extensive simulation studies. We further illustrate that our proposed framework achieves good operating characteristics as compared to commonly used methods in real DNA methylation data that aims to detect differential methylation sites. © 2012, The International Biometric Society.

  2. The evaluation of anoxia responsive E2F DNA binding activity in the red eared slider turtle, Trachemys scripta elegans.

    PubMed

    Biggar, Kyle K; Storey, Kenneth B

    2018-01-01

    In many cases, the DNA-binding activity of a transcription factor does not change, while its transcriptional activity is greatly influenced by the make-up of bound proteins. In this study, we assessed the protein composition and DNA-binding ability of the E2F transcription factor complex to provide insight into cell cycle control in an anoxia tolerant turtle through the use of a modified ELISA protocol. This modification also permits the use of custom DNA probes that are tailored to a specific DNA binding region, introducing the ability to design capture probes for non-model organisms. Through the use of EMSA and ELISA DNA binding assays, we have successfully determined the in vitro DNA binding activity and complex dynamics of the Rb/E2F cell cycle regulatory mechanisms in an anoxic turtle, Trachemys scripta elegans . Repressive cell cycle proteins (E2F4, Rb, HDAC4 and Suv39H1) were found to significantly increase at E2F DNA-binding sites upon anoxic exposure in anoxic turtle liver. The lack of p130 involvement in the E2F DNA-bound complex indicates that anoxic turtle liver may maintain G 1 arrest for the duration of stress survival.

  3. The evaluation of anoxia responsive E2F DNA binding activity in the red eared slider turtle, Trachemys scripta elegans

    PubMed Central

    Biggar, Kyle K.

    2018-01-01

    In many cases, the DNA-binding activity of a transcription factor does not change, while its transcriptional activity is greatly influenced by the make-up of bound proteins. In this study, we assessed the protein composition and DNA-binding ability of the E2F transcription factor complex to provide insight into cell cycle control in an anoxia tolerant turtle through the use of a modified ELISA protocol. This modification also permits the use of custom DNA probes that are tailored to a specific DNA binding region, introducing the ability to design capture probes for non-model organisms. Through the use of EMSA and ELISA DNA binding assays, we have successfully determined the in vitro DNA binding activity and complex dynamics of the Rb/E2F cell cycle regulatory mechanisms in an anoxic turtle, Trachemys scripta elegans. Repressive cell cycle proteins (E2F4, Rb, HDAC4 and Suv39H1) were found to significantly increase at E2F DNA-binding sites upon anoxic exposure in anoxic turtle liver. The lack of p130 involvement in the E2F DNA-bound complex indicates that anoxic turtle liver may maintain G1 arrest for the duration of stress survival. PMID:29770276

  4. Novel structural features drive DNA binding properties of Cmr, a CRP family protein in TB complex mycobacteria.

    PubMed

    Ranganathan, Sridevi; Cheung, Jonah; Cassidy, Michael; Ginter, Christopher; Pata, Janice D; McDonough, Kathleen A

    2018-01-09

    Mycobacterium tuberculosis (Mtb) encodes two CRP/FNR family transcription factors (TF) that contribute to virulence, Cmr (Rv1675c) and CRPMt (Rv3676). Prior studies identified distinct chromosomal binding profiles for each TF despite their recognizing overlapping DNA motifs. The present study shows that Cmr binding specificity is determined by discriminator nucleotides at motif positions 4 and 13. X-ray crystallography and targeted mutational analyses identified an arginine-rich loop that expands Cmr's DNA interactions beyond the classical helix-turn-helix contacts common to all CRP/FNR family members and facilitates binding to imperfect DNA sequences. Cmr binding to DNA results in a pronounced asymmetric bending of the DNA and its high level of cooperativity is consistent with DNA-facilitated dimerization. A unique N-terminal extension inserts between the DNA binding and dimerization domains, partially occluding the site where the canonical cAMP binding pocket is found. However, an unstructured region of this N-terminus may help modulate Cmr activity in response to cellular signals. Cmr's multiple levels of DNA interaction likely enhance its ability to integrate diverse gene regulatory signals, while its novel structural features establish Cmr as an atypical CRP/FNR family member. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. The identification of FANCD2 DNA binding domains reveals nuclear localization sequences.

    PubMed

    Niraj, Joshi; Caron, Marie-Christine; Drapeau, Karine; Bérubé, Stéphanie; Guitton-Sert, Laure; Coulombe, Yan; Couturier, Anthony M; Masson, Jean-Yves

    2017-08-21

    Fanconi anemia (FA) is a recessive genetic disorder characterized by congenital abnormalities, progressive bone-marrow failure, and cancer susceptibility. The FA pathway consists of at least 21 FANC genes (FANCA-FANCV), and the encoded protein products interact in a common cellular pathway to gain resistance against DNA interstrand crosslinks. After DNA damage, FANCD2 is monoubiquitinated and accumulates on chromatin. FANCD2 plays a central role in the FA pathway, using yet unidentified DNA binding regions. By using synthetic peptide mapping and DNA binding screen by electromobility shift assays, we found that FANCD2 bears two major DNA binding domains predominantly consisting of evolutionary conserved lysine residues. Furthermore, one domain at the N-terminus of FANCD2 bears also nuclear localization sequences for the protein. Mutations in the bifunctional DNA binding/NLS domain lead to a reduction in FANCD2 monoubiquitination and increase in mitomycin C sensitivity. Such phenotypes are not fully rescued by fusion with an heterologous NLS, which enable separation of DNA binding and nuclear import functions within this domain that are necessary for FANCD2 functions. Collectively, our results enlighten the importance of DNA binding and NLS residues in FANCD2 to activate an efficient FA pathway. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Multivalent DNA-binding properties of the HMG-1 proteins.

    PubMed Central

    Maher, J F; Nathans, D

    1996-01-01

    HMG-I proteins are DNA-binding proteins thought to affect the formation and function of transcription complexes. Each protein contains three DNA-binding motifs, known as AT-hooks, that bind in the minor groove of AT tracts in DNA. Multiple AT-hooks within a polypeptide chain should contact multiple AT tracts, but the rules governing these interactions have not been defined. In this study, we demonstrate that high-affinity binding uses two or three appropriately spaced AT tracts as a single multivalent binding site. These principles have implications for binding to regulatory elements such as the interferon beta enhancer, TATA boxes, and serum response elements. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:8692884

  7. Vital Roles of the Second DNA-binding Site of Rad52 Protein in Yeast Homologous Recombination*

    PubMed Central

    Arai, Naoto; Kagawa, Wataru; Saito, Kengo; Shingu, Yoshinori; Mikawa, Tsutomu; Kurumizaka, Hitoshi; Shibata, Takehiko

    2011-01-01

    RecA/Rad51 proteins are essential in homologous DNA recombination and catalyze the ATP-dependent formation of D-loops from a single-stranded DNA and an internal homologous sequence in a double-stranded DNA. RecA and Rad51 require a “recombination mediator” to overcome the interference imposed by the prior binding of single-stranded binding protein/replication protein A to the single-stranded DNA. Rad52 is the prototype of recombination mediators, and the human Rad52 protein has two distinct DNA-binding sites: the first site binds to single-stranded DNA, and the second site binds to either double- or single-stranded DNA. We previously showed that yeast Rad52 extensively stimulates Rad51-catalyzed D-loop formation even in the absence of replication protein A, by forming a 2:1 stoichiometric complex with Rad51. However, the precise roles of Rad52 and Rad51 within the complex are unknown. In the present study, we constructed yeast Rad52 mutants in which the amino acid residues corresponding to the second DNA-binding site of the human Rad52 protein were replaced with either alanine or aspartic acid. We found that the second DNA-binding site is important for the yeast Rad52 function in vivo. Rad51-Rad52 complexes consisting of these Rad52 mutants were defective in promoting the formation of D-loops, and the ability of the complex to associate with double-stranded DNA was specifically impaired. Our studies suggest that Rad52 within the complex associates with double-stranded DNA to assist Rad51-mediated homologous pairing. PMID:21454474

  8. Structural Reorganization and the Cooperative Binding of Single-stranded Telomere DNA in Sterkiella nova*

    PubMed Central

    Buczek, Pawel; Horvath, Martin P.

    2009-01-01

    In Sterkiella nova, α and β telomere proteins bind cooperatively with single-stranded DNA to form a ternary α·β·DNA complex. Association of telomere protein subunits is DNA-dependent, and α-β association enhances DNA affinity. To further understand the molecular basis for binding cooperativity, we characterized several possible stepwise assembly pathways using isothermal titration calorimetry. In one path, α and DNA first form a stable α·DNA complex followed by addition of β in a second step. Binding energy accumulates with nearly equal free energy of association for each of these steps. Heat capacity is nonetheless dramatically different with ΔCp = −305 ± 3 cal mol−1 K−1 for α binding with DNA and ΔCp = −2010 ± 20 cal mol−1 K−1 for addition of β to complete the α·β·DNA complex. By examining alternate routes including titration of single-stranded DNA with a preformed α·β complex, a significant portion of binding energy and heat capacity could be assigned to structural reorganization involving protein-protein interactions and repositioning of the DNA. Structural reorganization probably affords a mechanism to regulate high affinity binding of telomere single-stranded DNA with important implications for telomere biology. Regulation of telomere complex dissociation is thought to involve post-translational modifications in the lysine-rich C-terminal portion of β. We observed no difference in binding energetics or crystal structure when comparing complexes prepared with full-length β or a C-terminally truncated form, supporting interesting parallels between the intrinsically disordered regions of histones and this portion of β. PMID:17082188

  9. Synthesis, crystal structure, DFT calculation and DNA binding studies of new water-soluble derivatives of dppz

    NASA Astrophysics Data System (ADS)

    Aminzadeh, Mohammad; Eslami, Abbas; Kia, Reza; Aleeshah, Roghayeh

    2017-10-01

    Diquaternarization of dipyrido-[2,3-a:2‧,3‧-c]-phenazine,(dppz) and its analogous dipyrido-[2,3-a:2‧,3‧-c]-dimethylphenazine,(dppx) using 1,3-dibromopropane afford new water-soluble derivatives of phenazine, propylene-bipyridyldiylium-phenazine (1) and propylene-bipyridyldiylium-dimethylphenazine (2). The compounds have been characterized by means of FT-IR, NMR, elemental analysis and conductometric measurements and their structure were determined by X-ray crystallography. The experimental studies on the compounds have been accompanied computationally by Density Functional Theory (DFT) calculations. The DNA binding properties of both compounds to calf thymus DNA (ctDNA) were investigated by UV-Vis absorption and emission methods. The expanded UV-Vis spectral data matrix was analyzed by multivariate curve resolution-alternating least squares (MCR-ALS) technique to obtain the concentration profile and pure spectra of all reaction species which existed in the interaction procedure. Multivariate curve resolution may help us to give a better understanding of the 1(Cl)2-ctDNA and 2(Cl)2-ctDNA interaction mechanism. The results suggest that both compounds bind tightly to DNA through intercalation mechanism and the DNA binding affinity of 2 is slightly lower than that of 1 due to steric hindrance of the methyl group. Also, thermal denaturation studies reveal that these compounds show strong affinity for binding with calf thymus DNA. The thermodynamic parameters of the DNA binding process were obtained from the temperature dependence of the binding constants and the results showed that binding of both compounds to DNA is an enthalpically driven process that is in agreement with proposed DNA intercalation capability of these compounds.

  10. Spectroscopic profiling and computational study of the binding of tschimgine: A natural monoterpene derivative, with calf thymus DNA

    NASA Astrophysics Data System (ADS)

    Khajeh, Masoumeh Ashrafi; Dehghan, Gholamreza; Dastmalchi, Siavoush; Shaghaghi, Masoomeh; Iranshahi, Mehrdad

    2018-03-01

    DNA is a major target for a number of anticancer substances. Interaction studies between small molecules and DNA are essential for rational drug designing to influence main biological processes and also introducing new probes for the assay of DNA. Tschimgine (TMG) is a monoterpene derivative with anticancer properties. In the present study we tried to elucidate the interaction of TMG with calf thymus DNA (CT-DNA) using different spectroscopic methods. UV-visible absorption spectrophotometry, fluorescence and circular dichroism (CD) spectroscopies as well as molecular docking study revealed formation of complex between TMG and CT-DNA. Binding constant (Kb) between TMG and DNA was 2.27 × 104 M- 1, that is comparable to groove binding agents. The fluorescence spectroscopic data revealed that the quenching mechanism of fluorescence of TMG by CT-DNA is static quenching. Thermodynamic parameters (ΔH < 0 and ΔS < 0) at different temperatures indicated that van der Waals forces and hydrogen bonds were involved in the binding process of TMG with CT-DNA. Competitive binding assay with methylene blue (MB) and Hoechst 33258 using fluorescence spectroscopy displayed that TMG possibly binds to the minor groove of CT-DNA. These observations were further confirmed by CD spectral analysis, viscosity measurements and molecular docking.

  11. RecA binding to a single double-stranded DNA molecule: A possible role of DNA conformational fluctuations

    PubMed Central

    Leger, J. F.; Robert, J.; Bourdieu, L.; Chatenay, D.; Marko, J. F.

    1998-01-01

    Most genetic regulatory mechanisms involve protein–DNA interactions. In these processes, the classical Watson–Crick DNA structure sometimes is distorted severely, which in turn enables the precise recognition of the specific sites by the protein. Despite its key importance, very little is known about such deformation processes. To address this general question, we have studied a model system, namely, RecA binding to double-stranded DNA. Results from micromanipulation experiments indicate that RecA binds strongly to stretched DNA; based on this observation, we propose that spontaneous thermal stretching fluctuations may play a role in the binding of RecA to DNA. This has fundamental implications for the protein–DNA binding mechanism, which must therefore rely in part on a combination of flexibility and thermal fluctuations of the DNA structure. We also show that this mechanism is sequence sensitive. Theoretical simulations support this interpretation of our experimental results, and it is argued that this is of broad relevance to DNA–protein interactions. PMID:9770480

  12. Role of indirect readout mechanism in TATA box binding protein-DNA interaction.

    PubMed

    Mondal, Manas; Choudhury, Devapriya; Chakrabarti, Jaydeb; Bhattacharyya, Dhananjay

    2015-03-01

    Gene expression generally initiates from recognition of TATA-box binding protein (TBP) to the minor groove of DNA of TATA box sequence where the DNA structure is significantly different from B-DNA. We have carried out molecular dynamics simulation studies of TBP-DNA system to understand how the DNA structure alters for efficient binding. We observed rigid nature of the protein while the DNA of TATA box sequence has an inherent flexibility in terms of bending and minor groove widening. The bending analysis of the free DNA and the TBP bound DNA systems indicate presence of some similar structures. Principal coordinate ordination analysis also indicates some structural features of the protein bound and free DNA are similar. Thus we suggest that the DNA of TATA box sequence regularly oscillates between several alternate structures and the one suitable for TBP binding is induced further by the protein for proper complex formation.

  13. Evaluation of simultaneous binding of Chromomycin A3 to the multiple sites of DNA by the new restriction enzyme assay.

    PubMed

    Murase, Hirotaka; Noguchi, Tomoharu; Sasaki, Shigeki

    2018-06-01

    Chromomycin A3 (CMA3) is an aureolic acid-type antitumor antibiotic. CMA3 forms dimeric complexes with divalent cations, such as Mg 2+ , which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. In this study, the binding property of CMA3 to the DNA sequence containing multiple GC-rich binding sites was investigated by measuring the protection from hydrolysis by the restriction enzymes, AccII and Fnu4HI, for the center of the CGCG site and the 5'-GC↓GGC site, respectively. In contrast to the standard DNase I footprinting method, the DNA substrates are fully hydrolyzed by the restriction enzymes, therefore, the full protection of DNA at all the cleavable sites indicates that CMA3 simultaneously binds to all the binding sites. The restriction enzyme assay has suggested that CMA3 has a high tendency to bind the successive CGCG sites and the CGG repeat. Copyright © 2018 Elsevier Ltd. All rights reserved.

  14. Synthesis, DNA Binding, and Antiproliferative Activity of Novel Acridine-Thiosemicarbazone Derivatives

    PubMed Central

    de Almeida, Sinara Mônica Vitalino; Lafayette, Elizabeth Almeida; Gomes da Silva, Lúcia Patrícia Bezerra; Amorim, Cézar Augusto da Cruz; de Oliveira, Tiago Bento; Gois Ruiz, Ana Lucia Tasca; de Carvalho, João Ernesto; de Moura, Ricardo Olímpio; Beltrão, Eduardo Isidoro Carneiro; de Lima, Maria do Carmo Alves; de Carvalho Júnior, Luiz Bezerra

    2015-01-01

    In this work, the acridine nucleus was used as a lead-compound for structural modification by adding different substituted thiosemicarbazide moieties. Eight new (Z)-2-(acridin-9-ylmethylene)-N-phenylhydrazinecarbothioamide derivatives (3a–h) were synthesized, their antiproliferative activities were evaluated, and DNA binding properties were performed with calf thymus DNA (ctDNA) by electronic absorption and fluorescence spectroscopies. Both hyperchromic and hypochromic effects, as well as red or blue shifts were demonstrated by addition of ctDNA to the derivatives. The calculated binding constants ranged from 1.74 × 104 to 1.0 × 106 M−1 and quenching constants from −0.2 × 104 to 2.18 × 104 M−1 indicating high affinity to ctDNA base pairs. The most efficient compound in binding to ctDNA in vitro was (Z)-2-(acridin-9-ylmethylene)-N-(4-chlorophenyl) hydrazinecarbothioamide (3f), while the most active compound in antiproliferative assay was (Z)-2-(acridin-9-ylmethylene)-N-phenylhydrazinecarbothioamide (3a). There was no correlation between DNA-binding and in vitro antiproliferative activity, but the results suggest that DNA binding can be involved in the biological activity mechanism. This study may guide the choice of the size and shape of the intercalating part of the ligand and the strategic selection of substituents that increase DNA-binding or antiproliferative properties. PMID:26068233

  15. Spectral investigations on binding of DNA-CTMA complex with tetrameric copper phthalocyanines

    NASA Astrophysics Data System (ADS)

    Venkat, Narayanan; Haley, Joy E.; Swiger, Rachel; Zhu, Lei; Wei, Xiaoliang; Ouchen, Fahima; Grote, James G.

    2013-10-01

    The binding of DNA-CTMA (Deoxyribonucleic acid-cetyltrimethylammonium) complex with two tetrameric Copper Phthalocyanine (CuPc) systems, substituted with carboxylic acid (CuPc-COOH) and derivatized further as an imidazolium salt (CuPc-COOR), was investigated in dimethylsulfoxide (DMSO) solutions using UV/Visible Spectroscopy. Absorbance changes at 685 nm (Q band of the CuPc) were monitored as a function of DNA-CTMA added to the dye solution and stock concentrations of DNA-CTMA in DMSO were varied to facilitate observation of the full binding process. Our findings indicated that while binding with DNA-CTMA was more well-defined in the case of CuPc-COOH, the binding profile of the CuPc-COOR showed initial growth followed by decay in its Q-band absorbance which was indicative of a more complex binding mechanism involving the dye and DNA-CTMA. Preliminary findings from photophysical studies involving the CuPc tetramers and DNA-CTMA are also discussed in this paper.

  16. Measurements of nonlinear Hall-driven reconnection in the reversed field pinch

    NASA Astrophysics Data System (ADS)

    Tharp, Timothy D.

    Complex organisms are able to develop because of the complex regulatory systems that control their gene expression. The first step in this regulation, transcription initiation, is controlled by transcription factors. Transcription factors are modular proteins composed of two distinct domains, the DNA binding domain and the regulatory domain. These molecules are involved in a plethora of important biological processes including embryogenesis, development, cell health, and cancer. Tissue enriched transcription factors Nkx-2.5 and Gata4 are involved in cardiac development and cardiac health. In this thesis the DNA binding specificity of Nkx-2.5 will be analyzed using a high throughput double stranded DNA platform called Cognate Site Identifier (CSI) arrays (Chapter 2). The full DNA binding specificity of Nkx-2.5 and Nkx-2.5 mutants will be visualized using Sequence Specificity Landscapes (SSLs). In Chapter 3, the definition of binding specificity will be investigated by evaluating a number of different DNA binding folds by CSI and SSLs. CSI and SSLs will also be used to evaluate different pyrrole/imidazole hairpin polyamides in order to better characterize these small molecule DNA binding domains. CSI and SSL data will be applied to the genome in order to explain the biological function an artificial transcription factor. Chapter 4 will discuss the mechanism of nonspecific DNA binding. The historical means of predicting DNA binding will be challenged by utilizing high throughput experiments. The effect of salt concentration on both specific and nonspecific binding will also be investigated. Finally, in Chapter 5, a generation of Protein DNA Dimerizer will be discussed. A PDD that regulates transcription on genomic DNA by binding cooperatively with the heart IF Gata4 will be characterized. These studies provide understanding of, and a means to control, how transcription factors sample the endless sea of DNA in the genome in order to regulate gene expression with such wonderful specificity.

  17. DOTAP cationic liposomes prefer relaxed over supercoiled plasmids.

    PubMed

    Even-Chen, S; Barenholz, Y

    2000-12-20

    Cationic liposomes and DNA interact electrostatically to form complexes called lipoplexes. The amounts of unbound (free) DNA in a mixture of cationic liposomes and DNA at different cationic lipid:DNA molar ratios can be used to describe DNA binding isotherms; these provide a measure of the binding efficiency of DNA to different cationic lipid formulations at various medium conditions. In order to quantify the ratio between the various forms of naked DNA and supercoiled, relaxed and single-stranded DNA, and the ratio between cationic lipid bound and unbound DNA of various forms we developed a simple, sensitive quantitative assay using agarose gel electrophoresis, followed by staining with the fluorescent cyanine DNA dyes SYBR Green I or SYBR Gold. This assay was compared with that based on the use of ethidium bromide (the most commonly used nucleic acid stain). Unlike ethidium bromide, SYBR Green I DNA sensitivity and concentration-dependent fluorescence intensity were identical for supercoiled and nicked-relaxed forms. DNA detection by SYBR Green I in solution is approximately 40-fold more sensitive than by ethidium bromide for double-stranded DNA and approximately 10-fold for single-stranded DNA, and in agarose gel it is 16-fold more sensitive for double-stranded DNA compared with ethidium bromide. SYBR Gold performs similarly to SYBR Green I. This study shows that: (a) there is no significant difference in DNA binding isotherms to the monocationic DOTAP (DOTAP/DOPE) liposomes and to the polycationic DOSPA (DOSPA/DOPE) liposomes, even when four DOSPA positive charges are involved in the electrostatic interaction with DNA; (b) the helper lipids affect DNA binding, as DOTAP/DOPE liposomes bind more DNA than DOTAP/cholesterol; (c) in the process of lipoplex formation, when the DNA is a mixture of two forms, supercoiled and nicked-relaxed (open circular), there is a preference for the binding to the cationic liposomes of plasmid DNA in the nicked-relaxed over the supercoiled form. This preference is much more pronounced when the cationic liposome formulation is based on the monocationic lipid DOTAP than on the polycationic lipid DOSPA. The preference of DOTAP formulations to bind to the relaxed DNA plasmid suggests that the binding of supercoiled DNA is weaker and easier to dissociate from the complex.

  18. Interaction of Sulforaphane with DNA and RNA

    PubMed Central

    Abassi Joozdani, Farzaneh; Yari, Faramarz; Abassi Joozdani, Parvaneh; Nafisi, Shohreh

    2015-01-01

    Sulforaphane (SFN) is an isothiocyanate found in cruciferous vegetables with anti-inflammatory, anti-oxidant and anti-cancer activities. However, the antioxidant and anticancer mechanism of sulforaphane is not well understood. In the present research, we reported binding modes, binding constants and stability of SFN–DNA and -RNA complexes by Fourier transform infrared (FTIR) and UV–Visible spectroscopic methods. Spectroscopic evidence showed DNA intercalation with some degree of groove binding. SFN binds minor and major grooves of DNA and backbone phosphate (PO2), while RNA binding is through G, U, A bases with some degree of SFN–phosphate (PO2) interaction. Overall binding constants were estimated to be K(SFN–DNA)=3.01 (± 0.035)×104 M-1 and K(SFN–RNA)= 6.63 (±0.042)×103 M-1. At high SFN concentration (SFN/RNA = 1/1), DNA conformation changed from B to A occurred, while RNA remained in A-family structure. PMID:26030290

  19. Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

    DOEpatents

    McCutchen-Maloney, Sandra L.

    2002-01-01

    DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

  20. DNA-binding study of anticancer drug cytarabine by spectroscopic and molecular docking techniques.

    PubMed

    Shahabadi, Nahid; Falsafi, Monireh; Maghsudi, Maryam

    2017-01-02

    The interaction of anticancer drug cytarabine with calf thymus DNA (CT-DNA) was investigated in vitro under simulated physiological conditions by multispectroscopic techniques and molecular modeling study. The fluorescence spectroscopy and UV absorption spectroscopy indicated drug interacted with CT-DNA in a groove-binding mode, while the binding constant of UV-vis and the number of binding sites were 4.0 ± 0.2 × 10 4 L mol -1 and 1.39, respectively. The fluorimetric studies showed that the reaction between the drugs with CT-DNA is exothermic. Circular dichroism spectroscopy was employed to measure the conformational change of DNA in the presence of cytarabine. Furthermore, the drug induces detectable changes in its viscosity for DNA interaction. The molecular modeling results illustrated that cytarabine strongly binds to groove of DNA by relative binding energy of docked structure -20.61 KJ mol -1 . This combination of multiple spectroscopic techniques and molecular modeling methods can be widely used in the investigation on the interaction of small molecular pollutants and drugs with biomacromolecules for clarifying the molecular mechanism of toxicity or side effect in vivo.

  1. Discrimination against RNA Backbones by a ssDNA Binding Protein.

    PubMed

    Lloyd, Neil R; Wuttke, Deborah S

    2018-05-01

    Pot1 is the shelterin component responsible for the protection of the single-stranded DNA (ssDNA) overhang at telomeres in nearly all eukaryotic organisms. The C-terminal domain of the DNA-binding domain, Pot1pC, exhibits non-specific ssDNA recognition, achieved through thermodynamically equivalent alternative binding conformations. Given this flexibility, it is unclear how specificity for ssDNA over RNA, an activity required for biological function, is achieved. Examination of the ribose-position specificity of Pot1pC shows that ssDNA specificity is additive but not uniformly distributed across the ligand. High-resolution structures of several Pot1pC complexes with RNA-DNA chimeric ligands reveal Pot1pC discriminates against RNA by utilizing non-compensatory binding modes that feature significant rearrangement of the binding interface. These alternative conformations, accessed through both ligand and protein flexibility, recover much, but not all, of the binding energy, leading to the observed reduction in affinities. These findings suggest that intermolecular interfaces are remarkably sophisticated in their tuning of specificity toward flexible ligands. Copyright © 2018 Elsevier Ltd. All rights reserved.

  2. Novel DNA Motif Binding Activity Observed In Vivo With an Estrogen Receptor α Mutant Mouse

    PubMed Central

    Li, Leping; Grimm, Sara A.; Winuthayanon, Wipawee; Hamilton, Katherine J.; Pockette, Brianna; Rubel, Cory A.; Pedersen, Lars C.; Fargo, David; Lanz, Rainer B.; DeMayo, Francesco J.; Schütz, Günther; Korach, Kenneth S.

    2014-01-01

    Estrogen receptor α (ERα) interacts with DNA directly or indirectly via other transcription factors, referred to as “tethering.” Evidence for tethering is based on in vitro studies and a widely used “KIKO” mouse model containing mutations that prevent direct estrogen response element DNA- binding. KIKO mice are infertile, due in part to the inability of estradiol (E2) to induce uterine epithelial proliferation. To elucidate the molecular events that prevent KIKO uterine growth, regulation of the pro-proliferative E2 target gene Klf4 and of Klf15, a progesterone (P4) target gene that opposes the pro-proliferative activity of KLF4, was evaluated. Klf4 induction was impaired in KIKO uteri; however, Klf15 was induced by E2 rather than by P4. Whole uterine chromatin immunoprecipitation-sequencing revealed enrichment of KIKO ERα binding to hormone response elements (HREs) motifs. KIKO binding to HRE motifs was verified using reporter gene and DNA-binding assays. Because the KIKO ERα has HRE DNA-binding activity, we evaluated the “EAAE” ERα, which has more severe DNA-binding domain mutations, and demonstrated a lack of estrogen response element or HRE reporter gene induction or DNA-binding. The EAAE mouse has an ERα null–like phenotype, with impaired uterine growth and transcriptional activity. Our findings demonstrate that the KIKO mouse model, which has been used by numerous investigators, cannot be used to establish biological functions for ERα tethering, because KIKO ERα effectively stimulates transcription using HRE motifs. The EAAE-ERα DNA-binding domain mutant mouse demonstrates that ERα DNA-binding is crucial for biological and transcriptional processes in reproductive tissues and that ERα tethering may not contribute to estrogen responsiveness in vivo. PMID:24713037

  3. Molecular cloning of MSSP-2, a c-myc gene single-strand binding protein: characterization of binding specificity and DNA replication activity.

    PubMed Central

    Takai, T; Nishita, Y; Iguchi-Ariga, S M; Ariga, H

    1994-01-01

    We have previously reported the human cDNA encoding MSSP-1, a sequence-specific double- and single-stranded DNA binding protein [Negishi, Nishita, Saëgusa, Kakizaki, Galli, Kihara, Tamai, Miyajima, Iguchi-Ariga and Ariga (1994) Oncogene, 9, 1133-1143]. MSSP-1 binds to a DNA replication origin/transcriptional enhancer of the human c-myc gene and has turned out to be identical with Scr2, a human protein which complements the defect of cdc2 kinase in S.pombe [Kataoka and Nojima (1994) Nucleic Acid Res., 22, 2687-2693]. We have cloned the cDNA for MSSP-2, another member of the MSSP family of proteins. The MSSP-2 cDNA shares highly homologous sequences with MSSP-1 cDNA, except for the insertion of 48 bp coding 16 amino acids near the C-terminus. Like MSSP-1, MSSP-2 has RNP-1 consensus sequences. The results of the experiments using bacterially expressed MSSP-2, and its deletion mutants, as histidine fusion proteins suggested that the binding specificity of MSSP-2 to double- and single-stranded DNA is the same as that of MSSP-1, and that the RNP consensus sequences are required for the DNA binding of the protein. MSSP-2 stimulated the DNA replication of an SV40-derived plasmid containing the binding sequence for MSSP-1 or -2. MSSP-2 is hence suggested to play an important role in regulation of DNA replication. Images PMID:7838710

  4. Plasticity of BRCA2 Function in Homologous Recombination: Genetic Interactions of the PALB2 and DNA Binding Domains

    PubMed Central

    Siaud, Nicolas; Lam, Isabel; Christ, Nicole; Schlacher, Katharina; Xia, Bing; Jasin, Maria

    2011-01-01

    The breast cancer suppressor BRCA2 is essential for the maintenance of genomic integrity in mammalian cells through its role in DNA repair by homologous recombination (HR). Human BRCA2 is 3,418 amino acids and is comprised of multiple domains that interact with the RAD51 recombinase and other proteins as well as with DNA. To gain insight into the cellular function of BRCA2 in HR, we created fusions consisting of various BRCA2 domains and also introduced mutations into these domains to disrupt specific protein and DNA interactions. We find that a BRCA2 fusion peptide deleted for the DNA binding domain and active in HR is completely dependent on interaction with the PALB2 tumor suppressor for activity. Conversely, a BRCA2 fusion peptide deleted for the PALB2 binding domain is dependent on an intact DNA binding domain, providing a role for this conserved domain in vivo; mutagenesis suggests that both single-stranded and double-stranded DNA binding activities in the DNA binding domain are required for its activity. Given that PALB2 itself binds DNA, these results suggest alternative mechanisms to deliver RAD51 to DNA. In addition, the BRCA2 C terminus contains both RAD51-dependent and -independent activities which are essential to HR in some contexts. Finally, binding the small peptide DSS1 is essential for activity when its binding domain is present, but not when it is absent. Our results reveal functional redundancy within the BRCA2 protein and emphasize the plasticity of this large protein built for optimal HR function in mammalian cells. The occurrence of disease-causing mutations throughout BRCA2 suggests sub-optimal HR from a variety of domain modulations. PMID:22194698

  5. Electrostatic study of Alanine mutational effects on transcription: application to GATA-3:DNA interaction complex.

    PubMed

    El-Assaad, Atlal; Dawy, Zaher; Nemer, Georges

    2015-01-01

    Protein-DNA interaction is of fundamental importance in molecular biology, playing roles in functions as diverse as DNA transcription, DNA structure formation, and DNA repair. Protein-DNA association is also important in medicine; understanding Protein-DNA binding kinetics can assist in identifying disease root causes which can contribute to drug development. In this perspective, this work focuses on the transcription process by the GATA Transcription Factor (TF). GATA TF binds to DNA promoter region represented by `G,A,T,A' nucleotides sequence, and initiates transcription of target genes. When proper regulation fails due to some mutations on the GATA TF protein sequence or on the DNA promoter sequence (weak promoter), deregulation of the target genes might lead to various disorders. In this study, we aim to understand the electrostatic mechanism behind GATA TF and DNA promoter interactions, in order to predict Protein-DNA binding in the presence of mutations, while elaborating on non-covalent binding kinetics. To generate a family of mutants for the GATA:DNA complex, we replaced every charged amino acid, one at a time, with a neutral amino acid like Alanine (Ala). We then applied Poisson-Boltzmann electrostatic calculations feeding into free energy calculations, for each mutation. These calculations delineate the contribution to binding from each Ala-replaced amino acid in the GATA:DNA interaction. After analyzing the obtained data in view of a two-step model, we are able to identify potential key amino acids in binding. Finally, we applied the model to GATA-3:DNA (crystal structure with PDB-ID: 3DFV) binding complex and validated it against experimental results from the literature.

  6. Screening the sequence selectivity of DNA-binding molecules using a gold nanoparticle-based colorimetric approach.

    PubMed

    Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A

    2007-09-15

    We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.

  7. FACT is a sensor of DNA torsional stress in eukaryotic cells

    PubMed Central

    Safina, Alfiya; Cheney, Peter; Pal, Mahadeb; Brodsky, Leonid; Ivanov, Alexander; Kirsanov, Kirill; Lesovaya, Ekaterina; Naberezhnov, Denis; Nesher, Elimelech; Koman, Igor; Wang, Dan; Wang, Jianming; Yakubovskaya, Marianna; Winkler, Duane

    2017-01-01

    Abstract Transitions of B-DNA to alternative DNA structures (ADS) can be triggered by negative torsional strain, which occurs during replication and transcription, and may lead to genomic instability. However, how ADS are recognized in cells is unclear. We found that the binding of candidate anticancer drug, curaxin, to cellular DNA results in uncoiling of nucleosomal DNA, accumulation of negative supercoiling and conversion of multiple regions of genomic DNA into left-handed Z-form. Histone chaperone FACT binds rapidly to the same regions via the SSRP1 subunit in curaxin-treated cells. In vitro binding of purified SSRP1 or its isolated CID domain to a methylated DNA fragment containing alternating purine/pyrimidines, which is prone to Z-DNA transition, is much stronger than to other types of DNA. We propose that FACT can recognize and bind Z-DNA or DNA in transition from a B to Z form. Binding of FACT to these genomic regions triggers a p53 response. Furthermore, FACT has been shown to bind to other types of ADS through a different structural domain, which also leads to p53 activation. Thus, we propose that FACT acts as a sensor of ADS formation in cells. Recognition of ADS by FACT followed by a p53 response may explain the role of FACT in DNA damage prevention. PMID:28082391

  8. Replication of damaged DNA in vitro is blocked by p53

    PubMed Central

    Zhou, Jianmin; Prives, Carol

    2003-01-01

    The tumor suppressor protein p53 may have other roles and functions in addition to its well-documented ability to serve as a sequence-specific transcriptional activator in response to DNA damage. We showed previously that p53 can block the replication of polyomavirus origin-containing DNA (Py ori-DNA) in vitro when p53 binding sites are present on the late side of the Py ori. Here we have both further extended these observations and have also examined whether p53 might be able to bind directly to and inhibit the replication of damaged DNA. We found that p53 strongly inhibits replication of γ-irradiated Py ori-DNA and such inhibition requires both the central DNA binding domain and the extreme C-terminus of the p53 protein. An endogenous p53 binding site lies within the Py origin and is required for the ability of p53 to block initiation of replication from γ-irradiated Py ori-DNA, suggesting the possibility of DNA looping caused by p53 binding both non-specifically to sites of DNA damage and specifically to the endogenous site in the polyomavirus origin. Our results thus suggest the possibility that under some circumstances p53 might serve as a direct regulator of DNA replication and suggest as well an additional function for cooperation between its two autonomous DNA binding domains. PMID:12853603

  9. Single-molecule imaging of DNA polymerase I (Klenow fragment) activity by atomic force microscopy

    NASA Astrophysics Data System (ADS)

    Chao, J.; Zhang, P.; Wang, Q.; Wu, N.; Zhang, F.; Hu, J.; Fan, C. H.; Li, B.

    2016-03-01

    We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA.We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr06544e

  10. Recognition of Local DNA Structures by p53 Protein

    PubMed Central

    Brázda, Václav; Coufal, Jan

    2017-01-01

    p53 plays critical roles in regulating cell cycle, apoptosis, senescence and metabolism and is commonly mutated in human cancer. These roles are achieved by interaction with other proteins, but particularly by interaction with DNA. As a transcription factor, p53 is well known to bind consensus target sequences in linear B-DNA. Recent findings indicate that p53 binds with higher affinity to target sequences that form cruciform DNA structure. Moreover, p53 binds very tightly to non-B DNA structures and local DNA structures are increasingly recognized to influence the activity of wild-type and mutant p53. Apart from cruciform structures, p53 binds to quadruplex DNA, triplex DNA, DNA loops, bulged DNA and hemicatenane DNA. In this review, we describe local DNA structures and summarize information about interactions of p53 with these structural DNA motifs. These recent data provide important insights into the complexity of the p53 pathway and the functional consequences of wild-type and mutant p53 activation in normal and tumor cells. PMID:28208646

  11. H3K4me3 induces allosteric conformational changes in the DNA-binding and catalytic regions of the V(D)J recombinase

    PubMed Central

    Bettridge, John; Na, Chan Hyun; Desiderio, Stephen

    2017-01-01

    V(D)J recombination is initiated by the recombination-activating gene (RAG) recombinase, consisting of RAG-1 and RAG-2 subunits. The susceptibility of gene segments to cleavage by RAG is associated with histone modifications characteristic of active chromatin, including trimethylation of histone H3 at lysine 4 (H3K4me3). Binding of H3K4me3 by a plant homeodomain (PHD) in RAG-2 stimulates substrate binding and catalysis, which are functions of RAG-1. This has suggested an allosteric mechanism in which information regarding occupancy of the RAG-2 PHD is transmitted to RAG-1. To determine whether the conformational distribution of RAG is altered by H3K4me3, we mapped changes in solvent accessibility of cysteine thiols by differential isotopic chemical footprinting. Binding of H3K4me3 to the RAG-2 PHD induces conformational changes in RAG-1 within a DNA-binding domain and in the ZnH2 domain, which acts as a scaffold for the catalytic center. Thus, engagement of H3K4me3 by the RAG-2 PHD is associated with dynamic conformational changes in RAG-1, consistent with allosteric control by active chromatin. PMID:28174273

  12. The Agrobacterium tumefaciens Transcription Factor BlcR Is Regulated via Oligomerization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pan, Yi; Fiscus, Valena; Meng, Wuyi

    2012-02-08

    The Agrobacterium tumefaciens BlcR is a member of the emerging isocitrate lyase transcription regulators that negatively regulates metabolism of {gamma}-butyrolactone, and its repressing function is relieved by succinate semialdehyde (SSA). Our crystal structure showed that BlcR folded into the DNA- and SSA-binding domains and dimerized via the DNA-binding domains. Mutational analysis identified residues, including Phe{sup 147}, that are important for SSA association; BlcR{sup F147A} existed as tetramer. Two BlcR dimers bound to target DNA and in a cooperative manner, and the distance between the two BlcR-binding sequences in DNA was critical for BlcR-DNA association. Tetrameric BlcR{sup F147A} retained DNA bindingmore » activity, and importantly, this activity was not affected by the distance separating the BlcR-binding sequences in DNA. SSA did not dissociate tetrameric BlcR{sup F147A} or BlcR{sup F147A}-DNA. As well as in the SSA-binding site, Phe{sup 147} is located in a structurally flexible loop that may be involved in BlcR oligomerization. We propose that SSA regulates BlcR DNA-binding function via oligomerization.« less

  13. Chemical shift changes provide evidence for overlapping single-stranded DNA- and XPA-binding sites on the 70 kDa subunit of human replication protein A.

    PubMed

    Daughdrill, Gary W; Buchko, Garry W; Botuyan, Maria V; Arrowsmith, Cheryl; Wold, Marc S; Kennedy, Michael A; Lowry, David F

    2003-07-15

    Replication protein A (RPA) is a heterotrimeric single-stranded DNA- (ssDNA) binding protein that can form a complex with the xeroderma pigmentosum group A protein (XPA). This complex can preferentially recognize UV-damaged DNA over undamaged DNA and has been implicated in the stabilization of open complex formation during nucleotide excision repair. In this report, nuclear magnetic resonance (NMR) spectroscopy was used to investigate the interaction between a fragment of the 70 kDa subunit of human RPA, residues 1-326 (hRPA70(1-326)), and a fragment of the human XPA protein, residues 98-219 (XPA-MBD). Intensity changes were observed for amide resonances in the (1)H-(15)N correlation spectrum of uniformly (15)N-labeled hRPA70(1-326) after the addition of unlabeled XPA-MBD. The intensity changes observed were restricted to an ssDNA-binding domain that is between residues 183 and 296 of the hRPA70(1-326) fragment. The hRPA70(1-326) residues with the largest resonance intensity reductions were mapped onto the structure of the ssDNA-binding domain to identify the binding surface with XPA-MBD. The XPA-MBD-binding surface showed significant overlap with an ssDNA-binding surface that was previously identified using NMR spectroscopy and X-ray crystallography. Overlapping XPA-MBD- and ssDNA-binding sites on hRPA70(1-326) suggests that a competitive binding mechanism mediates the formation of the RPA-XPA complex. To determine whether a ternary complex could form between hRPA70(1-326), XPA-MBD and ssDNA, a (1)H-(15)N correlation spectrum was acquired for uniformly (15)N-labeled hRPA70(1-326) after the simultaneous addition of unlabeled XPA-MBD and ssDNA. In this experiment, the same chemical shift perturbations were observed for hRPA70(1-326) in the presence of XPA-MBD and ssDNA as was previously observed in the presence of ssDNA alone. The ability of ssDNA to compete with XPA-MBD for an overlapping binding site on hRPA70(1-326) suggests that any complex formation between RPA and XPA that involves the interaction between XPA-MBD and hRPA70(1-326) may be modulated by ssDNA.

  14. Chemical shift changes provide evidence for overlapping single-stranded DNA- and XPA-binding sites on the 70 kDa subunit of human replication protein A

    PubMed Central

    Daughdrill, Gary W.; Buchko, Garry W.; Botuyan, Maria V.; Arrowsmith, Cheryl; Wold, Marc S.; Kennedy, Michael A.; Lowry, David F.

    2003-01-01

    Replication protein A (RPA) is a heterotrimeric single-stranded DNA- (ssDNA) binding protein that can form a complex with the xeroderma pigmentosum group A protein (XPA). This complex can preferentially recognize UV-damaged DNA over undamaged DNA and has been implicated in the stabilization of open complex formation during nucleotide excision repair. In this report, nuclear magnetic resonance (NMR) spectroscopy was used to investigate the interaction between a fragment of the 70 kDa subunit of human RPA, residues 1–326 (hRPA701–326), and a fragment of the human XPA protein, residues 98–219 (XPA-MBD). Intensity changes were observed for amide resonances in the 1H–15N correlation spectrum of uniformly 15N-labeled hRPA701–326 after the addition of unlabeled XPA-MBD. The intensity changes observed were restricted to an ssDNA-binding domain that is between residues 183 and 296 of the hRPA701–326 fragment. The hRPA701–326 residues with the largest resonance intensity reductions were mapped onto the structure of the ssDNA-binding domain to identify the binding surface with XPA-MBD. The XPA-MBD-binding surface showed significant overlap with an ssDNA-binding surface that was previously identified using NMR spectroscopy and X-ray crystallography. Overlapping XPA-MBD- and ssDNA-binding sites on hRPA701–326 suggests that a competitive binding mechanism mediates the formation of the RPA–XPA complex. To determine whether a ternary complex could form between hRPA701–326, XPA-MBD and ssDNA, a 1H–15N correlation spectrum was acquired for uniformly 15N-labeled hRPA701–326 after the simultaneous addition of unlabeled XPA-MBD and ssDNA. In this experiment, the same chemical shift perturbations were observed for hRPA701–326 in the presence of XPA-MBD and ssDNA as was previously observed in the presence of ssDNA alone. The ability of ssDNA to compete with XPA-MBD for an overlapping binding site on hRPA701–326 suggests that any complex formation between RPA and XPA that involves the interaction between XPA-MBD and hRPA701–326 may be modulated by ssDNA. PMID:12853635

  15. Spectrophotometric analysis of flavonoid-DNA binding interactions at physiological conditions

    NASA Astrophysics Data System (ADS)

    Janjua, Naveed Kausar; Siddiqa, Asima; Yaqub, Azra; Sabahat, Sana; Qureshi, Rumana; Haque, Sayed ul

    2009-12-01

    Mode of interactions of three flavonoids [morin (M), quercetin (Q), and rutin (R)] with chicken blood ds.DNA (ck.DNA) has been investigated spectrophotometrically at different temperatures including body temperature (310 K) and at two physiological pH values, i.e. 7.4 (human blood pH) and 4.7 (stomach pH). The binding constants, Kf, evaluated using Benesi-Hildebrand equation showed that the flavonoids bind effectively through intercalation at both pH values and body temperature. Quercetin, somehow, showed greater binding capabilities with DNA. The free energies of flavonoid-DNA complexes indicated the spontaneity of their binding. The order of binding constants of three flavonoids at both pH values were found to be Kf(Q) > Kf(R) > Kf(M) and at 310 K.

  16. TALE: a tale of genome editing.

    PubMed

    Zhang, Mingjie; Wang, Feng; Li, Shifei; Wang, Yan; Bai, Yun; Xu, Xueqing

    2014-01-01

    Transcription activator-like effectors (TALEs), first identified in Xanthomonas bacteria, are naturally occurring or artificially designed proteins that modulate gene transcription. These proteins recognize and bind DNA sequences based on a variable numbers of tandem repeats. Each repeat is comprised of a set of ∼ 34 conserved amino acids; within this conserved domain, there are usually two amino acids that distinguish one TALE from another. Interestingly, TALEs have revealed a simple cipher for the one-to-one recognition of proteins for DNA bases. Synthetic TALEs have been used to successfully target genes in a variety of species, including humans. Depending on the type of functional domain that is fused to the TALE of interest, these proteins can have diverse biological effects. For example, after binding DNA, TALEs fused to transcriptional activation domains can function as robust transcription factors (TALE-TFs), while fused to restriction endonucleases (TALENs) can cut DNA. Targeted genome editing, in theory, is capable of modifying any endogenous gene sequence of interest; this can be performed in cells or organisms, and may be applied to clinical gene-based therapies in the future. With current technologies, highly accurate, specific, and reliable gene editing cannot be achieved. Thus, recognition and binding mechanisms governing TALE biology are currently hot research areas. In this review, we summarize the major advances in TALE technology over the past several years with a focus on the interaction between TALEs and DNA, TALE design and construction, potential applications for this technology, and unique characteristics that make TALEs superior to zinc finger endonucleases. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. pH-Assisted control over the binding and relocation of an acridine guest between a macrocyclic nanocarrier and natural DNA.

    PubMed

    Sayed, Mhejabeen; Pal, Haridas

    2015-04-14

    The differential binding affinity of the hydroxypropyl-β-cyclodextrin (HPβCD) macrocycle, a drug delivery vehicle, towards the protonated and deprotonated forms of the well-known DNA binder and model anticancer drug acridine has been exploited as a strategy for dye-drug transportation and pH-responsive delivery to a natural DNA target. From pH-sensitive changes in the ground state absorption and steady-state fluorescence characteristics of the studied acridine dye-HPβCD-DNA ternary system and strongly supported by fluorescence lifetime, fluorescence anisotropy, Job's plots, (1)H NMR and circular dichroism results, it is revealed that in a moderately alkaline solution (pH ∼ 8.5), the dye can be predominantly bound to the HPβCD macrocycle and when the pH is lowered to a moderately acidic region (pH ∼ 4), the dye efficiently detaches from the HPβCD cavity and almost exclusively binds to DNA. In the present study we are thus able to construct a pH-sensitive supramolecular assembly where pH acts as a simple stimulus for controlled uptake and targeted release of the dye-drug. As pH is an essential and sensitive factor in various biological processes, a simple yet reliable pH-sensitive model such as is demonstrated here can have promising applications in the host-assisted delivery of prodrug to the target sites, such as cancer or tumour microenvironments, with an enhanced stability, bioavailability and activity, and also in the design of new fluorescent probes, sensors and smart materials for applications in nano-science.

  18. IFI16 Preferentially Binds to DNA with Quadruplex Structure and Enhances DNA Quadruplex Formation.

    PubMed

    Hároníková, Lucia; Coufal, Jan; Kejnovská, Iva; Jagelská, Eva B; Fojta, Miroslav; Dvořáková, Petra; Muller, Petr; Vojtesek, Borivoj; Brázda, Václav

    2016-01-01

    Interferon-inducible protein 16 (IFI16) is a member of the HIN-200 protein family, containing two HIN domains and one PYRIN domain. IFI16 acts as a sensor of viral and bacterial DNA and is important for innate immune responses. IFI16 binds DNA and binding has been described to be DNA length-dependent, but a preference for supercoiled DNA has also been demonstrated. Here we report a specific preference of IFI16 for binding to quadruplex DNA compared to other DNA structures. IFI16 binds to quadruplex DNA with significantly higher affinity than to the same sequence in double stranded DNA. By circular dichroism (CD) spectroscopy we also demonstrated the ability of IFI16 to stabilize quadruplex structures with quadruplex-forming oligonucleotides derived from human telomere (HTEL) sequences and the MYC promotor. A novel H/D exchange mass spectrometry approach was developed to assess protein interactions with quadruplex DNA. Quadruplex DNA changed the IFI16 deuteration profile in parts of the PYRIN domain (aa 0-80) and in structurally identical parts of both HIN domains (aa 271-302 and aa 586-617) compared to single stranded or double stranded DNAs, supporting the preferential affinity of IFI16 for structured DNA. Our results reveal the importance of quadruplex DNA structure in IFI16 binding and improve our understanding of how IFI16 senses DNA. IFI16 selectivity for quadruplex structure provides a mechanistic framework for IFI16 in immunity and cellular processes including DNA damage responses and cell proliferation.

  19. Effect of point substitutions within the minimal DNA-binding domain of xeroderma pigmentosum group A protein on interaction with DNA intermediates of nucleotide excision repair.

    PubMed

    Maltseva, E A; Krasikova, Y S; Naegeli, H; Lavrik, O I; Rechkunova, N I

    2014-06-01

    Xeroderma pigmentosum factor A (XPA) is one of the key proteins in the nucleotide excision repair (NER) process. The effects of point substitutions in the DNA-binding domain of XPA (positively charged lysine residues replaced by negatively charged glutamate residues: XPA K204E, K179E, K141E, and tandem mutant K141E/K179E) on the interaction of the protein with DNA structures modeling intermediates of the damage recognition and pre-incision stages in NER were analyzed. All these mutations decreased the affinity of the protein to DNA, the effect depending on the substitution and the DNA structure. The mutant as well as wild-type proteins bind with highest efficiency partly open damaged DNA duplex, and the affinity of the mutants to this DNA is reduced in the order: K204E > K179E > K141E = K141/179E. For all the mutants, decrease in DNA binding efficiency was more pronounced in the case of full duplex and single-stranded DNA than with bubble-DNA structure, the difference between protein affinities to different DNA structures increasing as DNA binding activity of the mutant decreased. No effect of the studied XPA mutations on the location of the protein on the partially open DNA duplex was observed using photoinduced crosslinking with 5-I-dUMP in different positions of the damaged DNA strand. These results combined with earlier published data suggest no direct correlation between DNA binding and activity in NER for these XPA mutants.

  20. A new structural framework for integrating replication protein A into DNA processing machinery

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brosey, Chris A; Yan, Chunli; Tsutakawa, Susan E

    2013-01-01

    By coupling the protection and organization of ssDNA with the recruitment and alignment of DNA processing factors, Replication Protein A (RPA) lies at the heart of dynamic multi-protein DNA processing machinery. Nevertheless, how RPA manages to coordinate the biochemical functions of its eight domains remains unknown. We examined the structural biochemistry of RPA s DNA binding activity, combining small-angle x-ray and neutron scattering with all-atom molecular dynamics simulations to investigate the architecture of RPA s DNA-binding core. It has been long held that RPA engages ssDNA in three stages, but our data reveal that RPA undergoes two rather than threemore » transitions as it binds ssDNA. In contrast to previous models, RPA is more compact when fully engaged on 20-30 nucleotides of ssDNA than when DNA-free, and there is no evidence for significant population of a highly compacted structure in the initial 8-10 nucleotide binding mode. These results provide a new framework for understanding the integration of ssDNA into DNA processing machinery and how binding partners may manipulate RPA architecture to gain access to the substrate.« less

  1. Molecular characterization and functional analysis of pheromone binding protein 1 from Cydia pomonella (L.).

    PubMed

    Tian, Z; Zhang, Y

    2016-12-01

    A full-length cDNA encoding Cydia pomonella pheromone binding protein 1 (CpomPBP1) was cloned and characterized. CpomPBP1, possessing the typical characteristics of lepidopteran odorant binding proteins, was detected to be specifically expressed in the antennae of male and female moths at the mRNA and protein level. Soluble recombinant CpomPBP1 was subjected to in vitro binding to analyse its binding properties and to search for potentially active semiochemicals. A competitive binding assay showed that three 12-carbon ligands, codlemone, 1-dodecanol and E,E-2,4-dodecadienal, were able to bind to CpomPBP1 in decreasing order of affinity. Moreover, unlike the wild-type CpomPBP1, the C-terminus truncated CpomPBP1 exhibited high affinity to ligands even in an acidic environment, suggesting that the C-terminus plays a role in preventing ligands from binding to CpomPBP1 in a lower pH environment. © 2016 The Royal Entomological Society.

  2. Cdc45-induced loading of human RPA onto single-stranded DNA.

    PubMed

    Szambowska, Anna; Tessmer, Ingrid; Prus, Piotr; Schlott, Bernhard; Pospiech, Helmut; Grosse, Frank

    2017-04-07

    Cell division cycle protein 45 (Cdc45) is an essential component of the eukaryotic replicative DNA helicase. We found that human Cdc45 forms a complex with the single-stranded DNA (ssDNA) binding protein RPA. Moreover, it actively loads RPA onto nascent ssDNA. Pull-down assays and surface plasmon resonance studies revealed that Cdc45-bound RPA complexed with ssDNA in the 8-10 nucleotide binding mode, but dissociated when RPA covered a 30-mer. Real-time analysis of RPA-ssDNA binding demonstrated that Cdc45 catalytically loaded RPA onto ssDNA. This placement reaction required physical contacts of Cdc45 with the RPA70A subdomain. Our results imply that Cdc45 controlled stabilization of the 8-nt RPA binding mode, the subsequent RPA transition into 30-mer mode and facilitated an ordered binding to ssDNA. We propose that a Cdc45-mediated loading guarantees a seamless deposition of RPA on newly emerging ssDNA at the nascent replication fork. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Preferential Binding of Hot Spot Mutant p53 Proteins to Supercoiled DNA In Vitro and in Cells

    PubMed Central

    Brázdová, Marie; Navrátilová, Lucie; Tichý, Vlastimil; Němcová, Kateřina; Lexa, Matej; Hrstka, Roman; Pečinka, Petr; Adámik, Matej; Vojtesek, Borivoj; Paleček, Emil; Deppert, Wolfgang; Fojta, Miroslav

    2013-01-01

    Hot spot mutant p53 (mutp53) proteins exert oncogenic gain-of-function activities. Binding of mutp53 to DNA is assumed to be involved in mutp53-mediated repression or activation of several mutp53 target genes. To investigate the importance of DNA topology on mutp53-DNA recognition in vitro and in cells, we analyzed the interaction of seven hot spot mutp53 proteins with topologically different DNA substrates (supercoiled, linear and relaxed) containing and/or lacking mutp53 binding sites (mutp53BS) using a variety of electrophoresis and immunoprecipitation based techniques. All seven hot spot mutp53 proteins (R175H, G245S, R248W, R249S, R273C, R273H and R282W) were found to have retained the ability of wild-type p53 to preferentially bind circular DNA at native negative superhelix density, while linear or relaxed circular DNA was a poor substrate. The preference of mutp53 proteins for supercoiled DNA (supercoil-selective binding) was further substantiated by competition experiments with linear DNA or relaxed DNA in vitro and ex vivo. Using chromatin immunoprecipitation, the preferential binding of mutp53 to a sc mutp53BS was detected also in cells. Furthermore, we have shown by luciferase reporter assay that the DNA topology influences p53 regulation of BAX and MSP/MST1 promoters. Possible modes of mutp53 binding to topologically constrained DNA substrates and their biological consequences are discussed. PMID:23555710

  4. Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively.

    PubMed

    Clifford, Jacob; Adami, Christoph

    2015-09-02

    Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

  5. DNA Mismatch Binding and Antiproliferative Activity of Rhodium Metalloinsertors

    PubMed Central

    Ernst, Russell J.; Song, Hang; Barton, Jacqueline K.

    2009-01-01

    Deficiencies in mismatch repair (MMR) are associated with carcinogenesis. Rhodium metalloinsertors bind to DNA base mismatches with high specificity and inhibit cellular proliferation preferentially in MMR-deficient cells versus MMR-proficient cells. A family of chrysenequinone diimine complexes of rhodium with varying ancillary ligands that serve as DNA metalloinsertors has been synthesized, and both DNA mismatch binding affinities and antiproliferative activities against the human colorectal carcinoma cell lines HCT116N and HCT116O, an isogenic model system for MMR deficiency, have been determined. DNA photocleavage experiments reveal that all complexes bind to the mismatch sites with high specificities; DNA binding affinities to oligonucleotides containing single base CA and CC mismatches, obtained through photocleavage titration or competition, vary from 104 to 108 M−1 for the series of complexes. Significantly, binding affinities are found to be inversely related to ancillary ligand size and directly related to differential inhibition of the HCT116 cell lines. The observed trend in binding affinity is consistent with the metalloinsertion mode where the complex binds from the minor groove with ejection of mismatched base pairs. The correlation between binding affinity and targeting of the MMR-deficient cell line suggests that rhodium metalloinsertors exert their selective biological effects on MMR-deficient cells through mismatch binding in vivo. PMID:19175313

  6. Hormone induces binding of receptors and transcription factors to a rearranged nucleosome on the MMTV promoter in vivo.

    PubMed Central

    Truss, M; Bartsch, J; Schelbert, A; Haché, R J; Beato, M

    1995-01-01

    Hormonal induction of the mouse mammary tumour virus (MMTV) promoter is mediated by interactions between hormone receptors and other transcription factors bound to a complex array of sites. Previous results suggested that access to these sites is modulated by their precise organization into a positioned regulatory nucleosome. Using genomic footprinting, we show that MMTV promoter DNA is rotationally phased in intact cells containing either episomal or chromosomally integrated proviral fragments. Prior to induction there is no evidence for factors bound to the promoter. Following progesterone induction of cells with high levels of receptor, genomic footprinting detects simultaneous protection over the binding sites for hormone receptors, NF-I and the octamer binding proteins. Glucocorticoid or progestin induction leads to a characteristic chromatin remodelling that is independent of ongoing transcription. The centre of the regulatory nucleosome becomes more accessible to DNase I and restriction enzymes, but the limits of the nucleosome are unchanged and the 145 bp core region remains protected against micrococcal nuclease digestion. Thus, the nucleosome covering the MMTV promoter is neither removed nor shifted upon hormone induction, and all relevant transcription factors bind to the surface of the rearranged nucleosome. Since these factors cannot bind simultaneously to free DNA, maintainance of the nucleosome may be required for binding of factors to contiguous sites. Images PMID:7737125

  7. Phenazine virulence factor binding to extracellular DNA is important for Pseudomonas aeruginosa biofilm formation.

    PubMed

    Das, Theerthankar; Kutty, Samuel K; Tavallaie, Roya; Ibugo, Amaye I; Panchompoo, Janjira; Sehar, Shama; Aldous, Leigh; Yeung, Amanda W S; Thomas, Shane R; Kumar, Naresh; Gooding, J Justin; Manefield, Mike

    2015-02-11

    Bacterial resistance to conventional antibiotics necessitates the identification of novel leads for infection control. Interference with extracellular phenomena, such as quorum sensing, extracellular DNA integrity and redox active metabolite release, represents a new frontier to control human pathogens such as Pseudomonas aeruginosa and hence reduce mortality. Here we reveal that the extracellular redox active virulence factor pyocyanin produced by P. aeruginosa binds directly to the deoxyribose-phosphate backbone of DNA and intercalates with DNA nitrogenous base pair regions. Binding results in local perturbations of the DNA double helix structure and enhanced electron transfer along the nucleic acid polymer. Pyocyanin binding to DNA also increases DNA solution viscosity. In contrast, antioxidants interacting with DNA and pyocyanin decrease DNA solution viscosity. Biofilms deficient in pyocyanin production and biofilms lacking extracellular DNA show similar architecture indicating the interaction is important in P. aeruginosa biofilm formation.

  8. Phenazine virulence factor binding to extracellular DNA is important for Pseudomonas aeruginosa biofilm formation

    PubMed Central

    Das, Theerthankar; Kutty, Samuel K.; Tavallaie, Roya; Ibugo, Amaye I.; Panchompoo, Janjira; Sehar, Shama; Aldous, Leigh; Yeung, Amanda W. S.; Thomas, Shane R.; Kumar, Naresh; Gooding, J. Justin; Manefield, Mike

    2015-01-01

    Bacterial resistance to conventional antibiotics necessitates the identification of novel leads for infection control. Interference with extracellular phenomena, such as quorum sensing, extracellular DNA integrity and redox active metabolite release, represents a new frontier to control human pathogens such as Pseudomonas aeruginosa and hence reduce mortality. Here we reveal that the extracellular redox active virulence factor pyocyanin produced by P. aeruginosa binds directly to the deoxyribose-phosphate backbone of DNA and intercalates with DNA nitrogenous base pair regions. Binding results in local perturbations of the DNA double helix structure and enhanced electron transfer along the nucleic acid polymer. Pyocyanin binding to DNA also increases DNA solution viscosity. In contrast, antioxidants interacting with DNA and pyocyanin decrease DNA solution viscosity. Biofilms deficient in pyocyanin production and biofilms lacking extracellular DNA show similar architecture indicating the interaction is important in P. aeruginosa biofilm formation. PMID:25669133

  9. (CAG)(n)-hairpin DNA binds to Msh2-Msh3 and changes properties of mismatch recognition.

    PubMed

    Owen, Barbara A L; Yang, Zungyoon; Lai, Maoyi; Gajec, Maciej; Gajek, Maciez; Badger, John D; Hayes, Jeffrey J; Edelmann, Winfried; Kucherlapati, Raju; Wilson, Teresa M; McMurray, Cynthia T

    2005-08-01

    Cells have evolved sophisticated DNA repair systems to correct damaged DNA. However, the human DNA mismatch repair protein Msh2-Msh3 is involved in the process of trinucleotide (CNG) DNA expansion rather than repair. Using purified protein and synthetic DNA substrates, we show that Msh2-Msh3 binds to CAG-hairpin DNA, a prime candidate for an expansion intermediate. CAG-hairpin binding inhibits the ATPase activity of Msh2-Msh3 and alters both nucleotide (ADP and ATP) affinity and binding interfaces between protein and DNA. These changes in Msh2-Msh3 function depend on the presence of A.A mispaired bases in the stem of the hairpin and on the hairpin DNA structure per se. These studies identify critical functional defects in the Msh2-Msh3-CAG hairpin complex that could misdirect the DNA repair process.

  10. [Research Progress on the Detection Method of DNA Methylation and Its Application in Forensic Science].

    PubMed

    Nie, Y C; Yu, L J; Guan, H; Zhao, Y; Rong, H B; Jiang, B W; Zhang, T

    2017-06-01

    As an important part of epigenetic marker, DNA methylation involves in the gene regulation and attracts a wide spread attention in biological auxology, geratology and oncology fields. In forensic science, because of the relative stable, heritable, abundant, and age-related characteristics, DNA methylation is considered to be a useful complement to the classic genetic markers for age-prediction, tissue-identification, and monozygotic twins' discrimination. Various methods for DNA methylation detection have been validated based on methylation sensitive restriction endonuclease, bisulfite modification and methylation-CpG binding protein. In recent years, it is reported that the third generation sequencing method can be used to detect DNA methylation. This paper aims to make a review on the detection method of DNA methylation and its applications in forensic science. Copyright© by the Editorial Department of Journal of Forensic Medicine.

  11. A novel class of plant-specific zinc-dependent DNA-binding protein that binds to A/T-rich DNA sequences

    PubMed Central

    Nagano, Yukio; Furuhashi, Hirofumi; Inaba, Takehito; Sasaki, Yukiko

    2001-01-01

    Complementary DNA encoding a DNA-binding protein, designated PLATZ1 (plant AT-rich sequence- and zinc-binding protein 1), was isolated from peas. The amino acid sequence of the protein is similar to those of other uncharacterized proteins predicted from the genome sequences of higher plants. However, no paralogous sequences have been found outside the plant kingdom. Multiple alignments among these paralogous proteins show that several cysteine and histidine residues are invariant, suggesting that these proteins are a novel class of zinc-dependent DNA-binding proteins with two distantly located regions, C-x2-H-x11-C-x2-C-x(4–5)-C-x2-C-x(3–7)-H-x2-H and C-x2-C-x(10–11)-C-x3-C. In an electrophoretic mobility shift assay, the zinc chelator 1,10-o-phenanthroline inhibited DNA binding, and two distant zinc-binding regions were required for DNA binding. A protein blot with 65ZnCl2 showed that both regions are required for zinc-binding activity. The PLATZ1 protein non-specifically binds to A/T-rich sequences, including the upstream region of the pea GTPase pra2 and plastocyanin petE genes. Expression of the PLATZ1 repressed those of the reporter constructs containing the coding sequence of luciferase gene driven by the cauliflower mosaic virus (CaMV) 35S90 promoter fused to the tandem repeat of the A/T-rich sequences. These results indicate that PLATZ1 is a novel class of plant-specific zinc-dependent DNA-binding protein responsible for A/T-rich sequence-mediated transcriptional repression. PMID:11600698

  12. NMR studies of DNA oligomers and their interactions with minor groove binding ligands

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fagan, Patricia A.

    1996-05-01

    The cationic peptide ligands distamycin and netropsin bind noncovalently to the minor groove of DNA. The binding site, orientation, stoichiometry, and qualitative affinity of distamycin binding to several short DNA oligomers were investigated by NMR spectroscopy. The oligomers studied contain A,T-rich or I,C-rich binding sites, where I = 2-desaminodeoxyguanosine. I•C base pairs are functional analogs of A•T base pairs in the minor groove. The different behaviors exhibited by distamycin and netropsin binding to various DNA sequences suggested that these ligands are sensitive probes of DNA structure. For sites of five or more base pairs, distamycin can form 1:1 or 2:1more » ligand:DNA complexes. Cooperativity in distamycin binding is low in sites such as AAAAA which has narrow minor grooves, and is higher in sites with wider minor grooves such as ATATAT. The distamycin binding and base pair opening lifetimes of I,C-containing DNA oligomers suggest that the I,C minor groove is structurally different from the A,T minor groove. Molecules which direct chemistry to a specific DNA sequence could be used as antiviral compounds, diagnostic probes, or molecular biology tools. The author studied two ligands in which reactive groups were tethered to a distamycin to increase the sequence specificity of the reactive agent.« less

  13. RNA binding to APOBEC3G induces the disassembly of functional deaminase complexes by displacing single-stranded DNA substrates

    PubMed Central

    Polevoda, Bogdan; McDougall, William M.; Tun, Bradley N.; Cheung, Michael; Salter, Jason D.; Friedman, Alan E.; Smith, Harold C.

    2015-01-01

    APOBEC3G (A3G) DNA deaminase activity requires a holoenzyme complex whose assembly on nascent viral reverse transcripts initiates with A3G dimers binding to ssDNA followed by formation of higher-order A3G homo oligomers. Catalytic activity is inhibited when A3G binds to RNA. Our prior studies suggested that RNA inhibited A3G binding to ssDNA. In this report, near equilibrium binding and gel shift analyses showed that A3G assembly and disassembly on ssDNA was an ordered process involving A3G dimers and multimers thereof. Although, fluorescence anisotropy showed that A3G had similar nanomolar affinity for RNA and ssDNA, RNA stochastically dissociated A3G dimers and higher-order oligomers from ssDNA, suggesting a different modality for RNA binding. Mass spectrometry mapping of A3G peptides cross-linked to nucleic acid suggested ssDNA only bound to three peptides, amino acids (aa) 181–194 in the N-terminus and aa 314–320 and 345–374 in the C-terminus that were part of a continuous exposed surface. RNA bound to these peptides and uniquely associated with three additional peptides in the N- terminus, aa 15–29, 41–52 and 83–99, that formed a continuous surface area adjacent to the ssDNA binding surface. The data predict a mechanistic model of RNA inhibition of ssDNA binding to A3G in which competitive and allosteric interactions determine RNA-bound versus ssDNA-bound conformational states. PMID:26424853

  14. DNA as a Target for Anticancer Phen-Imidazole Pd(II) Complexes.

    PubMed

    Heydari, Maryam; Moghadam, Mahboube Eslami; Tarlani, AliAkbar; Farhangian, Hossein

    2017-05-01

    Imidazole ring is a known structure in many natural or synthetic drug molecules and its metal complexes can interact with DNA and do the cleavage. Hence, to study the influence of the structure and size of the ligand on biological behavior of metal complexes, two water-soluble Pd(II) complexes of phen and FIP ligands (where phen is 1,10-phenanthroline and FIP is 2-(Furan-2-yl)-1H-Imidazo[4,5-f][1, 10]phenanthroline) with the formula of [Pd(phen)(FIP)](NO 3 ) 2 and [Pd(FIP) 2 ]Cl 2 , that were activated against chronic myelogenous leukemia cell line, K562, were selected. Also, the interaction of these anticancer Pd(II) complexes with highly polymerized calf thymus DNA was extensively studied by means of electronic absorption, fluorescence, and circular dichroism in Tris-buffer. The results showed that the binding was positive cooperation and [Pd(phen)(FIP)](NO 3 ) 2 (K f  = 127 M -1 G = 1.2) exhibited higher binding constant and number of binding sites than [Pd(FIP) 2 ]Cl 2 (K f  = 13 M -1 G = 1.03) upon binding to DNA. The fluorescence data indicates that quenching effect for [Pd(phen)(FIP)](NO 3 ) 2 (K SV  = 58 mM -1 ) was higher than [Pd(FIP) 2 ]Cl 2 (K SV  = 12 mM -1 ). Also, [Pd(FIP) 2 ]Cl 2 interacts with ethidium bromide-DNA, as non-competitive inhibition, and can bind to DNA via groove binding and [Pd(phen)(FIP)](NO 3 ) 2 can intercalate in DNA. These results were confirmed by circular dichroism spectra. Docking data revealed that longer complexes have higher interaction energy and bind to DNA via groove binding. Graphical Abstract Two anticancer Pd(II) complexes of imidazole derivative have been synthesized and interacted with calf thymus DNA. Modes of binding have been studied by electronic absorption, fluorescence, and CD measurements. [Pd(FIP) 2 ]Cl 2 can bind to DNA via groove binding while intercalation mode of binding is observed for [Pd(phen)(FIP)](NO 3 ) 2 .

  15. The intervening domain from MeCP2 enhances the DNA affinity of the methyl binding domain and provides an independent DNA interaction site.

    PubMed

    Claveria-Gimeno, Rafael; Lanuza, Pilar M; Morales-Chueca, Ignacio; Jorge-Torres, Olga C; Vega, Sonia; Abian, Olga; Esteller, Manel; Velazquez-Campoy, Adrian

    2017-01-31

    Methyl-CpG binding protein 2 (MeCP2) preferentially interacts with methylated DNA and it is involved in epigenetic regulation and chromatin remodelling. Mutations in MeCP2 are linked to Rett syndrome, the leading cause of intellectual retardation in girls and causing mental, motor and growth impairment. Unstructured regions in MeCP2 provide the plasticity for establishing interactions with multiple binding partners. We present a biophysical characterization of the methyl binding domain (MBD) from MeCP2 reporting the contribution of flanking domains to its structural stability and dsDNA interaction. The flanking disordered intervening domain (ID) increased the structural stability of MBD, modified its dsDNA binding profile from an entropically-driven moderate-affinity binding to an overwhelmingly enthalpically-driven high-affinity binding. Additionally, ID provided an additional site for simultaneously and autonomously binding an independent dsDNA molecule, which is a key feature linked to the chromatin remodelling and looping activity of MeCP2, as well as its ability to interact with nucleosomes replacing histone H1. The dsDNA interaction is characterized by an unusually large heat capacity linked to a cluster of water molecules trapped within the binding interface. The dynamics of disordered regions together with extrinsic factors are key determinants of MeCP2 global structural properties and functional capabilities.

  16. The intervening domain from MeCP2 enhances the DNA affinity of the methyl binding domain and provides an independent DNA interaction site

    PubMed Central

    Claveria-Gimeno, Rafael; Lanuza, Pilar M.; Morales-Chueca, Ignacio; Jorge-Torres, Olga C.; Vega, Sonia; Abian, Olga; Esteller, Manel; Velazquez-Campoy, Adrian

    2017-01-01

    Methyl-CpG binding protein 2 (MeCP2) preferentially interacts with methylated DNA and it is involved in epigenetic regulation and chromatin remodelling. Mutations in MeCP2 are linked to Rett syndrome, the leading cause of intellectual retardation in girls and causing mental, motor and growth impairment. Unstructured regions in MeCP2 provide the plasticity for establishing interactions with multiple binding partners. We present a biophysical characterization of the methyl binding domain (MBD) from MeCP2 reporting the contribution of flanking domains to its structural stability and dsDNA interaction. The flanking disordered intervening domain (ID) increased the structural stability of MBD, modified its dsDNA binding profile from an entropically-driven moderate-affinity binding to an overwhelmingly enthalpically-driven high-affinity binding. Additionally, ID provided an additional site for simultaneously and autonomously binding an independent dsDNA molecule, which is a key feature linked to the chromatin remodelling and looping activity of MeCP2, as well as its ability to interact with nucleosomes replacing histone H1. The dsDNA interaction is characterized by an unusually large heat capacity linked to a cluster of water molecules trapped within the binding interface. The dynamics of disordered regions together with extrinsic factors are key determinants of MeCP2 global structural properties and functional capabilities. PMID:28139759

  17. Hemi-methylated DNA regulates DNA methylation inheritance through allosteric activation of H3 ubiquitylation by UHRF1.

    PubMed

    Harrison, Joseph S; Cornett, Evan M; Goldfarb, Dennis; DaRosa, Paul A; Li, Zimeng M; Yan, Feng; Dickson, Bradley M; Guo, Angela H; Cantu, Daniel V; Kaustov, Lilia; Brown, Peter J; Arrowsmith, Cheryl H; Erie, Dorothy A; Major, Michael B; Klevit, Rachel E; Krajewski, Krzysztof; Kuhlman, Brian; Strahl, Brian D; Rothbart, Scott B

    2016-09-06

    The epigenetic inheritance of DNA methylation requires UHRF1, a histone- and DNA-binding RING E3 ubiquitin ligase that recruits DNMT1 to sites of newly replicated DNA through ubiquitylation of histone H3. UHRF1 binds DNA with selectivity towards hemi-methylated CpGs (HeDNA); however, the contribution of HeDNA sensing to UHRF1 function remains elusive. Here, we reveal that the interaction of UHRF1 with HeDNA is required for DNA methylation but is dispensable for chromatin interaction, which is governed by reciprocal positive cooperativity between the UHRF1 histone- and DNA-binding domains. HeDNA recognition activates UHRF1 ubiquitylation towards multiple lysines on the H3 tail adjacent to the UHRF1 histone-binding site. Collectively, our studies are the first demonstrations of a DNA-protein interaction and an epigenetic modification directly regulating E3 ubiquitin ligase activity. They also define an orchestrated epigenetic control mechanism involving modifications both to histones and DNA that facilitate UHRF1 chromatin targeting, H3 ubiquitylation, and DNA methylation inheritance.

  18. The Reach of Linear Protein-DNA Dimerizers

    PubMed Central

    Stafford, Ryan L.; Dervan, Peter B.

    2008-01-01

    A protein-DNA dimerizer constructed from a DNA-binding pyrrole-imidazole polyamide and the peptide FYPWMK facilitates binding of the natural transcription factor Exd to an adjacent DNA site. Previous dimerizers have been constructed with the peptide attached to an internal pyrrole monomer in an overall branched oligomer. Linear oligomers constructed by attaching the peptide to the polyamide C-terminus expand the range of protein-DNA dimerization to six additional DNA sites. Replacing the FYPWMK hexapeptide with a WM dipeptide, which was previously functional in branched compounds, does not lead to a functional linear dimerizer. Instead, inserting an additional lysine generates a minimal, linear WMK tripeptide conjugate that maintains the activity of the larger FYPWMK dimerizers in a single DNA-binding site orientation. These studies provide insight into the importance of linker length and composition, binding site spacing and orientation, and the protein-binding domain content that are important for the optimization of protein DNA-dimerizers suitable for biological experiments. PMID:17949089

  19. Imaging chromatin nanostructure with binding-activated localization microscopy based on DNA structure fluctuations

    PubMed Central

    Szczurek, Aleksander; Klewes, Ludger; Xing, Jun; Gourram, Amine; Birk, Udo; Knecht, Hans; Dobrucki, Jurek W.; Mai, Sabine

    2017-01-01

    Abstract Advanced light microscopy is an important tool for nanostructure analysis of chromatin. In this report we present a general concept for Single Molecule localization Microscopy (SMLM) super-resolved imaging of DNA-binding dyes based on modifying the properties of DNA and the dye. By careful adjustment of the chemical environment leading to local, reversible DNA melting and hybridization control over the fluorescence signal of the DNA-binding dye molecules can be introduced. We postulate a transient binding as the basis for our variation of binding-activated localization microscopy (BALM). We demonstrate that several intercalating and minor-groove binding DNA dyes can be used to register (optically isolate) only a few DNA-binding dye signals at a time. To highlight this DNA structure fluctuation-assisted BALM (fBALM), we applied it to measure, for the first time, nanoscale differences in nuclear architecture in model ischemia with an anticipated structural resolution of approximately 50 nm. Our data suggest that this approach may open an avenue for the enhanced microscopic analysis of chromatin nano-architecture and hence the microscopic analysis of nuclear structure aberrations occurring in various pathological conditions. It may also become possible to analyse nuclear nanostructure differences in different cell types, stages of development or environmental stress conditions. PMID:28082388

  20. Determination of DNA Binding Behavior of FoxA1 Constructs Using a Gold Nanoparticle-Based High Throughput Assay

    NASA Astrophysics Data System (ADS)

    Aung, Khin Moh Moh; Lim, Michelle Gek Liang; Hong, Shuzhen; Cheung, Edwin; Su, Xiaodi

    Forkhead box protein 1 (FoxA1) is a member of the forkhead family of winged-helix transcription factors. It plays crucial roles in the development and differentiation of multiple organs and in the regulation of estrogen-stimulated genes. In this study, in order to determine the regions of FoxA1 necessary for efficient Deoxyribonucleic Acid (DNA) binding, we cloned, expressed and purified a series of FoxA1 constructs that contain either the DNA Binding Domain (DBD), the Transcription Activation Domain (TAD), or both. We determined the DNA binding behavior of these constructs using traditional electrophoretic mobility shift assay (EMSA) and a recently developed gold nanoparticles (AuNPs)-based fast screening method. We conclude that just the DBD region alone is not sufficient for protein-DNA binding activity. Amino acids flanking the upstream of the DBD region are required for maximal DNA binding activity. Through this study, we have also further validated the AuNPs assay for its generality and expanded the existing protocol for comparing the DNA binding behavior of multiple proteins of different charge properties and molecular weights.

  1. Structure analysis of FAAP24 reveals single-stranded DNA-binding activity and domain functions in DNA damage response

    PubMed Central

    Wang, Yucai; Han, Xiao; Wu, Fangming; Leung, Justin W; Lowery, Megan G; Do, Huong; Chen, Junjie; Shi, Chaowei; Tian, Changlin; Li, Lei; Gong, Weimin

    2013-01-01

    The FANCM/FAAP24 heterodimer has distinct functions in protecting cells from complex DNA lesions such as interstrand crosslinks. These functions rely on the biochemical activity of FANCM/FAAP24 to recognize and bind to damaged DNA or stalled replication forks. However, the DNA-binding activity of this complex was not clearly defined. We investigated how FAAP24 contributes to the DNA-interacting functions of the FANCM/FAAP24 complex by acquiring the N-terminal and C-terminal solution structures of human FAAP24. Modeling of the FAAP24 structure indicates that FAAP24 may possess a high affinity toward single-stranded DNA (ssDNA). Testing of various FAAP24 mutations in vitro and in vivo validated this prediction derived from structural analyses. We found that the DNA-binding and FANCM-interacting functions of FAAP24, although both require the C-terminal (HhH)2 domain, can be distinguished by segregation-of-function mutations. These results demonstrate dual roles of FAAP24 in DNA damage response against crosslinking lesions, one through the formation of FANCM/FAAP24 heterodimer and the other via its ssDNA-binding activity required in optimized checkpoint activation. PMID:23999858

  2. Stopped-flow kinetic studies of poly(amidoamine) dendrimer-calf thymus DNA to form dendriplexes.

    PubMed

    Dey, Debabrata; Kumar, Santosh; Maiti, Souvik; Dhara, Dibakar

    2013-11-07

    Poly(amidoamine) (PAMAM) dendrimers are known to be highly efficient nonviral carriers in gene delivery. Dendrimer-mediated transfection is known to be a function of the dendrimer to DNA charge ratio as well as the size of the dendrimer. In the present study, the binding kinetics of four PAMAM dendrimers (G1, G2, G3, and G4) with calf thymus DNA (CT-DNA) has been studied using stopped-flow fluorescence spectroscopy. The effect of dendrimer-to-DNA charge ratio and dendrimer generation on the binding kinetics was investigated. In most cases, the results of dendrimer-CT-DNA binding can be explained by a two-step reaction mechanism: a rapid electrostatic binding between the dendrimer and DNA, followed by a conformational change of the dendrimer-DNA complex that ultimately leads to DNA condensation. It was observed that the charge ratio on the dendrimer and the DNA phosphate groups, as well as the dendrimer generation (size), has a marked effect on the kinetics of binding between the DNA and the dendrimers. The rate constant (k'1) of the first step was much higher compared to that of the second step (k'2), and both were found to increase with an increase in dendrimer concentration. Among the four generations of dendrimers, G4 exhibited significantly faster binding kinetics compared to the three smaller generation dendrimers.

  3. Identification of DNA-binding proteins by combining auto-cross covariance transformation and ensemble learning.

    PubMed

    Liu, Bin; Wang, Shanyi; Dong, Qiwen; Li, Shumin; Liu, Xuan

    2016-04-20

    DNA-binding proteins play a pivotal role in various intra- and extra-cellular activities ranging from DNA replication to gene expression control. With the rapid development of next generation of sequencing technique, the number of protein sequences is unprecedentedly increasing. Thus it is necessary to develop computational methods to identify the DNA-binding proteins only based on the protein sequence information. In this study, a novel method called iDNA-KACC is presented, which combines the Support Vector Machine (SVM) and the auto-cross covariance transformation. The protein sequences are first converted into profile-based protein representation, and then converted into a series of fixed-length vectors by the auto-cross covariance transformation with Kmer composition. The sequence order effect can be effectively captured by this scheme. These vectors are then fed into Support Vector Machine (SVM) to discriminate the DNA-binding proteins from the non DNA-binding ones. iDNA-KACC achieves an overall accuracy of 75.16% and Matthew correlation coefficient of 0.5 by a rigorous jackknife test. Its performance is further improved by employing an ensemble learning approach, and the improved predictor is called iDNA-KACC-EL. Experimental results on an independent dataset shows that iDNA-KACC-EL outperforms all the other state-of-the-art predictors, indicating that it would be a useful computational tool for DNA binding protein identification. .

  4. Spectroscopic profiling and computational study of the binding of tschimgine: A natural monoterpene derivative, with calf thymus DNA.

    PubMed

    Khajeh, Masoumeh Ashrafi; Dehghan, Gholamreza; Dastmalchi, Siavoush; Shaghaghi, Masoomeh; Iranshahi, Mehrdad

    2018-03-05

    DNA is a major target for a number of anticancer substances. Interaction studies between small molecules and DNA are essential for rational drug designing to influence main biological processes and also introducing new probes for the assay of DNA. Tschimgine (TMG) is a monoterpene derivative with anticancer properties. In the present study we tried to elucidate the interaction of TMG with calf thymus DNA (CT-DNA) using different spectroscopic methods. UV-visible absorption spectrophotometry, fluorescence and circular dichroism (CD) spectroscopies as well as molecular docking study revealed formation of complex between TMG and CT-DNA. Binding constant (K b ) between TMG and DNA was 2.27×10 4 M -1 , that is comparable to groove binding agents. The fluorescence spectroscopic data revealed that the quenching mechanism of fluorescence of TMG by CT-DNA is static quenching. Thermodynamic parameters (ΔH<0 and ΔS<0) at different temperatures indicated that van der Waals forces and hydrogen bonds were involved in the binding process of TMG with CT-DNA. Competitive binding assay with methylene blue (MB) and Hoechst 33258 using fluorescence spectroscopy displayed that TMG possibly binds to the minor groove of CT-DNA. These observations were further confirmed by CD spectral analysis, viscosity measurements and molecular docking. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Chlorella virus DNA ligase: nick recognition and mutational analysis.

    PubMed

    Sriskanda, V; Shuman, S

    1998-01-15

    Chlorella virus PBCV-1 DNA ligase seals nicked DNA substrates consisting of a 5'-phosphate-terminated strand and a 3'-hydroxyl-terminated strand annealed to a bridging DNA template strand. The enzyme discriminates at the DNA binding step between substrates containing a 5'-phosphate versus a 5'-hydroxyl at the nick. Mutational analysis of the active site motif KxDGxR (residues 27-32) illuminates essential roles for the conserved Lys, Asp and Arg moieties at different steps of the ligase reaction. Mutant K27A is unable to form the covalent ligase-(Lys-straightepsilonN-P)-adenylate intermediate and hence cannot activate a nicked DNA substrate via formation of the DNA-adenylate intermediate. Nonetheless, K27A catalyzes phosphodiester bond formation at a pre-adenylated nick. This shows that the active site lysine is not required for the strand closure reaction. K27A binds to nicked DNA-adenylate, but not to a standard DNA nick. This suggests that occupancy of the AMP binding pocket of DNA ligase is important for nick recognition. Mutant D29A is active in enzyme-adenylate formation and binds readily to nicked DNA, but is inert in DNA-adenylate formation. R32A is unable to catalyze any of the three reactions of the ligation pathway and does not bind to nicked DNA.

  6. Quercetin improves the postthaw characteristics of cryopreserved sex-sorted and nonsorted stallion sperm.

    PubMed

    Gibb, Z; Butler, T J; Morris, L H A; Maxwell, W M C; Grupen, C G

    2013-04-01

    Excessive reactive oxygen species generation during sex sorting and cryopreservation of stallion sperm leads to DNA fragmentation, lipid peroxidation, and motility loss. In this study we investigated whether antioxidant supplementation during sex sorting and cryopreservation could ameliorate the effects of reactive oxygen species on stallion sperm. In experiment 1, the postthaw characteristics of stallion sperm (N = 9) cryopreserved in the presence or absence of catalase (200 U/mL), cysteine (0.2 mg/mL), or quercetin (0.15 mM) was examined. Motility and acrosome integrity were assessed at 0, 1, and 3 hours after thawing. The sperm chromatin structure assay (SCSA; detectable DNA fragmentation index [DFI], mean DFI, and DFI) was used to assess DNA integrity immediately after thawing. Quercetin increased the total postthaw motility (25.3% vs. 20.9%; P < 0.05), but there was no beneficial effect of catalase or cysteine. Based on these results, the effect of quercetin during cryopreservation on the postthaw zona binding ability of sperm was assessed using a heterologous (bovine) zona binding assay. Quercetin increased the number of sperm bound per oocyte (13.6 vs. 9.2; P < 0.05) compared with the control. In experiment 2, the effect of quercetin (0.15 mM) in the media used during semen storage and transport, Hoechst 33342 staining and cryopreservation of stallion sperm (N = 9) was investigated. Motility, acrosome integrity, and viability were assessed at 0, 1, and 3 hours after thawing and SCSA was performed at 0 hours after thawing. Quercetin supplementation during sex sorting and cryopreservation improved DNA integrity (SCSA; detectable DFI of 54.9% vs. 74.6%, P < 0.05; mean DFI of 270.2 vs. 288.1, P < 0.05; and DFI of 26.3% vs. 28.5%, P < 0.05) compared with control sex-sorted sperm. There was no beneficial effect of quercetin on the motility, acrosome integrity, or viability of sex-sorted sperm. In conclusion, quercetin significantly improved the motility and zona binding ability of cryopreserved stallion sperm, and reduced DNA fragmentation in sex-sorted, cryopreserved stallion sperm. Copyright © 2013 Elsevier Inc. All rights reserved.

  7. The suitability of DEAE-Cl active groups on customized poly(GMA-co-EDMA) continuous stationary phase for fast enzyme-free isolation of plasmid DNA.

    PubMed

    Danquah, Michael K; Forde, Gareth M

    2007-06-15

    The creation of a commercially viable and a large-scale purification process for plasmid DNA (pDNA) production requires a whole-systems continuous or semi-continuous purification strategy employing optimised stationary adsorption phase(s) without the use of expensive and toxic chemicals, avian/bovine-derived enzymes and several built-in unit processes, thus affecting overall plasmid recovery, processing time and economics. Continuous stationary phases are known to offer fast separation due to their large pore diameter making large molecule pDNA easily accessible with limited mass transfer resistance even at high flow rates. A monolithic stationary sorbent was synthesised via free radical liquid porogenic polymerisation of ethylene glycol dimethacrylate (EDMA) and glycidyl methacrylate (GMA) with surface and pore characteristics tailored specifically for plasmid binding, retention and elution. The polymer was functionalised with an amine active group for anion-exchange purification of pDNA from cleared lysate obtained from E. coli DH5alpha-pUC19 pellets in RNase/protease-free process. Characterization of the resin showed a unique porous material with 70% of the pores sizes above 300 nm. The final product isolated from anion-exchange purification in only 5 min was pure and homogenous supercoiled pDNA with no gDNA, RNA and protein contamination as confirmed with DNA electrophoresis, restriction analysis and SDS page. The resin showed a maximum binding capacity of 15.2 mg/mL and this capacity persisted after several applications of the resin. This technique is cGMP compatible and commercially viable for rapid isolation of pDNA.

  8. DNA-bending properties of TF1.

    PubMed

    Schneider, G J; Sayre, M H; Geiduschek, E P

    1991-10-05

    Transcription factor 1 (TF1) is the Bacillus subtilis phage SPO1-encoded member of the family of DNA-binding proteins that includes Escherichia coli HU and integration host factor, IHF. A gel electrophoretic retardation method has been used to show that a TF1 dimer binding to one of its preferred sites in (5-hydroxymethyl)uracil (hmUra)-containing DNA sharply bends the latter. In fact, the DNA-bending properties of TF1 and E. coli IHF are indistinguishable. Substitutions at amino acid 61 in the DNA-binding "arm" of TF1 are known to affect DNA-binding affinity and site selectivity. Experiments described here show that these substitutions also affect DNA bending. The selectivity of TF1 binding is very greatly diminished and the affinity is reduced when hmUra is replaced in DNA by thymine (T). An extension of the gel retardation method that permits an analysis of DNA bending by non-specifically bound TF1 is proposed. Under the assumptions of this analysis, the reduced affinity of TF1 for T-containing DNA is shown to be associated with bending that is still sharp. The analysis of the TF1-DNA interaction has also been extended by hydroxyl radical (.OH) and methylation interference footprinting at two DNA sites. At each of these sites, and on each strand, TF1 strongly protects three segments of DNA from attack by OH. Patches of protected DNA are centered approximately ten base-pairs apart and fall on one side of the B-helix. Methylation in either the major or minor groove in the central ten base-pairs of the two TF1 binding sites quantitatively diminishes, but does not abolish, TF1 binding. We propose that multiple protein contacts allow DNA to wrap around the relatively small TF1 dimer, considerably deforming the DNA B-helix in the process.

  9. STN1 OB Fold Mutation Alters DNA Binding and Affects Selective Aspects of CST Function

    PubMed Central

    Bhattacharjee, Anukana; Stewart, Jason; Chaiken, Mary; Price, Carolyn M.

    2016-01-01

    Mammalian CST (CTC1-STN1-TEN1) participates in multiple aspects of telomere replication and genome-wide recovery from replication stress. CST resembles Replication Protein A (RPA) in that it binds ssDNA and STN1 and TEN1 are structurally similar to RPA2 and RPA3. Conservation between CTC1 and RPA1 is less apparent. Currently the mechanism underlying CST action is largely unknown. Here we address CST mechanism by using a DNA-binding mutant, (STN1 OB-fold mutant, STN1-OBM) to examine the relationship between DNA binding and CST function. In vivo, STN1-OBM affects resolution of endogenous replication stress and telomere duplex replication but telomeric C-strand fill-in and new origin firing after exogenous replication stress are unaffected. These selective effects indicate mechanistic differences in CST action during resolution of different replication problems. In vitro binding studies show that STN1 directly engages both short and long ssDNA oligonucleotides, however STN1-OBM preferentially destabilizes binding to short substrates. The finding that STN1-OBM affects binding to only certain substrates starts to explain the in vivo separation of function observed in STN1-OBM expressing cells. CST is expected to engage DNA substrates of varied length and structure as it acts to resolve different replication problems. Since STN1-OBM will alter CST binding to only some of these substrates, the mutant should affect resolution of only a subset of replication problems, as was observed in the STN1-OBM cells. The in vitro studies also provide insight into CST binding mechanism. Like RPA, CST likely contacts DNA via multiple OB folds. However, the importance of STN1 for binding short substrates indicates differences in the architecture of CST and RPA DNA-protein complexes. Based on our results, we propose a dynamic DNA binding model that provides a general mechanism for CST action at diverse forms of replication stress. PMID:27690379

  10. Binding the Mammalian High Mobility Group Protein AT-hook 2 to AT-Rich Deoxyoligonucleotides: Enthalpy-Entropy Compensation

    PubMed Central

    Joynt, Suzanne; Morillo, Victor; Leng, Fenfei

    2009-01-01

    HMGA2 is a DNA minor-groove binding protein. We previously demonstrated that HMGA2 binds to AT-rich DNA with very high binding affinity where the binding of HMGA2 to poly(dA-dT)2 is enthalpy-driven and to poly(dA)poly(dT) is entropy-driven. This is a typical example of enthalpy-entropy compensation. To further study enthalpy-entropy compensation of HMGA2, we used isothermal-titration-calorimetry to examine the interactions of HMGA2 with two AT-rich DNA hairpins: 5′-CCAAAAAAAAAAAAAAAGCCCCCGCTTTTTTTTTTTTTTTGG-3′ (FL-AT-1) and 5′-CCATATATATATATATAGCCCCCGCTATATATATATATATGG-3′ (FL-AT-2). Surprisingly, we observed an atypical isothermal-titration-calorimetry-binding curve at low-salt aqueous solutions whereby the apparent binding-enthalpy decreased dramatically as the titration approached the end. This unusual behavior can be attributed to the DNA-annealing coupled to the ligand DNA-binding and is eliminated by increasing the salt concentration to ∼200 mM. At this condition, HMGA2 binding to FL-AT-1 is entropy-driven and to FL-AT-2 is enthalpy-driven. Interestingly, the DNA-binding free energies for HMGA2 binding to both hairpins are almost temperature independent; however, the enthalpy-entropy changes are dependent on temperature, which is another aspect of enthalpy-entropy compensation. The heat capacity change for HMGA2 binding to FL-AT-1 and FL-AT-2 are almost identical, indicating that the solvent displacement and charge-charge interaction in the coupled folding/binding processes for both binding reactions are similar. PMID:19450485

  11. The Inhibitory Effect of Non-Substrate and Substrate DNA on the Ligation and Self-Adenylylation Reactions Catalyzed by T4 DNA Ligase

    PubMed Central

    Bauer, Robert J.; Evans, Thomas C.; Lohman, Gregory J. S.

    2016-01-01

    DNA ligases are essential both to in vivo replication, repair and recombination processes, and in vitro molecular biology protocols. Prior characterization of DNA ligases through gel shift assays has shown the presence of a nick site to be essential for tight binding between the enzyme and its dsDNA substrate, with no interaction evident on dsDNA lacking a nick. In the current study, we observed a significant substrate inhibition effect, as well as the inhibition of both the self-adenylylation and nick-sealing steps of T4 DNA ligase by non-nicked, non-substrate dsDNA. Inhibition by non-substrate DNA was dependent only on the total DNA concentration rather than the structure; with 1 μg/mL of 40-mers, 75-mers, or circular plasmid DNA all inhibiting ligation equally. A >15-fold reduction in T4 DNA ligase self-adenylylation rate when in the presence of high non-nicked dsDNA concentrations was observed. Finally, EMSAs were utilized to demonstrate that non-substrate dsDNA can compete with nicked dsDNA substrates for enzyme binding. Based upon these data, we hypothesize the inhibition of T4 DNA ligase by non-nicked dsDNA is direct evidence for a two-step nick-binding mechanism, with an initial, nick-independent, transient dsDNA-binding event preceding a transition to a stable binding complex in the presence of a nick site. PMID:26954034

  12. The Inhibitory Effect of Non-Substrate and Substrate DNA on the Ligation and Self-Adenylylation Reactions Catalyzed by T4 DNA Ligase.

    PubMed

    Bauer, Robert J; Evans, Thomas C; Lohman, Gregory J S

    2016-01-01

    DNA ligases are essential both to in vivo replication, repair and recombination processes, and in vitro molecular biology protocols. Prior characterization of DNA ligases through gel shift assays has shown the presence of a nick site to be essential for tight binding between the enzyme and its dsDNA substrate, with no interaction evident on dsDNA lacking a nick. In the current study, we observed a significant substrate inhibition effect, as well as the inhibition of both the self-adenylylation and nick-sealing steps of T4 DNA ligase by non-nicked, non-substrate dsDNA. Inhibition by non-substrate DNA was dependent only on the total DNA concentration rather than the structure; with 1 μg/mL of 40-mers, 75-mers, or circular plasmid DNA all inhibiting ligation equally. A >15-fold reduction in T4 DNA ligase self-adenylylation rate when in the presence of high non-nicked dsDNA concentrations was observed. Finally, EMSAs were utilized to demonstrate that non-substrate dsDNA can compete with nicked dsDNA substrates for enzyme binding. Based upon these data, we hypothesize the inhibition of T4 DNA ligase by non-nicked dsDNA is direct evidence for a two-step nick-binding mechanism, with an initial, nick-independent, transient dsDNA-binding event preceding a transition to a stable binding complex in the presence of a nick site.

  13. Solution structure of the DNA-binding domain of RPA from Saccharomyces cerevisiae and its interaction with single-stranded DNA and SV40 T antigen

    PubMed Central

    Park, Chin-Ju; Lee, Joon-Hwa; Choi, Byong-Seok

    2005-01-01

    Replication protein A (RPA) is a three-subunit complex with multiple roles in DNA metabolism. DNA-binding domain A in the large subunit of human RPA (hRPA70A) binds to single-stranded DNA (ssDNA) and is responsible for the species-specific RPA–T antigen (T-ag) interaction required for Simian virus 40 replication. Although Saccharomyces cerevisiae RPA70A (scRPA70A) shares high sequence homology with hRPA70A, the two are not functionally equivalent. To elucidate the similarities and differences between these two homologous proteins, we determined the solution structure of scRPA70A, which closely resembled the structure of hRPA70A. The structure of ssDNA-bound scRPA70A, as simulated by residual dipolar coupling-based homology modeling, suggested that the positioning of the ssDNA is the same for scRPA70A and hRPA70A, although the conformational changes that occur in the two proteins upon ssDNA binding are not identical. NMR titrations of hRPA70A with T-ag showed that the T-ag binding surface is separate from the ssDNA-binding region and is more neutral than the corresponding part of scRPA70A. These differences might account for the species-specific nature of the hRPA70A–T-ag interaction. Our results provide insight into how these two homologous RPA proteins can exhibit functional differences, but still both retain their ability to bind ssDNA. PMID:16043636

  14. Spectrophotometric study on binding of 2-thioxanthone acetic acid with ct-DNA.

    PubMed

    Ataci, Nese; Ozcelik, Elif; Arsu, Nergis

    2018-06-02

    Thioxanthone and its derivatives are the most remarkable molecules due to their vast variety of application such as radiation curing that is, until using them as a therapeutic drug. Therefore, in this study it was intended to use 2-Thioxanthone acetic acid with and without NaCl in Tris HCl buffer solution (pH:7.0) to represent the interaction with ct-DNA. The UV-vis absorption spectra of TXCH 2 COOH in the presence of ct-DNA showed hypochromism and the intrinstic binding constant (K b ) was determined as 6 × 10 3  L mol -1 . The fluoresence intensity of TXCH 2 COOH with ct-DNA clearly increased up to 101% which indicated that the fluorescence intensity was very sensitive to ct-DNA concentration. The binding constant (K) and the values of number of binding sites (n) and were calculated as 1.8 × 10 3  L mol -1 and 0.69, respectively. When the quenching constants (K sv ) of free TXCH 2 COOH and TXCH 2 COOH, which were bonded with ct-DNA were compared, slightly changed values of Ksv were seen. Moreover, displacement assay with Hoechst 33,258 and viscosity measurements in the presence and absence of NaCl salt also confirmed the binding mode which noted the electrostatic interaction following groove binding between TXCH 2 COOH and ct-DNA. Last but not least, the salt effect was examined on ct-DNA binding with TXCH 2 COOH. The results of the experiments indicated that the groove binding was strengthened by NaCl whereas in the high NaCl concentration, the binding ability of TXCH 2 COOH to ct-DNA was inversely affected. Copyright © 2018 Elsevier B.V. All rights reserved.

  15. NPIDB: Nucleic acid-Protein Interaction DataBase.

    PubMed

    Kirsanov, Dmitry D; Zanegina, Olga N; Aksianov, Evgeniy A; Spirin, Sergei A; Karyagina, Anna S; Alexeevski, Andrei V

    2013-01-01

    The Nucleic acid-Protein Interaction DataBase (http://npidb.belozersky.msu.ru/) contains information derived from structures of DNA-protein and RNA-protein complexes extracted from the Protein Data Bank (3846 complexes in October 2012). It provides a web interface and a set of tools for extracting biologically meaningful characteristics of nucleoprotein complexes. The content of the database is updated weekly. The current version of the Nucleic acid-Protein Interaction DataBase is an upgrade of the version published in 2007. The improvements include a new web interface, new tools for calculation of intermolecular interactions, a classification of SCOP families that contains DNA-binding protein domains and data on conserved water molecules on the DNA-protein interface.

  16. Shikonin, a natural product from the root of Lithospermum erythrorhizon, is a cytotoxic DNA-binding agent.

    PubMed

    Chen, Changmin; Shanmugasundaram, Kumaran; Rigby, Alan C; Kung, Andrew L

    2013-04-11

    To search for compounds that disrupt binding of the EWS-FLI1 fusion protein to its cognate targets, we developed a homogeneous high-throughput proximity assay and screened 5200 small molecule compounds. Many well-known DNA-binding chemotherapeutic agents, such as actinomycin D, cisplatin, doxorubicin, daunorubicin, and epirubicin scored in the assay and not surprising also disrupted the binding of other transcription factors. Unexpectedly, we found that Shikonin, a natural product from the root of Lithospermum erythrorhizon, similarly disrupted protein-DNA interactions. Mechanistic studies demonstrated that Shikonin displaces SYBR green from binding to the minor groove of DNA and is able to inhibit topoisomerase mediated DNA relaxation. In cells, Shikonin blocked the binding of EWS-FLI1 to the NR0B1 promoter, and attenuated gene expression. Shikonin rapidly induced G2/M arrest and apoptosis in Ewing sarcoma cells. These results demonstrate that contrary to other purported mechanisms of action, Shikonin is a DNA-binding cytotoxic agent. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. A statistical model for investigating binding probabilities of DNA nucleotide sequences using microarrays.

    PubMed

    Lee, Mei-Ling Ting; Bulyk, Martha L; Whitmore, G A; Church, George M

    2002-12-01

    There is considerable scientific interest in knowing the probability that a site-specific transcription factor will bind to a given DNA sequence. Microarray methods provide an effective means for assessing the binding affinities of a large number of DNA sequences as demonstrated by Bulyk et al. (2001, Proceedings of the National Academy of Sciences, USA 98, 7158-7163) in their study of the DNA-binding specificities of Zif268 zinc fingers using microarray technology. In a follow-up investigation, Bulyk, Johnson, and Church (2002, Nucleic Acid Research 30, 1255-1261) studied the interdependence of nucleotides on the binding affinities of transcription proteins. Our article is motivated by this pair of studies. We present a general statistical methodology for analyzing microarray intensity measurements reflecting DNA-protein interactions. The log probability of a protein binding to a DNA sequence on an array is modeled using a linear ANOVA model. This model is convenient because it employs familiar statistical concepts and procedures and also because it is effective for investigating the probability structure of the binding mechanism.

  18. Sequence-specific binding of counterions to B-DNA

    PubMed Central

    Denisov, Vladimir P.; Halle, Bertil

    2000-01-01

    Recent studies by x-ray crystallography, NMR, and molecular simulations have suggested that monovalent counterions can penetrate deeply into the minor groove of B form DNA. Such groove-bound ions potentially could play an important role in AT-tract bending and groove narrowing, thereby modulating DNA function in vivo. To address this issue, we report here 23Na magnetic relaxation dispersion measurements on oligonucleotides, including difference experiments with the groove-binding drug netropsin. The exquisite sensitivity of this method to ions in long-lived and intimate association with DNA allows us to detect sequence-specific sodium ion binding in the minor groove AT tract of three B-DNA dodecamers. The sodium ion occupancy is only a few percent, however, and therefore is not likely to contribute importantly to the ensemble of B-DNA structures. We also report results of ion competition experiments, indicating that potassium, rubidium, and cesium ions bind to the minor groove with similarly weak affinity as sodium ions, whereas ammonium ion binding is somewhat stronger. The present findings are discussed in the light of previous NMR and diffraction studies of sequence-specific counterion binding to DNA. PMID:10639130

  19. Experimental and DFT studies on DNA binding and photocleavage of two cationic porphyrins. Effects of the introduction of a carboxyphenyl into pyridinium porphyrin.

    PubMed

    Zhao, Ping; Xu, Lian-Cai; Huang, Jin-Wang; Liu, Jie; Yu, Han-Cheng; Zheng, Kang-Cheng; Ji, Liang-Nian

    2008-12-15

    The DNA-binding affinities and DNA photocleavage abilities of cationic porphyrin, 5-(4-carboxyphenyl)-10,15,20-tris(4-methylpyridiniumyl)porphyrin (CTMPyP), and its reference compound meso-tetrakis(N-methyl-4-pyridiniumyl)porphyrin (H2TMPyP) have been investigated. The DNA-binding behaviors of the two compounds in NaH2PO4 buffer were compared systematically by using absorption, fluorescence and circular dichroism (CD) spectra, thermal denaturation as well as viscosity measurements. The experimental results show that CTMPyP binds to DNA in an outside binding mode, while H2TMPyP in an intercalative mode. Photocleavage experiments reveal that both two compounds employ 1O2-mediated mechanism in cleaving DNA and H2TMPyP can cleave DNA more efficiently than CTMPyP. Theoretical calculations were carried out with the density functional theory (DFT), and the calculated results indicate that the character and energies of some frontier orbitals of CTMPyP are quite different from those of H2TMPyP. These theoretical results can be used to explain their different DNA-binding modes and affinities to a certain extent.

  20. Generalized theory on the mechanism of site-specific DNA-protein interactions

    NASA Astrophysics Data System (ADS)

    Niranjani, G.; Murugan, R.

    2016-05-01

    We develop a generalized theoretical framework on the binding of transcription factor proteins (TFs) with specific sites on DNA that takes into account the interplay of various factors regarding overall electrostatic potential at the DNA-protein interface, occurrence of kinetic traps along the DNA sequence, presence of other roadblock protein molecules along DNA and crowded environment, conformational fluctuations in the DNA binding domains (DBDs) of TFs, and the conformational state of the DNA. Starting from a Smolochowski type theoretical framework on site-specific binding of TFs we logically build our model by adding the effects of these factors one by one. Our generalized two-step model suggests that the electrostatic attractive forces present inbetween the positively charged DBDs of TFs and the negatively charged phosphate backbone of DNA, along with the counteracting shielding effects of solvent ions, is the core factor that creates a fluidic type environment at the DNA-protein interface. This in turn facilitates various one-dimensional diffusion (1Dd) processes such as sliding, hopping and intersegmental transfers. These facilitating processes as well as flipping dynamics of conformational states of DBDs of TFs between stationary and mobile states can enhance the 1Dd coefficient on a par with three-dimensional diffusion (3Dd). The random coil conformation of DNA also plays critical roles in enhancing the site-specific association rate. The extent of enhancement over the 3Dd controlled rate seems to be directly proportional to the maximum possible 1Dd length. We show that the overall site-specific binding rate scales with the length of DNA in an asymptotic way. For relaxed DNA, the specific binding rate will be independent of the length of DNA as length increases towards infinity. For condensed DNA as in in vivo conditions, the specific binding rate depends on the length of DNA in a turnover way with a maximum. This maximum rate seems to scale with the maximum possible 1Dd length of TFs in a square root manner. Results suggest that 1Dd processes contribute much less to the enhancement of specific binding rate under in vivo conditions for condensed DNA. There exists a critical length of binding stretch of TFs beyond which the probability associated with the random occurrence of similar specific binding sites will be close to zero. TFs in natural systems from prokaryotes to eukaryotes seem to handle sequence-mediated kinetic traps via increasing the length of their recognition stretch or combinatorial binding. TFs overcome the hurdles of roadblocks via switching efficiently between sliding, hopping and intersegmental transfer modes. The site-specific binding rate as well as the maximum possible 1Dd length seem to be directly proportional to the square root of the probability (p R) of finding a nonspecific binding site to be free from dynamic roadblocks. Here p R seems to be a function of the number of nsbs available per DNA binding protein (ϕ) inside the living cell. It seems that p R  >  0.8 when ϕ  >  10 which is true for the Escherichia coli cell system.

  1. From face to interface recognition: a differential geometric approach to distinguish DNA from RNA binding surfaces.

    PubMed

    Shazman, Shula; Elber, Gershon; Mandel-Gutfreund, Yael

    2011-09-01

    Protein nucleic acid interactions play a critical role in all steps of the gene expression pathway. Nucleic acid (NA) binding proteins interact with their partners, DNA or RNA, via distinct regions on their surface that are characterized by an ensemble of chemical, physical and geometrical properties. In this study, we introduce a novel methodology based on differential geometry, commonly used in face recognition, to characterize and predict NA binding surfaces on proteins. Applying the method on experimentally solved three-dimensional structures of proteins we successfully classify double-stranded DNA (dsDNA) from single-stranded RNA (ssRNA) binding proteins, with 83% accuracy. We show that the method is insensitive to conformational changes that occur upon binding and can be applicable for de novo protein-function prediction. Remarkably, when concentrating on the zinc finger motif, we distinguish successfully between RNA and DNA binding interfaces possessing the same binding motif even within the same protein, as demonstrated for the RNA polymerase transcription-factor, TFIIIA. In conclusion, we present a novel methodology to characterize protein surfaces, which can accurately tell apart dsDNA from an ssRNA binding interfaces. The strength of our method in recognizing fine-tuned differences on NA binding interfaces make it applicable for many other molecular recognition problems, with potential implications for drug design.

  2. A Comparison Study for DNA Motif Modeling on Protein Binding Microarray.

    PubMed

    Wong, Ka-Chun; Li, Yue; Peng, Chengbin; Wong, Hau-San

    2016-01-01

    Transcription factor binding sites (TFBSs) are relatively short (5-15 bp) and degenerate. Identifying them is a computationally challenging task. In particular, protein binding microarray (PBM) is a high-throughput platform that can measure the DNA binding preference of a protein in a comprehensive and unbiased manner; for instance, a typical PBM experiment can measure binding signal intensities of a protein to all possible DNA k-mers (k = 8∼10). Since proteins can often bind to DNA with different binding intensities, one of the major challenges is to build TFBS (also known as DNA motif) models which can fully capture the quantitative binding affinity data. To learn DNA motif models from the non-convex objective function landscape, several optimization methods are compared and applied to the PBM motif model building problem. In particular, representative methods from different optimization paradigms have been chosen for modeling performance comparison on hundreds of PBM datasets. The results suggest that the multimodal optimization methods are very effective for capturing the binding preference information from PBM data. In particular, we observe a general performance improvement if choosing di-nucleotide modeling over mono-nucleotide modeling. In addition, the models learned by the best-performing method are applied to two independent applications: PBM probe rotation testing and ChIP-Seq peak sequence prediction, demonstrating its biological applicability.

  3. Structural basis of DNA bending and oriented heterodimer binding by the basic leucine zipper domains of Fos and Jun.

    PubMed

    Leonard, D A; Rajaram, N; Kerppola, T K

    1997-05-13

    Interactions among transcription factors that bind to separate sequence elements require bending of the intervening DNA and juxtaposition of interacting molecular surfaces in an appropriate orientation. Here, we examine the effects of single amino acid substitutions adjacent to the basic regions of Fos and Jun as well as changes in sequences flanking the AP-1 site on DNA bending. Substitution of charged amino acid residues at positions adjacent to the basic DNA-binding domains of Fos and Jun altered DNA bending. The change in DNA bending was directly proportional to the change in net charge for all heterodimeric combinations between these proteins. Fos and Jun induced distinct DNA bends at different binding sites. Exchange of a single base pair outside of the region contacted in the x-ray crystal structure altered DNA bending. Substitution of base pairs flanking the AP-1 site had converse effects on the opposite directions of DNA bending induced by homodimers and heterodimers. These results suggest that Fos and Jun induce DNA bending in part through electrostatic interactions between amino acid residues adjacent to the basic region and base pairs flanking the AP-1 site. DNA bending by Fos and Jun at inverted binding sites indicated that heterodimers bind to the AP-1 site in a preferred orientation. Mutation of a conserved arginine within the basic regions of Fos and transversion of the central C:G base pair in the AP-1 site to G:C had complementary effects on the orientation of heterodimer binding and DNA bending. The conformational variability of the Fos-Jun-AP-1 complex may contribute to its functional versatility at different promoters.

  4. Guazuma ulmifolia bark-synthesized Ag, Au and Ag/Au alloy nanoparticles: Photocatalytic potential, DNA/protein interactions, anticancer activity and toxicity against 14 species of microbial pathogens.

    PubMed

    Karthika, Viswanathan; Arumugam, Ayyakannu; Gopinath, Kasi; Kaleeswarran, Periyannan; Govindarajan, Marimuthu; Alharbi, Naiyf S; Kadaikunnan, Shine; Khaled, Jamal M; Benelli, Giovanni

    2017-02-01

    In the present study, we focused on a quick and green method to fabricate Ag, Au and Ag/Au alloy nanoparticles (NPs) using the bark extract of Guazuma ulmifolia L. Green synthesized metal NPs were characterized using different techniques, including UV-Vis spectroscopy, FT-IR, XRD, AFM and HR-TEM analyses. The production of Ag, Au and Ag/Au alloy NPs was observed monitoring color change from colorless to brown, followed by pink and dark brown, as confirmed by UV-Vis spectroscopy characteristic peaks at 436, 522 and 510nm, respectively. TEM shed light on the spherical shapes of NPs with size ranges of 10-15, 20-25 and 10-20nm. Biosynthesized NPs showed good catalytic activity reducing two organic dyes, 4-nitrophenol (4-NP) and Congo red (CR). UV-vis spectroscopy, fluorescence, circular dichroism spectroscopy and viscosity analyses were used to investigate the NP binding with calf thymus DNA. The binding constant of NPs with DNA calculated in UV-Vis absorption studies were 1.18×10 4 , 1.83×10 4 and 2.91×10 4 M -1 , respectively, indicating that NPs were able to bind DNA with variable binding affinity: Ag/Au alloy NPs>Ag NPs>Au NPs. Ag/Au alloy NPs also showed binding activity to bovine serum albumin (BSA) over the other NPs. Ag and Ag/Au alloy NPs exhibited good antimicrobial activity on 14 species of microbial pathogens. In addition, the cytotoxic effects of Ag/Au alloy NPs were studied on human cervical cancer cells (HeLa) using MTT assay. Overall, our work showed the promising potential of bark-synthesized Ag and Ag/Au alloy NPs as cheap sources to develop novel and safer photocatalytic, antimicrobial and anticancer agents. Copyright © 2017. Published by Elsevier B.V.

  5. OnTheFly: a database of Drosophila melanogaster transcription factors and their binding sites.

    PubMed

    Shazman, Shula; Lee, Hunjoong; Socol, Yakov; Mann, Richard S; Honig, Barry

    2014-01-01

    We present OnTheFly (http://bhapp.c2b2.columbia.edu/OnTheFly/index.php), a database comprising a systematic collection of transcription factors (TFs) of Drosophila melanogaster and their DNA-binding sites. TFs predicted in the Drosophila melanogaster genome are annotated and classified and their structures, obtained via experiment or homology models, are provided. All known preferred TF DNA-binding sites obtained from the B1H, DNase I and SELEX methodologies are presented. DNA shape parameters predicted for these sites are obtained from a high throughput server or from crystal structures of protein-DNA complexes where available. An important feature of the database is that all DNA-binding domains and their binding sites are fully annotated in a eukaryote using structural criteria and evolutionary homology. OnTheFly thus provides a comprehensive view of TFs and their binding sites that will be a valuable resource for deciphering non-coding regulatory DNA.

  6. Chiral halogenated Schiff base compounds: green synthesis, anticancer activity and DNA-binding study

    NASA Astrophysics Data System (ADS)

    Ariyaeifar, Mahnaz; Amiri Rudbari, Hadi; Sahihi, Mehdi; Kazemi, Zahra; Kajani, Abolghasem Abbasi; Zali-Boeini, Hassan; Kordestani, Nazanin; Bruno, Giuseppe; Gharaghani, Sajjad

    2018-06-01

    Eight enantiomerically pure halogenated Schiff base compounds were synthesized by reaction of halogenated salicylaldehydes with 3-Amino-1,2-propanediol (R or S) in water as green solvent at ambient temperature. All compounds were characterized by elemental analyses, NMR (1H and 13C), circular dichroism (CD) and FT-IR spectroscopy. FS-DNA binding studies of these compounds carried out by fluorescence quenching and UV-vis spectroscopy. The obtained results revealed that the ligands bind to DNA as: (Rsbnd ClBr) > (Rsbnd Cl2) > (Rsbnd Br2) > (Rsbnd I2) and (Ssbnd ClBr) > (Ssbnd Cl2) > (Ssbnd Br2) > (Ssbnd I2), indicating the effect of halogen on binding constant. In addition, DNA-binding constant of the Ssbnd and R-enantiomers are different from each other. The ligands can form halogen bonds with DNA that were confirmed by molecular docking. This method was also measured the bond distances and bond angles. The study of obtained data can have concluded that binding affinity of the ligands to DNA depends on strength of halogen bonds. The potential anticancer activity of ligands were also evaluated on MCF-7 and HeLa cancer cell lines by using MTT assay. The results showed that the anticancer activity and FS-DNA interaction is significantly dependent on the stereoisomers of Schiff base compounds as R-enantiomers displayed significantly higher activity than S-enantiomers. The molecular docking was also used to illustrate the specific DNA-binding of synthesized compounds and groove binding mode of DNA interaction was proposed for them. In addition, molecular docking results indicated that there are three types of bonds (Hsbnd and X-bond and hX-bond) between synthesized compounds and base pairs of DNA.

  7. DNA binding specificity of the basic-helix-loop-helix protein MASH-1.

    PubMed

    Meierhan, D; el-Ariss, C; Neuenschwander, M; Sieber, M; Stackhouse, J F; Allemann, R K

    1995-09-05

    Despite the high degree of sequence similarity in their basic-helix-loop-helix (BHLH) domains, MASH-1 and MyoD are involved in different biological processes. In order to define possible differences between the DNA binding specificities of these two proteins, we investigated the DNA binding properties of MASH-1 by circular dichroism spectroscopy and by electrophoretic mobility shift assays (EMSA). Upon binding to DNA, the BHLH domain of MASH-1 underwent a conformational change from a mainly unfolded to a largely alpha-helical form, and surprisingly, this change was independent of the specific DNA sequence. The same conformational transition could be induced by the addition of 20% 2,2,2-trifluoroethanol. The apparent dissociation constants (KD) of the complexes of full-length MASH-1 with various oligonucleotides were determined from half-saturation points in EMSAs. MASH-1 bound as a dimer to DNA sequences containing an E-box with high affinity KD = 1.4-4.1 x 10(-14) M2). However, the specificity of DNA binding was low. The dissociation constant for the complex between MASH-1 and the highest affinity E-box sequence (KD = 1.4 x 10(-14) M2) was only a factor of 10 smaller than for completely unrelated DNA sequences (KD = approximately 1 x 10(-13) M2). The DNA binding specificity of MASH-1 was not significantly increased by the formation of an heterodimer with the ubiquitous E12 protein. MASH-1 and MyoD displayed similar binding site preferences, suggesting that their different target gene specificities cannot be explained solely by differential DNA binding. An explanation for these findings is provided on the basis of the known crystal structure of the BHLH domain of MyoD.

  8. DNA sequence+shape kernel enables alignment-free modeling of transcription factor binding.

    PubMed

    Ma, Wenxiu; Yang, Lin; Rohs, Remo; Noble, William Stafford

    2017-10-01

    Transcription factors (TFs) bind to specific DNA sequence motifs. Several lines of evidence suggest that TF-DNA binding is mediated in part by properties of the local DNA shape: the width of the minor groove, the relative orientations of adjacent base pairs, etc. Several methods have been developed to jointly account for DNA sequence and shape properties in predicting TF binding affinity. However, a limitation of these methods is that they typically require a training set of aligned TF binding sites. We describe a sequence + shape kernel that leverages DNA sequence and shape information to better understand protein-DNA binding preference and affinity. This kernel extends an existing class of k-mer based sequence kernels, based on the recently described di-mismatch kernel. Using three in vitro benchmark datasets, derived from universal protein binding microarrays (uPBMs), genomic context PBMs (gcPBMs) and SELEX-seq data, we demonstrate that incorporating DNA shape information improves our ability to predict protein-DNA binding affinity. In particular, we observe that (i) the k-spectrum + shape model performs better than the classical k-spectrum kernel, particularly for small k values; (ii) the di-mismatch kernel performs better than the k-mer kernel, for larger k; and (iii) the di-mismatch + shape kernel performs better than the di-mismatch kernel for intermediate k values. The software is available at https://bitbucket.org/wenxiu/sequence-shape.git. rohs@usc.edu or william-noble@uw.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

  9. Anti-DNA antibodies--quintessential biomarkers of SLE.

    PubMed

    Pisetsky, David S

    2016-02-01

    Antibodies that recognize and bind to DNA (anti-DNA antibodies) are serological hallmarks of systemic lupus erythematosus (SLE) and key markers for diagnosis and disease activity. In addition to common use in the clinic, anti-DNA antibody testing now also determines eligibility for clinical trials, raising important questions about the nature of the antibody-antigen interaction. At present, no 'gold standard' for serological assessment exists, and anti-DNA antibody binding can be measured with a variety of assay formats, which differ in the nature of the DNA substrates and in the conditions for binding and detection of antibodies. A mechanism called monogamous bivalency--in which high avidity results from simultaneous interaction of IgG Fab sites with a single polynucleotide chain--determines anti-DNA antibody binding; this mechanism might affect antibody detection in different assay formats. Although anti-DNA antibodies can promote pathogenesis by depositing in the kidney or driving cytokine production, they are not all alike, pathologically, and anti-DNA antibody expression does not necessarily correlate with active disease. Levels of anti-DNA antibodies in patients with SLE can vary over time, distinguishing anti-DNA antibodies from other pathogenic antinuclear antibodies. Elucidation of the binding specificities and the pathogenic roles of anti-DNA antibodies in SLE should enable improvements in the design of informative assays for both clinical and research purposes.

  10. Trigger Factor and DnaK possess overlapping substrate pools and binding specificities.

    PubMed

    Deuerling, Elke; Patzelt, Holger; Vorderwülbecke, Sonja; Rauch, Thomas; Kramer, Günter; Schaffitzel, Elke; Mogk, Axel; Schulze-Specking, Agnes; Langen, Hanno; Bukau, Bernd

    2003-03-01

    Ribosome-associated Trigger Factor (TF) and the DnaK chaperone system assist the folding of newly synthesized proteins in Escherichia coli. Here, we show that DnaK and TF share a common substrate pool in vivo. In TF-deficient cells, deltatig, depleted for DnaK and DnaJ the amount of aggregated proteins increases with increasing temperature, amounting to 10% of total soluble protein (approximately 340 protein species) at 37 degrees C. A similar population of proteins aggregated in DnaK depleted tig+ cells, albeit to a much lower extent. Ninety-four aggregated proteins isolated from DnaK- and DnaJ-depleted deltatig cells were identified by mass spectrometry and found to include essential cytosolic proteins. Four potential in vivo substrates were screened for chaperone binding sites using peptide libraries. Although TF and DnaK recognize different binding motifs, 77% of TF binding peptides also associated with DnaK. In the case of the nascent polypeptides TF and DnaK competed for binding, however, with competitive advantage for TF. In vivo, the loss of TF is compensated by the induction of the heat shock response and thus enhanced levels of DnaK. In summary, our results demonstrate that the co-operation of the two mechanistically distinct chaperones in protein folding is based on their overlap in substrate specificities.

  11. Acanthamoeba castellanii contains a ribosomal RNA enhancer binding protein which stimulates TIF-IB binding and transcription under stringent conditions.

    PubMed

    Yang, Q; Radebaugh, C A; Kubaska, W; Geiss, G K; Paule, M R

    1995-11-11

    The intergenic spacer (IGS) of Acanthamoeba castellanii rRNA genes contains repeated elements which are weak enhancers for transcription by RNA polymerase I. A protein, EBF, was identified and partially purified which binds to the enhancers and to several other sequences within the IGS, but not to other DNA fragments, including the rRNA core promoter. No consensus binding sequence could be discerned in these fragments and bound factor is in rapid equilibrium with unbound. EBF has functional characteristics similar to vertebrate upstream binding factors (UBF). Not only does it bind to the enhancer and other IGS elements, but it also stimulates binding of TIF-IB, the fundamental transcription initiation factor, to the core promoter and stimulates transcription from the promoter. Attempts to identify polypeptides with epitopes similar to rat or Xenopus laevis UBF suggest that structurally the protein from A.castellanii is not closely related to vertebrate UBF.

  12. Acanthamoeba castellanii contains a ribosomal RNA enhancer binding protein which stimulates TIF-IB binding and transcription under stringent conditions.

    PubMed Central

    Yang, Q; Radebaugh, C A; Kubaska, W; Geiss, G K; Paule, M R

    1995-01-01

    The intergenic spacer (IGS) of Acanthamoeba castellanii rRNA genes contains repeated elements which are weak enhancers for transcription by RNA polymerase I. A protein, EBF, was identified and partially purified which binds to the enhancers and to several other sequences within the IGS, but not to other DNA fragments, including the rRNA core promoter. No consensus binding sequence could be discerned in these fragments and bound factor is in rapid equilibrium with unbound. EBF has functional characteristics similar to vertebrate upstream binding factors (UBF). Not only does it bind to the enhancer and other IGS elements, but it also stimulates binding of TIF-IB, the fundamental transcription initiation factor, to the core promoter and stimulates transcription from the promoter. Attempts to identify polypeptides with epitopes similar to rat or Xenopus laevis UBF suggest that structurally the protein from A.castellanii is not closely related to vertebrate UBF. Images PMID:7501455

  13. Binding affinities of Schiff base Fe(II) complex with BSA and calf-thymus DNA: Spectroscopic investigations and molecular docking analysis

    NASA Astrophysics Data System (ADS)

    Rudra, Suparna; Dasmandal, Somnath; Patra, Chiranjit; Kundu, Arjama; Mahapatra, Ambikesh

    2016-09-01

    The binding interaction of a synthesized Schiff base Fe(II) complex with biological macromolecules viz., bovine serum albumin (BSA) and calf thymus(ct)-DNA have been investigated using different spectroscopic techniques coupled with viscosity measurements at physiological pH and 298 K. Regular amendments in emission intensities of BSA upon the action of the complex indicate significant interaction between them, and the binding interaction have been characterized by Stern Volmer plots and thermodynamic binding parameters. On the basis of this quenching technique one binding site with binding constant (Kb = (7.6 ± 0.21) × 105) between complex and protein have been obtained at 298 K. Time-resolved fluorescence studies have also been encountered to understand the mechanism of quenching induced by the complex. Binding affinities of the complex to the fluorophores of BSA namely tryptophan (Trp) and tyrosine (Tyr) have been judged by synchronous fluorescence studies. Secondary structural changes of BSA rooted by the complex has been revealed by CD spectra. On the other hand, hypochromicity of absorption spectra of the complex with the addition of ct-DNA and the gradual reduction in emission intensities of ethidium bromide bound ct-DNA in presence of the complex indicate noticeable interaction between ct-DNA and the complex with the binding constant (4.2 ± 0.11) × 106 M- 1. Life-time measurements have been studied to determine the relative amplitude of binding of the complex to ct-DNA base pairs. Mode of binding interaction of the complex with ct-DNA has been deciphered by viscosity measurements. CD spectra have also been used to understand the changes in ct-DNA structure upon binding with the metal complex. Density functional theory (DFT) and molecular docking analysis have been employed in highlighting the interactive phenomenon and binding location of the complex with the macromolecules.

  14. Electrostatic interactions during acidic phospholipid reactivation of DnaA protein, the Escherichia coli initiator of chromosomal replication.

    PubMed

    Kitchen, J L; Li, Z; Crooke, E

    1999-05-11

    The initiation of Escherichia coli chromosomal replication by DnaA protein is strongly influenced by the tight binding of the nucleotides ATP and ADP. Anionic phospholipids in a fluid bilayer promote the conversion of inactive ADP-DnaA protein to replicatively active ATP-DnaA protein in vitro, and thus likely play a key role in regulating DnaA activity. Previous studies have revealed that, during this reactivation, a specific region of DnaA protein inserts into the hydrophobic portion of the lipid bilayer in an acidic phospholipid-dependent manner. To elucidate the requirement for acidic phospholipids in the reactivation process, the contribution of electrostatic forces in the interaction of DnaA and lipid was examined. DnaA-lipid binding required anionic phospholipids, and DnaA-lipid binding as well as lipid-mediated release of DnaA-bound nucleotide were inhibited by increased ionic strength, suggesting the involvement of electrostatic interactions in these processes. As the vesicular content of acidic phospholipids was increased, both nucleotide release and DnaA-lipid binding increased in a linear, parallel manner. Given that DnaA-membrane binding, the insertion of DnaA into the membrane, and the consequent nucleotide release all require anionic phospholipids, the acidic headgroup may be necessary to recruit DnaA protein to the membrane for insertion and subsequent reactivation for replication.

  15. Impact of cadmium, cobalt and nickel on sequence-specific DNA binding of p63 and p73 in vitro and in cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Adámik, Matej; Bažantová, Pavla; Department of Biology and Ecology, Faculty of Science, University of Ostrava, Chittussiho 10, 701 03 Ostrava

    Highlights: • DNA binding of p53 family core domains is inhibited by cadmium, cobalt and nickel. • Binding to DNA protects p53 family core domains from metal induced inhibition. • Cadmium, cobalt and nickel induced inhibition was reverted by EDTA in vitro. - Abstract: Site-specific DNA recognition and binding activity belong to common attributes of all three members of tumor suppressor p53 family proteins: p53, p63 and p73. It was previously shown that heavy metals can affect p53 conformation, sequence-specific binding and suppress p53 response to DNA damage. Here we report for the first time that cadmium, nickel and cobalt,more » which have already been shown to disturb various DNA repair mechanisms, can also influence p63 and p73 sequence-specific DNA binding activity and transactivation of p53 family target genes. Based on results of electrophoretic mobility shift assay and luciferase reporter assay, we conclude that cadmium inhibits sequence-specific binding of all three core domains to p53 consensus sequences and abolishes transactivation of several promoters (e.g. BAX and MDM2) by 50 μM concentrations. In the presence of specific DNA, all p53 family core domains were partially protected against loss of DNA binding activity due to cadmium treatment. Effective cadmium concentration to abolish DNA–protein interactions was about two times higher for p63 and p73 proteins than for p53. Furthermore, we detected partial reversibility of cadmium inhibition for all p53 family members by EDTA. DTT was able to reverse cadmium inhibition only for p53 and p73. Nickel and cobalt abolished DNA–p53 interaction at sub-millimolar concentrations while inhibition of p63 and p73 DNA binding was observed at millimolar concentrations. In summary, cadmium strongly inhibits p53, p63 and p73 DNA binding in vitro and in cells in comparison to nickel and cobalt. The role of cadmium inhibition of p53 tumor suppressor family in carcinogenesis is discussed.« less

  16. Acemannan increases NF-κB/DNA binding and IL-6/-8 expression by selectively binding Toll-like receptor-5 in human gingival fibroblasts.

    PubMed

    Thunyakitpisal, Pasutha; Ruangpornvisuti, Vithaya; Kengkwasing, Pattrawadee; Chokboribal, Jaroenporn; Sangvanich, Polkit

    2017-04-01

    Acemannan, an acetylated polymannose from Aloe vera, has immunomodulatory effects. We investigated whether acemannan induces IL-6 and -8 expression and NF-κB/DNA binding in human gingival fibroblasts. IL-6 and -8 expression levels were assessed via RT-PCR and ELISA. The NF-κB p50/p65-DNA binding was determined. The structures of acemannan mono-pentamers and Toll-like receptor 5 (TLR5) were simulated. The binding energies between acemannan and TLR5 were identified. We found that acemannan significantly stimulated IL-6/-8 expression at both the mRNA and protein level and significantly increased p50/DNA binding. Preincubation with an anti-TLR5 neutralizing antibody abolished acemannan-induced IL-6/-8 expression and p50/DNA binding, and co-incubation of acemannan with Bay11-7082, a specific NF- κB inhibitor, abolished IL-6/-8 expression. The computer modeling indicated that monomeric/dimeric single stranded acemannan molecules interacted with the TLR5 flagellin recognition sites with a high binding affinity. We conclude that acemannan induces IL-6/-8 expression, and p50/DNA binding in gingival fibroblasts, at least partly, via a TLR5/NF-κB-dependent signaling pathway. Furthermore, acemannan selectively binds with TLR5 ectodomain flagellin recognition sites. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Saccharomyces cerevisiae MSH2-MSH3 and MSH2-MSH6 complexes display distinct requirements for DNA binding Domain I in mismatch recognition.

    PubMed Central

    Lee, Susan D.; Surtees, Jennifer A.; Alani, Eric

    2007-01-01

    In eukaryotic mismatch repair (MMR) MSH2-MSH6 initiates the repair of base-base and small insertion/deletion mismatches while MSH2-MSH3 repairs larger insertion/deletion mismatches. In this study we showed that the msh2Δ1 mutation, containing a complete deletion of the conserved mismatch recognition Domain I of MSH2, conferred a separation of function phenotype with respect to MSH2-MSH3 and MSH2-MSH6 functions. Strains bearing the msh2Δ1 mutation were nearly wild-type in MSH2-MSH6-mediated MMR and in suppressing recombination between DNA sequences predicted to form mismatches recognized by MSH2-MSH6. However, these strains were completely defective in MSH2-MSH3-mediated MMR and recombination functions. This information encouraged us to analyze the contributions of Domain I to the mismatch binding specificity of MSH2-MSH3 in genetic and biochemical assays. We found that Domain I in MSH2 contributed a non-specific DNA binding activity while Domain I of MSH3 appeared important for mismatch binding specificity and for suppressing non-specific DNA-binding. These observations reveal distinct requirements for the MSH2 DNA binding Domain I in the repair of DNA mismatches and suggest that the binding of MSH2-MSH3 to mismatch DNA involves protein-DNA contacts that appear very different from those required for MSH2-MSH6 mismatch binding. PMID:17157869

  18. Saccharomyces cerevisiae MSH2-MSH3 and MSH2-MSH6 complexes display distinct requirements for DNA binding domain I in mismatch recognition.

    PubMed

    Lee, Susan D; Surtees, Jennifer A; Alani, Eric

    2007-02-09

    In eukaryotic mismatch repair (MMR) MSH2-MSH6 initiates the repair of base-base and small insertion/deletion mismatches while MSH2-MSH3 repairs larger insertion/deletion mismatches. Here, we show that the msh2Delta1 mutation, containing a complete deletion of the conserved mismatch recognition domain I of MSH2, conferred a separation of function phenotype with respect to MSH2-MSH3 and MSH2-MSH6 functions. Strains bearing the msh2Delta1 mutation were nearly wild-type in MSH2-MSH6-mediated MMR and in suppressing recombination between DNA sequences predicted to form mismatches recognized by MSH2-MSH6. However, these strains were completely defective in MSH2-MSH3-mediated MMR and recombination functions. This information encouraged us to analyze the contributions of domain I to the mismatch binding specificity of MSH2-MSH3 in genetic and biochemical assays. We found that domain I in MSH2 contributed a non-specific DNA binding activity while domain I of MSH3 appeared important for mismatch binding specificity and for suppressing non-specific DNA binding. These observations reveal distinct requirements for the MSH2 DNA binding domain I in the repair of DNA mismatches and suggest that the binding of MSH2-MSH3 to mismatch DNA involves protein-DNA contacts that appear very different from those required for MSH2-MSH6 mismatch binding.

  19. HMGB1-mediated DNA bending: Distinct roles in increasing p53 binding to DNA and the transactivation of p53-responsive gene promoters.

    PubMed

    Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva

    2018-03-01

    HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.

  20. Interference between Triplex and Protein Binding to Distal Sites on Supercoiled DNA.

    PubMed

    Noy, Agnes; Maxwell, Anthony; Harris, Sarah A

    2017-02-07

    We have explored the interdependence of the binding of a DNA triplex and a repressor protein to distal recognition sites on supercoiled DNA minicircles using MD simulations. We observe that the interaction between the two ligands through their influence on their DNA template is determined by a subtle interplay of DNA mechanics and electrostatics, that the changes in flexibility induced by ligand binding play an important role and that supercoiling can instigate additional ligand-DNA contacts that would not be possible in simple linear DNA sequences. Copyright © 2017. Published by Elsevier Inc.

  1. Mutational analyses of Aquifex pyrophilus DNA ligase define essential domains for self-adenylation and DNA binding activity.

    PubMed

    Lim, J H; Choi, J; Kim, W; Ahn, B Y; Han, Y S

    2001-04-15

    We constructed nine deletion mutants of NAD+-dependent DNA ligase from Aquifex pyrophilus to characterize the functional domains. All of DNA ligase deletion mutants were analyzed in biochemical assays for NAD+-dependent self-adenylation, DNA binding, and nick-closing activity. Although the mutant lsub1 (91-362) included the active site lysine (KxDG), self-adenylation was not shown. However, the mutants lsub6 (1-362), lsub7 (1-516), and lsub9 (1-635) showed the same adenylation activity as that of wild type. The lsub5 (91-719), which has the C-terminal domain (487-719) as to lsub4 (91-486), showed minimal adenylation activity. These results suggest that the presence of N-terminal 90 residues is essential for the formation of an enzyme-AMP complex, while C-terminal domain (487-719) appears to play a minimal role in adenylation. It was found that the presence of C-terminal domain (487-719) is indispensable for DNA binding activity of lsub5 (91-719). The mutant lsub9 (1-635) showed reduced DNA binding activity compared to that of wild type, suggesting the contribution of the domain (636-719) for the DNA binding activity. Thus, we concluded that the N-terminal 90 residues and C-terminal domain (487-719) of NAD+-dependent DNA ligase from A. pyrophilus are mutually indispensable for binding of DNA substrate.

  2. Characterization of the interaction of yeast enolase with polynucleotides.

    PubMed

    al-Giery, A G; Brewer, J M

    1992-09-23

    Yeast enolase is inhibited under certain conditions by DNA. The enzyme binds to single-stranded DNA-cellulose. Inhibition was used for routine characterization of the interaction. The presence of the substrate 2-phospho-D-glycerate reduces inhibition and binding. Both yeast enolase isozymes behave similarly. Impure yeast enolase was purified by adsorption onto a single-stranded DNA-cellulose column followed by elution with substrate. Interaction with RNA, double-stranded DNA, or degraded DNA results in less inhibition, suggesting that yeast enolase preferentially binds single-stranded DNA. However, yeast enolase is not a DNA-unwinding protein. The enzyme is inhibited by the short synthetic oligodeoxynucleotides G6, G8 and G10 but not T8 or T6, suggesting some base specificity in the interaction. The interaction is stronger at more acid pH values, with an apparent pK of 5.6. The interaction is prevented by 0.3 M KCl, suggesting that electrostatic factors are important. Histidine or lysine reverse the inhibition at lower concentrations, while phosphate is still more effective. Binding of single-stranded DNA to enolase reduces the reaction of protein histidyl residues with diethylpyrocarbonate. The inhibition of yeast enolase by single-stranded DNA is not total, and suggests the active site is not directly involved in the interaction. Binding of substrate may induce a conformational change in the enzyme that interferes with DNA binding and vice versa.

  3. Two residues in the basic region of the yeast transcription factor Yap8 are crucial for its DNA-binding specificity.

    PubMed

    Amaral, Catarina; Pimentel, Catarina; Matos, Rute G; Arraiano, Cecília M; Matzapetakis, Manolis; Rodrigues-Pousada, Claudina

    2013-01-01

    In Saccharomyces cerevisiae, the transcription factor Yap8 is a key determinant in arsenic stress response. Contrary to Yap1, another basic region-leucine zipper (bZIP) yeast regulator, Yap8 has a very restricted DNA-binding specificity and only orchestrates the expression of ACR2 and ACR3 genes. In the DNA-binding basic region, Yap8 has three distinct amino acids residues, Leu26, Ser29 and Asn31, at sites of highly conserved positions in the other Yap family of transcriptional regulators and Pap1 of Schizosaccharomyces pombe. To evaluate whether these residues are relevant to Yap8 specificity, we first built a homology model of the complex Yap8bZIP-DNA based on Pap1-DNA crystal structure. Several Yap8 mutants were then generated in order to confirm the contribution of the residues predicted to interact with DNA. Using bioinformatics analysis together with in vivo and in vitro approaches, we have identified several conserved residues critical for Yap8-DNA binding. Moreover, our data suggest that Leu26 is required for Yap8 binding to DNA and that this residue together with Asn31, hinder Yap1 response element recognition by Yap8, thus narrowing its DNA-binding specificity. Furthermore our results point to a role of these two amino acids in the stability of the Yap8-DNA complex.

  4. Specialized nucleoprotein structures at the origin of replication of bacteriophage lambda: localized unwinding of duplex DNA by a six-protein reaction.

    PubMed Central

    Dodson, M; Echols, H; Wickner, S; Alfano, C; Mensa-Wilmot, K; Gomes, B; LeBowitz, J; Roberts, J D; McMacken, R

    1986-01-01

    The O protein of bacteriophage lambda localizes the initiation of DNA replication to a unique site on the lambda genome, ori lambda. By means of electron microscopy, we infer that the binding of O to ori lambda initiates a series of protein addition and transfer reactions that culminate in localized unwinding of the origin DNA, generating a prepriming structure for the initiation of DNA replication. We can define three stages of this prepriming reaction, the first two of which we have characterized previously. First, dimeric O protein binds to multiple DNA binding sites and self-associates to form a nucleoprotein structure, the O-some. Second, lambda P and host DnaB proteins interact with the O-some to generate a larger complex that includes additional DNA from an A + T-rich region adjacent to the O binding sites. Third, the addition of the DnaJ, DnaK, and Ssb proteins and ATP results in an origin-specific unwinding reaction, probably catalyzed by the helicase activity of DnaB. The unwinding reaction is unidirectional, proceeding "rightward" from the origin. The minimal DNA sequence competent for unwinding consists of two O binding sites and the adjacent A + T-rich region to the right of the binding sites. We conclude that the lambda O protein localizes and initiates a six-protein sequential reaction responsible for but preceding the precise initiation of DNA replication. Specialized nucleoprotein structures similar to the O-some may be a general feature of DNA transactions requiring extraordinary precision in localization and control. Images PMID:3020552

  5. PriC-mediated DNA replication restart requires PriC complex formation with the single-stranded DNA-binding protein.

    PubMed

    Wessel, Sarah R; Marceau, Aimee H; Massoni, Shawn C; Zhou, Ruobo; Ha, Taekjip; Sandler, Steven J; Keck, James L

    2013-06-14

    Frequent collisions between cellular DNA replication complexes (replisomes) and obstacles such as damaged DNA or frozen protein complexes make DNA replication fork progression surprisingly sporadic. These collisions can lead to the ejection of replisomes prior to completion of replication, which, if left unrepaired, results in bacterial cell death. As such, bacteria have evolved DNA replication restart mechanisms that function to reload replisomes onto abandoned DNA replication forks. Here, we define a direct interaction between PriC, a key Escherichia coli DNA replication restart protein, and the single-stranded DNA-binding protein (SSB), a protein that is ubiquitously associated with DNA replication forks. PriC/SSB complex formation requires evolutionarily conserved residues from both proteins, including a pair of Arg residues from PriC and the C terminus of SSB. In vitro, disruption of the PriC/SSB interface by sequence changes in either protein blocks the first step of DNA replication restart, reloading of the replicative DnaB helicase onto an abandoned replication fork. Consistent with the critical role of PriC/SSB complex formation in DNA replication restart, PriC variants that cannot bind SSB are non-functional in vivo. Single-molecule experiments demonstrate that PriC binding to SSB alters SSB/DNA complexes, exposing single-stranded DNA and creating a platform for other proteins to bind. These data lead to a model in which PriC interaction with SSB remodels SSB/DNA structures at abandoned DNA replication forks to create a DNA structure that is competent for DnaB loading.

  6. Characteristics and Concepts of Dynamic Hub Proteins in DNA Processing Machinery from Studies of RPA

    PubMed Central

    Sugitani, Norie; Chazin, Walter J.

    2015-01-01

    DNA replication, damage response and repair require the coordinated action of multi-domain proteins operating within dynamic multi-protein machines that act upon the DNA substrate. These modular proteins contain flexible linkers of various lengths, which enable changes in the spatial distribution of the globular domains (architecture) that harbor their essential biochemical functions. This mobile architecture is uniquely suited to follow the evolving substrate landscape present over the course of the specific process performed by the multi-protein machinery. A fundamental advance in understanding of protein machinery is the realization of the pervasive role of dynamics. Not only is the machine undergoing dynamic transformations, but the proteins themselves are flexible and constantly adapting to the progression through the steps of the overall process. Within this dynamic context the activity of the constituent proteins must be coordinated, a role typically played by hub proteins. A number of important characteristics of modular proteins and concepts about the operation of dynamic machinery have been discerned. These provide the underlying basis for the action of the machinery that reads DNA, and responds to and repairs DNA damage. Here, we introduce a number of key characteristics and concepts, including the modularity of the proteins, linkage of weak binding sites, direct competition between sites, and allostery, using the well recognized hub protein replication protein A (RPA). PMID:25542993

  7. HMG I(Y) interferes with the DNA binding of NF-AT factors and the induction of the interleukin 4 promoter in T cells

    PubMed Central

    Klein-Hessling, Stefan; Schneider, Günter; Heinfling, Annette; Chuvpilo, Sergei; Serfling, Edgar

    1996-01-01

    HMG I(Y) proteins bind to double-stranded A+T oligonucleotides longer than three base pairs. Such motifs form part of numerous NF-AT-binding sites of lymphokine promoters, including the interleukin 4 (IL-4) promoter. NF-AT factors share short homologous peptide sequences in their DNA-binding domain with NF-κB factors and bind to certain NF-κB sites. It has been shown that HMG I(Y) proteins enhance NF-κB binding to the interferon β promoter and virus-mediated interferon β promoter induction. We show that HMG I(Y) proteins exert an opposite effect on the DNA binding of NF-AT factors and the induction of the IL-4 promoter in T lymphocytes. Introduction of mutations into a high-affinity HMG I(Y)-binding site of the IL-4 promoter, which decreased HMG I(Y)-binding to a NF-AT-binding sequence, the Pu-bB (or P) site, distinctly increased the induction of the IL-4 promoter in Jurkat T leukemia cells. High concentrations of HMG I(Y) proteins are able to displace NF-ATp from its binding to the Pu-bB site. High HMG I(Y) concentrations are typical for Jurkat cells and peripheral blood T lymphocytes, whereas El4 T lymphoma cells and certain T helper type 2 cell clones contain relatively low HMG I(Y) concentrations. Our results indicate that HMG I(Y) proteins do not cooperate, but instead compete with NF-AT factors for the binding to DNA even though NF-AT factors share some DNA-binding properties with NF-kB factors. This competition between HMG I(Y) and NF-AT proteins for DNA binding might be due to common contacts with minor groove nucleotides of DNA and may be one mechanism contributing to the selective IL-4 expression in certain T lymphocyte populations, such as T helper type 2 cells. PMID:8986808

  8. Identifying DNA-binding proteins using structural motifs and the electrostatic potential

    PubMed Central

    Shanahan, Hugh P.; Garcia, Mario A.; Jones, Susan; Thornton, Janet M.

    2004-01-01

    Robust methods to detect DNA-binding proteins from structures of unknown function are important for structural biology. This paper describes a method for identifying such proteins that (i) have a solvent accessible structural motif necessary for DNA-binding and (ii) a positive electrostatic potential in the region of the binding region. We focus on three structural motifs: helix–turn-helix (HTH), helix–hairpin–helix (HhH) and helix–loop–helix (HLH). We find that the combination of these variables detect 78% of proteins with an HTH motif, which is a substantial improvement over previous work based purely on structural templates and is comparable to more complex methods of identifying DNA-binding proteins. Similar true positive fractions are achieved for the HhH and HLH motifs. We see evidence of wide evolutionary diversity for DNA-binding proteins with an HTH motif, and much smaller diversity for those with an HhH or HLH motif. PMID:15356290

  9. Noncovalent Interactions of Tiopronin-Protected Gold Nanoparticles with DNA: Two Methods to Quantify Free Energy of Binding

    PubMed Central

    Prado-Gotor, R.; Grueso, E.

    2014-01-01

    The binding of gold nanoparticles capped with N-(2-mercaptopropionyl)glycine (Au@tiopronin) with double-stranded DNA has been investigated and quantified in terms of free energies by using two different approaches. The first approach follows the DNA conformational changes induced by gold nanoparticles using the CD technique. The second methodology consists in the use of pyrene-1-carboxaldehyde as a fluorescent probe. This second procedure implies the determination of the “true” free energy of binding of the probe with DNA, after corrections through solubility measurements. Working at different salt concentrations, the nonelectrostatic and electrostatic components of the binding free energy have been separated. The results obtained revealed that the binding is of nonelectrostatic character, fundamentally. The procedure used in this work could be extended to quantify the binding affinity of other AuNPs/DNA systems. PMID:24587710

  10. Synthesis and structure elucidation of a copper(II) Schiff-base complex: in vitro DNA binding, pBR322 plasmid cleavage and HSA binding studies.

    PubMed

    Tabassum, Sartaj; Ahmad, Musheer; Afzal, Mohd; Zaki, Mehvash; Bharadwaj, Parimal K

    2014-11-01

    New copper(II) complex with Schiff base ligand 4-[(2-Hydroxy-3-methoxy-benzylidene)-amino]-benzoic acid (H₂L) was synthesized and characterized by spectroscopic and analytical and single crystal X-ray diffraction studies which revealed that the complex 1 exist in a distorted octahedral environment. In vitro CT-DNA binding studies were performed by employing different biophysical technique which indicated that the 1 strongly binds to DNA in comparison to ligand via electrostatic binding mode. Complex 1 cleaves pBR322 DNA via hydrolytic pathway and recognizes minor groove of DNA double helix. The HSA binding results showed that ligand and complex 1 has ability to quench the fluorescence emission intensity of Trp 214 residue available in the subdomain IIA of HSA. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Human mRNA polyadenylate binding protein: evolutionary conservation of a nucleic acid binding motif.

    PubMed Central

    Grange, T; de Sa, C M; Oddos, J; Pictet, R

    1987-01-01

    We have isolated a full length cDNA (cDNA) coding for the human poly(A) binding protein. The cDNA derived 73 kd basic translation product has the same Mr, isoelectric point and peptidic map as the poly(A) binding protein. DNA sequence analysis reveals a 70,244 dalton protein. The N terminal part, highly homologous to the yeast poly(A) binding protein, is sufficient for poly(A) binding activity. This domain consists of a four-fold repeated unit of approximately 80 amino acids present in other nucleic acid binding proteins. In the C terminal part there is, as in the yeast protein, a sequence of approximately 150 amino acids, rich in proline, alanine and glutamine which together account for 48% of the residues. A 2,9 kb mRNA corresponding to this cDNA has been detected in several vertebrate cell types and in Drosophila melanogaster at every developmental stage including oogenesis. Images PMID:2885805

  12. Fluorescence correlation spectroscopy study of the complexation of DNA hybrids, IgG antibody, and a chimeric protein of IgG-binding ZZ domains fused with a carbohydrate binding module.

    PubMed

    Rosa, A M M; Prazeres, D M F; Paulo, P M R

    2017-06-28

    Fluorescence correlation spectroscopy (FCS) was used to characterize the molecular interactions between the four components of a DNA recognition system. A fluorescent DNA probe was used to assess: (i) the hybridization with a complementary biotin-labeled target, (ii) the complexation of the resulting hybrid and an anti-biotin antibody, and (iii) the binding of the latter complex to a ZZ-CBM fusion protein that combines small synthetic IgG Fc-binding Z domains with a carbohydrate binding module (CBM). These binding interactions were monitored by exposing the fluorescent DNA probe to different amounts and combinations of the other molecules in solution. Through the analysis of FCS autocorrelation curves, an association constant (K a ) of 2.9 × 10 7 M -1 was estimated for DNA·DNA hybridization, and the presence of (non-) complementary target DNA in solution could be discriminated. The specific capture of biotinylated DNA hybrids by anti-biotin IgG was verified, with an apparent K a of 2.5 × 10 6 M -1 . The increment in the diffusion time measured when the DNA·DNA:antibody complexes were in contact with the ZZ-CBM fusion protein suggested that the binding occurs at a stoichiometric ratio of DNA/antibody complex to fusion larger than 1 : 1. The FCS-derived information obtained is useful to gain insight into molecular interactions involved in diagnostic assays.

  13. A ruthenium dimer complex with a flexible linker slowly threads between DNA bases in two distinct steps.

    PubMed

    Bahira, Meriem; McCauley, Micah J; Almaqwashi, Ali A; Lincoln, Per; Westerlund, Fredrik; Rouzina, Ioulia; Williams, Mark C

    2015-10-15

    Several multi-component DNA intercalating small molecules have been designed around ruthenium-based intercalating monomers to optimize DNA binding properties for therapeutic use. Here we probe the DNA binding ligand [μ-C4(cpdppz)2(phen)4Ru2](4+), which consists of two Ru(phen)2dppz(2+) moieties joined by a flexible linker. To quantify ligand binding, double-stranded DNA is stretched with optical tweezers and exposed to ligand under constant applied force. In contrast to other bis-intercalators, we find that ligand association is described by a two-step process, which consists of fast bimolecular intercalation of the first dppz moiety followed by ∼10-fold slower intercalation of the second dppz moiety. The second step is rate-limited by the requirement for a DNA-ligand conformational change that allows the flexible linker to pass through the DNA duplex. Based on our measured force-dependent binding rates and ligand-induced DNA elongation measurements, we are able to map out the energy landscape and structural dynamics for both ligand binding steps. In addition, we find that at zero force the overall binding process involves fast association (∼10 s), slow dissociation (∼300 s), and very high affinity (Kd ∼10 nM). The methodology developed in this work will be useful for studying the mechanism of DNA binding by other multi-step intercalating ligands and proteins. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Nickel-quinolones interaction. Part 4. Structure and biological evaluation of nickel(II)-enrofloxacin complexes compared to zinc(II) analogues.

    PubMed

    Skyrianou, Kalliopi C; Psycharis, Vassilis; Raptopoulou, Catherine P; Kessissoglou, Dimitris P; Psomas, George

    2011-01-01

    The nickel(II) complexes with the second-generation quinolone antibacterial agent enrofloxacin in the presence or absence of the nitrogen-donor heterocyclic ligands 1,10-phenanthroline, 2,2'-bipyridine or pyridine have been synthesized and characterized. Enrofloxacin acts as bidentate ligand coordinated to Ni(II) ion through the ketone oxygen and a carboxylato oxygen. The crystal structure of (1,10-phenanthroline)bis(enrofloxacinato)nickel(II) has been determined by X-ray crystallography. UV study of the interaction of the complexes with calf-thymus DNA (CT DNA) has shown that they bind to CT DNA and bis(pyridine)bis(enrofloxacinato)nickel(II) exhibits the highest binding constant to CT DNA. The cyclic voltammograms of the complexes have shown that in the presence of CT DNA the complexes can bind to CT DNA by the intercalative binding mode which has also been verified by DNA solution viscosity measurements. Competitive study with ethidium bromide (EB) has shown that the complexes can displace the DNA-bound EB indicating that they bind to DNA in strong competition with EB. The complexes exhibit good binding propensity to human or bovine serum albumin protein having relatively high binding constant values. The biological properties of the complexes have been evaluated in comparison to the corresponding Zn(II) enrofloxacinato complexes as well as Ni(II) complexes with the first-generation quinolone oxolinic acid. Copyright © 2010 Elsevier Inc. All rights reserved.

  15. Solution structure of CEH-37 homeodomain of the nematode Caenorhabditis elegans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Moon, Sunjin; Lee, Yong Woo; Kim, Woo Taek

    Highlights: •We have determined solution structures of CEH-37 homedomain. •CEH-37 HD has a compact α-helical structure with HTH DNA binding motif. •Solution structure of CEH-37 HD shares its molecular topology with that of the homeodomain proteins. •Residues in the N-terminal region and HTH motif are important in binding to Caenorhabditis elegans telomeric DNA. •CEH-37 could play an important role in telomere function via DNA binding. -- Abstract: The nematode Caenorhabditis elegans protein CEH-37 belongs to the paired OTD/OTX family of homeobox-containing homeodomain proteins. CEH-37 shares sequence similarity with homeodomain proteins, although it specifically binds to double-stranded C. elegans telomeric DNA,more » which is unusual to homeodomain proteins. Here, we report the solution structure of CEH-37 homeodomain and molecular interaction with double-stranded C. elegans telomeric DNA using nuclear magnetic resonance (NMR) spectroscopy. NMR structure shows that CEH-37 homeodomain is composed of a flexible N-terminal region and three α-helices with a helix-turn-helix (HTH) DNA binding motif. Data from size-exclusion chromatography and fluorescence spectroscopy reveal that CEH-37 homeodomain interacts strongly with double-stranded C. elegans telomeric DNA. NMR titration experiments identified residues responsible for specific binding to nematode double-stranded telomeric DNA. These results suggest that C. elegans homeodomain protein, CEH-37 could play an important role in telomere function via DNA binding.« less

  16. Zinc-binding Domain of the Bacteriophage T7 DNA Primase Modulates Binding to the DNA Template*

    PubMed Central

    Lee, Seung-Joo; Zhu, Bin; Akabayov, Barak; Richardson, Charles C.

    2012-01-01

    The zinc-binding domain (ZBD) of prokaryotic DNA primases has been postulated to be crucial for recognition of specific sequences in the single-stranded DNA template. To determine the molecular basis for this role in recognition, we carried out homolog-scanning mutagenesis of the zinc-binding domain of DNA primase of bacteriophage T7 using a bacterial homolog from Geobacillus stearothermophilus. The ability of T7 DNA primase to catalyze template-directed oligoribonucleotide synthesis is eliminated by substitution of any five-amino acid residue-long segment within the ZBD. The most significant defect occurs upon substitution of a region (Pro-16 to Cys-20) spanning two cysteines that coordinate the zinc ion. The role of this region in primase function was further investigated by generating a protein library composed of multiple amino acid substitutions for Pro-16, Asp-18, and Asn-19 followed by genetic screening for functional proteins. Examination of proteins selected from the screening reveals no change in sequence-specific recognition. However, the more positively charged residues in the region facilitate DNA binding, leading to more efficient oligoribonucleotide synthesis on short templates. The results suggest that the zinc-binding mode alone is not responsible for sequence recognition, but rather its interaction with the RNA polymerase domain is critical for DNA binding and for sequence recognition. Consequently, any alteration in the ZBD that disturbs its conformation leads to loss of DNA-dependent oligoribonucleotide synthesis. PMID:23024359

  17. DNA-binding activity of TNF-{alpha} inducing protein from Helicobacter pylori

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kuzuhara, T.; Suganuma, M.; Oka, K.

    2007-11-03

    Tumor necrosis factor-{alpha} (TNF-{alpha}) inducing protein (Tip{alpha}) is a carcinogenic factor secreted from Helicobacter pylori (H. pylori), mediated through both enhanced expression of TNF-{alpha} and chemokine genes and activation of nuclear factor-{kappa}B. Since Tip{alpha} enters gastric cancer cells, the Tip{alpha} binding molecules in the cells should be investigated. The direct DNA-binding activity of Tip{alpha} was observed by pull down assay using single- and double-stranded genomic DNA cellulose. The surface plasmon resonance assay, indicating an association between Tip{alpha} and DNA, revealed that the affinity of Tip{alpha} for (dGdC)10 is 2400 times stronger than that of del-Tip{alpha}, an inactive Tip{alpha}. This suggestsmore » a strong correlation between DNA-binding activity and carcinogenic activity of Tip{alpha}. And the DNA-binding activity of Tip{alpha} was first demonstrated with a molecule secreted from H. pylori.« less

  18. Structure and mechanism of the phage T4 recombination mediator protein UvsY

    DOE PAGES

    Gajewski, Stefan; Waddell, Michael Brett; Vaithiyalingam, Sivaraja; ...

    2016-03-07

    The UvsY recombination mediator protein is critical for efficient homologous recombination in bacteriophage T4 and is the functional analog of the eukaryotic Rad52 protein. During T4 homologous recombination, the UvsX recombinase has to compete with the prebound gp32 single-stranded binding protein for DNA-binding sites and UvsY stimulates this filament nucleation event. We report here the crystal structure of UvsY in four similar open-barrel heptameric assemblies and provide structural and biophysical insights into its function. The UvsY heptamer was confirmed in solution by centrifugation and light scattering, and thermodynamic analyses revealed that the UvsY–ssDNA interaction occurs within the assembly via twomore » distinct binding modes. Using surface plasmon resonance, we also examined the binding of UvsY to both ssDNA and the ssDNA–gp32 complex. These analyses confirmed that ssDNA can bind UvsY and gp32 independently and also as a ternary complex. They also showed that residues located on the rim of the heptamer are required for optimal binding to ssDNA, thus identifying the putative ssDNA-binding surface. We propose a model in which UvsY promotes a helical ssDNA conformation that disfavors the binding of gp32 and initiates the assembly of the ssDNA–UvsX filament.« less

  19. Identification of Nucleic Acid Binding Sites on Translin-Associated Factor X (TRAX) Protein

    PubMed Central

    Gupta, Gagan Deep; Kumar, Vinay

    2012-01-01

    Translin and TRAX proteins play roles in very important cellular processes such as DNA recombination, spatial and temporal expression of mRNA, and in siRNA processing. Translin forms a homomeric nucleic acid binding complex and binds to ssDNA and RNA. However, a mutant translin construct that forms homomeric complex lacking nucleic acid binding activity is able to form fully active heteromeric translin-TRAX complex when co-expressed with TRAX. A substantial progress has been made in identifying translin sites that mediate its binding activity, while TRAX was thought not to bind DNA or RNA on its own. We here for the first time demonstrate nucleic acid binding to TRAX by crosslinking radiolabeled ssDNA to heteromeric translin-TRAX complex using UV-laser. The TRAX and translin, photochemically crosslinked with ssDNA, were individually detected on SDS-PAGE. We mutated two motifs in TRAX and translin, designated B2 and B3, to help define the nucleic acid binding sites in the TRAX sequence. The most pronounced effect was observed in the mutants of B3 motif that impaired nucleic acid binding activity of the heteromeric complexes. We suggest that both translin and TRAX are binding competent and contribute to the nucleic acid binding activity. PMID:22427937

  20. MFP1 is a thylakoid-associated, nucleoid-binding protein with a coiled-coil structure

    PubMed Central

    Jeong, Sun Yong; Rose, Annkatrin; Meier, Iris

    2003-01-01

    Plastid DNA, like bacterial and mitochondrial DNA, is organized into protein–DNA complexes called nucleoids. Plastid nucleoids are believed to be associated with the inner envelope in developing plastids and the thylakoid membranes in mature chloroplasts, but the mechanism for this re-localization is unknown. Here, we present the further characterization of the coiled-coil DNA-binding protein MFP1 as a protein associated with nucleoids and with the thylakoid membranes in mature chloroplasts. MFP1 is located in plastids in both suspension culture cells and leaves and is attached to the thylakoid membranes with its C-terminal DNA-binding domain oriented towards the stroma. It has a major DNA-binding activity in mature Arabidopsis chloroplasts and binds to all tested chloroplast DNA fragments without detectable sequence specificity. Its expression is tightly correlated with the accumulation of thylakoid membranes. Importantly, it is associated in vivo with nucleoids, suggesting a function for MFP1 at the interface between chloroplast nucleoids and the developing thylakoid membrane system. PMID:12930969

  1. Structural Analysis of HMGD-DNA Complexes Reveal Influence of Intercalation on Sequence Selectivity and DNA Bending

    PubMed Central

    Churchill, Mair E.A.; Klass, Janet; Zoetewey, David L.

    2010-01-01

    The ubiquitous eukaryotic High-Mobility-Group-Box (HMGB) chromosomal proteins promote many chromatin-mediated cellular activities through their non-sequence-specific binding and bending of DNA. Minor groove DNA binding by the HMG box results in substantial DNA bending toward the major groove owing to electrostatic interactions, shape complementarity and DNA intercalation that occurs at two sites. Here, the structures of the complexes formed with DNA by a partially DNA intercalation-deficient mutant of Drosophila melanogaster HMGD have been determined by X-ray crystallography at a resolution of 2.85 Å. The six proteins and fifty base pairs of DNA in the crystal structure revealed a variety of bound conformations. All of the proteins bound in the minor groove, bridging DNA molecules, presumably because these DNA regions are easily deformed. The loss of the primary site of DNA intercalation decreased overall DNA bending and shape complementarity. However, DNA bending at the secondary site of intercalation was retained and most protein-DNA contacts were preserved. The mode of binding resembles the HMGB1-boxA-cisplatin-DNA complex, which also lacks a primary intercalating residue. This study provides new insights into the binding mechanisms used by HMG boxes to recognize varied DNA structures and sequences as well as modulate DNA structure and DNA bending. PMID:20800069

  2. Non-enolisable Knoevenagel condensate appended Schiff bases-metal (II) complexes: Spectral characteristics, DNA-binding and nuclease activities

    NASA Astrophysics Data System (ADS)

    Gubendran, Ammavasi; Kesavan, Mookkandi Palsamy; Ayyanaar, Srinivasan; Mitu, Liviu; Athappan, Periyakaruppan; Rajesh, Jegathalaprathaban

    2017-06-01

    New Schiff base complexes [Cu(L1)Cl] (1), [Ni(L1)Cl] (2), [Zn(L1)Cl] (3), and [Fe(L2)H2OCl] (4) {L1 = (4E)-3-(2-hydroxybenzylidene)-4-(2-hydroxyphenylimino)pentan-2-one, L2 = 2,2‧-(1E,1‧E)-(3-(2-hydroxybenzylidene)-pentane-2,4-diylidene)bis(azan-1-yl-1 idene)diphenol} have been synthesized and characterized by elemental analysis, UV-Vis, IR, FAB-mass, EPR, spectral studies and electrochemical studies, the ligands L1 &L2 were characterized by 1H and 13C NMR spectra. Complex 1 show a visible spectral d-d band near 600 nm and display cyclic voltammetric quasireversible response for the Cu(II)/Cu(I) couple vs Ag/AgCl in DMSO. The EPR spectrum of 1 show g‖ > g⊥ suggesting a square planar geometry around copper with dx2 - y2 as the ground state. The mass spectral results have confirmed the proposed structure for complexes 1-4. DNA binding properties of these complexes 1-4 have been investigated by absorption titrations, cyclic voltammetric studies and circular dichroism studies. On titration with DNA, the complexes 1-4 show hypochromism at the MLCT band (13-31%) with a red shift of 1-8 nm in the electronic spectrum and positive shift of voltammetric E1/2 in the CV studies are in favour of intercalative binding. CD spectra of 1 showed an increase in molar ellipticity (θ278) of the positive band with a minor red shift indicating the transition of B-form of DNA to A like form. DNA cleavage studies of complexes 1 and 4 with pUC18 DNA were studied by gel electrophoresis and complex 4 cleaves supercoiled pUC18 DNA in an oxidative manner in the presence of H2O2 and on photo irradiation at 312 nm.

  3. Anti-dsDNA Antibodies Bind to Mesangial Annexin II in Lupus Nephritis

    PubMed Central

    Yung, Susan; Cheung, Kwok Fan; Zhang, Qing

    2010-01-01

    Production of anti-dsDNA antibodies is a hallmark of lupus nephritis, but how these antibodies deposit in organs and elicit inflammatory damage remains unknown. In this study, we sought to identify antigens on the surface of human mesangial cells (HMC) that mediate the binding of human anti-dsDNA antibodies and the subsequent pathogenic processes. We isolated anti-dsDNA antibodies from patients with lupus nephritis by affinity chromatography. We used multiple methods to identify and characterize antigens from the plasma membrane fraction of mesangial cells that crossreacted with the anti-dsDNA antibodies. We found that annexin II mediated the binding of anti-dsDNA antibodies to HMC. After binding to the mesangial cell surface, anti-dsDNA antibodies were internalized into the cytoplasm and nucleus. This also led to induction of IL-6 secretion and annexin II synthesis, mediated through activation of p38 MAPK, JNK, and AKT. Binding of anti-dsDNA antibodies to annexin II correlated with disease activity in human lupus nephritis. Glomerular expression of annexin II correlated with the severity of nephritis, and annexin II colocalized with IgG and C3 deposits in both human and murine lupus nephritis. Gene silencing of annexin II in HMC reduced binding of anti-dsDNA antibody and partially decreased IL-6 secretion. In summary, our data demonstrate that annexin II mediates the binding of anti-dsDNA antibodies to mesangial cells, contributing to the pathogenesis of lupus nephritis. This interaction provides a potential target for therapeutic intervention. PMID:20847146

  4. Compartmentalized self-replication (CSR) selection of Thermococcus litoralis Sh1B DNA polymerase for diminished uracil binding.

    PubMed

    Tubeleviciute, Agne; Skirgaila, Remigijus

    2010-08-01

    The thermostable archaeal DNA polymerase Sh1B from Thermococcus litoralis has a typical uracil-binding pocket, which in nature plays an essential role in preventing the accumulation of mutations caused by cytosine deamination to uracil and subsequent G-C base pair transition to A-T during the genomic DNA replication. The uracil-binding pocket recognizes and binds uracil base in a template strand trapping the polymerase. Since DNA replication stops, the repair systems have a chance to correct the promutagenic event. Archaeal family B DNA polymerases are employed in various PCR applications. Contrary to nature, in PCR the uracil-binding property of archaeal polymerases is disadvantageous and results in decreased DNA amplification yields and lowered sensitivity. Furthermore, in diagnostics qPCR, RT-qPCR and end-point PCR are performed using dNTP mixtures, where dTTP is partially or fully replaced by dUTP. Uracil-DNA glycosylase treatment and subsequent heating of the samples is used to degrade the DNA containing uracil and prevent carryover contamination, which is the main concern in diagnostic laboratories. A thermostable archaeal DNA polymerase with the abolished uracil binding would be a highly desirable and commercially interesting product. An attempt to disable uracil binding in DNA polymerase Sh1B from T. litoralis by generating site-specific mutants did not yield satisfactory results. However, a combination of random mutagenesis of the whole polymerase gene and compartmentalized self-replication was successfully used to select variants of thermostable Sh1B polymerase capable of performing PCR with dUTP instead of dTTP.

  5. DNA condensing effects and sequence selectivity of DNA binding of antitumor noncovalent polynuclear platinum complexes.

    PubMed

    Malina, Jaroslav; Farrell, Nicholas P; Brabec, Viktor

    2014-02-03

    The noncovalent analogues of antitumor polynuclear platinum complexes represent a structurally discrete class of platinum drugs. Their chemical and biological properties differ significantly from those of most platinum chemotherapeutics, which bind to DNA in a covalent manner by formation of Pt-DNA adducts. In spite of the fact that these noncovalent polynuclear platinum complexes contain no leaving groups, they have been shown to bind to DNA with high affinity. We report here on the DNA condensation properties of a series of noncovalent analogues of antitumor polynuclear platinum complexes described by biophysical and biochemical methods. The results demonstrate that these polynuclear platinum compounds are capable of inducing DNA condensation at more than 1 order of magnitude lower concentrations than conventional spermine. Atomic force microscopy studies of DNA condensation confined to a mica substrate have revealed that the DNA morphologies become more compact with increasing concentration of the platinum complexes. Moreover, we also found that the noncovalent polynuclear platinum complex [{Pt(NH3)3}2-μ-{trans-Pt(NH3)2(NH2(CH2)6NH2)2}](6+) (TriplatinNC-A) binds to DNA in a sequence-dependent manner, namely, to A/T-rich sequences and A-tract regions, and that noncovalent polynuclear platinum complexes protect DNA from enzymatic cleavage by DNase I. The results suggest that mechanisms of antitumor and cytotoxic activities of these complexes may be associated with their unique ability to condense DNA along with their sequence-specific DNA binding. Owing to their high cellular accumulation, it is also reasonable to suggest that their mechanism of action is based on the competition with naturally occurring DNA condensing agents, such as polyamines spermine, spermidine, and putrescine, for intracellular binding sites, resulting in the disturbance of the correct binding of regulatory proteins initiating the onset of apoptosis.

  6. Synthesis and crystal structure elucidation of new copper(II)-based chemotherapeutic agent coupled with 1,2-DACH and orthovanillin: Validated by in vitro DNA/HSA binding profile and pBR322 cleavage pathway.

    PubMed

    Zaki, Mehvash; Afzal, Mohd; Ahmad, Musheer; Tabassum, Sartaj

    2016-08-01

    New copper(II)-based complex (1) was synthesized and characterized by analytical, spectroscopic and single crystal X-ray diffraction. The in vitro binding studies of complex 1 with CT DNA and HSA have been investigated by employing biophysical techniques to examine the binding propensity of 1 towards DNA and HSA. The results showed that 1 avidly binds to CT DNA via electrostatic mode along with the hydrogen bonding interaction of NH2 and CN groups of Schiff base ligand with the base pairs of DNA helix, leads to partial unwinding and destabilization of the DNA double helix. Moreover, the CD spectral studies revealed that complex 1 binds through groove binding interaction that stabilizes the right-handed B-form of DNA. Complex 1 showed an impressive photoinduced nuclease activity generating single-strand breaks in comparison with the DNA cleavage activity in presence of visible light. The mechanistic investigation revealed the efficiency of 1 to cleave DNA strands by involving the generation of reactive oxygen species. Furthermore, the time dependent DNA cleavage activity showed that there was gradual increase in the amount of NC DNA on increasing the photoexposure time. However, the interaction of 1 and HSA showed that the change of intrinsic fluorescence intensity of HSA was induced by the microenvironment of Trp residue. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Mechanochemical regulations of RPA's binding to ssDNA

    NASA Astrophysics Data System (ADS)

    Chen, Jin; Le, Shimin; Basu, Anindita; Chazin, Walter J.; Yan, Jie

    2015-03-01

    Replication protein A (RPA) is a ubiquitous eukaryotic single-stranded DNA (ssDNA) binding protein that serves to protect ssDNA from degradation and annealing, and as a template for recruitment of many downstream factors in virtually all DNA transactions in cell. During many of these transactions, DNA is tethered and is likely subject to force. Previous studies of RPA's binding behavior on ssDNA were conducted in the absence of force; therefore the RPA-ssDNA conformations regulated by force remain unclear. Here, using a combination of atomic force microscopy imaging and mechanical manipulation of single ssDNA tethers, we show that force mediates a switch of the RPA bound ssDNA from amorphous aggregation to a much more regular extended conformation. Further, we found an interesting non-monotonic dependence of the binding affinity on monovalent salt concentration in the presence of force. In addition, we discovered that zinc in micromolar concentrations drives ssDNA to a unique, highly stiff and more compact state. These results provide new mechanochemical insights into the influences and the mechanisms of action of RPA on large single ssDNA.

  8. enDNA-Prot: identification of DNA-binding proteins by applying ensemble learning.

    PubMed

    Xu, Ruifeng; Zhou, Jiyun; Liu, Bin; Yao, Lin; He, Yulan; Zou, Quan; Wang, Xiaolong

    2014-01-01

    DNA-binding proteins are crucial for various cellular processes, such as recognition of specific nucleotide, regulation of transcription, and regulation of gene expression. Developing an effective model for identifying DNA-binding proteins is an urgent research problem. Up to now, many methods have been proposed, but most of them focus on only one classifier and cannot make full use of the large number of negative samples to improve predicting performance. This study proposed a predictor called enDNA-Prot for DNA-binding protein identification by employing the ensemble learning technique. Experiential results showed that enDNA-Prot was comparable with DNA-Prot and outperformed DNAbinder and iDNA-Prot with performance improvement in the range of 3.97-9.52% in ACC and 0.08-0.19 in MCC. Furthermore, when the benchmark dataset was expanded with negative samples, the performance of enDNA-Prot outperformed the three existing methods by 2.83-16.63% in terms of ACC and 0.02-0.16 in terms of MCC. It indicated that enDNA-Prot is an effective method for DNA-binding protein identification and expanding training dataset with negative samples can improve its performance. For the convenience of the vast majority of experimental scientists, we developed a user-friendly web-server for enDNA-Prot which is freely accessible to the public.

  9. Screening and analysis of bioactive compounds with biofingerprinting chromatogram analysis of traditional Chinese medicines targeting DNA by microdialysis/HPLC.

    PubMed

    Su, Xingye; Kong, Liang; Li, Xin; Chen, Xueguo; Guo, Ming; Zou, Hanfa

    2005-05-27

    Biofingerprinting chromatogram analysis, which is defined as the comparison of fingerprinting chromatograms of the extract of traditional Chinese medicines (TCMs) before and after the interaction with biological systems (DNA, protein, cell, etc.), was proposed for screening and analysis of the multiple bioactive compounds in TCMs. A method of microdialysis sampling combined with high performance liquid chromatography (HPLC) was applied to the study of DNA-binding property for the extracts of TCMs. Seven compounds were found to bind to calf thymus DNA (ct-DNA) from the TCMs of Coptis chinensis Franch (Coptis), but only three ones from Phellodendron amurense Rupr. (Phellodendron) and none from Sophoraflavescens Ait. (Sophora) to bind to ct-DNA, respectively. Three of them were identified as berberine, palmatine and jatrorrhizine and their association constants (K) to ct-DNA were determined by microdialysis/HPLC. Competitive binding behaviors of them to ct-DNA were also investigated.

  10. RPA binds histone H3-H4 and functions in DNA replication-coupled nucleosome assembly.

    PubMed

    Liu, Shaofeng; Xu, Zhiyun; Leng, He; Zheng, Pu; Yang, Jiayi; Chen, Kaifu; Feng, Jianxun; Li, Qing

    2017-01-27

    DNA replication-coupled nucleosome assembly is essential to maintain genome integrity and retain epigenetic information. Multiple involved histone chaperones have been identified, but how nucleosome assembly is coupled to DNA replication remains elusive. Here we show that replication protein A (RPA), an essential replisome component that binds single-stranded DNA, has a role in replication-coupled nucleosome assembly. RPA directly binds free H3-H4. Assays using a synthetic sequence that mimics freshly unwound single-stranded DNA at replication fork showed that RPA promotes DNA-(H3-H4) complex formation immediately adjacent to double-stranded DNA. Further, an RPA mutant defective in H3-H4 binding exhibited attenuated nucleosome assembly on nascent chromatin. Thus, we propose that RPA functions as a platform for targeting histone deposition to replication fork, through which RPA couples nucleosome assembly with ongoing DNA replication. Copyright © 2017, American Association for the Advancement of Science.

  11. Organometallic DNA-B12 Conjugates as Potential Oligonucleotide Vectors: Synthesis and Structural and Binding Studies with Human Cobalamin-Transport Proteins.

    PubMed

    Mutti, Elena; Hunger, Miriam; Fedosov, Sergey; Nexo, Ebba; Kräutler, Bernhard

    2017-11-16

    The synthesis and structural characterization of Co-(dN) 25 -Cbl (Cbl: cobalamin; dN: deoxynucleotide) and Co-(dN) 39 -Cbl, which are organometallic DNA-B 12 conjugates with single DNA strands consisting of 25 and 39 deoxynucleotides, respectively, and binding studies of these two DNA-Cbl conjugates to three homologous human Cbl transporting proteins, transcobalamin (TC), intrinsic factor (IF), and haptocorrin (HC), are reported. This investigation tests the suitability of such DNA-Cbls for the task of eventual in vivo oligonucleotide delivery. The binding of DNA-Cbl to TC, IF, and HC was investigated in competition with either a fluorescent Cbl derivative and Co-(dN) 25 -Cbl, or radiolabeled vitamin B 12 ( 57 Co-CNCbl) and Co-(dN) 25 -Cbl or Co-(dN) 39 -Cbl. Binding of the new DNA-Cbl conjugates was fast and tight with TC, but poorer with HC and IF, which extends a similar original finding with the simpler DNA-Cbl, Co-(dN) 18 -Cbl. The contrasting affinities of TC versus IF and HC for the DNA-Cbl conjugates are rationalized herein by a stepwise mechanism of Cbl binding. Critical contributions to overall affinity result from gradual conformational adaptations of the Cbl-binding proteins to the DNA-Cbl, which is first bound to the respective β domains. This transition is fast with TC, but slow with IF and HC, with which weaker binding results. The invariably tight interaction of the DNA-Cbl conjugates with TC makes the Cbl moiety a potential natural vector for the specific delivery of oligonucleotide loads from the blood into cells. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. NMR and computational methods applied to the 3- dimensional structure determination of DNA and ligand-DNA complexes in solution

    NASA Astrophysics Data System (ADS)

    Smith, Jarrod Anson

    2D homonuclear 1H NMR methods and restrained molecular dynamics (rMD) calculations have been applied to determining the three-dimensional structures of DNA and minor groove-binding ligand-DNA complexes in solution. The structure of the DNA decamer sequence d(GCGTTAACGC)2 has been solved both with a distance-based rMD protocol and an NOE relaxation matrix backcalculation-based protocol in order to probe the relative merits of the different refinement methods. In addition, three minor groove binding ligand-DNA complexes have been examined. The solution structure of the oligosaccharide moiety of the antitumor DNA scission agent calicheamicin γ1I has been determined in complex with a decamer duplex containing its high affinity 5'-TCCT- 3' binding sequence. The structure of the complex reinforces the belief that the oligosaccharide moiety is responsible for the sequence selective minor-groove binding activity of the agent, and critical intermolecular contacts are revealed. The solution structures of both the (+) and (-) enantiomers of the minor groove binding DNA alkylating agent duocarmycin SA have been determined in covalent complex with the undecamer DNA duplex d(GACTAATTGTC).d(GAC AATTAGTC). The results support the proposal that the alkylation activity of the duocarmycin antitumor antibiotics is catalyzed by a binding-induced conformational change in the ligand which activates the cyclopropyl group for reaction with the DNA. Comparisons between the structures of the two enantiomers covalently bound to the same DNA sequence at the same 5'-AATTA-3 ' site have provided insight into the binding orientation and site selectivity, as well as the relative rates of reactivity of these two agents.

  13. Sequence Discrimination by Alternatively Spliced Isoforms of a DNA Binding Zinc Finger Domain

    NASA Astrophysics Data System (ADS)

    Gogos, Joseph A.; Hsu, Tien; Bolton, Jesse; Kafatos, Fotis C.

    1992-09-01

    Two major developmentally regulated isoforms of the Drosophila chorion transcription factor CF2 differ by an extra zinc finger within the DNA binding domain. The preferred DNA binding sites were determined and are distinguished by an internal duplication of TAT in the site recognized by the isoform with the extra finger. The results are consistent with modular interactions between zinc fingers and trinucleotides and also suggest rules for recognition of AT-rich DNA sites by zinc finger proteins. The results show how modular finger interactions with trinucleotides can be used, in conjunction with alternative splicing, to alter the binding specificity and increase the spectrum of sites recognized by a DNA binding domain. Thus, CF2 may potentially regulate distinct sets of target genes during development.

  14. Mutations in the C-terminal fragment of DnaK affecting peptide binding.

    PubMed Central

    Burkholder, W F; Zhao, X; Zhu, X; Hendrickson, W A; Gragerov, A; Gottesman, M E

    1996-01-01

    Escherichia coli DnaK acts as a molecular chaperone through its ATP-regulated binding and release of polypeptide substrates. Overexpressing a C-terminal fragment (CTF) of DnaK (Gly-384 to Lys-638) containing the polypeptide substrate binding domain is lethal in wild-type E. coli. This dominant-negative phenotype may result from the nonproductive binding of CTF to cellular polypeptide targets of DnaK. Mutations affecting DnaK substrate binding were identified by selecting noncytotoxic CTF mutants followed by in vitro screening. The clustering of such mutations in the three-dimensional structure of CTF suggests the model that loops L1,2 and L4,5 form a rigid core structure critical for interactions with substrate. Images Fig. 1 Fig. 2 Fig. 3 PMID:8855230

  15. Multi-spectroscopic and molecular docking studies on the interaction of darunavir, a HIV protease inhibitor with calf thymus DNA

    NASA Astrophysics Data System (ADS)

    Shi, Jie-Hua; Zhou, Kai-Li; Lou, Yan-Yue; Pan, Dong-Qi

    2018-03-01

    Molecular interaction of darunavir (DRV), a HIV protease inhibitor with calf thymus deoxyribonucleic acid (ct-DNA) was studied in physiological buffer (pH 7.4) by multi-spectroscopic approaches hand in hand with viscosity measurements and molecular docking technique. The UV absorption and fluorescence results together revealed the formation of a DRV-ct-DNA complex having binding affinities of the order of 103 M- 1, which was more in keeping with the groove binding. The results that DRV bound to ct-DNA via groove binding mode was further evidenced by KI quenching studies, viscosity measurements, competitive binding investigations with EB and Rhodamine B and CD spectral analysis. The effect of ionic strength indicated the negligible involvement of electrostatic interaction between DRV and ct-DNA. The thermodynamic parameters regarding the binding interaction of DRV with ct-DNA in terms of enthalpy change (ΔH0) and entropy change (ΔS0) were - 63.19 kJ mol- 1 and - 141.92 J mol- 1 K- 1, indicating that hydrogen bonds and van der Waals forces played a predominant role in the binding process. Furthermore, molecular simulation studies suggested that DRV molecule was prone to bind in the A-T rich region of the minor groove of DNA.

  16. Experimental and molecular docking studies on DNA binding interaction of adefovir dipivoxil: Advances toward treatment of hepatitis B virus infections

    NASA Astrophysics Data System (ADS)

    Shahabadi, Nahid; Falsafi, Monireh

    The toxic interaction of adefovir dipivoxil with calf thymus DNA (CT-DNA) was investigated in vitro under simulated physiological conditions by multi-spectroscopic techniques and molecular modeling study. The fluorescence spectroscopy and UV absorption spectroscopy indicated drug interacted with CT-DNA in a groove binding mode. The binding constant of UV-visible and the number of binding sites were 3.33 ± 0.2 × 104 L mol-1and 0.99, respectively. The fluorimetric studies showed that the reaction between the drug and CT-DNA is exothermic (ΔH = 34.4 kJ mol-1; ΔS = 184.32 J mol-1 K-1). Circular dichroism spectroscopy (CD) was employed to measure the conformational change of CT-DNA in the presence of adefovir dipivoxil, which verified the groove binding mode. Furthermore, the drug induces detectable changes in its viscosity. The molecular modeling results illustrated that adefovir strongly binds to groove of DNA by relative binding energy of docked structure -16.83 kJ mol-1. This combination of multiple spectroscopic techniques and molecular modeling methods can be widely used in the investigation on the toxic interaction of small molecular pollutants and drugs with bio macromolecules, which contributes to clarify the molecular mechanism of toxicity or side effect in vivo.

  17. Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

    NASA Astrophysics Data System (ADS)

    Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

    2018-04-01

    We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

  18. Structural dynamics and interactions of Xeroderma pigmentosum complementation group A (XPA98-210) with damaged DNA.

    PubMed

    Pradhan, Sushmita; Mattaparthi, Venkata Satish Kumar

    2017-10-25

    Nucleotide excision repair (NER) in higher organisms repair massive DNA abrasions caused by ultraviolet rays, and various mutagens, where Xeroderma pigmentosum group A (XPA) protein is known to be involved in damage recognition step. Any mutations in XPA cause classical Xeroderma pigmentosum disease. The extent to which XPA is required in the NER is still unclear. Here, we present the comparative study on the structural and conformational changes in globular DNA binding domain of XPA 98-210 in DNA bound and DNA free state. Atomistic molecular dynamics simulation was carried out for both XPA 98-210 systems using AMBER force fields. We observed that XPA 98-210 in presence of damaged DNA exhibited more structural changes compared to XPA 98-210 in its free form. When XPA is in contact with DNA, we found marked stability of the complex due to the formation of characteristic longer antiparallel β-sheets consisting mainly lysine residues.

  19. Sox5 is a DNA binding co-factor for BMP R-Smads that directs target specificity during patterning of the early ectoderm

    PubMed Central

    Nordin, Kara; LaBonne, Carole

    2014-01-01

    SUMMARY The SoxD factor, Sox5, is expressed in ectodermal cells at times and places where BMP signaling is active, including the cells of the animal hemisphere at blastula stages, and the neural plate border (NPB) and neural crest (NC) at neurula stages. Sox5 is required for proper ectoderm development, and deficient embryos display patterning defects characteristic of perturbations of BMP signaling, including loss of neural crest and epidermis and expansion of the neural plate. We show that Sox5 is essential for activation of BMP target genes in embryos and explants, that it physically interacts with BMP R-Smads, and that it is essential for recruitment of Smad1/4 to BMP regulatory elements. Our findings identify Sox5 as the long sought DNA binding partner for BMP R-Smads essential to plasticity and pattern in the early ectoderm. PMID:25453832

  20. 3' Homologous Free Ends are Required for Stable Joint Molecule Formation by the RecA and Single-Stranded Binding Proteins of Escherichia coli

    NASA Astrophysics Data System (ADS)

    Konforti, Boyana B.; Davis, Ronald W.

    1987-02-01

    The RecA protein of Escherichia coli is important for genetic recombination in vivo and can promote synapsis and strand exchange in vitro. The DNA pairing and strand exchange reactions have been well characterized in reactions with circular single strands and linear duplexes, but little is known about these two processes using substrates more characteristic of those likely to exist in the cell. Single-stranded linear DNAs were prepared by separating strands of duplex molecules or by cleaving single-stranded circles at a unique restriction site created by annealing a short defined oligonucleotide to the circle. Analysis by gel electrophoresis and electron microscopy revealed that, in the presence of RecA and single-stranded binding proteins, a free 3' homologous end is essential for stable joint molecule formation between linear single-stranded and circular duplex DNA.

  1. The monomeric form of Neisseria DNA mimic protein DMP19 prevents DNA from binding to the histone-like HU protein

    PubMed Central

    Ko, Tzu-Ping; Liao, Yi-Ting; Hsu, Kai-Cheng

    2017-01-01

    DNA mimicry is a direct and effective strategy by which the mimic competes with DNA for the DNA binding sites on other proteins. Until now, only about a dozen proteins have been shown to function via this strategy, including the DNA mimic protein DMP19 from Neisseria meningitides. We have shown previously that DMP19 dimer prevents the operator DNA from binding to the transcription factor NHTF. Here, we provide new evidence that DMP19 monomer can also interact with the Neisseria nucleoid-associated protein HU. Using BS3 crosslinking, gel filtration and isothermal titration calorimetry assays, we found that DMP19 uses its monomeric form to interact with the Neisseria HU dimer. Crosslinking conjugated mass spectrometry was used to investigate the binding mode of DMP19 monomer and HU dimer. Finally, an electrophoretic mobility shift assay (EMSA) confirmed that the DNA binding affinity of HU is affected by DMP19. These results showed that DMP19 is bifunctional in the gene regulation of Neisseria through its variable oligomeric forms. PMID:29220372

  2. iDNA-Prot: Identification of DNA Binding Proteins Using Random Forest with Grey Model

    PubMed Central

    Lin, Wei-Zhong; Fang, Jian-An; Xiao, Xuan; Chou, Kuo-Chen

    2011-01-01

    DNA-binding proteins play crucial roles in various cellular processes. Developing high throughput tools for rapidly and effectively identifying DNA-binding proteins is one of the major challenges in the field of genome annotation. Although many efforts have been made in this regard, further effort is needed to enhance the prediction power. By incorporating the features into the general form of pseudo amino acid composition that were extracted from protein sequences via the “grey model” and by adopting the random forest operation engine, we proposed a new predictor, called iDNA-Prot, for identifying uncharacterized proteins as DNA-binding proteins or non-DNA binding proteins based on their amino acid sequences information alone. The overall success rate by iDNA-Prot was 83.96% that was obtained via jackknife tests on a newly constructed stringent benchmark dataset in which none of the proteins included has pairwise sequence identity to any other in a same subset. In addition to achieving high success rate, the computational time for iDNA-Prot is remarkably shorter in comparison with the relevant existing predictors. Hence it is anticipated that iDNA-Prot may become a useful high throughput tool for large-scale analysis of DNA-binding proteins. As a user-friendly web-server, iDNA-Prot is freely accessible to the public at the web-site on http://icpr.jci.edu.cn/bioinfo/iDNA-Prot or http://www.jci-bioinfo.cn/iDNA-Prot. Moreover, for the convenience of the vast majority of experimental scientists, a step-by-step guide is provided on how to use the web-server to get the desired results. PMID:21935457

  3. The Role of JMY in p53 Regulation.

    PubMed

    Adighibe, Omanma; Pezzella, Francesco

    2018-05-31

    Following the event of DNA damage, the level of tumour suppressor protein p53 increases inducing either cell cycle arrest or apoptosis. Junctional Mediating and Regulating Y protein (JMY) is a transcription co-factor involved in p53 regulation. In event of DNA damage, JMY levels also upregulate in the nucleus where JMY forms a co-activator complex with p300/CREB-binding protein (p300/CBP), Apoptosis-stimulating protein of p53 (ASPP) and Stress responsive activator of p53 (Strap). This co-activator complex then binds to and increases the ability of p53 to induce transcription of proteins triggering apoptosis but not cell cycle arrest. This then suggests that the increase of JMY levels due to DNA damage putatively "directs" p53 activity toward triggering apoptosis. JMY expression is also linked to increased cell motility as it: (1) downregulates the expression of adhesion molecules of the Cadherin family and (2) induces actin nucleation, making cells less adhesive and more mobile, favouring metastasis. All these characteristics taken together imply that JMY possesses both tumour suppressive and tumour metastasis promoting capabilities.

  4. On the electron affinity of cytosine in bulk water and at hydrophobic aqueous interfaces.

    PubMed

    Vöhringer-Martinez, Esteban; Dörner, Ciro; Abel, Bernd

    2014-10-01

    In the past one possible mechanism of DNA damage in bulk water has been attributed to the presence of hydrated electrons in water. Recently, one important property of hydrated electrons, namely their binding energy, was reported to be smaller at hydrophobic interfaces than in bulk aqueous solution. This possibly opens up new reaction possibilities with different solutes such as the DNA at hydrophobic, aqueous interfaces. Here, we use QM/MM molecular dynamics simulation to study how the molecular environment at the vacuum-water interface and in the bulk alters the electron affinity of cytosine being a characteristic part of the DNA. The electron affinity at the interface is closer to the corresponding binding energy of the partially hydrated electron. The increased energy resonance makes the electron capture process more probable and suggests that hydrated electrons at hydrophobic interfaces may be more reactive than the fully hydrated ones. Additionally, we found that the relaxation of the anionic form after electron attachment also induces a proton transfer from the surrounding solvent that was confirmed by comparison with the experimental reduction potential.

  5. Solution structure of telomere binding domain of AtTRB2 derived from Arabidopsis thaliana

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yun, Ji-Hye; Lee, Won Kyung; Kim, Heeyoun

    Highlights: • We have determined solution structure of Myb domain of AtTRB2. • The Myb domain of AtTRB2 is located in the N-terminal region. • The Myb domain of AtTRB2 binds to plant telomeric DNA without fourth helix. • Helix 2 and 3 of the Myb domain of AtTRB2 are involved in DNA recognition. • AtTRB2 is a novel protein distinguished from other known plant TBP. - Abstract: Telomere homeostasis is regulated by telomere-associated proteins, and the Myb domain is well conserved for telomere binding. AtTRB2 is a member of the SMH (Single-Myb-Histone)-like family in Arabidopsis thaliana, having an N-terminalmore » Myb domain, which is responsible for DNA binding. The Myb domain of AtTRB2 contains three α-helices and loops for DNA binding, which is unusual given that other plant telomere-binding proteins have an additional fourth helix that is essential for DNA binding. To understand the structural role for telomeric DNA binding of AtTRB2, we determined the solution structure of the Myb domain of AtTRB2 (AtTRB2{sub 1–64}) using nuclear magnetic resonance (NMR) spectroscopy. In addition, the inter-molecular interaction between AtTRB2{sub 1–64} and telomeric DNA has been characterized by the electrophoretic mobility shift assay (EMSA) and NMR titration analyses for both plant (TTTAGGG)n and human (TTAGGG)n telomere sequences. Data revealed that Trp28, Arg29, and Val47 residues located in Helix 2 and Helix 3 are crucial for DNA binding, which are well conserved among other plant telomere binding proteins. We concluded that although AtTRB2 is devoid of the additional fourth helix in the Myb-extension domain, it is able to bind to plant telomeric repeat sequences as well as human telomeric repeat sequences.« less

  6. Analyte-Triggered DNA-Probe Release from a Triplex Molecular Beacon for Nanopore Sensing.

    PubMed

    Guo, Bingyuan; Sheng, Yingying; Zhou, Ke; Liu, Quansheng; Liu, Lei; Wu, Hai-Chen

    2018-03-26

    A new nanopore sensing strategy based on triplex molecular beacon was developed for the detection of specific DNA or multivalent proteins. The sensor is composed of a triplex-forming molecular beacon and a stem-forming DNA component that is modified with a host-guest complex. Upon target DNA hybridizing with the molecular beacon loop or multivalent proteins binding to the recognition elements on the stem, the DNA probe is released and produces highly characteristic current signals when translocated through α-hemolysin. The frequency of current signatures can be used to quantify the concentrations of the target molecules. This sensing approach provides a simple, quick, and modular tool for the detection of specific macromolecules with high sensitivity and excellent selectivity. It may find useful applications in point-of-care diagnostics with a portable nanopore kit in the future. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. A single amino-acid substitution in the Ets domain alters core DNA binding specificity of Ets1 to that of the related transcription factors Elf1 and E74.

    PubMed

    Bosselut, R; Levin, J; Adjadj, E; Ghysdael, J

    1993-11-11

    Ets proteins form a family of sequence specific DNA binding proteins which bind DNA through a 85 aminoacids conserved domain, the Ets domain, whose sequence is unrelated to any other characterized DNA binding domain. Unlike all other known Ets proteins, which bind specific DNA sequences centered over either GGAA or GGAT core motifs, E74 and Elf1 selectively bind to GGAA corecontaining sites. Elf1 and E74 differ from other Ets proteins in three residues located in an otherwise highly conserved region of the Ets domain, referred to as conserved region III (CRIII). We show that a restricted selectivity for GGAA core-containing sites could be conferred to Ets1 upon changing a single lysine residue within CRIII to the threonine found in Elf1 and E74 at this position. Conversely, the reciprocal mutation in Elf1 confers to this protein the ability to bind to GGAT core containing EBS. This, together with the fact that mutation of two invariant arginine residues in CRIII abolishes DNA binding, indicates that CRIII plays a key role in Ets domain recognition of the GGAA/T core motif and lead us to discuss a model of Ets proteins--core motif interaction.

  8. Role of Nucleoid Associated Proteins in Stabilizing Supercoils

    NASA Astrophysics Data System (ADS)

    Dahlke, Katelyn; Sing, Charles

    Nucleoid associated proteins (NAPs) play an important role in prokaryotic cells by manipulating the shape and structure of the DNA. These NAPs act by bending or twisting DNA, and there are indications that NAPs bind preferentially to DNA that is already bent or twisted. We hypothesize that these binding behaviors strongly impact the stability and structure of DNA. We use coarse-grained simulation of NAPs and DNA that allow us to achieve the time and length scales where DNA supercoiling occurs. Supercoils are twist-induced structures that are the result of relaxing highly-twisted DNA by inducing higher degrees of bending and writhe. We are able to reproduce experimental observations, such as the extension of a DNA molecule as a function of force, linking number, and NAP concentration. Building upon these test cases, we allow the binding and unbinding energy of the simulated NAPs to be a function of the bending angle of the DNA at the site of binding (ΔEB (θ)). Consequently, NAPs localize along the contour of the supercoil, and this binding preference is capable of stabilizing supercoils that form within the nucleoid. National Institute Of General Medical Sciences of the National Institutes of Health under Award Number T32GM070421.

  9. New insight into multifunctional role of peroxiredoxin family protein: Determination of DNA protection properties of bacterioferritin comigratory protein under hyperthermal and oxidative stresses

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Sangmin, E-mail: taeinlee2011@kangwon.ac.kr; Chung, Jeong Min; Yun, Hyung Joong

    Bacterioferritin comigratory protein (BCP) is a monomeric conformer acting as a putative thiol-dependent bacterial peroxidase, however molecular basis of DNA-protection via DNA-binding has not been clearly understood. In this study, we characterized the DNA binding properties of BCP using various lengths and differently shaped architectures of DNA. An electrophoretic mobility shift assay and electron microscopy analysis showed that recombinant TkBCP bound to DNA of a circular shape (double-stranded DNA and single-stranded DNA) and a linear shape (16–1000 bp) as well as various architectures of DNA. In addition, DNA protection experiments indicated that TkBCP can protect DNA against hyperthermal and oxidative stressmore » by removing highly reactive oxygen species (ROS) or by protecting DNA from thermal degradation. Based on these results, we suggest that TkBCP is a multi-functional DNA-binding protein which has DNA chaperon and antioxidant functions. - Highlights: • Bacterioferritin comigratory protein (BCP) protects DNA from oxidative stress by reducing ROS. • TkBCP does not only scavenge ROS, but also protect DNA from hyperthermal stress. • BCP potentially adopts the multi-functional role in DNA binding activities and anti-oxidant functions.« less

  10. From face to interface recognition: a differential geometric approach to distinguish DNA from RNA binding surfaces

    PubMed Central

    Shazman, Shula; Elber, Gershon; Mandel-Gutfreund, Yael

    2011-01-01

    Protein nucleic acid interactions play a critical role in all steps of the gene expression pathway. Nucleic acid (NA) binding proteins interact with their partners, DNA or RNA, via distinct regions on their surface that are characterized by an ensemble of chemical, physical and geometrical properties. In this study, we introduce a novel methodology based on differential geometry, commonly used in face recognition, to characterize and predict NA binding surfaces on proteins. Applying the method on experimentally solved three-dimensional structures of proteins we successfully classify double-stranded DNA (dsDNA) from single-stranded RNA (ssRNA) binding proteins, with 83% accuracy. We show that the method is insensitive to conformational changes that occur upon binding and can be applicable for de novo protein-function prediction. Remarkably, when concentrating on the zinc finger motif, we distinguish successfully between RNA and DNA binding interfaces possessing the same binding motif even within the same protein, as demonstrated for the RNA polymerase transcription-factor, TFIIIA. In conclusion, we present a novel methodology to characterize protein surfaces, which can accurately tell apart dsDNA from an ssRNA binding interfaces. The strength of our method in recognizing fine-tuned differences on NA binding interfaces make it applicable for many other molecular recognition problems, with potential implications for drug design. PMID:21693557

  11. Expression of simian virus 40 T antigen in Escherichia coli: localization of T-antigen origin DNA-binding domain to within 129 amino acids.

    PubMed Central

    Arthur, A K; Höss, A; Fanning, E

    1988-01-01

    The genomic coding sequence of the large T antigen of simian virus 40 (SV40) was cloned into an Escherichia coli expression vector by joining new restriction sites, BglII and BamHI, introduced at the intron boundaries of the gene. Full-length large T antigen, as well as deletion and amino acid substitution mutants, were inducibly expressed from the lac promoter of pUC9, albeit with different efficiencies and protein stabilities. Specific interaction with SV40 origin DNA was detected for full-length T antigen and certain mutants. Deletion mutants lacking T-antigen residues 1 to 130 and 260 to 708 retained specific origin-binding activity, demonstrating that the region between residues 131 and 259 must carry the essential binding domain for DNA-binding sites I and II. A sequence between residues 302 and 320 homologous to a metal-binding "finger" motif is therefore not required for origin-specific binding. However, substitution of serine for either of two cysteine residues in this motif caused a dramatic decrease in origin DNA-binding activity. This region, as well as other regions of the full-length protein, may thus be involved in stabilizing the DNA-binding domain and altering its preference for binding to site I or site II DNA. Images PMID:2835505

  12. Studies on DNA-binding selectivity of WRKY transcription factors lend structural clues into WRKY-domain function.

    PubMed

    Ciolkowski, Ingo; Wanke, Dierk; Birkenbihl, Rainer P; Somssich, Imre E

    2008-09-01

    WRKY transcription factors have been shown to play a major role in regulating, both positively and negatively, the plant defense transcriptome. Nearly all studied WRKY factors appear to have a stereotypic binding preference to one DNA element termed the W-box. How specificity for certain promoters is accomplished therefore remains completely unknown. In this study, we tested five distinct Arabidopsis WRKY transcription factor subfamily members for their DNA binding selectivity towards variants of the W-box embedded in neighboring DNA sequences. These studies revealed for the first time differences in their binding site preferences, which are partly dependent on additional adjacent DNA sequences outside of the TTGACY-core motif. A consensus WRKY binding site derived from these studies was used for in silico analysis to identify potential target genes within the Arabidopsis genome. Furthermore, we show that even subtle amino acid substitutions within the DNA binding region of AtWRKY11 strongly impinge on its binding activity. Additionally, all five factors were found localized exclusively to the plant cell nucleus and to be capable of trans-activating expression of a reporter gene construct in vivo.

  13. Mycobacterium tuberculosis cAMP Receptor Protein (Rv3676) Differs from the Escherichia coli Paradigm in Its cAMP Binding and DNA Binding Properties and Transcription Activation Properties*

    PubMed Central

    Stapleton, Melanie; Haq, Ihtshamul; Hunt, Debbie M.; Arnvig, Kristine B.; Artymiuk, Peter J.; Buxton, Roger S.; Green, Jeffrey

    2010-01-01

    The pathogen Mycobacterium tuberculosis produces a burst of cAMP upon infection of macrophages. Bacterial cyclic AMP receptor proteins (CRP) are transcription factors that respond to cAMP by binding at target promoters when cAMP concentrations increase. Rv3676 (CRPMt) is a CRP family protein that regulates expression of genes (rpfA and whiB1) that are potentially involved in M. tuberculosis persistence and/or emergence from the dormant state. Here, the CRPMt homodimer is shown to bind two molecules of cAMP (one per protomer) at noninteracting sites. Furthermore, cAMP binding by CRPMt was relatively weak, entropy driven, and resulted in a relatively small enhancement in DNA binding. Tandem CRPMt-binding sites (CRP1 at −58.5 and CRP2 at −37.5) were identified at the whiB1 promoter (PwhiB1). In vitro transcription reactions showed that CRP1 is an activating site and that CRP2, which was only occupied in the presence of cAMP or at high CRPMt concentrations in the absence of cAMP, is a repressing site. Binding of CRPMt to CRP1 was not essential for open complex formation but was required for transcription activation. Thus, these data suggest that binding of CRPMt to the PwhiB1 CRP1 site activates transcription at a step after open complex formation. In contrast, high cAMP concentrations allowed occupation of both CRP1 and CRP2 sites, resulting in inhibition of open complex formation. Thus, M. tuberculosis CRP has evolved several distinct characteristics, compared with the Escherichia coli CRP paradigm, to allow it to regulate gene expression against a background of high concentrations of cAMP. PMID:20028978

  14. Direct measurement of torque and twist generated by a dye binding to DNA

    NASA Astrophysics Data System (ADS)

    Gore, Jeff; Bryant, Zev; Bustamante, Carlos

    2004-03-01

    Many biologically important chemicals and proteins change the twist of DNA upon binding. We have used magnetic tweezers to directly measure the torque and twist generated when ethidium bromide binds and unbinds to DNA. One end of the DNA is bound specifically to a glass coverslip and the opposite end is held away from the surface by a paramagnetic bead. Attached to the middle of the DNA is a second fluorescent bead whose position can be tracked with high angular and temporal resolution. On one side of the fluorescent bead binding site we have engineered a single strand nick that acts like a free swivel. Addition of ethidium bromide then powered rotation of the central fluorescent bead. After the ethidium bromide was bound we used magnesium to compete out the intercalated ethidium bromide, thus inducing a rotation in the opposite direction. We studied the torque generation, energetics, and kinetics associated with ethidium bromide binding and unbinding by tracking the rotation of the fluorescent bead. This system is a demonstration of a reversible chemically powered DNA-based rotary motor. We also expect that this technique will be useful in studying proteins that bind to or rotate DNA, including recA, polymerases, and topoisomerases.

  15. HMG-D is an architecture-specific protein that preferentially binds to DNA containing the dinucleotide TG.

    PubMed Central

    Churchill, M E; Jones, D N; Glaser, T; Hefner, H; Searles, M A; Travers, A A

    1995-01-01

    The high mobility group (HMG) protein HMG-D from Drosophila melanogaster is a highly abundant chromosomal protein that is closely related to the vertebrate HMG domain proteins HMG1 and HMG2. In general, chromosomal HMG domain proteins lack sequence specificity. However, using both NMR spectroscopy and standard biochemical techniques we show that binding of HMG-D to a single DNA site is sequence selective. The preferred duplex DNA binding site comprises at least 5 bp and contains the deformable dinucleotide TG embedded in A/T-rich sequences. The TG motif constitutes a common core element in the binding sites of the well-characterized sequence-specific HMG domain proteins. We show that a conserved aromatic residue in helix 1 of the HMG domain may be involved in recognition of this core sequence. In common with other HMG domain proteins HMG-D binds preferentially to DNA sites that are stably bent and underwound, therefore HMG-D can be considered an architecture-specific protein. Finally, we show that HMG-D bends DNA and may confer a superhelical DNA conformation at a natural DNA binding site in the Drosophila fushi tarazu scaffold-associated region. Images PMID:7720717

  16. DNA-binding regulates site-specific ubiquitination of IRF-1.

    PubMed

    Landré, Vivien; Pion, Emmanuelle; Narayan, Vikram; Xirodimas, Dimitris P; Ball, Kathryn L

    2013-02-01

    Understanding the determinants for site-specific ubiquitination by E3 ligase components of the ubiquitin machinery is proving to be a challenge. In the present study we investigate the role of an E3 ligase docking site (Mf2 domain) in an intrinsically disordered domain of IRF-1 [IFN (interferon) regulatory factor-1], a short-lived IFNγ-regulated transcription factor, in ubiquitination of the protein. Ubiquitin modification of full-length IRF-1 by E3 ligases such as CHIP [C-terminus of the Hsc (heat-shock cognate) 70-interacting protein] and MDM2 (murine double minute 2), which dock to the Mf2 domain, was specific for lysine residues found predominantly in loop structures that extend from the DNA-binding domain, whereas no modification was detected in the more conformationally flexible C-terminal half of the protein. The E3 docking site was not available when IRF-1 was in its DNA-bound conformation and cognate DNA-binding sequences strongly suppressed ubiquitination, highlighting a strict relationship between ligase binding and site-specific modification at residues in the DNA-binding domain. Hyperubiquitination of a non-DNA-binding mutant supports a mechanism where an active DNA-bound pool of IRF-1 is protected from polyubiquitination and degradation.

  17. DNA mimic proteins: functions, structures, and bioinformatic analysis.

    PubMed

    Wang, Hao-Ching; Ho, Chun-Han; Hsu, Kai-Cheng; Yang, Jinn-Moon; Wang, Andrew H-J

    2014-05-13

    DNA mimic proteins have DNA-like negative surface charge distributions, and they function by occupying the DNA binding sites of DNA binding proteins to prevent these sites from being accessed by DNA. DNA mimic proteins control the activities of a variety of DNA binding proteins and are involved in a wide range of cellular mechanisms such as chromatin assembly, DNA repair, transcription regulation, and gene recombination. However, the sequences and structures of DNA mimic proteins are diverse, making them difficult to predict by bioinformatic search. To date, only a few DNA mimic proteins have been reported. These DNA mimics were not found by searching for functional motifs in their sequences but were revealed only by structural analysis of their charge distribution. This review highlights the biological roles and structures of 16 reported DNA mimic proteins. We also discuss approaches that might be used to discover new DNA mimic proteins.

  18. Structure of the MecI repressor from Staphylococcus aureus in complex with the cognate DNA operator of mec

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Safo, Martin K., E-mail: msafo@vcu.edu; Ko, Tzu-Ping; Musayev, Faik N.

    The up-and-down binding of dimeric MecI to mecA dyad DNA may account for the cooperative effect of the repressor. The dimeric repressor MecI regulates the mecA gene that encodes the penicillin-binding protein PBP-2a in methicillin-resistant Staphylococcus aureus (MRSA). MecI is similar to BlaI, the repressor for the blaZ gene of β-lactamase. MecI and BlaI can bind to both operator DNA sequences. The crystal structure of MecI in complex with the 32 base-pair cognate DNA of mec was determined to 3.8 Å resolution. MecI is a homodimer and each monomer consists of a compact N-terminal winged-helix domain, which binds to DNA,more » and a loosely packed C-terminal helical domain, which intertwines with its counter-monomer. The crystal contains horizontal layers of virtual DNA double helices extending in three directions, which are separated by perpendicular DNA segments. Each DNA segment is bound to two MecI dimers. Similar to the BlaI–mec complex, but unlike the MecI–bla complex, the MecI repressors bind to both sides of the mec DNA dyad that contains four conserved sequences of TACA/TGTA. The results confirm the up-and-down binding to the mec operator, which may account for cooperative effect of the repressor.« less

  19. Fanconi Anemia Complementation Group A (FANCA) Protein Has Intrinsic Affinity for Nucleic Acids with Preference for Single-stranded Forms*

    PubMed Central

    Yuan, Fenghua; Qian, Liangyue; Zhao, Xinliang; Liu, Jesse Y.; Song, Limin; D'Urso, Gennaro; Jain, Chaitanya; Zhang, Yanbin

    2012-01-01

    The Fanconi anemia complementation group A (FANCA) gene is one of 15 disease-causing genes and has been found to be mutated in ∼60% of Fanconi anemia patients. Using purified protein, we report that human FANCA has intrinsic affinity for nucleic acids. FANCA binds to both single-stranded (ssDNA) and double-stranded (dsDNA) DNAs; however, its affinity for ssDNA is significantly higher than for dsDNA in an electrophoretic mobility shift assay. FANCA also binds to RNA with an intriguingly higher affinity than its DNA counterpart. FANCA requires a certain length of nucleic acids for optimal binding. Using DNA and RNA ladders, we determined that the minimum number of nucleotides required for FANCA recognition is ∼30 for both DNA and RNA. By testing the affinity between FANCA and a variety of DNA structures, we found that a 5′-flap or 5′-tail on DNA facilitates its interaction with FANCA. A patient-derived FANCA truncation mutant (Q772X) has diminished affinity for both DNA and RNA. In contrast, the complementing C-terminal fragment of Q772X, C772–1455, retains the differentiated nucleic acid-binding activity (RNA > ssDNA > dsDNA), indicating that the nucleic acid-binding domain of FANCA is located primarily at its C terminus, where most disease-causing mutations are found. PMID:22194614

  20. Fanconi anemia complementation group A (FANCA) protein has intrinsic affinity for nucleic acids with preference for single-stranded forms.

    PubMed

    Yuan, Fenghua; Qian, Liangyue; Zhao, Xinliang; Liu, Jesse Y; Song, Limin; D'Urso, Gennaro; Jain, Chaitanya; Zhang, Yanbin

    2012-02-10

    The Fanconi anemia complementation group A (FANCA) gene is one of 15 disease-causing genes and has been found to be mutated in ∼60% of Fanconi anemia patients. Using purified protein, we report that human FANCA has intrinsic affinity for nucleic acids. FANCA binds to both single-stranded (ssDNA) and double-stranded (dsDNA) DNAs; however, its affinity for ssDNA is significantly higher than for dsDNA in an electrophoretic mobility shift assay. FANCA also binds to RNA with an intriguingly higher affinity than its DNA counterpart. FANCA requires a certain length of nucleic acids for optimal binding. Using DNA and RNA ladders, we determined that the minimum number of nucleotides required for FANCA recognition is ∼30 for both DNA and RNA. By testing the affinity between FANCA and a variety of DNA structures, we found that a 5'-flap or 5'-tail on DNA facilitates its interaction with FANCA. A patient-derived FANCA truncation mutant (Q772X) has diminished affinity for both DNA and RNA. In contrast, the complementing C-terminal fragment of Q772X, C772-1455, retains the differentiated nucleic acid-binding activity (RNA > ssDNA > dsDNA), indicating that the nucleic acid-binding domain of FANCA is located primarily at its C terminus, where most disease-causing mutations are found.

  1. Timely binding of IHF and Fis to DARS2 regulates ATP–DnaA production and replication initiation

    PubMed Central

    Kasho, Kazutoshi; Fujimitsu, Kazuyuki; Matoba, Toshihiro; Oshima, Taku; Katayama, Tsutomu

    2014-01-01

    In Escherichia coli, the ATP-bound form of DnaA (ATP–DnaA) promotes replication initiation. During replication, the bound ATP is hydrolyzed to ADP to yield the ADP-bound form (ADP–DnaA), which is inactive for initiation. The chromosomal site DARS2 facilitates the regeneration of ATP–DnaA by catalyzing nucleotide exchange between free ATP and ADP bound to DnaA. However, the regulatory mechanisms governing this exchange reaction are unclear. Here, using in vitro reconstituted experiments, we show that two nucleoid-associated proteins, IHF and Fis, bind site-specifically to DARS2 to activate coordinately the exchange reaction. The regenerated ATP–DnaA was fully active in replication initiation and underwent DnaA–ATP hydrolysis. ADP–DnaA formed heteromultimeric complexes with IHF and Fis on DARS2, and underwent nucleotide dissociation more efficiently than ATP–DnaA. Consistently, mutant analyses demonstrated that specific binding of IHF and Fis to DARS2 stimulates the formation of ATP–DnaA production, thereby promoting timely initiation. Moreover, we show that IHF–DARS2 binding is temporally regulated during the cell cycle, whereas Fis only binds to DARS2 in exponentially growing cells. These results elucidate the regulation of ATP–DnaA and replication initiation in coordination with the cell cycle and growth phase. PMID:25378325

  2. Global Analysis of Transcription Factor-Binding Sites in Yeast Using ChIP-Seq

    PubMed Central

    Lefrançois, Philippe; Gallagher, Jennifer E. G.; Snyder, Michael

    2016-01-01

    Transcription factors influence gene expression through their ability to bind DNA at specific regulatory elements. Specific DNA-protein interactions can be isolated through the chromatin immunoprecipitation (ChIP) procedure, in which DNA fragments bound by the protein of interest are recovered. ChIP is followed by high-throughput DNA sequencing (Seq) to determine the genomic provenance of ChIP DNA fragments and their relative abundance in the sample. This chapter describes a ChIP-Seq strategy adapted for budding yeast to enable the genome-wide characterization of binding sites of transcription factors (TFs) and other DNA-binding proteins in an efficient and cost-effective way. Yeast strains with epitope-tagged TFs are most commonly used for ChIP-Seq, along with their matching untagged control strains. The initial step of ChIP involves the cross-linking of DNA and proteins. Next, yeast cells are lysed and sonicated to shear chromatin into smaller fragments. An antibody against an epitope-tagged TF is used to pull down chromatin complexes containing DNA and the TF of interest. DNA is then purified and proteins degraded. Specific barcoded adapters for multiplex DNA sequencing are ligated to ChIP DNA. Short DNA sequence reads (28–36 base pairs) are parsed according to the barcode and aligned against the yeast reference genome, thus generating a nucleotide-resolution map of transcription factor-binding sites and their occupancy. PMID:25213249

  3. Biophysical Fitness Landscapes for Transcription Factor Binding Sites

    PubMed Central

    Haldane, Allan; Manhart, Michael; Morozov, Alexandre V.

    2014-01-01

    Phenotypic states and evolutionary trajectories available to cell populations are ultimately dictated by complex interactions among DNA, RNA, proteins, and other molecular species. Here we study how evolution of gene regulation in a single-cell eukaryote S. cerevisiae is affected by interactions between transcription factors (TFs) and their cognate DNA sites. Our study is informed by a comprehensive collection of genomic binding sites and high-throughput in vitro measurements of TF-DNA binding interactions. Using an evolutionary model for monomorphic populations evolving on a fitness landscape, we infer fitness as a function of TF-DNA binding to show that the shape of the inferred fitness functions is in broad agreement with a simple functional form inspired by a thermodynamic model of two-state TF-DNA binding. However, the effective parameters of the model are not always consistent with physical values, indicating selection pressures beyond the biophysical constraints imposed by TF-DNA interactions. We find little statistical support for the fitness landscape in which each position in the binding site evolves independently, indicating that epistasis is common in the evolution of gene regulation. Finally, by correlating TF-DNA binding energies with biological properties of the sites or the genes they regulate, we are able to rule out several scenarios of site-specific selection, under which binding sites of the same TF would experience different selection pressures depending on their position in the genome. These findings support the existence of universal fitness landscapes which shape evolution of all sites for a given TF, and whose properties are determined in part by the physics of protein-DNA interactions. PMID:25010228

  4. DNA binding and unwinding by Hel308 helicase requires dual functions of a winged helix domain.

    PubMed

    Northall, Sarah J; Buckley, Ryan; Jones, Nathan; Penedo, J Carlos; Soultanas, Panos; Bolt, Edward L

    2017-09-01

    Hel308 helicases promote genome stability linked to DNA replication in archaea, and have homologues in metazoans. In the crystal structure of archaeal Hel308 bound to a tailed DNA duplex, core helicase domains encircle single-stranded DNA (ssDNA) in a "ratchet" for directional translocation. A winged helix domain (WHD) is also present, but its function is mysterious. We investigated the WHD in full-length Hel308, identifying that mutations in a solvent exposed α-helix resulted in reduced DNA binding and unwinding activities. When isolated from the rest of Hel308, the WHD protein alone bound to duplex DNA but not ssDNA, and DNA binding by WHD protein was abolished by the same mutations as were analyzed in full-length Hel308. Isolated WHD from a human Hel308 homologue (HelQ) also bound to duplex DNA. By disrupting the interface between the Hel308 WHD and a RecA-like domain, a topology typical of Ski2 helicases, we show that this is crucial for ATPase and helicase activities. The data suggest a model in which the WHD promotes activity of Hel308 directly, through binding to duplex DNA that is distinct from ssDNA binding by core helicase, and indirectly through interaction with the RecA-like domain. We propose how the WHD may contribute to ssDNA translocation, resulting in DNA helicase activity or in removal of other DNA bound proteins by "reeling" ssDNA. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Spermine Attenuates the Action of the DNA Intercalator, Actinomycin D, on DNA Binding and the Inhibition of Transcription and DNA Replication

    PubMed Central

    Chen, Jeremy J. W.; Wu, Wen-Lin; Yuann, Jeu-Ming P.; Su, Wang-Lin; Chuang, Show-Mei; Hou, Ming-Hon

    2012-01-01

    The anticancer activity of DNA intercalators is related to their ability to intercalate into the DNA duplex with high affinity, thereby interfering with DNA replication and transcription. Polyamines (spermine in particular) are almost exclusively bound to nucleic acids and are involved in many cellular processes that require nucleic acids. Until now, the effects of polyamines on DNA intercalator activities have remained unclear because intercalation is the most important mechanism employed by DNA-binding drugs. Herein, using actinomycin D (ACTD) as a model, we have attempted to elucidate the effects of spermine on the action of ACTD, including its DNA-binding ability, RNA and DNA polymerase interference, and its role in the transcription and replication inhibition of ACTD within cells. We found that spermine interfered with the binding and stabilization of ACTD to DNA. The presence of increasing concentrations of spermine enhanced the transcriptional and replication activities of RNA and DNA polymerases, respectively, in vitro treated with ActD. Moreover, a decrease in intracellular polyamine concentrations stimulated by methylglyoxal-bis(guanylhydrazone) (MGBG) enhanced the ACTD-induced inhibition of c-myc transcription and DNA replication in several cancer cell lines. The results indicated that spermine attenuates ACTD binding to DNA and its inhibition of transcription and DNA replication both in vitro and within cells. Finally, a synergistic antiproliferative effect of MGBG and ACTD was observed in a cell viability assay. Our findings will be of significant relevance to future developments in combination with cancer therapy by enhancing the anticancer activity of DNA interactors through polyamine depletion. PMID:23144800

  6. Spermine attenuates the action of the DNA intercalator, actinomycin D, on DNA binding and the inhibition of transcription and DNA replication.

    PubMed

    Wang, Sheng-Yu; Lee, Alan Yueh-Luen; Lee, Yueh-Luen; Lai, Yi-Hua; Chen, Jeremy J W; Wu, Wen-Lin; Yuann, Jeu-Ming P; Su, Wang-Lin; Chuang, Show-Mei; Hou, Ming-Hon

    2012-01-01

    The anticancer activity of DNA intercalators is related to their ability to intercalate into the DNA duplex with high affinity, thereby interfering with DNA replication and transcription. Polyamines (spermine in particular) are almost exclusively bound to nucleic acids and are involved in many cellular processes that require nucleic acids. Until now, the effects of polyamines on DNA intercalator activities have remained unclear because intercalation is the most important mechanism employed by DNA-binding drugs. Herein, using actinomycin D (ACTD) as a model, we have attempted to elucidate the effects of spermine on the action of ACTD, including its DNA-binding ability, RNA and DNA polymerase interference, and its role in the transcription and replication inhibition of ACTD within cells. We found that spermine interfered with the binding and stabilization of ACTD to DNA. The presence of increasing concentrations of spermine enhanced the transcriptional and replication activities of RNA and DNA polymerases, respectively, in vitro treated with ActD. Moreover, a decrease in intracellular polyamine concentrations stimulated by methylglyoxal-bis(guanylhydrazone) (MGBG) enhanced the ACTD-induced inhibition of c-myc transcription and DNA replication in several cancer cell lines. The results indicated that spermine attenuates ACTD binding to DNA and its inhibition of transcription and DNA replication both in vitro and within cells. Finally, a synergistic antiproliferative effect of MGBG and ACTD was observed in a cell viability assay. Our findings will be of significant relevance to future developments in combination with cancer therapy by enhancing the anticancer activity of DNA interactors through polyamine depletion.

  7. Combining H/D exchange mass spectroscopy and computational docking reveals extended DNA-binding surface on uracil-DNA glycosylase

    PubMed Central

    Roberts, Victoria A.; Pique, Michael E.; Hsu, Simon; Li, Sheng; Slupphaug, Geir; Rambo, Robert P.; Jamison, Jonathan W.; Liu, Tong; Lee, Jun H.; Tainer, John A.; Ten Eyck, Lynn F.; Woods, Virgil L.

    2012-01-01

    X-ray crystallography provides excellent structural data on protein–DNA interfaces, but crystallographic complexes typically contain only small fragments of large DNA molecules. We present a new approach that can use longer DNA substrates and reveal new protein–DNA interactions even in extensively studied systems. Our approach combines rigid-body computational docking with hydrogen/deuterium exchange mass spectrometry (DXMS). DXMS identifies solvent-exposed protein surfaces; docking is used to create a 3-dimensional model of the protein–DNA interaction. We investigated the enzyme uracil-DNA glycosylase (UNG), which detects and cleaves uracil from DNA. UNG was incubated with a 30 bp DNA fragment containing a single uracil, giving the complex with the abasic DNA product. Compared with free UNG, the UNG–DNA complex showed increased solvent protection at the UNG active site and at two regions outside the active site: residues 210–220 and 251–264. Computational docking also identified these two DNA-binding surfaces, but neither shows DNA contact in UNG–DNA crystallographic structures. Our results can be explained by separation of the two DNA strands on one side of the active site. These non-sequence-specific DNA-binding surfaces may aid local uracil search, contribute to binding the abasic DNA product and help present the DNA product to APE-1, the next enzyme on the DNA-repair pathway. PMID:22492624

  8. Keep your fingers off my DNA: protein-protein interactions mediated by C2H2 zinc finger domains.

    PubMed

    Brayer, Kathryn J; Segal, David J

    2008-01-01

    Cys2-His2 (C2H2) zinc finger domains (ZFs) were originally identified as DNA-binding domains, and uncharacterized domains are typically assumed to function in DNA binding. However, a growing body of evidence suggests an important and widespread role for these domains in protein binding. There are even examples of zinc fingers that support both DNA and protein interactions, which can be found in well-known DNA-binding proteins such as Sp1, Zif268, and Ying Yang 1 (YY1). C2H2 protein-protein interactions (PPIs) are proving to be more abundant than previously appreciated, more plastic than their DNA-binding counterparts, and more variable and complex in their interactions surfaces. Here we review the current knowledge of over 100 C2H2 zinc finger-mediated PPIs, focusing on what is known about the binding surface, contributions of individual fingers to the interaction, and function. An accurate understanding of zinc finger biology will likely require greater insights into the potential protein interaction capabilities of C2H2 ZFs.

  9. Cloning and characterization of a novel human STAR domain containing cDNA KHDRBS2.

    PubMed

    Wang, Liu; Xu, Jian; Zeng, Li; Ye, Xin; Wu, Qihan; Dai, Jianfeng; Ji, Chaoneng; Gu, Shaohua; Zhao, Chunhua; Xie, Yi; Mao, Yumin

    2002-12-01

    KHDRBS2, KH domain containing, RNA binding, signal transduction associated 2, is an RNA-binding protein that is tyrosine phosphorylated by Src during mitosis. It contains a KH domain,which is embedded in a larger conserved domain called the STAR domain. This protein has a 99% sequence identity with rat SLM-1 (the Sam68-like mammalian protein 1) and 98% sequence identity with mouse SLM-1 in its STAR domain. KHDRBS2 has the characteristic Sam68 SH2 and SH3 domain binding sites. RT-PCR analysis showed its transcript is ubiquitously expressed. The characterization of KHDRBS2 indicates it may link tyrosine kinase signaling cascades with some aspect of RNA metabolism.

  10. T7 RNA polymerase non-specifically transcribes and induces disassembly of DNA nanostructures

    PubMed Central

    Schaffter, Samuel W; Green, Leopold N; Schneider, Joanna; Subramanian, Hari K K; Schulman, Rebecca

    2018-01-01

    Abstract The use of proteins that bind and catalyze reactions with DNA alongside DNA nanostructures has broadened the functionality of DNA devices. DNA binding proteins have been used to specifically pattern and tune structural properties of DNA nanostructures and polymerases have been employed to directly and indirectly drive structural changes in DNA structures and devices. Despite these advances, undesired and poorly understood interactions between DNA nanostructures and proteins that bind DNA continue to negatively affect the performance and stability of DNA devices used in conjunction with enzymes. A better understanding of these undesired interactions will enable the construction of robust DNA nanostructure-enzyme hybrid systems. Here, we investigate the undesired disassembly of DNA nanotubes in the presence of viral RNA polymerases (RNAPs) under conditions used for in vitro transcription. We show that nanotubes and individual nanotube monomers (tiles) are non-specifically transcribed by T7 RNAP, and that RNA transcripts produced during non-specific transcription disassemble the nanotubes. Disassembly requires a single-stranded overhang on the nanotube tiles where transcripts can bind and initiate disassembly through strand displacement, suggesting that single-stranded domains on other DNA nanostructures could cause unexpected interactions in the presence of viral RNA polymerases. PMID:29718412

  11. T7 RNA polymerase non-specifically transcribes and induces disassembly of DNA nanostructures.

    PubMed

    Schaffter, Samuel W; Green, Leopold N; Schneider, Joanna; Subramanian, Hari K K; Schulman, Rebecca; Franco, Elisa

    2018-06-01

    The use of proteins that bind and catalyze reactions with DNA alongside DNA nanostructures has broadened the functionality of DNA devices. DNA binding proteins have been used to specifically pattern and tune structural properties of DNA nanostructures and polymerases have been employed to directly and indirectly drive structural changes in DNA structures and devices. Despite these advances, undesired and poorly understood interactions between DNA nanostructures and proteins that bind DNA continue to negatively affect the performance and stability of DNA devices used in conjunction with enzymes. A better understanding of these undesired interactions will enable the construction of robust DNA nanostructure-enzyme hybrid systems. Here, we investigate the undesired disassembly of DNA nanotubes in the presence of viral RNA polymerases (RNAPs) under conditions used for in vitro transcription. We show that nanotubes and individual nanotube monomers (tiles) are non-specifically transcribed by T7 RNAP, and that RNA transcripts produced during non-specific transcription disassemble the nanotubes. Disassembly requires a single-stranded overhang on the nanotube tiles where transcripts can bind and initiate disassembly through strand displacement, suggesting that single-stranded domains on other DNA nanostructures could cause unexpected interactions in the presence of viral RNA polymerases.

  12. The CcpA regulon of Streptococcus suis reveals novel insights into the regulation of the streptococcal central carbon metabolism by binding of CcpA to two distinct binding motifs.

    PubMed

    Willenborg, Jörg; de Greeff, Astrid; Jarek, Michael; Valentin-Weigand, Peter; Goethe, Ralph

    2014-04-01

    Streptococcus suis (S. suis) is a neglected zoonotic streptococcus causing fatal diseases in humans and in pigs. The transcriptional regulator CcpA (catabolite control protein A) is involved in the metabolic adaptation to different carbohydrate sources and virulence of S. suis and other pathogenic streptococci. In this study, we determined the DNA binding characteristics of CcpA and identified the CcpA regulon during growth of S. suis. Electrophoretic mobility shift analyses showed promiscuous DNA binding of CcpA to cognate cre sites in vitro. In contrast, sequencing of immunoprecipitated chromatin revealed two specific consensus motifs, a pseudo-palindromic cre motif (WWGAAARCGYTTTCWW) and a novel cre2 motif (TTTTYHWDHHWWTTTY), within the regulatory elements of the genes directly controlled by CcpA. Via these elements CcpA regulates expression of genes involved in carbohydrate uptake and conversion, and in addition in important metabolic pathways of the central carbon metabolism, like glycolysis, mixed-acid fermentation, and the fragmentary TCA cycle. Furthermore, our analyses provide evidence that CcpA regulates the genes of the central carbon metabolism by binding either the pseudo-palindromic cre motif or the cre2 motif in a HPr(Ser)∼P independent conformation. © 2014 John Wiley & Sons Ltd.

  13. Specific and non-specific interactions of ParB with DNA: implications for chromosome segregation

    PubMed Central

    Taylor, James A.; Pastrana, Cesar L.; Butterer, Annika; Pernstich, Christian; Gwynn, Emma J.; Sobott, Frank; Moreno-Herrero, Fernando; Dillingham, Mark S.

    2015-01-01

    The segregation of many bacterial chromosomes is dependent on the interactions of ParB proteins with centromere-like DNA sequences called parS that are located close to the origin of replication. In this work, we have investigated the binding of Bacillus subtilis ParB to DNA in vitro using a variety of biochemical and biophysical techniques. We observe tight and specific binding of a ParB homodimer to the parS sequence. Binding of ParB to non-specific DNA is more complex and displays apparent positive co-operativity that is associated with the formation of larger, poorly defined, nucleoprotein complexes. Experiments with magnetic tweezers demonstrate that non-specific binding leads to DNA condensation that is reversible by protein unbinding or force. The condensed DNA structure is not well ordered and we infer that it is formed by many looping interactions between neighbouring DNA segments. Consistent with this view, ParB is also able to stabilize writhe in single supercoiled DNA molecules and to bridge segments from two different DNA molecules in trans. The experiments provide no evidence for the promotion of non-specific DNA binding and/or condensation events by the presence of parS sequences. The implications of these observations for chromosome segregation are discussed. PMID:25572315

  14. Xeroderma pigmentosum complementation group C protein (XPC) serves as a general sensor of damaged DNA

    PubMed Central

    Shell, Steven M.; Hawkins, Edward K.; Tsai, Miaw-Sheue; Hlaing, Aye Su; Rizzo, Carmelo J.; Chazin, Walter J.

    2013-01-01

    The xeroderma pigmentosum complementation group C protein (XPC) serves as the primary initiating factor in the global genome nucleotide excision repair pathway (GG-NER). Recent reports suggest XPC also stimulates repair of oxidative lesions by base excision repair. However, whether XPC distinguishes among various types of DNA lesions remains unclear. Although the DNA binding properties of XPC have been studied by several groups, there is a lack of consensus over whether XPC discriminates between DNA damaged by lesions associated with NER activity versus those that are not. In this study we report a high-throughput fluorescence anisotropy assay used to measure the DNA binding affinity of XPC for a panel of DNA substrates containing a range of chemical lesions in a common sequence. Our results demonstrate that while XPC displays a preference for binding damaged DNA, the identity of the lesion has little effect on the binding affinity of XPC. Moreover, XPC was equally capable of binding to DNA substrates containing lesions not repaired by GG-NER. Our results support an indirect read-out model for sensing the presence of lesions by human XPC and suggest XPC may act as a general sensor of damaged DNA capable of recognizing DNA containing lesions not repaired by NER. PMID:24051049

  15. On binding specificity of (6-4) photolyase to a T(6-4)T DNA photoproduct*

    NASA Astrophysics Data System (ADS)

    Jepsen, Katrine Aalbæk; Solov'yov, Ilia A.

    2017-06-01

    Different factors lead to DNA damage and if it is not repaired in due time, the damaged DNA could initiate mutagenesis and cancer. To avoid this deadly scenario, specific enzymes can scavenge and repair the DNA, but the enzymes have to bind first to the damaged sites. We have investigated this binding for a specific enzyme called (6-4) photolyase, which is capable of repairing certain UV-induced damage in DNA. Through molecular dynamics simulations we describe the binding between photolyase and the DNA and reveal that several charged amino acid residues in the enzyme, such as arginines and lysines turn out to be important. Especially R421 is crucial, as it keeps the DNA strands at the damaged site inside the repair pocket of the enzyme separated. DNA photolyase is structurally highly homologous to a protein called cryptochrome. Both proteins are biologically activated similarly, namely through flavin co-factor photoexcitation. It is, however, striking that cryptochrome cannot repair UV-damaged DNA. The present investigation allowed us to conclude on the small but, apparently, critical differences between photolyase and cryptochrome. The performed analysis gives insight into important factors that govern the binding of UV-damaged DNA and reveal why cryptochrome cannot have this functionality.

  16. Accurate Prediction of Inducible Transcription Factor Binding Intensities In Vivo

    PubMed Central

    Siepel, Adam; Lis, John T.

    2012-01-01

    DNA sequence and local chromatin landscape act jointly to determine transcription factor (TF) binding intensity profiles. To disentangle these influences, we developed an experimental approach, called protein/DNA binding followed by high-throughput sequencing (PB–seq), that allows the binding energy landscape to be characterized genome-wide in the absence of chromatin. We applied our methods to the Drosophila Heat Shock Factor (HSF), which inducibly binds a target DNA sequence element (HSE) following heat shock stress. PB–seq involves incubating sheared naked genomic DNA with recombinant HSF, partitioning the HSF–bound and HSF–free DNA, and then detecting HSF–bound DNA by high-throughput sequencing. We compared PB–seq binding profiles with ones observed in vivo by ChIP–seq and developed statistical models to predict the observed departures from idealized binding patterns based on covariates describing the local chromatin environment. We found that DNase I hypersensitivity and tetra-acetylation of H4 were the most influential covariates in predicting changes in HSF binding affinity. We also investigated the extent to which DNA accessibility, as measured by digital DNase I footprinting data, could be predicted from MNase–seq data and the ChIP–chip profiles for many histone modifications and TFs, and found GAGA element associated factor (GAF), tetra-acetylation of H4, and H4K16 acetylation to be the most predictive covariates. Lastly, we generated an unbiased model of HSF binding sequences, which revealed distinct biophysical properties of the HSF/HSE interaction and a previously unrecognized substructure within the HSE. These findings provide new insights into the interplay between the genomic sequence and the chromatin landscape in determining transcription factor binding intensity. PMID:22479205

  17. A calmodulin binding protein from Arabidopsis is induced by ethylene and contains a DNA-binding motif

    NASA Technical Reports Server (NTRS)

    Reddy, A. S.; Reddy, V. S.; Golovkin, M.

    2000-01-01

    Calmodulin (CaM), a key calcium sensor in all eukaryotes, regulates diverse cellular processes by interacting with other proteins. To isolate CaM binding proteins involved in ethylene signal transduction, we screened an expression library prepared from ethylene-treated Arabidopsis seedlings with 35S-labeled CaM. A cDNA clone, EICBP (Ethylene-Induced CaM Binding Protein), encoding a protein that interacts with activated CaM was isolated in this screening. The CaM binding domain in EICBP was mapped to the C-terminus of the protein. These results indicate that calcium, through CaM, could regulate the activity of EICBP. The EICBP is expressed in different tissues and its expression in seedlings is induced by ethylene. The EICBP contains, in addition to a CaM binding domain, several features that are typical of transcription factors. These include a DNA-binding domain at the N terminus, an acidic region at the C terminus, and nuclear localization signals. In database searches a partial cDNA (CG-1) encoding a DNA-binding motif from parsley and an ethylene up-regulated partial cDNA from tomato (ER66) showed significant similarity to EICBP. In addition, five hypothetical proteins in the Arabidopsis genome also showed a very high sequence similarity with EICBP, indicating that there are several EICBP-related proteins in Arabidopsis. The structural features of EICBP are conserved in all EICBP-related proteins in Arabidopsis, suggesting that they may constitute a new family of DNA binding proteins and are likely to be involved in modulating gene expression in the presence of ethylene.

  18. DNA Length Modulates the Affinity of Fragments of Genomic DNA for the Nuclear Matrix In Vitro.

    PubMed

    García-Vilchis, David; Aranda-Anzaldo, Armando

    2017-12-01

    Classical observations have shown that during the interphase the chromosomal DNA of metazoans is organized in supercoiled loops attached to a compartment known as the nuclear matrix (NM). Fragments of chromosomal DNA able to bind the isolated NM in vitro are known as matrix associated/attachment/addressed regions or MARs. No specific consensus sequence or motif has been found that may constitute a universal, defining feature of MARs. On the other hand, high-salt resistant DNA-NM interactions in situ define true DNA loop anchorage regions or LARs, that might correspond to a subset of the potential MARs but are not necessarily identical to MARs characterized in vitro, since there are several examples of MARs able to bind the NM in vitro but which are not actually bound to the NM in situ. In the present work we assayed the capacity of two LARs, as well as of shorter fragments within such LARs, for binding to the NM in vitro. Paradoxically the isolated (≈2 kb) LARs cannot bind to the NM in vitro while their shorter (≈300 pb) sub-fragments and other non-related but equally short DNA fragments, bind to the NM in a high-salt resistant fashion. Our results suggest that the ability of a given DNA fragment for binding to the NM in vitro primarily depends on the length of the fragment, suggesting that binding to the NM is modulated by the local topology of the DNA fragment in suspension that it is known to depend on the DNA length. J. Cell. Biochem. 118: 4487-4497, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  19. The Arabidopsis class I TCP transcription factor AtTCP11 is a developmental regulator with distinct DNA-binding properties due to the presence of a threonine residue at position 15 of the TCP domain.

    PubMed

    Viola, Ivana L; Uberti Manassero, Nora G; Ripoll, Rodrigo; Gonzalez, Daniel H

    2011-04-01

    The TCP domain is a DNA-binding domain present in plant transcription factors that modulate different processes. In the present study, we show that Arabidopsis class I TCP proteins are able to interact with a dyad-symmetric sequence composed of two GTGGG half-sites. TCP20 establishes symmetric interactions with the 5' half of each strand, whereas TCP11 interacts mainly with the 3' half. SELEX (systematic evolution of ligands by exponential enrichment) experiments with TCP15 and TCP20 indicated that these proteins have similar, although not identical, DNA-binding preferences and are able to interact with non-palindromic binding sites of the type GTGGGNCCNN. TCP11 shows a different DNA-binding specificity, with a preference for the sequence GTGGGCCNNN. The distinct DNA-binding properties of TCP11 are due to the presence of a threonine residue at position 15 of the TCP domain, a position that is occupied by an arginine residue in most TCP proteins. TCP11 also forms heterodimers with TCP15 that have increased DNA-binding efficiency. The expression in plants of a repressor form of TCP11 demonstrated that this protein is a developmental regulator that influences the growth of leaves, stems and petioles, and pollen development. The results suggest that changes in DNA-binding preferences may be one of the mechanisms through which class I TCP proteins achieve functional specificity.

  20. A verotoxin 1 B subunit-lambda CRO chimeric protein specifically binds both DNA and globotriaosylceramide (Gb(3)) to effect nuclear targeting of exogenous DNA in Gb(3) positive cells.

    PubMed

    Facchini, L M; Lingwood, C A

    2001-09-10

    Inefficient nuclear incorporation of foreign DNA remains a critical roadblock in the development of effective nonviral gene delivery systems. DNA delivered by traditional protocols remains within endosomal/lysosomal vesicles, or is rapidly degraded in the cytoplasm. Verotoxin I (VT), an AB(5) subunit toxin produced by enterohaemorrhagic Escherichia coli, binds to the cell surface glycolipid, globotriaosylceramide (Gb(3)) and is internalized into preendosomes. VT is then retrograde transported to the Golgi, endoplasmic reticulum (ER), and nucleus of highly VT-sensitive cells. We have utilized this nuclear targeting of VT to design a unique delivery system which transports exogenous DNA via vesicular traffic to the nucleus. The nontoxic VT binding subunit (VTB) was fused to the lambda Cro DNA-binding repressor, generating a 14-kDa VTB-Cro chimera. VTB-Cro binds specifically via the Cro domain to a 25-bp DNA fragment containing the consensus Cro operator. VTB-Cro demonstrates simultaneous specific binding to Gb(3). Treatment of Vero cells with fluorescent-labeled Cro operator DNA in the presence of VTB-Cro, results in DNA internalization to the Golgi, ER, and nucleus, whereas fluorescent DNA alone is incorporated poorly and randomly within the cytoplasm. VTB-Cro mediated nuclear DNA transport is prevented by brefeldin A, consistent with Golgi/ER intracellular routing. Pretreatment with filipin had no effect, indicating that caveoli are not involved. This novel VTB-Cro shuttle protein may find practical applications in the fields of intracellular targeting, gene delivery, and gene therapy. Copyright 2001 Academic Press.

  1. Isolation and characterization of the DNA-binding protein (DBP) of the Autographa californica multiple nucleopolyhedrovirus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mikhailov, Victor S.; N. K. Koltzov Institute of Developmental Biology, Russian Academy of Sciences, Moscow 117808; Vanarsdall, Adam L.

    2008-01-20

    DNA-binding protein (DBP) of Autographa californica multiple nucleopolyhedrovirus (AcMNPV) was expressed as an N-terminal His{sub 6}-tag fusion using a recombinant baculovirus and purified to near homogeneity. Purified DBP formed oligomers that were crosslinked by redox reagents resulting in predominantly protein dimers and tetramers. In gel retardation assays, DBP showed a high affinity for single-stranded oligonucleotides and was able to compete with another baculovirus SSB protein, LEF-3, for binding sites. DBP binding protected ssDNA against hydrolysis by a baculovirus alkaline nuclease AN/LEF-3 complex. Partial proteolysis by trypsin revealed a domain structure of DBP that is required for interaction with DNA andmore » that can be disrupted by thermal treatment. Binding to ssDNA, but not to dsDNA, changed the pattern of proteolytic fragments of DBP indicating adjustments in protein structure upon interaction with ssDNA. DBP was capable of unwinding short DNA duplexes and also promoted the renaturation of long complementary strands of ssDNA into duplexes. The unwinding and renaturation activities of DBP, as well as the DNA binding activity, were sensitive to sulfhydryl reagents and were inhibited by oxidation of thiol groups with diamide or by alkylation with N-ethylmaleimide. A high affinity of DBP for ssDNA and its unwinding and renaturation activities confirmed identification of DBP as a member of the SSB/recombinase family. These activities and a tight association with subnuclear structures suggests that DBP is a component of the virogenic stroma that is involved in the processing of replicative intermediates.« less

  2. Crystal structure of the DNA-binding domain of the LysR-type transcriptional regulator CbnR in complex with a DNA fragment of the recognition-binding site in the promoter region.

    PubMed

    Koentjoro, Maharani Pertiwi; Adachi, Naruhiko; Senda, Miki; Ogawa, Naoto; Senda, Toshiya

    2018-03-01

    LysR-type transcriptional regulators (LTTRs) are among the most abundant transcriptional regulators in bacteria. CbnR is an LTTR derived from Cupriavidus necator (formerly Alcaligenes eutrophus or Ralstonia eutropha) NH9 and is involved in transcriptional activation of the cbnABCD genes encoding chlorocatechol degradative enzymes. CbnR interacts with a cbnA promoter region of approximately 60 bp in length that contains the recognition-binding site (RBS) and activation-binding site (ABS). Upon inducer binding, CbnR seems to undergo conformational changes, leading to the activation of the transcription. Since the interaction of an LTTR with RBS is considered to be the first step of the transcriptional activation, the CbnR-RBS interaction is responsible for the selectivity of the promoter to be activated. To understand the sequence selectivity of CbnR, we determined the crystal structure of the DNA-binding domain of CbnR in complex with RBS of the cbnA promoter at 2.55 Å resolution. The crystal structure revealed details of the interactions between the DNA-binding domain and the promoter DNA. A comparison with the previously reported crystal structure of the DNA-binding domain of BenM in complex with its cognate RBS showed several differences in the DNA interactions, despite the structural similarity between CbnR and BenM. These differences explain the observed promoter sequence selectivity between CbnR and BenM. Particularly, the difference between Thr33 in CbnR and Ser33 in BenM appears to affect the conformations of neighboring residues, leading to the selective interactions with DNA. Atomic coordinates and structure factors for the DNA-binding domain of Cupriavidus necatorNH9 CbnR in complex with RBS are available in the Protein Data Bank under the accession code 5XXP. © 2018 Federation of European Biochemical Societies.

  3. Silver(I) complexes with DNA and RNA studied by Fourier transform infrared spectroscopy and capillary electrophoresis.

    PubMed Central

    Arakawa, H; Neault, J F; Tajmir-Riahi, H A

    2001-01-01

    Ag(I) is a strong nucleic acids binder and forms several complexes with DNA such as types I, II, and III. However, the details of the binding mode of silver(I) in the Ag-polynucleotides remains unknown. Therefore, it was of interest to examine the binding of Ag(I) with calf-thymus DNA and bakers yeast RNA in aqueous solutions at pH 7.1-6.6 with constant concentration of DNA or RNA and various concentrations of Ag(I). Fourier transform infrared spectroscopy and capillary electrophoresis were used to analyze the Ag(I) binding mode, the binding constant, and the polynucleotides' structural changes in the Ag-DNA and Ag-RNA complexes. The spectroscopic results showed that in the type I complex formed with DNA, Ag(I) binds to guanine N7 at low cation concentration (r = 1/80) and adenine N7 site at higher concentrations (r = 1/20 to 1/10), but not to the backbone phosphate group. At r = 1/2, type II complexes formed with DNA in which Ag(I) binds to the G-C and A-T base pairs. On the other hand, Ag(I) binds to the guanine N7 atom but not to the adenine and the backbone phosphate group in the Ag-RNA complexes. Although a minor alteration of the sugar-phosphate geometry was observed, DNA remained in the B-family structure, whereas RNA retained its A conformation. Scatchard analysis following capillary electrophoresis showed two binding sites for the Ag-DNA complexes with K(1) = 8.3 x 10(4) M(-1) for the guanine and K(2) = 1.5 x 10(4) M(-1) for the adenine bases. On the other hand, Ag-RNA adducts showed one binding site with K = 1.5 x 10(5) M(-1) for the guanine bases. PMID:11509371

  4. DNA mutagenic activity and capacity for HIV-1 restriction of the cytidine deaminase APOBEC3G depend on whether DNA or RNA binds to tyrosine 315

    PubMed Central

    Polevoda, Bogdan; Joseph, Rebecca; Friedman, Alan E.; Bennett, Ryan P.; Greiner, Rebecca; De Zoysa, Thareendra; Stewart, Ryan A.; Smith, Harold C.

    2017-01-01

    APOBEC3G (A3G) belongs to the AID/APOBEC protein family of cytidine deaminases (CDA) that bind to nucleic acids. A3G mutates the HIV genome by deamination of dC to dU, leading to accumulation of virus-inactivating mutations. Binding to cellular RNAs inhibits A3G binding to substrate single-stranded (ss) DNA and CDA activity. Bulk RNA and substrate ssDNA bind to the same three A3G tryptic peptides (amino acids 181–194, 314–320, and 345–374) that form parts of a continuously exposed protein surface extending from the catalytic domain in the C terminus of A3G to its N terminus. We show here that the A3G tyrosines 181 and 315 directly cross-linked ssDNA. Binding experiments showed that a Y315A mutation alone significantly reduced A3G binding to both ssDNA and RNA, whereas Y181A and Y182A mutations only moderately affected A3G nucleic acid binding. Consistent with these findings, the Y315A mutant exhibited little to no deaminase activity in an Escherichia coli DNA mutator reporter, whereas Y181A and Y182A mutants retained ∼50% of wild-type A3G activity. The Y315A mutant also showed a markedly reduced ability to assemble into viral particles and had reduced antiviral activity. In uninfected cells, the impaired RNA-binding capacity of Y315A was evident by a shift of A3G from high-molecular-mass ribonucleoprotein complexes to low-molecular-mass complexes. We conclude that Tyr-315 is essential for coordinating ssDNA interaction with or entry to the deaminase domain and hypothesize that RNA bound to Tyr-315 may be sufficient to competitively inhibit ssDNA deaminase-dependent antiviral activity. PMID:28381554

  5. Amino acids 16-275 of minute virus of mice NS1 include a domain that specifically binds (ACCA)2-3-containing DNA.

    PubMed

    Mouw, M; Pintel, D J

    1998-11-10

    GST-NS1 purified from Escherichia coli and insect cells binds double-strand DNA in an (ACCA)2-3-dependent fashion under similar ionic conditions, independent of the presence of anti-NS1 antisera or exogenously supplied ATP and interacts with single-strand DNA and RNA in a sequence-independent manner. An amino-terminal domain (amino acids 1-275) of NS1 [GST-NS1(1-275)], representing 41% of the full-length NS1 molecule, includes a domain that binds double-strand DNA in a sequence-specific manner at levels comparable to full-length GST-NS1, as well as single-strand DNA and RNA in a sequence-independent manner. The deletion of 15 additional amino-terminal amino acids yielded a molecule [GST-NS1(1-275)] that maintained (ACCA)2-3-specific double-strand DNA binding; however, this molecule was more sensitive to increasing ionic conditions than full-length GST-NS1 and GST-NS1(1-275) and could not be demonstrated to bind single-strand nucleic acids. A quantitative filter binding assay showed that E. coli- and baculovirus-expressed GST-NS1 and E. coli GST-NS1(1-275) specifically bound double-strand DNA with similar equilibrium kinetics [as measured by their apparent equilibrium DNA binding constants (KD)], whereas GST-NS1(16-275) bound 4- to 8-fold less well. Copyright 1998 Academic Press.

  6. Effects of pH, conductivity, host cell protein, and DNA size distribution on DNA clearance in anion exchange chromatography media

    PubMed Central

    Stone, Melani C.; Borman, Jon; Ferreira, Gisela

    2017-01-01

    Flowthrough anion exchange chromatography is commonly used as a polishing step in downstream processing of monoclonal antibodies and other therapeutic proteins to remove process‐related impurities and contaminants such as host cell DNA, host cell proteins, endotoxin, and viruses. DNA with a wide range of molecular weight distributions derived from Chinese Hamster Ovary cells was used to advance the understanding of DNA binding behavior in selected anion exchange media using the resin (Toyopearl SuperQ‐650M) and membranes (Mustang® Q and Sartobind® Q) through DNA spiking studies. The impacts of the process parameters pH (6–8), conductivity (2–15 mS/cm), and the potential binding competition between host cell proteins and host cell DNA were studied. Studies were conducted at the least and most favorable experimental conditions for DNA binding based on the anticipated electrostatic interactions between the host cell DNA and the resin ligand. The resin showed 50% higher DNA binding capacity compared to the membrane media. Spiking host cell proteins in the load material showed no impact on the DNA clearance capability of the anion exchange media. DNA size distributions were characterized based on a “size exclusion qPCR assay.” Results showed preferential binding of larger DNA fragments (>409 base pairs). © 2017 The Authors Biotechnology Progress published by Wiley Periodicals, Inc. on behalf of American Institute of Chemical Engineers Biotechnol. Prog., 34:141–149, 2018 PMID:28884511

  7. The interaction of DiaA and DnaA regulates the replication cycle in E. coli by directly promoting ATP–DnaA-specific initiation complexes

    PubMed Central

    Keyamura, Kenji; Fujikawa, Norie; Ishida, Takuma; Ozaki, Shogo; Su’etsugu, Masayuki; Fujimitsu, Kazuyuki; Kagawa, Wataru; Yokoyama, Shigeyuki; Kurumizaka, Hitoshi; Katayama, Tsutomu

    2007-01-01

    Escherichia coli DiaA is a DnaA-binding protein that is required for the timely initiation of chromosomal replication during the cell cycle. In this study, we determined the crystal structure of DiaA at 1.8 Å resolution. DiaA forms a homotetramer consisting of a symmetrical pair of homodimers. Mutational analysis revealed that the DnaA-binding activity and formation of homotetramers are required for the stimulation of initiation by DiaA. DiaA tetramers can bind multiple DnaA molecules simultaneously. DiaA stimulated the assembly of multiple DnaA molecules on oriC, conformational changes in ATP–DnaA-specific initiation complexes, and unwinding of oriC duplex DNA. The mutant DiaA proteins are defective in these stimulations. DiaA associated also with ADP–DnaA, and stimulated the assembly of inactive ADP–DnaA–oriC complexes. Specific residues in the putative phosphosugar-binding motif of DiaA were required for the stimulation of initiation and formation of ATP–DnaA-specific–oriC complexes. Our data indicate that DiaA regulates initiation by a novel mechanism, in which DiaA tetramers most likely bind to multiple DnaA molecules and stimulate the assembly of specific ATP–DnaA–oriC complexes. These results suggest an essential role for DiaA in the promotion of replication initiation in a cell cycle coordinated manner. PMID:17699754

  8. Two phenylalanines in the C-terminus of Epstein-Barr virus Rta protein reciprocally modulate its DNA binding and transactivation function

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, L.-W.; Department of Molecular Biophysics and Biochemistry, Yale University School of Medicine, New Haven, CT 06520; Raghavan, Vineetha

    The Rta (R transactivator) protein plays an essential role in the Epstein-Barr viral (EBV) lytic cascade. Rta activates viral gene expression by several mechanisms including direct and indirect binding to target viral promoters, synergy with EBV ZEBRA protein, and stimulation of cellular signaling pathways. We previously found that Rta proteins with C-terminal truncations of 30 aa were markedly enhanced in their capacity to bind DNA (Chen, L.W., Chang, P.J., Delecluse, H.J., and Miller, G., (2005). Marked variation in response of consensus binding elements for the Rta protein of Epstein-Barr virus. J. Virol. 79(15), 9635-9650.). Here we show that two phenylalaninesmore » (F600 and F605) in the C-terminus of Rta play a crucial role in mediating this DNA binding inhibitory function. Amino acids 555 to 605 of Rta constitute a functional DNA binding inhibitory sequence (DBIS) that markedly decreased DNA binding when transferred to a minimal DNA binding domain of Rta (aa 1-350). Alanine substitution mutants, F600A/F605A, abolished activity of the DBIS. F600 and F605 are located in the transcriptional activation domain of Rta. Alanine substitutions, F600A/F605A, decreased transcriptional activation by Rta protein, whereas aromatic substitutions, such as F600Y/F605Y or F600W/F605W, partially restored transcriptional activation. Full-length Rta protein with F600A/F605A mutations were enhanced in DNA binding compared to wild-type, whereas Rta proteins with F600Y/F605Y or F600W/F605W substitutions were, like wild-type Rta, relatively poor DNA binders. GAL4 (1-147)/Rta (416-605) fusion proteins with F600A/F605A mutations were diminished in transcriptional activation, relative to GAL4/Rta chimeras without such mutations. The results suggest that, in the context of a larger DBIS, F600 and F605 play a role in the reciprocal regulation of DNA binding and transcriptional activation by Rta. Regulation of DNA binding by Rta is likely to be important in controlling its different modes of action.« less

  9. High abundance androgen receptor in goldfish brain: characteristics and seasonal changes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pasmanik, M.; Callard, G.V.

    1988-08-01

    Testosterone (T) exerts its actions in brain directly via androgen receptors or, after aromatization to estradiol, via estrogen receptors. Brain aromatase activity in teleost fish is 100-1000 times greater than in mammals and would be expected to significantly reduce the quantity of androgen available for receptor binding. Experiments were carried out on the goldfish Carassius auratus to determine if androgen receptors are present in teleost brain and whether their physicochemical properties reflect elevated aromatase. Cytosolic and nuclear extracts were assayed with the use of (/sup 3/H)T and charcoal, Sephadex LH-20, or DNA-cellulose chromatography to separate bound and free steroids. Bindingmore » activity was saturable and had an equally high affinity for T and 5 alpha-dihydrotestosterone. Although mibolerone was a relatively weak competitor, the putative teleost androgen 11-ketotestosterone, methyltrienolone (R1881), estradiol, progesterone, and cortisol were poor ligands. Characteristics that distinguish this receptor from a steroid-binding protein in goldfish serum are the presence of binding activity in both nuclear and cytosolic extracts, a low rate of ligand-receptor dissociation, electrophoretic mobility, sedimentation properties in low vs. high salt, and tissue distribution. DNA cellulose-adhering and nonadhering forms were detected, but these did not differ in other variables measured. Although goldfish androgen receptors resembled those of mammals in all important physicochemical characteristics, they were unusually abundant compared to levels in rat brain, but comparable to levels in prostate and other male sex hormone target organs. Moreover, there were seasonal variations in total receptors, with a peak at spawning (April) 4- to 5-fold higher than values in reproductively inactive fish.« less

  10. Atomistic Simulations of Complex DNA DSBs and the Interactions with Ku70/80 Heterodimer

    NASA Technical Reports Server (NTRS)

    Hu, Shaowen; Cucinotta, Francis A.

    2011-01-01

    Compared to DNA with simple DSBs, the complex lesions can enhance the hydrogen bonds opening rate at the DNA terminus, and increase the mobility of the whole duplex. Binding of Ku drastically reduces the structural disruption and flexibility caused by the complex lesions. In all complex DSBs systems, the binding of DSB terminus with Ku70 is softened while the binding of the middle duplex with Ku80 is tightened. Binding of Ku promotes the rigidity of DNA duplexes, due to the clamp structure of the inner surface of the rings of Ku70/80.

  11. EMSA Analysis of DNA Binding By Rgg Proteins

    PubMed Central

    LaSarre, Breah; Federle, Michael J.

    2016-01-01

    In bacteria, interaction of various proteins with DNA is essential for the regulation of specific target gene expression. Electrophoretic mobility shift assay (EMSA) is an in vitro approach allowing for the visualization of these protein-DNA interactions. Rgg proteins comprise a family of transcriptional regulators widespread among the Firmicutes. Some of these proteins function independently to regulate target gene expression, while others have now been demonstrated to function as effectors of cell-to-cell communication, having regulatory activities that are modulated via direct interaction with small signaling peptides. EMSA analysis can be used to assess DNA binding of either type of Rgg protein. EMSA analysis of Rgg protein activity has facilitated in vitro confirmation of regulatory targets, identification of precise DNA binding sites via DNA probe mutagenesis, and characterization of the mechanism by which some cognate signaling peptides modulate Rgg protein function (e.g. interruption of DNA-binding in some cases). PMID:27430004

  12. EMSA Analysis of DNA Binding By Rgg Proteins.

    PubMed

    LaSarre, Breah; Federle, Michael J

    2013-08-20

    In bacteria, interaction of various proteins with DNA is essential for the regulation of specific target gene expression. Electrophoretic mobility shift assay (EMSA) is an in vitro approach allowing for the visualization of these protein-DNA interactions. Rgg proteins comprise a family of transcriptional regulators widespread among the Firmicutes. Some of these proteins function independently to regulate target gene expression, while others have now been demonstrated to function as effectors of cell-to-cell communication, having regulatory activities that are modulated via direct interaction with small signaling peptides. EMSA analysis can be used to assess DNA binding of either type of Rgg protein. EMSA analysis of Rgg protein activity has facilitated in vitro confirmation of regulatory targets, identification of precise DNA binding sites via DNA probe mutagenesis, and characterization of the mechanism by which some cognate signaling peptides modulate Rgg protein function ( e.g. interruption of DNA-binding in some cases).

  13. Quest for the binding mode of tetrabromobisphenol A with Calf thymus DNA

    NASA Astrophysics Data System (ADS)

    Wang, Yan-Qing; Zhang, Hong-Mei; Cao, Jian

    2014-10-01

    The binding interaction of tetrabromobisphenol A with Calf thymus DNA was studied by multi-spectroscopic and molecular modeling methods. The UV-vis study revealed that an obvious interaction between tetrabromobisphenol A and Calf thymus DNA happened. The π-π∗ transitions and the electron cloud of tetrabromobisphenol A might be changed by entering the groove of Calf thymus DNA. From the fluorescence spectral and thermodynamics studies, it was concluded that the hydrogen bonds and hydrophobic force played a major role in the binding of tetrabromobisphenol A to Calf thymus DNA. The molecular modeling study showed that the possible sites of tetrabromobisphenol A in the groove of DNA. Circular dichroism study also depicted that tetrabromobisphenol A bond to DNA. These above results would further advance our knowledge on the molecular mechanism of the binding interactions of brominated flame-retardants with nucleic acid.

  14. Triple Helix Formation in a Topologically Controlled DNA Nanosystem.

    PubMed

    Yamagata, Yutaro; Emura, Tomoko; Hidaka, Kumi; Sugiyama, Hiroshi; Endo, Masayuki

    2016-04-11

    In the present study, we demonstrate single-molecule imaging of triple helix formation in DNA nanostructures. The binding of the single-molecule third strand to double-stranded DNA in a DNA origami frame was examined using two different types of triplet base pairs. The target DNA strand and the third strand were incorporated into the DNA frame, and the binding of the third strand was controlled by the formation of Watson-Crick base pairing. Triple helix formation was monitored by observing the structural changes in the incorporated DNA strands. It was also examined using a photocaged third strand wherein the binding of the third strand was directly observed using high-speed atomic force microscopy during photoirradiation. We found that the binding of the third strand could be controlled by regulating duplex formation and the uncaging of the photocaged strands in the designed nanospace. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Specific minor groove solvation is a crucial determinant of DNA binding site recognition

    PubMed Central

    Harris, Lydia-Ann; Williams, Loren Dean; Koudelka, Gerald B.

    2014-01-01

    The DNA sequence preferences of nearly all sequence specific DNA binding proteins are influenced by the identities of bases that are not directly contacted by protein. Discrimination between non-contacted base sequences is commonly based on the differential abilities of DNA sequences to allow narrowing of the DNA minor groove. However, the factors that govern the propensity of minor groove narrowing are not completely understood. Here we show that the differential abilities of various DNA sequences to support formation of a highly ordered and stable minor groove solvation network are a key determinant of non-contacted base recognition by a sequence-specific binding protein. In addition, disrupting the solvent network in the non-contacted region of the binding site alters the protein's ability to recognize contacted base sequences at positions 5–6 bases away. This observation suggests that DNA solvent interactions link contacted and non-contacted base recognition by the protein. PMID:25429976

  16. DNA-Damage Response RNA-Binding Proteins (DDRBPs): Perspectives from a New Class of Proteins and Their RNA Targets.

    PubMed

    Dutertre, Martin; Vagner, Stéphan

    2017-10-27

    Upon DNA damage, cells trigger an early DNA-damage response (DDR) involving DNA repair and cell cycle checkpoints, and late responses involving gene expression regulation that determine cell fate. Screens for genes involved in the DDR have found many RNA-binding proteins (RBPs), while screens for novel RBPs have identified DDR proteins. An increasing number of RBPs are involved in early and/or late DDR. We propose to call this new class of actors of the DDR, which contain an RNA-binding activity, DNA-damage response RNA-binding proteins (DDRBPs). We then discuss how DDRBPs contribute not only to gene expression regulation in the late DDR but also to early DDR signaling, DNA repair, and chromatin modifications at DNA-damage sites through interactions with both long and short noncoding RNAs. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Strong minor groove base conservation in sequence logos implies DNA distortion or base flipping during replication and transcription initiation.

    PubMed

    Schneider, T D

    2001-12-01

    The sequence logo for DNA binding sites of the bacteriophage P1 replication protein RepA shows unusually high sequence conservation ( approximately 2 bits) at a minor groove that faces RepA. However, B-form DNA can support only 1 bit of sequence conservation via contacts into the minor groove. The high conservation in RepA sites therefore implies a distorted DNA helix with direct or indirect contacts to the protein. Here I show that a high minor groove conservation signature also appears in sequence logos of sites for other replication origin binding proteins (Rts1, DnaA, P4 alpha, EBNA1, ORC) and promoter binding proteins (sigma(70), sigma(D) factors). This finding implies that DNA binding proteins generally use non-B-form DNA distortion such as base flipping to initiate replication and transcription.

  18. Fixed-Gap Tunnel Junction for Reading DNA Nucleotides

    PubMed Central

    2015-01-01

    Previous measurements of the electronic conductance of DNA nucleotides or amino acids have used tunnel junctions in which the gap is mechanically adjusted, such as scanning tunneling microscopes or mechanically controllable break junctions. Fixed-junction devices have, at best, detected the passage of whole DNA molecules without yielding chemical information. Here, we report on a layered tunnel junction in which the tunnel gap is defined by a dielectric layer, deposited by atomic layer deposition. Reactive ion etching is used to drill a hole through the layers so that the tunnel junction can be exposed to molecules in solution. When the metal electrodes are functionalized with recognition molecules that capture DNA nucleotides via hydrogen bonds, the identities of the individual nucleotides are revealed by characteristic features of the fluctuating tunnel current associated with single-molecule binding events. PMID:25380505

  19. Voltage dependency of transmission probability of aperiodic DNA molecule

    NASA Astrophysics Data System (ADS)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  20. Nucleic acid is a novel ligand for innate, immune pattern recognition collectins surfactant proteins A and D and mannose-binding lectin.

    PubMed

    Palaniyar, Nades; Nadesalingam, Jeya; Clark, Howard; Shih, Michael J; Dodds, Alister W; Reid, Kenneth B M

    2004-07-30

    Collectins are a family of innate immune proteins that contain fibrillar collagen-like regions and globular carbohydrate recognition domains (CRDs). The CRDs of these proteins recognize various microbial surface-specific carbohydrate patterns, particularly hexoses. We hypothesized that collectins, such as pulmonary surfactant proteins (SPs) SP-A and SP-D and serum protein mannose-binding lectin, could recognize nucleic acids, pentose-based anionic phosphate polymers. Here we show that collectins bind DNA from a variety of origins, including bacteria, mice, and synthetic oligonucleotides. Pentoses, such as arabinose, ribose, and deoxyribose, inhibit the interaction between SP-D and mannan, one of the well-studied hexose ligands for SP-D, and biologically relevant d-forms of the pentoses are better competitors than the l-forms. In addition, DNA and RNA polymer-related compounds, such as nucleotide diphosphates and triphosphates, also inhibit the carbohydrate binding ability of SP-D, or approximately 60 kDa trimeric recombinant fragments of SP-D that are composed of the alpha-helical coiled-coil neck region and three CRDs (SP-D(n/CRD)) or SP-D(n/CRD) with eight GXY repeats (SPD(GXY)(8)(n/CRD)). Direct binding and competition studies suggest that collectins bind nucleic acid via their CRDs as well as by their collagen-like regions, and that SP-D binds DNA more effectively than do SP-A and mannose-binding lectin at physiological salt conditions. Furthermore, the SP-D(GXY)(8)(n/CRD) fragments co-localize with DNA, and the protein competes the interaction between propidium iodide, a DNA-binding dye, and apoptotic cells. In conclusion, we show that collectins are a new class of proteins that bind free DNA and the DNA present on apoptotic cells by both their globular CRDs and collagen-like regions. Collectins may therefore play an important role in decreasing the inflammation caused by DNA in lungs and other tissues.

  1. Mechanism of the formation of the RecA-ssDNA nucleoprotein filament structure: a coarse-grained approach.

    PubMed

    Mukherjee, Goutam; Pal, Arumay; Levy, Yaakov

    2017-11-21

    In prokaryotes, the RecA protein catalyzes the repair and strand exchange of double-stranded DNA. RecA binds to single-stranded DNA (ssDNA) and forms a presynaptic complex in which the protein polymerizes around the ssDNA to form a right-handed helical nucleoprotein filament structure. In the present work, the mechanism for the formation of the RecA-ssDNA filament structure is modeled using coarse-grained molecular dynamics simulations. Information from the X-ray structure was used to model the protein itself but not its interactions; the interactions between the protein and the ssDNA were modeled solely by electrostatic, aromatic, and repulsive energies. For the present study, the monomeric, dimeric, and trimeric units of RecA and 4, 8, and 11 NT-long ssDNA, respectively, were studied. Our results indicate that monomeric RecA is not sufficient for nucleoprotein filament formation; rather, dimeric RecA is the elementary binding unit, with higher multimeric units of RecA facilitating filament formation. Our results reveal that loop region flexibility at the primary binding site of RecA is essential for it to bind the incoming ssDNA, that the aromatic residues present in the loop region play an important role in ssDNA binding, and that ATP may play a role in guiding the ssDNA by changing the electrostatic potential of the RecA protein.

  2. Prospects of nanoparticle-DNA binding and its implications in medical biotechnology.

    PubMed

    An, Hongjie; Jin, Bo

    2012-01-01

    Bio-nanotechnology is a new interdisciplinary R&D area that integrates engineering and physical science with biology through the development of multifunctional devices and systems, focusing biology inspired processes or their applications, in particular in medical biotechnology. DNA based nanotechnology, in many ways, has been one of the most intensively studied fields in recent years that involves the use and the creation of bio-inspired materials and their technologies for highly selective biosensing, nanoarchitecture engineering and nanoelectronics. Increasing researches have been offered to a fundamental understanding how the interactions between the nanoparticles and DNA molecules could alter DNA molecular structure and its biochemical activities. This minor review describes the mechanisms of the nanoparticle-DNA binding and molecular interactions. We present recent discoveries and research progresses how the nanoparticle-DNA binding could vary DNA molecular structure, DNA detection, and gene therapy. We report a few case studies associated with the application of the nanoparticle-DNA binding devices in medical detection and biotechnology. The potential impacts of the nanoparticles via DNA binding on toxicity of the microorganisms are briefly discussed. The nanoparticle-DNA interactions and their impact on molecular and microbial functionalities have only drown attention in recent a few years. The information presented in this review can provide useful references for further studies on biomedical science and technology. Copyright © 2012 Elsevier Inc. All rights reserved.

  3. BINDING OF CARCINOGENS TO DNA AND COVALENT ADDUCTS DNA DAMAGE - PAH, AROMATIC AMINES, NITRO-AROMATIC COMPOUNDS, AND HALOGENATED COMPOUNDS

    EPA Science Inventory

    DNA adducts are the covalent addition products resulting from binding of reactive chemical species to DNA bases. The cancer initiating role of DNA adducts is well-established, and is clearly reflected in the high cancer incidence observed in individuals with deficiencies in any o...

  4. Electrochemical and spectroscopic studies of the interaction of proflavine with DNA.

    PubMed

    Aslanoglu, Mehmet

    2006-03-01

    The interaction of proflavine with herring sperm DNA has been investigated by cyclic voltammetry and UV-Vis spectroscopy as well as viscosity measurements. Shifts in the peak potentials in cyclic voltammetry, spectral changes in UV absorption titration, an increase in viscosity of DNA and the results of the effect of ionic strength on the binding constant strongly support the intercalation of proflavine into the DNA double helix. The binding constant for the interaction between proflavine and DNA was K = 2.32 (+/- 0.41) x 10(4) M(-1) and the binding site size was 2.07 (+/- 0.1) base pairs, estimated in voltammetric measurements. The value of the binding site size was determined to be closer to that expected for a planar intercalating agent. The standard Gibbs free-energy change is ca. -24.90 kJ/mol at 25 degrees C, indicating the spontaneity of the binding interaction. The binding constant determined by UV absorption measurements was K = 2.20 (+/- 0.48) x 10(4) M(-1), which is very close to the value determined by cyclic voltammetry assuming that the binding equilibrium is static.

  5. Structural anatomy of telomere OB proteins.

    PubMed

    Horvath, Martin P

    2011-10-01

    Telomere DNA-binding proteins protect the ends of chromosomes in eukaryotes. A subset of these proteins are constructed with one or more OB folds and bind with G+T-rich single-stranded DNA found at the extreme termini. The resulting DNA-OB protein complex interacts with other telomere components to coordinate critical telomere functions of DNA protection and DNA synthesis. While the first crystal and NMR structures readily explained protection of telomere ends, the picture of how single-stranded DNA becomes available to serve as primer and template for synthesis of new telomere DNA is only recently coming into focus. New structures of telomere OB fold proteins alongside insights from genetic and biochemical experiments have made significant contributions towards understanding how protein-binding OB proteins collaborate with DNA-binding OB proteins to recruit telomerase and DNA polymerase for telomere homeostasis. This review surveys telomere OB protein structures alongside highly comparable structures derived from replication protein A (RPA) components, with the goal of providing a molecular context for understanding telomere OB protein evolution and mechanism of action in protection and synthesis of telomere DNA.

  6. Structural anatomy of telomere OB proteins

    PubMed Central

    Horvath, Martin P.

    2015-01-01

    Telomere DNA-binding proteins protect the ends of chromosomes in eukaryotes. A subset of these proteins are constructed with one or more OB folds and bind with G+T-rich single-stranded DNA found at the extreme termini. The resulting DNA-OB protein complex interacts with other telomere components to coordinate critical telomere functions of DNA protection and DNA synthesis. While the first crystal and NMR structures readily explained protection of telomere ends, the picture of how single-stranded DNA becomes available to serve as primer and template for synthesis of new telomere DNA is only recently coming into focus. New structures of telomere OB fold proteins alongside insights from genetic and biochemical experiments have made significant contributions towards understanding how protein-binding OB proteins collaborate with DNA-binding OB proteins to recruit telomerase and DNA polymerase for telomere homeostasis. This review surveys telomere OB protein structures alongside highly comparable structures derived from replication protein A (RPA) components, with the goal of providing a molecular context for understanding telomere OB protein evolution and mechanism of action in protection and synthesis of telomere DNA. PMID:21950380

  7. APOBEC3G Interacts with ssDNA by Two Modes: AFM Studies

    NASA Astrophysics Data System (ADS)

    Shlyakhtenko, Luda S.; Dutta, Samrat; Banga, Jaspreet; Li, Ming; Harris, Reuben S.; Lyubchenko, Yuri L.

    2015-10-01

    APOBEC3G (A3G) protein has antiviral activity against HIV and other pathogenic retroviruses. A3G has two domains: a catalytic C-terminal domain (CTD) that deaminates cytidine, and a N-terminal domain (NTD) that binds to ssDNA. Although abundant information exists about the biological activities of A3G protein, the interplay between sequence specific deaminase activity and A3G binding to ssDNA remains controversial. We used the topographic imaging and force spectroscopy modalities of Atomic Force Spectroscopy (AFM) to characterize the interaction of A3G protein with deaminase specific and nonspecific ssDNA substrates. AFM imaging demonstrated that A3G has elevated affinity for deaminase specific ssDNA than for nonspecific ssDNA. AFM force spectroscopy revealed two distinct binding modes by which A3G interacts with ssDNA. One mode requires sequence specificity, as demonstrated by stronger and more stable complexes with deaminase specific ssDNA than with nonspecific ssDNA. Overall these observations enforce prior studies suggesting that both domains of A3G contribute to the sequence specific binding of ssDNA.

  8. APOBEC3G Interacts with ssDNA by Two Modes: AFM Studies.

    PubMed

    Shlyakhtenko, Luda S; Dutta, Samrat; Banga, Jaspreet; Li, Ming; Harris, Reuben S; Lyubchenko, Yuri L

    2015-10-27

    APOBEC3G (A3G) protein has antiviral activity against HIV and other pathogenic retroviruses. A3G has two domains: a catalytic C-terminal domain (CTD) that deaminates cytidine, and a N-terminal domain (NTD) that binds to ssDNA. Although abundant information exists about the biological activities of A3G protein, the interplay between sequence specific deaminase activity and A3G binding to ssDNA remains controversial. We used the topographic imaging and force spectroscopy modalities of Atomic Force Spectroscopy (AFM) to characterize the interaction of A3G protein with deaminase specific and nonspecific ssDNA substrates. AFM imaging demonstrated that A3G has elevated affinity for deaminase specific ssDNA than for nonspecific ssDNA. AFM force spectroscopy revealed two distinct binding modes by which A3G interacts with ssDNA. One mode requires sequence specificity, as demonstrated by stronger and more stable complexes with deaminase specific ssDNA than with nonspecific ssDNA. Overall these observations enforce prior studies suggesting that both domains of A3G contribute to the sequence specific binding of ssDNA.

  9. Viral interference with DNA repair by targeting of the single-stranded DNA binding protein RPA.

    PubMed

    Banerjee, Pubali; DeJesus, Rowena; Gjoerup, Ole; Schaffhausen, Brian S

    2013-10-01

    Correct repair of damaged DNA is critical for genomic integrity. Deficiencies in DNA repair are linked with human cancer. Here we report a novel mechanism by which a virus manipulates DNA damage responses. Infection with murine polyomavirus sensitizes cells to DNA damage by UV and etoposide. Polyomavirus large T antigen (LT) alone is sufficient to sensitize cells 100 fold to UV and other kinds of DNA damage. This results in activated stress responses and apoptosis. Genetic analysis shows that LT sensitizes via the binding of its origin-binding domain (OBD) to the single-stranded DNA binding protein replication protein A (RPA). Overexpression of RPA protects cells expressing OBD from damage, and knockdown of RPA mimics the LT phenotype. LT prevents recruitment of RPA to nuclear foci after DNA damage. This leads to failure to recruit repair proteins such as Rad51 or Rad9, explaining why LT prevents repair of double strand DNA breaks by homologous recombination. A targeted intervention directed at RPA based on this viral mechanism could be useful in circumventing the resistance of cancer cells to therapy.

  10. DNA-binding protects p53 from interactions with cofactors involved in transcription-independent functions

    PubMed Central

    Lambrughi, Matteo; De Gioia, Luca; Gervasio, Francesco Luigi; Lindorff-Larsen, Kresten; Nussinov, Ruth; Urani, Chiara; Bruschi, Maurizio; Papaleo, Elena

    2016-01-01

    Binding-induced conformational changes of a protein at regions distant from the binding site may play crucial roles in protein function and regulation. The p53 tumour suppressor is an example of such an allosterically regulated protein. Little is known, however, about how DNA binding can affect distal sites for transcription factors. Furthermore, the molecular details of how a local perturbation is transmitted through a protein structure are generally elusive and occur on timescales hard to explore by simulations. Thus, we employed state-of-the-art enhanced sampling atomistic simulations to unveil DNA-induced effects on p53 structure and dynamics that modulate the recruitment of cofactors and the impact of phosphorylation at Ser215. We show that DNA interaction promotes a conformational change in a region 3 nm away from the DNA binding site. Specifically, binding to DNA increases the population of an occluded minor state at this distal site by more than 4-fold, whereas phosphorylation traps the protein in its major state. In the minor conformation, the interface of p53 that binds biological partners related to p53 transcription-independent functions is not accessible. Significantly, our study reveals a mechanism of DNA-mediated protection of p53 from interactions with partners involved in the p53 transcription-independent signalling. This also suggests that conformational dynamics is tightly related to p53 signalling. PMID:27604871

  11. Structures of minute virus of mice replication initiator protein N-terminal domain: Insights into DNA nicking and origin binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tewary, Sunil K.; Liang, Lingfei; Lin, Zihan

    Members of the Parvoviridae family all encode a non-structural protein 1 (NS1) that directs replication of single-stranded viral DNA, packages viral DNA into capsid, and serves as a potent transcriptional activator. Here we report the X-ray structure of the minute virus of mice (MVM) NS1 N-terminal domain at 1.45 Å resolution, showing that sites for dsDNA binding, ssDNA binding and cleavage, nuclear localization, and other functions are integrated on a canonical fold of the histidine-hydrophobic-histidine superfamily of nucleases, including elements specific for this Protoparvovirus but distinct from its Bocaparvovirus or Dependoparvovirus orthologs. High resolution structural analysis reveals a nickase activemore » site with an architecture that allows highly versatile metal ligand binding. The structures support a unified mechanism of replication origin recognition for homotelomeric and heterotelomeric parvoviruses, mediated by a basic-residue-rich hairpin and an adjacent helix in the initiator proteins and by tandem tetranucleotide motifs in the replication origins. - Highlights: • The structure of a parvovirus replication initiator protein has been determined; • The structure sheds light on mechanisms of ssDNA binding and cleavage; • The nickase active site is preconfigured for versatile metal ligand binding; • The binding site for the double-stranded replication origin DNA is identified; • A single domain integrates multiple functions in virus replication.« less

  12. Multi-spectroscopic and molecular docking studies on the interaction of darunavir, a HIV protease inhibitor with calf thymus DNA.

    PubMed

    Shi, Jie-Hua; Zhou, Kai-Li; Lou, Yan-Yue; Pan, Dong-Qi

    2018-03-15

    Molecular interaction of darunavir (DRV), a HIV protease inhibitor with calf thymus deoxyribonucleic acid (ct-DNA) was studied in physiological buffer (pH7.4) by multi-spectroscopic approaches hand in hand with viscosity measurements and molecular docking technique. The UV absorption and fluorescence results together revealed the formation of a DRV-ct-DNA complex having binding affinities of the order of 10 3 M -1 , which was more in keeping with the groove binding. The results that DRV bound to ct-DNA via groove binding mode was further evidenced by KI quenching studies, viscosity measurements, competitive binding investigations with EB and Rhodamine B and CD spectral analysis. The effect of ionic strength indicated the negligible involvement of electrostatic interaction between DRV and ct-DNA. The thermodynamic parameters regarding the binding interaction of DRV with ct-DNA in terms of enthalpy change (ΔH 0 ) and entropy change (ΔS 0 ) were -63.19kJ mol -1 and -141.92J mol -1 K -1 , indicating that hydrogen bonds and van der Waals forces played a predominant role in the binding process. Furthermore, molecular simulation studies suggested that DRV molecule was prone to bind in the A-T rich region of the minor groove of DNA. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Experimental and molecular docking studies on DNA binding interaction of adefovir dipivoxil: advances toward treatment of hepatitis B virus infections.

    PubMed

    Shahabadi, Nahid; Falsafi, Monireh

    2014-05-05

    The toxic interaction of adefovir dipivoxil with calf thymus DNA (CT-DNA) was investigated in vitro under simulated physiological conditions by multi-spectroscopic techniques and molecular modeling study. The fluorescence spectroscopy and UV absorption spectroscopy indicated drug interacted with CT-DNA in a groove binding mode. The binding constant of UV-visible and the number of binding sites were 3.33±0.2×10(4) L mol(-1)and 0.99, respectively. The fluorimetric studies showed that the reaction between the drug and CT-DNA is exothermic (ΔH=34.4 kJ mol(-1); ΔS=184.32 J mol(-1) K(-1)). Circular dichroism spectroscopy (CD) was employed to measure the conformational change of CT-DNA in the presence of adefovir dipivoxil, which verified the groove binding mode. Furthermore, the drug induces detectable changes in its viscosity. The molecular modeling results illustrated that adefovir strongly binds to groove of DNA by relative binding energy of docked structure -16.83 kJ mol(-1). This combination of multiple spectroscopic techniques and molecular modeling methods can be widely used in the investigation on the toxic interaction of small molecular pollutants and drugs with bio macromolecules, which contributes to clarify the molecular mechanism of toxicity or side effect in vivo. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Experimental studies on the nature of bonding of DNA/bipyridyl-(ethylenediamine)platinum(II) and DNA/netropsin complexes in solution and oriented wet-spun films

    NASA Astrophysics Data System (ADS)

    Marlowe, R. L.; Szabo, A.; Lee, S. A.; Rupprecht, A.

    2002-03-01

    The stability of complexes of NaDNA with bipyridyl-(ethylenediamine)platinum(II) (abbreviated [(bipy)Pt(en)]) and with netropsin has been studied using two techniques: (i) ultraviolet melting experiments were done on NaDNA/[(bipy)Pt(en)], showing that the [(bipy)Pt(en)] ligand stabilizes the DNA double helix structure; and (ii) swelling measurements (via optical microscopy) as a function of relative humidity were done on wet-spun oriented films of NaDNA/[(bipy)Pt(en)] and of NaDNA/netropsin. The swelling data shows that an irreversible transition of the films occurs at high relative humidity, first for the NaDNA/netropsin, then for pure NaDNA, and lastly for the NaDNA/[(bipy)Pt(en)]. These results are indicative that the [(bipy)Pt(en)] complex stabilizes the intermolecular bonds which mediate the film swelling characteristics. A model is suggested for the binding of [(bipy)Pt(en)] to DNA to explain why the swelling experiments show this ligand as increasing the intermolecular bond strength between the DNA double helices, while netropsin decreases this degree of stabilization.

  15. Differential sensitivities of cellular XPA and PARP-1 to arsenite inhibition and zinc rescue.

    PubMed

    Ding, Xiaofeng; Zhou, Xixi; Cooper, Karen L; Huestis, Juliana; Hudson, Laurie G; Liu, Ke Jian

    2017-09-15

    Arsenite directly binds to the zinc finger domains of the DNA repair protein poly (ADP ribose) polymerase (PARP)-1, and inhibits PARP-1 activity in the base excision repair (BER) pathway. PARP inhibition by arsenite enhances ultraviolet radiation (UVR)-induced DNA damage in keratinocytes, and the increase in DNA damage is reduced by zinc supplementation. However, little is known about the effects of arsenite and zinc on the zinc finger nucleotide excision repair (NER) protein xeroderma pigmentosum group A (XPA). In this study, we investigated the difference in response to arsenite exposure between XPA and PARP-1, and the differential effectiveness of zinc supplementation in restoring protein DNA binding and DNA damage repair. Arsenite targeted both XPA and PARP-1 in human keratinocytes, resulting in zinc loss from each protein and a pronounced decrease in XPA and PARP-1 binding to chromatin as demonstrated by Chip-on-Western assays. Zinc effectively restored DNA binding of PARP-1 and XPA to chromatin when zinc concentrations were equal to those of arsenite. In contrast, zinc was more effective in rescuing arsenite-augmented direct UVR-induced DNA damage than oxidative DNA damage. Taken together, our findings indicate that arsenite interferes with PARP-1 and XPA binding to chromatin, and that zinc supplementation fully restores DNA binding activity to both proteins in the cellular context. Interestingly, rescue of arsenite-inhibited DNA damage repair by supplemental zinc was more sensitive for DNA damage repaired by the XPA-associated NER pathway than for the PARP-1-dependent BER pathway. This study expands our understanding of arsenite's role in DNA repair inhibition and co-carcinogenesis. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Structural changes induced by binding of the high-mobility group I protein to a mouse satellite DNA sequence.

    PubMed Central

    Slama-Schwok, A; Zakrzewska, K; Léger, G; Leroux, Y; Takahashi, M; Käs, E; Debey, P

    2000-01-01

    Using spectroscopic methods, we have studied the structural changes induced in both protein and DNA upon binding of the High-Mobility Group I (HMG-I) protein to a 21-bp sequence derived from mouse satellite DNA. We show that these structural changes depend on the stoichiometry of the protein/DNA complexes formed, as determined by Job plots derived from experiments using pyrene-labeled duplexes. Circular dichroism and melting temperature experiments extended in the far ultraviolet range show that while native HMG-I is mainly random coiled in solution, it adopts a beta-turn conformation upon forming a 1:1 complex in which the protein first binds to one of two dA.dT stretches present in the duplex. HMG-I structure in the 1:1 complex is dependent on the sequence of its DNA target. A 3:1 HMG-I/DNA complex can also form and is characterized by a small increase in the DNA natural bend and/or compaction coupled to a change in the protein conformation, as determined from fluorescence resonance energy transfer (FRET) experiments. In addition, a peptide corresponding to an extended DNA-binding domain of HMG-I induces an ordered condensation of DNA duplexes. Based on the constraints derived from pyrene excimer measurements, we present a model of these nucleated structures. Our results illustrate an extreme case of protein structure induced by DNA conformation that may bear on the evolutionary conservation of the DNA-binding motifs of HMG-I. We discuss the functional relevance of the structural flexibility of HMG-I associated with the nature of its DNA targets and the implications of the binding stoichiometry for several aspects of chromatin structure and gene regulation. PMID:10777751

  17. Does TATA matter? A structural exploration of the selectivity determinants in its complexes with TATA box-binding protein.

    PubMed Central

    Pastor, N; Pardo, L; Weinstein, H

    1997-01-01

    The binding of the TATA box-binding protein (TBP) to a TATA sequence in DNA is essential for eukaryotic basal transcription. TBP binds in the minor groove of DNA, causing a large distortion of the DNA helix. Given the apparent stereochemical equivalence of AT and TA basepairs in the minor groove, DNA deformability must play a significant role in binding site selection, because not all AT-rich sequences are bound effectively by TBP. To gain insight into the precise role that the properties of the TATA sequence have in determining the specificity of the DNA substrates of TBP, the solution structure and dynamics of seven DNA dodecamers have been studied by using molecular dynamics simulations. The analysis of the structural properties of basepair steps in these TATA sequences suggests a reason for the preference for alternating pyrimidine-purine (YR) sequences, but indicates that these properties cannot be the sole determinant of the sequence specificity of TBP. Rather, recognition depends on the interplay between the inherent deformability of the DNA and steric complementarity at the molecular interface. Images FIGURE 2 PMID:9251783

  18. Structure-affinity relationships for the binding of actinomycin D to DNA

    NASA Astrophysics Data System (ADS)

    Gallego, José; Ortiz, Angel R.; de Pascual-Teresa, Beatriz; Gago, Federico

    1997-03-01

    Molecular models of the complexes between actinomycin D and 14 different DNA hexamers were built based on the X-ray crystal structure of the actinomycin-d(GAAGCTTC)2 complex. The DNA sequences included the canonical GpC binding step flanked by different base pairs, nonclassical binding sites such as GpG and GpT, and sites containing 2,6-diamino- purine. A good correlation was found between the intermolecular interaction energies calculated for the refined complexes and the relative preferences of actinomycin binding to standard and modified DNA. A detailed energy decomposition into van der Waals and electrostatic components for the interactions between the DNA base pairs and either the chromophore or the peptidic part of the antibiotic was performed for each complex. The resulting energy matrix was then subjected to principal component analysis, which showed that actinomycin D discriminates among different DNA sequences by an interplay of hydrogen bonding and stacking interactions. The structure-affinity relationships for this important antitumor drug are thus rationalized and may be used to advantage in the design of novel sequence-specific DNA-binding agents.

  19. Diversification of transcription factor-DNA interactions and the evolution of gene regulatory networks.

    PubMed

    Rogers, Julia M; Bulyk, Martha L

    2018-04-25

    Sequence-specific transcription factors (TFs) bind short DNA sequences in the genome to regulate the expression of target genes. In the last decade, numerous technical advances have enabled the determination of the DNA-binding specificities of many of these factors. Large-scale screens of many TFs enabled the creation of databases of TF DNA-binding specificities, typically represented as position weight matrices (PWMs). Although great progress has been made in determining and predicting binding specificities systematically, there are still many surprises to be found when studying a particular TF's interactions with DNA in detail. Paralogous TFs' binding specificities can differ in subtle ways, in a manner that is not immediately apparent from looking at their PWMs. These differences affect gene regulatory outputs and enable TFs to rewire transcriptional networks over evolutionary time. This review discusses recent observations made in the study of TF-DNA interactions that highlight the importance of continued in-depth analysis of TF-DNA interactions and their inherent complexity. This article is categorized under: Biological Mechanisms > Regulatory Biology. © 2018 Wiley Periodicals, Inc.

  20. Direct optical mapping of transcription factor binding sites on field-stretched λ-DNA in nanofluidic devices

    PubMed Central

    Sriram, K. K.; Yeh, Jia-Wei; Lin, Yii-Lih; Chang, Yi-Ren; Chou, Chia-Fu

    2014-01-01

    Mapping transcription factor (TF) binding sites along a DNA backbone is crucial in understanding the regulatory circuits that control cellular processes. Here, we deployed a method adopting bioconjugation, nanofluidic confinement and fluorescence single molecule imaging for direct mapping of TF (RNA polymerase) binding sites on field-stretched single DNA molecules. Using this method, we have mapped out five of the TF binding sites of E. coli RNA polymerase to bacteriophage λ-DNA, where two promoter sites and three pseudo-promoter sites are identified with the corresponding binding frequency of 45% and 30%, respectively. Our method is quick, robust and capable of resolving protein-binding locations with high accuracy (∼ 300 bp), making our system a complementary platform to the methods currently practiced. It is advantageous in parallel analysis and less prone to false positive results over other single molecule mapping techniques such as optical tweezers, atomic force microscopy and molecular combing, and could potentially be extended to general mapping of protein–DNA interaction sites. PMID:24753422

  1. Identification of a Hydrophobic Cleft in the LytTR Domain of AgrA as a Locus for Small Molecule Interactions that Inhibit DNA Binding

    PubMed Central

    Leonard, Paul G.; Bezar, Ian F.; Sidote, David J.; Stock, Ann M.

    2012-01-01

    The AgrA transcription factor regulates the quorum-sensing response in Staphylococcus aureus, controlling the production of hemolysins and other virulence factors. AgrA binds to DNA via its C-terminal LytTR domain, a domain not found in humans but common in many pathogenic bacteria, making it a potential target for antimicrobial development. We have determined the crystal structure of the apo AgrA LytTR domain and screened a library of 500 fragment compounds to find inhibitors of AgrA DNA-binding activity. Using NMR, the binding site for five compounds has been mapped to a common locus at the C-terminal end of the LytTR domain, a site known to be important for DNA-binding activity. Three of these compounds inhibit AgrA DNA binding. These results provide the first evidence that LytTR domains can be targeted by small organic compounds. PMID:23181972

  2. How proteins bind to DNA: target discrimination and dynamic sequence search by the telomeric protein TRF1

    PubMed Central

    2017-01-01

    Abstract Target search as performed by DNA-binding proteins is a complex process, in which multiple factors contribute to both thermodynamic discrimination of the target sequence from overwhelmingly abundant off-target sites and kinetic acceleration of dynamic sequence interrogation. TRF1, the protein that binds to telomeric tandem repeats, faces an intriguing variant of the search problem where target sites are clustered within short fragments of chromosomal DNA. In this study, we use extensive (>0.5 ms in total) MD simulations to study the dynamical aspects of sequence-specific binding of TRF1 at both telomeric and non-cognate DNA. For the first time, we describe the spontaneous formation of a sequence-specific native protein–DNA complex in atomistic detail, and study the mechanism by which proteins avoid off-target binding while retaining high affinity for target sites. Our calculated free energy landscapes reproduce the thermodynamics of sequence-specific binding, while statistical approaches allow for a comprehensive description of intermediate stages of complex formation. PMID:28633355

  3. Biochemical investigation of yttrium(III) complex containing 1,10-phenanthroline: DNA binding and antibacterial activity.

    PubMed

    Khorasani-Motlagh, Mozhgan; Noroozifar, Meissam; Moodi, Asieh; Niroomand, Sona

    2013-03-05

    Characterization of the interaction between yttrium(III) complex containing 1,10-phenanthroline as ligand, [Y(phen)2Cl(OH2)3]Cl2⋅H2O, and DNA has been carried out by UV absorption, fluorescence spectra and viscosity measurements in order to investigate binding mode. The experimental results indicate that the yttrium(III) complex binds to DNA and absorption is decreasing in charge transfer band with the increase in amount of DNA. The binding constant (Kb) at different temperatures as well as thermodynamic parameters, enthalpy change (ΔH°) and entropy change (ΔS°), were calculated according to relevant fluorescent data and Vant' Hoff equation. The results of interaction mechanism studies, suggested that groove binding plays a major role in the binding of the complex and DNA. The activity of yttrium(III) complex against some bacteria was tested and antimicrobial screening tests shown growth inhibitory activity in the presence of yttrium(III) complex. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. Exploring the mechanism of how tvMyb2 recognizes and binds ap65-1 by molecular dynamics simulations and free energy calculations.

    PubMed

    Li, Wei-Kang; Zheng, Qing-Chuan; Zhang, Hong-Xing

    2016-01-01

    TvMyb2, one of the Myb-like transcriptional factors in Trichomonas vaginalis, binds to two closely spaced promoter sites, MRE-1/MRE-2r and MRE-2f, on the ap65-1 gene. However, detailed dynamical structural characteristics of the tvMyb2-ap65-1 complex and a detailed study of the protein in the complex have not been done. Focused on a specific tvMyb2-MRE-2-13 complex (PDB code: ) and a series of mutants K51A, R84A and R87A, we applied molecular dynamics (MD) simulation and molecular mechanics generalized Born surface area (MM-GBSA) free energy calculations to examine the role of the tvMyb2 protein in recognition interaction. The simulation results indicate that tvMyb2 becomes stable when it binds the DNA duplex. A series of mutants, K51A, R84A and R87A, have been followed, and the results of statistical analyses of the H-bond and hydrophobic contacts show that some residues have significant influence on recognition and binding to ap65-1 DNA. Our work gives important information to understand the interactions of tvMyb2 with ap65-1.

  5. Extended HSR/CARD domain mediates AIRE binding to DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maslovskaja, Julia, E-mail: julia.maslovskaja@ut.ee; Saare, Mario; Liiv, Ingrid

    Autoimmune regulator (AIRE) activates the transcription of many genes in an unusual promiscuous and stochastic manner. The mechanism by which AIRE binds to the chromatin and DNA is not fully understood, and the regulatory elements that AIRE target genes possess are not delineated. In the current study, we demonstrate that AIRE activates the expression of transiently transfected luciferase reporters that lack defined promoter regions, as well as intron and poly(A) signal sequences. Our protein-DNA interaction experiments with mutated AIRE reveal that the intact homogeneously staining region/caspase recruitment domain (HSR/CARD) and amino acids R113 and K114 are key elements involved inmore » AIRE binding to DNA. - Highlights: • Promoter and mRNA processing elements are not important for AIRE to activate gene expression from reporter plasmids. • AIRE protein fragment aa 1–138 mediates direct binding to DNA. • Integrity of the HSR/CARD domain is needed for AIRE binding to DNA.« less

  6. Mechanistic aspects of thioflavin-T self-aggregation and DNA binding: evidence for dimer attack on DNA grooves.

    PubMed

    Biancardi, A; Biver, T; Burgalassi, A; Mattonai, M; Secco, F; Venturini, M

    2014-10-07

    Thioflavin-T (TFT) is a fluorescent marker widely employed in biomedical research but the mechanism of its binding to polynucleotides has been poorly understood. This paper presents a study of the mechanisms of TFT self-aggregation and binding to DNA. Relaxation kinetics of TFT solutions show that the cyanine undergoes dimerization followed by dimer isomerisation. The interaction of TFT with DNA has been investigated using static methods, such as spectrophotometric and spectrofluorometric titrations under different conditions (salt content, temperature), fluorescence quenching, viscometric experiments and the T-jump relaxation method. The combined use of these techniques enabled us to show that the TFT monomer undergoes intercalation between the DNA base pairs and external binding according to a branched mechanism. Moreover, it has also been observed that, under dye excess conditions, the TFT dimer binds to the DNA grooves. The molecular structures of intercalated TFT and the groove-bound TFT dimer are obtained by performing QM/MM MD simulations.

  7. Activator Protein-1: redox switch controlling structure and DNA-binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yin, Zhou; Machius, Mischa; Nestler, Eric J.

    The transcription factor, activator protein-1 (AP-1), binds to cognate DNA under redox control; yet, the underlying mechanism has remained enigmatic. A series of crystal structures of the AP-1 FosB/JunD bZIP domains reveal ordered DNA-binding regions in both FosB and JunD even in absence DNA. However, while JunD is competent to bind DNA, the FosB bZIP domain must undergo a large conformational rearrangement that is controlled by a ‘redox switch’ centered on an inter-molecular disulfide bond. Solution studies confirm that FosB/JunD cannot undergo structural transition and bind DNA when the redox-switch is in the ‘OFF’ state, and show that the mid-pointmore » redox potential of the redox switch affords it sensitivity to cellular redox homeostasis. The molecular and structural studies presented here thus reveal the mechanism underlying redox-regulation of AP-1 Fos/Jun transcription factors and provide structural insight for therapeutic interventions targeting AP-1 proteins.« less

  8. Targeting the FANCJ–BRCA1 interaction promotes a switch from recombination to polη-dependent bypass

    PubMed Central

    Xie, J; Litman, R; Wang, S; Peng, M; Guillemette, S; Rooney, T; Cantor, SB

    2010-01-01

    BRCA1 and the DNA helicase FANCJ (also known as BACH1 or BRIP1) have common functions in breast cancer suppression and DNA repair. However, the functional significance of the direct interaction between BRCA1 and FANCJ remains unclear. Here, we have discovered that BRCA1 binding to FANCJ regulates DNA damage repair choice. Thus, when FANCJ binding to BRCA1 is ablated, the molecular mechanism chosen for the repair of damaged DNA is dramatically altered. Specifically, a FANCJ protein that cannot be phosphorylated at serine 990 or bind BRCA1 inhibits DNA repair via homologous recombination and promotes polη-dependent bypass. Furthermore, the polη-dependent bypass promoted by FANCJ requires the direct binding to the mismatch repair (MMR) protein, MLH1. Together, our findings implicate that in human cells BRCA1 binding to FANCJ is critical to regulate DNA repair choice and promote genomic stability. Moreover, unregulated FANCJ function could be associated with cancer and/or chemoresistance. PMID:20173781

  9. Accurate and sensitive quantification of protein-DNA binding affinity.

    PubMed

    Rastogi, Chaitanya; Rube, H Tomas; Kribelbauer, Judith F; Crocker, Justin; Loker, Ryan E; Martini, Gabriella D; Laptenko, Oleg; Freed-Pastor, William A; Prives, Carol; Stern, David L; Mann, Richard S; Bussemaker, Harmen J

    2018-04-17

    Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. Copyright © 2018 the Author(s). Published by PNAS.

  10. Accurate and sensitive quantification of protein-DNA binding affinity

    PubMed Central

    Rastogi, Chaitanya; Rube, H. Tomas; Kribelbauer, Judith F.; Crocker, Justin; Loker, Ryan E.; Martini, Gabriella D.; Laptenko, Oleg; Freed-Pastor, William A.; Prives, Carol; Stern, David L.; Mann, Richard S.; Bussemaker, Harmen J.

    2018-01-01

    Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. PMID:29610332

  11. Dipeptidyl peptidase III is a zinc metallo-exopeptidase. Molecular cloning and expression.

    PubMed Central

    Fukasawa, K; Fukasawa, K M; Kanai, M; Fujii, S; Hirose, J; Harada, M

    1998-01-01

    We have purified dipeptidyl peptidase III (EC 3.4.14.4) from human placenta. It had a pH optimum of 8.8 and readily hydrolysed Arg-Arg-beta-naphthylamide. Monoamino acid-, Gly-Phe-, Gly-Pro- and Bz-Arg-beta-naphthylamides were not hydrolysed at all. The enzyme was inhibited by p-chloromercuriphenylsulphonic acid, metal chelators and 3,4-dichloroisocoumarin and contained 1 mol of zinc per mol of enzyme. The zinc dissociation constant was 250 fM at pH 7. 4 as determined by the zinc binding study. We isolated, by immunological screening of a Uni-ZAP XR cDNA library constructed from rat liver mRNA species, a cDNA clone with 2633 bp encoding the rat enzyme. The longest open reading frame encodes a 827-residue protein with a theoretical molecular mass of 92790 Da. Escherichia coli SOLR cells were infected with the pBluescript phagemid containing the cloned cDNA and established the overexpression of a protein that hydrolysed Arg-Arg-beta-naphthylamide. The recombinant protein was purified and the amino acid sequence of the protein was confirmed. We presumed that the putative zinc-binding domain involved in catalysis was present in the recombinant enzyme. It was a novel zinc-binding motif in that one amino acid residue was inserted into the conserved HEXXH motif characteristic of the metalloproteinases. PMID:9425109

  12. Yeast aconitase binds and provides metabolically coupled protection to mitochondrial DNA.

    PubMed

    Chen, Xin Jie; Wang, Xiaowen; Butow, Ronald A

    2007-08-21

    Aconitase (Aco1p) is a multifunctional protein: It is an enzyme of the tricarboxylic acid cycle. In animal cells, Aco1p also is a cytosolic protein binding to mRNAs to regulate iron metabolism. In yeast, Aco1p was identified as a component of mtDNA nucleoids. Here we show that yeast Aco1p protects mtDNA from excessive accumulation of point mutations and ssDNA breaks and suppresses reductive recombination of mtDNA. Aconitase binds to both ds- and ssDNA, with a preference for GC-containing sequences. Therefore, mitochondria are opportunistic organelles that seize proteins, such as metabolic enzymes, for construction of the nucleoid, an mtDNA maintenance/segregation apparatus.

  13. Determining the Specificity of Cascade Binding, Interference, and Primed Adaptation In Vivo in the Escherichia coli Type I-E CRISPR-Cas System.

    PubMed

    Cooper, Lauren A; Stringer, Anne M; Wade, Joseph T

    2018-04-17

    In clustered regularly interspaced short palindromic repeat (CRISPR)-Cas (CRISPR-associated) immunity systems, short CRISPR RNAs (crRNAs) are bound by Cas proteins, and these complexes target invading nucleic acid molecules for degradation in a process known as interference. In type I CRISPR-Cas systems, the Cas protein complex that binds DNA is known as Cascade. Association of Cascade with target DNA can also lead to acquisition of new immunity elements in a process known as primed adaptation. Here, we assess the specificity determinants for Cascade-DNA interaction, interference, and primed adaptation in vivo , for the type I-E system of Escherichia coli Remarkably, as few as 5 bp of crRNA-DNA are sufficient for association of Cascade with a DNA target. Consequently, a single crRNA promotes Cascade association with numerous off-target sites, and the endogenous E. coli crRNAs direct Cascade binding to >100 chromosomal sites. In contrast to the low specificity of Cascade-DNA interactions, >18 bp are required for both interference and primed adaptation. Hence, Cascade binding to suboptimal, off-target sites is inert. Our data support a model in which the initial Cascade association with DNA targets requires only limited sequence complementarity at the crRNA 5' end whereas recruitment and/or activation of the Cas3 nuclease, a prerequisite for interference and primed adaptation, requires extensive base pairing. IMPORTANCE Many bacterial and archaeal species encode CRISPR-Cas immunity systems that protect against invasion by foreign DNA. In the Escherichia coli CRISPR-Cas system, a protein complex, Cascade, binds 61-nucleotide (nt) CRISPR RNAs (crRNAs). The Cascade complex is directed to invading DNA molecules through base pairing between the crRNA and target DNA. This leads to recruitment of the Cas3 nuclease, which destroys the invading DNA molecule and promotes acquisition of new immunity elements. We made the first in vivo measurements of Cascade binding to DNA targets. Thus, we show that Cascade binding to DNA is highly promiscuous; endogenous E. coli crRNAs can direct Cascade binding to >100 chromosomal locations. In contrast, we show that targeted degradation and acquisition of new immunity elements require highly specific association of Cascade with DNA, limiting CRISPR-Cas function to the appropriate targets. Copyright © 2018 Cooper et al.

  14. Template-directed covalent conjugation of DNA to native antibodies, transferrin and other metal-binding proteins

    NASA Astrophysics Data System (ADS)

    Rosen, Christian B.; Kodal, Anne L. B.; Nielsen, Jesper S.; Schaffert, David H.; Scavenius, Carsten; Okholm, Anders H.; Voigt, Niels V.; Enghild, Jan J.; Kjems, Jørgen; Tørring, Thomas; Gothelf, Kurt V.

    2014-09-01

    DNA-protein conjugates are important in bioanalytical chemistry, molecular diagnostics and bionanotechnology, as the DNA provides a unique handle to identify, functionalize or otherwise manipulate proteins. To maintain protein activity, conjugation of a single DNA handle to a specific location on the protein is often needed. However, preparing such high-quality site-specific conjugates often requires genetically engineered proteins, which is a laborious and technically challenging approach. Here we demonstrate a simpler method to create site-selective DNA-protein conjugates. Using a guiding DNA strand modified with a metal-binding functionality, we directed a second DNA strand to the vicinity of a metal-binding site of His6-tagged or wild-type metal-binding proteins, such as serotransferrin, where it subsequently reacted with lysine residues at that site. This method, DNA-templated protein conjugation, facilitates the production of site-selective protein conjugates, and also conjugation to IgG1 antibodies via a histidine cluster in the constant domain.

  15. Design, synthesis, and functional testing of recombinant cell penetrating peptides

    NASA Astrophysics Data System (ADS)

    Widyaningtyas, S. T.; Soebandrio, A.; Ibrahim, F.; Bela, B.

    2017-08-01

    Cell penetrating peptides (CPP) are one of the most attractive DNA delivery systems currently in development. In this research, in silico CPP development was performed based on a literature study to look for peptides that induce endosome escape, have the ability to bind DNA, and pass through cell membranes and/or nuclear membranes with a final goal of creating a new CPP to be used as a DNA delivery system. We report herein the successful isolation of three candidate CPP molecules, which have all been successfully expressed and purified by NiNTA. One of the determinants of CPP success as a DNA carrier is the ability of the CPP to bind and protect DNA from the effects of nucleases. The DNA binding test results show that all three CPPs can bind to DNA and protect it from the effects of serum nucleases. These three CPP candidates designed in silico and synthesized in the prokaryote system are eligible candidates for further testing of their ability to deliver DNA in vitro and in vivo.

  16. DNA-modified electrodes fabricated using copper-free click chemistry for enhanced protein detection.

    PubMed

    Furst, Ariel L; Hill, Michael G; Barton, Jacqueline K

    2013-12-31

    A method of DNA monolayer formation has been developed using copper-free click chemistry that yields enhanced surface homogeneity and enables variation in the amount of DNA assembled; extremely low-density DNA monolayers, with as little as 5% of the monolayer being DNA, have been formed. These DNA-modified electrodes (DMEs) were characterized visually, with AFM, and electrochemically, and were found to facilitate DNA-mediated reduction of a distally bound redox probe. These low-density monolayers were found to be more homogeneous than traditional thiol-modified DNA monolayers, with greater helix accessibility through an increased surface area-to-volume ratio. Protein binding efficiency of the transcriptional activator TATA-binding protein (TBP) was also investigated on these surfaces and compared to that on DNA monolayers formed with standard thiol-modified DNA. Our low-density monolayers were found to be extremely sensitive to TBP binding, with a signal decrease in excess of 75% for 150 nM protein. This protein was detectable at 4 nM, on the order of its dissociation constant, with our low-density monolayers. The improved DNA helix accessibility and sensitivity of our low-density DNA monolayers to TBP binding reflects the general utility of this method of DNA monolayer formation for DNA-based electrochemical sensor development.

  17. Identification of functional domains of the IR2 protein of equine herpesvirus 1 required for inhibition of viral gene expression and replication

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Seong K., E-mail: skim1@lsuhsc.edu; Kim, Seongman; Dai Gan

    2011-09-01

    The equine herpesvirus 1 (EHV-1) negative regulatory IR2 protein (IR2P), an early 1,165-amino acid (aa) truncated form of the 1487-aa immediate-early protein (IEP), lacks the trans-activation domain essential for IEP activation functions but retains domains for binding DNA, TFIIB, and TBP and the nuclear localization signal. IR2P mutants of the N-terminal region which lack either DNA-binding activity or TFIIB-binding activity were unable to down-regulate EHV-1 promoters. In EHV-1-infected cells expressing full-length IR2P, transcription and protein expression of viral regulatory IE, early EICP0, IR4, and UL5, and late ETIF genes were dramatically inhibited. Viral DNA levels were reduced to 2.1% ofmore » control infected cells, but were vey weakly affected in cells that express the N-terminal 706 residues of IR2P. These results suggest that IR2P function requires the two N-terminal domains for binding DNA and TFIIB as well as the C-terminal residues 707 to 1116 containing the TBP-binding domain. - Highlights: > We examine the functional domains of IR2P that mediates negative regulation. > IR2P inhibits at the transcriptional level. > DNA-binding mutant or TFIIB-binding mutant fails to inhibit. > C-terminal aa 707 to 1116 are required for full inhibition. > Inhibition requires the DNA-binding domain, TFIIB-binding domain, and C-terminus.« less

  18. Ligand induced stabilization of the melting temperature of the HSV-1 single-strand DNA binding protein using the thermal shift assay.

    PubMed

    Rupesh, Kanchi Ravi; Smith, Aaron; Boehmer, Paul E

    2014-11-28

    We have adapted the thermal shift assay to measure the ligand binding properties of the herpes simplex virus-1 single-strand DNA binding protein, ICP8. By measuring SYPRO Orange fluorescence in microtiter plates using a fluorescence-enabled thermal cycler, we have quantified the effects of oligonucleotide ligands on the melting temperature of ICP8. We found that single-stranded oligomers raise the melting temperature of ICP8 in a length- and concentration-dependent manner, ranging from 1°C for (dT)5 to a maximum of 9°C with oligomers ⩾10 nucleotides, with an apparent Kd of <1μM for (dT)20. Specifically, the results indicate that ICP8 is capable of interacting with oligomers as short as 5 nucleotides. Moreover, the observed increases in melting temperature of up to 9°C, indicates that single-strand DNA binding significantly stabilizes the structure of ICP8. This assay may be applied to investigate the ligand binding proteins of other single-strand DNA binding proteins and used as a high-throughput screen to identify compounds with therapeutic potential that inhibit single-strand DNA binding. As proof of concept, the single-strand DNA binding agent ciprofloxacin reduces the ligand induced stabilization of the melting temperature of ICP8 in a dose-dependent manner. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. The prion protein has RNA binding and chaperoning properties characteristic of nucleocapsid protein NCP7 of HIV-1.

    PubMed

    Gabus, C; Derrington, E; Leblanc, P; Chnaiderman, J; Dormont, D; Swietnicki, W; Morillas, M; Surewicz, W K; Marc, D; Nandi, P; Darlix, J L

    2001-06-01

    Transmissible spongiform encephalopathies are fatal neurodegenerative diseases associated with the accumulation of a protease-resistant form of the prion protein (PrP). Although PrP is conserved in vertebrates, its function remains to be identified. In vitro PrP binds large nucleic acids causing the formation of nucleoprotein complexes resembling human immunodeficiency virus type 1 (HIV-1) nucleocapsid-RNA complexes and in vivo MuLV replication accelerates the scrapie infectious process, suggesting possible interactions between retroviruses and PrP. Retroviruses, including HIV-1 encode a major nucleic acid binding protein (NC protein) found within the virus where 2000 NC protein molecules coat the dimeric genome. NC is required in virus assembly and infection to chaperone RNA dimerization and packaging and in proviral DNA synthesis by reverse transcriptase (RT). In HIV-1, 5'-leader RNA/NC interactions appear to control these viral processes. This prompted us to compare and contrast the interactions of human and ovine PrP and HIV-1 NCp7 with HIV-1 5'-leader RNA. Results show that PrP has properties characteristic of NCp7 with respect to viral RNA dimerization and proviral DNA synthesis by RT. The NC-like properties of huPrP map to the N-terminal region of huPrP. Interestingly, PrP localizes in the membrane and cytoplasm of PrP-expressing cells. These findings suggest that PrP is a multifunctional protein possibly participating in nucleic acid metabolism.

  20. Trimeric association of Hox and TALE homeodomain proteins mediates Hoxb2 hindbrain enhancer activity.

    PubMed

    Jacobs, Y; Schnabel, C A; Cleary, M L

    1999-07-01

    Pbx/exd proteins modulate the DNA binding affinities and specificities of Hox proteins and contribute to the execution of Hox-dependent developmental programs in arthropods and vertebrates. Pbx proteins also stably heterodimerize and bind DNA with Meis and Pknox1-Prep1, additional members of the TALE (three-amino-acid loop extension) superclass of homeodomain proteins that function on common genetic pathways with a subset of Hox proteins. In this study, we demonstrated that Pbx and Meis bind DNA as heterotrimeric complexes with Hoxb1 on a genetically defined Hoxb2 enhancer, r4, that mediates the cross-regulatory transcriptional effects of Hoxb1 in vivo. The DNA binding specificity of the heterotrimeric complex for r4 is mediated by a Pbx-Hox site in conjunction with a distal Meis site, which we showed to be required for ternary complex formation and Meis-enhanced transcription. Formation of heterotrimeric complexes in which all three homeodomains bind their cognate DNA sites is topologically facilitated by the ability of Pbx and Meis to interact through their amino termini and bind DNA without stringent half-site orientation and spacing requirements. Furthermore, Meis site mutation in the Hoxb2 enhancer phenocopies Pbx-Hox site mutation to abrogate enhancer-directed expression of a reporter transgene in the murine embryonic hindbrain, demonstrating that DNA binding by all three proteins is required for trimer function in vivo. Our data provide in vitro and in vivo evidence for the combinatorial regulation of Hox and TALE protein functions that are mediated, in part, by their interdependent DNA binding activities as ternary complexes. As a consequence, Hoxb1 employs Pbx and Meis-related proteins, as a pair of essential cofactors in a higher-order molecular complex, to mediate its transcriptional effects on an endogenous Hox response element.

Top