Enantioselective binding of L, D-phenylalanine to ct DNA
NASA Astrophysics Data System (ADS)
Zhang, Lijin; Xu, Jianhua; Huang, Yan; Min, Shungeng
2009-10-01
The enantioselective binding of L, D-phenylalanine to calf thymus DNA was studied by absorption, circular dichroism, fluorescence quenching, viscosity, salt effect and emission experiments. The results obtained from absorption, circular dichroism, fluorescence quenching and viscosity experiments excluded the intercalative binding and salt effect experiments did not support electrostatic binding. So the binding of L, D-phenylalanine to ct DNA should be groove binding. Furthermore, the emission spectra revealed that the binding is enantioselective.
Enantioselective binding of L,D-phenylalanine to ct DNA.
Zhang, Lijin; Xu, Jianhua; Huang, Yan; Min, Shungeng
2009-10-15
The enantioselective binding of L,D-phenylalanine to calf thymus DNA was studied by absorption, circular dichroism, fluorescence quenching, viscosity, salt effect and emission experiments. The results obtained from absorption, circular dichroism, fluorescence quenching and viscosity experiments excluded the intercalative binding and salt effect experiments did not support electrostatic binding. So the binding of l,d-phenylalanine to ct DNA should be groove binding. Furthermore, the emission spectra revealed that the binding is enantioselective.
Prakash, Aishwarya; Natarajan, Amarnath; Marky, Luis A.; Ouellette, Michel M.; Borgstahl, Gloria E. O.
2011-01-01
Replication protein A (RPA), a key player in DNA metabolism, has 6 single-stranded DNA-(ssDNA-) binding domains (DBDs) A-F. SELEX experiments with the DBDs-C, -D, and -E retrieve a 20-nt G-quadruplex forming sequence. Binding studies show that RPA-DE binds preferentially to the G-quadruplex DNA, a unique preference not observed with other RPA constructs. Circular dichroism experiments show that RPA-CDE-core can unfold the G-quadruplex while RPA-DE stabilizes it. Binding studies show that RPA-C binds pyrimidine- and purine-rich sequences similarly. This difference between RPA-C and RPA-DE binding was also indicated by the inability of RPA-CDE-core to unfold an oligonucleotide containing a TC-region 5′ to the G-quadruplex. Molecular modeling studies of RPA-DE and telomere-binding proteins Pot1 and Stn1 reveal structural similarities between the proteins and illuminate potential DNA-binding sites for RPA-DE and Stn1. These data indicate that DBDs of RPA have different ssDNA recognition properties. PMID:21772997
ERIC Educational Resources Information Center
Kugel, Jennifer F.
2008-01-01
An undergraduate biochemistry laboratory experiment that will teach the technique of fluorescence resonance energy transfer (FRET) while analyzing protein-induced DNA bending is described. The experiment uses the protein TATA binding protein (TBP), which is a general transcription factor that recognizes and binds specific DNA sequences known as…
In vitro DNA binding studies of Aspartame, an artificial sweetener.
Kashanian, Soheila; Khodaei, Mohammad Mehdi; Kheirdoosh, Fahimeh
2013-03-05
A number of small molecules bind directly and selectively to DNA, by inhibiting replication, transcription or topoisomerase activity. In this work the interaction of native calf thymus DNA (CT-DNA) with Aspartame (APM), an artificial sweeteners was studied at physiological pH. DNA binding study of APM is useful to understand APM-DNA interaction mechanism and to provide guidance for the application and design of new and safer artificial sweeteners. The interaction was investigated using spectrophotometric, spectrofluorometric competition experiment and circular dichroism (CD). Hypochromism and red shift are shown in UV absorption band of APM. A strong fluorescence quenching reaction of DNA to APM was observed and the binding constants (Kf) of DNA with APM and corresponding number of binding sites (n) were calculated at different temperatures. Thermodynamic parameters, enthalpy changes (ΔH) and entropy changes (ΔS) were calculated to be +181kJmol(-1) and +681Jmol(-1)K(-1) according to Van't Hoff equation, which indicated that reaction is predominantly entropically driven. Moreover, spectrofluorometric competition experiment and circular dichroism (CD) results are indicative of non-intercalative DNA binding nature of APM. We suggest that APM interacts with calf thymus DNA via groove binding mode with an intrinsic binding constant of 5×10(+4)M(-1). Copyright © 2013 Elsevier B.V. All rights reserved.
Foti, M; Omichinski, J G; Stahl, S; Maloney, D; West, J; Schweitzer, B I
1999-02-05
We investigate here the effects of the incorporation of the nucleoside analogs araC (1-beta-D-arabinofuranosylcytosine) and ganciclovir (9-[(1,3-dihydroxy-2-propoxy)methyl] guanine) into the DNA binding recognition sequence for the GATA-1 erythroid transcription factor. A 10-fold decrease in binding affinity was observed for the ganciclovir-substituted DNA complex in comparison to an unmodified DNA of the same sequence composition. AraC substitution did not result in any changes in binding affinity. 1H-15N HSQC and NOESY NMR experiments revealed a number of chemical shift changes in both DNA and protein in the ganciclovir-modified DNA-protein complex when compared to the unmodified DNA-protein complex. These changes in chemical shift and binding affinity suggest a change in the binding mode of the complex when ganciclovir is incorporated into the GATA DNA binding site.
Sequence-specific binding of counterions to B-DNA
Denisov, Vladimir P.; Halle, Bertil
2000-01-01
Recent studies by x-ray crystallography, NMR, and molecular simulations have suggested that monovalent counterions can penetrate deeply into the minor groove of B form DNA. Such groove-bound ions potentially could play an important role in AT-tract bending and groove narrowing, thereby modulating DNA function in vivo. To address this issue, we report here 23Na magnetic relaxation dispersion measurements on oligonucleotides, including difference experiments with the groove-binding drug netropsin. The exquisite sensitivity of this method to ions in long-lived and intimate association with DNA allows us to detect sequence-specific sodium ion binding in the minor groove AT tract of three B-DNA dodecamers. The sodium ion occupancy is only a few percent, however, and therefore is not likely to contribute importantly to the ensemble of B-DNA structures. We also report results of ion competition experiments, indicating that potassium, rubidium, and cesium ions bind to the minor groove with similarly weak affinity as sodium ions, whereas ammonium ion binding is somewhat stronger. The present findings are discussed in the light of previous NMR and diffraction studies of sequence-specific counterion binding to DNA. PMID:10639130
DNA-cisplatin binding mechanism peculiarities studied with single molecule stretching experiments
NASA Astrophysics Data System (ADS)
Crisafuli, F. A. P.; Cesconetto, E. C.; Ramos, E. B.; Rocha, M. S.
2012-02-01
We propose a method to determine the DNA-cisplatin binding mechanism peculiarities by monitoring the mechanical properties of these complexes. To accomplish this task, we have performed single molecule stretching experiments by using optical tweezers, from which the persistence and contour lengths of the complexes can be promptly measured. The persistence length of the complexes as a function of the drug total concentration in the sample was used to deduce the binding data, from which we show that cisplatin binds cooperatively to the DNA molecule, a point which so far has not been stressed in binding equilibrium studies of this ligand.
Slama-Schwok, A; Zakrzewska, K; Léger, G; Leroux, Y; Takahashi, M; Käs, E; Debey, P
2000-01-01
Using spectroscopic methods, we have studied the structural changes induced in both protein and DNA upon binding of the High-Mobility Group I (HMG-I) protein to a 21-bp sequence derived from mouse satellite DNA. We show that these structural changes depend on the stoichiometry of the protein/DNA complexes formed, as determined by Job plots derived from experiments using pyrene-labeled duplexes. Circular dichroism and melting temperature experiments extended in the far ultraviolet range show that while native HMG-I is mainly random coiled in solution, it adopts a beta-turn conformation upon forming a 1:1 complex in which the protein first binds to one of two dA.dT stretches present in the duplex. HMG-I structure in the 1:1 complex is dependent on the sequence of its DNA target. A 3:1 HMG-I/DNA complex can also form and is characterized by a small increase in the DNA natural bend and/or compaction coupled to a change in the protein conformation, as determined from fluorescence resonance energy transfer (FRET) experiments. In addition, a peptide corresponding to an extended DNA-binding domain of HMG-I induces an ordered condensation of DNA duplexes. Based on the constraints derived from pyrene excimer measurements, we present a model of these nucleated structures. Our results illustrate an extreme case of protein structure induced by DNA conformation that may bear on the evolutionary conservation of the DNA-binding motifs of HMG-I. We discuss the functional relevance of the structural flexibility of HMG-I associated with the nature of its DNA targets and the implications of the binding stoichiometry for several aspects of chromatin structure and gene regulation. PMID:10777751
Modulation of DNA binding by gene-specific transcription factors.
Schleif, Robert F
2013-10-01
The transcription of many genes, particularly in prokaryotes, is controlled by transcription factors whose activity can be modulated by controlling their DNA binding affinity. Understanding the molecular mechanisms by which DNA binding affinity is regulated is important, but because forming definitive conclusions usually requires detailed structural information in combination with data from extensive biophysical, biochemical, and sometimes genetic experiments, little is truly understood about this topic. This review describes the biological requirements placed upon DNA binding transcription factors and their consequent properties, particularly the ways that DNA binding affinity can be modulated and methods for its study. What is known and not known about the mechanisms modulating the DNA binding affinity of a number of prokaryotic transcription factors, including CAP and lac repressor, is provided.
Wiegand, Thomas; Cadalbert, Riccardo; Gardiennet, Carole; Timmins, Joanna; Terradot, Laurent; Böckmann, Anja; Meier, Beat H
2016-11-02
DnaB helicases are bacterial, ATP-driven enzymes that unwind double-stranded DNA during DNA replication. Herein, we study the sequential binding of the "non-hydrolysable" ATP analogue AMP-PNP and of single-stranded (ss) DNA to the dodecameric DnaB helicase from Helicobacter pylori using solid-state NMR. Phosphorus cross-polarization experiments monitor the binding of AMP-PNP and DNA to the helicase. 13 C chemical-shift perturbations (CSPs) are used to detect conformational changes in the protein upon binding. The helicase switches upon AMP-PNP addition into a conformation apt for ssDNA binding, and AMP-PNP is hydrolyzed and released upon binding of ssDNA. Our study sheds light on the conformational changes which are triggered by the interaction with AMP-PNP and are needed for ssDNA binding of H. pylori DnaB in vitro. They also demonstrate the level of detail solid-state NMR can provide for the characterization of protein-DNA interactions and the interplay with ATP or its analogues. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Specific and non-specific interactions of ParB with DNA: implications for chromosome segregation
Taylor, James A.; Pastrana, Cesar L.; Butterer, Annika; Pernstich, Christian; Gwynn, Emma J.; Sobott, Frank; Moreno-Herrero, Fernando; Dillingham, Mark S.
2015-01-01
The segregation of many bacterial chromosomes is dependent on the interactions of ParB proteins with centromere-like DNA sequences called parS that are located close to the origin of replication. In this work, we have investigated the binding of Bacillus subtilis ParB to DNA in vitro using a variety of biochemical and biophysical techniques. We observe tight and specific binding of a ParB homodimer to the parS sequence. Binding of ParB to non-specific DNA is more complex and displays apparent positive co-operativity that is associated with the formation of larger, poorly defined, nucleoprotein complexes. Experiments with magnetic tweezers demonstrate that non-specific binding leads to DNA condensation that is reversible by protein unbinding or force. The condensed DNA structure is not well ordered and we infer that it is formed by many looping interactions between neighbouring DNA segments. Consistent with this view, ParB is also able to stabilize writhe in single supercoiled DNA molecules and to bridge segments from two different DNA molecules in trans. The experiments provide no evidence for the promotion of non-specific DNA binding and/or condensation events by the presence of parS sequences. The implications of these observations for chromosome segregation are discussed. PMID:25572315
Das, Devashish; Faridounnia, Maryam; Kovacic, Lidija; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.
2017-01-01
The nucleotide excision repair protein complex ERCC1-XPF is required for incision of DNA upstream of DNA damage. Functional studies have provided insights into the binding of ERCC1-XPF to various DNA substrates. However, because no structure for the ERCC1-XPF-DNA complex has been determined, the mechanism of substrate recognition remains elusive. Here we biochemically characterize the substrate preferences of the helix-hairpin-helix (HhH) domains of XPF and ERCC-XPF and show that the binding to single-stranded DNA (ssDNA)/dsDNA junctions is dependent on joint binding to the DNA binding domain of ERCC1 and XPF. We reveal that the homodimeric XPF is able to bind various ssDNA sequences but with a clear preference for guanine-containing substrates. NMR titration experiments and in vitro DNA binding assays also show that, within the heterodimeric ERCC1-XPF complex, XPF specifically recognizes ssDNA. On the other hand, the HhH domain of ERCC1 preferentially binds dsDNA through the hairpin region. The two separate non-overlapping DNA binding domains in the ERCC1-XPF heterodimer jointly bind to an ssDNA/dsDNA substrate and, thereby, at least partially dictate the incision position during damage removal. Based on structural models, NMR titrations, DNA-binding studies, site-directed mutagenesis, charge distribution, and sequence conservation, we propose that the HhH domain of ERCC1 binds to dsDNA upstream of the damage, and XPF binds to the non-damaged strand within a repair bubble. PMID:28028171
Deciphering the mechanism of interaction of edifenphos with calf thymus DNA
NASA Astrophysics Data System (ADS)
Ahmad, Ajaz; Ahmad, Masood
2018-01-01
Edifenphos is an important organophosphate pesticide with many antifungal and anti-insecticidal properties but it may cause potential hazards to human health. In this work, we have tried to explore the binding mode of action and mechanism of edifenphos to calf thymus DNA (CT-DNA). Several experiments such as ultraviolet-visible absorption spectra and emission spectroscopy showed complex formation between edifenphos and CT-DNA and low binding constant values supporting groove binding mode. These results were further confirmed by circular dichroism (CD), CT-DNA melting studies, viscosity measurements, density functional theory and molecular docking. CD study suggests that edifenphos does not alter native structure of CT-DNA. Isothermal calorimetry reveals that binding of edifenphos with CT-DNA is enthalpy driven process. Competitive binding assay and effect of ionic strength showed that edifenphos binds to CT-DNA via groove binding manner. Hence, edifenphos is a minor groove binder preferably interacting with A-T regions with docking score - 6.84 kJ/mol.
Non-B-DNA structures on the interferon-beta promoter?
Robbe, K; Bonnefoy, E
1998-01-01
The high mobility group (HMG) I protein intervenes as an essential factor during the virus induced expression of the interferon-beta (IFN-beta) gene. It is a non-histone chromatine associated protein that has the dual capacity of binding to a non-B-DNA structure such as cruciform-DNA as well as to AT rich B-DNA sequences. In this work we compare the binding affinity of HMGI for a synthetic cruciform-DNA to its binding affinity for the HMGI-binding-site present in the positive regulatory domain II (PRDII) of the IFN-beta promoter. Using gel retardation experiments, we show that HMGI protein binds with at least ten times more affinity to the synthetic cruciform-DNA structure than to the PRDII B-DNA sequence. DNA hairpin sequences are present in both the human and the murine PRDII-DNAs. We discuss in this work the presence of, yet putative, non-B-DNA structures in the IFN-beta promoter.
NASA Astrophysics Data System (ADS)
Niroomand, Sona; Khorasani-Motlagh, Mozhgan; Noroozifar, Meissam; Jahani, Shohreh; Moodi, Asieh
2017-02-01
The binding of the lanthanum(III) complex containing 1,10-phenanthroline (phen), [La(phen)3Cl3·OH2], to DNA is investigated by absorption and emission methods. This complex shows absorption decreasing in a charge transfer band, and fluorescence decrement when it binds to DNA. Electronic absorption spectroscopy (UV-Vis), fluorescence spectra, iodide quenching experiments, salt effect and viscosity measurements, ethidium bromide (EB) competition test, circular dichroism (CD) spectra as well as variable temperature experiments indicate that the La(III) complex binds to fish salmon (FS) DNA, presumably via groove binding mode. The binding constants (Kb) of the La(III) complex with DNA is (2.55 ± 0.02) × 106 M-1. Furthermore, the binding site size, n, the Stern-Volmer constant KSV and thermodynamic parameters; enthalpy change (ΔH0) and entropy change (ΔS0) and Gibb's free energy (ΔG0), are calculated according to relevant fluorescent data and the Van't Hoff equation. The La(III) complex has been screened for its antibacterial activities by the disc diffusion method. Also, in order to supplement the experimental findings, DFT computation and NBO analysis are carried out.
TFBSshape: a motif database for DNA shape features of transcription factor binding sites.
Yang, Lin; Zhou, Tianyin; Dror, Iris; Mathelier, Anthony; Wasserman, Wyeth W; Gordân, Raluca; Rohs, Remo
2014-01-01
Transcription factor binding sites (TFBSs) are most commonly characterized by the nucleotide preferences at each position of the DNA target. Whereas these sequence motifs are quite accurate descriptions of DNA binding specificities of transcription factors (TFs), proteins recognize DNA as a three-dimensional object. DNA structural features refine the description of TF binding specificities and provide mechanistic insights into protein-DNA recognition. Existing motif databases contain extensive nucleotide sequences identified in binding experiments based on their selection by a TF. To utilize DNA shape information when analysing the DNA binding specificities of TFs, we developed a new tool, the TFBSshape database (available at http://rohslab.cmb.usc.edu/TFBSshape/), for calculating DNA structural features from nucleotide sequences provided by motif databases. The TFBSshape database can be used to generate heat maps and quantitative data for DNA structural features (i.e., minor groove width, roll, propeller twist and helix twist) for 739 TF datasets from 23 different species derived from the motif databases JASPAR and UniPROBE. As demonstrated for the basic helix-loop-helix and homeodomain TF families, our TFBSshape database can be used to compare, qualitatively and quantitatively, the DNA binding specificities of closely related TFs and, thus, uncover differential DNA binding specificities that are not apparent from nucleotide sequence alone.
TFBSshape: a motif database for DNA shape features of transcription factor binding sites
Yang, Lin; Zhou, Tianyin; Dror, Iris; Mathelier, Anthony; Wasserman, Wyeth W.; Gordân, Raluca; Rohs, Remo
2014-01-01
Transcription factor binding sites (TFBSs) are most commonly characterized by the nucleotide preferences at each position of the DNA target. Whereas these sequence motifs are quite accurate descriptions of DNA binding specificities of transcription factors (TFs), proteins recognize DNA as a three-dimensional object. DNA structural features refine the description of TF binding specificities and provide mechanistic insights into protein–DNA recognition. Existing motif databases contain extensive nucleotide sequences identified in binding experiments based on their selection by a TF. To utilize DNA shape information when analysing the DNA binding specificities of TFs, we developed a new tool, the TFBSshape database (available at http://rohslab.cmb.usc.edu/TFBSshape/), for calculating DNA structural features from nucleotide sequences provided by motif databases. The TFBSshape database can be used to generate heat maps and quantitative data for DNA structural features (i.e., minor groove width, roll, propeller twist and helix twist) for 739 TF datasets from 23 different species derived from the motif databases JASPAR and UniPROBE. As demonstrated for the basic helix-loop-helix and homeodomain TF families, our TFBSshape database can be used to compare, qualitatively and quantitatively, the DNA binding specificities of closely related TFs and, thus, uncover differential DNA binding specificities that are not apparent from nucleotide sequence alone. PMID:24214955
Detection of Z DNA binding proteins in tissue culture cells.
Leith, I R; Hay, R T; Russell, W C
1988-01-01
A gel electrophoresis DNA binding assay to detect Z DNA binding proteins has been developed utilising [32P] labelled poly [d(G-C)] which was converted to the Z form by incubation in 100 microM Co(NH3)6Cl3. The parameters of the assay were established using a Z DNA antibody as a model system and then applied to extracts of Hela and BHK21 cells. Using an anti-Z DNA antibody conditions were established which allowed resolution of antibody-DNA complexes and free DNA in the presence of 100 microM Co(NH3)6Cl3. The inclusion of unlabelled complementary homopolymers eliminated non-specific binding to the labelled Z-DNA probe. Competition experiments demonstrated that the assay was highly specific for double stranded non-B DNA. Application of the technique to extracts of mammalian cells demonstrated that human and hamster cells contain Z-DNA binding proteins; further characterisation by a blotting technique indicated that a 56,000 molecular weight cell protein preferentially binds Z-DNA. Images PMID:3419919
Statistical-Mechanical Studies of the Collective Binding of Proteins to DNA
NASA Astrophysics Data System (ADS)
Zhang, Houyin
My dissertation work focuses on the microscopic statistical-mechanical studies of DNA-protein interactions and mainly comprises of three projects. In living cells, binding of proteins to DNA controls gene expression and packaging of the genome. Single-DNA stretching and twisting experiments provide a powerful tool to detect binding of proteins, via detection of their modification of DNA mechanical properties. However, it is often difficult or impossible to determine the numbers of proteins bound in such experiments, especially when the proteins interact nonspecifically with DNA. In the first project, we developed single-molecule versions of classical thermodynamic Maxwell relations and proposed that these relations could be used to measure DNA-bound protein numbers, changes in DNA double-helix torque with force, and many other quantities which are hard to directly measure. This approach does not need any theoretical assumptions beyond the existence of thermodynamic equilibrium and has been used in single-DNA experiments. Many single-molecule experiments associated with DNA-bending proteins suggest the existence of cooperative interactions between adjacent DNA-bound proteins. In the second project, we studied a statistical-mechanical worm-like chain model including binding cooperativity effects and found that the intrinsic cooperativity of binding sharpens force-extension curves and causes enhancement of fluctuation of extension and protein occupation. This model also allows us to estimate the intrinsic cooperativity in experiments. We also analyzed force-generated cooperativity and found that the related interaction between proteins is always attractive. This suggests that tension in DNA in vivo could alter the distribution of proteins bound along DNA, causing chromosome refolding, or changes in gene expression. In the third project, we investigated the correlations along DNA-protein complexes. We found there are two different correlation lengths corrected to the geometry of DNA bending - the shorter “longitudinal” correlation length ξ∥(
Leger, J. F.; Robert, J.; Bourdieu, L.; Chatenay, D.; Marko, J. F.
1998-01-01
Most genetic regulatory mechanisms involve protein–DNA interactions. In these processes, the classical Watson–Crick DNA structure sometimes is distorted severely, which in turn enables the precise recognition of the specific sites by the protein. Despite its key importance, very little is known about such deformation processes. To address this general question, we have studied a model system, namely, RecA binding to double-stranded DNA. Results from micromanipulation experiments indicate that RecA binds strongly to stretched DNA; based on this observation, we propose that spontaneous thermal stretching fluctuations may play a role in the binding of RecA to DNA. This has fundamental implications for the protein–DNA binding mechanism, which must therefore rely in part on a combination of flexibility and thermal fluctuations of the DNA structure. We also show that this mechanism is sequence sensitive. Theoretical simulations support this interpretation of our experimental results, and it is argued that this is of broad relevance to DNA–protein interactions. PMID:9770480
A Colorimetric Microplate Assay for DNA-Binding Activity of His-Tagged MutS Protein.
Banasik, Michał; Sachadyn, Paweł
2016-09-01
A simple microplate method was designed for rapid testing DNA-binding activity of proteins. The principle of the assay involves binding of tested DNA by his-tagged protein immobilized on a nickel-coated ELISA plate, following colorimetric detection of biotinylated DNA with avidin conjugated to horseradish peroxidase. The method was used to compare DNA mismatch binding activities of MutS proteins from three bacterial species. The assay required relatively low amounts of tested protein (approximately 0.5-10 pmol) and DNA (0.1-10 pmol) and a relatively short time of analysis (up to 60 min). The method is very simple to apply and convenient to test different buffer conditions of DNA-protein binding. Sensitive colorimetric detection enables naked eye observations and quantitation with an ELISA reader. The performance of the assay, which we believe is a distinguishing trait of the method, is based on two strong and specific molecular interactions: binding of a his-tagged protein to a nickel-coated microplate and binding of biotinylated DNA to avidin. In the reported experiments, the solution was used to optimize the conditions for DNA mismatch binding by MutS protein; however, the approach could be implemented to test nucleic acids interactions with any protein of interest.
The Reach of Linear Protein-DNA Dimerizers
Stafford, Ryan L.; Dervan, Peter B.
2008-01-01
A protein-DNA dimerizer constructed from a DNA-binding pyrrole-imidazole polyamide and the peptide FYPWMK facilitates binding of the natural transcription factor Exd to an adjacent DNA site. Previous dimerizers have been constructed with the peptide attached to an internal pyrrole monomer in an overall branched oligomer. Linear oligomers constructed by attaching the peptide to the polyamide C-terminus expand the range of protein-DNA dimerization to six additional DNA sites. Replacing the FYPWMK hexapeptide with a WM dipeptide, which was previously functional in branched compounds, does not lead to a functional linear dimerizer. Instead, inserting an additional lysine generates a minimal, linear WMK tripeptide conjugate that maintains the activity of the larger FYPWMK dimerizers in a single DNA-binding site orientation. These studies provide insight into the importance of linker length and composition, binding site spacing and orientation, and the protein-binding domain content that are important for the optimization of protein DNA-dimerizers suitable for biological experiments. PMID:17949089
Wienk, Hans; Slootweg, Jack C.; Speerstra, Sietske; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.
2013-01-01
To maintain the integrity of the genome, multiple DNA repair systems exist to repair damaged DNA. Recognition of altered DNA, including bulky adducts, pyrimidine dimers and interstrand crosslinks (ICL), partially depends on proteins containing helix-hairpin-helix (HhH) domains. To understand how ICL is specifically recognized by the Fanconi anemia proteins FANCM and FAAP24, we determined the structure of the HhH domain of FAAP24. Although it resembles other HhH domains, the FAAP24 domain contains a canonical hairpin motif followed by distorted motif. The HhH domain can bind various DNA substrates; using nuclear magnetic resonance titration experiments, we demonstrate that the canonical HhH motif is required for double-stranded DNA (dsDNA) binding, whereas the unstructured N-terminus can interact with single-stranded DNA. Both DNA binding surfaces are used for binding to ICL-like single/double-strand junction-containing DNA substrates. A structural model for FAAP24 bound to dsDNA has been made based on homology with the translesion polymerase iota. Site-directed mutagenesis, sequence conservation and charge distribution support the dsDNA-binding model. Analogous to other HhH domain-containing proteins, we suggest that multiple FAAP24 regions together contribute to binding to single/double-strand junction, which could contribute to specificity in ICL DNA recognition. PMID:23661679
DOE Office of Scientific and Technical Information (OSTI.GOV)
Akabayov, B.; Akabayov, S; Lee , S
Gene 5 of bacteriophage T7 encodes a DNA polymerase (gp5) responsible for the replication of the phage DNA. Gp5 polymerizes nucleotides with low processivity, dissociating after the incorporation of 1 to 50 nucleotides. Thioredoxin (trx) of Escherichia coli binds tightly (Kd = 5 nM) to a unique segment in the thumb subdomain of gp5 and increases processivity. We have probed the molecular basis for the increase in processivity. A single-molecule experiment reveals differences in rates of enzymatic activity and processivity between gp5 and gp5/trx. Small angle X-ray scattering studies combined with nuclease footprinting reveal two conformations of gp5, one inmore » the free state and one upon binding to trx. Comparative analysis of the DNA binding clefts of DNA polymerases and DNA binding proteins show that the binding surface contains more hydrophobic residues than other DNA binding proteins. The balanced composition between hydrophobic and charged residues of the binding site allows for efficient sliding of gp5/trx on the DNA. We propose a model for trx-induced conformational changes in gp5 that enhance the processivity by increasing the interaction of gp5 with DNA.« less
OnTheFly: a database of Drosophila melanogaster transcription factors and their binding sites.
Shazman, Shula; Lee, Hunjoong; Socol, Yakov; Mann, Richard S; Honig, Barry
2014-01-01
We present OnTheFly (http://bhapp.c2b2.columbia.edu/OnTheFly/index.php), a database comprising a systematic collection of transcription factors (TFs) of Drosophila melanogaster and their DNA-binding sites. TFs predicted in the Drosophila melanogaster genome are annotated and classified and their structures, obtained via experiment or homology models, are provided. All known preferred TF DNA-binding sites obtained from the B1H, DNase I and SELEX methodologies are presented. DNA shape parameters predicted for these sites are obtained from a high throughput server or from crystal structures of protein-DNA complexes where available. An important feature of the database is that all DNA-binding domains and their binding sites are fully annotated in a eukaryote using structural criteria and evolutionary homology. OnTheFly thus provides a comprehensive view of TFs and their binding sites that will be a valuable resource for deciphering non-coding regulatory DNA.
Hydration Changes upon DNA Folding Studied by Osmotic Stress Experiments
Nakano, Shu-ichi; Yamaguchi, Daisuke; Tateishi-Karimata, Hisae; Miyoshi, Daisuke; Sugimoto, Naoki
2012-01-01
The thermal stability of nucleic acid structures is perturbed under the conditions that mimic the intracellular environment, typically rich in inert components and under osmotic stress. We now describe the thermodynamic stability of DNA oligonucleotide structures in the presence of high background concentrations of neutral cosolutes. Small cosolutes destabilize the basepair structures, and the DNA structures consisting of the same nearest-neighbor composition show similar thermodynamic parameters in the presence of various types of cosolutes. The osmotic stress experiments reveal that water binding to flexible loops, unstable mismatches, and an abasic site upon DNA folding are almost negligible, whereas the binding to stable mismatch pairs is significant. The studies using the basepair-mimic nucleosides and the peptide nucleic acid suggest that the sugar-phosphate backbone and the integrity of the basepair conformation make important contributions to the binding of water molecules to the DNA bases and helical grooves. The study of the DNA hydration provides the basis for understanding and predicting nucleic acid structures in nonaqueous solvent systems. PMID:22735531
NASA Astrophysics Data System (ADS)
Movahedi, Elaheh; Rezvani, Ali Reza
2018-05-01
A novel mixed-ligand Ag(I) complex, , has been synthesized and characterized by the elemental analysis, IR spectroscopy and 1HNMR. In the formula, dian and phen are N-(4,5-diazafluoren-9-ylidene)aniline and 1,10-phenanthroline, respectively. This complex also has been prepared at nano size by sonochemical technique and characterized by the FTIR and scanning electron microscopy (SEM). To evaluate the biological preferences of the Ag(I) complex and nanocomplex and verify the relationships between the structure and biological function, in vitro DNA binding and antibacterial experiments have been carried out. DNA-complex interaction has been pursued by electronic absorption titration, luminescence titration, competitive binding experiment, effect of ionic strength, thermodynamic studies, viscometric evaluation and circular dichroism spectroscopy in the physiological pH. Each compound displays significant binding trend to the CT-DNA. The mode of binding to the CT-DNA probably is a moderate intercalation mode with the partial insertion of the planar ligands between the base stacks of double-stranded DNA. The relative viscosities and circular dichroism spectra of the CT-DNA with the complex solutions, confirm the intense interactions of the Ag(I) complex and nanocomplex with DNA. An in vitro antibacterial test of the complex and nanocomplex on a series of the Gram-positive bacteria (Staphylococcus aureus, Enterococcus faecalis) and the Gram-negative bacteria (Escherichia coli, Pseudomonas aeruginosa) shows a remarkable antibacterial feature of the Ag(I) complex. The MIC values (minimum inhibitory concentration) of the compounds compare with silver nitrate and silver sulfadiazine. The bacterial inhibitions of the Ag(I) complex and nanocomplex are agreed to their DNA binding affinities.
Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I
2013-03-29
The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.
Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.
2013-01-01
The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135
DNA Mismatch Binding and Antiproliferative Activity of Rhodium Metalloinsertors
Ernst, Russell J.; Song, Hang; Barton, Jacqueline K.
2009-01-01
Deficiencies in mismatch repair (MMR) are associated with carcinogenesis. Rhodium metalloinsertors bind to DNA base mismatches with high specificity and inhibit cellular proliferation preferentially in MMR-deficient cells versus MMR-proficient cells. A family of chrysenequinone diimine complexes of rhodium with varying ancillary ligands that serve as DNA metalloinsertors has been synthesized, and both DNA mismatch binding affinities and antiproliferative activities against the human colorectal carcinoma cell lines HCT116N and HCT116O, an isogenic model system for MMR deficiency, have been determined. DNA photocleavage experiments reveal that all complexes bind to the mismatch sites with high specificities; DNA binding affinities to oligonucleotides containing single base CA and CC mismatches, obtained through photocleavage titration or competition, vary from 104 to 108 M−1 for the series of complexes. Significantly, binding affinities are found to be inversely related to ancillary ligand size and directly related to differential inhibition of the HCT116 cell lines. The observed trend in binding affinity is consistent with the metalloinsertion mode where the complex binds from the minor groove with ejection of mismatched base pairs. The correlation between binding affinity and targeting of the MMR-deficient cell line suggests that rhodium metalloinsertors exert their selective biological effects on MMR-deficient cells through mismatch binding in vivo. PMID:19175313
Zhao, Ping; Xu, Lian-Cai; Huang, Jin-Wang; Liu, Jie; Yu, Han-Cheng; Zheng, Kang-Cheng; Ji, Liang-Nian
2008-12-15
The DNA-binding affinities and DNA photocleavage abilities of cationic porphyrin, 5-(4-carboxyphenyl)-10,15,20-tris(4-methylpyridiniumyl)porphyrin (CTMPyP), and its reference compound meso-tetrakis(N-methyl-4-pyridiniumyl)porphyrin (H2TMPyP) have been investigated. The DNA-binding behaviors of the two compounds in NaH2PO4 buffer were compared systematically by using absorption, fluorescence and circular dichroism (CD) spectra, thermal denaturation as well as viscosity measurements. The experimental results show that CTMPyP binds to DNA in an outside binding mode, while H2TMPyP in an intercalative mode. Photocleavage experiments reveal that both two compounds employ 1O2-mediated mechanism in cleaving DNA and H2TMPyP can cleave DNA more efficiently than CTMPyP. Theoretical calculations were carried out with the density functional theory (DFT), and the calculated results indicate that the character and energies of some frontier orbitals of CTMPyP are quite different from those of H2TMPyP. These theoretical results can be used to explain their different DNA-binding modes and affinities to a certain extent.
Esteghamat-Panah, Roya; Hadadzadeh, Hassan; Farrokhpour, Hossein; Simpson, Jim; Abdolmaleki, Amir; Abyar, Fatemeh
2017-02-15
A new mononuclear rhodium(III) complex, [Rh(bzimpy)Cl 3 ] (bzimpy = 2,6-bis(2-benzimidazolyl)pyridine), was synthesized and characterized by elemental analysis and spectroscopic methods. The molecular structure of the complex was confirmed by single-crystal X-ray crystallography. The interaction of the complex with fish sperm DNA (FS-DNA) was investigated by UV spectroscopy, emission titration, and viscosity measurement in order to evaluate the possible DNA-binding mode and to calculate the corresponding DNA-binding constant. The results reveal that the Rh(III) complex interacts with DNA through groove binding mode with a binding affinity on the order of 10 4 . In addition, the binding of the Rh(III) complex to bovine serum albumin (BSA) was monitored by UV-Vis and fluorescence emission spectroscopy at different temperatures. The mechanism of the complex interaction was found to be static quenching. The thermodynamic parameters (ΔH, ΔS, and ΔG) obtained from the fluorescence spectroscopy data show that van der Waals interactions and hydrogen bonds play a major role in the binding of the Rh(III) complex to BSA. For the comparison of the DNA- and BSA-binding affinities of the free bzimpy ligand with its Rh(III) complex, the absorbance titration and fluorescence quenching experiments of the free bzimpy ligand with DNA and BSA were carried out. Competitive experiments using eosin Y and ibuprofen as site markers indicated that the complex was mainly located in the hydrophobic cavity of site I of the protein. These experimental results were confirmed by the results of molecular docking. Finally, the in vitro cytotoxicity properties of the Rh(III) complex against the MCF-7, K562, and HT-29 cell lines were evaluated and compared with those of the free ligand (bzimpy). It was found that the complexation process improved the anticancer activity significantly. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Fisher, Susan H; Wray, Lewis V
2008-01-22
The Bacillus subtilis GlnR repressor controls gene expression in response to nitrogen availability. Because all GlnR-regulated genes are expressed constitutively in mutants lacking glutamine synthetase (GS), GS is required for repression by GlnR. Feedback-inhibited GS (FBI-GS) was shown to activate GlnR DNA binding with an in vitro electophoretic mobility shift assay (EMSA). The activation of GlnR DNA binding by GS in these experiments depended on the feedback inhibitor glutamine and did not occur with mutant GS proteins defective in regulating GlnR activity in vivo. Although stable GS-GlnR-DNA ternary complexes were not observed in the EMSA experiments, cross-linking experiments showed that a protein-protein interaction occurs between GlnR and FBI-GS. This interaction was reduced in the absence of the feedback inhibitor glutamine and with mutant GS proteins. Because FBI-GS significantly reduced the dissociation rate of the GlnR-DNA complexes, the stability of these complexes is enhanced by FBI-GS. These results argue that FBI-GS acts as a chaperone that activates GlnR DNA binding through a transient protein-protein interaction that stabilizes GlnR-DNA complexes. GS was shown to control the activity of the B. subtilis nitrogen transcription factor TnrA by forming a stable complex between FBI-GS and TnrA that inhibits TnrA DNA binding. Thus, B. subtilis GS is an enzyme with dual catalytic and regulatory functions that uses distinct mechanisms to control the activity of two different transcription factors.
Extended HSR/CARD domain mediates AIRE binding to DNA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maslovskaja, Julia, E-mail: julia.maslovskaja@ut.ee; Saare, Mario; Liiv, Ingrid
Autoimmune regulator (AIRE) activates the transcription of many genes in an unusual promiscuous and stochastic manner. The mechanism by which AIRE binds to the chromatin and DNA is not fully understood, and the regulatory elements that AIRE target genes possess are not delineated. In the current study, we demonstrate that AIRE activates the expression of transiently transfected luciferase reporters that lack defined promoter regions, as well as intron and poly(A) signal sequences. Our protein-DNA interaction experiments with mutated AIRE reveal that the intact homogeneously staining region/caspase recruitment domain (HSR/CARD) and amino acids R113 and K114 are key elements involved inmore » AIRE binding to DNA. - Highlights: • Promoter and mRNA processing elements are not important for AIRE to activate gene expression from reporter plasmids. • AIRE protein fragment aa 1–138 mediates direct binding to DNA. • Integrity of the HSR/CARD domain is needed for AIRE binding to DNA.« less
Biancardi, A; Biver, T; Burgalassi, A; Mattonai, M; Secco, F; Venturini, M
2014-10-07
Thioflavin-T (TFT) is a fluorescent marker widely employed in biomedical research but the mechanism of its binding to polynucleotides has been poorly understood. This paper presents a study of the mechanisms of TFT self-aggregation and binding to DNA. Relaxation kinetics of TFT solutions show that the cyanine undergoes dimerization followed by dimer isomerisation. The interaction of TFT with DNA has been investigated using static methods, such as spectrophotometric and spectrofluorometric titrations under different conditions (salt content, temperature), fluorescence quenching, viscometric experiments and the T-jump relaxation method. The combined use of these techniques enabled us to show that the TFT monomer undergoes intercalation between the DNA base pairs and external binding according to a branched mechanism. Moreover, it has also been observed that, under dye excess conditions, the TFT dimer binds to the DNA grooves. The molecular structures of intercalated TFT and the groove-bound TFT dimer are obtained by performing QM/MM MD simulations.
A Comparison Study for DNA Motif Modeling on Protein Binding Microarray.
Wong, Ka-Chun; Li, Yue; Peng, Chengbin; Wong, Hau-San
2016-01-01
Transcription factor binding sites (TFBSs) are relatively short (5-15 bp) and degenerate. Identifying them is a computationally challenging task. In particular, protein binding microarray (PBM) is a high-throughput platform that can measure the DNA binding preference of a protein in a comprehensive and unbiased manner; for instance, a typical PBM experiment can measure binding signal intensities of a protein to all possible DNA k-mers (k = 8∼10). Since proteins can often bind to DNA with different binding intensities, one of the major challenges is to build TFBS (also known as DNA motif) models which can fully capture the quantitative binding affinity data. To learn DNA motif models from the non-convex objective function landscape, several optimization methods are compared and applied to the PBM motif model building problem. In particular, representative methods from different optimization paradigms have been chosen for modeling performance comparison on hundreds of PBM datasets. The results suggest that the multimodal optimization methods are very effective for capturing the binding preference information from PBM data. In particular, we observe a general performance improvement if choosing di-nucleotide modeling over mono-nucleotide modeling. In addition, the models learned by the best-performing method are applied to two independent applications: PBM probe rotation testing and ChIP-Seq peak sequence prediction, demonstrating its biological applicability.
Wang, Shuo; Aston, Karl; Koeller, Kevin J.; Harris, G. Davis; Rath, Nigam P.
2014-01-01
Hairpin polyamides (PAs) are an important class of sequence-specific DNA minor groove binders, and frequently employ a flexible motif, β-alanine (β), to reduce the molecular rigidity to maintain the DNA recognition register. To better understand the diverse effects β can have on DNA-PA binding affinity, selectivity, and especially kinetics, which have rarely been reported, we have initiated a detailed study for an eight-heterocyclic hairpin PA and its β derivatives with their cognate and mutant sequences. With these derivatives, all internal pyrroles of the parent PA are systematically substituted with single or double βs. A set of complementary experiments have been conducted to evaluate the molecular interactions in detail: UV-melting, biosensor-surface plasmon resonance, circular dichroism and isothermal titration calorimetry. The β substitutions generally weaken the binding affinities of these PAs with cognate DNA, and have large and diverse influences on PA binding kinetics in a position- and number-dependent manner. The DNA base mutations have also shown positional effects on binding of a single PA. Besides the β substitutions, the monocationic Dp group [3-(dimethylamino) propylamine] in parent PA has been modified into a dicationic Ta group (3, 3'-Diamino-N-methyldipropylamine) to minimize the frequently observed PA aggregation with ITC experiments. The results clearly show that the Ta modification not only maintains the DNA binding mode and affinity of PA, but also significantly reduces PA aggregation and allows the complete thermodynamic signature of eight-ring hairpin PA to be determined for the first time. This combined set of results significantly extends our understanding of the energetic basis of specific DNA recognition by PAs. PMID:25141096
Kelemen, Zsolt; Sebastian, Alvaro; Xu, Wenjia; Grain, Damaris; Salsac, Fabien; Avon, Alexandra; Berger, Nathalie; Tran, Joseph; Dubreucq, Bertrand; Lurin, Claire; Lepiniec, Loïc; Contreras-Moreira, Bruno; Dubos, Christian
2015-01-01
The control of growth and development of all living organisms is a complex and dynamic process that requires the harmonious expression of numerous genes. Gene expression is mainly controlled by the activity of sequence-specific DNA binding proteins called transcription factors (TFs). Amongst the various classes of eukaryotic TFs, the MYB superfamily is one of the largest and most diverse, and it has considerably expanded in the plant kingdom. R2R3-MYBs have been extensively studied over the last 15 years. However, DNA-binding specificity has been characterized for only a small subset of these proteins. Therefore, one of the remaining challenges is the exhaustive characterization of the DNA-binding specificity of all R2R3-MYB proteins. In this study, we have developed a library of Arabidopsis thaliana R2R3-MYB open reading frames, whose DNA-binding activities were assayed in vivo (yeast one-hybrid experiments) with a pool of selected cis-regulatory elements. Altogether 1904 interactions were assayed leading to the discovery of specific patterns of interactions between the various R2R3-MYB subgroups and their DNA target sequences and to the identification of key features that govern these interactions. The present work provides a comprehensive in vivo analysis of R2R3-MYB binding activities that should help in predicting new DNA motifs and identifying new putative target genes for each member of this very large family of TFs. In a broader perspective, the generated data will help to better understand how TF interact with their target DNA sequences. PMID:26484765
Takai, T; Nishita, Y; Iguchi-Ariga, S M; Ariga, H
1994-01-01
We have previously reported the human cDNA encoding MSSP-1, a sequence-specific double- and single-stranded DNA binding protein [Negishi, Nishita, Saëgusa, Kakizaki, Galli, Kihara, Tamai, Miyajima, Iguchi-Ariga and Ariga (1994) Oncogene, 9, 1133-1143]. MSSP-1 binds to a DNA replication origin/transcriptional enhancer of the human c-myc gene and has turned out to be identical with Scr2, a human protein which complements the defect of cdc2 kinase in S.pombe [Kataoka and Nojima (1994) Nucleic Acid Res., 22, 2687-2693]. We have cloned the cDNA for MSSP-2, another member of the MSSP family of proteins. The MSSP-2 cDNA shares highly homologous sequences with MSSP-1 cDNA, except for the insertion of 48 bp coding 16 amino acids near the C-terminus. Like MSSP-1, MSSP-2 has RNP-1 consensus sequences. The results of the experiments using bacterially expressed MSSP-2, and its deletion mutants, as histidine fusion proteins suggested that the binding specificity of MSSP-2 to double- and single-stranded DNA is the same as that of MSSP-1, and that the RNP consensus sequences are required for the DNA binding of the protein. MSSP-2 stimulated the DNA replication of an SV40-derived plasmid containing the binding sequence for MSSP-1 or -2. MSSP-2 is hence suggested to play an important role in regulation of DNA replication. Images PMID:7838710
A method to identify and characterize Z-DNA binding proteins using a linear oligodeoxynucleotide
NASA Technical Reports Server (NTRS)
Herbert, A. G.; Rich, A.
1993-01-01
An oligodeoxynucleotide that readily flips to the Z-DNA conformation in 10mM MgCl2 was produced by using Klenow enzyme to incorporate 5-bromodeoxycytosine and deoxyguanosine into a (dC-dG)22 template. During synthesis the oligomer can be labeled with 32P to high specific activity. The labeled oligodeoxynucleotide can be used in bandshift experiment to detect proteins that bind Z-DNA. This allows the binding specificity of such proteins to be determined with high reliability using unlabeled linear and supercoiled DNA competitors. In addition, because the radioactive oligodeoxynucleotide contains bromine atoms, DNA-protein complexes can be readily crosslinked using UV light. This allows an estimate to be made of the molecular weight of the proteins that bind to the radioactive probe. Both techniques are demonstrated using a goat polyclonal anti-Z-DNA antiserum.
Footprinting of Chlorella virus DNA ligase bound at a nick in duplex DNA.
Odell, M; Shuman, S
1999-05-14
The 298-amino acid ATP-dependent DNA ligase of Chlorella virus PBCV-1 is the smallest eukaryotic DNA ligase known. The enzyme has intrinsic specificity for binding to nicked duplex DNA. To delineate the ligase-DNA interface, we have footprinted the enzyme binding site on DNA and the DNA binding site on ligase. The size of the exonuclease III footprint of ligase bound a single nick in duplex DNA is 19-21 nucleotides. The footprint is asymmetric, extending 8-9 nucleotides on the 3'-OH side of the nick and 11-12 nucleotides on the 5'-phosphate side. The 5'-phosphate moiety is essential for the binding of Chlorella virus ligase to nicked DNA. Here we show that the 3'-OH moiety is not required for nick recognition. The Chlorella virus ligase binds to a nicked ligand containing 2',3'-dideoxy and 5'-phosphate termini, but cannot catalyze adenylation of the 5'-end. Hence, the 3'-OH is important for step 2 chemistry even though it is not itself chemically transformed during DNA-adenylate formation. A 2'-OH cannot substitute for the essential 3'-OH in adenylation at a nick or even in strand closure at a preadenylated nick. The protein side of the ligase-DNA interface was probed by limited proteolysis of ligase with trypsin and chymotrypsin in the presence and absence of nicked DNA. Protease accessible sites are clustered within a short segment from amino acids 210-225 located distal to conserved motif V. The ligase is protected from proteolysis by nicked DNA. Protease cleavage of the native enzyme prior to DNA addition results in loss of DNA binding. These results suggest a bipartite domain structure in which the interdomain segment either comprises part of the DNA binding site or undergoes a conformational change upon DNA binding. The domain structure of Chlorella virus ligase inferred from the solution experiments is consistent with the structure of T7 DNA ligase determined by x-ray crystallography.
Komor, Alexis C.; Schneider, Curtis J.; Weidmann, Alyson G.; Barton, Jacqueline K.
2013-01-01
Deficiencies in the mismatch repair (MMR) pathway are associated with several types of cancers, as well as resistance to commonly used chemotherapeutics. Rhodium metalloinsertors have been found to bind DNA mismatches with high affinity and specificity in vitro, and also exhibit cell-selective cytotoxicity, targeting MMR-deficient cells over MMR-proficient cells. Ten distinct metalloinsertors with varying lipophilicities have been synthesized and their mismatch binding affinities and biological activities determined. Although DNA photocleavage experiments demonstrate that their binding affinities are quite similar, their cell-selective antiproliferative and cytotoxic activities vary significantly. Inductively coupled plasma mass spectrometry (ICP-MS) experiments have uncovered a relationship between the subcellular distribution of these metalloinsertors and their biological activities. Specifically, we find that all of our metalloinsertors localize in the nucleus at sufficient concentrations for binding to DNA mismatches. However, the metalloinsertors with high rhodium localization in the mitochondria show toxicity that is not selective for MMR-deficient cells, whereas metalloinsertors with less mitochondrial rhodium show activity that is highly selective for MMR-deficient versus proficient cells. This work supports the notion that specific targeting of the metalloinsertors to nuclear DNA gives rise to their cell-selective cytotoxic and antiproliferative activities. The selectivity in cellular targeting depends upon binding to mismatches in genomic DNA. PMID:23137296
Structural anatomy of telomere OB proteins.
Horvath, Martin P
2011-10-01
Telomere DNA-binding proteins protect the ends of chromosomes in eukaryotes. A subset of these proteins are constructed with one or more OB folds and bind with G+T-rich single-stranded DNA found at the extreme termini. The resulting DNA-OB protein complex interacts with other telomere components to coordinate critical telomere functions of DNA protection and DNA synthesis. While the first crystal and NMR structures readily explained protection of telomere ends, the picture of how single-stranded DNA becomes available to serve as primer and template for synthesis of new telomere DNA is only recently coming into focus. New structures of telomere OB fold proteins alongside insights from genetic and biochemical experiments have made significant contributions towards understanding how protein-binding OB proteins collaborate with DNA-binding OB proteins to recruit telomerase and DNA polymerase for telomere homeostasis. This review surveys telomere OB protein structures alongside highly comparable structures derived from replication protein A (RPA) components, with the goal of providing a molecular context for understanding telomere OB protein evolution and mechanism of action in protection and synthesis of telomere DNA.
Structural anatomy of telomere OB proteins
Horvath, Martin P.
2015-01-01
Telomere DNA-binding proteins protect the ends of chromosomes in eukaryotes. A subset of these proteins are constructed with one or more OB folds and bind with G+T-rich single-stranded DNA found at the extreme termini. The resulting DNA-OB protein complex interacts with other telomere components to coordinate critical telomere functions of DNA protection and DNA synthesis. While the first crystal and NMR structures readily explained protection of telomere ends, the picture of how single-stranded DNA becomes available to serve as primer and template for synthesis of new telomere DNA is only recently coming into focus. New structures of telomere OB fold proteins alongside insights from genetic and biochemical experiments have made significant contributions towards understanding how protein-binding OB proteins collaborate with DNA-binding OB proteins to recruit telomerase and DNA polymerase for telomere homeostasis. This review surveys telomere OB protein structures alongside highly comparable structures derived from replication protein A (RPA) components, with the goal of providing a molecular context for understanding telomere OB protein evolution and mechanism of action in protection and synthesis of telomere DNA. PMID:21950380
Preferential Binding of Hot Spot Mutant p53 Proteins to Supercoiled DNA In Vitro and in Cells
Brázdová, Marie; Navrátilová, Lucie; Tichý, Vlastimil; Němcová, Kateřina; Lexa, Matej; Hrstka, Roman; Pečinka, Petr; Adámik, Matej; Vojtesek, Borivoj; Paleček, Emil; Deppert, Wolfgang; Fojta, Miroslav
2013-01-01
Hot spot mutant p53 (mutp53) proteins exert oncogenic gain-of-function activities. Binding of mutp53 to DNA is assumed to be involved in mutp53-mediated repression or activation of several mutp53 target genes. To investigate the importance of DNA topology on mutp53-DNA recognition in vitro and in cells, we analyzed the interaction of seven hot spot mutp53 proteins with topologically different DNA substrates (supercoiled, linear and relaxed) containing and/or lacking mutp53 binding sites (mutp53BS) using a variety of electrophoresis and immunoprecipitation based techniques. All seven hot spot mutp53 proteins (R175H, G245S, R248W, R249S, R273C, R273H and R282W) were found to have retained the ability of wild-type p53 to preferentially bind circular DNA at native negative superhelix density, while linear or relaxed circular DNA was a poor substrate. The preference of mutp53 proteins for supercoiled DNA (supercoil-selective binding) was further substantiated by competition experiments with linear DNA or relaxed DNA in vitro and ex vivo. Using chromatin immunoprecipitation, the preferential binding of mutp53 to a sc mutp53BS was detected also in cells. Furthermore, we have shown by luciferase reporter assay that the DNA topology influences p53 regulation of BAX and MSP/MST1 promoters. Possible modes of mutp53 binding to topologically constrained DNA substrates and their biological consequences are discussed. PMID:23555710
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Sangmin, E-mail: taeinlee2011@kangwon.ac.kr; Chung, Jeong Min; Yun, Hyung Joong
Bacterioferritin comigratory protein (BCP) is a monomeric conformer acting as a putative thiol-dependent bacterial peroxidase, however molecular basis of DNA-protection via DNA-binding has not been clearly understood. In this study, we characterized the DNA binding properties of BCP using various lengths and differently shaped architectures of DNA. An electrophoretic mobility shift assay and electron microscopy analysis showed that recombinant TkBCP bound to DNA of a circular shape (double-stranded DNA and single-stranded DNA) and a linear shape (16–1000 bp) as well as various architectures of DNA. In addition, DNA protection experiments indicated that TkBCP can protect DNA against hyperthermal and oxidative stressmore » by removing highly reactive oxygen species (ROS) or by protecting DNA from thermal degradation. Based on these results, we suggest that TkBCP is a multi-functional DNA-binding protein which has DNA chaperon and antioxidant functions. - Highlights: • Bacterioferritin comigratory protein (BCP) protects DNA from oxidative stress by reducing ROS. • TkBCP does not only scavenge ROS, but also protect DNA from hyperthermal stress. • BCP potentially adopts the multi-functional role in DNA binding activities and anti-oxidant functions.« less
Kumar, Vikash; Chatterjee, Amrita; Kumar, Nupur; Ganguly, Anasuya; Chakraborty, Indranil; Banerjee, Mainak
2014-10-09
Four new D-glucose derived m-s-m type gemini surfactants with variable spacer and tail length have been synthesized by a simple and efficient synthetic methodology utilizing the free C-3 hydroxy group of diisopropylidene glucose. The synthetic route to these gemini surfactants with a quaternary ammonium group as polar head group involves a sequence of simple reactions including alkylation, imine formation, quaternization of amine etc. The surface properties of the new geminis were evaluated by surface tension and conductivity measurements. These gemini surfactants showed low cytotoxicity by MTT assay on HeLa cell line. The DNA binding capabilities of these surfactants were determined by agarose gel electrophoresis, fluorescence titration, and DLS experiments. The preliminary studies by agarose gel electrophoresis indicated chain length dependent DNA binding abilities, further supported by ethidium bromide exclusion experiments. Two of the D-glucose derived gemini surfactants showed effective binding with pET-28a plasmid DNA (pDNA) at relatively low N/P ratio (i.e., cationic nitrogen/DNA phosphate molar ratio). Copyright © 2014 Elsevier Ltd. All rights reserved.
Barut, Burak; Demirbaş, Ümit; Özel, Arzu; Kantekin, Halit
2017-12-01
In this study, novel peripherally tetra 3-morpholinophenol substituted zinc(II) phthalocyanine (4) and its water soluble form quaternized zinc(II) phthalocyanine (ZnQ) were synthesized for the first time. These novel compounds were characterized by a combination of different spectroscopic techniques such as FT-IR, 1 H NMR, 13 C NMR, UV-vis and mass. The DNA binding of ZnQ was investigated using UV-vis absorption titration, competitive ethidium bromide, thermal denaturation and viscosity experiments that the ZnQ bound to CT-DNA via intercalation mode. ZnQ indicated photocleavage activity on supercoiled pBR322 plasmid DNA via formation of singlet oxygen under irradiation at 700nm. Besides, the topoisomerase I inhibitory effect experiments showed that ZnQ inhibited topoisomerase I enzyme in a concentration-dependent manner. The bovine serum albumin (BSA) binding experiments indicated that ZnQ bound to proteins through a static quenching mechanism. All of these results claim that ZnQ has potential agent for photodynamic therapy owing to its nucleic acid interactions and photobiological or photochemical properties. Copyright © 2017 Elsevier B.V. All rights reserved.
DNA conformational change induced by the bacteriophage phi 29 connector.
Valpuesta, J M; Serrano, M; Donate, L E; Herranz, L; Carrascosa, J L
1992-01-01
Translocation of viral DNA inwards and outwards of the capsid of double-stranded DNA bacteriophages occurs through the connector, a key viral structure that is known to interact with DNA. It is shown here that phage phi 29 connector binds both linear and circular double-stranded DNA. However, DNA-mediated protection of phi 29 connectors against Staphylococcus aureus endoprotease V8 digestion suggests that binding to linear DNA is more stable than to circular DNA. Endoprotease V8-protection assays also suggest that the length of the linear DNA required to produce a stable phi 29 connector-DNA interaction is, at least, twice longer than the phi 29 connector channel. This result is confirmed by experiments of phi 29 connector-protection of DNA against DNase I digestion. Furthermore, DNA circularization assays indicate that phi 29 connectors restrain negative supercoiling when bound to linear DNA. This DNA conformational change is not observed upon binding to circular DNA and it could reflect the existence of some left-handed DNA coiling or DNA untwisting inside of the phi 29 connector channel. Images PMID:1454519
Solution structure of CEH-37 homeodomain of the nematode Caenorhabditis elegans
DOE Office of Scientific and Technical Information (OSTI.GOV)
Moon, Sunjin; Lee, Yong Woo; Kim, Woo Taek
Highlights: •We have determined solution structures of CEH-37 homedomain. •CEH-37 HD has a compact α-helical structure with HTH DNA binding motif. •Solution structure of CEH-37 HD shares its molecular topology with that of the homeodomain proteins. •Residues in the N-terminal region and HTH motif are important in binding to Caenorhabditis elegans telomeric DNA. •CEH-37 could play an important role in telomere function via DNA binding. -- Abstract: The nematode Caenorhabditis elegans protein CEH-37 belongs to the paired OTD/OTX family of homeobox-containing homeodomain proteins. CEH-37 shares sequence similarity with homeodomain proteins, although it specifically binds to double-stranded C. elegans telomeric DNA,more » which is unusual to homeodomain proteins. Here, we report the solution structure of CEH-37 homeodomain and molecular interaction with double-stranded C. elegans telomeric DNA using nuclear magnetic resonance (NMR) spectroscopy. NMR structure shows that CEH-37 homeodomain is composed of a flexible N-terminal region and three α-helices with a helix-turn-helix (HTH) DNA binding motif. Data from size-exclusion chromatography and fluorescence spectroscopy reveal that CEH-37 homeodomain interacts strongly with double-stranded C. elegans telomeric DNA. NMR titration experiments identified residues responsible for specific binding to nematode double-stranded telomeric DNA. These results suggest that C. elegans homeodomain protein, CEH-37 could play an important role in telomere function via DNA binding.« less
Rao, Harita; Damian, Mariana S; Alshiekh, Alak; Elmroth, Sofi K C; Diederichsen, Ulf
2015-12-28
Conjugation of metal complexes with peptide scaffolds possessing high DNA binding affinity has shown to modulate their biological activities and to enhance their interaction with DNA. In this work, a platinum complex/peptide chimera was synthesized based on a model of the Integration Host Factor (IHF), an architectural protein possessing sequence specific DNA binding and bending abilities through its interaction with a minor groove. The model peptide consists of a cyclic unit resembling the minor grove binding subdomain of IHF, a positively charged lysine dendrimer for electrostatic interactions with the DNA phosphate backbone and a flexible glycine linker tethering the two units. A norvaline derived artificial amino acid was designed to contain a dimethylethylenediamine as a bidentate platinum chelating unit, and introduced into the IHF mimicking peptides. The interaction of the chimeric peptides with various DNA sequences was studied by utilizing the following experiments: thermal melting studies, agarose gel electrophoresis for plasmid DNA unwinding experiments, and native and denaturing gel electrophoresis to visualize non-covalent and covalent peptide-DNA adducts, respectively. By incorporation of the platinum metal center within the model peptide mimicking IHF we have attempted to improve its specificity and DNA targeting ability, particularly towards those sequences containing adjacent guanine residues.
Timely binding of IHF and Fis to DARS2 regulates ATP–DnaA production and replication initiation
Kasho, Kazutoshi; Fujimitsu, Kazuyuki; Matoba, Toshihiro; Oshima, Taku; Katayama, Tsutomu
2014-01-01
In Escherichia coli, the ATP-bound form of DnaA (ATP–DnaA) promotes replication initiation. During replication, the bound ATP is hydrolyzed to ADP to yield the ADP-bound form (ADP–DnaA), which is inactive for initiation. The chromosomal site DARS2 facilitates the regeneration of ATP–DnaA by catalyzing nucleotide exchange between free ATP and ADP bound to DnaA. However, the regulatory mechanisms governing this exchange reaction are unclear. Here, using in vitro reconstituted experiments, we show that two nucleoid-associated proteins, IHF and Fis, bind site-specifically to DARS2 to activate coordinately the exchange reaction. The regenerated ATP–DnaA was fully active in replication initiation and underwent DnaA–ATP hydrolysis. ADP–DnaA formed heteromultimeric complexes with IHF and Fis on DARS2, and underwent nucleotide dissociation more efficiently than ATP–DnaA. Consistently, mutant analyses demonstrated that specific binding of IHF and Fis to DARS2 stimulates the formation of ATP–DnaA production, thereby promoting timely initiation. Moreover, we show that IHF–DARS2 binding is temporally regulated during the cell cycle, whereas Fis only binds to DARS2 in exponentially growing cells. These results elucidate the regulation of ATP–DnaA and replication initiation in coordination with the cell cycle and growth phase. PMID:25378325
Measurements of nonlinear Hall-driven reconnection in the reversed field pinch
NASA Astrophysics Data System (ADS)
Tharp, Timothy D.
Complex organisms are able to develop because of the complex regulatory systems that control their gene expression. The first step in this regulation, transcription initiation, is controlled by transcription factors. Transcription factors are modular proteins composed of two distinct domains, the DNA binding domain and the regulatory domain. These molecules are involved in a plethora of important biological processes including embryogenesis, development, cell health, and cancer. Tissue enriched transcription factors Nkx-2.5 and Gata4 are involved in cardiac development and cardiac health. In this thesis the DNA binding specificity of Nkx-2.5 will be analyzed using a high throughput double stranded DNA platform called Cognate Site Identifier (CSI) arrays (Chapter 2). The full DNA binding specificity of Nkx-2.5 and Nkx-2.5 mutants will be visualized using Sequence Specificity Landscapes (SSLs). In Chapter 3, the definition of binding specificity will be investigated by evaluating a number of different DNA binding folds by CSI and SSLs. CSI and SSLs will also be used to evaluate different pyrrole/imidazole hairpin polyamides in order to better characterize these small molecule DNA binding domains. CSI and SSL data will be applied to the genome in order to explain the biological function an artificial transcription factor. Chapter 4 will discuss the mechanism of nonspecific DNA binding. The historical means of predicting DNA binding will be challenged by utilizing high throughput experiments. The effect of salt concentration on both specific and nonspecific binding will also be investigated. Finally, in Chapter 5, a generation of Protein DNA Dimerizer will be discussed. A PDD that regulates transcription on genomic DNA by binding cooperatively with the heart IF Gata4 will be characterized. These studies provide understanding of, and a means to control, how transcription factors sample the endless sea of DNA in the genome in order to regulate gene expression with such wonderful specificity.
Nagle, Padraic S; McKeever, Caitriona; Rodriguez, Fernando; Nguyen, Binh; Wilson, W David; Rozas, Isabel
2014-09-25
In this paper we report the design and biophysical evaluation of novel rigid-core symmetric and asymmetric dicationic DNA binders containing 9H-fluorene and 9,10-dihydroanthracene cores as well as the synthesis of one of these fluorene derivatives. First, the affinity toward particular DNA sequences of these compounds and flexible core derivatives was evaluated by means of surface plasmon resonance and thermal denaturation experiments finding that the position of the cations significantly influence the binding strength. Then their affinity and mode of binding were further studied by performing circular dichroism and UV studies and the results obtained were rationalized by means of DFT calculations. We found that the fluorene derivatives prepared have the ability to bind to the minor groove of certain DNA sequences and intercalate to others, whereas the dihydroanthracene compounds bind via intercalation to all the DNA sequences studied here.
Spectrophotometric study on binding of 2-thioxanthone acetic acid with ct-DNA.
Ataci, Nese; Ozcelik, Elif; Arsu, Nergis
2018-06-02
Thioxanthone and its derivatives are the most remarkable molecules due to their vast variety of application such as radiation curing that is, until using them as a therapeutic drug. Therefore, in this study it was intended to use 2-Thioxanthone acetic acid with and without NaCl in Tris HCl buffer solution (pH:7.0) to represent the interaction with ct-DNA. The UV-vis absorption spectra of TXCH 2 COOH in the presence of ct-DNA showed hypochromism and the intrinstic binding constant (K b ) was determined as 6 × 10 3 L mol -1 . The fluoresence intensity of TXCH 2 COOH with ct-DNA clearly increased up to 101% which indicated that the fluorescence intensity was very sensitive to ct-DNA concentration. The binding constant (K) and the values of number of binding sites (n) and were calculated as 1.8 × 10 3 L mol -1 and 0.69, respectively. When the quenching constants (K sv ) of free TXCH 2 COOH and TXCH 2 COOH, which were bonded with ct-DNA were compared, slightly changed values of Ksv were seen. Moreover, displacement assay with Hoechst 33,258 and viscosity measurements in the presence and absence of NaCl salt also confirmed the binding mode which noted the electrostatic interaction following groove binding between TXCH 2 COOH and ct-DNA. Last but not least, the salt effect was examined on ct-DNA binding with TXCH 2 COOH. The results of the experiments indicated that the groove binding was strengthened by NaCl whereas in the high NaCl concentration, the binding ability of TXCH 2 COOH to ct-DNA was inversely affected. Copyright © 2018 Elsevier B.V. All rights reserved.
Wessel, Sarah R; Marceau, Aimee H; Massoni, Shawn C; Zhou, Ruobo; Ha, Taekjip; Sandler, Steven J; Keck, James L
2013-06-14
Frequent collisions between cellular DNA replication complexes (replisomes) and obstacles such as damaged DNA or frozen protein complexes make DNA replication fork progression surprisingly sporadic. These collisions can lead to the ejection of replisomes prior to completion of replication, which, if left unrepaired, results in bacterial cell death. As such, bacteria have evolved DNA replication restart mechanisms that function to reload replisomes onto abandoned DNA replication forks. Here, we define a direct interaction between PriC, a key Escherichia coli DNA replication restart protein, and the single-stranded DNA-binding protein (SSB), a protein that is ubiquitously associated with DNA replication forks. PriC/SSB complex formation requires evolutionarily conserved residues from both proteins, including a pair of Arg residues from PriC and the C terminus of SSB. In vitro, disruption of the PriC/SSB interface by sequence changes in either protein blocks the first step of DNA replication restart, reloading of the replicative DnaB helicase onto an abandoned replication fork. Consistent with the critical role of PriC/SSB complex formation in DNA replication restart, PriC variants that cannot bind SSB are non-functional in vivo. Single-molecule experiments demonstrate that PriC binding to SSB alters SSB/DNA complexes, exposing single-stranded DNA and creating a platform for other proteins to bind. These data lead to a model in which PriC interaction with SSB remodels SSB/DNA structures at abandoned DNA replication forks to create a DNA structure that is competent for DnaB loading.
Adsorption of plasmid DNA on anion exchange chromatography media.
Tarmann, Christina; Jungbauer, Alois
2008-08-01
Anion exchange chromatography (AEC) is a useful and effective tool for DNA purification, but due to average pore sizes between 40 and 100 nm most AEC resins lack truly useful binding capacities for plasmid DNA (pDNA). Equilibrium binding capacities and uptake kinetics of AEC media including conventional media (Source 30 Q, Q Sepharose HP), a polymer grafted medium (Fractogel EMD DEAE (M)), media with large pores (Celbeads DEAE, PL SAX 4000 A 30 microm) and a monolithic medium (CIM-DEAE) were investigated by batch uptake or shallow bed experiments at two salt concentrations. Theoretical and experimental binding capacities suggest that the shape of the pDNA molecule can be described by a rod with a length to diameter ratio of 20:1 and that the molecule binds in upright position. The arrangement of DNA like a brush at the surface can be considered as entropy driven, kind of self-assembly process which is inherent to highly and uniformly charged DNA molecules. The initial phase of adsorption is very fast and levels off, associated with a change in mass transfer mechanism. Feed concentrations higher than 0.1 mg/mL pDNA pronounce this effect. Monolithic media showed the fastest adsorption rate and highest binding capacity with 13 mg pDNA per mL.
Gadd45a Is an RNA Binding Protein and Is Localized in Nuclear Speckles
Sytnikova, Yuliya A.; Kubarenko, Andriy V.; Schäfer, Andrea; Weber, Alexander N. R.; Niehrs, Christof
2011-01-01
Background The Gadd45 proteins play important roles in growth control, maintenance of genomic stability, DNA repair, and apoptosis. Recently, Gadd45 proteins have also been implicated in epigenetic gene regulation by promoting active DNA demethylation. Gadd45 proteins have sequence homology with the L7Ae/L30e/S12e RNA binding superfamily of ribosomal proteins, which raises the question if they may interact directly with nucleic acids. Principal Findings Here we show that Gadd45a binds RNA but not single- or double stranded DNA or methylated DNA in vitro. Sucrose density gradient centrifugation experiments demonstrate that Gadd45a is present in high molecular weight particles, which are RNase sensitive. Gadd45a displays RNase-sensitive colocalization in nuclear speckles with the RNA helicase p68 and the RNA binding protein SC35. A K45A point mutation defective in RNA binding was still active in DNA demethylation. This suggests that RNA binding is not absolutely essential for demethylation of an artificial substrate. A point mutation at G39 impared RNA binding, nuclear speckle localization and DNA demethylation, emphasizing its relevance for Gadd45a function. Significance The results implicate RNA in Gadd45a function and suggest that Gadd45a is associated with a ribonucleoprotein particle. PMID:21249130
Binding site size limit of the 2:1 pyrrole-imidazole polyamide-DNA motif.
Kelly, J J; Baird, E E; Dervan, P B
1996-01-01
Polyamides containing N-methylimidazole (Im) and N-methylpyrrole (Py) amino acids can be combined in antiparallel side-by-side dimeric complexes for sequence-specific recognition in the minor groove of DNA. Six polyamides containing three to eight rings bind DNA sites 5-10 bp in length, respectively. Quantitative DNase I footprint titration experiments demonstrate that affinity maximizes and is similar at ring sizes of five, six, and seven. Sequence specificity decreases as the length of the polyamides increases beyond five rings. These results provide useful guidelines for the design of new polyamides that bind longer DNA sites with enhanced affinity and specificity. Images Fig. 4 PMID:8692930
Solution structure and DNA-binding properties of the C-terminal domain of UvrC from E.coli
Singh, S.; Folkers, G.E.; Bonvin, A.M.J.J.; Boelens, R.; Wechselberger, R.; Niztayev, A.; Kaptein, R.
2002-01-01
The C-terminal domain of the UvrC protein (UvrC CTD) is essential for 5′ incision in the prokaryotic nucleotide excision repair process. We have determined the three-dimensional structure of the UvrC CTD using heteronuclear NMR techniques. The structure shows two helix–hairpin–helix (HhH) motifs connected by a small connector helix. The UvrC CTD is shown to mediate structure-specific DNA binding. The domain binds to a single-stranded–double-stranded junction DNA, with a strong specificity towards looped duplex DNA that contains at least six unpaired bases per loop (‘bubble DNA’). Using chemical shift perturbation experiments, the DNA-binding surface is mapped to the first hairpin region encompassing the conserved glycine–valine–glycine residues followed by lysine–arginine–arginine, a positively charged surface patch and the second hairpin region consisting of glycine–isoleucine–serine. A model for the protein– DNA complex is proposed that accounts for this specificity. PMID:12426397
Viola, Ivana L; Uberti Manassero, Nora G; Ripoll, Rodrigo; Gonzalez, Daniel H
2011-04-01
The TCP domain is a DNA-binding domain present in plant transcription factors that modulate different processes. In the present study, we show that Arabidopsis class I TCP proteins are able to interact with a dyad-symmetric sequence composed of two GTGGG half-sites. TCP20 establishes symmetric interactions with the 5' half of each strand, whereas TCP11 interacts mainly with the 3' half. SELEX (systematic evolution of ligands by exponential enrichment) experiments with TCP15 and TCP20 indicated that these proteins have similar, although not identical, DNA-binding preferences and are able to interact with non-palindromic binding sites of the type GTGGGNCCNN. TCP11 shows a different DNA-binding specificity, with a preference for the sequence GTGGGCCNNN. The distinct DNA-binding properties of TCP11 are due to the presence of a threonine residue at position 15 of the TCP domain, a position that is occupied by an arginine residue in most TCP proteins. TCP11 also forms heterodimers with TCP15 that have increased DNA-binding efficiency. The expression in plants of a repressor form of TCP11 demonstrated that this protein is a developmental regulator that influences the growth of leaves, stems and petioles, and pollen development. The results suggest that changes in DNA-binding preferences may be one of the mechanisms through which class I TCP proteins achieve functional specificity.
Fluorescence Microscopy of Nanochannel-Confined DNA.
Westerlund, Fredrik; Persson, Fredrik; Fritzsche, Joachim; Beech, Jason P; Tegenfeldt, Jonas O
2018-01-01
Stretching of DNA in nanoscale confinement allows for several important studies. The genetic contents of the DNA can be visualized on the single DNA molecule level and both the polymer physics of confined DNA and also DNA/protein and other DNA/DNA-binding molecule interactions can be explored. This chapter describes the basic steps to fabricate the nanostructures, perform the experiments and analyze the data.
DNA-bending properties of TF1.
Schneider, G J; Sayre, M H; Geiduschek, E P
1991-10-05
Transcription factor 1 (TF1) is the Bacillus subtilis phage SPO1-encoded member of the family of DNA-binding proteins that includes Escherichia coli HU and integration host factor, IHF. A gel electrophoretic retardation method has been used to show that a TF1 dimer binding to one of its preferred sites in (5-hydroxymethyl)uracil (hmUra)-containing DNA sharply bends the latter. In fact, the DNA-bending properties of TF1 and E. coli IHF are indistinguishable. Substitutions at amino acid 61 in the DNA-binding "arm" of TF1 are known to affect DNA-binding affinity and site selectivity. Experiments described here show that these substitutions also affect DNA bending. The selectivity of TF1 binding is very greatly diminished and the affinity is reduced when hmUra is replaced in DNA by thymine (T). An extension of the gel retardation method that permits an analysis of DNA bending by non-specifically bound TF1 is proposed. Under the assumptions of this analysis, the reduced affinity of TF1 for T-containing DNA is shown to be associated with bending that is still sharp. The analysis of the TF1-DNA interaction has also been extended by hydroxyl radical (.OH) and methylation interference footprinting at two DNA sites. At each of these sites, and on each strand, TF1 strongly protects three segments of DNA from attack by OH. Patches of protected DNA are centered approximately ten base-pairs apart and fall on one side of the B-helix. Methylation in either the major or minor groove in the central ten base-pairs of the two TF1 binding sites quantitatively diminishes, but does not abolish, TF1 binding. We propose that multiple protein contacts allow DNA to wrap around the relatively small TF1 dimer, considerably deforming the DNA B-helix in the process.
Biophysical Fitness Landscapes for Transcription Factor Binding Sites
Haldane, Allan; Manhart, Michael; Morozov, Alexandre V.
2014-01-01
Phenotypic states and evolutionary trajectories available to cell populations are ultimately dictated by complex interactions among DNA, RNA, proteins, and other molecular species. Here we study how evolution of gene regulation in a single-cell eukaryote S. cerevisiae is affected by interactions between transcription factors (TFs) and their cognate DNA sites. Our study is informed by a comprehensive collection of genomic binding sites and high-throughput in vitro measurements of TF-DNA binding interactions. Using an evolutionary model for monomorphic populations evolving on a fitness landscape, we infer fitness as a function of TF-DNA binding to show that the shape of the inferred fitness functions is in broad agreement with a simple functional form inspired by a thermodynamic model of two-state TF-DNA binding. However, the effective parameters of the model are not always consistent with physical values, indicating selection pressures beyond the biophysical constraints imposed by TF-DNA interactions. We find little statistical support for the fitness landscape in which each position in the binding site evolves independently, indicating that epistasis is common in the evolution of gene regulation. Finally, by correlating TF-DNA binding energies with biological properties of the sites or the genes they regulate, we are able to rule out several scenarios of site-specific selection, under which binding sites of the same TF would experience different selection pressures depending on their position in the genome. These findings support the existence of universal fitness landscapes which shape evolution of all sites for a given TF, and whose properties are determined in part by the physics of protein-DNA interactions. PMID:25010228
Shi, Lei; Jiang, Yi-Yu; Jiang, Tao; Yin, Wei; Yang, Jian-Ping; Cao, Man-Li; Fang, Yu-Qi; Liu, Hai-Yang
2017-06-29
Two new water-soluble metal carboxyl porphyrins, manganese (III) meso -tetrakis (carboxyl) porphyrin and iron (III) meso -tetrakis (carboxyl) porphyrin, were synthesized and characterized. Their interactions with ct-DNA were investigated by UV-Vis titration, fluorescence spectra, viscosity measurement and CD spectra. The results showed they can strongly bind to ct-DNA via outside binding mode. Electrophoresis experiments revealed that both complexes can cleave pBR322 DNA efficiently in the presence of hydrogen peroxide, albeit 2-Mn exhibited a little higher efficiency. The inhibitor tests suggest the oxidative DNA cleavage by these two complexes may involve hydroxyl radical active intermediates. Notably, 2-Mn exhibited considerable photocytotoxicity against Hep G2 cell via triggering a significant generation of ROS and causing disruption of MMP after irradiation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tully, D.B.; Hillman, D.; Herbert, E.
1986-05-01
Glucocorticoids negatively regulate expression of the human proopiomelanocortin (POMC) gene. It has been postulated that this effect may be modulated by a direct interaction of the glucocorticoid receptor (GR) with DNA in the vicinity of the POMC promoter. In order to investigate interactions of GR with POMC DNA, DNA-cellulose competitive binding assays have been performed using isolated fragments of cloned POMC DNA to compete with calf thymus DNA-cellulose for binding of triamcinolone acetonide affinity-labelled GR prepared from HeLa S/sub 3/ cells. In these assays, two fragments isolated from the 5' flanking sequences of POMC DNA (Fragment 3,-1765 to -677 andmore » Fragment 4, -676 to +125 with respect to the mRNA cap site) have competed favorably, with Fragment 3 consistently competing more strongly than Fragment 4. Additional studies have been conducted utilizing a newly developed South-western Blot procedure in which specific /sup 32/P-labelled DNA fragments are allowed to bind to dexamethasone mesylate labelled GR immobilized on nitrocellulose filters. Results from these studies have also shown preferential binding by POMC DNA fragments 3 and 4. DNA footprinting and gene transfer experiments are now being conducted to further characterize the nature of GR interaction with POMC DNA.« less
He, Qiye; Johnston, Jeff; Zeitlinger, Julia
2014-01-01
Understanding how eukaryotic enhancers are bound and regulated by specific combinations of transcription factors is still a major challenge. To better map transcription factor binding genome-wide at nucleotide resolution in vivo, we have developed a robust ChIP-exo protocol called ChIP experiments with nucleotide resolution through exonuclease, unique barcode and single ligation (ChIP-nexus), which utilizes an efficient DNA self-circularization step during library preparation. Application of ChIP-nexus to four proteins—human TBP and Drosophila NFkB, Twist and Max— demonstrates that it outperforms existing ChIP protocols in resolution and specificity, pinpoints relevant binding sites within enhancers containing multiple binding motifs and allows the analysis of in vivo binding specificities. Notably, we show that Max frequently interacts with DNA sequences next to its motif, and that this binding pattern correlates with local DNA sequence features such as DNA shape. ChIP-nexus will be broadly applicable to studying in vivo transcription factor binding specificity and its relationship to cis-regulatory changes in humans and model organisms. PMID:25751057
DNA residence time is a regulatory factor of transcription repression
Clauß, Karen; Popp, Achim P.; Schulze, Lena; Hettich, Johannes; Reisser, Matthias; Escoter Torres, Laura; Uhlenhaut, N. Henriette
2017-01-01
Abstract Transcription comprises a highly regulated sequence of intrinsically stochastic processes, resulting in bursts of transcription intermitted by quiescence. In transcription activation or repression, a transcription factor binds dynamically to DNA, with a residence time unique to each factor. Whether the DNA residence time is important in the transcription process is unclear. Here, we designed a series of transcription repressors differing in their DNA residence time by utilizing the modular DNA binding domain of transcription activator-like effectors (TALEs) and varying the number of nucleotide-recognizing repeat domains. We characterized the DNA residence times of our repressors in living cells using single molecule tracking. The residence times depended non-linearly on the number of repeat domains and differed by more than a factor of six. The factors provoked a residence time-dependent decrease in transcript level of the glucocorticoid receptor-activated gene SGK1. Down regulation of transcription was due to a lower burst frequency in the presence of long binding repressors and is in accordance with a model of competitive inhibition of endogenous activator binding. Our single molecule experiments reveal transcription factor DNA residence time as a regulatory factor controlling transcription repression and establish TALE-DNA binding domains as tools for the temporal dissection of transcription regulation. PMID:28977492
Structure and DNA-binding of meiosis-specific protein Hop2
NASA Astrophysics Data System (ADS)
Zhou, Donghua; Moktan, Hem; Pezza, Roberto
2014-03-01
Here we report structure elucidation of the DNA binding domain of homologous pairing protein 2 (Hop2), which is important to gene diversity when sperms and eggs are produced. Together with another protein Mnd1, Hop2 enhances the strand invasion activity of recombinase Dmc1 by over 30 times, facilitating proper synapsis of homologous chromosomes. However, the structural and biochemical bases for the function of Hop2 and Mnd1 have not been well understood. As a first step toward such understanding, we recently solved the structure for the N-terminus of Hop2 (1-84) using solution NMR. This fragment shows a typical winged-head conformation with recognized DNA binding activity. DNA interacting sites were then investigated by chemical shift perturbations in a titration experiment. Information of these sites was used to guide protein-DNA docking with MD simulation, revealing that helix 3 is stably lodged in the DNA major groove and that wing 1 (connecting strands 2 and 3) transiently comes in contact with the minor groove in nanosecond time scale. Mutagenesis analysis further confirmed the DNA binding sites in this fragment of the protein.
Timely binding of IHF and Fis to DARS2 regulates ATP-DnaA production and replication initiation.
Kasho, Kazutoshi; Fujimitsu, Kazuyuki; Matoba, Toshihiro; Oshima, Taku; Katayama, Tsutomu
2014-12-01
In Escherichia coli, the ATP-bound form of DnaA (ATP-DnaA) promotes replication initiation. During replication, the bound ATP is hydrolyzed to ADP to yield the ADP-bound form (ADP-DnaA), which is inactive for initiation. The chromosomal site DARS2 facilitates the regeneration of ATP-DnaA by catalyzing nucleotide exchange between free ATP and ADP bound to DnaA. However, the regulatory mechanisms governing this exchange reaction are unclear. Here, using in vitro reconstituted experiments, we show that two nucleoid-associated proteins, IHF and Fis, bind site-specifically to DARS2 to activate coordinately the exchange reaction. The regenerated ATP-DnaA was fully active in replication initiation and underwent DnaA-ATP hydrolysis. ADP-DnaA formed heteromultimeric complexes with IHF and Fis on DARS2, and underwent nucleotide dissociation more efficiently than ATP-DnaA. Consistently, mutant analyses demonstrated that specific binding of IHF and Fis to DARS2 stimulates the formation of ATP-DnaA production, thereby promoting timely initiation. Moreover, we show that IHF-DARS2 binding is temporally regulated during the cell cycle, whereas Fis only binds to DARS2 in exponentially growing cells. These results elucidate the regulation of ATP-DnaA and replication initiation in coordination with the cell cycle and growth phase. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
NASA Astrophysics Data System (ADS)
Afrin, Shumaila; Rahman, Yusra; Sarwar, Tarique; Husain, Mohammed Amir; Ali, Abad; Shamsuzzaman; Tabish, Mohammad
2017-11-01
Ticlopidine is an anti-platelet drug which belongs to the thienopyridine structural family and exerts its effect by functioning as an ADP receptor inhibitor. Ticlopidine inhibits the expression of TarO gene in S. aureus and may provide protection against MRSA. Groove binding agents are known to disrupt the transcription factor DNA complex and consequently inhibit gene expression. Understanding the mechanism of interaction of ticlopidine with DNA can prove useful in the development of a rational drug designing system. At present, there is no such study on the interaction of anti-platelet drugs with nucleic acids. A series of biophysical experiments were performed to ascertain the binding mode between ticlopidine and calf thymus DNA. UV-visible and fluorescence spectroscopic experiments confirmed the formation of a complex between ticlopidine and calf thymus DNA. Moreover, the values of binding constant were found to be in the range of 103 M- 1, which is indicative of groove binding between ticlopidine and calf thymus DNA. These results were further confirmed by studying the effect of denaturation on double stranded DNA, iodide quenching, viscometric studies, thermal melting profile as well as CD spectral analysis. The thermodynamic profile of the interaction was also determined using isothermal titration calorimetric studies. The reaction was found to be endothermic and the parameters obtained were found to be consistent with those of known groove binders. In silico molecular docking studies further corroborated well with the experimental results.
Daughdrill, Gary W; Buchko, Garry W; Botuyan, Maria V; Arrowsmith, Cheryl; Wold, Marc S; Kennedy, Michael A; Lowry, David F
2003-07-15
Replication protein A (RPA) is a heterotrimeric single-stranded DNA- (ssDNA) binding protein that can form a complex with the xeroderma pigmentosum group A protein (XPA). This complex can preferentially recognize UV-damaged DNA over undamaged DNA and has been implicated in the stabilization of open complex formation during nucleotide excision repair. In this report, nuclear magnetic resonance (NMR) spectroscopy was used to investigate the interaction between a fragment of the 70 kDa subunit of human RPA, residues 1-326 (hRPA70(1-326)), and a fragment of the human XPA protein, residues 98-219 (XPA-MBD). Intensity changes were observed for amide resonances in the (1)H-(15)N correlation spectrum of uniformly (15)N-labeled hRPA70(1-326) after the addition of unlabeled XPA-MBD. The intensity changes observed were restricted to an ssDNA-binding domain that is between residues 183 and 296 of the hRPA70(1-326) fragment. The hRPA70(1-326) residues with the largest resonance intensity reductions were mapped onto the structure of the ssDNA-binding domain to identify the binding surface with XPA-MBD. The XPA-MBD-binding surface showed significant overlap with an ssDNA-binding surface that was previously identified using NMR spectroscopy and X-ray crystallography. Overlapping XPA-MBD- and ssDNA-binding sites on hRPA70(1-326) suggests that a competitive binding mechanism mediates the formation of the RPA-XPA complex. To determine whether a ternary complex could form between hRPA70(1-326), XPA-MBD and ssDNA, a (1)H-(15)N correlation spectrum was acquired for uniformly (15)N-labeled hRPA70(1-326) after the simultaneous addition of unlabeled XPA-MBD and ssDNA. In this experiment, the same chemical shift perturbations were observed for hRPA70(1-326) in the presence of XPA-MBD and ssDNA as was previously observed in the presence of ssDNA alone. The ability of ssDNA to compete with XPA-MBD for an overlapping binding site on hRPA70(1-326) suggests that any complex formation between RPA and XPA that involves the interaction between XPA-MBD and hRPA70(1-326) may be modulated by ssDNA.
Daughdrill, Gary W.; Buchko, Garry W.; Botuyan, Maria V.; Arrowsmith, Cheryl; Wold, Marc S.; Kennedy, Michael A.; Lowry, David F.
2003-01-01
Replication protein A (RPA) is a heterotrimeric single-stranded DNA- (ssDNA) binding protein that can form a complex with the xeroderma pigmentosum group A protein (XPA). This complex can preferentially recognize UV-damaged DNA over undamaged DNA and has been implicated in the stabilization of open complex formation during nucleotide excision repair. In this report, nuclear magnetic resonance (NMR) spectroscopy was used to investigate the interaction between a fragment of the 70 kDa subunit of human RPA, residues 1–326 (hRPA701–326), and a fragment of the human XPA protein, residues 98–219 (XPA-MBD). Intensity changes were observed for amide resonances in the 1H–15N correlation spectrum of uniformly 15N-labeled hRPA701–326 after the addition of unlabeled XPA-MBD. The intensity changes observed were restricted to an ssDNA-binding domain that is between residues 183 and 296 of the hRPA701–326 fragment. The hRPA701–326 residues with the largest resonance intensity reductions were mapped onto the structure of the ssDNA-binding domain to identify the binding surface with XPA-MBD. The XPA-MBD-binding surface showed significant overlap with an ssDNA-binding surface that was previously identified using NMR spectroscopy and X-ray crystallography. Overlapping XPA-MBD- and ssDNA-binding sites on hRPA701–326 suggests that a competitive binding mechanism mediates the formation of the RPA–XPA complex. To determine whether a ternary complex could form between hRPA701–326, XPA-MBD and ssDNA, a 1H–15N correlation spectrum was acquired for uniformly 15N-labeled hRPA701–326 after the simultaneous addition of unlabeled XPA-MBD and ssDNA. In this experiment, the same chemical shift perturbations were observed for hRPA701–326 in the presence of XPA-MBD and ssDNA as was previously observed in the presence of ssDNA alone. The ability of ssDNA to compete with XPA-MBD for an overlapping binding site on hRPA701–326 suggests that any complex formation between RPA and XPA that involves the interaction between XPA-MBD and hRPA701–326 may be modulated by ssDNA. PMID:12853635
Studies of interaction of emodin and DNA in the presence of ethidium bromide by spectroscopic method
NASA Astrophysics Data System (ADS)
Bi, Shuyun; Zhang, Hanqi; Qiao, Chunyu; Sun, Ying; Liu, Chunming
2008-01-01
Emodin interacting with deoxyribonucleic acid (DNA) has been studied by different spectroscopic techniques, such as fluorescence, ultraviolet and visible (UV-vis), and fourier transform infared (FT-IR) spectroscopies, using ethidium bromide (EB) as a fluorescence probe of DNA. The decrease in the fluorescence of DNA-EB system on addition of emodin shows that the fluorescence quenching of DNA-EB complex by emodin occurs. The binding constants of emodin with DNA in the presence of EB are 6.02 × 10 4, 9.20 × 10 4 and 1.17 × 10 5 L mol -1 at 20, 35 and 50 °C, respectively. FT-IR spectrum further suggests that both the phosphate groups and the bases of DNA react with emodin. The reaction of DNA with emodin in the presence of EB is affected by ionic strength and temperature. The values of melting temperature ( Tm) of DNA-EB complex and emodin-DNA-EB complexes were determined, respectively. From the experiment evidences, the major binding mode of emodin with DNA should be the groove binding.
Hybrid Methods Reveal Multiple Flexibly Linked DNA Polymerases within the Bacteriophage T7 Replisome
Wallen, Jamie R.; Zhang, Hao; Weis, Caroline; ...
2017-01-03
The physical organization of DNA enzymes at a replication fork enables efficient copying of two antiparallel DNA strands, yet dynamic protein interactions within the replication complex complicate replisome structural studies. We employed a combination of crystallographic, native mass spectrometry and small-angle X-ray scattering experiments to capture alternative structures of a model replication system encoded by bacteriophage T7. then, the two molecules of DNA polymerase bind the ring-shaped primase-helicase in a conserved orientation and provide structural insight into how the acidic C-terminal tail of the primase-helicase contacts the DNA polymerase to facilitate loading of the polymerase onto DNA. A third DNA polymerasemore » binds the ring in an offset manner that may enable polymerase exchange during replication. Alternative polymerase binding modes are also detected by small-angle X-ray scattering with DNA substrates present. The collective results unveil complex motions within T7 replisome higher-order structures that are underpinned by multivalent protein-protein interactions with functional implications.« less
Hybrid Methods Reveal Multiple Flexibly Linked DNA Polymerases within the Bacteriophage T7 Replisome
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wallen, Jamie R.; Zhang, Hao; Weis, Caroline
The physical organization of DNA enzymes at a replication fork enables efficient copying of two antiparallel DNA strands, yet dynamic protein interactions within the replication complex complicate replisome structural studies. We employed a combination of crystallographic, native mass spectrometry and small-angle X-ray scattering experiments to capture alternative structures of a model replication system encoded by bacteriophage T7. then, the two molecules of DNA polymerase bind the ring-shaped primase-helicase in a conserved orientation and provide structural insight into how the acidic C-terminal tail of the primase-helicase contacts the DNA polymerase to facilitate loading of the polymerase onto DNA. A third DNA polymerasemore » binds the ring in an offset manner that may enable polymerase exchange during replication. Alternative polymerase binding modes are also detected by small-angle X-ray scattering with DNA substrates present. The collective results unveil complex motions within T7 replisome higher-order structures that are underpinned by multivalent protein-protein interactions with functional implications.« less
Dummitt, Benjamin; Chang, Yie-Hwa
2006-06-01
Quantitation of the level or activity of specific proteins is one of the most commonly performed experiments in biomedical research. Protein detection has historically been difficult to adapt to high throughput platforms because of heavy reliance upon antibodies for protein detection. Molecular beacons for DNA binding proteins is a recently developed technology that attempts to overcome such limitations. Protein detection is accomplished using inexpensive, easy-to-synthesize oligonucleotides, accompanied by a fluorescence readout. Importantly, detection of the protein and reporting of the signal occur simultaneously, allowing for one-step protocols and increased potential for use in high throughput analysis. While the initial iteration of the technology allowed only for the detection of sequence-specific DNA binding proteins, more recent adaptations allow for the possibility of development of beacons for any protein, independent of native DNA binding activity. Here, we discuss the development of the technology, the mechanism of the reaction, and recent improvements and modifications made to improve the assay in terms of sensitivity, potential for multiplexing, and broad applicability.
Evers, R; Grummt, I
1995-01-01
Both the DNA elements and the nuclear factors that direct termination of ribosomal gene transcription exhibit species-specific differences. Even between mammals--e.g., human and mouse--the termination signals are not identical and the respective transcription termination factors (TTFs) which bind to the terminator sequence are not fully interchangeable. To elucidate the molecular basis for this species-specificity, we have cloned TTF-I from human and mouse cells and compared their structural and functional properties. Recombinant TTF-I exhibits species-specific DNA binding and terminates transcription both in cell-free transcription assays and in transfection experiments. Chimeric constructs of mouse TTF-I and human TTF-I reveal that the major determinant for species-specific DNA binding resides within the C terminus of TTF-I. Replacing 31 C-terminal amino acids of mouse TTF-I with the homologous human sequences relaxes the DNA-binding specificity and, as a consequence, allows the chimeric factor to bind the human terminator sequence and to specifically stop rDNA transcription. Images Fig. 2 Fig. 3 Fig. 4 PMID:7597036
Wang, Gongke; Li, Xiangrong; Gou, Yaping; Chen, Yuhan; Yan, Changling; Lu, Yan
2013-10-01
The binding properties of two medicinally important dihydropyrimidinones derivatives 5-(Ethoxycarbonyl)-6-methyl-4-phenyl-3,4-dihydropyrimidin-2(1H)-one (EMPD) and 5-(Ethoxycarbonyl)-6-methyl-4-(4-chlorophenyl)-3,4-dihydropyrimidin-2(1H)-one (EMCD) with calf-thymus DNA (ctDNA) were investigated by spectroscopy, viscosity, isothermal titration calorimetry (ITC) and molecular modeling techniques. Simultaneously, their biological activities were evaluated with MTT assay method. The binding constants determined with spectroscopic titration and ITC were found to be in the same order of 10(4)M(-1). According to the results of viscosity studies, fluorescence competitive binding experiment and ITC investigations, intercalative binding was evaluated as the dominant binding modes between the two compounds and ctDNA. Furthermore, the results of molecular modeling corroborated those obtained from spectroscopic, viscosimetric and ITC investigations. Evaluation of the antitumor activities of the two derivatives against different tumor cell lines proved that they exhibited significant tumor cell inhibition rate, accordingly blocking DNA transcription and replication. The present results favor the development of potential drugs related with dihydropyrimidinones derivatives in the treatment of some diseases. Copyright © 2013 Elsevier B.V. All rights reserved.
Carlini, Leslie E; Getz, Michael J; Strauch, Arthur R; Kelm, Robert J
2002-03-08
An asymmetric polypurine-polypyrimidine cis-element located in the 5' region of the mouse vascular smooth muscle alpha-actin gene serves as a binding site for multiple proteins with specific affinity for either single- or double-stranded DNA. Here, we test the hypothesis that single-stranded DNA-binding proteins are responsible for preventing a cryptic MCAT enhancer centered within this element from cooperating with a nearby serum response factor-interacting CArG motif to trans-activate the minimal promoter in fibroblasts and smooth muscle cells. DNA binding studies revealed that the core MCAT sequence mediates binding of transcription enhancer factor-1 to the double-stranded polypurine-polypyrimidine element while flanking nucleotides account for interaction of Pur alpha and Pur beta with the purine-rich strand and MSY1 with the complementary pyrimidine-rich strand. Mutations that selectively impaired high affinity single-stranded DNA binding by fibroblast or smooth muscle cell-derived Pur alpha, Pur beta, and MSY1 in vitro, released the cryptic MCAT enhancer from repression in transfected cells. Additional experiments indicated that Pur alpha, Pur beta, and MSY1 also interact specifically, albeit weakly, with double-stranded DNA and with transcription enhancer factor-1. These results are consistent with two plausible models of cryptic MCAT enhancer regulation by Pur alpha, Pur beta, and MSY1 involving either competitive single-stranded DNA binding or masking of MCAT-bound transcription enhancer factor-1.
NASA Astrophysics Data System (ADS)
Xu, Liang; Hu, Yan-Xi; Li, Yan-Cheng; Zhang, Li; Ai, Hai-Xin; Liu, Yu-Feng; Liu, Hong-Sheng
2018-02-01
In the present work, the binding interaction between lenalidomide (LEN) and calf thymus DNA (ct-DNA) was systematically studied by using fluorescence, ultraviolet-visible (UV-vis) absorption, circular dichroism (CD) spectroscopies under imitated physiological conditions (pH = 7.4) coupled with molecular docking. It was found that LEN was bound to ct-DNA with high binding affinity (Ka = 2.308 × 105 M-1 at 283 K) through groove binding as evidenced by a slight decrease in the absorption intensity in combination with CD spectra. Thermodynamic parameters (ΔG < 0, ΔH > 0 and ΔS < 0) of the LEN-DNA system obtained at three different temperatures suggested that the binding process was spontaneous and was primarily driven by hydrogen bonds and hydrophobic interaction. Furthermore, competitive binding experiments with ethidium bromide and 4‧, 6-dia-midino-2-phenylindoleas probes showed that LEN could preferentially bind in the minor groove of double-stranded DNA. The average lifetime of LEN was calculated to be 7.645 ns. The φ of LEN was measured as 0.09 and non-radiation energy transfer between LEN and DNA had occurred. The results of the molecular docking were consistent with the experimental results. This study explored the potential applicability of the spectroscopic properties of LEN and also investigated its interactions with relevant biological targets. In addition, it will provide some theoretical references for the deep research of simultaneous administration of LEN with other drugs.
Interactions of vitamin K3 with herring-sperm DNA using spectroscopy and electrochemistry.
Huang, Jianhang; Wang, Xingming; Fei, Dan; Ding, Lisheng
2010-10-01
By means of ultraviolet-visible (UV-Vis) and fluorescence spectra, the binding ratio between vitamin K(3) and herring-sperm DNA in a physiological pH environment (pH = 7.40) was determined as n(K3):n(DNA) = 2:1, and the binding constants of vitamin K(3) binding to DNA at different temperatures were determined as K(θ)(298K) = 1.28 × 10(5) L·mol(-1) and K(θ)(310K) = 7.19 × 10(4) L·mol(-1), which were confirmed using the double reciprocal method are Δ(r)H(m)(θ) = -3.57 × 10(4) J·mol(-1), Δ(r)G(m)(θ) = -2.92 × 10(4) J·mol(-1), and Δ(r)S(m)(θ) = 217.67 J·mol(-1)K(-1). The driving power of this process was enthalpy. An intercalation binding of the vitamin K(3) with DNA was supported by a competitive experiment using acridine orange (AO) as a spectral probe. By combination analysis of the Scatchard method and cyclic voltammetry, we suggested that the interaction mode between vitamin K(3) and herring-sperm DNA would be a mixed mode. The quinonoid, duality fused-ring of vitamin K(3) can intercalate into the base pairs of DNA, and there is an electrostatic binding along with intercalation binding.
Yuan, Jipei; Guo, Weiwei; Yang, Xiurong; Wang, Erkang
2009-01-01
A sensing system based on the photoinduced electron transfer of quantum dots (QDs) was designed to measure the interaction of anticancer drug and DNA, taking mitoxantrone (MTX) as a model drug. MTX adsorbed on the surface of QDs can quench the photoluminescence (PL) of QDs through the photoinduced electron-transfer process; and then the addition of DNA will bring the restoration of QDs PL intensity, as DNA can bind with MTX and remove it from QDs. Sensitive detection of MTX with the detection limit of 10 nmol L(-1) and a linear detection range from 10 nmol L(-1) to 4.5 micromol L(-1) was achieved. The dependence of PL intensity on DNA amount was successfully utilized to investigate the interactions between MTX and DNA. Both the binding constants and the sizes of binding site of MTX-DNA interactions were calculated based on the equations deduced for the PL recovery process. The binding constant obtained in our experiment was generally consistent with previous reports. The sensitive and speedy detection of MTX as well as the avoidance of modification or immobilization process made this system suitable and promising in the drug-DNA interaction studies.
Drug-DNA interactions at single molecule level: A view with optical tweezers
NASA Astrophysics Data System (ADS)
Paramanathan, Thayaparan
Studies of small molecule--DNA interactions are essential for developing new drugs for challenging diseases like cancer and HIV. The main idea behind developing these molecules is to target and inhibit the reproduction of the tumor cells and infected cells. We mechanically manipulate single DNA molecule using optical tweezers to investigate two molecules that have complex and multiple binding modes. Mononuclear ruthenium complexes have been extensively studied as a test for rational drug design. Potential drug candidates should have high affinity to DNA and slow dissociation kinetics. To achieve this, motifs of the ruthenium complexes are altered. Our collaborators designed a dumb-bell shaped binuclear ruthenium complex that can only intercalate DNA by threading through its bases. Studying the binding properties of this complex in bulk studies took hours. By mechanically manipulating a single DNA molecule held with optical tweezers, we lower the barrier to thread and make it fast compared to the bulk experiments. Stretching single DNA molecules with different concentration of drug molecules and holding it at a constant force allows the binding to reach equilibrium. By this we can obtain the equilibrium fractional ligand binding and length of DNA at saturated binding. Fitting these results yields quantitative measurements of the binding thermodynamics and kinetics of this complex process. The second complex discussed in this study is Actinomycin D (ActD), a well studied anti-cancer agent that is used as a prototype for developing new generations of drugs. However, the biophysical basis of its activity is still unclear. Because ActD is known to intercalate double stranded DNA (dsDNA), it was assumed to block replication by stabilizing dsDNA in front of the replication fork. However, recent studies have shown that ActD binds with even higher affinity to imperfect duplexes and some sequences of single stranded DNA (ssDNA). We directly measure the on and off rates by stretching the DNA molecule to a certain force and holding it at constant force while adding the drug and then while washing off the drug. Our finding resolves the long lasting controversy of ActD binding modes, clearly showing that both the dsDNA binding and ssDNA binding converge to the same single mode. The result supports the hypothesis that the primary characteristic of ActD that contributes to its biological activity is its ability to inhibit cellular replication by binding to transcription bubbles and causing cell death.
Understanding the Effect of Carbonate Ion on Cisplatin Binding to DNA
Todd, Ryan C.; Lovejoy, Katherine S.; Lippard, Stephen J.
2008-01-01
The role of carbonate in the binding of cis-diamminedichloroplatinum(II) to DNA was investigated in order to understand the potential involvement of carbonato-cisplatin species in the mechanism of action of platinum anticancer agents. Cisplatin was allowed to react with both double- and single-stranded DNA in carbonate, phosphate, and HEPES buffers, and the products were analyzed by agarose gel electrophoresis and enzymatic digestion/mass spectrometry, respectively. The data from these experiments demonstrate (1) that carbonate, like other biological nucleophiles, forms relatively inert complexes with platinum that inactivate cisplatin, and (2) that the major cisplatin-DNA adduct formed is a bifunctional cross-link. These results are in accord with previous studies of cisplatin-DNA binding and reveal that the presence of carbonate has no consequence on the nature of the resulting adducts. PMID:17465550
Rupture of DNA aptamer: New insights from simulations
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mishra, Rakesh Kumar; Nath, Shesh; Kumar, Sanjay
2015-10-28
Base-pockets (non-complementary base-pairs) in a double-stranded DNA play a crucial role in biological processes. Because of thermal fluctuations, it can lower the stability of DNA, whereas, in case of DNA aptamer, small molecules, e.g., adenosinemonophosphate and adenosinetriphosphate, form additional hydrogen bonds with base-pockets termed as “binding-pockets,” which enhance the stability. Using the Langevin dynamics simulations of coarse grained model of DNA followed by atomistic simulations, we investigated the influence of base-pocket and binding-pocket on the stability of DNA aptamer. Striking differences have been reported here for the separation induced by temperature and force, which require further investigation by single moleculemore » experiments.« less
Idili, Andrea
2017-01-01
Abstract DNA nanotechnology takes advantage of the predictability of DNA interactions to build complex DNA-based functional nanoscale structures. However, when DNA functional and responsive units that are based on non-canonical DNA interactions are employed it becomes quite challenging to predict, understand and control their thermodynamics. In response to this limitation, here we demonstrate the use of isothermal urea titration experiments to estimate the free energy involved in a set of DNA-based systems ranging from unimolecular DNA-based nanoswitches to more complex DNA folds (e.g. aptamers) and nanodevices. We propose here a set of fitting equations that allow to analyze the urea titration curves of these DNA responsive units based on Watson–Crick and non-canonical interactions (stem-loop, G-quadruplex, triplex structures) and to correctly estimate their relative folding and binding free energy values under different experimental conditions. The results described herein will pave the way toward the use of urea titration experiments in the field of DNA nanotechnology to achieve easier and more reliable thermodynamic characterization of DNA-based functional responsive units. More generally, our results will be of general utility to characterize other complex supramolecular systems based on different biopolymers. PMID:28605461
Naiser, Thomas; Ehler, Oliver; Kayser, Jona; Mai, Timo; Michel, Wolfgang; Ott, Albrecht
2008-01-01
Background The high binding specificity of short 10 to 30 mer oligonucleotide probes enables single base mismatch (MM) discrimination and thus provides the basis for genotyping and resequencing microarray applications. Recent experiments indicate that the underlying principles governing DNA microarray hybridization – and in particular MM discrimination – are not completely understood. Microarrays usually address complex mixtures of DNA targets. In order to reduce the level of complexity and to study the problem of surface-based hybridization with point defects in more detail, we performed array based hybridization experiments in well controlled and simple situations. Results We performed microarray hybridization experiments with short 16 to 40 mer target and probe lengths (in situations without competitive hybridization) in order to systematically investigate the impact of point-mutations – varying defect type and position – on the oligonucleotide duplex binding affinity. The influence of single base bulges and single base MMs depends predominantly on position – it is largest in the middle of the strand. The position-dependent influence of base bulges is very similar to that of single base MMs, however certain bulges give rise to an unexpectedly high binding affinity. Besides the defect (MM or bulge) type, which is the second contribution in importance to hybridization affinity, there is also a sequence dependence, which extends beyond the defect next-neighbor and which is difficult to quantify. Direct comparison between binding affinities of DNA/DNA and RNA/DNA duplexes shows, that RNA/DNA purine-purine MMs are more discriminating than corresponding DNA/DNA MMs. In DNA/DNA MM discrimination the affected base pair (C·G vs. A·T) is the pertinent parameter. We attribute these differences to the different structures of the duplexes (A vs. B form). Conclusion We have shown that DNA microarrays can resolve even subtle changes in hybridization affinity for simple target mixtures. We have further shown that the impact of point defects on oligonucleotide stability can be broken down to a hierarchy of effects. In order to explain our observations we propose DNA molecular dynamics – in form of zipping of the oligonucleotide duplex – to play an important role. PMID:18477387
Chen, Lin; Zheng, Qing-Chuan; Zhang, Hong-Xing
2015-02-28
A novel, highly conserved chromatin protein, Cren7 is involved in regulating essential cellular processes such as transcription, replication and repair. Although mutations in the DNA-binding loop of Cren7 destabilize the structure and reduce DNA-binding activity, the details are not very clear. Focusing on the specific Cren7-dsDNA complex (PDB code ), we applied molecular dynamics (MD) simulations and the molecular mechanics Poisson-Boltzmann surface area (MM-PBSA) free energy calculations to explore the structural and dynamic effects of W26A, L28A, and K53A mutations in comparison to the wild-type protein. The energetic analysis indicated that the intermolecular van der Waals interaction and nonpolar solvation energy play an important role in the binding process of Cren7 and dsDNA. Compared with the wild type Cren7, all the studied mutants W26A, L28A, and K53A have obviously reduced binding free energies with dsDNA in the reduction of the polar and/or nonpolar interactions. These results further elucidated the previous experiments to understand the Cren7-DNA interaction comprehensively. Our work also would provide support for an understanding of the interactions of proteins with nucleic acids.
Domingues, William Borges; da Silveira, Tony Leandro Rezende; Komninou, Eliza Rossi; Monte, Leonardo Garcia; Remião, Mariana Härter; Dellagostin, Odir Antônio; Corcini, Carine Dahl; Varela Junior, Antônio Sergio; Seixas, Fabiana Kömmling; Collares, Tiago; Campos, Vinicius Farias
2017-08-01
Bovine sex-sorted sperm have been commercialized and successfully used for the production of transgenic embryos of the desired sex through the sperm-mediated gene transfer (SMGT) technique. However, sex-sorted sperm show a reduced ability to internalize exogenous DNA. The interaction between sperm cells and the exogenous DNA has been reported in other species to be a CD4-like molecule-dependent process. The flow cytometry-based sex-sorting process subjects the spermatozoa to different stresses causing changes in the cell membrane. The aim of this study was to elucidate the relationship between the redistribution of CD4-like molecules and binding of exogenous DNA to sex-sorted bovine sperm. In the first set of experiments, the membrane phospholipid disorder and the redistribution of the CD4 were evaluated. The second set of experiments was conducted to investigate the effect of CD4 redistribution on the mechanism of binding of exogenous DNA to sperm cells and the efficiency of lipofection in sex-sorted bovine sperm. Sex-sorting procedure increased the membrane phospholipid disorder and induced the redistribution of CD4-like molecules. Both X-sorted and Y-sorted sperm had decreased DNA bound to membrane in comparison with the unsorted sperm; however, the binding of the exogenous DNA was significantly increased with the addition of liposomes. Moreover, we demonstrated that the number of sperm-bound exogenous DNA was decreased when these cells were preincubated with anti-bovine CD4 monoclonal antibody, supporting our hypothesis that CD4-like molecules indeed play a crucial role in the process of exogenous DNA/bovine sperm cells interaction.
NASA Astrophysics Data System (ADS)
Hamed, Mazen Y.
2018-05-01
Molecular dynamics and MM_GBSA energy calculations on various zinc finger proteins containing three and four fingers bound to their target DNA gave insights into the role of each finger in the DNA binding process as part of the protein structure. The wild type Zif 268 (PDB code: 1AAY) gave a ΔG value of - 76.1 (14) kcal/mol. Zinc fingers ZF1, ZF2 and ZF3 were mutated in one experiment and in another experiment one finger was cut and the rest of the protein was studied for binding. The ΔΔG values for the Zinc Finger protein with both ZF1 and ZF2 mutated was + 80 kcal/mol, while mutating only ZF1 the ΔΔG value was + 52 kcal/mol (relative to the wild type). Cutting ZF3 and studying the protein consisting only of ZF1 linked to ZF2 gave a ΔΔG value of + 68 kcal/mol. Upon cutting ZF1, the resulting ZF2 linked to ZF3 protein gave a ΔΔG value of + 41 kcal/mol. The above results shed light on the importance of each finger in the binding process, especially the role of ZF1 as the anchoring finger followed in importance by ZF2 and ZF3. The energy difference between the binding of the wild type protein Zif268 (1AAY) and that for individual finger binding to DNA according to the formula: ΔΔGlinkers, otherstructuralfactors = ΔGzif268 - (ΔGF1+F2+F3) gave a value = - 44.5 kcal/mol. This stabilization can be attributed to the contribution of linkers and other structural factors in the intact protein in the DNA binding process. DNA binding energies of variant proteins of the wild type Zif268 which differ in their ZF1 amino acid sequence gave evidence of a good relationship between binding energy and recognition and specificity, this finding confirms the reported vital role of ZF1 in the ZF protein scanning and anchoring to the target DNA sequence. The role of hydrogen bonds in both specific and nonspecific amino acid-DNA contacts is discussed in relation to mutations. The binding energies of variant Zinc Finger proteins confirmed the role of ZF1 in the recognition, specificity and anchoring of the zinc finger protein to DNA.
Hamed, Mazen Y
2018-05-03
Molecular dynamics and MM_GBSA energy calculations on various zinc finger proteins containing three and four fingers bound to their target DNA gave insights into the role of each finger in the DNA binding process as part of the protein structure. The wild type Zif 268 (PDB code: 1AAY) gave a ΔG value of - 76.1 (14) kcal/mol. Zinc fingers ZF1, ZF2 and ZF3 were mutated in one experiment and in another experiment one finger was cut and the rest of the protein was studied for binding. The ΔΔG values for the Zinc Finger protein with both ZF1 and ZF2 mutated was + 80 kcal/mol, while mutating only ZF1 the ΔΔG value was + 52 kcal/mol (relative to the wild type). Cutting ZF3 and studying the protein consisting only of ZF1 linked to ZF2 gave a ΔΔG value of + 68 kcal/mol. Upon cutting ZF1, the resulting ZF2 linked to ZF3 protein gave a ΔΔG value of + 41 kcal/mol. The above results shed light on the importance of each finger in the binding process, especially the role of ZF1 as the anchoring finger followed in importance by ZF2 and ZF3. The energy difference between the binding of the wild type protein Zif268 (1AAY) and that for individual finger binding to DNA according to the formula: ΔΔG linkers, otherstructuralfactors = ΔG zif268 - (ΔG F1+F2+F3 ) gave a value = - 44.5 kcal/mol. This stabilization can be attributed to the contribution of linkers and other structural factors in the intact protein in the DNA binding process. DNA binding energies of variant proteins of the wild type Zif268 which differ in their ZF1 amino acid sequence gave evidence of a good relationship between binding energy and recognition and specificity, this finding confirms the reported vital role of ZF1 in the ZF protein scanning and anchoring to the target DNA sequence. The role of hydrogen bonds in both specific and nonspecific amino acid-DNA contacts is discussed in relation to mutations. The binding energies of variant Zinc Finger proteins confirmed the role of ZF1 in the recognition, specificity and anchoring of the zinc finger protein to DNA.
Polevoda, Bogdan; Joseph, Rebecca; Friedman, Alan E.; Bennett, Ryan P.; Greiner, Rebecca; De Zoysa, Thareendra; Stewart, Ryan A.; Smith, Harold C.
2017-01-01
APOBEC3G (A3G) belongs to the AID/APOBEC protein family of cytidine deaminases (CDA) that bind to nucleic acids. A3G mutates the HIV genome by deamination of dC to dU, leading to accumulation of virus-inactivating mutations. Binding to cellular RNAs inhibits A3G binding to substrate single-stranded (ss) DNA and CDA activity. Bulk RNA and substrate ssDNA bind to the same three A3G tryptic peptides (amino acids 181–194, 314–320, and 345–374) that form parts of a continuously exposed protein surface extending from the catalytic domain in the C terminus of A3G to its N terminus. We show here that the A3G tyrosines 181 and 315 directly cross-linked ssDNA. Binding experiments showed that a Y315A mutation alone significantly reduced A3G binding to both ssDNA and RNA, whereas Y181A and Y182A mutations only moderately affected A3G nucleic acid binding. Consistent with these findings, the Y315A mutant exhibited little to no deaminase activity in an Escherichia coli DNA mutator reporter, whereas Y181A and Y182A mutants retained ∼50% of wild-type A3G activity. The Y315A mutant also showed a markedly reduced ability to assemble into viral particles and had reduced antiviral activity. In uninfected cells, the impaired RNA-binding capacity of Y315A was evident by a shift of A3G from high-molecular-mass ribonucleoprotein complexes to low-molecular-mass complexes. We conclude that Tyr-315 is essential for coordinating ssDNA interaction with or entry to the deaminase domain and hypothesize that RNA bound to Tyr-315 may be sufficient to competitively inhibit ssDNA deaminase-dependent antiviral activity. PMID:28381554
Synthetic polymers as substrates for a DNA-sliding clamp protein.
van Dongen, S F M; Clerx, J; van den Boomen, O I; Pervaiz, M; Trakselis, M A; Ritschel, T; Schoonen, L; Schoenmakers, D C; Nolte, R J M
2018-04-26
The clamp protein (gp45) of the DNA polymerase III of the bacteriophage T4 is known to bind to DNA and stay attached to it in order to facilitate the process of DNA copying by the polymerase. As part of a project aimed at developing new biomimetic data-encoding systems we have investigated the binding of gp45 to synthetic polymers, that is, rigid, helical polyisocyanopeptides. Molecular modelling studies suggest that the clamp protein may interact with the latter polymers. Experiments aimed at verifying these interactions are presented and discussed. © 2018 The Authors Biopolymers Published by Wiley Periodicals, Inc.
Ahn, Junho; Choi, Yeonweon; Lee, Ae-Ree; Lee, Joon-Hwa; Jung, Jong Hwa
2016-03-21
Using duplex DNA-AuNP aggregates, a sequence-specific DNA-binding protein, SQUAMOSA Promoter-binding-Like protein 12 (SPL-12), was directly determined by SPL-12-duplex DNA interaction-based colorimetric actions of DNA-Au assemblies. In order to prepare duplex DNA-Au aggregates, thiol-modified DNA 1 and DNA 2 were attached onto the surface of AuNPs, respectively, by the salt-aging method and then the DNA-attached AuNPs were mixed. Duplex-DNA-Au aggregates having the average size of 160 nm diameter and the maximum absorption at 529 nm were able to recognize SPL-12 and reached the equivalent state by the addition of ∼30 equivalents of SPL-12 accompanying a color change from red to blue with a red shift of the maximum absorption at 570 nm. As a result, the aggregation size grew to about 247 nm. Also, at higher temperatures of the mixture of duplex-DNA-Au aggregate solution and SPL-12, the equivalent state was reached rapidly. On the contrary, in the control experiment using Bovine Serum Albumin (BSA), no absorption band shift of duplex-DNA-Au aggregates was observed.
Emperle, Max; Rajavelu, Arumugam; Reinhardt, Richard; Jurkowska, Renata Z; Jeltsch, Albert
2014-10-24
The Dnmt3a DNA methyltransferase has been shown to bind cooperatively to DNA and to form large multimeric protein/DNA fibers. However, it has also been reported to methylate DNA in a processive manner, a property that is incompatible with protein/DNA fiber formation. We show here that the DNA methylation rate of Dnmt3a increases more than linearly with increasing enzyme concentration on a long DNA substrate, but not on a short 30-mer oligonucleotide substrate. We also show that addition of a catalytically inactive Dnmt3a mutant, which carries an amino acid exchange in the catalytic center, increases the DNA methylation rate by wild type Dnmt3a on the long substrate but not on the short one. In agreement with this finding, preincubation experiments indicate that stable protein/DNA fibers are formed on the long, but not on the short substrate. In addition, methylation experiments with substrates containing one or two CpG sites did not provide evidence for a processive mechanism over a wide range of enzyme concentrations. These data clearly indicate that Dnmt3a binds to DNA in a cooperative reaction and that the formation of stable protein/DNA fibers increases the DNA methylation rate. Fiber formation occurs at low μm concentrations of Dnmt3a, which are in the range of Dnmt3a concentrations in the nucleus of embryonic stem cells. Understanding the mechanism of Dnmt3a is of vital importance because Dnmt3a is a hotspot of somatic cancer mutations one of which has been implicated in changing Dnmt3a processivity. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Komori, S; Sakata, K; Kasumi, H; Tsuji, Y; Hamada, K; Koyama, K
1999-10-01
DNA analysis of the androgen receptor gene in a patient with complete androgen insensitivity syndrome identified a substitutional mutation (tyrosine converted to cysteine at position 571) in the DNA binding domain. In vitro transfection experiments with the patients' androgen receptor gene, indicated normal expression of the androgen receptor in transfected COS-7 cells compared to the wild type gene. There was also no evidence of impaired thermal stability of the 5 alpha-dihydrotestosterone-androgen receptor complex. However, the capacity of the androgen receptor to activate target gene transcription was found to be completely disrupted in a luciferase assay. These results confirmed that only one substitutional mutation in the DNA binding domain was related to the pathogenesis of the complete androgen insensitivity syndrome.
Synthesis, characterization and biological evaluation of novel α, β unsaturated amides.
Esmailzadeh, K; Housaindokht, M R; Moradi, A; Esmaeili, A A; Sharifi, Z
2016-05-15
Three derivatives of α,β unsaturated amides have been successfully synthesized via Ugi-four component (U-4CR) reaction. The interactions of the amides with calf thymus deoxyribonucleic acid (ct-DNA) have been investigated in the Tris-HCl buffer (pH=7.4) using viscometric, spectroscopic, thermal denaturation studies, and also molecular docking. By UV-Vis absorption spectroscopy studies, adding CT-DNA to the compound solution caused the hypochromism indicates that there are interactions between the compounds and DNA base pairs. In competitive fluorescence with methylene blue as an intercalator probe, adding compounds to DNA-MB solution caused an increase in emission spectra of the complex. This could be because of compound replacing, with similar binding mode of MB, between the DNA base pairs due to release of bonded MB molecules from DNA-MB complex. Thermal denaturation studies and viscometric experiments also indicated that all three investigated compounds bind to CT-DNA by non-classical intercalation mode. Additionally, molecular docking technique predicted partial intercalation binding mode for the compounds. Also, the highest binding energy was obtained for compound 5a. These results are in agreement with results obtained by empirical methods. Copyright © 2016 Elsevier B.V. All rights reserved.
Theory of nucleosome corkscrew sliding in the presence of synthetic DNA ligands.
Mohammad-Rafiee, Farshid; Kulić, Igor M; Schiessel, Helmut
2004-11-12
Histone octamers show a heat-induced mobility along DNA. Recent theoretical studies have established two mechanisms that are qualitatively and quantitatively compatible with in vitro experiments on nucleosome sliding: octamer repositioning through one-base-pair twist defects and through ten-base-pair bulge defects. A recent experiment demonstrated that the repositioning is strongly suppressed in the presence of minor-groove binding DNA ligands. In the present study, we give a quantitative theory for nucleosome repositioning in the presence of such ligands. We show that the experimentally observed octamer mobilities are consistent with the picture of bound ligands blocking the passage of twist defects through the nucleosome. This strongly supports the model of twist defects inducing a corkscrew motion of the nucleosome as the underlying mechanism of nucleosome sliding. We provide a theoretical estimate of the nucleosomal mobility without adjustable parameters, as a function of ligand concentration, binding affinity, binding site orientation, temperature and DNA anisotropy. Having this mobility in hand, we speculate on the interaction between a nucleosome and a transcribing RNA polymerase, and suggest a novel mechanism that might account for polymerase-induced nucleosome repositioning on short DNA templates.
Withey, Jeffrey H; DiRita, Victor J
2005-05-01
The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.
p53 Specifically Binds Triplex DNA In Vitro and in Cells
Brázdová, Marie; Tichý, Vlastimil; Helma, Robert; Bažantová, Pavla; Polášková, Alena; Krejčí, Aneta; Petr, Marek; Navrátilová, Lucie; Tichá, Olga; Nejedlý, Karel; Bennink, Martin L.; Subramaniam, Vinod; Bábková, Zuzana; Martínek, Tomáš; Lexa, Matej; Adámik, Matej
2016-01-01
Triplex DNA is implicated in a wide range of biological activities, including regulation of gene expression and genomic instability leading to cancer. The tumor suppressor p53 is a central regulator of cell fate in response to different type of insults. Sequence and structure specific modes of DNA recognition are core attributes of the p53 protein. The focus of this work is the structure-specific binding of p53 to DNA containing triplex-forming sequences in vitro and in cells and the effect on p53-driven transcription. This is the first DNA binding study of full-length p53 and its deletion variants to both intermolecular and intramolecular T.A.T triplexes. We demonstrate that the interaction of p53 with intermolecular T.A.T triplex is comparable to the recognition of CTG-hairpin non-B DNA structure. Using deletion mutants we determined the C-terminal DNA binding domain of p53 to be crucial for triplex recognition. Furthermore, strong p53 recognition of intramolecular T.A.T triplexes (H-DNA), stabilized by negative superhelicity in plasmid DNA, was detected by competition and immunoprecipitation experiments, and visualized by AFM. Moreover, chromatin immunoprecipitation revealed p53 binding T.A.T forming sequence in vivo. Enhanced reporter transactivation by p53 on insertion of triplex forming sequence into plasmid with p53 consensus sequence was observed by luciferase reporter assays. In-silico scan of human regulatory regions for the simultaneous presence of both consensus sequence and T.A.T motifs identified a set of candidate p53 target genes and p53-dependent activation of several of them (ABCG5, ENOX1, INSR, MCC, NFAT5) was confirmed by RT-qPCR. Our results show that T.A.T triplex comprises a new class of p53 binding sites targeted by p53 in a DNA structure-dependent mode in vitro and in cells. The contribution of p53 DNA structure-dependent binding to the regulation of transcription is discussed. PMID:27907175
Barrijal, S; Perros, M; Gu, Z; Avalosse, B L; Belenguer, P; Amalric, F; Rommelaere, J
1992-01-01
Nucleolin, a major nucleolar protein, forms a specific complex with the genome (a single-stranded DNA molecule of minus polarity) of parvovirus MVMp in vitro. By means of South-western blotting experiments, we mapped the binding site to a 222-nucleotide motif within the non-structural transcription unit, referred to as NUBE (nucleolin-binding element). The specificity of the interaction was confirmed by competitive gel retardation assays. DNaseI and nuclease S1 probing showed that NUBE folds into a secondary structure, in agreement with a computer-assisted conformational prediction. The whole NUBE may be necessary for the interaction with nucleolin, as suggested by the failure of NUBE subfragments to bind the protein and by the nuclease footprinting experiments. The present work extends the previously reported ability of nucleolin to form a specific complex with ribosomal RNA, to a defined DNA substrate. Considering the tropism of MVMp DNA replication for host cell nucleoli, these data raise the possibility that nucleolin may contribute to the regulation of the parvoviral life-cycle. Images PMID:1408821
Yoga, Yano M. K.; Traore, Daouda A. K.; Sidiqi, Mahjooba; Szeto, Chris; Pendini, Nicole R.; Barker, Andrew; Leedman, Peter J.; Wilce, Jacqueline A.; Wilce, Matthew C. J.
2012-01-01
Poly-C-binding proteins are triple KH (hnRNP K homology) domain proteins with specificity for single stranded C-rich RNA and DNA. They play diverse roles in the regulation of protein expression at both transcriptional and translational levels. Here, we analyse the contributions of individual αCP1 KH domains to binding C-rich oligonucleotides using biophysical and structural methods. Using surface plasmon resonance (SPR), we demonstrate that KH1 makes the most stable interactions with both RNA and DNA, KH3 binds with intermediate affinity and KH2 only interacts detectibly with DNA. The crystal structure of KH1 bound to a 5′-CCCTCCCT-3′ DNA sequence shows a 2:1 protein:DNA stoichiometry and demonstrates a molecular arrangement of KH domains bound to immediately adjacent oligonucleotide target sites. SPR experiments, with a series of poly-C-sequences reveals that cytosine is preferred at all four positions in the oligonucleotide binding cleft and that a C-tetrad binds KH1 with 10 times higher affinity than a C-triplet. The basis for this high affinity interaction is finally detailed with the structure determination of a KH1.W.C54S mutant bound to 5′-ACCCCA-3′ DNA sequence. Together, these data establish the lead role of KH1 in oligonucleotide binding by αCP1 and reveal the molecular basis of its specificity for a C-rich tetrad. PMID:22344691
Yoga, Yano M K; Traore, Daouda A K; Sidiqi, Mahjooba; Szeto, Chris; Pendini, Nicole R; Barker, Andrew; Leedman, Peter J; Wilce, Jacqueline A; Wilce, Matthew C J
2012-06-01
Poly-C-binding proteins are triple KH (hnRNP K homology) domain proteins with specificity for single stranded C-rich RNA and DNA. They play diverse roles in the regulation of protein expression at both transcriptional and translational levels. Here, we analyse the contributions of individual αCP1 KH domains to binding C-rich oligonucleotides using biophysical and structural methods. Using surface plasmon resonance (SPR), we demonstrate that KH1 makes the most stable interactions with both RNA and DNA, KH3 binds with intermediate affinity and KH2 only interacts detectibly with DNA. The crystal structure of KH1 bound to a 5'-CCCTCCCT-3' DNA sequence shows a 2:1 protein:DNA stoichiometry and demonstrates a molecular arrangement of KH domains bound to immediately adjacent oligonucleotide target sites. SPR experiments, with a series of poly-C-sequences reveals that cytosine is preferred at all four positions in the oligonucleotide binding cleft and that a C-tetrad binds KH1 with 10 times higher affinity than a C-triplet. The basis for this high affinity interaction is finally detailed with the structure determination of a KH1.W.C54S mutant bound to 5'-ACCCCA-3' DNA sequence. Together, these data establish the lead role of KH1 in oligonucleotide binding by αCP1 and reveal the molecular basis of its specificity for a C-rich tetrad.
Xu, Zhicheng; Bai, Guan; Dong, Chuan
2005-10-15
The interaction of a new intramolecular charge transfer probe, namely 4'-dimethylamino-2,5-dihydroxychalcone (DMADHC), with calf thymus DNA has been studied. Compared to the spectral characteristics of the free form in aqueous solution, the fluorescence of DMADHC enhanced dramatically accompanying a blueshift of the emission maxima in the presence of DNA. The absorption and fluorescence spectra, salt concentration effect, KI quenching, fluorescence polarization, and DNA denaturation experiments were given. These results give evidence that the DMADHC molecule is inserted into the base-stacking domain of the DNA double helix. The intrinsic binding constant and the binding site number were estimated. The analytical characteristics were also given.
Binding polarity of RPA to telomeric sequences and influence of G-quadruplex stability.
Safa, Layal; Delagoutte, Emmanuelle; Petruseva, Irina; Alberti, Patrizia; Lavrik, Olga; Riou, Jean-François; Saintomé, Carole
2014-08-01
Replication protein A (RPA) is a single-stranded DNA binding protein that plays an essential role in telomere maintenance. RPA binds to and unfolds G-quadruplex (G4) structures formed in telomeric DNA, thus facilitating lagging strand DNA replication and telomerase activity. To investigate the effect of G4 stability on the interactions with human RPA (hRPA), we used a combination of biochemical and biophysical approaches. Our data revealed an inverse relationship between G4 stability and ability of hRPA to bind to telomeric DNA; notably small G4 ligands that enhance G4 stability strongly impaired G4 unfolding by hRPA. To gain more insight into the mechanism of binding and unfolding of telomeric G4 structures by RPA, we carried out photo-crosslinking experiments to elucidate the spatial arrangement of the RPA subunits along the DNA strands. Our results showed that RPA1 and RPA2 are arranged from 5' to 3' along the unfolded telomeric G4, as already described for unstructured single-stranded DNA, while no contact is possible with RPA3 on this short oligonucleotide. In addition, these data are compatible with a 5' to 3' directionality in G4 unfolding by hRPA. Copyright © 2014 Elsevier Masson SAS. All rights reserved.
Biswas, N; Weller, S K
2001-05-18
Herpes simplex virus type 1 encodes a heterotrimeric helicase-primase complex composed of the products of the UL5, UL52, and UL8 genes. The UL5 protein contains seven motifs found in all members of helicase Superfamily 1 (SF1), and the UL52 protein contains several conserved motifs found in primases; however, the contributions of each subunit to the biochemical activities of the subcomplex are not clear. In this work, the DNA binding properties of wild type and mutant subcomplexes were examined using single-stranded, duplex, and forked substrates. A gel mobility shift assay indicated that the UL5-UL52 subcomplex binds more efficiently to the forked substrate than to either single strand or duplex DNA. Although nucleotides are not absolutely required for DNA binding, ADP stimulated the binding of UL5-UL52 to single strand DNA whereas ATP, ADP, and adenosine 5'-O-(thiotriphosphate) stimulated the binding to a forked substrate. We have previously shown that both subunits contact single-stranded DNA in a photocross-linking assay (Biswas, N., and Weller, S. K. (1999) J. Biol. Chem. 274, 8068-8076). In this study, photocross-linking assays with forked substrates indicate that the UL5 and UL52 subunits contact the forked substrates at different positions, UL52 at the single-stranded DNA tail and UL5 near the junction between single-stranded and double-stranded DNA. Neither subunit was able to cross-link a forked substrate when 5-iododeoxyuridine was located within the duplex portion. Photocross-linking experiments with subcomplexes containing mutant versions of UL5 and wild type UL52 indicated that the integrity of the ATP binding region is important for DNA binding of both subunits. These results support our previous proposal that UL5 and UL52 exhibit a complex interdependence for DNA binding (Biswas, N., and Weller, S. K. (1999) J. Biol. Chem. 274, 8068-8076) and indicate that the UL52 subunit may play a more active role in helicase activity than had previously been thought.
Protein associations in DnaA-ATP hydrolysis mediated by the Hda-replicase clamp complex.
Su'etsugu, Masayuki; Shimuta, Toh-Ru; Ishida, Takuma; Kawakami, Hironori; Katayama, Tsutomu
2005-02-25
In Escherichia coli, the activity of ATP-bound DnaA protein in initiating chromosomal replication is negatively controlled in a replication-coordinated manner. The RIDA (regulatory inactivation of DnaA) system promotes DnaA-ATP hydrolysis to produce the inactivated form DnaA-ADP in a manner depending on the Hda protein and the DNA-loaded form of the beta-sliding clamp, a subunit of the replicase holoenzyme. A highly functional form of Hda was purified and shown to form a homodimer in solution, and two Hda dimers were found to associate with a single clamp molecule. Purified mutant Hda proteins were used in a staged in vitro RIDA system followed by a pull-down assay to show that Hda-clamp binding is a prerequisite for DnaA-ATP hydrolysis and that binding is mediated by an Hda N-terminal motif. Arg(168) in the AAA(+) Box VII motif of Hda plays a role in stable homodimer formation and in DnaA-ATP hydrolysis, but not in clamp binding. Furthermore, the DnaA N-terminal domain is required for the functional interaction of DnaA with the Hda-clamp complex. Single cells contain approximately 50 Hda dimers, consistent with the results of in vitro experiments. These findings and the features of AAA(+) proteins, including DnaA, suggest the following model. DnaA-ATP is hydrolyzed at a binding interface between the AAA(+) domains of DnaA and Hda; the DnaA N-terminal domain supports this interaction; and the interaction of DnaA-ATP with the Hda-clamp complex occurs in a catalytic mode.
NASA Astrophysics Data System (ADS)
Moreland, Blythe; Oman, Kenji; Curfman, John; Yan, Pearlly; Bundschuh, Ralf
Methyl-binding domain (MBD) protein pulldown experiments have been a valuable tool in measuring the levels of methylated CpG dinucleotides. Due to the frequent use of this technique, high-throughput sequencing data sets are available that allow a detailed quantitative characterization of the underlying interaction between methylated DNA and MBD proteins. Analyzing such data sets, we first found that two such proteins cannot bind closer to each other than 2 bp, consistent with structural models of the DNA-protein interaction. Second, the large amount of sequencing data allowed us to find rather weak but nevertheless clearly statistically significant sequence preferences for several bases around the required CpG. These results demonstrate that pulldown sequencing is a high-precision tool in characterizing DNA-protein interactions. This material is based upon work supported by the National Science Foundation under Grant No. DMR-1410172.
Characterization of monomeric DNA-binding protein Histone H1 in Leishmania braziliensis.
Carmelo, Emma; González, Gloria; Cruz, Teresa; Osuna, Antonio; Hernández, Mariano; Valladares, Basilio
2011-08-01
Histone H1 in Leishmania presents relevant differences compared to higher eukaryote counterparts, such as the lack of a DNA-binding central globular domain. Despite that, it is apparently fully functional since its differential expression levels have been related to changes in chromatin condensation and infectivity, among other features. The localization and the aggregation state of L. braziliensis H1 has been determined by immunolocalization, mass spectrometry, cross-linking and electrophoretic mobility shift assays. Analysis of H1 sequences from the Leishmania Genome Database revealed that our protein is included in a very divergent group of histones H1 that is present only in L. braziliensis. An antibody raised against recombinant L. braziliensis H1 recognized specifically that protein by immunoblot in L. braziliensis extracts, but not in other Leishmania species, a consequence of the sequence divergences observed among Leishmania species. Mass spectrometry analysis and in vitro DNA-binding experiments have also proven that L. braziliensis H1 is monomeric in solution, but oligomerizes upon binding to DNA. Finally, despite the lack of a globular domain, L. braziliensis H1 is able to form complexes with DNA in vitro, with higher affinity for supercoiled compared to linear DNA.
NASA Astrophysics Data System (ADS)
Fu, Zheng; Cui, Yanrui; Cui, Fengling; Zhang, Guisheng
2016-01-01
A new anthraquinone derivative (AORha) was synthesized. Its interactions with human serum albumin (HSA) and calf thymus DNA (ctDNA) were investigated by fluorescence spectroscopy, UV-visible absorption spectroscopy and molecular modeling. Cell viability assay and cell imaging experiment were performed using cervical cancer cells (HepG2 cells). The fluorescence results revealed that the quenching mechanism was static quenching. At different temperatures (290, 300, 310 K), the binding constants (K) and the number of binding sites (n) were determined, respectively. The positive ΔH and ΔS values showed that the binding of AORha with HSA was hydrophobic force, which was identical with the molecular docking result. Studying the fluorescence spectra, UV spectra and molecular modeling also verified that the binding mode of AORha and ctDNA might be intercalative. When HepG2 cells were treated with AORha, the fluorescence became brighter and turned green, which could be used for bioimaging.
Fu, Zheng; Cui, Yanrui; Cui, Fengling; Zhang, Guisheng
2016-01-15
A new anthraquinone derivative (AORha) was synthesized. Its interactions with human serum albumin (HSA) and calf thymus DNA (ctDNA) were investigated by fluorescence spectroscopy, UV-visible absorption spectroscopy and molecular modeling. Cell viability assay and cell imaging experiment were performed using cervical cancer cells (HepG2 cells). The fluorescence results revealed that the quenching mechanism was static quenching. At different temperatures (290, 300, 310 K), the binding constants (K) and the number of binding sites (n) were determined, respectively. The positive ΔH and ΔS values showed that the binding of AORha with HSA was hydrophobic force, which was identical with the molecular docking result. Studying the fluorescence spectra, UV spectra and molecular modeling also verified that the binding mode of AORha and ctDNA might be intercalative. When HepG2 cells were treated with AORha, the fluorescence became brighter and turned green, which could be used for bioimaging. Copyright © 2015 Elsevier B.V. All rights reserved.
Solution structure and interactions of the Escherichia coli cell division activator protein CedA.
Chen, Ho An; Simpson, Peter; Huyton, Trevor; Roper, David; Matthews, Stephen
2005-05-10
CedA is a protein that is postulated to be involved in the regulation of cell division in Escherichia coli and related organisms; however, little biological data about its possible mode of action are available. Here we present a three-dimensional structure of this protein as determined by NMR spectroscopy. The protein is made up of four antiparallel beta-strands, an alpha-helix, and a large unstructured stretch of residues at the N-terminus. It shows structural similarity to a family of DNA-binding proteins which interact with dsDNA via a three-stranded beta-sheet, suggesting that CedA may be a DNA-binding protein. The putative binding surface of CedA is predominantly positively charged with a number of basic residues surrounding a groove largely dominated by aromatic residues. NMR chemical shift perturbations and gel-shift experiments performed with CedA confirm that the protein binds dsDNA, and its interaction is mediated primarily via the beta-sheet.
Tell, Gianluca; Zecca, Alessandro; Pellizzari, Lucia; Spessotto, Paola; Colombatti, Alfonso; Kelley, Mark R.; Damante, Giuseppe; Pucillo, Carlo
2000-01-01
The Ref-1 (also called APE or HAP1) protein is a bifunctional enzyme impacting on a wide variety of important cellular functions. It acts as a major member of the DNA base excision repair pathway. Moreover, Ref-1 stimulates the DNA-binding activity of several transcription factors (TFs) through the reduction of highly reactive cysteine residues. Therefore, it represents a mechanism that regulates eukaryotic gene expression in a fast way. However, it has been demonstrated that external stimuli directly act on Ref-1 by increasing its expression levels, a time-consuming mechanism representing a paradox in terms of rapidity of TF regulation. In this paper we demonstrate that this is only an apparent paradox. Exposure of B lymphocytes to H2O2 induced a rapid and sustained increase in Ref-1 protein levels in the nucleus as evaluated by both western blot analysis and by pulse–chase experiments. A time course, two color in situ immunocytochemistry indicated that the up-regulation of Ref-1 in the nucleus at <30 min was primarily the consequence of translocation of its cytoplasmic form. This early nuclear accumulation is effective in modulating the DNA-binding activity of the B cell-specific activator protein BSAP/Pax-5. In fact, EMSA experiments demonstrate that a transient interaction with Ref-1 up-regulates the DNA-binding activity of BSAP/Pax-5. Moreover, in a co-transfection experiment, Ref-1 increased the BSAP/Pax-5 activating effect on an oligomerized BSAP/Pax-5 binding site of the CD19 promoter by 5- to 8-fold. Thus, Ref-1 mediates its effect by up-regulating the DNA-binding activity of BSAP/Pax-5, accounting for a new and fast outside/inside pathway of signaling in B cells. PMID:10666449
Determination of adsorption and desorption of DNA molecules on freshwater and marine sediments.
Xue, J; Feng, Y
2018-06-01
Free DNA and its adsorption by sediment in the aquatic environment lead to ambiguity in the identification of recent faecal pollution sources. The goal of this study was to understand the mechanisms of DNA adsorption and desorption on aquatic sediment under various conditions using quantitative polymerase chain reaction (qPCR). Both raw sewage (RS) DNA and purified PCR product (PPP) were used in adsorption and desorption experiments; autoclaved freshwater and marine sediments served as sorbents. Thirty-six hours were needed for adsorption to reach equilibrium. More DNA was adsorbed on both sediments in stream water than in 5 mmol l -1 NaCl and DNA adsorption increased in the presence of Ca 2+ and Mg 2+ . Successive desorption experiments showed that between 5% and 22% of adsorbed DNA was desorbed. Organic matter and clay played a significant role in determining the DNA adsorption capacity on sediment. The data suggest the presence of multilayer adsorption. DNA molecules on sediments were mostly adsorbed through ligand binding rather than electrostatic binding. Quantitative polymerase chain reaction assays provide a better way to investigate the DNA adsorption and desorption mechanisms by sediment. DNA desorption can potentially complicate the outcomes of microbial source tracking studies. © 2018 The Society for Applied Microbiology.
Vicent, Guillermo P; Meliá, María J; Beato, Miguel
2002-11-29
Packaging of mouse mammary tumor virus (MMTV) promoter sequences in nucleosomes modulates access of DNA binding proteins and influences the interaction among DNA bound transcription factors. Here we analyze the binding of histone H1 to MMTV mononucleosomes assembled with recombinant histones and study its influence on nucleosome structure and stability as well as on progesterone receptor (PR) binding to the hormone responsive elements (HREs). The MMTV nucleosomes can be separated into three main populations, two of which exhibited precise translational positioning. Histone H1 bound preferentially to the 5' distal nucleosomal DNA protecting additional 27-28 nt from digestion by micrococcal nuclease. Binding of histone H1 was unaffected by prior crosslinking of protein and DNA in nucleosomes with formaldehyde. Neither the translational nor the rotational nucleosome positioning was altered by histone H1 binding, but the nucleosomes were stabilized as judged by the kinetics of nuclease cleavage. Unexpectedly, binding of recombinant PR to the exposed distal HRE-I in nucleosomes was enhanced in the presence of histone H1, as demonstrated by band shift and footprinting experiments. This enhanced PR affinity may contribute to the reported positive effect of histone H1 on the hormonal activation of MMTV reporter genes.
Sequence-selective binding of C8-conjugated pyrrolobenzodiazepines (PBDs) to DNA.
Basher, Mohammad A; Rahman, Khondaker Miraz; Jackson, Paul J M; Thurston, David E; Fox, Keith R
2017-11-01
DNA footprinting and melting experiments have been used to examine the sequence-specific binding of C8-conjugates of pyrrolobenzodiazepines (PBDs) and benzofused rings including benzothiophene and benzofuran, which are attached using pyrrole- or imidazole-containing linkers. The conjugates modulate the covalent attachment points of the PBDs, so that they bind best to guanines flanked by A/T-rich sequences on either the 5'- or 3'-side. The linker affects the binding, and pyrrole produces larger changes than imidazole. Melting studies with 14-mer oligonucleotide duplexes confirm covalent attachment of the conjugates, which show a different selectivity to anthramycin and reveal that more than one ligand molecule can bind to each duplex. Copyright © 2017 Elsevier B.V. All rights reserved.
Role of the p53 Tumor Suppressor Homolog, p63, in Breast Cancer
2007-05-01
paradigms. To understand the mechanisms of transcriptional regulation by p63, we analyzed p63 DNA-binding sites in vivo across the entire human ...biological function in human cells. Molecular Cell 24, 593-602 (*these authors contributed equally). Suh EK*, YANG A*, Kettenbach A*, Bamberger C... human genes. Results and details of these experiments are described in Yang et al., (2006), “Relationships between p63 binding, DNA sequence
Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development
Kazemian, Majid; Pham, Hannah; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh
2013-01-01
Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein–protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action. PMID:23847101
Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development.
Kazemian, Majid; Pham, Hannah; Wolfe, Scot A; Brodsky, Michael H; Sinha, Saurabh
2013-09-01
Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein-protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action.
A Comparison of Two Single-Stranded DNA Binding Models by Mutational Analysis of APOBEC3G
Shindo, Keisuke; Li, Ming; Gross, Phillip J.; Brown, William L.; Harjes, Elena; Lu, Yongjian; Matsuo, Hiroshi; Harris, Reuben S.
2012-01-01
APOBEC3G is the best known of several DNA cytosine deaminases that function to inhibit the replication of parasitic genetic elements including the lentivirus HIV. Several high-resolution structures of the APOBEC3G catalytic domain have been generated, but none reveal how this enzyme binds to substrate single-stranded DNA. Here, we constructed a panel of APOBEC3G amino acid substitution mutants and performed a series of biochemical, genetic, and structural assays to distinguish between “Brim” and “Kink” models for single-strand DNA binding. Each model predicts distinct sets of interactions between surface arginines and negatively charged phosphates in the DNA backbone. Concordant with both models, changing the conserved arginine at position 313 to glutamate abolished both catalytic and restriction activities. In support of the Brim model, arginine to glutamate substitutions at positions 213, 215, and 320 also compromised these APOBEC3G activities. Arginine to glutamate substitutions at Kink model residues 374 and 376 had smaller effects. These observations were supported by A3G catalytic domain-ssDNA chemical shift perturbation experiments. The overall data set is most consistent with the Brim model for single-stranded DNA binding by APOBEC3G. PMID:24832226
NASA Astrophysics Data System (ADS)
Raman, Natarajan; Selvaganapathy, Muthusamy; Radhakrishnan, Srinivasan
2014-06-01
The 4-aminoantipyrine derivatives (sbnd NO2, sbnd OCH3) and their mixed-ligand complexes with amino acids have been synthesized and investigated for their binding with CT DNA using UV-visible spectroscopy, cyclic voltammetry, and viscosity measurements under physiological conditions of pH (stomach 4.7; blood 7.4). The results from all techniques i.e. binding constant (Kb), and free energy change (ΔG) were in good agreement and inferred spontaneous compound-DNA complexes formation via intercalation. Among all the compounds 1 and 4 showed comparatively greater binding at pH 7.4 as evident from its greater Kb values. All the complexes exhibit oxidative cleavage of supercoiled (SC) pBR322 plasmid DNA in the presence of H2O2 as an activator. It is remarkable that at 25 μM concentration 1 and 4 completely degrade SC DNA into undetectable minor fragments and thus they act as efficient chemical nucleases. Among the new complexes, complexes 1 and 4 have highest potential against all the microorganisms tested. The results of the above biological experiments also reveal that the choice of different metal ions has little influence on the DNA binding, DNA cleavage and antimicrobial assay.
Jaeger, Alex M.; Makley, Leah N.; Gestwicki, Jason E.; Thiele, Dennis J.
2014-01-01
The heat shock transcription factor 1 (HSF1) activates expression of a variety of genes involved in cell survival, including protein chaperones, the protein degradation machinery, anti-apoptotic proteins, and transcription factors. Although HSF1 activation has been linked to amelioration of neurodegenerative disease, cancer cells exhibit a dependence on HSF1 for survival. Indeed, HSF1 drives a program of gene expression in cancer cells that is distinct from that activated in response to proteotoxic stress, and HSF1 DNA binding activity is elevated in cycling cells as compared with arrested cells. Active HSF1 homotrimerizes and binds to a DNA sequence consisting of inverted repeats of the pentameric sequence nGAAn, known as heat shock elements (HSEs). Recent comprehensive ChIP-seq experiments demonstrated that the architecture of HSEs is very diverse in the human genome, with deviations from the consensus sequence in the spacing, orientation, and extent of HSE repeats that could influence HSF1 DNA binding efficacy and the kinetics and magnitude of target gene expression. To understand the mechanisms that dictate binding specificity, HSF1 was purified as either a monomer or trimer and used to evaluate DNA-binding site preferences in vitro using fluorescence polarization and thermal denaturation profiling. These results were compared with quantitative chromatin immunoprecipitation assays in vivo. We demonstrate a role for specific orientations of extended HSE sequences in driving preferential HSF1 DNA binding to target loci in vivo. These studies provide a biochemical basis for understanding differential HSF1 target gene recognition and transcription in neurodegenerative disease and in cancer. PMID:25204655
Bazzicalupi, Carla; Bencini, Andrea; Bianchi, Antonio; Biver, Tarita; Boggioni, Alessia; Bonacchi, Sara; Danesi, Andrea; Giorgi, Claudia; Gratteri, Paola; Ingraín, Antonio Marchal; Secco, Fernando; Sissi, Claudia; Valtancoli, Barbara; Venturini, Marcella
2008-01-01
The new bifunctional molecule 3,6-diamine-9-[6,6-bis(2-aminoethyl)-1,6-diaminohexyl]acridine (D), which is characterised by both an aromatic moiety and a separate metal-complexing polyamine centre, has been synthesised. The characteristics of D and its ZnII complex ([ZnD]) (protonation and metal-complexing constants, optical properties and self-aggregation phenomena) have been analysed by means of NMR spectroscopy, potentiometric, spectrophotometric and spectrofluorimetric techniques. The equilibria and kinetics of the binding process of D and [ZnD] to calf thymus DNA have been investigated at I=0.11 M (NaCl) and 298.1 K by using spectroscopic methods and the stopped-flow technique. Static measurements show biphasic behaviour for both D-DNA and [ZnD]-DNA systems; this reveals the occurrence of two different binding processes depending on the polymer-to-dye molar ratio (P/D). The binding mode that occurs at low P/D values is interpreted in terms of external binding with a notable contribution from the polyamine residue. The binding mode at high P/D values corresponds to intercalation of the proflavine residue. Stopped-flow, circular dichroism and supercoiled-DNA unwinding experiments corroborate the proposed mechanism. Molecular-modelling studies support the intercalative process and evidence the influence of NH+...O interactions between the protonated acridine nitrogen atom and the oxygen atoms of the polyanion; these interactions play a key role in determining the conformation of DNA adducts.
Uncoupling metallonuclease metal ion binding sites via nudge mutagenesis.
Papadakos, Grigorios A; Nastri, Horacio; Riggs, Paul; Dupureur, Cynthia M
2007-05-01
The hydrolysis of phosphodiester bonds by nucleases is critical to nucleic acid processing. Many nucleases utilize metal ion cofactors, and for a number of these enzymes two active-site metal ions have been detected. Testing proposed mechanistic roles for individual bound metal ions has been hampered by the similarity between the sites and cooperative behavior. In the homodimeric PvuII restriction endonuclease, the metal ion dependence of DNA binding is sigmoidal and consistent with two classes of coupled metal ion binding sites. We reasoned that a conservative active-site mutation would perturb the ligand field sufficiently to observe the titration of individual metal ion binding sites without significantly disturbing enzyme function. Indeed, mutation of a Tyr residue 5.5 A from both metal ions in the enzyme-substrate crystal structure (Y94F) renders the metal ion dependence of DNA binding biphasic: two classes of metal ion binding sites become distinct in the presence of DNA. The perturbation in metal ion coordination is supported by 1H-15N heteronuclear single quantum coherence spectra of enzyme-Ca(II) and enzyme-Ca(II)-DNA complexes. Metal ion binding by free Y94F is basically unperturbed: through multiple experiments with different metal ions, the data are consistent with two alkaline earth metal ion binding sites per subunit of low millimolar affinity, behavior which is very similar to that of the wild type. The results presented here indicate a role for the hydroxyl group of Tyr94 in the coupling of metal ion binding sites in the presence of DNA. Its removal causes the affinities for the two metal ion binding sites to be resolved in the presence of substrate. Such tuning of metal ion affinities will be invaluable to efforts to ascertain the contributions of individual bound metal ions to metallonuclease function.
Yoder-Himes, Deborah R.; Kroos, Lee
2006-01-01
The bacterium Myxococcus xanthus employs extracellular signals to coordinate aggregation and sporulation during multicellular development. Extracellular, contact-dependent signaling that involves the CsgA protein (called C-signaling) activates FruA, a putative response regulator that governs a branched signaling pathway inside cells. One branch regulates cell movement, leading to aggregation. The other branch regulates gene expression, leading to sporulation. C-signaling is required for full expression of most genes induced after 6 h into development, including the gene identified by Tn5 lac insertion Ω4400. To determine if FruA is a direct regulator of Ω4400 transcription, a combination of in vivo and in vitro experiments was performed. Ω4400 expression was abolished in a fruA mutant. The DNA-binding domain of FruA bound specifically to DNA upstream of the promoter −35 region in vitro. Mutations between bp −86 and −77 greatly reduced binding. One of these mutations had been shown previously to reduce Ω4400 expression in vivo and make it independent of C-signaling. For the first time, chromatin immunoprecipitation (ChIP) experiments were performed on M. xanthus. The ChIP experiments demonstrated that FruA is associated with the Ω4400 promoter region late in development, even in the absence of C-signaling. Based on these results, we propose that FruA directly activates Ω4400 transcription to a moderate level prior to C-signaling and, in response to C-signaling, binds near bp −80 and activates transcription to a higher level. Also, the highly localized effects of mutations between bp −86 and −77 on DNA binding in vitro, together with recently published footprints, allow us to predict a consensus binding site of GTCG/CGA/G for the FruA DNA-binding domain. PMID:16816188
Li, Chaoqun; Wang, Yaru; Wang, Yan; Chen, Guangju
2013-11-01
We carried out molecular dynamics simulations and free energy calculations for a series of ternary and diplex models for the HipA protein, HipB dimer, and DNA molecule to address the mechanism of HipA sequestration and the binding order of events from apo HipB/HipA to 2HipA + HipB dimer + DNA complex. The results revealed that the combination of DNA with the HipB dimer is energetically favorable for the combination of HipB dimer with HipA protein. The binding of DNA to HipB dimer induces a long-range allosteric communication from the HipB2 -DNA interface to the HipA-HipB2 interface, which involves the closeness of α1 helices of HipB dimer to HipA protein and formations of extra hydrogen bonds in the HipA-HipB2 interface through the extension of α2/3 helices in the HipB dimer. These simulated results suggested that the DNA molecule, as a regulative media, modulates the HipB dimer conformation, consequently increasing the interactions of HipB dimer with the HipA proteins, which explains the mechanism of HipA sequestration reported by the previous experiment. Simultaneously, these simulations also explored that the thermodynamic binding order in a simulated physiological environment, that is, the HipB dimer first bind to DNA to form HipB dimer + DNA complex, then capturing strongly the HipA proteins to form a ternary complex, 2HipA + HipB dimer + DNA, for sequestrating HipA in the nucleoid. Copyright © 2013 John Wiley & Sons, Ltd.
Weidmann, Alyson G.; Barton, Jacqueline K.
2015-01-01
We report the synthesis and characterization of a bimetallic complex derived from a new family of potent and selective metalloinsertors containing an unusual Rh—O axial coordination. This complex incorporates a monofunctional platinum center containing only one labile site for coordination to DNA, rather than two, and coordinates DNA non-classically through adduct formation in the minor groove. This conjugate displays bifunctional, interdependent binding of mismatched DNA via metalloinsertion at a mismatch as well as covalent platinum binding. DNA sequencing experiments revealed that the preferred site of platinum coordination is not the traditional N7-guanine site in the major groove, but rather N3-adenine in the minor groove. The complex also displays enhanced cytotoxicity in mismatch repair-deficient and mismatch repair-proficient human colorectal carcinoma cell lines compared to the chemotherapeutic cisplatin, and triggers cell death via an apoptotic pathway, rather than the necrotic pathway induced by rhodium metalloinsertors. PMID:26397309
Weidmann, Alyson G; Barton, Jacqueline K
2015-10-05
We report the synthesis and characterization of a bimetallic complex derived from a new family of potent and selective metalloinsertors containing an unusual Rh-O axial coordination. This complex incorporates a monofunctional platinum center containing only one labile site for coordination to DNA, rather than two, and coordinates DNA nonclassically through adduct formation in the minor groove. This conjugate displays bifunctional, interdependent binding of mismatched DNA via metalloinsertion at a mismatch as well as covalent platinum binding. DNA sequencing experiments revealed that the preferred site of platinum coordination is not the traditional N7-guanine site in the major groove, but rather N3-adenine in the minor groove. The complex also displays enhanced cytotoxicity in mismatch repair-deficient and mismatch repair-proficient human colorectal carcinoma cell lines compared to the chemotherapeutic cisplatin, and it triggers cell death via an apoptotic pathway, rather than the necrotic pathway induced by rhodium metalloinsertors.
The force-dependent mechanism of DnaK-mediated mechanical folding
Perales-Calvo, Judit; Giganti, David; Stirnemann, Guillaume; Garcia-Manyes, Sergi
2018-01-01
It is well established that chaperones modulate the protein folding free-energy landscape. However, the molecular determinants underlying chaperone-mediated mechanical folding remain largely elusive, primarily because the force-extended unfolded conformation fundamentally differs from that characterized in biochemistry experiments. We use single-molecule force-clamp spectroscopy, combined with molecular dynamics simulations, to study the effect that the Hsp70 system has on the mechanical folding of three mechanically stiff model proteins. Our results demonstrate that, when working independently, DnaJ (Hsp40) and DnaK (Hsp70) work as holdases, blocking refolding by binding to distinct substrate conformations. Whereas DnaK binds to molten globule–like forms, DnaJ recognizes a cryptic sequence in the extended state in an unanticipated force-dependent manner. By contrast, the synergetic coupling of the Hsp70 system exhibits a marked foldase behavior. Our results offer unprecedented molecular and kinetic insights into the mechanisms by which mechanical force finely regulates chaperone binding, directly affecting protein elasticity. PMID:29487911
Yang, Haozhe; Mei, Hui; Seela, Frank
2015-07-06
Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
Radiation damage to DNA in DNA-protein complexes.
Spotheim-Maurizot, M; Davídková, M
2011-06-03
The most aggressive product of water radiolysis, the hydroxyl (OH) radical, is responsible for the indirect effect of ionizing radiations on DNA in solution and aerobic conditions. According to radiolytic footprinting experiments, the resulting strand breaks and base modifications are inhomogeneously distributed along the DNA molecule irradiated free or bound to ligands (polyamines, thiols, proteins). A Monte-Carlo based model of simulation of the reaction of OH radicals with the macromolecules, called RADACK, allows calculating the relative probability of damage of each nucleotide of DNA irradiated alone or in complexes with proteins. RADACK calculations require the knowledge of the three dimensional structure of DNA and its complexes (determined by X-ray crystallography, NMR spectroscopy or molecular modeling). The confrontation of the calculated values with the results of the radiolytic footprinting experiments together with molecular modeling calculations show that: (1) the extent and location of the lesions are strongly dependent on the structure of DNA, which in turns is modulated by the base sequence and by the binding of proteins and (2) the regions in contact with the protein can be protected against the attack by the hydroxyl radicals via masking of the binding site and by scavenging of the radicals. 2011 Elsevier B.V. All rights reserved.
Looping and clustering model for the organization of protein-DNA complexes on the bacterial genome
NASA Astrophysics Data System (ADS)
Walter, Jean-Charles; Walliser, Nils-Ole; David, Gabriel; Dorignac, Jérôme; Geniet, Frédéric; Palmeri, John; Parmeggiani, Andrea; Wingreen, Ned S.; Broedersz, Chase P.
2018-03-01
The bacterial genome is organized by a variety of associated proteins inside a structure called the nucleoid. These proteins can form complexes on DNA that play a central role in various biological processes, including chromosome segregation. A prominent example is the large ParB-DNA complex, which forms an essential component of the segregation machinery in many bacteria. ChIP-Seq experiments show that ParB proteins localize around centromere-like parS sites on the DNA to which ParB binds specifically, and spreads from there over large sections of the chromosome. Recent theoretical and experimental studies suggest that DNA-bound ParB proteins can interact with each other to condense into a coherent 3D complex on the DNA. However, the structural organization of this protein-DNA complex remains unclear, and a predictive quantitative theory for the distribution of ParB proteins on DNA is lacking. Here, we propose the looping and clustering model, which employs a statistical physics approach to describe protein-DNA complexes. The looping and clustering model accounts for the extrusion of DNA loops from a cluster of interacting DNA-bound proteins that is organized around a single high-affinity binding site. Conceptually, the structure of the protein-DNA complex is determined by a competition between attractive protein interactions and loop closure entropy of this protein-DNA cluster on the one hand, and the positional entropy for placing loops within the cluster on the other. Indeed, we show that the protein interaction strength determines the ‘tightness’ of the loopy protein-DNA complex. Thus, our model provides a theoretical framework for quantitatively computing the binding profiles of ParB-like proteins around a cognate (parS) binding site.
Corbett, John; Cornacchione, Louis; Daly, William; Galan, Diego; Wysota, Michael; Tivnan, Patrick; Collins, Justin; Nye, Dillon; Levitz, Talya; Breyer, Wendy A.; Glasfeld, Arthur
2015-01-01
ABSTRACT Streptococcus mutans is the causative agent of dental caries, a significant concern for human health, and therefore an attractive target for therapeutics development. Previous work in our laboratory has identified a homodimeric, manganese-dependent repressor protein, SloR, as an important regulator of cariogenesis and has used site-directed mutagenesis to map functions to specific regions of the protein. Here we extend those studies to better understand the structural interaction between SloR and its operator and its effector metal ions. The results of DNase I assays indicate that SloR protects a 42-bp region of DNA that overlaps the sloABC promoter on the S. mutans UA159 chromosome, while electrophoretic mobility shift and solution binding assays indicate that each of two SloR dimers binds to this region. Real-time semiquantitative reverse transcriptase PCR (real-time semi-qRT-PCR) experiments were used to determine the individual base pairs that contribute to SloR-DNA binding specificity. Solution studies indicate that Mn2+ is better than Zn2+ at specifically activating SloR to bind DNA, and yet the 2.8-Å resolved crystal structure of SloR bound to Zn2+ provides insight into the means by which selective activation by Mn2+ may be achieved and into how SloR may form specific interactions with its operator. Taken together, these experimental observations are significant because they can inform rational drug design aimed at alleviating and/or preventing S. mutans-induced caries formation. IMPORTANCE This report focuses on investigating the SloR protein as a regulator of essential metal ion transport and virulence gene expression in the oral pathogen Streptococcus mutans and on revealing the details of SloR binding to its metal ion effectors and binding to DNA that together facilitate this expression. We used molecular and biochemical approaches to characterize the interaction of SloR with Mn2+ and with its SloR recognition element to gain a clearer picture of the regulatory networks that optimize SloR-mediated metal ion homeostasis and virulence gene expression in S. mutans. These experiments can have a significant impact on caries treatment and/or prevention by revealing the S. mutans SloR-DNA binding interface as an appropriate target for the development of novel therapeutic interventions. PMID:26350131
Majeed, S Abdul; Nambi, K S N; Taju, G; Vimal, S; Venkatesan, C; Hameed, A S Sahul
2014-12-01
The cytotoxicity, genotoxicity and oxidative stress of malachite green (MG) was investigated using the fish Channa striata kidney (CSK) and Channa striata gill (CSG) cell lines. Five concentrations ranging from 0.001 to 10 μg mL(-1) were tested in three independent experiments. Cytotoxicity was assessed by 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, Rhodamine 123 and Alamar Blue. The mitochondrial changes and apoptosis of MG-exposed cells were observed by Rhodamine 123 and acridine orange/ethidium bromide (AO/EB) staining, respectively. In vitro potential DNA damaging effect of MG was tested using comet assay. Mitochondrial damage, apoptosis and DNA fragmentation increased in a concentration-dependent manner. Additionally, DNA electrophoretic mobility experiments were carried out to study the binding effect of MG to double-stranded DNA (dsDNA) of cells. DNA shift mobility experiments showed that MG is capable of strongly binding to linear dsDNA causing its degradation. Biochemical parameters such as lipid peroxidation (MDA), catalase (CAT) activity and reduced glutathione (GSH) levels were evaluated after exposure to MG. In CSK and CSG cell lines exposed to MG for 48 h, a significant increase in lipid peroxidation, which might be associated with decreased levels of reduced glutathione and catalase activity in these cell lines (p < 0.001), was observed.
Xu, Binjie; Soukup, Randal J; Jones, Christopher J; Fishel, Richard; Wozniak, Daniel J
2016-10-01
During late stages of cystic fibrosis pulmonary infections, Pseudomonas aeruginosa often overproduces the exopolysaccharide alginate, protecting the bacterial community from host immunity and antimicrobials. The transcription of the alginate biosynthesis operon is under tight control by a number of factors, including AmrZ, the focus of this study. Interestingly, multiple transcription factors interact with the far-upstream region of this promoter (PalgD), in which one AmrZ binding site has been identified previously. The mechanisms of AmrZ binding and subsequent activation remain unclear and require more-detailed investigation. In this study, in-depth examinations elucidated four AmrZ binding sites, and their disruption eliminated AmrZ binding and promoter activation. Furthermore, our in vitro fluorescence resonance energy transfer experiments suggest that AmrZ holds together multiple binding sites in PalgD and thereafter induces the formation of higher-order DNA-AmrZ complexes. To determine the importance of interactions between those AmrZ oligomers in the cell, a DNA phasing experiment was performed. PalgD transcription was significantly impaired when the relative phase between AmrZ binding sites was reversed (5 bp), while a full-DNA-turn insertion (10 bp) restored promoter activity. Taken together, the investigations presented here provide a deeper mechanistic understanding of AmrZ-mediated binding to PalgD IMPORTANCE: Overproduction of the exopolysaccharide alginate provides protection to Pseudomonas aeruginosa against antimicrobial treatments and is associated with chronic P. aeruginosa infections in the lungs of cystic fibrosis patients. In this study, we combined a variety of microbiological, genetic, biochemical, and biophysical approaches to investigate the activation of the alginate biosynthesis operon promoter by a key transcription factor named AmrZ. This study has provided important new information on the mechanism of activation of this extremely complex promoter. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Sharma, Pankaj; Tomar, Anil Kumar; Kundu, Bishwajit
2018-02-01
Cell division is compromised in DnaAcos mutant E. coli cells due to chromosome over-replication. In these cells, CedA acts as a regulatory protein and initiates cell division by a hitherto unknown mechanism. CedA, a double stranded DNA binding protein, interacts with various subunits of RNA polymerase complex, including rpoB. To reveal how this concert between CedA, rpoB and DNA brings about cell division in E. coli, we performed biophysical and in silico analysis and obtained mechanistic insights. Interaction between CedA and rpoB was shown by circular dichroism spectrometry and in silico docking experiments. Further, CedA and rpoB were allowed to interact individually to a selected DNA and their binding was monitored by fluorescence spectroscopy. The binding constants of these interactions as determined by BioLayer Interferometry clearly show that rpoB binds to DNA with higher affinity (K D2 =<1.0E-12M) as compared to CedA (K D2 =9.58E-09M). These findings were supported by docking analysis where 12 intermolecular H-bonds were formed in rpoB-DNA complex as compared to 4 in CedA-DNA complex. Based on our data we propose that in E. coli cells chromosome over-replication signals CedA to recruit rpoB to specific DNA site(s), which initiates transcription of cell division regulatory elements. Copyright © 2017 Elsevier B.V. All rights reserved.
Gattuso, Hugo; Besancenot, Vanessa; Grandemange, Stéphanie; Marazzi, Marco; Monari, Antonio
2016-01-01
We report a molecular modeling study, coupled with spectroscopy experiments, on the behavior of two well known organic dyes, nile blue and nile red, when interacting with B-DNA. In particular, we evidence the presence of two competitive binding modes, for both drugs. However their subsequent photophysical behavior is different and only nile blue is able to induce DNA photosensitization via an electron transfer mechanism. Most notably, even in the case of nile blue, its sensitization capabilities strongly depend on the environment resulting in a single active binding mode: the minor groove. Fluorescence spectroscopy confirms the presence of competitive interaction modes for both sensitizers, while the sensitization via electron transfer, is possible only in the case of nile blue. PMID:27329409
TALE proteins search DNA using a rotationally decoupled mechanism.
Cuculis, Luke; Abil, Zhanar; Zhao, Huimin; Schroeder, Charles M
2016-10-01
Transcription activator-like effector (TALE) proteins are a class of programmable DNA-binding proteins used extensively for gene editing. Despite recent progress, however, little is known about their sequence search mechanism. Here, we use single-molecule experiments to study TALE search along DNA. Our results show that TALEs utilize a rotationally decoupled mechanism for nonspecific search, despite remaining associated with DNA templates during the search process. Our results suggest that the protein helical structure enables TALEs to adopt a loosely wrapped conformation around DNA templates during nonspecific search, facilitating rapid one-dimensional (1D) diffusion under a range of solution conditions. Furthermore, this model is consistent with a previously reported two-state mechanism for TALE search that allows these proteins to overcome the search speed-stability paradox. Taken together, our results suggest that TALE search is unique among the broad class of sequence-specific DNA-binding proteins and supports efficient 1D search along DNA.
Weber, Janine; Bao, Han; Hartlmüller, Christoph; Wang, Zhiqin; Windhager, Almut; Janowski, Robert; Madl, Tobias; Jin, Peng; Niessing, Dierk
2016-01-01
The neuronal DNA-/RNA-binding protein Pur-alpha is a transcription regulator and core factor for mRNA localization. Pur-alpha-deficient mice die after birth with pleiotropic neuronal defects. Here, we report the crystal structure of the DNA-/RNA-binding domain of Pur-alpha in complex with ssDNA. It reveals base-specific recognition and offers a molecular explanation for the effect of point mutations in the 5q31.3 microdeletion syndrome. Consistent with the crystal structure, biochemical and NMR data indicate that Pur-alpha binds DNA and RNA in the same way, suggesting binding modes for tri- and hexanucleotide-repeat RNAs in two neurodegenerative RNAopathies. Additionally, structure-based in vitro experiments resolved the molecular mechanism of Pur-alpha's unwindase activity. Complementing in vivo analyses in Drosophila demonstrated the importance of a highly conserved phenylalanine for Pur-alpha's unwinding and neuroprotective function. By uncovering the molecular mechanisms of nucleic-acid binding, this study contributes to understanding the cellular role of Pur-alpha and its implications in neurodegenerative diseases. DOI: http://dx.doi.org/10.7554/eLife.11297.001 PMID:26744780
Hou, Ming-Hon; Lu, Wen-Je; Huang, Chun-Yu; Fan, Ruey-Jane; Yuann, Jeu-Ming P
2009-06-09
Few studies have examined the effects of polyamines on the action of DNA-binding anticancer drugs. Here, a Co(II)-mediated dimeric mithramycin (Mith) complex, (Mith)(2)-Co(II), was shown to be resistant to polyamine competition toward the divalent metal ion when compared to the Fe(II)-mediated drug complexes. Surface plasmon resonance experiments demonstrated that polyamines interfered with the binding capacity and association rates of (Mith)(2)-Co(II) binding to DNA duplexes, while the dissociation rates were not affected. Although (Mith)(2)-Co(II) exhibited the highest oxidative activity under physiological conditions (pH 7.3 and 37 degrees C), polyamines (spermine in particular) inhibited the DNA cleavage activity of the (Mith)(2)-Co(II) in a concentration-dependent manner. Depletion of intracellular polyamines by methylglyoxal bis(guanylhydrazone) (MGBG) enhanced the sensitivity of A549 lung cancer cells to (Mith)(2)-Co(II), most likely due to the decreased intracellular effect of polyamines on the action of (Mith)(2)-Co(II). Our study suggests a novel method for enhancing the anticancer activity of DNA-binding metalloantibiotics through polyamine depletion.
Predicting DNA binding proteins using support vector machine with hybrid fractal features.
Niu, Xiao-Hui; Hu, Xue-Hai; Shi, Feng; Xia, Jing-Bo
2014-02-21
DNA-binding proteins play a vitally important role in many biological processes. Prediction of DNA-binding proteins from amino acid sequence is a significant but not fairly resolved scientific problem. Chaos game representation (CGR) investigates the patterns hidden in protein sequences, and visually reveals previously unknown structure. Fractal dimensions (FD) are good tools to measure sizes of complex, highly irregular geometric objects. In order to extract the intrinsic correlation with DNA-binding property from protein sequences, CGR algorithm, fractal dimension and amino acid composition are applied to formulate the numerical features of protein samples in this paper. Seven groups of features are extracted, which can be computed directly from the primary sequence, and each group is evaluated by the 10-fold cross-validation test and Jackknife test. Comparing the results of numerical experiments, the group of amino acid composition and fractal dimension (21-dimension vector) gets the best result, the average accuracy is 81.82% and average Matthew's correlation coefficient (MCC) is 0.6017. This resulting predictor is also compared with existing method DNA-Prot and shows better performances. © 2013 The Authors. Published by Elsevier Ltd All rights reserved.
2011-01-01
Background Existing methods of predicting DNA-binding proteins used valuable features of physicochemical properties to design support vector machine (SVM) based classifiers. Generally, selection of physicochemical properties and determination of their corresponding feature vectors rely mainly on known properties of binding mechanism and experience of designers. However, there exists a troublesome problem for designers that some different physicochemical properties have similar vectors of representing 20 amino acids and some closely related physicochemical properties have dissimilar vectors. Results This study proposes a systematic approach (named Auto-IDPCPs) to automatically identify a set of physicochemical and biochemical properties in the AAindex database to design SVM-based classifiers for predicting and analyzing DNA-binding domains/proteins. Auto-IDPCPs consists of 1) clustering 531 amino acid indices in AAindex into 20 clusters using a fuzzy c-means algorithm, 2) utilizing an efficient genetic algorithm based optimization method IBCGA to select an informative feature set of size m to represent sequences, and 3) analyzing the selected features to identify related physicochemical properties which may affect the binding mechanism of DNA-binding domains/proteins. The proposed Auto-IDPCPs identified m=22 features of properties belonging to five clusters for predicting DNA-binding domains with a five-fold cross-validation accuracy of 87.12%, which is promising compared with the accuracy of 86.62% of the existing method PSSM-400. For predicting DNA-binding sequences, the accuracy of 75.50% was obtained using m=28 features, where PSSM-400 has an accuracy of 74.22%. Auto-IDPCPs and PSSM-400 have accuracies of 80.73% and 82.81%, respectively, applied to an independent test data set of DNA-binding domains. Some typical physicochemical properties discovered are hydrophobicity, secondary structure, charge, solvent accessibility, polarity, flexibility, normalized Van Der Waals volume, pK (pK-C, pK-N, pK-COOH and pK-a(RCOOH)), etc. Conclusions The proposed approach Auto-IDPCPs would help designers to investigate informative physicochemical and biochemical properties by considering both prediction accuracy and analysis of binding mechanism simultaneously. The approach Auto-IDPCPs can be also applicable to predict and analyze other protein functions from sequences. PMID:21342579
NASA Astrophysics Data System (ADS)
Asadi, Zahra; Nasrollahi, Neda; Karbalaei-Heidari, Hamidreza; Eigner, Vaclav; Dusek, Michal; Mobaraki, Nabiallah; Pournejati, Roya
2017-05-01
Two water-soluble mono-nuclear macrocyclic lanthanum(III) complexes of 2,6-diformyl-4-methylphenol with 1,3-diamino-2-propanol (C1) or 1,3-propylenediamine (C2) were synthesized and characterized by UV-Vis, FT-IR, 13C and 1H NMR spectroscopy and elemental analysis. C1 complex was structurally characterized by single-crystal X-ray diffraction, which revealed that the complex was mononuclear and ten-coordinated. The coordination sites around lanthanum(III) were occupied with a five-dentate ligand, two bidentate nitrates, and one water molecule. The interaction of complexes with DNA was studied in buffered aqueous solution at pH 7.4. UV-Vis absorption spectroscopy, emission spectroscopy, circular dichroism (CD) and viscometric measurements provided clear evidence of the intercalation mechanism of binding. The obtained intrinsic binding constants (Kb) 9.3 × 103 and 1.2 × 103 M- 1 for C1 and C2, respectively confirmed that C1 is better intercalator than C2. The DNA docking studies suggested that the complexes bind with DNA in a groove binding mode with the binding affinity of C1 > C2. Moreover, agarose gel electrophoresis study of the DNA-complex for both compounds revealed that the C1 intercalation cause ethidium bromide replacement in a competitive manner which confirms the suggested mechanism of binding. Finally, the anticancer experiments for the treated cancerous cell lines with both synthesized compounds show that these hydrophilic molecules need a suitable carrier to pass through the hydrophobic nature of cell membrane efficiently.
In silico modeling of epigenetic-induced changes in photoreceptor cis-regulatory elements.
Hossain, Reafa A; Dunham, Nicholas R; Enke, Raymond A; Berndsen, Christopher E
2018-01-01
DNA methylation is a well-characterized epigenetic repressor of mRNA transcription in many plant and vertebrate systems. However, the mechanism of this repression is not fully understood. The process of transcription is controlled by proteins that regulate recruitment and activity of RNA polymerase by binding to specific cis-regulatory sequences. Cone-rod homeobox (CRX) is a well-characterized mammalian transcription factor that controls photoreceptor cell-specific gene expression. Although much is known about the functions and DNA binding specificity of CRX, little is known about how DNA methylation modulates CRX binding affinity to genomic cis-regulatory elements. We used bisulfite pyrosequencing of human ocular tissues to measure DNA methylation levels of the regulatory regions of RHO , PDE6B, PAX6 , and LINE1 retrotransposon repeats. To describe the molecular mechanism of repression, we used molecular modeling to illustrate the effect of DNA methylation on human RHO regulatory sequences. In this study, we demonstrate an inverse correlation between DNA methylation in regulatory regions adjacent to the human RHO and PDE6B genes and their subsequent transcription in human ocular tissues. Docking of CRX to the DNA models shows that CRX interacts with the grooves of these sequences, suggesting changes in groove structure could regulate binding. Molecular dynamics simulations of the RHO promoter and enhancer regions show changes in the flexibility and groove width upon epigenetic modification. Models also demonstrate changes in the local dynamics of CRX binding sites within RHO regulatory sequences which may account for the repression of CRX-dependent transcription. Collectively, these data demonstrate epigenetic regulation of CRX binding sites in human retinal tissue and provide insight into the mechanism of this mode of epigenetic regulation to be tested in future experiments.
Oliviero, S; Cortese, R
1989-01-01
Transcription of the human haptoglobin (Hp) gene is induced by interleukin-6 (IL-6) in the human hepatoma cell line Hep3B. Cis-acting elements responsible for this response are localized within the first 186 bp of the 5'-flanking region. Site-specific mutants of the Hp promoter fused to the chloramphenicol acetyl transferase (CAT) gene were analysed by transient transfection into uninduced and IL-6-treated Hep3B cells. We identified three regions, A, B and C, defined by mutation, which are important for the IL-6 response. Band shift experiments using nuclear extracts from untreated or IL-6-treated cells revealed the presence of IL-6-inducible DNA binding activities when DNA fragments containing the A or the C sequences were used. Competition experiments showed that both sequences bind to the same nuclear factors. Polymers of oligonucleotides containing either the A or the C regions confer IL-6 responsiveness to a truncated SV40 promoter. The B region forms several complexes with specific DNA-binding proteins different from those which bind to the A and C region. The B region complexes are identical in nuclear extracts from IL-6-treated and untreated cells. While important for IL-6 induction in the context of the haptoglobin promoter, the B site does not confer IL-6 inducibility to the SV40 promoter. Our results indicate that the IL-6 response of the haptoglobin promoter is dependent on the presence of multiple, partly redundant, cis-acting elements. Images PMID:2787245
DNA Knots: Theory and Experiments
NASA Astrophysics Data System (ADS)
Sumners, D. W.
Cellular DNA is a long, thread-like molecule with remarkably complex topology. Enzymes that manipulate the geometry and topology of cellular DNA perform many vital cellular processes (including segregation of daughter chromosomes, gene regulation, DNA repair, and generation of antibody diversity). Some enzymes pass DNA through itself via enzyme-bridged transient breaks in the DNA; other enzymes break the DNA apart and reconnect it to different ends. In the topological approach to enzymology, circular DNA is incubated with an enzyme, producing an enzyme signature in the form of DNA knots and links. By observing the changes in DNA geometry (supercoiling) and topology (knotting and linking) due to enzyme action, the enzyme binding and mechanism can often be characterized. This paper will discuss some personal research history, and the tangle model for the analysis of site-specific recombination experiments on circular DNA.
A purified transcription factor (TIF-IB) binds to essential sequences of the mouse rDNA promoter.
Clos, J; Buttgereit, D; Grummt, I
1986-01-01
A transcription factor that is specific for mouse rDNA has been partially purified from Ehrlich ascites cells. This factor [designated transcription initiation factor (TIF)-IB] is required for accurate in vitro synthesis of mouse rRNA in addition to RNA polymerase I and another regulatory factor, TIF-IA. TIF-IB activity is present in extracts both from growing and nongrowing cells in comparable amounts. Prebinding competition experiments with wild-type and mutant templates suggest that TIF-IB interacts with the core control element of the rDNA promoter, which is located immediately upstream of the initiation site. The specific binding of TIF-IB to the RNA polymerase I promoter is demonstrated by exonuclease III protection experiments. The 3' border of the sequences protected by TIF-IB is shown to be on the coding strand at position -21 and on the noncoding strand at position -7. The results suggest that direct binding of TIF-IB to sequences in the core promoter element is the mechanism by which this factor imparts promoter selectivity to RNA polymerase I. Images PMID:3456157
Sheridan, P L; Schorpp, M; Voz, M L; Jones, K A
1995-03-03
We have isolated a human cDNA clone encoding HIP116, a protein that binds to the SPH repeats of the SV40 enhancer and to the TATA/inhibitor region of the human immunodeficiency virus (HIV)-1 promoter. The predicted HIP116 protein is related to the yeast SNF2/SWI2 transcription factor and to other members of this extended family and contains seven domains similar to those found in the vaccinia NTP1 ATPase. Interestingly, HIP116 also contains a C3HC4 zinc-binding motif (RING finger) interspersed between the ATPase motifs in an arrangement similar to that found in the yeast RAD5 and RAD16 proteins. The HIP116 amino terminus is unique among the members of this family, and houses a specific DNA-binding domain. Antiserum raised against HIP116 recognizes a 116-kDa nuclear protein in Western blots and specifically supershifts SV40 and HIV-1 protein-DNA complexes in gel shift experiments. The binding site for HIP116 on the SV40 enhancer directly overlaps the site for TEF-1, and like TEF-1, binding of HIP116 to the SV40 enhancer is destroyed by mutations that inhibit SPH enhancer activity in vivo. Purified fractions of HIP116 display strong ATPase activity that is preferentially stimulated by SPH DNA and can be inhibited specifically by antibodies to HIP116. These findings suggest that HIP116 might affect transcription, directly or indirectly, by acting as a DNA binding site-specific ATPase.
“Ultra-high resolution optical trap with single fluorophore sensitivity”
Comstock, Matthew J; Ha, Taekjip; Chemla, Yann R
2013-01-01
We present a single-molecule instrument that combines a timeshared ultra-high resolution dual optical trap interlaced with a confocal fluorescence microscope. In a demonstration experiment, individual single-fluorophore labeled DNA oligonucleotides were observed to bind and unbind to complementary DNA suspended between two trapped beads. Simultaneous with the single-fluorophore detection, coincident angstrom-scale changes in tether extension could be clearly observed. Fluorescence readout allowed us to determine the duplex melting rate as a function of force. The new instrument will enable the simultaneous measurement of angstrom-scale mechanical motion of individual DNA-binding proteins (e.g., single base pair stepping of DNA translocases) along with the detection of fluorescently labeled protein properties (e.g., internal configuration). PMID:21336286
Shahabadi, Nahid; Khodaei, Mohammad Mehdi; Kashanian, Soheila; Kheirdoosh, Fahimeh
2014-01-01
A copper (II) complex containing aspartame (APM) as ligand, Cu(APM)2Cl2⋅2H2O, was synthesized and characterized. In vitro binding interaction of this complex with native calf thymus DNA (CT-DNA) was studied at physiological pH. The interaction was studied using different methods: spectrophotometric, spectrofluorometric, competition experiment, circular dichroism (CD) and viscosimetric techniques. Hyperchromicity was observed in UV absorption band of Cu(APM)2Cl2⋅2H2O. A strong fluorescence quenching reaction of DNA to Cu(APM)2Cl2⋅2H2O was observed and the binding constants (Kf) and corresponding numbers of binding sites (n) were calculated at different temperatures. Thermodynamic parameters, enthalpy change (ΔH) and entropy change (ΔS) were calculated to be+89.3 kJ mol(-1) and+379.3 J mol(-1) K(-1) according to Van't Hoff equation which indicated that reaction is predominantly entropically driven. Experimental results from spectroscopic methods were comparable and further supported by viscosity measurements. We suggest that Cu(APM)2Cl2⋅2H2O interacts with calf thymus DNA via a groove interaction mode with an intrinsic binding constant of 8×10+4 M(-1). Binding of this copper complex to DNA was found to be stronger compared to aspartame which was studied recently. Copyright © 2013 Elsevier B.V. All rights reserved.
2016-01-01
The four-way (Holliday) DNA junction of homologous recombination is processed by the symmetrical cleavage of two strands by a nuclease. These junction-resolving enzymes bind to four-way junctions in dimeric form, distorting the structure of the junction in the process. Crystal structures of T7 endonuclease I have been determined as free protein, and the complex with a DNA junction. In neither crystal structure was the N-terminal 16-amino acid peptide visible, yet deletion of this peptide has a marked effect on the resolution process. Here we have investigated the N-terminal peptide by inclusion of spin-label probes at unique sites within this region, studied by electron paramagnetic resonance. Continuous wave experiments show that these labels are mobile in the free protein but become constrained on binding a DNA junction, with the main interaction occurring for residues 7–10 and 12. Distance measurements between equivalent positions within the two peptides of a dimer using PELDOR showed that the intermonomeric distances for residues 2–12 are long and broadly distributed in the free protein but are significantly shortened and become more defined on binding to DNA. These results suggest that the N-terminal peptides become more organized on binding to the DNA junction and nestle into the minor grooves at the branchpoint, consistent with the biochemical data indicating an important role in the resolution process. This study demonstrates the presence of structure within a protein region that cannot be viewed by crystallography. PMID:27387136
An immunoassay for the study of DNA-binding activities of herpes simplex virus protein ICP8.
Lee, C K; Knipe, D M
1985-06-01
An immunoassay was used to examine the interaction between a herpes simplex virus protein, ICP8, and various types of DNA. The advantage of this assay is that the protein is not subjected to harsh purification procedures. We characterized the binding of ICP8 to both single-stranded (ss) and double-stranded (ds) DNA. ICP8 bound ss DNA fivefold more efficiently than ds DNA, and both binding activities were most efficient in 150 mM NaCl. Two lines of evidence indicate that the binding activities were not identical: (i) ds DNA failed to complete with ss DNA binding even with a large excess of ds DNA; (ii) Scatchard plots of DNA binding with various amounts of DNA were fundamentally different for ss DNA and ds DNA. However, the two activities were related in that ss DNA efficiently competed with the binding of ds DNA. We conclude that the ds DNA-binding activity of ICP8 is probably distinct from the ss DNA-binding activity. No evidence for sequence-specific ds DNA binding was obtained for either the entire herpes simplex virus genome or cloned viral sequences.
ERIC Educational Resources Information Center
Heffler, Michael A.; Walters, Ryan D.; Kugel, Jennifer F.
2012-01-01
An undergraduate biochemistry laboratory experiment is described that will teach students the practical and theoretical considerations for measuring the equilibrium dissociation constant (K[subscript D]) for a protein/DNA interaction using electrophoretic mobility shift assays (EMSAs). An EMSA monitors the migration of DNA through a native gel;…
Corbi, N; Libri, V; Fanciulli, M; Tinsley, J M; Davies, K E; Passananti, C
2000-06-01
Up-regulation of utrophin gene expression is recognized as a plausible therapeutic approach in the treatment of Duchenne muscular dystrophy (DMD). We have designed and engineered new zinc finger-based transcription factors capable of binding and activating transcription from the promoter of the dystrophin-related gene, utrophin. Using the recognition 'code' that proposes specific rules between zinc finger primary structure and potential DNA binding sites, we engineered a new gene named 'Jazz' that encodes for a three-zinc finger peptide. Jazz belongs to the Cys2-His2 zinc finger type and was engineered to target the nine base pair DNA sequence: 5'-GCT-GCT-GCG-3', present in the promoter region of both the human and mouse utrophin gene. The entire zinc finger alpha-helix region, containing the amino acid positions that are crucial for DNA binding, was specifically chosen on the basis of the contacts more frequently represented in the available list of the 'code'. Here we demonstrate that Jazz protein binds specifically to the double-stranded DNA target, with a dissociation constant of about 32 nM. Band shift and super-shift experiments confirmed the high affinity and specificity of Jazz protein for its DNA target. Moreover, we show that chimeric proteins, named Gal4-Jazz and Sp1-Jazz, are able to drive the transcription of a test gene from the human utrophin promoter.
MeDReaders: a database for transcription factors that bind to methylated DNA.
Wang, Guohua; Luo, Ximei; Wang, Jianan; Wan, Jun; Xia, Shuli; Zhu, Heng; Qian, Jiang; Wang, Yadong
2018-01-04
Understanding the molecular principles governing interactions between transcription factors (TFs) and DNA targets is one of the main subjects for transcriptional regulation. Recently, emerging evidence demonstrated that some TFs could bind to DNA motifs containing highly methylated CpGs both in vitro and in vivo. Identification of such TFs and elucidation of their physiological roles now become an important stepping-stone toward understanding the mechanisms underlying the methylation-mediated biological processes, which have crucial implications for human disease and disease development. Hence, we constructed a database, named as MeDReaders, to collect information about methylated DNA binding activities. A total of 731 TFs, which could bind to methylated DNA sequences, were manually curated in human and mouse studies reported in the literature. In silico approaches were applied to predict methylated and unmethylated motifs of 292 TFs by integrating whole genome bisulfite sequencing (WGBS) and ChIP-Seq datasets in six human cell lines and one mouse cell line extracted from ENCODE and GEO database. MeDReaders database will provide a comprehensive resource for further studies and aid related experiment designs. The database implemented unified access for users to most TFs involved in such methylation-associated binding actives. The website is available at http://medreader.org/. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Shen, Zhanhang; Mulholland, Kelly A; Zheng, Yujun; Wu, Chun
2017-09-01
DNA G-quadruplex structures are emerging cancer-specific targets for chemotherapeutics. Ligands that bind to and stabilize DNA G-quadruplexes have the potential to be anti-cancer drugs. Lack of binding selectivity to DNA G-quadruplex over DNA duplex remains a major challenge when attempting to develop G-quadruplex ligands into successful anti-cancer drugs. Thorough understanding of the binding nature of existing non-selective ligands that bind to both DNA quadruplex and DNA duplex will help to address this challenge. Daunomycin and doxorubicin, two commonly used anticancer drugs, are examples of non-selective DNA ligands. In this study, we extended our early all-atom binding simulation studies between doxorubicin and a DNA duplex (d(CGATCG) 2 ) to probe the binding between daunomycin and a parallel DNA quadruplex (d(TGGGGT) 4 ) and DNA duplex. In addition to the end stacking mode, which mimics the mode in the crystal structure, a pure groove binding mode was observed in our free binding simulations. The dynamic and energetic properties of these two binding modes are thoroughly examined, and a detailed comparison is made between DNA quadruplex binding modes and DNA duplex binding modes. Implications on the design of more selective DNA quadruplex ligands are also discussed. Graphical abstract Top stacking and groov binding modes from the MD simulations.
Ghobadi, Ahmadreza F; Letteri, Rachel; Parelkar, Sangram S; Zhao, Yue; Chan-Seng, Delphine; Emrick, Todd; Jayaraman, Arthi
2016-02-08
Polymer-based gene delivery vehicles benefit from the presence of hydrophilic groups that mitigate the inherent toxicity of polycations and that provide tunable polymer-DNA binding strength and stable complexes (polyplexes). However, hydrophilic groups screen charge, and as such can reduce cell uptake and transfection efficiency. We report the effect of embedding zwitterionic sulfobetaine (SB) groups in cationic comb polymers, using a combination of experiments and molecular simulations. Ring-opening metathesis polymerization (ROMP) produced comb polymers with tetralysine (K4) and SB pendent groups. Dynamic light scattering, zeta potential measurements, and fluorescence-based experiments, together with coarse-grained molecular dynamics simulations, described the effect of SB groups on the size, shape, surface charge, composition, and DNA binding strength of polyplexes formed using these comb polymers. Experiments and simulations showed that increasing SB composition in the comb polymers decreased polymer-DNA binding strength, while simulations indicated that the SB groups distributed throughout the polyplex. This allows polyplexes to maintain a positive surface charge and provide high levels of gene expression in live cells. Notably, comb polymers with nearly 50 mol % SB form polyplexes that exhibit positive surface charge similarly as polyplexes formed from purely cationic comb polymers, indicating the ability to introduce an appreciable amount of SB functionality without screening surface charge. This integrated simulation-experimental study demonstrates the effectiveness of incorporating zwitterions in polyplexes, while guiding the design of new and effective gene delivery vectors.
Kulakovskiy, Ivan V; Vorontsov, Ilya E; Yevshin, Ivan S; Sharipov, Ruslan N; Fedorova, Alla D; Rumynskiy, Eugene I; Medvedeva, Yulia A; Magana-Mora, Arturo; Bajic, Vladimir B; Papatsenko, Dmitry A; Kolpakov, Fedor A; Makeev, Vsevolod J
2018-01-04
We present a major update of the HOCOMOCO collection that consists of patterns describing DNA binding specificities for human and mouse transcription factors. In this release, we profited from a nearly doubled volume of published in vivo experiments on transcription factor (TF) binding to expand the repertoire of binding models, replace low-quality models previously based on in vitro data only and cover more than a hundred TFs with previously unknown binding specificities. This was achieved by systematic motif discovery from more than five thousand ChIP-Seq experiments uniformly processed within the BioUML framework with several ChIP-Seq peak calling tools and aggregated in the GTRD database. HOCOMOCO v11 contains binding models for 453 mouse and 680 human transcription factors and includes 1302 mononucleotide and 576 dinucleotide position weight matrices, which describe primary binding preferences of each transcription factor and reliable alternative binding specificities. An interactive interface and bulk downloads are available on the web: http://hocomoco.autosome.ru and http://www.cbrc.kaust.edu.sa/hocomoco11. In this release, we complement HOCOMOCO by MoLoTool (Motif Location Toolbox, http://molotool.autosome.ru) that applies HOCOMOCO models for visualization of binding sites in short DNA sequences. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
G = MAT: linking transcription factor expression and DNA binding data.
Tretyakov, Konstantin; Laur, Sven; Vilo, Jaak
2011-01-31
Transcription factors are proteins that bind to motifs on the DNA and thus affect gene expression regulation. The qualitative description of the corresponding processes is therefore important for a better understanding of essential biological mechanisms. However, wet lab experiments targeted at the discovery of the regulatory interplay between transcription factors and binding sites are expensive. We propose a new, purely computational method for finding putative associations between transcription factors and motifs. This method is based on a linear model that combines sequence information with expression data. We present various methods for model parameter estimation and show, via experiments on simulated data, that these methods are reliable. Finally, we examine the performance of this model on biological data and conclude that it can indeed be used to discover meaningful associations. The developed software is available as a web tool and Scilab source code at http://biit.cs.ut.ee/gmat/.
G = MAT: Linking Transcription Factor Expression and DNA Binding Data
Tretyakov, Konstantin; Laur, Sven; Vilo, Jaak
2011-01-01
Transcription factors are proteins that bind to motifs on the DNA and thus affect gene expression regulation. The qualitative description of the corresponding processes is therefore important for a better understanding of essential biological mechanisms. However, wet lab experiments targeted at the discovery of the regulatory interplay between transcription factors and binding sites are expensive. We propose a new, purely computational method for finding putative associations between transcription factors and motifs. This method is based on a linear model that combines sequence information with expression data. We present various methods for model parameter estimation and show, via experiments on simulated data, that these methods are reliable. Finally, we examine the performance of this model on biological data and conclude that it can indeed be used to discover meaningful associations. The developed software is available as a web tool and Scilab source code at http://biit.cs.ut.ee/gmat/. PMID:21297945
Segers-Nolten, G M J; Wyman, C; Wijgers, N; Vermeulen, W; Lenferink, A T M; Hoeijmakers, J H J; Greve, J; Otto, C
2002-11-01
We used scanning confocal fluorescence microscopy to observe and analyze individual DNA- protein complexes formed between human nucleotide excision repair (NER) proteins and model DNA substrates. For this purpose human XPA protein was fused to EGFP, purified and shown to be functional. Binding of EGFP-labeled XPA protein to a Cy3.5-labeled DNA substrate, in the presence and absence of RPA, was assessed quantitatively by simultaneous excitation and emission detection of both fluorophores. Co-localization of Cy3.5 and EGFP signals within one diffraction limited spot indicated complexes of XPA with DNA. Measurements were performed on samples in a 1% agarose matrix in conditions that are compatible with protein activity and where reactions can be studied under equilibrium conditions. In these samples DNA alone was freely diffusing and protein-bound DNA was immobile, whereby they could be discriminated resulting in quantitative data on DNA binding. On the single molecule level approximately 10% of XPA co-localized with DNA; this increased to 32% in the presence of RPA. These results, especially the enhanced binding of XPA in the presence of RPA, are similar to those obtained in bulk experiments, validating the utility of scanning confocal fluorescence microscopy for investigating functional interactions at the single molecule level.
Rocha, M S
2015-09-01
In this review we focus on the idea of establishing connections between the mechanical properties of DNA-ligand complexes and the physical chemistry of DNA-ligand interactions. This type of connection is interesting because it opens the possibility of performing a robust characterization of such interactions by using only one experimental technique: single molecule stretching. Furthermore, it also opens new possibilities in comparing results obtained by very different approaches, in particular when comparing single molecule techniques to ensemble-averaging techniques. We start the manuscript reviewing important concepts of DNA mechanics, from the basic mechanical properties to the Worm-Like Chain model. Next we review the basic concepts of the physical chemistry of DNA-ligand interactions, revisiting the most important models used to analyze the binding data and discussing their binding isotherms. Then, we discuss the basic features of the single molecule techniques most used to stretch DNA-ligand complexes and to obtain "force × extension" data, from which the mechanical properties of the complexes can be determined. We also discuss the characteristics of the main types of interactions that can occur between DNA and ligands, from covalent binding to simple electrostatic driven interactions. Finally, we present a historical survey of the attempts to connect mechanics to physical chemistry for DNA-ligand systems, emphasizing a recently developed fitting approach useful to connect the persistence length of DNA-ligand complexes to the physicochemical properties of the interaction. Such an approach in principle can be used for any type of ligand, from drugs to proteins, even if multiple binding modes are present.
Macroscopic modeling and simulations of supercoiled DNA with bound proteins
NASA Astrophysics Data System (ADS)
Huang, Jing; Schlick, Tamar
2002-11-01
General methods are presented for modeling and simulating DNA molecules with bound proteins on the macromolecular level. These new approaches are motivated by the need for accurate and affordable methods to simulate slow processes (on the millisecond time scale) in DNA/protein systems, such as the large-scale motions involved in the Hin-mediated inversion process. Our approaches, based on the wormlike chain model of long DNA molecules, introduce inhomogeneous potentials for DNA/protein complexes based on available atomic-level structures. Electrostatically, treat those DNA/protein complexes as sets of effective charges, optimized by our discrete surface charge optimization package, in which the charges are distributed on an excluded-volume surface that represents the macromolecular complex. We also introduce directional bending potentials as well as non-identical bead hydrodynamics algorithm to further mimic the inhomogeneous effects caused by protein binding. These models thus account for basic elements of protein binding effects on DNA local structure but remain computational tractable. To validate these models and methods, we reproduce various properties measured by both Monte Carlo methods and experiments. We then apply the developed models to study the Hin-mediated inversion system in long DNA. By simulating supercoiled, circular DNA with or without bound proteins, we observe significant effects of protein binding on global conformations and long-time dynamics of the DNA on the kilo basepair length.
Xiao, Botao; Zhang, Houyin; Johnson, Reid C.; Marko, John F.
2011-01-01
Determining numbers of proteins bound to large DNAs is important for understanding their chromosomal functions. Protein numbers may be affected by physical factors such as mechanical forces generated in DNA, e.g. by transcription or replication. We performed single-DNA stretching experiments with bacterial nucleoid proteins HU and Fis, verifying that the force–extension measurements were in thermodynamic equilibrium. We, therefore, could use a thermodynamic Maxwell relation to deduce the change of protein number on a single DNA due to varied force. For the binding of both HU and Fis under conditions studied, numbers of bound proteins decreased as force was increased. Our experiments showed that most of the bound HU proteins were driven off the DNA at 6.3 pN for HU concentrations lower than 150 nM; our HU data were fit well by a statistical-mechanical model of protein-induced bending of DNA. In contrast, a significant amount of Fis proteins could not be forced off the DNA at forces up to 12 pN and Fis concentrations up to 20 nM. This thermodynamic approach may be applied to measure changes in numbers of a wide variety of molecules bound to DNA or other polymers. Force-dependent DNA binding by proteins suggests mechano-chemical mechanisms for gene regulation. PMID:21427084
Barut, Burak; Sofuoğlu, Ayşenur; Biyiklioglu, Zekeriya; Özel, Arzu
2016-09-28
In this study, [2-(2-morpholin-4-ylethoxy)ethoxy] group substituted zinc(ii), manganese(iii) and copper(ii) phthalocyanines 2-4 and their water soluble derivatives 2a, 3a and 4a were synthesized and the interactions of compounds 2a, 3a and 4a with CT-DNA and supercoiled pBR322 plasmid DNA were investigated. The results of binding experiments showed that these compounds were able to interact with CT-DNA via intercalative mode with a strong binding affinity in the order 3a > 2a > 4a. DNA-photocleavage activities of compounds 2a, 3a and 4a were determined. These compounds cleaved supercoiled pBR322 plasmid DNA efficiently under irradiation at 650 nm for 2a and 4a, and at 750 nm for 3a. These compounds displayed remarkable inhibitory activities against topoisomerase I enzyme in a dose-dependent manner. All of these results suggest that these phthalocyanines might be suitable anticancer agents due to their strong binding affinities, significant cleavage activities and effective topoisomerase I inhibition.
Jangir, Deepak Kumar; Dey, Sanjay Kumar; Kundu, Suman; Mehrotra, Ranjana
2012-09-03
Proper understanding of the mechanism of binding of drugs to their targets in cell is a fundamental requirement to develop new drug therapy regimen. Amsacrine is a rationally designed anticancer drug, used to treat leukemia and lymphoma. Binding with cellular DNA is a crucial step in its mechanism of cytotoxicity. Despite numerous studies, DNA binding properties of amsacrine are poorly understood. Its reversible binding with DNA does not permit X-ray crystallography or NMR spectroscopic evaluation of amsacrine-DNA complexes. In the present work, interaction of amsacrine with calf thymus DNA is investigated at physiological conditions. UV-visible, FT-Raman and circular dichroism spectroscopic techniques were employed to determine the binding mode, binding constant, sequence specificity and conformational effects of amsacrine binding to native calf thymus DNA. Our results illustrate that amsacrine interacts with DNA by and large through intercalation between base pairs. Binding constant of the amsacrine-DNA complex was found to be K=1.2±0.1×10(4) M(-1) which is indicative of moderate type of binding of amsacrine to DNA. Raman spectroscopic results suggest that amsacrine has a binding preference of intercalation between AT base pairs of DNA. Minor groove binding is also observed in amsacrine-DNA complexes. These results are in good agreement with in silico investigation of amsacrine binding to DNA and thus provide detailed insight into DNA binding properties of amsacrine, which could ultimately, renders its cytotoxic efficacy. Copyright © 2012 Elsevier B.V. All rights reserved.
Dai, Hanjun; Umarov, Ramzan; Kuwahara, Hiroyuki; Li, Yu; Song, Le; Gao, Xin
2017-11-15
An accurate characterization of transcription factor (TF)-DNA affinity landscape is crucial to a quantitative understanding of the molecular mechanisms underpinning endogenous gene regulation. While recent advances in biotechnology have brought the opportunity for building binding affinity prediction methods, the accurate characterization of TF-DNA binding affinity landscape still remains a challenging problem. Here we propose a novel sequence embedding approach for modeling the transcription factor binding affinity landscape. Our method represents DNA binding sequences as a hidden Markov model which captures both position specific information and long-range dependency in the sequence. A cornerstone of our method is a novel message passing-like embedding algorithm, called Sequence2Vec, which maps these hidden Markov models into a common nonlinear feature space and uses these embedded features to build a predictive model. Our method is a novel combination of the strength of probabilistic graphical models, feature space embedding and deep learning. We conducted comprehensive experiments on over 90 large-scale TF-DNA datasets which were measured by different high-throughput experimental technologies. Sequence2Vec outperforms alternative machine learning methods as well as the state-of-the-art binding affinity prediction methods. Our program is freely available at https://github.com/ramzan1990/sequence2vec. xin.gao@kaust.edu.sa or lsong@cc.gatech.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hinerman, Jennifer M.; Dignam, J. David; Mueser, Timothy C.
2012-04-05
The bacteriophage T4 gp59 helicase assembly protein (gp59) is required for loading of gp41 replicative helicase onto DNA protected by gp32 single-stranded DNA-binding protein. The gp59 protein recognizes branched DNA structures found at replication and recombination sites. Binding of gp32 protein (full-length and deletion constructs) to gp59 protein measured by isothermal titration calorimetry demonstrates that the gp32 protein C-terminal A-domain is essential for protein-protein interaction in the absence of DNA. Sedimentation velocity experiments with gp59 protein and gp32ΔB protein (an N-terminal B-domain deletion) show that these proteins are monomers but form a 1:1 complex with a dissociation constant comparable withmore » that determined by isothermal titration calorimetry. Small angle x-ray scattering (SAXS) studies indicate that the gp59 protein is a prolate monomer, consistent with the crystal structure and hydrodynamic properties determined from sedimentation velocity experiments. SAXS experiments also demonstrate that gp32ΔB protein is a prolate monomer with an elongated A-domain protruding from the core. Moreover, fitting structures of gp59 protein and the gp32 core into the SAXS-derived molecular envelope supports a model for the gp59 protein-gp32ΔB protein complex. Our earlier work demonstrated that gp59 protein attracts full-length gp32 protein to pseudo-Y junctions. A model of the gp59 protein-DNA complex, modified to accommodate new SAXS data for the binary complex together with mutational analysis of gp59 protein, is presented in the accompanying article (Dolezal, D., Jones, C. E., Lai, X., Brister, J. R., Mueser, T. C., Nossal, N. G., and Hinton, D. M. (2012) J. Biol. Chem. 287, 18596–18607).« less
Shahraki, Somaye; Mansouri-Torshizi, Hassan; Sori Nezami, Ziba; Ghahghaei, Arezou; Yaghoubi, Fatemeh; Divsalar, Adeleh; Saboury, Ali-Akbar; H. Shirazi, Farshad
2014-01-01
In depth interaction studies between calf thymus deoxyribonucleic acid (CT-DNA) and a series of four structurally relative palladium(II) complexes [Pd(en)(HB)](NO3)2 (a-d), where en is ethylenediamine and heterocyclic base (HB) is 2,2'-bipyridine (bpy, a); 1,10-phenanthroline (phen, b); dipyridoquinoxaline (dpq, c) and dipyridophenazine (dppz, d) (Figure 1), were performed. These studies have been investigated by utilizing the electronic absorption spectroscopy, fluorescence spectra and ethidium bromide (EBr) displacement and gel filtration techniques. a-d complexes cooperatively bind and denature the DNA at low concentrations. Their concentration at midpoint of transition, L1/2, follows the order a >> b > c > d. Also the g, the number of binding sites per 1000 nucleotides, follows the order a >> b ~ c > d. EBr and Scatchard experiments for a-d complexes suggest efficient intercalative binding affinity to CT-DNA giving the order: d > c > b > a. Several binding and thermodynamic parameters are also described. The biological activity of these cationic and water soluble palladium complexes were tested against chronic myelogenous leukemia cell line, K562. b, c and d complexes show cytotoxic concentration (Cc50) values much lower than cisplatin. PMID:25587317
Why double-stranded RNA resists condensation
Tolokh, Igor S.; Pabit, Suzette A.; Katz, Andrea M.; Chen, Yujie; Drozdetski, Aleksander; Baker, Nathan; Pollack, Lois; Onufriev, Alexey V.
2014-01-01
The addition of small amounts of multivalent cations to solutions containing double-stranded DNA leads to inter-DNA attraction and eventual condensation. Surprisingly, the condensation is suppressed in double-stranded RNA, which carries the same negative charge as DNA, but assumes a different double helical form. Here, we combine experiment and atomistic simulations to propose a mechanism that explains the variations in condensation of short (25 base-pairs) nucleic acid (NA) duplexes, from B-like form of homopolymeric DNA, to mixed sequence DNA, to DNA:RNA hybrid, to A-like RNA. Circular dichroism measurements suggest that duplex helical geometry is not the fundamental property that ultimately determines the observed differences in condensation. Instead, these differences are governed by the spatial variation of cobalt hexammine (CoHex) binding to NA. There are two major NA-CoHex binding modes—internal and external—distinguished by the proximity of bound CoHex to the helical axis. We find a significant difference, up to 5-fold, in the fraction of ions bound to the external surfaces of the different NA constructs studied. NA condensation propensity is determined by the fraction of CoHex ions in the external binding mode. PMID:25123663
DNA motif elucidation using belief propagation.
Wong, Ka-Chun; Chan, Tak-Ming; Peng, Chengbin; Li, Yue; Zhang, Zhaolei
2013-09-01
Protein-binding microarray (PBM) is a high-throughout platform that can measure the DNA-binding preference of a protein in a comprehensive and unbiased manner. A typical PBM experiment can measure binding signal intensities of a protein to all the possible DNA k-mers (k=8∼10); such comprehensive binding affinity data usually need to be reduced and represented as motif models before they can be further analyzed and applied. Since proteins can often bind to DNA in multiple modes, one of the major challenges is to decompose the comprehensive affinity data into multimodal motif representations. Here, we describe a new algorithm that uses Hidden Markov Models (HMMs) and can derive precise and multimodal motifs using belief propagations. We describe an HMM-based approach using belief propagations (kmerHMM), which accepts and preprocesses PBM probe raw data into median-binding intensities of individual k-mers. The k-mers are ranked and aligned for training an HMM as the underlying motif representation. Multiple motifs are then extracted from the HMM using belief propagations. Comparisons of kmerHMM with other leading methods on several data sets demonstrated its effectiveness and uniqueness. Especially, it achieved the best performance on more than half of the data sets. In addition, the multiple binding modes derived by kmerHMM are biologically meaningful and will be useful in interpreting other genome-wide data such as those generated from ChIP-seq. The executables and source codes are available at the authors' websites: e.g. http://www.cs.toronto.edu/∼wkc/kmerHMM.
DNA interrogation by the CRISPR RNA-guided endonuclease Cas9.
Sternberg, Samuel H; Redding, Sy; Jinek, Martin; Greene, Eric C; Doudna, Jennifer A
2014-03-06
The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.
DNA interrogation by the CRISPR RNA-guided endonuclease Cas9
NASA Astrophysics Data System (ADS)
Sternberg, Samuel H.; Redding, Sy; Jinek, Martin; Greene, Eric C.; Doudna, Jennifer A.
2014-03-01
The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.
[125I]-GR231118: a high affinity radioligand to investigate neuropeptide Y Y1 and Y4 receptors
Dumont, Yvan; Quirion, Rémi
2000-01-01
GR231118 (also known as 1229U91 and GW1229), a purported Y1 antagonist and Y4 agonist was radiolabelled using the chloramine T method. [125I]-GR231118 binding reached equilibrium within 10 min at room temperature and remained stable for at least 4 h. Saturation binding experiments showed that [125I]-GR231118 binds with very high affinity (Kd of 0.09–0.24 nM) in transfected HEK293 cells with the rat Y1 and Y4 receptor cDNA and in rat brain membrane homogenates. No specific binding sites could be detected in HEK293 cells transfected with the rat Y2 or Y5 receptor cDNA demonstrating the absence of significant affinity of GR231118 for these two receptor classes. Competition binding experiments revealed that specific [125I]-GR231118 binding in rat brain homogenates is most similar to that observed in HEK293 cells transfected with the rat Y1, but not rat Y4, receptor cDNA. Autoradiographic studies demonstrated that [125I]-GR231118 binding sites were fully inhibited by the Y1 antagonist BIBO3304 in most areas of the rat brain. Interestingly, high percentage of [125I]-GR231118/BIBO3304-insensitive binding sites were detected in few areas. These [125I]-GR231118/BIBO3304-insensitive binding sites likely represent labelling to the Y4 receptor subtype. In summary, [125I]-GR231118 is a new radiolabelled probe to investigate the Y1 and Y4 receptors; its major advantage being its high affinity. Using highly selective Y1 antagonists such as BIBO3304 or BIBP3226 it is possible to block the binding of [125I]-GR231118 to the Y1 receptor allowing for the characterization and visualization of the purported Y4 subtype. PMID:10694200
Gershberg, Jana; Radić Stojković, Marijana; Škugor, Marko; Tomić, Sanja; Rehm, Thomas H; Rehm, Stefanie; Saha-Möller, Chantu R; Piantanida, Ivo; Würthner, Frank
2015-05-18
A broad series of homochiral perylene bisimide (PBI) dyes were synthesized that are appended with amino acids and cationic side chains at the imide positions. Self-assembly behavior of these ionic PBIs has been studied in aqueous media by UV/Vis spectroscopy, revealing formation of excitonically coupled H-type aggregates. The interactions of these ionic PBIs with different ds-DNA and ds-RNA have been explored by thermal denaturation, fluorimetric titration and circular dichroism (CD) experiments. These PBIs strongly stabilized ds-DNA/RNA against thermal denaturation as revealed by high melting temperatures of the formed PBI/polynucleotide complexes. Fluorimetric titrations showed that these PBIs bind to ds-DNA/RNA with high binding constants depending on the number of the positive charges in the side chains. Thus, spermine-containing PBIs with six positive charges each showed higher binding constants (logKs =9.2-9.8) than their dioxa analogues (logKs =6.5-7.9) having two positive charges each. Induced circular dichroism (ICD) of PBI assemblies created within DNA/RNA grooves was observed. These ICD profiles are strongly dependent on the steric demand of the chiral substituents of the amino acid units and the secondary structure of the DNA or RNA. The observed ICD effects can be explained by non-covalent binding of excitonically coupled PBI dimer aggregates into the minor groove of DNA and major groove of RNA which is further supported by molecular modeling studies. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Raju, Gajjela; Srinivas, Ragampeta; Santhosh Reddy, Vangala; Idris, Mohammed M.; Kamal, Ahmed; Nagesh, Narayana
2012-01-01
Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS) and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1), mixed imine-amide pyrrolobenzodiazepine dimer (PBD2) and 5,10,15,20-tetrakis(N-methyl-4-pyridyl)porphyrin (TMPyP4) were studied. G-rich single-stranded oligonucleotide d(5′GGGGTTGGGG3′) designated as d(T2G8), from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD), UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T2G8) sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T2G8)2 and d(T2G8)4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T2G8) quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex. PMID:22558271
NASA Astrophysics Data System (ADS)
Wolff, Philippe; Da Veiga, Cyrielle; Ennifar, Eric; Bec, Guillaume; Guichard, Gilles; Burnouf, Dominique; Dumas, Philippe
2017-02-01
We studied by native ESI-MS the binding of various DNA-polymerase-derived peptides onto DNA-polymerase processivity rings from Escherichia coli, Pseudomonas aeruginosa, and Mycobacterium tuberculosis. These homodimeric rings present two equivalent specific binding sites, which leads to successive formation during a titration experiment of singly- and doubly occupied rings. By using the ESI-MS free-ring spectrum as a ruler, we derived by robust linear regression the fractions of the different ring species at each step of a titration experiment. These results led to accurate Kd values (from 0.03 to 0.5 μM) along with the probability of peptide loss due to gas phase dissociation (GPD). We show that this good quality is due to the increased information content of a titration experiment with a homodimer. Isothermal titration calorimetry (ITC) led with the same binding model to Kd(ITC) values systematically higher than their ESI-MS counterparts and, often, to poor fit of the ITC curves. A processing with two competing modes of binding on the same site requiring determination of two (Kd, ΔH) pairs greatly improved the fits and yielded a second Kd(ITC) close to Kd(ESI-MS). The striking features are: (1) ITC detected a minor binding mode ( 20%) of `low-affinity' that did not appear with ESI-MS; (2) the simplest processing of ITC data with only one (Kd, ΔH) pair led wrongly to the Kd of the low-affinity binding mode but to the ΔH of the high-affinity binding mode. Analogous misleading results might well exist in published data based on ITC experiments.
Wolff, Philippe; Da Veiga, Cyrielle; Ennifar, Eric; Bec, Guillaume; Guichard, Gilles; Burnouf, Dominique; Dumas, Philippe
2017-02-01
We studied by native ESI-MS the binding of various DNA-polymerase-derived peptides onto DNA-polymerase processivity rings from Escherichia coli, Pseudomonas aeruginosa, and Mycobacterium tuberculosis. These homodimeric rings present two equivalent specific binding sites, which leads to successive formation during a titration experiment of singly- and doubly occupied rings. By using the ESI-MS free-ring spectrum as a ruler, we derived by robust linear regression the fractions of the different ring species at each step of a titration experiment. These results led to accurate K d values (from 0.03 to 0.5 μM) along with the probability of peptide loss due to gas phase dissociation (GPD). We show that this good quality is due to the increased information content of a titration experiment with a homodimer. Isothermal titration calorimetry (ITC) led with the same binding model to K d (ITC) values systematically higher than their ESI-MS counterparts and, often, to poor fit of the ITC curves. A processing with two competing modes of binding on the same site requiring determination of two (K d , ΔH) pairs greatly improved the fits and yielded a second K d (ITC) close to K d (ESI-MS). The striking features are: (1) ITC detected a minor binding mode (~20%) of 'low-affinity' that did not appear with ESI-MS; (2) the simplest processing of ITC data with only one (K d , ΔH) pair led wrongly to the Kd of the low-affinity binding mode but to the ΔH of the high-affinity binding mode. Analogous misleading results might well exist in published data based on ITC experiments. Graphical Abstract ᅟ.
Romine, L E; Wood, J R; Lamia, L A; Prendergast, P; Edwards, D P; Nardulli, A M
1998-05-01
We have examined the ability of the high-mobility group protein 1 (HMG1) to alter binding of the estrogen receptor DNA-binding domain (DBD) to the estrogen response element (ERE). HMG1 dramatically enhanced binding of purified, bacterially expressed DBD to the consensus vitellogenin A2 ERE in a dose-dependent manner. The ability of HMG1 to stabilize the DBD-ERE complex resulted in part from a decrease in the dissociation rate of the DBD from the ERE. Antibody supershift experiments demonstrated that HMG1 was also capable of forming a ternary complex with the ERE-bound DBD in the presence of HMG1-specific antibody. HMG1 did not substantially affect DBD-ERE contacts as assessed by methylation interference assays, nor did it alter the ability of the DBD to induce distortion in ERE-containing DNA fragments. Because HMG1 dramatically enhanced estrogen receptor DBD binding to the ERE, and the DBD is the most highly conserved region among the nuclear receptor superfamily members, HMG1 may function to enhance binding of other nuclear receptors to their respective response elements and act in concert with coactivator proteins to regulate expression of hormone-responsive genes.
Murphy, Samantha; Bright, Sandra A; Poynton, Fergus E; McCabe, Thomas; Kitchen, Jonathan A; Veale, Emma B; Williams, D Clive; Gunnlaugsson, Thorfinnur
2014-09-14
The synthesis and characterisation of five bis-1,8-naphthalimide containing Tröger's bases 1–5 formed from their corresponding 3-amino-1,8-naphthalimide precursors 6–10 is described. The photophysical investigations of 1–5 and 6–10 were carried out in several organic solvents as well as in water and as a function of pH using UV-Vis absorption and fluorescence spectroscopies. The DNA binding affinities of 1–5 in aqueous solution at pH 7.4 were also investigated using several UV-Vis absorption and fluorescence experiments by using calf thymus DNA (ct-DNA). These molecules exhibited significant DNA binding affinities; where large binding values (Kb) in the range of 10(6) M(−1) were determined, even in competitive media (50 mM and 160 mM NaCl at pH 7.4). Thermal denaturation measurements also showed that 1–5 significantly stabilised the DNA helix. Using linear and circular dichroism we further demonstrated that the DNA binding interaction occurs both by intercalation and by groove binding. The Tröger's bases were further shown to be rapidly taken up into cells using confocal fluorescence spectroscopy; and cytotoxic studies in HeLa and MCF-7 cells showed that most of the Tröger's bases were effective cytotoxic agents with EC50 values of between 1.1–12 μM and that all the active compounds induced programmed cell death by apoptosis, where up to 70% cellular death was observed after 24 h of incubation for 4.
Sharma, Amit; Jenkins, Katherine R.; Héroux, Annie; Bowman, Gregory D.
2011-01-01
Chromatin remodelers are ATP-dependent machines that dynamically alter the chromatin packaging of eukaryotic genomes by assembling, sliding, and displacing nucleosomes. The Chd1 chromatin remodeler possesses a C-terminal DNA-binding domain that is required for efficient nucleosome sliding and believed to be essential for sensing the length of DNA flanking the nucleosome core. The structure of the Chd1 DNA-binding domain was recently shown to consist of a SANT and SLIDE domain, analogous to the DNA-binding domain of the ISWI family, yet the details of how Chd1 recognized DNA were not known. Here we present the crystal structure of the Saccharomyces cerevisiae Chd1 DNA-binding domain in complex with a DNA duplex. The bound DNA duplex is straight, consistent with the preference exhibited by the Chd1 DNA-binding domain for extranucleosomal DNA. Comparison of this structure with the recently solved ISW1a DNA-binding domain bound to DNA reveals that DNA lays across each protein at a distinct angle, yet contacts similar surfaces on the SANT and SLIDE domains. In contrast to the minor groove binding seen for Isw1 and predicted for Chd1, the SLIDE domain of the Chd1 DNA-binding domain contacts the DNA major groove. The majority of direct contacts with the phosphate backbone occur only on one DNA strand, suggesting that Chd1 may not strongly discriminate between major and minor grooves. PMID:22033927
Characterization of the DNA binding properties of polyomavirus capsid protein
NASA Technical Reports Server (NTRS)
Chang, D.; Cai, X.; Consigli, R. A.; Spooner, B. S. (Principal Investigator)
1993-01-01
The DNA binding properties of the polyomavirus structural proteins VP1, VP2, and VP3 were studied by Southwestern analysis. The major viral structural protein VP1 and host-contributed histone proteins of polyomavirus virions were shown to exhibit DNA binding activity, but the minor capsid proteins VP2 and VP3 failed to bind DNA. The N-terminal first five amino acids (Ala-1 to Lys-5) were identified as the VP1 DNA binding domain by genetic and biochemical approaches. Wild-type VP1 expressed in Escherichia coli (RK1448) exhibited DNA binding activity, but the N-terminal truncated VP1 mutants (lacking Ala-1 to Lys-5 and Ala-1 to Cys-11) failed to bind DNA. The synthetic peptide (Ala-1 to Cys-11) was also shown to have an affinity for DNA binding. Site-directed mutagenesis of the VP1 gene showed that the point mutations at Pro-2, Lys-3, and Arg-4 on the VP1 molecule did not affect DNA binding properties but that the point mutation at Lys-5 drastically reduced DNA binding affinity. The N-terminal (Ala-1 to Lys-5) region of VP1 was found to be essential and specific for DNA binding, while the DNA appears to be non-sequence specific. The DNA binding domain and the nuclear localization signal are located in the same N-terminal region.
Vasiliu, Tudor; Cojocaru, Corneliu; Rotaru, Alexandru; Pricope, Gabriela; Pinteala, Mariana; Clima, Lilia
2017-06-17
The polyplexes formed by nucleic acids and polycations have received a great attention owing to their potential application in gene therapy. In our study, we report experimental results and modeling outcomes regarding the optimization of polyplex formation between the double-stranded DNA (dsDNA) and poly(ʟ-Lysine) (PLL). The quantification of the binding efficiency during polyplex formation was performed by processing of the images captured from the gel electrophoresis assays. The design of experiments (DoE) and response surface methodology (RSM) were employed to investigate the coupling effect of key factors (pH and N/P ratio) affecting the binding efficiency. According to the experimental observations and response surface analysis, the N/P ratio showed a major influence on binding efficiency compared to pH. Model-based optimization calculations along with the experimental confirmation runs unveiled the maximal binding efficiency (99.4%) achieved at pH 5.4 and N/P ratio 125. To support the experimental data and reveal insights of molecular mechanism responsible for the polyplex formation between dsDNA and PLL, molecular dynamics simulations were performed at pH 5.4 and 7.4.
Vasiliu, Tudor; Cojocaru, Corneliu; Rotaru, Alexandru; Pricope, Gabriela; Pinteala, Mariana; Clima, Lilia
2017-01-01
The polyplexes formed by nucleic acids and polycations have received a great attention owing to their potential application in gene therapy. In our study, we report experimental results and modeling outcomes regarding the optimization of polyplex formation between the double-stranded DNA (dsDNA) and poly(l-Lysine) (PLL). The quantification of the binding efficiency during polyplex formation was performed by processing of the images captured from the gel electrophoresis assays. The design of experiments (DoE) and response surface methodology (RSM) were employed to investigate the coupling effect of key factors (pH and N/P ratio) affecting the binding efficiency. According to the experimental observations and response surface analysis, the N/P ratio showed a major influence on binding efficiency compared to pH. Model-based optimization calculations along with the experimental confirmation runs unveiled the maximal binding efficiency (99.4%) achieved at pH 5.4 and N/P ratio 125. To support the experimental data and reveal insights of molecular mechanism responsible for the polyplex formation between dsDNA and PLL, molecular dynamics simulations were performed at pH 5.4 and 7.4. PMID:28629130
NASA Astrophysics Data System (ADS)
Zhang, Xirui; Daaboul, George G.; Spuhler, Philipp S.; Dröge, Peter; Ünlü, M. Selim
2016-03-01
DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are not fully understood. Recently, it was discovered that DNA-binding proteins recognize specific binding sites to carry out their functions through an indirect readout mechanism by recognizing and capturing DNA conformational flexibility and deformation. High-throughput DNA microarray-based methods that provide large-scale protein-DNA binding information have shown effective and comprehensive analysis of protein-DNA binding affinities, but do not provide information of DNA conformational changes in specific protein-DNA complexes. Building on the high-throughput capability of DNA microarrays, we demonstrate a quantitative approach that simultaneously measures the amount of protein binding to DNA and nanometer-scale DNA conformational change induced by protein binding in a microarray format. Both measurements rely on spectral interferometry on a layered substrate using a single optical instrument in two distinct modalities. In the first modality, we quantitate the amount of binding of protein to surface-immobilized DNA in each DNA spot using a label-free spectral reflectivity technique that accurately measures the surface densities of protein and DNA accumulated on the substrate. In the second modality, for each DNA spot, we simultaneously measure DNA conformational change using a fluorescence vertical sectioning technique that determines average axial height of fluorophores tagged to specific nucleotides of the surface-immobilized DNA. The approach presented in this paper, when combined with current high-throughput DNA microarray-based technologies, has the potential to serve as a rapid and simple method for quantitative and large-scale characterization of conformational specific protein-DNA interactions.DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are not fully understood. Recently, it was discovered that DNA-binding proteins recognize specific binding sites to carry out their functions through an indirect readout mechanism by recognizing and capturing DNA conformational flexibility and deformation. High-throughput DNA microarray-based methods that provide large-scale protein-DNA binding information have shown effective and comprehensive analysis of protein-DNA binding affinities, but do not provide information of DNA conformational changes in specific protein-DNA complexes. Building on the high-throughput capability of DNA microarrays, we demonstrate a quantitative approach that simultaneously measures the amount of protein binding to DNA and nanometer-scale DNA conformational change induced by protein binding in a microarray format. Both measurements rely on spectral interferometry on a layered substrate using a single optical instrument in two distinct modalities. In the first modality, we quantitate the amount of binding of protein to surface-immobilized DNA in each DNA spot using a label-free spectral reflectivity technique that accurately measures the surface densities of protein and DNA accumulated on the substrate. In the second modality, for each DNA spot, we simultaneously measure DNA conformational change using a fluorescence vertical sectioning technique that determines average axial height of fluorophores tagged to specific nucleotides of the surface-immobilized DNA. The approach presented in this paper, when combined with current high-throughput DNA microarray-based technologies, has the potential to serve as a rapid and simple method for quantitative and large-scale characterization of conformational specific protein-DNA interactions. Electronic supplementary information (ESI) available: DNA sequences and nomenclature (Table 1S); SDS-PAGE assay of IHF stock solution (Fig. 1S); determination of the concentration of IHF stock solution by Bradford assay (Fig. 2S); equilibrium binding isotherm fitting results of other DNA sequences (Table 2S); calculation of dissociation constants (Fig. 3S, 4S; Table 2S); geometric model for quantitation of DNA bending angle induced by specific IHF binding (Fig. 4S); customized flow cell assembly (Fig. 5S); real-time measurement of average fluorophore height change by SSFM (Fig. 6S); summary of binding parameters obtained from additive isotherm model fitting (Table 3S); average surface densities of 10 dsDNA spots and bound IHF at equilibrium (Table 4S); effects of surface densities on the binding and bending of dsDNA (Tables 5S, 6S and Fig. 7S-10S). See DOI: 10.1039/c5nr06785e
Sun, Hui-Juan; Wang, Ai-Ling; Chu, Hai-Bin; Zhao, Yong-Liang
2015-03-01
Twelve lanthanide complexes with cinnamate (cin(-) ) and 1,10-phenanthroline (phen) were synthesized and characterized. Their compositions were assumed to be RE(cin)3 phen (RE(3+) = La(3+) , Pr(3+) , Nd(3+) , Sm(3+) , Eu(3+) , Gd(3+) , Tb(3+) , Dy(3+) , Ho(3+) , Tm(3+) , Yb(3+) , Lu(3+) ). The interaction mode between the complexes and DNA was investigated by fluorescence quenching experiment. The results indicated the complexes could bind to DNA and the main binding mode is intercalative binding. The fluorescence quenching constants of the complexes increased from La(cin)3 phen to Lu(cin)3 phen. Additionally, the antibacterial activity testing showed that the complexes exhibited excellent antibacterial ability against Escherichia coli, and the changes of antibacterial ability are in agreement with that of the fluorescence quenching constants. Copyright © 2014 John Wiley & Sons, Ltd.
Tabassum, Sartaj; Zaki, Mehvash; Ahmad, Musheer; Afzal, Mohd; Srivastav, Saurabh; Srikrishna, Saripella; Arjmand, Farukh
2014-08-18
New Cu(II) complex 1 of indole-3-propionic acid and 1,10-phenanthroline was synthesized and characterized by analytical, spectroscopic and single crystal X-ray diffraction. In vitro DNA binding studies of 1 was performed by employing UV-vis and fluorescence spectroscopic techniques. The binding affinity towards human serum albumin (HSA) was also investigated to understand the carrier role in body system, as the time dependent HPLC experiment of 1 revealed that bonded drug with protein releases slowly in presence of DNA. Complex 1 exhibited good anti-tumor activity (GI50 values <10 μg/ml), and to elucidate the mechanism of tumor inhibition, topoisomerase I enzymatic activity was carried out and further validated by cell imaging studies which clearly showed its nuclear localization. Copyright © 2014 Elsevier Masson SAS. All rights reserved.
Alam, Tanfis I; Rao, Venigalla B
2008-03-07
Translocation of double-stranded DNA into a preformed capsid by tailed bacteriophages is driven by powerful motors assembled at the special portal vertex. The motor is thought to drive processive cycles of DNA binding, movement, and release to package the viral genome. In phage T4, there is evidence that the large terminase protein, gene product 17 (gp17), assembles into a multisubunit motor and translocates DNA by an inchworm mechanism. gp17 consists of two domains; an N-terminal ATPase domain (amino acids 1-360) that powers translocation of DNA, and a C-terminal nuclease domain (amino acids 361-610) that cuts concatemeric DNA to generate a headful-size viral genome. While the functional motifs of ATPase and nuclease have been well defined and the ATPase atomic structure has been solved, the DNA binding motif(s) responsible for viral DNA recognition, cutting, and translocation are unknown. Here we report the first evidence for the presence of a double-stranded DNA binding activity in the gp17 ATPase domain. Binding to DNA is sensitive to Mg(2+) and salt, but not the type of DNA used. DNA fragments as short as 20 bp can bind to the ATPase but preferential binding was observed to DNA greater than 1 kb. A high molecular weight ATPase-DNA complex was isolated by gel filtration, suggesting oligomerization of ATPase following DNA interaction. DNA binding was not observed with the full-length gp17, or the C-terminal nuclease domain. The small terminase protein, gp16, inhibited DNA binding, which was further accentuated by ATP. The presence of a DNA binding site in the ATPase domain and its binding properties implicate a role in the DNA packaging mechanism.
Dynamic binding of replication protein a is required for DNA repair
Chen, Ran; Subramanyam, Shyamal; Elcock, Adrian H.; Spies, Maria; Wold, Marc S.
2016-01-01
Replication protein A (RPA), the major eukaryotic single-stranded DNA (ssDNA) binding protein, is essential for replication, repair and recombination. High-affinity ssDNA-binding by RPA depends on two DNA binding domains in the large subunit of RPA. Mutation of the evolutionarily conserved aromatic residues in these two domains results in a separation-of-function phenotype: aromatic residue mutants support DNA replication but are defective in DNA repair. We used biochemical and single-molecule analyses, and Brownian Dynamics simulations to determine the molecular basis of this phenotype. Our studies demonstrated that RPA binds to ssDNA in at least two modes characterized by different dissociation kinetics. We also showed that the aromatic residues contribute to the formation of the longer-lived state, are required for stable binding to short ssDNA regions and are needed for RPA melting of partially duplex DNA structures. We conclude that stable binding and/or the melting of secondary DNA structures by RPA is required for DNA repair, including RAD51 mediated DNA strand exchange, but is dispensable for DNA replication. It is likely that the binding modes are in equilibrium and reflect dynamics in the RPA–DNA complex. This suggests that dynamic binding of RPA to DNA is necessary for different cellular functions. PMID:27131385
The substrate binding interface of alkylpurine DNA glycosylase AlkD.
Mullins, Elwood A; Rubinson, Emily H; Eichman, Brandt F
2014-01-01
Tandem helical repeats have emerged as an important DNA binding architecture. DNA glycosylase AlkD, which excises N3- and N7-alkylated nucleobases, uses repeating helical motifs to bind duplex DNA and to selectively pause at non-Watson-Crick base pairs. Remodeling of the DNA backbone promotes nucleotide flipping of the lesion and the complementary base into the solvent and toward the protein surface, respectively. The important features of this new DNA binding architecture that allow AlkD to distinguish between damaged and normal DNA without contacting the lesion are poorly understood. Here, we show through extensive mutational analysis that DNA binding and N3-methyladenine (3mA) and N7-methylguanine (7mG) excision are dependent upon each residue lining the DNA binding interface. Disrupting electrostatic or hydrophobic interactions with the DNA backbone substantially reduced binding affinity and catalytic activity. These results demonstrate that residues seemingly only involved in general DNA binding are important for catalytic activity and imply that base excision is driven by binding energy provided by the entire substrate interface of this novel DNA binding architecture. Copyright © 2013 Elsevier B.V. All rights reserved.
Stoichiometry of DNA binding by the bacteriophage SP01-encoded type II DNA-binding protein TF1.
Schneider, G J; Geiduschek, E P
1990-06-25
The stoichiometry of DNA binding by the bacteriophage SP01-encoded type II DNA-binding protein TF1 has been determined. 3H-Labeled TF1 was allowed to bind to a 32P-labeled DNA fragment containing a TF1 binding site. Multiple TF1-DNA complexes were resolved from each other and from unbound DNA by native gel electrophoresis. DNA-protein complexes were cut from polyacrylamide gels, and the amounts of 3H and 32P contained in each slice were measured. A ratio of 1.12 +/- 0.06 TF1 dimer/DNA molecule was calculated for the fastest-migrating TF1-DNA complex. We conclude that TF1 has a DNA-binding unit of one dimer. More slowly migrating complexes are apparently formed by serial addition of single TF1 dimers.
Jose, Davis; Weitzel, Steven E.; Baase, Walter A.; Michael, Miya M.; von Hippel, Peter H.
2015-01-01
We here use our site-specific base analog mapping approach to study the interactions and binding equilibria of cooperatively-bound clusters of the single-stranded DNA binding protein (gp32) of the T4 DNA replication complex with longer ssDNA (and dsDNA) lattices. We show that in cooperatively bound clusters the binding free energy appears to be equi-partitioned between the gp32 monomers of the cluster, so that all bind to the ssDNA lattice with comparable affinity, but also that the outer domains of the gp32 monomers at the ends of the cluster can fluctuate on and off the lattice and that the clusters of gp32 monomers can slide along the ssDNA. We also show that at very low binding densities gp32 monomers bind to the ssDNA lattice at random, but that cooperatively bound gp32 clusters bind preferentially at the 5′-end of the ssDNA lattice. We use these results and the gp32 monomer-binding results of the companion paper to propose a detailed model for how gp32 might bind to and interact with ssDNA lattices in its various binding modes, and also consider how these clusters might interact with other components of the T4 DNA replication complex. PMID:26275774
Comparison between TRF2 and TRF1 of their telomeric DNA-bound structures and DNA-binding activities
Hanaoka, Shingo; Nagadoi, Aritaka; Nishimura, Yoshifumi
2005-01-01
Mammalian telomeres consist of long tandem arrays of double-stranded telomeric TTAGGG repeats packaged by the telomeric DNA-binding proteins TRF1 and TRF2. Both contain a similar C-terminal Myb domain that mediates sequence-specific binding to telomeric DNA. In a DNA complex of TRF1, only the single Myb-like domain consisting of three helices can bind specifically to double-stranded telomeric DNA. TRF2 also binds to double-stranded telomeric DNA. Although the DNA binding mode of TRF2 is likely identical to that of TRF1, TRF2 plays an important role in the t-loop formation that protects the ends of telomeres. Here, to clarify the details of the double-stranded telomeric DNA-binding modes of TRF1 and TRF2, we determined the solution structure of the DNA-binding domain of human TRF2 bound to telomeric DNA; it consists of three helices, and like TRF1, the third helix recognizes TAGGG sequence in the major groove of DNA with the N-terminal arm locating in the minor groove. However, small but significant differences are observed; in contrast to the minor groove recognition of TRF1, in which an arginine residue recognizes the TT sequence, a lysine residue of TRF2 interacts with the TT part. We examined the telomeric DNA-binding activities of both DNA-binding domains of TRF1 and TRF2 and found that TRF1 binds more strongly than TRF2. Based on the structural differences of both domains, we created several mutants of the DNA-binding domain of TRF2 with stronger binding activities compared to the wild-type TRF2. PMID:15608118
Computational Identification of Diverse Mechanisms Underlying Transcription Factor-DNA Occupancy
Cheng, Qiong; Kazemian, Majid; Pham, Hannah; Blatti, Charles; Celniker, Susan E.; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh
2013-01-01
ChIP-based genome-wide assays of transcription factor (TF) occupancy have emerged as a powerful, high-throughput method to understand transcriptional regulation, especially on a global scale. This has led to great interest in the underlying biochemical mechanisms that direct TF-DNA binding, with the ultimate goal of computationally predicting a TF's occupancy profile in any cellular condition. In this study, we examined the influence of various potential determinants of TF-DNA binding on a much larger scale than previously undertaken. We used a thermodynamics-based model of TF-DNA binding, called “STAP,” to analyze 45 TF-ChIP data sets from Drosophila embryonic development. We built a cross-validation framework that compares a baseline model, based on the ChIP'ed (“primary”) TF's motif, to more complex models where binding by secondary TFs is hypothesized to influence the primary TF's occupancy. Candidates interacting TFs were chosen based on RNA-SEQ expression data from the time point of the ChIP experiment. We found widespread evidence of both cooperative and antagonistic effects by secondary TFs, and explicitly quantified these effects. We were able to identify multiple classes of interactions, including (1) long-range interactions between primary and secondary motifs (separated by ≤150 bp), suggestive of indirect effects such as chromatin remodeling, (2) short-range interactions with specific inter-site spacing biases, suggestive of direct physical interactions, and (3) overlapping binding sites suggesting competitive binding. Furthermore, by factoring out the previously reported strong correlation between TF occupancy and DNA accessibility, we were able to categorize the effects into those that are likely to be mediated by the secondary TF's effect on local accessibility and those that utilize accessibility-independent mechanisms. Finally, we conducted in vitro pull-down assays to test model-based predictions of short-range cooperative interactions, and found that seven of the eight TF pairs tested physically interact and that some of these interactions mediate cooperative binding to DNA. PMID:23935523
NASA Astrophysics Data System (ADS)
Thai, Nguyen Quoc; Tseng, Ning-Hsuan; Vu, Mui Thi; Nguyen, Tin Trung; Linh, Huynh Quang; Hu, Chin-Kun; Chen, Yun-Ru; Li, Mai Suan
2016-08-01
Combining Lipinski's rule with the docking and steered molecular dynamics simulations and using the PubChem data base of about 1.4 million compounds, we have obtained DNA dyes Hoechst 34580 and Hoechst 33342 as top-leads for the Alzheimer's disease. The binding properties of these ligands to amyloid beta (Aβ) fibril were thoroughly studied by in silico and in vitro experiments. Hoechst 34580 and Hoechst 33342 prefer to locate near hydrophobic regions with binding affinity mainly governed by the van der Waals interaction. By the Thioflavin T assay, it was found that the inhibition constant IC50 ≈ 0.86 and 0.68 μM for Hoechst 34580 and Hoechst 33342, respectively. This result qualitatively agrees with the binding free energy estimated using the molecular mechanic-Poisson Boltzmann surface area method and all-atom simulations with the AMBER-f99SB-ILDN force field and water model TIP3P. In addition, DNA dyes have the high capability to cross the blood brain barrier. Thus, both in silico and in vitro experiments have shown that Hoechst 34580 and 33342 are good candidates for treating the Alzheimer's disease by inhibiting Aβ formation.
Synthesis and DNA interaction of a mixed proflavine-phenanthroline Tröger base.
Baldeyrou, Brigitte; Tardy, Christelle; Bailly, Christian; Colson, Pierre; Houssier, Claude; Charmantray, Franck; Demeunynck, Martine
2002-04-01
We report the synthesis of an asymmetric Tröger base containing the two well characterised DNA binding chromophores, proflavine and phenanthroline. The mode of interaction of the hybrid molecule was investigated by circular and linear dichroism experiments and a biochemical assay using DNA topoisomerase I. The data are compatible with a model in which the proflavine moiety intercalates between DNA base pairs and the phenanthroline ring occupies the DNA groove. DNase I cleavage experiments were carried out to investigate the sequence preference of the hybrid ligand and a well resolved footprint was detected at a site encompassing two adjacent 5'-GTC.5-GAC triplets. The sequence preference of the asymmetric molecule is compared to that of the symmetric analogues.
Exploring DNA-binding Proteins with In Vivo Chemical Cross-linking and Mass Spectrometry
Qiu, Haibo; Wang, Yinsheng
2009-01-01
DNA-binding proteins are very important constituents of proteomes of all species and play crucial roles in transcription, DNA replication, recombination, repair and other activities associated with DNA. Although a number of DNA-binding proteins have been identified, many proteins involved in gene regulation and DNA repair are likely still unknown because of their dynamic and/or weak interactions with DNA. In this report, we described an approach for the comprehensive identification of DNA-binding proteins with in vivo formaldehyde cross-linking and LC-MS/MS. DNA-binding proteins could be purified via the isolation of DNA-protein complexes and released from the complexes by reversing the cross-linking. By using this method, we were able to identify more than one hundred DNA-binding proteins, such as proteins involved in transcription, gene regulation, DNA replication and repair, and a large number of proteins which are potentially associated with DNA and DNA-binding proteins. This method should be generally applicable to the investigation of other nucleic acid-binding proteins, and hold great potential in the comprehensive study of gene regulation, DNA damage response and repair, as well as many other critical biological processes at proteomic level. PMID:19714816
Binding of DNA-bending non-histone proteins destabilizes regular 30-nm chromatin structure
Bajpai, Gaurav; Jain, Ishutesh; Inamdar, Mandar M.; Das, Dibyendu; Padinhateeri, Ranjith
2017-01-01
Why most of the in vivo experiments do not find the 30-nm chromatin fiber, well studied in vitro, is a puzzle. Two basic physical inputs that are crucial for understanding the structure of the 30-nm fiber are the stiffness of the linker DNA and the relative orientations of the DNA entering/exiting nucleosomes. Based on these inputs we simulate chromatin structure and show that the presence of non-histone proteins, which bind and locally bend linker DNA, destroys any regular higher order structures (e.g., zig-zag). Accounting for the bending geometry of proteins like nhp6 and HMG-B, our theory predicts phase-diagram for the chromatin structure as a function of DNA-bending non-histone protein density and mean linker DNA length. For a wide range of linker lengths, we show that as we vary one parameter, that is, the fraction of bent linker region due to non-histone proteins, the steady-state structure will show a transition from zig-zag to an irregular structure—a structure that is reminiscent of what is observed in experiments recently. Our theory can explain the recent in vivo observation of irregular chromatin having co-existence of finite fraction of the next-neighbor (i + 2) and neighbor (i + 1) nucleosome interactions. PMID:28135276
Liu, Shangfeng; Chu, Jessica; Yucer, Nur; Leng, Mei; Wang, Shih-Ya; Chen, Benjamin P C; Hittelman, Walter N; Wang, Yi
2011-06-24
DNA damage response is crucial for maintaining genomic integrity and preventing cancer by coordinating the activation of checkpoints and the repair of damaged DNA. Central to DNA damage response are the two checkpoint kinases ATM and ATR that phosphorylate a wide range of substrates. RING finger and WD repeat domain 3 (RFWD3) was initially identified as a substrate of ATM/ATR from a proteomic screen. Subsequent studies showed that RFWD3 is an E3 ubiquitin ligase that ubiquitinates p53 in vitro and positively regulates p53 levels in response to DNA damage. We report here that RFWD3 associates with replication protein A (RPA), a single-stranded DNA-binding protein that plays essential roles in DNA replication, recombination, and repair. Binding of RPA to single-stranded DNA (ssDNA), which is generated by DNA damage and repair, is essential for the recruitment of DNA repair factors to damaged sites and the activation of checkpoint signaling. We show that RFWD3 is physically associated with RPA and rapidly localizes to sites of DNA damage in a RPA-dependent manner. In vitro experiments suggest that the C terminus of RFWD3, which encompass the coiled-coil domain and the WD40 domain, is necessary for binding to RPA. Furthermore, DNA damage-induced phosphorylation of RPA and RFWD3 is dependent upon each other. Consequently, loss of RFWD3 results in the persistent foci of DNA damage marker γH2AX and the repair protein Rad51 in damaged cells. These findings suggest that RFWD3 is recruited to sites of DNA damage and facilitates RPA-mediated DNA damage signaling and repair.
Genome wide approaches to identify protein-DNA interactions.
Ma, Tao; Ye, Zhenqing; Wang, Liguo
2018-05-29
Transcription factors are DNA-binding proteins that play key roles in many fundamental biological processes. Unraveling their interactions with DNA is essential to identify their target genes and understand the regulatory network. Genome-wide identification of their binding sites became feasible thanks to recent progress in experimental and computational approaches. ChIP-chip, ChIP-seq, and ChIP-exo are three widely used techniques to demarcate genome-wide transcription factor binding sites. This review aims to provide an overview of these three techniques including their experiment procedures, computational approaches, and popular analytic tools. ChIP-chip, ChIP-seq, and ChIP-exo have been the major techniques to study genome-wide in vivo protein-DNA interaction. Due to the rapid development of next-generation sequencing technology, array-based ChIP-chip is deprecated and ChIP-seq has become the most widely used technique to identify transcription factor binding sites in genome-wide. The newly developed ChIP-exo further improves the spatial resolution to single nucleotide. Numerous tools have been developed to analyze ChIP-chip, ChIP-seq and ChIP-exo data. However, different programs may employ different mechanisms or underlying algorithms thus each will inherently include its own set of statistical assumption and bias. So choosing the most appropriate analytic program for a given experiment needs careful considerations. Moreover, most programs only have command line interface so their installation and usage will require basic computation expertise in Unix/Linux. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Sugitani, Norie; Voehler, Markus W; Roh, Michelle S; Topolska-Woś, Agnieszka M; Chazin, Walter J
2017-10-13
Xeroderma pigmentosum (XP) complementation group A (XPA) is an essential scaffolding protein in the multiprotein nucleotide excision repair (NER) machinery. The interaction of XPA with DNA is a core function of this protein; a number of mutations in the DNA-binding domain (DBD) are associated with XP disease. Although structures of the central globular domain of human XPA and data on binding of DNA substrates have been reported, the structural basis for XPA's DNA-binding activity remains unknown. X-ray crystal structures of the central globular domain of yeast XPA (Rad14) with lesion-containing DNA duplexes have provided valuable insights, but the DNA substrates used for this study do not correspond to the substrates of XPA as it functions within the NER machinery. To better understand the DNA-binding activity of human XPA in NER, we used NMR to investigate the interaction of its DBD with a range of DNA substrates. We found that XPA binds different single-stranded/double-stranded junction DNA substrates with a common surface. Comparisons of our NMR-based mapping of binding residues with the previously reported Rad14-DNA crystal structures revealed similarities and differences in substrate binding between XPA and Rad14. This includes direct evidence for DNA contacts to the residues extending C-terminally from the globular core, which are lacking in the Rad14 construct. Moreover, mutation of the XPA residue corresponding to Phe-262 in Rad14, previously reported as being critical for DNA binding, had only a moderate effect on the DNA-binding activity of XPA. The DNA-binding properties of several disease-associated mutations in the DBD were investigated. These results suggest that for XPA mutants exhibiting altered DNA-binding properties, a correlation exists between the extent of reduction in DNA-binding affinity and the severity of symptoms in XP patients. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Zhang, Xirui; Daaboul, George G; Spuhler, Philipp S; Dröge, Peter; Ünlü, M Selim
2016-03-14
DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are not fully understood. Recently, it was discovered that DNA-binding proteins recognize specific binding sites to carry out their functions through an indirect readout mechanism by recognizing and capturing DNA conformational flexibility and deformation. High-throughput DNA microarray-based methods that provide large-scale protein-DNA binding information have shown effective and comprehensive analysis of protein-DNA binding affinities, but do not provide information of DNA conformational changes in specific protein-DNA complexes. Building on the high-throughput capability of DNA microarrays, we demonstrate a quantitative approach that simultaneously measures the amount of protein binding to DNA and nanometer-scale DNA conformational change induced by protein binding in a microarray format. Both measurements rely on spectral interferometry on a layered substrate using a single optical instrument in two distinct modalities. In the first modality, we quantitate the amount of binding of protein to surface-immobilized DNA in each DNA spot using a label-free spectral reflectivity technique that accurately measures the surface densities of protein and DNA accumulated on the substrate. In the second modality, for each DNA spot, we simultaneously measure DNA conformational change using a fluorescence vertical sectioning technique that determines average axial height of fluorophores tagged to specific nucleotides of the surface-immobilized DNA. The approach presented in this paper, when combined with current high-throughput DNA microarray-based technologies, has the potential to serve as a rapid and simple method for quantitative and large-scale characterization of conformational specific protein-DNA interactions.
Single Molecule Study of DNA Organization and Recombination
NASA Astrophysics Data System (ADS)
Xiao, Botao
We have studied five projects related to DNA organization and recombination using mainly single molecule force-spectroscopy and statistical tools. First, HU is one of the most abundant DNA-organizing proteins in bacterial chromosomes and participates in gene regulation. We report experiments that study the dependence of DNA condensation by HU on force, salt and HU concentration. A first important result is that at physiological salt levels, HU only bends DNA, resolving a previous paradox of why a chromosome-compacting protein should have a DNA-stiffening function. A second major result is quantitative demonstration of strong dependencies of HU-DNA dissociation on both salt concentration and force. Second, we have used a thermodynamic Maxwell relation to count proteins driven off large DNAs by tension, an effect important to understanding DNA organization. Our results compare well with estimates of numbers of proteins HU and Fis in previous studies. We have also shown that a semi-flexible polymer model describes our HU experimental data well. The force-dependent binding suggests mechano-chemical mechanisms for gene regulation. Third, the elusive role of protein H1 in chromatin has been clarified with purified H1 and Xenopus extracts. We find that H1 compacts DNA by both bending and looping. Addition of H1 enhances chromatin formation and maintains the plasticity of the chromatin. Fourth, the topology and mechanics of DNA twisting are critical to DNA organization and recombination. We have systematically measured DNA extension as a function of linking number density from 0.08 to -2 with holding forces from 0.2 to 2.4 pN. Unlike previous proposals, the DNA extension decreases with negative linking number. Finally, DNA recombination is a dynamic process starting from enzyme-DNA binding. We report that the Int-DBD domain of lambda integrase binds to DNA without compaction at low Int-DBD concentration. High concentration of Int-DBD loops DNA below a threshold force, which depends on salt concentration. We also report experiments with the recombinase Hin mutant H107Y. The synapse formation is demonstrated with single DNA containing two hix sites. We further show preliminary data for cleavage and subunit rotation from a braiding assay. These direct observations elucidate the recombination mechanism.
Facilitated Diffusion of Transcription Factor Proteins with Anomalous Bulk Diffusion.
Liu, Lin; Cherstvy, Andrey G; Metzler, Ralf
2017-02-16
What are the physical laws of the diffusive search of proteins for their specific binding sites on DNA in the presence of the macromolecular crowding in cells? We performed extensive computer simulations to elucidate the protein target search on DNA. The novel feature is the viscoelastic non-Brownian protein bulk diffusion recently observed experimentally. We examine the influence of the protein-DNA binding affinity and the anomalous diffusion exponent on the target search time. In all cases an optimal search time is found. The relative contribution of intermittent three-dimensional bulk diffusion and one-dimensional sliding of proteins along the DNA is quantified. Our results are discussed in the light of recent single molecule tracking experiments, aiming at a better understanding of the influence of anomalous kinetics of proteins on the facilitated diffusion mechanism.
Subrahmanyam, S; Cronan, J E
1999-01-21
We report an efficient and flexible in vitro method for the isolation of genomic DNA sequences that are the binding targets of a given DNA binding protein. This method takes advantage of the fact that binding of a protein to a DNA molecule generally increases the rate of migration of the protein in nondenaturing gel electrophoresis. By the use of a radioactively labeled DNA-binding protein and nonradioactive DNA coupled with PCR amplification from gel slices, we show that specific binding sites can be isolated from Escherichia coli genomic DNA. We have applied this method to isolate a binding site for FadR, a global regulator of fatty acid metabolism in E. coli. We have also isolated a second binding site for BirA, the biotin operon repressor/biotin ligase, from the E. coli genome that has a very low binding efficiency compared with the bio operator region.
Interactions of the SAP Domain of Human Ku70 with DNA Substrate: A Molecular Dynamics Study
NASA Technical Reports Server (NTRS)
Hu, Shaowen; Carra, Claudio; Huff, Janice; Pluth, Janice M.; Cucinotta, Francis A.
2007-01-01
NASA is developing a systems biology approach to improve the assessment of health risks associated with space radiation. The primary toxic and mutagenic lesion following radiation exposure is the DNA double strand break (DSB), thus a model incorporating proteins and pathways important in response and repair of this lesion is critical. One key protein heterodimer for systems models of radiation effects is the Ku70/80 complex. The Ku70/80 complex is important in the initial binding of DSB ends following DNA damage, and is a component of nonhomologous end joining repair, the primary pathway for DSB repair in mammalian cells. The SAP domain of Ku70 (residues 556-609), contains an a helix-extended strand-helix motif and similar motifs have been found in other nucleic acid-binding proteins critical for DNA repair. However, the exact mechanism of damage recognition and substrate specificity for the Ku heterodimer remains unclear in part due to the absence of a high-resolution structure of the SAP/DNA complex. We performed a series of molecular dynamics (MD) simulations on a system with the SAP domain of Ku70 and a 10 base pairs DNA duplex. Large-scale conformational changes were observed and some putative binding modes were suggested based on energetic analysis. These modes are consistent with previous experimental investigations. In addition, the results indicate that cooperation of SAP with other domains of Ku70/80 is necessary to explain the high affinity of binding as observed in experiments.
The helical structure of DNA facilitates binding
NASA Astrophysics Data System (ADS)
Berg, Otto G.; Mahmutovic, Anel; Marklund, Emil; Elf, Johan
2016-09-01
The helical structure of DNA imposes constraints on the rate of diffusion-limited protein binding. Here we solve the reaction-diffusion equations for DNA-like geometries and extend with simulations when necessary. We find that the helical structure can make binding to the DNA more than twice as fast compared to a case where DNA would be reactive only along one side. We also find that this rate advantage remains when the contributions from steric constraints and rotational diffusion of the DNA-binding protein are included. Furthermore, we find that the association rate is insensitive to changes in the steric constraints on the DNA in the helix geometry, while it is much more dependent on the steric constraints on the DNA-binding protein. We conclude that the helical structure of DNA facilitates the nonspecific binding of transcription factors and structural DNA-binding proteins in general.
High-Affinity Quasi-Specific Sites in the Genome: How the DNA-Binding Proteins Cope with Them
Chakrabarti, J.; Chandra, Navin; Raha, Paromita; Roy, Siddhartha
2011-01-01
Many prokaryotic transcription factors home in on one or a few target sites in the presence of a huge number of nonspecific sites. Our analysis of λ-repressor in the Escherichia coli genome based on single basepair substitution experiments shows the presence of hundreds of sites having binding energy within 3 Kcal/mole of the OR1 binding energy, and thousands of sites with binding energy above the nonspecific binding energy. The effect of such sites on DNA-based processes has not been fully explored. The presence of such sites dramatically lowers the occupation probability of the specific site far more than if the genome were composed of nonspecific sites only. Our Brownian dynamics studies show that the presence of quasi-specific sites results in very significant kinetic effects as well. In contrast to λ-repressor, the E. coli genome has orders of magnitude lower quasi-specific sites for GalR, an integral transcription factor, thus causing little competition for the specific site. We propose that GalR and perhaps repressors of the same family have evolved binding modes that lead to much smaller numbers of quasi-specific sites to remove the untoward effects of genomic DNA. PMID:21889449
JASPAR 2010: the greatly expanded open-access database of transcription factor binding profiles
Portales-Casamar, Elodie; Thongjuea, Supat; Kwon, Andrew T.; Arenillas, David; Zhao, Xiaobei; Valen, Eivind; Yusuf, Dimas; Lenhard, Boris; Wasserman, Wyeth W.; Sandelin, Albin
2010-01-01
JASPAR (http://jaspar.genereg.net) is the leading open-access database of matrix profiles describing the DNA-binding patterns of transcription factors (TFs) and other proteins interacting with DNA in a sequence-specific manner. Its fourth major release is the largest expansion of the core database to date: the database now holds 457 non-redundant, curated profiles. The new entries include the first batch of profiles derived from ChIP-seq and ChIP-chip whole-genome binding experiments, and 177 yeast TF binding profiles. The introduction of a yeast division brings the convenience of JASPAR to an active research community. As binding models are refined by newer data, the JASPAR database now uses versioning of matrices: in this release, 12% of the older models were updated to improved versions. Classification of TF families has been improved by adopting a new DNA-binding domain nomenclature. A curated catalog of mammalian TFs is provided, extending the use of the JASPAR profiles to additional TFs belonging to the same structural family. The changes in the database set the system ready for more rapid acquisition of new high-throughput data sources. Additionally, three new special collections provide matrix profile data produced by recent alternative high-throughput approaches. PMID:19906716
Parmar, Jyotsana J; Das, Dibyendu; Padinhateeri, Ranjith
2016-02-29
It is being increasingly realized that nucleosome organization on DNA crucially regulates DNA-protein interactions and the resulting gene expression. While the spatial character of the nucleosome positioning on DNA has been experimentally and theoretically studied extensively, the temporal character is poorly understood. Accounting for ATPase activity and DNA-sequence effects on nucleosome kinetics, we develop a theoretical method to estimate the time of continuous exposure of binding sites of non-histone proteins (e.g. transcription factors and TATA binding proteins) along any genome. Applying the method to Saccharomyces cerevisiae, we show that the exposure timescales are determined by cooperative dynamics of multiple nucleosomes, and their behavior is often different from expectations based on static nucleosome occupancy. Examining exposure times in the promoters of GAL1 and PHO5, we show that our theoretical predictions are consistent with known experiments. We apply our method genome-wide and discover huge gene-to-gene variability of mean exposure times of TATA boxes and patches adjacent to TSS (+1 nucleosome region); the resulting timescale distributions have non-exponential tails. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Heintz, Udo; Schlichting, Ilme
2016-01-01
The design of synthetic optogenetic tools that allow precise spatiotemporal control of biological processes previously inaccessible to optogenetic control has developed rapidly over the last years. Rational design of such tools requires detailed knowledge of allosteric light signaling in natural photoreceptors. To understand allosteric communication between sensor and effector domains, characterization of all relevant signaling states is required. Here, we describe the mechanism of light-dependent DNA binding of the light-oxygen-voltage (LOV) transcription factor Aureochrome 1a from Phaeodactylum tricornutum (PtAu1a) and present crystal structures of a dark state LOV monomer and a fully light-adapted LOV dimer. In combination with hydrogen/deuterium-exchange, solution scattering data and DNA-binding experiments, our studies reveal a light-sensitive interaction between the LOV and basic region leucine zipper DNA-binding domain that together with LOV dimerization results in modulation of the DNA affinity of PtAu1a. We discuss the implications of these results for the design of synthetic LOV-based photosensors with application in optogenetics. DOI: http://dx.doi.org/10.7554/eLife.11860.001 PMID:26754770
footprintDB: a database of transcription factors with annotated cis elements and binding interfaces.
Sebastian, Alvaro; Contreras-Moreira, Bruno
2014-01-15
Traditional and high-throughput techniques for determining transcription factor (TF) binding specificities are generating large volumes of data of uneven quality, which are scattered across individual databases. FootprintDB integrates some of the most comprehensive freely available libraries of curated DNA binding sites and systematically annotates the binding interfaces of the corresponding TFs. The first release contains 2422 unique TF sequences, 10 112 DNA binding sites and 3662 DNA motifs. A survey of the included data sources, organisms and TF families was performed together with proprietary database TRANSFAC, finding that footprintDB has a similar coverage of multicellular organisms, while also containing bacterial regulatory data. A search engine has been designed that drives the prediction of DNA motifs for input TFs, or conversely of TF sequences that might recognize input regulatory sequences, by comparison with database entries. Such predictions can also be extended to a single proteome chosen by the user, and results are ranked in terms of interface similarity. Benchmark experiments with bacterial, plant and human data were performed to measure the predictive power of footprintDB searches, which were able to correctly recover 10, 55 and 90% of the tested sequences, respectively. Correctly predicted TFs had a higher interface similarity than the average, confirming its diagnostic value. Web site implemented in PHP,Perl, MySQL and Apache. Freely available from http://floresta.eead.csic.es/footprintdb.
van der Vaart, Arjan
2015-05-01
Protein-DNA binding often involves dramatic conformational changes such as protein folding and DNA bending. While thermodynamic aspects of this behavior are understood, and its biological function is often known, the mechanism by which the conformational changes occur is generally unclear. By providing detailed structural and energetic data, molecular dynamics simulations have been helpful in elucidating and rationalizing protein-DNA binding. This review will summarize recent atomistic molecular dynamics simulations of the conformational dynamics of DNA and protein-DNA binding. A brief overview of recent developments in DNA force fields is given as well. Simulations have been crucial in rationalizing the intrinsic flexibility of DNA, and have been instrumental in identifying the sequence of binding events, the triggers for the conformational motion, and the mechanism of binding for a number of important DNA-binding proteins. Molecular dynamics simulations are an important tool for understanding the complex binding behavior of DNA-binding proteins. With recent advances in force fields and rapid increases in simulation time scales, simulations will become even more important for future studies. This article is part of a Special Issue entitled Recent developments of molecular dynamics. Copyright © 2014. Published by Elsevier B.V.
Genome-wide profiling of DNA-binding proteins using barcode-based multiplex Solexa sequencing.
Raghav, Sunil Kumar; Deplancke, Bart
2012-01-01
Chromatin immunoprecipitation (ChIP) is a commonly used technique to detect the in vivo binding of proteins to DNA. ChIP is now routinely paired to microarray analysis (ChIP-chip) or next-generation sequencing (ChIP-Seq) to profile the DNA occupancy of proteins of interest on a genome-wide level. Because ChIP-chip introduces several biases, most notably due to the use of a fixed number of probes, ChIP-Seq has quickly become the method of choice as, depending on the sequencing depth, it is more sensitive, quantitative, and provides a greater binding site location resolution. With the ever increasing number of reads that can be generated per sequencing run, it has now become possible to analyze several samples simultaneously while maintaining sufficient sequence coverage, thus significantly reducing the cost per ChIP-Seq experiment. In this chapter, we provide a step-by-step guide on how to perform multiplexed ChIP-Seq analyses. As a proof-of-concept, we focus on the genome-wide profiling of RNA Polymerase II as measuring its DNA occupancy at different stages of any biological process can provide insights into the gene regulatory mechanisms involved. However, the protocol can also be used to perform multiplexed ChIP-Seq analyses of other DNA-binding proteins such as chromatin modifiers and transcription factors.
Yang, Hongmei; Wang, Yihan; Yu, Wenjing; Shi, Lei; Wang, Hongfeng; Su, Rui; Chen, Changbao; Liu, Shuying
2018-05-15
The identification and screening of triplex DNA binders are important because these compounds, in many cases, are potential anticancer agents as well as promising drug candidates. Therefore, the ability to screen for these compounds in a high-throughput mode could dramatically improve the drug screening process. A method involving a combination of 96-well plate format and peak area-fading ultra high performance liquid chromatography coupled with Orbitrap mass spectrometry was employed for screening bioactive compounds binding to the triplex DNA from the extracts of Stephania tetrandra S. Moore. Two compounds were screened out and identified as fangchinoline and tetrandrine, based on the comparison of retention time and MS 2 data with those of standards. The binding mechanisms of fangchinoline and tetrandrine at the molecular level were explored using MS 2 , fluorescence spectroscopy, ultraviolet-visible spectroscopy, and circular dichroism. Collision-induced dissociation experiments showed that the complexes with fangchinoline and tetrandrine were dissociated by ligand elimination. According to these measurements, an intercalating binding is the most appropriate binding mode of these two alkaloids to the triplex DNA. The current work provides not only deep insight into alkaloid-triplex DNA complexes but also useful guidelines for the design of efficient anticancer agents. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Bioassays Based on Molecular Nanomechanics
Majumdar, Arun
2002-01-01
Recent experiments have shown that when specific biomolecular interactions are confined to one surface of a microcantilever beam, changes in intermolecular nanomechanical forces provide sufficient differential torque to bend the cantilever beam. This has been used to detect single base pair mismatches during DNA hybridization, as well as prostate specific antigen (PSA) at concentrations and conditions that are clinically relevant for prostate cancer diagnosis. Since cantilever motion originates from free energy change induced by specific biomolecular binding, this technique is now offering a common platform for label-free quantitative analysis of protein-protein binding, DNA hybridization DNA-protein interactions, and in general receptor-ligandmore » interactions. Current work is focused on developing “universal microarrays” of microcantilever beams for high-throughput multiplexed bioassays.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Donahue, B.A.; Augot, M.; Bellon, S.F.
1990-06-19
A factor has been identified in extracts from human HeLa and hamster V79 cells that retards the electrophoretic mobility of several DNA restriction fragments modified with the antitumor drug cis-diamminedichloroplatinum(II) (cisplatin). Binding of the factor to cisplatin-modified DNA was sensitive to pretreatment with proteinase K, establishing that the factor is a protein. Gel mobility shifts were observed with probes containing as few as seven Pt atoms per kilobase of duplex DNA. By competition experiments the dissociation constant, K{sub d}, of the protein from cisplatin-modified DNA was estimated to be (1-20) {times} 10{sup {minus}10} M. Protein binding is selective for DNAmore » modified with cisplatin, (Pt(en)Cl{sub 2}) (en, ethylenediamine), and (Pt(dach)Cl{sub 2}) (dach, 1,2-diaminocyclohexane) but not with chemotherapeutically inactive trans-diamminedichloroplatinum(II) or monofunctionally coordinating (Pt(dien)Cl)Cl (dien, diethylenetriamine) complexes. The protein binds specifically to 1,2-intrastrand d(GpG) and d(ApG) cross-links formed by cisplatin. The apparent molecular weight of the protein is 91,000, as determined by sucrose gradient centrifugation of a preparation partially purified by ammonium sulfate fractionation. Binding of the protein to platinum-modified DNA does not require cofactors but is sensitive to treatment with 5 mM MnCl{sub 2}, CdCl{sub 2}, CoCl{sub 2}, or ZnCl{sub 2} and with 1 mM HgCl{sub 2}. This protein, alone or in conjunction with other cellular constituents, could be of general importance in the initial stages of processing of mammalian DNA damaged by cisplatin or other genotoxic agents and may belong to a wider class of such cellular damage-recognition proteins (DRPs).« less
Quantification of transcription factor-DNA binding affinity in a living cell
Belikov, Sergey; Berg, Otto G.; Wrange, Örjan
2016-01-01
The apparent dissociation constant (Kd) for specific binding of glucocorticoid receptor (GR) and androgen receptor (AR) to DNA was determined in vivo in Xenopus oocytes. The total nuclear receptor concentration was quantified as specifically retained [3H]-hormone in manually isolated oocyte nuclei. DNA was introduced by nuclear microinjection of single stranded phagemid DNA, chromatin is then formed during second strand synthesis. The fraction of DNA sites occupied by the expressed receptor was determined by dimethylsulphate in vivo footprinting and used for calculation of the receptor-DNA binding affinity. The forkhead transcription factor FoxA1 enhanced the DNA binding by GR with an apparent Kd of ∼1 μM and dramatically stimulated DNA binding by AR with an apparent Kd of ∼0.13 μM at a composite androgen responsive DNA element containing one FoxA1 binding site and one palindromic hormone receptor binding site known to bind one receptor homodimer. FoxA1 exerted a weak constitutive- and strongly cooperative DNA binding together with AR but had a less prominent effect with GR, the difference reflecting the licensing function of FoxA1 at this androgen responsive DNA element. PMID:26657626
Stoyan, T; Gloeckner, G; Diekmann, S; Carbon, J
2001-08-01
The CBF1 (centromere binding factor 1) gene of Candida glabrata was cloned by functional complementation of the methionine biosynthesis defect of a Saccharomyces cerevisiae cbf1 deletion mutant. The C. glabrata-coded protein, CgCbf1, contains a basic-helix-loop-helix leucine zipper domain and has features similar to those of other budding yeast Cbf1 proteins. CgCbf1p binds in vitro to the centromere DNA element I (CDEI) sequence GTCACATG with high affinity (0.9 x 10(9) M(-1)). Bandshift experiments revealed a pattern of protein-DNA complexes on CgCEN DNA different from that known for S. cerevisiae. We examined the effect of altering the CDEI binding site on CEN plasmid segregation, using a newly developed colony-sectoring assay. Internal deletion of the CDEI binding site led only to a fivefold increase in rates of plasmid loss, indicating that direct binding of Cbf1p to the centromere DNA is not required for full function. Additional deletion of sequences to the left of CDEI, however, led to a 70-fold increase in plasmid loss rates. Deletion of the CBF1 gene proved to be lethal in C. glabrata. C. glabrata cells containing the CBF1 gene under the influence of a shutdown promoter (tetO-ScHOP) arrested their growth after 5 h of cultivation in the presence of the reactive drug doxycycline. DAPI (4',6'-diamidino-2-phenylindole) staining of the arrested cells revealed a significant increase in the number of large-budded cells with single nuclei, 2C DNA content, and short spindles, indicating a defect in the G(2)/M transition of the cell cycle. Thus, we conclude that Cbf1p is required for chromosome segregation in C. glabrata.
Foster, David A.; Hantzopoulos, Petros; Zubay, Geoffrey
1982-01-01
Aphidicolin is a highly specific inhibitor of DNA polymerase α and has been most useful for assessing the role of this enzyme in various replication processes (J. A. Huberman, Cell 23:647-648, 1981). Both nuclear DNA replication and simian virus 40 DNA replication are highly sensitive to this drug (Krokan et al., Biochemistry 18:4431-4443, 1979), whereas mitochondrial DNA synthesis is completely insensitive (Zimmerman et al., J. Biol. Chem. 255:11847-11852, 1980). Adenovirus DNA replication is sensitive to aphidicolin, but only at much higher concentrations. These patterns of sensitivity are seen both in vivo and in vitro (Krokan et al., Biochemistry 18:4431-4443, 1979). A temperature-sensitive mutant of adenovirus type 5 known as H5ts125 is able to complete but not initiate new rounds of replication at nonpermissive temperatures (P. C. van der Vliet and J. S. Sussenbach, Virology 67:415-426, 1975). When cells infected with H5ts125 were shifted from permissive (33°C) to nonpermissive (41°C) conditions, the residual DNA synthesis (elongation) showed a striking increase in sensitivity to aphidicolin. The temperature-sensitive mutation of H5ts125 is in the gene for the 72-kilodalton single-stranded DNA-binding protein. This demonstrated that the increased resistance to aphidicolin shown by adenovirus DNA replication was dependent on that protein. It also supports an elongation role for both DNA polymerase α and the 72-kilodalton single-stranded DNA-binding protein in adenovirus DNA replication. Further support for an elongation role of DNA polymerase α came from experiments with permissive temperature conditions and inhibiting levels of aphidicolin in which it was shown that newly initiated strands failed to elongate to completion. Images PMID:6809958
Mechanistic Insights on the Inhibition of C5 DNA Methyltransferases by Zebularine
Champion, Christine; Guianvarc'h, Dominique; Sénamaud-Beaufort, Catherine; Jurkowska, Renata Z.; Jeltsch, Albert; Ponger, Loïc; Arimondo, Paola B.; Guieysse-Peugeot, Anne-Laure
2010-01-01
In mammals DNA methylation occurs at position 5 of cytosine in a CpG context and regulates gene expression. It plays an important role in diseases and inhibitors of DNA methyltransferases (DNMTs)—the enzymes responsible for DNA methylation—are used in clinics for cancer therapy. The most potent inhibitors are 5-azacytidine and 5-azadeoxycytidine. Zebularine (1-(β-D-ribofuranosyl)-2(1H)- pyrimidinone) is another cytidine analog described as a potent inhibitor that acts by forming a covalent complex with DNMT when incorporated into DNA. Here we bring additional experiments to explain its mechanism of action. First, we observe an increase in the DNA binding when zebularine is incorporated into the DNA, compared to deoxycytidine and 5-fluorodeoxycytidine, together with a strong decrease in the dissociation rate. Second, we show by denaturing gel analysis that the intermediate covalent complex between the enzyme and the DNA is reversible, differing thus from 5-fluorodeoxycytidine. Third, no methylation reaction occurs when zebularine is present in the DNA. We confirm that zebularine exerts its demethylation activity by stabilizing the binding of DNMTs to DNA, hindering the methylation and decreasing the dissociation, thereby trapping the enzyme and preventing turnover even at other sites. PMID:20808780
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio
The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less
Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio; ...
2016-03-09
The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less
Biondi, Elisa; Lane, Joshua D.; Das, Debasis; Dasgupta, Saurja; Piccirilli, Joseph A.; Hoshika, Shuichi; Bradley, Kevin M.; Krantz, Bryan A.; Benner, Steven A.
2016-01-01
Reported here is a laboratory in vitro evolution (LIVE) experiment based on an artificially expanded genetic information system (AEGIS). This experiment delivers the first example of an AEGIS aptamer that binds to an isolated protein target, the first whose structural contact with its target has been outlined and the first to inhibit biologically important activities of its target, the protective antigen from Bacillus anthracis. We show how rational design based on secondary structure predictions can also direct the use of AEGIS to improve the stability and binding of the aptamer to its target. The final aptamer has a dissociation constant of ∼35 nM. These results illustrate the value of AEGIS-LIVE for those seeking to obtain receptors and ligands without the complexities of medicinal chemistry, and also challenge the biophysical community to develop new tools to analyze the spectroscopic signatures of new DNA folds that will emerge in synthetic genetic systems replacing standard DNA and RNA as platforms for LIVE. PMID:27701076
Binding of undamaged double stranded DNA to vaccinia virus uracil-DNA glycosylase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schormann, Norbert; Banerjee, Surajit; Ricciardi, Robert
Background: Uracil-DNA glycosylases are evolutionarily conserved DNA repair enzymes. However, vaccinia virus uracil-DNA glycosylase (known as D4), also serves as an intrinsic and essential component of the processive DNA polymerase complex during DNA replication. In this complex D4 binds to a unique poxvirus specific protein A20 which tethers it to the DNA polymerase. At the replication fork the DNA scanning and repair function of D4 is coupled with DNA replication. So far, DNA-binding to D4 has not been structurally characterized. Results: This manuscript describes the first structure of a DNA-complex of a uracil-DNA glycosylase from the poxvirus family. This alsomore » represents the first structure of a uracil DNA glycosylase in complex with an undamaged DNA. In the asymmetric unit two D4 subunits bind simultaneously to complementary strands of the DNA double helix. Each D4 subunit interacts mainly with the central region of one strand. DNA binds to the opposite side of the A20-binding surface on D4. In comparison of the present structure with the structure of uracil-containing DNA-bound human uracil-DNA glycosylase suggests that for DNA binding and uracil removal D4 employs a unique set of residues and motifs that are highly conserved within the poxvirus family but different in other organisms. Conclusion: The first structure of D4 bound to a truly non-specific undamaged double-stranded DNA suggests that initial binding of DNA may involve multiple non-specific interactions between the protein and the phosphate backbone.« less
Binding of undamaged double stranded DNA to vaccinia virus uracil-DNA glycosylase
Schormann, Norbert; Banerjee, Surajit; Ricciardi, Robert; ...
2015-06-02
Background: Uracil-DNA glycosylases are evolutionarily conserved DNA repair enzymes. However, vaccinia virus uracil-DNA glycosylase (known as D4), also serves as an intrinsic and essential component of the processive DNA polymerase complex during DNA replication. In this complex D4 binds to a unique poxvirus specific protein A20 which tethers it to the DNA polymerase. At the replication fork the DNA scanning and repair function of D4 is coupled with DNA replication. So far, DNA-binding to D4 has not been structurally characterized. Results: This manuscript describes the first structure of a DNA-complex of a uracil-DNA glycosylase from the poxvirus family. This alsomore » represents the first structure of a uracil DNA glycosylase in complex with an undamaged DNA. In the asymmetric unit two D4 subunits bind simultaneously to complementary strands of the DNA double helix. Each D4 subunit interacts mainly with the central region of one strand. DNA binds to the opposite side of the A20-binding surface on D4. In comparison of the present structure with the structure of uracil-containing DNA-bound human uracil-DNA glycosylase suggests that for DNA binding and uracil removal D4 employs a unique set of residues and motifs that are highly conserved within the poxvirus family but different in other organisms. Conclusion: The first structure of D4 bound to a truly non-specific undamaged double-stranded DNA suggests that initial binding of DNA may involve multiple non-specific interactions between the protein and the phosphate backbone.« less
2011-01-01
Background Transcription factors (TFs) play a central role in regulating gene expression by interacting with cis-regulatory DNA elements associated with their target genes. Recent surveys have examined the DNA binding specificities of most Saccharomyces cerevisiae TFs, but a comprehensive evaluation of their data has been lacking. Results We analyzed in vitro and in vivo TF-DNA binding data reported in previous large-scale studies to generate a comprehensive, curated resource of DNA binding specificity data for all characterized S. cerevisiae TFs. Our collection comprises DNA binding site motifs and comprehensive in vitro DNA binding specificity data for all possible 8-bp sequences. Investigation of the DNA binding specificities within the basic leucine zipper (bZIP) and VHT1 regulator (VHR) TF families revealed unexpected plasticity in TF-DNA recognition: intriguingly, the VHR TFs, newly characterized by protein binding microarrays in this study, recognize bZIP-like DNA motifs, while the bZIP TF Hac1 recognizes a motif highly similar to the canonical E-box motif of basic helix-loop-helix (bHLH) TFs. We identified several TFs with distinct primary and secondary motifs, which might be associated with different regulatory functions. Finally, integrated analysis of in vivo TF binding data with protein binding microarray data lends further support for indirect DNA binding in vivo by sequence-specific TFs. Conclusions The comprehensive data in this curated collection allow for more accurate analyses of regulatory TF-DNA interactions, in-depth structural studies of TF-DNA specificity determinants, and future experimental investigations of the TFs' predicted target genes and regulatory roles. PMID:22189060
Kimoto, Michiko; Nakamura, Mana; Hirao, Ichiro
2016-09-06
A new technology, genetic alphabet expansion using artificial bases (unnatural bases), has created high-affinity DNA ligands (aptamers) that specifically bind to target proteins by ExSELEX (genetic alphabet Expansion for Systematic Evolution of Ligands by EXponential enrichment). We recently found that the unnatural-base DNA aptamers can be stabilized against nucleases, by introducing an extraordinarily stable, unique hairpin DNA (mini-hairpin DNA) and by reinforcing the stem region with G-C pairs. Here, to establish this aptamer generation method, we examined the stabilization of a high-affinity anti-VEGF165 unnatural-base DNA aptamer. The stabilized aptamers displayed significantly increased thermal and nuclease stabilities, and furthermore, exhibited higher affinity to the target. As compared to the well-known anti-VEGF165 RNA aptamer, pegaptanib (Macugen), our aptamers did not require calcium ions for binding to VEGF165 Biological experiments using cultured cells revealed that our stabilized aptamers efficiently inhibited the interaction between VEGF165 and its receptor, with the same or slightly higher efficiency than that of the pegaptanib RNA aptamer. The development of cost-effective and calcium ion-independent high-affinity anti-VEGF165 DNA aptamers encourages further progress in diagnostic and therapeutic applications. In addition, the stabilization process provided additional information about the key elements required for aptamer binding to VEGF165. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Johnson, G G; Geiduschek, E P
1977-04-05
The interaction of the phage SPO1 protein transcription factor 1 (TF1), with DNA has been analyzed by membrane filter binding and by sedimentation methods. Substantially specific binding of TF1 to helical SPO1 DNA can be demonstrated by nitrocellulose filter-binding assays at relatively low ionic strength (0.08). However, TF1-DNA complexes dissociate and reequilibrate relatively rapidly and this makes filter-binding assays unsuitable for quantitative measurements of binding equilibra. Accordingly, the sedimentation properties of TF1-DNA complexes have been explored and a short-column centrifugation assay has been elaborated for quantitative measurements. Preferential binding of TF1 to the hydroxymethyluracil-containing SPO1 DNA has also been demonstrated by short-column centrifugation. TF1 binds relatively weakly and somewhat cooperatively to SPO1 DNA at many sites; TF1-DNA complexes dissociate and reequilibrate rapidly. At 20 degrees C in 0.01 M phosphate, pH 7.5, 0.15 KC1, one molecule of TF1 can bind to approximately every 60 nucleotide pairs of SPO1 DNA.
Chikira, Makoto; Ng, Chew Hee; Palaniandavar, Mallayan
2015-01-01
The interaction of simple and ternary Cu(II) complexes of 1,10-phenanthrolines with DNA has been studied extensively because of their various interesting and important functions such as DNA cleavage activity, cytotoxicity towards cancer cells, and DNA based asymmetric catalysis. Such functions are closely related to the DNA binding modes of the complexes such as intercalation, groove binding, and electrostatic surface binding. A variety of spectroscopic methods have been used to study the DNA binding mode of the Cu(II) complexes. Of all these methods, DNA-fiber electron paramagnetic resonance (EPR) spectroscopy affords unique information on the DNA binding structures of the complexes. In this review we summarize the results of our DNA-fiber EPR studies on the DNA binding structure of the complexes and discuss them together with the data accumulated by using other measurements. PMID:26402668
MCM ring hexamerization is a prerequisite for DNA-binding
Froelich, Clifford A.; Nourse, Amanda; Enemark, Eric J.
2015-09-13
The hexameric Minichromosome Maintenance (MCM) protein complex forms a ring that unwinds DNA at the replication fork in eukaryotes and archaea. Our recent crystal structure of an archaeal MCM N-terminal domain bound to single-stranded DNA (ssDNA) revealed ssDNA associating across tight subunit interfaces but not at the loose interfaces, indicating that DNA-binding is governed not only by the DNA-binding residues of the subunits (MCM ssDNA-binding motif, MSSB) but also by the relative orientation of the subunits. We now extend these findings to show that DNA-binding by the MCM N-terminal domain of the archaeal organism Pyrococcus furiosus occurs specifically in themore » hexameric oligomeric form. We show that mutants defective for hexamerization are defective in binding ssDNA despite retaining all the residues observed to interact with ssDNA in the crystal structure. One mutation that exhibits severely defective hexamerization and ssDNA-binding is at a conserved phenylalanine that aligns with the mouse Mcm4(Chaos3) mutation associated with chromosomal instability, cancer, and decreased intersubunit association.« less
NASA Astrophysics Data System (ADS)
Chinnathambi, Shanmugavel; Karthikeyan, Subramani; Velmurugan, Devadasan; Hanagata, Nobutaka; Aruna, Prakasarao; Ganesan, Singaravelu
2015-04-01
In the present study, the interaction of 5-Fluorouracil with herring sperm DNA is reported using spectroscopic and molecular modeling techniques. This binding study of 5-FU with hs-DNA is of paramount importance in understanding chemico-biological interactions for drug design, pharmacy and biochemistry without altering the original structure. The challenge of the study was to find the exact binding mode of the drug 5-Fluorouracil with hs-DNA. From the absorption studies, a hyperchromic effect was observed for the herring sperm DNA in the presence of 5-Fluorouracil and a binding constant of 6.153 × 103 M-1 for 5-Fluorouracil reveals the existence of weak interaction between the 5-Fluorouracil and herring sperm DNA. Ethidium bromide loaded herring sperm DNA showed a quenching in the fluorescence intensity after the addition of 5-Fluorouracil. The binding constants for 5-Fluorouracil stranded DNA and competitive bindings of 5-FU interacting with DNA-EB systems were examined by fluorescence spectra. The Stern-Volmer plots and fluorescence lifetime results confirm the static quenching nature of the drug-DNA complex. The binding constant Kb was 2.5 × 104 L mol-1 and the number of binding sites are 1.17. The 5-FU on DNA system was calculated using double logarithmic plot. From the Forster nonradiative energy transfer study it has been found that the distance of 5-FU from DNA was 4.24 nm. In addition to the spectroscopic results, the molecular modeling studies also revealed the major groove binding as well as the partial intercalation mode of binding between the 5-Fluorouracil and herring sperm DNA. The binding energy and major groove binding as -6.04 kcal mol-1 and -6.31 kcal mol-1 were calculated from the modeling studies. All the testimonies manifested that binding modes between 5-Fluorouracil and DNA were evidenced to be groove binding and in partial intercalative mode.
Patel, Meera J; Bhatia, Lavesh; Yilmaz, Gulden; Biswas-Fiss, Esther E; Biswas, Subhasis B
2017-09-01
DnaA protein is the initiator of genomic DNA replication in prokaryotes. It binds to specific DNA sequences in the origin of DNA replication and unwinds small AT-rich sequences downstream for the assembly of the replisome. The mechanism of activation of DnaA that enables it to bind and organize the origin DNA and leads to replication initiation remains unclear. In this study, we have developed double-labeled fluorescent DnaA probes to analyze conformational states of DnaA protein upon binding DNA, nucleotide, and Soj sporulation protein using Fluorescence Resonance Energy Transfer (FRET). Our studies demonstrate that DnaA protein undergoes large conformational changes upon binding to substrates and there are multiple distinct conformational states that enable it to initiate DNA replication. DnaA protein adopted a relaxed conformation by expanding ~15Å upon binding ATP and DNA to form the ATP·DnaA·DNA complex. Hydrolysis of bound ATP to ADP led to a contraction of DnaA within the complex. The relaxed conformation of DnaA is likely required for the formation of the multi-protein ATP·DnaA·DNA complex. In the initiation of sporulation, Soj binding to DnaA prevented relaxation of its conformation. Soj·ADP appeared to block the activation of DnaA, suggesting a mechanism for Soj·ADP in switching initiation of DNA replication to sporulation. Our studies demonstrate that multiple conformational states of DnaA protein regulate its binding to DNA in the initiation of DNA replication. Copyright © 2017 Elsevier B.V. All rights reserved.
Smaczniak, Cezary; Muiño, Jose M; Chen, Dijun; Angenent, Gerco C; Kaufmann, Kerstin
2017-08-01
Floral organ identities in plants are specified by the combinatorial action of homeotic master regulatory transcription factors. However, how these factors achieve their regulatory specificities is still largely unclear. Genome-wide in vivo DNA binding data show that homeotic MADS domain proteins recognize partly distinct genomic regions, suggesting that DNA binding specificity contributes to functional differences of homeotic protein complexes. We used in vitro systematic evolution of ligands by exponential enrichment followed by high-throughput DNA sequencing (SELEX-seq) on several floral MADS domain protein homo- and heterodimers to measure their DNA binding specificities. We show that specification of reproductive organs is associated with distinct binding preferences of a complex formed by SEPALLATA3 and AGAMOUS. Binding specificity is further modulated by different binding site spacing preferences. Combination of SELEX-seq and genome-wide DNA binding data allows differentiation between targets in specification of reproductive versus perianth organs in the flower. We validate the importance of DNA binding specificity for organ-specific gene regulation by modulating promoter activity through targeted mutagenesis. Our study shows that intrafamily protein interactions affect DNA binding specificity of floral MADS domain proteins. Differential DNA binding of MADS domain protein complexes plays a role in the specificity of target gene regulation. © 2017 American Society of Plant Biologists. All rights reserved.
Song, Wei; Guo, Jun-Tao
2015-01-01
Transcription factors regulate gene expression through binding to specific DNA sequences. How transcription factors achieve high binding specificity is still not well understood. In this paper, we investigated the role of protein flexibility in protein-DNA-binding specificity by comparative molecular dynamics (MD) simulations. Protein flexibility has been considered as a key factor in molecular recognition, which is intrinsically a dynamic process involving fine structural fitting between binding components. In this study, we performed comparative MD simulations on wild-type and F10V mutant P22 Arc repressor in both free and complex conformations. The F10V mutant has lower DNA-binding specificity though both the bound and unbound main-chain structures between the wild-type and F10V mutant Arc are highly similar. We found that the DNA-binding motif of wild-type Arc is structurally more flexible than the F10V mutant in the unbound state, especially for the six DNA base-contacting residues in each dimer. We demonstrated that the flexible side chains of wild-type Arc lead to a higher DNA-binding specificity through forming more hydrogen bonds with DNA bases upon binding. Our simulations also showed a possible conformational selection mechanism for Arc-DNA binding. These results indicate the important roles of protein flexibility and dynamic properties in protein-DNA-binding specificity.
Li, Richard Y.; Di Felice, Rosa; Rohs, Remo; Lidar, Daniel A.
2018-01-01
Transcription factors regulate gene expression, but how these proteins recognize and specifically bind to their DNA targets is still debated. Machine learning models are effective means to reveal interaction mechanisms. Here we studied the ability of a quantum machine learning approach to predict binding specificity. Using simplified datasets of a small number of DNA sequences derived from actual binding affinity experiments, we trained a commercially available quantum annealer to classify and rank transcription factor binding. The results were compared to state-of-the-art classical approaches for the same simplified datasets, including simulated annealing, simulated quantum annealing, multiple linear regression, LASSO, and extreme gradient boosting. Despite technological limitations, we find a slight advantage in classification performance and nearly equal ranking performance using the quantum annealer for these fairly small training data sets. Thus, we propose that quantum annealing might be an effective method to implement machine learning for certain computational biology problems. PMID:29652405
PRODORIC2: the bacterial gene regulation database in 2018
Dudek, Christian-Alexander; Hartlich, Juliane; Brötje, David; Jahn, Dieter
2018-01-01
Abstract Bacteria adapt to changes in their environment via differential gene expression mediated by DNA binding transcriptional regulators. The PRODORIC2 database hosts one of the largest collections of DNA binding sites for prokaryotic transcription factors. It is the result of the thoroughly redesigned PRODORIC database. PRODORIC2 is more intuitive and user-friendly. Besides significant technical improvements, the new update offers more than 1000 new transcription factor binding sites and 110 new position weight matrices for genome-wide pattern searches with the Virtual Footprint tool. Moreover, binding sites deduced from high-throughput experiments were included. Data for 6 new bacterial species including bacteria of the Rhodobacteraceae family were added. Finally, a comprehensive collection of sigma- and transcription factor data for the nosocomial pathogen Clostridium difficile is now part of the database. PRODORIC2 is publicly available at http://www.prodoric2.de. PMID:29136200
Lee, Wonbae; Gillies, John P.; Jose, Davis; Israels, Brett A.; von Hippel, Peter H.; Marcus, Andrew H.
2016-01-01
Gene 32 protein (gp32) is the single-stranded (ss) DNA binding protein of the bacteriophage T4. It binds transiently and cooperatively to ssDNA sequences exposed during the DNA replication process and regulates the interactions of the other sub-assemblies of the replication complex during the replication cycle. We here use single-molecule FRET techniques to build on previous thermodynamic studies of gp32 binding to initiate studies of the dynamics of the isolated and cooperative binding of gp32 molecules within the replication complex. DNA primer/template (p/t) constructs are used as models to determine the effects of ssDNA lattice length, gp32 concentration, salt concentration, binding cooperativity and binding polarity at p/t junctions. Hidden Markov models (HMMs) and transition density plots (TDPs) are used to characterize the dynamics of the multi-step assembly pathway of gp32 at p/t junctions of differing polarity, and show that isolated gp32 molecules bind to their ssDNA targets weakly and dissociate quickly, while cooperatively bound dimeric or trimeric clusters of gp32 bind much more tightly, can ‘slide’ on ssDNA sequences, and exhibit binding dynamics that depend on p/t junction polarities. The potential relationships of these binding dynamics to interactions with other components of the T4 DNA replication complex are discussed. PMID:27694621
NASA Astrophysics Data System (ADS)
Matsushita, Y.; Murakawa, T.; Shimamura, K.; Oishi, M.; Ohyama, T.; Kurita, N.
2015-02-01
The catabolite activator protein (CAP) is one of the regulatory proteins controlling the transcription mechanism of gene. Biochemical experiments elucidated that the complex of CAP with cyclic AMP (cAMP) is indispensable for controlling the mechanism, while previous molecular simulations for the monomer of CAP+cAMP complex revealed the specific interactions between CAP and cAMP. However, the effect of cAMP-binding to CAP on the specific interactions between CAP and DNA is not elucidated at atomic and electronic levels. We here considered the ternary complex of CAP, cAMP and DNA in solvating water molecules and investigated the specific interactions between them at atomic and electronic levels using ab initio molecular simulations based on classical molecular dynamics and ab initio fragment molecular orbital methods. The results highlight the important amino acid residues of CAP for the interactions between CAP and cAMP and between CAP and DNA.
Mapping and analysis of Caenorhabditis elegans transcription factor sequence specificities
Narasimhan, Kamesh; Lambert, Samuel A; Yang, Ally WH; Riddell, Jeremy; Mnaimneh, Sanie; Zheng, Hong; Albu, Mihai; Najafabadi, Hamed S; Reece-Hoyes, John S; Fuxman Bass, Juan I; Walhout, Albertha JM; Weirauch, Matthew T; Hughes, Timothy R
2015-01-01
Caenorhabditis elegans is a powerful model for studying gene regulation, as it has a compact genome and a wealth of genomic tools. However, identification of regulatory elements has been limited, as DNA-binding motifs are known for only 71 of the estimated 763 sequence-specific transcription factors (TFs). To address this problem, we performed protein binding microarray experiments on representatives of canonical TF families in C. elegans, obtaining motifs for 129 TFs. Additionally, we predict motifs for many TFs that have DNA-binding domains similar to those already characterized, increasing coverage of binding specificities to 292 C. elegans TFs (∼40%). These data highlight the diversification of binding motifs for the nuclear hormone receptor and C2H2 zinc finger families and reveal unexpected diversity of motifs for T-box and DM families. Motif enrichment in promoters of functionally related genes is consistent with known biology and also identifies putative regulatory roles for unstudied TFs. DOI: http://dx.doi.org/10.7554/eLife.06967.001 PMID:25905672
Heiss, Elke; Gerhäuser, Clarissa
2005-01-01
The chemopreventive agent sulforaphane (SFN) exerts anti-inflammatory activity by thiol-dependent inhibition of nuclear factor kappaB (NF-kappaB) DNA binding. To further analyze the underlying mechanisms, we focused on the thioredoxin/thioredoxin reductase (TrxR) system as a key redox mechanism regulating NF-kappaB DNA binding. Using cultured Raw 264.7 mouse macrophages as a model, 1-chloro-2,4-dinitrobenzene (CDNB), a known inhibitor of TrxR, was identified as an inhibitor of lipopolysaccharide (LPS)-mediated nitric oxide (NO) production and of NF-kappaB DNA binding. CDNB and SFN acted synergistically with respect to inhibition of LPS-induced NO release, and we consequently identified SFN as a novel inhibitor of TrxR enzymatic activity in vitro. Short-term treatment of Raw macrophages with SFN or CDNB resulted in the inhibition of TrxR activity in vivo with half-maximal inhibitory concentration of 25.0 +/- 3.5 microM and 9.4 +/- 3.7 microM, respectively, whereas after a 24-h treatment with 25 microM SFN, TrxR activity was >1.5-fold elevated. In additional experiments, we could exclude that inhibition of trans-activating activity of NF-kappaB contributed to the reduced expression of pro-inflammatory proteins by SFN, based on transient transfection experiments with a (kappaB)(2)- chloramphenicol acetyltransferase construct and a lack of inhibition of protein kinase A activity. These findings further emphasize the importance of redox modulation or thiol reactivity for the regulation of NF-kappaB-dependent transcription by SFN. Antioxid. Redox Signal. 7, 1601-1611. Antioxid. Redox Signal. 7, 1601-1611.
Context influences on TALE–DNA binding revealed by quantitative profiling
Rogers, Julia M.; Barrera, Luis A.; Reyon, Deepak; Sander, Jeffry D.; Kellis, Manolis; Joung, J Keith; Bulyk, Martha L.
2015-01-01
Transcription activator-like effector (TALE) proteins recognize DNA using a seemingly simple DNA-binding code, which makes them attractive for use in genome engineering technologies that require precise targeting. Although this code is used successfully to design TALEs to target specific sequences, off-target binding has been observed and is difficult to predict. Here we explore TALE–DNA interactions comprehensively by quantitatively assaying the DNA-binding specificities of 21 representative TALEs to ∼5,000–20,000 unique DNA sequences per protein using custom-designed protein-binding microarrays (PBMs). We find that protein context features exert significant influences on binding. Thus, the canonical recognition code does not fully capture the complexity of TALE–DNA binding. We used the PBM data to develop a computational model, Specificity Inference For TAL-Effector Design (SIFTED), to predict the DNA-binding specificity of any TALE. We provide SIFTED as a publicly available web tool that predicts potential genomic off-target sites for improved TALE design. PMID:26067805
Context influences on TALE-DNA binding revealed by quantitative profiling.
Rogers, Julia M; Barrera, Luis A; Reyon, Deepak; Sander, Jeffry D; Kellis, Manolis; Joung, J Keith; Bulyk, Martha L
2015-06-11
Transcription activator-like effector (TALE) proteins recognize DNA using a seemingly simple DNA-binding code, which makes them attractive for use in genome engineering technologies that require precise targeting. Although this code is used successfully to design TALEs to target specific sequences, off-target binding has been observed and is difficult to predict. Here we explore TALE-DNA interactions comprehensively by quantitatively assaying the DNA-binding specificities of 21 representative TALEs to ∼5,000-20,000 unique DNA sequences per protein using custom-designed protein-binding microarrays (PBMs). We find that protein context features exert significant influences on binding. Thus, the canonical recognition code does not fully capture the complexity of TALE-DNA binding. We used the PBM data to develop a computational model, Specificity Inference For TAL-Effector Design (SIFTED), to predict the DNA-binding specificity of any TALE. We provide SIFTED as a publicly available web tool that predicts potential genomic off-target sites for improved TALE design.
Kinetics and Mechanism of Mammalian Mitochondrial Ribosome Assembly.
Bogenhagen, Daniel F; Ostermeyer-Fay, Anne G; Haley, John D; Garcia-Diaz, Miguel
2018-02-13
Mammalian mtDNA encodes only 13 proteins, all essential components of respiratory complexes, synthesized by mitochondrial ribosomes. Mitoribosomes contain greatly truncated RNAs transcribed from mtDNA, including a structural tRNA in place of 5S RNA as a scaffold for binding 82 nucleus-encoded proteins, mitoribosomal proteins (MRPs). Cryoelectron microscopy (cryo-EM) studies have determined the structure of the mitoribosome, but its mechanism of assembly is unknown. Our SILAC pulse-labeling experiments determine the rates of mitochondrial import of MRPs and their assembly into intact mitoribosomes, providing a basis for distinguishing MRPs that bind at early and late stages in mitoribosome assembly to generate a working model for mitoribosome assembly. Mitoribosome assembly is a slow process initiated at the mtDNA nucleoid driven by excess synthesis of individual MRPs. MRPs that are tightly associated in the structure frequently join the complex in a coordinated manner. Clinically significant MRP mutations reported to date affect proteins that bind early on during assembly. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.
Electrophoretic mobility shift scanning using an automated infrared DNA sequencer.
Sano, M; Ohyama, A; Takase, K; Yamamoto, M; Machida, M
2001-11-01
Electrophoretic mobility shift assay (EMSA) is widely used in the study of sequence-specific DNA-binding proteins, including transcription factors and mismatch binding proteins. We have established a non-radioisotope-based protocol for EMSA that features an automated DNA sequencer with an infrared fluorescent dye (IRDye) detection unit. Our modification of the elec- trophoresis unit, which includes cooling the gel plates with a reduced well-to-read length, has made it possible to detect shifted bands within 1 h. Further, we have developed a rapid ligation-based method for generating IRDye-labeled probes with an approximately 60% cost reduction. This method has the advantages of real-time scanning, stability of labeled probes, and better safety associated with nonradioactive methods of detection. Analysis of a promoter from an industrially important filamentous fungus, Aspergillus oryzae, in a prototype experiment revealed that the method we describe has potential for use in systematic scanning and identification of the functionally important elements to which cellular factors bind in a sequence-specific manner.
Screening for Protein-DNA Interactions by Automatable DNA-Protein Interaction ELISA
Schüssler, Axel; Kolukisaoglu, H. Üner; Koch, Grit; Wallmeroth, Niklas; Hecker, Andreas; Thurow, Kerstin; Zell, Andreas; Harter, Klaus; Wanke, Dierk
2013-01-01
DNA-binding proteins (DBPs), such as transcription factors, constitute about 10% of the protein-coding genes in eukaryotic genomes and play pivotal roles in the regulation of chromatin structure and gene expression by binding to short stretches of DNA. Despite their number and importance, only for a minor portion of DBPs the binding sequence had been disclosed. Methods that allow the de novo identification of DNA-binding motifs of known DBPs, such as protein binding microarray technology or SELEX, are not yet suited for high-throughput and automation. To close this gap, we report an automatable DNA-protein-interaction (DPI)-ELISA screen of an optimized double-stranded DNA (dsDNA) probe library that allows the high-throughput identification of hexanucleotide DNA-binding motifs. In contrast to other methods, this DPI-ELISA screen can be performed manually or with standard laboratory automation. Furthermore, output evaluation does not require extensive computational analysis to derive a binding consensus. We could show that the DPI-ELISA screen disclosed the full spectrum of binding preferences for a given DBP. As an example, AtWRKY11 was used to demonstrate that the automated DPI-ELISA screen revealed the entire range of in vitro binding preferences. In addition, protein extracts of AtbZIP63 and the DNA-binding domain of AtWRKY33 were analyzed, which led to a refinement of their known DNA-binding consensi. Finally, we performed a DPI-ELISA screen to disclose the DNA-binding consensus of a yet uncharacterized putative DBP, AtTIFY1. A palindromic TGATCA-consensus was uncovered and we could show that the GATC-core is compulsory for AtTIFY1 binding. This specific interaction between AtTIFY1 and its DNA-binding motif was confirmed by in vivo plant one-hybrid assays in protoplasts. Thus, the value and applicability of the DPI-ELISA screen for de novo binding site identification of DBPs, also under automatized conditions, is a promising approach for a deeper understanding of gene regulation in any organism of choice. PMID:24146751
Chung, C N; Hamaguchi, Y; Honjo, T; Kawaichi, M
1994-01-01
To map regions important for DNA binding of the mouse homologue of Suppressor of Hairless or RBP-J kappa protein, mutated mouse RBP-J kappa cDNAs were made by insertion of oligonucleotide linkers or base replacement. DNA binding assays using the mutated proteins expressed in COS cells showed that various mutations between 218 Arg and 227 Arg decreased the DNA binding activity drastically. The DNA binding activity was not affected by amino acid replacements within the integrase motif of the RBP-J kappa protein (230His-269His). Replacements between 291Arg and 323Tyr affected the DNA binding activity slightly but reproducibly. These results indicate that the region encompassing 218Arg-227Arg is critical for the DNA binding activity of RBP-J kappa. This region did not show any significant homology to motifs or domains of the previously described DNA binding proteins. Using a truncation mutant protein RBP-J kappa was shown to associate with DNA as a monomer. Images PMID:8065905
Andera, L; Geiduschek, E P
1994-03-01
The role of the carboxy-terminal amino acids of the bacteriophage SPO1-encoded type II DNA-binding protein, TF1, in DNA binding was analyzed. Chain-terminating mutations truncating the normally 99-amino-acid TF1 at amino acids 96, 97, and 98 were constructed, as were missense mutations substituting cysteine, arginine, and serine for phenylalanine at amino acid 97 and tryptophan for lysine at amino acid 99. The binding of the resulting proteins to a synthetic 44-bp binding site in 5-(hydroxymethyl)uracil DNA, to binding sites in larger SPO1 [5-(hydroxymethyl)uracil-containing] DNA fragments, and to thymine-containing homologous DNA was analyzed by gel retardation and also by DNase I and hydroxy radical footprinting. We conclude that the C tail up to and including phenylalanine at amino acid 97 is essential for DNA binding and that the two C-terminal amino acids, 98 and 99, are involved in protein-protein interactions between TF1 dimers bound to DNA.
Raman, Natarajan; Mahalakshmi, Rajkumar; Arun, T; Packianathan, S; Rajkumar, R
2014-09-05
The present contribution reports a thorough characterization of newly obtained metallointercalators incorporating Schiff bases, formed by the condensation of N-acetoacetyl-o-toluidine with 1-amino-4-nitrobenzene (L(1))/1-amino-4-chlorobenzene (L(2)) as main ligand and 1,10-phenanthroline as co-ligand respectively. The characterization of newly formed metallointercalators has been done by (1)H NMR, UV-Vis, IR, EPR spectroscopy and molar conductivity studies. X-ray powder diffraction illustrates that they are crystalline nature. Binding interaction of these complexes with calf thymus (CT-DNA) has been investigated by emission, absorption, viscosity, cyclic voltammetry and differential pulse voltammetry. DNA binding experiments results reveal that the synthesized complexes interact with DNA through intercalative mode. The in vitro antibacterial and antifungal assay indicate that these complexes are good antimicrobial agents against various pathogens. The DNA cleavage exhibits that they act as efficient cleaving agents. Copyright © 2014 Elsevier B.V. All rights reserved.
Suzuki, Toru; Muto, Shinsuke; Miyamoto, Saku; Aizawa, Kenichi; Horikoshi, Masami; Nagai, Ryozo
2003-08-01
Transcription involves molecular interactions between general and regulatory transcription factors with further regulation by protein-protein interactions (e.g. transcriptional cofactors). Here we describe functional interaction between DNA-binding transcription factor and histone chaperone. Affinity purification of factors interacting with the DNA-binding domain of the transcription factor Sp1 showed Sp1 to interact with the histone chaperone TAF-I, both alpha and beta isoforms. This interaction was specific as Sp1 did not interact with another histone chaperone CIA nor did other tested DNA-binding regulatory factors (MyoD, NFkappaB, p53) interact with TAF-I. Interaction of Sp1 and TAF-I occurs both in vitro and in vivo. Interaction with TAF-I results in inhibition of DNA-binding, and also likely as a result of such, inhibition of promoter activation by Sp1. Collectively, we describe interaction between DNA-binding transcription factor and histone chaperone which results in negative regulation of the former. This novel regulatory interaction advances our understanding of the mechanisms of eukaryotic transcription through DNA-binding regulatory transcription factors by protein-protein interactions, and also shows the DNA-binding domain to mediate important regulatory interactions.
Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites
Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot
2013-01-01
Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958
Interactions of the C-terminal Domain of Human Ku70 with DNA Substrate: A Molecular Dynamics Study
NASA Technical Reports Server (NTRS)
Hu, Shaowen; Huff, Janice; Pluth, Janice M.; Cucinotta, Francis A.
2007-01-01
NASA is developing a systems biology approach to improve the assessment of health risks associated with space radiation. The primary toxic and mutagenic lesion following radiation exposure is the DNA double strand break (DSB), thus a model incorporating proteins and pathways important in response and repair of this lesion is critical. One key protein heterodimer for systems models of radiation effects is the Ku(sub 70/80) complex. The Ku70/80 complex is important in the initial binding of DSB ends following DNA damage, and is a component of nonhomologous end joining repair, the primary pathway for DSB repair in mammalian cells. The C-terminal domain of Ku70 (Ku70c, residues 559-609), contains an helix-extended strand-helix motif and similar motifs have been found in other nucleic acid-binding proteins critical for DNA repair. However, the exact mechanism of damage recognition and substrate specificity for the Ku heterodimer remains unclear in part due to the absence of a high-resolution structure of the Ku70c/DNA complex. We performed a series of molecular dynamics (MD) simulations on a system with the subunit Ku70c and a 14 base pairs DNA duplex, whose starting structures are designed to be variable so as to mimic their different binding modes. By analyzing conformational changes and energetic properties of the complex during MD simulations, we found that interactions are preferred at DNA ends, and within the major groove, which is consistent with previous experimental investigations. In addition, the results indicate that cooperation of Ku70c with other subunits of Ku(sub 70/80) is necessary to explain the high affinity of binding as observed in experiments.
Stigter, Dirk
2004-07-01
Brewer et al. (Biophys. J. 85 (2003) 2519-2524) have studied the compaction of dsDNA in a double flow cell by observing the extension of stained DNA tethered in buffer solutions with or without Abf2p. They use a Langmuir adsorption model in which one Abf2p molecule adsorbs on one site on the DNA, and the binding constant, K, is given as the ratio of the experimental rates of adsorption and desorption. This paper presents an improved interpretation. Instead of Langmuir adsorption we use the more appropriate McGhee-von Hippel (J. Mol. Biol. 86 (1974) 469-489) theory for the adsorption of large ligands to a one-dimensional lattice. We assume that each adsorbed molecule shortens the effective contour length of DNA by the foot print of Abf2p of 27 base pairs. When Abf2p adsorbs to DNA stretched in the flowing buffer solution, we account for a tension effect that decreases the adsorption rate and the binding constant by a factor of 2 to 4. The data suggest that the accessibility to Abf2p decreases significantly with increasing compaction of DNA, resulting in a lower adsorption rate and a lower binding constant. The kinetics reported by Brewer et al. (Biophys. J. 85 (2003) 2519-2524) lead to a binding constant K=3.6 x 10(6) M(-1) at the beginning, and to K=5 x 10(5) M(-1) near the end of a compaction run, more than an order of magnitude lower than the value K=2.57 x 10(7) M(-1) calculated by Brewer et al. (Biophys. J. 85 (2003) 2519-2524).
Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny
2012-11-01
The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.
Nuclear magnetic resonance-based model of a TF1/HmU-DNA complex.
Silva, M V; Pasternack, L B; Kearns, D R
1997-12-15
Transcription factor 1 (TF1), a type II DNA-binding protein encoded by the Bacillus subtilis bacteriophage SPO1, has the capacity for sequence-selective DNA binding and a preference for 5-hydroxymethyl-2'-deoxyuridine (HmU)-containing DNA. In NMR studies of the TF1/HmU-DNA complex, intermolecular NOEs indicate that the flexible beta-ribbon and C-terminal alpha-helix are involved in the DNA-binding site of TF1, placing it in the beta-sheet category of DNA-binding proteins proposed to bind by wrapping two beta-ribbon "arms" around the DNA. Intermolecular and intramolecular NOEs were used to generate an energy-minimized model of the protein-DNA complex in which both DNA bending and protein structure changes are evident.
Grove, A; Galeone, A; Mayol, L; Geiduschek, E P
1996-07-12
TF1 is a member of the family of type II DNA-binding proteins, which also includes the bacterial HU proteins and the Escherichia coli integration host factor (IHF). Distinctive to TF1, which is encoded by the Bacillus subtilis bacteriophage SPO1, is its preferential binding to DNA in which thymine is replaced by 5-hydroxymethyluracil (hmU), as it is in the phage genome. TF1 binds to preferred sites within the phage genome and generates pronounced DNA bending. The extent to which DNA flexibility contributes to the sequence-specific binding of TF1, and the connection between hmU preference and DNA flexibility has been examined. Model flexible sites, consisting of consecutive mismatches, increase the affinity of thymine-containing DNA for TF1. In particular, tandem mismatches separated by nine base-pairs generate an increase, by orders of magnitude, in the affinity of TF1 for T-containing DNA with the sequence of a preferred TF1 binding site, and fully match the affinity of TF1 for this cognate site in hmU-containing DNA (Kd approximately 3 nM). Other placements of loops generate suboptimal binding. This is consistent with a significant contribution of site-specific DNA flexibility to complex formation. Analysis of complexes with hmU-DNA of decreasing length shows that a major part of the binding affinity is generated within a central 19 bp segment (delta G0 = 41.7 kJ mol-1) with more-distal DNA contributing modestly to the affinity (delta delta G = -0.42 kJ mol-1 bp-1 on increasing duplex length to 37 bp). However, a previously characterised thermostable and more tightly binding mutant TF1, TF1(E15G/T32I), derives most of its extra affinity from interaction with flanking DNA. We propose that inherent but sequence-dependent deformability of hmU-containing DNA underlies the preferential binding of TF1 and that TF1-induced DNA bendings is a result of distortions at two distinct sites separated by 9 bp of duplex DNA.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lu, Xun; Guanga, Gerald P; Wan, Cheng
2012-11-13
MafA is a proto-oncoprotein and is critical for insulin gene expression in pancreatic β-cells. Maf proteins belong to the AP1 superfamily of basic region-leucine zipper (bZIP) transcription factors. Residues in the basic helix and an ancillary N-terminal domain, the Extended Homology Region (EHR), endow maf proteins with unique DNA binding properties: binding a 13 bp consensus site consisting of a core AP1 site (TGACTCA) flanked by TGC sequences and binding DNA stably as monomers. To further characterize maf DNA binding, we determined the structure of a MafA–DNA complex. MafA forms base-specific hydrogen bonds with the flanking G –5C –4 andmore » central C 0/G 0 bases, but not with the core-TGA bases. However, in vitro binding studies utilizing a pulse–chase electrophoretic mobility shift assay protocol revealed that mutating either the core-TGA or flanking-TGC bases dramatically increases the binding off rate. Comparing the known maf structures, we propose that DNA binding specificity results from positioning the basic helix through unique phosphate contacts. The EHR does not contact DNA directly but stabilizes DNA binding by contacting the basic helix. Collectively, these results suggest a novel multistep DNA binding process involving a conformational change from contacting the core-TGA to contacting the flanking-TGC bases.« less
Ping, Gang; Lv, Gang; Gutmann, Sebastian; Chen, Chen; Zhang, Renyun; Wang, Xuemei
2006-01-01
The interaction between procaine hydrochloride and DNA/DNA bases in the absence and presence of cadmium sulfide (CdS) nanoparticles has been explored in this study by using differential pulse voltammetry, atomic force microscopy (AFM) and so on, which illustrates the different binding behaviors of procaine hydrochloride with different DNA bases. The results clearly indicate that the binding of purines to procaine hydrochloride is stronger than that of pyrimidines and the binding affinity is in the order of G > A > T > C. In addition, it was observed that the presence of CdS nanoparticles could remarkably enhance the probing sensitivity for the interaction between procaine hydrochloride and DNA/DNA bases. Furthermore, AFM study illustrates that procaine hydrochloride can bind to some specific sites of DNA chains, which indicates that procaine hydrochloride may interact with some special sequences of DNA.
Non-intercalative, deoxyribose binding of boric acid to calf thymus DNA.
Ozdemir, Ayse; Gursaclı, Refiye Tekiner; Tekinay, Turgay
2014-05-01
The present study characterizes the effects of the boric acid binding on calf thymus DNA (ct-DNA) by spectroscopic and calorimetric methods. UV-Vis absorbance spectroscopy, circular dichroism (CD) spectroscopy, transmission electron microscopy (TEM), isothermal titration calorimetry (ITC), and Fourier transform infrared (FT-IR) spectroscopy were employed to characterize binding properties. Changes in the secondary structure of ct-DNA were determined by CD spectroscopy. Sizes and morphologies of boric acid-DNA complexes were determined by transmission electron microscopy (TEM). The kinetics of boric acid binding to calf thymus DNA (ct-DNA) was investigated by isothermal titration calorimetry (ITC). ITC results revealed that boric acid exhibits a moderate affinity to ct-DNA with a binding constant (K a) of 9.54 × 10(4) M(-1). FT-IR results revealed that boric acid binds to the deoxyribose sugar of DNA without disrupting the B-conformation at tested concentrations.
A new structural framework for integrating replication protein A into DNA processing machinery
Brosey, Chris A.; Yan, Chunli; Tsutakawa, Susan E.; Heller, William T.; Rambo, Robert P.; Tainer, John A.; Ivanov, Ivaylo; Chazin, Walter J.
2013-01-01
By coupling the protection and organization of single-stranded DNA (ssDNA) with recruitment and alignment of DNA processing factors, replication protein A (RPA) lies at the heart of dynamic multi-protein DNA processing machinery. Nevertheless, how RPA coordinates biochemical functions of its eight domains remains unknown. We examined the structural biochemistry of RPA’s DNA-binding activity, combining small-angle X-ray and neutron scattering with all-atom molecular dynamics simulations to investigate the architecture of RPA’s DNA-binding core. The scattering data reveal compaction promoted by DNA binding; DNA-free RPA exists in an ensemble of states with inter-domain mobility and becomes progressively more condensed and less dynamic on binding ssDNA. Our results contrast with previous models proposing RPA initially binds ssDNA in a condensed state and becomes more extended as it fully engages the substrate. Moreover, the consensus view that RPA engages ssDNA in initial, intermediate and final stages conflicts with our data revealing that RPA undergoes two (not three) transitions as it binds ssDNA with no evidence for a discrete intermediate state. These results form a framework for understanding how RPA integrates the ssDNA substrate into DNA processing machinery, provides substrate access to its binding partners and promotes the progression and selection of DNA processing pathways. PMID:23303776
A new structural framework for integrating replication protein A into DNA processing machinery
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brosey, Chris; Yan, Chunli; Tsutakawa, Susan
2013-01-17
By coupling the protection and organization of single-stranded DNA (ssDNA) with recruitment and alignment of DNA processing factors, replication protein A (RPA) lies at the heart of dynamic multi-protein DNA processing machinery. Nevertheless, how RPA coordinates biochemical functions of its eight domains remains unknown. We examined the structural biochemistry of RPA's DNA-binding activity, combining small-angle X-ray and neutron scattering with all-atom molecular dynamics simulations to investigate the architecture of RPA's DNA-binding core. The scattering data reveal compaction promoted by DNA binding; DNA-free RPA exists in an ensemble of states with inter-domain mobility and becomes progressively more condensed and less dynamicmore » on binding ssDNA. Our results contrast with previous models proposing RPA initially binds ssDNA in a condensed state and becomes more extended as it fully engages the substrate. Moreover, the consensus view that RPA engages ssDNA in initial, intermediate and final stages conflicts with our data revealing that RPA undergoes two (not three) transitions as it binds ssDNA with no evidence for a discrete intermediate state. These results form a framework for understanding how RPA integrates the ssDNA substrate into DNA processing machinery, provides substrate access to its binding partners and promotes the progression and selection of DNA processing pathways.« less
DIVERSITY in binding, regulation, and evolution revealed from high-throughput ChIP.
Mitra, Sneha; Biswas, Anushua; Narlikar, Leelavati
2018-04-01
Genome-wide in vivo protein-DNA interactions are routinely mapped using high-throughput chromatin immunoprecipitation (ChIP). ChIP-reported regions are typically investigated for enriched sequence-motifs, which are likely to model the DNA-binding specificity of the profiled protein and/or of co-occurring proteins. However, simple enrichment analyses can miss insights into the binding-activity of the protein. Note that ChIP reports regions making direct contact with the protein as well as those binding through intermediaries. For example, consider a ChIP experiment targeting protein X, which binds DNA at its cognate sites, but simultaneously interacts with four other proteins. Each of these proteins also binds to its own specific cognate sites along distant parts of the genome, a scenario consistent with the current view of transcriptional hubs and chromatin loops. Since ChIP will pull down all X-associated regions, the final reported data will be a union of five distinct sets of regions, each containing binding sites of one of the five proteins, respectively. Characterizing all five different motifs and the corresponding sets is important to interpret the ChIP experiment and ultimately, the role of X in regulation. We present diversity which attempts exactly this: it partitions the data so that each partition can be characterized with its own de novo motif. Diversity uses a Bayesian approach to identify the optimal number of motifs and the associated partitions, which together explain the entire dataset. This is in contrast to standard motif finders, which report motifs individually enriched in the data, but do not necessarily explain all reported regions. We show that the different motifs and associated regions identified by diversity give insights into the various complexes that may be forming along the chromatin, something that has so far not been attempted from ChIP data. Webserver at http://diversity.ncl.res.in/; standalone (Mac OS X/Linux) from https://github.com/NarlikarLab/DIVERSITY/releases/tag/v1.0.0.
Graham, Brian W.; Tao, Yeqing; Dodge, Katie L.; Thaxton, Carly T.; Olaso, Danae; Young, Nicolas L.; Marshall, Alan G.
2016-01-01
The archaeal minichromosomal maintenance (MCM) helicase from Sulfolobus solfataricus (SsoMCM) is a model for understanding structural and mechanistic aspects of DNA unwinding. Although interactions of the encircled DNA strand within the central channel provide an accepted mode for translocation, interactions with the excluded strand on the exterior surface have mostly been ignored with regard to DNA unwinding. We have previously proposed an extension of the traditional steric exclusion model of unwinding to also include significant contributions with the excluded strand during unwinding, termed steric exclusion and wrapping (SEW). The SEW model hypothesizes that the displaced single strand tracks along paths on the exterior surface of hexameric helicases to protect single-stranded DNA (ssDNA) and stabilize the complex in a forward unwinding mode. Using hydrogen/deuterium exchange monitored by Fourier transform ion cyclotron resonance MS, we have probed the binding sites for ssDNA, using multiple substrates targeting both the encircled and excluded strand interactions. In each experiment, we have obtained >98.7% sequence coverage of SsoMCM from >650 peptides (5–30 residues in length) and are able to identify interacting residues on both the interior and exterior of SsoMCM. Based on identified contacts, positively charged residues within the external waist region were mutated and shown to generally lower DNA unwinding without negatively affecting the ATP hydrolysis. The combined data globally identify binding sites for ssDNA during SsoMCM unwinding as well as validating the importance of the SEW model for hexameric helicase unwinding. PMID:27044751
Why double-stranded RNA resists condensation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tolokh, Igor S.; Pabit, Suzette; Katz, Andrea M.
2014-09-15
The addition of small amounts of multivalent cations to solutions containing double-stranded DNA leads to attraction between the negatively charged helices and eventually to condensation. Surprisingly, this effect is suppressed in double-stranded RNA, which carries the same charge as the DNA, but assumes a different double helical form. However, additional characterization of short (25 base-pairs) nucleic acid (NA) duplex structures by circular dichroism shows that measured differences in condensation are not solely determined by duplex helical geometry. Here we combine experiment, theory, and atomistic simulations to propose a mechanism that connects the observed variations in condensation of short NA duplexesmore » with the spatial variation of cobalt hexammine (CoHex) binding at the NA duplex surface. The atomistic picture that emerged showed that CoHex distributions around the NA reveals two major NA-CoHex binding modes -- internal and external -- distinguished by the proximity of bound CoHex to the helical axis. Decreasing trends in experimentally observed condensation propensity of the four studied NA duplexes (from B-like form of homopolymeric DNA, to mixed sequence DNA, to DNA:RNA hybrid, to A-like RNA) are explained by the progressive decrease of a single quantity: the fraction of CoHex ions in the external binding mode. Thus, while NA condensation depends on a complex interplay between various structural and sequence features, our coupled experimental and theoretical results suggest a new model in which a single parameter connects the NA condensation propensity with geometry and sequence dependence of CoHex binding.« less
Kakikawa, M; Ohkubo, S; Sakate, T; Sayama, M; Taketo, A; Kodaira, K
2000-05-16
The putative repressor protein Cng (10kDa on an SDS gel) for the lytic pathway of Lactobacillus plantarum phage φg1e was purified using the Escherichia coli Pt7 system, and its DNA-binding ability for the seven operator-like sequences, the GATAC-boxes (Gb1 to Gb7), was investigated in vitro. In gel-shift assays, Cng selectively bound to the DNA fragments containing the GATAC-box(es). In addition, DNase I footprinting analysis with supercoiled DNA demonstrated that Cng can specifically cover about a 25bp region centered around each of the GATAC-boxes, although two boxes, Gb4 and Gb6, were only partially protected. Moreover, protein crosslinking experiments using glutaraldehyde suggested that Cng most likely functions as a dimer. On the other hand, the binding ability of Cpg for the GATAC-boxes in supercoiled DNA was also examined under the same conditions as in Cng; unlike Cng, Cpg covered Gb4 and Gb6 completely sufficiently as well as the other five boxes. Thus, the present and previous [Kakikawa et al., Gene 215 (1998) 371-379; 242 (2000) 155-166] results indicate a possibility that the two proteins Cng and Cpg selectively bind to the GATAC-boxes that act as operators, and can decide between the lytic or lysogenic pathways through repression of the promoter activity of P(R) as well as P(L).
Actinomycin D binding mode reveals the basis for its potent HIV-1 and cancer activity
NASA Astrophysics Data System (ADS)
Paramanathan, Thayaparan; Vladescu, Ioana D.; McCauley, Micah J.; Rouzina, Ioulia; Williams, Mark C.
2011-03-01
Actinomycin D (ActD) is one of the most studied antibiotics, which has been used as an anti-cancer agent and also shown to inhibit HIV reverse transcription. Initial studies with ActD established that it intercalates double stranded DNA (dsDNA). However, recent studies have shown that ActD binds with even higher affinity to single stranded DNA (ssDNA). In our studies we use optical tweezers to stretch and hold single dsDNA molecule at constant force in the presence of varying ActD concentrations until the binding reaches equilibrium. The change in dsDNA length upon ActD binding measured as a function of time yields the rate of binding in addition to the equilibrium lengthening of DNA. The results suggest extremely slow kinetics, on the order of several minutes and 0.52 +/- 0.06 μ M binding affinity. Holding DNA at constant force while stretching and relaxing suggests that ActD binds to two single strands that are close to each other rather than to pure dsDNA or ssDNA. This suggests that biological activity of ActD that contributes towards the inhibition of cellular replication is due to its ability to bind at DNA bubbles during RNA transcription, thereby stalling the transcription process.
Shahabadi, Nahid; Pourfoulad, Mehdi; Moghadam, Neda Hosseinpour
2017-01-02
DNA-binding properties of an antiviral drug, valganciclovir (valcyte) was studied by using emission, absorption, circular dichroism, viscosity, differential pulse voltammetry, fluorescence techniques, and computational studies. The drug bound to calf thymus DNA (ct-DNA) in a groove-binding mode. The calculated binding constant of UV-vis, K a , is comparable to groove-binding drugs. Competitive fluorimetric studies with Hoechst 33258 showed that valcyte could displace the DNA-bound Hoechst 33258. The drug could not displace intercalated methylene blue from DNA double helix. Furthermore, the induced detectable changes in the CD spectrum of ct-DNA as well as changes in its viscosity confirm the groove-binding mode. In addition, an integrated molecular docking was employed to further investigate the binding interactions between valcyte and calf thymus DNA.
MOCCS: Clarifying DNA-binding motif ambiguity using ChIP-Seq data.
Ozaki, Haruka; Iwasaki, Wataru
2016-08-01
As a key mechanism of gene regulation, transcription factors (TFs) bind to DNA by recognizing specific short sequence patterns that are called DNA-binding motifs. A single TF can accept ambiguity within its DNA-binding motifs, which comprise both canonical (typical) and non-canonical motifs. Clarification of such DNA-binding motif ambiguity is crucial for revealing gene regulatory networks and evaluating mutations in cis-regulatory elements. Although chromatin immunoprecipitation sequencing (ChIP-seq) now provides abundant data on the genomic sequences to which a given TF binds, existing motif discovery methods are unable to directly answer whether a given TF can bind to a specific DNA-binding motif. Here, we report a method for clarifying the DNA-binding motif ambiguity, MOCCS. Given ChIP-Seq data of any TF, MOCCS comprehensively analyzes and describes every k-mer to which that TF binds. Analysis of simulated datasets revealed that MOCCS is applicable to various ChIP-Seq datasets, requiring only a few minutes per dataset. Application to the ENCODE ChIP-Seq datasets proved that MOCCS directly evaluates whether a given TF binds to each DNA-binding motif, even if known position weight matrix models do not provide sufficient information on DNA-binding motif ambiguity. Furthermore, users are not required to provide numerous parameters or background genomic sequence models that are typically unavailable. MOCCS is implemented in Perl and R and is freely available via https://github.com/yuifu/moccs. By complementing existing motif-discovery software, MOCCS will contribute to the basic understanding of how the genome controls diverse cellular processes via DNA-protein interactions. Copyright © 2016 Elsevier Ltd. All rights reserved.
Protein Cofactors Are Essential for High-Affinity DNA Binding by the Nuclear Factor κB RelA Subunit.
Mulero, Maria Carmen; Shahabi, Shandy; Ko, Myung Soo; Schiffer, Jamie M; Huang, De-Bin; Wang, Vivien Ya-Fan; Amaro, Rommie E; Huxford, Tom; Ghosh, Gourisankar
2018-05-22
Transcription activator proteins typically contain two functional domains: a DNA binding domain (DBD) that binds to DNA with sequence specificity and an activation domain (AD) whose established function is to recruit RNA polymerase. In this report, we show that purified recombinant nuclear factor κB (NF-κB) RelA dimers bind specific κB DNA sites with an affinity significantly lower than that of the same dimers from nuclear extracts of activated cells, suggesting that additional nuclear cofactors might facilitate DNA binding by the RelA dimers. Additionally, recombinant RelA binds DNA with relatively low affinity at a physiological salt concentration in vitro. The addition of p53 or RPS3 (ribosomal protein S3) increases RelA:DNA binding affinity 2- to >50-fold depending on the protein and ionic conditions. These cofactor proteins do not form stable ternary complexes, suggesting that they stabilize the RelA:DNA complex through dynamic interactions. Surprisingly, the RelA-DBD alone fails to bind DNA under the same solution conditions even in the presence of cofactors, suggesting an important role of the RelA-AD in DNA binding. Reduced RelA:DNA binding at a physiological ionic strength suggests that multiple cofactors might be acting simultaneously to mitigate the electrolyte effect and stabilize the RelA:DNA complex in vivo. Overall, our observations suggest that the RelA-AD and multiple cofactor proteins function cooperatively to prime the RelA-DBD and stabilize the RelA:DNA complex in cells. Our study provides a mechanism for nuclear cofactor proteins in NF-κB-dependent gene regulation.
Gel Electrophoresis of Gold-DNA Nano-Conjugates
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pellegrino, T.; Sperling, R.A.; Alivisatos, A.P.
2006-01-10
Single stranded DNA of different lengths and different amounts was attached to colloidal phosphine stabilized Au nanoparticles. The resulting conjugates were investigated in detail by a gel electrophoresis study based on 1200 gels. We demonstrate how these experiments help to understand the binding of DNA to Au particles. In particular we compare specific attachment of DNA via gold-thiol bonds with nonspecific adsorption of DNA. The maximum number of DNA molecules that can be bound per particle was determined. We also compare several methods to used gel electrophoresis for investigating the effective diameter of DNA-Au conjugates, such as using a calibrationmore » curve of particles with known diameters and Ferguson plots.« less
Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales
NASA Astrophysics Data System (ADS)
Qian, Long; Kussell, Edo
The composition of genomes with respect to short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. The underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, which we detect in all species across domains of life. We hypothesize that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Alternative contributions may come from interference of protein-DNA binding with replication and mutational repair processes, which operates with similar rates. We conclude that genome-wide word compositions have been molded by DNA binding proteins through tiny evolutionary steps over timescales spanning millions of generations.
NASA Astrophysics Data System (ADS)
Wang, Yan; Cui, Haixin; Sun, Changjiao; Du, Wei; Cui, Jinhui; Zhao, Xiang
2013-03-01
We evaluated the performance of green fluorescent magnetic Fe3O4 nanoparticles (NPs) as gene carrier and location in pig kidney cells. When the mass ratio of NPs to green fluorescent protein plasmid DNA reached 1:16 or above, DNA molecules can be combined completely with NPs, which indicates that the NPs have good ability to bind negative DNA. Atomic force microscopy (AFM) experiments were carried out to investigate the binding mechanism between NPs and DNA. AFM images show that individual DNA strands come off of larger pieces of netlike agglomerations and several spherical nanoparticles are attached to each individual DNA strand and interact with each other. The pig kidney cells were labelled with membrane-specific red fluorescent dye 1,1'-dioctadecyl-3,3,3',3'-tetramethylindocarbocyanine perchlorate and nucleus-specific blue fluorescent dye 4',6-diamidino-2-phenylindole dihydrochloride. We found that green fluorescent nanoparticles can past the cell membrane and spread throughout the interior of the cell. The NPs seem to locate more frequently in the cytoplasm than in the nucleus.
Mantaj, Julia; Jackson, Paul J. M.; Karu, Kersti; Rahman, Khondaker M.; Thurston, David E.
2016-01-01
Pyrrolobenzodiazepines (PBDs) are covalent-binding DNA-interactive agents with growing importance as payloads in Antibody Drug Conjugates (ADCs). Until now, PBDs were thought to covalently bond to C2-NH2 groups of guanines in the DNA-minor groove across a three-base-pair recognition sequence. Using HPLC/MS methodology with designed hairpin and duplex oligonucleotides, we have now demonstrated that the PBD Dimer SJG-136 and the C8-conjugated PBD Monomer GWL-78 can covalently bond to a terminal guanine of DNA, with the PBD skeleton spanning only two base pairs. Control experiments with the non-C8-conjugated anthramycin along with molecular dynamics simulations suggest that the C8-substituent of a PBD Monomer, or one-half of a PBD Dimer, may provide stability for the adduct. This observation highlights the importance of PBD C8-substituents, and also suggests that PBDs may bind to terminal guanines within stretches of DNA in cells, thus representing a potentially novel mechanism of action at the end of DNA strand breaks. PMID:27055050
Dixit, Ritu B; Patel, Tarosh S; Vanparia, Satish F; Kunjadiya, Anju P; Keharia, Harish R; Dixit, Bharat C
2011-01-01
Sulfonamide substituted 8-hydroxyquinoline derivatives were prepared using a microwave synthesizer. The interaction of sulfonamide substituted 8-hydroxyquinoline derivatives and their transition metal complexes with Plasmid (pUC 19) DNA and Calf Thymus DNA were investigated by UV spectroscopic studies and gel electrophoresis measurements. The interaction between ligand/metal complexes and DNA was carried out by increasing the concentration of DNA from 0 to 12 μl in UV spectroscopic study, while the concentration of DNA in gel electrophoresis remained constant at 10 μl. These studies supported the fact that, the complex binds to DNA by intercalation via ligand into the base pairs of DNA. The relative binding efficacy of the complexes to DNA was much higher than the binding efficacy of ligands, especially the complex of Cu-AHQMBSH had the highest binding ability to DNA. The mobility of the bands decreased as the concentration of the complex was increased, indicating that there was increase in the interaction between the metal ion and DNA. Complexes of AHQMBSH were excellent for DNA binding as compared to HQMABS.
Unique structural modulation of a non-native substrate by cochaperone DnaJ.
Tiwari, Satyam; Kumar, Vignesh; Jayaraj, Gopal Gunanathan; Maiti, Souvik; Mapa, Koyeli
2013-02-12
The role of bacterial DnaJ protein as a cochaperone of DnaK is strongly appreciated. Although DnaJ unaccompanied by DnaK can bind unfolded as well as native substrate proteins, its role as an individual chaperone remains elusive. In this study, we demonstrate that DnaJ binds a model non-native substrate with a low nanomolar dissociation constant and, more importantly, modulates the structure of its non-native state. The structural modulation achieved by DnaJ is different compared to that achieved by the DnaK-DnaJ complex. The nature of structural modulation exerted by DnaJ is suggestive of a unique unfolding activity on the non-native substrate by the chaperone. Furthermore, we demonstrate that the zinc binding motif along with the C-terminal substrate binding domain of DnaJ is necessary and sufficient for binding and the subsequent binding-induced structural alterations of the non-native substrate. We hypothesize that this hitherto unknown structural alteration of non-native states by DnaJ might be important for its chaperoning activity by removing kinetic traps of the folding intermediates.
Nakano, Shu-ichi; Uotani, Yuuki; Sato, Yuichi; Oka, Hirohito; Fujii, Masayuki; Sugimoto, Naoki
2013-01-01
DNA lesions produced by aromatic isocyanates have an extra bulky group on the nucleotide bases, with the capability of forming stacking interaction within a DNA helix. In this work, we investigated the conformation of the 2′-deoxyadenosine and 2′-deoxycytidine derivatives tethering a phenyl or naphthyl group, introduced in a DNA duplex. The chemical modification experiments using KMnO4 and 1-cyclohexyl-3 -(2-morpholinoethyl) carbodiimide metho-p-toluenesulfonate have shown that the 2′-deoxycytidine lesions form the base pair with guanine while the 2′-deoxyadenosine lesions have less ability of forming the base pair with thymine in solution. Nevertheless, the kinetic analysis shows that these DNA lesions are compatible with DNA ligase and DNA polymerase reactions, as much as natural DNA bases. We suggest that the adduct lesions have a capability of adopting dual conformations, depending on the difference in their interaction energies between stacking of the attached aromatic group and base pairing through hydrogen bonds. It is also presented that the attached aromatic groups change their orientation by interacting with the minor groove binding netropsin, distamycin and synthetic polyamide. The nucleotide derivatives would be useful for enhancing the phenotypic diversity of DNA molecules and for exploring new non-natural nucleotides. PMID:23873956
Structural and Histone Binding Ability Characterizations of Human PWWP Domains
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu, Hong; Zeng, Hong; Lam, Robert
2013-09-25
The PWWP domain was first identified as a structural motif of 100-130 amino acids in the WHSC1 protein and predicted to be a protein-protein interaction domain. It belongs to the Tudor domain 'Royal Family', which consists of Tudor, chromodomain, MBT and PWWP domains. While Tudor, chromodomain and MBT domains have long been known to bind methylated histones, PWWP was shown to exhibit histone binding ability only until recently. The PWWP domain has been shown to be a DNA binding domain, but sequence analysis and previous structural studies show that the PWWP domain exhibits significant similarity to other 'Royal Family' members,more » implying that the PWWP domain has the potential to bind histones. In order to further explore the function of the PWWP domain, we used the protein family approach to determine the crystal structures of the PWWP domains from seven different human proteins. Our fluorescence polarization binding studies show that PWWP domains have weak histone binding ability, which is also confirmed by our NMR titration experiments. Furthermore, we determined the crystal structures of the BRPF1 PWWP domain in complex with H3K36me3, and HDGF2 PWWP domain in complex with H3K79me3 and H4K20me3. PWWP proteins constitute a new family of methyl lysine histone binders. The PWWP domain consists of three motifs: a canonical {beta}-barrel core, an insertion motif between the second and third {beta}-strands and a C-terminal {alpha}-helix bundle. Both the canonical {beta}-barrel core and the insertion motif are directly involved in histone binding. The PWWP domain has been previously shown to be a DNA binding domain. Therefore, the PWWP domain exhibits dual functions: binding both DNA and methyllysine histones.« less
Aggarwal, Pooja; Das Gupta, Mainak; Joseph, Agnel Praveen; Chatterjee, Nirmalya; Srinivasan, N.; Nath, Utpal
2010-01-01
The TCP transcription factors control multiple developmental traits in diverse plant species. Members of this family share an ∼60-residue-long TCP domain that binds to DNA. The TCP domain is predicted to form a basic helix-loop-helix (bHLH) structure but shares little sequence similarity with canonical bHLH domain. This classifies the TCP domain as a novel class of DNA binding domain specific to the plant kingdom. Little is known about how the TCP domain interacts with its target DNA. We report biochemical characterization and DNA binding properties of a TCP member in Arabidopsis thaliana, TCP4. We have shown that the 58-residue domain of TCP4 is essential and sufficient for binding to DNA and possesses DNA binding parameters comparable to canonical bHLH proteins. Using a yeast-based random mutagenesis screen and site-directed mutants, we identified the residues important for DNA binding and dimer formation. Mutants defective in binding and dimerization failed to rescue the phenotype of an Arabidopsis line lacking the endogenous TCP4 activity. By combining structure prediction, functional characterization of the mutants, and molecular modeling, we suggest a possible DNA binding mechanism for this class of transcription factors. PMID:20363772
Khund-Sayeed, Syed; He, Ximiao; Holzberg, Timothy; Wang, Jun; Rajagopal, Divya; Upadhyay, Shriyash; Durell, Stewart R; Mukherjee, Sanjit; Weirauch, Matthew T; Rose, Robert; Vinson, Charles
2016-09-12
We evaluated DNA binding of the B-HLH family members TCF4 and USF1 using protein binding microarrays (PBMs) containing double-stranded DNA probes with cytosine on both strands or 5-methylcytosine (5mC) or 5-hydroxymethylcytosine (5hmC) on one DNA strand and cytosine on the second strand. TCF4 preferentially bound the E-box motif (CAN|NTG) with strongest binding to the 8-mer CAG|GTGGT. 5mC uniformly decreases DNA binding of both TCF4 and USF1. The bulkier 5hmC also inhibited USF1 binding to DNA. In contrast, 5hmC dramatically enhanced TCF4 binding to E-box motifs ACAT|GTG and ACAC|GTG, being better bound than any 8-mer containing cytosine. Examination of X-ray structures of the closely related TCF3 and USF1 bound to DNA suggests TCF3 can undergo a conformational shift to preferentially bind to 5hmC while the USF1 basic region is bulkier and rigid precluding a conformation shift to bind 5hmC. These results greatly expand the regulatory DNA sequence landscape bound by TCF4.
[Features of binding of proflavine to DNA at different DNA-ligand concentration ratios].
Berezniak, E G; gladkovskaia, N A; Khrebtova, A S; Dukhopel'nikov, E V; Zinchenko, A V
2009-01-01
The binding of proflavine to calf thymus DNA has been studied using the methods of differential scanning calorimetry and spectrophotometry. It was shown that proflavine can interact with DNA by at least 3 binding modes. At high DNA-ligand concentration ratios (P/D), proflavine intercalates into both GC- and AT-sites, with a preference to GC-rich sequences. At low P/D ratios proflavine interacts with DNA by the external binding mode. From spectrophotometric concentration dependences, the parameters of complexing of proflavine with DNA were calculated. Thermodynamic parameters of DNA melting were calculated from differential scanning calorimetry data.
1993-04-29
corresponding to ACIa-PADPRP truncated by 44 amino acids, was identified below the 113 kud cndogenous murine PADPRP in clones 42 and 49 but not in the...strand breaks. A third avenue, originally suggested to be addressed in Aim I of the application (1992) involved the swapping of the DNA binding zinc...subsequent to DNA damage or perhaps during DNA replication and such experiments will be underway during the second and third of the granting period. C
Alchemical Free Energy Calculations for Nucleotide Mutations in Protein-DNA Complexes.
Gapsys, Vytautas; de Groot, Bert L
2017-12-12
Nucleotide-sequence-dependent interactions between proteins and DNA are responsible for a wide range of gene regulatory functions. Accurate and generalizable methods to evaluate the strength of protein-DNA binding have long been sought. While numerous computational approaches have been developed, most of them require fitting parameters to experimental data to a certain degree, e.g., machine learning algorithms or knowledge-based statistical potentials. Molecular-dynamics-based free energy calculations offer a robust, system-independent, first-principles-based method to calculate free energy differences upon nucleotide mutation. We present an automated procedure to set up alchemical MD-based calculations to evaluate free energy changes occurring as the result of a nucleotide mutation in DNA. We used these methods to perform a large-scale mutation scan comprising 397 nucleotide mutation cases in 16 protein-DNA complexes. The obtained prediction accuracy reaches 5.6 kJ/mol average unsigned deviation from experiment with a correlation coefficient of 0.57 with respect to the experimentally measured free energies. Overall, the first-principles-based approach performed on par with the molecular modeling approaches Rosetta and FoldX. Subsequently, we utilized the MD-based free energy calculations to construct protein-DNA binding profiles for the zinc finger protein Zif268. The calculation results compare remarkably well with the experimentally determined binding profiles. The software automating the structure and topology setup for alchemical calculations is a part of the pmx package; the utilities have also been made available online at http://pmx.mpibpc.mpg.de/dna_webserver.html .
DOE Office of Scientific and Technical Information (OSTI.GOV)
Verbakel, Werner, E-mail: werner.verbakel@chem.kuleuven.be; Carmeliet, Geert, E-mail: geert.carmeliet@med.kuleuven.be; Engelborghs, Yves, E-mail: yves.engelborghs@fys.kuleuven.be
2011-08-12
Highlights: {yields} The SAP-like domain in NuSAP is a functional DNA-binding domain with preference for dsDNA. {yields} This SAP-like domain is essential for chromosome loading during early mitosis. {yields} NuSAP is highly dynamic on mitotic chromatin, as evident from photobleaching experiments. {yields} The SAP-like domain also mediates NuSAP-chromatin interaction in interphase nucleoplasm. -- Abstract: Nucleolar spindle associated protein (NuSAP) is a microtubule-stabilizing protein that localizes to chromosome arms and chromosome-proximal microtubules during mitosis and to the nucleus, with enrichment in the nucleoli, during interphase. The critical function of NuSAP is underscored by the finding that its depletion in HeLa cellsmore » results in various mitotic defects. Moreover, NuSAP is found overexpressed in multiple cancers and its expression levels often correlate with the aggressiveness of cancer. Due to its localization on chromosome arms and combination of microtubule-stabilizing and DNA-binding properties, NuSAP takes a special place within the extensive group of spindle assembly factors. In this study, we identify a SAP-like domain that shows DNA binding in vitro with a preference for dsDNA. Deletion of the SAP-like domain abolishes chromosome arm binding of NuSAP during mitosis, but is not sufficient to abrogate its chromosome-proximal localization after anaphase onset. Fluorescence recovery after photobleaching experiments revealed the highly dynamic nature of this NuSAP-chromatin interaction during mitosis. In interphase cells, NuSAP also interacts with chromatin through its SAP-like domain, as evident from its enrichment on dense chromatin regions and intranuclear mobility, measured by fluorescence correlation spectroscopy. The obtained results are in agreement with a model where NuSAP dynamically stabilizes newly formed microtubules on mitotic chromosomes to enhance chromosome positioning without immobilizing these microtubules. Interphase NuSAP-chromatin interaction suggests additional functions for NuSAP, as recently identified for other nuclear spindle assembly factors with a role in gene expression or DNA damage response.« less
Dpb11 may function with RPA and DNA to initiate DNA replication.
Bruck, Irina; Dhingra, Nalini; Martinez, Matthew P; Kaplan, Daniel L
2017-01-01
Dpb11 is required for the initiation of DNA replication in budding yeast. We found that Dpb11 binds tightly to single-stranded DNA (ssDNA) or branched DNA structures, while its human homolog, TopBP1, binds tightly to branched-DNA structures. We also found that Dpb11 binds stably to CDK-phosphorylated RPA, the eukaryotic ssDNA binding protein, in the presence of branched DNA. A Dpb11 mutant specifically defective for DNA binding did not exhibit tight binding to RPA in the presence of DNA, suggesting that Dpb11-interaction with DNA may promote the recruitment of RPA to melted DNA. We then characterized a mutant of Dpb11 that is specifically defective in DNA binding in budding yeast cells. Expression of dpb11-m1,2,3,5,ΔC results in a substantial decrease in RPA recruitment to origins, suggesting that Dpb11 interaction with DNA may be required for RPA recruitment to origins. Expression of dpb11-m1,2,3,5,ΔC also results in diminished GINS interaction with Mcm2-7 during S phase, while Cdc45 interaction with Mcm2-7 is like wild-type. The reduced GINS interaction with Mcm2-7 may be an indirect consequence of diminished origin melting. We propose that the tight interaction between Dpb11, CDK-phosphorylated RPA, and branched-DNA may be required for the essential function of stabilizing melted origin DNA in vivo. We also propose an alternative model, wherein Dpb11-DNA interaction is required for some other function in DNA replication initiation, such as helicase activation.
SivaRaman, L; Subramanian, S; Thimmappaya, B
1986-01-01
Utilizing the gel electrophoresis/DNA binding assay, a factor specific for the upstream transcriptional control sequence of the EIA-inducible adenovirus EIIA-early promoter has been detected in HeLa cell nuclear extract. Analysis of linker-scanning mutants of the promoter by DNA binding assays and methylation-interference experiments show that the factor binds to the 17-nucleotide sequence 5' TGGAGATGACGTAGTTT 3' located between positions -66 and -82 upstream from the cap site. This sequence has been shown to be essential for transcription of this promoter. The EIIA-early-promoter specific factor was found to be present at comparable levels in uninfected HeLa cells and in cells infected with either wild-type adenovirus or the EIA-deletion mutant dl312 under conditions in which the EIA proteins are induced to high levels [7 or 20 hr after infection in the presence of arabinonucleoside (cytosine arabinoside)]. Based on the quantitation in DNA binding assays, it appears that the mechanism of EIA-activated transcription of the EIIA-early promoter does not involve a net change in the amounts of this factor. Images PMID:2942943
DNA-Directed Assembly of Capture Tools for Constitutional Studies of Large Protein Complexes.
Meyer, Rebecca; Faesen, Alex; Vogel, Katrin; Jeganathan, Sadasivam; Musacchio, Andrea; Niemeyer, Christof M
2015-06-10
Large supramolecular protein complexes, such as the molecular machinery involved in gene regulation, cell signaling, or cell division, are key in all fundamental processes of life. Detailed elucidation of structure and dynamics of such complexes can be achieved by reverse-engineering parts of the complexes in order to probe their interactions with distinctive binding partners in vitro. The exploitation of DNA nanostructures to mimic partially assembled supramolecular protein complexes in which the presence and state of two or more proteins are decisive for binding of additional building blocks is reported here. To this end, four-way DNA Holliday junction motifs bearing a fluorescein and a biotin tag, for tracking and affinity capture, respectively, are site-specifically functionalized with centromeric protein (CENP) C and CENP-T. The latter serves as baits for binding of the so-called KMN component, thereby mimicking early stages of the assembly of kinetochores, structures that mediate and control the attachment of microtubules to chromosomes in the spindle apparatus. Results from pull-down experiments are consistent with the hypothesis that CENP-C and CENP-T may bind cooperatively to the KMN network. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Concerted formation of macromolecular Suppressor–mutator transposition complexes
Raina, Ramesh; Schläppi, Michael; Karunanandaa, Balasulojini; Elhofy, Adam; Fedoroff, Nina
1998-01-01
Transposition of the maize Suppressor–mutator (Spm) transposon requires two element-encoded proteins, TnpA and TnpD. Although there are multiple TnpA binding sites near each element end, binding of TnpA to DNA is not cooperative, and the binding affinity is not markedly affected by the number of binding sites per DNA fragment. However, intermolecular complexes form cooperatively between DNA fragments with three or more TnpA binding sites. TnpD, itself not a sequence-specific DNA-binding protein, binds to TnpA and stabilizes the TnpA–DNA complex. The high redundancy of TnpA binding sites at both element ends and the protein–protein interactions between DNA-bound TnpA complexes and between these and TnpD imply a concerted transition of the element from a linear to a protein crosslinked transposition complex within a very narrow protein concentration range. PMID:9671711
DNA Binding of Centromere Protein C (CENPC) Is Stabilized by Single-Stranded RNA
Du, Yaqing; Topp, Christopher N.; Dawe, R. Kelly
2010-01-01
Centromeres are the attachment points between the genome and the cytoskeleton: centromeres bind to kinetochores, which in turn bind to spindles and move chromosomes. Paradoxically, the DNA sequence of centromeres has little or no role in perpetuating kinetochores. As such they are striking examples of genetic information being transmitted in a manner that is independent of DNA sequence (epigenetically). It has been found that RNA transcribed from centromeres remains bound within the kinetochore region, and this local population of RNA is thought to be part of the epigenetic marking system. Here we carried out a genetic and biochemical study of maize CENPC, a key inner kinetochore protein. We show that DNA binding is conferred by a localized region 122 amino acids long, and that the DNA-binding reaction is exquisitely sensitive to single-stranded RNA. Long, single-stranded nucleic acids strongly promote the binding of CENPC to DNA, and the types of RNAs that stabilize DNA binding match in size and character the RNAs present on kinetochores in vivo. Removal or replacement of the binding module with HIV integrase binding domain causes a partial delocalization of CENPC in vivo. The data suggest that centromeric RNA helps to recruit CENPC to the inner kinetochore by altering its DNA binding characteristics. PMID:20140237
A Key Evolutionary Mutation Enhances DNA Binding of the FOXP2 Forkhead Domain.
Morris, Gavin; Fanucchi, Sylvia
2016-04-05
Forkhead box (FOX) transcription factors share a conserved forkhead DNA binding domain (FHD) and are key role players in the development of many eukaryotic species. Their involvement in various congenital disorders and cancers makes them clinically relevant targets for novel therapeutic strategies. Among them, the FOXP subfamily of multidomain transcriptional repressors is unique in its ability to form DNA binding homo and heterodimers. The truncated FOXP2 FHD, in the absence of the leucine zipper, exists in equilibrium between monomeric and domain-swapped dimeric states in vitro. As a consequence, determining the DNA binding properties of the FOXP2 FHD becomes inherently difficult. In this work, two FOXP2 FHD hinge loop mutants have been generated to successfully prevent both the formation (A539P) and the dissociation (F541C) of the homodimers. This allows for the separation of the two species for downstream DNA binding studies. Comparison of DNA binding of the different species using electrophoretic mobility shift assay, fluorescence anisotropy and isothermal titration calorimetry indicates that the wild-type FOXP2 FHD binds DNA as a monomer. However, comparison of the DNA-binding energetics of the monomer and wild-type FHD, reveals that there is a difference in the mechanism of binding between the two species. We conclude that the naturally occurring reverse mutation (P539A) seen in the FOXP subfamily increases DNA binding affinity and may increase the potential for nonspecific binding compared to other FOX family members.
Ma, Liang; Wang, Jiaman; Zhang, Yuhao
2017-01-01
The binding characterization of aflatoxins with calf thymus DNA (ctDNA) under physiological conditions was investigated. Multispectroscopic techniques, ctDNA melting, viscosity measurements, and molecular docking techniques were employed to elucidate the binding mechanism of the aflatoxins with DNA. The fluorescence results indicated that both aflatoxin B1 (AFB1) and aflatoxin G1 (AFG1) bound to the ctDNA, forming complexes through hydrogen bonding. The binding constants of AFB1 and AFG1 with ctDNA reached up to 103 L·mol−1 and 104 L·mol−1, respectively, and AFG1 exhibited a higher binding propensity than that of AFB1. Furthermore, both AFB1 and AFG1 bound to the ctDNA through groove binding, as evidenced by the results of the spectroscopic, iodide quenching effect, viscosity, and ctDNA melting measurements. Changes in the circular dichroism signal manifested that both AFB1 and AFG1 induced an increase in the right-handed helicity, but only minimally influenced the base stacking of the DNA. A molecular docking study of the aflatoxin’s binding with the DNA revealed a groove binding mode, which was driven mainly by hydrogen bonding. This study of aflatoxin–ctDNA interaction may provide novel insights into the toxicological effect of the mycotoxins. PMID:28671585
Cooley, Anne E; Riley, Sean P; Kral, Keith; Miller, M Clarke; DeMoll, Edward; Fried, Michael G; Stevenson, Brian
2009-07-13
Genes orthologous to the ybaB loci of Escherichia coli and Haemophilus influenzae are widely distributed among eubacteria. Several years ago, the three-dimensional structures of the YbaB orthologs of both E. coli and H. influenzae were determined, revealing a novel "tweezer"-like structure. However, a function for YbaB had remained elusive, with an early study of the H. influenzae ortholog failing to detect DNA-binding activity. Our group recently determined that the Borrelia burgdorferi YbaB ortholog, EbfC, is a DNA-binding protein. To reconcile those results, we assessed the abilities of both the H. influenzae and E. coli YbaB proteins to bind DNA to which B. burgdorferi EbfC can bind. Both the H. influenzae and the E. coli YbaB proteins bound to tested DNAs. DNA-binding was not well competed with poly-dI-dC, indicating some sequence preferences for those two proteins. Analyses of binding characteristics determined that both YbaB orthologs bind as homodimers. Different DNA sequence preferences were observed between H. influenzae YbaB, E. coli YbaB and B. burgdorferi EbfC, consistent with amino acid differences in the putative DNA-binding domains of these proteins. Three distinct members of the YbaB/EbfC bacterial protein family have now been demonstrated to bind DNA. Members of this protein family are encoded by a broad range of bacteria, including many pathogenic species, and results of our studies suggest that all such proteins have DNA-binding activities. The functions of YbaB/EbfC family members in each bacterial species are as-yet unknown, but given the ubiquity of these DNA-binding proteins among Eubacteria, further investigations are warranted.
Wang, Shuo; Nanjunda, Rupesh; Aston, Karl; Bashkin, James K.; Wilson, W. David
2012-01-01
In order to better understand the effects of β-alanine (β) substitution and the number of heterocycles on DNA binding affinity and selectivity, the interactions of an eight-ring hairpin polyamide (PA) and two β derivatives as well as a six-heterocycle analog have been investigated with their cognate DNA sequence, 5′-TGGCTT-3′. Binding selectivity and the effects of β have been investigated with the cognate and five mutant DNAs. A set of powerful and complementary methods have been employed for both energetic and structural evaluations: UV-melting, biosensor-surface plasmon resonance, isothermal titration calorimetry, circular dichroism and a DNA ligation ladder global structure assay. The reduced number of heterocycles in the six-ring PA weakens the binding affinity; however, the smaller PA aggregates significantly less than the larger PAs, and allows us to obtain the binding thermodynamics. The PA-DNA binding enthalpy is large and negative with a large negative ΔCp, and is the primary driving component of the Gibbs free energy. The complete SPR binding results clearly show that β substitutions can substantially weaken the binding affinity of hairpin PAs in a position-dependent manner. More importantly, the changes in PA binding to the mutant DNAs further confirm the position-dependent effects on PA-DNA interaction affinity. Comparison of mutant DNA sequences also shows a different effect in recognition of T•A versus A•T base pairs. The effects of DNA mutations on binding of a single PA as well as the effects of the position of β substitution on binding tell a clear and very important story about sequence dependent binding of PAs to DNA. PMID:23167504
Munde, Manoj; Poon, Gregory M. K.; Wilson, W. David
2013-01-01
Members of the ETS family of transcription factors regulate a functionally diverse array of genes. All ETS proteins share a structurally-conserved but sequence-divergent DNA-binding domain, known as the ETS domain. Although the structure and thermodynamics of the ETS-DNA complexes are well known, little is known about the kinetics of sequence recognition, a facet that offers potential insight into its molecular mechanism. We have characterized DNA binding by the ETS domain of PU.1 by biosensor-surface plasmon resonance (SPR). SPR analysis revealed a striking kinetic profile for DNA binding by the PU.1 ETS domain. At low salt concentrations, it binds high-affinity cognate DNA with a very slow association rate constant (≤105 M−1 s−1), compensated by a correspondingly small dissociation rate constant. The kinetics are strongly salt-dependent but mutually balance to produce a relatively weak dependence in the equilibrium constant. This profile contrasts sharply with reported data for other ETS domains (e.g., Ets-1, TEL) for which high-affinity binding is driven by rapid association (>107 M−1 s−1). We interpret this difference in terms of the hydration properties of ETS-DNA binding and propose that at least two mechanisms of sequence recognition are employed by this family of DNA-binding domain. Additionally, we use SPR to demonstrate the potential for pharmacological inhibition of sequence-specific ETS-DNA binding, using the minor groove-binding distamycin as a model compound. Our work establishes SPR as a valuable technique for extending our understanding of the molecular mechanisms of ETS-DNA interactions as well as developing potential small-molecule agents for biotechnological and therapeutic purposes. PMID:23416556
Elder, Robert M; Jayaraman, Arthi
2013-10-10
Gene therapy relies on the delivery of DNA into cells, and polycations are one class of vectors enabling efficient DNA delivery. Nuclear localization sequences (NLS), cationic oligopeptides that target molecules for nuclear entry, can be incorporated into polycations to improve their gene delivery efficiency. We use simulations to study the effect of peptide chemistry and sequence on the DNA-binding behavior of NLS-grafted polycations by systematically mutating the residues in the grafts, which are based on the SV40 NLS (peptide sequence PKKKRKV). Replacing arginine (R) with lysine (K) reduces binding strength by eliminating arginine-DNA interactions, but placing R in a less hindered location (e.g., farther from the grafting point to the polycation backbone) has surprisingly little effect on polycation-DNA binding strength. Changing the positions of the hydrophobic proline (P) and valine (V) residues relative to the polycation backbone changes hydrophobic aggregation within the polycation and, consequently, changes the conformational entropy loss that occurs upon polycation-DNA binding. Since conformational entropy loss affects the free energy of binding, the positions of P and V in the grafts affect DNA binding affinity. The insight from this work guides synthesis of polycations with tailored DNA binding affinity and, in turn, efficient DNA delivery.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Frankfurt, O.S.
A new method for the measurement of DNA damage in individual cells treated with alkylating agents is described. The method is based on the binding of anti-DNA monoclonal antibody to DNA in situ. Binding of antibody was evaluated by flow cytometry with indirect immunofluorescence. No binding of antibody to DNA in non-treated HeLa S3 cells was detected. Treatment of cells with HN2 or L-phenylalanine mustard induced binding of antibody to DNA in situ. Binding of antibody was observed after treating cells with doses of drugs which reduced the surviving fraction below 20%. Intensity of binding increased in proportion to themore » drug dose. In HN2-treated cells a cell subset with the lowest antibody binding was observed among cells in G1 phase. Binding of antibody to DNA in HN2-treated cells was eliminated by single-strand (ss) specific S1 nuclease. In competition assay, antibody was inhibited by thermally denatured DNA, but not by native double-stranded (ds) DNA, RNA, nucleosides and deoxyribohomopolymers. Immunoreactivity of cells with the monoclonal antibody F7-26 may be a useful probe for the assessment of cell damage induced by alkylating agents, especially in heterogeneous cell populations.« less
Mechanism of opening a sliding clamp
Douma, Lauren G.; Yu, Kevin K.; England, Jennifer K.
2017-01-01
Abstract Clamp loaders load ring-shaped sliding clamps onto DNA where the clamps serve as processivity factors for DNA polymerases. In the first stage of clamp loading, clamp loaders bind and stabilize clamps in an open conformation, and in the second stage, clamp loaders place the open clamps around DNA so that the clamps encircle DNA. Here, the mechanism of the initial clamp opening stage is investigated. Mutations were introduced into the Escherichia coli β-sliding clamp that destabilize the dimer interface to determine whether the formation of an open clamp loader–clamp complex is dependent on spontaneous clamp opening events. In other work, we showed that mutation of a positively charged Arg residue at the β-dimer interface and high NaCl concentrations destabilize the clamp, but neither facilitates the formation of an open clamp loader–clamp complex in experiments presented here. Clamp opening reactions could be fit to a minimal three-step ‘bind-open-lock’ model in which the clamp loader binds a closed clamp, the clamp opens, and subsequent conformational rearrangements ‘lock’ the clamp loader–clamp complex in a stable open conformation. Our results support a model in which the E. coli clamp loader actively opens the β-sliding clamp. PMID:28973453
Qian, Yufeng; Johnson, Kenneth A.
2017-01-01
The human mitochondrial ssDNA-binding protein (mtSSB) is a homotetrameric protein, involved in mtDNA replication and maintenance. Although mtSSB is structurally similar to SSB from Escherichia coli (EcoSSB), it lacks the C-terminal disordered domain, and little is known about the biophysics of mtSSB–ssDNA interactions. Here, we characterized the kinetics and thermodynamics of mtSSB binding to ssDNA by equilibrium titrations and stopped-flow kinetic measurements. We show that the mtSSB tetramer can bind to ssDNA in two distinct binding modes: (SSB)30 and (SSB)60, defined by DNA binding site sizes of 30 and 60 nucleotides, respectively. We found that the binding mode is modulated by magnesium ion and NaCl concentration, but unlike EcoSSB, the mtSSB does not show negative intersubunit cooperativity. Global fitting of both the equilibrium and kinetic data afforded estimates for the rate and equilibrium constants governing the formation of (SSB)60 and (SSB)30 complexes and for the transitions between the two binding modes. We found that the mtSSB tetramer binds to ssDNA with a rate constant near the diffusion limit (2 × 109 m−1 s−1) and that longer DNA (≥60 nucleotides) rapidly wraps around all four monomers, as revealed by FRET assays. We also show that the mtSSB tetramer can directly transfer from one ssDNA molecule to another via an intermediate with two DNA molecules bound to the mtSSB. In conclusion, our results indicate that human mtSSB shares many physicochemical properties with EcoSSB and that the differences may be explained by the lack of an acidic, disordered C-terminal tail in human mtSSB protein. PMID:28615444
Ando, Tadashi; Skolnick, Jeffrey
2014-12-01
DNA binding proteins efficiently search for their cognitive sites on long genomic DNA by combining 3D diffusion and 1D diffusion (sliding) along the DNA. Recent experimental results and theoretical analyses revealed that the proteins show a rotation-coupled sliding along DNA helical pitch. Here, we performed Brownian dynamics simulations using newly developed coarse-grained protein and DNA models for evaluating how hydrodynamic interactions between the protein and DNA molecules, binding affinity of the protein to DNA, and DNA fluctuations affect the one dimensional diffusion of the protein on the DNA. Our results indicate that intermolecular hydrodynamic interactions reduce 1D diffusivity by 30%. On the other hand, structural fluctuations of DNA give rise to steric collisions between the CG-proteins and DNA, resulting in faster 1D sliding of the protein. Proteins with low binding affinities consistent with experimental estimates of non-specific DNA binding show hopping along the CG-DNA. This hopping significantly increases sliding speed. These simulation studies provide additional insights into the mechanism of how DNA binding proteins find their target sites on the genome.
Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales
NASA Astrophysics Data System (ADS)
Qian, Long; Kussell, Edo
2016-10-01
The composition of a genome with respect to all possible short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional DNA binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. We demonstrate that the underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, a signal that we detect in all species across domains of life. We consider the possibility that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Likewise, we show that evolutionary mechanisms based on interference of protein-DNA binding with replication and mutational repair processes could yield similar results and operate with similar rates. On the basis of these modeling and bioinformatic results, we conclude that genome-wide word compositions have been molded by DNA binding proteins acting through tiny evolutionary steps over time scales spanning millions of generations.
DNA-binding mechanism of the Escherichia coli Ada O6-alkylguanine–DNA alkyltransferase
Verdemato, Philip E.; Brannigan, James A.; Damblon, Christian; Zuccotto, Fabio; Moody, Peter C. E.; Lian, Lu-Yun
2000-01-01
The C-terminal domain of the Escherichia coli Ada protein (Ada-C) aids in the maintenance of genomic integrity by efficiently repairing pre-mutagenic O6-alkylguanine lesions in DNA. Structural and thermodynamic studies were carried out to obtain a model of the DNA-binding process. Nuclear magnetic resonance (NMR) studies map the DNA-binding site to helix 5, and a loop region (residues 151–160) which form the recognition helix and the ‘wing’ of a helix–turn–wing motif, respectively. The NMR data also suggest the absence of a large conformational change in the protein upon binding to DNA. Hence, an O6-methylguanine (O6meG) lesion would be inaccessible to active site nucleophile Cys146 if the modified base remained stacked within the DNA duplex. The experimentally determined DNA-binding face of Ada-C was used in combination with homology modelling, based on the catabolite activator protein, and the accepted base-flipping mechanism, to construct a model of how Ada-C binds to DNA in a productive manner. To complement the structural studies, thermodynamic data were obtained which demonstrate that binding to unmethylated DNA was entropically driven, whilst the demethylation reaction provoked an exothermic heat change. Methylation of Cys146 leads to a loss of structural integrity of the DNA-binding subdomain. PMID:11000262
Change of the binding mode of the DNA/proflavine system induced by ethanol.
García, Begoña; Leal, José M; Ruiz, Rebeca; Biver, Tarita; Secco, Fernando; Venturini, M
2010-07-01
The equilibria and kinetics of the binding of proflavine to poly(dG-dC).poly(dG-dC) and poly(dA-dT).poly(dA-dT) were investigated in ethanol/water mixtures using spectrophotometric, circular dichroism, viscometric, and T-jump methods. All methods concur in showing that two modes of interaction are operative: intercalation and surface binding. The latter mode is favored by increasing ethanol and/or the proflavine content. Both static and kinetic experiments show that, concerning the poly(dG-dC).poly(dG-dC)/proflavine system, intercalation largely prevails up to 20% EtOH. For higher EtOH levels surface binding becomes dominant. Concerning the poly(dA-dT).poly(dA-dT)/proflavine system, melting experiments show that addition of proflavine stabilizes the double stranded structure, but the effect is reduced in the presence of EtOH. The DeltaH degrees and DeltaS degrees values of the melting process, measured at different concentrations of added proflavine, are linearly correlated, revealing the presence of the enthalpy-entropy compensation phenomenon (EEC). The nonmonotonicity of the "entropic term" of the EEC reveals the transition between the two binding modes. T-jump experiments show two relaxation effects, but at the highest levels of EtOH (>25%) the kinetic curves become monophasic, confirming the prevalence of the surface complex. A branched mechanism is proposed where diffusion controlled formation of a precursor complex occurs in the early stage of the binding process. This evolves toward the surface and/or the intercalated complex according to two rate-determining parallel steps. CD spectra suggest that, in the surface complex, proflavine is bound to DNA in the form of an aggregate.
Wang, Wei; Liu, Juan; Sun, Lin
2016-07-01
Protein-DNA bindings are critical to many biological processes. However, the structural mechanisms underlying these interactions are not fully understood. Here, we analyzed the residues shape (peak, flat, or valley) and the surrounding environment of double-stranded DNA-binding proteins (DSBs) and single-stranded DNA-binding proteins (SSBs) in protein-DNA interfaces. In the results, we found that the interface shapes, hydrogen bonds, and the surrounding environment present significant differences between the two kinds of proteins. Built on the investigation results, we constructed a random forest (RF) classifier to distinguish DSBs and SSBs with satisfying performance. In conclusion, we present a novel methodology to characterize protein interfaces, which will deepen our understanding of the specificity of proteins binding to ssDNA (single-stranded DNA) or dsDNA (double-stranded DNA). Proteins 2016; 84:979-989. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Wang, Ying; Schellenberg, Helene; Walhorn, Volker; Toensing, Katja; Anselmetti, Dario
2017-09-01
Fluorescent dyes are broadly used in many biotechnological applications to detect and visualize DNA molecules. However, their binding to DNA alters the structural and nanomechanical properties of DNA and, thus, interferes with associated biological processes. In this work we employed magnetic tweezers and fluorescence spectroscopy to investigate the binding of PicoGreen to DNA at room temperature in a concentration-dependent manner. PicoGreen is an ultrasensitive quinolinium nucleic acid stain exhibiting hardly any background signal from unbound dye molecules. By means of stretching and overwinding single, torsionally constrained, nick-free double-stranded DNA molecules, we acquired force-extension and supercoiling curves which allow quantifying DNA contour length, persistence length and other thermodynamical binding parameters, respectively. The results of our magnetic tweezers single-molecule binding study were well supported through analyzing the fluorescent spectra of stained DNA. On the basis of our work, we could identify a concentration-dependent bimodal binding behavior, where, apparently, PicoGreen associates to DNA as an intercalator and minor-groove binder simultaneously.
Koh, Junseock; Shkel, Irina; Saecker, Ruth M.; Record, M. Thomas
2011-01-01
Previous ITC and FRET studies demonstrated that Escherichia coli HUαβ binds nonspecifically to duplex DNA in three different binding modes: a tighter-binding 34 bp mode which interacts with DNA in large (>34 bp) gaps between bound proteins, reversibly bending it 140° and thereby increasing its flexibility, and two weaker, modestly cooperative small-site-size modes (10 bp, 6 bp) useful for filling gaps between bound proteins shorter than 34 bp. Here we use ITC to determine the thermodynamics of these binding modes as a function of salt concentration, and deduce that DNA in the 34 bp mode is bent around but not wrapped on the body of HU, in contrast to specific binding of IHF. Analyses of binding isotherms (8, 15, 34 bp DNA) and initial binding heats (34, 38, 160 bp DNA) reveal that all three modes have similar log-log salt concentration derivatives of the binding constants (Ski) even though their binding site sizes differ greatly; most probable values of Ski on 34 bp or larger DNA are − 7.5 ± 0.5. From the similarity of Ski values, we conclude that binding interfaces of all three modes involve the same region of the arms and saddle of HU. All modes are entropy-driven, as expected for nonspecific binding driven by the polyelectrolyte effect. The bent-DNA 34 bp mode is most endothermic, presumably because of the cost of HU-induced DNA bending, while the 6 bp mode is modestly exothermic at all salt concentrations examined. Structural models consistent with the observed Ski values are proposed. PMID:21513716
Yang, Robin C K; Huang, Jonathan T B; Chien, Shih-Chuan; Huang, Roy; Jeng, Kee-Ching G; Chen, Yen-Chung; Liao, Mokai; Wu, Jia-Rong; Hung, Wei-Kang; Hung, Chia-Chun; Chen, Yu-Ling; Waring, Michael J; Sheh, Leung
2013-01-07
This study aims to interpret the energetic basis of complex DNA-peptide interactions according to a novel allosteric interaction network approach. In common with other designed peptides, five new conjugates incorporating the XPRK or XHypRK motif (Hyp = hydroxyproline) attached to a N-methylpyrrole (Py) tract with a basic tail have been found to display cooperative binding to DNA involving multiple monodentate as well as interstrand bidentate interactions. Using quantitative DNase I footprinting it appears that allosteric communication via cooperative binding to multiple sites on complementary DNA strands corresponds to two different types of DNA-peptide interaction network. Temperature variation experiments using a dodecapeptide RY-12 show that lower temperature (25 °C) favor a circuit type of allosteric interaction network, whereas higher temperatures (31 and 37 °C) afford only a partial-circuit type of network. Circular dichroism studies show that our five peptides induce significant local conformational changes in DNA via the minor groove, with apparently dimeric binding stoichiometry. Isothermal titration calorimetry reveals that these peptides, together with another seven for comparison, are strongly exothermic upon binding to a model 13-mer DNA duplex, characterized by ΔH ranging from -14.7 to -74.4 kcal mol(-1), and also high TΔS ranging from -6.5 to -65.9 kcal mol(-1). Multiple monodentate and bidentate interactions, as well as ionic forces that mediate positive cooperativity in sequence recognition, are consistent with a dramatic decrease in entropy and a 'tightening' effect of DNA conformation. Distinctive enthalpy-entropy compensation (EEC) relationships are demonstrated for the interaction of all twelve designed peptides with DNA, affording a straight line of slope close to unity when ΔH is plotted versus TΔS, with a y-axis intercept (average ΔG) corresponding to -8.5 kcal mol(-1), while the observed ΔG ranges from -8.2 to -9.1 kcal mol(-1) for the peptides. The EEC seen with peptide RY-12 binding to the model duplex persists throughout various incubation temperatures. The net compensation of energy between the favorable negative ΔH and unfavorable negative ΔS components thus constrains the value of net binding free energy ΔG within a remarkably constant range, as is clearly visible in a 3-dimensional energetic plot. We conclude that the preservation of a rather narrowly-defined ΔG value is central to the EEC in DNA-peptide interactions, illuminating the universal EEC paradox commonly found in diverse biochemical reactions.
Ma, Xin; Guo, Jing; Sun, Xiao
2016-01-01
DNA-binding proteins are fundamentally important in cellular processes. Several computational-based methods have been developed to improve the prediction of DNA-binding proteins in previous years. However, insufficient work has been done on the prediction of DNA-binding proteins from protein sequence information. In this paper, a novel predictor, DNABP (DNA-binding proteins), was designed to predict DNA-binding proteins using the random forest (RF) classifier with a hybrid feature. The hybrid feature contains two types of novel sequence features, which reflect information about the conservation of physicochemical properties of the amino acids, and the binding propensity of DNA-binding residues and non-binding propensities of non-binding residues. The comparisons with each feature demonstrated that these two novel features contributed most to the improvement in predictive ability. Furthermore, to improve the prediction performance of the DNABP model, feature selection using the minimum redundancy maximum relevance (mRMR) method combined with incremental feature selection (IFS) was carried out during the model construction. The results showed that the DNABP model could achieve 86.90% accuracy, 83.76% sensitivity, 90.03% specificity and a Matthews correlation coefficient of 0.727. High prediction accuracy and performance comparisons with previous research suggested that DNABP could be a useful approach to identify DNA-binding proteins from sequence information. The DNABP web server system is freely available at http://www.cbi.seu.edu.cn/DNABP/.
Liu, Ying; Matthews, Kathleen S.; Bondos, Sarah E.
2008-01-01
During animal development, distinct tissues, organs, and appendages are specified through differential gene transcription by Hox transcription factors. However, the conserved Hox homeodomains bind DNA with high affinity yet low specificity. We have therefore explored the structure of the Drosophila melanogaster Hox protein Ultrabithorax and the impact of its nonhomeodomain regions on DNA binding properties. Computational and experimental approaches identified several conserved, intrinsically disordered regions outside the homeodomain of Ultrabithorax that impact DNA binding by the homeodomain. Full-length Ultrabithorax bound to target DNA 2.5-fold weaker than its isolated homeodomain. Using N-terminal and C-terminal deletion mutants, we demonstrate that the YPWM region and the disordered microexons (termed the I1 region) inhibit DNA binding ∼2-fold, whereas the disordered I2 region inhibits homeodomain-DNA interaction a further ∼40-fold. Binding is restored almost to homeodomain affinity by the mostly disordered N-terminal 174 amino acids (R region) in a length-dependent manner. Both the I2 and R regions contain portions of the activation domain, functionally linking DNA binding and transcription regulation. Given that (i) the I1 region and a portion of the R region alter homeodomain-DNA binding as a function of pH and (ii) an internal deletion within I1 increases Ultrabithorax-DNA affinity, I1 must directly impact homeodomain-DNA interaction energetics. However, I2 appears to indirectly affect DNA binding in a manner countered by the N terminus. The amino acid sequences of I2 and much of the I1 and R regions vary significantly among Ultrabithorax orthologues, potentially diversifying Hox-DNA interactions. PMID:18508761
Tseng, Boo Shan; Howlin, Robert P.; Deacon, Jill; Wharton, Julian A.; Thurner, Philipp J.; Gilmore, Brendan F.; Parsek, Matthew R.; Stoodley, Paul
2014-01-01
Staphylococcus epidermidis biofilm formation is responsible for the persistence of orthopedic implant infections. Previous studies have shown that exposure of S. epidermidis biofilms to sub-MICs of antibiotics induced an increased level of biofilm persistence. BODIPY FL-vancomycin (a fluorescent vancomycin conjugate) and confocal microscopy were used to show that the penetration of vancomycin through sub-MIC-vancomycin-treated S. epidermidis biofilms was impeded compared to that of control, untreated biofilms. Further experiments showed an increase in the extracellular DNA (eDNA) concentration in biofilms preexposed to sub-MIC vancomycin, suggesting a potential role for eDNA in the hindrance of vancomycin activity. Exogenously added, S. epidermidis DNA increased the planktonic vancomycin MIC and protected biofilm cells from lethal vancomycin concentrations. Finally, isothermal titration calorimetry (ITC) revealed that the binding constant of DNA and vancomycin was 100-fold higher than the previously reported binding constant of vancomycin and its intended cellular d-Ala-d-Ala peptide target. This study provides an explanation of the eDNA-based mechanism of antibiotic tolerance in sub-MIC-vancomycin-treated S. epidermidis biofilms, which might be an important factor for the persistence of biofilm infections. PMID:25267673
New DNA-binding radioprotectors
NASA Astrophysics Data System (ADS)
Martin, Roger
The normal tissue damage associated with cancer radiotherapy has motivated the development at Peter Mac of a new class of DNA-binding radioprotecting drugs that could be applied top-ically to normal tissues at risk. Methylproamine (MP), the lead compound, reduces radiation induced cell kill at low concentrations. For example, experiments comparing the clonogenic survival of transformed human keratinocytes treated with 30 micromolar MP before and dur-ing various doses of ionising radiation, with the radiation dose response for untreated cells, indicate a dose reduction factor (DRF) of 2. Similar survival curve experiments using various concentrations of MP, with parallel measurements of uptake of MP into cell nuclei, have en-abled the relationship between drug uptake and extent of radioprotection to be established. Radioprotection has also been demonstrated after systemic administration to mice, for three different endpoints, namely lung, jejunum and bone marrow (survival at 30 days post-TBI). The results of pulse radiolysis studies indicated that the drugs act by reduction of transient radiation-induced oxidative species on DNA. This hypothesis was substantiated by the results of experiments in which MP radioprotection of radiation-induced DNA double-strand breaks, assessed as -H2AX foci, in the human keratinocyte cell line. For both endpoints, the extent of radioprotection increased with MP concentration up to a maximal value. These results are consistent with the hypothesis that radioprotection by MP is mediated by attenuation of the extent of initial DNA damage. However, although MP is a potent radioprotector, it becomes cytotoxic at higher concentrations. This limitation has been addressed in an extensive program of lead optimisation and some promising analogues have emerged from which the next lead will be selected. Given the clinical potential of topical radioprotection, the new analogues are being assessed in terms of delivery to mouse oral mucosa. This is facilitated by the fact that, like the parent minor groove-binding drug Hoechst 33342, DNA-bound MP (and its analogues) are fluorescent, enabling quantitative assessment of delivery of topically applied drug to basal cells in the mouse oral mucosa. Comparison with the data from prior in vitro experiments described above, indicate that topical delivery is sufficient to confer radioprotection. Although the primary motivation for this project relates to Radiation Oncology, the new ra-dioprotectors obviously have more general potential.
Mechanisms of small molecule–DNA interactions probed by single-molecule force spectroscopy
Almaqwashi, Ali A.; Paramanathan, Thayaparan; Rouzina, Ioulia; Williams, Mark C.
2016-01-01
There is a wide range of applications for non-covalent DNA binding ligands, and optimization of such interactions requires detailed understanding of the binding mechanisms. One important class of these ligands is that of intercalators, which bind DNA by inserting aromatic moieties between adjacent DNA base pairs. Characterizing the dynamic and equilibrium aspects of DNA-intercalator complex assembly may allow optimization of DNA binding for specific functions. Single-molecule force spectroscopy studies have recently revealed new details about the molecular mechanisms governing DNA intercalation. These studies can provide the binding kinetics and affinity as well as determining the magnitude of the double helix structural deformations during the dynamic assembly of DNA–ligand complexes. These results may in turn guide the rational design of intercalators synthesized for DNA-targeted drugs, optical probes, or integrated biological self-assembly processes. Herein, we survey the progress in experimental methods as well as the corresponding analysis framework for understanding single molecule DNA binding mechanisms. We discuss briefly minor and major groove binding ligands, and then focus on intercalators, which have been probed extensively with these methods. Conventional mono-intercalators and bis-intercalators are discussed, followed by unconventional DNA intercalation. We then consider the prospects for using these methods in optimizing conventional and unconventional DNA-intercalating small molecules. PMID:27085806
Enantiospecific recognition of DNA sequences by a proflavine Tröger base.
Bailly, C; Laine, W; Demeunynck, M; Lhomme, J
2000-07-05
The DNA interaction of a chiral Tröger base derived from proflavine was investigated by DNA melting temperature measurements and complementary biochemical assays. DNase I footprinting experiments demonstrate that the binding of the proflavine-based Tröger base is both enantio- and sequence-specific. The (+)-isomer poorly interacts with DNA in a non-sequence-selective fashion. In sharp contrast, the corresponding (-)-isomer recognizes preferentially certain DNA sequences containing both A. T and G. C base pairs, such as the motifs 5'-GTT. AAC and 5'-ATGA. TCAT. This is the first experimental demonstration that acridine-type Tröger bases can be used for enantiospecific recognition of DNA sequences. Copyright 2000 Academic Press.
Clark, Andrew G; Naufer, M Nabuan; Westerlund, Fredrik; Lincoln, Per; Rouzina, Ioulia; Paramanathan, Thayaparan; Williams, Mark C
2018-02-06
Molecules that bind DNA via threading intercalation show high binding affinity as well as slow dissociation kinetics, properties ideal for the development of anticancer drugs. To this end, it is critical to identify the specific molecular characteristics of threading intercalators that result in optimal DNA interactions. Using single-molecule techniques, we quantify the binding of a small metal-organic ruthenium threading intercalator (Δ,Δ-B) and compare its binding characteristics to a similar molecule with significantly larger threading moieties (Δ,Δ-P). The binding affinities of the two molecules are the same, while comparison of the binding kinetics reveals significantly faster kinetics for Δ,Δ-B. However, the kinetics is still much slower than that observed for conventional intercalators. Comparison of the two threading intercalators shows that the binding affinity is modulated independently by the intercalating section and the binding kinetics is modulated by the threading moiety. In order to thread DNA, Δ,Δ-P requires a "lock mechanism", in which a large length increase of the DNA duplex is required for both association and dissociation. In contrast, measurements of the force-dependent binding kinetics show that Δ,Δ-B requires a large DNA length increase for association but no length increase for dissociation from DNA. This contrasts strongly with conventional intercalators, for which almost no DNA length change is required for association but a large DNA length change must occur for dissociation. This result illustrates the fundamentally different mechanism of threading intercalation compared with conventional intercalation and will pave the way for the rational design of therapeutic drugs based on DNA threading intercalation.
Dpb11 may function with RPA and DNA to initiate DNA replication
Bruck, Irina; Dhingra, Nalini; Martinez, Matthew P.
2017-01-01
Dpb11 is required for the initiation of DNA replication in budding yeast. We found that Dpb11 binds tightly to single-stranded DNA (ssDNA) or branched DNA structures, while its human homolog, TopBP1, binds tightly to branched-DNA structures. We also found that Dpb11 binds stably to CDK-phosphorylated RPA, the eukaryotic ssDNA binding protein, in the presence of branched DNA. A Dpb11 mutant specifically defective for DNA binding did not exhibit tight binding to RPA in the presence of DNA, suggesting that Dpb11-interaction with DNA may promote the recruitment of RPA to melted DNA. We then characterized a mutant of Dpb11 that is specifically defective in DNA binding in budding yeast cells. Expression of dpb11-m1,2,3,5,ΔC results in a substantial decrease in RPA recruitment to origins, suggesting that Dpb11 interaction with DNA may be required for RPA recruitment to origins. Expression of dpb11-m1,2,3,5,ΔC also results in diminished GINS interaction with Mcm2-7 during S phase, while Cdc45 interaction with Mcm2-7 is like wild-type. The reduced GINS interaction with Mcm2-7 may be an indirect consequence of diminished origin melting. We propose that the tight interaction between Dpb11, CDK-phosphorylated RPA, and branched-DNA may be required for the essential function of stabilizing melted origin DNA in vivo. We also propose an alternative model, wherein Dpb11-DNA interaction is required for some other function in DNA replication initiation, such as helicase activation. PMID:28467467
Binding and thermodynamics of REV peptide-ctDNA interaction.
Upadhyay, Santosh Kumar
2017-03-01
The thermodynamics of DNA-ligand binding is important as it provides useful information to understand the details of binding processes. HIV-1 REV response element (RRE) located in the env coding region of the viral genome is reported to be well conserved across different HIV-1 isolates. In this study, the binding characteristics of Calf thymus DNA (ctDNA) and REV peptide from HIV-1 were investigated using spectroscopic (UV-visible, fluorescence, and circular dichroism (CD)) and isothermal titration calorimetric (ITC) techniques. Thermal stability and ligand binding properties of the ctDNA revealed that native ctDNA had a T m of 75.5 °C, whereas the ctDNA-REV peptide complex exhibited an incremental shift in the T m by 8 °C, indicating thermal stability of the complex. CD data indicated increased ellipticity due to large conformational changes in ctDNA molecule upon binding with REV peptide and two binding stoichiometric modes are apparent. The ctDNA experienced condensation due to large conformational changes in the presence of REV peptide and positive B→Ψ transition was observed at higher molar charge ratios. Fluorescence studies performed at several ligand concentrations revealed a gradual decrease in the fluorescence intensity of EtBr-bound ctDNA in response to increasing ligand concentrations. The fluorescence data further confirmed two stoichiometric modes of binding for ctDNA-REV peptide complex as previously observed with CD studies. The binding enthalpies were determined using ITC in the temperature range of 293 K-308 K. The ITC binding isotherm was exothermic at all temperatures examined, with low ΔH values indicating that the ctDNA-REV peptide interaction is driven largely by entropy. The heat capacity change (ΔC p ) was insignificant, an unusual finding in the area of DNA-peptide interaction studies. The variation in the values obtained for ΔH, ΔS, and ΔG with temperature further suggests that ctDNA-REV peptide interaction is entropically driven. ITC based analysis of salt dependence of binding constant gave a charge value (Z) = +4.01, as determined for the δlnK/δln[Na + ] parameter, suggesting the participation of only 3-4 Arg out of 11 Arg charge from REV peptide. The stoichiometry observed for the complex was three molar charge of REV peptide binding per molar charge of ctDNA. ITC based analysis further confirmed that the binding between ctDNA and REV peptide is governed by electrostatic interaction. Molecular interactions including H-bonding, van der Waals forces, and solvent molecules rearrangement, underlie the binding of REV peptide to ctDNA. © 2016 Wiley Periodicals, Inc.
Mitra, A; Saikh, F; Das, J; Ghosh, S; Ghosh, R
2018-05-22
Interaction of a ligand with DNA is often the basis of drug action of many molecules. Flavones are important in this regard as their structural features confer them the ability to bind to DNA. 2-(4-Nitrophenyl)-4H-chromen-4-one (4NCO) is an important biologically active synthetic flavone derivative. We are therefore interested in studying its interaction with DNA. Absorption spectroscopy studies included standard and reverse titration, effect of ionic strength on titration, determination of stoichiometry of binding and thermal denaturation. Spectrofluorimetry techniques included fluorimetric titration, quenching studies and fluorescence displacement assay. Assessment of relative viscosity and estimation of thermodynamic parameters from CD spectral studies were also undertaken. Furthermore, molecular docking analyses were also done with different short DNA sequences. The fluorescent flavone 4NCO reversibly interacted with DNA through partial intercalation as well as minor-groove binding. The binding constant and the number of binding sites were of the order 10 4 M -1 and 1 respectively. The binding stoichiometry with DNA was found to be 1:1. The nature of the interaction of 4NCO with DNA was hydrophobic in nature and the process of binding was spontaneous, endothermic and entropy-driven. The flavone also showed a preference for binding to GC rich sequences. The study presents a profile for structural and thermodynamic parameters, for the binding of 4NCO with DNA. DNA is an important target for ligands that are effective against cell proliferative disorders. In this regard, the molecule 4NCO is important since it can exert its biological activity through its DNA binding ability and can be a potential drug candidate. Copyright © 2018 Elsevier B.V. All rights reserved.
Lin, Kevin N; Grandhi, Taraka Sai Pavan; Goklany, Sheba; Rege, Kaushal
2018-04-10
Plasmid DNA (pDNA) is an attractive therapeutic biomolecule in several diseases including cancer, AIDS, cystic fibrosis, Parkinson's disease, and Alzheimer's disease. Increasing demand for plasmid DNA as a therapeutic biomolecule for transgene expression or vaccine applications necessitate novel approaches to bioprocessing. The synthesis, characterization and evaluation of aminoglycoside-derived hydrogel microbeads (Amikabeads) for pDNA binding is described previously. Here, the generation and evaluation of novel chemotherapeutic drug-conjugated microbeads for application in pDNA binding and recovery is described. Chemotherapeutic drug-conjugated Amikabeads demonstrate higher binding of methylated pDNA compared to unmethylated pDNA in presence of high salt concentrations. Desorption of plasmids from drug-conjugated microbeads is facilitated by the use of organic modifiers. The observed differences in binding methylated versus unmethylated DNA can make drug-conjugated microbeads useful in diagnostic as well as therapeutic applications. These results demonstrate that anti-cancer drugs represent a diverse set of ligands that may be exploited for molecular engineering of novel DNA binding materials for applications in delivery, diagnostics, and biomanufacturing. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Yamanaka, Yuki; Winardhi, Ricksen S; Yamauchi, Erika; Nishiyama, So-Ichiro; Sowa, Yoshiyuki; Yan, Jie; Kawagishi, Ikuro; Ishihama, Akira; Yamamoto, Kaneyoshi
2018-06-15
The bacterial nucleoid-associated protein H-NS is a DNA-binding protein, playing a major role in gene regulation. To regulate transcription, H-NS silences genes, including horizontally acquired foreign genes. Escherichia coli H-NS is 137 residues long and consists of two discrete and independent structural domains: an N-terminal oligomerization domain and a C-terminal DNA-binding domain, joined by a flexible linker. The N-terminal oligomerization domain is composed of two dimerization sites, dimerization sites 1 and 2, which are both required for H-NS oligomerization, but the exact role of dimerization site 2 in gene silencing is unclear. To this end, we constructed a whole set of single amino acid substitution variants spanning residues 2 to 137. Using a well-characterized H-NS target, the slp promoter of the glutamic acid-dependent acid resistance (GAD) cluster promoters, we screened for any variants defective in gene silencing. Focusing on the function of dimerization site 2, we analyzed four variants, I70C/I70A and L75C/L75A, which all could actively bind DNA but are defective in gene silencing. Atomic force microscopy analysis of DNA-H-NS complexes revealed that all of these four variants formed condensed complexes on DNA, whereas WT H-NS formed rigid and extended nucleoprotein filaments, a conformation required for gene silencing. Single-molecule stretching experiments confirmed that the four variants had lost the ability to form stiffened filaments. We conclude that dimerization site 2 of H-NS plays a key role in the formation of rigid H-NS nucleoprotein filament structures required for gene silencing. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Yoshii, Katsuhiro; Tajima, Fumihisa; Ishijima, Sumio; Sagami, Ikuko
2015-01-20
Neuronal PAS domain protein 2 (NPAS2) is a core clock transcription factor that forms a heterodimer with BMAL1 to bind the E-box in the promoter of clock genes and is regulated by various environmental stimuli such as heme, carbon monoxide, and NAD(P)H. In this study, we investigated the effects of pH and NADPH on the DNA binding activity of NPAS2. In an electrophoretic mobility shift (EMS) assay, the pH of the reaction mixture affected the DNA binding activity of the NPAS2/BMAL1 heterodimer but not that of the BMAL1/BMAL1 homodimer. A change in pH from 7.0 to 7.5 resulted in a 1.7-fold increase in activity in the absence of NADPH, and NADPH additively enhanced the activity up to 2.7-fold at pH 7.5. The experiments using truncated mutants revealed that N-terminal amino acids 1-61 of NPAS2 were sufficient to sense the change in both pH and NADPH. We further analyzed the kinetics of formation and DNA binding of the NPAS2/BMAL1 heterodimer at various pH values. In the absence of NADPH, a change in pH from 6.5 to 8.0 decreased the KD(app) value of the E-box from 125 to 22 nM, with an 8-fold increase in the maximal level of DNA binding for the NPAS2/BMAL1 heterodimer. The addition of NADPH resulted in a further decrease in KD(app) to 9 nM at pH 8.0. Furthermore, NPAS2-dependent transcriptional activity in a luciferase assay using NIH3T3 cells also increased with the pH of the culture medium. These results suggest that NPAS2 has a role as a pH and metabolite sensor in regulating circadian rhythms.
Design Rule for Colloidal Crystals of DNA-Functionalized Particles
NASA Astrophysics Data System (ADS)
Martinez-Veracoechea, Francisco J.; Mladek, Bianca M.; Tkachenko, Alexei V.; Frenkel, Daan
2011-07-01
We report a Monte Carlo simulation study of the phase behavior of colloids coated with long, flexible DNA chains. We find that an important change occurs in the phase diagram when the number of DNAs per colloid is decreased below a critical value. In this case, the triple point disappears and the condensed phase that coexists with the vapor is always liquid. Our simulations thus explain why, in the dilute solutions typically used in experiments, colloids coated with a small number of DNA strands cannot crystallize. We understand this behavior in terms of the discrete nature of DNA binding.
Nina, Mafalda; Fonné-Pfister, Raymonde; Beaudegnies, Renaud; Chekatt, Habiba; Jung, Pierre M J; Murphy-Kessabi, Fiona; De Mesmaeker, Alain; Wendeborn, Sebastian
2005-04-27
Thermodynamic and structural properties of a chemically modified DNA-RNA hybrid in which a phosphodiester linkage is replaced by a neutral amide-3 linkage (3'-CH(2)-CONH-5') were investigated using UV melting experiments, molecular dynamics simulations in explicit water, and continuum solvent models. van't Hoff analysis of the experimental UV melting curves suggests that the significant increase of the thermodynamic stability of a 15-mer DNA-RNA with seven alternated amide-3 modifications (+11 degrees C) is mainly due to an increased binding enthalpy. To further evaluate the origin in the observed affinities differences, the electrostatic contribution to the binding free energy was calculated by solving the Poisson-Boltzmann equation numerically. The nonelectrostatic contribution was estimated as the product of a hydrophobic surface tension coefficient and the surface area that is buried upon double strand formation. Structures were taken from 10 ns molecular dynamics simulations computed in a consistent fashion using explicit solvent, counterions, and the particle-mesh Ewald procedure. The present preliminary thermodynamic study suggests that the favorable binding free energy of the amide-3 DNA single strand to the complementary RNA is equally driven by electrostatic and nonpolar contributions to the binding compared to their natural analogues. In addition, molecular dynamics simulations in explicit water were performed on an amide-3 DNA single strand and the corresponding natural DNA. Results from the conformations cluster analysis of the simulated amide-3 DNA single strand ensembles suggest that the 25% of the population sampled within 10 ns has a pre-organized conformation where the sugar C3' endo pucker is favored at the 3'-flanking nucleotides. These structural and thermodynamic features contribute to the understanding of the observed increased affinities of the amide-3 DNA-RNA hybrids at the microscopic level.
DNA Recognition by a σ 54 Transcriptional Activator from Aquifex aeolicus
Vidangos, Natasha K.; Heideker, Johanna; Lyubimov, Artem; ...
2014-08-23
Transcription initiation by bacterial σ 54-polymerase requires the action of a transcriptional activator protein. Activators bind sequence-specifically upstream of the transcription initiation site via a DNA-binding domain. The structurally characterized DNA-binding domains from activators all belong to the Factor for Inversion Stimulation (Fis) family of helix-turn-helix DNA-binding proteins. We report here structures of the free and DNA-bound forms of the DNA-binding domain of NtrC4 (4DBD) from Aquifex aeolicus, a member of the NtrC family of σ 54 activators. Two NtrC4 binding sites were identified upstream (-145 and -85 base pairs) from the start of the lpxC gene, which is responsiblemore » for the first committed step in Lipid A biosynthesis. This is the first experimental evidence for σ 54 regulation in lpxC expression. 4DBD was crystallized both without DNA and in complex with the -145 binding site. The structures, together with biochemical data, indicate that NtrC4 binds to DNA in a manner that is similar to that of its close homologue, Fis. Ultimately, the greater sequence specificity for the binding of 4DBD relative to Fis seems to arise from a larger number of base specific contacts contributing to affinity than for Fis.« less
Yuan, Cui-Li; Zhang, An-Guo; Zheng, Ze-Bo; Wang, Ke-Zhi
2013-03-01
A phenylthiophenyl-bearing Ru(II) complex of [Ru(bpy)₂(Hbptip)](PF₆)₂ {bpy = 2,2'-bipyridine, Hbptip = 2-(4-phenylthiophen-2-yl)-1H-imidazo[4,5-f][1,10]phenanthroline} was synthesized and characterized by elemental analysis, ¹H NMR spectroscopy, and electrospray ionization mass spectrometry. The ground- and excited-state acid-base properties of the complex were studied by UV-visible absorption and photoluminescence spectrophotometric pH titrations and the negative logarithm values of the ground-state acid ionization constants were derived to be pK(a1) = 1.31 ± 0.09 and pK(a2) = 5.71 ± 0.11 with the pK(a2) associated deprotonation/protonation process occurring over 3 pK(a) units more acidic than thiophenyl-free parent complex of [Ru(bpy)₂(Hpip)]²⁺ {Hpip = 2-phenyl-1H-imidazo[4,5-f][1,10]phenanthroline}. The calf thymus DNA-binding properties of [Ru(bpy)₂(Hbptip)]²⁺ in Tris-HCl buffer (pH 7.1 and 50 mM NaCl) were investigated by DNA viscosities and density functional theoretical calculations as well as UV-visible and emission spectroscopy techniques of UV-visible and luminescence titrations, steady-state emission quenching by [Fe(CN)₆]⁴⁻, DNA competitive binding with ethidium bromide, DNA melting experiments, and reverse salt effects. The complex was evidenced to bind to the DNA intercalatively with binding affinity being greater than those for previously reported analogs of [Ru(bpy)₂(Hip)]²⁺, [Ru(bpy)₂(Htip)]²⁺, and [Ru(bpy)₂(Haptip)]²⁺ {Hip = 1H-imidazo[4,5-f][1,10]phenanthroline, Htip = 2-thiophenimidazo[4,5-f][1,10]phenanthroline, Haptip = 2-(5-phenylthiophen-2-yl)-1H-imidazo[4,5-f][1,10]phenanthroline}.
Structural Determinants of DNA Binding by a P. falciparum ApiAP2 Transcriptional Regulator
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lindner, Scott E.; De Silva, Erandi K.; Keck, James L.
2010-11-05
Putative transcription factors have only recently been identified in the Plasmodium spp., with the major family of regulators comprising the Apicomplexan Apetala2 (AP2) proteins. To better understand the DNA-binding mechanisms of these transcriptional regulators, we characterized the structure and in vitro function of an AP2 DNA-binding domain from a prototypical Apicomplexan AP2 protein, PF14{_}0633 from Plasmodium falciparum. The X-ray crystal structure of the PF14{_}0633 AP2 domain bound to DNA reveals a {beta}-sheet fold that binds the DNA major groove through base-specific and backbone contacts; a prominent {alpha}-helix supports the {beta}-sheet structure. Substitution of predicted DNA-binding residues with alanine weakened ormore » eliminated DNA binding in solution. In contrast to plant AP2 domains, the PF14{_}0633 AP2 domain dimerizes upon binding to DNA through a domain-swapping mechanism in which the {alpha}-helices of the AP2 domains pack against the {beta}-sheets of the dimer mates. DNA-induced dimerization of PF14{_}0633 may be important for tethering two distal DNA loci together in the nucleus and/or for inducing functional rearrangements of its domains to facilitate transcriptional regulation. Consistent with a multisite binding mode, at least two copies of the consensus sequence recognized by PF14{_}0633 are present upstream of a previously identified group of sporozoite-stage genes. Taken together, these findings illustrate how Plasmodium has adapted the AP2 DNA-binding domain for genome-wide transcriptional regulation.« less
Wang, Hao-Ching; Ko, Tzu-Ping; Wu, Mao-Lun; Ku, Shan-Chi; Wu, Hsing-Ju; Wang, Andrew H.-J.
2012-01-01
DNA mimic proteins occupy the DNA binding sites of DNA-binding proteins, and prevent these sites from being accessed by DNA. We show here that the Neisseria conserved hypothetical protein DMP19 acts as a DNA mimic. The crystal structure of DMP19 shows a dsDNA-like negative charge distribution on the surface, suggesting that this protein should be added to the short list of known DNA mimic proteins. The crystal structure of another related protein, NHTF (Neisseria hypothetical transcription factor), provides evidence that it is a member of the xenobiotic-response element (XRE) family of transcriptional factors. NHTF binds to a palindromic DNA sequence containing a 5′-TGTNAN11TNACA-3′ recognition box that controls the expression of an NHTF-related operon in which the conserved nitrogen-response protein [i.e. (Protein-PII) uridylyltransferase] is encoded. The complementary surface charges between DMP19 and NHTF suggest specific charge–charge interaction. In a DNA-binding assay, we found that DMP19 can prevent NHTF from binding to its DNA-binding sites. Finally, we used an in situ gene regulation assay to provide evidence that NHTF is a repressor of its down-stream genes and that DMP19 can neutralize this effect. We therefore conclude that the interaction of DMP19 and NHTF provides a novel gene regulation mechanism in Neisseria spps. PMID:22373915
Cr(3+) Binding to DNA Backbone Phosphate and Bases: Slow Ligand Exchange Rates and Metal Hydrolysis.
Zhou, Wenhu; Yu, Tianmeng; Vazin, Mahsa; Ding, Jinsong; Liu, Juewen
2016-08-15
The interaction between chromium ions and DNA is of great interest in inorganic chemistry, toxicology, and analytical chemistry. Most previous studies focused on in situ reduction of Cr(VI), producing Cr(3+) for DNA binding. Recently, Cr(3+) was reported to activate the Ce13d DNAzyme for RNA cleavage. Herein, the Ce13d is used to study two types of Cr(3+) and DNA interactions. First, Cr(3+) binds to the DNA phosphate backbone weakly through reversible electrostatic interactions, which is weakened by adding competing inorganic phosphate. However, Cr(3+) coordinates with DNA nucleobases forming stable cross-links that can survive denaturing gel electrophoresis condition. The binding of Cr(3+) to different nucleobases was further studied in terms of binding kinetics and affinity by exploiting carboxyfluorescein-labeled DNA homopolymers. Once binding takes place, the stable Cr(3+)/DNA complex cannot be dissociated by EDTA, attributable to the ultraslow ligand exchange rate of Cr(3+). The binding rate follows the order of G > C > T ≈ A. Finally, Cr(3+) gradually loses its DNA binding ability after being stored at neutral or high pH, attributable to hydrolysis. This hydrolysis can be reversed by lowering the pH. This work provides a deeper insight into the bioinorganic chemistry of Cr(3+) coordination with DNA, clarifies some inconsistency in the previous literature, and offers practically useful information for generating reproducible results.
Kramers, C; Hylkema, M N; van Bruggen, M C; van de Lagemaat, R; Dijkman, H B; Assmann, K J; Smeenk, R J; Berden, J H
1994-01-01
Histones can mediate the binding of DNA and anti-DNA to the glomerular basement membrane (GBM). In ELISA histone/DNA/anti-DNA complexes are able to bind to heparan sulfate (HS), an intrinsic constituent of the GBM. We questioned whether histone containing immune complexes are able to bind to the GBM, and if so, whether the ligand in the GBM is HS. Monoclonal antibodies (mAbs) complexed to nucleosomal antigens and noncomplexed mAbs were isolated from culture supernatants of four IgG anti-nuclear mAbs. All noncomplexed mAbs showed strong anti-nucleosome reactivity in ELISA. One of them showed in addition anti-DNA reactivity in noncomplexed form. The other three mAbs only showed anti-DNA reactivity when they were complexed to nucleosomal antigens. After renal perfusion a fine granular binding of complexed mAbs to the glomerular capillary wall and activation of complement was observed in immunofluorescence, whereas noncomplexed mAbs did not bind. Immuno-electron microscopy showed binding of complexes to the whole width of the GBM. When HS in the GBM was removed by renal heparinase perfusion the binding of complexed mAb decreased, but did not disappear completely. We conclude that anti-nucleosome mAbs, which do not bind DNA, become DNA reactive once complexed to nucleosomal antigens. These complexed mAbs can bind to the GBM. The binding ligand in the GBM is partly, but not solely, HS. Binding to the GBM of immune complexes containing nucleosomal material might be an important event in the pathogenesis of lupus nephritis. Images PMID:8040312
Titration of DnaA protein by oriC DnaA-boxes increases dnaA gene expression in Escherichia coli.
Hansen, F G; Koefoed, S; Sørensen, L; Atlung, T
1987-01-01
Binding of the DnaA protein to its binding sites, the DnaA-boxes (TTATCCACA), was measured by a simple physiological approach. The presence of extra DnaA-boxes in growing cells leads to a derepression of dnaA gene expression, measured as beta-galactosidase activity of a dnaA-lacZ fusion polypeptide. Different DnaA-boxes caused different degrees of derepression indicating that the DnaA protein requires sequences in addition to the DnaA-box for efficient binding. The DnaA-boxes in oriC might act cooperatively in binding of the DnaA protein. The derepressed levels of DnaA protein obtained in a strain carrying an oriC+-pBR322 chimera were very high and sufficient to activate oriC on the chimeric plasmid, which was maintained at a copy number more than three times that of pBR322. PMID:3034578
An ancient protein-DNA interaction underlying metazoan sex determination.
Murphy, Mark W; Lee, John K; Rojo, Sandra; Gearhart, Micah D; Kurahashi, Kayo; Banerjee, Surajit; Loeuille, Guy-André; Bashamboo, Anu; McElreavey, Kenneth; Zarkower, David; Aihara, Hideki; Bardwell, Vivian J
2015-06-01
DMRT transcription factors are deeply conserved regulators of metazoan sexual development. They share the DM DNA-binding domain, a unique intertwined double zinc-binding module followed by a C-terminal recognition helix, which binds a pseudopalindromic target DNA. Here we show that DMRT proteins use a unique binding interaction, inserting two adjacent antiparallel recognition helices into a widened DNA major groove to make base-specific contacts. Versatility in how specific base contacts are made allows human DMRT1 to use multiple DNA binding modes (tetramer, trimer and dimer). Chromatin immunoprecipitation with exonuclease treatment (ChIP-exo) indicates that multiple DNA binding modes also are used in vivo. We show that mutations affecting residues crucial for DNA recognition are associated with an intersex phenotype in flies and with male-to-female sex reversal in humans. Our results illuminate an ancient molecular interaction underlying much of metazoan sexual development.
An ancient protein-DNA interaction underlying metazoan sex determination
Murphy, Mark W.; Lee, John K.; Rojo, Sandra; ...
2015-05-25
DMRT transcription factors are deeply conserved regulators of metazoan sexual development. They share the DM DNA-binding domain, a unique intertwined double zinc-binding module followed by a C-terminal recognition helix, which binds a pseudopalindromic target DNA. In this paper, we show that DMRT proteins use a unique binding interaction, inserting two adjacent antiparallel recognition helices into a widened DNA major groove to make base-specific contacts. Versatility in how specific base contacts are made allows human DMRT1 to use multiple DNA binding modes (tetramer, trimer and dimer). Chromatin immunoprecipitation with exonuclease treatment (ChIP-exo) indicates that multiple DNA binding modes also are usedmore » in vivo. We show that mutations affecting residues crucial for DNA recognition are associated with an intersex phenotype in flies and with male-to-female sex reversal in humans. Finally, our results illuminate an ancient molecular interaction underlying much of metazoan sexual development.« less
An ancient protein-DNA interaction underlying metazoan sex determination
DOE Office of Scientific and Technical Information (OSTI.GOV)
Murphy, Mark W.; Lee, John K.; Rojo, Sandra
DMRT transcription factors are deeply conserved regulators of metazoan sexual development. They share the DM DNA-binding domain, a unique intertwined double zinc-binding module followed by a C-terminal recognition helix, which binds a pseudopalindromic target DNA. In this paper, we show that DMRT proteins use a unique binding interaction, inserting two adjacent antiparallel recognition helices into a widened DNA major groove to make base-specific contacts. Versatility in how specific base contacts are made allows human DMRT1 to use multiple DNA binding modes (tetramer, trimer and dimer). Chromatin immunoprecipitation with exonuclease treatment (ChIP-exo) indicates that multiple DNA binding modes also are usedmore » in vivo. We show that mutations affecting residues crucial for DNA recognition are associated with an intersex phenotype in flies and with male-to-female sex reversal in humans. Finally, our results illuminate an ancient molecular interaction underlying much of metazoan sexual development.« less
McCutchen-Maloney, Sandra L.
2002-01-01
Chimeric proteins having both DNA mutation binding activity and nuclease activity are synthesized by recombinant technology. The proteins are of the general formula A-L-B and B-L-A where A is a peptide having DNA mutation binding activity, L is a linker and B is a peptide having nuclease activity. The chimeric proteins are useful for detection and identification of DNA sequence variations including DNA mutations (including DNA damage and mismatches) by binding to the DNA mutation and cutting the DNA once the DNA mutation is detected.
Graham, Brian W; Tao, Yeqing; Dodge, Katie L; Thaxton, Carly T; Olaso, Danae; Young, Nicolas L; Marshall, Alan G; Trakselis, Michael A
2016-06-10
The archaeal minichromosomal maintenance (MCM) helicase from Sulfolobus solfataricus (SsoMCM) is a model for understanding structural and mechanistic aspects of DNA unwinding. Although interactions of the encircled DNA strand within the central channel provide an accepted mode for translocation, interactions with the excluded strand on the exterior surface have mostly been ignored with regard to DNA unwinding. We have previously proposed an extension of the traditional steric exclusion model of unwinding to also include significant contributions with the excluded strand during unwinding, termed steric exclusion and wrapping (SEW). The SEW model hypothesizes that the displaced single strand tracks along paths on the exterior surface of hexameric helicases to protect single-stranded DNA (ssDNA) and stabilize the complex in a forward unwinding mode. Using hydrogen/deuterium exchange monitored by Fourier transform ion cyclotron resonance MS, we have probed the binding sites for ssDNA, using multiple substrates targeting both the encircled and excluded strand interactions. In each experiment, we have obtained >98.7% sequence coverage of SsoMCM from >650 peptides (5-30 residues in length) and are able to identify interacting residues on both the interior and exterior of SsoMCM. Based on identified contacts, positively charged residues within the external waist region were mutated and shown to generally lower DNA unwinding without negatively affecting the ATP hydrolysis. The combined data globally identify binding sites for ssDNA during SsoMCM unwinding as well as validating the importance of the SEW model for hexameric helicase unwinding. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Koh, Junseock; Saecker, Ruth M.; Record, M. Thomas
2008-01-01
Escherichia coli HUαβ, a major nucleoid associated protein (NAP), organizes the DNA chromosome and facilitates numerous DNA transactions. Using isothermal titration calorimetry (ITC), fluorescence resonance energy transfer (FRET) and a series of DNA lengths (8, 15, 34, 38 and 160 base pairs) we establish that HUαβ interacts with duplex DNA using three different nonspecific binding modes. Both the HU to DNA mole ratio ([HU]/[DNA]) and DNA length dictate the dominant HU binding mode. On sufficiently long DNA (≥ 34 base pairs), at low [HU]/[DNA], HU populates a noncooperative 34 bp binding mode with a binding constant of 2.1 (± 0.4) × 106 M−1, and a binding enthalpy of +7.7 (± 0.6) kcal/mol at 15 °C and 0.15 M Na+. With increasing [HU]/[DNA], HU bound in the noncooperative 34 bp mode progressively converts to two cooperative (ω ~ 20) modes with site sizes of 10 bp and 6 bp. These latter modes exhibit smaller binding constants (1.1 (± 0.2) × 105 M−1 for the 10 bp mode, 3.5 (± 1.4) × 104 M−1 for the 6 bp mode) and binding enthalpies (4.2 (± 0.3) kcal/mol for the 10 bp mode, −1.6 (±0.3) kcal/mol for the 6 bp mode). As DNA length increases to 34 bp or more at low [HU]/[DNA], the small modes are replaced by the 34 bp binding mode. FRET data demonstrate that the 34 bp mode bends DNA by 143 ± 6° whereas the 6 and 10 bp modes do not. The model proposed in this study provides a novel quantitative and comprehensive framework for reconciling previous structural and solution studies of HU, including single molecule (force extension measurement, AFM), fluorescence, and electrophoretic gel mobility shift assays. In particular, it explains how HU condenses or extends DNA depending on the relative concentrations of HU and DNA. PMID:18657548
Pfohl-Leszkowicz, A; Hadjeba-Medjdoub, K; Ballet, N; Schrickx, J; Fink-Gremmels, J
2015-01-01
The aim of this paper was to evaluate the capacity of several yeast-based products, derived from baker's and brewer's yeasts, to sequester the mycotoxin ochratoxin A (OTA) and to decrease its rate of absorption and DNA adduct formation in vivo. The experimental protocol included in vitro binding studies using isotherm models, in vivo chicken experiments, in which the serum and tissue concentrations of OTA were analysed in the absence and presence of the test compounds, and the profile of OTA-derived metabolites and their associated DNA adducts were determined. Additionally in vitro cell culture studies (HK2 cells) were applied to assess further the effects for yeast cell product enriched with glutathione (GSH) or selenium. Results of the in vitro binding assay in a buffer system indicated the ability of the yeast-based products, as sequester of OTA, albeit at a different level. In the in vitro experiments in chickens, decreased serum and tissue concentrations of treated animals confirmed that yeast-based products are able to prevent the absorption of OTA. A comparison of the binding affinity in a standard in vitro binding assay with the results obtained in an in vivo chicken experiment, however, showed a poor correlation and resulted in a different ranking of the products. More importantly, we could show that yeast-based products actively modulate the biotransformation of OTA in vivo as well as in vitro in a cell culture model. This effect seems to be attributable to residual enzymatic activities in the yeast-based products. An enrichment of yeast cell wall products with GSH or selenium further modulated the profile of the generated OTA metabolites and the associated pattern of OTA-induced DNA adducts by increasing the conversion of OTA into less toxic metabolites such as OTA, OTB and 4-OH-OTA. A reduced absorption and DNA adduct formation was particularly observed with GSH-enriched yeast, whereas selenium-enriched yeasts could counteract the OTA-induced decrease in cell viability, but at the same time increased the OTA-DNA adducts formation. These findings indicate the need for an in-depth characterisation of yeast-based products used as mycotoxin-mitigating feed additives, in in vivo models with target animal species taking into account not only their ability to sequester toxins in the gastrointestinal tract but also their potential effects on the biotransformation of mycotoxins.
Ishige, K; Endo, H; Saito, H; Ito, Y
2001-01-19
To characterize seizure-associated increases in cerebral cortical and thalamic cyclic AMP responsive element (CRE)- and activator protein 1 (AP-1) DNA-binding activities in lethargic (lh/lh) mice, a genetic model of absence seizures, we examined the effects of ethosuximide and CGP 46381 on these DNA-binding activities. Repeated administration (twice a day for 5 days) of ethosuximide (200 mg/kg) or CGP 46381 (60 mg/kg) attenuated both seizure behavior and the increased DNA-binding activities, and was more effective than a single administration of these drugs. These treatments did not affect either normal behavior or basal DNA-binding activities in non-epileptic control (+/+) mice. Gel supershift assays revealed that the increased CRE-binding activity was attributable to activation of the binding activity of CREB, and that the c-Fos-c-Jun complex was a component of the increased AP-1 DNA-binding activity.
Engineering and Application of Zinc Finger Proteins and TALEs for Biomedical Research.
Kim, Moon-Soo; Kini, Anu Ganesh
2017-08-01
Engineered DNA-binding domains provide a powerful technology for numerous biomedical studies due to their ability to recognize specific DNA sequences. Zinc fingers (ZF) are one of the most common DNA-binding domains and have been extensively studied for a variety of applications, such as gene regulation, genome engineering and diagnostics. Another novel DNA-binding domain known as a transcriptional activator-like effector (TALE) has been more recently discovered, which has a previously undescribed DNA-binding mode. Due to their modular architecture and flexibility, TALEs have been rapidly developed into artificial gene targeting reagents. Here, we describe the methods used to design these DNA-binding proteins and their key applications in biomedical research.
Moghadam, Neda Hosseinpour; Salehzadeh, Sadegh; Shahabadi, Nahid
2017-09-02
The interaction of calf thymus DNA with nevirapine at physiological pH was studied by using absorption, circular dichroism, viscosity, differential pulse voltammetry, fluorescence techniques, salt effect studies and computational methods. The drug binds to ct-DNA in a groove binding mode, as shown by slight variation in the viscosity of ct-DNA. Furthermore, competitive fluorimetric studies with Hoechst 33258 indicate that nevirapine binds to DNA via groove binding. Moreover, the structure of nevirapine was optimized by DFT calculations and was used for the molecular docking calculations. The molecular docking results suggested that nevirapine prefers to bind on the minor groove of ct-DNA.
NASA Astrophysics Data System (ADS)
Li, Richard Y.; Di Felice, Rosa; Rohs, Remo; Lidar, Daniel A.
2018-03-01
Transcription factors regulate gene expression, but how these proteins recognize and specifically bind to their DNA targets is still debated. Machine learning models are effective means to reveal interaction mechanisms. Here we studied the ability of a quantum machine learning approach to classify and rank binding affinities. Using simplified data sets of a small number of DNA sequences derived from actual binding affinity experiments, we trained a commercially available quantum annealer to classify and rank transcription factor binding. The results were compared to state-of-the-art classical approaches for the same simplified data sets, including simulated annealing, simulated quantum annealing, multiple linear regression, LASSO, and extreme gradient boosting. Despite technological limitations, we find a slight advantage in classification performance and nearly equal ranking performance using the quantum annealer for these fairly small training data sets. Thus, we propose that quantum annealing might be an effective method to implement machine learning for certain computational biology problems.
A comprehensive approach to ascertain the binding mode of curcumin with DNA
NASA Astrophysics Data System (ADS)
Haris, P.; Mary, Varughese; Aparna, P.; Dileep, K. V.; Sudarsanakumar, C.
2017-03-01
Curcumin is a natural phytochemical from the rhizoma of Curcuma longa, the popular Indian spice that exhibits a wide range of pharmacological properties like antioxidant, anticancer, anti-inflammatory, antitumor, and antiviral activities. In the published literatures we can see different studies and arguments on the interaction of curcumin with DNA. The intercalative binding, groove binding and no binding of curcumin with DNA were reported. In this context, we conducted a detailed study to understand the mechanism of recognition of dimethylsulfoxide-solubilized curcumin by DNA. The interaction of curcumin with calf thymus DNA (ctDNA) was confirmed by agarose gel electrophoresis. The nature of binding and energetics of interaction were studied by Isothermal Titration Calorimetry (ITC), Differential Scanning Calorimetry (DSC), UV-visible, fluorescence and melting temperature (Tm) analysis. The experimental data were compared with molecular modeling studies. Our investigation confirmed that dimethylsulfoxide-solubilized curcumin binds in the minor groove of the ctDNA without causing significant structural alteration to the DNA.
Armas, Pablo; Margarit, Ezequiel; Mouguelar, Valeria S; Allende, Miguel L; Calcaterra, Nora B
2013-01-01
CNBP is a nucleic acid chaperone implicated in vertebrate craniofacial development, as well as in myotonic dystrophy type 2 (DM2) and sporadic inclusion body myositis (sIBM) human muscle diseases. CNBP is highly conserved among vertebrates and has been implicated in transcriptional regulation; however, its DNA binding sites and molecular targets remain elusive. The main goal of this work was to identify CNBP DNA binding sites that might reveal target genes involved in vertebrate embryonic development. To accomplish this, we used a recently described yeast one-hybrid assay to identify DNA sequences bound in vivo by CNBP. Bioinformatic analyses revealed that these sequences are G-enriched and show high frequency of putative G-quadruplex DNA secondary structure. Moreover, an in silico approach enabled us to establish the CNBP DNA-binding site and to predict CNBP putative targets based on gene ontology terms and synexpression with CNBP. The direct interaction between CNBP and candidate genes was proved by EMSA and ChIP assays. Besides, the role of CNBP upon the identified genes was validated in loss-of-function experiments in developing zebrafish. We successfully confirmed that CNBP up-regulates tbx2b and smarca5, and down-regulates wnt5b gene expression. The highly stringent strategy used in this work allowed us to identify new CNBP target genes functionally important in different contexts of vertebrate embryonic development. Furthermore, it represents a novel approach toward understanding the biological function and regulatory networks involving CNBP in the biology of vertebrates.
Mouguelar, Valeria S.; Allende, Miguel L.; Calcaterra, Nora B.
2013-01-01
CNBP is a nucleic acid chaperone implicated in vertebrate craniofacial development, as well as in myotonic dystrophy type 2 (DM2) and sporadic inclusion body myositis (sIBM) human muscle diseases. CNBP is highly conserved among vertebrates and has been implicated in transcriptional regulation; however, its DNA binding sites and molecular targets remain elusive. The main goal of this work was to identify CNBP DNA binding sites that might reveal target genes involved in vertebrate embryonic development. To accomplish this, we used a recently described yeast one-hybrid assay to identify DNA sequences bound in vivo by CNBP. Bioinformatic analyses revealed that these sequences are G-enriched and show high frequency of putative G-quadruplex DNA secondary structure. Moreover, an in silico approach enabled us to establish the CNBP DNA-binding site and to predict CNBP putative targets based on gene ontology terms and synexpression with CNBP. The direct interaction between CNBP and candidate genes was proved by EMSA and ChIP assays. Besides, the role of CNBP upon the identified genes was validated in loss-of-function experiments in developing zebrafish. We successfully confirmed that CNBP up-regulates tbx2b and smarca5, and down-regulates wnt5b gene expression. The highly stringent strategy used in this work allowed us to identify new CNBP target genes functionally important in different contexts of vertebrate embryonic development. Furthermore, it represents a novel approach toward understanding the biological function and regulatory networks involving CNBP in the biology of vertebrates. PMID:23667590
Structural and Thermodynamic Signatures of DNA Recognition by Mycobacterium tuberculosis DnaA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tsodikov, Oleg V.; Biswas, Tapan
An essential protein, DnaA, binds to 9-bp DNA sites within the origin of replication oriC. These binding events are prerequisite to forming an enigmatic nucleoprotein scaffold that initiates replication. The number, sequences, positions, and orientations of these short DNA sites, or DnaA boxes, within the oriCs of different bacteria vary considerably. To investigate features of DnaA boxes that are important for binding Mycobacterium tuberculosis DnaA (MtDnaA), we have determined the crystal structures of the DNA binding domain (DBD) of MtDnaA bound to a cognate MtDnaA-box (at 2.0 {angstrom} resolution) and to a consensus Escherichia coli DnaA-box (at 2.3 {angstrom}). Thesemore » structures, complemented by calorimetric equilibrium binding studies of MtDnaA DBD in a series of DnaA-box variants, reveal the main determinants of DNA recognition and establish the [T/C][T/A][G/A]TCCACA sequence as a high-affinity MtDnaA-box. Bioinformatic and calorimetric analyses indicate that DnaA-box sequences in mycobacterial oriCs generally differ from the optimal binding sequence. This sequence variation occurs commonly at the first 2 bp, making an in vivo mycobacterial DnaA-box effectively a 7-mer and not a 9-mer. We demonstrate that the decrease in the affinity of these MtDnaA-box variants for MtDnaA DBD relative to that of the highest-affinity box TTGTCCACA is less than 10-fold. The understanding of DnaA-box recognition by MtDnaA and E. coli DnaA enables one to map DnaA-box sequences in the genomes of M. tuberculosis and other eubacteria.« less
Binding Linkage in a Telomere DNA–Protein Complex at the Ends of Oxytricha nova Chromosomes
Buczek, Pawel; Orr, Rochelle S.; Pyper, Sean R.; Shum, Mili; Ota, Emily Kimmel Irene; Gerum, Shawn E.; Horvath, Martin P.
2005-01-01
Alpha and beta protein subunits of the telomere end binding protein from Oxytricha nova (OnTEBP) combine with telomere single strand DNA to form a protective cap at the ends of chromosomes. We tested how protein–protein interactions seen in the co-crystal structure relate to DNA binding through use of fusion proteins engineered as different combinations of domains and subunits derived from OnTEBP. Joining alpha and beta resulted in a protein that bound single strand telomere DNA with high affinity (KD-DNA=1.4 nM). Another fusion protein, constructed without the C-terminal protein–protein interaction domain of alpha, bound DNA with 200-fold diminished affinity (KD-DNA=290 nM) even though the DNA-binding domains of alpha and beta were joined through a peptide linker. Adding back the alpha C-terminal domain as a separate protein restored high-affinity DNA binding. The binding behaviors of these fusion proteins and the native protein subunits are consistent with cooperative linkage between protein-association and DNA-binding equilibria. Linking DNA–protein stability to protein–protein contacts at a remote site may provide a trigger point for DNA–protein disassembly during telomere replication when the single strand telomere DNA must exchange between a very stable OnTEBP complex and telomerase. PMID:15967465
Deciphering the groove binding modes of tau-fluvalinate and flumethrin with calf thymus DNA
NASA Astrophysics Data System (ADS)
Tao, Mo; Zhang, Guowen; Pan, Junhui; Xiong, Chunhong
2016-02-01
Tau-fluvalinate (TFL) and flumethrin (FL), widely used in agriculture and a class of synthetic pyrethroid pesticides with a similar structure, may cause a potential security risk. Herein, the modes of binding in vitro of TFL and FL with calf thymus DNA (ctDNA) were characterized by fluorescence, UV-vis absorption, circular dichroism (CD) and Fourier transform infrared (FT-IR) spectroscopy with the aid of viscosity measurements, melting analyses and molecular docking studies. The fluorescence titration indicated that both TFL and FL bound to ctDNA forming complexes through hydrogen bonding and van der Waals forces. The binding constants of TFL and FL with ctDNA were in the range of 104 L mol- 1, and FL exhibited a higher binding propensity than TFL. The iodide quenching effect, single/double-stranded DNA effects, and ctDNA melting and viscosity measurements demonstrated that the binding of both TFL and FL to ctDNA was groove mode. The FT-IR analyses suggested the A-T region of the minor groove of ctDNA as the preferential binding for TFL and FL, which was confirmed by the displacement assays with Hoechst 33258 probe, and the molecular docking visualized the specific binding. The changes in CD spectra indicated that both FL and TFL induced the perturbation on the base stacking and helicity of B-DNA, but the disturbance caused by FL was more obvious. Gel electrophoresis analyses indicated that both TFL and FL did not cause significant DNA cleavage. This study provides novel insights into the binding properties of TFL/FL with ctDNA and its toxic mechanisms.
Deep-sea vent phage DNA polymerase specifically initiates DNA synthesis in the absence of primers.
Zhu, Bin; Wang, Longfei; Mitsunobu, Hitoshi; Lu, Xueling; Hernandez, Alfredo J; Yoshida-Takashima, Yukari; Nunoura, Takuro; Tabor, Stanley; Richardson, Charles C
2017-03-21
A DNA polymerase is encoded by the deep-sea vent phage NrS-1. NrS-1 has a unique genome organization containing genes that are predicted to encode a helicase and a single-stranded DNA (ssDNA)-binding protein. The gene for an unknown protein shares weak homology with the bifunctional primase-polymerases (prim-pols) from archaeal plasmids but is missing the zinc-binding domain typically found in primases. We show that this gene product has efficient DNA polymerase activity and is processive in DNA synthesis in the presence of the NrS-1 helicase and ssDNA-binding protein. Remarkably, this NrS-1 DNA polymerase initiates DNA synthesis from a specific template DNA sequence in the absence of any primer. The de novo DNA polymerase activity resides in the N-terminal domain of the protein, whereas the C-terminal domain enhances DNA binding.
Modeling the interactions of the nucleotide excision repair UvrA(2) dimer with DNA.
Gantchev, Tsvetan G; Hunting, Darel J
2010-12-28
The UvrA protein initiates the DNA damage recognition process by the bacterial nucleotide excision repair (NER) system. Recently, crystallographic structures of holo-UvrA(2) dimers from two different microorganisms have been released (Protein Data Bank entries 2r6f , 2vf7 , and 2vf8 ). However, the details of the DNA binding by UvrA(2) and other peculiarities involved in the damage recognition process remain unknown. We have undertaken a molecular modeling approach to appraise the possible modes of DNA-UvrA(2) interaction using molecular docking and short-scale guided molecular dynamics [continuum field, constrained, and/or unrestricted simulated annealing (SA)], taking into account the three-dimensional location of a series of mutation-identified UvrA residues implicated in DNA binding. The molecular docking was based on the assumptions that the UvrA(2) dimer is preformed prior to DNA binding and that no major protein conformational rearrangements, except moderate domain reorientations, are required for binding of undamaged DNA. As a first approximation, DNA was treated as a rigid ligand. From the electrostatic relief of the ventral surface of UvrA(2), we initially identified three, noncollinear DNA binding paths. Each of the three resulting nucleoprotein complexes (C1, C2, and C3) was analyzed separately, including calculation of binding energies, the number and type of interaction residues (including mutated ones), and the predominant mode of translational and rotational motion of specific protein domains after SA to ensure improved DNA binding. The UvrA(2) dimer can accommodate DNA in all three orientations, albeit with different binding strengths. One of the UvrA(2)-DNA complexes (C1) fulfilled most of the requirements (high interaction energy, proximity of DNA to mutated residues, etc.) expected for a natural, high-affinity DNA binding site. This nucleoprotein presents a structural organization that is designed to clamp and bend double-stranded DNA. We examined the binding site in more detail by docking DNAs of significantly different (AT- vs CG-enriched) sequences and by submitting the complexes to DNA-unrestricted SA. It was found that in a manner independent of the DNA sequence and applied MD protocols, UvrA(2) favors binding of a bent and unwound undamaged DNA, with a kink positioned in the proximity of the Zn3 hairpins, anticollinearly aligned at the bottom of the ventral protein surface. It is further hypothesized that the Zn3 modules play an essential role in the damage recognition process and that the apparent existence of a family of DNA binding sites might be biologically relevant. Our data should prove to be useful in rational (structure-based) mutation studies.
NASA Astrophysics Data System (ADS)
Marlowe, R. L.; Szabo, A.; Lee, S. A.; Rupprecht, A.
2002-03-01
The stability of complexes of NaDNA with bipyridyl-(ethylenediamine)platinum(II) (abbreviated [(bipy)Pt(en)]) and with netropsin has been studied using two techniques: (i) ultraviolet melting experiments were done on NaDNA/[(bipy)Pt(en)], showing that the [(bipy)Pt(en)] ligand stabilizes the DNA double helix structure; and (ii) swelling measurements (via optical microscopy) as a function of relative humidity were done on wet-spun oriented films of NaDNA/[(bipy)Pt(en)] and of NaDNA/netropsin. The swelling data shows that an irreversible transition of the films occurs at high relative humidity, first for the NaDNA/netropsin, then for pure NaDNA, and lastly for the NaDNA/[(bipy)Pt(en)]. These results are indicative that the [(bipy)Pt(en)] complex stabilizes the intermolecular bonds which mediate the film swelling characteristics. A model is suggested for the binding of [(bipy)Pt(en)] to DNA to explain why the swelling experiments show this ligand as increasing the intermolecular bond strength between the DNA double helices, while netropsin decreases this degree of stabilization.
DNA Repair and the Evolution of Transformation in Bacillus Subtilis. II. Role of Inducible Repair
Wojciechowski, M. F.; Hoelzer, M. A.; Michod, R. E.
1989-01-01
In Bacillus subtilis, DNA repair and recombination are intimately associated with competence, the physiological state in which the bacterium can bind, take up and recombine exogenous DNA. Previously, we have shown that the homologous DNA transformation rate (ratio of transformants to total cells) increases with increasing UV dosage if cells are transformed after exposure to UV radiation (UV-DNA), whereas the transformation rate decreases if cells are transformed before exposure to UV (DNA-UV). In this report, by using different DNA repair-deficient mutants, we show that the greater increase in transformation rate in UV-DNA experiments than in DNA-UV experiments does not depend upon excision repair or inducible SOS-like repair, although certain quantitative aspects of the response do depend upon these repair systems. We also show that there is no increase in the transformation rate in a UV-DNA experiment when repair and recombination proficient cells are transformed with nonhomologous plasmid DNA, although the results in a DNA-UV experiment are essentially unchanged by using plasmid DNA. We have used din operon fusions as a sensitive means of assaying for the expression of genes under the control of the SOS-like regulon in both competent and noncompetent cell subpopulations as a consequence of competence development and our subsequent experimental treatments. Results indicate that the SOS-like system is induced in both competent and noncompetent subpopulations in our treatments and so should not be a major factor in the differential response in transformation rate observed in UV-DNA and DNA-UV treatments. These results provide further support to the hypothesis that the evolutionary function of competence is to bring DNA into the cell for use as template in the repair of DNA damage. PMID:2497048
DNA sensing by a Eu-binding peptide containing a proflavine unit.
Ancel, Laetitia; Gateau, Christelle; Lebrun, Colette; Delangle, Pascale
2013-01-18
Synthesis of a lanthanide-binding peptide (LBP) for the detection of double-stranded DNA is presented. A proflavine moiety was introduced into a high affinity LBP involving two unnatural chelating amino acids in the Ln ion coordination. The Eu(3+)-LBP complex is demonstrated to bind to ct-DNA and to sensitize Eu luminescence. The DNA binding process is effectively detected via the Eu-centered luminescence thanks to the intimate coupling between the LBP scaffold and DNA intercalating unit.
Buczek, Pawel; Horvath, Martin P
2006-06-23
The Oxytricha nova telemere binding protein alpha subunit binds single strand DNA and participates in a nucleoprotein complex that protects the very ends of chromosomes. To understand how the N-terminal, DNA binding domain of alpha interacts with DNA we measured the stoichiometry, enthalpy (DeltaH), entropy (DeltaS), and dissociation constant (K(D-DNA)) for binding telomere DNA fragments at different temperatures and salt concentrations using native gel electrophoresis and isothermal titration calorimetry (ITC). About 85% of the total free energy of binding corresponded with non-electrostatic interactions for all DNAs. Telomere DNA fragments d(T(2)G(4)), d(T(4)G(4)), d(G(3)T(4)G(4)), and d(G(4)T(4)G(4)) each formed monovalent protein complexes. In the case of d(T(4)G(4)T(4)G(4)), which has two tandemly repeated d(TTTTTGGGG) telomere motifs, two binding sites were observed. The high-affinity "A site" has a dissociation constant, K(D-DNA(A)) = 13(+/-4) nM, while the low-affinity "B site" is characterized by K(D-DNA(B)) = 5600(+/-600) nM at 25 degrees C. Nucleotide substitution variants verified that the A site corresponds principally with the 3'-terminal portion of d(T(4)G(4)T(4)G(4)). The relative contributions of entropy (DeltaS) and enthalpy (DeltaH) for binding reactions were DNA length-dependent as was heat capacity (DeltaCp). These trends with respect to DNA length likely reflect structural transitions in the DNA molecule that are coupled with DNA-protein association. Results presented here are important for understanding early intermediates and subsequent stages in the assembly of the full telomere nucleoprotein complex and how binding events can prepare the telomere DNA for extension by telomerase, a critical event in telomere biology.
Real-Time Analysis of Specific Protein-DNA Interactions with Surface Plasmon Resonance
Ritzefeld, Markus; Sewald, Norbert
2012-01-01
Several proteins, like transcription factors, bind to certain DNA sequences, thereby regulating biochemical pathways that determine the fate of the corresponding cell. Due to these key positions, it is indispensable to analyze protein-DNA interactions and to identify their mode of action. Surface plasmon resonance is a label-free method that facilitates the elucidation of real-time kinetics of biomolecular interactions. In this article, we focus on this biosensor-based method and provide a detailed guide how SPR can be utilized to study binding of proteins to oligonucleotides. After a description of the physical phenomenon and the instrumental realization including fiber-optic-based SPR and SPR imaging, we will continue with a survey of immobilization methods. Subsequently, we will focus on the optimization of the experiment, expose pitfalls, and introduce how data should be analyzed and published. Finally, we summarize several interesting publications of the last decades dealing with protein-DNA and RNA interaction analysis by SPR. PMID:22500214
Structural basis for DNA binding by replication initiator Mcm10
DOE Office of Scientific and Technical Information (OSTI.GOV)
Warren, Eric M.; Vaithiyalingam, Sivaraja; Haworth, Justin
2009-06-30
Mcm10 is an essential eukaryotic DNA replication protein required for assembly and progression of the replication fork. The highly conserved internal domain (Mcm10-ID) has been shown to physically interact with single-stranded (ss) DNA, DNA polymerase alpha, and proliferating cell nuclear antigen (PCNA). The crystal structure of Xenopus laevis Mcm10-ID presented here reveals a DNA binding architecture composed of an oligonucleotide/oligosaccharide-fold followed in tandem by a variant and highly basic zinc finger. NMR chemical shift perturbation and mutational studies of DNA binding activity in vitro reveal how Mcm10 uses this unique surface to engage ssDNA. Corresponding mutations in Saccharomyces cerevisiae resultmore » in increased sensitivity to replication stress, demonstrating the functional importance of DNA binding by this region of Mcm10 to replication. In addition, mapping Mcm10 mutations known to disrupt PCNA, polymerase alpha, and DNA interactions onto the crystal structure provides insight into how Mcm10 might coordinate protein and DNA binding within the replisome.« less
Non-B-Form DNA Is Enriched at Centromeres
Henikoff, Steven
2018-01-01
Abstract Animal and plant centromeres are embedded in repetitive “satellite” DNA, but are thought to be epigenetically specified. To define genetic characteristics of centromeres, we surveyed satellite DNA from diverse eukaryotes and identified variation in <10-bp dyad symmetries predicted to adopt non-B-form conformations. Organisms lacking centromeric dyad symmetries had binding sites for sequence-specific DNA-binding proteins with DNA-bending activity. For example, human and mouse centromeres are depleted for dyad symmetries, but are enriched for non-B-form DNA and are associated with binding sites for the conserved DNA-binding protein CENP-B, which is required for artificial centromere function but is paradoxically nonessential. We also detected dyad symmetries and predicted non-B-form DNA structures at neocentromeres, which form at ectopic loci. We propose that centromeres form at non-B-form DNA because of dyad symmetries or are strengthened by sequence-specific DNA binding proteins. This may resolve the CENP-B paradox and provide a general basis for centromere specification. PMID:29365169
Cdc45-induced loading of human RPA onto single-stranded DNA
Tessmer, Ingrid; Prus, Piotr; Schlott, Bernhard; Pospiech, Helmut
2017-01-01
Abstract Cell division cycle protein 45 (Cdc45) is an essential component of the eukaryotic replicative DNA helicase. We found that human Cdc45 forms a complex with the single-stranded DNA (ssDNA) binding protein RPA. Moreover, it actively loads RPA onto nascent ssDNA. Pull-down assays and surface plasmon resonance studies revealed that Cdc45-bound RPA complexed with ssDNA in the 8–10 nucleotide binding mode, but dissociated when RPA covered a 30-mer. Real-time analysis of RPA-ssDNA binding demonstrated that Cdc45 catalytically loaded RPA onto ssDNA. This placement reaction required physical contacts of Cdc45 with the RPA70A subdomain. Our results imply that Cdc45 controlled stabilization of the 8-nt RPA binding mode, the subsequent RPA transition into 30-mer mode and facilitated an ordered binding to ssDNA. We propose that a Cdc45-mediated loading guarantees a seamless deposition of RPA on newly emerging ssDNA at the nascent replication fork. PMID:28100698
A new trinuclear complex of platinum and iron efficiently promotes cleavage of plasmid DNA.
Lempers, E L; Bashkin, J S; Kostić, N M
1993-01-01
The compound [[Pt(trpy)]2Arg-EDTA]+ is synthesized in five steps, purified, and characterized by 1H, 13C, and 195Pt NMR spectroscopy, mass spectrometry, UV-vis spectrophotometry, and elemental analysis. The binuclear [[(Pt(trpy)]2Arg]3+ moiety binds to double-stranded DNA, and the chelating EDTA moiety holds metal cations. In the presence of ferrous ions and the reductant dithiothreitol, the new compound cleaves DNA. It cleaves a single strand in the pBR322 plasmid nearly as efficiently as methidiumrpropyl-EDTA (MPE), and it cleaves a restriction fragment of the XP10 plasmid nonselectively and more efficiently than [Fe(EDTA)]2-. The mechanism of cleavage was studied in control experiments involving different transition-metal ions, superoxide dismutase, catalase, glucose oxidase with glucose, metal-sequestering agents, and deaeration. These experiments indicate that adventitious iron and copper ions, superoxide anion, and hydrogen peroxide are not involved and that dioxygen is required. The cleavage apparently is done by hydroxyl radicals generated in the vicinity of the DNA molecule. The reagent [[Pt(trypy)]2Arg-EDTA]+ differs from methidiumpropyl-EDTA in not containing an intercalator. This difference in binding modes between the binuclear platinum(II) complex and the planar heterocycle may cause useful differences between the two reagents in cleavage of nucleic acids. Images PMID:8493109
Peixoto, Paul; Liu, Yang; Depauw, Sabine; Hildebrand, Marie-Paule; Boykin, David W; Bailly, Christian; Wilson, W David; David-Cordonnier, Marie-Hélène
2008-06-01
The development of small molecules to control gene expression could be the spearhead of future-targeted therapeutic approaches in multiple pathologies. Among heterocyclic dications developed with this aim, a phenyl-furan-benzimidazole dication DB293 binds AT-rich sites as a monomer and 5'-ATGA sequence as a stacked dimer, both in the minor groove. Here, we used a protein/DNA array approach to evaluate the ability of DB293 to specifically inhibit transcription factors DNA-binding in a single-step, competitive mode. DB293 inhibits two POU-domain transcription factors Pit-1 and Brn-3 but not IRF-1, despite the presence of an ATGA and AT-rich sites within all three consensus sequences. EMSA, DNase I footprinting and surface-plasmon-resonance experiments determined the precise binding site, affinity and stoichiometry of DB293 interaction to the consensus targets. Binding of DB293 occurred as a cooperative dimer on the ATGA part of Brn-3 site but as two monomers on AT-rich sites of IRF-1 sequence. For Pit-1 site, ATGA or AT-rich mutated sequences identified the contribution of both sites for DB293 recognition. In conclusion, DB293 is a strong inhibitor of two POU-domain transcription factors through a cooperative binding to ATGA. These findings are the first to show that heterocyclic dications can inhibit major groove transcription factors and they open the door to the control of transcription factors activity by those compounds.
Frouco, Gonçalo; Freitas, Ferdinando B; Coelho, João; Leitão, Alexandre; Martins, Carlos; Ferreira, Fernando
2017-06-15
African swine fever virus (ASFV) codes for a putative histone-like protein (pA104R) with extensive sequence homology to bacterial proteins that are implicated in genome replication and packaging. Functional characterization of purified recombinant pA104R revealed that it binds to single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) over a wide range of temperatures, pH values, and salt concentrations and in an ATP-independent manner, with an estimated binding site size of about 14 to 16 nucleotides. Using site-directed mutagenesis, the arginine located in pA104R's DNA-binding domain, at position 69, was found to be relevant for efficient DNA-binding activity. Together, pA104R and ASFV topoisomerase II (pP1192R) display DNA-supercoiling activity, although none of the proteins by themselves do, indicating that the two cooperate in this process. In ASFV-infected cells, A104R transcripts were detected from 2 h postinfection (hpi) onward, reaching a maximum concentration around 16 hpi. pA104R was detected from 12 hpi onward, localizing with viral DNA replication sites and being found exclusively in the Triton-insoluble fraction. Small interfering RNA (siRNA) knockdown experiments revealed that pA104R plays a critical role in viral DNA replication and gene expression, with transfected cells showing lower viral progeny numbers (up to a reduction of 82.0%), lower copy numbers of viral genomes (-78.3%), and reduced transcription of a late viral gene (-47.6%). Taken together, our results strongly suggest that pA104R participates in the modulation of viral DNA topology, probably being involved in viral DNA replication, transcription, and packaging, emphasizing that ASFV mutants lacking the A104R gene could be used as a strategy to develop a vaccine against ASFV. IMPORTANCE Recently reintroduced in Europe, African swine fever virus (ASFV) causes a fatal disease in domestic pigs, causing high economic losses in affected countries, as no vaccine or treatment is currently available. Remarkably, ASFV is the only known mammalian virus that putatively codes for a histone-like protein (pA104R) that shares extensive sequence homology with bacterial histone-like proteins. In this study, we characterized the DNA-binding properties of pA104R, analyzed the functional importance of two conserved residues, and showed that pA104R and ASFV topoisomerase II cooperate and display DNA-supercoiling activity. Moreover, pA104R is expressed during the late phase of infection and accumulates in viral DNA replication sites, and its downregulation revealed that pA104R is required for viral DNA replication and transcription. These results suggest that pA104R participates in the modulation of viral DNA topology and genome packaging, indicating that A104R deletion mutants may be a good strategy for vaccine development against ASFV. Copyright © 2017 American Society for Microbiology.
Malhotra, Sony; Sowdhamini, Ramanathan
2013-08-01
The interaction of proteins with their respective DNA targets is known to control many high-fidelity cellular processes. Performing a comprehensive survey of the sequenced genomes for DNA-binding proteins (DBPs) will help in understanding their distribution and the associated functions in a particular genome. Availability of fully sequenced genome of Arabidopsis thaliana enables the review of distribution of DBPs in this model plant genome. We used profiles of both structure and sequence-based DNA-binding families, derived from PDB and PFam databases, to perform the survey. This resulted in 4471 proteins, identified as DNA-binding in Arabidopsis genome, which are distributed across 300 different PFam families. Apart from several plant-specific DNA-binding families, certain RING fingers and leucine zippers also had high representation. Our search protocol helped to assign DNA-binding property to several proteins that were previously marked as unknown, putative or hypothetical in function. The distribution of Arabidopsis genes having a role in plant DNA repair were particularly studied and noted for their functional mapping. The functions observed to be overrepresented in the plant genome harbour DNA-3-methyladenine glycosylase activity, alkylbase DNA N-glycosylase activity and DNA-(apurinic or apyrimidinic site) lyase activity, suggesting their role in specialized functions such as gene regulation and DNA repair.
Hilbert, Brendan J.; Hayes, Janelle A.; Stone, Nicholas P.; Xu, Rui-Gang
2017-01-01
Abstract Many viruses use a powerful terminase motor to pump their genome inside an empty procapsid shell during virus maturation. The large terminase (TerL) protein contains both enzymatic activities necessary for packaging in such viruses: the adenosine triphosphatase (ATPase) that powers DNA translocation and an endonuclease that cleaves the concatemeric genome at both initiation and completion of genome packaging. However, how TerL binds DNA during translocation and cleavage remains mysterious. Here we investigate DNA binding and cleavage using TerL from the thermophilic phage P74-26. We report the structure of the P74-26 TerL nuclease domain, which allows us to model DNA binding in the nuclease active site. We screened a large panel of TerL variants for defects in binding and DNA cleavage, revealing that the ATPase domain is the primary site for DNA binding, and is required for nuclease activity. The nuclease domain is dispensable for DNA binding but residues lining the active site guide DNA for cleavage. Kinetic analysis of DNA cleavage suggests flexible tethering of the nuclease domains during DNA cleavage. We propose that interactions with the procapsid during DNA translocation conformationally restrict the nuclease domain, inhibiting cleavage; TerL release from the capsid upon completion of packaging unlocks the nuclease domains to cleave DNA. PMID:28082398
DOE Office of Scientific and Technical Information (OSTI.GOV)
Niyogi, S.K.; Ratrie, H. III; Datta, A.K.
E. coli DNA binding protein strongly inhibits the transcription of single-stranded rather than double-stranded phage M13 DNA by E. coli RNA polymerase. This inhibition cannot be significantly overcome by increasing the concentration of RNA polymerase. Nor does the order of addition of binding protein affect its inhibitory property: inhibition is evident whether binding protein is added before or after the formation of the RNA polymerase--DNA complex. Inhibition is also observed if binding protein is added at various times after initiation of RNA synthesis. Maximal inhibition occurs at a binding protein-to-DNA ratio (w/w) of about 8:1. This corresponds to one bindingmore » protein molecule covering about 30 nucleotides, in good agreement with values obtained by physical measurements.« less
Mulholland, Kelly; Siddiquei, Farzana; Wu, Chun
2017-07-19
RHPS4, a potent binder to human telomeric DNA G-quadruplex, shows high efficacy in tumor cell growth inhibition. However, it's preferential binding to DNA G-quadruplex over DNA duplex (about 10 fold) remains to be improved toward its clinical application. A high resolution structure of the single-stranded telomeric DNA G-quadruplexes, or B-DNA duplex, in complex with RHPS4 is not available yet, and the binding nature of this ligand to these DNA forms remains to be elusive. In this study, we carried out 40 μs molecular dynamics binding simulations with a free ligand to decipher the binding pathway of RHPS4 to a DNA duplex and three G-quadruplex folders (parallel, antiparallel and hybrid) of the human telomeric DNA sequence. The most stable binding mode identified for the duplex, parallel, antiparallel and hybrid G-quadruplexes is an intercalation, bottom stacking, top intercalation and bottom intercalation mode, respectively. The intercalation mode with similar binding strength to both the duplex and the G-quadruplexes, explains the lack of binding selectivity of RHPS4 to the G-quadruplex form. Therefore, a ligand modification that destabilizes the duplex intercalation mode but stabilizes the G-quadruplex intercalation mode will improve the binding selectivity toward G-quadruplex. The intercalation mode of RHPS4 to both the duplex and the antiparallel and the hybrid G-quadruplex follows a base flipping-insertion mechanism rather than an open-insertion mechanism. The groove binding, the side binding and the intercalation with flipping out of base were observed to be intermediate states before the full intercalation state with paired bases.
Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models.
Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook
2014-11-01
As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of our knowledge, this is the first attempt to predict protein-binding nucleotides in a given DNA sequence from the sequence data alone. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Shinohara, Takeshi; Ikawa, Shukuko; Iwasaki, Wakana; Hiraki, Toshiki; Hikima, Takaaki; Mikawa, Tsutomu; Arai, Naoto; Kamiya, Nobuo; Shibata, Takehiko
2015-01-01
In all organisms, RecA-family recombinases catalyze homologous joint formation in homologous genetic recombination, which is essential for genome stability and diversification. In homologous joint formation, ATP-bound RecA/Rad51-recombinases first bind single-stranded DNA at its primary site and then interact with double-stranded DNA at another site. The underlying reason and the regulatory mechanism for this conserved binding order remain unknown. A comparison of the loop L1 structures in a DNA-free RecA crystal that we originally determined and in the reported DNA-bound active RecA crystals suggested that the aspartate at position 161 in loop L1 in DNA-free RecA prevented double-stranded, but not single-stranded, DNA-binding to the primary site. This was confirmed by the effects of the Ala-replacement of Asp-161 (D161A), analyzed directly by gel-mobility shift assays and indirectly by DNA-dependent ATPase activity and SOS repressor cleavage. When RecA/Rad51-recombinases interact with double-stranded DNA before single-stranded DNA, homologous joint-formation is suppressed, likely by forming a dead-end product. We found that the D161A-replacement reduced this suppression, probably by allowing double-stranded DNA to bind preferentially and reversibly to the primary site. Thus, Asp-161 in the flexible loop L1 of wild-type RecA determines the preference for single-stranded DNA-binding to the primary site and regulates the DNA-binding order in RecA-catalyzed recombinase reactions. PMID:25561575
Belgrano, Fabricio S.; de Abreu da Silva, Isabel C.; Bastos de Oliveira, Francisco M.; Fantappié, Marcelo R.; Mohana-Borges, Ronaldo
2013-01-01
High mobility group box (HMGB) proteins are abundant nonhistone proteins found in all eukaryotic nuclei and are capable of binding/bending DNA. The human HMGB1 is composed of two binding motifs, known as Boxes A and B, are L-shaped alpha-helix structures, followed by a random-coil acidic tail that consists of 30 Asp and Glu residues. This work aimed at evaluating the role of the acidic tail of human HMGB1 in protein stability and DNA interactions. For this purpose, we cloned, expressed and purified HMGB1 and its tailless form, HMGB1ΔC, in E. coli strain. Tryptophan fluorescence spectroscopy and circular dichroism (CD) experiments clearly showed an increase in protein stability promoted by the acidic tail under different conditions, such as the presence of the chemical denaturant guanidine hydrochloride (Gdn.HCl), high temperature and low pH. Folding intermediates found at low pH for both proteins were denatured only in the presence of chemical denaturant, thus showing a relatively high stability. The acidic tail did not alter the DNA-binding properties of the protein, although it enhanced the DNA bending capability from 76° (HMGB1ΔC) to 91° (HMGB1), as measured using the fluorescence resonance energy transfer technique. A model of DNA bending in vivo was proposed, which might help to explain the interaction of HMGB1 with DNA and other proteins, i.e., histones, and the role of that protein in chromatin remodeling. PMID:24255708
Structures of apo IRF-3 and IRF-7 DNA binding domains: effect of loop L1 on DNA binding
DOE Office of Scientific and Technical Information (OSTI.GOV)
De Ioannes, Pablo; Escalante, Carlos R.; Aggarwal, Aneel K.
2013-11-20
Interferon regulatory factors IRF-3 and IRF-7 are transcription factors essential in the activation of interferon-{beta} (IFN-{beta}) gene in response to viral infections. Although, both proteins recognize the same consensus IRF binding site AANNGAAA, they have distinct DNA binding preferences for sites in vivo. The X-ray structures of IRF-3 and IRF-7 DNA binding domains (DBDs) bound to IFN-{beta} promoter elements revealed flexibility in the loops (L1-L3) and the residues that make contacts with the target sequence. To characterize the conformational changes that occur on DNA binding and how they differ between IRF family members, we have solved the X-ray structures ofmore » IRF-3 and IRF-7 DBDs in the absence of DNA. We found that loop L1, carrying the conserved histidine that interacts with the DNA minor groove, is disordered in apo IRF-3 but is ordered in apo IRF-7. This is reflected in differences in DNA binding affinities when the conserved histidine in loop L1 is mutated to alanine in the two proteins. The stability of loop L1 in IRF-7 derives from a unique combination of hydrophobic residues that pack against the protein core. Together, our data show that differences in flexibility of loop L1 are an important determinant of differential IRF-DNA binding.« less
Isolation and characterization of target sequences of the chicken CdxA homeobox gene.
Margalit, Y; Yarus, S; Shapira, E; Gruenbaum, Y; Fainsod, A
1993-01-01
The DNA binding specificity of the chicken homeodomain protein CDXA was studied. Using a CDXA-glutathione-S-transferase fusion protein, DNA fragments containing the binding site for this protein were isolated. The sources of DNA were oligonucleotides with random sequence and chicken genomic DNA. The DNA fragments isolated were sequenced and tested in DNA binding assays. Sequencing revealed that most DNA fragments are AT rich which is a common feature of homeodomain binding sites. By electrophoretic mobility shift assays it was shown that the different target sequences isolated bind to the CDXA protein with different affinities. The specific sequences bound by the CDXA protein in the genomic fragments isolated, were determined by DNase I footprinting. From the footprinted sequences, the CDXA consensus binding site was determined. The CDXA protein binds the consensus sequence A, A/T, T, A/T, A, T, A/G. The CAUDAL binding site in the ftz promoter is also included in this consensus sequence. When tested, some of the genomic target sequences were capable of enhancing the transcriptional activity of reporter plasmids when introduced into CDXA expressing cells. This study determined the DNA sequence specificity of the CDXA protein and it also shows that this protein can further activate transcription in cells in culture. Images PMID:7909943
Andera, L; Spangler, C J; Galeone, A; Mayol, L; Geiduschek, E P
1994-02-11
TF1, a homodimeric DNA-binding and -bending protein with a preference for hydroxymethyluracil-containing DNA is the Bacillus subtilis-encoded homolog of the bacterial HU proteins and of the E. coli integration host factor. A temperature-sensitive mutation at amino acid 25 of TF1 (L25-->A) and two intragenic second site revertants at amino acids 15 (E15-->G) and 32 (L32-->I) were previously identified and their effects on virus development were examined. The DNA-binding properties of these proteins and the thermal stability of their secondary structures have now been analyzed. Amino acids 15 and 32 are far removed from the putative DNA-binding domains of TF1 but changes there exert striking effects on DNA affinity that correlate with effects on structure. The double mutant protein TF1-G15I32 binds to a preferred site in hydroxymethyluracil-containing DNA 40 times more tightly, denatures at higher temperature (delta tm = 21 degrees C), and also exchanges subunits much more slowly than does the wild-type protein. The L25-->A mutation makes TF1 secondary structure and DNA-binding highly salt concentration-dependent. The E15-->G mutation partly suppresses this effect: secondary structure of TF1-A25G15 is restored at 21 degrees C by 1 M NaCl or, at low NaCl concentration, by binding to DNA.
Alonso, A; Almendral, M J; Curto, Y; Criado, J J; Rodríguez, E; Manzano, J L
2006-08-15
Flow injection analysis was used to study the reactions occurring between DNA and certain compounds that bind to its double helix, deforming this and even breaking it, such that some of them (e.g., cisplatin) are endowed with antitumoral activity. Use of this technique in the merging zones and stopped-flow modes afforded data on the binding parameters and the kinetic characteristics of the process. The first compound studied was ethidium bromide (EtdBr), used as a fluorescent marker because its fluorescence is enhanced when it binds to DNA. The DNA-EtdBr binding parameters, the apparent intrinsic binding constant (0.31+/-0.02 microM(-1)), and the maximum number of binding sites per nucleotide (0.327+/-0.009) were determined. The modification introduced in these parameters by the presence of proflavine (Prf), a classic competitive inhibitor of the binding of EtdBr to the DNA double helix, was also studied, determining the value of the intrinsic binding constant of Prf (K(Prf) = 0.119+/-9x10(-3) microM(-1)). Finally, we determined the binding parameters between DNA and EtdBr in the presence of the antitumor agent cisplatin, a noncompetitive inhibitor of such binding. This provided information about the binding mechanism as well as the duration and activity of the binding of the compound in its pharmacological use.
Buczek, Pawel; Horvath, Martin P.
2010-01-01
The Oxytricha nova telomere binding protein alpha subunit binds single strand DNA and participates in a nucleoprotein complex that protects the very ends of chromosomes. To understand how the N-terminal, DNA binding domain of alpha interacts with DNA we measured the stoichiometry, enthalpy (ΔH), entropy (ΔS), and dissociation constant (KD-DNA) for binding telomere DNA fragments at different temperatures and salt concentrations using native gel electrophoresis and isothermal titration calorimetry (ITC). About 85% of the total free energy of binding corresponded with non-electrostatic interactions for all DNAs. Telomere DNA fragments d(T2G4), d(T4G4), d(G3T4G4), and d(G4T4G4) each formed monovalent protein complexes. In the case of d(T4G4T4G4), which has two tandemly repeated d(TTTTTGGGG) telomere motifs, two binding sites were observed. The high-affinity “A site” has a dissociation constant, KD-DNA(A)=13(±4) nM, while the low-affinity “B site” is characterized by KD-DNA(B)=5600(±600) nM at 25 °C. Nucleotide substitution variants verified that the A site corresponds principally with the 3′-terminal portion of d(T4G4T4G4). The relative contributions of entropy (ΔS) and enthalpy (ΔH) for binding reactions were DNA length-dependent as was heat capacity (ΔCp). These trends with respect to DNA length likely reflect structural transitions in the DNA molecule that are coupled with DNA–protein association. Results presented here are important for understanding early intermediates and subsequent stages in the assembly of the full telomere nucleoprotein complex and how binding events can prepare the telomere DNA for extension by telomerase, a critical event in telomere biology. PMID:16678852
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hastings, Adam F.; Otting, Gottfried; Folmer, Rutger H.A.
2005-09-23
Termination of DNA replication in Bacillus subtilis involves the polar arrest of replication forks by a specific complex formed between the dimeric 29 kDa replication terminator protein (RTP) and DNA terminator sites. We have used NMR spectroscopy to probe the changes in {sup 1}H-{sup 15}N correlation spectra of a {sup 15}N-labelled RTP.C110S mutant upon the addition of a 21 base pair symmetrical DNA binding site. Assignment of the {sup 1}H-{sup 15}N correlations was achieved using a suite of triple resonance NMR experiments with {sup 15}N,{sup 13}C,70% {sup 2}H enriched protein recorded at 800 MHz and using TROSY pulse sequences. Perturbationsmore » to {sup 1}H-{sup 15}N spectra revealed that the N-termini, {alpha}3-helices and several loops are affected by the binding interaction. An analysis of this data in light of the crystallographically determined apo- and DNA-bound forms of RTP.C110S revealed that the NMR spectral perturbations correlate more closely to protein structural changes upon complex formation rather than to interactions at the protein-DNA interface.« less
Protein-nucleotide contacts in motor proteins detected by DNP-enhanced solid-state NMR.
Wiegand, Thomas; Liao, Wei-Chih; Ong, Ta Chung; Däpp, Alexander; Cadalbert, Riccardo; Copéret, Christophe; Böckmann, Anja; Meier, Beat H
2017-11-01
DNP (dynamic nuclear polarization)-enhanced solid-state NMR is employed to directly detect protein-DNA and protein-ATP interactions and identify the residue type establishing the intermolecular contacts. While conventional solid-state NMR can detect protein-DNA interactions in large oligomeric protein assemblies in favorable cases, it typically suffers from low signal-to-noise ratios. We show here, for the oligomeric DnaB helicase from Helicobacter pylori complexed with ADP and single-stranded DNA, that this limitation can be overcome by using DNP-enhanced spectroscopy. Interactions are established by DNP-enhanced 31 P- 13 C polarization-transfer experiments followed by the recording of a 2D 13 C- 13 C correlation experiment. The NMR spectra were obtained in less than 2 days and allowed the identification of residues of the motor protein involved in nucleotide binding.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jha, Jyoti K.; Li, Mi; Ghirlando, Rodolfo
Replication of Vibrio cholerae chromosome 2 (Chr2) depends on molecular chaperone DnaK to facilitate binding of the initiator (RctB) to the replication origin. The binding occurs at two kinds of site, 12-mers and 39-mers, which promote and inhibit replication, respectively. Here we show that DnaK employs different mechanisms to enhance the two kinds of binding. We found that mutations inrctBthat reduce DnaK binding also reduce 12-mer binding and initiation. The initiation defect is suppressed by second-site mutations that increase 12-mer binding only marginally. Instead, they reduce replication inhibitory mechanisms: RctB dimerization and 39-mer binding. One suppressing change was in amore » dimerization domain which is folded similarly to the initiator of an iteron plasmid—the presumed progenitor of Chr2. In plasmids, DnaK promotes initiation by reducing dimerization. A different mutation was in the 39-mer binding domain of RctB and inactivated it, indicating an alternative suppression mechanism. Paradoxically, although DnaK increases 39-mer binding, the increase was also achieved by inactivating the DnaK binding site of RctB. This result suggests that the site inhibits the 39-mer binding domain (via autoinhibition) when prevented from binding DnaK. Taken together, our results reveal an important feature of the transition from plasmid to chromosome: the Chr2 initiator retains the plasmid-like dimerization domain and its control by chaperones but uses the chaperones in an unprecedented way to control the inhibitory 39-mer binding. IMPORTANCE The capacity of proteins to undergo remodeling provides opportunities to control their function. However, remodeling remains a poorly understood aspect of the structure-function paradigm due to its dynamic nature. Here we have studied remodeling of the initiator of replication ofVibrio choleraeChr2 by the molecular chaperone, DnaK. We show that DnaK binds to a site on the Chr2 initiator (RctB) that promotes initiation by reducing the initiator’s propensity to dimerize. Dimerization of the initiator of the putative plasmid progenitor of Chr2 is also reduced by DnaK, which promotes initiation. Paradoxically, the DnaK binding also promotes replication inhibition by reducing an autoinhibitory activity of RctB. In the plasmid-to-chromosome transition, it appears that the initiator has acquired an autoinhibitory activity and along with it a new chaperone activity that apparently helps to control replication inhibition independently of replication promotion.« less
Nayab, Pattan Sirajuddin; Akrema; Ansari, Istikhar A; Shahid, Mohammad; Rahisuddin
2017-08-01
Herein, we investigated new phthalimide-based Schiff base molecules as promising DNA-binding and free radical scavenging agents. Physicochemical properties of these molecules were demonstrated on the basis of elemental analysis, ultraviolet-visible (UV-Vis), infra-red (IR), 1 H and 13 C nuclear magnetic resonance (NMR) spectroscopy. All spectral data are agreed well with the proposed Schiff base framework. The DNA-binding potential of synthesized compounds were investigated by means of UV-visible, fluorescence, iodide quenching, circular dichroism, viscosity and thermal denaturation studies. The intrinsic binding constants (K b ) were calculated from absorption studies were found to be 1.1 × 10 4 and 1.0 × 10 4 M -1 for compounds 2a and 2b suggesting that compound 2a binding abilities with DNA were stronger than the compound 2b. Our studies showed that the presented compounds interact with DNA through groove binding. Molecular docking studies were carried out to predict the binding between Ct-DNA and test compounds. Interestingly, in silico predictions were corroborated with in vitro DNA-binding conclusions. Furthermore, the title compounds displayed remarkable antioxidant activity compared with reference standard. Copyright © 2016 John Wiley & Sons, Ltd.
Slayton, Mark; Hossain, Tanvir; Biegalke, Bonita J
2018-05-01
The human cytomegalovirus (HCMV) UL34 gene encodes sequence-specific DNA-binding proteins (pUL34) which are required for viral replication. Interactions of pUL34 with DNA binding sites represses transcription of two viral immune evasion genes, US3 and US9. 12 additional predicted pUL34-binding sites are present in the HCMV genome (strain AD169) with three binding sites concentrated near the HCMV origin of lytic replication (oriLyt). We used ChIP-seq analysis of pUL34-DNA interactions to confirm that pUL34 binds to the oriLyt region during infection. Mutagenesis of the UL34-binding sites in an oriLyt-containing plasmid significantly reduced viral-mediated oriLyt-dependent DNA replication. Mutagenesis of these sites in the HCMV genome reduced the replication efficiencies of the resulting viruses. Protein-protein interaction analyses demonstrated that pUL34 interacts with the viral proteins IE2, UL44, and UL84, that are essential for viral DNA replication, suggesting that pUL34-DNA interactions in the oriLyt region are involved in the DNA replication cascade. Copyright © 2018 Elsevier Inc. All rights reserved.
Baril, E; Bonin, P; Burstein, D; Mara, K; Zamecnik, P
1983-01-01
A diadenosine 5',5"'-P1,P4-tetraphosphate (Ap4A) binding subunit has been resolved from a high molecular weight (640,000) multiprotein form of DNA polymerase alpha [deoxynucleoside triphosphate:DNA nucleotidyltransferase (DNA-directed), EC 2.7.7.7] from HeLa cells [DNA polymerase alpha 2 of Lamothe, P., Baril, B., Chi, A., Lee, L. & Baril, E. (1981) Proc. Natl. Acad. Sci. USA 78, 4723-4727]. The Ap4A binding activity copurifies with the DNA polymerizing activity during the course of purification. Hydrophobic chromatography on butylagarose resolves the Ap4A binding activity from the DNA polymerase. The Ap4A binding activity is protein in nature since the binding of Ap4A is abolished by treatment of the isolated binding activity with proteinase K but is insensitive to treatment with DNase or RNase. The molecular weight of the Ap4A binding protein, as determined by polyacrylamide gel electrophoresis under nondenaturing conditions or by NaDodSO4/polyacrylamide gel electrophoresis after photoaffinity labeling of the protein with [32P]Ap4A is 92,000 or 47,000. The binding activity of this protein is highly specific for Ap4A. Images PMID:6576366
End-specific strategies of attachment of long double stranded DNA onto gold-coated nanofiber arrays
NASA Astrophysics Data System (ADS)
Peckys, Diana B.; de Jonge, Niels; Simpson, Michael L.; McKnight, Timothy E.
2008-10-01
We report the effective and site-specific binding of long double stranded (ds)DNA to high aspect ratio carbon nanofiber arrays. The carbon nanofibers were first coated with a thin gold layer to provide anchorage for two controllable binding methods. One method was based on the direct binding of thiol end-labeled dsDNA. The second and enhanced method used amine end-labeled dsDNA bound with crosslinkers to a carboxyl-terminated self-assembled monolayer. The bound dsDNA was first visualized with a fluorescent, dsDNA-intercalating dye. The specific binding onto the carbon nanofiber was verified by a high resolution detection method using scanning electron microscopy in combination with the binding of neutravidin-coated fluorescent microspheres to the immobilized and biotinylated dsDNA. Functional activity of thiol end-labeled dsDNA on gold-coated nanofiber arrays was verified with a transcriptional assay, whereby Chinese hamster lung cells (V79) were impaled upon the DNA-modified nanofibers and scored for transgene expression of the tethered template. Thiol end-labeled dsDNA demonstrated significantly higher expression levels than nanofibers prepared with control dsDNA that lacked a gold-binding end-label. Employing these site-specific and robust techniques of immobilization of dsDNA onto nanodevices can be of advantage for the study of DNA/protein interactions and for gene delivery applications.
Huang, You-Yi; Deng, Jiao-Yu; Gu, Jing; Zhang, Zhi-Ping; Maxwell, Anthony; Bi, Li-Jun; Chen, Yuan-Yuan; Zhou, Ya-Feng; Yu, Zi-Niu; Zhang, Xian-En
2006-01-01
As only the type II topoisomerase is capable of introducing negative supercoiling, DNA gyrase is involved in crucial cellular processes. Although the other domains of DNA gyrase are better understood, the mechanism of DNA binding by the C-terminal domain of the DNA gyrase A subunit (GyrA-CTD) is less clear. Here, we investigated the DNA-binding sites in the GyrA-CTD of Mycobacterium tuberculosis gyrase through site-directed mutagenesis. The results show that Y577, R691 and R745 are among the key DNA-binding residues in M.tuberculosis GyrA-CTD, and that the third blade of the GyrA-CTD is the main DNA-binding region in M.tuberculosis DNA gyrase. The substitutions of Y577A, D669A, R691A, R745A and G729W led to the loss of supercoiling and relaxation activities, although they had a little effect on the drug-dependent DNA cleavage and decatenation activities, and had no effect on the ATPase activity. Taken together, these results showed that the GyrA-CTD is essential to DNA gyrase of M.tuberculosis, and promote the idea that the M.tuberculosis GyrA-CTD is a new potential target for drug design. It is the first time that the DNA-binding sites in GyrA-CTD have been identified. PMID:17038336
Molecular dynamics studies on the DNA-binding process of ERG.
Beuerle, Matthias G; Dufton, Neil P; Randi, Anna M; Gould, Ian R
2016-11-15
The ETS family of transcription factors regulate gene targets by binding to a core GGAA DNA-sequence. The ETS factor ERG is required for homeostasis and lineage-specific functions in endothelial cells, some subset of haemopoietic cells and chondrocytes; its ectopic expression is linked to oncogenesis in multiple tissues. To date details of the DNA-binding process of ERG including DNA-sequence recognition outside the core GGAA-sequence are largely unknown. We combined available structural and experimental data to perform molecular dynamics simulations to study the DNA-binding process of ERG. In particular we were able to reproduce the ERG DNA-complex with a DNA-binding simulation starting in an unbound configuration with a final root-mean-square-deviation (RMSD) of 2.1 Å to the core ETS domain DNA-complex crystal structure. This allowed us to elucidate the relevance of amino acids involved in the formation of the ERG DNA-complex and to identify Arg385 as a novel key residue in the DNA-binding process. Moreover we were able to show that water-mediated hydrogen bonds are present between ERG and DNA in our simulations and that those interactions have the potential to achieve sequence recognition outside the GGAA core DNA-sequence. The methodology employed in this study shows the promising capabilities of modern molecular dynamics simulations in the field of protein DNA-interactions.
Biggar, Kyle K; Storey, Kenneth B
2018-01-01
In many cases, the DNA-binding activity of a transcription factor does not change, while its transcriptional activity is greatly influenced by the make-up of bound proteins. In this study, we assessed the protein composition and DNA-binding ability of the E2F transcription factor complex to provide insight into cell cycle control in an anoxia tolerant turtle through the use of a modified ELISA protocol. This modification also permits the use of custom DNA probes that are tailored to a specific DNA binding region, introducing the ability to design capture probes for non-model organisms. Through the use of EMSA and ELISA DNA binding assays, we have successfully determined the in vitro DNA binding activity and complex dynamics of the Rb/E2F cell cycle regulatory mechanisms in an anoxic turtle, Trachemys scripta elegans . Repressive cell cycle proteins (E2F4, Rb, HDAC4 and Suv39H1) were found to significantly increase at E2F DNA-binding sites upon anoxic exposure in anoxic turtle liver. The lack of p130 involvement in the E2F DNA-bound complex indicates that anoxic turtle liver may maintain G 1 arrest for the duration of stress survival.
Biggar, Kyle K.
2018-01-01
In many cases, the DNA-binding activity of a transcription factor does not change, while its transcriptional activity is greatly influenced by the make-up of bound proteins. In this study, we assessed the protein composition and DNA-binding ability of the E2F transcription factor complex to provide insight into cell cycle control in an anoxia tolerant turtle through the use of a modified ELISA protocol. This modification also permits the use of custom DNA probes that are tailored to a specific DNA binding region, introducing the ability to design capture probes for non-model organisms. Through the use of EMSA and ELISA DNA binding assays, we have successfully determined the in vitro DNA binding activity and complex dynamics of the Rb/E2F cell cycle regulatory mechanisms in an anoxic turtle, Trachemys scripta elegans. Repressive cell cycle proteins (E2F4, Rb, HDAC4 and Suv39H1) were found to significantly increase at E2F DNA-binding sites upon anoxic exposure in anoxic turtle liver. The lack of p130 involvement in the E2F DNA-bound complex indicates that anoxic turtle liver may maintain G1 arrest for the duration of stress survival. PMID:29770276
Ranganathan, Sridevi; Cheung, Jonah; Cassidy, Michael; Ginter, Christopher; Pata, Janice D; McDonough, Kathleen A
2018-01-09
Mycobacterium tuberculosis (Mtb) encodes two CRP/FNR family transcription factors (TF) that contribute to virulence, Cmr (Rv1675c) and CRPMt (Rv3676). Prior studies identified distinct chromosomal binding profiles for each TF despite their recognizing overlapping DNA motifs. The present study shows that Cmr binding specificity is determined by discriminator nucleotides at motif positions 4 and 13. X-ray crystallography and targeted mutational analyses identified an arginine-rich loop that expands Cmr's DNA interactions beyond the classical helix-turn-helix contacts common to all CRP/FNR family members and facilitates binding to imperfect DNA sequences. Cmr binding to DNA results in a pronounced asymmetric bending of the DNA and its high level of cooperativity is consistent with DNA-facilitated dimerization. A unique N-terminal extension inserts between the DNA binding and dimerization domains, partially occluding the site where the canonical cAMP binding pocket is found. However, an unstructured region of this N-terminus may help modulate Cmr activity in response to cellular signals. Cmr's multiple levels of DNA interaction likely enhance its ability to integrate diverse gene regulatory signals, while its novel structural features establish Cmr as an atypical CRP/FNR family member. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
The identification of FANCD2 DNA binding domains reveals nuclear localization sequences.
Niraj, Joshi; Caron, Marie-Christine; Drapeau, Karine; Bérubé, Stéphanie; Guitton-Sert, Laure; Coulombe, Yan; Couturier, Anthony M; Masson, Jean-Yves
2017-08-21
Fanconi anemia (FA) is a recessive genetic disorder characterized by congenital abnormalities, progressive bone-marrow failure, and cancer susceptibility. The FA pathway consists of at least 21 FANC genes (FANCA-FANCV), and the encoded protein products interact in a common cellular pathway to gain resistance against DNA interstrand crosslinks. After DNA damage, FANCD2 is monoubiquitinated and accumulates on chromatin. FANCD2 plays a central role in the FA pathway, using yet unidentified DNA binding regions. By using synthetic peptide mapping and DNA binding screen by electromobility shift assays, we found that FANCD2 bears two major DNA binding domains predominantly consisting of evolutionary conserved lysine residues. Furthermore, one domain at the N-terminus of FANCD2 bears also nuclear localization sequences for the protein. Mutations in the bifunctional DNA binding/NLS domain lead to a reduction in FANCD2 monoubiquitination and increase in mitomycin C sensitivity. Such phenotypes are not fully rescued by fusion with an heterologous NLS, which enable separation of DNA binding and nuclear import functions within this domain that are necessary for FANCD2 functions. Collectively, our results enlighten the importance of DNA binding and NLS residues in FANCD2 to activate an efficient FA pathway. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Multivalent DNA-binding properties of the HMG-1 proteins.
Maher, J F; Nathans, D
1996-01-01
HMG-I proteins are DNA-binding proteins thought to affect the formation and function of transcription complexes. Each protein contains three DNA-binding motifs, known as AT-hooks, that bind in the minor groove of AT tracts in DNA. Multiple AT-hooks within a polypeptide chain should contact multiple AT tracts, but the rules governing these interactions have not been defined. In this study, we demonstrate that high-affinity binding uses two or three appropriately spaced AT tracts as a single multivalent binding site. These principles have implications for binding to regulatory elements such as the interferon beta enhancer, TATA boxes, and serum response elements. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:8692884
Gup, Ramazan; Gökçe, Cansu; Dilek, Nefise
2015-03-01
A new water soluble zinc complex has been prepared and structurally characterized. The Zn(II) complex was synthesized by the reaction of 2,6-diacetylpyridine dihydrazone (dph) with {4-[(2E)-2-(hydroxyimino)acetyl]phenoxy} acetic acid (H₂L) in the presence of zinc(II) acetate. Single crystal X-ray diffraction study revealed that the zinc ion is situated in distorted trigonal-bipyramidal environment where the equatorial position is occupied by the nitrogen atom of pyridine ring and the oxygen atoms of acetate groups of two oxime ligands (H₂L) whereas the axial positions of the zinc complex are occupied by the imine nitrogen atoms of dph ligand. Characterization of the complex with FTIR, (1)H and (13)C NMR, UV-vis and elemental analysis also confirmed the proposed structure. Interaction of the Zn(II) complex with calf-thymus DNA (CT-DNA) was investigated through UV-vis spectroscopy and viscosity measurements. The results suggest that the complex preferably bind to DNA through the groove binding mode. The zinc complex cleaves plasmid pBR 322 DNA in the presence and absence of an oxidative agent (H₂O₂), possibly through a hydrolytic pathway which is also supported by DNA cleave experiments in the presence of different radical scavengers. The nuclease activity of the zinc complex significantly depends on concentration of the complex and incubation time both in the presence and absence of H₂O₂. DNA cleave activity is inhibited in the presence of methyl green indicating that the zinc complex seems to bind the major groove of DNA. Copyright © 2015 Elsevier B.V. All rights reserved.
Complex formation by the human Rad51B and Rad51C DNA repair proteins and their activities in vitro
NASA Technical Reports Server (NTRS)
Lio, Yi-Ching; Mazin, Alexander V.; Kowalczykowski, Stephen C.; Chen, David J.
2003-01-01
The human Rad51 protein is essential for DNA repair by homologous recombination. In addition to Rad51 protein, five paralogs have been identified: Rad51B/Rad51L1, Rad51C/Rad51L2, Rad51D/Rad51L3, XRCC2, and XRCC3. To further characterize a subset of these proteins, recombinant Rad51, Rad51B-(His)(6), and Rad51C proteins were individually expressed employing the baculovirus system, and each was purified from Sf9 insect cells. Evidence from nickel-nitrilotriacetic acid pull-down experiments demonstrates a highly stable Rad51B.Rad51C heterodimer, which interacts weakly with Rad51. Rad51B and Rad51C proteins were found to bind single- and double-stranded DNA and to preferentially bind 3'-end-tailed double-stranded DNA. The ability to bind DNA was elevated with mixed Rad51 and Rad51C, as well as with mixed Rad51B and Rad51C, compared with that of the individual protein. In addition, both Rad51B and Rad51C exhibit DNA-stimulated ATPase activity. Rad51C displays an ATP-independent apparent DNA strand exchange activity, whereas Rad51B shows no such activity; this apparent strand exchange ability results actually from a duplex DNA destabilization capability of Rad51C. By analogy to the yeast Rad55 and Rad57, our results suggest that Rad51B and Rad51C function through interactions with the human Rad51 recombinase and play a crucial role in the homologous recombinational repair pathway.
Vital Roles of the Second DNA-binding Site of Rad52 Protein in Yeast Homologous Recombination*
Arai, Naoto; Kagawa, Wataru; Saito, Kengo; Shingu, Yoshinori; Mikawa, Tsutomu; Kurumizaka, Hitoshi; Shibata, Takehiko
2011-01-01
RecA/Rad51 proteins are essential in homologous DNA recombination and catalyze the ATP-dependent formation of D-loops from a single-stranded DNA and an internal homologous sequence in a double-stranded DNA. RecA and Rad51 require a “recombination mediator” to overcome the interference imposed by the prior binding of single-stranded binding protein/replication protein A to the single-stranded DNA. Rad52 is the prototype of recombination mediators, and the human Rad52 protein has two distinct DNA-binding sites: the first site binds to single-stranded DNA, and the second site binds to either double- or single-stranded DNA. We previously showed that yeast Rad52 extensively stimulates Rad51-catalyzed D-loop formation even in the absence of replication protein A, by forming a 2:1 stoichiometric complex with Rad51. However, the precise roles of Rad52 and Rad51 within the complex are unknown. In the present study, we constructed yeast Rad52 mutants in which the amino acid residues corresponding to the second DNA-binding site of the human Rad52 protein were replaced with either alanine or aspartic acid. We found that the second DNA-binding site is important for the yeast Rad52 function in vivo. Rad51-Rad52 complexes consisting of these Rad52 mutants were defective in promoting the formation of D-loops, and the ability of the complex to associate with double-stranded DNA was specifically impaired. Our studies suggest that Rad52 within the complex associates with double-stranded DNA to assist Rad51-mediated homologous pairing. PMID:21454474
Buczek, Pawel; Horvath, Martin P.
2009-01-01
In Sterkiella nova, α and β telomere proteins bind cooperatively with single-stranded DNA to form a ternary α·β·DNA complex. Association of telomere protein subunits is DNA-dependent, and α-β association enhances DNA affinity. To further understand the molecular basis for binding cooperativity, we characterized several possible stepwise assembly pathways using isothermal titration calorimetry. In one path, α and DNA first form a stable α·DNA complex followed by addition of β in a second step. Binding energy accumulates with nearly equal free energy of association for each of these steps. Heat capacity is nonetheless dramatically different with ΔCp = −305 ± 3 cal mol−1 K−1 for α binding with DNA and ΔCp = −2010 ± 20 cal mol−1 K−1 for addition of β to complete the α·β·DNA complex. By examining alternate routes including titration of single-stranded DNA with a preformed α·β complex, a significant portion of binding energy and heat capacity could be assigned to structural reorganization involving protein-protein interactions and repositioning of the DNA. Structural reorganization probably affords a mechanism to regulate high affinity binding of telomere single-stranded DNA with important implications for telomere biology. Regulation of telomere complex dissociation is thought to involve post-translational modifications in the lysine-rich C-terminal portion of β. We observed no difference in binding energetics or crystal structure when comparing complexes prepared with full-length β or a C-terminally truncated form, supporting interesting parallels between the intrinsically disordered regions of histones and this portion of β. PMID:17082188
NASA Astrophysics Data System (ADS)
Aminzadeh, Mohammad; Eslami, Abbas; Kia, Reza; Aleeshah, Roghayeh
2017-10-01
Diquaternarization of dipyrido-[2,3-a:2‧,3‧-c]-phenazine,(dppz) and its analogous dipyrido-[2,3-a:2‧,3‧-c]-dimethylphenazine,(dppx) using 1,3-dibromopropane afford new water-soluble derivatives of phenazine, propylene-bipyridyldiylium-phenazine (1) and propylene-bipyridyldiylium-dimethylphenazine (2). The compounds have been characterized by means of FT-IR, NMR, elemental analysis and conductometric measurements and their structure were determined by X-ray crystallography. The experimental studies on the compounds have been accompanied computationally by Density Functional Theory (DFT) calculations. The DNA binding properties of both compounds to calf thymus DNA (ctDNA) were investigated by UV-Vis absorption and emission methods. The expanded UV-Vis spectral data matrix was analyzed by multivariate curve resolution-alternating least squares (MCR-ALS) technique to obtain the concentration profile and pure spectra of all reaction species which existed in the interaction procedure. Multivariate curve resolution may help us to give a better understanding of the 1(Cl)2-ctDNA and 2(Cl)2-ctDNA interaction mechanism. The results suggest that both compounds bind tightly to DNA through intercalation mechanism and the DNA binding affinity of 2 is slightly lower than that of 1 due to steric hindrance of the methyl group. Also, thermal denaturation studies reveal that these compounds show strong affinity for binding with calf thymus DNA. The thermodynamic parameters of the DNA binding process were obtained from the temperature dependence of the binding constants and the results showed that binding of both compounds to DNA is an enthalpically driven process that is in agreement with proposed DNA intercalation capability of these compounds.
NASA Astrophysics Data System (ADS)
Khajeh, Masoumeh Ashrafi; Dehghan, Gholamreza; Dastmalchi, Siavoush; Shaghaghi, Masoomeh; Iranshahi, Mehrdad
2018-03-01
DNA is a major target for a number of anticancer substances. Interaction studies between small molecules and DNA are essential for rational drug designing to influence main biological processes and also introducing new probes for the assay of DNA. Tschimgine (TMG) is a monoterpene derivative with anticancer properties. In the present study we tried to elucidate the interaction of TMG with calf thymus DNA (CT-DNA) using different spectroscopic methods. UV-visible absorption spectrophotometry, fluorescence and circular dichroism (CD) spectroscopies as well as molecular docking study revealed formation of complex between TMG and CT-DNA. Binding constant (Kb) between TMG and DNA was 2.27 × 104 M- 1, that is comparable to groove binding agents. The fluorescence spectroscopic data revealed that the quenching mechanism of fluorescence of TMG by CT-DNA is static quenching. Thermodynamic parameters (ΔH < 0 and ΔS < 0) at different temperatures indicated that van der Waals forces and hydrogen bonds were involved in the binding process of TMG with CT-DNA. Competitive binding assay with methylene blue (MB) and Hoechst 33258 using fluorescence spectroscopy displayed that TMG possibly binds to the minor groove of CT-DNA. These observations were further confirmed by CD spectral analysis, viscosity measurements and molecular docking.
Interplay of protein and DNA structure revealed in simulations of the lac operon.
Czapla, Luke; Grosner, Michael A; Swigon, David; Olson, Wilma K
2013-01-01
The E. coli Lac repressor is the classic textbook example of a protein that attaches to widely spaced sites along a genome and forces the intervening DNA into a loop. The short loops implicated in the regulation of the lac operon suggest the involvement of factors other than DNA and repressor in gene control. The molecular simulations presented here examine two likely structural contributions to the in-vivo looping of bacterial DNA: the distortions of the double helix introduced upon association of the highly abundant, nonspecific nucleoid protein HU and the large-scale deformations of the repressor detected in low-resolution experiments. The computations take account of the three-dimensional arrangements of nucleotides and amino acids found in crystal structures of DNA with the two proteins, the natural rest state and deformational properties of protein-free DNA, and the constraints on looping imposed by the conformation of the repressor and the orientation of bound DNA. The predicted looping propensities capture the complex, chain-length-dependent variation in repression efficacy extracted from gene expression studies and in vitro experiments and reveal unexpected chain-length-dependent variations in the uptake of HU, the deformation of repressor, and the folding of DNA. Both the opening of repressor and the presence of HU, at levels approximating those found in vivo, enhance the probability of loop formation. HU affects the global organization of the repressor and the opening of repressor influences the levels of HU binding to DNA. The length of the loop determines whether the DNA adopts antiparallel or parallel orientations on the repressor, whether the repressor is opened or closed, and how many HU molecules bind to the loop. The collective behavior of proteins and DNA is greater than the sum of the parts and hints of ways in which multiple proteins may coordinate the packaging and processing of genetic information.
Molecular traffic jams on DNA.
Finkelstein, Ilya J; Greene, Eric C
2013-01-01
All aspects of DNA metabolism-including transcription, replication, and repair-involve motor enzymes that move along genomic DNA. These processes must all take place on chromosomes that are occupied by a large number of other proteins. However, very little is known regarding how nucleic acid motor proteins move along the crowded DNA substrates that are likely to exist in physiological settings. This review summarizes recent progress in understanding how DNA-binding motor proteins respond to the presence of other proteins that lie in their paths. We highlight recent single-molecule biophysical experiments aimed at addressing this question, with an emphasis placed on analyzing the single-molecule, ensemble biochemical, and in vivo data from a mechanistic perspective.
NASA Astrophysics Data System (ADS)
Ikhlas, Shoeb; Ahmad, Masood
2018-02-01
Guggulsterone, a sterol found in plants is used as an ayurvedic medicine for many diseases such as obesity, internal tumors, ulcers etc. E and Z are two isoforms of guggulsterone, wherein guggulsterone-E (GUGE) has also been shown to have anticancer potential. Most of the anticancer drugs target nucleic acids. Therefore, we studied the mode of interaction between ctDNA and GUGE using UV-Vis, fluorescence and CD spectroscopy, isothermal calorimetry along with molecular docking studies. Hoechst 3325, ethidium bromide and rhodamine-B displacement experiments confirms that GUGE binds in the minor groove of DNA. ITC results further suggest these interactions to be feasible and spontaneous with hydrogen bond formation and van der waals interactions. Lastly, molecular docking also suggests GUGE to be a minor groove binder interacting through a single hydrogen bond formation between OH group of GUGE and nitrogen (N3) of adenosine (A6).
Role of indirect readout mechanism in TATA box binding protein-DNA interaction.
Mondal, Manas; Choudhury, Devapriya; Chakrabarti, Jaydeb; Bhattacharyya, Dhananjay
2015-03-01
Gene expression generally initiates from recognition of TATA-box binding protein (TBP) to the minor groove of DNA of TATA box sequence where the DNA structure is significantly different from B-DNA. We have carried out molecular dynamics simulation studies of TBP-DNA system to understand how the DNA structure alters for efficient binding. We observed rigid nature of the protein while the DNA of TATA box sequence has an inherent flexibility in terms of bending and minor groove widening. The bending analysis of the free DNA and the TBP bound DNA systems indicate presence of some similar structures. Principal coordinate ordination analysis also indicates some structural features of the protein bound and free DNA are similar. Thus we suggest that the DNA of TATA box sequence regularly oscillates between several alternate structures and the one suitable for TBP binding is induced further by the protein for proper complex formation.
Orientational dynamics and dye-DNA interactions in a dye-labeled DNA aptamer.
Unruh, Jay R; Gokulrangan, Giridharan; Lushington, G H; Johnson, Carey K; Wilson, George S
2005-05-01
We report the picosecond and nanosecond timescale rotational dynamics of a dye-labeled DNA oligonucleotide or "aptamer" designed to bind specifically to immunoglobulin E. Rotational dynamics in combination with fluorescence lifetime measurements provide information about dye-DNA interactions. Comparison of Texas Red (TR), fluorescein, and tetramethylrhodamine (TAMRA)-labeled aptamers reveals surprising differences with significant implications for biophysical studies employing such conjugates. Time-resolved anisotropy studies demonstrate that the TR- and TAMRA-aptamer anisotropy decays are dominated by the overall rotation of the aptamer, whereas the fluorescein-aptamer anisotropy decay displays a subnanosecond rotational correlation time much shorter than that expected for the overall rotation of the aptamer. Docking and molecular dynamics simulations suggest that the low mobility of TR is a result of binding in the groove of the DNA helix. Additionally, associated anisotropy analysis of the TAMRA-aptamer reveals both quenched and unquenched states that experience significant coupling to the DNA motion. Therefore, quenching of TAMRA by guanosine must depend on the configuration of the dye bound to the DNA. The strong coupling of TR to the rotational dynamics of the DNA aptamer, together with the absence of quenching of its fluorescence by DNA, makes it a good probe of DNA orientational dynamics. The understanding of the nature of dye-DNA interactions provides the basis for the development of bioconjugates optimized for specific biophysical measurements and is important for the sensitivity of anisotropy-based DNA-protein interaction studies employing such conjugates.
Orientational Dynamics and Dye-DNA Interactions in a Dye-Labeled DNA Aptamer
Unruh, Jay R.; Gokulrangan, Giridharan; Lushington, G. H.; Johnson, Carey K.; Wilson, George S.
2005-01-01
We report the picosecond and nanosecond timescale rotational dynamics of a dye-labeled DNA oligonucleotide or “aptamer” designed to bind specifically to immunoglobulin E. Rotational dynamics in combination with fluorescence lifetime measurements provide information about dye-DNA interactions. Comparison of Texas Red (TR), fluorescein, and tetramethylrhodamine (TAMRA)-labeled aptamers reveals surprising differences with significant implications for biophysical studies employing such conjugates. Time-resolved anisotropy studies demonstrate that the TR- and TAMRA-aptamer anisotropy decays are dominated by the overall rotation of the aptamer, whereas the fluorescein-aptamer anisotropy decay displays a subnanosecond rotational correlation time much shorter than that expected for the overall rotation of the aptamer. Docking and molecular dynamics simulations suggest that the low mobility of TR is a result of binding in the groove of the DNA helix. Additionally, associated anisotropy analysis of the TAMRA-aptamer reveals both quenched and unquenched states that experience significant coupling to the DNA motion. Therefore, quenching of TAMRA by guanosine must depend on the configuration of the dye bound to the DNA. The strong coupling of TR to the rotational dynamics of the DNA aptamer, together with the absence of quenching of its fluorescence by DNA, makes it a good probe of DNA orientational dynamics. The understanding of the nature of dye-DNA interactions provides the basis for the development of bioconjugates optimized for specific biophysical measurements and is important for the sensitivity of anisotropy-based DNA-protein interaction studies employing such conjugates. PMID:15731389
Ho, Dominik; Dose, Christian; Albrecht, Christian H.; Severin, Philip; Falter, Katja; Dervan, Peter B.; Gaub, Hermann E.
2009-01-01
Force-based ligand detection is a promising method to characterize molecular complexes label-free at physiological conditions. Because conventional implementations of this technique, e.g., based on atomic force microscopy or optical traps, are low-throughput and require extremely sensitive and sophisticated equipment, this approach has to date found only limited application. We present a low-cost, chip-based assay, which combines high-throughput force-based detection of dsDNA·ligand interactions with the ease of fluorescence detection. Within the comparative unbinding force assay, many duplicates of a target DNA duplex are probed against a defined reference DNA duplex each. The fractions of broken target and reference DNA duplexes are determined via fluorescence. With this assay, we investigated the DNA binding behavior of artificial pyrrole-imidazole polyamides. These small compounds can be programmed to target specific dsDNA sequences and distinguish between D- and L-DNA. We found that titration with polyamides specific for a binding motif, which is present in the target DNA duplex and not in the reference DNA duplex, reliably resulted in a shift toward larger fractions of broken reference bonds. From the concentration dependence nanomolar to picomolar dissociation constants of dsDNA·ligand complexes were determined, agreeing well with prior quantitative DNAase footprinting experiments. This finding corroborates that the forced unbinding of dsDNA in presence of a ligand is a nonequilibrium process that produces a snapshot of the equilibrium distribution between dsDNA and dsDNA·ligand complexes. PMID:19486688
1988-01-01
Biotinylated nucleotides (bio-11-dCTP, bio-11-dUTP, and bio-7-dATP) were microinjected into unfertilized and fertilized Xenopus laevis eggs. The amounts introduced were comparable to in vivo deoxy- nucleoside triphosphate pools. At various times after microinjection, DNA was extracted from eggs or embryos and subjected to electrophoresis on agarose gels. Newly synthesized biotinylated DNA was analyzed by Southern transfer and visualized using either the BluGENE or Detek-hrp streptavidin-based nucleic acid detection systems. Quantitation of the amount of biotinylated DNA observed at various times showed that the microinjected biotinylated nucleotides were efficiently incorporated in vivo, both into replicating endogenous chromosomal DNA and into replicating microinjected exogenous plasmid DNA. At least one biotinylated nucleotide could be incorporated in vivo for every eight nucleotides of DNA synthesized. Control experiments also showed that heavily biotinylated DNA was not subjected to detectable DNA repair during early embryogenesis (for at least 5 h after activation of the eggs). The incorporated biotinylated nucleotides were visualized by electron microscopy by using streptavidin-colloidal gold or streptavidin-ferritin conjugates to bind specifically to the biotin groups projecting from the newly replicated DNA. The incorporated biotinylated nucleotides were thus made visible as electron-dense spots on the underlying DNA molecules. Biotinylated nucleotides separated by 20-50 bases could be resolved. We conclude that nascent DNA synthesized in vivo in Xenopus laevis eggs can be visualized efficiently and specifically using the techniques described. PMID:3392102
Murase, Hirotaka; Noguchi, Tomoharu; Sasaki, Shigeki
2018-06-01
Chromomycin A3 (CMA3) is an aureolic acid-type antitumor antibiotic. CMA3 forms dimeric complexes with divalent cations, such as Mg 2+ , which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. In this study, the binding property of CMA3 to the DNA sequence containing multiple GC-rich binding sites was investigated by measuring the protection from hydrolysis by the restriction enzymes, AccII and Fnu4HI, for the center of the CGCG site and the 5'-GC↓GGC site, respectively. In contrast to the standard DNase I footprinting method, the DNA substrates are fully hydrolyzed by the restriction enzymes, therefore, the full protection of DNA at all the cleavable sites indicates that CMA3 simultaneously binds to all the binding sites. The restriction enzyme assay has suggested that CMA3 has a high tendency to bind the successive CGCG sites and the CGG repeat. Copyright © 2018 Elsevier Ltd. All rights reserved.
de Almeida, Sinara Mônica Vitalino; Lafayette, Elizabeth Almeida; Gomes da Silva, Lúcia Patrícia Bezerra; Amorim, Cézar Augusto da Cruz; de Oliveira, Tiago Bento; Gois Ruiz, Ana Lucia Tasca; de Carvalho, João Ernesto; de Moura, Ricardo Olímpio; Beltrão, Eduardo Isidoro Carneiro; de Lima, Maria do Carmo Alves; de Carvalho Júnior, Luiz Bezerra
2015-01-01
In this work, the acridine nucleus was used as a lead-compound for structural modification by adding different substituted thiosemicarbazide moieties. Eight new (Z)-2-(acridin-9-ylmethylene)-N-phenylhydrazinecarbothioamide derivatives (3a–h) were synthesized, their antiproliferative activities were evaluated, and DNA binding properties were performed with calf thymus DNA (ctDNA) by electronic absorption and fluorescence spectroscopies. Both hyperchromic and hypochromic effects, as well as red or blue shifts were demonstrated by addition of ctDNA to the derivatives. The calculated binding constants ranged from 1.74 × 104 to 1.0 × 106 M−1 and quenching constants from −0.2 × 104 to 2.18 × 104 M−1 indicating high affinity to ctDNA base pairs. The most efficient compound in binding to ctDNA in vitro was (Z)-2-(acridin-9-ylmethylene)-N-(4-chlorophenyl) hydrazinecarbothioamide (3f), while the most active compound in antiproliferative assay was (Z)-2-(acridin-9-ylmethylene)-N-phenylhydrazinecarbothioamide (3a). There was no correlation between DNA-binding and in vitro antiproliferative activity, but the results suggest that DNA binding can be involved in the biological activity mechanism. This study may guide the choice of the size and shape of the intercalating part of the ligand and the strategic selection of substituents that increase DNA-binding or antiproliferative properties. PMID:26068233
Spectral investigations on binding of DNA-CTMA complex with tetrameric copper phthalocyanines
NASA Astrophysics Data System (ADS)
Venkat, Narayanan; Haley, Joy E.; Swiger, Rachel; Zhu, Lei; Wei, Xiaoliang; Ouchen, Fahima; Grote, James G.
2013-10-01
The binding of DNA-CTMA (Deoxyribonucleic acid-cetyltrimethylammonium) complex with two tetrameric Copper Phthalocyanine (CuPc) systems, substituted with carboxylic acid (CuPc-COOH) and derivatized further as an imidazolium salt (CuPc-COOR), was investigated in dimethylsulfoxide (DMSO) solutions using UV/Visible Spectroscopy. Absorbance changes at 685 nm (Q band of the CuPc) were monitored as a function of DNA-CTMA added to the dye solution and stock concentrations of DNA-CTMA in DMSO were varied to facilitate observation of the full binding process. Our findings indicated that while binding with DNA-CTMA was more well-defined in the case of CuPc-COOH, the binding profile of the CuPc-COOR showed initial growth followed by decay in its Q-band absorbance which was indicative of a more complex binding mechanism involving the dye and DNA-CTMA. Preliminary findings from photophysical studies involving the CuPc tetramers and DNA-CTMA are also discussed in this paper.
DOTAP cationic liposomes prefer relaxed over supercoiled plasmids.
Even-Chen, S; Barenholz, Y
2000-12-20
Cationic liposomes and DNA interact electrostatically to form complexes called lipoplexes. The amounts of unbound (free) DNA in a mixture of cationic liposomes and DNA at different cationic lipid:DNA molar ratios can be used to describe DNA binding isotherms; these provide a measure of the binding efficiency of DNA to different cationic lipid formulations at various medium conditions. In order to quantify the ratio between the various forms of naked DNA and supercoiled, relaxed and single-stranded DNA, and the ratio between cationic lipid bound and unbound DNA of various forms we developed a simple, sensitive quantitative assay using agarose gel electrophoresis, followed by staining with the fluorescent cyanine DNA dyes SYBR Green I or SYBR Gold. This assay was compared with that based on the use of ethidium bromide (the most commonly used nucleic acid stain). Unlike ethidium bromide, SYBR Green I DNA sensitivity and concentration-dependent fluorescence intensity were identical for supercoiled and nicked-relaxed forms. DNA detection by SYBR Green I in solution is approximately 40-fold more sensitive than by ethidium bromide for double-stranded DNA and approximately 10-fold for single-stranded DNA, and in agarose gel it is 16-fold more sensitive for double-stranded DNA compared with ethidium bromide. SYBR Gold performs similarly to SYBR Green I. This study shows that: (a) there is no significant difference in DNA binding isotherms to the monocationic DOTAP (DOTAP/DOPE) liposomes and to the polycationic DOSPA (DOSPA/DOPE) liposomes, even when four DOSPA positive charges are involved in the electrostatic interaction with DNA; (b) the helper lipids affect DNA binding, as DOTAP/DOPE liposomes bind more DNA than DOTAP/cholesterol; (c) in the process of lipoplex formation, when the DNA is a mixture of two forms, supercoiled and nicked-relaxed (open circular), there is a preference for the binding to the cationic liposomes of plasmid DNA in the nicked-relaxed over the supercoiled form. This preference is much more pronounced when the cationic liposome formulation is based on the monocationic lipid DOTAP than on the polycationic lipid DOSPA. The preference of DOTAP formulations to bind to the relaxed DNA plasmid suggests that the binding of supercoiled DNA is weaker and easier to dissociate from the complex.
Interaction of Sulforaphane with DNA and RNA
Abassi Joozdani, Farzaneh; Yari, Faramarz; Abassi Joozdani, Parvaneh; Nafisi, Shohreh
2015-01-01
Sulforaphane (SFN) is an isothiocyanate found in cruciferous vegetables with anti-inflammatory, anti-oxidant and anti-cancer activities. However, the antioxidant and anticancer mechanism of sulforaphane is not well understood. In the present research, we reported binding modes, binding constants and stability of SFN–DNA and -RNA complexes by Fourier transform infrared (FTIR) and UV–Visible spectroscopic methods. Spectroscopic evidence showed DNA intercalation with some degree of groove binding. SFN binds minor and major grooves of DNA and backbone phosphate (PO2), while RNA binding is through G, U, A bases with some degree of SFN–phosphate (PO2) interaction. Overall binding constants were estimated to be K(SFN–DNA)=3.01 (± 0.035)×104 M-1 and K(SFN–RNA)= 6.63 (±0.042)×103 M-1. At high SFN concentration (SFN/RNA = 1/1), DNA conformation changed from B to A occurred, while RNA remained in A-family structure. PMID:26030290
Muraiso, T; Nomoto, S; Yamazaki, H; Mishima, Y; Kominami, R
1992-01-01
A protein that binds to a synthetic oligonucleotide of (CCT)12 has been purified from Ehrlich ascites tumor cells by a (CCT)12 affinity chromatography. The protein (p70) has an apparent molecular mass of 70 kDa, as assayed by Southwestern analysis. A competition experiment revealed that p70 binds to (CCT)12, (CCCT)8 and (CCTCCCT)6, but not to (CTT)12, (CT)16 and (CCTGCCT)6, suggesting that p70 has a sequence-specificity. The complementary (AGG)12 and the double stranded DNA did not show the binding. It is also confirmed by S1 nuclease analysis that the (AGG:CCT)12 duplex takes a single-stranded conformation in the absence of the protein. This raises a possibility that the duplex forms two single-stranded loops in chromosomes, the C-rich strand being bound to p70. Structural analysis of the resulting (AGG)12 strand by non-denaturing polyacrylamide gel electrophoresis demonstrated the presence of slower and faster migrated conformers in a neutral pH buffer containing 50 mM NaCl at 5 degrees C. The ratio was dependent on the DNA concentration. Both conformers disappeared in the absence of NaCl. This suggests that (AGG)12 can form intra- and inter-molecular complexes by non-Watson-Crick, guanine:guanine base-pairing. The possible biological function of the (AGG:CCT)n duplex and the p70 is discussed. Images PMID:1480484
Farasat, Iman; Salis, Howard M.
2016-01-01
The ability to precisely modify genomes and regulate specific genes will greatly accelerate several medical and engineering applications. The CRISPR/Cas9 (Type II) system binds and cuts DNA using guide RNAs, though the variables that control its on-target and off-target activity remain poorly characterized. Here, we develop and parameterize a system-wide biophysical model of Cas9-based genome editing and gene regulation to predict how changing guide RNA sequences, DNA superhelical densities, Cas9 and crRNA expression levels, organisms and growth conditions, and experimental conditions collectively control the dynamics of dCas9-based binding and Cas9-based cleavage at all DNA sites with both canonical and non-canonical PAMs. We combine statistical thermodynamics and kinetics to model Cas9:crRNA complex formation, diffusion, site selection, reversible R-loop formation, and cleavage, using large amounts of structural, biochemical, expression, and next-generation sequencing data to determine kinetic parameters and develop free energy models. Our results identify DNA supercoiling as a novel mechanism controlling Cas9 binding. Using the model, we predict Cas9 off-target binding frequencies across the lambdaphage and human genomes, and explain why Cas9’s off-target activity can be so high. With this improved understanding, we propose several rules for designing experiments for minimizing off-target activity. We also discuss the implications for engineering dCas9-based genetic circuits. PMID:26824432
Molecular modeling and SPRi investigations of interleukin 6 (IL6) protein and DNA aptamers.
Rhinehardt, Kristen L; Vance, Stephen A; Mohan, Ram V; Sandros, Marinella; Srinivas, Goundla
2018-06-01
Interleukin 6 (IL6), an inflammatory response protein has major implications in immune-related inflammatory diseases. Identification of aptamers for the IL6 protein aids in diagnostic, therapeutic, and theranostic applications. Three different DNA aptamers and their interactions with IL6 protein were extensively investigated in a phosphate buffed saline (PBS) solution. Molecular-level modeling through molecular dynamics provided insights of structural, conformational changes and specific binding domains of these protein-aptamer complexes. Multiple simulations reveal consistent binding region for all protein-aptamer complexes. Conformational changes coupled with quantitative analysis of center of mass (COM) distance, radius of gyration (R g ), and number of intermolecular hydrogen bonds in each IL6 protein-aptamer complex was used to determine their binding performance strength and obtain molecular configurations with strong binding. A similarity comparison of the molecular configurations with strong binding from molecular-level modeling concurred with Surface Plasmon Resonance imaging (SPRi) for these three aptamer complexes, thus corroborating molecular modeling analysis findings. Insights from the natural progression of IL6 protein-aptamer binding modeled in this work has identified key features such as the orientation and location of the aptamer in the binding event. These key features are not readily feasible from wet lab experiments and impact the efficacy of the aptamers in diagnostic and theranostic applications.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fradkin, L.G.; Yoshinaga, S.K.; Berk, A.J.
1987-11-01
The inhibition of transcription by RNA polymerase III in poliovirus-infected cells was studied. Experiments utilizing two different cell lines showed that the initiation step of transcription by RNA polymerase III was impaired by infection of these cells with the virus. The observed inhibition of transcription was not due to shut-off of host cell protein synthesis by poliovirus. Among four distinct components required for accurate transcription in vitro from cloned DNA templates, activities of RNA polymerase III and transcription factor TFIIIA were not significantly affected by virus infection. The activity of transcription factor TFIIIC, the limiting component required for transcription ofmore » RNA polymerase III genes, was severely inhibited in infected cells, whereas that of transcription factor TFIIIB was inhibited to a lesser extent. The sequence-specific DNA-binding of TFIIIC to the adenovirus VA1 gene internal promoted, however, was not altered by infection of cells with the virus. The authors conclude that (i) at least two transcription factors, TFIIIB and TFIIIC, are inhibited by infection of cells with poliovirtus, (ii) inactivation of TFIIIC does not involve destruction of its DNA-binding domain, and (iii) sequence-specific DNA binding by TFIIIC may be necessary but is not sufficient for the formation of productive transcription complexes.« less
Herrera-Moyano, Emilia; Moriel-Carretero, María; Montelone, Beth A; Aguilera, Andrés
2014-12-01
The eukaryotic TFIIH complex is involved in Nucleotide Excision Repair and transcription initiation. We analyzed three yeast mutations of the Rad3/XPD helicase of TFIIH known as rem (recombination and mutation phenotypes). We found that, in these mutants, incomplete NER reactions lead to replication fork breaking and the subsequent engagement of the homologous recombination machinery to restore them. Nevertheless, the penetrance varies among mutants, giving rise to a phenotype gradient. Interestingly, the mutations analyzed reside at the ATP-binding groove of Rad3 and in vivo experiments reveal a gain of DNA affinity upon damage of the mutant Rad3 proteins. Since mutations at the ATP-binding groove of XPD in humans are present in the Xeroderma pigmentosum-Cockayne Syndrome (XP-CS), we recreated rem mutations in human cells, and found that these are XP-CS-like. We propose that the balance between the loss of helicase activity and the gain of DNA affinity controls the capacity of TFIIH to open DNA during NER, and its persistence at both DNA lesions and promoters. This conditions NER efficiency and transcription resumption after damage, which in human cells would explain the XP-CS phenotype, opening new perspectives to understand the molecular basis of the role of XPD in human disease.
McCutchen-Maloney, Sandra L.
2002-01-01
DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.
DNA-binding study of anticancer drug cytarabine by spectroscopic and molecular docking techniques.
Shahabadi, Nahid; Falsafi, Monireh; Maghsudi, Maryam
2017-01-02
The interaction of anticancer drug cytarabine with calf thymus DNA (CT-DNA) was investigated in vitro under simulated physiological conditions by multispectroscopic techniques and molecular modeling study. The fluorescence spectroscopy and UV absorption spectroscopy indicated drug interacted with CT-DNA in a groove-binding mode, while the binding constant of UV-vis and the number of binding sites were 4.0 ± 0.2 × 10 4 L mol -1 and 1.39, respectively. The fluorimetric studies showed that the reaction between the drugs with CT-DNA is exothermic. Circular dichroism spectroscopy was employed to measure the conformational change of DNA in the presence of cytarabine. Furthermore, the drug induces detectable changes in its viscosity for DNA interaction. The molecular modeling results illustrated that cytarabine strongly binds to groove of DNA by relative binding energy of docked structure -20.61 KJ mol -1 . This combination of multiple spectroscopic techniques and molecular modeling methods can be widely used in the investigation on the interaction of small molecular pollutants and drugs with biomacromolecules for clarifying the molecular mechanism of toxicity or side effect in vivo.
Discrimination against RNA Backbones by a ssDNA Binding Protein.
Lloyd, Neil R; Wuttke, Deborah S
2018-05-01
Pot1 is the shelterin component responsible for the protection of the single-stranded DNA (ssDNA) overhang at telomeres in nearly all eukaryotic organisms. The C-terminal domain of the DNA-binding domain, Pot1pC, exhibits non-specific ssDNA recognition, achieved through thermodynamically equivalent alternative binding conformations. Given this flexibility, it is unclear how specificity for ssDNA over RNA, an activity required for biological function, is achieved. Examination of the ribose-position specificity of Pot1pC shows that ssDNA specificity is additive but not uniformly distributed across the ligand. High-resolution structures of several Pot1pC complexes with RNA-DNA chimeric ligands reveal Pot1pC discriminates against RNA by utilizing non-compensatory binding modes that feature significant rearrangement of the binding interface. These alternative conformations, accessed through both ligand and protein flexibility, recover much, but not all, of the binding energy, leading to the observed reduction in affinities. These findings suggest that intermolecular interfaces are remarkably sophisticated in their tuning of specificity toward flexible ligands. Copyright © 2018 Elsevier Ltd. All rights reserved.
An ensemble model of competitive multi-factor binding of the genome
Wasson, Todd; Hartemink, Alexander J.
2009-01-01
Hundreds of different factors adorn the eukaryotic genome, binding to it in large number. These DNA binding factors (DBFs) include nucleosomes, transcription factors (TFs), and other proteins and protein complexes, such as the origin recognition complex (ORC). DBFs compete with one another for binding along the genome, yet many current models of genome binding do not consider different types of DBFs together simultaneously. Additionally, binding is a stochastic process that results in a continuum of binding probabilities at any position along the genome, but many current models tend to consider positions as being either binding sites or not. Here, we present a model that allows a multitude of DBFs, each at different concentrations, to compete with one another for binding sites along the genome. The result is an “occupancy profile,” a probabilistic description of the DNA occupancy of each factor at each position. We implement our model efficiently as the software package COMPETE. We demonstrate genome-wide and at specific loci how modeling nucleosome binding alters TF binding, and vice versa, and illustrate how factor concentration influences binding occupancy. Binding cooperativity between nearby TFs arises implicitly via mutual competition with nucleosomes. Our method applies not only to TFs, but also recapitulates known occupancy profiles of a well-studied replication origin with and without ORC binding. Importantly, the sequence preferences our model takes as input are derived from in vitro experiments. This ensures that the calculated occupancy profiles are the result of the forces of competition represented explicitly in our model and the inherent sequence affinities of the constituent DBFs. PMID:19720867
Novel DNA Motif Binding Activity Observed In Vivo With an Estrogen Receptor α Mutant Mouse
Li, Leping; Grimm, Sara A.; Winuthayanon, Wipawee; Hamilton, Katherine J.; Pockette, Brianna; Rubel, Cory A.; Pedersen, Lars C.; Fargo, David; Lanz, Rainer B.; DeMayo, Francesco J.; Schütz, Günther; Korach, Kenneth S.
2014-01-01
Estrogen receptor α (ERα) interacts with DNA directly or indirectly via other transcription factors, referred to as “tethering.” Evidence for tethering is based on in vitro studies and a widely used “KIKO” mouse model containing mutations that prevent direct estrogen response element DNA- binding. KIKO mice are infertile, due in part to the inability of estradiol (E2) to induce uterine epithelial proliferation. To elucidate the molecular events that prevent KIKO uterine growth, regulation of the pro-proliferative E2 target gene Klf4 and of Klf15, a progesterone (P4) target gene that opposes the pro-proliferative activity of KLF4, was evaluated. Klf4 induction was impaired in KIKO uteri; however, Klf15 was induced by E2 rather than by P4. Whole uterine chromatin immunoprecipitation-sequencing revealed enrichment of KIKO ERα binding to hormone response elements (HREs) motifs. KIKO binding to HRE motifs was verified using reporter gene and DNA-binding assays. Because the KIKO ERα has HRE DNA-binding activity, we evaluated the “EAAE” ERα, which has more severe DNA-binding domain mutations, and demonstrated a lack of estrogen response element or HRE reporter gene induction or DNA-binding. The EAAE mouse has an ERα null–like phenotype, with impaired uterine growth and transcriptional activity. Our findings demonstrate that the KIKO mouse model, which has been used by numerous investigators, cannot be used to establish biological functions for ERα tethering, because KIKO ERα effectively stimulates transcription using HRE motifs. The EAAE-ERα DNA-binding domain mutant mouse demonstrates that ERα DNA-binding is crucial for biological and transcriptional processes in reproductive tissues and that ERα tethering may not contribute to estrogen responsiveness in vivo. PMID:24713037
Kellum, John A; Song, Mingchen; Venkataraman, Ramesh
2004-03-01
Previous studies have shown that inflammatory mediators can be removed from the circulation with hemofiltration and that adsorption plays an important role. Because adsorptive capacity of hollow-fiber dialyzers is limited, we sought to determine whether hemoadsorption using high surface area beads would result in greater mediator removal and improved survival in experimental sepsis. Randomized controlled laboratory experiment. University laboratory. Sixty-six adult Sprague-Dawley rats. We conducted two ex vivo and two in vivo experiments. For in vivo experiments, we administered Escherichia coli endotoxin (20 mg/kg) by intravenous infusion and then randomized each animal to receive either hemoadsorption or a sham circuit for 4 hrs. Hemoadsorption was performed for 4 hrs using an arterial-venous circuit and a CytoSorb cartridge containing 10 g of polystyrene divinyl benzene copolymer beads with a biocompatible polyvinylpyrrolidone coating. Survival time was measured to a maximum of 12 hrs. In a separate set of experiments, we studied 12 animals using the same protocol except that we killed all animals at 4 hrs and removed standardized sections of liver for analysis of nuclear factor-kappaB DNA binding. Mean survival time among hemoadsorption-treated animals was 629+/-114 vs. 518+/-120 mins for sham-treated animals (p <.01). Overall survival (defined at 12 hrs) was also significantly better in the hemoadsorption group, seven of 20 vs. one of 20 (p <.05). Plasma interleukin-6 and interleukin-10 concentrations and liver nuclear factor-kappaB DNA binding were significantly reduced by hemoadsorption. Ex vivo experiments showed no endotoxin adsorption but strengthened our in vivo observations by showing rapid adsorption of tumor necrosis factor, interleukin-6, and interleukin-10. Hemoadsorption was associated with reduced inflammation and improved survival in this murine model of septic shock.
Siaud, Nicolas; Lam, Isabel; Christ, Nicole; Schlacher, Katharina; Xia, Bing; Jasin, Maria
2011-01-01
The breast cancer suppressor BRCA2 is essential for the maintenance of genomic integrity in mammalian cells through its role in DNA repair by homologous recombination (HR). Human BRCA2 is 3,418 amino acids and is comprised of multiple domains that interact with the RAD51 recombinase and other proteins as well as with DNA. To gain insight into the cellular function of BRCA2 in HR, we created fusions consisting of various BRCA2 domains and also introduced mutations into these domains to disrupt specific protein and DNA interactions. We find that a BRCA2 fusion peptide deleted for the DNA binding domain and active in HR is completely dependent on interaction with the PALB2 tumor suppressor for activity. Conversely, a BRCA2 fusion peptide deleted for the PALB2 binding domain is dependent on an intact DNA binding domain, providing a role for this conserved domain in vivo; mutagenesis suggests that both single-stranded and double-stranded DNA binding activities in the DNA binding domain are required for its activity. Given that PALB2 itself binds DNA, these results suggest alternative mechanisms to deliver RAD51 to DNA. In addition, the BRCA2 C terminus contains both RAD51-dependent and -independent activities which are essential to HR in some contexts. Finally, binding the small peptide DSS1 is essential for activity when its binding domain is present, but not when it is absent. Our results reveal functional redundancy within the BRCA2 protein and emphasize the plasticity of this large protein built for optimal HR function in mammalian cells. The occurrence of disease-causing mutations throughout BRCA2 suggests sub-optimal HR from a variety of domain modulations. PMID:22194698
El-Assaad, Atlal; Dawy, Zaher; Nemer, Georges
2015-01-01
Protein-DNA interaction is of fundamental importance in molecular biology, playing roles in functions as diverse as DNA transcription, DNA structure formation, and DNA repair. Protein-DNA association is also important in medicine; understanding Protein-DNA binding kinetics can assist in identifying disease root causes which can contribute to drug development. In this perspective, this work focuses on the transcription process by the GATA Transcription Factor (TF). GATA TF binds to DNA promoter region represented by `G,A,T,A' nucleotides sequence, and initiates transcription of target genes. When proper regulation fails due to some mutations on the GATA TF protein sequence or on the DNA promoter sequence (weak promoter), deregulation of the target genes might lead to various disorders. In this study, we aim to understand the electrostatic mechanism behind GATA TF and DNA promoter interactions, in order to predict Protein-DNA binding in the presence of mutations, while elaborating on non-covalent binding kinetics. To generate a family of mutants for the GATA:DNA complex, we replaced every charged amino acid, one at a time, with a neutral amino acid like Alanine (Ala). We then applied Poisson-Boltzmann electrostatic calculations feeding into free energy calculations, for each mutation. These calculations delineate the contribution to binding from each Ala-replaced amino acid in the GATA:DNA interaction. After analyzing the obtained data in view of a two-step model, we are able to identify potential key amino acids in binding. Finally, we applied the model to GATA-3:DNA (crystal structure with PDB-ID: 3DFV) binding complex and validated it against experimental results from the literature.
Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A
2007-09-15
We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.
FACT is a sensor of DNA torsional stress in eukaryotic cells
Safina, Alfiya; Cheney, Peter; Pal, Mahadeb; Brodsky, Leonid; Ivanov, Alexander; Kirsanov, Kirill; Lesovaya, Ekaterina; Naberezhnov, Denis; Nesher, Elimelech; Koman, Igor; Wang, Dan; Wang, Jianming; Yakubovskaya, Marianna; Winkler, Duane
2017-01-01
Abstract Transitions of B-DNA to alternative DNA structures (ADS) can be triggered by negative torsional strain, which occurs during replication and transcription, and may lead to genomic instability. However, how ADS are recognized in cells is unclear. We found that the binding of candidate anticancer drug, curaxin, to cellular DNA results in uncoiling of nucleosomal DNA, accumulation of negative supercoiling and conversion of multiple regions of genomic DNA into left-handed Z-form. Histone chaperone FACT binds rapidly to the same regions via the SSRP1 subunit in curaxin-treated cells. In vitro binding of purified SSRP1 or its isolated CID domain to a methylated DNA fragment containing alternating purine/pyrimidines, which is prone to Z-DNA transition, is much stronger than to other types of DNA. We propose that FACT can recognize and bind Z-DNA or DNA in transition from a B to Z form. Binding of FACT to these genomic regions triggers a p53 response. Furthermore, FACT has been shown to bind to other types of ADS through a different structural domain, which also leads to p53 activation. Thus, we propose that FACT acts as a sensor of ADS formation in cells. Recognition of ADS by FACT followed by a p53 response may explain the role of FACT in DNA damage prevention. PMID:28082391
Replication of damaged DNA in vitro is blocked by p53
Zhou, Jianmin; Prives, Carol
2003-01-01
The tumor suppressor protein p53 may have other roles and functions in addition to its well-documented ability to serve as a sequence-specific transcriptional activator in response to DNA damage. We showed previously that p53 can block the replication of polyomavirus origin-containing DNA (Py ori-DNA) in vitro when p53 binding sites are present on the late side of the Py ori. Here we have both further extended these observations and have also examined whether p53 might be able to bind directly to and inhibit the replication of damaged DNA. We found that p53 strongly inhibits replication of γ-irradiated Py ori-DNA and such inhibition requires both the central DNA binding domain and the extreme C-terminus of the p53 protein. An endogenous p53 binding site lies within the Py origin and is required for the ability of p53 to block initiation of replication from γ-irradiated Py ori-DNA, suggesting the possibility of DNA looping caused by p53 binding both non-specifically to sites of DNA damage and specifically to the endogenous site in the polyomavirus origin. Our results thus suggest the possibility that under some circumstances p53 might serve as a direct regulator of DNA replication and suggest as well an additional function for cooperation between its two autonomous DNA binding domains. PMID:12853603
Single-molecule imaging of DNA polymerase I (Klenow fragment) activity by atomic force microscopy
NASA Astrophysics Data System (ADS)
Chao, J.; Zhang, P.; Wang, Q.; Wu, N.; Zhang, F.; Hu, J.; Fan, C. H.; Li, B.
2016-03-01
We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA.We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr06544e
Recognition of Local DNA Structures by p53 Protein
Brázda, Václav; Coufal, Jan
2017-01-01
p53 plays critical roles in regulating cell cycle, apoptosis, senescence and metabolism and is commonly mutated in human cancer. These roles are achieved by interaction with other proteins, but particularly by interaction with DNA. As a transcription factor, p53 is well known to bind consensus target sequences in linear B-DNA. Recent findings indicate that p53 binds with higher affinity to target sequences that form cruciform DNA structure. Moreover, p53 binds very tightly to non-B DNA structures and local DNA structures are increasingly recognized to influence the activity of wild-type and mutant p53. Apart from cruciform structures, p53 binds to quadruplex DNA, triplex DNA, DNA loops, bulged DNA and hemicatenane DNA. In this review, we describe local DNA structures and summarize information about interactions of p53 with these structural DNA motifs. These recent data provide important insights into the complexity of the p53 pathway and the functional consequences of wild-type and mutant p53 activation in normal and tumor cells. PMID:28208646
The Agrobacterium tumefaciens Transcription Factor BlcR Is Regulated via Oligomerization
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pan, Yi; Fiscus, Valena; Meng, Wuyi
2012-02-08
The Agrobacterium tumefaciens BlcR is a member of the emerging isocitrate lyase transcription regulators that negatively regulates metabolism of {gamma}-butyrolactone, and its repressing function is relieved by succinate semialdehyde (SSA). Our crystal structure showed that BlcR folded into the DNA- and SSA-binding domains and dimerized via the DNA-binding domains. Mutational analysis identified residues, including Phe{sup 147}, that are important for SSA association; BlcR{sup F147A} existed as tetramer. Two BlcR dimers bound to target DNA and in a cooperative manner, and the distance between the two BlcR-binding sequences in DNA was critical for BlcR-DNA association. Tetrameric BlcR{sup F147A} retained DNA bindingmore » activity, and importantly, this activity was not affected by the distance separating the BlcR-binding sequences in DNA. SSA did not dissociate tetrameric BlcR{sup F147A} or BlcR{sup F147A}-DNA. As well as in the SSA-binding site, Phe{sup 147} is located in a structurally flexible loop that may be involved in BlcR oligomerization. We propose that SSA regulates BlcR DNA-binding function via oligomerization.« less
Biophysics and bioinformatics of transcription regulation in bacteria and bacteriophages
NASA Astrophysics Data System (ADS)
Djordjevic, Marko
2005-11-01
Due to rapid accumulation of biological data, bioinformatics has become a very important branch of biological research. In this thesis, we develop novel bioinformatic approaches and aid design of biological experiments by using ideas and methods from statistical physics. Identification of transcription factor binding sites within the regulatory segments of genomic DNA is an important step towards understanding of the regulatory circuits that control expression of genes. We propose a novel, biophysics based algorithm, for the supervised detection of transcription factor (TF) binding sites. The method classifies potential binding sites by explicitly estimating the sequence-specific binding energy and the chemical potential of a given TF. In contrast with the widely used information theory based weight matrix method, our approach correctly incorporates saturation in the transcription factor/DNA binding probability. This results in a significant reduction in the number of expected false positives, and in the explicit appearance---and determination---of a binding threshold. The new method was used to identify likely genomic binding sites for the Escherichia coli TFs, and to examine the relationship between TF binding specificity and degree of pleiotropy (number of regulatory targets). We next address how parameters of protein-DNA interactions can be obtained from data on protein binding to random oligos under controlled conditions (SELEX experiment data). We show that 'robust' generation of an appropriate data set is achieved by a suitable modification of the standard SELEX procedure, and propose a novel bioinformatic algorithm for analysis of such data. Finally, we use quantitative data analysis, bioinformatic methods and kinetic modeling to analyze gene expression strategies of bacterial viruses. We study bacteriophage Xp10 that infects rice pathogen Xanthomonas oryzae. Xp10 is an unusual bacteriophage, which has morphology and genome organization that most closely resembles temperate phages, such as lambda. It, however, encodes its own T7-like RNA polymerase (characteristic of virulent phages), whose role in gene expression was unclear. Our analysis resulted in quantitative understanding of the role of both host and phage RNA polymerase, and in the identification of the previously unknown promoter sequence for Xp10 RNA polymerase. More generally, an increasing number of phage genomes are being sequenced every year, and we expect that methods of quantitative data analysis that we introduced will provide an efficient way to study gene expression strategies of novel bacterial viruses.
Spectrophotometric analysis of flavonoid-DNA binding interactions at physiological conditions
NASA Astrophysics Data System (ADS)
Janjua, Naveed Kausar; Siddiqa, Asima; Yaqub, Azra; Sabahat, Sana; Qureshi, Rumana; Haque, Sayed ul
2009-12-01
Mode of interactions of three flavonoids [morin (M), quercetin (Q), and rutin (R)] with chicken blood ds.DNA (ck.DNA) has been investigated spectrophotometrically at different temperatures including body temperature (310 K) and at two physiological pH values, i.e. 7.4 (human blood pH) and 4.7 (stomach pH). The binding constants, Kf, evaluated using Benesi-Hildebrand equation showed that the flavonoids bind effectively through intercalation at both pH values and body temperature. Quercetin, somehow, showed greater binding capabilities with DNA. The free energies of flavonoid-DNA complexes indicated the spontaneity of their binding. The order of binding constants of three flavonoids at both pH values were found to be Kf(Q) > Kf(R) > Kf(M) and at 310 K.
Moghadam, Neda Hosseinpour; Salehzadeh, Sadegh; Shahabadi, Nahid; Golbedaghi, Reza
2017-07-03
The possible interaction between the antiviral drug oseltamivir and calf thymus DNA at physiological pH was studied by spectrophotometry, competitive spectrofluorimetry, differential pulse voltammogram (DPV), circular dichroism spectroscopy (CD), viscosity measurements, salt effect, and computational studies. Intercalation of oseltamivir between the base pairs of DNA was shown by a sharp increase in specific viscosity of DNA and a decrease of the peak current and a positive shift in differential pulse voltammogram. Competitive fluorescence experiments were performed using neutral red (NR) as a probe for the intercalation binding mode. The studies showed that oseltamivir is able to release the NR.
IFI16 Preferentially Binds to DNA with Quadruplex Structure and Enhances DNA Quadruplex Formation.
Hároníková, Lucia; Coufal, Jan; Kejnovská, Iva; Jagelská, Eva B; Fojta, Miroslav; Dvořáková, Petra; Muller, Petr; Vojtesek, Borivoj; Brázda, Václav
2016-01-01
Interferon-inducible protein 16 (IFI16) is a member of the HIN-200 protein family, containing two HIN domains and one PYRIN domain. IFI16 acts as a sensor of viral and bacterial DNA and is important for innate immune responses. IFI16 binds DNA and binding has been described to be DNA length-dependent, but a preference for supercoiled DNA has also been demonstrated. Here we report a specific preference of IFI16 for binding to quadruplex DNA compared to other DNA structures. IFI16 binds to quadruplex DNA with significantly higher affinity than to the same sequence in double stranded DNA. By circular dichroism (CD) spectroscopy we also demonstrated the ability of IFI16 to stabilize quadruplex structures with quadruplex-forming oligonucleotides derived from human telomere (HTEL) sequences and the MYC promotor. A novel H/D exchange mass spectrometry approach was developed to assess protein interactions with quadruplex DNA. Quadruplex DNA changed the IFI16 deuteration profile in parts of the PYRIN domain (aa 0-80) and in structurally identical parts of both HIN domains (aa 271-302 and aa 586-617) compared to single stranded or double stranded DNAs, supporting the preferential affinity of IFI16 for structured DNA. Our results reveal the importance of quadruplex DNA structure in IFI16 binding and improve our understanding of how IFI16 senses DNA. IFI16 selectivity for quadruplex structure provides a mechanistic framework for IFI16 in immunity and cellular processes including DNA damage responses and cell proliferation.
Maltseva, E A; Krasikova, Y S; Naegeli, H; Lavrik, O I; Rechkunova, N I
2014-06-01
Xeroderma pigmentosum factor A (XPA) is one of the key proteins in the nucleotide excision repair (NER) process. The effects of point substitutions in the DNA-binding domain of XPA (positively charged lysine residues replaced by negatively charged glutamate residues: XPA K204E, K179E, K141E, and tandem mutant K141E/K179E) on the interaction of the protein with DNA structures modeling intermediates of the damage recognition and pre-incision stages in NER were analyzed. All these mutations decreased the affinity of the protein to DNA, the effect depending on the substitution and the DNA structure. The mutant as well as wild-type proteins bind with highest efficiency partly open damaged DNA duplex, and the affinity of the mutants to this DNA is reduced in the order: K204E > K179E > K141E = K141/179E. For all the mutants, decrease in DNA binding efficiency was more pronounced in the case of full duplex and single-stranded DNA than with bubble-DNA structure, the difference between protein affinities to different DNA structures increasing as DNA binding activity of the mutant decreased. No effect of the studied XPA mutations on the location of the protein on the partially open DNA duplex was observed using photoinduced crosslinking with 5-I-dUMP in different positions of the damaged DNA strand. These results combined with earlier published data suggest no direct correlation between DNA binding and activity in NER for these XPA mutants.
A new structural framework for integrating replication protein A into DNA processing machinery
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brosey, Chris A; Yan, Chunli; Tsutakawa, Susan E
2013-01-01
By coupling the protection and organization of ssDNA with the recruitment and alignment of DNA processing factors, Replication Protein A (RPA) lies at the heart of dynamic multi-protein DNA processing machinery. Nevertheless, how RPA manages to coordinate the biochemical functions of its eight domains remains unknown. We examined the structural biochemistry of RPA s DNA binding activity, combining small-angle x-ray and neutron scattering with all-atom molecular dynamics simulations to investigate the architecture of RPA s DNA-binding core. It has been long held that RPA engages ssDNA in three stages, but our data reveal that RPA undergoes two rather than threemore » transitions as it binds ssDNA. In contrast to previous models, RPA is more compact when fully engaged on 20-30 nucleotides of ssDNA than when DNA-free, and there is no evidence for significant population of a highly compacted structure in the initial 8-10 nucleotide binding mode. These results provide a new framework for understanding the integration of ssDNA into DNA processing machinery and how binding partners may manipulate RPA architecture to gain access to the substrate.« less
Cdc45-induced loading of human RPA onto single-stranded DNA.
Szambowska, Anna; Tessmer, Ingrid; Prus, Piotr; Schlott, Bernhard; Pospiech, Helmut; Grosse, Frank
2017-04-07
Cell division cycle protein 45 (Cdc45) is an essential component of the eukaryotic replicative DNA helicase. We found that human Cdc45 forms a complex with the single-stranded DNA (ssDNA) binding protein RPA. Moreover, it actively loads RPA onto nascent ssDNA. Pull-down assays and surface plasmon resonance studies revealed that Cdc45-bound RPA complexed with ssDNA in the 8-10 nucleotide binding mode, but dissociated when RPA covered a 30-mer. Real-time analysis of RPA-ssDNA binding demonstrated that Cdc45 catalytically loaded RPA onto ssDNA. This placement reaction required physical contacts of Cdc45 with the RPA70A subdomain. Our results imply that Cdc45 controlled stabilization of the 8-nt RPA binding mode, the subsequent RPA transition into 30-mer mode and facilitated an ordered binding to ssDNA. We propose that a Cdc45-mediated loading guarantees a seamless deposition of RPA on newly emerging ssDNA at the nascent replication fork. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Doroshenko, Natalya; Tseng, Boo Shan; Howlin, Robert P; Deacon, Jill; Wharton, Julian A; Thurner, Philipp J; Gilmore, Brendan F; Parsek, Matthew R; Stoodley, Paul
2014-12-01
Staphylococcus epidermidis biofilm formation is responsible for the persistence of orthopedic implant infections. Previous studies have shown that exposure of S. epidermidis biofilms to sub-MICs of antibiotics induced an increased level of biofilm persistence. BODIPY FL-vancomycin (a fluorescent vancomycin conjugate) and confocal microscopy were used to show that the penetration of vancomycin through sub-MIC-vancomycin-treated S. epidermidis biofilms was impeded compared to that of control, untreated biofilms. Further experiments showed an increase in the extracellular DNA (eDNA) concentration in biofilms preexposed to sub-MIC vancomycin, suggesting a potential role for eDNA in the hindrance of vancomycin activity. Exogenously added, S. epidermidis DNA increased the planktonic vancomycin MIC and protected biofilm cells from lethal vancomycin concentrations. Finally, isothermal titration calorimetry (ITC) revealed that the binding constant of DNA and vancomycin was 100-fold higher than the previously reported binding constant of vancomycin and its intended cellular d-Ala-d-Ala peptide target. This study provides an explanation of the eDNA-based mechanism of antibiotic tolerance in sub-MIC-vancomycin-treated S. epidermidis biofilms, which might be an important factor for the persistence of biofilm infections. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Gao, Yingning; Roberts, Christopher C; Toop, Aaron; Chang, Chia-En A; Wheeldon, Ian
2016-08-03
Understanding and controlling the molecular interactions between enzyme substrates and DNA nanostructures has important implications in the advancement of enzyme-DNA technologies as solutions in biocatalysis. Such hybrid nanostructures can be used to create enzyme systems with enhanced catalysis by controlling the local chemical and physical environments and the spatial organization of enzymes. Here we have used molecular simulations with corresponding experiments to describe a mechanism of enhanced catalysis due to locally increased substrate concentrations. With a series of DNA nanostructures conjugated to horseradish peroxidase, we show that binding interactions between substrates and the DNA structures can increase local substrate concentrations. Increased local substrate concentrations in HRP(DNA) nanostructures resulted in 2.9- and 2.4-fold decreases in the apparent Michaelis constants of tetramethylbenzidine and 4-aminophenol, substrates of HRP with tunable binding interactions to DNA nanostructures with dissociation constants in the micromolar range. Molecular simulations and kinetic analysis also revealed that increased local substrate concentrations enhanced the rates of substrate association. Identification of the mechanism of increased local concentration of substrates in close proximity to enzymes and their active sites adds to our understanding of nanostructured biocatalysis from which we can develop guidelines for enhancing catalysis in rationally designed systems. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Two-photon fluorescence and fluorescence imaging of two styryl heterocyclic dyes combined with DNA
NASA Astrophysics Data System (ADS)
Gao, Chao; Liu, Shu-yao; Zhang, Xian; Liu, Ying-kai; Qiao, Cong-de; Liu, Zhao-e.
2016-03-01
Two new styryl heterocyclic two-photon (TP) materials, 4-[4-(N-methyl)styrene]-imidazo [4,5-f][1,10] phenanthroline-benzene iodated salt (probe-1) and 4,4- [4-(N-methyl)styrene] -benzene iodated salt (probe-2) were successfully synthesized and studied as potential fluorescent probes of DNA detection. The linear and nonlinear photophysical properties of two compounds in different solvents were investigated. The absorption, one- and two-photon fluorescent spectra of the free dye and dye-DNA complex were also examined to evaluate their photophysical properties. The binding constants of dye-DNA were obtained according to Scatchard equation with good values. The results showed that two probes could be used as fluorescent DNA probes by two-photon excitation, and TP fluorescent properties of probe-1 are superior to that of probe-2. The fluorescent method date indicated that the mechanisms of dye-DNA complex interaction may be groove binding for probe-1 and electrostatic interaction for probe-2, respectively. The MTT assay experiments showed two probes are low toxicity. Moreover, the TP fluorescence imaging of DNA detection in living cells at 800 nm indicated that the ability to locate in cell nuclei of probe-1 is better than that of probe-2.
Two-photon fluorescence and fluorescence imaging of two styryl heterocyclic dyes combined with DNA.
Gao, Chao; Liu, Shu-yao; Zhang, Xian; Liu, Ying-kai; Qiao, Cong-de; Liu, Zhao-e
2016-03-05
Two new styryl heterocyclic two-photon (TP) materials, 4-[4-(N-methyl)styrene]-imidazo [4,5-f][1,10] phenanthroline-benzene iodated salt (probe-1) and 4,4-[4-(N-methyl)styrene]-benzene iodated salt (probe-2) were successfully synthesized and studied as potential fluorescent probes of DNA detection. The linear and nonlinear photophysical properties of two compounds in different solvents were investigated. The absorption, one- and two-photon fluorescent spectra of the free dye and dye-DNA complex were also examined to evaluate their photophysical properties. The binding constants of dye-DNA were obtained according to Scatchard equation with good values. The results showed that two probes could be used as fluorescent DNA probes by two-photon excitation, and TP fluorescent properties of probe-1 are superior to that of probe-2. The fluorescent method date indicated that the mechanisms of dye-DNA complex interaction may be groove binding for probe-1 and electrostatic interaction for probe-2, respectively. The MTT assay experiments showed two probes are low toxicity. Moreover, the TP fluorescence imaging of DNA detection in living cells at 800 nm indicated that the ability to locate in cell nuclei of probe-1 is better than that of probe-2. Copyright © 2015 Elsevier B.V. All rights reserved.
Structure and dynamics of proflavine association around DNA.
Sasikala, Wilbee D; Mukherjee, Arnab
2016-04-21
Proflavine is a small molecule that intercalates into DNA and, thereby, acts as an anticancer agent. Intercalation of proflavine is shown to be a two-step process in which the first step is believed to be the formation of a pre-intercalative outside bound state. Experimental studies so far have been unable to capture the nature of the outside bound state. However, the sub-millisecond timescale observed in fluorescence kinetic experiments is often attributed to the binding of proflavine outside of DNA. Here, we have performed molecular dynamics simulations with multiple proflavine molecules to study the structure and dynamics of the formation of the outside bound state of DNA at different ion concentrations. We observed that the timescale of the outside bound state formation is, at least, five orders of magnitude faster (in nanoseconds) than the experimentally reported timescale (sub-milliseconds) attributed to binding outside DNA. Moreover, we also observed the stacked arrangement of proflavine all around DNA, which is different from the experimentally predicted stacking arrangement perpendicular to the helical axis of DNA in the close vicinity of the phosphate groups. This study, therefore, provides insight into the molecular structure and dynamics of the pre-intercalative outside bound state and will help in understanding the overall intercalation mechanism.
2015-01-01
The protein MeCP2 mediates epigenetic regulation by binding methyl-CpG (mCpG) sites on chromatin. MeCP2 consists of six domains of which one, the methyl binding domain (MBD), binds mCpG sites in duplex DNA. We show that solution conditions with physiological or greater salt concentrations or the presence of nonspecific competitor DNA is necessary for the MBD to discriminate mCpG from CpG with high specificity. The specificity for mCpG over CpG is >100-fold under these solution conditions. In contrast, the MBD does not discriminate hydroxymethyl-CpG from CpG. The MBD is unusual among site-specific DNA binding proteins in that (i) specificity is not conferred by the enhanced affinity for the specific site but rather by suppression of its affinity for generic DNA, (ii) its specific binding to mCpG is highly electrostatic, and (iii) it takes up as well as displaces monovalent cations upon DNA binding. The MBD displays an unusually high affinity for single-stranded DNA independent of modification or sequence. In addition, the MBD forms a discrete dimer on DNA via a noncooperative binding pathway. Because the affinity of the second monomer is 1 order of magnitude greater than that of nonspecific binding, the MBD dimer is a unique molecular complex. The significance of these results in the context of neuronal function and development and MeCP2-related developmental disorders such as Rett syndrome is discussed. PMID:24828757
Fan, Hsiu-Fang; Cox, Michael M.; Li, Hung-Wen
2011-01-01
RecA recombinases play a central role in homologous recombination. Once assembled on single-stranded (ss) DNA, RecA nucleoprotein filaments mediate the pairing of homologous DNA sequences and strand exchange processes. We have designed two experiments based on tethered particle motion (TPM) to investigate the fates of the invading and the outgoing strands during E. coli RecA-mediated pairing and strand exchange at the single-molecule level in the absence of force. TPM experiments measure the tethered bead Brownian motion indicative of the DNA tether length change resulting from RecA binding and dissociation. Experiments with beads labeled on either the invading strand or the outgoing strand showed that DNA pairing and strand exchange occurs successfully in the presence of either ATP or its non-hydrolyzable analog, ATPγS. The strand exchange rates and efficiencies are similar under both ATP and ATPγS conditions. In addition, the Brownian motion time-courses suggest that the strand exchange process progresses uni-directionally in the 5′-to-3′ fashion, using a synapse segment with a wide and continuous size distribution. PMID:21765895
Clifford, Jacob; Adami, Christoph
2015-09-02
Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.
Das, Theerthankar; Kutty, Samuel K; Tavallaie, Roya; Ibugo, Amaye I; Panchompoo, Janjira; Sehar, Shama; Aldous, Leigh; Yeung, Amanda W S; Thomas, Shane R; Kumar, Naresh; Gooding, J Justin; Manefield, Mike
2015-02-11
Bacterial resistance to conventional antibiotics necessitates the identification of novel leads for infection control. Interference with extracellular phenomena, such as quorum sensing, extracellular DNA integrity and redox active metabolite release, represents a new frontier to control human pathogens such as Pseudomonas aeruginosa and hence reduce mortality. Here we reveal that the extracellular redox active virulence factor pyocyanin produced by P. aeruginosa binds directly to the deoxyribose-phosphate backbone of DNA and intercalates with DNA nitrogenous base pair regions. Binding results in local perturbations of the DNA double helix structure and enhanced electron transfer along the nucleic acid polymer. Pyocyanin binding to DNA also increases DNA solution viscosity. In contrast, antioxidants interacting with DNA and pyocyanin decrease DNA solution viscosity. Biofilms deficient in pyocyanin production and biofilms lacking extracellular DNA show similar architecture indicating the interaction is important in P. aeruginosa biofilm formation.
Das, Theerthankar; Kutty, Samuel K.; Tavallaie, Roya; Ibugo, Amaye I.; Panchompoo, Janjira; Sehar, Shama; Aldous, Leigh; Yeung, Amanda W. S.; Thomas, Shane R.; Kumar, Naresh; Gooding, J. Justin; Manefield, Mike
2015-01-01
Bacterial resistance to conventional antibiotics necessitates the identification of novel leads for infection control. Interference with extracellular phenomena, such as quorum sensing, extracellular DNA integrity and redox active metabolite release, represents a new frontier to control human pathogens such as Pseudomonas aeruginosa and hence reduce mortality. Here we reveal that the extracellular redox active virulence factor pyocyanin produced by P. aeruginosa binds directly to the deoxyribose-phosphate backbone of DNA and intercalates with DNA nitrogenous base pair regions. Binding results in local perturbations of the DNA double helix structure and enhanced electron transfer along the nucleic acid polymer. Pyocyanin binding to DNA also increases DNA solution viscosity. In contrast, antioxidants interacting with DNA and pyocyanin decrease DNA solution viscosity. Biofilms deficient in pyocyanin production and biofilms lacking extracellular DNA show similar architecture indicating the interaction is important in P. aeruginosa biofilm formation. PMID:25669133
(CAG)(n)-hairpin DNA binds to Msh2-Msh3 and changes properties of mismatch recognition.
Owen, Barbara A L; Yang, Zungyoon; Lai, Maoyi; Gajec, Maciej; Gajek, Maciez; Badger, John D; Hayes, Jeffrey J; Edelmann, Winfried; Kucherlapati, Raju; Wilson, Teresa M; McMurray, Cynthia T
2005-08-01
Cells have evolved sophisticated DNA repair systems to correct damaged DNA. However, the human DNA mismatch repair protein Msh2-Msh3 is involved in the process of trinucleotide (CNG) DNA expansion rather than repair. Using purified protein and synthetic DNA substrates, we show that Msh2-Msh3 binds to CAG-hairpin DNA, a prime candidate for an expansion intermediate. CAG-hairpin binding inhibits the ATPase activity of Msh2-Msh3 and alters both nucleotide (ADP and ATP) affinity and binding interfaces between protein and DNA. These changes in Msh2-Msh3 function depend on the presence of A.A mispaired bases in the stem of the hairpin and on the hairpin DNA structure per se. These studies identify critical functional defects in the Msh2-Msh3-CAG hairpin complex that could misdirect the DNA repair process.
Nagano, Yukio; Furuhashi, Hirofumi; Inaba, Takehito; Sasaki, Yukiko
2001-01-01
Complementary DNA encoding a DNA-binding protein, designated PLATZ1 (plant AT-rich sequence- and zinc-binding protein 1), was isolated from peas. The amino acid sequence of the protein is similar to those of other uncharacterized proteins predicted from the genome sequences of higher plants. However, no paralogous sequences have been found outside the plant kingdom. Multiple alignments among these paralogous proteins show that several cysteine and histidine residues are invariant, suggesting that these proteins are a novel class of zinc-dependent DNA-binding proteins with two distantly located regions, C-x2-H-x11-C-x2-C-x(4–5)-C-x2-C-x(3–7)-H-x2-H and C-x2-C-x(10–11)-C-x3-C. In an electrophoretic mobility shift assay, the zinc chelator 1,10-o-phenanthroline inhibited DNA binding, and two distant zinc-binding regions were required for DNA binding. A protein blot with 65ZnCl2 showed that both regions are required for zinc-binding activity. The PLATZ1 protein non-specifically binds to A/T-rich sequences, including the upstream region of the pea GTPase pra2 and plastocyanin petE genes. Expression of the PLATZ1 repressed those of the reporter constructs containing the coding sequence of luciferase gene driven by the cauliflower mosaic virus (CaMV) 35S90 promoter fused to the tandem repeat of the A/T-rich sequences. These results indicate that PLATZ1 is a novel class of plant-specific zinc-dependent DNA-binding protein responsible for A/T-rich sequence-mediated transcriptional repression. PMID:11600698
NMR studies of DNA oligomers and their interactions with minor groove binding ligands
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fagan, Patricia A.
1996-05-01
The cationic peptide ligands distamycin and netropsin bind noncovalently to the minor groove of DNA. The binding site, orientation, stoichiometry, and qualitative affinity of distamycin binding to several short DNA oligomers were investigated by NMR spectroscopy. The oligomers studied contain A,T-rich or I,C-rich binding sites, where I = 2-desaminodeoxyguanosine. I•C base pairs are functional analogs of A•T base pairs in the minor groove. The different behaviors exhibited by distamycin and netropsin binding to various DNA sequences suggested that these ligands are sensitive probes of DNA structure. For sites of five or more base pairs, distamycin can form 1:1 or 2:1more » ligand:DNA complexes. Cooperativity in distamycin binding is low in sites such as AAAAA which has narrow minor grooves, and is higher in sites with wider minor grooves such as ATATAT. The distamycin binding and base pair opening lifetimes of I,C-containing DNA oligomers suggest that the I,C minor groove is structurally different from the A,T minor groove. Molecules which direct chemistry to a specific DNA sequence could be used as antiviral compounds, diagnostic probes, or molecular biology tools. The author studied two ligands in which reactive groups were tethered to a distamycin to increase the sequence specificity of the reactive agent.« less
Polevoda, Bogdan; McDougall, William M.; Tun, Bradley N.; Cheung, Michael; Salter, Jason D.; Friedman, Alan E.; Smith, Harold C.
2015-01-01
APOBEC3G (A3G) DNA deaminase activity requires a holoenzyme complex whose assembly on nascent viral reverse transcripts initiates with A3G dimers binding to ssDNA followed by formation of higher-order A3G homo oligomers. Catalytic activity is inhibited when A3G binds to RNA. Our prior studies suggested that RNA inhibited A3G binding to ssDNA. In this report, near equilibrium binding and gel shift analyses showed that A3G assembly and disassembly on ssDNA was an ordered process involving A3G dimers and multimers thereof. Although, fluorescence anisotropy showed that A3G had similar nanomolar affinity for RNA and ssDNA, RNA stochastically dissociated A3G dimers and higher-order oligomers from ssDNA, suggesting a different modality for RNA binding. Mass spectrometry mapping of A3G peptides cross-linked to nucleic acid suggested ssDNA only bound to three peptides, amino acids (aa) 181–194 in the N-terminus and aa 314–320 and 345–374 in the C-terminus that were part of a continuous exposed surface. RNA bound to these peptides and uniquely associated with three additional peptides in the N- terminus, aa 15–29, 41–52 and 83–99, that formed a continuous surface area adjacent to the ssDNA binding surface. The data predict a mechanistic model of RNA inhibition of ssDNA binding to A3G in which competitive and allosteric interactions determine RNA-bound versus ssDNA-bound conformational states. PMID:26424853
DNA as a Target for Anticancer Phen-Imidazole Pd(II) Complexes.
Heydari, Maryam; Moghadam, Mahboube Eslami; Tarlani, AliAkbar; Farhangian, Hossein
2017-05-01
Imidazole ring is a known structure in many natural or synthetic drug molecules and its metal complexes can interact with DNA and do the cleavage. Hence, to study the influence of the structure and size of the ligand on biological behavior of metal complexes, two water-soluble Pd(II) complexes of phen and FIP ligands (where phen is 1,10-phenanthroline and FIP is 2-(Furan-2-yl)-1H-Imidazo[4,5-f][1, 10]phenanthroline) with the formula of [Pd(phen)(FIP)](NO 3 ) 2 and [Pd(FIP) 2 ]Cl 2 , that were activated against chronic myelogenous leukemia cell line, K562, were selected. Also, the interaction of these anticancer Pd(II) complexes with highly polymerized calf thymus DNA was extensively studied by means of electronic absorption, fluorescence, and circular dichroism in Tris-buffer. The results showed that the binding was positive cooperation and [Pd(phen)(FIP)](NO 3 ) 2 (K f = 127 M -1 G = 1.2) exhibited higher binding constant and number of binding sites than [Pd(FIP) 2 ]Cl 2 (K f = 13 M -1 G = 1.03) upon binding to DNA. The fluorescence data indicates that quenching effect for [Pd(phen)(FIP)](NO 3 ) 2 (K SV = 58 mM -1 ) was higher than [Pd(FIP) 2 ]Cl 2 (K SV = 12 mM -1 ). Also, [Pd(FIP) 2 ]Cl 2 interacts with ethidium bromide-DNA, as non-competitive inhibition, and can bind to DNA via groove binding and [Pd(phen)(FIP)](NO 3 ) 2 can intercalate in DNA. These results were confirmed by circular dichroism spectra. Docking data revealed that longer complexes have higher interaction energy and bind to DNA via groove binding. Graphical Abstract Two anticancer Pd(II) complexes of imidazole derivative have been synthesized and interacted with calf thymus DNA. Modes of binding have been studied by electronic absorption, fluorescence, and CD measurements. [Pd(FIP) 2 ]Cl 2 can bind to DNA via groove binding while intercalation mode of binding is observed for [Pd(phen)(FIP)](NO 3 ) 2 .
G-quadruplex induced stabilization by 2′-deoxy-2′-fluoro-d-arabinonucleic acids (2′F-ANA)
Peng, Chang Geng; Damha, Masad J.
2007-01-01
The impact of 2′-deoxy-2′-fluoroarabinonucleotide residues (2′F-araN) on different G-quadruplexes derived from a thrombin-binding DNA aptamer d(G2T2G2TGTG2T2G2), an anti-HIV phosphorothioate aptamer PS-d(T2G4T2) and a DNA telomeric sequence d(G4T4G4) via UV thermal melting (Tm) and circular dichroism (CD) experiments has been investigated. Generally, replacement of deoxyguanosines that adopt the anti conformation (anti-guanines) with 2′F-araG can stabilize G-quartets and maintain the quadruplex conformation, while replacement of syn-guanines with 2′F-araG is not favored and results in a dramatic switch to an alternative quadruplex conformation. It was found that incorporation of 2′F-araG or T residues into a thrombin-binding DNA G-quadruplex stabilizes the complex (ΔTm up to ∼+3°C/2′F-araN modification); 2′F-araN units also increased the half-life in 10% fetal bovine serum (FBS) up to 48-fold. Two modified thrombin-binding aptamers (PG13 and PG14) show an approximately 4-fold increase in binding affinity to thrombin, as assessed via a nitrocellulose filter binding assay, both with increased thermal stability (∼1°C/2′F-ANA modification increase in Tm) and nuclease resistance (4–7-fold) as well. Therefore, the 2′-deoxy-2′-fluoro-d-arabinonucleic acid (2′F-ANA) modification is well suited to tune (and improve) the physicochemical and biological properties of naturally occurring DNA G-quartets. PMID:17636049
Claveria-Gimeno, Rafael; Lanuza, Pilar M; Morales-Chueca, Ignacio; Jorge-Torres, Olga C; Vega, Sonia; Abian, Olga; Esteller, Manel; Velazquez-Campoy, Adrian
2017-01-31
Methyl-CpG binding protein 2 (MeCP2) preferentially interacts with methylated DNA and it is involved in epigenetic regulation and chromatin remodelling. Mutations in MeCP2 are linked to Rett syndrome, the leading cause of intellectual retardation in girls and causing mental, motor and growth impairment. Unstructured regions in MeCP2 provide the plasticity for establishing interactions with multiple binding partners. We present a biophysical characterization of the methyl binding domain (MBD) from MeCP2 reporting the contribution of flanking domains to its structural stability and dsDNA interaction. The flanking disordered intervening domain (ID) increased the structural stability of MBD, modified its dsDNA binding profile from an entropically-driven moderate-affinity binding to an overwhelmingly enthalpically-driven high-affinity binding. Additionally, ID provided an additional site for simultaneously and autonomously binding an independent dsDNA molecule, which is a key feature linked to the chromatin remodelling and looping activity of MeCP2, as well as its ability to interact with nucleosomes replacing histone H1. The dsDNA interaction is characterized by an unusually large heat capacity linked to a cluster of water molecules trapped within the binding interface. The dynamics of disordered regions together with extrinsic factors are key determinants of MeCP2 global structural properties and functional capabilities.
Claveria-Gimeno, Rafael; Lanuza, Pilar M.; Morales-Chueca, Ignacio; Jorge-Torres, Olga C.; Vega, Sonia; Abian, Olga; Esteller, Manel; Velazquez-Campoy, Adrian
2017-01-01
Methyl-CpG binding protein 2 (MeCP2) preferentially interacts with methylated DNA and it is involved in epigenetic regulation and chromatin remodelling. Mutations in MeCP2 are linked to Rett syndrome, the leading cause of intellectual retardation in girls and causing mental, motor and growth impairment. Unstructured regions in MeCP2 provide the plasticity for establishing interactions with multiple binding partners. We present a biophysical characterization of the methyl binding domain (MBD) from MeCP2 reporting the contribution of flanking domains to its structural stability and dsDNA interaction. The flanking disordered intervening domain (ID) increased the structural stability of MBD, modified its dsDNA binding profile from an entropically-driven moderate-affinity binding to an overwhelmingly enthalpically-driven high-affinity binding. Additionally, ID provided an additional site for simultaneously and autonomously binding an independent dsDNA molecule, which is a key feature linked to the chromatin remodelling and looping activity of MeCP2, as well as its ability to interact with nucleosomes replacing histone H1. The dsDNA interaction is characterized by an unusually large heat capacity linked to a cluster of water molecules trapped within the binding interface. The dynamics of disordered regions together with extrinsic factors are key determinants of MeCP2 global structural properties and functional capabilities. PMID:28139759
Harrison, Joseph S; Cornett, Evan M; Goldfarb, Dennis; DaRosa, Paul A; Li, Zimeng M; Yan, Feng; Dickson, Bradley M; Guo, Angela H; Cantu, Daniel V; Kaustov, Lilia; Brown, Peter J; Arrowsmith, Cheryl H; Erie, Dorothy A; Major, Michael B; Klevit, Rachel E; Krajewski, Krzysztof; Kuhlman, Brian; Strahl, Brian D; Rothbart, Scott B
2016-09-06
The epigenetic inheritance of DNA methylation requires UHRF1, a histone- and DNA-binding RING E3 ubiquitin ligase that recruits DNMT1 to sites of newly replicated DNA through ubiquitylation of histone H3. UHRF1 binds DNA with selectivity towards hemi-methylated CpGs (HeDNA); however, the contribution of HeDNA sensing to UHRF1 function remains elusive. Here, we reveal that the interaction of UHRF1 with HeDNA is required for DNA methylation but is dispensable for chromatin interaction, which is governed by reciprocal positive cooperativity between the UHRF1 histone- and DNA-binding domains. HeDNA recognition activates UHRF1 ubiquitylation towards multiple lysines on the H3 tail adjacent to the UHRF1 histone-binding site. Collectively, our studies are the first demonstrations of a DNA-protein interaction and an epigenetic modification directly regulating E3 ubiquitin ligase activity. They also define an orchestrated epigenetic control mechanism involving modifications both to histones and DNA that facilitate UHRF1 chromatin targeting, H3 ubiquitylation, and DNA methylation inheritance.
Zhang, Chao; Guo, Xiaofei; Cai, Wenqian; Ma, Yue; Zhao, Xiaoyan
2015-04-01
The binding characteristics and protective capacity of cyanidin (Cy) and cyanidin-3-glucoside (C3G) to calf thymus DNA were explored for the first time. The Cy and C3G gave a bathochromic shift to the ultraviolet-visible spectra of the DNA, indicating the formation of the DNA-Cy and DNA-C3G complexes. The complexes were formed by an intercalative binding mode based on the results of the fluorescence spectra and competitive binding analysis. Meanwhile, the Cy and C3G protected the DNA from the damage induced by the hydroxyl radical. The binding capacity and protective capacity of the C3G were stronger than that of the Cy. Furthermore, the formation of the DNA-anthocyanin complexes was spontaneous when the hydrogen bond and hydrophobic force played a key role. Hence, the Cy and C3G could protect the DNA automatically from the damage induced by the hydroxyl radical. © 2015 Institute of Food Technologists®
Szczurek, Aleksander; Klewes, Ludger; Xing, Jun; Gourram, Amine; Birk, Udo; Knecht, Hans; Dobrucki, Jurek W.; Mai, Sabine
2017-01-01
Abstract Advanced light microscopy is an important tool for nanostructure analysis of chromatin. In this report we present a general concept for Single Molecule localization Microscopy (SMLM) super-resolved imaging of DNA-binding dyes based on modifying the properties of DNA and the dye. By careful adjustment of the chemical environment leading to local, reversible DNA melting and hybridization control over the fluorescence signal of the DNA-binding dye molecules can be introduced. We postulate a transient binding as the basis for our variation of binding-activated localization microscopy (BALM). We demonstrate that several intercalating and minor-groove binding DNA dyes can be used to register (optically isolate) only a few DNA-binding dye signals at a time. To highlight this DNA structure fluctuation-assisted BALM (fBALM), we applied it to measure, for the first time, nanoscale differences in nuclear architecture in model ischemia with an anticipated structural resolution of approximately 50 nm. Our data suggest that this approach may open an avenue for the enhanced microscopic analysis of chromatin nano-architecture and hence the microscopic analysis of nuclear structure aberrations occurring in various pathological conditions. It may also become possible to analyse nuclear nanostructure differences in different cell types, stages of development or environmental stress conditions. PMID:28082388
Jagla, K; Stanceva, I; Dretzen, G; Bellard, F; Bellard, M
1994-01-01
Homeodomains appear to be one of the most frequently employed DNA-binding domains in a superfamily of transacting factors. It is likely that during evolution several sub-types of homeodomain have evolved from a common ancestral domain, resulting in distinct but closely related DNA-binding preferences. Here we describe the conservation of a distinct type of homeodomain encoded by the Drosophila lady-bird-late (lbl) gene, previously named nkch4 (1). Using degenerate PCR primers corresponding to the most divergent regions of the first and third helix of the Lbl homeodomain we have amplified, from genomic DNA of the fly, a lady-bird-like homeobox fragment. The Drosophila PCR products contained both the lbl (1) and a highly related homeobox sequence, which we named lady-bird-early (lbe). This new Drosophila gene resides directly upstream to lbl and together with tinman/NK4 (2, 3, 4, 5), bagpipe/NK3 (2, 4) S59/NK1 (4, 6) and 93Bal (7) compose the 93D/E homeobox gene cluster. Ibe and lbl are transcribed from the same strand and in a temporal order corresponding to their 5'-3' chromosomal location. Transcripts of both genes are found in the epiderm of Drosophila embryos, in cells known to express a segment polarity gene wingless (8), and their spatial and temporal colinearity of expression strongly suggests that they cooperate during segmentation. The amino-acid composition of both Lady-bird homeodomains differ from that of Antp-type at several positions involved in DNA recognition. These substitutions appear to modify DNA-binding preferences since Lbl homeodomain is unable to recognize the most common homeodomain binding TAAT motif in gel retardation experiments. Images PMID:7909370
Ma, Tieliang; Xu, Jun; Wang, Yuan; Yu, Hao; Yang, Yong; Liu, Yang; Ding, Weiliang; Zhu, Wenjiao; Chen, Ruhua; Ge, Zhijun; Tan, Yongfei; Jia, Lei; Zhu, Taofeng
2015-03-01
Nowadays, chemotherapy is a common means of oncology. However, it is difficult to find excellent chemotherapy drugs. Here we reported three new ternary copper(II) complexes which have potential chemotherapy characteristics with reduced Schiff base ligand and heterocyclic bases (TBHP), [Cu(phen)(TBHP)]H2O (1), [Cu(dpz)(TBHP)]H2O (2) and [Cu(dppz)(TBHP)]H2O (3) (phen=1,10-phenanthroline, dpz=dipyrido [3,2:2',3'-f]quinoxaline, dppz=dipyrido [3,2-a:2',3'-c]phenazine, H2TBHP=2-(3,5-di-tert-butyl-2-hydroxybenzylamino)-2-benzyl-acetic acid). The DNA-binding properties of the complexes were investigated by spectrometric titrations, ethidium bromide displacement experiments and viscosity measurements. The results indicated that the three complexes, especially the complex 13, can strongly bind to calf-thymus DNA (CT-DNA). The intrinsic binding constants Kb of the ternary copper(II) complexes with CT-DNA were 1.37×10(5), 1.81×10(5) and 3.21×10(5) for 1, 2 and 3 respectively. Comparative cytotoxic activities of the copper(II) complexes were also determined by 3-(4,5-dimethylthiazol-2yl)-2,5-diphenyltetrazolium bromide (MTT) assay. The results showed that the ternary copper(II) complexes had significant cytotoxic activity against the human lung cancer (A549), human esophageal cancer (Eca109) and human gastric cancer (SGC7901) cell lines. Cell apoptosis were detected by AnnexinV/PI flow cytometry and by Western blotting with the protein expression of p53, Bax and Bcl-2. All the three copper complexes can effectively induce apoptosis of the three human tumor cells. Copyright © 2014 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Aung, Khin Moh Moh; Lim, Michelle Gek Liang; Hong, Shuzhen; Cheung, Edwin; Su, Xiaodi
Forkhead box protein 1 (FoxA1) is a member of the forkhead family of winged-helix transcription factors. It plays crucial roles in the development and differentiation of multiple organs and in the regulation of estrogen-stimulated genes. In this study, in order to determine the regions of FoxA1 necessary for efficient Deoxyribonucleic Acid (DNA) binding, we cloned, expressed and purified a series of FoxA1 constructs that contain either the DNA Binding Domain (DBD), the Transcription Activation Domain (TAD), or both. We determined the DNA binding behavior of these constructs using traditional electrophoretic mobility shift assay (EMSA) and a recently developed gold nanoparticles (AuNPs)-based fast screening method. We conclude that just the DBD region alone is not sufficient for protein-DNA binding activity. Amino acids flanking the upstream of the DBD region are required for maximal DNA binding activity. Through this study, we have also further validated the AuNPs assay for its generality and expanded the existing protocol for comparing the DNA binding behavior of multiple proteins of different charge properties and molecular weights.
Wang, Yucai; Han, Xiao; Wu, Fangming; Leung, Justin W; Lowery, Megan G; Do, Huong; Chen, Junjie; Shi, Chaowei; Tian, Changlin; Li, Lei; Gong, Weimin
2013-01-01
The FANCM/FAAP24 heterodimer has distinct functions in protecting cells from complex DNA lesions such as interstrand crosslinks. These functions rely on the biochemical activity of FANCM/FAAP24 to recognize and bind to damaged DNA or stalled replication forks. However, the DNA-binding activity of this complex was not clearly defined. We investigated how FAAP24 contributes to the DNA-interacting functions of the FANCM/FAAP24 complex by acquiring the N-terminal and C-terminal solution structures of human FAAP24. Modeling of the FAAP24 structure indicates that FAAP24 may possess a high affinity toward single-stranded DNA (ssDNA). Testing of various FAAP24 mutations in vitro and in vivo validated this prediction derived from structural analyses. We found that the DNA-binding and FANCM-interacting functions of FAAP24, although both require the C-terminal (HhH)2 domain, can be distinguished by segregation-of-function mutations. These results demonstrate dual roles of FAAP24 in DNA damage response against crosslinking lesions, one through the formation of FANCM/FAAP24 heterodimer and the other via its ssDNA-binding activity required in optimized checkpoint activation. PMID:23999858
Stopped-flow kinetic studies of poly(amidoamine) dendrimer-calf thymus DNA to form dendriplexes.
Dey, Debabrata; Kumar, Santosh; Maiti, Souvik; Dhara, Dibakar
2013-11-07
Poly(amidoamine) (PAMAM) dendrimers are known to be highly efficient nonviral carriers in gene delivery. Dendrimer-mediated transfection is known to be a function of the dendrimer to DNA charge ratio as well as the size of the dendrimer. In the present study, the binding kinetics of four PAMAM dendrimers (G1, G2, G3, and G4) with calf thymus DNA (CT-DNA) has been studied using stopped-flow fluorescence spectroscopy. The effect of dendrimer-to-DNA charge ratio and dendrimer generation on the binding kinetics was investigated. In most cases, the results of dendrimer-CT-DNA binding can be explained by a two-step reaction mechanism: a rapid electrostatic binding between the dendrimer and DNA, followed by a conformational change of the dendrimer-DNA complex that ultimately leads to DNA condensation. It was observed that the charge ratio on the dendrimer and the DNA phosphate groups, as well as the dendrimer generation (size), has a marked effect on the kinetics of binding between the DNA and the dendrimers. The rate constant (k'1) of the first step was much higher compared to that of the second step (k'2), and both were found to increase with an increase in dendrimer concentration. Among the four generations of dendrimers, G4 exhibited significantly faster binding kinetics compared to the three smaller generation dendrimers.
Liu, Bin; Wang, Shanyi; Dong, Qiwen; Li, Shumin; Liu, Xuan
2016-04-20
DNA-binding proteins play a pivotal role in various intra- and extra-cellular activities ranging from DNA replication to gene expression control. With the rapid development of next generation of sequencing technique, the number of protein sequences is unprecedentedly increasing. Thus it is necessary to develop computational methods to identify the DNA-binding proteins only based on the protein sequence information. In this study, a novel method called iDNA-KACC is presented, which combines the Support Vector Machine (SVM) and the auto-cross covariance transformation. The protein sequences are first converted into profile-based protein representation, and then converted into a series of fixed-length vectors by the auto-cross covariance transformation with Kmer composition. The sequence order effect can be effectively captured by this scheme. These vectors are then fed into Support Vector Machine (SVM) to discriminate the DNA-binding proteins from the non DNA-binding ones. iDNA-KACC achieves an overall accuracy of 75.16% and Matthew correlation coefficient of 0.5 by a rigorous jackknife test. Its performance is further improved by employing an ensemble learning approach, and the improved predictor is called iDNA-KACC-EL. Experimental results on an independent dataset shows that iDNA-KACC-EL outperforms all the other state-of-the-art predictors, indicating that it would be a useful computational tool for DNA binding protein identification. .
Khajeh, Masoumeh Ashrafi; Dehghan, Gholamreza; Dastmalchi, Siavoush; Shaghaghi, Masoomeh; Iranshahi, Mehrdad
2018-03-05
DNA is a major target for a number of anticancer substances. Interaction studies between small molecules and DNA are essential for rational drug designing to influence main biological processes and also introducing new probes for the assay of DNA. Tschimgine (TMG) is a monoterpene derivative with anticancer properties. In the present study we tried to elucidate the interaction of TMG with calf thymus DNA (CT-DNA) using different spectroscopic methods. UV-visible absorption spectrophotometry, fluorescence and circular dichroism (CD) spectroscopies as well as molecular docking study revealed formation of complex between TMG and CT-DNA. Binding constant (K b ) between TMG and DNA was 2.27×10 4 M -1 , that is comparable to groove binding agents. The fluorescence spectroscopic data revealed that the quenching mechanism of fluorescence of TMG by CT-DNA is static quenching. Thermodynamic parameters (ΔH<0 and ΔS<0) at different temperatures indicated that van der Waals forces and hydrogen bonds were involved in the binding process of TMG with CT-DNA. Competitive binding assay with methylene blue (MB) and Hoechst 33258 using fluorescence spectroscopy displayed that TMG possibly binds to the minor groove of CT-DNA. These observations were further confirmed by CD spectral analysis, viscosity measurements and molecular docking. Copyright © 2017 Elsevier B.V. All rights reserved.
Chlorella virus DNA ligase: nick recognition and mutational analysis.
Sriskanda, V; Shuman, S
1998-01-15
Chlorella virus PBCV-1 DNA ligase seals nicked DNA substrates consisting of a 5'-phosphate-terminated strand and a 3'-hydroxyl-terminated strand annealed to a bridging DNA template strand. The enzyme discriminates at the DNA binding step between substrates containing a 5'-phosphate versus a 5'-hydroxyl at the nick. Mutational analysis of the active site motif KxDGxR (residues 27-32) illuminates essential roles for the conserved Lys, Asp and Arg moieties at different steps of the ligase reaction. Mutant K27A is unable to form the covalent ligase-(Lys-straightepsilonN-P)-adenylate intermediate and hence cannot activate a nicked DNA substrate via formation of the DNA-adenylate intermediate. Nonetheless, K27A catalyzes phosphodiester bond formation at a pre-adenylated nick. This shows that the active site lysine is not required for the strand closure reaction. K27A binds to nicked DNA-adenylate, but not to a standard DNA nick. This suggests that occupancy of the AMP binding pocket of DNA ligase is important for nick recognition. Mutant D29A is active in enzyme-adenylate formation and binds readily to nicked DNA, but is inert in DNA-adenylate formation. R32A is unable to catalyze any of the three reactions of the ligation pathway and does not bind to nicked DNA.
Kessels, Jana Elena; Wessels, Inga; Haase, Hajo; Rink, Lothar; Uciechowski, Peter
2016-09-01
The distribution of intracellular zinc, predominantly regulated through zinc transporters and zinc binding proteins, is required to support an efficient immune response. Epigenetic mechanisms such as DNA methylation are involved in the expression of these genes. In demethylation experiments using 5-Aza-2'-deoxycytidine (AZA) increased intracellular (after 24 and 48h) and total cellular zinc levels (after 48h) were observed in the myeloid cell line HL-60. To uncover the mechanisms that cause the disturbed zinc homeostasis after DNA demethylation, the expression of human zinc transporters and zinc binding proteins were investigated. Real time PCR analyses of 14 ZIP (solute-linked carrier (SLC) SLC39A; Zrt/IRT-like protein), and 9 ZnT (SLC30A) zinc transporters revealed significantly enhanced mRNA expression of the zinc importer ZIP1 after AZA treatment. Because ZIP1 protein was also enhanced after AZA treatment, ZIP1 up-regulation might be the mediator of enhanced intracellular zinc levels. The mRNA expression of ZIP14 was decreased, whereas zinc exporter ZnT3 mRNA was also significantly increased; which might be a cellular reaction to compensate elevated zinc levels. An enhanced but not significant chromatin accessibility of ZIP1 promoter region I was detected by chromatin accessibility by real-time PCR (CHART) assays after demethylation. Additionally, DNA demethylation resulted in increased mRNA accumulation of zinc binding proteins metallothionein (MT) and S100A8/S100A9 after 48h. MT mRNA was significantly enhanced after 24h of AZA treatment also suggesting a reaction of the cell to restore zinc homeostasis. These data indicate that DNA methylation is an important epigenetic mechanism affecting zinc binding proteins and transporters, and, therefore, regulating zinc homeostasis in myeloid cells. Copyright © 2016 Elsevier GmbH. All rights reserved.
STN1 OB Fold Mutation Alters DNA Binding and Affects Selective Aspects of CST Function
Bhattacharjee, Anukana; Stewart, Jason; Chaiken, Mary; Price, Carolyn M.
2016-01-01
Mammalian CST (CTC1-STN1-TEN1) participates in multiple aspects of telomere replication and genome-wide recovery from replication stress. CST resembles Replication Protein A (RPA) in that it binds ssDNA and STN1 and TEN1 are structurally similar to RPA2 and RPA3. Conservation between CTC1 and RPA1 is less apparent. Currently the mechanism underlying CST action is largely unknown. Here we address CST mechanism by using a DNA-binding mutant, (STN1 OB-fold mutant, STN1-OBM) to examine the relationship between DNA binding and CST function. In vivo, STN1-OBM affects resolution of endogenous replication stress and telomere duplex replication but telomeric C-strand fill-in and new origin firing after exogenous replication stress are unaffected. These selective effects indicate mechanistic differences in CST action during resolution of different replication problems. In vitro binding studies show that STN1 directly engages both short and long ssDNA oligonucleotides, however STN1-OBM preferentially destabilizes binding to short substrates. The finding that STN1-OBM affects binding to only certain substrates starts to explain the in vivo separation of function observed in STN1-OBM expressing cells. CST is expected to engage DNA substrates of varied length and structure as it acts to resolve different replication problems. Since STN1-OBM will alter CST binding to only some of these substrates, the mutant should affect resolution of only a subset of replication problems, as was observed in the STN1-OBM cells. The in vitro studies also provide insight into CST binding mechanism. Like RPA, CST likely contacts DNA via multiple OB folds. However, the importance of STN1 for binding short substrates indicates differences in the architecture of CST and RPA DNA-protein complexes. Based on our results, we propose a dynamic DNA binding model that provides a general mechanism for CST action at diverse forms of replication stress. PMID:27690379
Joynt, Suzanne; Morillo, Victor; Leng, Fenfei
2009-01-01
HMGA2 is a DNA minor-groove binding protein. We previously demonstrated that HMGA2 binds to AT-rich DNA with very high binding affinity where the binding of HMGA2 to poly(dA-dT)2 is enthalpy-driven and to poly(dA)poly(dT) is entropy-driven. This is a typical example of enthalpy-entropy compensation. To further study enthalpy-entropy compensation of HMGA2, we used isothermal-titration-calorimetry to examine the interactions of HMGA2 with two AT-rich DNA hairpins: 5′-CCAAAAAAAAAAAAAAAGCCCCCGCTTTTTTTTTTTTTTTGG-3′ (FL-AT-1) and 5′-CCATATATATATATATAGCCCCCGCTATATATATATATATGG-3′ (FL-AT-2). Surprisingly, we observed an atypical isothermal-titration-calorimetry-binding curve at low-salt aqueous solutions whereby the apparent binding-enthalpy decreased dramatically as the titration approached the end. This unusual behavior can be attributed to the DNA-annealing coupled to the ligand DNA-binding and is eliminated by increasing the salt concentration to ∼200 mM. At this condition, HMGA2 binding to FL-AT-1 is entropy-driven and to FL-AT-2 is enthalpy-driven. Interestingly, the DNA-binding free energies for HMGA2 binding to both hairpins are almost temperature independent; however, the enthalpy-entropy changes are dependent on temperature, which is another aspect of enthalpy-entropy compensation. The heat capacity change for HMGA2 binding to FL-AT-1 and FL-AT-2 are almost identical, indicating that the solvent displacement and charge-charge interaction in the coupled folding/binding processes for both binding reactions are similar. PMID:19450485
Bigler, J; Eisenman, R N
1994-01-01
Thyroid hormone (T3) receptor (TR) is a ligand-dependent transcription factor that acts through specific binding sites in the promoter region of target genes. In order to identify new genes that are regulated by T3, we used anti-TR antiserum to immunoprecipitate TR-DNA complexes from GH4 cell nuclei that had previously been treated with a restriction enzyme. Screening of the immunopurified, cloned DNA for TR binding sites by electrophoretic mobility shift assay yielded 53 positive clones. A subset of these clones was specifically immunoprecipitated with anti-TR antiserum and may therefore represent biologically significant binding sites. One of these clones, clone 122, was characterized in detail. It includes sequences highly related to the NICER long terminal repeat-like element and contains three TR binding sites as determined by DNase I footprinting. Two of the clone 122 TR binding sites are located upstream of the TATA box, and one is located downstream. The TR binding site downstream from the promoter was necessary and sufficient to confer T3-dependent regulation in transient transfection experiments. Expression of a reporter construct under the control of the clone 122 promoter region was activated by TR in the absence of ligand and returned to basal levels after T3 addition. Clone 122 sequences hybridize to at least two different mRNAs of approximately 6 and 10 kb from GH4 cells. The levels of both of these mRNAs increased upon removal of T3. Our studies suggest that specific immunoprecipitation of chromatin allows identification of binding sites and target genes for transcription factors. Images PMID:7935476
Bauer, Robert J.; Evans, Thomas C.; Lohman, Gregory J. S.
2016-01-01
DNA ligases are essential both to in vivo replication, repair and recombination processes, and in vitro molecular biology protocols. Prior characterization of DNA ligases through gel shift assays has shown the presence of a nick site to be essential for tight binding between the enzyme and its dsDNA substrate, with no interaction evident on dsDNA lacking a nick. In the current study, we observed a significant substrate inhibition effect, as well as the inhibition of both the self-adenylylation and nick-sealing steps of T4 DNA ligase by non-nicked, non-substrate dsDNA. Inhibition by non-substrate DNA was dependent only on the total DNA concentration rather than the structure; with 1 μg/mL of 40-mers, 75-mers, or circular plasmid DNA all inhibiting ligation equally. A >15-fold reduction in T4 DNA ligase self-adenylylation rate when in the presence of high non-nicked dsDNA concentrations was observed. Finally, EMSAs were utilized to demonstrate that non-substrate dsDNA can compete with nicked dsDNA substrates for enzyme binding. Based upon these data, we hypothesize the inhibition of T4 DNA ligase by non-nicked dsDNA is direct evidence for a two-step nick-binding mechanism, with an initial, nick-independent, transient dsDNA-binding event preceding a transition to a stable binding complex in the presence of a nick site. PMID:26954034
Bauer, Robert J; Evans, Thomas C; Lohman, Gregory J S
2016-01-01
DNA ligases are essential both to in vivo replication, repair and recombination processes, and in vitro molecular biology protocols. Prior characterization of DNA ligases through gel shift assays has shown the presence of a nick site to be essential for tight binding between the enzyme and its dsDNA substrate, with no interaction evident on dsDNA lacking a nick. In the current study, we observed a significant substrate inhibition effect, as well as the inhibition of both the self-adenylylation and nick-sealing steps of T4 DNA ligase by non-nicked, non-substrate dsDNA. Inhibition by non-substrate DNA was dependent only on the total DNA concentration rather than the structure; with 1 μg/mL of 40-mers, 75-mers, or circular plasmid DNA all inhibiting ligation equally. A >15-fold reduction in T4 DNA ligase self-adenylylation rate when in the presence of high non-nicked dsDNA concentrations was observed. Finally, EMSAs were utilized to demonstrate that non-substrate dsDNA can compete with nicked dsDNA substrates for enzyme binding. Based upon these data, we hypothesize the inhibition of T4 DNA ligase by non-nicked dsDNA is direct evidence for a two-step nick-binding mechanism, with an initial, nick-independent, transient dsDNA-binding event preceding a transition to a stable binding complex in the presence of a nick site.
Park, Chin-Ju; Lee, Joon-Hwa; Choi, Byong-Seok
2005-01-01
Replication protein A (RPA) is a three-subunit complex with multiple roles in DNA metabolism. DNA-binding domain A in the large subunit of human RPA (hRPA70A) binds to single-stranded DNA (ssDNA) and is responsible for the species-specific RPA–T antigen (T-ag) interaction required for Simian virus 40 replication. Although Saccharomyces cerevisiae RPA70A (scRPA70A) shares high sequence homology with hRPA70A, the two are not functionally equivalent. To elucidate the similarities and differences between these two homologous proteins, we determined the solution structure of scRPA70A, which closely resembled the structure of hRPA70A. The structure of ssDNA-bound scRPA70A, as simulated by residual dipolar coupling-based homology modeling, suggested that the positioning of the ssDNA is the same for scRPA70A and hRPA70A, although the conformational changes that occur in the two proteins upon ssDNA binding are not identical. NMR titrations of hRPA70A with T-ag showed that the T-ag binding surface is separate from the ssDNA-binding region and is more neutral than the corresponding part of scRPA70A. These differences might account for the species-specific nature of the hRPA70A–T-ag interaction. Our results provide insight into how these two homologous RPA proteins can exhibit functional differences, but still both retain their ability to bind ssDNA. PMID:16043636
Interactions of Ku70/80 with Double-Strand DNA: Energetic, Dynamics, and Functional Implications
NASA Technical Reports Server (NTRS)
Hu, Shaowen; Cucinotta, Francis A.
2010-01-01
Space radiation is a proficient inducer of DNA damage leading to mutation, aberrant cell signaling, and cancer formation. Ku is among the first responding proteins in nucleus to recognize and bind the DNA double strand breaks (DSBs) whenever they are introduced. Once loaded Ku works as a scaffold to recruit other repair factors of non-homologous end joining and facilitates the following repair processes. The crystallographic study of the Ku70/80 heterodimer indicate the core structure of this protein shows virtually no conformational change after binding with DNA. To investigate the dynamical features as well as the energetic characteristics of Ku-DNA binding, we conduct multi-nanosecond molecular dynamics simulations of a modeled Ku70/80 structure and several complexes with two 24-bp DNA duplexes. Free energy calculations show significant energy differences between the complexes with Ku bound at DSBs and those with Ku associated at an internal site of a chromosome. The results also reveal detailed interactions between different nucleotides and the amino acids along the DNA-binding cradle of Ku, indicating subtle binding preference of Ku at specific DNA sequences. The covariance matrix analyses along the trajectories demonstrate the protein is stimulated to undergo correlated motions of different domains once bound to DNA ends. Additionally, principle component analyses identify these low frequency collective motions suitable for binding with and translocation along duplex DNA. It is proposed that the modification of dynamical properties of Ku upon binding with DSBs may provide a signal for the further recruitment of other repair factors such as DNA-PKcs, XLF, and XRCC4.
Chen, Changmin; Shanmugasundaram, Kumaran; Rigby, Alan C; Kung, Andrew L
2013-04-11
To search for compounds that disrupt binding of the EWS-FLI1 fusion protein to its cognate targets, we developed a homogeneous high-throughput proximity assay and screened 5200 small molecule compounds. Many well-known DNA-binding chemotherapeutic agents, such as actinomycin D, cisplatin, doxorubicin, daunorubicin, and epirubicin scored in the assay and not surprising also disrupted the binding of other transcription factors. Unexpectedly, we found that Shikonin, a natural product from the root of Lithospermum erythrorhizon, similarly disrupted protein-DNA interactions. Mechanistic studies demonstrated that Shikonin displaces SYBR green from binding to the minor groove of DNA and is able to inhibit topoisomerase mediated DNA relaxation. In cells, Shikonin blocked the binding of EWS-FLI1 to the NR0B1 promoter, and attenuated gene expression. Shikonin rapidly induced G2/M arrest and apoptosis in Ewing sarcoma cells. These results demonstrate that contrary to other purported mechanisms of action, Shikonin is a DNA-binding cytotoxic agent. Copyright © 2013 Elsevier B.V. All rights reserved.
Lee, Mei-Ling Ting; Bulyk, Martha L; Whitmore, G A; Church, George M
2002-12-01
There is considerable scientific interest in knowing the probability that a site-specific transcription factor will bind to a given DNA sequence. Microarray methods provide an effective means for assessing the binding affinities of a large number of DNA sequences as demonstrated by Bulyk et al. (2001, Proceedings of the National Academy of Sciences, USA 98, 7158-7163) in their study of the DNA-binding specificities of Zif268 zinc fingers using microarray technology. In a follow-up investigation, Bulyk, Johnson, and Church (2002, Nucleic Acid Research 30, 1255-1261) studied the interdependence of nucleotides on the binding affinities of transcription proteins. Our article is motivated by this pair of studies. We present a general statistical methodology for analyzing microarray intensity measurements reflecting DNA-protein interactions. The log probability of a protein binding to a DNA sequence on an array is modeled using a linear ANOVA model. This model is convenient because it employs familiar statistical concepts and procedures and also because it is effective for investigating the probability structure of the binding mechanism.
Generalized theory on the mechanism of site-specific DNA-protein interactions
NASA Astrophysics Data System (ADS)
Niranjani, G.; Murugan, R.
2016-05-01
We develop a generalized theoretical framework on the binding of transcription factor proteins (TFs) with specific sites on DNA that takes into account the interplay of various factors regarding overall electrostatic potential at the DNA-protein interface, occurrence of kinetic traps along the DNA sequence, presence of other roadblock protein molecules along DNA and crowded environment, conformational fluctuations in the DNA binding domains (DBDs) of TFs, and the conformational state of the DNA. Starting from a Smolochowski type theoretical framework on site-specific binding of TFs we logically build our model by adding the effects of these factors one by one. Our generalized two-step model suggests that the electrostatic attractive forces present inbetween the positively charged DBDs of TFs and the negatively charged phosphate backbone of DNA, along with the counteracting shielding effects of solvent ions, is the core factor that creates a fluidic type environment at the DNA-protein interface. This in turn facilitates various one-dimensional diffusion (1Dd) processes such as sliding, hopping and intersegmental transfers. These facilitating processes as well as flipping dynamics of conformational states of DBDs of TFs between stationary and mobile states can enhance the 1Dd coefficient on a par with three-dimensional diffusion (3Dd). The random coil conformation of DNA also plays critical roles in enhancing the site-specific association rate. The extent of enhancement over the 3Dd controlled rate seems to be directly proportional to the maximum possible 1Dd length. We show that the overall site-specific binding rate scales with the length of DNA in an asymptotic way. For relaxed DNA, the specific binding rate will be independent of the length of DNA as length increases towards infinity. For condensed DNA as in in vivo conditions, the specific binding rate depends on the length of DNA in a turnover way with a maximum. This maximum rate seems to scale with the maximum possible 1Dd length of TFs in a square root manner. Results suggest that 1Dd processes contribute much less to the enhancement of specific binding rate under in vivo conditions for condensed DNA. There exists a critical length of binding stretch of TFs beyond which the probability associated with the random occurrence of similar specific binding sites will be close to zero. TFs in natural systems from prokaryotes to eukaryotes seem to handle sequence-mediated kinetic traps via increasing the length of their recognition stretch or combinatorial binding. TFs overcome the hurdles of roadblocks via switching efficiently between sliding, hopping and intersegmental transfer modes. The site-specific binding rate as well as the maximum possible 1Dd length seem to be directly proportional to the square root of the probability (p R) of finding a nonspecific binding site to be free from dynamic roadblocks. Here p R seems to be a function of the number of nsbs available per DNA binding protein (ϕ) inside the living cell. It seems that p R > 0.8 when ϕ > 10 which is true for the Escherichia coli cell system.
Theoretical modeling of masking DNA application in aptamer-facilitated biomarker discovery.
Cherney, Leonid T; Obrecht, Natalia M; Krylov, Sergey N
2013-04-16
In aptamer-facilitated biomarker discovery (AptaBiD), aptamers are selected from a library of random DNA (or RNA) sequences for their ability to specifically bind cell-surface biomarkers. The library is incubated with intact cells, and cell-bound DNA molecules are separated from those unbound and amplified by the polymerase chain reaction (PCR). The partitioning/amplification cycle is repeated multiple times while alternating target cells and control cells. Efficient aptamer selection in AptaBiD relies on the inclusion of masking DNA within the cell and library mixture. Masking DNA lacks primer regions for PCR amplification and is typically taken in excess to the library. The role of masking DNA within the selection mixture is to outcompete any nonspecific binding sequences within the initial library, thus allowing specific DNA sequences (i.e., aptamers) to be selected more efficiently. Efficient AptaBiD requires an optimum ratio of masking DNA to library DNA, at which aptamers still bind specific binding sites but nonaptamers within the library do not bind nonspecific binding sites. Here, we have developed a mathematical model that describes the binding processes taking place within the equilibrium mixture of masking DNA, library DNA, and target cells. An obtained mathematical solution allows one to estimate the concentration of masking DNA that is required to outcompete the library DNA at a desirable ratio of bound masking DNA to bound library DNA. The required concentration depends on concentrations of the library and cells as well as on unknown cell characteristics. These characteristics include the concentration of total binding sites on the cell surface, N, and equilibrium dissociation constants, K(nsL) and K(nsM), for nonspecific binding of the library DNA and masking DNA, respectively. We developed a theory that allows the determination of N, K(nsL), and K(nsM) based on measurements of EC50 values for cells mixed separately with the library and masking DNA (EC50 is the concentration of fluorescently labeled DNA at which half of the maximum fluorescence signal from DNA-bound cells is reached). We also obtained expressions for signals from bound DNA (measured by flow cytometry) in terms of N, K(nsL), and K(nsM). These expressions can be used for the verification of N, K(nsL), and K(nsM) values found from EC50 measurements. The developed procedure was applied to MCF-7 breast cancer cells, and corresponding values of N, K(nsL), and K(nsM) were established for the first time. The concentration of masking DNA required for AptaBiD with MCF-7 breast cancer cells was also estimated.
Spot Surface Labeling of Magnetic Microbeads and Application in Biological Force Measurements
NASA Astrophysics Data System (ADS)
Estes, Ashley; O'Brien, E. Tim; Hill, David; Superfine, Richard
2006-11-01
Biological force measurements on single molecules and macromolecular structures often use microbeads for the application of force. These techniques are often complicated by multiple attachments and nonspecific binding. In one set of experiments, we are applying a magnetic force microscope that allows us to pull on magnetic beads attached to ciliated human bronchial epithelial cells. These experiments provide a means to measure the stall force of cilia and understand how cilia propel fluids. However, because we are using beads with diameters of one and 2.8 microns, and the diameter of human airway cilia is approximately 200 nm, we cannot be assured that the bead is bound to a single cilium. To address this, we have developed a sputter coating technique to block the biotin binding capability of the streptavidin labeled bead over its entire surface except for a small spot. These beads may also have applications in other biological experiments such as DNA force experiments in which binding of a single target to an individual bead is critical.
Shazman, Shula; Elber, Gershon; Mandel-Gutfreund, Yael
2011-09-01
Protein nucleic acid interactions play a critical role in all steps of the gene expression pathway. Nucleic acid (NA) binding proteins interact with their partners, DNA or RNA, via distinct regions on their surface that are characterized by an ensemble of chemical, physical and geometrical properties. In this study, we introduce a novel methodology based on differential geometry, commonly used in face recognition, to characterize and predict NA binding surfaces on proteins. Applying the method on experimentally solved three-dimensional structures of proteins we successfully classify double-stranded DNA (dsDNA) from single-stranded RNA (ssRNA) binding proteins, with 83% accuracy. We show that the method is insensitive to conformational changes that occur upon binding and can be applicable for de novo protein-function prediction. Remarkably, when concentrating on the zinc finger motif, we distinguish successfully between RNA and DNA binding interfaces possessing the same binding motif even within the same protein, as demonstrated for the RNA polymerase transcription-factor, TFIIIA. In conclusion, we present a novel methodology to characterize protein surfaces, which can accurately tell apart dsDNA from an ssRNA binding interfaces. The strength of our method in recognizing fine-tuned differences on NA binding interfaces make it applicable for many other molecular recognition problems, with potential implications for drug design.
Cho, Sang-Yun; Cho, Won Kyong; Sohn, Seong-Han; Kim, Kook-Hyung
2012-01-06
Plant viruses must interact with host cellular components to replicate and move from cell to cell. In the case of Potato virus X (PVX), it carries stem-loop 1 (SL1) RNA essential for viral replication and movement. Using two-dimensional electrophoresis northwestern blot analysis, we previously identified several host proteins that bind to SL1 RNA. Of those, we further characterized a DnaJ-like protein from Nicotiana benthamiana named NbDnaJ. An electrophoretic mobility shift assay confirmed that NbDnaJ binds only to SL1 minus-strand RNA, and bimolecular fluorescence complementation (BiFC) indicated that NbDnaJ interacts with PVX capsid protein (CP). Using a series of deletion mutants, the C-terminal region of NbDnaJ was found to be essential for the interaction with PVX CP. The expression of NbDnaJ significantly changed upon infection with different plant viruses such as PVX, Tobacco mosaic virus, and Cucumber mosaic virus, but varied depending on the viral species. In transient experiments, both PVX replication and movement were inhibited in plants that over-expressed NbDnaJ but accelerated in plants in which NbDnaJ was silenced. In summary, we suggest that the newly identified NbDnaJ plays a role in PVX replication and movement by interacting with SL1(-) RNA and PVX CP. Copyright © 2011 Elsevier Inc. All rights reserved.
A new insight into the interaction of ZnO with calf thymus DNA through surface defects.
Das, Sumita; Chatterjee, Sabyasachi; Pramanik, Srikrishna; Devi, Parukuttyamma Sujatha; Kumar, Gopinatha Suresh
2018-01-01
Experimental evidences on the binding interaction of ZnO and Calf Thymus (CT) DNA using several biophysical techniques are the centre of interest of the present study. The interaction of ZnO with CT DNA has been investigated in detail by absorption spectral study, fluorescence titration, Raman analysis, zeta potential measurement, viscometric experiment along with thermal melting study and microscopic analysis. Steady-state fluorescence study revealed the quenching (48%) of the surface defect related peak intensity of ZnO on interaction with DNA. The optimized concentration of ZnO and DNA to obtain this level of quenching has been found to be 0.049mM and 1.027μM, respectively. Additional fluorescence study with 8-hydroxy-5-quinoline (HQ) as a fluorescence probe for Zn 2+ ruled out the dissolution effect of ZnO under the experimental conditions. DNA conjugation on the surface of ZnO was also supported by Raman study. The quantitative variation in conductivity as well as electrophoretic mobility indicated significant interaction of ZnO with the DNA molecule. Circular dichroism (CD) and viscometry titrations provided clear evidence in support of the conformational retention of the DNA on interaction with ZnO. The binding interaction was found to be predominantly entropy driven in nature. The bio-physical studies presented in this paper exploring ZnO-CT DNA interaction could add a new horizon to understand the interaction between metal oxide and DNA. Copyright © 2017. Published by Elsevier B.V.
Effect of Rap1 binding on DNA distortion and potassium permanganate hypersensitivity.
Le Bihan, Yann-Vaï; Matot, Béatrice; Pietrement, Olivier; Giraud-Panis, Marie-Josèphe; Gasparini, Sylvaine; Le Cam, Eric; Gilson, Eric; Sclavi, Bianca; Miron, Simona; Le Du, Marie-Hélène
2013-03-01
Repressor activator protein 1 (Rap1) is an essential factor involved in transcription and telomere stability in the budding yeast Saccharomyces cerevisiae. Its interaction with DNA causes hypersensitivity to potassium permanganate, suggesting local DNA melting and/or distortion. In this study, various Rap1-DNA crystal forms were obtained using specifically designed crystal screens. Analysis of the DNA conformation showed that its distortion was not sufficient to explain the permanganate reactivity. However, anomalous data collected at the Mn edge using a Rap1-DNA crystal soaked in potassium permanganate solution indicated that the DNA conformation in the crystal was compatible with interaction with permanganate ions. Sequence-conservation analysis revealed that double-Myb-containing Rap1 proteins all carry a fully conserved Arg580 at a position that may favour interaction with permanganate ions, although it is not involved in the hypersensitive cytosine distortion. Permanganate reactivity assays with wild-type Rap1 and the Rap1[R580A] mutant demonstrated that Arg580 is essential for hypersensitivity. AFM experiments showed that wild-type Rap1 and the Rap1[R580A] mutant interact with DNA over 16 successive binding sites, leading to local DNA stiffening but not to accumulation of the observed local distortion. Therefore, Rap1 may cause permanganate hypersensitivity of DNA by forming a pocket between the reactive cytosine and Arg580, driving the permanganate ion towards the C5-C6 bond of the cytosine.
Leonard, D A; Rajaram, N; Kerppola, T K
1997-05-13
Interactions among transcription factors that bind to separate sequence elements require bending of the intervening DNA and juxtaposition of interacting molecular surfaces in an appropriate orientation. Here, we examine the effects of single amino acid substitutions adjacent to the basic regions of Fos and Jun as well as changes in sequences flanking the AP-1 site on DNA bending. Substitution of charged amino acid residues at positions adjacent to the basic DNA-binding domains of Fos and Jun altered DNA bending. The change in DNA bending was directly proportional to the change in net charge for all heterodimeric combinations between these proteins. Fos and Jun induced distinct DNA bends at different binding sites. Exchange of a single base pair outside of the region contacted in the x-ray crystal structure altered DNA bending. Substitution of base pairs flanking the AP-1 site had converse effects on the opposite directions of DNA bending induced by homodimers and heterodimers. These results suggest that Fos and Jun induce DNA bending in part through electrostatic interactions between amino acid residues adjacent to the basic region and base pairs flanking the AP-1 site. DNA bending by Fos and Jun at inverted binding sites indicated that heterodimers bind to the AP-1 site in a preferred orientation. Mutation of a conserved arginine within the basic regions of Fos and transversion of the central C:G base pair in the AP-1 site to G:C had complementary effects on the orientation of heterodimer binding and DNA bending. The conformational variability of the Fos-Jun-AP-1 complex may contribute to its functional versatility at different promoters.
Cloned Hemoglobin Genes Enhance Growth Of Cells
NASA Technical Reports Server (NTRS)
Khosla, Chaitan; Bailey, James E.
1991-01-01
Experiments show that portable deoxyribonucleic acid (DNA) sequences incorporated into host cells make them produce hemoglobins - oxygen-binding proteins essential to function of red blood cells. Method useful in several biotechnological applications. One, enhancement of growth of cells at higher densities. Another, production of hemoglobin to enhance supplies of oxygen in cells, for use in chemical reactions requiring oxygen, as additive to serum to increase transport of oxygen, and for binding and separating oxygen from mixtures of gases.
Chiral halogenated Schiff base compounds: green synthesis, anticancer activity and DNA-binding study
NASA Astrophysics Data System (ADS)
Ariyaeifar, Mahnaz; Amiri Rudbari, Hadi; Sahihi, Mehdi; Kazemi, Zahra; Kajani, Abolghasem Abbasi; Zali-Boeini, Hassan; Kordestani, Nazanin; Bruno, Giuseppe; Gharaghani, Sajjad
2018-06-01
Eight enantiomerically pure halogenated Schiff base compounds were synthesized by reaction of halogenated salicylaldehydes with 3-Amino-1,2-propanediol (R or S) in water as green solvent at ambient temperature. All compounds were characterized by elemental analyses, NMR (1H and 13C), circular dichroism (CD) and FT-IR spectroscopy. FS-DNA binding studies of these compounds carried out by fluorescence quenching and UV-vis spectroscopy. The obtained results revealed that the ligands bind to DNA as: (Rsbnd ClBr) > (Rsbnd Cl2) > (Rsbnd Br2) > (Rsbnd I2) and (Ssbnd ClBr) > (Ssbnd Cl2) > (Ssbnd Br2) > (Ssbnd I2), indicating the effect of halogen on binding constant. In addition, DNA-binding constant of the Ssbnd and R-enantiomers are different from each other. The ligands can form halogen bonds with DNA that were confirmed by molecular docking. This method was also measured the bond distances and bond angles. The study of obtained data can have concluded that binding affinity of the ligands to DNA depends on strength of halogen bonds. The potential anticancer activity of ligands were also evaluated on MCF-7 and HeLa cancer cell lines by using MTT assay. The results showed that the anticancer activity and FS-DNA interaction is significantly dependent on the stereoisomers of Schiff base compounds as R-enantiomers displayed significantly higher activity than S-enantiomers. The molecular docking was also used to illustrate the specific DNA-binding of synthesized compounds and groove binding mode of DNA interaction was proposed for them. In addition, molecular docking results indicated that there are three types of bonds (Hsbnd and X-bond and hX-bond) between synthesized compounds and base pairs of DNA.
DNA binding specificity of the basic-helix-loop-helix protein MASH-1.
Meierhan, D; el-Ariss, C; Neuenschwander, M; Sieber, M; Stackhouse, J F; Allemann, R K
1995-09-05
Despite the high degree of sequence similarity in their basic-helix-loop-helix (BHLH) domains, MASH-1 and MyoD are involved in different biological processes. In order to define possible differences between the DNA binding specificities of these two proteins, we investigated the DNA binding properties of MASH-1 by circular dichroism spectroscopy and by electrophoretic mobility shift assays (EMSA). Upon binding to DNA, the BHLH domain of MASH-1 underwent a conformational change from a mainly unfolded to a largely alpha-helical form, and surprisingly, this change was independent of the specific DNA sequence. The same conformational transition could be induced by the addition of 20% 2,2,2-trifluoroethanol. The apparent dissociation constants (KD) of the complexes of full-length MASH-1 with various oligonucleotides were determined from half-saturation points in EMSAs. MASH-1 bound as a dimer to DNA sequences containing an E-box with high affinity KD = 1.4-4.1 x 10(-14) M2). However, the specificity of DNA binding was low. The dissociation constant for the complex between MASH-1 and the highest affinity E-box sequence (KD = 1.4 x 10(-14) M2) was only a factor of 10 smaller than for completely unrelated DNA sequences (KD = approximately 1 x 10(-13) M2). The DNA binding specificity of MASH-1 was not significantly increased by the formation of an heterodimer with the ubiquitous E12 protein. MASH-1 and MyoD displayed similar binding site preferences, suggesting that their different target gene specificities cannot be explained solely by differential DNA binding. An explanation for these findings is provided on the basis of the known crystal structure of the BHLH domain of MyoD.
DNA sequence+shape kernel enables alignment-free modeling of transcription factor binding.
Ma, Wenxiu; Yang, Lin; Rohs, Remo; Noble, William Stafford
2017-10-01
Transcription factors (TFs) bind to specific DNA sequence motifs. Several lines of evidence suggest that TF-DNA binding is mediated in part by properties of the local DNA shape: the width of the minor groove, the relative orientations of adjacent base pairs, etc. Several methods have been developed to jointly account for DNA sequence and shape properties in predicting TF binding affinity. However, a limitation of these methods is that they typically require a training set of aligned TF binding sites. We describe a sequence + shape kernel that leverages DNA sequence and shape information to better understand protein-DNA binding preference and affinity. This kernel extends an existing class of k-mer based sequence kernels, based on the recently described di-mismatch kernel. Using three in vitro benchmark datasets, derived from universal protein binding microarrays (uPBMs), genomic context PBMs (gcPBMs) and SELEX-seq data, we demonstrate that incorporating DNA shape information improves our ability to predict protein-DNA binding affinity. In particular, we observe that (i) the k-spectrum + shape model performs better than the classical k-spectrum kernel, particularly for small k values; (ii) the di-mismatch kernel performs better than the k-mer kernel, for larger k; and (iii) the di-mismatch + shape kernel performs better than the di-mismatch kernel for intermediate k values. The software is available at https://bitbucket.org/wenxiu/sequence-shape.git. rohs@usc.edu or william-noble@uw.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.
Anti-DNA antibodies--quintessential biomarkers of SLE.
Pisetsky, David S
2016-02-01
Antibodies that recognize and bind to DNA (anti-DNA antibodies) are serological hallmarks of systemic lupus erythematosus (SLE) and key markers for diagnosis and disease activity. In addition to common use in the clinic, anti-DNA antibody testing now also determines eligibility for clinical trials, raising important questions about the nature of the antibody-antigen interaction. At present, no 'gold standard' for serological assessment exists, and anti-DNA antibody binding can be measured with a variety of assay formats, which differ in the nature of the DNA substrates and in the conditions for binding and detection of antibodies. A mechanism called monogamous bivalency--in which high avidity results from simultaneous interaction of IgG Fab sites with a single polynucleotide chain--determines anti-DNA antibody binding; this mechanism might affect antibody detection in different assay formats. Although anti-DNA antibodies can promote pathogenesis by depositing in the kidney or driving cytokine production, they are not all alike, pathologically, and anti-DNA antibody expression does not necessarily correlate with active disease. Levels of anti-DNA antibodies in patients with SLE can vary over time, distinguishing anti-DNA antibodies from other pathogenic antinuclear antibodies. Elucidation of the binding specificities and the pathogenic roles of anti-DNA antibodies in SLE should enable improvements in the design of informative assays for both clinical and research purposes.
Trigger Factor and DnaK possess overlapping substrate pools and binding specificities.
Deuerling, Elke; Patzelt, Holger; Vorderwülbecke, Sonja; Rauch, Thomas; Kramer, Günter; Schaffitzel, Elke; Mogk, Axel; Schulze-Specking, Agnes; Langen, Hanno; Bukau, Bernd
2003-03-01
Ribosome-associated Trigger Factor (TF) and the DnaK chaperone system assist the folding of newly synthesized proteins in Escherichia coli. Here, we show that DnaK and TF share a common substrate pool in vivo. In TF-deficient cells, deltatig, depleted for DnaK and DnaJ the amount of aggregated proteins increases with increasing temperature, amounting to 10% of total soluble protein (approximately 340 protein species) at 37 degrees C. A similar population of proteins aggregated in DnaK depleted tig+ cells, albeit to a much lower extent. Ninety-four aggregated proteins isolated from DnaK- and DnaJ-depleted deltatig cells were identified by mass spectrometry and found to include essential cytosolic proteins. Four potential in vivo substrates were screened for chaperone binding sites using peptide libraries. Although TF and DnaK recognize different binding motifs, 77% of TF binding peptides also associated with DnaK. In the case of the nascent polypeptides TF and DnaK competed for binding, however, with competitive advantage for TF. In vivo, the loss of TF is compensated by the induction of the heat shock response and thus enhanced levels of DnaK. In summary, our results demonstrate that the co-operation of the two mechanistically distinct chaperones in protein folding is based on their overlap in substrate specificities.
NASA Astrophysics Data System (ADS)
Rudra, Suparna; Dasmandal, Somnath; Patra, Chiranjit; Kundu, Arjama; Mahapatra, Ambikesh
2016-09-01
The binding interaction of a synthesized Schiff base Fe(II) complex with biological macromolecules viz., bovine serum albumin (BSA) and calf thymus(ct)-DNA have been investigated using different spectroscopic techniques coupled with viscosity measurements at physiological pH and 298 K. Regular amendments in emission intensities of BSA upon the action of the complex indicate significant interaction between them, and the binding interaction have been characterized by Stern Volmer plots and thermodynamic binding parameters. On the basis of this quenching technique one binding site with binding constant (Kb = (7.6 ± 0.21) × 105) between complex and protein have been obtained at 298 K. Time-resolved fluorescence studies have also been encountered to understand the mechanism of quenching induced by the complex. Binding affinities of the complex to the fluorophores of BSA namely tryptophan (Trp) and tyrosine (Tyr) have been judged by synchronous fluorescence studies. Secondary structural changes of BSA rooted by the complex has been revealed by CD spectra. On the other hand, hypochromicity of absorption spectra of the complex with the addition of ct-DNA and the gradual reduction in emission intensities of ethidium bromide bound ct-DNA in presence of the complex indicate noticeable interaction between ct-DNA and the complex with the binding constant (4.2 ± 0.11) × 106 M- 1. Life-time measurements have been studied to determine the relative amplitude of binding of the complex to ct-DNA base pairs. Mode of binding interaction of the complex with ct-DNA has been deciphered by viscosity measurements. CD spectra have also been used to understand the changes in ct-DNA structure upon binding with the metal complex. Density functional theory (DFT) and molecular docking analysis have been employed in highlighting the interactive phenomenon and binding location of the complex with the macromolecules.
Kitchen, J L; Li, Z; Crooke, E
1999-05-11
The initiation of Escherichia coli chromosomal replication by DnaA protein is strongly influenced by the tight binding of the nucleotides ATP and ADP. Anionic phospholipids in a fluid bilayer promote the conversion of inactive ADP-DnaA protein to replicatively active ATP-DnaA protein in vitro, and thus likely play a key role in regulating DnaA activity. Previous studies have revealed that, during this reactivation, a specific region of DnaA protein inserts into the hydrophobic portion of the lipid bilayer in an acidic phospholipid-dependent manner. To elucidate the requirement for acidic phospholipids in the reactivation process, the contribution of electrostatic forces in the interaction of DnaA and lipid was examined. DnaA-lipid binding required anionic phospholipids, and DnaA-lipid binding as well as lipid-mediated release of DnaA-bound nucleotide were inhibited by increased ionic strength, suggesting the involvement of electrostatic interactions in these processes. As the vesicular content of acidic phospholipids was increased, both nucleotide release and DnaA-lipid binding increased in a linear, parallel manner. Given that DnaA-membrane binding, the insertion of DnaA into the membrane, and the consequent nucleotide release all require anionic phospholipids, the acidic headgroup may be necessary to recruit DnaA protein to the membrane for insertion and subsequent reactivation for replication.
NASA Astrophysics Data System (ADS)
Reiß, Edda; Hölzel, Ralph; von Nickisch-Rosenegk, Markus; Bier, Frank F.
2006-09-01
In this article the usefulness of the enzyme phi29 DNA polymerase and the principle of rolling circle amplification (RCA) for creating single-stranded DNA (ssDNA) nanostructures is described. Currently we are working on the spatial orientation of a growing ssDNA molecule during its RCA-based synthesis by the application of a hydrodynamic force. Starting at an immobilized primer at single molecule level, the aim is to construct a nanostructure of known location and orientation, providing multiple repeating binding sites that can be addressed via complementary base-pairing. Proof-of-principle experiments demonstrate the potential of the enzymatic reaction. ssDNA molecules of more than 20 μm length were created at an immobilized primer and detected by means of fluorescence microscopy.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Adámik, Matej; Bažantová, Pavla; Department of Biology and Ecology, Faculty of Science, University of Ostrava, Chittussiho 10, 701 03 Ostrava
Highlights: • DNA binding of p53 family core domains is inhibited by cadmium, cobalt and nickel. • Binding to DNA protects p53 family core domains from metal induced inhibition. • Cadmium, cobalt and nickel induced inhibition was reverted by EDTA in vitro. - Abstract: Site-specific DNA recognition and binding activity belong to common attributes of all three members of tumor suppressor p53 family proteins: p53, p63 and p73. It was previously shown that heavy metals can affect p53 conformation, sequence-specific binding and suppress p53 response to DNA damage. Here we report for the first time that cadmium, nickel and cobalt,more » which have already been shown to disturb various DNA repair mechanisms, can also influence p63 and p73 sequence-specific DNA binding activity and transactivation of p53 family target genes. Based on results of electrophoretic mobility shift assay and luciferase reporter assay, we conclude that cadmium inhibits sequence-specific binding of all three core domains to p53 consensus sequences and abolishes transactivation of several promoters (e.g. BAX and MDM2) by 50 μM concentrations. In the presence of specific DNA, all p53 family core domains were partially protected against loss of DNA binding activity due to cadmium treatment. Effective cadmium concentration to abolish DNA–protein interactions was about two times higher for p63 and p73 proteins than for p53. Furthermore, we detected partial reversibility of cadmium inhibition for all p53 family members by EDTA. DTT was able to reverse cadmium inhibition only for p53 and p73. Nickel and cobalt abolished DNA–p53 interaction at sub-millimolar concentrations while inhibition of p63 and p73 DNA binding was observed at millimolar concentrations. In summary, cadmium strongly inhibits p53, p63 and p73 DNA binding in vitro and in cells in comparison to nickel and cobalt. The role of cadmium inhibition of p53 tumor suppressor family in carcinogenesis is discussed.« less
Thunyakitpisal, Pasutha; Ruangpornvisuti, Vithaya; Kengkwasing, Pattrawadee; Chokboribal, Jaroenporn; Sangvanich, Polkit
2017-04-01
Acemannan, an acetylated polymannose from Aloe vera, has immunomodulatory effects. We investigated whether acemannan induces IL-6 and -8 expression and NF-κB/DNA binding in human gingival fibroblasts. IL-6 and -8 expression levels were assessed via RT-PCR and ELISA. The NF-κB p50/p65-DNA binding was determined. The structures of acemannan mono-pentamers and Toll-like receptor 5 (TLR5) were simulated. The binding energies between acemannan and TLR5 were identified. We found that acemannan significantly stimulated IL-6/-8 expression at both the mRNA and protein level and significantly increased p50/DNA binding. Preincubation with an anti-TLR5 neutralizing antibody abolished acemannan-induced IL-6/-8 expression and p50/DNA binding, and co-incubation of acemannan with Bay11-7082, a specific NF- κB inhibitor, abolished IL-6/-8 expression. The computer modeling indicated that monomeric/dimeric single stranded acemannan molecules interacted with the TLR5 flagellin recognition sites with a high binding affinity. We conclude that acemannan induces IL-6/-8 expression, and p50/DNA binding in gingival fibroblasts, at least partly, via a TLR5/NF-κB-dependent signaling pathway. Furthermore, acemannan selectively binds with TLR5 ectodomain flagellin recognition sites. Copyright © 2017 Elsevier Ltd. All rights reserved.
Lee, Susan D.; Surtees, Jennifer A.; Alani, Eric
2007-01-01
In eukaryotic mismatch repair (MMR) MSH2-MSH6 initiates the repair of base-base and small insertion/deletion mismatches while MSH2-MSH3 repairs larger insertion/deletion mismatches. In this study we showed that the msh2Δ1 mutation, containing a complete deletion of the conserved mismatch recognition Domain I of MSH2, conferred a separation of function phenotype with respect to MSH2-MSH3 and MSH2-MSH6 functions. Strains bearing the msh2Δ1 mutation were nearly wild-type in MSH2-MSH6-mediated MMR and in suppressing recombination between DNA sequences predicted to form mismatches recognized by MSH2-MSH6. However, these strains were completely defective in MSH2-MSH3-mediated MMR and recombination functions. This information encouraged us to analyze the contributions of Domain I to the mismatch binding specificity of MSH2-MSH3 in genetic and biochemical assays. We found that Domain I in MSH2 contributed a non-specific DNA binding activity while Domain I of MSH3 appeared important for mismatch binding specificity and for suppressing non-specific DNA-binding. These observations reveal distinct requirements for the MSH2 DNA binding Domain I in the repair of DNA mismatches and suggest that the binding of MSH2-MSH3 to mismatch DNA involves protein-DNA contacts that appear very different from those required for MSH2-MSH6 mismatch binding. PMID:17157869
Lee, Susan D; Surtees, Jennifer A; Alani, Eric
2007-02-09
In eukaryotic mismatch repair (MMR) MSH2-MSH6 initiates the repair of base-base and small insertion/deletion mismatches while MSH2-MSH3 repairs larger insertion/deletion mismatches. Here, we show that the msh2Delta1 mutation, containing a complete deletion of the conserved mismatch recognition domain I of MSH2, conferred a separation of function phenotype with respect to MSH2-MSH3 and MSH2-MSH6 functions. Strains bearing the msh2Delta1 mutation were nearly wild-type in MSH2-MSH6-mediated MMR and in suppressing recombination between DNA sequences predicted to form mismatches recognized by MSH2-MSH6. However, these strains were completely defective in MSH2-MSH3-mediated MMR and recombination functions. This information encouraged us to analyze the contributions of domain I to the mismatch binding specificity of MSH2-MSH3 in genetic and biochemical assays. We found that domain I in MSH2 contributed a non-specific DNA binding activity while domain I of MSH3 appeared important for mismatch binding specificity and for suppressing non-specific DNA binding. These observations reveal distinct requirements for the MSH2 DNA binding domain I in the repair of DNA mismatches and suggest that the binding of MSH2-MSH3 to mismatch DNA involves protein-DNA contacts that appear very different from those required for MSH2-MSH6 mismatch binding.
Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva
2018-03-01
HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.
Interference between Triplex and Protein Binding to Distal Sites on Supercoiled DNA.
Noy, Agnes; Maxwell, Anthony; Harris, Sarah A
2017-02-07
We have explored the interdependence of the binding of a DNA triplex and a repressor protein to distal recognition sites on supercoiled DNA minicircles using MD simulations. We observe that the interaction between the two ligands through their influence on their DNA template is determined by a subtle interplay of DNA mechanics and electrostatics, that the changes in flexibility induced by ligand binding play an important role and that supercoiling can instigate additional ligand-DNA contacts that would not be possible in simple linear DNA sequences. Copyright © 2017. Published by Elsevier Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Hee-Young; Kim, Hye-Young; Jung, Jaesung
2008-01-05
Our recent observation that hepatitis B virus (HBV) DNA polymerase (P) might initiate minus-strand DNA synthesis without primer [Kim et al., (2004) Virology 322, 22-30], raised a possibility that HBV P protein may have the potential to function as an RNA polymerase. Thus, we mutated Phe 436, a bulky amino acid with aromatic side chain, at the putative dNTP-binding cleft in reverse transcriptase (RT) domain of P protein to smaller amino acids (Gly or Val), and examined RNA polymerase activity. HBV core particles containing RT dNTP-binding cleft mutant P protein were able to incorporate {sup 32}P-ribonucleotides, but not HBV coremore » particles containing wild type (wt), priming-deficient mutant, or RT-deficient mutant P proteins. Since all the experiments were conducted with core particles isolated from transfected cells, our results indicate that the HBV RT mutant core particles containing RT dNTP-binding cleft mutant P protein could incorporate both deoxyribonucleotides and ribonucleotides in replicating systems.« less
Van Meervelt, Veerle; Soskine, Misha; Maglia, Giovanni
2015-01-01
Protein-DNA interactions play critical roles in biological systems, and they often involve complex mechanisms and dynamics that are not easily measured by ensemble experiments. Recently, we have shown that folded proteins can be internalised inside ClyA nanopores and studied by ionic current recordings at the single-molecule level. Here, we use ClyA nanopores to sample the interaction between the G-quadruplex fold of the thrombin binding aptamer (TBA) and human thrombin (HT). Surprisingly, the internalisation of the HT:TBA complex inside the nanopore induced two types of current blockades with distinguished residual current and lifetime. Using single nucleobase substitutions to TBA we showed that these two types of blockades originate from TBA binding to thrombin with two isomeric orientations. Voltage dependencies and the use of ClyA nanopores with two different diameters allowed assessing the effect of the applied potential and confinement, and revealed that the two binding configurations of TBA to HT display different lifetimes. These results show that the ClyA nanopores might provide a new approach to probe conformational heterogeneity in protein:DNA interactions. PMID:25493908
Lim, J H; Choi, J; Kim, W; Ahn, B Y; Han, Y S
2001-04-15
We constructed nine deletion mutants of NAD+-dependent DNA ligase from Aquifex pyrophilus to characterize the functional domains. All of DNA ligase deletion mutants were analyzed in biochemical assays for NAD+-dependent self-adenylation, DNA binding, and nick-closing activity. Although the mutant lsub1 (91-362) included the active site lysine (KxDG), self-adenylation was not shown. However, the mutants lsub6 (1-362), lsub7 (1-516), and lsub9 (1-635) showed the same adenylation activity as that of wild type. The lsub5 (91-719), which has the C-terminal domain (487-719) as to lsub4 (91-486), showed minimal adenylation activity. These results suggest that the presence of N-terminal 90 residues is essential for the formation of an enzyme-AMP complex, while C-terminal domain (487-719) appears to play a minimal role in adenylation. It was found that the presence of C-terminal domain (487-719) is indispensable for DNA binding activity of lsub5 (91-719). The mutant lsub9 (1-635) showed reduced DNA binding activity compared to that of wild type, suggesting the contribution of the domain (636-719) for the DNA binding activity. Thus, we concluded that the N-terminal 90 residues and C-terminal domain (487-719) of NAD+-dependent DNA ligase from A. pyrophilus are mutually indispensable for binding of DNA substrate.
Characterization of the interaction of yeast enolase with polynucleotides.
al-Giery, A G; Brewer, J M
1992-09-23
Yeast enolase is inhibited under certain conditions by DNA. The enzyme binds to single-stranded DNA-cellulose. Inhibition was used for routine characterization of the interaction. The presence of the substrate 2-phospho-D-glycerate reduces inhibition and binding. Both yeast enolase isozymes behave similarly. Impure yeast enolase was purified by adsorption onto a single-stranded DNA-cellulose column followed by elution with substrate. Interaction with RNA, double-stranded DNA, or degraded DNA results in less inhibition, suggesting that yeast enolase preferentially binds single-stranded DNA. However, yeast enolase is not a DNA-unwinding protein. The enzyme is inhibited by the short synthetic oligodeoxynucleotides G6, G8 and G10 but not T8 or T6, suggesting some base specificity in the interaction. The interaction is stronger at more acid pH values, with an apparent pK of 5.6. The interaction is prevented by 0.3 M KCl, suggesting that electrostatic factors are important. Histidine or lysine reverse the inhibition at lower concentrations, while phosphate is still more effective. Binding of single-stranded DNA to enolase reduces the reaction of protein histidyl residues with diethylpyrocarbonate. The inhibition of yeast enolase by single-stranded DNA is not total, and suggests the active site is not directly involved in the interaction. Binding of substrate may induce a conformational change in the enzyme that interferes with DNA binding and vice versa.
Amaral, Catarina; Pimentel, Catarina; Matos, Rute G; Arraiano, Cecília M; Matzapetakis, Manolis; Rodrigues-Pousada, Claudina
2013-01-01
In Saccharomyces cerevisiae, the transcription factor Yap8 is a key determinant in arsenic stress response. Contrary to Yap1, another basic region-leucine zipper (bZIP) yeast regulator, Yap8 has a very restricted DNA-binding specificity and only orchestrates the expression of ACR2 and ACR3 genes. In the DNA-binding basic region, Yap8 has three distinct amino acids residues, Leu26, Ser29 and Asn31, at sites of highly conserved positions in the other Yap family of transcriptional regulators and Pap1 of Schizosaccharomyces pombe. To evaluate whether these residues are relevant to Yap8 specificity, we first built a homology model of the complex Yap8bZIP-DNA based on Pap1-DNA crystal structure. Several Yap8 mutants were then generated in order to confirm the contribution of the residues predicted to interact with DNA. Using bioinformatics analysis together with in vivo and in vitro approaches, we have identified several conserved residues critical for Yap8-DNA binding. Moreover, our data suggest that Leu26 is required for Yap8 binding to DNA and that this residue together with Asn31, hinder Yap1 response element recognition by Yap8, thus narrowing its DNA-binding specificity. Furthermore our results point to a role of these two amino acids in the stability of the Yap8-DNA complex.
Contacts between the factor TUF and RPG sequences.
Vignais, M L; Huet, J; Buhler, J M; Sentenac, A
1990-08-25
The yeast TUF factor binds specifically to RPG-like sequences involved in multiple functions at enhancers, silencers, and telomeres. We have characterized the interaction of TUF with its optimal binding sequence, rpg-1 (1-ACACCCATACATTT-14), using a gel DNA-binding assay in combination with methylation protection and mutagenesis experiments. As many as 10 base pairs appear to be engaged in factor binding. Analysis of a collection of 30 different RPG mutants demonstrated the importance of 8 base pairs at position 2, 3, 4, 5, 6, 7, 10, and 12 and the critical role of the central GC pair at position 5. Methylation protection data on four different natural sites confirmed a close contact at positions 4, 5, 6, and 10 and suggested additional contacts at base pairs 8, 12, and 13. The derived consensus sequence was RCAAYCCRYNCAYY. A quantitative band shift analysis was used to determine the equilibrium dissociation constant for the complex of TUF and its optimal binding site rpg-1. The specific dissociation constant (K8) was found to be 1.3 x 10(-11) M. The comparison of the K8 value with the dissociation constant obtained for nonspecific DNA sites (Kn8 = 8.7 x 10(-6) M) shows the high binding selectivity of TUF for its specific RPG target.
Dodson, M; Echols, H; Wickner, S; Alfano, C; Mensa-Wilmot, K; Gomes, B; LeBowitz, J; Roberts, J D; McMacken, R
1986-01-01
The O protein of bacteriophage lambda localizes the initiation of DNA replication to a unique site on the lambda genome, ori lambda. By means of electron microscopy, we infer that the binding of O to ori lambda initiates a series of protein addition and transfer reactions that culminate in localized unwinding of the origin DNA, generating a prepriming structure for the initiation of DNA replication. We can define three stages of this prepriming reaction, the first two of which we have characterized previously. First, dimeric O protein binds to multiple DNA binding sites and self-associates to form a nucleoprotein structure, the O-some. Second, lambda P and host DnaB proteins interact with the O-some to generate a larger complex that includes additional DNA from an A + T-rich region adjacent to the O binding sites. Third, the addition of the DnaJ, DnaK, and Ssb proteins and ATP results in an origin-specific unwinding reaction, probably catalyzed by the helicase activity of DnaB. The unwinding reaction is unidirectional, proceeding "rightward" from the origin. The minimal DNA sequence competent for unwinding consists of two O binding sites and the adjacent A + T-rich region to the right of the binding sites. We conclude that the lambda O protein localizes and initiates a six-protein sequential reaction responsible for but preceding the precise initiation of DNA replication. Specialized nucleoprotein structures similar to the O-some may be a general feature of DNA transactions requiring extraordinary precision in localization and control. Images PMID:3020552