Sample records for dna binding induces

  1. Acemannan increases NF-κB/DNA binding and IL-6/-8 expression by selectively binding Toll-like receptor-5 in human gingival fibroblasts.

    PubMed

    Thunyakitpisal, Pasutha; Ruangpornvisuti, Vithaya; Kengkwasing, Pattrawadee; Chokboribal, Jaroenporn; Sangvanich, Polkit

    2017-04-01

    Acemannan, an acetylated polymannose from Aloe vera, has immunomodulatory effects. We investigated whether acemannan induces IL-6 and -8 expression and NF-κB/DNA binding in human gingival fibroblasts. IL-6 and -8 expression levels were assessed via RT-PCR and ELISA. The NF-κB p50/p65-DNA binding was determined. The structures of acemannan mono-pentamers and Toll-like receptor 5 (TLR5) were simulated. The binding energies between acemannan and TLR5 were identified. We found that acemannan significantly stimulated IL-6/-8 expression at both the mRNA and protein level and significantly increased p50/DNA binding. Preincubation with an anti-TLR5 neutralizing antibody abolished acemannan-induced IL-6/-8 expression and p50/DNA binding, and co-incubation of acemannan with Bay11-7082, a specific NF- κB inhibitor, abolished IL-6/-8 expression. The computer modeling indicated that monomeric/dimeric single stranded acemannan molecules interacted with the TLR5 flagellin recognition sites with a high binding affinity. We conclude that acemannan induces IL-6/-8 expression, and p50/DNA binding in gingival fibroblasts, at least partly, via a TLR5/NF-κB-dependent signaling pathway. Furthermore, acemannan selectively binds with TLR5 ectodomain flagellin recognition sites. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Structural changes induced by binding of the high-mobility group I protein to a mouse satellite DNA sequence.

    PubMed Central

    Slama-Schwok, A; Zakrzewska, K; Léger, G; Leroux, Y; Takahashi, M; Käs, E; Debey, P

    2000-01-01

    Using spectroscopic methods, we have studied the structural changes induced in both protein and DNA upon binding of the High-Mobility Group I (HMG-I) protein to a 21-bp sequence derived from mouse satellite DNA. We show that these structural changes depend on the stoichiometry of the protein/DNA complexes formed, as determined by Job plots derived from experiments using pyrene-labeled duplexes. Circular dichroism and melting temperature experiments extended in the far ultraviolet range show that while native HMG-I is mainly random coiled in solution, it adopts a beta-turn conformation upon forming a 1:1 complex in which the protein first binds to one of two dA.dT stretches present in the duplex. HMG-I structure in the 1:1 complex is dependent on the sequence of its DNA target. A 3:1 HMG-I/DNA complex can also form and is characterized by a small increase in the DNA natural bend and/or compaction coupled to a change in the protein conformation, as determined from fluorescence resonance energy transfer (FRET) experiments. In addition, a peptide corresponding to an extended DNA-binding domain of HMG-I induces an ordered condensation of DNA duplexes. Based on the constraints derived from pyrene excimer measurements, we present a model of these nucleated structures. Our results illustrate an extreme case of protein structure induced by DNA conformation that may bear on the evolutionary conservation of the DNA-binding motifs of HMG-I. We discuss the functional relevance of the structural flexibility of HMG-I associated with the nature of its DNA targets and the implications of the binding stoichiometry for several aspects of chromatin structure and gene regulation. PMID:10777751

  3. Detection of DNA damage in individual cells by flow cytometric analysis using anti-DNA monoclonal antibody

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Frankfurt, O.S.

    A new method for the measurement of DNA damage in individual cells treated with alkylating agents is described. The method is based on the binding of anti-DNA monoclonal antibody to DNA in situ. Binding of antibody was evaluated by flow cytometry with indirect immunofluorescence. No binding of antibody to DNA in non-treated HeLa S3 cells was detected. Treatment of cells with HN2 or L-phenylalanine mustard induced binding of antibody to DNA in situ. Binding of antibody was observed after treating cells with doses of drugs which reduced the surviving fraction below 20%. Intensity of binding increased in proportion to themore » drug dose. In HN2-treated cells a cell subset with the lowest antibody binding was observed among cells in G1 phase. Binding of antibody to DNA in HN2-treated cells was eliminated by single-strand (ss) specific S1 nuclease. In competition assay, antibody was inhibited by thermally denatured DNA, but not by native double-stranded (ds) DNA, RNA, nucleosides and deoxyribohomopolymers. Immunoreactivity of cells with the monoclonal antibody F7-26 may be a useful probe for the assessment of cell damage induced by alkylating agents, especially in heterogeneous cell populations.« less

  4. An exclusive α/β code directs allostery in TetR-peptide complexes.

    PubMed

    Sevvana, Madhumati; Goetz, Christoph; Goeke, Dagmar; Wimmer, Cornelius; Berens, Christian; Hillen, Wolfgang; Muller, Yves A

    2012-02-10

    The allosteric mechanism of one of the best characterized bacterial transcription regulators, tetracycline repressor (TetR), has recently been questioned. Tetracycline binding induces cooperative folding of TetR, as suggested by recent unfolding studies, rather than switching between two defined conformational states, namely a DNA-binding-competent conformation and a non-DNA-binding conformation. Upon ligand binding, a host of near-native multiconformational structures collapse into a single, highly stabilized protein conformation that is no longer able to bind DNA. Here, structure-function studies performed with four synthetic peptides that bind to TetR and mimic the function of low-molecular-weight effectors, such as tetracyclines, provide new means to discriminate between different allosteric models. Whereas two inducing peptides bind in an extended β-like conformation, two anti-inducing peptides form an α-helix in the effector binding site of TetR. This exclusive bimodal interaction mode coincides with two distinct overall conformations of TetR, namely one that is identical with induced TetR and one that mirrors the DNA-bound state of TetR. Urea-induced unfolding studies show no increase in thermodynamic stability for any of the peptide complexes, although fluorescence measurements demonstrate peptide binding to TetR. This strongly suggests that, at least for these peptide effectors, a classical two-state allosteric model best describes TetR function. Copyright © 2011 Elsevier Ltd. All rights reserved.

  5. Binding characteristics and protective capacity of cyanidin-3-glucoside and its aglycon to calf thymus DNA.

    PubMed

    Zhang, Chao; Guo, Xiaofei; Cai, Wenqian; Ma, Yue; Zhao, Xiaoyan

    2015-04-01

    The binding characteristics and protective capacity of cyanidin (Cy) and cyanidin-3-glucoside (C3G) to calf thymus DNA were explored for the first time. The Cy and C3G gave a bathochromic shift to the ultraviolet-visible spectra of the DNA, indicating the formation of the DNA-Cy and DNA-C3G complexes. The complexes were formed by an intercalative binding mode based on the results of the fluorescence spectra and competitive binding analysis. Meanwhile, the Cy and C3G protected the DNA from the damage induced by the hydroxyl radical. The binding capacity and protective capacity of the C3G were stronger than that of the Cy. Furthermore, the formation of the DNA-anthocyanin complexes was spontaneous when the hydrogen bond and hydrophobic force played a key role. Hence, the Cy and C3G could protect the DNA automatically from the damage induced by the hydroxyl radical. © 2015 Institute of Food Technologists®

  6. DNA-binding activity of TNF-{alpha} inducing protein from Helicobacter pylori

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kuzuhara, T.; Suganuma, M.; Oka, K.

    2007-11-03

    Tumor necrosis factor-{alpha} (TNF-{alpha}) inducing protein (Tip{alpha}) is a carcinogenic factor secreted from Helicobacter pylori (H. pylori), mediated through both enhanced expression of TNF-{alpha} and chemokine genes and activation of nuclear factor-{kappa}B. Since Tip{alpha} enters gastric cancer cells, the Tip{alpha} binding molecules in the cells should be investigated. The direct DNA-binding activity of Tip{alpha} was observed by pull down assay using single- and double-stranded genomic DNA cellulose. The surface plasmon resonance assay, indicating an association between Tip{alpha} and DNA, revealed that the affinity of Tip{alpha} for (dGdC)10 is 2400 times stronger than that of del-Tip{alpha}, an inactive Tip{alpha}. This suggestsmore » a strong correlation between DNA-binding activity and carcinogenic activity of Tip{alpha}. And the DNA-binding activity of Tip{alpha} was first demonstrated with a molecule secreted from H. pylori.« less

  7. Structural basis of DNA bending and oriented heterodimer binding by the basic leucine zipper domains of Fos and Jun.

    PubMed

    Leonard, D A; Rajaram, N; Kerppola, T K

    1997-05-13

    Interactions among transcription factors that bind to separate sequence elements require bending of the intervening DNA and juxtaposition of interacting molecular surfaces in an appropriate orientation. Here, we examine the effects of single amino acid substitutions adjacent to the basic regions of Fos and Jun as well as changes in sequences flanking the AP-1 site on DNA bending. Substitution of charged amino acid residues at positions adjacent to the basic DNA-binding domains of Fos and Jun altered DNA bending. The change in DNA bending was directly proportional to the change in net charge for all heterodimeric combinations between these proteins. Fos and Jun induced distinct DNA bends at different binding sites. Exchange of a single base pair outside of the region contacted in the x-ray crystal structure altered DNA bending. Substitution of base pairs flanking the AP-1 site had converse effects on the opposite directions of DNA bending induced by homodimers and heterodimers. These results suggest that Fos and Jun induce DNA bending in part through electrostatic interactions between amino acid residues adjacent to the basic region and base pairs flanking the AP-1 site. DNA bending by Fos and Jun at inverted binding sites indicated that heterodimers bind to the AP-1 site in a preferred orientation. Mutation of a conserved arginine within the basic regions of Fos and transversion of the central C:G base pair in the AP-1 site to G:C had complementary effects on the orientation of heterodimer binding and DNA bending. The conformational variability of the Fos-Jun-AP-1 complex may contribute to its functional versatility at different promoters.

  8. Locked and proteolysis-based transcription activator-like effector (TALE) regulation.

    PubMed

    Lonzarić, Jan; Lebar, Tina; Majerle, Andreja; Manček-Keber, Mateja; Jerala, Roman

    2016-02-18

    Development of orthogonal, designable and adjustable transcriptional regulators is an important goal of synthetic biology. Their activity has been typically modulated through stimulus-induced oligomerization or interaction between the DNA-binding and activation/repression domain. We exploited a feature of the designable Transcription activator-like effector (TALE) DNA-binding domain that it winds around the DNA which allows to topologically prevent it from binding by intramolecular cyclization. This new approach was investigated through noncovalent ligand-induced cyclization or through a covalent split intein cyclization strategy, where the topological inhibition of DNA binding by cyclization and its restoration by a proteolytic release of the topologic constraint was expected. We show that locked TALEs indeed have diminished DNA binding and regain full transcriptional activity by stimulation with the rapamycin ligand or site-specific proteolysis of the peptide linker, with much higher level of activation than rapamycin-induced heterodimerization. Additionally, we demonstrated reversibility, activation of genomic targets and implemented logic gates based on combinations of protein cyclization, proteolytic cleavage and ligand-induced dimerization, where the strongest fold induction was achieved by the proteolytic cleavage of a repression domain from a linear TALE. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Analysis of LexA binding sites and transcriptomics in response to genotoxic stress in Leptospira interrogans.

    PubMed

    Schons-Fonseca, Luciane; da Silva, Josefa B; Milanez, Juliana S; Domingos, Renan H; Smith, Janet L; Nakaya, Helder I; Grossman, Alan D; Ho, Paulo L; da Costa, Renata M A

    2016-02-18

    We determined the effects of DNA damage caused by ultraviolet radiation on gene expression in Leptospira interrogans using DNA microarrays. These data were integrated with DNA binding in vivo of LexA1, a regulator of the DNA damage response, assessed by chromatin immunoprecipitation and massively parallel DNA sequencing (ChIP-seq). In response to DNA damage, Leptospira induced expression of genes involved in DNA metabolism, in mobile genetic elements and defective prophages. The DNA repair genes involved in removal of photo-damage (e.g. nucleotide excision repair uvrABC, recombinases recBCD and resolvases ruvABC) were not induced. Genes involved in various metabolic pathways were down regulated, including genes involved in cell growth, RNA metabolism and the tricarboxylic acid cycle. From ChIP-seq data, we observed 24 LexA1 binding sites located throughout chromosome 1 and one binding site in chromosome 2. Expression of many, but not all, genes near those sites was increased following DNA damage. Binding sites were found as far as 550 bp upstream from the start codon, or 1 kb into the coding sequence. Our findings indicate that there is a shift in gene expression following DNA damage that represses genes involved in cell growth and virulence, and induces genes involved in mutagenesis and recombination. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. A calmodulin binding protein from Arabidopsis is induced by ethylene and contains a DNA-binding motif

    NASA Technical Reports Server (NTRS)

    Reddy, A. S.; Reddy, V. S.; Golovkin, M.

    2000-01-01

    Calmodulin (CaM), a key calcium sensor in all eukaryotes, regulates diverse cellular processes by interacting with other proteins. To isolate CaM binding proteins involved in ethylene signal transduction, we screened an expression library prepared from ethylene-treated Arabidopsis seedlings with 35S-labeled CaM. A cDNA clone, EICBP (Ethylene-Induced CaM Binding Protein), encoding a protein that interacts with activated CaM was isolated in this screening. The CaM binding domain in EICBP was mapped to the C-terminus of the protein. These results indicate that calcium, through CaM, could regulate the activity of EICBP. The EICBP is expressed in different tissues and its expression in seedlings is induced by ethylene. The EICBP contains, in addition to a CaM binding domain, several features that are typical of transcription factors. These include a DNA-binding domain at the N terminus, an acidic region at the C terminus, and nuclear localization signals. In database searches a partial cDNA (CG-1) encoding a DNA-binding motif from parsley and an ethylene up-regulated partial cDNA from tomato (ER66) showed significant similarity to EICBP. In addition, five hypothetical proteins in the Arabidopsis genome also showed a very high sequence similarity with EICBP, indicating that there are several EICBP-related proteins in Arabidopsis. The structural features of EICBP are conserved in all EICBP-related proteins in Arabidopsis, suggesting that they may constitute a new family of DNA binding proteins and are likely to be involved in modulating gene expression in the presence of ethylene.

  11. Dimerization-induced corepressor binding and relaxed DNA-binding specificity are critical for PML/RARA-induced immortalization

    PubMed Central

    Zhou, Jun; Pérès, Laurent; Honoré, Nicole; Nasr, Rihab; Zhu, Jun; de Thé, Hugues

    2006-01-01

    The pathogenesis of acute promyelocytic leukemia involves the transcriptional repression of master genes of myeloid differentiation by the promyelocytic leukemia–retinoic acid receptor α (PML/RARA) oncogene. PML-enforced RARA homodimerization allows the tighter binding of corepressors, silencing RARA target genes. In addition, homodimerization dramatically extends the spectrum of DNA-binding sites of the fusion protein compared with those of normal RARA. Yet, any contribution of these two properties of PML/RARA to differentiation arrest and immortalization of primary mouse hematopoietic progenitors was unknown. We demonstrate that dimerization-induced silencing mediator of retinoid and thyroid receptors (SMRT)-enhanced binding and relaxed DNA-binding site specificity are both required for efficient immortalization. Thus, enforced RARA dimerization is critical not only for triggering transcriptional repression but also for extending the repertoire of target genes. Our studies exemplify how dimerization-induced gain of functions converts an unessential transcription factor into a dominant oncogenic protein. PMID:16757557

  12. Structural Determinants of DNA Binding by a P. falciparum ApiAP2 Transcriptional Regulator

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lindner, Scott E.; De Silva, Erandi K.; Keck, James L.

    2010-11-05

    Putative transcription factors have only recently been identified in the Plasmodium spp., with the major family of regulators comprising the Apicomplexan Apetala2 (AP2) proteins. To better understand the DNA-binding mechanisms of these transcriptional regulators, we characterized the structure and in vitro function of an AP2 DNA-binding domain from a prototypical Apicomplexan AP2 protein, PF14{_}0633 from Plasmodium falciparum. The X-ray crystal structure of the PF14{_}0633 AP2 domain bound to DNA reveals a {beta}-sheet fold that binds the DNA major groove through base-specific and backbone contacts; a prominent {alpha}-helix supports the {beta}-sheet structure. Substitution of predicted DNA-binding residues with alanine weakened ormore » eliminated DNA binding in solution. In contrast to plant AP2 domains, the PF14{_}0633 AP2 domain dimerizes upon binding to DNA through a domain-swapping mechanism in which the {alpha}-helices of the AP2 domains pack against the {beta}-sheets of the dimer mates. DNA-induced dimerization of PF14{_}0633 may be important for tethering two distal DNA loci together in the nucleus and/or for inducing functional rearrangements of its domains to facilitate transcriptional regulation. Consistent with a multisite binding mode, at least two copies of the consensus sequence recognized by PF14{_}0633 are present upstream of a previously identified group of sporozoite-stage genes. Taken together, these findings illustrate how Plasmodium has adapted the AP2 DNA-binding domain for genome-wide transcriptional regulation.« less

  13. Quantitative characterization of conformational-specific protein-DNA binding using a dual-spectral interferometric imaging biosensor

    NASA Astrophysics Data System (ADS)

    Zhang, Xirui; Daaboul, George G.; Spuhler, Philipp S.; Dröge, Peter; Ünlü, M. Selim

    2016-03-01

    DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are not fully understood. Recently, it was discovered that DNA-binding proteins recognize specific binding sites to carry out their functions through an indirect readout mechanism by recognizing and capturing DNA conformational flexibility and deformation. High-throughput DNA microarray-based methods that provide large-scale protein-DNA binding information have shown effective and comprehensive analysis of protein-DNA binding affinities, but do not provide information of DNA conformational changes in specific protein-DNA complexes. Building on the high-throughput capability of DNA microarrays, we demonstrate a quantitative approach that simultaneously measures the amount of protein binding to DNA and nanometer-scale DNA conformational change induced by protein binding in a microarray format. Both measurements rely on spectral interferometry on a layered substrate using a single optical instrument in two distinct modalities. In the first modality, we quantitate the amount of binding of protein to surface-immobilized DNA in each DNA spot using a label-free spectral reflectivity technique that accurately measures the surface densities of protein and DNA accumulated on the substrate. In the second modality, for each DNA spot, we simultaneously measure DNA conformational change using a fluorescence vertical sectioning technique that determines average axial height of fluorophores tagged to specific nucleotides of the surface-immobilized DNA. The approach presented in this paper, when combined with current high-throughput DNA microarray-based technologies, has the potential to serve as a rapid and simple method for quantitative and large-scale characterization of conformational specific protein-DNA interactions.DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are not fully understood. Recently, it was discovered that DNA-binding proteins recognize specific binding sites to carry out their functions through an indirect readout mechanism by recognizing and capturing DNA conformational flexibility and deformation. High-throughput DNA microarray-based methods that provide large-scale protein-DNA binding information have shown effective and comprehensive analysis of protein-DNA binding affinities, but do not provide information of DNA conformational changes in specific protein-DNA complexes. Building on the high-throughput capability of DNA microarrays, we demonstrate a quantitative approach that simultaneously measures the amount of protein binding to DNA and nanometer-scale DNA conformational change induced by protein binding in a microarray format. Both measurements rely on spectral interferometry on a layered substrate using a single optical instrument in two distinct modalities. In the first modality, we quantitate the amount of binding of protein to surface-immobilized DNA in each DNA spot using a label-free spectral reflectivity technique that accurately measures the surface densities of protein and DNA accumulated on the substrate. In the second modality, for each DNA spot, we simultaneously measure DNA conformational change using a fluorescence vertical sectioning technique that determines average axial height of fluorophores tagged to specific nucleotides of the surface-immobilized DNA. The approach presented in this paper, when combined with current high-throughput DNA microarray-based technologies, has the potential to serve as a rapid and simple method for quantitative and large-scale characterization of conformational specific protein-DNA interactions. Electronic supplementary information (ESI) available: DNA sequences and nomenclature (Table 1S); SDS-PAGE assay of IHF stock solution (Fig. 1S); determination of the concentration of IHF stock solution by Bradford assay (Fig. 2S); equilibrium binding isotherm fitting results of other DNA sequences (Table 2S); calculation of dissociation constants (Fig. 3S, 4S; Table 2S); geometric model for quantitation of DNA bending angle induced by specific IHF binding (Fig. 4S); customized flow cell assembly (Fig. 5S); real-time measurement of average fluorophore height change by SSFM (Fig. 6S); summary of binding parameters obtained from additive isotherm model fitting (Table 3S); average surface densities of 10 dsDNA spots and bound IHF at equilibrium (Table 4S); effects of surface densities on the binding and bending of dsDNA (Tables 5S, 6S and Fig. 7S-10S). See DOI: 10.1039/c5nr06785e

  14. Arsenite binding-induced zinc loss from PARP-1 is equivalent to zinc deficiency in reducing PARP-1 activity, leading to inhibition of DNA repair

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sun, Xi; Zhou, Xixi; Du, Libo

    2014-01-15

    Inhibition of DNA repair is a recognized mechanism for arsenic enhancement of ultraviolet radiation-induced DNA damage and carcinogenesis. Poly(ADP-ribose) polymerase-1 (PARP-1), a zinc finger DNA repair protein, has been identified as a sensitive molecular target for arsenic. The zinc finger domains of PARP-1 protein function as a critical structure in DNA recognition and binding. Since cellular poly(ADP-ribosyl)ation capacity has been positively correlated with zinc status in cells, we hypothesize that arsenite binding-induced zinc loss from PARP-1 is equivalent to zinc deficiency in reducing PARP-1 activity, leading to inhibition of DNA repair. To test this hypothesis, we compared the effects ofmore » arsenite exposure with zinc deficiency, created by using the membrane-permeable zinc chelator TPEN, on 8-OHdG formation, PARP-1 activity and zinc binding to PARP-1 in HaCat cells. Our results show that arsenite exposure and zinc deficiency had similar effects on PARP-1 protein, whereas supplemental zinc reversed these effects. To investigate the molecular mechanism of zinc loss induced by arsenite, ICP-AES, near UV spectroscopy, fluorescence, and circular dichroism spectroscopy were utilized to examine arsenite binding and occupation of a peptide representing the first zinc finger of PARP-1. We found that arsenite binding as well as zinc loss altered the conformation of zinc finger structure which functionally leads to PARP-1 inhibition. These findings suggest that arsenite binding to PARP-1 protein created similar adverse biological effects as zinc deficiency, which establishes the molecular mechanism for zinc supplementation as a potentially effective treatment to reverse the detrimental outcomes of arsenic exposure. - Highlights: • Arsenite binding is equivalent to zinc deficiency in reducing PARP-1 function. • Zinc reverses arsenic inhibition of PARP-1 activity and enhancement of DNA damage. • Arsenite binding and zinc loss alter the conformation of zinc finger structure.« less

  15. BclxL changes conformation upon binding to wild-type but not mutant p53 DNA binding domain.

    PubMed

    Hagn, Franz; Klein, Christian; Demmer, Oliver; Marchenko, Natasha; Vaseva, Angelina; Moll, Ute M; Kessler, Horst

    2010-01-29

    p53 can induce apoptosis through mitochondrial membrane permeabilization by interaction of its DNA binding region with the anti-apoptotic proteins BclxL and Bcl2. However, little is known about the action of p53 at the mitochondria in molecular detail. By using NMR spectroscopy and fluorescence polarization we characterized the binding of wild-type and mutant p53 DNA binding domains to BclxL and show that the wild-type p53 DNA binding domain leads to structural changes in the BH3 binding region of BclxL, whereas mutants fail to induce such effects due to reduced affinity. This was probed by induced chemical shift and residual dipolar coupling data. These data imply that p53 partly achieves its pro-apoptotic function at the mitochondria by facilitating interaction between BclxL and BH3-only proteins in an allosteric mode of action. Furthermore, we characterize for the first time the binding behavior of Pifithrin-mu, a specific small molecule inhibitor of the p53-BclxL interaction, and present a structural model of the protein-ligand complex. A rather unusual behavior is revealed whereby Pifithrin-mu binds to both sides of the protein-protein complex. These data should facilitate the rational design of more potent specific BclxL-p53 inhibitors.

  16. Role of Nucleoid Associated Proteins in Stabilizing Supercoils

    NASA Astrophysics Data System (ADS)

    Dahlke, Katelyn; Sing, Charles

    Nucleoid associated proteins (NAPs) play an important role in prokaryotic cells by manipulating the shape and structure of the DNA. These NAPs act by bending or twisting DNA, and there are indications that NAPs bind preferentially to DNA that is already bent or twisted. We hypothesize that these binding behaviors strongly impact the stability and structure of DNA. We use coarse-grained simulation of NAPs and DNA that allow us to achieve the time and length scales where DNA supercoiling occurs. Supercoils are twist-induced structures that are the result of relaxing highly-twisted DNA by inducing higher degrees of bending and writhe. We are able to reproduce experimental observations, such as the extension of a DNA molecule as a function of force, linking number, and NAP concentration. Building upon these test cases, we allow the binding and unbinding energy of the simulated NAPs to be a function of the bending angle of the DNA at the site of binding (ΔEB (θ)). Consequently, NAPs localize along the contour of the supercoil, and this binding preference is capable of stabilizing supercoils that form within the nucleoid. National Institute Of General Medical Sciences of the National Institutes of Health under Award Number T32GM070421.

  17. NF-κB DNA-binding activity in embryos responding to a teratogen, cyclophosphamide

    PubMed Central

    Torchinsky, Arkady; Lishanski, Lucy; Wolstein, Orit; Shepshelovich, Jeanne; Orenstein, Hasida; Savion, Shoshana; Zaslavsky, Zeev; Carp, Howard; Brill, Alexander; Dikstein, Rivka; Toder, Vladimir; Fein, Amos

    2002-01-01

    Background The Rel/NF-κB transcription factors have been shown to regulate apoptosis in different cell types, acting as inducers or blockers in a stimuli- and cell type-dependent fashion. One of the Rel/NF-κB subunits, RelA, has been shown to be crucial for normal embryonic development, in which it functions in the embryonic liver as a protector against TNFα-induced physiological apoptosis. This study assesses whether NF-κB may be involved in the embryo's response to teratogens. Fot this, we evaluated how NF-KappaB DNA binding activity in embryonic organs demonstraiting differential sensitivity to a reference teratogen, cyclophosphamide, correlates with dysmorphic events induced by the teratogen at the cellular level (excessive apoptosis) and at the organ level (structural anomalies). Results The embryonic brain and liver were used as target organs. We observed that the Cyclophosphamide-induced excessive apoptosis in the brain, followed by the formation of severe craniofacial structural anomalies, was accompanied by suppression of NF-κB DNA-binding activity as well as by a significant and lasting increase in the activity of caspases 3 and 8. However, in the liver, in which cyclophosphamide induced transient apoptosis was not followed by dysmorphogenesis, no suppression of NF-κB DNA-binding activity was registered and the level of active caspases 3 and 8 was significantly lower than in the brain. It has also been observed that both the brain and liver became much more sensitive to the CP-induced teratogenic insult if the embryos were exposed to a combined treatment with the teratogen and sodium salicylate that suppressed NF-κB DNA-binding activity in these organs. Conclusion The results of this study demonstrate that suppression of NF-κB DNA-binding activity in embryos responding to the teratogenic insult may be associated with their decreased resistance to this insult. They also suggest that teratogens may suppress NF-κB DNA-binding activity in the embryonic tissues in an organ type- and dose-dependent fashion. PMID:11893254

  18. Experimental and computational studies on the effects of valganciclovir as an antiviral drug on calf thymus DNA.

    PubMed

    Shahabadi, Nahid; Pourfoulad, Mehdi; Moghadam, Neda Hosseinpour

    2017-01-02

    DNA-binding properties of an antiviral drug, valganciclovir (valcyte) was studied by using emission, absorption, circular dichroism, viscosity, differential pulse voltammetry, fluorescence techniques, and computational studies. The drug bound to calf thymus DNA (ct-DNA) in a groove-binding mode. The calculated binding constant of UV-vis, K a , is comparable to groove-binding drugs. Competitive fluorimetric studies with Hoechst 33258 showed that valcyte could displace the DNA-bound Hoechst 33258. The drug could not displace intercalated methylene blue from DNA double helix. Furthermore, the induced detectable changes in the CD spectrum of ct-DNA as well as changes in its viscosity confirm the groove-binding mode. In addition, an integrated molecular docking was employed to further investigate the binding interactions between valcyte and calf thymus DNA.

  19. Alternative Use of DNA Binding Domains by the Neurospora White Collar Complex Dictates Circadian Regulation and Light Responses

    PubMed Central

    Wang, Bin; Zhou, Xiaoying; Loros, Jennifer J.

    2015-01-01

    In the Neurospora circadian system, the White Collar complex (WCC) of WC-1 and WC-2 drives transcription of the circadian pacemaker gene frequency (frq), whose gene product, FRQ, as a part of the FRQ-FRH complex (FFC), inhibits its own expression. The WCC is also the principal Neurospora photoreceptor; WCC-mediated light induction of frq resets the clock, and all acute light induction is triggered by WCC binding to promoters of light-induced genes. However, not all acutely light-induced genes are also clock regulated, and conversely, not all clock-regulated direct targets of WCC are light induced; the structural determinants governing the shift from WCC's dark circadian role to its light activation role are poorly described. We report that the DBD region (named for being defective in binding DNA), a basic region in WC-1 proximal to the DNA-binding zinc finger (ZnF) whose function was previously ascribed to nuclear localization, instead plays multiple essential roles assisting in DNA binding and mediating interactions with the FFC. DNA binding for light induction by the WCC requires only WC-2, whereas DNA binding for circadian functions requires WC-2 as well as the ZnF and DBD motif of WC-1. The data suggest a means by which alterations in the tertiary and quaternary structures of the WCC can lead to its distinct functions in the dark and in the light. PMID:26711258

  20. Genome-Wide Cell Type-Specific Mapping of In Vivo Chromatin Protein Binding Using an FLP-Inducible DamID System in Drosophila.

    PubMed

    Pindyurin, Alexey V

    2017-01-01

    A thorough study of the genome-wide binding patterns of chromatin proteins is essential for understanding the regulatory mechanisms of genomic processes in eukaryotic nuclei, including DNA replication, transcription, and repair. The DNA adenine methyltransferase identification (DamID) method is a powerful tool to identify genomic binding sites of chromatin proteins. This method does not require fixation of cells and the use of specific antibodies, and has been used to generate genome-wide binding maps of more than a hundred different proteins in Drosophila tissue culture cells. Recent versions of inducible DamID allow performing cell type-specific profiling of chromatin proteins even in small samples of Drosophila tissues that contain heterogeneous cell types. Importantly, with these methods sorting of cells of interest or their nuclei is not necessary as genomic DNA isolated from the whole tissue can be used as an input. Here, I describe in detail an FLP-inducible DamID method, namely generation of suitable transgenic flies, activation of the Dam transgenes by the FLP recombinase, isolation of DNA from small amounts of dissected tissues, and subsequent identification of the DNA binding sites of the chromatin proteins.

  1. Molecular modelling study of changes induced by netropsin binding to nucleosome core particles.

    PubMed Central

    Pérez, J J; Portugal, J

    1990-01-01

    It is well known that certain sequence-dependent modulators in structure appear to determine the rotational positioning of DNA on the nucleosome core particle. That preference is rather weak and could be modified by some ligands as netropsin, a minor-groove binding antibiotic. We have undertaken a molecular modelling approach to calculate the relative energy of interaction between a DNA molecule and the protein core particle. The histones particle is considered as a distribution of positive charges on the protein surface that interacts with the DNA molecule. The molecular electrostatic potentials for the DNA, simulated as a discontinuous cylinder, were calculated using the values for all the base pairs. Computing these parameters, we calculated the relative energy of interaction and the more stable rotational setting of DNA. The binding of four molecules of netropsin to this model showed that a new minimum of energy is obtained when the DNA turns toward the protein surface by about 180 degrees, so a new energetically favoured structure appears where netropsin binding sites are located facing toward the histones surface. The effect of netropsin could be explained in terms of an induced change in the phasing of DNA on the core particle. The induced rotation is considered to optimize non-bonded contacts between the netropsin molecules and the DNA backbone. PMID:2165249

  2. Evolution of Metal(Loid) Binding Sites in Transcriptional Regulators

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ordonez, E.; Thiyagarajan, S.; Cook, J.D.

    2009-05-22

    Expression of the genes for resistance to heavy metals and metalloids is transcriptionally regulated by the toxic ions themselves. Members of the ArsR/SmtB family of small metalloregulatory proteins respond to transition metals, heavy metals, and metalloids, including As(III), Sb(III), Cd(II), Pb(II), Zn(II), Co(II), and Ni(II). These homodimeric repressors bind to DNA in the absence of inducing metal(loid) ion and dissociate from the DNA when inducer is bound. The regulatory sites are often three- or four-coordinate metal binding sites composed of cysteine thiolates. Surprisingly, in two different As(III)-responsive regulators, the metalloid binding sites were in different locations in the repressor, andmore » the Cd(II) binding sites were in two different locations in two Cd(II)-responsive regulators. We hypothesize that ArsR/SmtB repressors have a common backbone structure, that of a winged helix DNA-binding protein, but have considerable plasticity in the location of inducer binding sites. Here we show that an As(III)-responsive member of the family, CgArsR1 from Corynebacterium glutamicum, binds As(III) to a cysteine triad composed of Cys{sup 15}, Cys{sup 16}, and Cys{sup 55}. This binding site is clearly unrelated to the binding sites of other characterized ArsR/SmtB family members. This is consistent with our hypothesis that metal(loid) binding sites in DNA binding proteins evolve convergently in response to persistent environmental pressures.« less

  3. Novel DNA Motif Binding Activity Observed In Vivo With an Estrogen Receptor α Mutant Mouse

    PubMed Central

    Li, Leping; Grimm, Sara A.; Winuthayanon, Wipawee; Hamilton, Katherine J.; Pockette, Brianna; Rubel, Cory A.; Pedersen, Lars C.; Fargo, David; Lanz, Rainer B.; DeMayo, Francesco J.; Schütz, Günther; Korach, Kenneth S.

    2014-01-01

    Estrogen receptor α (ERα) interacts with DNA directly or indirectly via other transcription factors, referred to as “tethering.” Evidence for tethering is based on in vitro studies and a widely used “KIKO” mouse model containing mutations that prevent direct estrogen response element DNA- binding. KIKO mice are infertile, due in part to the inability of estradiol (E2) to induce uterine epithelial proliferation. To elucidate the molecular events that prevent KIKO uterine growth, regulation of the pro-proliferative E2 target gene Klf4 and of Klf15, a progesterone (P4) target gene that opposes the pro-proliferative activity of KLF4, was evaluated. Klf4 induction was impaired in KIKO uteri; however, Klf15 was induced by E2 rather than by P4. Whole uterine chromatin immunoprecipitation-sequencing revealed enrichment of KIKO ERα binding to hormone response elements (HREs) motifs. KIKO binding to HRE motifs was verified using reporter gene and DNA-binding assays. Because the KIKO ERα has HRE DNA-binding activity, we evaluated the “EAAE” ERα, which has more severe DNA-binding domain mutations, and demonstrated a lack of estrogen response element or HRE reporter gene induction or DNA-binding. The EAAE mouse has an ERα null–like phenotype, with impaired uterine growth and transcriptional activity. Our findings demonstrate that the KIKO mouse model, which has been used by numerous investigators, cannot be used to establish biological functions for ERα tethering, because KIKO ERα effectively stimulates transcription using HRE motifs. The EAAE-ERα DNA-binding domain mutant mouse demonstrates that ERα DNA-binding is crucial for biological and transcriptional processes in reproductive tissues and that ERα tethering may not contribute to estrogen responsiveness in vivo. PMID:24713037

  4. Using FRET to Measure the Angle at Which a Protein Bends DNA: TBP Binding a TATA Box as a Model System

    ERIC Educational Resources Information Center

    Kugel, Jennifer F.

    2008-01-01

    An undergraduate biochemistry laboratory experiment that will teach the technique of fluorescence resonance energy transfer (FRET) while analyzing protein-induced DNA bending is described. The experiment uses the protein TATA binding protein (TBP), which is a general transcription factor that recognizes and binds specific DNA sequences known as…

  5. Sa-Lrp from Sulfolobus acidocaldarius is a versatile, glutamine-responsive, and architectural transcriptional regulator

    PubMed Central

    Vassart, Amelia; Wolferen, Marleen; Orell, Alvaro; Hong, Ye; Peeters, Eveline; Albers, Sonja-Verena; Charlier, Daniel

    2013-01-01

    Sa-Lrp is a member of the leucine-responsive regulatory protein (Lrp)-like family of transcriptional regulators in Sulfolobus acidocaldarius. Previously, we demonstrated the binding of Sa-Lrp to the control region of its own gene in vitro. However, the function and cofactor of Sa-Lrp remained an enigma. In this work, we demonstrate that glutamine is the cofactor of Sa-Lrp by inducing the formation of octamers and increasing the DNA-binding affinity and sequence specificity. In vitro protein-DNA interaction assays indicate that Sa-Lrp binds to promoter regions of genes with a variety of functions including ammonia assimilation, transcriptional control, and UV-induced pili synthesis. DNA binding occurs with a specific affinity for AT-rich binding sites, and the protein induces DNA bending and wrapping upon binding, indicating an architectural role of the regulator. Furthermore, by analyzing an Sa-lrp deletion mutant, we demonstrate that the protein affects transcription of some of the genes of which the promoter region is targeted and that it is an important determinant of the cellular aggregation phenotype. Taking all these results into account, we conclude that Sa-Lrp is a glutamine-responsive global transcriptional regulator with an additional architectural role. PMID:23255531

  6. UV-induced DNA damage is an intermediate step in UV-induced expression of human immunodeficiency virus type 1, collagenase, c-fos, and metallothionein.

    PubMed Central

    Stein, B; Rahmsdorf, H J; Steffen, A; Litfin, M; Herrlich, P

    1989-01-01

    UV irradiation of human and murine cells enhances the transcription of several genes. Here we report on the primary target of relevant UV absorption, on pathways leading to gene activation, and on the elements receiving the UV-induced signal in the human immunodeficiency virus type 1 (HIV-1) long terminal repeat, in the gene coding for collagenase, and in the cellular oncogene fos. In order to induce the expression of genes. UV radiation needs to be absorbed by DNA and to cause DNA damage of the kind that cannot be repaired by cells from patients with xeroderma pigmentosum group A. UV-induced activation of the three genes is mediated by the major enhancer elements (located between nucleotide positions -105 and -79 of HIV-1, between positions -72 and -65 of the collagenase gene, and between positions -320 and -299 of fos). These elements share no apparent sequence motif and bind different trans-acting proteins; a member of the NF kappa B family binds to the HIV-1 enhancer, the heterodimer of Jun and Fos (AP-1) binds to the collagenase enhancer, and the serum response factors p67 and p62 bind to fos. DNA-binding activities of the factors recognizing the HIV-1 and collagenase enhancers are augmented in extracts from UV-treated cells. The increase in activity is due to posttranslational modification. While AP-1 resides in the nucleus and must be modulated there, NF kappa B is activated in the cytoplasm, indicating the existence of a cytoplasmic signal transduction pathway triggered by UV-induced DNA damage. In addition to activation, new synthesis of AP-1 is induced by UV radiation. Images PMID:2557547

  7. DNA-binding protects p53 from interactions with cofactors involved in transcription-independent functions

    PubMed Central

    Lambrughi, Matteo; De Gioia, Luca; Gervasio, Francesco Luigi; Lindorff-Larsen, Kresten; Nussinov, Ruth; Urani, Chiara; Bruschi, Maurizio; Papaleo, Elena

    2016-01-01

    Binding-induced conformational changes of a protein at regions distant from the binding site may play crucial roles in protein function and regulation. The p53 tumour suppressor is an example of such an allosterically regulated protein. Little is known, however, about how DNA binding can affect distal sites for transcription factors. Furthermore, the molecular details of how a local perturbation is transmitted through a protein structure are generally elusive and occur on timescales hard to explore by simulations. Thus, we employed state-of-the-art enhanced sampling atomistic simulations to unveil DNA-induced effects on p53 structure and dynamics that modulate the recruitment of cofactors and the impact of phosphorylation at Ser215. We show that DNA interaction promotes a conformational change in a region 3 nm away from the DNA binding site. Specifically, binding to DNA increases the population of an occluded minor state at this distal site by more than 4-fold, whereas phosphorylation traps the protein in its major state. In the minor conformation, the interface of p53 that binds biological partners related to p53 transcription-independent functions is not accessible. Significantly, our study reveals a mechanism of DNA-mediated protection of p53 from interactions with partners involved in the p53 transcription-independent signalling. This also suggests that conformational dynamics is tightly related to p53 signalling. PMID:27604871

  8. Interference between Triplex and Protein Binding to Distal Sites on Supercoiled DNA.

    PubMed

    Noy, Agnes; Maxwell, Anthony; Harris, Sarah A

    2017-02-07

    We have explored the interdependence of the binding of a DNA triplex and a repressor protein to distal recognition sites on supercoiled DNA minicircles using MD simulations. We observe that the interaction between the two ligands through their influence on their DNA template is determined by a subtle interplay of DNA mechanics and electrostatics, that the changes in flexibility induced by ligand binding play an important role and that supercoiling can instigate additional ligand-DNA contacts that would not be possible in simple linear DNA sequences. Copyright © 2017. Published by Elsevier Inc.

  9. Ligand induced stabilization of the melting temperature of the HSV-1 single-strand DNA binding protein using the thermal shift assay.

    PubMed

    Rupesh, Kanchi Ravi; Smith, Aaron; Boehmer, Paul E

    2014-11-28

    We have adapted the thermal shift assay to measure the ligand binding properties of the herpes simplex virus-1 single-strand DNA binding protein, ICP8. By measuring SYPRO Orange fluorescence in microtiter plates using a fluorescence-enabled thermal cycler, we have quantified the effects of oligonucleotide ligands on the melting temperature of ICP8. We found that single-stranded oligomers raise the melting temperature of ICP8 in a length- and concentration-dependent manner, ranging from 1°C for (dT)5 to a maximum of 9°C with oligomers ⩾10 nucleotides, with an apparent Kd of <1μM for (dT)20. Specifically, the results indicate that ICP8 is capable of interacting with oligomers as short as 5 nucleotides. Moreover, the observed increases in melting temperature of up to 9°C, indicates that single-strand DNA binding significantly stabilizes the structure of ICP8. This assay may be applied to investigate the ligand binding proteins of other single-strand DNA binding proteins and used as a high-throughput screen to identify compounds with therapeutic potential that inhibit single-strand DNA binding. As proof of concept, the single-strand DNA binding agent ciprofloxacin reduces the ligand induced stabilization of the melting temperature of ICP8 in a dose-dependent manner. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. Non-B-DNA structures on the interferon-beta promoter?

    PubMed

    Robbe, K; Bonnefoy, E

    1998-01-01

    The high mobility group (HMG) I protein intervenes as an essential factor during the virus induced expression of the interferon-beta (IFN-beta) gene. It is a non-histone chromatine associated protein that has the dual capacity of binding to a non-B-DNA structure such as cruciform-DNA as well as to AT rich B-DNA sequences. In this work we compare the binding affinity of HMGI for a synthetic cruciform-DNA to its binding affinity for the HMGI-binding-site present in the positive regulatory domain II (PRDII) of the IFN-beta promoter. Using gel retardation experiments, we show that HMGI protein binds with at least ten times more affinity to the synthetic cruciform-DNA structure than to the PRDII B-DNA sequence. DNA hairpin sequences are present in both the human and the murine PRDII-DNAs. We discuss in this work the presence of, yet putative, non-B-DNA structures in the IFN-beta promoter.

  11. Unique structural modulation of a non-native substrate by cochaperone DnaJ.

    PubMed

    Tiwari, Satyam; Kumar, Vignesh; Jayaraj, Gopal Gunanathan; Maiti, Souvik; Mapa, Koyeli

    2013-02-12

    The role of bacterial DnaJ protein as a cochaperone of DnaK is strongly appreciated. Although DnaJ unaccompanied by DnaK can bind unfolded as well as native substrate proteins, its role as an individual chaperone remains elusive. In this study, we demonstrate that DnaJ binds a model non-native substrate with a low nanomolar dissociation constant and, more importantly, modulates the structure of its non-native state. The structural modulation achieved by DnaJ is different compared to that achieved by the DnaK-DnaJ complex. The nature of structural modulation exerted by DnaJ is suggestive of a unique unfolding activity on the non-native substrate by the chaperone. Furthermore, we demonstrate that the zinc binding motif along with the C-terminal substrate binding domain of DnaJ is necessary and sufficient for binding and the subsequent binding-induced structural alterations of the non-native substrate. We hypothesize that this hitherto unknown structural alteration of non-native states by DnaJ might be important for its chaperoning activity by removing kinetic traps of the folding intermediates.

  12. Cold-inducible RNA-binding protein through TLR4 signaling induces mitochondrial DNA fragmentation and regulates macrophage cell death after trauma.

    PubMed

    Li, Zhigang; Fan, Erica K; Liu, Jinghua; Scott, Melanie J; Li, Yuehua; Li, Song; Xie, Wen; Billiar, Timothy R; Wilson, Mark A; Jiang, Yong; Wang, Ping; Fan, Jie

    2017-05-11

    Trauma is a major cause of systemic inflammatory response syndrome and multiple organ dysfunction syndrome. Macrophages (Mφ) direct trauma-induced inflammation, and Mφ death critically influences the progression of the inflammatory response. In the current study, we explored an important role of trauma in inducing mitochondrial DNA (mtDNA) damage in Mφ and the subsequent regulation of Mφ death. Using an animal pseudo-fracture trauma model, we demonstrated that tissue damage induced NADPH oxidase activation and increased the release of reactive oxygen species via cold-inducible RNA-binding protein (CIRP)-TLR4-MyD88 signaling. This in turn, activates endonuclease G, which serves as an executor for the fragmentation of mtDNA in Mφ. We further showed that fragmented mtDNA triggered both p62-related autophagy and necroptosis in Mφ. However, autophagy activation also suppressed Mφ necroptosis and pro-inflammatory responses. This study demonstrates a previously unidentified intracellular regulation of Mφ homeostasis in response to trauma.

  13. Cold-inducible RNA-binding protein through TLR4 signaling induces mitochondrial DNA fragmentation and regulates macrophage cell death after trauma

    PubMed Central

    Li, Zhigang; Fan, Erica K; Liu, Jinghua; Scott, Melanie J; Li, Yuehua; Li, Song; Xie, Wen; Billiar, Timothy R; Wilson, Mark A; Jiang, Yong; Wang, Ping; Fan, Jie

    2017-01-01

    Trauma is a major cause of systemic inflammatory response syndrome and multiple organ dysfunction syndrome. Macrophages (Mϕ) direct trauma-induced inflammation, and Mϕ death critically influences the progression of the inflammatory response. In the current study, we explored an important role of trauma in inducing mitochondrial DNA (mtDNA) damage in Mϕ and the subsequent regulation of Mϕ death. Using an animal pseudo-fracture trauma model, we demonstrated that tissue damage induced NADPH oxidase activation and increased the release of reactive oxygen species via cold-inducible RNA-binding protein (CIRP)–TLR4–MyD88 signaling. This in turn, activates endonuclease G, which serves as an executor for the fragmentation of mtDNA in Mϕ. We further showed that fragmented mtDNA triggered both p62-related autophagy and necroptosis in Mϕ. However, autophagy activation also suppressed Mϕ necroptosis and pro-inflammatory responses. This study demonstrates a previously unidentified intracellular regulation of Mϕ homeostasis in response to trauma. PMID:28492546

  14. Accurate Prediction of Inducible Transcription Factor Binding Intensities In Vivo

    PubMed Central

    Siepel, Adam; Lis, John T.

    2012-01-01

    DNA sequence and local chromatin landscape act jointly to determine transcription factor (TF) binding intensity profiles. To disentangle these influences, we developed an experimental approach, called protein/DNA binding followed by high-throughput sequencing (PB–seq), that allows the binding energy landscape to be characterized genome-wide in the absence of chromatin. We applied our methods to the Drosophila Heat Shock Factor (HSF), which inducibly binds a target DNA sequence element (HSE) following heat shock stress. PB–seq involves incubating sheared naked genomic DNA with recombinant HSF, partitioning the HSF–bound and HSF–free DNA, and then detecting HSF–bound DNA by high-throughput sequencing. We compared PB–seq binding profiles with ones observed in vivo by ChIP–seq and developed statistical models to predict the observed departures from idealized binding patterns based on covariates describing the local chromatin environment. We found that DNase I hypersensitivity and tetra-acetylation of H4 were the most influential covariates in predicting changes in HSF binding affinity. We also investigated the extent to which DNA accessibility, as measured by digital DNase I footprinting data, could be predicted from MNase–seq data and the ChIP–chip profiles for many histone modifications and TFs, and found GAGA element associated factor (GAF), tetra-acetylation of H4, and H4K16 acetylation to be the most predictive covariates. Lastly, we generated an unbiased model of HSF binding sequences, which revealed distinct biophysical properties of the HSF/HSE interaction and a previously unrecognized substructure within the HSE. These findings provide new insights into the interplay between the genomic sequence and the chromatin landscape in determining transcription factor binding intensity. PMID:22479205

  15. Probing the DNA kink structure induced by the hyperthermophilic chromosomal protein Sac7d

    PubMed Central

    Chen, Chin-Yu; Ko, Tzu-Ping; Lin, Ting-Wan; Chou, Chia-Cheng; Chen, Chun-Jung; Wang, Andrew H.-J.

    2005-01-01

    Sac7d, a small, abundant, sequence-general DNA-binding protein from the hyperthermophilic archaeon Sulfolobus acidocaldarius, causes a single-step sharp kink in DNA (∼60°) via the intercalation of both Val26 and Met29. These two amino acids were systematically changed in size to probe their effects on DNA kinking. Eight crystal structures of five Sac7d mutant–DNA complexes have been analyzed. The DNA-binding pattern of the V26A and M29A single mutants is similar to that of the wild-type, whereas the V26A/M29A protein binds DNA without side chain intercalation, resulting in a smaller overall bending (∼50°). The M29F mutant inserts the Phe29 side chain orthogonally to the C2pG3 step without stacking with base pairs, inducing a sharp kink (∼80°). In the V26F/M29F-GCGATCGC complex, Phe26 intercalates deeply into DNA bases by stacking with the G3 base, whereas Phe29 is stacked on the G15 deoxyribose, in a way similar to those used by the TATA box-binding proteins. All mutants have reduced DNA-stabilizing ability, as indicated by their lower Tm values. The DNA kink patterns caused by different combinations of hydrophobic side chains may be relevant in understanding the manner by which other minor groove-binding proteins interact with DNA. PMID:15653643

  16. Binding of resveratrol to the minor groove of DNA sequences with AATT and TTAA segments induces differential stability.

    PubMed

    Nair, Maya S; D'Mello, Samar; Pant, Rashmi; Poluri, Krishna Mohan

    2017-05-01

    Interactions of a natural stilbene compound, resveratrol with two DNA sequences containing AATT/TTAA segments have been studied. Resveratrol is found to interact with both the sequences. The mode of interaction has been studied using absorption, steady state fluorescence and circular dichroism spectroscopic techniques. UV-visible absorption and fluorescence studies provided the information regarding the binding constants and the stoichiometry of binding, whereas circular dichroism studies depicted the structural changes in DNA upon resveratrol binding. Our results evidenced that, though resveratrol showed similar affinity to both the sequences, the mode of interactions was different. The binding constants of resveratrol to AATT/TTAA sequences were found to be 7.55×10 5 M -1 and 5.42×10 5 M -1 respectively. Spectroscopic data evidenced for a groove binding interaction. Melting studies showed that the binding of resveratrol induces differential stability to the DNA sequences d(CGTTAACG) 2 and d(CGAATTCG) 2 . Fluorescence data showed a stoichiometry of 1:1 for d(CGAATTCG) 2 -resveratrol complex and 1:4 for d(CGTTAACG) 2 -resveratrol complex. Molecular docking studies demonstrated that resveratrol binds to the minor groove region of both the sequences to form stable complexes with varied atomic contacts to the DNA bases or backbone. Both the complexes are stabilized by hydrogen bond formation. Our results evidenced that modulation of DNA sequence within the same bases can greatly alter the binding geometry and stability of the complex upon binding to small molecule inhibitor compounds like resveratrol. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Role of indirect readout mechanism in TATA box binding protein-DNA interaction.

    PubMed

    Mondal, Manas; Choudhury, Devapriya; Chakrabarti, Jaydeb; Bhattacharyya, Dhananjay

    2015-03-01

    Gene expression generally initiates from recognition of TATA-box binding protein (TBP) to the minor groove of DNA of TATA box sequence where the DNA structure is significantly different from B-DNA. We have carried out molecular dynamics simulation studies of TBP-DNA system to understand how the DNA structure alters for efficient binding. We observed rigid nature of the protein while the DNA of TATA box sequence has an inherent flexibility in terms of bending and minor groove widening. The bending analysis of the free DNA and the TBP bound DNA systems indicate presence of some similar structures. Principal coordinate ordination analysis also indicates some structural features of the protein bound and free DNA are similar. Thus we suggest that the DNA of TATA box sequence regularly oscillates between several alternate structures and the one suitable for TBP binding is induced further by the protein for proper complex formation.

  18. DNA-binding protects p53 from interactions with cofactors involved in transcription-independent functions.

    PubMed

    Lambrughi, Matteo; De Gioia, Luca; Gervasio, Francesco Luigi; Lindorff-Larsen, Kresten; Nussinov, Ruth; Urani, Chiara; Bruschi, Maurizio; Papaleo, Elena

    2016-11-02

    Binding-induced conformational changes of a protein at regions distant from the binding site may play crucial roles in protein function and regulation. The p53 tumour suppressor is an example of such an allosterically regulated protein. Little is known, however, about how DNA binding can affect distal sites for transcription factors. Furthermore, the molecular details of how a local perturbation is transmitted through a protein structure are generally elusive and occur on timescales hard to explore by simulations. Thus, we employed state-of-the-art enhanced sampling atomistic simulations to unveil DNA-induced effects on p53 structure and dynamics that modulate the recruitment of cofactors and the impact of phosphorylation at Ser215. We show that DNA interaction promotes a conformational change in a region 3 nm away from the DNA binding site. Specifically, binding to DNA increases the population of an occluded minor state at this distal site by more than 4-fold, whereas phosphorylation traps the protein in its major state. In the minor conformation, the interface of p53 that binds biological partners related to p53 transcription-independent functions is not accessible. Significantly, our study reveals a mechanism of DNA-mediated protection of p53 from interactions with partners involved in the p53 transcription-independent signalling. This also suggests that conformational dynamics is tightly related to p53 signalling. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. DNA Replication Arrest and DNA Damage Responses Induced by Alkylating Minor Groove Binders

    DTIC Science & Technology

    2001-05-01

    We are interested in the molecular mechanisms involved in DNA replication arrest by the S phase DNA damage checkpoints. Using in vitro simian virus...40 DNA replication assays, we have found three factors that directly contribute to DNA damage-induced DNA replication arrest: Replication Protein A...trans-acting inhibitors. RPA is the major eukaryotic single-stranded DNA binding protein required for DNA replication , repair and recombination. Upon DNA

  20. Cdc45-induced loading of human RPA onto single-stranded DNA

    PubMed Central

    Tessmer, Ingrid; Prus, Piotr; Schlott, Bernhard; Pospiech, Helmut

    2017-01-01

    Abstract Cell division cycle protein 45 (Cdc45) is an essential component of the eukaryotic replicative DNA helicase. We found that human Cdc45 forms a complex with the single-stranded DNA (ssDNA) binding protein RPA. Moreover, it actively loads RPA onto nascent ssDNA. Pull-down assays and surface plasmon resonance studies revealed that Cdc45-bound RPA complexed with ssDNA in the 8–10 nucleotide binding mode, but dissociated when RPA covered a 30-mer. Real-time analysis of RPA-ssDNA binding demonstrated that Cdc45 catalytically loaded RPA onto ssDNA. This placement reaction required physical contacts of Cdc45 with the RPA70A subdomain. Our results imply that Cdc45 controlled stabilization of the 8-nt RPA binding mode, the subsequent RPA transition into 30-mer mode and facilitated an ordered binding to ssDNA. We propose that a Cdc45-mediated loading guarantees a seamless deposition of RPA on newly emerging ssDNA at the nascent replication fork. PMID:28100698

  1. Differential sensitivities of cellular XPA and PARP-1 to arsenite inhibition and zinc rescue.

    PubMed

    Ding, Xiaofeng; Zhou, Xixi; Cooper, Karen L; Huestis, Juliana; Hudson, Laurie G; Liu, Ke Jian

    2017-09-15

    Arsenite directly binds to the zinc finger domains of the DNA repair protein poly (ADP ribose) polymerase (PARP)-1, and inhibits PARP-1 activity in the base excision repair (BER) pathway. PARP inhibition by arsenite enhances ultraviolet radiation (UVR)-induced DNA damage in keratinocytes, and the increase in DNA damage is reduced by zinc supplementation. However, little is known about the effects of arsenite and zinc on the zinc finger nucleotide excision repair (NER) protein xeroderma pigmentosum group A (XPA). In this study, we investigated the difference in response to arsenite exposure between XPA and PARP-1, and the differential effectiveness of zinc supplementation in restoring protein DNA binding and DNA damage repair. Arsenite targeted both XPA and PARP-1 in human keratinocytes, resulting in zinc loss from each protein and a pronounced decrease in XPA and PARP-1 binding to chromatin as demonstrated by Chip-on-Western assays. Zinc effectively restored DNA binding of PARP-1 and XPA to chromatin when zinc concentrations were equal to those of arsenite. In contrast, zinc was more effective in rescuing arsenite-augmented direct UVR-induced DNA damage than oxidative DNA damage. Taken together, our findings indicate that arsenite interferes with PARP-1 and XPA binding to chromatin, and that zinc supplementation fully restores DNA binding activity to both proteins in the cellular context. Interestingly, rescue of arsenite-inhibited DNA damage repair by supplemental zinc was more sensitive for DNA damage repaired by the XPA-associated NER pathway than for the PARP-1-dependent BER pathway. This study expands our understanding of arsenite's role in DNA repair inhibition and co-carcinogenesis. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Binding-induced DNA walker for signal amplification in highly selective electrochemical detection of protein.

    PubMed

    Ji, Yuhang; Zhang, Lei; Zhu, Longyi; Lei, Jianping; Wu, Jie; Ju, Huangxian

    2017-10-15

    A binding-induced DNA walker-assisted signal amplification was developed for highly selective electrochemical detection of protein. Firstly, the track of DNA walker was constructed by self-assembly of the high density ferrocene (Fc)-labeled anchor DNA and aptamer 1 on the gold electrode surface. Sequentially, a long swing-arm chain containing aptamer 2 and walking strand DNA was introduced onto gold electrode through aptamers-target specific recognition, and thus initiated walker strand sequences to hybridize with anchor DNA. Then, the DNA walker was activated by the stepwise cleavage of the hybridized anchor DNA by nicking endonuclease to release multiple Fc molecules for signal amplification. Taking thrombin as the model target, the Fc-generated electrochemical signal decreased linearly with logarithm value of thrombin concentration ranging from 10pM to 100nM with a detection limit of 2.5pM under the optimal conditions. By integrating the specific recognition of aptamers to target with the enzymatic cleavage of nicking endonuclease, the aptasensor showed the high selectivity. The binding-induced DNA walker provides a promising strategy for signal amplification in electrochemical biosensor, and has the extensive applications in sensitive and selective detection of the various targets. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Evidence for double-strand break mediated mitochondrial DNA replication in Saccharomyces cerevisiae

    PubMed Central

    Prasai, Kanchanjunga; Robinson, Lucy C.; Scott, Rona S.; Tatchell, Kelly

    2017-01-01

    Abstract The mechanism of mitochondrial DNA (mtDNA) replication in Saccharomyces cerevisiae is controversial. Evidence exists for double-strand break (DSB) mediated recombination-dependent replication at mitochondrial replication origin ori5 in hypersuppressive ρ− cells. However, it is not clear if this replication mode operates in ρ+ cells. To understand this, we targeted bacterial Ku (bKu), a DSB binding protein, to the mitochondria of ρ+ cells with the hypothesis that bKu would bind persistently to mtDNA DSBs, thereby preventing mtDNA replication or repair. Here, we show that mitochondrial-targeted bKu binds to ori5 and that inducible expression of bKu triggers petite formation preferentially in daughter cells. bKu expression also induces mtDNA depletion that eventually results in the formation of ρ0 cells. This data supports the idea that yeast mtDNA replication is initiated by a DSB and bKu inhibits mtDNA replication by binding to a DSB at ori5, preventing mtDNA segregation to daughter cells. Interestingly, we find that mitochondrial-targeted bKu does not decrease mtDNA content in human MCF7 cells. This finding is in agreement with the fact that human mtDNA replication, typically, is not initiated by a DSB. Therefore, this study provides evidence that DSB-mediated replication is the predominant form of mtDNA replication in ρ+ yeast cells. PMID:28549155

  4. Quantitative characterization of conformational-specific protein-DNA binding using a dual-spectral interferometric imaging biosensor.

    PubMed

    Zhang, Xirui; Daaboul, George G; Spuhler, Philipp S; Dröge, Peter; Ünlü, M Selim

    2016-03-14

    DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are not fully understood. Recently, it was discovered that DNA-binding proteins recognize specific binding sites to carry out their functions through an indirect readout mechanism by recognizing and capturing DNA conformational flexibility and deformation. High-throughput DNA microarray-based methods that provide large-scale protein-DNA binding information have shown effective and comprehensive analysis of protein-DNA binding affinities, but do not provide information of DNA conformational changes in specific protein-DNA complexes. Building on the high-throughput capability of DNA microarrays, we demonstrate a quantitative approach that simultaneously measures the amount of protein binding to DNA and nanometer-scale DNA conformational change induced by protein binding in a microarray format. Both measurements rely on spectral interferometry on a layered substrate using a single optical instrument in two distinct modalities. In the first modality, we quantitate the amount of binding of protein to surface-immobilized DNA in each DNA spot using a label-free spectral reflectivity technique that accurately measures the surface densities of protein and DNA accumulated on the substrate. In the second modality, for each DNA spot, we simultaneously measure DNA conformational change using a fluorescence vertical sectioning technique that determines average axial height of fluorophores tagged to specific nucleotides of the surface-immobilized DNA. The approach presented in this paper, when combined with current high-throughput DNA microarray-based technologies, has the potential to serve as a rapid and simple method for quantitative and large-scale characterization of conformational specific protein-DNA interactions.

  5. Impact of cadmium, cobalt and nickel on sequence-specific DNA binding of p63 and p73 in vitro and in cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Adámik, Matej; Bažantová, Pavla; Department of Biology and Ecology, Faculty of Science, University of Ostrava, Chittussiho 10, 701 03 Ostrava

    Highlights: • DNA binding of p53 family core domains is inhibited by cadmium, cobalt and nickel. • Binding to DNA protects p53 family core domains from metal induced inhibition. • Cadmium, cobalt and nickel induced inhibition was reverted by EDTA in vitro. - Abstract: Site-specific DNA recognition and binding activity belong to common attributes of all three members of tumor suppressor p53 family proteins: p53, p63 and p73. It was previously shown that heavy metals can affect p53 conformation, sequence-specific binding and suppress p53 response to DNA damage. Here we report for the first time that cadmium, nickel and cobalt,more » which have already been shown to disturb various DNA repair mechanisms, can also influence p63 and p73 sequence-specific DNA binding activity and transactivation of p53 family target genes. Based on results of electrophoretic mobility shift assay and luciferase reporter assay, we conclude that cadmium inhibits sequence-specific binding of all three core domains to p53 consensus sequences and abolishes transactivation of several promoters (e.g. BAX and MDM2) by 50 μM concentrations. In the presence of specific DNA, all p53 family core domains were partially protected against loss of DNA binding activity due to cadmium treatment. Effective cadmium concentration to abolish DNA–protein interactions was about two times higher for p63 and p73 proteins than for p53. Furthermore, we detected partial reversibility of cadmium inhibition for all p53 family members by EDTA. DTT was able to reverse cadmium inhibition only for p53 and p73. Nickel and cobalt abolished DNA–p53 interaction at sub-millimolar concentrations while inhibition of p63 and p73 DNA binding was observed at millimolar concentrations. In summary, cadmium strongly inhibits p53, p63 and p73 DNA binding in vitro and in cells in comparison to nickel and cobalt. The role of cadmium inhibition of p53 tumor suppressor family in carcinogenesis is discussed.« less

  6. Diethylpyrocarbonate and permanganate provide evidence for an unusual DNA conformation induced by binding of the antitumour antibiotics bleomycin and phleomycin.

    PubMed Central

    Fox, K R; Grigg, G W

    1988-01-01

    DNA structural changes induced by bleomycin have been investigated using diethylpyrocarbonate and permanganate as probes under conditions in which the antibiotic binds to, but does not cut the DNA. Diethyl-pyrocarbonate shows an enhanced reaction with adenines in the presence of the antibiotic in the sequences GTA greater than GCA greater than GAA, on the 3' side of the drug cutting site (GPy). Permanganate ions display an enhanced reactivity at the second pyrimidine of the sequence GPyPy. The results are consistent with a model in which bleomycin distorts the structure of the base pair on the 3' side of its binding site. Images PMID:2451809

  7. Probing the Characterization of the Interaction of Aflatoxins B1 and G1 with Calf Thymus DNA In Vitro

    PubMed Central

    Ma, Liang; Wang, Jiaman; Zhang, Yuhao

    2017-01-01

    The binding characterization of aflatoxins with calf thymus DNA (ctDNA) under physiological conditions was investigated. Multispectroscopic techniques, ctDNA melting, viscosity measurements, and molecular docking techniques were employed to elucidate the binding mechanism of the aflatoxins with DNA. The fluorescence results indicated that both aflatoxin B1 (AFB1) and aflatoxin G1 (AFG1) bound to the ctDNA, forming complexes through hydrogen bonding. The binding constants of AFB1 and AFG1 with ctDNA reached up to 103 L·mol−1 and 104 L·mol−1, respectively, and AFG1 exhibited a higher binding propensity than that of AFB1. Furthermore, both AFB1 and AFG1 bound to the ctDNA through groove binding, as evidenced by the results of the spectroscopic, iodide quenching effect, viscosity, and ctDNA melting measurements. Changes in the circular dichroism signal manifested that both AFB1 and AFG1 induced an increase in the right-handed helicity, but only minimally influenced the base stacking of the DNA. A molecular docking study of the aflatoxin’s binding with the DNA revealed a groove binding mode, which was driven mainly by hydrogen bonding. This study of aflatoxin–ctDNA interaction may provide novel insights into the toxicological effect of the mycotoxins. PMID:28671585

  8. CHD3 and CHD4 recruitment and chromatin remodeling activity at DNA breaks is promoted by early poly(ADP-ribose)-dependent chromatin relaxation.

    PubMed

    Smith, Rebecca; Sellou, Hafida; Chapuis, Catherine; Huet, Sébastien; Timinszky, Gyula

    2018-05-04

    One of the first events to occur upon DNA damage is the local opening of the compact chromatin architecture, facilitating access of repair proteins to DNA lesions. This early relaxation is triggered by poly(ADP-ribosyl)ation by PARP1 in addition to ATP-dependent chromatin remodeling. CHD4 recruits to DNA breaks in a PAR-dependent manner, although it lacks any recognizable PAR-binding domain, and has the ability to relax chromatin structure. However, its role in chromatin relaxation at the site of DNA damage has not been explored. Using a live cell fluorescence three-hybrid assay, we demonstrate that the recruitment of CHD4 to DNA damage, while being poly(ADP-ribosyl)ation-dependent, is not through binding poly(ADP-ribose). Additionally, we show that CHD3 is recruited to DNA breaks in the same manner as CHD4 and that both CHD3 and CHD4 play active roles in chromatin remodeling at DNA breaks. Together, our findings reveal a two-step mechanism for DNA damage induced chromatin relaxation in which PARP1 and the PAR-binding remodeler activities of Alc1/CHD1L induce an initial chromatin relaxation phase that promotes the subsequent recruitment of CHD3 and CHD4 via binding to DNA for further chromatin remodeling at DNA breaks.

  9. Fis protein induced λF-DNA bending observed by single-pair fluorescence resonance energy transfer

    NASA Astrophysics Data System (ADS)

    Chi-Cheng, Fu; Wunshain, Fann; Yuan Hanna, S.

    2006-03-01

    Fis, a site-specific DNA binding protein, regulates many biological processes including recombination, transcription, and replication in E.coli. Fis induced DNA bending plays an important role in regulating these functions and bending angle range from ˜50 to 95 dependent on the DNA sequence. For instance, the average bending angle of λF-DNA (26 bp, 8.8nm long, contained λF binding site on the center) measured by gel mobility shift assays was ˜ 94 . But the traditional method cannot provide information about the dynamics and the angle distribution. In this study, λF-DNA was labeled with donor (Alexa Fluor 546) and acceptor (Alexa Fluor 647) dyes on its two 5' ends and the donor-acceptor distances were measured using single-pair fluorescence resonance energy transfer (sp-FRET) with and without the present of Fis protein. Combing with structure information of Fis-DNA complex, the sp-FRET results are used to estimate the protein induced DNA bending angle distribution and dynamics.

  10. A PARP1-ERK2 synergism is required for the induction of LTP

    PubMed Central

    Visochek, L.; Grigoryan, G.; Kalal, A.; Milshtein-Parush, H.; Gazit, N.; Slutsky, I.; Yeheskel, A.; Shainberg, A.; Castiel, A.; Seger, R.; Langelier, M. F.; Dantzer, F.; Pascal, J. M.; Segal, M.; Cohen-Armon, M.

    2016-01-01

    Unexpectedly, a post-translational modification of DNA-binding proteins, initiating the cell response to single-strand DNA damage, was also required for long-term memory acquisition in a variety of learning paradigms. Our findings disclose a molecular mechanism based on PARP1-Erk synergism, which may underlie this phenomenon. A stimulation induced PARP1 binding to phosphorylated Erk2 in the chromatin of cerebral neurons caused Erk-induced PARP1 activation, rendering transcription factors and promoters of immediate early genes (IEG) accessible to PARP1-bound phosphorylated Erk2. Thus, Erk-induced PARP1 activation mediated IEG expression implicated in long-term memory. PARP1 inhibition, silencing, or genetic deletion abrogated stimulation-induced Erk-recruitment to IEG promoters, gene expression and LTP generation in hippocampal CA3-CA1-connections. Moreover, a predominant binding of PARP1 to single-strand DNA breaks, occluding its Erk binding sites, suppressed IEG expression and prevented the generation of LTP. These findings outline a PARP1-dependent mechanism required for LTP generation, which may be implicated in long-term memory acquisition and in its deterioration in senescence. PMID:27121568

  11. A PARP1-ERK2 synergism is required for the induction of LTP.

    PubMed

    Visochek, L; Grigoryan, G; Kalal, A; Milshtein-Parush, H; Gazit, N; Slutsky, I; Yeheskel, A; Shainberg, A; Castiel, A; Seger, R; Langelier, M F; Dantzer, F; Pascal, J M; Segal, M; Cohen-Armon, M

    2016-04-28

    Unexpectedly, a post-translational modification of DNA-binding proteins, initiating the cell response to single-strand DNA damage, was also required for long-term memory acquisition in a variety of learning paradigms. Our findings disclose a molecular mechanism based on PARP1-Erk synergism, which may underlie this phenomenon. A stimulation induced PARP1 binding to phosphorylated Erk2 in the chromatin of cerebral neurons caused Erk-induced PARP1 activation, rendering transcription factors and promoters of immediate early genes (IEG) accessible to PARP1-bound phosphorylated Erk2. Thus, Erk-induced PARP1 activation mediated IEG expression implicated in long-term memory. PARP1 inhibition, silencing, or genetic deletion abrogated stimulation-induced Erk-recruitment to IEG promoters, gene expression and LTP generation in hippocampal CA3-CA1-connections. Moreover, a predominant binding of PARP1 to single-strand DNA breaks, occluding its Erk binding sites, suppressed IEG expression and prevented the generation of LTP. These findings outline a PARP1-dependent mechanism required for LTP generation, which may be implicated in long-term memory acquisition and in its deterioration in senescence.

  12. DNA sequence determinants controlling affinity, stability and shape of DNA complexes bound by the nucleoid protein Fis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio

    The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less

  13. DNA sequence determinants controlling affinity, stability and shape of DNA complexes bound by the nucleoid protein Fis

    DOE PAGES

    Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio; ...

    2016-03-09

    The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less

  14. An SRY mutation causing human sex reversal resolves a general mechanism of structure-specific DNA recognition: application to the four-way DNA junction.

    PubMed

    Peters, R; King, C Y; Ukiyama, E; Falsafi, S; Donahoe, P K; Weiss, M A

    1995-04-11

    SRY, a genetic "master switch" for male development in mammals, exhibits two biochemical activities: sequence-specific recognition of duplex DNA and sequence-independent binding to the sharp angles of four-way DNA junctions. Here, we distinguish between these activities by analysis of a mutant SRY associated with human sex reversal (46, XY female with pure gonadal dysgenesis). The substitution (168T in human SRY) alters a nonpolar side chain in the minor-groove DNA recognition alpha-helix of the HMG box [Haqq, C.M., King, C.-Y., Ukiyama, E., Haqq, T.N., Falsalfi, S., Donahoe, P.K., & Weiss, M.A. (1994) Science 266, 1494-1500]. The native (but not mutant) side chain inserts between specific base pairs in duplex DNA, interrupting base stacking at a site of induced DNA bending. Isotope-aided 1H-NMR spectroscopy demonstrates that analogous side-chain insertion occurs on binding of SRY to a four-way junction, establishing a shared mechanism of sequence- and structure-specific DNA binding. Although the mutant DNA-binding domain exhibits > 50-fold reduction in sequence-specific DNA recognition, near wild-type affinity for four-way junctions is retained. Our results (i) identify a shared SRY-DNA contact at a site of either induced or intrinsic DNA bending, (ii) demonstrate that this contact is not required to bind an intrinsically bent DNA target, and (iii) rationalize patterns of sequence conservation or diversity among HMG boxes. Clinical association of the I68T mutation with human sex reversal supports the hypothesis that specific DNA recognition by SRY is required for male sex determination.

  15. COMPARISON OF BLOOD PROTEIN AND TARGET ORGAN DNA AND PROTEIN BINDING FOLLOWING TOPICAL APPLICATION OF BENZO[A]PYRENE AND 7H-DIBENZO[C,G]CARBAZOLE TO MICE

    EPA Science Inventory

    7H-Dibenzo[c,g]carbazole (DBC) induces skin and liver tumors in mice following topical application, whereas benzo[a]pyrene (BP) induces only skin tumors. DBC also binds to liver DNA to a much greater extent than does BP. The present study examined factors that might account for t...

  16. Mitochondrial DNA maintenance is regulated in human hepatoma cells by glycogen synthase kinase 3β and p53 in response to tumor necrosis factor α.

    PubMed

    Vadrot, Nathalie; Ghanem, Sarita; Braut, Françoise; Gavrilescu, Laura; Pilard, Nathalie; Mansouri, Abdellah; Moreau, Richard; Reyl-Desmars, Florence

    2012-01-01

    During chronic liver inflammation, up-regulated Tumor Necrosis Factor alpha (TNF-α) targets hepatocytes and induces abnormal reactive oxygen species (ROS) production responsible for mitochondrial DNA (mtDNA) alterations. The serine/threonine Glycogen Synthase Kinase 3 beta (GSK3β) plays a pivotal role during inflammation but its involvement in the maintenance of mtDNA remains unknown. The aim of this study was to investigate its involvement in TNF-α induced mtDNA depletion and its interrelationship with p53 a protein known to maintain mtDNA copy numbers. Using quantitative polymerase chain reaction (qPCR) we found that at 30 min in human hepatoma HepG2 cells TNF-α induced 0.55±0.10 mtDNA lesions per 10 Kb and a 52.4±2.8% decrease in mtDNA content dependent on TNF-R1 receptor and ROS production. Both lesions and depletion returned to baseline from 1 to 6 h after TNF-α exposure. Luminol-amplified chemiluminescence (LAC) was used to measure the rapid (10 min) and transient TNF-α induced increase in ROS production (168±15%). A transient 8-oxo-dG level of 1.4±0.3 ng/mg DNA and repair of abasic sites were also measured by ELISA assays. Translocation of p53 to mitochondria was observed by Western Blot and co-immunoprecipitations showed that TNF-α induced p53 binding to GSK3β and mitochondrial transcription factor A (TFAM). In addition, mitochondrial D-loop immunoprecipitation (mtDIP) revealed that TNF-α induced p53 binding to the regulatory D-loop region of mtDNA. The knockdown of p53 by siRNAs, inhibition by the phosphoSer(15)p53 antibody or transfection of human mutant active GSK3βS9A pcDNA3 plasmid inhibited recovery of mtDNA content while blockade of GSK3β activity by SB216763 inhibitor or knockdown by siRNAs suppressed mtDNA depletion. This study is the first to report the involvement of GSK3β in TNF-α induced mtDNA depletion. We suggest that p53 binding to GSK3β, TFAM and D-loop could induce recovery of mtDNA content through mtDNA repair.

  17. Binding of sulphonated indigo derivatives to RepA-WH1 inhibits DNA-induced protein amyloidogenesis

    PubMed Central

    Gasset-Rosa, Fátima; Maté, María Jesús; Dávila-Fajardo, Cristina; Bravo, Jerónimo; Giraldo, Rafael

    2008-01-01

    The quest for inducers and inhibitors of protein amyloidogenesis is of utmost interest, since they are key tools to understand the molecular bases of proteinopathies such as Alzheimer, Parkinson, Huntington and Creutzfeldt–Jakob diseases. It is also expected that such molecules could lead to valid therapeutic agents. In common with the mammalian prion protein (PrP), the N-terminal Winged-Helix (WH1) domain of the pPS10 plasmid replication protein (RepA) assembles in vitro into a variety of amyloid nanostructures upon binding to different specific dsDNA sequences. Here we show that di- (S2) and tetra-sulphonated (S4) derivatives of indigo stain dock at the DNA recognition interface in the RepA-WH1 dimer. They compete binding of RepA to its natural target dsDNA repeats, found at the repA operator and at the origin of replication of the plasmid. Calorimetry points to the existence of a major site, with micromolar affinity, for S4-indigo in RepA-WH1 dimers. As revealed by electron microscopy, in the presence of inducer dsDNA, both S2/S4 stains inhibit the assembly of RepA-WH1 into fibres. These results validate the concept that DNA can promote protein assembly into amyloids and reveal that the binding sites of effector molecules can be targeted to inhibit amyloidogenesis. PMID:18285361

  18. Allosteric analysis of glucocorticoid receptor-DNA interface induced by cyclic Py-Im polyamide: a molecular dynamics simulation study.

    PubMed

    Wang, Yaru; Ma, Na; Wang, Yan; Chen, Guangju

    2012-01-01

    It has been extensively developed in recent years that cell-permeable small molecules, such as polyamide, can be programmed to disrupt transcription factor-DNA interfaces and can silence aberrant gene expression. For example, cyclic pyrrole-imidazole polyamide that competes with glucocorticoid receptor (GR) for binding to glucocorticoid response elements could be expected to affect the DNA dependent binding by interfering with the protein-DNA interface. However, how such small molecules affect the transcription factor-DNA interfaces and gene regulatory pathways through DNA structure distortion is not fully understood so far. In the present work, we have constructed some models, especially the ternary model of polyamides+DNA+GR DNA-binding domain (GRDBD) dimer, and carried out molecular dynamics simulations and free energy calculations for them to address how polyamide molecules disrupt the GRDBD and DNA interface when polyamide and protein bind at the same sites on opposite grooves of DNA. We found that the cyclic polyamide binding in minor groove of DNA can induce a large structural perturbation of DNA, i.e. a >4 Å widening of the DNA minor groove and a compression of the major groove by more than 4 Å as compared with the DNA molecule in the GRDBD dimer+DNA complex. Further investigations for the ternary system of polyamides+DNA+GRDBD dimer and the binary system of allosteric DNA+GRDBD dimer revealed that the compression of DNA major groove surface causes GRDBD to move away from the DNA major groove with the initial average distance of ∼4 Å to the final average distance of ∼10 Å during 40 ns simulation course. Therefore, this study straightforward explores how small molecule targeting specific sites in the DNA minor groove disrupts the transcription factor-DNA interface in DNA major groove, and consequently modulates gene expression.

  19. Noncovalent Interactions of Tiopronin-Protected Gold Nanoparticles with DNA: Two Methods to Quantify Free Energy of Binding

    PubMed Central

    Prado-Gotor, R.; Grueso, E.

    2014-01-01

    The binding of gold nanoparticles capped with N-(2-mercaptopropionyl)glycine (Au@tiopronin) with double-stranded DNA has been investigated and quantified in terms of free energies by using two different approaches. The first approach follows the DNA conformational changes induced by gold nanoparticles using the CD technique. The second methodology consists in the use of pyrene-1-carboxaldehyde as a fluorescent probe. This second procedure implies the determination of the “true” free energy of binding of the probe with DNA, after corrections through solubility measurements. Working at different salt concentrations, the nonelectrostatic and electrostatic components of the binding free energy have been separated. The results obtained revealed that the binding is of nonelectrostatic character, fundamentally. The procedure used in this work could be extended to quantify the binding affinity of other AuNPs/DNA systems. PMID:24587710

  20. DNA-binding study of anticancer drug cytarabine by spectroscopic and molecular docking techniques.

    PubMed

    Shahabadi, Nahid; Falsafi, Monireh; Maghsudi, Maryam

    2017-01-02

    The interaction of anticancer drug cytarabine with calf thymus DNA (CT-DNA) was investigated in vitro under simulated physiological conditions by multispectroscopic techniques and molecular modeling study. The fluorescence spectroscopy and UV absorption spectroscopy indicated drug interacted with CT-DNA in a groove-binding mode, while the binding constant of UV-vis and the number of binding sites were 4.0 ± 0.2 × 10 4 L mol -1 and 1.39, respectively. The fluorimetric studies showed that the reaction between the drugs with CT-DNA is exothermic. Circular dichroism spectroscopy was employed to measure the conformational change of DNA in the presence of cytarabine. Furthermore, the drug induces detectable changes in its viscosity for DNA interaction. The molecular modeling results illustrated that cytarabine strongly binds to groove of DNA by relative binding energy of docked structure -20.61 KJ mol -1 . This combination of multiple spectroscopic techniques and molecular modeling methods can be widely used in the investigation on the interaction of small molecular pollutants and drugs with biomacromolecules for clarifying the molecular mechanism of toxicity or side effect in vivo.

  1. Cerium chloride stimulated controlled conversion of B-to-Z DNA in self-assembled nanostructures

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bhanjadeo, Madhabi M.; Academy of Scientific & Innovative Research; Nayak, Ashok K.

    DNA adopts different conformation not only because of novel base pairs but also while interacting with inorganic or organic compounds. Self-assembled branched DNA (bDNA) structures or DNA origami that change conformation in response to environmental cues hold great promises in sensing and actuation at the nanoscale. Recently, the B-Z transition in DNA is being explored to design various nanomechanical devices. In this communication we have demonstrated that Cerium chloride binds to the phosphate backbone of self-assembled bDNA structure and induce B-to-Z transition at physiological concentration. The mechanism of controlled conversion from right-handed to left-handed has been assayed by various dyemore » binding studies using CD and fluorescence spectroscopy. Three different bDNA structures have been identified to display B-Z transition. This approach provides a rapid and reversible means to change bDNA conformation, which can be used for dynamic and progressive control at the nanoscale. - Highlights: • Cerium-induced B-to-Z DNA transition in self-assembled nanostructures. • Lower melting temperature of Z-DNA than B-DNA confirmed by CD spectroscopy. • Binding mechanism of cerium chloride is explained using fluorescence spectroscopy. • Right-handed to left-handed DNA conformation is also noticed in modified bDNA structure.« less

  2. DNA-Binding Kinetics Determines the Mechanism of Noise-Induced Switching in Gene Networks

    PubMed Central

    Tse, Margaret J.; Chu, Brian K.; Roy, Mahua; Read, Elizabeth L.

    2015-01-01

    Gene regulatory networks are multistable dynamical systems in which attractor states represent cell phenotypes. Spontaneous, noise-induced transitions between these states are thought to underlie critical cellular processes, including cell developmental fate decisions, phenotypic plasticity in fluctuating environments, and carcinogenesis. As such, there is increasing interest in the development of theoretical and computational approaches that can shed light on the dynamics of these stochastic state transitions in multistable gene networks. We applied a numerical rare-event sampling algorithm to study transition paths of spontaneous noise-induced switching for a ubiquitous gene regulatory network motif, the bistable toggle switch, in which two mutually repressive genes compete for dominant expression. We find that the method can efficiently uncover detailed switching mechanisms that involve fluctuations both in occupancies of DNA regulatory sites and copy numbers of protein products. In addition, we show that the rate parameters governing binding and unbinding of regulatory proteins to DNA strongly influence the switching mechanism. In a regime of slow DNA-binding/unbinding kinetics, spontaneous switching occurs relatively frequently and is driven primarily by fluctuations in DNA-site occupancies. In contrast, in a regime of fast DNA-binding/unbinding kinetics, switching occurs rarely and is driven by fluctuations in levels of expressed protein. Our results demonstrate how spontaneous cell phenotype transitions involve collective behavior of both regulatory proteins and DNA. Computational approaches capable of simulating dynamics over many system variables are thus well suited to exploring dynamic mechanisms in gene networks. PMID:26488666

  3. Cdc45-induced loading of human RPA onto single-stranded DNA.

    PubMed

    Szambowska, Anna; Tessmer, Ingrid; Prus, Piotr; Schlott, Bernhard; Pospiech, Helmut; Grosse, Frank

    2017-04-07

    Cell division cycle protein 45 (Cdc45) is an essential component of the eukaryotic replicative DNA helicase. We found that human Cdc45 forms a complex with the single-stranded DNA (ssDNA) binding protein RPA. Moreover, it actively loads RPA onto nascent ssDNA. Pull-down assays and surface plasmon resonance studies revealed that Cdc45-bound RPA complexed with ssDNA in the 8-10 nucleotide binding mode, but dissociated when RPA covered a 30-mer. Real-time analysis of RPA-ssDNA binding demonstrated that Cdc45 catalytically loaded RPA onto ssDNA. This placement reaction required physical contacts of Cdc45 with the RPA70A subdomain. Our results imply that Cdc45 controlled stabilization of the 8-nt RPA binding mode, the subsequent RPA transition into 30-mer mode and facilitated an ordered binding to ssDNA. We propose that a Cdc45-mediated loading guarantees a seamless deposition of RPA on newly emerging ssDNA at the nascent replication fork. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Evidence for double-strand break mediated mitochondrial DNA replication in Saccharomyces cerevisiae.

    PubMed

    Prasai, Kanchanjunga; Robinson, Lucy C; Scott, Rona S; Tatchell, Kelly; Harrison, Lynn

    2017-07-27

    The mechanism of mitochondrial DNA (mtDNA) replication in Saccharomyces cerevisiae is controversial. Evidence exists for double-strand break (DSB) mediated recombination-dependent replication at mitochondrial replication origin ori5 in hypersuppressive ρ- cells. However, it is not clear if this replication mode operates in ρ+ cells. To understand this, we targeted bacterial Ku (bKu), a DSB binding protein, to the mitochondria of ρ+ cells with the hypothesis that bKu would bind persistently to mtDNA DSBs, thereby preventing mtDNA replication or repair. Here, we show that mitochondrial-targeted bKu binds to ori5 and that inducible expression of bKu triggers petite formation preferentially in daughter cells. bKu expression also induces mtDNA depletion that eventually results in the formation of ρ0 cells. This data supports the idea that yeast mtDNA replication is initiated by a DSB and bKu inhibits mtDNA replication by binding to a DSB at ori5, preventing mtDNA segregation to daughter cells. Interestingly, we find that mitochondrial-targeted bKu does not decrease mtDNA content in human MCF7 cells. This finding is in agreement with the fact that human mtDNA replication, typically, is not initiated by a DSB. Therefore, this study provides evidence that DSB-mediated replication is the predominant form of mtDNA replication in ρ+ yeast cells. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Akabayov, B.; Akabayov, S; Lee , S

    Gene 5 of bacteriophage T7 encodes a DNA polymerase (gp5) responsible for the replication of the phage DNA. Gp5 polymerizes nucleotides with low processivity, dissociating after the incorporation of 1 to 50 nucleotides. Thioredoxin (trx) of Escherichia coli binds tightly (Kd = 5 nM) to a unique segment in the thumb subdomain of gp5 and increases processivity. We have probed the molecular basis for the increase in processivity. A single-molecule experiment reveals differences in rates of enzymatic activity and processivity between gp5 and gp5/trx. Small angle X-ray scattering studies combined with nuclease footprinting reveal two conformations of gp5, one inmore » the free state and one upon binding to trx. Comparative analysis of the DNA binding clefts of DNA polymerases and DNA binding proteins show that the binding surface contains more hydrophobic residues than other DNA binding proteins. The balanced composition between hydrophobic and charged residues of the binding site allows for efficient sliding of gp5/trx on the DNA. We propose a model for trx-induced conformational changes in gp5 that enhance the processivity by increasing the interaction of gp5 with DNA.« less

  6. Shikonin, a natural product from the root of Lithospermum erythrorhizon, is a cytotoxic DNA-binding agent.

    PubMed

    Chen, Changmin; Shanmugasundaram, Kumaran; Rigby, Alan C; Kung, Andrew L

    2013-04-11

    To search for compounds that disrupt binding of the EWS-FLI1 fusion protein to its cognate targets, we developed a homogeneous high-throughput proximity assay and screened 5200 small molecule compounds. Many well-known DNA-binding chemotherapeutic agents, such as actinomycin D, cisplatin, doxorubicin, daunorubicin, and epirubicin scored in the assay and not surprising also disrupted the binding of other transcription factors. Unexpectedly, we found that Shikonin, a natural product from the root of Lithospermum erythrorhizon, similarly disrupted protein-DNA interactions. Mechanistic studies demonstrated that Shikonin displaces SYBR green from binding to the minor groove of DNA and is able to inhibit topoisomerase mediated DNA relaxation. In cells, Shikonin blocked the binding of EWS-FLI1 to the NR0B1 promoter, and attenuated gene expression. Shikonin rapidly induced G2/M arrest and apoptosis in Ewing sarcoma cells. These results demonstrate that contrary to other purported mechanisms of action, Shikonin is a DNA-binding cytotoxic agent. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. Role of platinum DNA damage-induced transcriptional inhibition in chemotherapy-induced neuronal atrophy and peripheral neurotoxicity.

    PubMed

    Yan, Fang; Liu, Johnson J; Ip, Virginia; Jamieson, Stephen M F; McKeage, Mark J

    2015-12-01

    Platinum-based anticancer drugs cause peripheral neurotoxicity by damaging sensory neurons within the dorsal root ganglia (DRG), but the mechanisms are incompletely understood. The roles of platinum DNA binding, transcription inhibition and altered cell size were investigated in primary cultures of rat DRG cells. Click chemistry quantitative fluorescence imaging of RNA-incorporated 5-ethynyluridine showed high, but wide ranging, global levels of transcription in individual neurons that correlated with their cell body size. Treatment with platinum drugs reduced neuronal transcription and cell body size to an extent that corresponded to the amount of preceding platinum DNA binding, but without any loss of neuronal cells. The effects of platinum drugs on neuronal transcription and cell body size were inhibited by blocking platinum DNA binding with sodium thiosulfate, and mimicked by treatment with a model transcriptional inhibitor, actinomycin D. In vivo oxaliplatin treatment depleted the total RNA content of DRG tissue concurrently with altering DRG neuronal size. These findings point to a mechanism of chemotherapy-induced peripheral neurotoxicity, whereby platinum DNA damage induces global transcriptional arrest leading in turn to neuronal atrophy. DRG neurons may be particularly vulnerable to this mechanism of toxicity because of their requirements for high basal levels of global transcriptional activity. Findings point to a new stepwise mechanism of chemotherapy-induced peripheral neurotoxicity, whereby platinum DNA damage induces global transcriptional arrest leading in turn to neuronal atrophy. Dorsal root ganglion neurons may be particularly vulnerable to this neurotoxicity because of their high global transcriptional outputs, demonstrated in this study by click chemistry quantitative fluorescence imaging. © 2015 International Society for Neurochemistry.

  8. S-nitrosation on zinc finger motif of PARP-1 as a mechanism of DNA repair inhibition by arsenite

    PubMed Central

    Zhou, Xixi; Cooper, Karen L.; Huestis, Juliana; Xu, Huan; Burchiel, Scott W.; Hudson, Laurie G.; Liu, Ke Jian

    2016-01-01

    Arsenic, a widely distributed carcinogen, is known to significantly amplify the impact of other carcinogens through inhibition of DNA repair. Our recent work suggests that reactive oxygen/nitrogen species (ROS/RNS) induced by arsenite (AsIII) play an important role in the inhibition of the DNA repair protein Poly(ADP-ribose) polymerase 1 (PARP-1). AsIII-induced ROS lead to oxidation of cysteine residues within the PARP-1 zinc finger DNA binding domain. However, the mechanism underlying RNS-mediated PARP inhibition by arsenic remains unknown. In this work, we demonstrate that AsIII treatment of normal human keratinocyte (HEKn) cells induced S-nitrosation on cysteine residues of PARP-1 protein, in a similar manner to a nitric oxide donor. S-nitrosation of PARP-1 could be reduced by 1400W (inducible nitric oxide synthase inhibitor) or c-PTIO (a nitric oxide scavenger). Furthermore, AsIII treatment of HEKn cells leads to zinc loss and inhibition of PARP-1 enzymatic activity. AsIII and 1400W/c-PTIO co-treatment demonstrate that these effects occur in an iNOS- and NO-dependent manner. Importantly, we confirmed S-nitrosation on the zinc finger DNA binding domain of PARP-1 protein. Taken together, AsIII induces S-nitrosation on PARP-1 zinc finger DNA binding domain by generating NO through iNOS activation, leading to zinc loss and inhibition of PARP-1 activity, thereby increasing retention of damaged DNA. These findings identify S-nitrosation as an important component of the molecular mechanism underlying AsIII inhibition of DNA repair, which may benefit the development of preventive and intervention strategies against AsIII co-carcinogenesis. PMID:27741521

  9. S-nitrosation on zinc finger motif of PARP-1 as a mechanism of DNA repair inhibition by arsenite.

    PubMed

    Zhou, Xixi; Cooper, Karen L; Huestis, Juliana; Xu, Huan; Burchiel, Scott W; Hudson, Laurie G; Liu, Ke Jian

    2016-12-06

    Arsenic, a widely distributed carcinogen, is known to significantly amplify the impact of other carcinogens through inhibition of DNA repair. Our recent work suggests that reactive oxygen/nitrogen species (ROS/RNS) induced by arsenite (AsIII) play an important role in the inhibition of the DNA repair protein Poly(ADP-ribose) polymerase 1 (PARP-1). AsIII-induced ROS lead to oxidation of cysteine residues within the PARP-1 zinc finger DNA binding domain. However, the mechanism underlying RNS-mediated PARP inhibition by arsenic remains unknown. In this work, we demonstrate that AsIII treatment of normal human keratinocyte (HEKn) cells induced S-nitrosation on cysteine residues of PARP-1 protein, in a similar manner to a nitric oxide donor. S-nitrosation of PARP-1 could be reduced by 1400W (inducible nitric oxide synthase inhibitor) or c-PTIO (a nitric oxide scavenger). Furthermore, AsIII treatment of HEKn cells leads to zinc loss and inhibition of PARP-1 enzymatic activity. AsIII and 1400W/c-PTIO co-treatment demonstrate that these effects occur in an iNOS- and NO-dependent manner. Importantly, we confirmed S-nitrosation on the zinc finger DNA binding domain of PARP-1 protein. Taken together, AsIII induces S-nitrosation on PARP-1 zinc finger DNA binding domain by generating NO through iNOS activation, leading to zinc loss and inhibition of PARP-1 activity, thereby increasing retention of damaged DNA. These findings identify S-nitrosation as an important component of the molecular mechanism underlying AsIII inhibition of DNA repair, which may benefit the development of preventive and intervention strategies against AsIII co-carcinogenesis.

  10. TATA Binding Protein Discriminates between Different Lesions on DNA, Resulting in a Transcription Decrease

    PubMed Central

    Coin, Frédéric; Frit, Philippe; Viollet, Benoit; Salles, Bernard; Egly, Jean-Marc

    1998-01-01

    DNA damage recognition by basal transcription factors follows different mechanisms. Using transcription-competition, nitrocellulose filter binding, and DNase I footprinting assays, we show that, although the general transcription factor TFIIH is able to target any kind of lesion which can be repaired by the nucleotide excision repair pathway, TATA binding protein (TBP)-TFIID is more selective in damage recognition. Only genotoxic agents which are able to induce kinked DNA structures similar to the one for the TATA box in its TBP complex are recognized. Indeed, DNase I footprinting patterns reveal that TBP protects equally 4 nucleotides upstream and 6 nucleotides downstream from the A-T (at position −29 of the noncoding strand) of the adenovirus major late promoter and from the G-G of a cisplatin-induced 1,2-d(GpG) cross-link. Together, our results may partially explain differences in transcription inhibition rates following DNA damage. PMID:9632775

  11. Regulation of the yeast RAD2 gene: DNA damage-dependent induction correlates with protein binding to regulatory sequences and their deletion influences survival.

    PubMed

    Siede, W; Friedberg, E C

    1992-03-01

    In the yeast Saccharomyces cerevisiae the RAD2 gene is absolutely required for damage-specific incision of DNA during nucleotide excision repair and is inducible by DNA-damaging agents. In the present study we correlated sensitivity to killing by DNA-damaging agents with the deletion of previously defined specific promoter elements. Deletion of the element DRE2 increased the UV sensitivity of cells in both the G1/early S and S/G2 phases of the cell cycle as well as in stationary phase. On the other hand, increased UV sensitivity associated with deletion of the sequence-related element DRE1 was restricted to cells irradiated in G1/S. Specific binding of protein(s) to the promoter elements DRE1 and DRE2 was observed under non-inducing conditions using gel retardation assays. Exposure of cells to DNA-damaging agents resulted in increased protein binding that was dependent on de novo protein synthesis.

  12. Theory of nucleosome corkscrew sliding in the presence of synthetic DNA ligands.

    PubMed

    Mohammad-Rafiee, Farshid; Kulić, Igor M; Schiessel, Helmut

    2004-11-12

    Histone octamers show a heat-induced mobility along DNA. Recent theoretical studies have established two mechanisms that are qualitatively and quantitatively compatible with in vitro experiments on nucleosome sliding: octamer repositioning through one-base-pair twist defects and through ten-base-pair bulge defects. A recent experiment demonstrated that the repositioning is strongly suppressed in the presence of minor-groove binding DNA ligands. In the present study, we give a quantitative theory for nucleosome repositioning in the presence of such ligands. We show that the experimentally observed octamer mobilities are consistent with the picture of bound ligands blocking the passage of twist defects through the nucleosome. This strongly supports the model of twist defects inducing a corkscrew motion of the nucleosome as the underlying mechanism of nucleosome sliding. We provide a theoretical estimate of the nucleosomal mobility without adjustable parameters, as a function of ligand concentration, binding affinity, binding site orientation, temperature and DNA anisotropy. Having this mobility in hand, we speculate on the interaction between a nucleosome and a transcribing RNA polymerase, and suggest a novel mechanism that might account for polymerase-induced nucleosome repositioning on short DNA templates.

  13. Inhibition of Oncogenic Transcription Factor REL by the Natural Product Derivative Calafianin Monomer 101 Induces Proliferation Arrest and Apoptosis in Human B-Lymphoma Cell Lines.

    PubMed

    Yeo, Alan T; Chennamadhavuni, Spandan; Whitty, Adrian; Porco, John A; Gilmore, Thomas D

    2015-04-23

    Increased activity of transcription factor NF-κB has been implicated in many B-cell lymphomas. We investigated effects of synthetic compound calafianin monomer (CM101) on biochemical and biological properties of NF-κB. In human 293 cells, CM101 selectively inhibited DNA binding by overexpressed NF-κB subunits REL (human c-Rel) and p65 as compared to NF-κB p50, and inhibition of REL and p65 DNA binding by CM101 required a conserved cysteine residue. CM101 also inhibited DNA binding by REL in human B-lymphoma cell lines, and the sensitivity of several B-lymphoma cell lines to CM101-induced proliferation arrest and apoptosis correlated with levels of cellular and nuclear REL. CM101 treatment induced both phosphorylation and decreased expression of anti-apoptotic protein Bcl-XL, a REL target gene product, in sensitive B-lymphoma cell lines. Ectopic expression of Bcl-XL protected SUDHL-2 B-lymphoma cells against CM101-induced apoptosis, and overexpression of a transforming mutant of REL decreased the sensitivity of BJAB B-lymphoma cells to CM101-induced apoptosis. Lipopolysaccharide-induced activation of NF-κB signaling upstream components occurred in RAW264.7 macrophages at CM101 concentrations that blocked NF-κB DNA binding. Direct inhibitors of REL may be useful for treating B-cell lymphomas in which REL is active, and may inhibit B-lymphoma cell growth at doses that do not affect some immune-related responses in normal cells.

  14. Atomic Force Microscopy Studies on DNA Structural Changes Induced by Vincristine Sulfate and Aspirin

    NASA Astrophysics Data System (ADS)

    Zhu, Yi; Zeng, Hu; Xie, Jianming; Ba, Long; Gao, Xiang; Lu, Zuhong

    2004-04-01

    We report that atomic force microscopy (AFM) studies on structural variations of a linear plasmid DNA interact with various concentrations of vincristine sulfate and aspirin. The different binding images show that vincrinstine sulfate binding DNA chains caused some loops and cleavages of the DNA fragments, whereas aspirin interaction caused the width changes and conformational transition of the DNA fragments. Two different DNA structural alternations could be explained by the different mechanisms of the interactions with these two components. Our work indicates that the AFM is a powerful tool in studying the interaction between DNA and small molecules.

  15. HTLV-1 Tax Oncoprotein Subverts the Cellular DNA Damage Response via Binding to DNA-dependent Protein Kinase*S⃞

    PubMed Central

    Durkin, Sarah S.; Guo, Xin; Fryrear, Kimberly A.; Mihaylova, Valia T.; Gupta, Saurabh K.; Belgnaoui, S. Mehdi; Haoudi, Abdelali; Kupfer, Gary M.; Semmes, O. John

    2008-01-01

    Human T-cell leukemia virus type-1 is the causative agent for adult T-cell leukemia. Previous research has established that the viral oncoprotein Tax mediates the transformation process by impairing cell cycle control and cellular response to DNA damage. We showed previously that Tax sequesters huChk2 within chromatin and impairs the response to ionizing radiation. Here we demonstrate that DNA-dependent protein kinase (DNA-PK) is a member of the Tax·Chk2 nuclear complex. The catalytic subunit, DNA-PKcs, and the regulatory subunit, Ku70, were present. Tax-containing nuclear extracts showed increased DNA-PK activity, and specific inhibition of DNA-PK prevented Tax-induced activation of Chk2 kinase activity. Expression of Tax induced foci formation and phosphorylation of H2AX. However, Tax-induced constitutive signaling of the DNA-PK pathway impaired cellular response to new damage, as reflected in suppression of ionizing radiation-induced DNA-PK phosphorylation and γH2AX stabilization. Tax co-localized with phospho-DNA-PK into nuclear speckles and a nuclear excluded Tax mutant sequestered endogenous phospho-DNA-PK into the cytoplasm, suggesting that Tax interaction with DNA-PK is an initiating event. We also describe a novel interaction between DNA-PK and Chk2 that requires Tax. We propose that Tax binds to and stabilizes a protein complex with DNA-PK and Chk2, resulting in a saturation of DNA-PK-mediated damage repair response. PMID:18957425

  16. /sup 32/P-postlabeling assay in mice of transplacental DNA damage induced by the environmental carcinogens safrole, 4-aminobiphenyl, and benzo(a)pyrene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lu, L.J.; Disher, R.M.; Reddy, M.V.

    1986-06-01

    Transplacental exposure of fetuses to carcinogens is known to induce tumors in the offspring, often with a high incidence and short latency. While covalent adduction of DNA appears to be essential for tumor initiation, little is known about the binding of carcinogens to the DNA of fetal tissues. A sensitive /sup 32/P-postlabeling method enabled us to study the binding of the environmental carcinogens safrole (600 mumol/kg p.o.), 4-aminobiphenyl (800 mumol/kg), and benzo(a)pyrene (200 mumol/kg) to the DNA of various maternal and fetal tissues after administration of test carcinogens to pregnant ICR mice on day 18 of gestation. The results showmore » that these carcinogens bound to the DNA of maternal and fetal liver, lung, kidney, heart, brain, intestine, skin, maternal uterus, and placenta, with organ-specific quantitative and qualitative differences. It was possible for the first time to analyze DNA adduct patterns in minute amounts of tissue, for example those available from fetal heart. The covalent binding index 24 h after safrole treatment was estimated for the different organs and ranged from 0.1 to 247 and 0.1 to 5.8 for maternal and fetal DNA, respectively. Covalent binding index values of 0.2 to 13 and 0.1 to 0.3 for maternal and fetal DNA, respectively, were found for 4-aminobiphenyl. Benzo(a)pyrene treatment yielded covalent binding index values of 0.6 to 6.5 and 0.3 to 0.7 for maternal and fetal DNA, respectively. In both maternal and fetal tissues, safrole exhibited preferential binding to liver DNA. 4-Aminobiphenyl bound preferentially to DNA of maternal liver and kidney but showed no preference among fetal tissues. Benzo(a)pyrene exhibited weak tissue preference in both maternal and fetal organs.« less

  17. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  18. Nonspecific DNA Binding and Bending by HUαβ: Interfaces of the Three Binding Modes Characterized by Salt Dependent Thermodynamics

    PubMed Central

    Koh, Junseock; Shkel, Irina; Saecker, Ruth M.; Record, M. Thomas

    2011-01-01

    Previous ITC and FRET studies demonstrated that Escherichia coli HUαβ binds nonspecifically to duplex DNA in three different binding modes: a tighter-binding 34 bp mode which interacts with DNA in large (>34 bp) gaps between bound proteins, reversibly bending it 140° and thereby increasing its flexibility, and two weaker, modestly cooperative small-site-size modes (10 bp, 6 bp) useful for filling gaps between bound proteins shorter than 34 bp. Here we use ITC to determine the thermodynamics of these binding modes as a function of salt concentration, and deduce that DNA in the 34 bp mode is bent around but not wrapped on the body of HU, in contrast to specific binding of IHF. Analyses of binding isotherms (8, 15, 34 bp DNA) and initial binding heats (34, 38, 160 bp DNA) reveal that all three modes have similar log-log salt concentration derivatives of the binding constants (Ski) even though their binding site sizes differ greatly; most probable values of Ski on 34 bp or larger DNA are − 7.5 ± 0.5. From the similarity of Ski values, we conclude that binding interfaces of all three modes involve the same region of the arms and saddle of HU. All modes are entropy-driven, as expected for nonspecific binding driven by the polyelectrolyte effect. The bent-DNA 34 bp mode is most endothermic, presumably because of the cost of HU-induced DNA bending, while the 6 bp mode is modestly exothermic at all salt concentrations examined. Structural models consistent with the observed Ski values are proposed. PMID:21513716

  19. THAP5 is a DNA-binding transcriptional repressor that is regulated in melanoma cells during DNA damage-induced cell death

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Balakrishnan, Meenakshi P.; Cilenti, Lucia; Ambivero, Camilla

    2011-01-07

    Research highlights: {yields} THAP5 is a DNA-binding protein and a transcriptional repressor. {yields} THAP5 is induced in melanoma cells upon exposure to UV or treatment with cisplatin. {yields} THAP5 induction correlates with the degree of apoptosis in melanoma cell population. {yields} THAP5 is a pro-apoptotic protein involved in melanoma cell death. -- Abstract: THAP5 was originally isolated as a specific interactor and substrate of the mitochondrial pro-apoptotic Omi/HtrA2 protease. It is a human zinc finger protein characterized by a restricted pattern of expression and the lack of orthologs in mouse and rat. The biological function of THAP5 is unknown butmore » our previous studies suggest it could regulate G2/M transition in kidney cells and could be involved in human cardiomyocyte cell death associated with coronary artery disease (CAD). In this report, we expanded our studies on the properties and function of THAP5 in human melanoma cells. THAP5 was expressed in primary human melanocytes as well as in all melanoma cell lines that were tested. THAP5 protein level was significantly induced by UV irradiation or cisplatin treatment, conditions known to cause DNA damage. The induction of THAP5 correlated with a significant increase in apoptotic cell death. In addition, we show that THAP5 is a nuclear protein that could recognize and bind a specific DNA motif. THAP5 could also repress the transcription of a reporter gene in a heterologous system. Our work suggests that THAP5 is a DNA-binding protein and a transcriptional repressor. Furthermore, THAP5 has a pro-apoptotic function and it was induced in melanoma cells under conditions that promoted cell death.« less

  20. The adsorption-desorption transition of double-stranded DNA interacting with an oppositely charged dendrimer induced by multivalent anions.

    PubMed

    Jiang, Yangwei; Zhang, Dong; Zhang, Yaoyang; Deng, Zhenyu; Zhang, Linxi

    2014-05-28

    The adsorption-desorption transition of DNA in DNA-dendrimer solutions is observed when high-valence anions, such as hexavalent anions, are added to the DNA-dendrimer solutions. In the DNA-dendrimer solutions with low-valence anions, dendrimers bind tightly with the V-shaped double-stranded DNA. When high-valence anions, such as pentavalent or hexavalent anions, are added to the DNA-dendrimer solutions, the double-stranded DNA chains can be stretched straightly and the dendrimers are released from the double-stranded DNA chains. In fact, adding high-valence anions to the solutions can change the charge spatial distribution in the DNA-dendrimer solutions, and weaken the electrostatic interactions between the positively charged dendrimers and the oppositely charged DNA chains. Adsorption-desorption transition of DNA is induced by the overcharging of dendrimers. This investigation is capable of helping us understand how to control effectively the release of DNA in gene/drug delivery because an effective gene delivery for dendrimers includes non-covalent DNA-dendrimer binding and the effective release of DNA in gene therapy.

  1. Rhodium metalloinsertor binding generates a lesion with selective cytotoxicity for mismatch repair-deficient cells.

    PubMed

    Bailis, Julie M; Weidmann, Alyson G; Mariano, Natalie F; Barton, Jacqueline K

    2017-07-03

    The DNA mismatch repair (MMR) pathway recognizes and repairs errors in base pairing and acts to maintain genome stability. Cancers that have lost MMR function are common and comprise an important clinical subtype that is resistant to many standard of care chemotherapeutics such as cisplatin. We have identified a family of rhodium metalloinsertors that bind DNA mismatches with high specificity and are preferentially cytotoxic to MMR-deficient cells. Here, we characterize the cellular mechanism of action of the most potent and selective complex in this family, [Rh(chrysi)(phen)(PPO)] 2+ (Rh-PPO). We find that Rh-PPO binding induces a lesion that triggers the DNA damage response (DDR). DDR activation results in cell-cycle blockade and inhibition of DNA replication and transcription. Significantly, the lesion induced by Rh-PPO is not repaired in MMR-deficient cells, resulting in selective cytotoxicity. The Rh-PPO mechanism is reminiscent of DNA repair enzymes that displace mismatched bases, and is differentiated from other DNA-targeted chemotherapeutics such as cisplatin by its potency, cellular mechanism, and selectivity for MMR-deficient cells.

  2. Design, synthesis, and functional testing of recombinant cell penetrating peptides

    NASA Astrophysics Data System (ADS)

    Widyaningtyas, S. T.; Soebandrio, A.; Ibrahim, F.; Bela, B.

    2017-08-01

    Cell penetrating peptides (CPP) are one of the most attractive DNA delivery systems currently in development. In this research, in silico CPP development was performed based on a literature study to look for peptides that induce endosome escape, have the ability to bind DNA, and pass through cell membranes and/or nuclear membranes with a final goal of creating a new CPP to be used as a DNA delivery system. We report herein the successful isolation of three candidate CPP molecules, which have all been successfully expressed and purified by NiNTA. One of the determinants of CPP success as a DNA carrier is the ability of the CPP to bind and protect DNA from the effects of nucleases. The DNA binding test results show that all three CPPs can bind to DNA and protect it from the effects of serum nucleases. These three CPP candidates designed in silico and synthesized in the prokaryote system are eligible candidates for further testing of their ability to deliver DNA in vitro and in vivo.

  3. Mutation-Induced Population Shift in the MexR Conformational Ensemble Disengages DNA Binding: A Novel Mechanism for MarR Family Derepression.

    PubMed

    Anandapadamanaban, Madhanagopal; Pilstål, Robert; Andresen, Cecilia; Trewhella, Jill; Moche, Martin; Wallner, Björn; Sunnerhagen, Maria

    2016-08-02

    MexR is a repressor of the MexAB-OprM multidrug efflux pump operon of Pseudomonas aeruginosa, where DNA-binding impairing mutations lead to multidrug resistance (MDR). Surprisingly, the crystal structure of an MDR-conferring MexR mutant R21W (2.19 Å) presented here is closely similar to wild-type MexR. However, our extended analysis, by molecular dynamics and small-angle X-ray scattering, reveals that the mutation stabilizes a ground state that is deficient of DNA binding and is shared by both mutant and wild-type MexR, whereas the DNA-binding state is only transiently reached by the more flexible wild-type MexR. This population shift in the conformational ensemble is effected by mutation-induced allosteric coupling of contact networks that are independent in the wild-type protein. We propose that the MexR-R21W mutant mimics derepression by small-molecule binding to MarR proteins, and that the described allosteric model based on population shifts may also apply to other MarR family members. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. The FOXP2 forkhead domain binds to a variety of DNA sequences with different rates and affinities.

    PubMed

    Webb, Helen; Steeb, Olga; Blane, Ashleigh; Rotherham, Lia; Aron, Shaun; Machanick, Philip; Dirr, Heini; Fanucchi, Sylvia

    2017-07-01

    FOXP2 is a member of the P subfamily of FOX transcription factors, the DNA-binding domain of which is the winged helix forkhead domain (FHD). In this work we show that the FOXP2 FHD is able to bind to various DNA sequences, including a novel sequence identified in this work, with different affinities and rates as detected using surface plasmon resonance. Combining the experimental work with molecular docking, we show that high-affinity sequences remain bound to the protein for longer, form a greater number of interactions with the protein and induce a greater structural change in the protein than low-affinity sequences. We propose a binding model for the FOXP2 FHD that involves three types of binding sequence: low affinity sites which allow for rapid scanning of the genome by the protein in a partially unstructured state; moderate affinity sites which serve to locate the protein near target sites and high-affinity sites which secure the protein to the DNA and induce a conformational change necessary for functional binding and the possible initiation of downstream transcriptional events. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  5. Deciphering the groove binding modes of tau-fluvalinate and flumethrin with calf thymus DNA

    NASA Astrophysics Data System (ADS)

    Tao, Mo; Zhang, Guowen; Pan, Junhui; Xiong, Chunhong

    2016-02-01

    Tau-fluvalinate (TFL) and flumethrin (FL), widely used in agriculture and a class of synthetic pyrethroid pesticides with a similar structure, may cause a potential security risk. Herein, the modes of binding in vitro of TFL and FL with calf thymus DNA (ctDNA) were characterized by fluorescence, UV-vis absorption, circular dichroism (CD) and Fourier transform infrared (FT-IR) spectroscopy with the aid of viscosity measurements, melting analyses and molecular docking studies. The fluorescence titration indicated that both TFL and FL bound to ctDNA forming complexes through hydrogen bonding and van der Waals forces. The binding constants of TFL and FL with ctDNA were in the range of 104 L mol- 1, and FL exhibited a higher binding propensity than TFL. The iodide quenching effect, single/double-stranded DNA effects, and ctDNA melting and viscosity measurements demonstrated that the binding of both TFL and FL to ctDNA was groove mode. The FT-IR analyses suggested the A-T region of the minor groove of ctDNA as the preferential binding for TFL and FL, which was confirmed by the displacement assays with Hoechst 33258 probe, and the molecular docking visualized the specific binding. The changes in CD spectra indicated that both FL and TFL induced the perturbation on the base stacking and helicity of B-DNA, but the disturbance caused by FL was more obvious. Gel electrophoresis analyses indicated that both TFL and FL did not cause significant DNA cleavage. This study provides novel insights into the binding properties of TFL/FL with ctDNA and its toxic mechanisms.

  6. The human haptoglobin gene promoter: interleukin-6-responsive elements interact with a DNA-binding protein induced by interleukin-6.

    PubMed Central

    Oliviero, S; Cortese, R

    1989-01-01

    Transcription of the human haptoglobin (Hp) gene is induced by interleukin-6 (IL-6) in the human hepatoma cell line Hep3B. Cis-acting elements responsible for this response are localized within the first 186 bp of the 5'-flanking region. Site-specific mutants of the Hp promoter fused to the chloramphenicol acetyl transferase (CAT) gene were analysed by transient transfection into uninduced and IL-6-treated Hep3B cells. We identified three regions, A, B and C, defined by mutation, which are important for the IL-6 response. Band shift experiments using nuclear extracts from untreated or IL-6-treated cells revealed the presence of IL-6-inducible DNA binding activities when DNA fragments containing the A or the C sequences were used. Competition experiments showed that both sequences bind to the same nuclear factors. Polymers of oligonucleotides containing either the A or the C regions confer IL-6 responsiveness to a truncated SV40 promoter. The B region forms several complexes with specific DNA-binding proteins different from those which bind to the A and C region. The B region complexes are identical in nuclear extracts from IL-6-treated and untreated cells. While important for IL-6 induction in the context of the haptoglobin promoter, the B site does not confer IL-6 inducibility to the SV40 promoter. Our results indicate that the IL-6 response of the haptoglobin promoter is dependent on the presence of multiple, partly redundant, cis-acting elements. Images PMID:2787245

  7. Acrolein preferentially damages nucleolus eliciting ribosomal stress and apoptosis in human cancer cells.

    PubMed

    Wang, Hsiang-Tsui; Chen, Tzu-Ying; Weng, Ching-Wen; Yang, Chun-Hsiang; Tang, Moon-Shong

    2016-12-06

    Acrolein (Acr) is a potent cytotoxic and DNA damaging agent which is ubiquitous in the environment and abundant in tobacco smoke. Acr is also an active cytotoxic metabolite of the anti-cancer drugs cyclophosphamide and ifosfamide. The mechanisms via which Acr exerts its anti-cancer activity and cytotoxicity are not clear. In this study, we found that Acr induces cytotoxicity and cell death in human cancer cells with different activities of p53. Acr preferentially binds nucleolar ribosomal DNA (rDNA) to form Acr-deoxyguanosine adducts, and induces oxidative damage to both rDNA and ribosomal RNA (rRNA). Acr triggers ribosomal stress responses, inhibits rRNA synthesis, reduces RNA polymerase I binding to the promoter of rRNA gene, disrupts nucleolar integrity, and impairs ribosome biogenesis and polysome formation. Acr causes an increase in MDM2 levels and phosphorylation of MDM2 in A549 and HeLa cells which are p53 active and p53 inactive, respectively. It enhances the binding of ribosomal protein RPL11 to MDM2 and reduces the binding of p53 and E2F-1 to MDM2 resulting in stabilization/activation of p53 in A549 cells and degradation of E2F-1 in A549 and HeLa cells. We propose that Acr induces ribosomal stress which leads to activation of MDM2 and RPL11-MDM2 binding, consequently, activates p53 and enhances E2F-1 degradation, and that taken together these two processes induce apoptosis and cell death.

  8. Histone-like DNA binding protein of Streptococcus intermedius induces the expression of pro-inflammatory cytokines in human monocytes via activation of ERK1/2 and JNK pathways.

    PubMed

    Liu, Dali; Yumoto, Hiromichi; Hirota, Katsuhiko; Murakami, Keiji; Takahashi, Kanako; Hirao, Kouji; Matsuo, Takashi; Ohkura, Kazuto; Nagamune, Hideaki; Miyake, Yoichiro

    2008-01-01

    Streptococcus intermedius is a commensal associated with serious, deep-seated purulent infections in major organs, such as the brain and liver. Histone-like DNA binding protein (HLP) is an accessory architectural protein in a variety of bacterial cellular processes. In this study, we investigated the mechanisms of pro-inflammatory cytokine inductions in THP-1 cells by stimulation with recombinant HLP of S. intermedius (rSi-HLP). rSi-HLP stimulation-induced production of pro-inflammatory cytokines (IL-8, IL-1 beta and TNF-alpha) occurred in a time- and dose-dependent manner. In contrast with the heat-stable activity of DNA binding, the induction activity of rSi-HLP was heat-unstable. In subsequent studies, rSi-HLP acted cooperatively with lipoteichoic acid, the synthetic Toll-like receptor 2 agonist, Pam3CSK4, and the cytosolic nucleotide binding oligomerization domain 2 receptor agonist, muramyldipeptide. Furthermore, Western blot and blocking assays with specific inhibitors showed that rSi-HLP stimulation induced the activation of cell signal transduction pathways, extracellular signal-regulated kinase 1/2 (ERK1/2) and c-Jun N-terminal kinase (JNK). In addition to its physiological role in bacterial growth through DNA binding, these results indicate that Si-HLP can trigger a cascade of events that induce pro-inflammatory responses via ERK1/2 and JNK signal pathways, and suggest that bacterial HLP may contribute to the activation of host innate immunity during bacterial infection.

  9. Mitochondrial telomerase reverse transcriptase binds to and protects mitochondrial DNA and function from damage.

    PubMed

    Haendeler, Judith; Dröse, Stefan; Büchner, Nicole; Jakob, Sascha; Altschmied, Joachim; Goy, Christine; Spyridopoulos, Ioakim; Zeiher, Andreas M; Brandt, Ulrich; Dimmeler, Stefanie

    2009-06-01

    The enzyme telomerase and its catalytic subunit the telomerase reverse transcriptase (TERT) are important for maintenance of telomere length in the nucleus. Recent studies provided evidence for a mitochondrial localization of TERT. Therefore, we investigated the exact localization of TERT within the mitochondria and its function. Here, we demonstrate that TERT is localized in the matrix of the mitochondria. TERT binds to mitochondrial DNA at the coding regions for ND1 and ND2. Binding of TERT to mitochondrial DNA protects against ethidium bromide-induced damage. TERT increases overall respiratory chain activity, which is most pronounced at complex I and dependent on the reverse transcriptase activity of the enzyme. Moreover, mitochondrial reactive oxygen species are increased after genetic ablation of TERT by shRNA. Mitochondrially targeted TERT and not wild-type TERT revealed the most prominent protective effect on H(2)O(2)-induced apoptosis. Lung fibroblasts from 6-month-old TERT(-/-) mice (F2 generation) showed increased sensitivity toward UVB radiation and heart mitochondria exhibited significantly reduced respiratory chain activity already under basal conditions, demonstrating the protective function of TERT in vivo. Mitochondrial TERT exerts a novel protective function by binding to mitochondrial DNA, increasing respiratory chain activity and protecting against oxidative stress-induced damage.

  10. DNA sequences, recombinant DNA molecules and processes for producing the A and B subunits of cholera toxin and preparations containing so-obtained subunit or subunits

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Harford, N.; De Wilde, M.

    1987-05-19

    A recombinant DNA molecule is described comprising at least a portion coding for subunits A and B of cholera toxin, or a fragment or derivative of the portion wherein the fragment or derivative codes for a polypeptide have an activity which can induce an immune response to subunit A; can induce an immune response to subunit A and cause epithelial cell penetration and the enzymatic effect leading to net loss of fluid into the gut lumen; can bind to the membrane receptor for the B subunit of cholera toxin; can induce an immune response to subunit B; can induce anmore » immune response to subunit B and bind to the membrane receptor; or has a combination of the activities.« less

  11. Pyruvate kinase M2 interacts with DNA damage-binding protein 2 and reduces cell survival upon UV irradiation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xie, Xiao; Wang, Mingsong; Mei, Ju, E-mail: jumei_xinhua@163.com

    Pyruvate Kinase M2 (PKM2) is highly expressed in many solid tumors and associated with metabolism reprogramming and proliferation of tumors. Here, we report that PKM2 can bind to DNA Damage-Binding Protein 2 (DDB2), which is necessary for global nucleotide excision repair of UV induced DNA damage. The binding is promoted by UV irradiation and K433 acetylation of PKM2. Over expression of PKM2 facilitates phosphorylation of DDB2 and impairs DDB2-DDB1 binding. Furthermore, knocking down of PKM2 increases cell survival upon UV irradiation, while over expression of PKM2 reduces cell survival and over expression of DDB2-DDB1 reverts this effect. These results revealmore » a previously unknown regulation of PKM2 on DDB2 and provide a possible mechanism for UV induced tumorigenesis. - Highlights: • PKM2 interacts with DDB2. • UV irradiation increases PKM2-DDB2 binding via up regulation of PKM2 K433 acetylation. • PKM2 facilitates DDB2 phosphorylation and impairs DDB2-DDB1 binding. • PKM2 reduces cell survival upon UV irradiation.« less

  12. On the connection between inherent DNA flexure and preferred binding of hydroxymethyluracil-containing DNA by the type II DNA-binding protein TF1.

    PubMed

    Grove, A; Galeone, A; Mayol, L; Geiduschek, E P

    1996-07-12

    TF1 is a member of the family of type II DNA-binding proteins, which also includes the bacterial HU proteins and the Escherichia coli integration host factor (IHF). Distinctive to TF1, which is encoded by the Bacillus subtilis bacteriophage SPO1, is its preferential binding to DNA in which thymine is replaced by 5-hydroxymethyluracil (hmU), as it is in the phage genome. TF1 binds to preferred sites within the phage genome and generates pronounced DNA bending. The extent to which DNA flexibility contributes to the sequence-specific binding of TF1, and the connection between hmU preference and DNA flexibility has been examined. Model flexible sites, consisting of consecutive mismatches, increase the affinity of thymine-containing DNA for TF1. In particular, tandem mismatches separated by nine base-pairs generate an increase, by orders of magnitude, in the affinity of TF1 for T-containing DNA with the sequence of a preferred TF1 binding site, and fully match the affinity of TF1 for this cognate site in hmU-containing DNA (Kd approximately 3 nM). Other placements of loops generate suboptimal binding. This is consistent with a significant contribution of site-specific DNA flexibility to complex formation. Analysis of complexes with hmU-DNA of decreasing length shows that a major part of the binding affinity is generated within a central 19 bp segment (delta G0 = 41.7 kJ mol-1) with more-distal DNA contributing modestly to the affinity (delta delta G = -0.42 kJ mol-1 bp-1 on increasing duplex length to 37 bp). However, a previously characterised thermostable and more tightly binding mutant TF1, TF1(E15G/T32I), derives most of its extra affinity from interaction with flanking DNA. We propose that inherent but sequence-dependent deformability of hmU-containing DNA underlies the preferential binding of TF1 and that TF1-induced DNA bendings is a result of distortions at two distinct sites separated by 9 bp of duplex DNA.

  13. Arsenite-induced ROS/RNS generation causes zinc loss and inhibits the activity of poly(ADP-ribose) polymerase-1.

    PubMed

    Wang, Feng; Zhou, Xixi; Liu, Wenlan; Sun, Xi; Chen, Chen; Hudson, Laurie G; Jian Liu, Ke

    2013-08-01

    Arsenic enhances the genotoxicity of other carcinogenic agents such as ultraviolet radiation and benzo[a]pyrene. Recent reports suggest that inhibition of DNA repair is an important aspect of arsenic cocarcinogenesis, and DNA repair proteins such as poly(ADP ribose) polymerase (PARP)-1 are direct molecular targets of arsenic. Although arsenic has been shown to generate reactive oxygen/nitrogen species (ROS/RNS), little is known about the role of arsenic-induced ROS/RNS in the mechanism underlying arsenic inhibition of DNA repair. We report herein that arsenite-generated ROS/RNS inhibits PARP-1 activity in cells. Cellular exposure to arsenite, as well as hydrogen peroxide and NONOate (nitric oxide donor), decreased PARP-1 zinc content, enzymatic activity, and PARP-1 DNA binding. Furthermore, the effects of arsenite on PARP-1 activity, DNA binding, and zinc content were partially reversed by the antioxidant ascorbic acid, catalase, and the NOS inhibitor, aminoguanidine. Most importantly, arsenite incubation with purified PARP-1 protein in vitro did not alter PARP-1 activity or DNA-binding ability, whereas hydrogen peroxide or NONOate retained PARP-1 inhibitory activity. These results strongly suggest that cellular generation of ROS/RNS plays an important role in arsenite inhibition of PARP-1 activity, leading to the loss of PARP-1 DNA-binding ability and enzymatic activity. Copyright © 2013 Elsevier Inc. All rights reserved.

  14. Non-covalent Interactions with SUMO and Ubiquitin Orchestrate Distinct Functions of the SLX4 Complex in Genome Maintenance

    PubMed Central

    Ouyang, Jian; Garner, Elizabeth; Hallet, Alexander; Nguyen, Hai Dang; Rickman, Kimberly A.; Gill, Grace; Smogorzewska, Agata; Zou, Lee

    2014-01-01

    SLX4, a coordinator of multiple DNA structure-specific endonucleases, is important for several DNA repair pathways. Non-covalent interactions of SLX4 with ubiquitin are required for localizing SLX4 to DNA-interstrand crosslinks (ICLs), yet how SLX4 is targeted to other functional contexts remains unclear. Here, we show that SLX4 binds SUMO-2/3 chains via SUMO-interacting motifs (SIMs). The SIMs of SLX4 are dispensable for ICL repair, but important for processing CPT-induced replication intermediates, suppressing fragile site instability, and localizing SLX4 to ALT telomeres. The localization of SLX4 to laser-induced DNA damage also requires the SIMs, as well as DNA-end resection, UBC9 and MDC1. Furthermore, the SUMO binding of SLX4 enhances its interaction with specific DNA-damage sensors or telomere-binding proteins, including RPA, MRE11-RAD50-NBS1 and TRF2. Thus, the interactions of SLX4 with SUMO and ubiquitin increase its affinity for factors recognizing different DNA lesions or telomeres, helping to direct the SLX4 complex in distinct functional contexts. PMID:25533185

  15. Direct measurement of torque and twist generated by a dye binding to DNA

    NASA Astrophysics Data System (ADS)

    Gore, Jeff; Bryant, Zev; Bustamante, Carlos

    2004-03-01

    Many biologically important chemicals and proteins change the twist of DNA upon binding. We have used magnetic tweezers to directly measure the torque and twist generated when ethidium bromide binds and unbinds to DNA. One end of the DNA is bound specifically to a glass coverslip and the opposite end is held away from the surface by a paramagnetic bead. Attached to the middle of the DNA is a second fluorescent bead whose position can be tracked with high angular and temporal resolution. On one side of the fluorescent bead binding site we have engineered a single strand nick that acts like a free swivel. Addition of ethidium bromide then powered rotation of the central fluorescent bead. After the ethidium bromide was bound we used magnesium to compete out the intercalated ethidium bromide, thus inducing a rotation in the opposite direction. We studied the torque generation, energetics, and kinetics associated with ethidium bromide binding and unbinding by tracking the rotation of the fluorescent bead. This system is a demonstration of a reversible chemically powered DNA-based rotary motor. We also expect that this technique will be useful in studying proteins that bind to or rotate DNA, including recA, polymerases, and topoisomerases.

  16. DIRECT BINDING OF GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE TO TELOMERIC DNA PROTECTS TELOMERES AGAINST CHEMOTHERAPY-INDUCED RAPID DEGRADATION

    PubMed Central

    Demarse, Neil A.; Ponnusamy, Suriyan; Spicer, Eleanor K.; Apohan, Elif; Baatz, John E.; Ogretmen, Besim; Davies, Christopher

    2009-01-01

    GAPDH (glyceraldehyde 3-phosphate dehydrogenase) is a glycolytic enzyme that displays several non-glycolytic activities, including the maintenance and/or protection of telomeres. In this study, we determined the molecular mechanism and biological role of the interaction between GAPDH and human telomeric DNA. Using gel shift assays, we show that recombinant GAPDH binds directly with high affinity (Kd = 45 nM) to a single-stranded oligonucleotide comprising three telomeric DNA repeats and that nucleotides T1, G5 and G6 of the TTAGGG repeat are essential for binding. The stoichiometry of the interaction is 2:1 (DNA: GAPDH), and GAPDH appears to form a high-molecular weight complex when bound to the oligonucleotide. Mutation of Asp32 and Cys149, which are localized to the NAD-binding site and the active site center of GAPDH, respectively, produced mutants that almost completely lost their telomere-binding functions both in vitro and in situ (in A549 human lung cancer cells). Treatment of A549 cells with the chemotherapeutic agents gemcitabine and doxorubicin resulted in increased nuclear localization of expressed wild-type GAPDH, where it protected telomeres against rapid degradation, concomitant with increased resistance to the growth inhibitory effects of these drugs. The non-DNA-binding mutants of GAPDH also localized to the nucleus when expressed in A549 cells, but did not confer any significant protection of telomeres against chemotherapy-induced degradation or growth inhibition, and this occurred without the involvement of caspase activation or apoptosis regulation. Overall, these data demonstrate that GAPDH binds telomeric DNA directly in vitro and may have a biological role in the protection of telomeres against rapid degradation in response to chemotherapeutic agents in A549 human lung cancer cells. PMID:19800890

  17. Metal Ion Binding at the Catalytic Site Induces Widely Distributed Changes in a Sequence Specific Protein–DNA Complex

    PubMed Central

    2016-01-01

    Metal ion cofactors can alter the energetics and specificity of sequence specific protein–DNA interactions, but it is unknown if the underlying effects on structure and dynamics are local or dispersed throughout the protein–DNA complex. This work uses EcoRV endonuclease as a model, and catalytically inactive lanthanide ions, which replace the Mg2+ cofactor. Nuclear magnetic resonance (NMR) titrations indicate that four Lu3+ or two La3+ cations bind, and two new crystal structures confirm that Lu3+ binding is confined to the active sites. NMR spectra show that the metal-free EcoRV complex with cognate (GATATC) DNA is structurally distinct from the nonspecific complex, and that metal ion binding sites are not assembled in the nonspecific complex. NMR chemical shift perturbations were determined for 1H–15N amide resonances, for 1H–13C Ile-δ-CH3 resonances, and for stereospecifically assigned Leu-δ-CH3 and Val-γ-CH3 resonances. Many chemical shifts throughout the cognate complex are unperturbed, so metal binding does not induce major conformational changes. However, some large perturbations of amide and side chain methyl resonances occur as far as 34 Å from the metal ions. Concerted changes in specific residues imply that local effects of metal binding are propagated via a β-sheet and an α-helix. Both amide and methyl resonance perturbations indicate changes in the interface between subunits of the EcoRV homodimer. Bound metal ions also affect amide hydrogen exchange rates for distant residues, including a distant subdomain that contacts DNA phosphates and promotes DNA bending, showing that metal ions in the active sites, which relieve electrostatic repulsion between protein and DNA, cause changes in slow dynamics throughout the complex. PMID:27786446

  18. T7 RNA polymerase non-specifically transcribes and induces disassembly of DNA nanostructures

    PubMed Central

    Schaffter, Samuel W; Green, Leopold N; Schneider, Joanna; Subramanian, Hari K K; Schulman, Rebecca

    2018-01-01

    Abstract The use of proteins that bind and catalyze reactions with DNA alongside DNA nanostructures has broadened the functionality of DNA devices. DNA binding proteins have been used to specifically pattern and tune structural properties of DNA nanostructures and polymerases have been employed to directly and indirectly drive structural changes in DNA structures and devices. Despite these advances, undesired and poorly understood interactions between DNA nanostructures and proteins that bind DNA continue to negatively affect the performance and stability of DNA devices used in conjunction with enzymes. A better understanding of these undesired interactions will enable the construction of robust DNA nanostructure-enzyme hybrid systems. Here, we investigate the undesired disassembly of DNA nanotubes in the presence of viral RNA polymerases (RNAPs) under conditions used for in vitro transcription. We show that nanotubes and individual nanotube monomers (tiles) are non-specifically transcribed by T7 RNAP, and that RNA transcripts produced during non-specific transcription disassemble the nanotubes. Disassembly requires a single-stranded overhang on the nanotube tiles where transcripts can bind and initiate disassembly through strand displacement, suggesting that single-stranded domains on other DNA nanostructures could cause unexpected interactions in the presence of viral RNA polymerases. PMID:29718412

  19. T7 RNA polymerase non-specifically transcribes and induces disassembly of DNA nanostructures.

    PubMed

    Schaffter, Samuel W; Green, Leopold N; Schneider, Joanna; Subramanian, Hari K K; Schulman, Rebecca; Franco, Elisa

    2018-06-01

    The use of proteins that bind and catalyze reactions with DNA alongside DNA nanostructures has broadened the functionality of DNA devices. DNA binding proteins have been used to specifically pattern and tune structural properties of DNA nanostructures and polymerases have been employed to directly and indirectly drive structural changes in DNA structures and devices. Despite these advances, undesired and poorly understood interactions between DNA nanostructures and proteins that bind DNA continue to negatively affect the performance and stability of DNA devices used in conjunction with enzymes. A better understanding of these undesired interactions will enable the construction of robust DNA nanostructure-enzyme hybrid systems. Here, we investigate the undesired disassembly of DNA nanotubes in the presence of viral RNA polymerases (RNAPs) under conditions used for in vitro transcription. We show that nanotubes and individual nanotube monomers (tiles) are non-specifically transcribed by T7 RNAP, and that RNA transcripts produced during non-specific transcription disassemble the nanotubes. Disassembly requires a single-stranded overhang on the nanotube tiles where transcripts can bind and initiate disassembly through strand displacement, suggesting that single-stranded domains on other DNA nanostructures could cause unexpected interactions in the presence of viral RNA polymerases.

  20. Experimental and molecular docking studies on DNA binding interaction of adefovir dipivoxil: Advances toward treatment of hepatitis B virus infections

    NASA Astrophysics Data System (ADS)

    Shahabadi, Nahid; Falsafi, Monireh

    The toxic interaction of adefovir dipivoxil with calf thymus DNA (CT-DNA) was investigated in vitro under simulated physiological conditions by multi-spectroscopic techniques and molecular modeling study. The fluorescence spectroscopy and UV absorption spectroscopy indicated drug interacted with CT-DNA in a groove binding mode. The binding constant of UV-visible and the number of binding sites were 3.33 ± 0.2 × 104 L mol-1and 0.99, respectively. The fluorimetric studies showed that the reaction between the drug and CT-DNA is exothermic (ΔH = 34.4 kJ mol-1; ΔS = 184.32 J mol-1 K-1). Circular dichroism spectroscopy (CD) was employed to measure the conformational change of CT-DNA in the presence of adefovir dipivoxil, which verified the groove binding mode. Furthermore, the drug induces detectable changes in its viscosity. The molecular modeling results illustrated that adefovir strongly binds to groove of DNA by relative binding energy of docked structure -16.83 kJ mol-1. This combination of multiple spectroscopic techniques and molecular modeling methods can be widely used in the investigation on the toxic interaction of small molecular pollutants and drugs with bio macromolecules, which contributes to clarify the molecular mechanism of toxicity or side effect in vivo.

  1. Membrane Destruction and DNA Binding of Staphylococcus aureus Cells Induced by Carvacrol and Its Combined Effect with a Pulsed Electric Field.

    PubMed

    Wang, Lang-Hong; Wang, Man-Sheng; Zeng, Xin-An; Zhang, Zhi-Hong; Gong, De-Ming; Huang, Yan-Bo

    2016-08-17

    Carvacrol (5-isopropyl-2-methylphenol, CAR) is an antibacterial ingredient that occurs naturally in the leaves of the plant Origanum vulgare. The antimicrobial mechanism of CAR against Staphylococcus aureus ATCC 43300 was investigated in the study. Analysis of the membrane fatty acids by gas chromatography-mass spectrometry (GC-MS) showed that exposure to CAR at low concentrations induced a marked increase in the level of unbranched fatty acids (from 34.90 ± 1.77% to 62.37 ± 4.26%). Moreover, CAR at higher levels severely damaged the integrity and morphologies of the S. aureus cell membrane. The DNA-binding properties of CAR were also investigated using fluorescence, circular dichroism, molecular modeling, and atomic-force microscopy. The results showed that CAR bound to DNA via the minor-groove mode, mildly perturbed the DNA secondary structure, and induced DNA molecules to be aggregated. Furthermore, a combination of CAR with a pulsed-electric field was found to exhibit strong synergistic effects on S. aureus.

  2. STAT3 and importins are novel mediators of early molecular and cellular responses in experimental duodenal ulceration.

    PubMed

    Khomenko, Tetyana; Deng, Xiaoming; Ahluwalia, Amrita; Tarnawski, Andrzej; Patel, Khushin N; Sandor, Zsuzsanna; Szabo, Sandor

    2014-02-01

    Signal transducer and activator of transcription 3 (STAT3) is a transcription factor that directly upregulates VEGF, Ref-1, p21, and anti-apoptotic genes such as Bcl-xL. In this study, we hypothesized that STAT3 signaling is activated and provides a critical protective role that is required for enterocyte survival during the early phases of cysteamine-induced duodenal ulcers. We studied the effect of inhibition of STAT3 activity on cysteamine-induced duodenal ulcers in rats and egr-1 knockout mice using STAT3/DNA binding assay, immunohistochemistry, immunoblot, and quantitative reverse transcriptase PCR analyses. We found that G-quartet oligodeoxynucleotides T40214, a specific inhibitor of STAT3/DNA binding, aggravated cysteamine-induced duodenal ulcers in rats 2.8-fold (p < 0.05). In the pre-ulcerogenic stage, cysteamine induced STAT3 tyrosine phosphorylation, its translocation to nuclei, an increased expression and nuclear translocation of importin α and β in the rat duodenal mucosa. Cysteamine enhanced the binding of STAT3 to its DNA consensus sequences at 6, 12, and 24 h after cysteamine by 1.5-, 1.8-, and 3.5-fold, respectively, and activated the expression of STAT3 target genes such as VEGF, Bcl-xL, Ref-1, and STAT3-induced feedback inhibitor, a suppressor of cytokine signaling 3. We also demonstrated that egr-1 knockout mice, which are more susceptible to cysteamine-induced duodenal ulcers, had lower levels of STAT3 expression, its phosphorylation, expression of importin α or β, and STAT3/DNA binding than wild-type mice in response to cysteamine. Thus, STAT3 represents an important new molecular mechanism in experimental duodenal ulceration.

  3. Characterization of the interaction of yeast enolase with polynucleotides.

    PubMed

    al-Giery, A G; Brewer, J M

    1992-09-23

    Yeast enolase is inhibited under certain conditions by DNA. The enzyme binds to single-stranded DNA-cellulose. Inhibition was used for routine characterization of the interaction. The presence of the substrate 2-phospho-D-glycerate reduces inhibition and binding. Both yeast enolase isozymes behave similarly. Impure yeast enolase was purified by adsorption onto a single-stranded DNA-cellulose column followed by elution with substrate. Interaction with RNA, double-stranded DNA, or degraded DNA results in less inhibition, suggesting that yeast enolase preferentially binds single-stranded DNA. However, yeast enolase is not a DNA-unwinding protein. The enzyme is inhibited by the short synthetic oligodeoxynucleotides G6, G8 and G10 but not T8 or T6, suggesting some base specificity in the interaction. The interaction is stronger at more acid pH values, with an apparent pK of 5.6. The interaction is prevented by 0.3 M KCl, suggesting that electrostatic factors are important. Histidine or lysine reverse the inhibition at lower concentrations, while phosphate is still more effective. Binding of single-stranded DNA to enolase reduces the reaction of protein histidyl residues with diethylpyrocarbonate. The inhibition of yeast enolase by single-stranded DNA is not total, and suggests the active site is not directly involved in the interaction. Binding of substrate may induce a conformational change in the enzyme that interferes with DNA binding and vice versa.

  4. IFI16 Preferentially Binds to DNA with Quadruplex Structure and Enhances DNA Quadruplex Formation.

    PubMed

    Hároníková, Lucia; Coufal, Jan; Kejnovská, Iva; Jagelská, Eva B; Fojta, Miroslav; Dvořáková, Petra; Muller, Petr; Vojtesek, Borivoj; Brázda, Václav

    2016-01-01

    Interferon-inducible protein 16 (IFI16) is a member of the HIN-200 protein family, containing two HIN domains and one PYRIN domain. IFI16 acts as a sensor of viral and bacterial DNA and is important for innate immune responses. IFI16 binds DNA and binding has been described to be DNA length-dependent, but a preference for supercoiled DNA has also been demonstrated. Here we report a specific preference of IFI16 for binding to quadruplex DNA compared to other DNA structures. IFI16 binds to quadruplex DNA with significantly higher affinity than to the same sequence in double stranded DNA. By circular dichroism (CD) spectroscopy we also demonstrated the ability of IFI16 to stabilize quadruplex structures with quadruplex-forming oligonucleotides derived from human telomere (HTEL) sequences and the MYC promotor. A novel H/D exchange mass spectrometry approach was developed to assess protein interactions with quadruplex DNA. Quadruplex DNA changed the IFI16 deuteration profile in parts of the PYRIN domain (aa 0-80) and in structurally identical parts of both HIN domains (aa 271-302 and aa 586-617) compared to single stranded or double stranded DNAs, supporting the preferential affinity of IFI16 for structured DNA. Our results reveal the importance of quadruplex DNA structure in IFI16 binding and improve our understanding of how IFI16 senses DNA. IFI16 selectivity for quadruplex structure provides a mechanistic framework for IFI16 in immunity and cellular processes including DNA damage responses and cell proliferation.

  5. Localized frustration and binding-induced conformational change in recognition of 5S RNA by TFIIIA zinc finger.

    PubMed

    Tan, Cheng; Li, Wenfei; Wang, Wei

    2013-12-19

    Protein TFIIIA is composed of nine tandemly arranged Cys2His2 zinc fingers. It can bind either to the 5S RNA gene as a transcription factor or to the 5S RNA transcript as a chaperone. Although structural and biochemical data provided valuable information on the recognition between the TFIIIIA and the 5S DNA/RNA, the involved conformational motions and energetic factors contributing to the binding affinity and specificity remain unclear. In this work, we conducted MD simulations and MM/GBSA calculations to investigate the binding-induced conformational changes in the recognition of the 5S RNA by the central three zinc fingers of TFIIIA and the energetic factors that influence the binding affinity and specificity at an atomistic level. Our results revealed drastic interdomain conformational changes between these three zinc fingers, involving the exposure/burial of several crucial DNA/RNA binding residues, which can be related to the competition between DNA and RNA for the binding of TFIIIA. We also showed that the specific recognition between finger 4/finger 6 and the 5S RNA introduces frustrations to the nonspecific interactions between finger 5 and the 5S RNA, which may be important to achieve optimal binding affinity and specificity.

  6. NFκB- and AP-1-mediated DNA looping regulates matrix metalloproteinase-9 transcription in TNF-α-treated human leukemia U937 cells.

    PubMed

    Chen, Ying-Jung; Chang, Long-Sen

    2015-10-01

    The aim of this study is to explore the spatial association of critical genomic elements in the effect of TNF-α on matrix metalloproteinase-9 (MMP-9) expression in human leukemia U937 cells. TNF-α up-regulated MMP-9 protein expression and mRNA level in U937 cells, and Akt-mediated-NFκB/p65 activation and JNK-mediated c-Jun activation were proven to be involved in TNF-α-induced MMP-9 up-regulation. Promoter luciferase activity assay revealed that NFκB (nt-600) and AP-1 (nt-79) binding sites were crucial for TNF-α-induced transcription of MMP-9 gene. The results of a chromatin immunoprecipitation assay indicated that TNF-α reduced histone deacetylase-1 (HDAC-1) recruitment but increased p300 (a histone acetyltransferase) recruitment to MMP-9 promoter regions surrounding NFκB and AP-1 binding sites. Consistently, TNF-α increased enrichment of the acetylated histone H3 mark on MMP-9 promoter regions. DNA affinity purification assay revealed that p300 and HDAC1 could bind oligonucleotides containing AP-1/c-Jun and NFκB/p65 binding sites. Chromosome conformation capture assay showed that TNF-α stimulated chromosomal loops in the MMP-9 promoter via NFκB/p65 and AP-1/c-Jun. The p300-associated acetyltransferase activity was crucial for p65/c-Jun-mediated DNA looping, and inhibition of HDAC activity increased the level of DNA looping. Reduction in the level of DNA looping eliminated all TNF-α-stimulated MMP-9 up-regulation. Taken together, our data suggest that p65/c-Jun-mediated DNA looping is involved in TNF-α-induced MMP-9 up-regulation and that the recruitment of p300 or HDAC1 to NFκB and AP-1 binding sites modifies the level of DNA looping. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. A potent transrepression domain in the retinoblastoma protein induces a cell cycle arrest when bound to E2F sites.

    PubMed Central

    Sellers, W R; Rodgers, J W; Kaelin, W G

    1995-01-01

    An intact T/E1A-binding domain (the pocket) is necessary, but not sufficient, for the retinoblastoma protein (RB) to bind to DNA-protein complexes containing E2F and for RB to induce a G1/S block. Indirect evidence suggests that the binding of RB to E2F may, in addition to inhibiting E2F transactivation function, generate a complex capable of functioning as a transrepressor. Here we show that a chimera in which the E2F1 transactivation domain was replaced with the RB pocket could, in a DNA-binding and pocket-dependent manner, mimic the ability of RB to repress transcription and induce a cell cycle arrest. In contrast, a transdominant negative E2F1 mutant that is capable of blocking E2F-dependent transactivation did not. Fusion of the RB pocket to a heterologous DNA-binding domain unrelated to E2F likewise generated a transrepressor protein when scored against a suitable reporter. These results suggest that growth suppression by RB is due, at least in part, to transrepression mediated by the pocket domain bound to certain promoters via E2F. Images Fig. 4 Fig. 5 PMID:8524800

  8. DNA conformational change induced by the bacteriophage phi 29 connector.

    PubMed Central

    Valpuesta, J M; Serrano, M; Donate, L E; Herranz, L; Carrascosa, J L

    1992-01-01

    Translocation of viral DNA inwards and outwards of the capsid of double-stranded DNA bacteriophages occurs through the connector, a key viral structure that is known to interact with DNA. It is shown here that phage phi 29 connector binds both linear and circular double-stranded DNA. However, DNA-mediated protection of phi 29 connectors against Staphylococcus aureus endoprotease V8 digestion suggests that binding to linear DNA is more stable than to circular DNA. Endoprotease V8-protection assays also suggest that the length of the linear DNA required to produce a stable phi 29 connector-DNA interaction is, at least, twice longer than the phi 29 connector channel. This result is confirmed by experiments of phi 29 connector-protection of DNA against DNase I digestion. Furthermore, DNA circularization assays indicate that phi 29 connectors restrain negative supercoiling when bound to linear DNA. This DNA conformational change is not observed upon binding to circular DNA and it could reflect the existence of some left-handed DNA coiling or DNA untwisting inside of the phi 29 connector channel. Images PMID:1454519

  9. On binding specificity of (6-4) photolyase to a T(6-4)T DNA photoproduct*

    NASA Astrophysics Data System (ADS)

    Jepsen, Katrine Aalbæk; Solov'yov, Ilia A.

    2017-06-01

    Different factors lead to DNA damage and if it is not repaired in due time, the damaged DNA could initiate mutagenesis and cancer. To avoid this deadly scenario, specific enzymes can scavenge and repair the DNA, but the enzymes have to bind first to the damaged sites. We have investigated this binding for a specific enzyme called (6-4) photolyase, which is capable of repairing certain UV-induced damage in DNA. Through molecular dynamics simulations we describe the binding between photolyase and the DNA and reveal that several charged amino acid residues in the enzyme, such as arginines and lysines turn out to be important. Especially R421 is crucial, as it keeps the DNA strands at the damaged site inside the repair pocket of the enzyme separated. DNA photolyase is structurally highly homologous to a protein called cryptochrome. Both proteins are biologically activated similarly, namely through flavin co-factor photoexcitation. It is, however, striking that cryptochrome cannot repair UV-damaged DNA. The present investigation allowed us to conclude on the small but, apparently, critical differences between photolyase and cryptochrome. The performed analysis gives insight into important factors that govern the binding of UV-damaged DNA and reveal why cryptochrome cannot have this functionality.

  10. Identification of a factor in HeLa cells specific for an upstream transcriptional control sequence of an EIA-inducible adenovirus promoter and its relative abundance in infected and uninfected cells.

    PubMed Central

    SivaRaman, L; Subramanian, S; Thimmappaya, B

    1986-01-01

    Utilizing the gel electrophoresis/DNA binding assay, a factor specific for the upstream transcriptional control sequence of the EIA-inducible adenovirus EIIA-early promoter has been detected in HeLa cell nuclear extract. Analysis of linker-scanning mutants of the promoter by DNA binding assays and methylation-interference experiments show that the factor binds to the 17-nucleotide sequence 5' TGGAGATGACGTAGTTT 3' located between positions -66 and -82 upstream from the cap site. This sequence has been shown to be essential for transcription of this promoter. The EIIA-early-promoter specific factor was found to be present at comparable levels in uninfected HeLa cells and in cells infected with either wild-type adenovirus or the EIA-deletion mutant dl312 under conditions in which the EIA proteins are induced to high levels [7 or 20 hr after infection in the presence of arabinonucleoside (cytosine arabinoside)]. Based on the quantitation in DNA binding assays, it appears that the mechanism of EIA-activated transcription of the EIIA-early promoter does not involve a net change in the amounts of this factor. Images PMID:2942943

  11. Expression of simian virus 40 T antigen in Escherichia coli: localization of T-antigen origin DNA-binding domain to within 129 amino acids.

    PubMed Central

    Arthur, A K; Höss, A; Fanning, E

    1988-01-01

    The genomic coding sequence of the large T antigen of simian virus 40 (SV40) was cloned into an Escherichia coli expression vector by joining new restriction sites, BglII and BamHI, introduced at the intron boundaries of the gene. Full-length large T antigen, as well as deletion and amino acid substitution mutants, were inducibly expressed from the lac promoter of pUC9, albeit with different efficiencies and protein stabilities. Specific interaction with SV40 origin DNA was detected for full-length T antigen and certain mutants. Deletion mutants lacking T-antigen residues 1 to 130 and 260 to 708 retained specific origin-binding activity, demonstrating that the region between residues 131 and 259 must carry the essential binding domain for DNA-binding sites I and II. A sequence between residues 302 and 320 homologous to a metal-binding "finger" motif is therefore not required for origin-specific binding. However, substitution of serine for either of two cysteine residues in this motif caused a dramatic decrease in origin DNA-binding activity. This region, as well as other regions of the full-length protein, may thus be involved in stabilizing the DNA-binding domain and altering its preference for binding to site I or site II DNA. Images PMID:2835505

  12. Interactions of Ku70/80 with Double-Strand DNA: Energetic, Dynamics, and Functional Implications

    NASA Technical Reports Server (NTRS)

    Hu, Shaowen; Cucinotta, Francis A.

    2010-01-01

    Space radiation is a proficient inducer of DNA damage leading to mutation, aberrant cell signaling, and cancer formation. Ku is among the first responding proteins in nucleus to recognize and bind the DNA double strand breaks (DSBs) whenever they are introduced. Once loaded Ku works as a scaffold to recruit other repair factors of non-homologous end joining and facilitates the following repair processes. The crystallographic study of the Ku70/80 heterodimer indicate the core structure of this protein shows virtually no conformational change after binding with DNA. To investigate the dynamical features as well as the energetic characteristics of Ku-DNA binding, we conduct multi-nanosecond molecular dynamics simulations of a modeled Ku70/80 structure and several complexes with two 24-bp DNA duplexes. Free energy calculations show significant energy differences between the complexes with Ku bound at DSBs and those with Ku associated at an internal site of a chromosome. The results also reveal detailed interactions between different nucleotides and the amino acids along the DNA-binding cradle of Ku, indicating subtle binding preference of Ku at specific DNA sequences. The covariance matrix analyses along the trajectories demonstrate the protein is stimulated to undergo correlated motions of different domains once bound to DNA ends. Additionally, principle component analyses identify these low frequency collective motions suitable for binding with and translocation along duplex DNA. It is proposed that the modification of dynamical properties of Ku upon binding with DSBs may provide a signal for the further recruitment of other repair factors such as DNA-PKcs, XLF, and XRCC4.

  13. Role for a region of helically unstable DNA within the Epstein-Barr virus latent cycle origin of DNA replication oriP in origin function

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Polonskaya, Zhanna; Benham, Craig J.; Hearing, Janet

    The minimal replicator of the Epstein-Barr virus (EBV) latent cycle origin of DNA replication oriP is composed of two binding sites for the Epstein-Barr virus nuclear antigen-1 (EBNA-1) and flanking inverted repeats that bind the telomere repeat binding factor TRF2. Although not required for minimal replicator activity, additional binding sites for EBNA-1 and TRF2 and one or more auxiliary elements located to the right of the EBNA-1/TRF2 sites are required for the efficient replication of oriP plasmids. Another region of oriP that is predicted to be destabilized by DNA supercoiling is shown here to be an important functional component ofmore » oriP. The ability of DNA fragments of unrelated sequence and possessing supercoiled-induced DNA duplex destabilized (SIDD) structures, but not fragments characterized by helically stable DNA, to substitute for this component of oriP demonstrates a role for the SIDD region in the initiation of oriP-plasmid DNA replication.« less

  14. Studies on interaction of norbixin with DNA: Multispectroscopic and in silico analysis

    NASA Astrophysics Data System (ADS)

    Anantharaman, Amrita; Priya, Rajendra Rao; Hemachandran, Hridya; Sivaramakrishna, Akella; Babu, Subramanian; Siva, Ramamoorthy

    2015-06-01

    The interaction of food colorant norbixin with calf thymus DNA (CTDNA) was investigated through UV-Visible spectroscopy, Fourier Transform Infrared (FTIR), Circular Dichroism (CD), Nuclear Magnetic Resonance (NMR), DNA melting studies, electrophoretic analysis, histological staining technique and molecular docking studies. The results indicated that norbixin interacted with CTDNA by partial intercalation mode. The binding constant (K) of norbixin with CTDNA was calculated to be 5.08 × 105 Mol-1 L. FTIR and CD studies were coupled with 1H NMR spectra revealed that norbixin intercalates partially and binds to the groove's, phosphate group, deoxyribose sugar of DNA and also induces conformational transition of B-form to A-form DNA. Agarose gel electrophoretic and histological staining technique results further prove that, norbixin specifically binds to the DNA in the cell. Moreover, molecular docking studies on the specific binding of norbixin with CTDNA have exhibited lowest conformation energy score of -3.2. Therefore, this food colorant has the ability to interact with DNA and it could emerge as a promising class of natural DNA targeted therapeutic.

  15. Spectroscopic and microcalorimetric studies on the molecular binding of food colorant acid red 27 with deoxyribonucleic acid.

    PubMed

    Basu, Anirban; Kumar, Gopinatha Suresh

    2016-08-01

    Interaction of the food colorant acid red 27 with double stranded DNA was investigated using spectroscopic and calorimetric methods. Absorbance and fluorescence studies suggested an intimate binding interaction between the dye and DNA. The quantum efficiency value testified an effective energy transfer from the DNA base pairs to the dye molecules. Minor groove displacement assay with Hoechst 33258 revealed that the binding occurs in the minor groove of DNA. Circular dichroism studies revealed that acid red 27 induces moderate conformational perturbations in DNA. Results of calorimetric studies suggested that the complexation process was driven largely by positive entropic contribution with a smaller favorable enthalpy contribution. The equilibrium constant of the binding was calculated to be (3.04 ± 0.09) × 10(4)  M(-1) at 298.15 K. Negative heat capacity value along with the enthalpy-entropy compensation phenomenon established the involvement of dominant hydrophobic forces in the binding process. Differential scanning calorimetry studies presented evidence for an increased thermal stability of DNA on binding of acid red 27. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  16. RNA binding to APOBEC3G induces the disassembly of functional deaminase complexes by displacing single-stranded DNA substrates

    PubMed Central

    Polevoda, Bogdan; McDougall, William M.; Tun, Bradley N.; Cheung, Michael; Salter, Jason D.; Friedman, Alan E.; Smith, Harold C.

    2015-01-01

    APOBEC3G (A3G) DNA deaminase activity requires a holoenzyme complex whose assembly on nascent viral reverse transcripts initiates with A3G dimers binding to ssDNA followed by formation of higher-order A3G homo oligomers. Catalytic activity is inhibited when A3G binds to RNA. Our prior studies suggested that RNA inhibited A3G binding to ssDNA. In this report, near equilibrium binding and gel shift analyses showed that A3G assembly and disassembly on ssDNA was an ordered process involving A3G dimers and multimers thereof. Although, fluorescence anisotropy showed that A3G had similar nanomolar affinity for RNA and ssDNA, RNA stochastically dissociated A3G dimers and higher-order oligomers from ssDNA, suggesting a different modality for RNA binding. Mass spectrometry mapping of A3G peptides cross-linked to nucleic acid suggested ssDNA only bound to three peptides, amino acids (aa) 181–194 in the N-terminus and aa 314–320 and 345–374 in the C-terminus that were part of a continuous exposed surface. RNA bound to these peptides and uniquely associated with three additional peptides in the N- terminus, aa 15–29, 41–52 and 83–99, that formed a continuous surface area adjacent to the ssDNA binding surface. The data predict a mechanistic model of RNA inhibition of ssDNA binding to A3G in which competitive and allosteric interactions determine RNA-bound versus ssDNA-bound conformational states. PMID:26424853

  17. The gene therapy of collagen-induced arthritis in rats by intramuscular administration of the plasmid encoding TNF-binding domain of variola virus CrmB protein.

    PubMed

    Shchelkunov, S N; Taranov, O S; Tregubchak, T V; Maksyutov, R A; Silkov, A N; Nesterov, A E; Sennikov, S V

    2016-07-01

    Wistar rats with collagen-induced arthritis were intramuscularly injected with the recombinant plasmid pcDNA/sTNF-BD encoding the sequence of the TNF-binding protein domain of variola virus CrmB protein (VARV sTNF-BD) or the pcDNA3.1 vector. Quantitative analysis showed that the histopathological changes in the hind-limb joints of rats were most severe in the animals injected with pcDNA3.1 and much less severe in the group of rats injected with pcDNA/sTNF-BD, which indicates that gene therapy of rheumatoid arthritis is promising in the case of local administration of plasmids governing the synthesis of VARV immunomodulatory proteins.

  18. A ruthenium dimer complex with a flexible linker slowly threads between DNA bases in two distinct steps.

    PubMed

    Bahira, Meriem; McCauley, Micah J; Almaqwashi, Ali A; Lincoln, Per; Westerlund, Fredrik; Rouzina, Ioulia; Williams, Mark C

    2015-10-15

    Several multi-component DNA intercalating small molecules have been designed around ruthenium-based intercalating monomers to optimize DNA binding properties for therapeutic use. Here we probe the DNA binding ligand [μ-C4(cpdppz)2(phen)4Ru2](4+), which consists of two Ru(phen)2dppz(2+) moieties joined by a flexible linker. To quantify ligand binding, double-stranded DNA is stretched with optical tweezers and exposed to ligand under constant applied force. In contrast to other bis-intercalators, we find that ligand association is described by a two-step process, which consists of fast bimolecular intercalation of the first dppz moiety followed by ∼10-fold slower intercalation of the second dppz moiety. The second step is rate-limited by the requirement for a DNA-ligand conformational change that allows the flexible linker to pass through the DNA duplex. Based on our measured force-dependent binding rates and ligand-induced DNA elongation measurements, we are able to map out the energy landscape and structural dynamics for both ligand binding steps. In addition, we find that at zero force the overall binding process involves fast association (∼10 s), slow dissociation (∼300 s), and very high affinity (Kd ∼10 nM). The methodology developed in this work will be useful for studying the mechanism of DNA binding by other multi-step intercalating ligands and proteins. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Synthesis and crystal structure elucidation of new copper(II)-based chemotherapeutic agent coupled with 1,2-DACH and orthovanillin: Validated by in vitro DNA/HSA binding profile and pBR322 cleavage pathway.

    PubMed

    Zaki, Mehvash; Afzal, Mohd; Ahmad, Musheer; Tabassum, Sartaj

    2016-08-01

    New copper(II)-based complex (1) was synthesized and characterized by analytical, spectroscopic and single crystal X-ray diffraction. The in vitro binding studies of complex 1 with CT DNA and HSA have been investigated by employing biophysical techniques to examine the binding propensity of 1 towards DNA and HSA. The results showed that 1 avidly binds to CT DNA via electrostatic mode along with the hydrogen bonding interaction of NH2 and CN groups of Schiff base ligand with the base pairs of DNA helix, leads to partial unwinding and destabilization of the DNA double helix. Moreover, the CD spectral studies revealed that complex 1 binds through groove binding interaction that stabilizes the right-handed B-form of DNA. Complex 1 showed an impressive photoinduced nuclease activity generating single-strand breaks in comparison with the DNA cleavage activity in presence of visible light. The mechanistic investigation revealed the efficiency of 1 to cleave DNA strands by involving the generation of reactive oxygen species. Furthermore, the time dependent DNA cleavage activity showed that there was gradual increase in the amount of NC DNA on increasing the photoexposure time. However, the interaction of 1 and HSA showed that the change of intrinsic fluorescence intensity of HSA was induced by the microenvironment of Trp residue. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Mechanisms of inhibition of zinc-finger transcription factors by selenium compounds ebselen and selenite.

    PubMed

    Larabee, Jason L; Hocker, James R; Hanas, Jay S

    2009-03-01

    The anti-inflammatory selenium compounds, ebselen (2-phenyl-1,2-benzisoselenazol-3[2H]-one) and selenite, were found to alter the DNA binding mechanisms and structures of cysteine-rich zinc-finger transcription factors. As assayed by DNase I protection, DNA binding by TFIIIA (transcription factor IIIA, prototypical Cys(2)His(2) zinc finger protein), was inhibited by micromolar amounts of ebselen. In a gel shift assay, ebselen inhibited the Cys(2)His(2) zinc finger-containing DNA binding domain (DBD) of the NF-kappaB mediated transcription factor Sp1. Ebselen also inhibited DNA binding by the p50 subunit of the pro-inflammatory Cys-containing NF-kappaB transcription factor. Electrospray ionization mass spectrometry (ESI-MS) was utilized to elucidate mechanisms of chemical interaction between ebselen and a zinc-bound Cys(2)His(2) zinc finger polypeptide modeled after the third finger of Sp1 (Sp1-3). Exposing Sp1-3 to micromolar amounts of ebselen resulted in Zn(2+) release from this peptide and the formation of a disulfide bond by oxidation of zinc finger SH groups, the likely mechanism for DNA binding inhibition. Selenite was shown by ESI-MS to also eject zinc from Sp1-3 as well as induce disulfide bond formation through SH oxidation. The selenite-dependent inhibition/oxidation mechanism differed from that of ebselen by inducing the formation of a stable selenotrisulfide bond. Selenite-induced selenotrisulfide formation was dependent upon the structure of the Cys(2)His(2) zinc finger as alteration in the finger structure enhanced this reaction as well as selenite-dependent zinc release. Ebselen and selenite-dependent inhibition/oxidation of Cys-rich zinc finger proteins, with concomitant release of zinc and finger structural changes, points to mechanisms at the atomic and protein level for selenium-induced alterations in Cys-rich proteins, and possible amelioration of certain inflammatory, neurodegenerative, and oncogenic responses.

  1. Lipopolysaccharide (LPS)-stimulated iNOS Induction Is Increased by Glucosamine under Normal Glucose Conditions but Is Inhibited by Glucosamine under High Glucose Conditions in Macrophage Cells*

    PubMed Central

    Hwang, Ji-Sun; Kwon, Mi-Youn; Kim, Kyung-Hong; Lee, Yunkyoung; Lyoo, In Kyoon; Kim, Jieun E.; Oh, Eok-Soo; Han, Inn-Oc

    2017-01-01

    We investigated the regulatory effect of glucosamine (GlcN) for the production of nitric oxide (NO) and expression of inducible NO synthase (iNOS) under various glucose conditions in macrophage cells. At normal glucose concentrations, GlcN dose dependently increased LPS-stimulated production of NO/iNOS. However, GlcN suppressed NO/iNOS production under high glucose culture conditions. Moreover, GlcN suppressed LPS-induced up-regulation of COX-2, IL-6, and TNF-α mRNAs under 25 mm glucose conditions yet did not inhibit up-regulation under 5 mm glucose conditions. Glucose itself dose dependently increased LPS-induced iNOS expression. LPS-induced MAPK and IκB-α phosphorylation did not significantly differ at normal and high glucose conditions. The activity of LPS-induced nuclear factor-κB (NF-κB) and DNA binding of c-Rel to the iNOS promoter were inhibited under high glucose conditions in comparison with no significant changes under normal glucose conditions. In addition, we found that the LPS-induced increase in O-GlcNAcylation as well as DNA binding of c-Rel to the iNOS promoter were further increased by GlcN under normal glucose conditions. However, both O-GlcNAcylation and DNA binding of c-Rel decreased under high glucose conditions. The NF-κB inhibitor, pyrrolidine dithiocarbamate, inhibited LPS-induced iNOS expression under high glucose conditions but it did not influence iNOS induction under normal glucose conditions. In addition, pyrrolidine dithiocarbamate inhibited NF-κB DNA binding and c-Rel O-GlcNAcylation only under high glucose conditions. By blocking transcription with actinomycin D, we found that stability of LPS-induced iNOS mRNA was increased by GlcN under normal glucose conditions. These results suggest that GlcN regulates inflammation by sensing energy states of normal and fuel excess. PMID:27927986

  2. Specific interaction of the nonstructural protein NS1 of minute virus of mice (MVM) with [ACCA](2) motifs in the centre of the right-end MVM DNA palindrome induces hairpin-primed viral DNA replication.

    PubMed

    Willwand, Kurt; Moroianu, Adela; Hörlein, Rita; Stremmel, Wolfgang; Rommelaere, Jean

    2002-07-01

    The linear single-stranded DNA genome of minute virus of mice (MVM) is replicated via a double-stranded replicative form (RF) intermediate DNA. Amplification of viral RF DNA requires the structural transition of the right-end palindrome from a linear duplex into a double-hairpin structure, which serves for the repriming of unidirectional DNA synthesis. This conformational transition was found previously to be induced by the MVM nonstructural protein NS1. Elimination of the cognate NS1-binding sites, [ACCA](2), from the central region of the right-end palindrome next to the axis of symmetry was shown to markedly reduce the efficiency of hairpin-primed DNA replication, as measured in a reconstituted in vitro replication system. Thus, [ACCA](2) sequence motifs are essential as NS1-binding elements in the context of the structural transition of the right-end MVM palindrome.

  3. Unusually Strong Binding to the DNA Minor Groove by a Highly Twisted Benzimidazole-Diphenylether: Induced Fit and Bound Water†

    PubMed Central

    Tanious, Farial A.; Laine, William; Peixoto, Paul; Bailly, Christian; Goodwin, Kristie D.; Lewis, Mark A.; Long, Eric C.; Georgiadis, Millie M.; Tidwell, Richard R.; Wilson, W. David

    2008-01-01

    RT29 is a dicationic diamidine derivative that does not obey the classical “rules” for shape and functional group placement that are expected to result in strong binding and specific recognition of the DNA minor groove. The compound contains a benzimidazole-diphenyl ether core that is flanked by the amidine cations. The diphenyl ether is highly twisted and gives the entire compound too much curvature to fit well to the shape of the minor groove. DNaseI footprinting, fluorescence intercalator displacement studies and circular dichroism spectra, however, indicate that the compound is an AT specific minor groove binding agent. Even more surprisingly, quantitative biosensor-surface plasmon resonance and isothermal titration calorimetric results indicate that the compound binds with exceptional strength to certain AT sequences in DNA with a large negative enthalpy of binding. Crystallographic results for the DNA complex of RT29 compared to calculated results for the free compound show that the compound undergoes significant conformational changes to enhance its minor groove interactions. In addition, a water molecule is incorporated directly into the complex to complete the compound-DNA interface and it forms an essential link between the compound and base pair edges at the floor of the minor groove. The calculated ΔCp value for complex formation is substantially less than the experimentally observed value in support of water being an intrinsic part of the complex with a major contribution to the ΔCp value. Both the induced fit conformational changes of the compound and the bound water are essential for strong binding to DNA by RT29. PMID:17506529

  4. Genotoxic effect and antigen binding characteristics of SLE auto-antibodies to peroxynitrite-modified human DNA.

    PubMed

    Khan, Md Asad; Alam, Khursheed; Mehdi, Syed Hassan; Rizvi, M Moshahid A

    2017-12-01

    Systemic lupus erythematosus (SLE) is an inflammatory autoimmune disease characterized by auto-antibodies against native deoxyribonucleic acid after modification and is one of the reasons for the development of SLE. Here, we have evaluated the structural perturbations in human placental DNA by peroxynitrite using spectroscopy, thermal denaturation and high-performance liquid chromatography (HPLC). Peroxynitrite is a powerful potent bi-functional oxidative/nitrative agent that is produced both endogenously and exogenously. In experimental animals, the peroxynitrite-modified DNA was found to be highly immunogenic. The induced antibodies showed cross-reactions with different types of DNA and nitrogen bases that were modified with peroxynitrite by inhibition ELISA. The antibody activity was inhibited by approximately 89% with its immunogen as the inhibitor. The antigen-antibodies interaction between induced antibodies with peroxynitrite-modified DNA showed retarded mobility as compared to the native form. Furthermore, significantly increased binding was also observed in SLE autoantibodies with peroxynitrite-modified DNA than native form. Moreover, DNA isolated from lymphocyte of SLE patients revealed significant recognition of anti-peroxynitrite-modified DNA immunoglobulin G (IgG). Our data indicates that DNA modified with peroxynitrite presents unique antigenic determinants that may induce autoantibody response in SLE. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Structure and decoy-mediated inhibition of the SOX18/Prox1-DNA interaction

    PubMed Central

    Klaus, Miriam; Prokoph, Nina; Girbig, Mathias; Wang, Xuecong; Huang, Yong-Heng; Srivastava, Yogesh; Hou, Linlin; Narasimhan, Kamesh; Kolatkar, Prasanna R.; Francois, Mathias; Jauch, Ralf

    2016-01-01

    The transcription factor (TF) SOX18 drives lymphatic vessel development in both embryogenesis and tumour-induced neo-lymphangiogenesis. Genetic disruption of Sox18 in a mouse model protects from tumour metastasis and established the SOX18 protein as a molecular target. Here, we report the crystal structure of the SOX18 DNA binding high-mobility group (HMG) box bound to a DNA element regulating Prox1 transcription. The crystals diffracted to 1.75Å presenting the highest resolution structure of a SOX/DNA complex presently available revealing water structure, structural adjustments at the DNA contact interface and non-canonical conformations of the DNA backbone. To explore alternatives to challenging small molecule approaches for targeting the DNA-binding activity of SOX18, we designed a set of five decoys based on modified Prox1-DNA. Four decoys potently inhibited DNA binding of SOX18 in vitro and did not interact with non-SOX TFs. Serum stability, nuclease resistance and thermal denaturation assays demonstrated that a decoy circularized with a hexaethylene glycol linker and terminal phosphorothioate modifications is most stable. This SOX decoy also interfered with the expression of a luciferase reporter under control of a SOX18-dependent VCAM1 promoter in COS7 cells. Collectively, we propose SOX decoys as potential strategy for inhibiting SOX18 activity to disrupt tumour-induced neo-lymphangiogenesis. PMID:26939885

  6. Experimental and molecular docking studies on DNA binding interaction of adefovir dipivoxil: advances toward treatment of hepatitis B virus infections.

    PubMed

    Shahabadi, Nahid; Falsafi, Monireh

    2014-05-05

    The toxic interaction of adefovir dipivoxil with calf thymus DNA (CT-DNA) was investigated in vitro under simulated physiological conditions by multi-spectroscopic techniques and molecular modeling study. The fluorescence spectroscopy and UV absorption spectroscopy indicated drug interacted with CT-DNA in a groove binding mode. The binding constant of UV-visible and the number of binding sites were 3.33±0.2×10(4) L mol(-1)and 0.99, respectively. The fluorimetric studies showed that the reaction between the drug and CT-DNA is exothermic (ΔH=34.4 kJ mol(-1); ΔS=184.32 J mol(-1) K(-1)). Circular dichroism spectroscopy (CD) was employed to measure the conformational change of CT-DNA in the presence of adefovir dipivoxil, which verified the groove binding mode. Furthermore, the drug induces detectable changes in its viscosity. The molecular modeling results illustrated that adefovir strongly binds to groove of DNA by relative binding energy of docked structure -16.83 kJ mol(-1). This combination of multiple spectroscopic techniques and molecular modeling methods can be widely used in the investigation on the toxic interaction of small molecular pollutants and drugs with bio macromolecules, which contributes to clarify the molecular mechanism of toxicity or side effect in vivo. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Small RNA-mediated repair of UV-induced DNA lesions by the DNA DAMAGE-BINDING PROTEIN 2 and ARGONAUTE 1

    PubMed Central

    Schalk, Catherine; Cognat, Valérie; Graindorge, Stéfanie; Vincent, Timothée; Voinnet, Olivier; Molinier, Jean

    2017-01-01

    As photosynthetic organisms, plants need to prevent irreversible UV-induced DNA lesions. Through an unbiased, genome-wide approach, we have uncovered a previously unrecognized interplay between Global Genome Repair and small interfering RNAs (siRNAs) in the recognition of DNA photoproducts, prevalently in intergenic regions. Genetic and biochemical approaches indicate that, upon UV irradiation, the DNA DAMAGE-BINDING PROTEIN 2 (DDB2) and ARGONAUTE 1 (AGO1) of Arabidopsis thaliana form a chromatin-bound complex together with 21-nt siRNAs, which likely facilitates recognition of DNA damages in an RNA/DNA complementary strand-specific manner. The biogenesis of photoproduct-associated siRNAs involves the noncanonical, concerted action of RNA POLYMERASE IV, RNA-DEPENDENT RNA POLYMERASE-2, and DICER-LIKE-4. Furthermore, the chromatin association/dissociation of the DDB2-AGO1 complex is under the control of siRNA abundance and DNA damage signaling. These findings reveal unexpected nuclear functions for DCL4 and AGO1, and shed light on the interplay between small RNAs and DNA repair recognition factors at damaged sites. PMID:28325872

  8. DNA binding specificity of the basic-helix-loop-helix protein MASH-1.

    PubMed

    Meierhan, D; el-Ariss, C; Neuenschwander, M; Sieber, M; Stackhouse, J F; Allemann, R K

    1995-09-05

    Despite the high degree of sequence similarity in their basic-helix-loop-helix (BHLH) domains, MASH-1 and MyoD are involved in different biological processes. In order to define possible differences between the DNA binding specificities of these two proteins, we investigated the DNA binding properties of MASH-1 by circular dichroism spectroscopy and by electrophoretic mobility shift assays (EMSA). Upon binding to DNA, the BHLH domain of MASH-1 underwent a conformational change from a mainly unfolded to a largely alpha-helical form, and surprisingly, this change was independent of the specific DNA sequence. The same conformational transition could be induced by the addition of 20% 2,2,2-trifluoroethanol. The apparent dissociation constants (KD) of the complexes of full-length MASH-1 with various oligonucleotides were determined from half-saturation points in EMSAs. MASH-1 bound as a dimer to DNA sequences containing an E-box with high affinity KD = 1.4-4.1 x 10(-14) M2). However, the specificity of DNA binding was low. The dissociation constant for the complex between MASH-1 and the highest affinity E-box sequence (KD = 1.4 x 10(-14) M2) was only a factor of 10 smaller than for completely unrelated DNA sequences (KD = approximately 1 x 10(-13) M2). The DNA binding specificity of MASH-1 was not significantly increased by the formation of an heterodimer with the ubiquitous E12 protein. MASH-1 and MyoD displayed similar binding site preferences, suggesting that their different target gene specificities cannot be explained solely by differential DNA binding. An explanation for these findings is provided on the basis of the known crystal structure of the BHLH domain of MyoD.

  9. Functional Characterization of the Mannitol Promoter of Pseudomonas fluorescens DSM 50106 and Its Application for a Mannitol-Inducible Expression System for Pseudomonas putida KT2440

    PubMed Central

    Hoffmann, Jana; Altenbuchner, Josef

    2015-01-01

    A new pBBR1MCS-2-derived vector containing the Pseudomonas fluorescens DSM10506 mannitol promoter PmtlE and mtlR encoding its AraC/XylS type transcriptional activator was constructed and optimized for low basal expression. Mannitol, arabitol, and glucitol-inducible gene expression was demonstrated with Pseudomonas putida and eGFP as reporter gene. The new vector was applied for functional characterization of PmtlE. Identification of the DNA binding site of MtlR was achieved by in vivo eGFP measurement with PmtlE wild type and mutants thereof. Moreover, purified MtlR was applied for detailed in vitro investigations using electrophoretic mobility shift assays and DNaseI footprinting experiments. The obtained data suggest that MtlR binds to PmtlE as a dimer. The proposed DNA binding site of MtlR is AGTGC-N5-AGTAT-N7-AGTGC-N5-AGGAT. The transcription activation mechanism includes two binding sites with different binding affinities, a strong upstream binding site and a weaker downstream binding site. The presence of the weak downstream binding site was shown to be necessary to sustain mannitol-inducibility of PmtlE. Two possible functions of mannitol are discussed; the effector might stabilize binding of the second monomer to the downstream half site or promote transcription activation by inducing a conformational change of the regulator that influences the contact to the RNA polymerase. PMID:26207762

  10. Peroxynitrite modified DNA presents better epitopes for anti-DNA autoantibodies in diabetes type 1 patients.

    PubMed

    Tripathi, Prashant; Moinuddin; Dixit, Kiran; Mir, Abdul Rouf; Habib, Safia; Alam, Khursheed; Ali, Asif

    2014-07-01

    Peroxynitrite (ONOO(-)), formed by the reaction between nitric oxide (NO) and superoxide (O2(-)), has been implicated in the etiology of numerous disease processes. Peroxynitrite interacts with DNA via direct oxidative reactions or via indirect radical-mediated mechanism. It can inflict both oxidative and nitrosative damages on DNA bases, generating abasic sites, resulting in the single strand breaks. Plasmid pUC 18 isolated from Escherichiacoli was modified with peroxynitrite, generated by quenched flow process. Modifications incurred in plasmid DNA were characterized by ultraviolet and fluorescence spectroscopy, circular dichroism, HPLC and melting temperature studies. Binding characteristics and specificity of antibodies from diabetes patients were analyzed by direct binding and inhibition ELISA. Peroxynitrite modification of pUC 18 plasmid resulted in the formation of strand breaks and base modification. The major compound formed when peroxynitrite reacted with DNA was 8-nitroguanine, a specific marker for peroxynitrite induced DNA damage in inflamed tissues. The concentration of 8-nitroguanine was found to be 3.8 μM. Sera from diabetes type 1 patients from different age groups were studied for their binding to native and peroxynitrite modified plasmid. Direct binding and competitive-inhibition ELISA results showed higher recognition of peroxynitrite modified plasmid, as compared to the native form, by auto-antibodies present in diabetes patients. The preferential recognition of modified plasmid by diabetes autoantibodies was further reiterated by gel shift assay. Experimentally induced anti-peroxynitrite-modified plasmid IgG was used as a probe to detect nitrosative lesions in the DNA isolated from diabetes patients. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Light-up fluorescent probes utilizing binding behavior of perylenediimide derivatives to a hydrophobic pocket within DNA.

    PubMed

    Takada, Tadao; Yamaguchi, Kosato; Tsukamoto, Suguru; Nakamura, Mitsunobu; Yamana, Kazushige

    2014-08-21

    Here we study the binding behavior of perylenediimide () derivatives to a hydrophobic pocket created inside DNA and their photochemical properties capable of designing a light-up fluorescent sensor for short single-stranded DNA or RNA. The perylenediimide derivative with alkoxy groups () suppressing electron transfer quenching was examined. The bound randomly to DNA showed negligible fluorescence due to the aggregation-induced quenching, whereas the bound to the pocket as a monomeric form showed more than 100-fold fluorescence enhancement. Switching the binding states of the corresponded to a change in the fluorescence response for the hybridization event, which allowed us to design a fluorescent sensor of nucleic acids with a nanomolar detection limit.

  12. Two-stage DNA compaction induced by silver ions suggests a cooperative binding mechanism

    NASA Astrophysics Data System (ADS)

    Jiang, Wen-Yan; Ran, Shi-Yong

    2018-05-01

    The interaction between silver ions and DNA plays an important role in the therapeutic use of silver ions and in related technologies such as DNA sensors. However, the underlying mechanism has not been fully understood. In this study, the dynamics of Ag+-DNA interaction at a single-molecule level was studied using magnetic tweezers. AgNO3 solutions with concentrations ranging from 1 μM to 20 μM led to a 1.4-1.8 μm decrease in length of a single λ-DNA molecule, indicating that Ag+ has a strong binding with DNA, causing the DNA conformational change. The compaction process comprises one linear declining stage and another sigmoid-shaped stage, which can be attributed to the interaction mechanism. Considering the cooperative effect, the sigmoid trend was well explained using a phenomenological model. By contrast, addition of silver nanoparticle solution induced no detectable transition of DNA. The dependence of the interaction on ionic strength and DNA concentration was examined via morphology characterization and particle size distribution measurement. The size of the Ag+-DNA complex decreased with an increase in Ag+ ionic strength ranging from 1 μM to 1 mM. Morphology characterization confirmed that silver ions induced DNA to adopt a compacted globular conformation. At a fixed [AgNO3]:[DNA base pairs] ratio, increasing DNA concentration led to increased sizes of the complexes. Intermolecular interaction is believed to affect the Ag+-DNA complex formation to a large extent.

  13. The Structure of the Transcriptional Repressor KstR in Complex with CoA Thioester Cholesterol Metabolites Sheds Light on the Regulation of Cholesterol Catabolism in Mycobacterium tuberculosis*

    PubMed Central

    Ho, Ngoc Anh Thu; Dawes, Stephanie S.; Crowe, Adam M.; Casabon, Israël; Gao, Chen; Kendall, Sharon L.; Baker, Edward N.; Eltis, Lindsay D.; Lott, J. Shaun

    2016-01-01

    Cholesterol can be a major carbon source for Mycobacterium tuberculosis during infection, both at an early stage in the macrophage phagosome and later within the necrotic granuloma. KstR is a highly conserved TetR family transcriptional repressor that regulates a large set of genes responsible for cholesterol catabolism. Many genes in this regulon, including kstR, are either induced during infection or are essential for survival of M. tuberculosis in vivo. In this study, we identified two ligands for KstR, both of which are CoA thioester cholesterol metabolites with four intact steroid rings. A metabolite in which one of the rings was cleaved was not a ligand. We confirmed the ligand-protein interactions using intrinsic tryptophan fluorescence and showed that ligand binding strongly inhibited KstR-DNA binding using surface plasmon resonance (IC50 for ligand = 25 nm). Crystal structures of the ligand-free form of KstR show variability in the position of the DNA-binding domain. In contrast, structures of KstR·ligand complexes are highly similar to each other and demonstrate a position of the DNA-binding domain that is unfavorable for DNA binding. Comparison of ligand-bound and ligand-free structures identifies residues involved in ligand specificity and reveals a distinctive mechanism by which the ligand-induced conformational change mediates DNA release. PMID:26858250

  14. A combinatorial approach to synthetic transcription factor-promoter combinations for yeast strain engineering

    DOE PAGES

    Dossani, Zain Y.; Reider Apel, Amanda; Szmidt-Middleton, Heather; ...

    2017-10-30

    Despite the need for inducible promoters in strain development efforts, the majority of engineering in Saccharomyces cerevisiae continues to rely on a few constitutively active or inducible promoters. Building on advances that use the modular nature of both transcription factors and promoter regions, we have built a library of hybrid promoters that are regulated by a synthetic transcription factor. The hybrid promoters consist of native S. cerevisiae promoters, in which the operator regions have been replaced with sequences that are recognized by the bacterial LexA DNA binding protein. Correspondingly, the synthetic transcription factor (TF) consists of the DNA binding domainmore » of the LexA protein, fused with the human estrogen binding domain and the viral activator domain, VP16. The resulting system with a bacterial DNA binding domain avoids the transcription of native S. cerevisiae genes, and the hybrid promoters can be induced using estradiol, a compound with no detectable impact on S. cerevisiae physiology. Using combinations of one, two or three operator sequence repeats and a set of native S. cerevisiae promoters, we obtained a series of hybrid promoters that can be induced to different levels, using the same synthetic TF and a given estradiol. Finally, this set of promoters, in combination with our synthetic TF, has the potential to regulate numerous genes or pathways simultaneously, to multiple desired levels, in a single strain.« less

  15. A combinatorial approach to synthetic transcription factor‐promoter combinations for yeast strain engineering

    PubMed Central

    Dossani, Zain Y.; Reider Apel, Amanda; Szmidt‐Middleton, Heather; Hillson, Nathan J.; Deutsch, Samuel; Keasling, Jay D.

    2017-01-01

    Abstract Despite the need for inducible promoters in strain development efforts, the majority of engineering in Saccharomyces cerevisiae continues to rely on a few constitutively active or inducible promoters. Building on advances that use the modular nature of both transcription factors and promoter regions, we have built a library of hybrid promoters that are regulated by a synthetic transcription factor. The hybrid promoters consist of native S. cerevisiae promoters, in which the operator regions have been replaced with sequences that are recognized by the bacterial LexA DNA binding protein. Correspondingly, the synthetic transcription factor (TF) consists of the DNA binding domain of the LexA protein, fused with the human estrogen binding domain and the viral activator domain, VP16. The resulting system with a bacterial DNA binding domain avoids the transcription of native S. cerevisiae genes, and the hybrid promoters can be induced using estradiol, a compound with no detectable impact on S. cerevisiae physiology. Using combinations of one, two or three operator sequence repeats and a set of native S. cerevisiae promoters, we obtained a series of hybrid promoters that can be induced to different levels, using the same synthetic TF and a given estradiol. This set of promoters, in combination with our synthetic TF, has the potential to regulate numerous genes or pathways simultaneously, to multiple desired levels, in a single strain. PMID:29084380

  16. A combinatorial approach to synthetic transcription factor-promoter combinations for yeast strain engineering

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dossani, Zain Y.; Reider Apel, Amanda; Szmidt-Middleton, Heather

    Despite the need for inducible promoters in strain development efforts, the majority of engineering in Saccharomyces cerevisiae continues to rely on a few constitutively active or inducible promoters. Building on advances that use the modular nature of both transcription factors and promoter regions, we have built a library of hybrid promoters that are regulated by a synthetic transcription factor. The hybrid promoters consist of native S. cerevisiae promoters, in which the operator regions have been replaced with sequences that are recognized by the bacterial LexA DNA binding protein. Correspondingly, the synthetic transcription factor (TF) consists of the DNA binding domainmore » of the LexA protein, fused with the human estrogen binding domain and the viral activator domain, VP16. The resulting system with a bacterial DNA binding domain avoids the transcription of native S. cerevisiae genes, and the hybrid promoters can be induced using estradiol, a compound with no detectable impact on S. cerevisiae physiology. Using combinations of one, two or three operator sequence repeats and a set of native S. cerevisiae promoters, we obtained a series of hybrid promoters that can be induced to different levels, using the same synthetic TF and a given estradiol. Finally, this set of promoters, in combination with our synthetic TF, has the potential to regulate numerous genes or pathways simultaneously, to multiple desired levels, in a single strain.« less

  17. NMR and computational methods applied to the 3- dimensional structure determination of DNA and ligand-DNA complexes in solution

    NASA Astrophysics Data System (ADS)

    Smith, Jarrod Anson

    2D homonuclear 1H NMR methods and restrained molecular dynamics (rMD) calculations have been applied to determining the three-dimensional structures of DNA and minor groove-binding ligand-DNA complexes in solution. The structure of the DNA decamer sequence d(GCGTTAACGC)2 has been solved both with a distance-based rMD protocol and an NOE relaxation matrix backcalculation-based protocol in order to probe the relative merits of the different refinement methods. In addition, three minor groove binding ligand-DNA complexes have been examined. The solution structure of the oligosaccharide moiety of the antitumor DNA scission agent calicheamicin γ1I has been determined in complex with a decamer duplex containing its high affinity 5'-TCCT- 3' binding sequence. The structure of the complex reinforces the belief that the oligosaccharide moiety is responsible for the sequence selective minor-groove binding activity of the agent, and critical intermolecular contacts are revealed. The solution structures of both the (+) and (-) enantiomers of the minor groove binding DNA alkylating agent duocarmycin SA have been determined in covalent complex with the undecamer DNA duplex d(GACTAATTGTC).d(GAC AATTAGTC). The results support the proposal that the alkylation activity of the duocarmycin antitumor antibiotics is catalyzed by a binding-induced conformational change in the ligand which activates the cyclopropyl group for reaction with the DNA. Comparisons between the structures of the two enantiomers covalently bound to the same DNA sequence at the same 5'-AATTA-3 ' site have provided insight into the binding orientation and site selectivity, as well as the relative rates of reactivity of these two agents.

  18. Ethanol-induced changes in Poly (ADP ribose) Polymerase and neuronal developmental gene expression

    PubMed Central

    Gavin, David P.; Kusumo, Handojo; Sharma, Rajiv P.; Guizzetti, Marina

    2016-01-01

    Prenatal alcohol exposure has profound effects on neuronal growth and development. Poly-ADP Ribose Polymerase (PARP) enzymes are perhaps unique in the field of epigenetics in that they directly participate in histone modifications, transcription factor modifications, DNA methylation/demethylation and are highly inducible by ethanol. It was our hypothesis that ethanol would induce PARP enzymatic activity leading to alterations in neurodevelopmental gene expression. Mouse E18 cortical neurons were treated with ethanol, PARP inhibitors, and nuclear hormone receptor transcription factor PPARγ agonists and antagonists. Subsequently, we measured PARP activity and changes in Bdnf, OKSM (Oct4, Klf4, Sox2, c-Myc), DNA methylating/demethylating factors, and Pparγ mRNA expression, promoter 5-methylcytosine (5MC) and 5-hydroxymethylcytosine (5HMC), and PPARγ promoter binding. We found that ethanol reduced Bdnf4, 9a, and Klf4 mRNA expression, and increased c-Myc expression. These changes were reversed with a PARP inhibitor. In agreement with its role in DNA demethylation PARP inhibition increased 5MC levels at the c-Myc promoter. In addition, we found that elevated PARP enzymatic activity reduced PPARγ promoter binding, and this corresponded to decreased Bdnf and Klf4 mRNA expression. Our results suggest that PARP participates in DNA demethylation and reduces PPARγ promoter binding. The current study underscores the importance of PARP in ethanol-induced changes to neurodevelopmental gene expression. PMID:27497606

  19. Ethanol-induced changes in poly (ADP ribose) polymerase and neuronal developmental gene expression.

    PubMed

    Gavin, David P; Kusumo, Handojo; Sharma, Rajiv P; Guizzetti, Marina

    2016-11-01

    Prenatal alcohol exposure has profound effects on neuronal growth and development. Poly-ADP Ribose Polymerase (PARP) enzymes are perhaps unique in the field of epigenetics in that they directly participate in histone modifications, transcription factor modifications, DNA methylation/demethylation and are highly inducible by ethanol. It was our hypothesis that ethanol would induce PARP enzymatic activity leading to alterations in neurodevelopmental gene expression. Mouse E18 cortical neurons were treated with ethanol, PARP inhibitors, and nuclear hormone receptor transcription factor PPARγ agonists and antagonists. Subsequently, we measured PARP activity and changes in Bdnf, OKSM (Oct4, Klf4, Sox2, c-Myc), DNA methylating/demethylating factors, and Pparγ mRNA expression, promoter 5-methylcytosine (5MC) and 5-hydroxymethylcytosine (5HMC), and PPARγ promoter binding. We found that ethanol reduced Bdnf4, 9a, and Klf4 mRNA expression, and increased c-Myc expression. These changes were reversed with a PARP inhibitor. In agreement with its role in DNA demethylation PARP inhibition increased 5MC levels at the c-Myc promoter. In addition, we found that inhibition of PARP enzymatic activity increased PPARγ promoter binding, and this corresponded to increased Bdnf and Klf4 mRNA expression. Our results suggest that PARP participates in DNA demethylation and reduces PPARγ promoter binding. The current study underscores the importance of PARP in ethanol-induced changes to neurodevelopmental gene expression. Published by Elsevier Ltd.

  20. Analytical methods to determine the comparative DNA binding studies of curcumin-Cu(II) complexes

    NASA Astrophysics Data System (ADS)

    Rajesh, Jegathalaprathaban; Rajasekaran, Marichamy; Rajagopal, Gurusamy; Athappan, Periakaruppan

    2012-11-01

    DNA interaction studies of two mononuclear [1:1(1); 1:2(2)] copper(II) complexes of curcumin have been studied. The interaction of these complexes with CT-DNA has been explored by physical methods to propose modes of DNA binding of the complexes. Absorption spectral titrations of complex 1 with CT-DNA shows a red-shift of 3 nm with the DNA binding affinity of Kb, 5.21 × 104 M-1 that are higher than that obtained for 2 (red-shift, 2 nm; Kb, 1.73 × 104 M-1) reveal that the binding occurs in grooves as a result of the interaction is via exterior phosphates. The CD spectra of these Cu(II) complexes show a red shift of 3-10 nm in the positive band with increase in intensities. This spectral change of induced CD due to the hydrophobic interaction of copper complexes with DNA is the characteristic of B to A conformational change. The EB displacement assay also reveals the same trend as observed in UV-Vis spectral titration. The addition of complexes 1 and 2 to the DNA bound ethidium bromide (EB) solutions causes an obvious reduction in emission intensities indicating that these complexes competitively bind to DNA with EB. The positive shift of both the Epc and E0' accompanied by reduction of peak currents in differential pulse voltammogram (DPV), upon adding different concentrations of DNA to the metal complexes, are obviously in favor of strong binding to DNA. The super coiled plasmid pUC18 DNA cleavage ability of Cu(II) complexes in the presence of reducing agent reveals the single strand DNA cleavage (ssDNA) is observed. The hydroxyl radical (HOrad ) and the singlet oxygen are believed to be the reactive species responsible for the cleavage.

  1. Spermine Attenuates the Action of the DNA Intercalator, Actinomycin D, on DNA Binding and the Inhibition of Transcription and DNA Replication

    PubMed Central

    Chen, Jeremy J. W.; Wu, Wen-Lin; Yuann, Jeu-Ming P.; Su, Wang-Lin; Chuang, Show-Mei; Hou, Ming-Hon

    2012-01-01

    The anticancer activity of DNA intercalators is related to their ability to intercalate into the DNA duplex with high affinity, thereby interfering with DNA replication and transcription. Polyamines (spermine in particular) are almost exclusively bound to nucleic acids and are involved in many cellular processes that require nucleic acids. Until now, the effects of polyamines on DNA intercalator activities have remained unclear because intercalation is the most important mechanism employed by DNA-binding drugs. Herein, using actinomycin D (ACTD) as a model, we have attempted to elucidate the effects of spermine on the action of ACTD, including its DNA-binding ability, RNA and DNA polymerase interference, and its role in the transcription and replication inhibition of ACTD within cells. We found that spermine interfered with the binding and stabilization of ACTD to DNA. The presence of increasing concentrations of spermine enhanced the transcriptional and replication activities of RNA and DNA polymerases, respectively, in vitro treated with ActD. Moreover, a decrease in intracellular polyamine concentrations stimulated by methylglyoxal-bis(guanylhydrazone) (MGBG) enhanced the ACTD-induced inhibition of c-myc transcription and DNA replication in several cancer cell lines. The results indicated that spermine attenuates ACTD binding to DNA and its inhibition of transcription and DNA replication both in vitro and within cells. Finally, a synergistic antiproliferative effect of MGBG and ACTD was observed in a cell viability assay. Our findings will be of significant relevance to future developments in combination with cancer therapy by enhancing the anticancer activity of DNA interactors through polyamine depletion. PMID:23144800

  2. Spermine attenuates the action of the DNA intercalator, actinomycin D, on DNA binding and the inhibition of transcription and DNA replication.

    PubMed

    Wang, Sheng-Yu; Lee, Alan Yueh-Luen; Lee, Yueh-Luen; Lai, Yi-Hua; Chen, Jeremy J W; Wu, Wen-Lin; Yuann, Jeu-Ming P; Su, Wang-Lin; Chuang, Show-Mei; Hou, Ming-Hon

    2012-01-01

    The anticancer activity of DNA intercalators is related to their ability to intercalate into the DNA duplex with high affinity, thereby interfering with DNA replication and transcription. Polyamines (spermine in particular) are almost exclusively bound to nucleic acids and are involved in many cellular processes that require nucleic acids. Until now, the effects of polyamines on DNA intercalator activities have remained unclear because intercalation is the most important mechanism employed by DNA-binding drugs. Herein, using actinomycin D (ACTD) as a model, we have attempted to elucidate the effects of spermine on the action of ACTD, including its DNA-binding ability, RNA and DNA polymerase interference, and its role in the transcription and replication inhibition of ACTD within cells. We found that spermine interfered with the binding and stabilization of ACTD to DNA. The presence of increasing concentrations of spermine enhanced the transcriptional and replication activities of RNA and DNA polymerases, respectively, in vitro treated with ActD. Moreover, a decrease in intracellular polyamine concentrations stimulated by methylglyoxal-bis(guanylhydrazone) (MGBG) enhanced the ACTD-induced inhibition of c-myc transcription and DNA replication in several cancer cell lines. The results indicated that spermine attenuates ACTD binding to DNA and its inhibition of transcription and DNA replication both in vitro and within cells. Finally, a synergistic antiproliferative effect of MGBG and ACTD was observed in a cell viability assay. Our findings will be of significant relevance to future developments in combination with cancer therapy by enhancing the anticancer activity of DNA interactors through polyamine depletion.

  3. A novel carbohydrate derived compound FCP5 causes DNA strand breaks and oxidative modifications of DNA bases in cancer cells.

    PubMed

    Czubatka, Anna; Sarnik, Joanna; Lucent, Del; Blasiak, Janusz; Witczak, Zbigniew J; Poplawski, Tomasz

    2015-02-05

    1,5-Anhydro-6-deoxy-methane-sulfamido-D-glucitol (FCP5) is a functionalized carbohydrate containing functional groups that render it potentially therapeutically useful. According to our concept of 'functional carb-pharmacophores' (FCPs) incorporation of the methanesulfonamido pharmacophore to 1,5 glucitol could create a therapeutically useful compound. Our previous studies revealed that FCP5 was cytotoxic to cancer cells. Therefore, in this work we assessed the cytotoxic mechanisms of FCP5 in four cancer cell lines - HeLa, LoVo, A549 and MCF-7, with particular focus on DNA damage and repair. A broad spectrum of methods, including comet assay with modifications, DNA repair enzyme assay, plasmid relaxation assay, and DNA fragmentation assay, were used. We also checked the potential for FCP5 to induce apoptosis. The results show that FCP5 can induce DNA strand breaks as well as oxidative modifications of DNA bases. DNA lesions induced by FCP5 were not entirely repaired in HeLa cells and DNA repair kinetics differs from other cell lines. Results from molecular docking and plasmid relaxation assay suggest that FCP5 binds to the major groove of DNA with a preference for adenosine-thymine base pair sequences and directly induces DNA strand breaks. Thus, FCP5 may represent a novel lead for the design of new major groove-binding compounds. The results also confirmed the validity of functional carb-pharmacophores as a new source of innovative drugs. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  4. The Chemical and Biological Effects of cis-Dichlorodiammineplatinum (II), an Antitumor Agent, on DNA

    PubMed Central

    Munchausen, Linda L.

    1974-01-01

    cis-Dichlorodiammineplatinum (II) binds irreversibly to the bases in DNA; the amount of platinum complex bound can be determined from changes in the ultraviolet absorption spectrum. As the ratio of platinum to phosphate is increased, an increasing inactivation of bacterial transforming DNA is observed. At a ratio that corresponds to spectrometric saturation, transforming activity is inactivated >105-fold. The trans isomer of the platinum complex, which is not effective against tumors, induces a similar inactivation of transforming DNA but with half the efficiency, indicating a different mode of binding. The sensitivity to inactivation by cis isomer varies slightly with the genetic marker assayed but is not dependent on the excision repair system. Uptake of DNA by competent cells is unaffected by bound platinum complex; however, integration of platinum-bound transforming DNA into the host genome decreases as the mole fraction of platinum increases. This loss of integration parallels the decreased transforming activity of the DNA. Although the drug induces interstrand crosslinks in DNA in vitro, these crosslinks are relatively rare events and cannot account for the observed inactivation. PMID:4548188

  5. The interaction of E. coli integration host factor and lambda cos DNA: multiple complex formation and protein-induced bending.

    PubMed Central

    Kosturko, L D; Daub, E; Murialdo, H

    1989-01-01

    The interaction of E. coli's integration Host Factor (IHF) with fragments of lambda DNA containing the cos site has been studied by gel-mobility retardation and electron microscopy. The cos fragment used in the mobility assays is 398 bp and spans a region from 48,298 to 194 on the lambda chromosome. Several different complexes of IHF with this fragment can be distinguished by their differential mobility on polyacrylamide gels. Relative band intensities indicate that the formation of a complex between IHF and this DNA fragment has an equilibrium binding constant of the same magnitude as DNA fragments containing lambda's attP site. Gel-mobility retardation and electron microscopy have been employed to show that IHF sharply bends DNA near cos and to map the bending site. The protein-induced bend is near an intrinsic bend due to DNA sequence. The position of the bend suggests that IHF's role in lambda DNA packaging may be the enhancement of terminase binding/cos cutting by manipulating DNA structure. Images PMID:2521383

  6. Oxidized mitochondrial DNA activates the NLRP3 inflammasome during apoptosis.

    PubMed

    Shimada, Kenichi; Crother, Timothy R; Karlin, Justin; Dagvadorj, Jargalsaikhan; Chiba, Norika; Chen, Shuang; Ramanujan, V Krishnan; Wolf, Andrea J; Vergnes, Laurent; Ojcius, David M; Rentsendorj, Altan; Vargas, Mario; Guerrero, Candace; Wang, Yinsheng; Fitzgerald, Katherine A; Underhill, David M; Town, Terrence; Arditi, Moshe

    2012-03-23

    We report that in the presence of signal 1 (NF-κB), the NLRP3 inflammasome was activated by mitochondrial apoptotic signaling that licensed production of interleukin-1β (IL-1β). NLRP3 secondary signal activators such as ATP induced mitochondrial dysfunction and apoptosis, resulting in release of oxidized mitochondrial DNA (mtDNA) into the cytosol, where it bound to and activated the NLRP3 inflammasome. The antiapoptotic protein Bcl-2 inversely regulated mitochondrial dysfunction and NLRP3 inflammasome activation. Mitochondrial DNA directly induced NLRP3 inflammasome activation, because macrophages lacking mtDNA had severely attenuated IL-1β production, yet still underwent apoptosis. Both binding of oxidized mtDNA to the NLRP3 inflammasome and IL-1β secretion could be competitively inhibited by the oxidized nucleoside 8-OH-dG. Thus, our data reveal that oxidized mtDNA released during programmed cell death causes activation of the NLRP3 inflammasome. These results provide a missing link between apoptosis and inflammasome activation, via binding of cytosolic oxidized mtDNA to the NLRP3 inflammasome. Copyright © 2012 Elsevier Inc. All rights reserved.

  7. Oxidized Mitochondrial DNA Activates the NLRP3 Inflammasome During Apoptosis

    PubMed Central

    Shimada, Kenichi; Crother, Timothy R.; Karlin, Justin; Dagvadorj, Jargalsaikhan; Chiba, Norika; Chen, Shuang; Ramanujan, V. Krishnan; Wolf, Andrea J.; Vergnes, Laurent; Ojcius, David M.; Rentsendorj, Altan; Vargas, Mario; Guerrero, Candace; Wang, Yinsheng; Fitzgerald, Katherine A.; Underhill, David M.; Town, Terrence; Arditi, Moshe

    2012-01-01

    SUMMARY We report that in the presence of signal 1 (NF-κB), the NLRP3 inflammasome was activated by mitochondrial apoptotic signaling that licensed production of interleukin-1β (IL-1β). NLRP3 secondary signal activators such as ATP induced mitochondrial dysfunction and apoptosis, resulting in release of oxidized mitochondrial DNA (mtDNA) into the cytosol, where it bound to and activated the NLRP3 inflammasome. The anti-apoptotic protein Bcl-2 inversely regulated mitochondrial dysfunction and NLRP3 inflammasome activation. Mitochondrial DNA directly induced NLRP3 inflammasome activation, because macrophages lacking mtDNA had severely attenuated IL-1β production, yet still underwent apoptosis. Both binding of oxidized mtDNA to the NLRP3 inflammasome and IL-1β secretion could be competitively inhibited by the oxidized nucleoside, 8-OH-dG. Thus, our data reveal that oxidized mtDNA released during programmed cell death causes activation of the NLRP3 inflammasome. These results provide a missing link between apoptosis and inflammasome activation, via binding of cytosolic oxidized mtDNA to the NLRP3 inflammasome. PMID:22342844

  8. Decipher the mechanisms of protein conformational changes induced by nucleotide binding through free-energy landscape analysis: ATP binding to Hsp70.

    PubMed

    Nicolaï, Adrien; Delarue, Patrice; Senet, Patrick

    2013-01-01

    ATP regulates the function of many proteins in the cell by transducing its binding and hydrolysis energies into protein conformational changes by mechanisms which are challenging to identify at the atomic scale. Based on molecular dynamics (MD) simulations, a method is proposed to analyze the structural changes induced by ATP binding to a protein by computing the effective free-energy landscape (FEL) of a subset of its coordinates along its amino-acid sequence. The method is applied to characterize the mechanism by which the binding of ATP to the nucleotide-binding domain (NBD) of Hsp70 propagates a signal to its substrate-binding domain (SBD). Unbiased MD simulations were performed for Hsp70-DnaK chaperone in nucleotide-free, ADP-bound and ATP-bound states. The simulations revealed that the SBD does not interact with the NBD for DnaK in its nucleotide-free and ADP-bound states whereas the docking of the SBD was found in the ATP-bound state. The docked state induced by ATP binding found in MD is an intermediate state between the initial nucleotide-free and final ATP-bound states of Hsp70. The analysis of the FEL projected along the amino-acid sequence permitted to identify a subset of 27 protein internal coordinates corresponding to a network of 91 key residues involved in the conformational change induced by ATP binding. Among the 91 residues, 26 are identified for the first time, whereas the others were shown relevant for the allosteric communication of Hsp70 s in several experiments and bioinformatics analysis. The FEL analysis revealed also the origin of the ATP-induced structural modifications of the SBD recently measured by Electron Paramagnetic Resonance. The pathway between the nucleotide-free and the intermediate state of DnaK was extracted by applying principal component analysis to the subset of internal coordinates describing the transition. The methodology proposed is general and could be applied to analyze allosteric communication in other proteins.

  9. Decipher the Mechanisms of Protein Conformational Changes Induced by Nucleotide Binding through Free-Energy Landscape Analysis: ATP Binding to Hsp70

    PubMed Central

    Nicolaï, Adrien; Delarue, Patrice; Senet, Patrick

    2013-01-01

    ATP regulates the function of many proteins in the cell by transducing its binding and hydrolysis energies into protein conformational changes by mechanisms which are challenging to identify at the atomic scale. Based on molecular dynamics (MD) simulations, a method is proposed to analyze the structural changes induced by ATP binding to a protein by computing the effective free-energy landscape (FEL) of a subset of its coordinates along its amino-acid sequence. The method is applied to characterize the mechanism by which the binding of ATP to the nucleotide-binding domain (NBD) of Hsp70 propagates a signal to its substrate-binding domain (SBD). Unbiased MD simulations were performed for Hsp70-DnaK chaperone in nucleotide-free, ADP-bound and ATP-bound states. The simulations revealed that the SBD does not interact with the NBD for DnaK in its nucleotide-free and ADP-bound states whereas the docking of the SBD was found in the ATP-bound state. The docked state induced by ATP binding found in MD is an intermediate state between the initial nucleotide-free and final ATP-bound states of Hsp70. The analysis of the FEL projected along the amino-acid sequence permitted to identify a subset of 27 protein internal coordinates corresponding to a network of 91 key residues involved in the conformational change induced by ATP binding. Among the 91 residues, 26 are identified for the first time, whereas the others were shown relevant for the allosteric communication of Hsp70 s in several experiments and bioinformatics analysis. The FEL analysis revealed also the origin of the ATP-induced structural modifications of the SBD recently measured by Electron Paramagnetic Resonance. The pathway between the nucleotide-free and the intermediate state of DnaK was extracted by applying principal component analysis to the subset of internal coordinates describing the transition. The methodology proposed is general and could be applied to analyze allosteric communication in other proteins. PMID:24348227

  10. pH-Dependent DNA Distortion and Repression of Gene Expression by Pectobacterium atrosepticum PecS.

    PubMed

    Deochand, Dinesh K; Meariman, Jacob K; Grove, Anne

    2016-07-15

    Transcriptional activity is exquisitely sensitive to changes in promoter DNA topology. Transcription factors may therefore control gene activity by modulating the relative positioning of -10 and -35 promoter elements. The plant pathogen Pectobacterium atrosepticum, which causes soft rot in potatoes, must alter gene expression patterns to ensure growth in planta. In the related soft-rot enterobacterium Dickeya dadantii, PecS functions as a master regulator of virulence gene expression. Here, we report that P. atrosepticum PecS controls gene activity by altering promoter DNA topology in response to pH. While PecS binds the pecS promoter with high affinity regardless of pH, it induces significant DNA distortion only at neutral pH, the pH at which the pecS promoter is repressed in vivo. At pH ∼8, DNA distortions are attenuated, and PecS no longer represses the pecS promoter. A specific histidine (H142) located in a crevice between the dimerization- and DNA-binding regions is required for pH-dependent changes in DNA distortion and repression of gene activity, and mutation of this histidine renders the mutant protein incapable of repressing the pecS promoter. We propose that protonated PecS induces a DNA conformation at neutral pH in which -10 and -35 promoter elements are suboptimally positioned for RNA polymerase binding; on deprotonation of PecS, binding is no longer associated with significant changes in DNA conformation, allowing gene expression. We suggest that this mode of gene regulation leads to differential expression of the PecS regulon in response to alkalinization of the plant apoplast.

  11. Rupture of DNA aptamer: New insights from simulations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mishra, Rakesh Kumar; Nath, Shesh; Kumar, Sanjay

    2015-10-28

    Base-pockets (non-complementary base-pairs) in a double-stranded DNA play a crucial role in biological processes. Because of thermal fluctuations, it can lower the stability of DNA, whereas, in case of DNA aptamer, small molecules, e.g., adenosinemonophosphate and adenosinetriphosphate, form additional hydrogen bonds with base-pockets termed as “binding-pockets,” which enhance the stability. Using the Langevin dynamics simulations of coarse grained model of DNA followed by atomistic simulations, we investigated the influence of base-pocket and binding-pocket on the stability of DNA aptamer. Striking differences have been reported here for the separation induced by temperature and force, which require further investigation by single moleculemore » experiments.« less

  12. Structure of the MLL CXXC domain – DNA complex and its functional role in MLL-AF9 leukemia

    PubMed Central

    Cierpicki, Tomasz; Risner, Laurie E.; Grembecka, Jolanta; Lukasik, Stephen M.; Popovic, Relja; Omonkowska, Monika; Shultis, David S.; Zeleznik-Le, Nancy J.; Bushweller, John H.

    2010-01-01

    MLL (Mixed Lineage Leukemia) is the target of chromosomal translocations which cause leukemias with poor prognosis. All leukemogenic MLL fusion proteins retain the CXXC domain which binds to nonmethylated CpG DNA. We present the solution structure of the MLL CXXC domain in complex with DNA, showing for the first time how the CXXC domain distinguishes nonmethylated from methylated CpG DNA. Based on the structure, we designed point mutations which disrupt DNA binding. Introduction of these mutations into MLL-AF9 results in increased DNA methylation of specific CpG nucleotides in Hoxa9, increased H3K9 methylation, decreased expression of Hoxa9 locus transcripts, loss of immortalization potential, and inability to induce leukemia in mice. These results establish that DNA binding by the CXXC domain and protection against DNA methylation is essential for MLL fusion leukemia. They also provide support for this interaction as a potential target for therapeutic intervention. PMID:20010842

  13. Mononuclear Pd(II) complex as a new therapeutic agent: Synthesis, characterization, biological activity, spectral and DNA binding approaches

    NASA Astrophysics Data System (ADS)

    Saeidifar, Maryam; Mirzaei, Hamidreza; Ahmadi Nasab, Navid; Mansouri-Torshizi, Hassan

    2017-11-01

    The binding ability between a new water-soluble palladium(II) complex [Pd(bpy)(bez-dtc)]Cl (where bpy is 2,2‧-bipyridine and bez-dtc is benzyl dithiocarbamate), as an antitumor agent, and calf thymus DNA was evaluated using various physicochemical methods, such as UV-Vis absorption, Competitive fluorescence studies, viscosity measurement, zeta potential and circular dichroism (CD) spectroscopy. The Pd(II) complex was synthesized and characterized using elemental analysis, molar conductivity measurements, FT-IR, 1H NMR, 13C NMR and electronic spectra studies. The anticancer activity against HeLa cell lines demonstrated lower cytotoxicity than cisplatin. The binding constants and the thermodynamic parameters were determined at different temperatures (300 K, 310 K and 320 K) and shown that the complex can bind to DNA via electrostatic forces. Furthermore, this result was confirmed by the viscosity and zeta potential measurements. The CD spectral results demonstrated that the binding of Pd(II) complex to DNA induced conformational changes in DNA. We hope that these results will provide a basis for further studies and practical clinical use of anticancer drugs.

  14. Cyclic perylene diimide: Selective ligand for tetraplex DNA binding over double stranded DNA.

    PubMed

    Vasimalla, Suresh; Sato, Shinobu; Takenaka, Fuminori; Kurose, Yui; Takenaka, Shigeori

    2017-12-15

    Synthesized cyclic perylene diimide, cPDI, showed the binding constant of 6.3 × 10 6  M -1 with binding number of n = 2 with TA-core as a tetraplex DNA in 50 mM Tris-HCl buffer (pH = 7.4) containing 100 mM KCl using Schatchard analysis and showed a higher preference for tetraplex DNA than for double stranded DNA with over 10 3 times. CD spectra showed that TA-core induced its antiparallel conformation upon addition of cPDI in the absence or presence of K + or Na + ions. The cPDI inhibits the telomerase activity with IC 50 of 0.3 µM using TRAP assay which is potential anti-cancer drug with low side effect. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. NOTCH1 Inhibits Activation of ATM by Impairing the Formation of an ATM-FOXO3a-KAT5/Tip60 Complex.

    PubMed

    Adamowicz, Marek; Vermezovic, Jelena; d'Adda di Fagagna, Fabrizio

    2016-08-23

    The DNA damage response (DDR) signal transduction pathway is responsible for sensing DNA damage and further relaying this signal into the cell. ATM is an apical DDR kinase that orchestrates the activation and the recruitment of downstream DDR factors to induce cell-cycle arrest and repair. We have previously shown that NOTCH1 inhibits ATM activation upon DNA damage, but the underlying mechanism remains unclear. Here, we show that NOTCH1 does not impair ATM recruitment to DNA double-strand breaks (DSBs). Rather, NOTCH1 prevents binding of FOXO3a and KAT5/Tip60 to ATM through a mechanism in which NOTCH1 competes with FOXO3a for ATM binding. Lack of FOXO3a binding to ATM leads to the loss of KAT5/Tip60 association with ATM. Moreover, expression of NOTCH1 or depletion of ATM impairs the formation of the FOXO3a-KAT5/Tip60 protein complex. Finally, we show that pharmacological induction of FOXO3a nuclear localization sensitizes NOTCH1-driven cancers to DNA-damage-induced cell death. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  16. Binding affinities of Schiff base Fe(II) complex with BSA and calf-thymus DNA: Spectroscopic investigations and molecular docking analysis

    NASA Astrophysics Data System (ADS)

    Rudra, Suparna; Dasmandal, Somnath; Patra, Chiranjit; Kundu, Arjama; Mahapatra, Ambikesh

    2016-09-01

    The binding interaction of a synthesized Schiff base Fe(II) complex with biological macromolecules viz., bovine serum albumin (BSA) and calf thymus(ct)-DNA have been investigated using different spectroscopic techniques coupled with viscosity measurements at physiological pH and 298 K. Regular amendments in emission intensities of BSA upon the action of the complex indicate significant interaction between them, and the binding interaction have been characterized by Stern Volmer plots and thermodynamic binding parameters. On the basis of this quenching technique one binding site with binding constant (Kb = (7.6 ± 0.21) × 105) between complex and protein have been obtained at 298 K. Time-resolved fluorescence studies have also been encountered to understand the mechanism of quenching induced by the complex. Binding affinities of the complex to the fluorophores of BSA namely tryptophan (Trp) and tyrosine (Tyr) have been judged by synchronous fluorescence studies. Secondary structural changes of BSA rooted by the complex has been revealed by CD spectra. On the other hand, hypochromicity of absorption spectra of the complex with the addition of ct-DNA and the gradual reduction in emission intensities of ethidium bromide bound ct-DNA in presence of the complex indicate noticeable interaction between ct-DNA and the complex with the binding constant (4.2 ± 0.11) × 106 M- 1. Life-time measurements have been studied to determine the relative amplitude of binding of the complex to ct-DNA base pairs. Mode of binding interaction of the complex with ct-DNA has been deciphered by viscosity measurements. CD spectra have also been used to understand the changes in ct-DNA structure upon binding with the metal complex. Density functional theory (DFT) and molecular docking analysis have been employed in highlighting the interactive phenomenon and binding location of the complex with the macromolecules.

  17. Specific binding of the Xanthomonas campestris pv. vesicatoria AraC-type transcriptional activator HrpX to plant-inducible promoter boxes.

    PubMed

    Koebnik, Ralf; Krüger, Antje; Thieme, Frank; Urban, Alexander; Bonas, Ulla

    2006-11-01

    The pathogenicity of the plant-pathogenic bacterium Xanthomonas campestris pv. vesicatoria depends on a type III secretion system which is encoded by the 23-kb hrp (hypersensitive response and pathogenicity) gene cluster. Expression of the hrp operons is strongly induced in planta and in a special minimal medium and depends on two regulatory proteins, HrpG and HrpX. In this study, DNA affinity enrichment was used to demonstrate that the AraC-type transcriptional activator HrpX binds to a conserved cis-regulatory element, the plant-inducible promoter (PIP) box (TTCGC-N(15)-TTCGC), present in the promoter regions of four hrp operons. No binding of HrpX was observed when DNA fragments lacking a PIP box were used. HrpX also bound to a DNA fragment containing an imperfect PIP box (TTCGC-N(8)-TTCGT). Dinucleotide replacements in each half-site of the PIP box strongly decreased binding of HrpX, while simultaneous dinucleotide replacements in both half-sites completely abolished binding. Based on the complete genome sequence of Xanthomonas campestris pv. vesicatoria, putative plant-inducible promoters consisting of a PIP box and a -10 promoter motif were identified in the promoter regions of almost all HrpX-activated genes. Bioinformatic analyses and reverse transcription-PCR experiments revealed novel HrpX-dependent genes, among them a NUDIX hydrolase gene and several genes with a predicted role in the degradation of the plant cell wall. We conclude that HrpX is the most downstream component of the hrp regulatory cascade, which is proposed to directly activate most genes of the hrpX regulon via binding to corresponding PIP boxes.

  18. Structure of p73 DNA-binding domain tetramer modulates p73 transactivation

    PubMed Central

    Ethayathulla, Abdul S.; Tse, Pui-Wah; Monti, Paola; Nguyen, Sonha; Inga, Alberto; Fronza, Gilberto; Viadiu, Hector

    2012-01-01

    The transcription factor p73 triggers developmental pathways and overlaps stress-induced p53 transcriptional pathways. How p53-family response elements determine and regulate transcriptional specificity remains an unsolved problem. In this work, we have determined the first crystal structures of p73 DNA-binding domain tetramer bound to response elements with spacers of different length. The structure and function of the adaptable tetramer are determined by the distance between two half-sites. The structures with zero and one base-pair spacers show compact p73 DNA-binding domain tetramers with large tetramerization interfaces; a two base-pair spacer results in DNA unwinding and a smaller tetramerization interface, whereas a four base-pair spacer hinders tetramerization. Functionally, p73 is more sensitive to spacer length than p53, with one base-pair spacer reducing 90% of transactivation activity and longer spacers reducing transactivation to basal levels. Our results establish the quaternary structure of the p73 DNA-binding domain required as a scaffold to promote transactivation. PMID:22474346

  19. HMGB1-mediated DNA bending: Distinct roles in increasing p53 binding to DNA and the transactivation of p53-responsive gene promoters.

    PubMed

    Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva

    2018-03-01

    HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.

  20. Cdc6-Induced Conformational Changes in ORC Bound to Origin DNA Revealed by Cryo-Electron Microscopy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sun J.; Li H.; Kawakami, H.

    2012-03-07

    The eukaryotic origin recognition complex (ORC) interacts with and remodels origins of DNA replication prior to initiation in S phase. Here, we report a single-particle cryo-EM-derived structure of the supramolecular assembly comprising Saccharomyces cerevisiae ORC, the replication initiation factor Cdc6, and double-stranded ARS1 origin DNA in the presence of ATP{gamma}S. The six subunits of ORC are arranged as Orc1:Orc4:Orc5:Orc2:Orc3, with Orc6 binding to Orc2. Cdc6 binding changes the conformation of ORC, in particular reorienting the Orc1 N-terminal BAH domain. Segmentation of the 3D map of ORC-Cdc6 on DNA and docking with the crystal structure of the homologous archaeal Orc1/Cdc6 proteinmore » suggest an origin DNA binding model in which the DNA tracks along the interior surface of the crescent-like ORC. Thus, ORC bends and wraps the DNA. This model is consistent with the observation that binding of a single Cdc6 extends the ORC footprint on origin DNA from both ends.« less

  1. DNA condensing effects and sequence selectivity of DNA binding of antitumor noncovalent polynuclear platinum complexes.

    PubMed

    Malina, Jaroslav; Farrell, Nicholas P; Brabec, Viktor

    2014-02-03

    The noncovalent analogues of antitumor polynuclear platinum complexes represent a structurally discrete class of platinum drugs. Their chemical and biological properties differ significantly from those of most platinum chemotherapeutics, which bind to DNA in a covalent manner by formation of Pt-DNA adducts. In spite of the fact that these noncovalent polynuclear platinum complexes contain no leaving groups, they have been shown to bind to DNA with high affinity. We report here on the DNA condensation properties of a series of noncovalent analogues of antitumor polynuclear platinum complexes described by biophysical and biochemical methods. The results demonstrate that these polynuclear platinum compounds are capable of inducing DNA condensation at more than 1 order of magnitude lower concentrations than conventional spermine. Atomic force microscopy studies of DNA condensation confined to a mica substrate have revealed that the DNA morphologies become more compact with increasing concentration of the platinum complexes. Moreover, we also found that the noncovalent polynuclear platinum complex [{Pt(NH3)3}2-μ-{trans-Pt(NH3)2(NH2(CH2)6NH2)2}](6+) (TriplatinNC-A) binds to DNA in a sequence-dependent manner, namely, to A/T-rich sequences and A-tract regions, and that noncovalent polynuclear platinum complexes protect DNA from enzymatic cleavage by DNase I. The results suggest that mechanisms of antitumor and cytotoxic activities of these complexes may be associated with their unique ability to condense DNA along with their sequence-specific DNA binding. Owing to their high cellular accumulation, it is also reasonable to suggest that their mechanism of action is based on the competition with naturally occurring DNA condensing agents, such as polyamines spermine, spermidine, and putrescine, for intracellular binding sites, resulting in the disturbance of the correct binding of regulatory proteins initiating the onset of apoptosis.

  2. A Broad-Spectrum Inhibitor of CRISPR-Cas9.

    PubMed

    Harrington, Lucas B; Doxzen, Kevin W; Ma, Enbo; Liu, Jun-Jie; Knott, Gavin J; Edraki, Alireza; Garcia, Bianca; Amrani, Nadia; Chen, Janice S; Cofsky, Joshua C; Kranzusch, Philip J; Sontheimer, Erik J; Davidson, Alan R; Maxwell, Karen L; Doudna, Jennifer A

    2017-09-07

    CRISPR-Cas9 proteins function within bacterial immune systems to target and destroy invasive DNA and have been harnessed as a robust technology for genome editing. Small bacteriophage-encoded anti-CRISPR proteins (Acrs) can inactivate Cas9, providing an efficient off switch for Cas9-based applications. Here, we show that two Acrs, AcrIIC1 and AcrIIC3, inhibit Cas9 by distinct strategies. AcrIIC1 is a broad-spectrum Cas9 inhibitor that prevents DNA cutting by multiple divergent Cas9 orthologs through direct binding to the conserved HNH catalytic domain of Cas9. A crystal structure of an AcrIIC1-Cas9 HNH domain complex shows how AcrIIC1 traps Cas9 in a DNA-bound but catalytically inactive state. By contrast, AcrIIC3 blocks activity of a single Cas9 ortholog and induces Cas9 dimerization while preventing binding to the target DNA. These two orthogonal mechanisms allow for separate control of Cas9 target binding and cleavage and suggest applications to allow DNA binding while preventing DNA cutting by Cas9. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Triplex DNA-binding proteins are associated with clinical outcomes revealed by proteomic measurements in patients with colorectal cancer

    PubMed Central

    2012-01-01

    Background Tri- and tetra-nucleotide repeats in mammalian genomes can induce formation of alternative non-B DNA structures such as triplexes and guanine (G)-quadruplexes. These structures can induce mutagenesis, chromosomal translocations and genomic instability. We wanted to determine if proteins that bind triplex DNA structures are quantitatively or qualitatively different between colorectal tumor and adjacent normal tissue and if this binding activity correlates with patient clinical characteristics. Methods Extracts from 63 human colorectal tumor and adjacent normal tissues were examined by gel shifts (EMSA) for triplex DNA-binding proteins, which were correlated with clinicopathological tumor characteristics using the Mann-Whitney U, Spearman’s rho, Kaplan-Meier and Mantel-Cox log-rank tests. Biotinylated triplex DNA and streptavidin agarose affinity binding were used to purify triplex-binding proteins in RKO cells. Western blotting and reverse-phase protein array were used to measure protein expression in tissue extracts. Results Increased triplex DNA-binding activity in tumor extracts correlated significantly with lymphatic disease, metastasis, and reduced overall survival. We identified three multifunctional splicing factors with biotinylated triplex DNA affinity: U2AF65 in cytoplasmic extracts, and PSF and p54nrb in nuclear extracts. Super-shift EMSA with anti-U2AF65 antibodies produced a shifted band of the major EMSA H3 complex, identifying U2AF65 as the protein present in the major EMSA band. U2AF65 expression correlated significantly with EMSA H3 values in all extracts and was higher in extracts from Stage III/IV vs. Stage I/II colon tumors (p = 0.024). EMSA H3 values and U2AF65 expression also correlated significantly with GSK3 beta, beta-catenin, and NF- B p65 expression, whereas p54nrb and PSF expression correlated with c-Myc, cyclin D1, and CDK4. EMSA values and expression of all three splicing factors correlated with ErbB1, mTOR, PTEN, and Stat5. Western blots confirmed that full-length and truncated beta-catenin expression correlated with U2AF65 expression in tumor extracts. Conclusions Increased triplex DNA-binding activity in vitro correlates with lymph node disease, metastasis, and reduced overall survival in colorectal cancer, and increased U2AF65 expression is associated with total and truncated beta-catenin expression in high-stage colorectal tumors. PMID:22682314

  4. Acetaminophen-induced hepatotoxicity is associated with early changes in NF-kB and NF-IL6 DNA binding activity.

    PubMed

    Blazka, M E; Germolec, D R; Simeonova, P; Bruccoleri, A; Pennypacker, K R; Luster, M I

    Nuclear transcription factors, such as NF-kB and NF-IL6, are believed to play an important role in regulating the expression of genes that encode for products involved in tissue damage and inflammation and, thus, may represent early biomarkers for chemical toxicities. In the present study changes in DNA binding activity of these factors were examined in livers of mice administered hepatotoxic doses of acetaminophen (APAP). NF-kB and NF-IL6 DNA binding occurred constitutively in control mouse liver. However, within 4 hr following administration of hepatotoxic doses of APAP, their binding activities were transiently lost and is in contrast to AP-1 transcription factor where activation occurs under similar conditions. These changes corresponded with increased release of inflammatory mediators (IL-6, serum amyloid A) and increased levels of enzymatic markers of hepatocyte damage. Similarly, treatment of mice with gadolinium chloride, an inhibitor of Kupffer cell activation and known to protect against APAP-induced hepatotoxicity, reduced the observed pathophysiological response in the liver while altering the APAP-associated changes in NF-kB DNA binding activity. NF-kB was found predominantly in parenchymal and endothelial cells and was composed primarily of relatively inactive p50 homodimer subunits in control liver. Taken together, these studies suggest that hepatotoxicity is associated with early and complex changes in DNA binding activities of specific transcription factors. In particular, NF-kB and NF-IL6 may serve as negative regulators of hepatocyte-derived inflammatory mediators and is analogous to that previously observed in certain other cell systems such as B lymphocytes.

  5. G-Quadruplex Induction by the Hairpin Pyrrole-Imidazole Polyamide Dimer.

    PubMed

    Obata, Shunsuke; Asamitsu, Sefan; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

    2018-02-06

    The G-quadruplex (G4) is one type of higher-order structure of nucleic acids and is thought to play important roles in various biological events such as regulation of transcription and inhibition of DNA replication. Pyrrole-imidazole polyamides (PIPs) are programmable small molecules that can sequence-specifically bind with high affinity to the minor groove of double-stranded DNA (dsDNA). Herein, we designed head-to-head hairpin PIP dimers and their target dsDNA in a model G4-forming sequence. Using an electrophoresis mobility shift assay and transcription arrest assay, we found that PIP dimers could induce the structural change to G4 DNA from dsDNA through the recognition by one PIP dimer molecule of two duplex-binding sites flanking both ends of the G4-forming sequence. This induction ability was dependent on linker length. This is the first study to induce G4 formation using PIPs, which are known to be dsDNA binders. The results reported here suggest that selective G4 induction in native sequences may be achieved with PIP dimers by applying the same design strategy.

  6. The centromeric nucleosome-like CENP–T–W–S–X complex induces positive supercoils into DNA

    PubMed Central

    Takeuchi, Kozo; Nishino, Tatsuya; Mayanagi, Kouta; Horikoshi, Naoki; Osakabe, Akihisa; Tachiwana, Hiroaki; Hori, Tetsuya; Kurumizaka, Hitoshi; Fukagawa, Tatsuo

    2014-01-01

    The centromere is a specific genomic region upon which the kinetochore is formed to attach to spindle microtubules for faithful chromosome segregation. To distinguish this chromosomal region from other genomic loci, the centromere contains a specific chromatin structure including specialized nucleosomes containing the histone H3 variant CENP–A. In addition to CENP–A nucleosomes, we have found that centromeres contain a nucleosome-like structure comprised of the histone-fold CENP–T–W–S–X complex. However, it is unclear how the CENP–T–W–S–X complex associates with centromere chromatin. Here, we demonstrate that the CENP–T–W–S–X complex binds preferentially to ∼100 bp of linker DNA rather than nucleosome-bound DNA. In addition, we find that the CENP–T–W–S–X complex primarily binds to DNA as a (CENP–T–W–S–X)2 structure. Interestingly, in contrast to canonical nucleosomes that negatively supercoil DNA, the CENP–T–W–S–X complex induces positive DNA supercoils. We found that the DNA-binding regions in CENP–T or CENP–W, but not CENP–S or CENP–X, are required for this positive supercoiling activity and the kinetochore targeting of the CENP–T–W–S–X complex. In summary, our work reveals the structural features and properties of the CENP–T–W–S–X complex for its localization to centromeres. PMID:24234442

  7. Role of the DNA Damage Response in Human Papillomavirus RNA Splicing and Polyadenylation.

    PubMed

    Nilsson, Kersti; Wu, Chengjun; Schwartz, Stefan

    2018-06-12

    Human papillomaviruses (HPVs) have evolved to use the DNA repair machinery to replicate its DNA genome in differentiated cells. HPV activates the DNA damage response (DDR) in infected cells. Cellular DDR factors are recruited to the HPV DNA genome and position the cellular DNA polymerase on the HPV DNA and progeny genomes are synthesized. Following HPV DNA replication, HPV late gene expression is activated. Recent research has shown that the DDR factors also interact with RNA binding proteins and affects RNA processing. DDR factors activated by DNA damage and that associate with HPV DNA can recruit splicing factors and RNA binding proteins to the HPV DNA and induce HPV late gene expression. This induction is the result of altered alternative polyadenylation and splicing of HPV messenger RNA (mRNA). HPV uses the DDR machinery to replicate its DNA genome and to activate HPV late gene expression at the level of RNA processing.

  8. Control of DNA hybridization by photoswitchable molecular glue.

    PubMed

    Dohno, Chikara; Nakatani, Kazuhiko

    2011-12-01

    Hybridization of DNA is one of the most intriguing events in molecular recognition and is essential for living matter to inherit life beyond generations. In addition to the function of DNA as genetic material, DNA hybridization is a key to control the function of DNA-based materials in nanoscience. Since the hybridization of two single stranded DNAs is a thermodynamically favorable process, dissociation of the once formed DNA duplex is normally unattainable under isothermal conditions. As the progress of DNA-based nanoscience, methodology to control the DNA hybridization process has become increasingly important. Besides many reports using the chemically modified DNA for the regulation of hybridization, we focused our attention on the use of a small ligand as the molecular glue for the DNA. In 2001, we reported the first designed molecule that strongly and specifically bound to the mismatched base pairs in double stranded DNA. Further studies on the mismatch binding molecules provided us a key discovery of a novel mode of the binding of a mismatch binding ligand that induced the base flipping. With these findings we proposed the concept of molecular glue for DNA for the unidirectional control of DNA hybridization and, eventually photoswitchable molecular glue for DNA, which enabled the bidirectional control of hybridization under photoirradiation. In this tutorial review, we describe in detail how we integrated the mismatch binding ligand into photoswitchable molecular glue for DNA, and the application and perspective in DNA-based nanoscience.

  9. Targeted DNA demethylation in human cells by fusion of a plant 5-methylcytosine DNA glycosylase to a sequence-specific DNA binding domain

    PubMed Central

    Parrilla-Doblas, Jara Teresa; Ariza, Rafael R.; Roldán-Arjona, Teresa

    2017-01-01

    ABSTRACT DNA methylation is a crucial epigenetic mark associated to gene silencing, and its targeted removal is a major goal of epigenetic editing. In animal cells, DNA demethylation involves iterative 5mC oxidation by TET enzymes followed by replication-dependent dilution and/or replication-independent DNA repair of its oxidized derivatives. In contrast, plants use specific DNA glycosylases that directly excise 5mC and initiate its substitution for unmethylated C in a base excision repair process. In this work, we have fused the catalytic domain of Arabidopsis ROS1 5mC DNA glycosylase (ROS1_CD) to the DNA binding domain of yeast GAL4 (GBD). We show that the resultant GBD-ROS1_CD fusion protein binds specifically a GBD-targeted DNA sequence in vitro. We also found that transient in vivo expression of GBD-ROS1_CD in human cells specifically reactivates transcription of a methylation-silenced reporter gene, and that such reactivation requires both ROS1_CD catalytic activity and GBD binding capacity. Finally, we show that reactivation induced by GBD-ROS1_CD is accompanied by decreased methylation levels at several CpG sites of the targeted promoter. All together, these results show that plant 5mC DNA glycosylases can be used for targeted active DNA demethylation in human cells. PMID:28277978

  10. Superlattices assembled through shape-induced directional binding

    NASA Astrophysics Data System (ADS)

    Lu, Fang; Yager, Kevin G.; Zhang, Yugang; Xin, Huolin; Gang, Oleg

    2015-04-01

    Organization of spherical particles into lattices is typically driven by packing considerations. Although the addition of directional binding can significantly broaden structural diversity, nanoscale implementation remains challenging. Here we investigate the assembly of clusters and lattices in which anisotropic polyhedral blocks coordinate isotropic spherical nanoparticles via shape-induced directional interactions facilitated by DNA recognition. We show that these polyhedral blocks--cubes and octahedrons--when mixed with spheres, promote the assembly of clusters with architecture determined by polyhedron symmetry. Moreover, three-dimensional binary superlattices are formed when DNA shells accommodate the shape disparity between nanoparticle interfaces. The crystallographic symmetry of assembled lattices is determined by the spatial symmetry of the block's facets, while structural order depends on DNA-tuned interactions and particle size ratio. The presented lattice assembly strategy, exploiting shape for defining the global structure and DNA-mediation locally, opens novel possibilities for by-design fabrication of binary lattices.

  11. Superlattices assembled through shape-induced directional binding

    DOE PAGES

    Lu, Fang; Yager, Kevin G.; Zhang, Yugang; ...

    2015-04-23

    Organization of spherical particles into lattices is typically driven by packing considerations. Although the addition of directional binding can significantly broaden structural diversity, nanoscale implementation remains challenging. Here we investigate the assembly of clusters and lattices in which anisotropic polyhedral blocks coordinate isotropic spherical nanoparticles via shape-induced directional interactions facilitated by DNA recognition. We show that these polyhedral blocks—cubes and octahedrons—when mixed with spheres, promote the assembly of clusters with architecture determined by polyhedron symmetry. Moreover, three-dimensional binary superlattices are formed when DNA shells accommodate the shape disparity between nanoparticle interfaces. The crystallographic symmetry of assembled lattices is determined bymore » the spatial symmetry of the block’s facets, while structural order depends on DNA-tuned interactions and particle size ratio. Lastly, the presented lattice assembly strategy, exploiting shape for defining the global structure and DNA-mediation locally, opens novel possibilities for by-design fabrication of binary lattices.« less

  12. TAF(II)170 interacts with the concave surface of TATA-binding protein to inhibit its DNA binding activity.

    PubMed

    Pereira, L A; van der Knaap, J A; van den Boom, V; van den Heuvel, F A; Timmers, H T

    2001-11-01

    The human RNA polymerase II transcription factor B-TFIID consists of TATA-binding protein (TBP) and the TBP-associated factor (TAF) TAF(II)170 and can rapidly redistribute over promoter DNA. Here we report the identification of human TBP-binding regions in human TAF(II)170. We have defined the TBP interaction domain of TAF(II)170 within three amino-terminal regions: residues 2 to 137, 290 to 381, and 380 to 460. Each region contains a pair of Huntington-elongation-A subunit-Tor repeats and exhibits species-specific interactions with TBP family members. Remarkably, the altered-specificity TBP mutant (TBP(AS)) containing a triple mutation in the concave surface is defective for binding the TAF(II)170 amino-terminal region of residues 1 to 504. Furthermore, within this region the TAF(II)170 residues 290 to 381 can inhibit the interaction between Drosophila TAF(II)230 (residues 2 to 81) and TBP through competition for the concave surface of TBP. Biochemical analyses of TBP binding to the TATA box indicated that TAF(II)170 region 290-381 inhibits TBP-DNA complex formation. Importantly, the TBP(AS) mutant is less sensitive to TAF(II)170 inhibition. Collectively, our results support a mechanism in which TAF(II)170 induces high-mobility DNA binding by TBP through reversible interactions with its concave DNA binding surface.

  13. Structure-based Analysis to Hu-DNA Binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Swinger,K.; Rice, P.

    2007-01-01

    HU and IHF are prokaryotic proteins that induce very large bends in DNA. They are present in high concentrations in the bacterial nucleoid and aid in chromosomal compaction. They also function as regulatory cofactors in many processes, such as site-specific recombination and the initiation of replication and transcription. HU and IHF have become paradigms for understanding DNA bending and indirect readout of sequence. While IHF shows significant sequence specificity, HU binds preferentially to certain damaged or distorted DNAs. However, none of the structurally diverse HU substrates previously studied in vitro is identical with the distorted substrates in the recently publishedmore » Anabaena HU(AHU)-DNA cocrystal structures. Here, we report binding affinities for AHU and the DNA in the cocrystal structures. The binding free energies for formation of these AHU-DNA complexes range from 10-14.5 kcal/mol, representing K{sub d} values in the nanomolar to low picomolar range, and a maximum stabilization of at least 6.3 kcal/mol relative to complexes with undistorted, non-specific DNA. We investigated IHF binding and found that appropriate structural distortions can greatly enhance its affinity. On the basis of the coupling of structural and relevant binding data, we estimate the amount of conformational strain in an IHF-mediated DNA kink that is relieved by a nick (at least 0.76 kcal/mol) and pinpoint the location of the strain. We show that AHU has a sequence preference for an A+T-rich region in the center of its DNA-binding site, correlating with an unusually narrow minor groove. This is similar to sequence preferences shown by the eukaryotic nucleosome.« less

  14. Time-resolved analysis of DNA-protein interactions in living cells by UV laser pulses.

    PubMed

    Nebbioso, Angela; Benedetti, Rosaria; Conte, Mariarosaria; Carafa, Vincenzo; De Bellis, Floriana; Shaik, Jani; Matarese, Filomena; Della Ventura, Bartolomeo; Gesuele, Felice; Velotta, Raffaele; Martens, Joost H A; Stunnenberg, Hendrik G; Altucci, Carlo; Altucci, Lucia

    2017-09-15

    Interactions between DNA and proteins are mainly studied through chemical procedures involving bi-functional reagents, mostly formaldehyde. Chromatin immunoprecipitation is used to identify the binding between transcription factors (TFs) and chromatin, and to evaluate the occurrence and impact of histone/DNA modifications. The current bottleneck in probing DNA-protein interactions using these approaches is caused by the fact that chemical crosslinkers do not discriminate direct and indirect bindings or short-lived chromatin occupancy. Here, we describe a novel application of UV laser-induced (L-) crosslinking and demonstrate that a combination of chemical and L-crosslinking is able to distinguish between direct and indirect DNA-protein interactions in a small number of living cells. The spatial and temporal dynamics of TF bindings to chromatin and their role in gene expression regulation may thus be assessed. The combination of chemical and L-crosslinking offers an exciting and unprecedented tool for biomedical applications.

  15. DNA interaction with naturally occurring antioxidant flavonoids quercetin, kaempferol, and delphinidin.

    PubMed

    Kanakis, C D; Tarantilis, P A; Polissiou, M G; Diamantoglou, S; Tajmir-Riahi, H A

    2005-06-01

    Flavonoids are strong antioxidants that prevent DNA damage. The anticancer and antiviral activities of these natural products are implicated in their mechanism of actions. However, there has been no information on the interactions of these antioxidants with individual DNA at molecular level. This study was designed to examine the interaction of quercetin (que), kaempferol (kae), and delphinidin (del) with calf-thymus DNA in aqueous solution at physiological conditions, using constant DNA concentration (6.5 mmol) and various drug/DNA(phosphate) ratios of 1/65 to 1. FTIR and UV-Visible difference spectroscopic methods are used to determine the drug binding sites, the binding constants and the effects of drug complexation on the stability and conformation of DNA duplex. Structural analysis showed quercetin, kaempferol, and delphinidin bind weakly to adenine, guanine (major groove), and thymine (minor groove) bases, as well as to the backbone phosphate group with overall binding constants K(que) = 7.25 x 10(4)M(-1), K(kae) = 3.60 x 10(4)M(-1), and K(del) = 1.66 x 10(4)M(-1). The stability of adduct formation is in the order of que>kae>del. Delphinidin with a positive charge induces more stabilizing effect on DNA duplex than quercetin and kaempferol. A partial B to A-DNA transition occurs at high drug concentrations.

  16. TALE-PvuII fusion proteins--novel tools for gene targeting.

    PubMed

    Yanik, Mert; Alzubi, Jamal; Lahaye, Thomas; Cathomen, Toni; Pingoud, Alfred; Wende, Wolfgang

    2013-01-01

    Zinc finger nucleases (ZFNs) consist of zinc fingers as DNA-binding module and the non-specific DNA-cleavage domain of the restriction endonuclease FokI as DNA-cleavage module. This architecture is also used by TALE nucleases (TALENs), in which the DNA-binding modules of the ZFNs have been replaced by DNA-binding domains based on transcription activator like effector (TALE) proteins. Both TALENs and ZFNs are programmable nucleases which rely on the dimerization of FokI to induce double-strand DNA cleavage at the target site after recognition of the target DNA by the respective DNA-binding module. TALENs seem to have an advantage over ZFNs, as the assembly of TALE proteins is easier than that of ZFNs. Here, we present evidence that variant TALENs can be produced by replacing the catalytic domain of FokI with the restriction endonuclease PvuII. These fusion proteins recognize only the composite recognition site consisting of the target site of the TALE protein and the PvuII recognition sequence (addressed site), but not isolated TALE or PvuII recognition sites (unaddressed sites), even at high excess of protein over DNA and long incubation times. In vitro, their preference for an addressed over an unaddressed site is > 34,000-fold. Moreover, TALE-PvuII fusion proteins are active in cellula with minimal cytotoxicity.

  17. Cannabinoid inhibition of adenylate cyclase-mediated signal transduction and interleukin 2 (IL-2) expression in the murine T-cell line, EL4.IL-2.

    PubMed

    Condie, R; Herring, A; Koh, W S; Lee, M; Kaminski, N E

    1996-05-31

    Cannabinoid receptors negatively regulate adenylate cyclase through a pertussis toxin-sensitive GTP-binding protein. In the present studies, signaling via the adenylate cyclase/cAMP pathway was investigated in the murine thymoma-derived T-cell line, EL4.IL-2. Northern analysis of EL4.IL-2 cells identified the presence of 4-kilobase CB2 but not CB1 receptor-subtype mRNA transcripts. Southern analysis of genomic DNA digests for the CB2 receptor demonstrated identical banding patterns for EL4.IL-2 cells and mouse-derived DNA, both of which were dissimilar to DNA isolated from rat. Treatment of EL4.IL-2 cells with either cannabinol or Delta9-THC disrupted the adenylate cyclase signaling cascade by inhibiting forskolin-stimulated cAMP accumulation which consequently led to a decrease in protein kinase A activity and the binding of transcription factors to a CRE consensus sequence. Likewise, an inhibition of phorbol 12-myristate 13-acetate (PMA)/ionomycin-induced interleukin 2 (IL-2) protein secretion, which correlated to decreased IL-2 gene transcription, was induced by both cannabinol and Delta9-THC. Further, cannabinoid treatment also decreased PMA/ionomycin-induced nuclear factor binding to the AP-1 proximal site of the IL-2 promoter. Conversely, forskolin enhanced PMA/ionomycin-induced AP-1 binding. These findings suggest that inhibition of signal transduction via the adenylate cyclase/cAMP pathway induces T-cell dysfunction which leads to a diminution in IL-2 gene transcription.

  18. [RXR, a key member of the oncogenic complex in acute promyelocytic leukemia].

    PubMed

    Halftermeyer, Juliane; Le Bras, Morgane; De Thé, Hugues

    2011-11-01

    Acute promyelocytic leukaemia (APL) is induced by fusion proteins always implying the retinoic acid receptor RARa. Although PML-RARa and other fusion oncoproteins are able to bind DNA as homodimers, in vivo they are always found in association with the nuclear receptor RXRa (Retinoid X Receptor). Thus, RXRa is an essential cofactor of the fusion protein for the transformation. Actually, RXRa contributes to several aspects of in vivo -transformation: RARa fusion:RXRa hetero-oligomeric complexes bind DNA with a much greater affinity than RARa fusion homodimers. Besides, PML-RARa:RXRa recognizes an enlarged repertoire of DNA binding sites. Thus the association between fusion proteins and RXRa regulates more genes than the homodimer alone. Titration of RXRa by the fusion protein may also play a role in the transformation process, as well as post-translational modifications of RXRa in the complex. Finally, RXRa is required for rexinoid-induced APL differentiation. Thus, RXRa is a key member of the oncogenic complex. © 2011 médecine/sciences – Inserm / SRMS.

  19. The Kaposi Sarcoma Herpesvirus Latency-associated Nuclear Antigen DNA Binding Domain Dorsal Positive Electrostatic Patch Facilitates DNA Replication and Episome Persistence*

    PubMed Central

    Li, Shijun; Tan, Min; Juillard, Franceline; Ponnusamy, Rajesh; Correia, Bruno; Simas, J. Pedro; Carrondo, Maria A.; McVey, Colin E.; Kaye, Kenneth M.

    2015-01-01

    Kaposi sarcoma-associated herpesvirus (KSHV) has a causative role in several human malignancies. KSHV latency-associated nuclear antigen (LANA) mediates persistence of viral episomes in latently infected cells. LANA mediates KSHV DNA replication and segregates episomes to progeny nuclei. The structure of the LANA DNA binding domain was recently solved, revealing a positive electrostatic patch opposite the DNA binding surface, which is the site of BET protein binding. Here we investigate the functional role of the positive patch in LANA-mediated episome persistence. As expected, LANA mutants with alanine or glutamate substitutions in the central, peripheral, or lateral portions of the positive patch maintained the ability to bind DNA by EMSA. However, all of the substitution mutants were deficient for LANA DNA replication and episome maintenance. Mutation of the peripheral region generated the largest deficiencies. Despite these deficiencies, all positive patch mutants concentrated to dots along mitotic chromosomes in cells containing episomes, similar to LANA. The central and peripheral mutants, but not the lateral mutants, were reduced for BET protein interaction as assessed by co-immunoprecipitation. However, defects in BET protein binding were independent of episome maintenance function. Overall, the reductions in episome maintenance closely correlated with DNA replication deficiencies, suggesting that the replication defects account for the reduced episome persistence. Therefore, the electrostatic patch exerts a key role in LANA-mediated DNA replication and episome persistence and may act through a host cell partner(s) other than a BET protein or by inducing specific structures or complexes. PMID:26420481

  20. Force-extension behavior of DNA in the presence of DNA-bending nucleoid associated proteins

    NASA Astrophysics Data System (ADS)

    Dahlke, K.; Sing, C. E.

    2018-02-01

    Interactions between nucleoid associated proteins (NAPs) and DNA affect DNA polymer conformation, leading to phenomena such as concentration dependent force-extension behavior. These effects, in turn, also impact the local binding behavior of the protein, such as high forces causing proteins to unbind, or proteins binding favorably to locally bent DNA. We develop a coarse-grained NAP-DNA simulation model that incorporates both force- and concentration-dependent behaviors, in order to study the interplay between NAP binding and DNA conformation. This model system includes multi-state protein binding and unbinding, motivated by prior work, but is now dependent on the local structure of the DNA, which is related to external forces acting on the DNA strand. We observe the expected qualitative binding behavior, where more proteins are bound at lower forces than at higher forces. Our model also includes NAP-induced DNA bending, which affects DNA elasticity. We see semi-quantitative matching of our simulated force-extension behavior to the reported experimental data. By using a coarse-grained simulation, we are also able to look at non-equilibrium behaviors, such as dynamic extension of a DNA strand. We stretch a DNA strand at different rates and at different NAP concentrations to observe how the time scales of the system (such as pulling time and unbinding time) work in concert. When these time scales are similar, we observe measurable rate-dependent changes in the system, which include the number of proteins bound and the force required to extend the DNA molecule. This suggests that the relative time scales of different dynamic processes play an important role in the behavior of NAP-DNA systems.

  1. Crystal structure of the DNA-binding domain of the LysR-type transcriptional regulator CbnR in complex with a DNA fragment of the recognition-binding site in the promoter region.

    PubMed

    Koentjoro, Maharani Pertiwi; Adachi, Naruhiko; Senda, Miki; Ogawa, Naoto; Senda, Toshiya

    2018-03-01

    LysR-type transcriptional regulators (LTTRs) are among the most abundant transcriptional regulators in bacteria. CbnR is an LTTR derived from Cupriavidus necator (formerly Alcaligenes eutrophus or Ralstonia eutropha) NH9 and is involved in transcriptional activation of the cbnABCD genes encoding chlorocatechol degradative enzymes. CbnR interacts with a cbnA promoter region of approximately 60 bp in length that contains the recognition-binding site (RBS) and activation-binding site (ABS). Upon inducer binding, CbnR seems to undergo conformational changes, leading to the activation of the transcription. Since the interaction of an LTTR with RBS is considered to be the first step of the transcriptional activation, the CbnR-RBS interaction is responsible for the selectivity of the promoter to be activated. To understand the sequence selectivity of CbnR, we determined the crystal structure of the DNA-binding domain of CbnR in complex with RBS of the cbnA promoter at 2.55 Å resolution. The crystal structure revealed details of the interactions between the DNA-binding domain and the promoter DNA. A comparison with the previously reported crystal structure of the DNA-binding domain of BenM in complex with its cognate RBS showed several differences in the DNA interactions, despite the structural similarity between CbnR and BenM. These differences explain the observed promoter sequence selectivity between CbnR and BenM. Particularly, the difference between Thr33 in CbnR and Ser33 in BenM appears to affect the conformations of neighboring residues, leading to the selective interactions with DNA. Atomic coordinates and structure factors for the DNA-binding domain of Cupriavidus necatorNH9 CbnR in complex with RBS are available in the Protein Data Bank under the accession code 5XXP. © 2018 Federation of European Biochemical Societies.

  2. A novel cold-inducible zinc finger protein from soybean, SCOF-1, enhances cold tolerance in transgenic plants.

    PubMed

    Kim, J C; Lee, S H; Cheong, Y H; Yoo, C M; Lee, S I; Chun, H J; Yun, D J; Hong, J C; Lee, S Y; Lim, C O; Cho, M J

    2001-02-01

    Cold stress on plants induces changes in the transcription of cold response genes. A cDNA clone encoding C2H2-type zinc finger protein, SCOF-1, was isolated from soybean. The transcription of SCOF-1 is specifically induced by low temperature and abscisic acid (ABA) but not by dehydration or high salinity. Constitutive overexpression of SCOF-1 induced cold-regulated (COR) gene expression and enhanced cold tolerance of non-acclimated transgenic Arabidopsis and tobacco plants. SCOF-1 localized to the nucleus but did not bind directly to either C-repeat/dehydration (CRT/DRE) or ABA responsive element (ABRE), cis-acting DNA regulatory elements present in COR gene promoters. However, SCOF-1 greatly enhanced the DNA binding activity of SGBF-1, a soybean G-box binding bZIP transcription factor, to ABRE in vitro. SCOF-1 also interacted with SGBF-1 in a yeast two-hybrid system. The SGBF-1 transactivated the beta-glucuronidase reporter gene driven by the ABRE element in Arabidopsis leaf protoplasts. Furthermore, the SCOF-1 enhanced ABRE-dependent gene expression mediated by SGBF-1. These results suggest that SCOF-1 may function as a positive regulator of COR gene expression mediated by ABRE via protein-protein interaction, which in turn enhances cold tolerance of plants.

  3. One base pair change abolishes the T cell-restricted activity of a kB-like proto-enhancer element from the interleukin 2 promoter.

    PubMed Central

    Briegel, K; Hentsch, B; Pfeuffer, I; Serfling, E

    1991-01-01

    The inducible, T cell-specific enhancers of murine and human Interleukin 2 (Il-2) genes contain the kB-like sequence GGGATTTCACC as an essential cis-acting enhancer motif. When cloned in multiple copies this so-called TCEd (distal T cell element) acts as an inducible proto-enhancer element in E14 T lymphoma cells, but not in HeLa cells. In extracts of induced, Il-2 secreting El4 cells three individual protein factors bind to TCEd DNA. The binding of the most prominent factor, named TCF-1 (T cell factor 1), is correlated with the proto-enhancer activity of TCEd. TCF-1 consists of two polypeptides of about 50 kD and 105 kD; the former seems to be related to the 50 kD polypeptide of NF-kB. Purified NF-kB is also able to bind to the TCEd, but TCF-1 binds stronger than NF-kB to TCEd DNA. The conversion of the TCEd to a 'perfect' NF-kB binding site leads to a tighter binding of NF-kB to TCEd DNA and, as a functional consequence, to the activity of the 'converted' TCEd motifs in HeLa cells. Thus, the substitution of the underlined A residue to a C within the GGGATTTCACC motif abolishes its T cell-restricted activity and leads to its functioning in both El4 cells and HeLa cells. These results indicate that lymphocyte-specific factors binding to the TCEd are involved in the control of T cell specific-transcription of the Il-2 gene. Images PMID:1945879

  4. Targeting GLI by GANT61 involves mechanisms dependent on inhibition of both transcription and DNA licensing.

    PubMed

    Zhang, Ruowen; Wu, Jiahui; Ferrandon, Sylvain; Glowacki, Katie J; Houghton, Janet A

    2016-12-06

    The GLI genes are transcription factors and in cancers are oncogenes, aberrantly and constitutively activated. GANT61, a specific GLI inhibitor, has induced extensive cytotoxicity in human models of colon cancer. The FOXM1 promoter was determined to be a transcriptional target of GLI1. In HT29 cells, inhibition of GLI1 binding at the GLI consensus sequence by GANT61 led to inhibited binding of Pol II, the pause-release factors DSIF, NELF and p-TEFb. The formation of R-loops (RNA:DNA hybrids, ssDNA), were reduced by GANT61 at the FOXM1 promoter. Pretreatment of HT29 cells with α-amanitin reduced GANT61-induced γH2AX foci. Co-localization of GLI1 and BrdU foci, inhibited by GANT61, indicated GLI1 and DNA replication to be linked. By co-immunoprecipitation and confocal microscopy, GLI1 co-localized with the DNA licensing factors ORC4, CDT1, and MCM2. Significant co-localization of GLI1 and ORC4 was inhibited by GANT61, and enrichment of ORC4 occurred at the GLI binding site in the FOXM1 promoter. CDT1 was found to be a transcription target of GLI1. Overexpression of CDT1 in HT29 and SW480 cells reduced GANT61-induced cell death, gH2AX foci, and cleavage of caspase-3. Data demonstrate involvement of transcription and of DNA replication licensing factors by non-transcriptional and transcriptional mechanisms in the GLI-dependent mechanism of action of GANT61.

  5. A calmodulin-binding/CGCG box DNA-binding protein family involved in multiple signaling pathways in plants

    NASA Technical Reports Server (NTRS)

    Yang, Tianbao; Poovaiah, B. W.

    2002-01-01

    We reported earlier that the tobacco early ethylene-responsive gene NtER1 encodes a calmodulin-binding protein (Yang, T., and Poovaiah, B. W. (2000) J. Biol. Chem. 275, 38467-38473). Here we demonstrate that there is one NtER1 homolog as well as five related genes in Arabidopsis. These six genes are rapidly and differentially induced by environmental signals such as temperature extremes, UVB, salt, and wounding; hormones such as ethylene and abscisic acid; and signal molecules such as methyl jasmonate, H(2)O(2), and salicylic acid. Hence, they were designated as AtSR1-6 (Arabidopsis thaliana signal-responsive genes). Ca(2+)/calmodulin binds to all AtSRs, and their calmodulin-binding regions are located on a conserved basic amphiphilic alpha-helical motif in the C terminus. AtSR1 targets the nucleus and specifically recognizes a novel 6-bp CGCG box (A/C/G)CGCG(G/T/C). The multiple CGCG cis-elements are found in promoters of genes such as those involved in ethylene signaling, abscisic acid signaling, and light signal perception. The DNA-binding domain in AtSR1 is located on the N-terminal 146 bp where all AtSR1-related proteins share high similarity but have no similarity to other known DNA-binding proteins. The calmodulin-binding nuclear proteins isolated from wounded leaves exhibit specific CGCG box DNA binding activities. These results suggest that the AtSR gene family encodes a family of calmodulin-binding/DNA-binding proteins involved in multiple signal transduction pathways in plants.

  6. A General Method for Discovering Inhibitors of Protein–DNA Interactions Using Photonic Crystal Biosensors

    PubMed Central

    Chan, Leo L.; Pineda, Maria; Heeres, James T.; Hergenrother, Paul J.; Cunningham, Brian T.

    2009-01-01

    Protein–DNA interactions are essential for fundamental cellular processes such as transcription, DNA damage repair, and apoptosis. As such, small molecule disruptors of these interactions could be powerful tools for investigation of these biological processes, and such compounds would have great potential as therapeutics. Unfortunately, there are few methods available for the rapid identification of compounds that disrupt protein–DNA interactions. Here we show that photonic crystal (PC) technology can be utilized to detect protein–DNA interactions, and can be used in a high-throughput screening mode to identify compounds that prevent protein–DNA binding. The PC technology is used to detect binding between protein–DNA interactions that are DNA-sequence-dependent (the bacterial toxin–antitoxin system MazEF) and those that are DNA-sequence-independent (the human apoptosis inducing factor (AIF)). The PC technology was further utilized in a screen for inhibitors of the AIF–DNA interaction, and through this screen aurin tricarboxylic acid was identified as the first in vitro inhibitor of AIF. The generality and simplicity of the photonic crystal method should enable this technology to find broad utility for identification of compounds that inhibit protein–DNA binding. PMID:18582039

  7. Spectroscopic, electrochemical DNA binding and in vivo anti-inflammatory studies on newly synthesized Schiff bases of 4-aminophenazone.

    PubMed

    Arshad, Nasima; Ahmad, Mukhtar; Ashraf, Muhammad Zaman; Nadeem, Humaira

    2014-09-05

    4-Aminophenazone (Ap-1) Schiff bases i.e., 4-{(3,4,5-trimethoxybenzylidine) amino}phenazone (Ap-2), 4-{(2-chlorobenzylidine) amino}phenazone (Ap-3) and 4-{(4-chlorobenzylidine)amino} phenazone (Ap-4) were synthesized and characterized by different spectroscopic techniques. Interaction of these compounds with ds.DNA was investigated through UV-Visible spectroscopy, fluorescence spectroscopy and cyclic voltammetry at stomach (4.7) and blood (7.4) pH under 37 °C (human body temperature). Instrumental findings were further quantified both kinetically and thermodynamically. Results obtained through these techniques inferred intercalative mode of binding of all the compounds with DNA. The binding constant data, "Kb", and free energy change, ΔG, indicated comparatively greater binding affinity and more spontaneity of binding of compounds with DNA at stomach pH (4.7), respectively. However, among these compounds, Ap-4 showed comparatively greater binding at both the pH. Formation of compound-DNA complex was further confirmed through the decrease in diffusion rates after the addition of DNA. The in vivo anti-inflammatory activity of the compounds was evaluated using the carrageenan-induced hind paw edema method. The results revealed that among all the compounds, Ap-4 showed greater percentage of edema inhibition compared to standard drug. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Molecular mechanisms by which oxidative DNA damage promotes telomerase activity.

    PubMed

    Lee, Hui-Ting; Bose, Arindam; Lee, Chun-Ying; Opresko, Patricia L; Myong, Sua

    2017-11-16

    Telomeres are highly susceptible to oxidative DNA damage, which if left unrepaired can lead to dysregulation of telomere length homeostasis. Here we employed single molecule FRET, single molecule pull-down and biochemical analysis to investigate how the most common oxidative DNA lesions, 8-oxoguanine (8oxoG) and thymine glycol (Tg), regulate the structural properties of telomeric DNA and telomerase extension activity. In contrast to 8oxoG which disrupts the telomeric DNA structure, Tg exhibits substantially reduced perturbation of G-quadruplex folding. As a result, 8oxoG induces high accessibility, whereas Tg retains limited accessibility, of telomeric G-quadruplex DNA to complementary single stranded DNA and to telomere binding protein POT1. Surprisingly, the Tg lesion stimulates telomerase loading and activity to a similar degree as an 8oxoG lesion. We demonstrate that this unexpected stimulation arises from Tg-induced conformational alterations and dynamics in telomeric DNA. Despite impacting structure by different mechanisms, both 8oxoG and Tg enhance telomerase binding and extension activity to the same degree, potentially contributing to oncogenesis. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Selective DNA demethylation by fusion of TDG with a sequence-specific DNA-binding domain

    PubMed Central

    Gregory, David J.; Mikhaylova, Lyudmila; Fedulov, Alexey V.

    2012-01-01

    Our ability to selectively manipulate gene expression by epigenetic means is limited, as there is no approach for targeted reactivation of epigenetically silenced genes, in contrast to what is available for selective gene silencing. We aimed to develop a tool for selective transcriptional activation by DNA demethylation. Here we present evidence that direct targeting of thymine-DNA-glycosylase (TDG) to specific sequences in the DNA can result in local DNA demethylation at potential regulatory sequences and lead to enhanced gene induction. When TDG was fused to a well-characterized DNA-binding domain [the Rel-homology domain (RHD) of NFκB], we observed decreased DNA methylation and increased transcriptional response to unrelated stimulus of inducible nitric oxide synthase (NOS2). The effect was not seen for control genes lacking either RHD-binding sites or high levels of methylation, nor in control mock-transduced cells. Specific reactivation of epigenetically silenced genes may thus be achievable by this approach, which provides a broadly useful strategy to further our exploration of biological mechanisms and to improve control over the epigenome. PMID:22419066

  10. Mechanistic insight into ligand binding to G-quadruplex DNA

    PubMed Central

    Di Leva, Francesco Saverio; Novellino, Ettore; Cavalli, Andrea; Parrinello, Michele; Limongelli, Vittorio

    2014-01-01

    Specific guanine-rich regions in human genome can form higher-order DNA structures called G-quadruplexes, which regulate many relevant biological processes. For instance, the formation of G-quadruplex at telomeres can alter cellular functions, inducing apoptosis. Thus, developing small molecules that are able to bind and stabilize the telomeric G-quadruplexes represents an attractive strategy for antitumor therapy. An example is 3-(benzo[d]thiazol-2-yl)-7-hydroxy-8-((4-(2-hydroxyethyl)piperazin-1-yl)methyl)-2H-chromen-2-one (compound 1), recently identified as potent ligand of the G-quadruplex [d(TGGGGT)]4 with promising in vitro antitumor activity. The experimental observations are suggestive of a complex binding mechanism that, despite efforts, has defied full characterization. Here, we provide through metadynamics simulations a comprehensive understanding of the binding mechanism of 1 to the G-quadruplex [d(TGGGGT)]4. In our calculations, the ligand explores all the available binding sites on the DNA structure and the free-energy landscape of the whole binding process is computed. We have thus disclosed a peculiar hopping binding mechanism whereas 1 is able to bind both to the groove and to the 3’ end of the G-quadruplex. Our results fully explain the available experimental data, rendering our approach of great value for further ligand/DNA studies. PMID:24753420

  11. Interactions of RadB, a DNA repair protein in archaea, with DNA and ATP.

    PubMed

    Guy, Colin P; Haldenby, Sam; Brindley, Amanda; Walsh, David A; Briggs, Geoffrey S; Warren, Martin J; Allers, Thorsten; Bolt, Edward L

    2006-04-21

    The RecA family of recombinases (RecA, Rad51, RadA and UvsX) catalyse strand-exchange between homologous DNA molecules by utilising conserved DNA-binding modules and a common core ATPase domain. RadB was identified in archaea as a Rad51-like protein on the basis of conserved ATPase sequences. However, RadB does not catalyse strand exchange and does not turn over ATP efficiently. RadB does bind DNA, and here we report a triplet of residues (Lys-His-Arg) that is highly conserved at the RadB C terminus, and is crucial for DNA binding. This is consistent with the motif forming a "basic patch" of highly conserved residues identified in an atomic structure of RadB from Thermococcus kodakaraensis. As the triplet motif is conserved at the C terminus of XRCC2 also, a mammalian Rad51-paralogue, we present a phylogenetic analysis that clarifies the relationship between RadB, Rad51-paralogues and recombinases. We investigate interactions between RadB and ATP using genetics and biochemistry; ATP binding by RadB is needed to promote survival of Haloferax volcanii after UV irradiation, and ATP, but not other NTPs, induces pronounced conformational change in RadB. This is the first genetic analysis of radB, and establishes its importance for maintaining genome stability in archaea. ATP-induced conformational change in RadB may explain previous reports that RadB controls Holliday junction resolution by Hjc, depending on the presence or the absence of ATP.

  12. Dynamic maps of UV damage formation and repair for the human genome

    PubMed Central

    Hu, Jinchuan; Adebali, Ogun; Adar, Sheera; Sancar, Aziz

    2017-01-01

    Formation and repair of UV-induced DNA damage in human cells are affected by cellular context. To study factors influencing damage formation and repair genome-wide, we developed a highly sensitive single-nucleotide resolution damage mapping method [high-sensitivity damage sequencing (HS–Damage-seq)]. Damage maps of both cyclobutane pyrimidine dimers (CPDs) and pyrimidine-pyrimidone (6-4) photoproducts [(6-4)PPs] from UV-irradiated cellular and naked DNA revealed that the effect of transcription factor binding on bulky adducts formation varies, depending on the specific transcription factor, damage type, and strand. We also generated time-resolved UV damage maps of both CPDs and (6-4)PPs by HS–Damage-seq and compared them to the complementary repair maps of the human genome obtained by excision repair sequencing to gain insight into factors that affect UV-induced DNA damage and repair and ultimately UV carcinogenesis. The combination of the two methods revealed that, whereas UV-induced damage is virtually uniform throughout the genome, repair is affected by chromatin states, transcription, and transcription factor binding, in a manner that depends on the type of DNA damage. PMID:28607063

  13. Dynamic maps of UV damage formation and repair for the human genome.

    PubMed

    Hu, Jinchuan; Adebali, Ogun; Adar, Sheera; Sancar, Aziz

    2017-06-27

    Formation and repair of UV-induced DNA damage in human cells are affected by cellular context. To study factors influencing damage formation and repair genome-wide, we developed a highly sensitive single-nucleotide resolution damage mapping method [high-sensitivity damage sequencing (HS-Damage-seq)]. Damage maps of both cyclobutane pyrimidine dimers (CPDs) and pyrimidine-pyrimidone (6-4) photoproducts [(6-4)PPs] from UV-irradiated cellular and naked DNA revealed that the effect of transcription factor binding on bulky adducts formation varies, depending on the specific transcription factor, damage type, and strand. We also generated time-resolved UV damage maps of both CPDs and (6-4)PPs by HS-Damage-seq and compared them to the complementary repair maps of the human genome obtained by excision repair sequencing to gain insight into factors that affect UV-induced DNA damage and repair and ultimately UV carcinogenesis. The combination of the two methods revealed that, whereas UV-induced damage is virtually uniform throughout the genome, repair is affected by chromatin states, transcription, and transcription factor binding, in a manner that depends on the type of DNA damage.

  14. Polymerase/DNA interactions and enzymatic activity: multi-parameter analysis with electro-switchable biosurfaces

    NASA Astrophysics Data System (ADS)

    Langer, Andreas; Schräml, Michael; Strasser, Ralf; Daub, Herwin; Myers, Thomas; Heindl, Dieter; Rant, Ulrich

    2015-07-01

    The engineering of high-performance enzymes for future sequencing and PCR technologies as well as the development of many anticancer drugs requires a detailed analysis of DNA/RNA synthesis processes. However, due to the complex molecular interplay involved, real-time methodologies have not been available to obtain comprehensive information on both binding parameters and enzymatic activities. Here we introduce a chip-based method to investigate polymerases and their interactions with nucleic acids, which employs an electrical actuation of DNA templates on microelectrodes. Two measurement modes track both the dynamics of the induced switching process and the DNA extension simultaneously to quantitate binding kinetics, dissociation constants and thermodynamic energies. The high sensitivity of the method reveals previously unidentified tight binding states for Taq and Pol I (KF) DNA polymerases. Furthermore, the incorporation of label-free nucleotides can be followed in real-time and changes in the DNA polymerase conformation (finger closing) during enzymatic activity are observable.

  15. Sulforaphane inhibits CYP1A1 activity and promotes genotoxicity induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin in vitro

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yang, Fangxing, E-mail: fxyang@zju.edu.cn; Zhuang, Shulin; Zhang, Chao

    2013-06-15

    Increasing environmental pollution by carcinogens such as some of persistent organic pollutants (POPs) has prompted growing interest in searching for chemopreventive compounds which are readily obtainable. Sulforaphane (SFN) is isolated from cruciferous vegetables and has the potentials to reduce carcinogenesis through various pathways. In this study, we studied the effects of SFN on CYP1A1 activity and genotoxicity induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). The results showed that SFN inhibited TCDD-induced CYP1A1 activity in H4IIE cells by directly inhibiting CYP1A1 activity, probably through binding to aryl hydrocarbon receptor and/or CYP1A1 revealed by molecular docking. However, SFN promoted TCDD-induced DNA damage in yeast cellsmore » and reduced the viability of initiated yeast cells. Besides, it is surprising that SFN also failed to reduce genotoxicity induced by other genotoxic reagents which possess different mechanisms to lead to DNA damage. Currently, it is difficult to predict whether SFN has the potentials to reduce the risk of TCDD based on the conflicting observations in the study. Therefore, further studies should be urgent to reveal the function and mechanism of SFN in the stress of such POPs on human health. - Highlights: • Sulforaphane inhibited TCDD-induced CYP1A1 activity in H4IIE cells. • Sulforaphane may bind to aryl hydrocarbon receptor and/or CYP1A1. • Sulforaphane promoted TCDD-induced DNA damage in yeast cells. • Sulforaphane may promote DNA damage by DNA strand breaks or DNA alkylation.« less

  16. NLRC3, a member of the NLR family of proteins, is a negative regulator of innate immune signaling induced by the DNA sensor STING

    PubMed Central

    Zhang, Lu; Mo, Jinyao; Swanson, Karen V.; Wen, Haitao; Petrucelli, Alex; Gregory, Sean M.; Zhang, Zhigang; Schneider, Monika; Jiang, Yan; Fitzgerald, Katherine A.; Ouyang, Songying; Liu, Zhi-Jie; Damania, Blossom A; Shu, Hong-Bing; Duncan, Joseph A.; Ting, Jenny P-Y.

    2014-01-01

    SUMMARY Stimulator of interferon genes (STING, also named MITA, MYPS or ERIS) is an intracellular DNA sensor that induces type I interferon through its interaction with TANK-binding kinase 1 (TBK1). Here we found that the nucleotide-binding, leucine-rich repeat containing protein, NLRC3, reduced STING-dependent innate immune activation in response to cytosolic DNA, cyclic di-GMP (c-di-GMP) and DNA viruses. NLRC3 associated with both STING and TBK1, and impeded STING-TBK1 interaction and downstream type I interferon production. Using purified recombinant proteins NLRC3 was found to interact directly with STING. Furthermore, NLRC3 prevented proper trafficking of STING to perinuclear and punctated region, known to be important for its activation. In animals, herpes simplex virus 1 (HSV-1)-infected Nlrc3−/− mice exhibited enhanced innate immunity, reduced morbidity and viral load. This demonstrates the intersection of two key pathways of innate immune regulation, NLR and STING, to fine tune host response to intracellular DNA, DNA virus and c-di-GMP PMID:24560620

  17. Evidence for the role of Mycobacterium tuberculosis RecG helicase in DNA repair and recombination.

    PubMed

    Thakur, Roshan S; Basavaraju, Shivakumar; Somyajit, Kumar; Jain, Akshatha; Subramanya, Shreelakshmi; Muniyappa, Kalappa; Nagaraju, Ganesh

    2013-04-01

    In order to survive and replicate in a variety of stressful conditions during its life cycle, Mycobacterium tuberculosis must possess mechanisms to safeguard the integrity of the genome. Although DNA repair and recombination related genes are thought to play key roles in the repair of damaged DNA in all organisms, so far only a few of them have been functionally characterized in the tubercle bacillus. In this study, we show that M. tuberculosis RecG (MtRecG) expression was induced in response to different genotoxic agents. Strikingly, expression of MtRecG in Escherichia coli ∆recG mutant strain provided protection against mitomycin C, methyl methane sulfonate and UV induced cell death. Purified MtRecG exhibited higher binding affinity for the Holliday junction (HJ) compared with a number of canonical recombinational DNA repair intermediates. Notably, although MtRecG binds at the core of the mobile and immobile HJs, and with higher binding affinity for the immobile HJ, branch migration was evident only in the case of the mobile HJ. Furthermore, immobile HJs stimulate MtRecG ATPase activity less efficiently than mobile HJs. In addition to HJ substrates, MtRecG exhibited binding affinity for a variety of branched DNA structures including three-way junctions, replication forks, flap structures, forked duplex and a D-loop structure, but demonstrated strong unwinding activity on replication fork and flap DNA structures. Together, these results support that MtRecG plays an important role in processes related to DNA metabolism under normal as well as stress conditions. © 2013 The Authors Journal compilation © 2013 FEBS.

  18. DNA Replication Arrest and DNA Damage Responses Induced by Alkylating Minor Groove Binders

    DTIC Science & Technology

    2003-05-01

    Alkylating minor groove DNA binder adozelesin is capable of inhibiting DNA replication in treated cells through a trans-acting mechanism. The trans... replication in vitro. Using purified proteins in DNA replication initiation assays, we found that RPA purified from cells treated with adozelesin in not...adozelesin has the same single-stranded DNA binding activity and support nucleotide excision repair as normal RPA, but is not able to support SV40 DNA

  19. SMAD3 augments FoxO3-induced MuRF-1 promoter activity in a DNA-binding-dependent manner

    PubMed Central

    Bollinger, Lance M.; Witczak, Carol A.; Houmard, Joseph A.

    2014-01-01

    Muscle-specific RING finger-1 (MuRF-1), a ubiquitin ligase and key regulator of proteasome-dependent protein degradation, is highly expressed during skeletal muscle atrophy. The transcription factor forkhead box O3 (FoxO3) induces MuRF-1 expression, but the direct role of other major atrophy-related transcription factors, such as SMAD3, is largely unknown. The goal of this study was to determine whether SMAD3 individually regulates, or with FoxO3 coordinately regulates, MuRF-1 expression. In cultured myotubes or human embryonic kidney cells, MuRF-1 mRNA content and promoter activity were increased by FoxO3 but not by SMAD3 overexpression. However, FoxO3 and SMAD3 coexpression synergistically increased MuRF-1 mRNA and promoter activity. Mutation of the SMAD-binding element (SBE) in the proximal MuRF-1 promoter or overexpression of a SMAD3 DNA-binding mutant attenuated FoxO3-dependent MuRF-1 promoter activation, showing that SMAD binding to DNA is required for optimal activation of FoxO3-induced transcription of MuRF-1. Using chromatin immunoprecipitation, SMAD3 DNA binding increased FoxO3 abundance and SBE mutation reduced FoxO3 abundance on the MuRF-1 promoter. Furthermore, SMAD3 overexpression dose-dependently increased FoxO3 protein content, and coexpression of FoxO3 and SMAD3 synergistically increased FoxO-dependent gene transcription [assessed with a FoxO response element (FRE)-driven reporter]. Collectively, these results show that SMAD3 regulates transcription of MuRF-1 by increasing FoxO3 binding at a conserved FRE-SBE motif within the proximal promoter region, and by increasing FoxO3 protein content and transcriptional activity. These data are the first to indicate that two major transcription factors regulating protein degradation, FoxO3 and SMAD3, converge to coordinately and directly regulate transcription of MuRF-1. PMID:24920680

  20. Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes

    PubMed Central

    van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.

    2016-01-01

    Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol pathogenicity chromosome may be partially transcriptionally autonomous, but there are also extensive transcriptional connections between core and accessory chromosomes. PMID:27855160

  1. A new method for the construction of a mutant library with a predictable occurrence rate using Poisson distribution.

    PubMed

    Seong, Ki Moon; Park, Hweon; Kim, Seong Jung; Ha, Hyo Nam; Lee, Jae Yung; Kim, Joon

    2007-06-01

    A yeast transcriptional activator, Gcn4p, induces the expression of genes that are involved in amino acid and purine biosynthetic pathways under amino acid starvation. Gcn4p has an acidic activation domain in the central region and a bZIP domain in the C-terminus that is divided into the DNA-binding motif and dimerization leucine zipper motif. In order to identify amino acids in the DNA-binding motif of Gcn4p which are involved in transcriptional activation, we constructed mutant libraries in the DNA-binding motif through an innovative application of random mutagenesis. Mutant library made by oligonucleotides which were mutated randomly using the Poisson distribution showed that the actual mutation frequency was in good agreement with expected values. This method could save the time and effort to create a mutant library with a predictable mutation frequency. Based on the studies using the mutant libraries constructed by the new method, the specific residues of the DNA-binding domain in Gcn4p appear to be involved in the transcriptional activities on a conserved binding site.

  2. Cyclosporin A and FK-506 both affect DNA binding of regulatory nuclear proteins to the human interleukin-2 promoter.

    PubMed

    Baumann, G; Geisse, S; Sullivan, M

    1991-03-01

    The structurally unrelated immunosuppressive drugs cyclosporin A (Sandimmun) and FK-506 both interfere with the process of T-cell proliferation by blocking the transcription of the T-cell growth factor interleukin-2 (IL-2). Here we demonstrate that the transcriptional activation of this gene requires the binding of regulatory nuclear proteins to a promoter element with sequence similarity to the consensus binding site for NF-kappa B-related transcription factors. We present evidence that the binding by regulatory nuclear proteins to the kappa B element of the IL-2 promoter is affected negatively by cyclosporin A and FK-506 at concentrations paralleling their immunosuppressive activity in vivo. The decrease in DNA-protein complex formation induced by the immunosuppressive drugs correlates with a decrease in IL-2 production. FK-506 is 10 to 100 times more potent than cyclosporin A in its ability to inhibit sequence-specific DNA binding and IL-2 production. Our findings suggest that the actions of both drugs converge at the level of DNA-protein interaction.

  3. Sanguinarine interacts with chromatin, modulates epigenetic modifications, and transcription in the context of chromatin.

    PubMed

    Selvi B, Ruthrotha; Pradhan, Suman Kalyan; Shandilya, Jayasha; Das, Chandrima; Sailaja, Badi Sri; Shankar G, Naga; Gadad, Shrikanth S; Reddy, Ashok; Dasgupta, Dipak; Kundu, Tapas K

    2009-02-27

    DNA-binding anticancer agents cause alteration in chromatin structure and dynamics. We report the dynamic interaction of the DNA intercalator and potential anticancer plant alkaloid, sanguinarine (SGR), with chromatin. Association of SGR with different levels of chromatin structure was enthalpy driven with micromolar dissociation constant. Apart from DNA, it binds with comparable affinity with core histones and induces chromatin aggregation. The dual binding property of SGR leads to inhibition of core histone modifications. Although it potently inhibits H3K9 methylation by G9a in vitro, H3K4 and H3R17 methylation are more profoundly inhibited in cells. SGR inhibits histone acetylation both in vitro and in vivo. It does not affect the in vitro transcription from DNA template but significantly represses acetylation-dependent chromatin transcription. SGR-mediated repression of epigenetic marks and the alteration of chromatin geography (nucleography) also result in the modulation of global gene expression. These data, conclusively, show an anticancer DNA binding intercalator as a modulator of chromatin modifications and transcription in the chromatin context.

  4. Changes in solvation during DNA binding and cleavage are critical to altered specificity of the EcoRI endonuclease

    PubMed Central

    Robinson, Clifford R.; Sligar, Stephen G.

    1998-01-01

    Restriction endonucleases such as EcoRI bind and cleave DNA with great specificity and represent a paradigm for protein–DNA interactions and molecular recognition. Using osmotic pressure to induce water release, we demonstrate the participation of bound waters in the sequence discrimination of substrate DNA by EcoRI. Changes in solvation can play a critical role in directing sequence-specific DNA binding by EcoRI and are also crucial in assisting site discrimination during catalysis. By measuring the volume change for complex formation, we show that at the cognate sequence (GAATTC) EcoRI binding releases about 70 fewer water molecules than binding at an alternate DNA sequence (TAATTC), which differs by a single base pair. EcoRI complexation with nonspecific DNA releases substantially less water than either of these specific complexes. In cognate substrates (GAATTC) kcat decreases as osmotic pressure is increased, indicating the binding of about 30 water molecules accompanies the cleavage reaction. For the alternate substrate (TAATTC), release of about 40 water molecules accompanies the reaction, indicated by a dramatic acceleration of the rate when osmotic pressure is raised. These large differences in solvation effects demonstrate that water molecules can be key players in the molecular recognition process during both association and catalytic phases of the EcoRI reaction, acting to change the specificity of the enzyme. For both the protein–DNA complex and the transition state, there may be substantial conformational differences between cognate and alternate sites, accompanied by significant alterations in hydration and solvent accessibility. PMID:9482860

  5. Structural mechanisms of DNA binding and unwinding in bacterial RecQ helicases

    DOE PAGES

    Manthei, Kelly A.; Hill, Morgan C.; Burke, Jordan E.; ...

    2015-03-23

    RecQ helicases unwind remarkably diverse DNA structures as key components of many cellular processes. How RecQ enzymes accommodate different substrates in a unified mechanism that couples ATP hydrolysis to DNA unwinding is unknown. In this paper, the X-ray crystal structure of the Cronobacter sakazakii RecQ catalytic core domain bound to duplex DNA with a 3' single-stranded extension identifies two DNA-dependent conformational rearrangements: a winged-helix domain pivots ~90° to close onto duplex DNA, and a conserved aromatic-rich loop is remodeled to bind ssDNA. These changes coincide with a restructuring of the RecQ ATPase active site that positions catalytic residues for ATPmore » hydrolysis. Complex formation also induces a tight bend in the DNA and melts a portion of the duplex. Finally, this bending, coupled with translocation, could provide RecQ with a mechanism for unwinding duplex and other DNA structures.« less

  6. Mechanosensing Potentials Gate Fuel Consumption in a Bipedal DNA Nanowalker

    NASA Astrophysics Data System (ADS)

    Tee, Shern Ren; Hu, Xinpeng; Loh, Iong Ying; Wang, Zhisong

    2018-03-01

    A bipedal DNA nanowalker was recently reported to convert chemical energy into directional motion autonomously and efficiently. To elucidate its chemomechanical coupling mechanisms, three-dimensional molecular modeling is used to obtain coarse-grained foot-track binding potentials of the DNA nanowalker via unbiased and biased sampling techniques (for the potentials' basin and high-energy edges, respectively). The binding state that is protected against fuel-induced dissociation responds asymmetrically to forward versus backward forces, unlike the unprotected state, demonstrating a mechanosensing capability to gate fuel binding. Despite complex DNA mechanics, the foot-track potential exhibits a surprisingly neat three-part profile, offering some general guidelines to rationally design efficient nanowalkers. Subsequent modeling of the bipedal walker attached to the track gives estimates of the free energy for each bipedal state, showing how the mechanosensing foot-track binding breaks the symmetry between the rear and front feet, enabling the rear foot to be selectively dissociated by fuel and generating efficient chemomechanical coupling.

  7. DNA Damage Signaling Is Induced in the Absence of Epstein-Barr Virus (EBV) Lytic DNA Replication and in Response to Expression of ZEBRA.

    PubMed

    Wang'ondu, Ruth; Teal, Stuart; Park, Richard; Heston, Lee; Delecluse, Henri; Miller, George

    2015-01-01

    Epstein Barr virus (EBV), like other oncogenic viruses, modulates the activity of cellular DNA damage responses (DDR) during its life cycle. Our aim was to characterize the role of early lytic proteins and viral lytic DNA replication in activation of DNA damage signaling during the EBV lytic cycle. Our data challenge the prevalent hypothesis that activation of DDR pathways during the EBV lytic cycle occurs solely in response to large amounts of exogenous double stranded DNA products generated during lytic viral DNA replication. In immunofluorescence or immunoblot assays, DDR activation markers, specifically phosphorylated ATM (pATM), H2AX (γH2AX), or 53BP1 (p53BP1), were induced in the presence or absence of viral DNA amplification or replication compartments during the EBV lytic cycle. In assays with an ATM inhibitor and DNA damaging reagents in Burkitt lymphoma cell lines, γH2AX induction was necessary for optimal expression of early EBV genes, but not sufficient for lytic reactivation. Studies in lytically reactivated EBV-positive cells in which early EBV proteins, BGLF4, BGLF5, or BALF2, were not expressed showed that these proteins were not necessary for DDR activation during the EBV lytic cycle. Expression of ZEBRA, a viral protein that is necessary for EBV entry into the lytic phase, induced pATM foci and γH2AX independent of other EBV gene products. ZEBRA mutants deficient in DNA binding, Z(R183E) and Z(S186E), did not induce foci of pATM. ZEBRA co-localized with HP1β, a heterochromatin associated protein involved in DNA damage signaling. We propose a model of DDR activation during the EBV lytic cycle in which ZEBRA induces ATM kinase phosphorylation, in a DNA binding dependent manner, to modulate gene expression. ATM and H2AX phosphorylation induced prior to EBV replication may be critical for creating a microenvironment of viral and cellular gene expression that enables lytic cycle progression.

  8. [6]-Gingerol induces caspase 3 dependent apoptosis and autophagy in cancer cells: drug-DNA interaction and expression of certain signal genes in HeLa cells.

    PubMed

    Chakraborty, Debrup; Bishayee, Kausik; Ghosh, Samrat; Biswas, Raktim; Mandal, Sushil Kumar; Khuda-Bukhsh, Anisur Rahman

    2012-11-05

    [6]-Gingerol, a pharmacologically important bioactive component of ginger, has been reported to have anti-hyperglycemic, anti-cancer and anti-oxidative properties, but mechanisms through which these are achieved are largely unclear. The present study focuses on apoptosis and autophagy, two key events of anti-cancer activity, in HeLa cells treated with [6]-gingerol. The treated cells showed several morphological changes, including externalization of phosphatidyl serine, degradation of DNA and increase in TUNEL positivity. Furthermore, there was depolarization of mitochondrial membrane potential, providing evidence of mitochondria mediated apoptosis. The expression of caspase 3 and PARP was increased in cells exposed to [6]-gingerol. Circular dichroism study for testing drug-DNA interaction with both calf thymus and nuclear DNA as target revealed that the drug had potential to bind with the nuclear DNA and induce conformational changes of DNA. The over-expression of NFkβ, AKT and Bcl2 genes in cancer cells was down-regulated by [6]-gingerol treatment. On the other hand the expression levels of TNFα, Bax and cytochrome c were enhanced in [6]-gingerol treated cells. Thus, overall results suggest that [6]-gingerol has potential to bind with DNA and induce cell death by autophagy and caspase 3 mediated apoptosis. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. USF-related transcription factor, HIV-TF1, stimulates transcription of human immunodeficiency virus-1.

    PubMed

    Maekawa, T; Sudo, T; Kurimoto, M; Ishii, S

    1991-09-11

    The transcription factor HIV-TF1, which binds to a region about 60 bp upstream from the enhancer of the human immunodeficiency virus-1 (HIV-1), was purified from human B cells. HIV-TF1 had a molecular weight of 39,000. Binding of HIV-TF1 to the HIV long terminal repeat (LTR) activated transcription from the HIV promoter in vitro. The HIV-TF1-binding site in HIV LTR was similar to the site recognized by upstream stimulatory factor (USF) in the adenovirus major late promoter. DNA-binding properties of HIV-TF1 suggested that HIV-TF1 might be identical or related to USF. Interestingly, treatment of purified HIV-TF1 by phosphatase greatly reduced its DNA-binding activity, suggesting that phosphorylation of HIV-TF1 was essential for DNA binding. The disruption of HIV-TF1-binding site induced a 60% decrease in the level of transcription from the HIV promoter in vivo. These results suggest that HIV-TF1 is involved in transcriptional regulation of HIV-1.

  10. Histone H1 and Chromosomal Protein HMGN2 Regulate Prolactin-induced STAT5 Transcription Factor Recruitment and Function in Breast Cancer Cells.

    PubMed

    Schauwecker, Suzanne M; Kim, J Julie; Licht, Jonathan D; Clevenger, Charles V

    2017-02-10

    The hormone prolactin (PRL) contributes to breast cancer pathogenesis through various signaling pathways, one of the most notable being the JAK2/signal transducer and activator of transcription 5 (STAT5) pathway. PRL-induced activation of the transcription factor STAT5 results in the up-regulation of numerous genes implicated in breast cancer pathogenesis. However, the molecular mechanisms that enable STAT5 to access the promoters of these genes are not well understood. Here, we show that PRL signaling induces chromatin decompaction at promoter DNA, corresponding with STAT5 binding. The chromatin-modifying protein high mobility group nucleosomal binding domain 2 (HMGN2) specifically promotes STAT5 accessibility at promoter DNA by facilitating the dissociation of the linker histone H1 in response to PRL. Knockdown of H1 rescues the decrease in PRL-induced transcription following HMGN2 knockdown, and it does so by allowing increased STAT5 recruitment. Moreover, H1 and STAT5 are shown to function antagonistically in regulating PRL-induced transcription as well as breast cancer cell biology. While reduced STAT5 activation results in decreased PRL-induced transcription and cell proliferation, knockdown of H1 rescues both of these effects. Taken together, we elucidate a novel mechanism whereby the linker histone H1 prevents STAT5 binding at promoter DNA, and the PRL-induced dissociation of H1 mediated by HMGN2 is necessary to allow full STAT5 recruitment and promote the biological effects of PRL signaling. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Histone H1 and Chromosomal Protein HMGN2 Regulate Prolactin-induced STAT5 Transcription Factor Recruitment and Function in Breast Cancer Cells*

    PubMed Central

    Schauwecker, Suzanne M.; Kim, J. Julie; Licht, Jonathan D.; Clevenger, Charles V.

    2017-01-01

    The hormone prolactin (PRL) contributes to breast cancer pathogenesis through various signaling pathways, one of the most notable being the JAK2/signal transducer and activator of transcription 5 (STAT5) pathway. PRL-induced activation of the transcription factor STAT5 results in the up-regulation of numerous genes implicated in breast cancer pathogenesis. However, the molecular mechanisms that enable STAT5 to access the promoters of these genes are not well understood. Here, we show that PRL signaling induces chromatin decompaction at promoter DNA, corresponding with STAT5 binding. The chromatin-modifying protein high mobility group nucleosomal binding domain 2 (HMGN2) specifically promotes STAT5 accessibility at promoter DNA by facilitating the dissociation of the linker histone H1 in response to PRL. Knockdown of H1 rescues the decrease in PRL-induced transcription following HMGN2 knockdown, and it does so by allowing increased STAT5 recruitment. Moreover, H1 and STAT5 are shown to function antagonistically in regulating PRL-induced transcription as well as breast cancer cell biology. While reduced STAT5 activation results in decreased PRL-induced transcription and cell proliferation, knockdown of H1 rescues both of these effects. Taken together, we elucidate a novel mechanism whereby the linker histone H1 prevents STAT5 binding at promoter DNA, and the PRL-induced dissociation of H1 mediated by HMGN2 is necessary to allow full STAT5 recruitment and promote the biological effects of PRL signaling. PMID:28035005

  12. The Kaposi Sarcoma Herpesvirus Latency-associated Nuclear Antigen DNA Binding Domain Dorsal Positive Electrostatic Patch Facilitates DNA Replication and Episome Persistence.

    PubMed

    Li, Shijun; Tan, Min; Juillard, Franceline; Ponnusamy, Rajesh; Correia, Bruno; Simas, J Pedro; Carrondo, Maria A; McVey, Colin E; Kaye, Kenneth M

    2015-11-20

    Kaposi sarcoma-associated herpesvirus (KSHV) has a causative role in several human malignancies. KSHV latency-associated nuclear antigen (LANA) mediates persistence of viral episomes in latently infected cells. LANA mediates KSHV DNA replication and segregates episomes to progeny nuclei. The structure of the LANA DNA binding domain was recently solved, revealing a positive electrostatic patch opposite the DNA binding surface, which is the site of BET protein binding. Here we investigate the functional role of the positive patch in LANA-mediated episome persistence. As expected, LANA mutants with alanine or glutamate substitutions in the central, peripheral, or lateral portions of the positive patch maintained the ability to bind DNA by EMSA. However, all of the substitution mutants were deficient for LANA DNA replication and episome maintenance. Mutation of the peripheral region generated the largest deficiencies. Despite these deficiencies, all positive patch mutants concentrated to dots along mitotic chromosomes in cells containing episomes, similar to LANA. The central and peripheral mutants, but not the lateral mutants, were reduced for BET protein interaction as assessed by co-immunoprecipitation. However, defects in BET protein binding were independent of episome maintenance function. Overall, the reductions in episome maintenance closely correlated with DNA replication deficiencies, suggesting that the replication defects account for the reduced episome persistence. Therefore, the electrostatic patch exerts a key role in LANA-mediated DNA replication and episome persistence and may act through a host cell partner(s) other than a BET protein or by inducing specific structures or complexes. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. AgI -Induced Switching of DNA Binding Modes via Formation of a Supramolecular Metallacycle.

    PubMed

    Basak, Shibaji; Léon, J Christian; Ferranco, Annaleizle; Sharma, Renu; Hebenbrock, Marian; Lough, Alan; Müller, Jens; Kraatz, Heinz-Bernhard

    2018-03-12

    The histidine derivative L1 of the DNA intercalator naphthalenediimide (NDI) forms a triangular Ag I complex (C2). The interactions of L1 and of C2 with DNA were studied by circular dichroism (CD) and UV/Vis spectroscopy and by viscosity studies. Different binding modes were observed for L1 and for C2, as the Ag I complex C2 is too large in size to act as an intercalator. If Ag I is added to the NDI molecule that is already intercalated into a duplex, higher order complexes are formed within the DNA duplex and cause disruptions in the helical duplex structure, which leads to a significant decrease in the characteristic CD features of B-DNA. Thus, via addition of a metal we show how a classic and well-known organic intercalator unit can be turned into a partial metallo insertor. We also show how electrochemical impedance spectroscopy (EIS) can be used to probe DNA binding modes on DNA films that are immobilized on gold surfaces. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. TALE-PvuII Fusion Proteins – Novel Tools for Gene Targeting

    PubMed Central

    Yanik, Mert; Alzubi, Jamal; Lahaye, Thomas; Cathomen, Toni; Pingoud, Alfred; Wende, Wolfgang

    2013-01-01

    Zinc finger nucleases (ZFNs) consist of zinc fingers as DNA-binding module and the non-specific DNA-cleavage domain of the restriction endonuclease FokI as DNA-cleavage module. This architecture is also used by TALE nucleases (TALENs), in which the DNA-binding modules of the ZFNs have been replaced by DNA-binding domains based on transcription activator like effector (TALE) proteins. Both TALENs and ZFNs are programmable nucleases which rely on the dimerization of FokI to induce double-strand DNA cleavage at the target site after recognition of the target DNA by the respective DNA-binding module. TALENs seem to have an advantage over ZFNs, as the assembly of TALE proteins is easier than that of ZFNs. Here, we present evidence that variant TALENs can be produced by replacing the catalytic domain of FokI with the restriction endonuclease PvuII. These fusion proteins recognize only the composite recognition site consisting of the target site of the TALE protein and the PvuII recognition sequence (addressed site), but not isolated TALE or PvuII recognition sites (unaddressed sites), even at high excess of protein over DNA and long incubation times. In vitro, their preference for an addressed over an unaddressed site is > 34,000-fold. Moreover, TALE-PvuII fusion proteins are active in cellula with minimal cytotoxicity. PMID:24349308

  15. A damaged DNA binding protein 2 mutation disrupting interaction with proliferating-cell nuclear antigen affects DNA repair and confers proliferation advantage.

    PubMed

    Perucca, Paola; Mocchi, Roberto; Guardamagna, Isabella; Bassi, Elisabetta; Sommatis, Sabrina; Nardo, Tiziana; Prosperi, Ennio; Stivala, Lucia Anna; Cazzalini, Ornella

    2018-06-01

    In mammalian cells, Nucleotide Excision Repair (NER) plays a role in removing DNA damage induced by UV radiation. In Global Genome-NER subpathway, DDB2 protein forms a complex with DDB1 (UV-DDB), recognizing photolesions. During DNA repair, DDB2 interacts directly with PCNA through a conserved region in N-terminal tail and this interaction is important for DDB2 degradation. In this work, we sought to investigate the role of DDB2-PCNA association in DNA repair and cell proliferation after UV-induced DNA damage. To this end, stable clones expressing DDB2 Wt and DDB2 PCNA- were used. We have found that cells expressing a mutant DDB2 show inefficient photolesions removal, and a concomitant lack of binding to damaged DNA in vitro. Unexpected cellular behaviour after DNA damage, such as UV-resistance, increased cell growth and motility were found in DDB2 PCNA- stable cell clones, in which the most significant defects in cell cycle checkpoint were observed, suggesting a role in the new cellular phenotype. Based on these findings, we propose that DDB2-PCNA interaction may contribute to a correct DNA damage response for maintaining genome integrity. Copyright © 2018 Elsevier B.V. All rights reserved.

  16. Raman microspectroscopic study of effects of Na(I) and Mg(II) ions on low pH induced DNA structural changes.

    PubMed

    Muntean, C M; Segers-Nolten, G M J

    2003-01-01

    In this work a confocal Raman microspectrometer is used to investigate the influence of Na(+) and Mg(2+) ions on the DNA structural changes induced by low pH. Measurements are carried out on calf thymus DNA at neutral pH (7) and pH 3 in the presence of low and high concentrations of Na(+) and Mg(2+) ions, respectively. It is found that low concentrations of Na(+) ions do not protect DNA against binding of H(+). High concentrations of monovalent ions can prevent protonation of the DNA double helix. Our Raman spectra show that low concentrations of Mg(2+) ions partly protect DNA against protonation of cytosine (line at 1262 cm(-1)) but do not protect adenine and guanine N(7) against binding of H(+) (characteristic lines at 1304 and 1488 cm(-1), respectively). High concentrations of Mg(2+) can prevent protonation of cytosine and protonation of adenine (disruption of AT pairs). By analyzing the line at 1488 cm(-1), which obtains most of its intensity from a guanine vibration, high magnesium salt protect the N(7) of guanine against protonation. A high salt concentration can prevent protonation of guanine, cytosine, and adenine in DNA. Higher salt concentrations cause less DNA protonation than lower salt concentrations. Magnesium ions are found to be more effective in protecting DNA against binding of H(+) as compared with calcium ions presented in a previous study. Divalent metal cations (Mg(2+), Ca(2+)) are more effective in protecting DNA against protonation than monovalent ions (Na(+)). Copyright 2003 Wiley Periodicals, Inc. Biopolymers (Biospectroscopy) 72: 000-000, 2003

  17. DNA/RNA hybrid substrates modulate the catalytic activity of purified AID.

    PubMed

    Abdouni, Hala S; King, Justin J; Ghorbani, Atefeh; Fifield, Heather; Berghuis, Lesley; Larijani, Mani

    2018-01-01

    Activation-induced cytidine deaminase (AID) converts cytidine to uridine at Immunoglobulin (Ig) loci, initiating somatic hypermutation and class switching of antibodies. In vitro, AID acts on single stranded DNA (ssDNA), but neither double-stranded DNA (dsDNA) oligonucleotides nor RNA, and it is believed that transcription is the in vivo generator of ssDNA targeted by AID. It is also known that the Ig loci, particularly the switch (S) regions targeted by AID are rich in transcription-generated DNA/RNA hybrids. Here, we examined the binding and catalytic behavior of purified AID on DNA/RNA hybrid substrates bearing either random sequences or GC-rich sequences simulating Ig S regions. If substrates were made up of a random sequence, AID preferred substrates composed entirely of DNA over DNA/RNA hybrids. In contrast, if substrates were composed of S region sequences, AID preferred to mutate DNA/RNA hybrids over substrates composed entirely of DNA. Accordingly, AID exhibited a significantly higher affinity for binding DNA/RNA hybrid substrates composed specifically of S region sequences, than any other substrates composed of DNA. Thus, in the absence of any other cellular processes or factors, AID itself favors binding and mutating DNA/RNA hybrids composed of S region sequences. AID:DNA/RNA complex formation and supporting mutational analyses suggest that recognition of DNA/RNA hybrids is an inherent structural property of AID. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Modulation of DNA methylation machineries in japanese rice fish (Oryzias latipes) embryogenesis by ethanol and 5-azacytidine

    USDA-ARS?s Scientific Manuscript database

    As a sequel of our investigations on the impact of epigenome in inducing fetal alcohol spectrum disorder (FASD) phenotypes in Japanese rice fish, we investigated on several DNA methylation machinery genes including DNA methyl transferase 3ba (dnmt3ba) and methyl binding proteins (MBPs), namely, mbdl...

  19. Human ISWI complexes are targeted by SMARCA5 ATPase and SLIDE domains to help resolve lesion-stalled transcription

    PubMed Central

    Aydin, Özge Z.; Marteijn, Jurgen A.; Ribeiro-Silva, Cristina; Rodríguez López, Aida; Wijgers, Nils; Smeenk, Godelieve; van Attikum, Haico; Poot, Raymond A.; Vermeulen, Wim; Lans, Hannes

    2014-01-01

    Chromatin compaction of deoxyribonucleic acid (DNA) presents a major challenge to the detection and removal of DNA damage. Helix-distorting DNA lesions that block transcription are specifically repaired by transcription-coupled nucleotide excision repair, which is initiated by binding of the CSB protein to lesion-stalled RNA polymerase II. Using live cell imaging, we identify a novel function for two distinct mammalian ISWI adenosine triphosphate (ATP)-dependent chromatin remodeling complexes in resolving lesion-stalled transcription. Human ISWI isoform SMARCA5/SNF2H and its binding partners ACF1 and WSTF are rapidly recruited to UV-C induced DNA damage to specifically facilitate CSB binding and to promote transcription recovery. SMARCA5 targeting to UV-C damage depends on transcription and histone modifications and requires functional SWI2/SNF2-ATPase and SLIDE domains. After initial recruitment to UV damage, SMARCA5 re-localizes away from the center of DNA damage, requiring its HAND domain. Our studies support a model in which SMARCA5 targeting to DNA damage-stalled transcription sites is controlled by an ATP-hydrolysis-dependent scanning and proofreading mechanism, highlighting how SWI2/SNF2 chromatin remodelers identify and bind nucleosomes containing damaged DNA. PMID:24990377

  20. Interaction of zanamivir with DNA and RNA: Models for drug DNA and drug RNA bindings

    NASA Astrophysics Data System (ADS)

    Nafisi, Shohreh; Kahangi, Fatemeh Ghoreyshi; Azizi, Ebrahim; Zebarjad, Nader; Tajmir-Riahi, Heidar-Ali

    2007-03-01

    Zanamivir (ZAN) is the first of a new generation of influenza virus-specific drugs known as neuraminidase inhibitors, which acts by interfering with life cycles of influenza viruses A and B. It prevents the virus spreading infection to other cells by blocking the neuraminidase enzyme present on the surface of the virus. The aim of this study was to examine the stability and structural features of calf thymus DNA and yeast RNA complexes with zanamivir in aqueous solution, using constant DNA or RNA concentration (12.5 mM) and various zanamivir/polynucleotide ( P) ratios of 1/20, 1/10, 1/4, and 1/2. FTIR and UV-visible spectroscopy are used to determine the drug external binding modes, the binding constant and the stability of zanamivir-DNA and RNA complexes in aqueous solution. Structural analysis showed major interaction of zanamivir with G-C (major groove) and A-T (minor groove) base pairs and minor perturbations of the backbone PO 2 group with overall binding constants of Kzanamivir-DNA = 1.30 × 10 4 M -1 and Kzanamivir-RNA = 1.38 × 10 4 M -1. The drug interaction induces a partial B to A-DNA transition, while RNA remains in A-conformation.

  1. Coulomb and CH-π interactions in (6-4) photolyase-DNA complex dominate DNA binding and repair abilities.

    PubMed

    Terai, Yuma; Sato, Ryuma; Yumiba, Takahiro; Harada, Ryuhei; Shimizu, Kohei; Toga, Tatsuya; Ishikawa-Fujiwara, Tomoko; Todo, Takeshi; Iwai, Shigenori; Shigeta, Yasuteru; Yamamoto, Junpei

    2018-05-14

    (6-4) Photolyases ((6-4)PLs) are flavoenzymes that repair the carcinogenic UV-induced DNA damage, pyrimidine(6-4)pyrimidone photoproducts ((6-4)PPs), in a light-dependent manner. Although the reaction mechanism of DNA photorepair by (6-4)PLs has been intensively investigated, the molecular mechanism of the lesion recognition remains obscure. We show that a well-conserved arginine residue in Xenopus laevis (6-4)PL (Xl64) participates in DNA binding, through Coulomb and CH-π interactions. Fragment molecular orbital calculations estimated attractive interaction energies of -80-100 kcal mol-1 for the Coulomb interaction and -6 kcal mol-1 for the CH-π interaction, and the loss of either of them significantly reduced the affinity for (6-4)PP-containing oligonucleotides, as well as the quantum yield of DNA photorepair. From experimental and theoretical observations, we formulated a DNA binding model of (6-4)PLs. Based on the binding model, we mutated this Arg in Xl64 to His, which is well conserved among the animal cryptochromes (CRYs), and found that the CRY-type mutant exhibited reduced affinity for the (6-4)PP-containing oligonucleotides, implying the possible molecular origin of the functional diversity of the photolyase/cryptochrome superfamily.

  2. Lithium promotes DNA stability and survival of ischemic retinal neurocytes by upregulating DNA ligase IV.

    PubMed

    Yang, Ying; Wu, Nandan; Tian, Sijia; Li, Fan; Hu, Huan; Chen, Pei; Cai, Xiaoxiao; Xu, Lijun; Zhang, Jing; Chen, Zhao; Ge, Jian; Yu, Keming; Zhuang, Jing

    2016-11-17

    Neurons display genomic fragility and show fragmented DNA in pathological degeneration. A failure to repair DNA breaks may result in cell death or apoptosis. Lithium protects retinal neurocytes following nutrient deprivation or partial nerve crush, but the underlying mechanisms are not well defined. Here we demonstrate that pretreatment with lithium protects retinal neurocytes from ischemia-induced damage and enhances light response in rat retina following ischemia-reperfusion injury. Moreover, we found that DNA nonhomologous end-joining (NHEJ) repair is implicated in this process because in ischemic retinal neurocytes, lithium significantly reduces the number of γ-H2AX foci (well-characterized markers of DNA double-strand breaks in situ) and increases the DNA ligase IV expression level. Furthermore, we also demonstrate that nuclear respiratory factor 1 (Nrf-1) and phosphorylated cyclic AMP-response element binding protein-1 (P-CREB1) bind to ligase IV promoter to cause upregulation of ligase IV in neurocytes. The ischemic upregulation of Nrf-1 and lithium-induced increase of P-CREB1 cooperate to promote transcription of ligase IV. Short hairpin RNAs against Nrf-1 and CREB1 could significantly inhibit the increase in promoter activity and expression of ligase IV observed in the control oligos following lithium treatment in retinal neurocytes. More importantly, ischemic stimulation triggers the expression of ligase IV. Taken together, our results thus reveal a novel mechanism that lithium offers neuroprotection from ischemia-induced damage by enhancing DNA NHEJ repair.

  3. Lithium promotes DNA stability and survival of ischemic retinal neurocytes by upregulating DNA ligase IV

    PubMed Central

    Yang, Ying; Wu, Nandan; Tian, Sijia; Li, Fan; Hu, Huan; Chen, Pei; Cai, Xiaoxiao; Xu, Lijun; Zhang, Jing; Chen, Zhao; Ge, Jian; Yu, Keming; Zhuang, Jing

    2016-01-01

    Neurons display genomic fragility and show fragmented DNA in pathological degeneration. A failure to repair DNA breaks may result in cell death or apoptosis. Lithium protects retinal neurocytes following nutrient deprivation or partial nerve crush, but the underlying mechanisms are not well defined. Here we demonstrate that pretreatment with lithium protects retinal neurocytes from ischemia-induced damage and enhances light response in rat retina following ischemia–reperfusion injury. Moreover, we found that DNA nonhomologous end-joining (NHEJ) repair is implicated in this process because in ischemic retinal neurocytes, lithium significantly reduces the number of γ-H2AX foci (well-characterized markers of DNA double-strand breaks in situ) and increases the DNA ligase IV expression level. Furthermore, we also demonstrate that nuclear respiratory factor 1 (Nrf-1) and phosphorylated cyclic AMP-response element binding protein-1 (P-CREB1) bind to ligase IV promoter to cause upregulation of ligase IV in neurocytes. The ischemic upregulation of Nrf-1 and lithium-induced increase of P-CREB1 cooperate to promote transcription of ligase IV. Short hairpin RNAs against Nrf-1 and CREB1 could significantly inhibit the increase in promoter activity and expression of ligase IV observed in the control oligos following lithium treatment in retinal neurocytes. More importantly, ischemic stimulation triggers the expression of ligase IV. Taken together, our results thus reveal a novel mechanism that lithium offers neuroprotection from ischemia-induced damage by enhancing DNA NHEJ repair. PMID:27853172

  4. Thermodynamic investigation of the binding of dissymmetric pyrenyl-gemini surfactants to DNA.

    PubMed

    Wettig, Shawn D; Deubry, Rubena; Akbar, Javed; Kaur, Tranum; Wang, Haitang; Sheinin, Tatiana; Joseph, Jamie W; Slavcev, Roderick A

    2010-05-14

    Gemini surfactants have demonstrated significant potential for use in constructing non-viral transfection vectors for the delivery of genes into cells to induce protein expression. Previously, two asymmetric gemini surfactants containing pyrenyl groups in one of the alkyl tails of the surfactants were synthesized as fluorescence probes for use in mechanistic studies of the transfection process. Here we present the results of a thermodynamic investigation of the binding interaction(s) between the pyrenyl-modified surfactants and DNA. The thermodynamics of the interactions have been examined using isothermal titration calorimetry, light scattering, zeta potential, and circular dichroism measurements. Distinct differences are observed between the interaction of 12-s-12 vs. the pyrene modified py-s-12 surfactants with DNA; an intercalated binding is found for the py-s-12 surfactants that disrupts the typical interactions observed between DNA and gemini surfactants.

  5. The organophosphate insecticide chlorpyrifos confers its genotoxic effects by inducing DNA damage and cell apoptosis.

    PubMed

    Li, Diqiu; Huang, Qingchun; Lu, Miaoqing; Zhang, Lei; Yang, Zhichuan; Zong, Mimi; Tao, Liming

    2015-09-01

    The organophosphate insecticide chlorpyrifos (CPF) is known to induce neurological effects, malformation and micronucleus formation, persistent developmental disorders, and maternal toxicity in rats and mice. The binding of chlorpyrifos with DNA to produce DNA adducts leads to an increasing social concern about the genotoxic risk of CPF in human, but CPF-induced cytotoxicity through DNA damage and cell apoptosis is not well understood. Here, we quantified the cytotoxicity and potential genotoxicity of CPF using the alkaline comet assay, γH2AX foci formation, and the DNA laddering assay in order to detect DNA damage and apoptosis in human HeLa and HEK293 cells in vitro. Drosophila S2 cells were used as a positive control. The alkaline comet assay showed that sublethal concentrations of CPF induced significant concentration-dependent increases in single-strand DNA breaks in the treated cells compared with the control. The percentage of γH2AX-positive HeLa cells revealed that CPF also causes DNA double-strand breaks in a time-dependent manner. Moreover, DNA fragmentation analysis demonstrated that exposure to CPF induced a significant concentration- and time-dependent increase in cell apoptosis. We conclude that CPF is a strongly genotoxic agent that induces DNA damage and cell apoptosis. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Hypoxia-inducible factor 1 mediates hypoxia-induced cardiomyocyte lipid accumulation by reducing the DNA binding activity of peroxisome proliferator-activated receptor {alpha}/retinoid X receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Belanger, Adam J.; Luo Zhengyu; Vincent, Karen A.

    2007-12-21

    In response to cellular hypoxia, cardiomyocytes adapt to consume less oxygen by shifting ATP production from mitochondrial fatty acid {beta}-oxidation to glycolysis. The transcriptional activation of glucose transporters and glycolytic enzymes by hypoxia is mediated by hypoxia-inducible factor 1 (HIF-1). In this study, we examined whether HIF-1 was involved in the suppression of mitochondrial fatty acid {beta}-oxidation in hypoxic cardiomyocytes. We showed that either hypoxia or adenovirus-mediated expression of a constitutively stable hybrid form (HIF-1{alpha}/VP16) suppressed mitochondrial fatty acid metabolism, as indicated by an accumulation of intracellular neutral lipid. Both treatments also reduced the mRNA levels of muscle carnitine palmitoyltransferasemore » I which catalyzes the rate-limiting step in the mitochondrial import of fatty acids for {beta}-oxidation. Furthermore, adenovirus-mediated expression of HIF-1{alpha}/VP16 in cardiomyocytes under normoxic conditions also mimicked the reduction in the DNA binding activity of peroxisome proliferator-activated receptor {alpha} (PPAR{alpha})/retinoid X receptor (RXR), in the presence or absence of a PPAR{alpha} ligand. These results suggest that HIF-1 may be involved in hypoxia-induced suppression of fatty acid metabolism in cardiomyocytes by reducing the DNA binding activity of PPAR{alpha}/RXR.« less

  7. TNF-{alpha} promotes cell survival through stimulation of K{sup +} channel and NF{kappa}B activity in corneal epithelial cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang Ling; Reinach, Peter; Lu, Luo

    2005-11-15

    Tumor necrosis factor (TNF-{alpha}) in various cell types induces either cell death or mitogenesis through different signaling pathways. In the present study, we determined in human corneal epithelial cells how TNF-{alpha} also promotes cell survival. Human corneal epithelial (HCE) cells were cultured in DMEM/F-12 medium containing 10% FBS. TNF-{alpha} stimulation induced activation of a voltage-gated K{sup +} channel detected by measuring single channel activity using patch clamp techniques. The effect of TNF-{alpha} on downstream events included NF{kappa}B nuclear translocation and increases in DNA binding activities, but did not elicit ERK, JNK, or p38 limb signaling activation. TNF-{alpha} induced increases inmore » p21 expression resulting in partial cell cycle attenuation in the G{sub 1} phase. Cell cycle progression was also mapped by flow cytometer analysis. Blockade of TNF-{alpha}-induced K{sup +} channel activity effectively prevented NF{kappa}B nuclear translocation and binding to DNA, diminishing the cell-survival protective effect of TNF-{alpha}. In conclusion, TNF-{alpha} promotes survival of HCE cells through sequential stimulation of K{sup +} channel and NF{kappa}B activities. This response to TNF-{alpha} is dependent on stimulating K{sup +} channel activity because following suppression of K{sup +} channel activity TNF-{alpha} failed to activate NF{kappa}B nuclear translocation and binding to nuclear DNA.« less

  8. RRR-alpha-tocopheryl succinate inhibits EL4 thymic lymphoma cell growth by inducing apoptosis and DNA synthesis arrest.

    PubMed

    Yu, W; Sanders, B G; Kline, K

    1997-01-01

    RRR-alpha-tocopheryl succinate (vitamin E succinate, VES) treatment of murine EL4 T lymphoma cells induced the cells to undergo apoptosis. After 48 hours of VES treatment at 20 micrograms/ml, 95% of cells were apoptotic. Evidence for the induction of apoptosis by VES treatments is based on staining of DNA for detection of chromatin condensation/fragmentation, two-color flow-cytometric analyses of DNA content, and end-labeled DNA and electrophoretic analyses for detection of DNA ladder formation. VES-treated EL4 cells were blocked in the G1 cell cycle phase; however, apoptotic cells came from all cell cycle phases. Analyses of mRNA expression of genes involved in apoptosis revealed decreased c-myc and increased bcl-2, c-fos, and c-jun mRNAs within three to six hours after treatment. Western analyses showed increased c-Jun, c-Fos, and Bcl-2 protein levels. Electrophoretic mobility shift assays showed increased AP-1 binding at 6, 12, and 24 hours after treatment and decreased c-Myc binding after 12 and 24 hours of VES treatment. Treatments of EL4 cells with VES+RRR-alpha-to-copherol reduced apoptosis without effecting DNA synthesis arrest. Treatments of EL4 cells with VES+rac-6-hydroxyl-2, 5,7,8-tetramethyl-chroman-2-carboxylic acid, butylated hydroxytoluene, or butylated hydroxyanisole had no effect on apoptosis or DNA synthesis arrest caused by VES treatments. Analyses of bcl-2, c-myc, c-jun, and c-fos mRNA levels in cells receiving VES + RRR-alpha-tocopherol treatments showed no change from cells receiving VES treatments alone, implying that these changes are correlated with VES treatments but are not causal for apoptosis. However, treatments with VES + RRR-alpha-tocopherol decreased AP-1 binding to consensus DNA oligomer, suggesting AP-1 involvement in apoptosis induced by VES treatments.

  9. Radiation-induced tetramer-to-dimer transition of Escherichia coli lactose repressor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Goffinont, S.; Davidkova, M.; Spotheim-Maurizot, M., E-mail: spotheim@cnrs-orleans.fr

    2009-08-21

    The wild type lactose repressor of Escherichia coli is a tetrameric protein formed by two identical dimers. They are associated via a C-terminal 4-helix bundle (called tetramerization domain) whose stability is ensured by the interaction of leucine zipper motifs. Upon in vitro {gamma}-irradiation the repressor losses its ability to bind the operator DNA sequence due to damage of its DNA-binding domains. Using an engineered dimeric repressor for comparison, we show here that irradiation induces also the change of repressor oligomerisation state from tetramer to dimer. The splitting of the tetramer into dimers can result from the oxidation of the leucinemore » residues of the tetramerization domain.« less

  10. Human XPA and RPA DNA repair proteins participate in specific recognition of triplex-induced helical distortions

    NASA Astrophysics Data System (ADS)

    Vasquez, Karen M.; Christensen, Jesper; Li, Lei; Finch, Rick A.; Glazer, Peter M.

    2002-04-01

    Nucleotide excision repair (NER) plays a central role in maintaining genomic integrity by detecting and repairing a wide variety of DNA lesions. Xeroderma pigmentosum complementation group A protein (XPA) is an essential component of the repair machinery, and it is thought to be involved in the initial step as a DNA damage recognition and/or confirmation factor. Human replication protein A (RPA) and XPA have been reported to interact to form a DNA damage recognition complex with greater specificity for damaged DNA than XPA alone. The mechanism by which these two proteins recognize such a wide array of structures resulting from different types of DNA damage is not known. One possibility is that they recognize a common feature of the lesions, such as distortions of the helical backbone. We have tested this idea by determining whether human XPA and RPA proteins can recognize the helical distortions induced by a DNA triple helix, a noncanonical DNA structure that has been shown to induce DNA repair, mutagenesis, and recombination. We measured binding of XPA and RPA, together or separately, to substrates containing triplexes with three, two, or no strands covalently linked by psoralen conjugation and photoaddition. We found that RPA alone recognizes all covalent triplex structures, but also forms multivalent nonspecific DNA aggregates at higher concentrations. XPA by itself does not recognize the substrates, but it binds them in the presence of RPA. Addition of XPA decreases the nonspecific DNA aggregate formation. These results support the hypothesis that the NER machinery is targeted to helical distortions and demonstrate that RPA can recognize damaged DNA even without XPA.

  11. A Monofunctional Platinum Complex Coordinated to a Rhodium Metalloinsertor Selectively Binds Mismatched DNA in the Minor Groove

    PubMed Central

    Weidmann, Alyson G.; Barton, Jacqueline K.

    2015-01-01

    We report the synthesis and characterization of a bimetallic complex derived from a new family of potent and selective metalloinsertors containing an unusual Rh—O axial coordination. This complex incorporates a monofunctional platinum center containing only one labile site for coordination to DNA, rather than two, and coordinates DNA non-classically through adduct formation in the minor groove. This conjugate displays bifunctional, interdependent binding of mismatched DNA via metalloinsertion at a mismatch as well as covalent platinum binding. DNA sequencing experiments revealed that the preferred site of platinum coordination is not the traditional N7-guanine site in the major groove, but rather N3-adenine in the minor groove. The complex also displays enhanced cytotoxicity in mismatch repair-deficient and mismatch repair-proficient human colorectal carcinoma cell lines compared to the chemotherapeutic cisplatin, and triggers cell death via an apoptotic pathway, rather than the necrotic pathway induced by rhodium metalloinsertors. PMID:26397309

  12. A monofunctional platinum complex coordinated to a rhodium metalloinsertor selectively binds mismatched DNA in the minor groove.

    PubMed

    Weidmann, Alyson G; Barton, Jacqueline K

    2015-10-05

    We report the synthesis and characterization of a bimetallic complex derived from a new family of potent and selective metalloinsertors containing an unusual Rh-O axial coordination. This complex incorporates a monofunctional platinum center containing only one labile site for coordination to DNA, rather than two, and coordinates DNA nonclassically through adduct formation in the minor groove. This conjugate displays bifunctional, interdependent binding of mismatched DNA via metalloinsertion at a mismatch as well as covalent platinum binding. DNA sequencing experiments revealed that the preferred site of platinum coordination is not the traditional N7-guanine site in the major groove, but rather N3-adenine in the minor groove. The complex also displays enhanced cytotoxicity in mismatch repair-deficient and mismatch repair-proficient human colorectal carcinoma cell lines compared to the chemotherapeutic cisplatin, and it triggers cell death via an apoptotic pathway, rather than the necrotic pathway induced by rhodium metalloinsertors.

  13. Improved bioactivity of G-rich triplex-forming oligonucleotides containing modified guanine bases

    PubMed Central

    Rogers, Faye A; Lloyd, Janice A; Tiwari, Meetu Kaushik

    2014-01-01

    Triplex structures generated by sequence-specific triplex-forming oligonucleotides (TFOs) have proven to be promising tools for gene targeting strategies. In addition, triplex technology has been highly utilized to study the molecular mechanisms of DNA repair, recombination and mutagenesis. However, triplex formation utilizing guanine-rich oligonucleotides as third strands can be inhibited by potassium-induced self-association resulting in G-quadruplex formation. We report here that guanine-rich TFOs partially substituted with 8-aza-7-deaza-guanine (PPG) have improved target site binding in potassium compared with TFOs containing the natural guanine base. We designed PPG-substituted TFOs to bind to a polypurine sequence in the supFG1 reporter gene. The binding efficiency of PPG-substituted TFOs to the target sequence was analyzed using electrophoresis mobility gel shift assays. We have determined that in the presence of potassium, the non-substituted TFO, AG30 did not bind to its target sequence, however binding was observed with the PPG-substituted AG30 under conditions with up to 140 mM KCl. The PPG-TFOs were able to maintain their ability to induce genomic modifications as measured by an assay for gene-targeted mutagenesis. In addition, these compounds were capable of triplex-induced DNA double strand breaks, which resulted in activation of apoptosis. PMID:25483840

  14. Pseudomonas aeruginosa AmrZ Binds to Four Sites in the algD Promoter, Inducing DNA-AmrZ Complex Formation and Transcriptional Activation.

    PubMed

    Xu, Binjie; Soukup, Randal J; Jones, Christopher J; Fishel, Richard; Wozniak, Daniel J

    2016-10-01

    During late stages of cystic fibrosis pulmonary infections, Pseudomonas aeruginosa often overproduces the exopolysaccharide alginate, protecting the bacterial community from host immunity and antimicrobials. The transcription of the alginate biosynthesis operon is under tight control by a number of factors, including AmrZ, the focus of this study. Interestingly, multiple transcription factors interact with the far-upstream region of this promoter (PalgD), in which one AmrZ binding site has been identified previously. The mechanisms of AmrZ binding and subsequent activation remain unclear and require more-detailed investigation. In this study, in-depth examinations elucidated four AmrZ binding sites, and their disruption eliminated AmrZ binding and promoter activation. Furthermore, our in vitro fluorescence resonance energy transfer experiments suggest that AmrZ holds together multiple binding sites in PalgD and thereafter induces the formation of higher-order DNA-AmrZ complexes. To determine the importance of interactions between those AmrZ oligomers in the cell, a DNA phasing experiment was performed. PalgD transcription was significantly impaired when the relative phase between AmrZ binding sites was reversed (5 bp), while a full-DNA-turn insertion (10 bp) restored promoter activity. Taken together, the investigations presented here provide a deeper mechanistic understanding of AmrZ-mediated binding to PalgD IMPORTANCE: Overproduction of the exopolysaccharide alginate provides protection to Pseudomonas aeruginosa against antimicrobial treatments and is associated with chronic P. aeruginosa infections in the lungs of cystic fibrosis patients. In this study, we combined a variety of microbiological, genetic, biochemical, and biophysical approaches to investigate the activation of the alginate biosynthesis operon promoter by a key transcription factor named AmrZ. This study has provided important new information on the mechanism of activation of this extremely complex promoter. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  15. The type III effector HsvG of the gall-forming Pantoea agglomerans mediates expression of the host gene HSVGT.

    PubMed

    Nissan, Gal; Manulis-Sasson, Shulamit; Chalupowicz, Laura; Teper, Doron; Yeheskel, Adva; Pasmanik-Chor, Metsada; Sessa, Guido; Barash, Isaac

    2012-02-01

    The type III effector HsvG of the gall-forming Pantoea agglomerans pv. gypsophilae is a DNA-binding protein that is imported to the host nucleus and involved in host specificity. The DNA-binding region of HsvG was delineated to 266 amino acids located within a secondary structure region near the N-terminus of the protein but did not display any homology to canonical DNA-binding motifs. A binding site selection procedure was used to isolate a target gene of HsvG, named HSVGT, in Gypsophila paniculata. HSVGT is a predicted acidic protein of the DnaJ family with 244 amino acids. It harbors characteristic conserved motifs of a eukaryotic transcription factor, including a bipartite nuclear localization signal, zinc finger, and leucine zipper DNA-binding motifs. Quantitative real-time polymerase chain reaction analysis demonstrated that HSVGT transcription is specifically induced in planta within 2 h after inoculation with the wild-type P. agglomerans pv. gypsophilae compared with the hsvG mutant. Induction of HSVGT reached a peak of sixfold at 4 h after inoculation and progressively declined thereafter. Gel-shift assay demonstrated that HsvG binds to the HSVGT promoter, indicating that HSVGT is a direct target of HsvG. Our results support the hypothesis that HsvG functions as a transcription factor in gypsophila.

  16. Metabolic activation and nucleic acid binding of acetaminophen and related arylamine substrates by the respiratory burst of human granulocytes.

    PubMed

    Corbett, M D; Corbett, B R; Hannothiaux, M H; Quintana, S J

    1989-01-01

    Following stimulation with phorbol myristate acetate, human granulocytes were found to incorporate acetaminophen, p-phenetidine, p-aminophenol, and p-chloroaniline into cellular DNA and RNA. Phenacetin was not incorporated into nucleic acid or metabolized by such activated granulocytes. None of the substrates gave nucleic acid binding if the granulocyte cultures were not induced to undergo the respiratory burst. Additional studies on the binding of acetaminophen to DNA and RNA were made by use of both ring-14C-labeled and carbonyl-14C-labeled forms of this substrate. The finding that equivalent amounts of these two labeled acetaminophen substrates were bound to cellular DNA demonstrated that the intact acetaminophen molecule was incorporated into DNA. On the other hand, the finding that excess ring-14C-labeled acetaminophen was incorporated into cellular RNA implies partial hydrolysis of the acetaminophen substrate prior to RNA binding. Evidence was presented which strongly indicates that the nucleic acid binding of the substrates was covalent in nature. The inability of the respiratory burst to result in the binding of phenacetin to nucleic acid suggests that arylamides are not normally activated or metabolized by activated granulocytes. Acetaminophen is an exception to the recalcitrance of arylamides to such bioactivation processes because it also possesses the phenolic functional group, which, like the arylamine group, is oxidized by certain reactive oxygen species. Myeloperoxidase appears to be much more important in the binding of acetaminophen to DNA than it is in the DNA binding of arylamines in general. The role of the respiratory burst in causing the bioactivation of certain arylamines, which are not normally genotoxic via the more usual microsomal activation pathways, was extended to include certain amide substrates such as acetaminophen.

  17. DNA wrapping and distortion by an oligomeric homeodomain protein.

    PubMed

    Williams, Hannah; Jayaraman, Padma-Sheela; Gaston, Kevin

    2008-10-31

    Many transcription factors alter DNA or chromatin structure. Changes in chromatin structure are often brought about by the recruitment of chromatin-binding proteins, chromatin-modifying proteins, or other transcription co-activator or co-repressor proteins. However, some transcription factors form oligomeric assemblies that may themselves induce changes in DNA conformation and chromatin structure. The proline-rich homeodomain (PRH/Hex) protein is a transcription factor that regulates cell differentiation and cell proliferation, and has multiple roles in embryonic development. Earlier, we showed that PRH can repress transcription by multiple mechanisms, including the recruitment of co-repressor proteins belonging to the TLE family of chromatin-binding proteins. Our in vivo crosslinking studies have shown that PRH forms oligomeric complexes in cells and a variety of biophysical techniques suggest that the protein forms octamers. However, as yet we have little knowledge of the role played by PRH oligomerisation in the regulation of promoter activity or of the architecture of promoters that are regulated directly by PRH in cells. Here, we compare the binding of PRH and the isolated PRH homeodomain to DNA fragments with single and multiple PRH sites, using gel retardation assays and DNase I and chemical footprinting. We show that the PRH oligomer binds to multiple sites within the human Goosecoid promoter with high affinity and that the binding of PRH brings about DNA distortion. We suggest that PRH octamers wrap DNA in order to bring about transcriptional repression.

  18. Eicosapentaenoic acid induces DNA demethylation in carcinoma cells through a TET1-dependent mechanism.

    PubMed

    Ceccarelli, Veronica; Valentini, Virginia; Ronchetti, Simona; Cannarile, Lorenza; Billi, Monia; Riccardi, Carlo; Ottini, Laura; Talesa, Vincenzo Nicola; Grignani, Francesco; Vecchini, Alba

    2018-05-14

    In cancer cells, global genomic hypomethylation is found together with localized hypermethylation of CpG islands within the promoters and regulatory regions of silenced tumor suppressor genes. Demethylating agents may reverse hypermethylation, thus promoting gene re-expression. Unfortunately, demethylating strategies are not efficient in solid tumor cells. DNA demethylation is mediated by ten-eleven translocation enzymes (TETs). They sequentially convert 5-methylcytosine (5mC) to 5-hydroxymethylcytosine (5hmC), which is associated with active transcription; 5-formylcytosine; and finally, 5-carboxylcytosine. Although α-linolenic acid, eicosapentaenoic acid (EPA), and docosahexaenoic acid, the major n-3 polyunsaturated fatty acids, have anti-cancer effects, their action, as DNA-demethylating agents, has never been investigated in solid tumor cells. Here, we report that EPA demethylates DNA in hepatocarcinoma cells. EPA rapidly increases 5hmC on DNA, inducing p21 Waf1/Cip1 gene expression, which slows cancer cell-cycle progression. We show that the underlying molecular mechanism involves TET1. EPA simultaneously binds peroxisome proliferator-activated receptor γ (PPARγ) and retinoid X receptor α (RXRα), thus promoting their heterodimer and inducing a PPARγ-TET1 interaction. They generate a TET1-PPARγ-RXRα protein complex, which binds to a hypermethylated CpG island on the p21 gene, where TET1 converts 5mC to 5hmC. In an apparent shuttling motion, PPARγ and RXRα leave the DNA, whereas TET1 associates stably. Overall, EPA directly regulates DNA methylation levels, permitting TET1 to exert its anti-tumoral function.-Ceccarelli, V., Valentini, V., Ronchetti, S., Cannarile, L., Billi, M., Riccardi, C., Ottini, L., Talesa, V. N., Grignani, F., Vecchini, A., Eicosapentaenoic acid induces DNA demethylation in carcinoma cells through a TET1-dependent mechanism.

  19. Interaction of antitumor drug Sn(CH 3) 2Cl 2 with DNA and RNA

    NASA Astrophysics Data System (ADS)

    Nafisi, Shohreh; Sobhanmanesh, Amir; Esm-Hosseini, Majid; Alimoghaddam, Kamran; Tajmir-Riahi, Heidar Ali

    2005-08-01

    Sn(CH3)2Cl2 exerts its antitumor activity in a specific way. Unlike anticancer cis-Pt(NH3)2Cl2 drug which binds strongly to the nitrogen atoms of DNA bases, Sn(CH3)2Cl2 shows no major affinity towards base binding. Thus, the mechanism of action by which tinorganometallic compounds exert antitumor activity would be different from that of the cisplatin drug. The aim of this study was to examine the binding of Sn(CH3)2Cl2 with calf thymus DNA and yeast RNA in aqueous solutions at pH 7.1-6.6 with constant concentrations of DNA and RNA and various molar ratios of Sn(CH3)2Cl2/DNA (phosphate) and Sn(CH3)2Cl2/RNA of 1/40, 1/20, 1/10, 1/5. Fourier transform infrared (FTIR) and UV-visible difference spectroscopic methods were used to determine the Sn(CH3)2Cl2 binding mode, binding constant, sequence selectivity and structural variations of Sn(CH3)2Cl2/DNA and Sn(CH3)2Cl2/RNA complexes in aqueous solution. Sn(CH3)2Cl2 hydrolyzes in water to give Sn(CH3)2(OH)2 and [Sn(CH3)2(OH)(H2O)n]+ species. Spectroscopic evidence showed that interaction occurred mainly through (CH3)2Sn(IV) hydroxide and polynucleotide backbone phosphate group with overall binding constant of K(Sn(CH3)2Cl2-DNA)=1.47×105 M-1 and K(Sn(CH3)2Cl2-RNA)=7.33×105 M-1. Sn(CH3)2Cl2 induced no biopolymer conformational changes with DNA remaining in the B-family structure and RNA in A-conformation upon drug complexation.

  20. Structural and Functional Analysis of DDX41: a bispecific immune receptor for DNA and cyclic dinucleotide

    PubMed Central

    Omura, Hiroki; Oikawa, Daisuke; Nakane, Takanori; Kato, Megumi; Ishii, Ryohei; Ishitani, Ryuichiro; Tokunaga, Fuminori; Nureki, Osamu

    2016-01-01

    In the innate immune system, pattern recognition receptors (PRRs) specifically recognize ligands derived from bacteria or viruses, to trigger the responsible downstream pathways. DEAD box protein 41 (DDX41) is an intracellular PRR that triggers the downstream pathway involving the adapter STING, the kinase TBK1, and the transcription factor IRF3, to activate the type I interferon response. DDX41 is unique in that it recognizes two different ligands; i.e., double-stranded DNA (dsDNA) and cyclic dinucleotides (CDN), via its DEAD domain. However, the structural basis for the ligand recognition by the DDX41 DEAD domain has remained elusive. Here, we report two crystal structures of the DDX41 DEAD domain in apo forms, at 1.5 and 2.2 Å resolutions. A comparison of the two crystal structures revealed the flexibility in the ATP binding site, suggesting its formation upon ATP binding. Structure-guided functional analyses in vitro and in vivo demonstrated the overlapped binding surface for dsDNA and CDN, which is distinct from the ATP-binding site. We propose that the structural rearrangement of the ATP binding site is crucial for the release of ADP, enabling the fast turnover of DDX41 for the dsDNA/CDN-induced STING activation pathway. PMID:27721487

  1. From non-covalent binding to irreversible DNA lesions: nile blue and nile red as photosensitizing agents

    PubMed Central

    Gattuso, Hugo; Besancenot, Vanessa; Grandemange, Stéphanie; Marazzi, Marco; Monari, Antonio

    2016-01-01

    We report a molecular modeling study, coupled with spectroscopy experiments, on the behavior of two well known organic dyes, nile blue and nile red, when interacting with B-DNA. In particular, we evidence the presence of two competitive binding modes, for both drugs. However their subsequent photophysical behavior is different and only nile blue is able to induce DNA photosensitization via an electron transfer mechanism. Most notably, even in the case of nile blue, its sensitization capabilities strongly depend on the environment resulting in a single active binding mode: the minor groove. Fluorescence spectroscopy confirms the presence of competitive interaction modes for both sensitizers, while the sensitization via electron transfer, is possible only in the case of nile blue. PMID:27329409

  2. Favorable 2'-substitution in the loop region of a thrombin-binding DNA aptamer.

    PubMed

    Awachat, Ragini; Wagh, Atish A; Aher, Manisha; Fernandes, Moneesha; Kumar, Vaijayanti A

    2018-06-01

    Simple 2'-OMe-chemical modification in the loop region of the 15mer G-rich DNA sequence GGTTGGTGTGGTTGG is reported. The G-quadruplex structure of this thrombin-binding aptamer (TBA), is stabilized by single modifications (T → 2'-OMe-U), depending on the position of the modification. The structural stability also renders significantly increased inhibition of thrombin-induced fibrin polymerization, a process closely associated with blood-clotting. Copyright © 2018 Elsevier Ltd. All rights reserved.

  3. Interaction investigations of HipA binding to HipB dimer and HipB dimer + DNA complex: a molecular dynamics simulation study.

    PubMed

    Li, Chaoqun; Wang, Yaru; Wang, Yan; Chen, Guangju

    2013-11-01

    We carried out molecular dynamics simulations and free energy calculations for a series of ternary and diplex models for the HipA protein, HipB dimer, and DNA molecule to address the mechanism of HipA sequestration and the binding order of events from apo HipB/HipA to 2HipA + HipB dimer + DNA complex. The results revealed that the combination of DNA with the HipB dimer is energetically favorable for the combination of HipB dimer with HipA protein. The binding of DNA to HipB dimer induces a long-range allosteric communication from the HipB2 -DNA interface to the HipA-HipB2 interface, which involves the closeness of α1 helices of HipB dimer to HipA protein and formations of extra hydrogen bonds in the HipA-HipB2 interface through the extension of α2/3 helices in the HipB dimer. These simulated results suggested that the DNA molecule, as a regulative media, modulates the HipB dimer conformation, consequently increasing the interactions of HipB dimer with the HipA proteins, which explains the mechanism of HipA sequestration reported by the previous experiment. Simultaneously, these simulations also explored that the thermodynamic binding order in a simulated physiological environment, that is, the HipB dimer first bind to DNA to form HipB dimer + DNA complex, then capturing strongly the HipA proteins to form a ternary complex, 2HipA + HipB dimer + DNA, for sequestrating HipA in the nucleoid. Copyright © 2013 John Wiley & Sons, Ltd.

  4. A monoclonal antibody against PDGF B-chain inhibits PDGF-induced DNA synthesis in C3H fibroblasts and prevents binding of PDGF to its receptor.

    PubMed

    Vassbotn, F S; Langeland, N; Hagen, I; Holmsen, H

    1990-09-01

    A monoclonal antibody (MAb 6D11) against platelet-derived growth factor (PDGF) was studied. We found that the MAb 6D11 in concentrations equimolar to PDGF blocked the [3H]thymidine incorporation in C3H/10T1/2 C18 fibroblasts stimulated by PDGF B-B and PDGF A-B. This inhibition was overcome by high doses of PDGF. The [3H]thymidine incorporation stimulated by other growth factors (aFGF, bFGF and bombesin) was not inhibited by the antibody. The MAb 6D11 blocked receptor binding of PDGF B-B, but not PDGF A-A. These findings suggest that the MAb 6D11 abolishes PDGF-induced DNA synthesis by blocking PDGF receptor binding. In this communication we demonstrate an isoform-specific monoclonal antibody against PDGF.

  5. NLRC3, a member of the NLR family of proteins, is a negative regulator of innate immune signaling induced by the DNA sensor STING.

    PubMed

    Zhang, Lu; Mo, Jinyao; Swanson, Karen V; Wen, Haitao; Petrucelli, Alex; Gregory, Sean M; Zhang, Zhigang; Schneider, Monika; Jiang, Yan; Fitzgerald, Katherine A; Ouyang, Songying; Liu, Zhi-Jie; Damania, Blossom; Shu, Hong-Bing; Duncan, Joseph A; Ting, Jenny P-Y

    2014-03-20

    Stimulator of interferon genes (STING, also named MITA, MYPS, or ERIS) is an intracellular DNA sensor that induces type I interferon through its interaction with TANK-binding kinase 1 (TBK1). Here we found that the nucleotide-binding, leucine-rich-repeat-containing protein, NLRC3, reduced STING-dependent innate immune activation in response to cytosolic DNA, cyclic di-GMP (c-di-GMP), and DNA viruses. NLRC3 associated with both STING and TBK1 and impeded STING-TBK1 interaction and downstream type I interferon production. By using purified recombinant proteins, we found NLRC3 to interact directly with STING. Furthermore, NLRC3 prevented proper trafficking of STING to perinuclear and punctated region, known to be important for its activation. In animals, herpes simplex virus 1 (HSV-1)-infected Nlrc3(-/-) mice exhibited enhanced innate immunity and reduced morbidity and viral load. This demonstrates the intersection of two key pathways of innate immune regulation, NLR and STING, to fine tune host response to intracellular DNA, DNA virus, and c-di-GMP. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Progerin sequestration of PCNA promotes replication fork collapse and mislocalization of XPA in laminopathy-related progeroid syndromes.

    PubMed

    Hilton, Benjamin A; Liu, Ji; Cartwright, Brian M; Liu, Yiyong; Breitman, Maya; Wang, Youjie; Jones, Rowdy; Tang, Hui; Rusinol, Antonio; Musich, Phillip R; Zou, Yue

    2017-09-01

    Hutchinson-Gilford progeria syndrome (HGPS) is a rare genetic disorder that is caused by a point mutation in the LMNA gene, resulting in production of a truncated farnesylated-prelamin A protein (progerin). We previously reported that XPA mislocalized to the progerin-induced DNA double-strand break (DSB) sites, blocking DSB repair, which led to DSB accumulation, DNA damage responses, and early replication arrest in HGPS. In this study, the XPA mislocalization to DSBs occurred at stalled or collapsed replication forks, concurrent with a significant loss of PCNA at the forks, whereas PCNA efficiently bound to progerin. This PCNA sequestration likely exposed ds-ssDNA junctions at replication forks for XPA binding. Depletion of XPA or progerin each significantly restored PCNA at replication forks. Our results suggest that although PCNA is much more competitive than XPA in binding replication forks, PCNA sequestration by progerin may shift the equilibrium to favor XPA binding. Furthermore, we demonstrated that progerin-induced apoptosis could be rescued by XPA, suggesting that XPA-replication fork binding may prevent apoptosis in HGPS cells. Our results propose a mechanism for progerin-induced genome instability and accelerated replicative senescence in HGPS.-Hilton, B. A., Liu, J., Cartwright, B. M., Liu, Y., Breitman, M., Wang, Y., Jones, R., Tang, H., Rusinol, A., Musich, P. R., Zou, Y. Progerin sequestration of PCNA promotes replication fork collapse and mislocalization of XPA in laminopathy-related progeroid syndromes. © FASEB.

  7. Binding of the Zn2+ ion to ferric uptake regulation protein from E. coli and the competition with Fe2+ binding: a molecular modeling study of the effect on DNA binding and conformational changes of Fur

    NASA Astrophysics Data System (ADS)

    Jabour, Salih; Hamed, Mazen Y.

    2009-04-01

    The three dimensional structure of Ferric uptake regulation protein dimer from E. coli, determined by molecular modeling, was docked on a DNA fragment (iron box) and Zn2+ ions were added in two steps. The first step involved the binding of one Zn2+ ion to what is known as the zinc site which consists of the residues Cys 92, Cys 95, Asp 137, Asp141, Arg139, Glu 140, His 145 and His 143 with an average metal-Nitrogen distance of 2.5 Å and metal-oxygen distance of 3.1-3.2 Å. The second Zn2+ ion is bound to the iron activating site formed from the residues Ile 50, His 71, Asn 72, Gly 97, Asp 105 and Ala 109. The binding of the second Zn2+ ion strengthened the binding of the first ion as indicated by the shortening of the zinc-residue distances. Fe2+, when added to the complex consisting of 2Zn2+/Fur dimer/DNA, replaced the Zn2+ ion in the zinc site and when a second Fe2+ was added, it replaced the second zinc ion in the iron activating site. The binding of both zinc and iron ions induced a similar change in Fur conformations, but shifted residues closer to DNA in a different manner. This is discussed along with a possible role for the Zn2+ ion in the Fur dimer binding of DNA in its repressor activity.

  8. Erythroblast Transformation by the Friend Spleen Focus-Forming Virus Is Associated with a Block in Erythropoietin-Induced STAT1 Phosphorylation and DNA Binding and Correlates with High Expression of the Hematopoietic Phosphatase SHP-1

    PubMed Central

    Nishigaki, Kazuo; Hanson, Charlotte; Ohashi, Takashi; Spadaccini, Angelo; Ruscetti, Sandra

    2006-01-01

    Infection of mice with Friend spleen focus-forming virus (SFFV) results in a multistage erythroleukemia. In the first stage, the SFFV envelope glycoprotein interacts with the erythropoietin receptor and a short form of the receptor tyrosine kinase sf-Stk, resulting in constitutive activation of signal transducing molecules and the development of erythropoietin (Epo)-independent erythroid hyperplasia and polycythemia. The second stage results from the outgrowth of a rare virus-infected erythroid cell that expresses nonphysiological levels of the myeloid transcription factor PU.1. These cells exhibit a differentiation block and can be grown as murine erythroleukemia (MEL) cell lines. In this study, we examined SFFV MEL cells to determine whether their transformed phenotype was associated with a block in the activation of any Epo signal-transducing molecules. Our studies indicate that Epo- or SFFV-induced activation of STAT1/3 DNA binding activity is blocked in SFFV MEL cells. The block is at the level of tyrosine phosphorylation of STAT1, although Jak2 phosphorylation is not blocked in these cells. In contrast to Epo, alpha interferon can induce STAT1 phosphorylation and DNA binding in SFFV MEL cells. The SFFV-transformed cells were shown to express elevated levels of the hematopoietic phosphatase SHP-1, and treatment of the cells with a phosphatase inhibitor restored STAT1 tyrosine phosphorylation. MEL cells derived from Friend murine leukemia virus (MuLV) or ME26 MuLV-infected mice, which do not express PU.1, express lower levels of SHP-1 and are not blocked in STAT1/3 DNA-binding activity. Our studies suggest that SFFV-infected erythroid cells become transformed when differentiation signals activated by STAT1/3 are blocked due to high SHP-1 levels induced by inappropriate expression of the PU.1 protein. PMID:16731906

  9. Diarctigenin, a lignan constituent from Arctium lappa, down-regulated zymosan-induced transcription of inflammatory genes through suppression of DNA binding ability of nuclear factor-kappaB in macrophages.

    PubMed

    Kim, Byung Hak; Hong, Seong Su; Kwon, Soon Woo; Lee, Hwa Young; Sung, Hyeran; Lee, In-Jeong; Hwang, Bang Yeon; Song, Sukgil; Lee, Chong-Kil; Chung, Daehyun; Ahn, Byeongwoo; Nam, Sang-Yoon; Han, Sang-Bae; Kim, Youngsoo

    2008-11-01

    Diarctigenin was previously isolated as an inhibitor of nitric oxide (NO) production in macrophages from the seeds of Arctium lappa used as an alternative medicine for the treatment of inflammatory disorders. However, little is known about the molecular basis of these effects. Here, we demonstrated that diarctigenin inhibited the production of NO, prostaglandin E(2), tumor necrosis factor-alpha, and interleukin (IL)-1beta and IL-6 with IC(50) values of 6 to 12 miciroM in zymosan- or lipopolysaccharide-(LPS) activated macrophages. Diarctigenin attenuated zymosan-induced mRNA synthesis of inducible NO synthase (iNOS) and also inhibited promoter activities of iNOS and cytokine genes in the cells. Because nuclear factor (NF)-kappaB plays a pivotal role in inflammatory gene transcription, we next investigated the effect of diarctigenin on NF-kappaB activation. Diarctigenin inhibited the transcriptional activity and DNA binding ability of NF-kappaB in zymosan-activated macrophages but did not affect the degradation and phosphorylation of inhibitory kappaB (IkappaB) proteins. Moreover, diarctigenin suppressed expression vector NF-kappaB p65-elicited NF-kappaB activation and also iNOS promoter activity, indicating that the compound could directly target an NF-kappa-activating signal cascade downstream of IkappaB degradation and inhibit NF-kappaB-regulated iNOS expression. Diarctigenin also inhibited the in vitro DNA binding ability of NF-kappaB but did not affect the nuclear import of NF-kappaB p65 in the cells. Taken together, diarctigenin down-regulated zymosan- or LPS-induced inflammatory gene transcription in macrophages, which was due to direct inhibition of the DNA binding ability of NF-kappaB. Finally, this study provides a pharmacological potential of diarctigenin in the NF-kappaB-associated inflammatory disorders.

  10. Strip biosensor for amplified detection of nerve growth factor-beta based on a molecular translator and catalytic DNA circuit.

    PubMed

    Liu, Jun; Lai, Ting; Mu, Kejie; Zhou, Zheng

    2014-10-07

    We have demonstrated a new visual detection approach based on a molecular translator and a catalytic DNA circuit for the detection of nerve growth factor-beta (NGF-β). In this assay, a molecular translator based on the binding-induced DNA strand-displacement reaction was employed to convert the input protein to an output DNA signal. The molecular translator is composed of a target recognition element and a signal output element. Target recognition is achieved by the binding of the anti-NGF-β antibody to the target protein. Polyclonal anti-NGF-β antibody is conjugated to DNA1 and DNA2. The antibody conjugated DNA1 is initially hybridized to DNA3 to form a stable DNA1/DNA3 duplex. In the presence of NGF-β, the binding of the same target protein brings DNA1 and DNA2 into close proximity, resulting in an increase in their local effective concentration. This process triggers the strand-displacement reaction between DNA2 and DNA3 and releases the output DNA3. The released DNA3 is further amplified by a catalytic DNA circuit. The product of the catalytic DNA circuit is detected by a strip biosensor. This proposed assay has high sensitivity and selectivity with a dynamic response ranging from 10 fM to 10 pM, and its detection limit is 10 fM of NGF-β. This work provides a sensitive, enzyme-free, and universal strategy for the detection of other proteins.

  11. An Improved Method for TAL Effectors DNA-Binding Sites Prediction Reveals Functional Convergence in TAL Repertoires of Xanthomonas oryzae Strains

    PubMed Central

    Pérez-Quintero, Alvaro L.; Rodriguez-R, Luis M.; Dereeper, Alexis; López, Camilo; Koebnik, Ralf; Szurek, Boris; Cunnac, Sebastien

    2013-01-01

    Transcription Activators-Like Effectors (TALEs) belong to a family of virulence proteins from the Xanthomonas genus of bacterial plant pathogens that are translocated into the plant cell. In the nucleus, TALEs act as transcription factors inducing the expression of susceptibility genes. A code for TALE-DNA binding specificity and high-resolution three-dimensional structures of TALE-DNA complexes were recently reported. Accurate prediction of TAL Effector Binding Elements (EBEs) is essential to elucidate the biological functions of the many sequenced TALEs as well as for robust design of artificial TALE DNA-binding domains in biotechnological applications. In this work a program with improved EBE prediction performances was developed using an updated specificity matrix and a position weight correction function to account for the matching pattern observed in a validation set of TALE-DNA interactions. To gain a systems perspective on the large TALE repertoires from X. oryzae strains, this program was used to predict rice gene targets for 99 sequenced family members. Integrating predictions and available expression data in a TALE-gene network revealed multiple candidate transcriptional targets for many TALEs as well as several possible instances of functional convergence among TALEs. PMID:23869221

  12. Adhesion signaling promotes protease‑driven polyploidization of glioblastoma cells.

    PubMed

    Mercapide, Javier; Lorico, Aurelio

    2014-11-01

    An increase in ploidy (polyploidization) causes genomic instability in cancer. However, the determinants for the increased DNA content of cancer cells have not yet been fully elucidated. In the present study, we investigated whether adhesion induces polyploidization in human U87MG glioblastoma cells. For this purpose, we employed expression vectors that reported transcriptional activation by signaling networks implicated in cancer. Signaling activation induced by intercellular integrin binding elicited both extracellular signal‑regulated kinase (ERK) and Notch target transcription. Upon the prolonged activation of both ERK and Notch target transcription induced by integrin binding to adhesion protein, cell cultures accumulated polyploid cells, as determined by cell DNA content distribution analysis and the quantification of polynucleated cells. This linked the transcriptional activation induced by integrin adhesion to the increased frequency of polyploidization. Accordingly, the inhibition of signaling decreased the extent of polyploidization mediated by protease‑driven intracellular invasion. Therefore, the findings of this study indicate that integrin adhesion induces polyploidization through the stimulation of glioblastoma cell invasiveness.

  13. Shikonin reduces oedema induced by phorbol ester by interfering with IκBα degradation thus inhibiting translocation of NF-κB to the nucleus

    PubMed Central

    Andújar, I; Recio, MC; Bacelli, T; Giner, RM; Ríos, JL

    2010-01-01

    Background and purpose: In the present paper we studied the effect of shikonin on ear oedema induced by 12-O-tetradecanoylphorbol-13-acetate (TPA), and determined the mechanisms through which shikonin might exert its topical anti-inflammatory action. Experimental approach: Acute ear oedema was induced in mice by topical application of TPA. The in vitro assays used macrophages RAW 264.7 cells stimulated with lipopolysaccharide. Cyclooxygenase-2, inducible nitric oxide synthase, protein kinase Cα, extracellular signal-regulated protein kinase (ERK), phosphorylated ERK (pERK), c-Jun N-terminal kinase (JNK), pJNK, p38, p-p38, p65, p-p65, inhibitor protein of nuclear factor-κB (NF-κB) (IκBα) and pIκBα were measured by Western blotting, activation and binding of NF-κB to DNA was detected by reporter gene and electrophoretic mobility shift assay, respectively, and NF-κB p65 localization was detected by immunocytochemistry. Key results: Shikonin reduced the oedema (inhibitory dose 50 = 1.0 mg per ear), the expression of cyclooxygenase-2 (70%) and of inducible nitric oxide synthase (100%) in vivo. It significantly decreased TPA-induced translocation of protein kinase Cα, the phosphorylation and activation of ERK, the nuclear translocation of NF-κB and the TPA-induced NF-κB-DNA-binding activity in mouse skin. Moreover, in RAW 264.7 cells, shikonin significantly inhibited the binding of NF-κB to DNA in a dose-dependent manner and the nuclear translocation of p65. Conclusions and implications: Shikonin exerted its topical anti-inflammatory action by interfering with the degradation of IκBα, thus inhibiting the activation of NF-κB. PMID:20423347

  14. Microwave-Induced Inactivation of DNA-Based Hybrid Catalyst in Asymmetric Catalysis

    PubMed Central

    Zhao, Hua; Shen, Kai

    2015-01-01

    DNA-based hybrid catalysts have gained strong interests in asymmetric reactions. However, to maintain the high enantioselectivity, these reactions are usually conducted at relatively low temperatures (e.g. < 5 °C) for 2–3 days. Aiming to improve the reaction’s turnover rate, we evaluated microwave irradiation with simultaneous cooling as potential energy source since this method has been widely used to accelerate various chemical and enzymatic reactions. However, our data indicated that microwave irradiation induced an inactivation of DNA-based hybrid catalyst even at low temperatures (such as 5 °C). Circular dichroism (CD) spectra and gel electrophoresis of DNA suggest that microwave exposure degrades DNA molecules and disrupts DNA double-stranded structures, causing changes of DNA–metal ligand binding properties and thus poor DNA catalytic performance. PMID:26712696

  15. Binding of radiation-induced phenylalanine radicals to DNA: influence on the biological activity of the DNA and on its sensitivity to the induction of breaks by gamma rays

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vanderschans, G.P.; Vanrijn, C.J.S.; Bleichrodt, J.F.

    1975-11-01

    When an aqueous solution of double-stranded deoxyribonucleic acid (DNA) of bacteriophage PM2 containing phenylalanine and saturated with N2O is irradiated with gamma rays, radiation induced phenylalanine radicals are bound covalently. Under the conditions used about 25 phenylalanine molecules may be bound per lethal hit. Also for single-stranded PM2 DNA most of the phenylalanine radicals bound are nonlethal. Evidence is presented that in double-stranded DNA an appreciable fraction of the single-strand breaks is induced by phenylalanine radicals. Radiation products of phenylalanine and the phenylalanine bound to the DNA decrease the sensitivity of the DNA to the induction of single-strand breaks. Theremore » are indications that the high efficiency of protection by radiation products of phenylalanine is due to their positive charge, which will result in a relatively high concentration of these compounds in the vicinity of the negatively charged DNA molecules. (Author) (GRA)« less

  16. ATM Protein Physically and Functionally Interacts with Proliferating Cell Nuclear Antigen to Regulate DNA Synthesis*

    PubMed Central

    Gamper, Armin M.; Choi, Serah; Matsumoto, Yoshihiro; Banerjee, Dibyendu; Tomkinson, Alan E.; Bakkenist, Christopher J.

    2012-01-01

    Ataxia telangiectasia (A-T) is a pleiotropic disease, with a characteristic hypersensitivity to ionizing radiation that is caused by biallelic mutations in A-T mutated (ATM), a gene encoding a protein kinase critical for the induction of cellular responses to DNA damage, particularly to DNA double strand breaks. A long known characteristic of A-T cells is their ability to synthesize DNA even in the presence of ionizing radiation-induced DNA damage, a phenomenon termed radioresistant DNA synthesis. We previously reported that ATM kinase inhibition, but not ATM protein disruption, blocks sister chromatid exchange following DNA damage. We now show that ATM kinase inhibition, but not ATM protein disruption, also inhibits DNA synthesis. Investigating a potential physical interaction of ATM with the DNA replication machinery, we found that ATM co-precipitates with proliferating cell nuclear antigen (PCNA) from cellular extracts. Using bacterially purified ATM truncation mutants and in vitro translated PCNA, we showed that the interaction is direct and mediated by the C terminus of ATM. Indeed, a 20-amino acid region close to the kinase domain is sufficient for strong binding to PCNA. This binding is specific to ATM, because the homologous regions of other PIKK members, including the closely related kinase A-T and Rad3-related (ATR), did not bind PCNA. ATM was found to bind two regions in PCNA. To examine the functional significance of the interaction between ATM and PCNA, we tested the ability of ATM to stimulate DNA synthesis by DNA polymerase δ, which is implicated in both DNA replication and DNA repair processes. ATM was observed to stimulate DNA polymerase activity in a PCNA-dependent manner. PMID:22362778

  17. Controlling gene networks and cell fate with precision-targeted DNA-binding proteins and small-molecule-based genome readers

    PubMed Central

    Eguchi, Asuka; Lee, Garrett O.; Wan, Fang; Erwin, Graham S.; Ansari, Aseem Z.

    2014-01-01

    Transcription factors control the fate of a cell by regulating the expression of genes and regulatory networks. Recent successes in inducing pluripotency in terminally differentiated cells as well as directing differentiation with natural transcription factors has lent credence to the efforts that aim to direct cell fate with rationally designed transcription factors. Because DNA-binding factors are modular in design, they can be engineered to target specific genomic sequences and perform pre-programmed regulatory functions upon binding. Such precision-tailored factors can serve as molecular tools to reprogramme or differentiate cells in a targeted manner. Using different types of engineered DNA binders, both regulatory transcriptional controls of gene networks, as well as permanent alteration of genomic content, can be implemented to study cell fate decisions. In the present review, we describe the current state of the art in artificial transcription factor design and the exciting prospect of employing artificial DNA-binding factors to manipulate the transcriptional networks as well as epigenetic landscapes that govern cell fate. PMID:25145439

  18. NF-κB– and AP-1–Mediated DNA Looping Regulates Osteopontin Transcription in Endotoxin-Stimulated Murine Macrophages

    PubMed Central

    Zhao, Wei; Wang, Lijuan; Zhang, Meng; Wang, Peng; Zhang, Lei; Yuan, Chao; Qi, Jianni; Qiao, Yu; Kuo, Paul C.; Gao, Chengjiang

    2013-01-01

    Osteopontin (OPN) is expressed by various immune cells and modulates both innate and adaptive immune responses. However, the molecular mechanisms that control opn gene expression, especially at the chromatin level, remain largely unknown. We have previously demonstrated many specific cis- and trans-regulatory elements that determine the extent of endotoxin (LPS)-mediated induction of OPN synthesis in murine macrophages. In the present study, we confirm that NF-κB also plays an important role in the setting of LPS-stimulated OPN expression through binding to a distal regulatory element. Importantly, we demonstrate that LPS stimulates chromosomal loops in the OPN promoter between NF-κB binding site and AP-1 binding site using chromosome conformation capture technology. The crucial role of NF-κB and AP-1 in LPS-stimulated DNA looping was confirmed, as small interfering RNA knock-down of NF-κB p65 and AP-1 c-Jun exhibited decreased levels of DNA looping. Furthermore, we demonstrate that p300 can form a complex with NF-κB and AP-1 and is involved in DNA looping and LPS-induced OPN expression. Therefore, we have identified an essential mechanism to remodel the local chromatin structures and spatial conformations to regulate LPS-induced OPN expression. PMID:21257959

  19. Cerium chloride stimulated controlled conversion of B-to-Z DNA in self-assembled nanostructures.

    PubMed

    Bhanjadeo, Madhabi M; Nayak, Ashok K; Subudhi, Umakanta

    2017-01-22

    DNA adopts different conformation not only because of novel base pairs but also while interacting with inorganic or organic compounds. Self-assembled branched DNA (bDNA) structures or DNA origami that change conformation in response to environmental cues hold great promises in sensing and actuation at the nanoscale. Recently, the B-Z transition in DNA is being explored to design various nanomechanical devices. In this communication we have demonstrated that Cerium chloride binds to the phosphate backbone of self-assembled bDNA structure and induce B-to-Z transition at physiological concentration. The mechanism of controlled conversion from right-handed to left-handed has been assayed by various dye binding studies using CD and fluorescence spectroscopy. Three different bDNA structures have been identified to display B-Z transition. This approach provides a rapid and reversible means to change bDNA conformation, which can be used for dynamic and progressive control at the nanoscale. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Pregnane X receptor regulates the AhR/Cyp1A1 pathway and protects liver cells from benzo-[α]-pyrene-induced DNA damage.

    PubMed

    Cui, Hongmei; Gu, Xinsheng; Chen, Jingshu; Xie, Ying; Ke, Sui; Wu, Jing; Golovko, Andrei; Morpurgo, Benjamin; Yan, Chunhong; Phillips, Timothy D; Xie, Wen; Luo, Jianyuan; Zhou, Zhijun; Tian, Yanan

    2017-06-05

    Pregnane X receptor (PXR) plays an important role in protecting cells from mutagenic DNA damages induced by endogenous and exogenous toxicants. This protective function is often attributed to the PXR-regulated metabolic detoxification. Here we report a novel potential mechanism that PXR reduces benzo-[α]-pyrene(BaP)-induced DNA damage through inhibiting the transcriptional activity of aryl hydrocarbon receptor (AhR) which plays a pivotal role in the bioactivation of BaP. We have utilized three well-characterized cell lines, i.e. Hepa1c1c7, AhR +/+; Bpr lacks AhR obligatory partner ARNT; Tao, lacks AhR, to analyze pivotal role of AhR/ARNT complex in mediating the BaP-induced DNA damages using comet assay (single-cell gel electrophoresis). We found that PXR activation could significantly inhibit BaP-induced DNA damage in the HepG2 cells as well as mouse hepatocytes. Using PXR-null and wild type mouse hepatocytes we showed that PXR activation by pregnenolone 16α-carbonitrile (PCN) significantly inhibited BaP-induced DNA damage and this protective effect was abolished in PXR-null hepatocytes. Mechanistically, PXR activation inhibited expression of AhR-target genes for CYP1A1, CYP1B1 and CYP1A2 that are required for BaP biotransformation in cultured liver cells, or in the livers of C57BL/6J mice. Using an AhR-responsive reporter assay as well as chromatin immunoprecipitation assay we found that PXR activation transcriptionally represses AhR-regulated gene expression. Furthermore, we found that PXR directly bound AhR at its DNA-binding domain, and this association may play a role in preventing of the AhR from binding to its target genes as shown in the ChIP assay. Taken together, our study has revealed a novel mechanism by which PXR protects liver cells from BaP-induced DNA damage through inhibiting the BaP biotransformation. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. MMPP Attenuates Non-Small Cell Lung Cancer Growth by Inhibiting the STAT3 DNA-Binding Activity via Direct Binding to the STAT3 DNA-Binding Domain.

    PubMed

    Son, Dong Ju; Zheng, Jie; Jung, Yu Yeon; Hwang, Chul Ju; Lee, Hee Pom; Woo, Ju Rang; Baek, Song Yi; Ham, Young Wan; Kang, Min Woong; Shong, Minho; Kweon, Gi Ryang; Song, Min Jong; Jung, Jae Kyung; Han, Sang-Bae; Kim, Bo Yeon; Yoon, Do Young; Choi, Bu Young; Hong, Jin Tae

    2017-01-01

    Rationale: Signal transducer and activator of transcription-3 (STAT3) plays a pivotal role in cancer biology. Many small-molecule inhibitors that target STAT3 have been developed as potential anticancer drugs. While designing small-molecule inhibitors that target the SH2 domain of STAT3 remains the leading focus for drug discovery, there has been a growing interest in targeting the DNA-binding domain (DBD) of the protein. Methods: We demonstrated the potential antitumor activity of a novel, small-molecule (E)-2-methoxy-4-(3-(4-methoxyphenyl)prop-1-en-1-yl)phenol (MMPP) that directly binds to the DBD of STAT3, in patient-derived non-small cell lung cancer (NSCLC) xenograft model as well as in NCI-H460 cell xenograft model in nude mice. Results: MMPP effectively inhibited the phosphorylation of STAT3 and its DNA binding activity in vitro and in vivo . It induced G1-phase cell cycle arrest and apoptosis through the regulation of cell cycle- and apoptosis-regulating genes by directly binding to the hydroxyl residue of threonine 456 in the DBD of STAT3. Furthermore, MMPP showed a similar or better antitumor activity than that of docetaxel or cisplatin. Conclusion: MMPP is suggested to be a potential candidate for further development as an anticancer drug that targets the DBD of STAT3.

  2. The single-strand DNA binding activity of human PC4 preventsmutagenesis and killing by oxidative DNA damage

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Jen-Yeu; Sarker, Altaf Hossain; Cooper, Priscilla K.

    Human positive cofactor 4 (PC4) is a transcriptional coactivator with a highly conserved single-strand DNA (ssDNA) binding domain of unknown function. We identified PC4 as a suppressor of the oxidative mutator phenotype of the Escherichia coli fpg mutY mutant and demonstrate that this suppression requires its ssDNA binding activity. Yeast mutants lacking their PC4 ortholog Sub1 are sensitive to hydrogen peroxide and exhibit spontaneous and peroxide induced hypermutability. PC4 expression suppresses the peroxide sensitivity of the yeast sub l{Delta} mutant, suggesting that the human protein has a similar function. A role for yeast and human proteins in DNA repair ismore » suggested by the demonstration that Sub1 acts in a peroxide-resistance pathway involving Rad2 and by the physical interaction of PC4 with the human Rad2 homolog XPG. We show XPG recruits PC4 to a bubble-containing DNA substrate with resulting displacement of XPG and formation of a PC4-DNA complex. We discuss the possible requirement for PC4 in either global or transcription-coupled repair of oxidative DNA damage to mediate the release of XPG bound to its substrate.« less

  3. Simulation studies of DNA at the nanoscale: Interactions with proteins, polycations, and surfaces

    NASA Astrophysics Data System (ADS)

    Elder, Robert M.

    Understanding the nanoscale interactions of DNA, a multifunctional biopolymer with sequence-dependent properties, with other biological and synthetic substrates and molecules is essential to advancing these technologies. This doctoral thesis research is aimed at understanding the thermodynamics and molecular-level structure when DNA interacts with proteins, polycations, and functionalized surfaces. First, we investigate the ability of a DNA damage recognition protein (HMGB1a) to bind to anti-cancer drug-induced DNA damage, seeking to explain how HMGB1a differentiates between the drugs in vivo. Using atomistic molecular dynamics simulations, we show that the structure of the drug-DNA molecule exhibits drug- and base sequence-dependence that explains some of the experimentally observed differential recognition of the drugs in various sequence contexts. Then, we show how steric hindrance from the drug decreases the deformability of the drug-DNA molecule, which decreases recognition by the protein, a concept that can be applied to rational drug design. Second, we study how polycation architecture and chemistry affect polycation-DNA binding so as to design optimal polycations for high efficiency gene (DNA) delivery. Using a multiscale computational approach involving atomistic and coarse-grained simulations, we examine how rearranging polylysine from a linear to a grafted architecture, and several aspects of the grafted architecture, affect polycation-DNA binding and the structure of polycation-DNA complexes. Next, going beyond lysine we examine how oligopeptide chemistry and sequence in the grafted architecture affects polycation-DNA binding and find that strategic placement of hydrophobic peptides might be used to tailor binding strength. Third, we study the adsorption and conformations of single-stranded DNA (an amphiphilic biopolymer) on model hydrophilic and hydrophobic surfaces. Short ssDNA oligomers adsorb to both surfaces with similar strength, with the strength of adsorption to the hydrophobic surface depending on the composition of the DNA strands, i.e. purine or pyrimidine bases. Additionally, DNA-surface and DNA-water interactions near the surfaces govern the adsorption. For longer ssDNA oligomers, the effects of surface chemistry and temperature on ssDNA conformations are rather small, but either the hydrophilic surface or increased temperature favor slightly more compact conformations due to energetic and entropic effects, respectively.

  4. Nitric oxide sensitizes tumor cells to TRAIL-induced apoptosis via inhibition of the DR5 transcription repressor Yin Yang 1.

    PubMed

    Huerta-Yepez, Sara; Vega, Mario; Escoto-Chavez, Saul E; Murdock, Benjamin; Sakai, Toshiyuki; Baritaki, Stavroula; Bonavida, Benjamin

    2009-02-01

    Treatment of TRAIL-resistant tumor cells with the nitric oxide donor DETANONOate sensitizes the tumor cells to TRAIL-induced apoptosis concomitantly with DR5 upregulation. The mechanism of sensitization was examined based on the hypothesis that DETANONOate inhibits a transcription repressor Yin Yang 1 (YY1) that negatively regulates DR5 transcription. Treatment of the prostate carcinoma cell lines with DETANONOate inhibited both NF-kappaB and YY1 DNA-binding activities concomitantly with upregulation of DR5 expression. The direct role of YY1 in the regulation of TRAIL resistance was demonstrated in cells treated with YY1 siRNA resulting in TRAIL-induced apoptosis. The role of YY1 in the transcriptional regulation of DR5 was examined in cells treated with a DR5 luciferase reporter system (pDR5) and two constructs, namely, the pDR5/-605 construct with a deletion of the putative YY1 DNA-binding region (-1224 to -605) and a construct pDR5-YY1 with a mutation of the YY1 DNA-binding site. A significant (3-fold) augmentation of luciferase activity over baseline transfection with pDR5 was observed in cells transfected with the modified constructs. ChIP analysis corroborated the YY1 binding to the DR5 promoter. In vivo, tissues from nude mice bearing the PC-3 xenograft and treated with DETANONOate showed inhibition of YY1 and upregulation of DR5. The present findings demonstrate that YY1 negatively regulates DR5 transcription and expression and these correlated with resistance to TRAIL-induced apoptosis. DETANONOate inhibits both NF-kappaB and YY1 and in combination with TRAIL reverses tumor cell resistance to TRAIL apoptosis.

  5. New orally active DNA minor groove binding small molecule CT-1 acts against breast cancer by targeting tumor DNA damage leading to p53-dependent apoptosis.

    PubMed

    Saini, Karan Singh; Hamidullah; Ashraf, Raghib; Mandalapu, Dhanaraju; Das, Sharmistha; Siddiqui, Mohd Quadir; Dwivedi, Sonam; Sarkar, Jayanta; Sharma, Vishnu Lal; Konwar, Rituraj

    2017-04-01

    Targeting tumor DNA damage and p53 pathway is a clinically established strategy in the development of cancer chemotherapeutics. Majority of anti-cancer drugs are delivered through parenteral route for reasons like severe toxicity, lack of stability, and poor enteral absorption. Current DNA targeting drugs in clinical like anthracycline suffers from major drawbacks like cardiotoxicity. Here, we report identification of a new orally active small molecule curcumin-triazole conjugate (CT-1) with significant anti-breast cancer activity in vitro and in vivo. CT-1 selectively and significantly inhibits viability of breast cancer cell lines; retards cells cycle progression at S phase and induce mitochondrial-mediated cell apoptosis. CT-1 selectively binds to minor groove of DNA and induces DNA damage leading to increase in p53 along with decrease in its ubiquitination. Inhibition of p53 with pharmacological inhibitor as well as siRNA revealed the necessity of p53 in CT-1-mediated anti-cancer effects in breast cancer cells. Studies using several other intact p53 and deficient p53 cancer cell lines further confirmed necessity of p53 in CT-1-mediated anti-cancer response. Pharmacological inhibition of pan-caspase showed CT-1 induces caspase-dependent cell death in breast cancer cells. Most interestingly, oral administration of CT-1 induces significant inhibition of tumor growth in LA-7 syngeneic orthotropic rat mammary tumor model. CT-1 treated mammary tumor shows enhancement in DNA damage, p53 upregulation, and apoptosis. Collectively, CT-1 exhibits potent anti-cancer effect both in vitro and in vivo and could serve as a safe orally active lead for anti-cancer drug development. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  6. In silico modeling of epigenetic-induced changes in photoreceptor cis-regulatory elements.

    PubMed

    Hossain, Reafa A; Dunham, Nicholas R; Enke, Raymond A; Berndsen, Christopher E

    2018-01-01

    DNA methylation is a well-characterized epigenetic repressor of mRNA transcription in many plant and vertebrate systems. However, the mechanism of this repression is not fully understood. The process of transcription is controlled by proteins that regulate recruitment and activity of RNA polymerase by binding to specific cis-regulatory sequences. Cone-rod homeobox (CRX) is a well-characterized mammalian transcription factor that controls photoreceptor cell-specific gene expression. Although much is known about the functions and DNA binding specificity of CRX, little is known about how DNA methylation modulates CRX binding affinity to genomic cis-regulatory elements. We used bisulfite pyrosequencing of human ocular tissues to measure DNA methylation levels of the regulatory regions of RHO , PDE6B, PAX6 , and LINE1 retrotransposon repeats. To describe the molecular mechanism of repression, we used molecular modeling to illustrate the effect of DNA methylation on human RHO regulatory sequences. In this study, we demonstrate an inverse correlation between DNA methylation in regulatory regions adjacent to the human RHO and PDE6B genes and their subsequent transcription in human ocular tissues. Docking of CRX to the DNA models shows that CRX interacts with the grooves of these sequences, suggesting changes in groove structure could regulate binding. Molecular dynamics simulations of the RHO promoter and enhancer regions show changes in the flexibility and groove width upon epigenetic modification. Models also demonstrate changes in the local dynamics of CRX binding sites within RHO regulatory sequences which may account for the repression of CRX-dependent transcription. Collectively, these data demonstrate epigenetic regulation of CRX binding sites in human retinal tissue and provide insight into the mechanism of this mode of epigenetic regulation to be tested in future experiments.

  7. Molecular cloning and characterization of a tomato cDNA encoding a systemically wound-inducible bZIP DNA-binding protein

    NASA Technical Reports Server (NTRS)

    Stankovic, B.; Vian, A.; Henry-Vian, C.; Davies, E.

    2000-01-01

    Localized wounding of one leaf in intact tomato (Lycopersicon esculentum Mill.) plants triggers rapid systemic transcriptional responses that might be involved in defense. To better understand the mechanism(s) of intercellular signal transmission in wounded tomatoes, and to identify the array of genes systemically up-regulated by wounding, a subtractive cDNA library for wounded tomato leaves was constructed. A novel cDNA clone (designated LebZIP1) encoding a DNA-binding protein was isolated and identified. This clone appears to be encoded by a single gene, and belongs to the family of basic leucine zipper domain (bZIP) transcription factors shown to be up-regulated by cold and dark treatments. Analysis of the mRNA levels suggests that the transcript for LebZIP1 is both organ-specific and up-regulated by wounding. In wounded wild-type tomatoes, the LebZIP1 mRNA levels in distant tissue were maximally up-regulated within only 5 min following localized wounding. Exogenous abscisic acid (ABA) prevented the rapid wound-induced increase in LebZIP1 mRNA levels, while the basal levels of LebZIP1 transcripts were higher in the ABA mutants notabilis (not), sitiens (sit), and flacca (flc), and wound-induced increases were greater in the ABA-deficient mutants. Together, these results suggest that ABA acts to curtail the wound-induced synthesis of LebZIP1 mRNA.

  8. Mangiferin activates the Nrf2-ARE pathway and reduces etoposide-induced DNA damage in human umbilical cord mononuclear blood cells.

    PubMed

    Zhang, Benping; Zhao, Jie; Li, Shanshan; Zeng, Linglan; Chen, Yan; Fang, Jun

    2015-04-01

    Mangiferin (2-C-β-d-gluco-pyranosyl-1,3,6,7-tetrahydroxyxanthone) is a well-known natural antioxidant distributed in various plants of the Anacardiaceae and Gentianaceae families. Mangiferin can inhibit carcinogen-induced lung or colon tumor formation in experimental animals. However, the molecular mechanisms of its chemopreventive activity remain unexplored. This study aimed to investigate the effects of mangiferin on chemical carcinogen-induced DNA damage and Nrf2-ARE signaling in hematopoietic cells. Mononuclear cells (MNCs) were isolated from human umbilical cord blood (hUCB). DNA damage was evaluated by comet and micronucleus assays. The expression of Nrf2 and NQO1 was examined by immunofluorescence and western blotting. An electrophoretic mobility shift assay (EMSA) was used to detect the binding activity of Nrf2 with NQO1-ARE sequences. We found that mangiferin treatment significantly reduced DNA damage in etoposide-treated MNCs, which was verified by decreased olive tail moment (OTM) and micronucleus (MN) frequency. Mangiferin treatment significantly promoted Nrf2 translocation into the nucleus and increased nuclear Nrf2 expression. Moreover, NQO1, an Nrf2 signaling target, was significantly upregulated by mangiferin treatment, and the binding activity of Nrf2 with NQO1-ARE sequences was elevated after mangiferin treatment. Mangiferin activated Nrf2 signaling, upregulated NQO1 expression, and significantly reduced etoposide-induced DNA damage. Thus, mangiferin is a potential cytoprotective agent for hematopoietic cells.

  9. A novel mode for transcription inhibition mediated by PNA-induced R-loops with a model in vitro system.

    PubMed

    D'Souza, Alicia D; Belotserkovskii, Boris P; Hanawalt, Philip C

    2018-02-01

    The selective inhibition of transcription of a chosen gene by an artificial agent has numerous applications. Usually, these agents are designed to bind a specific nucleotide sequence in the promoter or within the transcribed region of the chosen gene. However, since optimal binding sites might not exist within the gene, it is of interest to explore the possibility of transcription inhibition when the agent is designed to bind at other locations. One of these possibilities arises when an additional transcription initiation site (e.g. secondary promoter) is present upstream from the primary promoter of the target gene. In this case, transcription inhibition might be achieved by inducing the formation of an RNA-DNA hybrid (R-loop) upon transcription from the secondary promoter. The R-loop could extend into the region of the primary promoter, to interfere with promoter recognition by RNA polymerase and thereby inhibit transcription. As a sequence-specific R-loop-inducing agent, a peptide nucleic acid (PNA) could be designed to facilitate R-loop formation by sequestering the non-template DNA strand. To investigate this mode for transcription inhibition, we have employed a model system in which a PNA binding site is localized between the T3 and T7 phage RNA polymerase promoters, which respectively assume the roles of primary and secondary promoters. In accord with our model, we have demonstrated that with PNA-bound DNA substrates, transcription from the T7 promoter reduces transcription from the T3 promoter by 30-fold, while in the absence of PNA binding there is no significant effect of T7 transcription upon T3 transcription. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. Rapid colorimetric detection of p53 protein function using DNA-gold nanoconjugates with applications for drug discovery and cancer diagnostics.

    PubMed

    Assah, Enock; Goh, Walter; Zheng, Xin Ting; Lim, Ting Xiang; Li, Jun; Lane, David; Ghadessy, Farid; Tan, Yen Nee

    2018-05-05

    The tumor suppressor protein p53 plays a central role in preventing cancer through interaction with DNA response elements (REs) to regulate target gene expression in cells. Due to its significance in cancer biology, relentless efforts have been directed toward understanding p53-DNA interactions for the development of cancer therapeutics and diagnostics. In this paper, we report a rapid, label-free and versatile colorimetric assay to detect wildtype p53 DNA-binding function in complex solutions. The assay design is based on a concept that alters interparticle-distances between RE-AuNPs from a crosslinking effect induced through tetramerization of wildtype p53 protein (p53-WT) upon binding to canonical DNA motifs modified on gold nanoparticles (RE-AuNPs). This leads to a visible solution color change from red to blue, which is quantifiable by the UV- visible absorption spectra with a detection limit of 5 nM. Contrastingly, no color change was observed for the binding-deficient p53 mutants and non-specific proteins due to their inability to crosslink RE-AuNPs. Based on this sensing principle, we further demonstrate its utility for fast detection of drug-induced DNA binding function to cancer-associated Y220C mutant p53 protein using well-established reactivating compounds. By exploiting the dominant-negative property of mutant p53 over p53-WT and interactions with RE-AuNPs, this assay is configurable to detect low numbers of mutant p53 expressing cells in miniscule sample fractions obtained from typical core needle biopsy-sized tissues without signal attrition, alluding to the potential for biopsy sampling in cancer diagnostics or for defining cancer margins. This nanogold enabled colorimetric assay provides a facile yet robust method for studying important parameters influencing p53-DNA interactions with great promises for clinically pertinent applications. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. RPA and Rad51 constitute a cell intrinsic mechanism to protect the cytosol from self DNA.

    PubMed

    Wolf, Christine; Rapp, Alexander; Berndt, Nicole; Staroske, Wolfgang; Schuster, Max; Dobrick-Mattheuer, Manuela; Kretschmer, Stefanie; König, Nadja; Kurth, Thomas; Wieczorek, Dagmar; Kast, Karin; Cardoso, M Cristina; Günther, Claudia; Lee-Kirsch, Min Ae

    2016-05-27

    Immune recognition of cytosolic DNA represents a central antiviral defence mechanism. Within the host, short single-stranded DNA (ssDNA) continuously arises during the repair of DNA damage induced by endogenous and environmental genotoxic stress. Here we show that short ssDNA traverses the nuclear membrane, but is drawn into the nucleus by binding to the DNA replication and repair factors RPA and Rad51. Knockdown of RPA and Rad51 enhances cytosolic leakage of ssDNA resulting in cGAS-dependent type I IFN activation. Mutations in the exonuclease TREX1 cause type I IFN-dependent autoinflammation and autoimmunity. We demonstrate that TREX1 is anchored within the outer nuclear membrane to ensure immediate degradation of ssDNA leaking into the cytosol. In TREX1-deficient fibroblasts, accumulating ssDNA causes exhaustion of RPA and Rad51 resulting in replication stress and activation of p53 and type I IFN. Thus, the ssDNA-binding capacity of RPA and Rad51 constitutes a cell intrinsic mechanism to protect the cytosol from self DNA.

  12. Regulatory Phosphorylation of Ikaros by Bruton's Tyrosine Kinase

    PubMed Central

    Zhang, Jian; Ishkhanian, Rita; Uckun, Fatih M.

    2013-01-01

    Diminished Ikaros function has been implicated in the pathogenesis of acute lymphoblastic leukemia (ALL), the most common form of childhood cancer. Therefore, a stringent regulation of Ikaros is of paramount importance for normal lymphocyte ontogeny. Here we provide genetic and biochemical evidence for a previously unknown function of Bruton's tyrosine kinase (BTK) as a partner and posttranslational regulator of Ikaros, a zinc finger-containing DNA-binding protein that plays a pivotal role in immune homeostasis. We demonstrate that BTK phosphorylates Ikaros at unique phosphorylation sites S214 and S215 in the close vicinity of its zinc finger 4 (ZF4) within the DNA binding domain, thereby augmenting its nuclear localization and sequence-specific DNA binding activity. Our results further demonstrate that BTK-induced activating phosphorylation is critical for the optimal transcription factor function of Ikaros. PMID:23977012

  13. The Role of JMY in p53 Regulation.

    PubMed

    Adighibe, Omanma; Pezzella, Francesco

    2018-05-31

    Following the event of DNA damage, the level of tumour suppressor protein p53 increases inducing either cell cycle arrest or apoptosis. Junctional Mediating and Regulating Y protein (JMY) is a transcription co-factor involved in p53 regulation. In event of DNA damage, JMY levels also upregulate in the nucleus where JMY forms a co-activator complex with p300/CREB-binding protein (p300/CBP), Apoptosis-stimulating protein of p53 (ASPP) and Stress responsive activator of p53 (Strap). This co-activator complex then binds to and increases the ability of p53 to induce transcription of proteins triggering apoptosis but not cell cycle arrest. This then suggests that the increase of JMY levels due to DNA damage putatively "directs" p53 activity toward triggering apoptosis. JMY expression is also linked to increased cell motility as it: (1) downregulates the expression of adhesion molecules of the Cadherin family and (2) induces actin nucleation, making cells less adhesive and more mobile, favouring metastasis. All these characteristics taken together imply that JMY possesses both tumour suppressive and tumour metastasis promoting capabilities.

  14. A novel transcriptional regulator of L-arabinose utilization in human gut bacteria

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chang, Changsoo; Tesar, Christine; Li, Xiaoqing

    2015-10-04

    Carbohydrate metabolism plays a crucial role in the ecophysiology of human gut microbiota. Mechanisms of transcriptional regulation of sugar catabolism in commensal and prevalent human gut bacteria such as Bacteroides thetaiotaomicron remain mostly unknown. By a combination of bioinformatics and experimental approaches, we have identified an NrtR family transcription factor (BT0354 in B. thetaiotaomicron, BtAraR) as a novel regulator controlling the arabinose utilization genes. L-arabinose was confirmed to be a negative effector of BtAraR. We have solved the crystal structures of the apo and L-arabinose-bound BtAraR proteins, as well as the complex of apo-protein with a specific DNA operator. BtAraRmore » forms a homodimer with each subunit comprised of the ligand-binding Nudix hydrolase-like domain and the DNA-binding winged-helix-turn-helix (wHTH) domain. We have identified the residues involved in binding of L-arabinose and recognition of DNA. The majority of these residues are well conserved in the AraR orthologs in Bacteroidetes. In the structure of the BtAraR-DNA complex, we found the unique interaction of arginine intercalating its guanidinum moiety into the base pair stacking of B-DNA. L-arabinose binding induces movement of wHTH domains, resulting in a conformation unsuitable for DNA binding. Our analysis facilitates reconstruction of the metabolic and regulatory networks involved in carbohydrate utilization in human gut Bacteroides.« less

  15. A novel transcriptional regulator of L-arabinose utilization in human gut bacteria

    DOE PAGES

    Chang, Changsoo; Tesar, Christine; Li, Xiaoqing; ...

    2015-10-04

    We report that carbohydrate metabolism plays a crucial role in the ecophysiology of human gut microbiota. Mechanisms of transcriptional regulation of sugar catabolism in commensal and prevalent human gut bacteria such as Bacteroides thetaiotaomicron remain mostly unknown. By a combination of bioinformatics and experimental approaches, we have identified an NrtR family transcription factor (BT0354 in B. thetaiotaomicron, BtAraR) as a novel regulator controlling the arabinose utilization genes. L-arabinose was confirmed to be a negative effector of BtAraR. We have solved the crystal structures of the apo and L-arabinose-bound BtAraR proteins, as well as the complex of apo-protein with a specificmore » DNA operator. BtAraR forms a homodimer with each subunit comprised of the ligand-binding Nudix hydrolase-like domain and the DNA-binding winged-helix-turn-helix (wHTH) domain. We have identified the residues involved in binding of L-arabinose and recognition of DNA. The majority of these residues are well conserved in the AraR orthologs in Bacteroidetes. In the structure of the BtAraR–DNA complex, we found the unique interaction of arginine intercalating its guanidinum moiety into the base pair stacking of B-DNA. L-arabinose binding induces movement of wHTH domains, resulting in a conformation unsuitable for DNA binding. Furthermore, our analysis facilitates reconstruction of the metabolic and regulatory networks involved in carbohydrate utilization in human gut Bacteroides.« less

  16. Physical interaction between replication protein A (RPA) and MRN: involvement of RPA2 phosphorylation and the N-terminus of RPA1.

    PubMed

    Oakley, Greg G; Tillison, Kristin; Opiyo, Stephen A; Glanzer, Jason G; Horn, Jeffrey M; Patrick, Steve M

    2009-08-11

    Replication protein A (RPA) is a heterotrimeric protein consisting of RPA1, RPA2, and RPA3 subunits that binds to single-stranded DNA (ssDNA) with high affinity. The response to replication stress requires the recruitment of RPA and the MRE11-RAD50-NBS1 (MRN) complex. RPA bound to ssDNA stabilizes stalled replication forks by recruiting checkpoint proteins involved in fork stabilization. MRN can bind DNA structures encountered at stalled or collapsed replication forks, such as ssDNA-double-stranded DNA (dsDNA) junctions or breaks, and promote the restart of DNA replication. Here, we demonstrate that RPA2 phosphorylation regulates the assembly of DNA damage-induced RPA and MRN foci. Using purified proteins, we observe a direct interaction between RPA with both NBS1 and MRE11. By utilizing RPA bound to ssDNA, we demonstrate that substituting RPA with phosphorylated RPA or a phosphomimetic weakens the interaction with the MRN complex. Also, the N-terminus of RPA1 is a critical component of the RPA-MRN protein-protein interaction. Deletion of the N-terminal oligonucleotide-oligosaccharide binding fold (OB-fold) of RPA1 abrogates interactions of RPA with MRN and individual proteins of the MRN complex. Further identification of residues critical for MRN binding in the N-terminus of RPA1 shows that substitution of Arg31 and Arg41 with alanines disrupts the RPA-MRN interaction and alters cell cycle progression in response to DNA damage. Thus, the N-terminus of RPA1 and phosphorylation of RPA2 regulate RPA-MRN interactions and are important in the response to DNA damage.

  17. Interaction of Diuron and Related Substituted Phenylureas with the Ah Receptor Pathway

    PubMed Central

    Zhao, Bin; Baston, David S.; Hammock, Bruce; Denison, Michael S.

    2011-01-01

    The aryl hydrocarbon receptor (AhR) is a ligand-dependent transcription factor that mediates many of the biological and toxicological actions of structurally diverse chemicals, including the ubiquitous environmental contaminant 2,3,7,8-tetrachlorodibenzo-p-dioxin. Here, we have examined the ability of diuron, a widely used herbicide, and several structurally related substituted phenylureas to bind to and activate/inhibit the AhR and AhR signal transduction. Diuron induced CYP1A1 mRNA levels in mouse hepatoma (Hepa1c1c7) cells and AhR-dependent luciferase reporter gene expression in stably transfected mouse, rat, guinea pig, and human cell lines. In addition, ligand binding and gel retardation analysis demonstrated the ability of diuron to competitively bind to and stimulate AhR transformation and DNA binding in vitro and in intact cells. Several structurally related substituted phenylureas competitively bound to the guinea pig hepatic cytosolic AhR, inhibited 2,3,7,8-tetrachlorodibenzo-p-dioxin-induced AhR-dependent luciferase reporter gene expression in a species-specific manner and stimulated AhR transformation and DNA binding, consistent with their role as partial AhR agonists. These results demonstrate not only that diuron and related substituted phenylureas are AhR ligands but also that exposure to these chemicals could induce/inhibit AhR-dependent biological effects. PMID:16788953

  18. PRP19 Transforms into a Sensor of RPA-ssDNA after DNA Damage and Drives ATR Activation via a Ubiquitin-Mediated Circuitry

    PubMed Central

    Maréchal, Alexandre; Wu, Ching-Shyi; Yazinski, Stephanie A.; Nguyen, Hai Dang; Liu, Shizhou; Jiménez, Amanda E.; Jin, Jianping; Zou, Lee

    2014-01-01

    Summary PRP19 is a ubiquitin ligase involved in pre-mRNA splicing and the DNA damage response (DDR). While the role for PRP19 in splicing is well characterized, its role in the DDR remains elusive. Through a proteomic screen for proteins that interact with RPA-coated single-stranded DNA (RPA-ssDNA), we identified PRP19 as a sensor of DNA damage. PRP19 binds RPA directly and localizes to DNA damage sites via RPA, promoting RPA ubiquitylation in a DNA damage-induced manner. PRP19 facilitates the accumulation of ATRIP, the regulatory partner of the ATR kinase, at DNA damage sites. Depletion of PRP19 compromised the phosphorylation of ATR substrates, the recovery of stalled replication forks, and the progression of replication forks on damaged DNA. Importantly, PRP19 mutants that cannot bind RPA or function as an E3 ligase failed to support the ATR response, revealing that PRP19 drives ATR activation by acting as an RPA-ssDNA-sensing ubiquitin ligase during the DDR. PMID:24332808

  19. BPF-1, a pathogen-induced DNA-binding protein involved in the plant defense response.

    PubMed

    da Costa e Silva, O; Klein, L; Schmelzer, E; Trezzini, G F; Hahlbrock, K

    1993-07-01

    The mechanisms by which plants restrict the growth of pathogens include transient activation of numerous defense-related genes. Box P is a putative cis-acting element of a distinct group of such genes, including those encoding the enzyme phenylalanine ammonialyase (PAL). A DNA-binding activity to Box P was identified in nuclear extracts from cultured parsley cells and a cDNA encoding the protein BPF-1 (Box P-binding Factor) partially characterized. BPF-1 binds to this element with specificity similar to that of the binding activity in nuclear extracts. BPF-1 mRNA accumulates rapidly in elicitor-treated parsley cells and around fungal infection sites on parsley leaves. This accumulation is, at least partly, due to a rapid and transient increase in the transcription rate of BPF-1. Moreover, tight correlation between the relative amounts of BPF-1 and PAL mRNAs was observed in different organs of a parsley plant. These results are consistent with the hypothesis that BPF-1 is involved in disease resistance by modulating plant defense gene expression.

  20. Retinoic acid induces proteasome-dependent degradation of retinoic acid receptor α (RARα) and oncogenic RARα fusion proteins

    PubMed Central

    Zhu, Jun; Gianni, Maurizio; Kopf, Eliezer; Honoré, Nicole; Chelbi-Alix, Mounira; Koken, Marcel; Quignon, Frédérique; Rochette-Egly, Cécile; de Thé, Hugues

    1999-01-01

    Analyzing the pathways by which retinoic acid (RA) induces promyelocytic leukemia/retinoic acid receptor α (PML/RARα) catabolism in acute promyelocytic leukemia (APL), we found that, in addition to caspase-mediated PML/RARα cleavage, RA triggers degradation of both PML/RARα and RARα. Similarly, in non-APL cells, RA directly targeted RARα and RARα fusions to the proteasome degradation pathway. Activation of either RARα or RXRα by specific agonists induced degradation of both proteins. Conversely, a mutation in RARα that abolishes heterodimer formation and DNA binding, blocked both RARα and RXRα degradation. Mutations in the RARα DNA-binding domain or AF-2 transcriptional activation region also impaired RARα catabolism. Hence, our results link transcriptional activation to receptor catabolism and suggest that transcriptional up-regulation of nuclear receptors by their ligands may be a feedback mechanism allowing sustained target-gene activation. PMID:10611294

  1. Cyclic Peptidic Mimetics of Apollo Peptides Targeting Telomeric Repeat Binding Factor 2 (TRF2) and Apollo Interaction.

    PubMed

    Chen, Xia; Liu, Liu; Chen, Yong; Yang, Yuting; Yang, Chao-Yie; Guo, Tianyue; Lei, Ming; Sun, Haiying; Wang, Shaomeng

    2018-05-10

    Telomeric repeat binding factor 2 (TRF2) is a telomere-associated protein that plays an important role in the formation of the 3' single strand DNA overhang and the "T loop", two structures critical for the stability of the telomeres. Apollo is a 5'-exonuclease recruited by TRF2 to the telomere and contributes to the formation of the 3' single strand DNA overhang. Knocking down of Apollo can induce DNA damage response similar to that caused by the knocking down of TRF2. In this Letter, we report the design and synthesis of a class of cyclic peptidic mimetics of the TRFH binding motif of Apollo (Apollo TBM ). We found conformational control of the C terminal residues of Apollo TBM can effectively improve the binding affinity. We have obtained a crystal structure of a cyclic peptidic Apollo peptide mimetic ( 34 ) complexed with TRF2, which provides valuable guidance to the future design of TRF2 inhibitors.

  2. Mechanistic insights into metal ion activation and operator recognition by the ferric uptake regulator

    NASA Astrophysics Data System (ADS)

    Deng, Zengqin; Wang, Qing; Liu, Zhao; Zhang, Manfeng; Machado, Ana Carolina Dantas; Chiu, Tsu-Pei; Feng, Chong; Zhang, Qi; Yu, Lin; Qi, Lei; Zheng, Jiangge; Wang, Xu; Huo, Xinmei; Qi, Xiaoxuan; Li, Xiaorong; Wu, Wei; Rohs, Remo; Li, Ying; Chen, Zhongzhou

    2015-07-01

    Ferric uptake regulator (Fur) plays a key role in the iron homeostasis of prokaryotes, such as bacterial pathogens, but the molecular mechanisms and structural basis of Fur-DNA binding remain incompletely understood. Here, we report high-resolution structures of Magnetospirillum gryphiswaldense MSR-1 Fur in four different states: apo-Fur, holo-Fur, the Fur-feoAB1 operator complex and the Fur-Pseudomonas aeruginosa Fur box complex. Apo-Fur is a transition metal ion-independent dimer whose binding induces profound conformational changes and confers DNA-binding ability. Structural characterization, mutagenesis, biochemistry and in vivo data reveal that Fur recognizes DNA by using a combination of base readout through direct contacts in the major groove and shape readout through recognition of the minor-groove electrostatic potential by lysine. The resulting conformational plasticity enables Fur binding to diverse substrates. Our results provide insights into metal ion activation and substrate recognition by Fur that suggest pathways to engineer magnetotactic bacteria and antipathogenic drugs.

  3. Desensitization of the growth hormone-induced Janus kinase 2 (Jak 2)/signal transducer and activator of transcription 5 (Stat5)-signaling pathway requires protein synthesis and phospholipase C.

    PubMed

    Fernández, L; Flores-Morales, A; Lahuna, O; Sliva, D; Norstedt, G; Haldosén, L A; Mode, A; Gustafsson, J A

    1998-04-01

    Signal transducers and activators of transcription (Stat) proteins are latent cytoplasmic transcription factors that are tyrosine phosphorylated by Janus kinases (Jak) in response to GH and other cytokines. GH activates Stat5 by a mechanism that involves tyrosine phosphorylation and nuclear translocation. However, the mechanisms that turn off the GH-activated Jak2/Stat5 pathway are unknown. Continuous exposure to GH of BRL-4 cells, a rat hepatoma cell line stably transfected with rat GH receptor, induces a rapid but transient activation of Jak2 and Stat5. GH-induced Stat5 DNA-binding activity was detected after 2 min and reached a maximum at 10 min. Continued exposure to GH resulted in a desensitization characterized by 1) a rapid decrease in Stat5 DNA-binding activity. The rate of decrease of activity was rapid up to 1 h of GH treatment, and the remaining activity declined slowly thereafter. The activity of Stat5 present after 5 h is still higher than the control levels and almost 10-20% with respect to maximal activity at 10 min; and 2) the inability of further GH treatment to reinduce activation of Stat5. In contrast, with transient exposures of BRL-4 cells to GH, Stat5 DNA-binding activity could repeatedly be induced. GH-induced Jak2 and Stat5 activities were independent of ongoing protein synthesis. However, Jak2 tyrosine phosphorylation and Stat5 DNA-binding activity were prolonged for at least 4 h in the presence of cycloheximide, which suggests that the maintenance of desensitization requires ongoing protein synthesis. Furthermore, inhibition of protein synthesis potentiated GH-induced transcriptional activity in BRL-4 cells transiently transfected with SPIGLE1CAT, a reporter plasmid activated by Stat5. GH-induced Jak2 and Stat5 activation were not affected by D609 or mepacrine, both inhibitors of phospholipase C. However, in the presence of D609 and mepacrine, GH maintained prolonged Jak2 and Stat5 activation. Transactivation of SPIGLE1 by GH was potentiated by mepacrine and D609 but not by the phospholipase A2 inhibitor AACOCF3. Thus, a regulatory circuit of GH-induced transcription through the Jak2/Stat5-signaling pathway includes a prompt GH-induced activation of Jak2/Stat5 followed by a negative regulatory response; ongoing protein synthesis and intracellular signaling pathways, where phospholipase C activity is involved, play a critical role to desensitize the GH-activated Jak2/Stat5-signaling pathway.

  4. C/EBPα Expression is Partially Regulated by C/EBPβ in Response to DNA Damage and C/EBPα Deficient Fibroblasts Display an Impaired G1 Checkpoint

    PubMed Central

    Ranjan, Rakesh; Thompson, Elizabeth A.; Yoon, Kyungsil; Smart, Robert C.

    2009-01-01

    We observed that C/EBPα is highly inducible in primary fibroblasts by DNA damaging agents that induce strand breaks, alkylate and crosslink DNA as well as those that produce bulky DNA lesions. Fibroblasts deficient in C/EBPα (C/EBPα-/-) display an impaired G1 checkpoint as evidenced by inappropriate entry into S-phase in response to DNA damage and these cells also display an enhanced G1 to S transition in response to mitogens. The induction of C/EBPα by DNA damage in fibroblasts does not require p53. EMSA analysis of nuclear extracts prepared from UVB- and MNNG-treated fibroblasts revealed increased binding of C/EBPβ to a C/EBP consensus sequence and ChIP analysis revealed increased C/EBPβ binding to the C/EBPα promoter. To determine whether C/EBPβ has a role in the regulation of C/EBPα we treated C/EBPβ-/- fibroblasts with UVB or MNNG. We observed C/EBPα induction was impaired in both UVB- and MNNG- treated C/EBPβ-/- fibroblasts. Our study reveals a novel role for C/EBPβ in the regulation of C/EBPα in response to DNA damage and provides definitive genetic evidence that C/EBPα has a critical role in the DNA damage G1 checkpoint. PMID:19581927

  5. Role of promoter DNA sequence variations on the binding of EGR1 transcription factor.

    PubMed

    Mikles, David C; Schuchardt, Brett J; Bhat, Vikas; McDonald, Caleb B; Farooq, Amjad

    2014-05-01

    In response to a wide variety of stimuli such as growth factors and hormones, EGR1 transcription factor is rapidly induced and immediately exerts downstream effects central to the maintenance of cellular homeostasis. Herein, our biophysical analysis reveals that DNA sequence variations within the target gene promoters tightly modulate the energetics of binding of EGR1 and that nucleotide substitutions at certain positions are much more detrimental to EGR1-DNA interaction than others. Importantly, the reduction in binding affinity poorly correlates with the loss of enthalpy and gain of entropy-a trend indicative of a complex interplay between underlying thermodynamic factors due to the differential role of water solvent upon nucleotide substitution. We also provide a rationale for the physical basis of the effect of nucleotide substitutions on the EGR1-DNA interaction at atomic level. Taken together, our study bears important implications on understanding the molecular determinants of a key protein-DNA interaction at the cross-roads of human health and disease. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Code-assisted discovery of TAL effector targets in bacterial leaf streak of rice reveals contrast with bacterial blight and a novel susceptibility gene

    USDA-ARS?s Scientific Manuscript database

    Transcription activator-like (TAL) effectors found in Xanthomonas spp. promote bacterial growth and plant susceptibility by binding specific DNA sequences or, effector-binding elements (EBEs), and inducing host gene expression. In this study, we have found substantially different transcriptional pro...

  7. RXR is an essential component of the oncogenic PML/RARA complex in vivo.

    PubMed

    Zhu, Jun; Nasr, Rihab; Pérès, Laurent; Riaucoux-Lormière, Florence; Honoré, Nicole; Berthier, Caroline; Kamashev, Dmitrii; Zhou, Jun; Vitoux, Dominique; Lavau, Catherine; de Thé, Hugues

    2007-07-01

    Although PML-enforced RARA homodimerization allows PML/RARA to bind DNA independently of its coreceptor RXR, the latter was identified within the PML/RARA complex. We demonstrate that a PML/RARA mutant defective for RXR binding fails to trigger APL development in transgenic mice, although it still transforms primary hematopoietic progenitors ex vivo. RXR enhances PML/RARA binding to DNA and is required for rexinoid-induced APL differentiation. In RA-treated PML/RARA-transformed cells, the absence of RXR binding results in monocytic, rather than granulocytic, differentiation. PML/RARA enhances posttranslational modifications of RXRA, including its sumoylation, suggesting that PML-bound sumoylation enzymes target RXRA and possibly other PML/RARA-bound chromatin proteins, further contributing to deregulated transcription. Thus, unexpectedly, RXR contributes to several critical aspects of in vivo transformation.

  8. PARP-1 dependent recruitment of the amyotrophic lateral sclerosis-associated protein FUS/TLS to sites of oxidative DNA damage

    PubMed Central

    Rulten, Stuart L.; Rotheray, Amy; Green, Ryan L.; Grundy, Gabrielle J.; Moore, Duncan A. Q.; Gómez-Herreros, Fernando; Hafezparast, Majid; Caldecott, Keith W

    2014-01-01

    Amyotrophic lateral sclerosis (ALS) is associated with progressive degeneration of motor neurons. Several of the genes associated with this disease encode proteins involved in RNA processing, including fused-in-sarcoma/translocated-in-sarcoma (FUS/TLS). FUS is a member of the heterogeneous nuclear ribonucleoprotein (hnRNP) family of proteins that bind thousands of pre-mRNAs and can regulate their splicing. Here, we have examined the possibility that FUS is also a component of the cellular response to DNA damage. We show that both GFP-tagged and endogenous FUS re-localize to sites of oxidative DNA damage induced by UVA laser, and that FUS recruitment is greatly reduced or ablated by an inhibitor of poly (ADP-ribose) polymerase activity. Consistent with this, we show that recombinant FUS binds directly to poly (ADP-ribose) in vitro, and that both GFP-tagged and endogenous FUS fail to accumulate at sites of UVA laser induced damage in cells lacking poly (ADP-ribose) polymerase-1. Finally, we show that GFP-FUSR521G, harbouring a mutation that is associated with ALS, exhibits reduced ability to accumulate at sites of UVA laser-induced DNA damage. Together, these data suggest that FUS is a component of the cellular response to DNA damage, and that defects in this response may contribute to ALS. PMID:24049082

  9. Mgm101p Is a Novel Component of the Mitochondrial Nucleoid That Binds DNA and Is Required for the Repair of Oxidatively Damaged Mitochondrial DNA

    PubMed Central

    Meeusen, Shelly; Tieu, Quinton; Wong, Edith; Weiss, Eric; Schieltz, David; Yates, John R.; Nunnari, Jodi

    1999-01-01

    Maintenance of mitochondrial DNA (mtDNA) during cell division is required for progeny to be respiratory competent. Maintenance involves the replication, repair, assembly, segregation, and partitioning of the mitochondrial nucleoid. MGM101 has been identified as a gene essential for mtDNA maintenance in S. cerevisiae, but its role is unknown. Using liquid chromatography coupled with tandem mass spectrometry, we identified Mgm101p as a component of highly enriched nucleoids, suggesting that it plays a nucleoid-specific role in maintenance. Subcellular fractionation, indirect immunofluorescence and GFP tagging show that Mgm101p is exclusively associated with the mitochondrial nucleoid structure in cells. Furthermore, DNA affinity chromatography of nucleoid extracts indicates that Mgm101p binds to DNA, suggesting that its nucleoid localization is in part due to this activity. Phenotypic analysis of cells containing a temperature sensitive mgm101 allele suggests that Mgm101p is not involved in mtDNA packaging, segregation, partitioning or required for ongoing mtDNA replication. We examined Mgm101p's role in mtDNA repair. As compared with wild-type cells, mgm101 cells were more sensitive to mtDNA damage induced by UV irradiation and were hypersensitive to mtDNA damage induced by gamma rays and H2O2 treatment. Thus, we propose that Mgm101p performs an essential function in the repair of oxidatively damaged mtDNA that is required for the maintenance of the mitochondrial genome. PMID:10209025

  10. Downstream promoter interactions of TFIID TAFs facilitate transcription reinitiation

    PubMed Central

    Joo, Yoo Jin; Ficarro, Scott B.; Soares, Luis M.; Chun, Yujin; Marto, Jarrod A.; Buratowski, Stephen

    2017-01-01

    TFIID binds promoter DNA to recruit RNA polymerase II and other basal factors for transcription. Although the TATA-binding protein (TBP) subunit of TFIID is necessary and sufficient for in vitro transcription, the TBP-associated factor (TAF) subunits recognize downstream promoter elements, act as coactivators, and interact with nucleosomes. In yeast nuclear extracts, transcription induces stable TAF binding to downstream promoter DNA, promoting subsequent activator-independent transcription reinitiation. In vivo, promoter responses to TAF mutations correlate with the level of downstream, rather than overall, Taf1 cross-linking. We propose a new model in which TAFs function as reinitiation factors, accounting for the differential responses of promoters to various transcription factor mutations. PMID:29203645

  11. Ca2+ improves organization of single-stranded DNA bases in human Rad51 filament, explaining stimulatory effect on gene recombination.

    PubMed

    Fornander, Louise H; Frykholm, Karolin; Reymer, Anna; Renodon-Cornière, Axelle; Takahashi, Masayuki; Nordén, Bengt

    2012-06-01

    Human RAD51 protein (HsRad51) catalyses the DNA strand exchange reaction for homologous recombination. To clarify the molecular mechanism of the reaction in vitro being more effective in the presence of Ca(2+) than of Mg(2+), we have investigated the effect of these ions on the structure of HsRad51 filament complexes with single- and double-stranded DNA, the reaction intermediates. Flow linear dichroism spectroscopy shows that the two ionic conditions induce significantly different structures in the HsRad51/single-stranded DNA complex, while the HsRad51/double-stranded DNA complex does not demonstrate this ionic dependence. In the HsRad51/single-stranded DNA filament, the primary intermediate of the strand exchange reaction, ATP/Ca(2+) induces an ordered conformation of DNA, with preferentially perpendicular orientation of nucleobases relative to the filament axis, while the presence of ATP/Mg(2+), ADP/Mg(2+) or ADP/Ca(2+) does not. A high strand exchange activity is observed for the filament formed with ATP/Ca(2+), whereas the other filaments exhibit lower activity. Molecular modelling suggests that the structural variation is caused by the divalent cation interfering with the L2 loop close to the DNA-binding site. It is proposed that the larger Ca(2+) stabilizes the loop conformation and thereby the protein-DNA interaction. A tight binding of DNA, with bases perpendicularly oriented, could facilitate strand exchange.

  12. The transformed glucocorticoid receptor has a lower steroid-binding affinity than the nontransformed receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nemoto, Takayuki; Ohara-Nemoto, Yuko; Denis, M.

    1990-02-20

    High-salt treatment of cytosolic glucocorticoid receptor (GR) preparations reduces the steroid-binding ability of the receptor and induces the conversion of the receptor from a nontransformed (non-DNA-binding) 9S form to a transformed (DNA-binding) 4S entity. Therefore, the authors decided to investigate the possible relationship between these two phenomena. The binding of ({sup 3}H)triamcinolone acetonide (({sup 3}H)TA) to the 9S form was almost saturated at a concentration of 20 nM, whereas ({sup 3}H)TA was hardly bound to the 4S form at this concentration. The 4S form was efficiently labeled at 200 nM. Scatchard analysis of the GR showed the presence of twomore » types of binding sites. In the absence of molybdate, the ratio of the lower affinity site was increased, but the total number of binding sites was not modified. The GR with the low ({sup 3}H)TA-binding affinity bound to DNA-cellulose even in its unliganded state, whereas the form with the high affinity did not. These results indicate that the transformed GR has a reduced ({sup 3}H)TA-binding affinity as compared to the nontransformed GR. The steroid-binding domain (amino acids 477-777) and the DNA- and steroid-binding domains (amino acids 415-777) of the human GR were expressed in Escherichia coli as protein A fused proteins. Taken together, these results suggest that the component(s) associating with the nontransformed GR, possibly the heat shock protein hsp 90, play(s) an important role in stabilizing the GR in a high-affinity state for steroids.« less

  13. Spectroscopic studies of the interaction between pirimicarb and calf thymus DNA.

    PubMed

    Zhang, Guowen; Hu, Xing; Pan, Junhui

    2011-02-01

    The interaction between pirimicarb and calf thymus DNA in physiological buffer (pH 7.4) was investigated with the use of Neutral Red (NR) dye as a spectral probe by UV-vis absorption, fluorescence and circular dichroism (CD) spectroscopy, as well as viscosity measurements and DNA melting techniques. The results revealed that an intercalation binding should be the interaction mode of pirimicarb to DNA. CD spectra indicated that pirimicarb induced conformational changes of DNA. The binding constants of pirimicarb with DNA were obtained by the fluorescence quenching method. The thermodynamic parameters, enthalpy change (ΔHθ) and entropy change (ΔSθ) were calculated to be -52.13±2.04 kJ mol(-1) and -108.8±6.72 J mol(-1) K(-1) according to the van't Hoff equation, which suggested that hydrogen bonds and van der Waals forces might play a major role in the binding of pirimicarb to DNA. Further, the alternative least squares (ALS) method was applied to resolve a complex two-way array of the absorption spectra data, which provided simultaneously the concentration information for the three reaction components, pirimicarb, NR and DNA-NR. This ALS analysis indicated that the intercalation of pirimicarb into the DNA by substituting for NR in the DNA-NR complex. Copyright © 2010 Elsevier B.V. All rights reserved.

  14. BuD, a helix–loop–helix DNA-binding domain for genome modification

    PubMed Central

    Stella, Stefano; Molina, Rafael; López-Méndez, Blanca; Juillerat, Alexandre; Bertonati, Claudia; Daboussi, Fayza; Campos-Olivas, Ramon; Duchateau, Phillippe; Montoya, Guillermo

    2014-01-01

    DNA editing offers new possibilities in synthetic biology and biomedicine for modulation or modification of cellular functions to organisms. However, inaccuracy in this process may lead to genome damage. To address this important problem, a strategy allowing specific gene modification has been achieved through the addition, removal or exchange of DNA sequences using customized proteins and the endogenous DNA-repair machinery. Therefore, the engineering of specific protein–DNA interactions in protein scaffolds is key to providing ‘toolkits’ for precise genome modification or regulation of gene expression. In a search for putative DNA-binding domains, BurrH, a protein that recognizes a 19 bp DNA target, was identified. Here, its apo and DNA-bound crystal structures are reported, revealing a central region containing 19 repeats of a helix–loop–helix modular domain (BurrH domain; BuD), which identifies the DNA target by a single residue-to-nucleotide code, thus facilitating its redesign for gene targeting. New DNA-binding specificities have been engineered in this template, showing that BuD-derived nucleases (BuDNs) induce high levels of gene targeting in a locus of the human haemoglobin β (HBB) gene close to mutations responsible for sickle-cell anaemia. Hence, the unique combination of high efficiency and specificity of the BuD arrays can push forward diverse genome-modification approaches for cell or organism redesign, opening new avenues for gene editing. PMID:25004980

  15. Preferential recognition of auto-antibodies against 4-hydroxynonenal modified DNA in the cancer patients.

    PubMed

    Faisal, Mohammad; Shahab, Uzma; Alatar, Abdulrahman A; Ahmad, Saheem

    2017-11-01

    The structural perturbations in DNA molecule may be caused by a break in a strand, a missing base from the backbone, or a chemically changed base. These alterations in DNA that occurs naturally can result from metabolic or hydrolytic processes. DNA damage plays a major role in the mutagenesis, carcinogenesis, aging and various other patho-physiological conditions. DNA damage can be induced through hydrolysis, exposure to reactive oxygen species (ROS) and other reactive carbonyl metabolites including 4-hydroxynonenal (HNE). 4-HNE is an important lipid peroxidation product which has been implicated in the mutagenesis and carcinogenesis processes. The present study examines to probe the presence of auto-antibodies against 4-hydroxynonenal damaged DNA (HNE-DNA) in various cancer subjects. In this study, the purified calf thymus DNA was damaged by the action of 4-HNE. The DNA was incubated with 4-HNE for 24 h at 37°C temperature. The binding characteristics of cancer auto-antibodies were assessed by direct binding and competitive inhibition ELISA. DNA modifications produced hyperchromicity in UV spectrum and decreased fluorescence intensity. Cancer sera exhibited enhanced binding with the 4-HNE modified calf thymus DNA as compared to its native conformer. The 4-HNE modified DNA presents unique epitopes which may be one of the factors for the auto-antibody induction in cancer patients. The HNE modified DNA presents unique epitopes which may be one of the factors for the autoantibody induction in cancer patients. © 2017 Wiley Periodicals, Inc.

  16. EFFECTS OF 4,4'-METHYLENEBIS-(2-CHLOROANILINE) AND BENZOTRICHLORIDE IN HUMAN AND/OR ANIMAL TISSUES

    EPA Science Inventory

    4,4'-Methylene-bis(2-chloraniline)(MOCA) is an aromatic amine with structural similarity to known human bladder carcinogens, and induces urothelial tumors in dogs. Therefore, the authors compare the binding to DNA and DNA-adduct formation of 4,4'-Methylene-bis(2-chloraniline) (MO...

  17. Synthesis and evaluation of 7-substituted-5,6-dihydrobenzo[c]acridine derivatives as new c-KIT promoter G-quadruplex binding ligands.

    PubMed

    Guo, Qian-Liang; Su, Hua-Fei; Wang, Ning; Liao, Sheng-Rong; Lu, Yu-Ting; Ou, Tian-Miao; Tan, Jia-Heng; Li, Ding; Huang, Zhi-Shu

    2017-04-21

    It has been shown that treatment of cancer cells with c-KIT G-quadruplex binding ligands can reduce their c-KIT expression levels thus inhibiting cell proliferation and inducing cell apoptosis. Herein, a series of new 7-substituted-5,6-dihydrobenzo[c]acridine derivatives were designed and synthesized. Subsequent biophysical evaluation demonstrated that the derivatives could effectively bind to and stabilize c-KIT G-quadruplex with good selectivity against duplex DNA. It was found that 12-N-methylated derivatives with a positive charge introduced at 12-position of 5,6-dihydrobenzo[c]acridine ring had similar binding affinity but lower stabilizing ability to c-KIT G-quadruplex DNA, compared with those of nonmethylated derivatives. Further molecular modeling studies showed possible binding modes of G-quadruplex with the ligands. RT-PCR assay and Western blot showed that compound 2b suppressed transcription and translation of c-KIT gene in K562 cells, which was consistent with the property of an effective G-quadruplex binding ligand targeting c-KIT oncogene promoter. Further biological evaluation showed that compound 2b could induce apoptosis through activation of the caspase-3 cascade pathway. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  18. Protein domains connect cell cycle stimulation directly to initiation of DNA replication.

    PubMed Central

    Gjørup, O V; Rose, P E; Holman, P S; Bockus, B J; Schaffhausen, B S

    1994-01-01

    Polyoma large T antigen (LT) is the only viral gene product required for viral DNA replication. LT can be divided into two domains, one N-terminal (NT) spanning residues 1-260 and one C-terminal (CT) comprising approximately residues 264-785. NT is known to immortalize primary cells in a manner dependent on binding of pRB/p107. Here a CT construct comprising residues 264-785 was shown to have independent function in DNA replication. CT is entirely sufficient for driving viral DNA replication in vivo in growing mouse cells at a level approaching that of full-length LT. In contrast, CT is strikingly deficient for replication in serum-starved cells. However, this deficiency can be complemented by coexpression of NT. BrdUrd incorporation in transfected, starved cells showed that NT was sufficient for inducing S phase, suggesting a mechanism for complementation. By contrast, CT was unable to induce S phase when tested in the same assay. NT also promotes phosphorylation of sites in CT that are likely to be important for replication. Other DNA tumor virus gene products such as adenovirus E1A 12S and human papillomavirus 16 E7 could also complement CT for replication. Although NT, E1A 12S, and E7 all bind the retinoblastoma gene product (pRB) and p107, genetic analysis demonstrates an additional function, independent of that binding, is responsible for complementation. Images PMID:7991595

  19. Effect of NaeI-L43K mutation on protein dynamics and DNA conformation: Insights from molecular dynamics simulations.

    PubMed

    Ramachandrakurup, Sreelakshmi; Ramakrishnan, Vigneshwar

    2017-09-01

    Protein-DNA interactions are an important class of biomolecular interactions inside the cell. Delineating the mechanisms of protein-DNA interactions and more specifically, how proteins search and bind to their specific cognate sequences has been the quest of many in the scientific community. Restriction enzymes have served as useful model systems to this end. In this work, we have investigated using molecular dynamics simulations the effect of L43K mutation on NaeI, a type IIE restriction enzyme. NaeI has two domains, the Topo and the Endo domains, each binding to identical strands of DNA sequences (GCCGGC) 2 . The binding of the DNA to the Topo domain is thought to enhance the binding and cleavage of DNA at the Endo domain. Interestingly, it has been found that the mutation of an amino acid that is distantly-located from the DNA cleavage site (L43K) converts the restriction endonuclease to a topoisomerase. Our investigations reveal that the L43K mutation not only induces local structural changes (as evidenced by changes in hydrogen bond propensities and differences in the percentage of secondary structure assignments of the residues in the ligase-like domain) but also alters the overall protein dynamics and DNA conformation which probably leads to the loss of specific cleavage of the recognition site. In a larger context, our study underscores the importance of considering the role of distantly-located amino acids in understanding protein-DNA interactions. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Influence of quasi-specific sites on kinetics of target DNA search by a sequence-specific DNA-binding protein.

    PubMed

    Kemme, Catherine A; Esadze, Alexandre; Iwahara, Junji

    2015-11-10

    Functions of transcription factors require formation of specific complexes at particular sites in cis-regulatory elements of genes. However, chromosomal DNA contains numerous sites that are similar to the target sequences recognized by transcription factors. The influence of such "quasi-specific" sites on functions of the transcription factors is not well understood at present by experimental means. In this work, using fluorescence methods, we have investigated the influence of quasi-specific DNA sites on the efficiency of target location by the zinc finger DNA-binding domain of the inducible transcription factor Egr-1, which recognizes a 9 bp sequence. By stopped-flow assays, we measured the kinetics of Egr-1's association with a target site on 143 bp DNA in the presence of various competitor DNAs, including nonspecific and quasi-specific sites. The presence of quasi-specific sites on competitor DNA significantly decelerated the target association by the Egr-1 protein. The impact of the quasi-specific sites depended strongly on their affinity, their concentration, and the degree of their binding to the protein. To quantitatively describe the kinetic impact of the quasi-specific sites, we derived an analytical form of the apparent kinetic rate constant for the target association and used it for fitting to the experimental data. Our kinetic data with calf thymus DNA as a competitor suggested that there are millions of high-affinity quasi-specific sites for Egr-1 among the 3 billion bp of genomic DNA. This study quantitatively demonstrates that naturally abundant quasi-specific sites on DNA can considerably impede the target search processes of sequence-specific DNA-binding proteins.

  1. Influence of Quasi-Specific Sites on Kinetics of Target DNA Search by a Sequence-Specific DNA-Binding Protein

    PubMed Central

    2015-01-01

    Functions of transcription factors require formation of specific complexes at particular sites in cis-regulatory elements of genes. However, chromosomal DNA contains numerous sites that are similar to the target sequences recognized by transcription factors. The influence of such “quasi-specific” sites on functions of the transcription factors is not well understood at present by experimental means. In this work, using fluorescence methods, we have investigated the influence of quasi-specific DNA sites on the efficiency of target location by the zinc finger DNA-binding domain of the inducible transcription factor Egr-1, which recognizes a 9 bp sequence. By stopped-flow assays, we measured the kinetics of Egr-1’s association with a target site on 143 bp DNA in the presence of various competitor DNAs, including nonspecific and quasi-specific sites. The presence of quasi-specific sites on competitor DNA significantly decelerated the target association by the Egr-1 protein. The impact of the quasi-specific sites depended strongly on their affinity, their concentration, and the degree of their binding to the protein. To quantitatively describe the kinetic impact of the quasi-specific sites, we derived an analytical form of the apparent kinetic rate constant for the target association and used it for fitting to the experimental data. Our kinetic data with calf thymus DNA as a competitor suggested that there are millions of high-affinity quasi-specific sites for Egr-1 among the 3 billion bp of genomic DNA. This study quantitatively demonstrates that naturally abundant quasi-specific sites on DNA can considerably impede the target search processes of sequence-specific DNA-binding proteins. PMID:26502071

  2. AtSPX1 affects the AtPHR1-DNA-binding equilibrium by binding monomeric AtPHR1 in solution.

    PubMed

    Qi, Wanjun; Manfield, Iain W; Muench, Stephen P; Baker, Alison

    2017-10-23

    Phosphorus is an essential macronutrient for plant growth and is deficient in ∼50% of agricultural soils. The transcription factor phosphate starvation response 1 (PHR1) plays a central role in regulating the expression of a subset of phosphate starvation-induced (PSI) genes through binding to a cis -acting DNA element termed P1BS (PHR1-binding sequences). In Arabidopsis and rice, activity of AtPHR1/OsPHR2 is regulated in part by their downstream target SPX ( S yg1, P ho81, X pr1) proteins through protein-protein interaction. Here, we provide kinetic and affinity data for interaction between AtPHR1 and P1BS sites. Using surface plasmon resonance, a tandem P1BS sequence showed ∼50-fold higher affinity for MBPAtdPHR1 (a fusion protein comprising the DNA-binding domain and coiled-coil domain of AtPHR1 fused to maltose-binding protein) than a single site. The affinity difference was largely reflected in a much slower dissociation rate from the 2× P1BS-binding site, suggesting an important role for protein co-operativity. Injection of AtSPX1 in the presence of phosphate or inositol hexakisphosphate (InsP6) failed to alter the MBPAtdPHR1-P1BS dissociation rate, while pre-mixing of these two proteins in the presence of either 5 mM Pi or 500 µM InsP6 resulted in a much lower DNA-binding signal from MBPAtdPHR1. These data suggest that, in the Pi-restored condition, AtSPX1 can bind to monomeric AtPHR1 in solution and therefore regulate PSI gene expression by tuning the AtPHR1-DNA-binding equilibrium. This Pi-dependent regulation of AtPHR1-DNA-binding equilibrium also generates a negative feedback loop on the expression of AtSPX1 itself, providing a tight control of PSI gene expression. © 2017 The Author(s).

  3. p21 differentially regulates DNA replication and DNA-repair-associated processes after UV irradiation.

    PubMed

    Soria, Gaston; Speroni, Juliana; Podhajcer, Osvaldo L; Prives, Carol; Gottifredi, Vanesa

    2008-10-01

    Although p21 upregulation is required to block cell-cycle progression following many types of genotoxic insult, UV irradiation triggers p21 proteolysis. The significance of the increased p21 turnover is unclear and might be associated with DNA repair. While the role of p21 in nucleotide excision repair (NER) remains controversial, recent reports have explored its effect on translesion DNA synthesis (TLS), a process that avoids replication blockage during S phase. Herein, we analyze the effect of p21 on different PCNA-driven processes including DNA replication, NER and TLS. Whereas only the CDK-binding domain of p21 is required for cell-cycle arrest in unstressed cells, neither the CDK-binding nor the PCNA-binding domain of p21 is able to block early and late steps of NER. Intriguingly, through its PCNA-binding domain, p21 inhibits the interaction of the TLS polymerase, pol eta (pol eta), with PCNA and impairs the assembly of pol eta foci after UV. Moreover, this obstruction correlates with accumulation of phosphorylated H2AX and increased apoptosis. By showing that p21 is a negative regulator of PCNA-pol eta interaction, our data unveil a link between efficient TLS and UV-induced degradation of p21.

  4. Crystal Structure of the Minimalist Max-E47 Protein Chimera

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ahmadpour, Faraz; Ghirlando, Rodolfo; De Jong, Antonia T.

    Max-E47 is a protein chimera generated from the fusion of the DNA-binding basic region of Max and the dimerization region of E47, both members of the basic region/helix-loop-helix (bHLH) superfamily of transcription factors. Like native Max, Max-E47 binds with high affinity and specificity to the E-box site, 5'-CACGTG, both in vivo and in vitro. We have determined the crystal structure of Max-E47 at 1.7 Å resolution, and found that it associates to form a well-structured dimer even in the absence of its cognate DNA. Analytical ultracentrifugation confirms that Max-E47 is dimeric even at low micromolar concentrations, indicating that the Max-E47more » dimer is stable in the absence of DNA. Circular dichroism analysis demonstrates that both non-specific DNA and the E-box site induce similar levels of helical secondary structure in Max-E47. These results suggest that Max-E47 may bind to the E-box following the two-step mechanism proposed for other bHLH proteins. In this mechanism, a rapid step where protein binds to DNA without sequence specificity is followed by a slow step where specific protein:DNA interactions are fine-tuned, leading to sequence-specific recognition. Collectively, these results show that the designed Max-E47 protein chimera behaves both structurally and functionally like its native counterparts.« less

  5. Development of a new fluorescent reporter:operator system: location of AraC regulated genes in Escherichia coli K-12.

    PubMed

    Sellars, Laura E; Bryant, Jack A; Sánchez-Romero, María-Antonia; Sánchez-Morán, Eugenio; Busby, Stephen J W; Lee, David J

    2017-08-03

    In bacteria, many transcription activator and repressor proteins regulate multiple transcription units that are often distally distributed on the bacterial genome. To investigate the subcellular location of DNA bound proteins in the folded bacterial nucleoid, fluorescent reporters have been developed which can be targeted to specific DNA operator sites. Such Fluorescent Reporter-Operator System (FROS) probes consist of a fluorescent protein fused to a DNA binding protein, which binds to an array of DNA operator sites located within the genome. Here we have developed a new FROS probe using the Escherichia coli MalI transcription factor, fused to mCherry fluorescent protein. We have used this in combination with a LacI repressor::GFP protein based FROS probe to assess the cellular location of commonly regulated transcription units that are distal on the Escherichia coli genome. We developed a new DNA binding fluorescent reporter, consisting of the Escherichia coli MalI protein fused to the mCherry fluorescent protein. This was used in combination with a Lac repressor:green fluorescent protein fusion to examine the spatial positioning and possible co-localisation of target genes, regulated by the Escherichia coli AraC protein. We report that induction of gene expression with arabinose does not result in co-localisation of AraC-regulated transcription units. However, measurable repositioning was observed when gene expression was induced at the AraC-regulated promoter controlling expression of the araFGH genes, located close to the DNA replication terminus on the chromosome. Moreover, in dividing cells, arabinose-induced expression at the araFGH locus enhanced chromosome segregation after replication. Regions of the chromosome regulated by AraC do not colocalise, but transcription events can induce movement of chromosome loci in bacteria and our observations suggest a role for gene expression in chromosome segregation.

  6. A map of human PRDM9 binding provides evidence for novel behaviors of PRDM9 and other zinc-finger proteins in meiosis

    PubMed Central

    Noor, Nudrat; Bitoun, Emmanuelle; Tumian, Afidalina; Imbeault, Michael; Chapman, J Ross; Aricescu, A Radu

    2017-01-01

    PRDM9 binding localizes almost all meiotic recombination sites in humans and mice. However, most PRDM9-bound loci do not become recombination hotspots. To explore factors that affect binding and subsequent recombination outcomes, we mapped human PRDM9 binding sites in a transfected human cell line and measured PRDM9-induced histone modifications. These data reveal varied DNA-binding modalities of PRDM9. We also find that human PRDM9 frequently binds promoters, despite their low recombination rates, and it can activate expression of a small number of genes including CTCFL and VCX. Furthermore, we identify specific sequence motifs that predict consistent, localized meiotic recombination suppression around a subset of PRDM9 binding sites. These motifs strongly associate with KRAB-ZNF protein binding, TRIM28 recruitment, and specific histone modifications. Finally, we demonstrate that, in addition to binding DNA, PRDM9's zinc fingers also mediate its multimerization, and we show that a pair of highly diverged alleles preferentially form homo-multimers. PMID:29072575

  7. An Enhanced Synthetic Multiclade DNA Prime Induces Improved Cross-Clade-Reactive Functional Antibodies when Combined with an Adjuvanted Protein Boost in Nonhuman Primates

    PubMed Central

    Wise, Megan C.; Hutnick, Natalie A.; Pollara, Justin; Myles, Devin J. F.; Williams, Constance; Yan, Jian; LaBranche, Celia C.; Khan, Amir S.; Sardesai, Niranjan Y.; Montefiori, David; Barnett, Susan W.; Zolla-Pazner, Susan; Ferrari, Guido

    2015-01-01

    ABSTRACT The search for an efficacious human immunodeficiency virus type 1 (HIV-1) vaccine remains a pressing need. The moderate success of the RV144 Thai clinical vaccine trial suggested that vaccine-induced HIV-1-specific antibodies can reduce the risk of HIV-1 infection. We have made several improvements to the DNA platform and have previously shown that improved DNA vaccines alone are capable of inducing both binding and neutralizing antibodies in small-animal models. In this study, we explored how an improved DNA prime and recombinant protein boost would impact HIV-specific vaccine immunogenicity in rhesus macaques (RhM). After DNA immunization with either a single HIV Env consensus sequence or multiple constructs expressing HIV subtype-specific Env consensus sequences, we detected both CD4+ and CD8+ T-cell responses to all vaccine immunogens. These T-cell responses were further increased after protein boosting to levels exceeding those of DNA-only or protein-only immunization. In addition, we observed antibodies that exhibited robust cross-clade binding and neutralizing and antibody-dependent cellular cytotoxicity (ADCC) activity after immunization with the DNA prime-protein boost regimen, with the multiple-Env formulation inducing a more robust and broader response than the single-Env formulation. The magnitude and functionality of these responses emphasize the strong priming effect improved DNA immunogens can induce, which are further expanded upon protein boost. These results support further study of an improved synthetic DNA prime together with a protein boost for enhancing anti-HIV immune responses. IMPORTANCE Even with effective antiretroviral drugs, HIV remains an enormous global health burden. Vaccine development has been problematic in part due to the high degree of diversity and poor immunogenicity of the HIV Env protein. Studies suggest that a relevant HIV vaccine will likely need to induce broad cellular and humoral responses from a simple vaccine regimen due to the resource-limited setting in which the HIV pandemic is most rampant. DNA vaccination lends itself well to increasing the amount of diversity included in a vaccine due to the ease of manufacturing multiple plasmids and formulating them as a single immunization. By increasing the number of Envs within a formulation, we were able to show an increased breadth of responses as well as improved functionality induced in a nonhuman primate model. This increased breadth could be built upon, leading to better coverage against circulating strains with broader vaccine-induced protection. PMID:26085155

  8. Variola virus E3L Zα domain, but not its Z-DNA binding activity, is required for PKR inhibition.

    PubMed

    Thakur, Meghna; Seo, Eun Joo; Dever, Thomas E

    2014-02-01

    Responding to viral infection, the interferon-induced, double-stranded RNA (dsRNA)-activated protein kinase PKR phosphorylates translation initiation factor eIF2α to inhibit cellular and viral protein synthesis. To overcome this host defense mechanism, many poxviruses express the protein E3L, containing an N-terminal Z-DNA binding (Zα) domain and a C-terminal dsRNA-binding domain (dsRBD). While E3L is thought to inhibit PKR activation by sequestering dsRNA activators and by directly binding the kinase, the role of the Zα domain in PKR inhibition remains unclear. Here, we show that the E3L Zα domain is required to suppress the growth-inhibitory properties associated with expression of human PKR in yeast, to inhibit PKR kinase activity in vitro, and to reverse the inhibitory effects of PKR on reporter gene expression in mammalian cells treated with dsRNA. Whereas previous studies revealed that the Z-DNA binding activity of E3L is critical for viral pathogenesis, we identified point mutations in E3L that functionally uncouple Z-DNA binding and PKR inhibition. Thus, our studies reveal a molecular distinction between the nucleic acid binding and PKR inhibitory functions of the E3L Zα domain, and they support the notion that E3L contributes to viral pathogenesis by targeting PKR and other components of the cellular anti-viral defense pathway.

  9. Genotoxic effect of N-hydroxy-4-acetylaminobiphenyl on human DNA: implications in bladder cancer.

    PubMed

    Shahab, Uzma; Moinuddin; Ahmad, Saheem; Dixit, Kiran; Habib, Safia; Alam, Khursheed; Ali, Asif

    2013-01-01

    The interaction of environmental chemicals and their metabolites with biological macromolecules can result in cytotoxic and genotoxic effects. 4-Aminobiphenyl (4-ABP) and several other related arylamines have been shown to be causally involved in the induction of human urinary bladder cancers. The genotoxic and the carcinogenic effects of 4-ABP are exhibited only when it is metabolically converted to a reactive electrophile, the aryl nitrenium ions, which subsequently binds to DNA and induce lesions. Although several studies have reported the formation of 4-ABP-DNA adducts, no extensive work has been done to investigate the immunogenicity of 4-ABP-modified DNA and its possible involvement in the generation of antibodies in bladder cancer patients. Human DNA was modified by N-hydroxy-4-acetylaminobiphenyl (N-OH-AABP), a reactive metabolite of 4-ABP. Structural perturbations in the N-OH-AABP modified DNA were assessed by ultraviolet, fluorescence, and circular dichroic spectroscopy as well as by agarose gel electrophoresis. Genotoxicity of N-OH-AABP modified DNA was ascertained by comet assay. High performance liquid chromatography (HPLC) analysis of native and modified DNA samples confirmed the formation of N-(deoxyguanosine-8-yl)-4-aminobiphenyl (dG-C8-4ABP) in the N-OH-AABP damaged DNA. The experimentally induced antibodies against N-OH-AABP-modified DNA exhibited much better recognition of the DNA isolated from bladder cancer patients as compared to the DNA obtained from healthy individuals in competitive binding ELISA. This work shows epitope sharing between the DNA isolated from bladder cancer patients and the N-OH-AABP-modified DNA implicating the role of 4-ABP metabolites in the DNA damage and neo-antigenic epitope generation that could lead to the induction of antibodies in bladder cancer patients.

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kitchin, Kirk T.; Wallace, Kathleen

    A large amount of evidence suggests that arsenicals act via oxidative stress in causing cancer in humans and experimental animals. It is possible that arsenicals could bind in situ close to nuclear DNA followed by Haber-Weiss type oxidative DNA damage. Therefore, we tested this hypothesis by using radioactive {sup 73}As labeled arsenite and vacuum filtration methodology to determine the binding affinity and capacity of {sup 73}As arsenite to calf thymus DNA and Type 2A unfractionated histones, histone H3, H4 and horse spleen ferritin. Arsenicals are known to release redox active Fe from ferritin. At concentrations up to about 1 mM,more » neither DNA nor any of the three proteins studied, Type II-A histones, histone H3, H4 or ferritin, bound radioactive arsenite in a specific manner. Therefore, it appears highly unlikely that initial in situ binding of trivalent arsenicals, followed by in situ oxidative DNA damage, can account for arsenic's carcinogenicity. This experimental evidence (lack of arsenite binding to DNA, histone Type II-A and histone H3, H4) does not rule out other possible oxidative stress modes of action for arsenic such as (a) diffusion of longer lived oxidative stress molecules, such as H{sub 2}O{sub 2} into the nucleus and ensuing oxidative damage, (b) redox chemistry by unbound arsenicals in the nucleus, or (c) arsenical-induced perturbations in Fe, Cu or other metals which are already known to oxidize DNA in vitro and in vivo.« less

  11. Sensing of Double-Stranded DNA/RNA Secondary Structures by Water Soluble Homochiral Perylene Bisimide Dyes.

    PubMed

    Gershberg, Jana; Radić Stojković, Marijana; Škugor, Marko; Tomić, Sanja; Rehm, Thomas H; Rehm, Stefanie; Saha-Möller, Chantu R; Piantanida, Ivo; Würthner, Frank

    2015-05-18

    A broad series of homochiral perylene bisimide (PBI) dyes were synthesized that are appended with amino acids and cationic side chains at the imide positions. Self-assembly behavior of these ionic PBIs has been studied in aqueous media by UV/Vis spectroscopy, revealing formation of excitonically coupled H-type aggregates. The interactions of these ionic PBIs with different ds-DNA and ds-RNA have been explored by thermal denaturation, fluorimetric titration and circular dichroism (CD) experiments. These PBIs strongly stabilized ds-DNA/RNA against thermal denaturation as revealed by high melting temperatures of the formed PBI/polynucleotide complexes. Fluorimetric titrations showed that these PBIs bind to ds-DNA/RNA with high binding constants depending on the number of the positive charges in the side chains. Thus, spermine-containing PBIs with six positive charges each showed higher binding constants (logKs =9.2-9.8) than their dioxa analogues (logKs =6.5-7.9) having two positive charges each. Induced circular dichroism (ICD) of PBI assemblies created within DNA/RNA grooves was observed. These ICD profiles are strongly dependent on the steric demand of the chiral substituents of the amino acid units and the secondary structure of the DNA or RNA. The observed ICD effects can be explained by non-covalent binding of excitonically coupled PBI dimer aggregates into the minor groove of DNA and major groove of RNA which is further supported by molecular modeling studies. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. The high mobility group protein 1 enhances binding of the estrogen receptor DNA binding domain to the estrogen response element.

    PubMed

    Romine, L E; Wood, J R; Lamia, L A; Prendergast, P; Edwards, D P; Nardulli, A M

    1998-05-01

    We have examined the ability of the high-mobility group protein 1 (HMG1) to alter binding of the estrogen receptor DNA-binding domain (DBD) to the estrogen response element (ERE). HMG1 dramatically enhanced binding of purified, bacterially expressed DBD to the consensus vitellogenin A2 ERE in a dose-dependent manner. The ability of HMG1 to stabilize the DBD-ERE complex resulted in part from a decrease in the dissociation rate of the DBD from the ERE. Antibody supershift experiments demonstrated that HMG1 was also capable of forming a ternary complex with the ERE-bound DBD in the presence of HMG1-specific antibody. HMG1 did not substantially affect DBD-ERE contacts as assessed by methylation interference assays, nor did it alter the ability of the DBD to induce distortion in ERE-containing DNA fragments. Because HMG1 dramatically enhanced estrogen receptor DBD binding to the ERE, and the DBD is the most highly conserved region among the nuclear receptor superfamily members, HMG1 may function to enhance binding of other nuclear receptors to their respective response elements and act in concert with coactivator proteins to regulate expression of hormone-responsive genes.

  13. Heat shock of Escherichia coli increases binding of dnaK (the hsp70 homolog) to polypeptides by promoting its phosphorylation.

    PubMed Central

    Sherman, M Y; Goldberg, A L

    1993-01-01

    The "molecular chaperone", dnaK, is induced in Escherichia coli upon heat shock and promotes ATP-dependent refolding or degradation of damaged proteins. When cells were grown at 25 degrees C and disrupted, a small fraction of the dnaK bound to affinity columns containing unfolded polypeptides (e.g., a fusion protein named CRAG or casein) and could be dissociated by ATP-Mg2+. After shifting cells to 42 degrees C for 30 min, up to 5-fold more dnaK bound to these columns than after growth at 25 degrees C. This enhanced binding capacity was reversed after shifting cells back to 25 degrees C. It resulted from a covalent modification, which decreases dnaK's electrophoretic mobility and isoelectric point. This modification appears to be phosphorylation; after treatment with phosphatases, the ATP-eluted dnaK resembled the predominant form in electrophoretic and binding properties. In addition, after incubating cells with [32P]orthophosphate at 42 degrees C, the 32P-labeled dnaK bound quantitatively to the CRAG column, unlike the nonlabeled protein. Thus, the phosphorylated dnaK is a special form of the chaperone with enhanced affinity for unfolded proteins. Its accumulation at high temperatures may account for dnaK's function as the "cellular thermometer." Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 Fig. 7 PMID:8378342

  14. The NMR solution structure of a mutant of the Max b/HLH/LZ free of DNA: insights into the specific and reversible DNA binding mechanism of dimeric transcription factors.

    PubMed

    Sauvé, Simon; Tremblay, Luc; Lavigne, Pierre

    2004-09-17

    Basic region-helix1-loop-helix2-leucine zipper (b/H(1)LH(2)/LZ) transcription factors bind specific DNA sequence in their target gene promoters as dimers. Max, a b/H(1)LH(2)/LZ transcription factor, is the obligate heterodimeric partner of the related b/H(1)LH(2)/LZ proteins of the Myc and Mad families. These heterodimers specifically bind E-box DNA sequence (CACGTG) to activate (e.g. c-Myc/Max) and repress (e.g. Mad1/Max) transcription. Max can also homodimerize and bind E-box sequences in c-Myc target gene promoters. While the X-ray structure of the Max b/H(1)LH(2)/LZ/DNA complex and that of others have been reported, the precise sequence of events leading to the reversible and specific binding of these important transcription factors is still largely unknown. In order to provide insights into the DNA binding mechanism, we have solved the NMR solution structure of a covalently homodimerized version of a Max b/H(1)LH(2)/LZ protein with two stabilizing mutations in the LZ, and characterized its backbone dynamics from (15)N spin-relaxation measurements in the absence of DNA. Apart from minor differences in the pitch of the LZ, possibly resulting from the mutations in the construct, we observe that the packing of the helices in the H(1)LH(2) domain is almost identical to that of the two crystal structures, indicating that no important conformational change in these helices occurs upon DNA binding. Conversely to the crystal structures of the DNA complexes, the first 14 residues of the basic region are found to be mostly unfolded while the loop is observed to be flexible. This indicates that these domains undergo conformational changes upon DNA binding. On the other hand, we find the last four residues of the basic region form a persistent helical turn contiguous to H(1). In addition, we provide evidence of the existence of internal motions in the backbone of H(1) that are of larger amplitude and longer time-scale (nanoseconds) than the ones in the H(2) and LZ domain. Most interestingly, we note that conformers in the ensemble of calculated structures have highly conserved basic residues (located in the persistent helical turn of the basic region and in the loop) known to be important for specific binding in a conformation that matches that of the DNA-bound state. These partially prefolded conformers can directly fit into the major groove of DNA and as such are proposed to lie on the pathway leading to the reversible and specific DNA binding. In these conformers, the conserved basic side-chains form a cluster that elevates the local electrostatic potential and could provide the necessary driving force for the generation of the internal motions localized in the H(1) and therefore link structural determinants with the DNA binding function. Overall, our results suggests that the Max homodimeric b/H(1)LH(2)/LZ can rapidly and preferentially bind DNA sequence through transient and partially prefolded states and subsequently, adopt the fully helical bound state in a DNA-assisted mechanism or induced-fit.

  15. Recognition of chromatin by the plant alkaloid, ellipticine as a dual binder

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Banerjee, Amrita; Sanyal, Sulagna; Majumder, Parijat

    Recognition of core histone components of chromatin along with chromosomal DNA by a class of small molecule modulators is worth examining to evaluate their intracellular mode of action. A plant alkaloid ellipticine (ELP) which is a putative anticancer agent has so far been reported to function via DNA intercalation, association with topoisomerase II and binding to telomere region. However, its effect upon the potential intracellular target, chromatin is hitherto unreported. Here we have characterized the biomolecular recognition between ELP and different hierarchical levels of chromatin. The significant result is that in addition to DNA, it binds to core histone(s) andmore » can be categorized as a ‘dual binder’. As a sequel to binding with histone(s) and core octamer, it alters post-translational histone acetylation marks. We have further demonstrated that it has the potential to modulate gene expression thereby regulating several key biological processes such as nuclear organization, transcription, translation and histone modifications. - Highlights: • Ellipticine acts a dual binder binding to both DNA and core histone(s). • It induces structural perturbations in chromatin, chromatosome and histone octamer. • It alters histones acetylation and affects global gene expression.« less

  16. c-Ski inhibits the TGF-beta signaling pathway through stabilization of inactive Smad complexes on Smad-binding elements.

    PubMed

    Suzuki, Hiroyuki; Yagi, Ken; Kondo, Miki; Kato, Mitsuyasu; Miyazono, Kohei; Miyazawa, Keiji

    2004-06-24

    c-Ski inhibits transforming growth factor-beta (TGF-beta) signaling through interaction with Smad proteins. c-Ski represses Smad-mediated transcriptional activation, probably through its action as a transcriptional co-repressor. c-Ski also inhibits TGF-beta-induced downregulation of genes such as c-myc. However, mechanisms for transcriptional regulation of target genes by c-Ski have not been fully determined. In this study, we examined how c-Ski inhibits both TGF-beta-induced transcriptional activation and repression. DNA-affinity precipitation analysis revealed that c-Ski enhances the binding of Smad2 and 4, and to a lesser extent Smad3, to both CAGA and TGF-beta1 inhibitory element probes. A c-Ski mutant, which is unable to interact with Smad4, failed to enhance the binding of Smad complex on these probes and to inhibit the Smad-responsive promoter. These results suggest that stabilization of inactive Smad complexes on DNA is a critical event in c-Ski-mediated inhibition of TGF-beta signaling.

  17. The nature of the force-induced conformation transition of dsDNA studied by using single molecule force spectroscopy.

    PubMed

    Liu, Ningning; Bu, Tianjia; Song, Yu; Zhang, Wei; Li, Jinjing; Zhang, Wenke; Shen, Jiacong; Li, Hongbin

    2010-06-15

    Single-stranded DNA binding proteins (SSB) interact with single-stranded DNA (ssDNA) specifically. Taking advantage of this character, we have employed Bacillus subtilis SSB protein to investigate the nature of force-induced conformation transition of double-stranded DNA (dsDNA) by using AFM-based single molecule force spectroscopy (SMFS) technique. Our results show that, when a dsDNA is stretched beyond its contour length, the dsDNA is partially melted, producing some ssDNA segments which can be captured by SSB proteins. We have also systematically investigated the effects of stretching length, waiting time, and salt concentration on the conformation transition of dsDNA and SSB-ssDNA interactions, respectively. Furthermore, the effect of proflavine, a DNA intercalator, on the SSB-DNA interactions has been investigated, and the results indicate that the proflavine-saturated dsDNA can be stabilized to the extent that the dsDNA will no longer melt into ssDNA under the mechanical force even up to 150 pN, and no SSB-DNA interactions are detectable.

  18. Astragalin from Cassia alata Induces DNA Adducts in Vitro and Repairable DNA Damage in the Yeast Saccharomyces cerevisiae

    PubMed Central

    Saito, Samuel; Silva, Givaldo; Santos, Regineide Xavier; Gosmann, Grace; Pungartnik, Cristina; Brendel, Martin

    2012-01-01

    Reverse phase-solid phase extraction from Cassia alata leaves (CaRP) was used to obtain a refined extract. Higher than wild-type sensitivity to CaRP was exhibited by 16 haploid Saccharomyces cerevisiae mutants with defects in DNA repair and membrane transport. CaRP had a strong DPPH free radical scavenging activity with an IC50 value of 2.27 μg mL−1 and showed no pro-oxidant activity in yeast. CaRP compounds were separated by HPLC and the three major components were shown to bind to DNA in vitro. The major HPLC peak was identified as kampferol-3-O-β-d-glucoside (astragalin), which showed high affinity to DNA as seen by HPLC-UV measurement after using centrifugal ultrafiltration of astragalin-DNA mixtures. Astragalin-DNA interaction was further studied by spectroscopic methods and its interaction with DNA was evaluated using solid-state FTIR. These and computational (in silico) docking studies revealed that astragalin-DNA binding occurs through interaction with G-C base pairs, possibly by intercalation stabilized by H-bond formation. PMID:22489129

  19. Astragalin from Cassia alata induces DNA adducts in vitro and repairable DNA damage in the yeast Saccharomyces cerevisiae.

    PubMed

    Saito, Samuel; Silva, Givaldo; Santos, Regineide Xavier; Gosmann, Grace; Pungartnik, Cristina; Brendel, Martin

    2012-01-01

    Reverse phase-solid phase extraction from Cassia alata leaves (CaRP) was used to obtain a refined extract. Higher than wild-type sensitivity to CaRP was exhibited by 16 haploid Saccharomyces cerevisiae mutants with defects in DNA repair and membrane transport. CaRP had a strong DPPH free radical scavenging activity with an IC(50) value of 2.27 μg mL(-1) and showed no pro-oxidant activity in yeast. CaRP compounds were separated by HPLC and the three major components were shown to bind to DNA in vitro. The major HPLC peak was identified as kampferol-3-O-β-d-glucoside (astragalin), which showed high affinity to DNA as seen by HPLC-UV measurement after using centrifugal ultrafiltration of astragalin-DNA mixtures. Astragalin-DNA interaction was further studied by spectroscopic methods and its interaction with DNA was evaluated using solid-state FTIR. These and computational (in silico) docking studies revealed that astragalin-DNA binding occurs through interaction with G-C base pairs, possibly by intercalation stabilized by H-bond formation.

  20. Novel insights into the apoptosis mechanism of DNA topoisomerase I inhibitor isoliquiritigenin on HCC tumor cell

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Ze-xin; Li, Jian; Li, Yan

    The inhibitory effect of DNA topoisomerase (Top I) by isoliquiritigenin(ISO) were investigated and their interaction mechanism was evaluated using methods including UV–vis absorption, fluorescence, coupled with molecular simulation, and using the MTT method of inhibition rate of HCC tumor cell SNU475 proliferation assay, finally, the interaction of ISO with calf thymus DNA was investigated by melting measurements and molecular docking studies. It was found that isoliquiritigenin reversibly inhibited DNA Top I in a competitive manner with the concentrations of ISO resulting in 50% activity lost (IC{sub 50}) were estimated to be 0.178 ± 0.12 mM. Isoliquiritigenin exhibited a strong ability to quench themore » intrinsic fluorescence of Top I through a static quenching procedure. The positive values of enthalpy change and entropy change suggested that the binding of isoliquiritigenin to Top I was driven mainly by hydrophobic interactions. The molecular docking results revealed isoliquiritigenin actually interacted with the primary amino acid residues on the active site of Top I, and the detection results of fluorescence staining and the inhibitory effect on the growth of HCC SUN475 showed that isoliquiritigenin induced the apoptosis cells increased gradually. The interaction of ISO with DNA can cause the denaturation temperature to be increased, which indicated that the stabilization of the DNA helix was increased in the presence of ISO, which indicated that the results provide strong evidence for intercalative binding of ISO with DNA. - Highlights: • ISO reversibly inhibits TOP I activity in an A dose dependent manner. • Hydrophobic interactions play a major role in ISO–TOP I interaction. • ISO has a high affinity close to the active site pocket of TOP I. • The binding of ISO to DNA induces the stability of the structure of DNA.« less

  1. Synthesis and characterization of DNA minor groove binding alkylating agents.

    PubMed

    Iyer, Prema; Srinivasan, Ajay; Singh, Sreelekha K; Mascara, Gerard P; Zayitova, Sevara; Sidone, Brian; Fouquerel, Elise; Svilar, David; Sobol, Robert W; Bobola, Michael S; Silber, John R; Gold, Barry

    2013-01-18

    Derivatives of methyl 3-(1-methyl-5-(1-methyl-5-(propylcarbamoyl)-1H-pyrrol-3-ylcarbamoyl)-1H-pyrrol-3-ylamino)-3-oxopropane-1-sulfonate (1), a peptide-based DNA minor groove binding methylating agent, were synthesized and characterized. In all cases, the N-terminus was appended with an O-methyl sulfonate ester, while the C-terminus group was varied with nonpolar and polar side chains. In addition, the number of pyrrole rings was varied from 2 (dipeptide) to 3 (tripeptide). The ability of the different analogues to efficiently generate N3-methyladenine was demonstrated as was their selectivity for minor groove (N3-methyladenine) versus major groove (N7-methylguanine) methylation. Induced circular dichroism studies were used to measure the DNA equilibrium binding properties of the stable sulfone analogues; the tripeptide binds with affinity that is >10-fold higher than that of the dipeptide. The toxicities of the compounds were evaluated in alkA/tag glycosylase mutant E. coli and in human WT glioma cells and in cells overexpressing and under-expressing N-methylpurine-DNA glycosylase, which excises N3-methyladenine from DNA. The results show that equilibrium binding correlates with the levels of N3-methyladenine produced and cellular toxicity. The toxicity of 1 was inversely related to the expression of MPG in both the bacterial and mammalian cell lines. The enhanced toxicity parallels the reduced activation of PARP and the diminished rate of formation of aldehyde reactive sites observed in the MPG knockdown cells. It is proposed that unrepaired N3-methyladenine is toxic due to its ability to directly block DNA polymerization.

  2. Synthesis, photophysical and cytotoxicity evaluations of DNA targeting agents based on 3-amino-1,8-naphthalimide derived Tröger's bases.

    PubMed

    Murphy, Samantha; Bright, Sandra A; Poynton, Fergus E; McCabe, Thomas; Kitchen, Jonathan A; Veale, Emma B; Williams, D Clive; Gunnlaugsson, Thorfinnur

    2014-09-14

    The synthesis and characterisation of five bis-1,8-naphthalimide containing Tröger's bases 1–5 formed from their corresponding 3-amino-1,8-naphthalimide precursors 6–10 is described. The photophysical investigations of 1–5 and 6–10 were carried out in several organic solvents as well as in water and as a function of pH using UV-Vis absorption and fluorescence spectroscopies. The DNA binding affinities of 1–5 in aqueous solution at pH 7.4 were also investigated using several UV-Vis absorption and fluorescence experiments by using calf thymus DNA (ct-DNA). These molecules exhibited significant DNA binding affinities; where large binding values (Kb) in the range of 10(6) M(−1) were determined, even in competitive media (50 mM and 160 mM NaCl at pH 7.4). Thermal denaturation measurements also showed that 1–5 significantly stabilised the DNA helix. Using linear and circular dichroism we further demonstrated that the DNA binding interaction occurs both by intercalation and by groove binding. The Tröger's bases were further shown to be rapidly taken up into cells using confocal fluorescence spectroscopy; and cytotoxic studies in HeLa and MCF-7 cells showed that most of the Tröger's bases were effective cytotoxic agents with EC50 values of between 1.1–12 μM and that all the active compounds induced programmed cell death by apoptosis, where up to 70% cellular death was observed after 24 h of incubation for 4.

  3. Yeast one-hybrid system used to identify the binding proteins for rat glutathione S-transferase P enhancer I.

    PubMed

    Liao, Ming-Xiang; Liu, Dong-Yuan; Zuo, Jin; Fang, Fu-De

    2002-03-01

    To detect the trans-factors specifically binding to the strong enhancer element (GPEI) in the upstream of rat glutathione S-transferase P (GST-P) gene. Yeast one-hybrid system was used to screen rat lung MATCHMAKER cDNA library to identify potential trans-factors that can interact with core sequence of GPEI(cGPEI). Electrophoresis mobility shift assay (EMSA) was used to analyze the binding of transfactors to cGPEI. cDNA fragments coding for the C-terminal part of the transcription factor c-Jun and rat adenine nucleotide translocator (ANT) were isolated. The binding of c-Jun and ANT to GPEI core sequence were confirmed. Rat c-jun transcriptional factor and ANT may interact with cGPEI. They could play an important role in the induced expression of GST-P gene.

  4. SLE syndrome, probably induced by labetalol

    PubMed Central

    Brown, R. C.; Cooke, J.; Losowsky, M. S.

    1981-01-01

    A 45-year-old woman developed polyarthralgia and muscle tenderness after 6 months' therapy with labetalol 1800 mg daily. A raised ANF titre but normal DNA binding levels suggested a drug-induced SLE syndrome. Both symptoms and ANF titre improved when therapy was changed from labetalol to propranolol. PMID:6977135

  5. Flexible DNA bending in HU–DNA cocrystal structures

    PubMed Central

    Swinger, Kerren K.; Lemberg, Kathryn M.; Zhang, Ying; Rice, Phoebe A.

    2003-01-01

    HU and IHF are members of a family of prokaryotic proteins that interact with the DNA minor groove in a sequence-specific (IHF) or non-specific (HU) manner to induce and/or stabilize DNA bending. HU plays architectural roles in replication initiation, transcription regulation and site-specific recombination, and is associated with bacterial nucleoids. Cocrystal structures of Anabaena HU bound to DNA (1P71, 1P78, 1P51) reveal that while underlying proline intercalation and asymmetric charge neutralization mechanisms of DNA bending are similar for IHF and HU, HU stabilizes different DNA bend angles (∼105–140°). The two bend angles within a single HU complex are not coplanar, and the resulting dihedral angle is consistent with negative supercoiling. Comparison of HU–DNA and IHF–DNA structures suggests that sharper bending is correlated with longer DNA binding sites and smaller dihedral angles. An HU-induced bend may be better modeled as a hinge, not a rigid bend. The ability to induce or stabilize varying bend angles is consistent with HU’s role as an architectural cofactor in many different systems that may require differing geometries. PMID:12853489

  6. The structural basis of actinomycin D–binding induces nucleotide flipping out, a sharp bend and a left-handed twist in CGG triplet repeats

    PubMed Central

    Lo, Yu-Sheng; Tseng, Wen-Hsuan; Chuang, Chien-Ying; Hou, Ming-Hon

    2013-01-01

    The potent anticancer drug actinomycin D (ActD) functions by intercalating into DNA at GpC sites, thereby interrupting essential biological processes including replication and transcription. Certain neurological diseases are correlated with the expansion of (CGG)n trinucleotide sequences, which contain many contiguous GpC sites separated by a single G:G mispair. To characterize the binding of ActD to CGG triplet repeat sequences, the structural basis for the strong binding of ActD to neighbouring GpC sites flanking a G:G mismatch has been determined based on the crystal structure of ActD bound to ATGCGGCAT, which contains a CGG triplet sequence. The binding of ActD molecules to GCGGC causes many unexpected conformational changes including nucleotide flipping out, a sharp bend and a left-handed twist in the DNA helix via a two site-binding model. Heat denaturation, circular dichroism and surface plasmon resonance analyses showed that adjacent GpC sequences flanking a G:G mismatch are preferred ActD-binding sites. In addition, ActD was shown to bind the hairpin conformation of (CGG)16 in a pairwise combination and with greater stability than that of other DNA intercalators. Our results provide evidence of a possible biological consequence of ActD binding to CGG triplet repeat sequences. PMID:23408860

  7. Sedimentation properties in density gradients correspond with levels of sperm DNA fragmentation, chromatin compaction and binding affinity to hyaluronic acid.

    PubMed

    Torabi, Forough; Binduraihem, Adel; Miller, David

    2017-03-01

    Mature spermatozoa bind hyaluronic acid in the extracellular matrix via hyaladherins. Immature spermatozoa may be unable to interact because they do not express the appropriate hyaladherins on their surface. Fresh human semen samples were fractionated using differential density gradient centrifugation (DDGC) and the ability of these fractions to bind hyaluronic acid was evaluated. The presence of sperm hyaladherins was also assessed. CD44 was located mainly on the acrosome and equatorial segment and became more restricted to the equatorial segment in capacitated spermatozoa. Hyaluronic acid-TRITC (hyaluronic acid conjugated with tetramethylrhodamine isothiocyanante), a generic hyaluronic-acid-binding reagent, labelled the membrane and the neck region, particularly after capacitation. Sperm populations obtained after DDGC or after interaction with hyaluronic acid were assessed for DNA fragmentation and chromatin maturity. Strong relationships between both measures and sperm sedimentation and hyaluronic-acid-binding profiles were revealed. Capacitation enhanced hyaluronic acid binding of both DDGC-pelleted sperm and sperm washed free of seminal fluid. In conclusion, hyaladherins were detected on human sperm and a higher capacity for sperm hyaluronic-acid-binding was shown to correspond with their DDGC sedimentation profiles and with lower levels of DNA fragmentation and better chromatin maturity. Capacitation induced changes in the distribution and presence of hyaladherins may enhance hyaluronic-acid-binding. Copyright © 2016 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.

  8. Overexpression of Transcription Factor Sp1 Leads to Gene Expression Perturbations and Cell Cycle Inhibition

    PubMed Central

    Deniaud, Emmanuelle; Baguet, Joël; Chalard, Roxane; Blanquier, Bariza; Brinza, Lilia; Meunier, Julien; Michallet, Marie-Cécile; Laugraud, Aurélie; Ah-Soon, Claudette; Wierinckx, Anne; Castellazzi, Marc; Lachuer, Joël; Gautier, Christian

    2009-01-01

    Background The ubiquitous transcription factor Sp1 regulates the expression of a vast number of genes involved in many cellular functions ranging from differentiation to proliferation and apoptosis. Sp1 expression levels show a dramatic increase during transformation and this could play a critical role for tumour development or maintenance. Although Sp1 deregulation might be beneficial for tumour cells, its overexpression induces apoptosis of untransformed cells. Here we further characterised the functional and transcriptional responses of untransformed cells following Sp1 overexpression. Methodology and Principal Findings We made use of wild-type and DNA-binding-deficient Sp1 to demonstrate that the induction of apoptosis by Sp1 is dependent on its capacity to bind DNA. Genome-wide expression profiling identified genes involved in cancer, cell death and cell cycle as being enriched among differentially expressed genes following Sp1 overexpression. In silico search to determine the presence of Sp1 binding sites in the promoter region of modulated genes was conducted. Genes that contained Sp1 binding sites in their promoters were enriched among down-regulated genes. The endogenous sp1 gene is one of the most down-regulated suggesting a negative feedback loop induced by overexpressed Sp1. In contrast, genes containing Sp1 binding sites in their promoters were not enriched among up-regulated genes. These results suggest that the transcriptional response involves both direct Sp1-driven transcription and indirect mechanisms. Finally, we show that Sp1 overexpression led to a modified expression of G1/S transition regulatory genes such as the down-regulation of cyclin D2 and the up-regulation of cyclin G2 and cdkn2c/p18 expression. The biological significance of these modifications was confirmed by showing that the cells accumulated in the G1 phase of the cell cycle before the onset of apoptosis. Conclusion This study shows that the binding to DNA of overexpressed Sp1 induces an inhibition of cell cycle progression that precedes apoptosis and a transcriptional response targeting genes containing Sp1 binding sites in their promoter or not suggesting both direct Sp1-driven transcription and indirect mechanisms. PMID:19753117

  9. Bioassays Based on Molecular Nanomechanics

    DOE PAGES

    Majumdar, Arun

    2002-01-01

    Recent experiments have shown that when specific biomolecular interactions are confined to one surface of a microcantilever beam, changes in intermolecular nanomechanical forces provide sufficient differential torque to bend the cantilever beam. This has been used to detect single base pair mismatches during DNA hybridization, as well as prostate specific antigen (PSA) at concentrations and conditions that are clinically relevant for prostate cancer diagnosis. Since cantilever motion originates from free energy change induced by specific biomolecular binding, this technique is now offering a common platform for label-free quantitative analysis of protein-protein binding, DNA hybridization DNA-protein interactions, and in general receptor-ligandmore » interactions. Current work is focused on developing “universal microarrays” of microcantilever beams for high-throughput multiplexed bioassays.« less

  10. Inhibition mechanisms of hemoglobin, immunoglobulin G, and whole blood in digital and real-time PCR.

    PubMed

    Sidstedt, Maja; Hedman, Johannes; Romsos, Erica L; Waitara, Leticia; Wadsö, Lars; Steffen, Carolyn R; Vallone, Peter M; Rådström, Peter

    2018-04-01

    Blood samples are widely used for PCR-based DNA analysis in fields such as diagnosis of infectious diseases, cancer diagnostics, and forensic genetics. In this study, the mechanisms behind blood-induced PCR inhibition were evaluated by use of whole blood as well as known PCR-inhibitory molecules in both digital PCR and real-time PCR. Also, electrophoretic mobility shift assay was applied to investigate interactions between inhibitory proteins and DNA, and isothermal titration calorimetry was used to directly measure effects on DNA polymerase activity. Whole blood caused a decrease in the number of positive digital PCR reactions, lowered amplification efficiency, and caused severe quenching of the fluorescence of the passive reference dye 6-carboxy-X-rhodamine as well as the double-stranded DNA binding dye EvaGreen. Immunoglobulin G was found to bind to single-stranded genomic DNA, leading to increased quantification cycle values. Hemoglobin affected the DNA polymerase activity and thus lowered the amplification efficiency. Hemoglobin and hematin were shown to be the molecules in blood responsible for the fluorescence quenching. In conclusion, hemoglobin and immunoglobulin G are the two major PCR inhibitors in blood, where the first affects amplification through a direct effect on the DNA polymerase activity and quenches the fluorescence of free dye molecules, and the latter binds to single-stranded genomic DNA, hindering DNA polymerization in the first few PCR cycles. Graphical abstract PCR inhibition mechanisms of hemoglobin and immunoglobulin G (IgG). Cq quantification cycle, dsDNA double-stranded DNA, ssDNA single-stranded DNA.

  11. Prosurvival long noncoding RNA PINCR regulates a subset of p53 targets in human colorectal cancer cells by binding to Matrin 3

    PubMed Central

    Chaudhary, Ritu; Gryder, Berkley; Woods, Wendy S; Subramanian, Murugan; Jones, Matthew F; Li, Xiao Ling; Jenkins, Lisa M; Shabalina, Svetlana A; Mo, Min; Dasso, Mary; Yang, Yuan; Wakefield, Lalage M; Zhu, Yuelin; Frier, Susan M; Moriarity, Branden S; Prasanth, Kannanganattu V; Perez-Pinera, Pablo; Lal, Ashish

    2017-01-01

    Thousands of long noncoding RNAs (lncRNAs) have been discovered, yet the function of the vast majority remains unclear. Here, we show that a p53-regulated lncRNA which we named PINCR (p53-induced noncoding RNA), is induced ~100-fold after DNA damage and exerts a prosurvival function in human colorectal cancer cells (CRC) in vitro and tumor growth in vivo. Targeted deletion of PINCR in CRC cells significantly impaired G1 arrest and induced hypersensitivity to chemotherapeutic drugs. PINCR regulates the induction of a subset of p53 targets involved in G1 arrest and apoptosis, including BTG2, RRM2B and GPX1. Using a novel RNA pulldown approach that utilized endogenous S1-tagged PINCR, we show that PINCR associates with the enhancer region of these genes by binding to RNA-binding protein Matrin 3 that, in turn, associates with p53. Our findings uncover a critical prosurvival function of a p53/PINCR/Matrin 3 axis in response to DNA damage in CRC cells. DOI: http://dx.doi.org/10.7554/eLife.23244.001 PMID:28580901

  12. High-resolution biophysical analysis of the dynamics of nucleosome formation

    PubMed Central

    Hatakeyama, Akiko; Hartmann, Brigitte; Travers, Andrew; Nogues, Claude; Buckle, Malcolm

    2016-01-01

    We describe a biophysical approach that enables changes in the structure of DNA to be followed during nucleosome formation in in vitro reconstitution with either the canonical “Widom” sequence or a judiciously mutated sequence. The rapid non-perturbing photochemical analysis presented here provides ‘snapshots’ of the DNA configuration at any given moment in time during nucleosome formation under a very broad range of reaction conditions. Changes in DNA photochemical reactivity upon protein binding are interpreted as being mainly induced by alterations in individual base pair roll angles. The results strengthen the importance of the role of an initial (H3/H4)2 histone tetramer-DNA interaction and highlight the modulation of this early event by the DNA sequence. (H3/H4)2 binding precedes and dictates subsequent H2A/H2B-DNA interactions, which are less affected by the DNA sequence, leading to the final octameric nucleosome. Overall, our results provide a novel, exciting way to investigate those biophysical properties of DNA that constitute a crucial component in nucleosome formation and stabilization. PMID:27263658

  13. TAL effector-DNA specificity.

    PubMed

    Scholze, Heidi; Boch, Jens

    2010-01-01

    TAL effectors are important virulence factors of bacterial plant pathogenic Xanthomonas, which infect a wide variety of plants including valuable crops like pepper, rice, and citrus. TAL proteins are translocated via the bacterial type III secretion system into host cells and induce transcription of plant genes by binding to target gene promoters. Members of the TAL effector family differ mainly in their central domain of tandemly arranged repeats of typically 34 amino acids each with hypervariable di-amino acids at positions 12 and 13. We recently showed that target DNA-recognition specificity of TAL effectors is encoded in a modular and clearly predictable mode. The repeats of TAL effectors feature a surprising one repeat-to-one-bp correlation with different repeat types exhibiting a different DNA base pair specificity. Accordingly, we predicted DNA specificities of TAL effectors and generated artificial TAL proteins with novel DNA recognition specificities. We describe here novel artificial TALs and discuss implications for the DNA recognition specificity. The unique TAL-DNA binding domain allows design of proteins with potentially any given DNA recognition specificity enabling many uses for biotechnology.

  14. A glass fiber/diethylaminoethyl double filter binding assay that measures apoptotic internucleosomal DNA fragmentation.

    PubMed

    Erusalimsky, J D; John, J; Hong, Y; Moore, M

    1996-11-15

    A filter binding assay that measures internucleosomal DNA fragmentation associated with apoptosis is described. The assay is based on a novel principle that consists of using simultaneously two kinds of glass fiber filters to harvest [3H]thymidine-prelabeled cells following their incubation with inducers of apoptosis. One filter, which is neutral, traps intact chromatin and high-molecular-weight DNA. The other filter, which is positively charged with DEAE active groups, traps low-molecular-weight DNA fragments. DNA fragmentation is quantified by measuring the radioactivity retained by each of the filters. The assay was evaluated with the histiocytic lymphoma cell line U937 and the topoisomerase inhibitors camptothecin, etoposide, and doxorubicin. These agents caused a dose-dependent decrease of radioactivity in the neutral filter and a parallel increase of radioactivity in the DEAE filter. Irradiation-induced single strand breaks and topoisomerase-mediated primary DNA damage were not detected by this method. Consistent with the detection of internucleosomal DNA fragmentation, the effects measured by this assay were prevented by the endonuclease inhibitor zinc acetate and by the metabolic inhibitor sodium azide. Results obtained using this assay were validated by observation of DNA ladders on agarose gels and by morphologic examination of apoptotic features. Evaluation of the assay in a mock screen demonstrated that the introduction of the DEAE filter increases the assay sensitivity and eliminates false positives. Thus, this assay may be used in high-throughput screening approaches to discover novel modulators of apoptosis.

  15. Conformational Dynamics of Thermus aquaticus DNA Polymerase I during Catalysis

    PubMed Central

    Suo, Zucai

    2014-01-01

    Despite the fact that DNA polymerases have been investigated for many years and are commonly used as tools in a number of molecular biology assays, many details of the kinetic mechanism they use to catalyze DNA synthesis remain unclear. Structural and kinetic studies have characterized a rapid, pre-catalytic open-to-close conformational change of the Finger domain during nucleotide binding for many DNA polymerases including Thermus aquaticus DNA polymerase I (Taq Pol), a thermostable enzyme commonly used for DNA amplification in PCR. However, little has been done to characterize the motions of other structural domains of Taq Pol or any other DNA polymerase during catalysis. Here, we used stopped-flow Förster resonance energy transfer (FRET) to investigate the conformational dynamics of all five structural domains of the full-length Taq Pol relative to the DNA substrate during nucleotide binding and incorporation. Our study provides evidence for a rapid conformational change step induced by dNTP binding and a subsequent global conformational transition involving all domains of Taq Pol during catalysis. Additionally, our study shows that the rate of the global transition was greatly increased with the truncated form of Taq Pol lacking the N-terminal domain. Finally, we utilized a mutant of Taq Pol containing a de novo disulfide bond to demonstrate that limiting protein conformational flexibility greatly reduced the polymerization activity of Taq Pol. PMID:24931550

  16. PRP19 transforms into a sensor of RPA-ssDNA after DNA damage and drives ATR activation via a ubiquitin-mediated circuitry.

    PubMed

    Maréchal, Alexandre; Li, Ju-Mei; Ji, Xiao Ye; Wu, Ching-Shyi; Yazinski, Stephanie A; Nguyen, Hai Dang; Liu, Shizhou; Jiménez, Amanda E; Jin, Jianping; Zou, Lee

    2014-01-23

    PRP19 is a ubiquitin ligase involved in pre-mRNA splicing and the DNA damage response (DDR). Although the role for PRP19 in splicing is well characterized, its role in the DDR remains elusive. Through a proteomic screen for proteins that interact with RPA-coated single-stranded DNA (RPA-ssDNA), we identified PRP19 as a sensor of DNA damage. PRP19 directly binds RPA and localizes to DNA damage sites via RPA, promoting RPA ubiquitylation in a DNA-damage-induced manner. PRP19 facilitates the accumulation of ATRIP, the regulatory partner of the ataxia telangiectasia mutated and Rad3-related (ATR) kinase, at DNA damage sites. Depletion of PRP19 compromised the phosphorylation of ATR substrates, recovery of stalled replication forks, and progression of replication forks on damaged DNA. Importantly, PRP19 mutants that cannot bind RPA or function as an E3 ligase failed to support the ATR response, revealing that PRP19 drives ATR activation by acting as an RPA-ssDNA-sensing ubiquitin ligase during the DDR. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Photosensitization by iodinated DNA minor groove binding ligands: Evaluation of DNA double-strand break induction and repair.

    PubMed

    Briggs, Benjamin; Ververis, Katherine; Rodd, Annabelle L; Foong, Laura J L; Silva, Fernando M Da; Karagiannis, Tom C

    2011-05-03

    Iodinated DNA minor groove binding bibenzimidazoles represent a unique class of UVA photosensitizer and their extreme photopotency has been previously characterized. Earlier studies have included a comparison of three isomers, referred to as ortho-, meta- and para-iodoHoechst, which differ only in the location of the iodine substituent in the phenyl ring of the bibenzimidazole. DNA breakage and clonogenic survival studies in human erythroleukemic K562 cells have highlighted the higher photo-efficiency of the ortho-isomer (subsequently designated UV(A)Sens) compared to the meta- and para-isomers. In this study, the aim was to compare the induction and repair of DNA double-strand breaks induced by the three isomers in K562 cells. Further, we examined the effects of the prototypical broad-spectrum histone deacetylase inhibitor, Trichostatin A, on ortho-iodoHoechst/UVA-induced double-strand breaks in K562 cells. Using γH2AX as a molecular marker of the DNA lesions, our findings indicate a disparity in the induction and particularly, in the repair kinetics of double-strand breaks for the three isomers. The accumulation of γH2AX foci induced by the meta- and para-isomers returned to background levels within 24 and 48 h, respectively; the number of γH2AX foci induced by ortho-iodoHoechst remained elevated even after incubation for 96 h post-irradiation. These findings provide further evidence that the extreme photopotency of ortho-iodoHoechst is due to not only to the high quantum yield of dehalogenation, but also to the severity of the DNA lesions which are not readily repaired. Finally, our findings which indicate that Trichostatin A has a remarkable potentiating effect on ortho-iodoHoechst/UVA-induced DNA lesions are encouraging, particularly in the context of cutaneous T-cell lymphoma, for which a histone deacetylase inhibitor is already approved for therapy. This finding prompts further evaluation of the potential of combination therapies. Copyright © 2011 Elsevier B.V. All rights reserved.

  18. CFS-1686 causes cell cycle arrest at intra-S phase by interference of interaction of topoisomerase 1 with DNA.

    PubMed

    Lin, Ru-Wei; Yang, Chia-Ning; Ku, ShengYu; Ho, Cheng-Jung; Huang, Shih-Bo; Yang, Min-Chi; Chang, Hsin-Wen; Lin, Chun-Mao; Hwang, Jaulang; Chen, Yeh-Long; Tzeng, Cherg-Chyi; Wang, Chihuei

    2014-01-01

    CFS-1686 (chemical name (E)-N-(2-(diethylamino)ethyl)-4-(2-(2-(5-nitrofuran-2-yl)vinyl)quinolin-4-ylamino)benzamide) inhibits cell proliferation and triggers late apoptosis in prostate cancer cell lines. Comparing the effect of CFS-1686 on cell cycle progression with the topoisomerase 1 inhibitor camptothecin revealed that CFS-1686 and camptothecin reduced DNA synthesis in S-phase, resulting in cell cycle arrest at the intra-S phase and G1-S boundary, respectively. The DNA damage in CFS-1686 and camptothecin treated cells was evaluated by the level of ATM phosphorylation, γH2AX, and γH2AX foci, showing that camptothecin was more effective than CFS-1686. However, despite its lower DNA damage capacity, CFS-1686 demonstrated 4-fold higher inhibition of topoisomerase 1 than camptothecin in a DNA relaxation assay. Unlike camptothecin, CFS-1686 demonstrated no activity on topoisomerase 1 in a DNA cleavage assay, but nevertheless it reduced the camptothecin-induced DNA cleavage of topoisomerase 1 in a dose-dependent manner. Our results indicate that CFS-1686 might bind to topoisomerase 1 to inhibit this enzyme from interacting with DNA relaxation activity, unlike campothecin's induction of a topoisomerase 1-DNA cleavage complex. Finally, we used a computer docking strategy to localize the potential binding site of CFS-1686 to topoisomerase 1, further indicating that CFS-1686 might inhibit the binding of Top1 to DNA.

  19. Flow cytometric sex sorting affects CD4 membrane distribution and binding of exogenous DNA on bovine sperm cells.

    PubMed

    Domingues, William Borges; da Silveira, Tony Leandro Rezende; Komninou, Eliza Rossi; Monte, Leonardo Garcia; Remião, Mariana Härter; Dellagostin, Odir Antônio; Corcini, Carine Dahl; Varela Junior, Antônio Sergio; Seixas, Fabiana Kömmling; Collares, Tiago; Campos, Vinicius Farias

    2017-08-01

    Bovine sex-sorted sperm have been commercialized and successfully used for the production of transgenic embryos of the desired sex through the sperm-mediated gene transfer (SMGT) technique. However, sex-sorted sperm show a reduced ability to internalize exogenous DNA. The interaction between sperm cells and the exogenous DNA has been reported in other species to be a CD4-like molecule-dependent process. The flow cytometry-based sex-sorting process subjects the spermatozoa to different stresses causing changes in the cell membrane. The aim of this study was to elucidate the relationship between the redistribution of CD4-like molecules and binding of exogenous DNA to sex-sorted bovine sperm. In the first set of experiments, the membrane phospholipid disorder and the redistribution of the CD4 were evaluated. The second set of experiments was conducted to investigate the effect of CD4 redistribution on the mechanism of binding of exogenous DNA to sperm cells and the efficiency of lipofection in sex-sorted bovine sperm. Sex-sorting procedure increased the membrane phospholipid disorder and induced the redistribution of CD4-like molecules. Both X-sorted and Y-sorted sperm had decreased DNA bound to membrane in comparison with the unsorted sperm; however, the binding of the exogenous DNA was significantly increased with the addition of liposomes. Moreover, we demonstrated that the number of sperm-bound exogenous DNA was decreased when these cells were preincubated with anti-bovine CD4 monoclonal antibody, supporting our hypothesis that CD4-like molecules indeed play a crucial role in the process of exogenous DNA/bovine sperm cells interaction.

  20. The nucleosome: A transparent, slippery, sticky and yet stable DNA-protein complex

    NASA Astrophysics Data System (ADS)

    Schiessel, H.

    2006-03-01

    Roughly three quarters of eucaryotic DNA are tightly wrapped onto protein cylinders organized in so-called nucleosomes. Despite this fact, the wrapped DNA cannot be inert since DNA is at the heart of many crucial life processes. We focus here on physical mechanisms that might allow nucleosomes to perform a great deal of such processes, specifically 1) on unwrapping fluctuations that give DNA-binding proteins access to the wrapped DNA portions without disrupting the nucleosome as a whole, 2) on corkscrew sliding along DNA and some implications and on 3) tail-bridging-induced attraction between nucleosomes as a means of controlling higher-order folding.

  1. H3K4me3 induces allosteric conformational changes in the DNA-binding and catalytic regions of the V(D)J recombinase

    PubMed Central

    Bettridge, John; Na, Chan Hyun; Desiderio, Stephen

    2017-01-01

    V(D)J recombination is initiated by the recombination-activating gene (RAG) recombinase, consisting of RAG-1 and RAG-2 subunits. The susceptibility of gene segments to cleavage by RAG is associated with histone modifications characteristic of active chromatin, including trimethylation of histone H3 at lysine 4 (H3K4me3). Binding of H3K4me3 by a plant homeodomain (PHD) in RAG-2 stimulates substrate binding and catalysis, which are functions of RAG-1. This has suggested an allosteric mechanism in which information regarding occupancy of the RAG-2 PHD is transmitted to RAG-1. To determine whether the conformational distribution of RAG is altered by H3K4me3, we mapped changes in solvent accessibility of cysteine thiols by differential isotopic chemical footprinting. Binding of H3K4me3 to the RAG-2 PHD induces conformational changes in RAG-1 within a DNA-binding domain and in the ZnH2 domain, which acts as a scaffold for the catalytic center. Thus, engagement of H3K4me3 by the RAG-2 PHD is associated with dynamic conformational changes in RAG-1, consistent with allosteric control by active chromatin. PMID:28174273

  2. RING finger and WD repeat domain 3 (RFWD3) associates with replication protein A (RPA) and facilitates RPA-mediated DNA damage response.

    PubMed

    Liu, Shangfeng; Chu, Jessica; Yucer, Nur; Leng, Mei; Wang, Shih-Ya; Chen, Benjamin P C; Hittelman, Walter N; Wang, Yi

    2011-06-24

    DNA damage response is crucial for maintaining genomic integrity and preventing cancer by coordinating the activation of checkpoints and the repair of damaged DNA. Central to DNA damage response are the two checkpoint kinases ATM and ATR that phosphorylate a wide range of substrates. RING finger and WD repeat domain 3 (RFWD3) was initially identified as a substrate of ATM/ATR from a proteomic screen. Subsequent studies showed that RFWD3 is an E3 ubiquitin ligase that ubiquitinates p53 in vitro and positively regulates p53 levels in response to DNA damage. We report here that RFWD3 associates with replication protein A (RPA), a single-stranded DNA-binding protein that plays essential roles in DNA replication, recombination, and repair. Binding of RPA to single-stranded DNA (ssDNA), which is generated by DNA damage and repair, is essential for the recruitment of DNA repair factors to damaged sites and the activation of checkpoint signaling. We show that RFWD3 is physically associated with RPA and rapidly localizes to sites of DNA damage in a RPA-dependent manner. In vitro experiments suggest that the C terminus of RFWD3, which encompass the coiled-coil domain and the WD40 domain, is necessary for binding to RPA. Furthermore, DNA damage-induced phosphorylation of RPA and RFWD3 is dependent upon each other. Consequently, loss of RFWD3 results in the persistent foci of DNA damage marker γH2AX and the repair protein Rad51 in damaged cells. These findings suggest that RFWD3 is recruited to sites of DNA damage and facilitates RPA-mediated DNA damage signaling and repair.

  3. The Zinc Finger Proteins Mxr1p and Repressor of Phosphoenolpyruvate Carboxykinase (ROP) Have the Same DNA Binding Specificity but Regulate Methanol Metabolism Antagonistically in Pichia pastoris*

    PubMed Central

    Kumar, Nallani Vijay; Rangarajan, Pundi N.

    2012-01-01

    The methanol-inducible alcohol oxidase I (AOXI) promoter of the methylotrophic yeast, Pichia pastoris, is used widely for the production of recombinant proteins. AOXI transcription is regulated by the zinc finger protein Mxr1p (methanol expression regulator 1). ROP (repressor of phosphoenolpyruvate carboxykinase, PEPCK) is a methanol- and biotin starvation-inducible zinc finger protein that acts as a negative regulator of PEPCK in P. pastoris cultured in biotin-deficient, glucose-ammonium medium. The function of ROP during methanol metabolism is not known. In this study, we demonstrate that ROP represses methanol-inducible expression of AOXI when P. pastoris is cultured in a nutrient-rich medium containing yeast extract, peptone, and methanol (YPM). Deletion of the gene encoding ROP results in enhanced expression of AOXI and growth promotion whereas overexpression of ROP results in repression of AOXI and growth retardation of P. pastoris cultured in YPM medium. Surprisingly, deletion or overexpression of ROP has no effect on AOXI gene expression and growth of P. pastoris cultured in a minimal medium containing yeast nitrogen base and methanol (YNBM). Subcellular localization studies indicate that ROP translocates from cytosol to nucleus of cells cultured in YPM but not YNBM. In vitro DNA binding studies indicate that AOXI promoter sequences containing 5′ CYCCNY 3′ motifs serve as binding sites for Mxr1p as well as ROP. Thus, Mxr1p and ROP exhibit the same DNA binding specificity but regulate methanol metabolism antagonistically in P. pastoris. This is the first report on the identification of a transcriptional repressor of methanol metabolism in any yeast species. PMID:22888024

  4. Nbs1 ChIP-Seq Identifies Off-Target DNA Double-Strand Breaks Induced by AID in Activated Splenic B Cells

    PubMed Central

    Linehan, Erin K.; Schrader, Carol E.; Stavnezer, Janet

    2015-01-01

    Activation-induced cytidine deaminase (AID) is required for initiation of Ig class switch recombination (CSR) and somatic hypermutation (SHM) of antibody genes during immune responses. AID has also been shown to induce chromosomal translocations, mutations, and DNA double-strand breaks (DSBs) involving non-Ig genes in activated B cells. To determine what makes a DNA site a target for AID-induced DSBs, we identify off-target DSBs induced by AID by performing chromatin immunoprecipitation (ChIP) for Nbs1, a protein that binds DSBs, followed by deep sequencing (ChIP-Seq). We detect and characterize hundreds of off-target AID-dependent DSBs. Two types of tandem repeats are highly enriched within the Nbs1-binding sites: long CA repeats, which can form Z-DNA, and tandem pentamers containing the AID target hotspot WGCW. These tandem repeats are not nearly as enriched at AID-independent DSBs, which we also identified. Msh2, a component of the mismatch repair pathway and important for genome stability, increases off-target DSBs, similar to its effect on Ig switch region DSBs, which are required intermediates during CSR. Most of the off-target DSBs are two-ended, consistent with generation during G1 phase, similar to DSBs in Ig switch regions. However, a minority are one-ended, presumably due to conversion of single-strand breaks to DSBs during replication. One-ended DSBs are repaired by processes involving homologous recombination, including break-induced replication repair, which can lead to genome instability. Off-target DSBs, especially those present during S phase, can lead to chromosomal translocations, deletions and gene amplifications, resulting in the high frequency of B cell lymphomas derived from cells that express or have expressed AID. PMID:26263206

  5. Metadynamics Simulation Study on the Conformational Transformation of HhaI Methyltransferase: An Induced-Fit Base-Flipping Hypothesis

    PubMed Central

    Ye, Fei; Zhao, Dan; Chen, Shijie; Jiang, Ren-Wang; Jiang, Hualiang; Luo, Cheng

    2014-01-01

    DNA methyltransferases play crucial roles in establishing and maintenance of DNA methylation, which is an important epigenetic mark. Flipping the target cytosine out of the DNA helical stack and into the active site of protein provides DNA methyltransferases with an opportunity to access and modify the genetic information hidden in DNA. To investigate the conversion process of base flipping in the HhaI methyltransferase (M.HhaI), we performed different molecular simulation approaches on M.HhaI-DNA-S-adenosylhomocysteine ternary complex. The results demonstrate that the nonspecific binding of DNA to M.HhaI is initially induced by electrostatic interactions. Differences in chemical environment between the major and minor grooves determine the orientation of DNA. Gln237 at the target recognition loop recognizes the GCGC base pair from the major groove side by hydrogen bonds. In addition, catalytic loop motion is a key factor during this process. Our study indicates that base flipping is likely to be an “induced-fit” process. This study provides a solid foundation for future studies on the discovery and development of mechanism-based DNA methyltransferases regulators. PMID:25045662

  6. Expression Profile of DNA Damage Signaling Genes in Proton Exposed Mouse Brain

    NASA Astrophysics Data System (ADS)

    Ramesh, Govindarajan; Wu, Honglu

    Exposure of living systems to radiation results in a wide assortment of lesions, the most signif-icant of is damage to genomic DNA which induce several cellular functions such as cell cycle arrest, repair, apoptosis etc. The radiation induced DNA damage investigation is one of the im-portant area in biology, but still the information available regarding the effects of proton is very limited. In this report, we investigated the differential gene expression pattern of DNA damage signaling genes particularly, damaged DNA binding, repair, cell cycle arrest, checkpoints and apoptosis using quantitative real-time RT-PCR array in proton exposed mouse brain tissues. The expression profiles showed significant changes in DNA damage related genes in 2Gy proton exposed mouse brain tissues as compared with control brain tissues. Furthermore, we also show that significantly increased levels of apoptotic related genes, caspase-3 and 8 activities in these cells, suggesting that in addition to differential expression of DNA damage genes, the alteration of apoptosis related genes may also contribute to the radiation induced DNA damage followed by programmed cell death. In summary, our findings suggest that proton exposed brain tissue undergo severe DNA damage which in turn destabilize the chromatin stability.

  7. Blue light-induced LOV domain dimerization enhances the affinity of Aureochrome 1a for its target DNA sequence

    PubMed Central

    Heintz, Udo; Schlichting, Ilme

    2016-01-01

    The design of synthetic optogenetic tools that allow precise spatiotemporal control of biological processes previously inaccessible to optogenetic control has developed rapidly over the last years. Rational design of such tools requires detailed knowledge of allosteric light signaling in natural photoreceptors. To understand allosteric communication between sensor and effector domains, characterization of all relevant signaling states is required. Here, we describe the mechanism of light-dependent DNA binding of the light-oxygen-voltage (LOV) transcription factor Aureochrome 1a from Phaeodactylum tricornutum (PtAu1a) and present crystal structures of a dark state LOV monomer and a fully light-adapted LOV dimer. In combination with hydrogen/deuterium-exchange, solution scattering data and DNA-binding experiments, our studies reveal a light-sensitive interaction between the LOV and basic region leucine zipper DNA-binding domain that together with LOV dimerization results in modulation of the DNA affinity of PtAu1a. We discuss the implications of these results for the design of synthetic LOV-based photosensors with application in optogenetics. DOI: http://dx.doi.org/10.7554/eLife.11860.001 PMID:26754770

  8. Multiple binding sites for transcriptional repressors can produce regular bursting and enhance noise suppression

    NASA Astrophysics Data System (ADS)

    Lengyel, Iván M.; Morelli, Luis G.

    2017-04-01

    Cells may control fluctuations in protein levels by means of negative autoregulation, where transcription factors bind DNA sites to repress their own production. Theoretical studies have assumed a single binding site for the repressor, while in most species it is found that multiple binding sites are arranged in clusters. We study a stochastic description of negative autoregulation with multiple binding sites for the repressor. We find that increasing the number of binding sites induces regular bursting of gene products. By tuning the threshold for repression, we show that multiple binding sites can also suppress fluctuations. Our results highlight possible roles for the presence of multiple binding sites of negative autoregulators.

  9. DNA strand scission induced by adriamycin and aclacinomycin A.

    PubMed

    Someya, A; Tanaka, N

    1979-08-01

    The binding of adriamycin and aclacinomycin A with PM2 DNA, and the consequent cleavage of DNA have been demonstrated by agarose gel electrophoresis, using an ethidium bromide assay. Adriamycin was observed to induce a single strand scission of DNA in the presence of a reducing agent, but aclacinomycin A caused much less degree of DNA breaks. The DNA cleavage was enhanced by Cu2+ and Fe2+, but not significantly by Ni2+, Zn2+, Mg2+ and Ca2+, suggesting that reduction and auto-oxidation of the quinone moiety and H2O2 production participate in the DNA-cutting effect. The DNA degradation was dependent upon concentrations of the anthracyclines and CuCl2. The degree of DNA cleavage at 0.04 mM adriamycin was similar to that at 0.4 mM aclacinomycin A in the presence of 1 mM NADPH and 0.4 mM CuCl2. DNA was degraded to small fragments at 0.4 mM adriamycin and 0.2 mM CuCl2. The anthracycline-induced DNA cleavage was stimulated by H2O2, but partially inhibited by potassium iodide, superoxide dismutase, catalase and nitrogen gas atmosphere. The results suggested that both free radical of anthracycline quinones and hydroxyl radical directly react with DNA strands.

  10. Mechanism of the CO-sensing heme protein CooA: new insights from the truncated heme domain and UVRR spectroscopy

    PubMed Central

    Ibrahim, Mohammed; Kuchinskas, Michael; Youn, Hwan; Kerby, Robert L.; Roberts, Gary P.; Poulos, Thomas L.; Spiro, Thomas G.

    2007-01-01

    The bacterial CO-sensing heme protein CooA activates expression of genes whose products perform CO-metabolism by binding its target DNA in response to CO binding. The required conformational change has been proposed to result from CO-induced displacement of the heme and of the adjacent C-helix, which connects the sensory and DNA-binding domains. Support for this proposal comes from UV Resonance Raman (UVRR) spectroscopy, which reveals a more hydrophobic environment for the C-helix residue Trp110 when CO binds. In addition, we find a tyrosine UVRR response, which is attributable to weakening of a Tyr55-Glu83 H-bond that anchors the proximal side of the heme. Both Trp and Tyr responses are augmented in the heme domain when the DNA-binding domain has been removed, apparently reflecting loss of the inter-domain restraint. This augmentation is abolished by a Glu83Gln substitution, which weakens the anchoring H-bond. The CO recombination rate following photolysis of the CO adduct is similar for truncated and full-length protein, though truncation does increase the rate of CO association in the absence of photolysis; together these data indicate that truncation causes a faster dissociation of the endogenous Pro2 ligand. These findings are discussed in the light of structural evidence that the N-terminal tail, once released from the heme, selects the proper orientation of the DNA-binding domain, via docking interactions. PMID:17720248

  11. Alpha3, a transposable element that promotes host sexual reproduction.

    PubMed

    Barsoum, Emad; Martinez, Paula; Aström, Stefan U

    2010-01-01

    Theoretical models predict that selfish DNA elements require host sex to persist in a population. Therefore, a transposon that induces sex would strongly favor its own spread. We demonstrate that a protein homologous to transposases, called alpha3, was essential for mating type switch in Kluyveromyces lactis. Mutational analysis showed that amino acids conserved among transposases were essential for its function. During switching, sequences in the 5' and 3' flanking regions of the alpha3 gene were joined, forming a DNA circle, showing that alpha3 mobilized from the genome. The sequences encompassing the alpha3 gene circle junctions in the mating type alpha (MATalpha) locus were essential for switching from MATalpha to MATa, suggesting that alpha3 mobilization was a coupled event. Switching also required a DNA-binding protein, Mating type switch 1 (Mts1), whose binding sites in MATalpha were important. Expression of Mts1 was repressed in MATa/MATalpha diploids and by nutrients, limiting switching to haploids in low-nutrient conditions. A hairpin-capped DNA double-strand break (DSB) was observed in the MATa locus in mre11 mutant strains, indicating that mating type switch was induced by MAT-specific DSBs. This study provides empirical evidence for selfish DNA promoting host sexual reproduction by mediating mating type switch.

  12. Lipopolysaccharide potentiates the effect of hepatocyte growth factor on hepatocyte replication in rats by augmenting AP-1 activity.

    PubMed

    Gao, C; Jokerst, R; Gondipalli, P; Cai, S R; Kennedy, S; Flye, M W; Ponder, K P

    1999-12-01

    The liver regenerates by replication of differentiated hepatocytes after damage or removal of part of the liver. Although several growth factors and signaling pathways are activated during regeneration, it is unclear as to which of these are essential for hepatocyte replication. We show here that low- (1 mg/kg) and high- (10 mg/kg) dose hepatocyte growth factor (HGF) induced replication of 2.1% and 11.1% of hepatocytes in rats, respectively. Lipopolysaccharide (LPS), an inducer of the acute phase response, augmented hepatocyte replication in response to low- and high-dose HGF by 4- and 2-fold, respectively. HGF alone induced moderate levels of c-Jun-N-terminal kinase (JNK) and p44/p42 mitogen-activated protein kinase (MAPK), resulting in moderate levels of AP-1-DNA binding activity. The combination of LPS + HGF increased JNK and AP-1-DNA binding activity more than levels seen with LPS or HGF alone. The activation of Stat3 that was observed after administration of LPS + HGF, but not HGF alone, could contribute to increased transcription of AP-1 components. Because phosphorylation of the c-Jun component of AP-1 by JNK increases its ability to activate transcription, the AP-1 in hepatocytes from animals treated with LPS + HGF may be more active than in rats treated with LPS or HGF alone. LPS may contribute to hepatocyte replication by potentiating the effect of HGF on the activation of both AP-1-DNA binding and transcriptional activity.

  13. FAAP20: a novel ubiquitin-binding FA nuclear core-complex protein required for functional integrity of the FA-BRCA DNA repair pathway

    PubMed Central

    Ali, Abdullah Mahmood; Pradhan, Arun; Singh, Thiyam Ramsingh; Du, Changhu; Li, Jie; Wahengbam, Kebola; Grassman, Elke; Auerbach, Arleen D.; Pang, Qishen

    2012-01-01

    Fanconi anemia (FA) nuclear core complex is a multiprotein complex required for the functional integrity of the FA-BRCA pathway regulating DNA repair. This pathway is inactivated in FA, a devastating genetic disease, which leads to hematologic defects and cancer in patients. Here we report the isolation and characterization of a novel 20-kDa FANCA-associated protein (FAAP20). We show that FAAP20 is an integral component of the FA nuclear core complex. We identify a region on FANCA that physically interacts with FAAP20, and show that FANCA regulates stability of this protein. FAAP20 contains a conserved ubiquitin-binding zinc-finger domain (UBZ), and binds K-63–linked ubiquitin chains in vitro. The FAAP20-UBZ domain is not required for interaction with FANCA, but is required for DNA-damage–induced chromatin loading of FANCA and the functional integrity of the FA pathway. These findings reveal critical roles for FAAP20 in the FA-BRCA pathway of DNA damage repair and genome maintenance. PMID:22343915

  14. P53-dependent upregulation of neutral sphingomyelinase-2: role in doxorubicin-induced growth arrest

    PubMed Central

    Shamseddine, A A; Clarke, C J; Carroll, B; Airola, M V; Mohammed, S; Rella, A; Obeid, L M; Hannun, Y A

    2015-01-01

    Neutral sphingomyelinase-2 (nSMase2) is a ceramide-generating enzyme that has been implicated in growth arrest, apoptosis and exosome secretion. Although previous studies have reported transcriptional upregulation of nSMase2 in response to daunorubicin, through Sp1 and Sp3 transcription factors, the role of the DNA damage pathway in regulating nSMase2 remains unclear. In this study, we show that doxorubicin induces a dose-dependent induction of nSMase2 mRNA and protein with concomitant increases in nSMase activity and ceramide levels. Upregulation of nSMase2 was dependent on ATR, Chk1 and p53, thus placing it downstream of the DNA damage pathway. Moreover, overexpression of p53 was sufficient to transcriptionally induce nSMase2, without the need for DNA damage. DNA-binding mutants as well as acetylation mutants of p53 were unable to induce nSMase2, suggesting a role of nSMase2 in growth arrest. Moreover, knockdown of nSMase2 prevented doxorubicin-induced growth arrest. Finally, p53-induced nSMase2 upregulation appears to occur via a novel transcription start site upstream of exon 3. These results identify nSMase2 as a novel p53 target gene, regulated by the DNA damage pathway to induce cell growth arrest. PMID:26512957

  15. P53-dependent upregulation of neutral sphingomyelinase-2: role in doxorubicin-induced growth arrest.

    PubMed

    Shamseddine, A A; Clarke, C J; Carroll, B; Airola, M V; Mohammed, S; Rella, A; Obeid, L M; Hannun, Y A

    2015-10-29

    Neutral sphingomyelinase-2 (nSMase2) is a ceramide-generating enzyme that has been implicated in growth arrest, apoptosis and exosome secretion. Although previous studies have reported transcriptional upregulation of nSMase2 in response to daunorubicin, through Sp1 and Sp3 transcription factors, the role of the DNA damage pathway in regulating nSMase2 remains unclear. In this study, we show that doxorubicin induces a dose-dependent induction of nSMase2 mRNA and protein with concomitant increases in nSMase activity and ceramide levels. Upregulation of nSMase2 was dependent on ATR, Chk1 and p53, thus placing it downstream of the DNA damage pathway. Moreover, overexpression of p53 was sufficient to transcriptionally induce nSMase2, without the need for DNA damage. DNA-binding mutants as well as acetylation mutants of p53 were unable to induce nSMase2, suggesting a role of nSMase2 in growth arrest. Moreover, knockdown of nSMase2 prevented doxorubicin-induced growth arrest. Finally, p53-induced nSMase2 upregulation appears to occur via a novel transcription start site upstream of exon 3. These results identify nSMase2 as a novel p53 target gene, regulated by the DNA damage pathway to induce cell growth arrest.

  16. Mitochondrial nucleoid clusters protect newly synthesized mtDNA during Doxorubicin- and Ethidium Bromide-induced mitochondrial stress

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alán, Lukáš, E-mail: lukas.alan@fgu.cas.cz; Špaček

    Mitochondrial DNA (mtDNA) is compacted in ribonucleoprotein complexes called nucleoids, which can divide or move within the mitochondrial network. Mitochondrial nucleoids are able to aggregate into clusters upon reaction with intercalators such as the mtDNA depletion agent Ethidium Bromide (EB) or anticancer drug Doxorobicin (DXR). However, the exact mechanism of nucleoid clusters formation remains unknown. Resolving these processes may help to elucidate the mechanisms of DXR-induced cardiotoxicity. Therefore, we addressed the role of two key nucleoid proteins; mitochondrial transcription factor A (TFAM) and mitochondrial single-stranded binding protein (mtSSB); in the formation of mitochondrial nucleoid clusters during the action of intercalators.more » We found that both intercalators cause numerous aberrations due to perturbing their native status. By blocking mtDNA replication, both agents also prevented mtDNA association with TFAM, consequently causing nucleoid aggregation into large nucleoid clusters enriched with TFAM, co-existing with the normal nucleoid population. In the later stages of intercalation (> 48 h), TFAM levels were reduced to 25%. In contrast, mtSSB was released from mtDNA and freely distributed within the mitochondrial network. Nucleoid clusters mostly contained nucleoids with newly replicated mtDNA, however the nucleoid population which was not in replication mode remained outside the clusters. Moreover, the nucleoid clusters were enriched with p53, an anti-oncogenic gatekeeper. We suggest that mitochondrial nucleoid clustering is a mechanism for protecting nucleoids with newly replicated DNA against intercalators mediating genotoxic stress. These results provide new insight into the common mitochondrial response to mtDNA stress and can be implied also on DXR-induced mitochondrial cytotoxicity. - Highlights: • The mechanism for mitochondrial nucleoid clustering is proposed. • DNA intercalators (Doxorubicin or Ethidium Bromide) prevent TFAM binding to mtDNA. • Replicating nucleoids are less prone to DNA intercalator and preserve more TFAM. • Nucleoid clusters mostly contain nucleoids with newly replicated mtDNA. • Recently replicated nucleoids are protected in clusters by increased TFAM and p53.« less

  17. Simultaneous In Vitro Characterisation of DNA Deaminase Function and Associated DNA Repair Pathways

    PubMed Central

    Franchini, Don-Marc; Incorvaia, Elisabetta; Rangam, Gopinath; Coker, Heather A.; Petersen-Mahrt, Svend K.

    2013-01-01

    During immunoglobulin (Ig) diversification, activation-induced deaminase (AID) initiates somatic hypermutation and class switch recombination by catalysing the conversion of cytosine to uracil. The synergy between AID and DNA repair pathways is fundamental for the introduction of mutations, however the molecular and biochemical mechanisms underlying this process are not fully elucidated. We describe a novel method to efficiently decipher the composition and activity of DNA repair pathways that are activated by AID-induced lesions. The in vitro resolution (IVR) assay combines AID based deamination and DNA repair activities from a cellular milieu in a single assay, thus avoiding synthetically created DNA-lesions or genetic-based readouts. Recombinant GAL4-AID fusion protein is targeted to a plasmid containing GAL4 binding sites, allowing for controlled cytosine deamination within a substrate plasmid. Subsequently, the Xenopus laevis egg extract provides a source of DNA repair proteins and functional repair pathways. Our results demonstrated that DNA repair pathways which are in vitro activated by AID-induced lesions are reminiscent of those found during AID-induced in vivo Ig diversification. The comparative ease of manipulation of this in vitro systems provides a new approach to dissect the complex DNA repair pathways acting on defined physiologically lesions, can be adapted to use with other DNA damaging proteins (e.g. APOBECs), and provide a means to develop and characterise pharmacological agents to inhibit these potentially oncogenic processes. PMID:24349193

  18. Mechanism for verification of mismatched and homoduplex DNAs by nucleotides-bound MutS analyzed by molecular dynamics simulations.

    PubMed

    Ishida, Hisashi; Matsumoto, Atsushi

    2016-09-01

    In order to understand how MutS recognizes mismatched DNA and induces the reaction of DNA repair using ATP, the dynamics of the complexes of MutS (bound to the ADP and ATP nucleotides, or not) and DNA (with mismatched and matched base-pairs) were investigated using molecular dynamics simulations. As for DNA, the structure of the base-pairs of the homoduplex DNA which interacted with the DNA recognition site of MutS was intermittently disturbed, indicating that the homoduplex DNA was unstable. As for MutS, the disordered loops in the ATPase domains, which are considered to be necessary for the induction of DNA repair, were close to (away from) the nucleotide-binding sites in the ATPase domains when the nucleotides were (not) bound to MutS. This indicates that the ATPase domains changed their structural stability upon ATP binding using the disordered loop. Conformational analysis by principal component analysis showed that the nucleotide binding changed modes which have structurally solid ATPase domains and the large bending motion of the DNA from higher to lower frequencies. In the MutS-mismatched DNA complex bound to two nucleotides, the bending motion of the DNA at low frequency modes may play a role in triggering the formation of the sliding clamp for the following DNA-repair reaction step. Moreover, MM-PBSA/GBSA showed that the MutS-homoduplex DNA complex bound to two nucleotides was unstable because of the unfavorable interactions between MutS and DNA. This would trigger the ATP hydrolysis or separation of MutS and DNA to continue searching for mismatch base-pairs. Proteins 2016; 84:1287-1303. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  19. Screening and investigation of triplex DNA binders from Stephania tetrandra S. Moore by a combination of peak area-fading UHPLC with orbitrap MS and optical spectroscopies.

    PubMed

    Yang, Hongmei; Wang, Yihan; Yu, Wenjing; Shi, Lei; Wang, Hongfeng; Su, Rui; Chen, Changbao; Liu, Shuying

    2018-05-15

    The identification and screening of triplex DNA binders are important because these compounds, in many cases, are potential anticancer agents as well as promising drug candidates. Therefore, the ability to screen for these compounds in a high-throughput mode could dramatically improve the drug screening process. A method involving a combination of 96-well plate format and peak area-fading ultra high performance liquid chromatography coupled with Orbitrap mass spectrometry was employed for screening bioactive compounds binding to the triplex DNA from the extracts of Stephania tetrandra S. Moore. Two compounds were screened out and identified as fangchinoline and tetrandrine, based on the comparison of retention time and MS 2 data with those of standards. The binding mechanisms of fangchinoline and tetrandrine at the molecular level were explored using MS 2 , fluorescence spectroscopy, ultraviolet-visible spectroscopy, and circular dichroism. Collision-induced dissociation experiments showed that the complexes with fangchinoline and tetrandrine were dissociated by ligand elimination. According to these measurements, an intercalating binding is the most appropriate binding mode of these two alkaloids to the triplex DNA. The current work provides not only deep insight into alkaloid-triplex DNA complexes but also useful guidelines for the design of efficient anticancer agents. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  20. Improved exogenous DNA uptake in bovine spermatozoa and gene expression in embryos using membrane destabilizing agents in ICSI-SMGT.

    PubMed

    Sánchez-Villalba, Esther; Arias, María Elena; Zambrano, Fabiola; Loren, Pía; Felmer, Ricardo

    2018-02-01

    Sperm-mediated gene transfer (SMGT) is a simple, fast, and economical biotechnological tool for producing transgenic animals. However, transgene expression with this technique in bovine embryos is still inefficient due to low uptake and binding of exogenous DNA in spermatozoa. The present study evaluated the effects of sperm membrane destabilization on the binding capacity, location and quantity of bound exogenous DNA in cryopreserved bovine spermatozoa using Triton X-100 (TX-100), lysolecithin (LL) and sodium hydroxide (NaOH). Effects of these treatments were also evaluated by intracytoplasmic sperm injection (ICSI)-SMGT. Results showed that all treatments bound exogenous DNA to spermatozoa including the control. Spermatozoa treated with different membrane destabilizing agents bound the exogenous DNA throughout the head and tail of spermatozoa, compared with the control, in which binding occurred mainly in the post-acrosomal region and tail. The amount of exogenous DNA bound to spermatozoa was much higher for the different sperm treatments than the control (P < 0.05), most likely due to the damage induced by these treatments to the plasma and acrosomal membranes. Exogenous gene expression in embryos was also improved by these treatments. These results demonstrated that sperm membrane destabilization could be a novel strategy in bovine SMGT protocols for the generation of transgenic embryos by ICSI.

  1. Elevated mitochondrial gene expression during rat liver regeneration after portal vein ligation.

    PubMed

    Shimizu, Y; Suzuki, H; Nimura, Y; Onoue, S; Nagino, M; Tanaka, M; Ozawa, T

    1995-10-01

    We explored the molecular basis of mitochondrial energy production during rat liver regeneration after portal vein ligation. Ligation of the left branch of the portal vein induces an increase in the weight of the nonligated lobe, counterbalancing the reduced weight of the ligated lobe. Using this model, we investigated changes in mitochondrial DNA-binding proteins, mitochondrial DNA, and mitochondrial messenger RNA (mRNA) in rat hepatocytes of the nonligated lobes. The amount of mitochondrial DNA-binding protein increased maximally (200% to 300% of the preoperative level) at 12 hours after the operation, before an increase (390%) in mitochondrial DNA content at 24 hours, and parallel to an increase (240%) in mitochondrial mRNA levels at 12 hours. These results suggest that the energy supply for liver regeneration is achieved through enhancement of mitochondrial DNA replication as well as transcription, in which the mitochondrial DNA-binding proteins probably play regulatory roles. We also found that in the nonligated lobes, mRNA levels of hepatocyte growth factor increased to a detectable level only 12 hours after the operation. These molecular biochemical data help explain why preoperative portal vein embolization, which is a modification of portal vein branch ligation, is an effective method to prevent posthepatectomy liver failure.

  2. Inhibitor of Differentiation/DNA Binding 1 (ID1) Inhibits Etoposide-induced Apoptosis in a c-Jun/c-Fos-dependent Manner.

    PubMed

    Zhao, Yahui; Luo, Aiping; Li, Sheng; Zhang, Wei; Chen, Hongyan; Li, Yi; Ding, Fang; Huang, Furong; Liu, Zhihua

    2016-03-25

    ID1 (inhibitor of differentiation/DNA binding 1) acts an important role in metastasis, tumorigenesis, and maintenance of cell viability. It has been shown that the up-regulation of ID1 is correlated with poor prognosis and the resistance to chemotherapy of human cancers. However, the underlying molecular mechanism remains elusive. Here, we determined for the first time that up-regulating ID1 upon etoposide activation was mediated through AP-1 binding sites within theID1promoter and confirmed that ID1 enhanced cell resistance to DNA damage-induced apoptosis in esophageal squamous cell carcinoma cells. Ablation of c-Jun/c-Fos or ID1 expression enhanced etoposide-mediated apoptosis through increasing activity of caspase 3 and PARP cleavage. Moreover, c-Jun/c-Fos and ID1 were positively correlated in human cancers. More importantly, simultaneous high expression of ID1 and c-Jun or c-Fos was correlated with poor survival in cancer patients. Collectively, we demonstrate the importance of c-Jun/c-Fos-ID1 signaling pathway in chemoresistance of esophageal cancer cells and provide considerable insight into understanding the underlying molecular mechanisms in esophageal squamous cell carcinoma cell biology. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Biochemical Regulatory Features of Activation-Induced Cytidine Deaminase Remain Conserved from Lampreys to Humans

    PubMed Central

    King, Justin J.; Amemiya, Chris T.; Hsu, Ellen

    2017-01-01

    ABSTRACT Activation-induced cytidine deaminase (AID) is a genome-mutating enzyme that initiates class switch recombination and somatic hypermutation of antibodies in jawed vertebrates. We previously described the biochemical properties of human AID and found that it is an unusual enzyme in that it exhibits binding affinities for its substrate DNA and catalytic rates several orders of magnitude higher and lower, respectively, than a typical enzyme. Recently, we solved the functional structure of AID and demonstrated that these properties are due to nonspecific DNA binding on its surface, along with a catalytic pocket that predominantly assumes a closed conformation. Here we investigated the biochemical properties of AID from a sea lamprey, nurse shark, tetraodon, and coelacanth: representative species chosen because their lineages diverged at the earliest critical junctures in evolution of adaptive immunity. We found that these earliest-diverged AID orthologs are active cytidine deaminases that exhibit unique substrate specificities and thermosensitivities. Significant amino acid sequence divergence among these AID orthologs is predicted to manifest as notable structural differences. However, despite major differences in sequence specificities, thermosensitivities, and structural features, all orthologs share the unusually high DNA binding affinities and low catalytic rates. This absolute conservation is evidence for biological significance of these unique biochemical properties. PMID:28716949

  4. Nicotine drives neutrophil extracellular traps formation and accelerates collagen-induced arthritis.

    PubMed

    Lee, Jaejoon; Luria, Ayala; Rhodes, Christopher; Raghu, Harini; Lingampalli, Nithya; Sharpe, Orr; Rada, Balazs; Sohn, Dong Hyun; Robinson, William H; Sokolove, Jeremy

    2017-04-01

    The aim was to investigate the effects of nicotine on neutrophil extracellular traps (NETs) formation in current and non-smokers and on a murine model of RA. We compared spontaneous and phorbol 12-myristate 13-acetate-induced NETosis between current and non-smokers by DNA release binding. Nicotine-induced NETosis from non-smokers was assessed by DNA release binding, NET-specific (myeloperoxidase (MPO)-DNA complex) ELISA and real-time fluorescence microscopy. We also used immunofluorescent staining to detect nicotinic acetylcholine receptors (nAChRs) on neutrophils and performed a functional analysis to assess the role of nAChRs in nicotine-induced NETosis. Finally, we investigated the effects of systemic nicotine exposure on arthritis severity and NETosis in the CIA mouse model. Neutrophils derived from current smokers displayed elevated levels of spontaneous and phorbol 12-myristate 13-acetate-induced NETosis. Nicotine induced dose-dependent NETosis in ex vivo neutrophils from healthy non-smokers, and co-incubation with ACPA-immune complexes or TNF-α facilitated a synergistic effect on NETosis. Real-time fluorescence microscopy revealed robust formation of NET-like structures in nicotine-exposed neutrophils. Immunofluorescent staining demonstrated the presence of the α7 subunit of the nAChR on neutrophils. Stimulation of neutrophils with an α7-specific nAChR agonist induced NETosis, whereas pretreatment with an nAChR antagonist attenuated nicotine-induced NETosis. Nicotine administration to mice with CIA exacerbated inflammatory arthritis, with higher plasma levels of NET-associated MPO-DNA complex. We demonstrate that nicotine is a potent inducer of NETosis, which may play an important role in accelerating arthritis in the CIA model. This study generates awareness of and the mechanisms by which nicotine-containing products, including e-cigarettes, may have deleterious effects on patients with RA. Published by Oxford University Press 2016. This work is written by US Government employees and is in the public domain in the United States.

  5. Molecular dynamics simulations suggest changes in electrostatic interactions as a potential mechanism through which serine phosphorylation inhibits DNA Polymerase β's activity.

    PubMed

    Homouz, Dirar; Joyce-Tan, Kwee Hong; Shahir Shamsir, Mohd; Moustafa, Ibrahim M; Idriss, Haitham

    2018-01-01

    DNA polymerase β is a 39kDa enzyme that is a major component of Base Excision Repair in human cells. The enzyme comprises two major domains, a 31kDa domain responsible for the polymerase activity and an 8kDa domain, which bind ssDNA and has a deoxyribose phosphate (dRP) lyase activity. DNA polymerase β was shown to be phosphorylated in vitro with protein kinase C (PKC) at serines 44 and 55 (S44 and S55), resulting in loss of its polymerase enzymic activity, but not its ability to bind ssDNA. In this study, we investigate the potential phosphorylation-induced structural changes for DNA polymerase β using molecular dynamics. The simulations show drastic conformational changes of the polymerase structure as a result of S44 phosphorylation. Phosphorylation-induced conformational changes transform the closed (active) enzyme structure into an open one. Further analysis of the results points to a key hydrogen bond and newly formed salt bridges as potential drivers of these structural fluctuations. The changes observed with S44/55 and S55 phosphorylation were less dramatic than S44 and the integrity of the H-bond was not compromised. Thus the phosphorylation of S44 is likely the major contributor to structural fluctuations that lead to loss of enzymatic activity. Copyright © 2017. Published by Elsevier Inc.

  6. EM structure of a helicase-loader complex depicting a 6:2 binding sub-stoichiometry from Geobacillus kaustophilus HTA426

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lin, Yen-Chen; Naveen, Vankadari; Molecular Cell Biology, Taiwan International Graduate Program, Institute of Molecular Biology, Academia Sinica, and Graduate Institute of Life Sciences, National Defense Medical Center, Taipei, Taiwan

    During DNA replication, bacterial helicase is recruited as a complex in association with loader proteins to unwind the parental duplex. Previous structural studies have reported saturated 6:6 helicase-loader complexes with different conformations. However, structural information on the sub-stoichiometric conformations of these previously-documented helicase-loader complexes remains elusive. Here, with the aid of single particle electron-microscopy (EM) image reconstruction, we present the Geobacillus kaustophilus HTA426 helicase-loader (DnaC-DnaI) complex with a 6:2 binding stoichiometry in the presence of ATPγS. In the 19 Å resolution EM map, the undistorted and unopened helicase ring holds a robust loader density above the C-terminal RecA-like domain. Meanwhile, themore » path of the central DNA binding channel appears to be obstructed by the reconstructed loader density, implying its potential role as a checkpoint conformation to prevent the loading of immature complex onto DNA. Our data also reveals that the bound nucleotides and the consequently induced conformational changes in the helicase hexamer are essential for active association with loader proteins. These observations provide fundamental insights into the formation of the helicase-loader complex in bacteria that regulates the DNA replication process. - Highlights: • Helicase-loader complex structure with 6:2 sub-stoichiometry is resolved by EM. • Helicase hexamer in 6:2 sub-stoichiometry is constricted and un-opened. • 6:2 binding ratio of helicase-loader complex could act as a DNA loading checkpoint. • Nucleotides stabilize helicase-loader complex at low protein concentrations.« less

  7. cDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  8. cDNA encoding a polypeptide including a hev ein sequence

    DOEpatents

    Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

    2000-07-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  9. cDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.

  10. cDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1995-03-21

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.

  11. The Transcription Elongation Complex Directs Activation-Induced Cytidine Deaminase-Mediated DNA Deamination†

    PubMed Central

    Besmer, Eva; Market, Eleonora; Papavasiliou, F. Nina

    2006-01-01

    Activation-induced cytidine deaminase (AID) is a single-stranded DNA deaminase required for somatic hypermutation of immunoglobulin (Ig) genes, a key process in the development of adaptive immunity. Transcription provides a single-stranded DNA substrate for AID, both in vivo and in vitro. We present here an assay which can faithfully replicate all of the molecular features of the initiation of hypermutation of Ig genes in vivo. In this assay, which detects AID-mediated deamination in the context of transcription by Escherichia coli RNA polymerase, deamination targets either strand and declines in efficiency as the distance from the promoter increases. We show that AID binds DNA exposed by the transcribing polymerase, implicating the polymerase itself as the vehicle which distributes AID on DNA as it moves away from the promoter. PMID:16705187

  12. Spectroscopic studies on the interactions of 5-ethyl-6-phenyl-3,8-bis((3-aminoalkyl)propanamido)phenanthridin-5-ium derivatives with G-quadruplex DNA

    NASA Astrophysics Data System (ADS)

    Yalçın, Ergin; Duyar, Halil; Ihmels, Heiko; Seferoğlu, Zeynel

    2018-05-01

    An improved microwave-induced synthesis of five ethidium derivatives (Ethidium derivatives, 2a-d) is presented. As the derivatives 2a-d have been proposed previously to be telomerase inhibitors, the binding interactions of these ethidium derivatives with G-quadruplex DNA were evaluated by means of photometric and fluorimetric titration, thermal DNA denaturation, CD and 1H NMR spectroscopy. In particular, the compound bearing 3,8-bis(pyrrolidin-1-yl)propanamido substituent 2a exhibits high selectivity for G-quadruplex DNA relative to duplex DNA.

  13. DNA oligonucleotide duplexes containing intramolecular platinated cross-links: energetics, hydration, sequence, and ionic effects.

    PubMed

    Kankia, Besik I; Soto, Ana Maria; Burns, Nicole; Shikiya, Ronald; Tung, Chang-Shung; Marky, Luis A

    2002-11-05

    The anticancer activity of cisplatin arises from its ability to bind covalently to DNA, forming primarily intrastrand cross-links to adjacent purine residues; the most common adducts involve d(GpG) (65%) and d(ApG) (25%) intrastrand cross-links. The incorporation of these platinum adducts in a B-DNA helix induces local distortions, causing bending and unwinding of the DNA. In this work, we used temperature-dependent UV spectroscopy to investigate the unfolding thermodynamics, and associated ionic effects, of two sets of DNA decamer duplexes containing either cis-[Pt(NH(3))(2)[d(GpG

  14. An immunoassay for the study of DNA-binding activities of herpes simplex virus protein ICP8.

    PubMed

    Lee, C K; Knipe, D M

    1985-06-01

    An immunoassay was used to examine the interaction between a herpes simplex virus protein, ICP8, and various types of DNA. The advantage of this assay is that the protein is not subjected to harsh purification procedures. We characterized the binding of ICP8 to both single-stranded (ss) and double-stranded (ds) DNA. ICP8 bound ss DNA fivefold more efficiently than ds DNA, and both binding activities were most efficient in 150 mM NaCl. Two lines of evidence indicate that the binding activities were not identical: (i) ds DNA failed to complete with ss DNA binding even with a large excess of ds DNA; (ii) Scatchard plots of DNA binding with various amounts of DNA were fundamentally different for ss DNA and ds DNA. However, the two activities were related in that ss DNA efficiently competed with the binding of ds DNA. We conclude that the ds DNA-binding activity of ICP8 is probably distinct from the ss DNA-binding activity. No evidence for sequence-specific ds DNA binding was obtained for either the entire herpes simplex virus genome or cloned viral sequences.

  15. E2 Proteins from High- and Low-Risk Human Papillomavirus Types Differ in Their Ability To Bind p53 and Induce Apoptotic Cell Death

    PubMed Central

    Parish, Joanna L.; Kowalczyk, Anna; Chen, Hsin-Tien; Roeder, Geraldine E.; Sessions, Richard; Buckle, Malcolm; Gaston, Kevin

    2006-01-01

    The E2 proteins from oncogenic (high-risk) human papillomaviruses (HPVs) can induce apoptotic cell death in both HPV-transformed and non-HPV-transformed cells. Here we show that the E2 proteins from HPV type 6 (HPV6) and HPV11, two nononcogenic (low-risk) HPV types, fail to induce apoptosis. Unlike the high-risk HPV16 E2 protein, these low-risk E2 proteins fail to bind p53 and fail to induce p53-dependent transcription activation. Interestingly, neither the ability of p53 to activate transcription nor the ability of p53 to bind DNA, are required for HPV16 E2-induced apoptosis in non-HPV-transformed cells. However, mutations that reduce the binding of the HPV16 E2 protein to p53 inhibit E2-induced apoptosis in non-HPV-transformed cells. In contrast, the interaction between HPV16 E2 and p53 is not required for this E2 protein to induce apoptosis in HPV-transformed cells. Thus, our data suggest that this high-risk HPV E2 protein induces apoptosis via two pathways. One pathway involves the binding of E2 to p53 and can operate in both HPV-transformed and non-HPV-transformed cells. The second pathway requires the binding of E2 to the viral genome and can only operate in HPV-transformed cells. PMID:16611918

  16. Using Specific Binding DNA Capture Elements to Direct Pulsed Power Killing of Biological Agents

    DTIC Science & Technology

    2003-06-01

    Department of the Air Force position, policy, or decision unless so designated by other documentation. VI. REFERENCES [1] V. Majidi and M. R. Joseph...Spectroscopic applications of laser-induced plasmas,” Crit. Rev. Analyt. Chem. 23, 143-162, 1992. [2] V. Majidi , “Laser-induced plasmas: A versatile tool

  17. Directing traffic on DNA-How transcription factors relieve or induce transcriptional interference.

    PubMed

    Hao, Nan; Palmer, Adam C; Dodd, Ian B; Shearwin, Keith E

    2017-03-15

    Transcriptional interference (TI) is increasingly recognized as a widespread mechanism of gene control, particularly given the pervasive nature of transcription, both sense and antisense, across all kingdoms of life. Here, we discuss how transcription factor binding kinetics strongly influence the ability of a transcription factor to relieve or induce TI.

  18. MorTAL Kombat: the story of defense against TAL effectors through loss-of-susceptibility

    PubMed Central

    Hutin, Mathilde; Pérez-Quintero, Alvaro L.; Lopez, Camilo; Szurek, Boris

    2015-01-01

    Many plant-pathogenic xanthomonads rely on Transcription Activator-Like (TAL) effectors to colonize their host. This particular family of type III effectors functions as specific plant transcription factors via a programmable DNA-binding domain. Upon binding to the promoters of plant disease susceptibility genes in a sequence-specific manner, the expression of these host genes is induced. However, plants have evolved specific strategies to counter the action of TAL effectors and confer resistance. One mechanism is to avoid the binding of TAL effectors by mutations of their DNA binding sites, resulting in resistance by loss-of-susceptibility. This article reviews our current knowledge of the susceptibility hubs targeted by Xanthomonas TAL effectors, possible evolutionary scenarios for plants to combat the pathogen with loss-of-function alleles, and how this knowledge can be used overall to develop new pathogen-informed breeding strategies and improve crop resistance. PMID:26236326

  19. Radiation-induced oxidative damage to the DNA-binding domain of the lactose repressor

    PubMed Central

    Gillard, Nathalie; Goffinont, Stephane; Buré, Corinne; Davidkova, Marie; Maurizot, Jean-Claude; Cadene, Martine; Spotheim-Maurizot, Melanie

    2007-01-01

    Understanding the cellular effects of radiation-induced oxidation requires the unravelling of key molecular events, particularly damage to proteins with important cellular functions. The Escherichia coli lactose operon is a classical model of gene regulation systems. Its functional mechanism involves the specific binding of a protein, the repressor, to a specific DNA sequence, the operator. We have shown previously that upon irradiation with γ-rays in solution, the repressor loses its ability to bind the operator. Water radiolysis generates hydroxyl radicals (OH· radicals) which attack the protein. Damage of the repressor DNA-binding domain, called the headpiece, is most likely to be responsible of this loss of function. Using CD, fluorescence spectroscopy and a combination of proteolytic cleavage with MS, we have examined the state of the irradiated headpiece. CD measurements revealed a dose-dependent conformational change involving metastable intermediate states. Fluorescence measurements showed a gradual degradation of tyrosine residues. MS was used to count the number of oxidations in different regions of the headpiece and to narrow down the parts of the sequence bearing oxidized residues. By calculating the relative probabilities of reaction of each amino acid with OH· radicals, we can predict the most probable oxidation targets. By comparing the experimental results with the predictions we conclude that Tyr7, Tyr12, Tyr17, Met42 and Tyr47 are the most likely hotspots of oxidation. The loss of repressor function is thus correlated with chemical modifications and conformational changes of the headpiece. PMID:17263689

  20. New inhibitor targeting human transcription factor HSF1: effects on the heat shock response and tumor cell survival

    PubMed Central

    Vilaboa, Nuria; Boré, Alba; Martin-Saavedra, Francisco; Bayford, Melanie; Winfield, Natalie; Firth-Clark, Stuart; Kirton, Stewart B.

    2017-01-01

    Abstract Comparative modeling of the DNA-binding domain of human HSF1 facilitated the prediction of possible binding pockets for small molecules and definition of corresponding pharmacophores. In silico screening of a large library of lead-like compounds identified a set of compounds that satisfied the pharmacophoric criteria, a selection of which compounds was purchased to populate a biased sublibrary. A discriminating cell-based screening assay identified compound 001, which was subjected to systematic analysis of structure–activity relationships, resulting in the development of compound 115 (IHSF115). IHSF115 bound to an isolated HSF1 DNA-binding domain fragment. The compound did not affect heat-induced oligomerization, nuclear localization and specific DNA binding but inhibited the transcriptional activity of human HSF1, interfering with the assembly of ATF1-containing transcription complexes. IHSF115 was employed to probe the human heat shock response at the transcriptome level. In contrast to earlier studies of differential regulation in HSF1-naïve and -depleted cells, our results suggest that a large majority of heat-induced genes is positively regulated by HSF1. That IHSF115 effectively countermanded repression in a significant fraction of heat-repressed genes suggests that repression of these genes is mediated by transcriptionally active HSF1. IHSF115 is cytotoxic for a variety of human cancer cell lines, multiple myeloma lines consistently exhibiting high sensitivity. PMID:28369544

  1. Binding of anticancer drug daunomycin to a TGGGGT G-quadruplex DNA probed by all-atom molecular dynamics simulations: additional pure groove binding mode and implications on designing more selective G-quadruplex ligands.

    PubMed

    Shen, Zhanhang; Mulholland, Kelly A; Zheng, Yujun; Wu, Chun

    2017-09-01

    DNA G-quadruplex structures are emerging cancer-specific targets for chemotherapeutics. Ligands that bind to and stabilize DNA G-quadruplexes have the potential to be anti-cancer drugs. Lack of binding selectivity to DNA G-quadruplex over DNA duplex remains a major challenge when attempting to develop G-quadruplex ligands into successful anti-cancer drugs. Thorough understanding of the binding nature of existing non-selective ligands that bind to both DNA quadruplex and DNA duplex will help to address this challenge. Daunomycin and doxorubicin, two commonly used anticancer drugs, are examples of non-selective DNA ligands. In this study, we extended our early all-atom binding simulation studies between doxorubicin and a DNA duplex (d(CGATCG) 2 ) to probe the binding between daunomycin and a parallel DNA quadruplex (d(TGGGGT) 4 ) and DNA duplex. In addition to the end stacking mode, which mimics the mode in the crystal structure, a pure groove binding mode was observed in our free binding simulations. The dynamic and energetic properties of these two binding modes are thoroughly examined, and a detailed comparison is made between DNA quadruplex binding modes and DNA duplex binding modes. Implications on the design of more selective DNA quadruplex ligands are also discussed. Graphical abstract Top stacking and groov binding modes from the MD simulations.

  2. A phosphorylation-and-ubiquitylation circuitry driving ATR activation and homologous recombination

    PubMed Central

    Dubois, Jean-Christophe; Yates, Maïlyn; Gaudreau-Lapierre, Antoine; Clément, Geneviève; Cappadocia, Laurent; Gaudreau, Luc

    2017-01-01

    Abstract RPA-coated single-stranded DNA (RPA–ssDNA), a nucleoprotein structure induced by DNA damage, promotes ATR activation and homologous recombination (HR). RPA is hyper-phosphorylated and ubiquitylated after DNA damage. The ubiquitylation of RPA by PRP19 and RFWD3 facilitates ATR activation and HR, but how it is stimulated by DNA damage is still unclear. Here, we show that RFWD3 binds RPA constitutively, whereas PRP19 recognizes RPA after DNA damage. The recruitment of PRP19 by RPA depends on PIKK-mediated RPA phosphorylation and a positively charged pocket in PRP19. An RPA32 mutant lacking phosphorylation sites fails to recruit PRP19 and support RPA ubiquitylation. PRP19 mutants unable to bind RPA or lacking ubiquitin ligase activity also fail to support RPA ubiquitylation and HR. These results suggest that RPA phosphorylation enhances the recruitment of PRP19 to RPA–ssDNA and stimulates RPA ubiquitylation through a process requiring both PRP19 and RFWD3, thereby triggering a phosphorylation-ubiquitylation circuitry that promotes ATR activation and HR. PMID:28666352

  3. UPregulated single-stranded DNA-binding protein 1 induces cell chemoresistance to cisplatin in lung cancer cell lines.

    PubMed

    Zhao, Xiang; He, Rong; Liu, Yu; Wu, Yongkai; Kang, Leitao

    2017-07-01

    Cisplatin and its analogues are widely used as anti-tumor drugs in lung cancer but many cisplatin-resistant lung cancer cases have been identified in recent years. Single-stranded DNA-binding protein 1 (SSDBP1) can effectively induce H69 cell resistance to cisplatin in our previous identification; thus, it is necessary to explore the mechanism underlying the effects of SSDBP1-induced resistance to cisplatin. First, SSDBP1-overexpressed or silent cell line was constructed and used to analyze the effects of SSDBP1 on chemoresistance of lung cancer cells to cisplatin. SSDBP1 expression was assayed by real-time PCR and Western blot. Next, the effects of SSDBP1 on cisplatin sensitivity, proliferation, and apoptosis of lung cancer cell lines were assayed by MTT and flow cytometry, respectively; ABC transporters, apoptosis-related genes, and cell cycle-related genes by real-time PCR, and DNA wound repair by comet assay. Low expression of SSDBP1 was observed in H69 cells, while increased expression in cisplatin-resistant H69 cells. Upregulated expression of SSDBP1 in H69AR cells was identified to promote proliferation and cisplatin resistance and inhibit apoptosis, while downregulation of SSDBP1 to inhibit cisplatin resistance and proliferation and promoted apoptosis. Moreover, SSDBP1 promoted the expression of P2gp, MRP1, Cyclin D1, and CDK4 and inhibited the expression of caspase 3 and caspase 9. Furthermore, SSDBP1 promoted the DNA wound repair. These results indicated that SSDBP1 may induce cell chemoresistance of cisplatin through promoting DNA repair, resistance-related gene expression, cell proliferation, and inhibiting apoptosis.

  4. Characterization of differential ripening pattern in association with ethylene biosynthesis in the fruits of five naturally occurring banana cultivars and detection of a GCC-box-specific DNA-binding protein.

    PubMed

    Choudhury, Swarup Roy; Roy, Sujit; Saha, Progya Paramita; Singh, Sanjay Kumar; Sengupta, Dibyendu N

    2008-07-01

    MA-ACS1 and MA-ACO1 are the two major ripening genes in banana and play crucial role in the regulation of ethylene production during ripening. Here, we report a comparative ripening pattern in five different naturally occurring banana cultivars namely Cavendish (AAA), Rasthali (AAB), Kanthali (AB), Poovan (AAB) and Monthan (ABB), which have distinct genome composition. We found a distinct variation in the climacteric ethylene production and in-vivo ACC oxidase activity level during the ripening stages in the five cultivars. We identified the cDNAs for MA-ACS1 and MA-ACO1 from the five cultivars and studied the transcript accumulation patterns of the two genes, which correlated well with the differential timing in the expression of these two genes during ripening. The GCC-box is one of the ethylene-responsive elements (EREs) found in the promoters of many ethylene-inducible genes. We have identified a GCC-box motif (putative ERE) in the promoters of MA-ACS1 and MA-ACO1 in banana cultivars. DNA-protein interaction studies revealed the presence of a GCC-box-specific DNA-binding activity in the fruit nuclear extract and such DNA-binding activity was enhanced following ethylene treatment. South-Western blotting revealed a 25-kDa nuclear protein that binds specifically to GCC-box DNA in the climacteric banana fruit. Together, these results indicate the probable involvement of the GCC-box motif as the cis-acting ERE in the regulation of MA-ACS1 and MA-ACO1 during ripening in banana fruits via binding of specific ERE-binding protein.

  5. Aptamer-based electrochemical sensors with aptamer-complementary DNA oligonucleotides as probe.

    PubMed

    Lu, Ying; Li, Xianchan; Zhang, Limin; Yu, Ping; Su, Lei; Mao, Lanqun

    2008-03-15

    This study describes a facile and general strategy for the development of aptamer-based electrochemical sensors with a high specificity toward the targets and a ready regeneration feature. Very different from the existing strategies for the development of electrochemical aptasensors with the aptamers as the probes, the strategy proposed here is essentially based on the utilization of the aptamer-complementary DNA (cDNA) oligonucleotides as the probes for electrochemical sensing. In this context, the sequences at both ends of the cDNA are tailor-made to be complementary and both the redox moiety (i.e., ferrocene in this study) and thiol group are labeled onto the cDNA. The labeled cDNA are hybridized with their respective aptamers (i.e., ATP- and thrombin-binding aptamers in this study) to form double-stranded DNA (ds-DNA) and the electrochemical aptasensors are prepared by self-assembling the labeled ds-DNA onto Au electrodes. Upon target binding, the aptamers confined onto electrode surface dissociate from their respective cDNA oligonucleotides into the solution and the single-stranded cDNA could thus tend to form a hairpin structure through the hybridization of the complementary sequences at both its ends. Such a conformational change of the cDNA resulting from the target binding-induced dissociation of the aptamers essentially leads to the change in the voltammetric signal of the redox moiety labeled onto the cDNA and thus constitutes the mechanism for the electrochemical aptasensors for specific target sensing. The aptasensors demonstrated here with the cDNA as the probe are readily regenerated and show good responses toward the targets. This study may offer a new and relatively general approach to electrochemical aptasensors with good analytical properties and potential applications.

  6. Structural Basis for Intrinsic Thermosensing by the Master Virulence Regulator RovA of Yersinia*

    PubMed Central

    Quade, Nick; Mendonca, Chriselle; Herbst, Katharina; Heroven, Ann Kathrin; Ritter, Christiane; Heinz, Dirk W.; Dersch, Petra

    2012-01-01

    Pathogens often rely on thermosensing to adjust virulence gene expression. In yersiniae, important virulence-associated traits are under the control of the master regulator RovA, which uses a built-in thermosensor to control its activity. Thermal upshifts encountered upon host entry induce conformational changes in the RovA dimer that attenuate DNA binding and render the protein more susceptible to proteolysis. Here, we report the crystal structure of RovA in the free and DNA-bound forms and provide evidence that thermo-induced loss of RovA activity is promoted mainly by a thermosensing loop in the dimerization domain and residues in the adjacent C-terminal helix. These determinants allow partial unfolding of the regulator upon an upshift to 37 °C. This structural distortion is transmitted to the flexible DNA-binding domain of RovA. RovA contacts mainly the DNA backbone in a low-affinity binding mode, which allows the immediate release of RovA from its operator sites. We also show that SlyA, a close homolog of RovA from Salmonella with a very similar structure, is not a thermosensor and remains active and stable at 37 °C. Strikingly, changes in only three amino acids, reflecting evolutionary replacements in SlyA, result in a complete loss of the thermosensing properties of RovA and prevent degradation. In conclusion, only minor alterations can transform a thermotolerant regulator into a thermosensor that allows adjustment of virulence and fitness determinants to their thermal environment. PMID:22936808

  7. Sequence-dependent nanometer-scale conformational dynamics of individual RecBCD–DNA complexes

    PubMed Central

    Carter, Ashley R.; Seaberg, Maasa H.; Fan, Hsiu-Fang; Sun, Gang; Wilds, Christopher J.; Li, Hung-Wen; Perkins, Thomas T.

    2016-01-01

    RecBCD is a multifunctional enzyme that possesses both helicase and nuclease activities. To gain insight into the mechanism of its helicase function, RecBCD unwinding at low adenosine triphosphate (ATP) (2–4 μM) was measured using an optical-trapping assay featuring 1 base-pair (bp) precision. Instead of uniformly sized steps, we observed forward motion convolved with rapid, large-scale (∼4 bp) variations in DNA length. We interpret this motion as conformational dynamics of the RecBCD–DNA complex in an unwinding-competent state, arising, in part, by an enzyme-induced, back-and-forth motion relative to the dsDNA that opens and closes the duplex. Five observations support this interpretation. First, these dynamics were present in the absence of ATP. Second, the onset of the dynamics was coupled to RecBCD entering into an unwinding-competent state that required a sufficiently long 5′ strand to engage the RecD helicase. Third, the dynamics were modulated by the GC-content of the dsDNA. Fourth, the dynamics were suppressed by an engineered interstrand cross-link in the dsDNA that prevented unwinding. Finally, these dynamics were suppressed by binding of a specific non-hydrolyzable ATP analog. Collectively, these observations show that during unwinding, RecBCD binds to DNA in a dynamic mode that is modulated by the nucleotide state of the ATP-binding pocket. PMID:27220465

  8. Binding of Bisphenol-F, a bisphenol analogue, to calf thymus DNA by multi-spectroscopic and molecular docking studies.

    PubMed

    Usman, Afia; Ahmad, Masood

    2017-08-01

    BPF (Bisphenol-F), a member of the bisphenol family, having a wide range of industrial applications is gradually replacing Bisphenol-A. It is a recognized endocrine disrupting chemical (EDC). EDCs have been implicated in increased incidences of breast, prostate and testis cancers besides diabetes, obesity and decreased fertility. Due to the adverse effects of EDCs on human health, attempts have been directed towards their mechanism of toxicity especially at the molecular level. Hence, to understand the mechanism at the DNA level, interaction of BPF with calf thymus DNA was studied employing multi-spectroscopic, voltammetric and molecular docking techniques. Fluorescence spectra, cyclic voltammetry (CV), circular dichroism (CD) and molecular docking studies of BPF with DNA were suggestive of minor groove binding of BPF. UV-visible absorption and fluorescence spectra suggested static quenching due to complex formation between BPF and ctDNA. Hoechst 33258 (HO) and ethidium bromide (EB) displacement studies further confirmed such mode of BPF interaction. Thermodynamic and molecular docking parameters revealed the mechanism of binding of BPF with ctDNA to be favorable and spontaneous due to negative ΔG and occurring through hydrogen bonds and van der waals interactions. BPF induced DNA cleavage under in vitro conditions by plasmid nicking assay suggested it to be genotoxic. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Light-Inducible Gene Regulation with Engineered Zinc Finger Proteins

    PubMed Central

    Polstein, Lauren R.; Gersbach, Charles A.

    2014-01-01

    The coupling of light-inducible protein-protein interactions with gene regulation systems has enabled the control of gene expression with light. In particular, heterodimer protein pairs from plants can be used to engineer a gene regulation system in mammalian cells that is reversible, repeatable, tunable, controllable in a spatiotemporal manner, and targetable to any DNA sequence. This system, Light-Inducible Transcription using Engineered Zinc finger proteins (LITEZ), is based on the blue light-induced interaction of GIGANTEA and the LOV domain of FKF1 that drives the localization of a transcriptional activator to the DNA-binding site of a highly customizable engineered zinc finger protein. This chapter provides methods for modifying LITEZ to target new DNA sequences, engineering a programmable LED array to illuminate cell cultures, and using the modified LITEZ system to achieve spatiotemporal control of transgene expression in mammalian cells. PMID:24718797

  10. An asymmetric structure of the Bacillus subtilis replication terminator protein in complex with DNA.

    PubMed

    Vivian, J P; Porter, C J; Wilce, J A; Wilce, M C J

    2007-07-13

    In Bacillus subtilis, the termination of DNA replication via polar fork arrest is effected by a specific protein:DNA complex formed between the replication terminator protein (RTP) and DNA terminator sites. We report the crystal structure of a replication terminator protein homologue (RTP.C110S) of B. subtilis in complex with the high affinity component of one of its cognate DNA termination sites, known as the TerI B-site, refined at 2.5 A resolution. The 21 bp RTP:DNA complex displays marked structural asymmetry in both the homodimeric protein and the DNA. This is in contrast to the previously reported complex formed with a symmetrical TerI B-site homologue. The induced asymmetry is consistent with the complex's solution properties as determined using NMR spectroscopy. Concomitant with this asymmetry is variation in the protein:DNA binding pattern for each of the subunits of the RTP homodimer. It is proposed that the asymmetric "wing" positions, as well as other asymmetrical features of the RTP:DNA complex, are critical for the cooperative binding that underlies the mechanism of polar fork arrest at the complete terminator site.

  11. Cations Form Sequence Selective Motifs within DNA Grooves via a Combination of Cation-Pi and Ion-Dipole/Hydrogen Bond Interactions

    PubMed Central

    Stewart, Mikaela; Dunlap, Tori; Dourlain, Elizabeth; Grant, Bryce; McFail-Isom, Lori

    2013-01-01

    The fine conformational subtleties of DNA structure modulate many fundamental cellular processes including gene activation/repression, cellular division, and DNA repair. Most of these cellular processes rely on the conformational heterogeneity of specific DNA sequences. Factors including those structural characteristics inherent in the particular base sequence as well as those induced through interaction with solvent components combine to produce fine DNA structural variation including helical flexibility and conformation. Cation-pi interactions between solvent cations or their first hydration shell waters and the faces of DNA bases form sequence selectively and contribute to DNA structural heterogeneity. In this paper, we detect and characterize the binding patterns found in cation-pi interactions between solvent cations and DNA bases in a set of high resolution x-ray crystal structures. Specifically, we found that monovalent cations (Tl+) and the polarized first hydration shell waters of divalent cations (Mg2+, Ca2+) form cation-pi interactions with DNA bases stabilizing unstacked conformations. When these cation-pi interactions are combined with electrostatic interactions a pattern of specific binding motifs is formed within the grooves. PMID:23940752

  12. Cations form sequence selective motifs within DNA grooves via a combination of cation-pi and ion-dipole/hydrogen bond interactions.

    PubMed

    Stewart, Mikaela; Dunlap, Tori; Dourlain, Elizabeth; Grant, Bryce; McFail-Isom, Lori

    2013-01-01

    The fine conformational subtleties of DNA structure modulate many fundamental cellular processes including gene activation/repression, cellular division, and DNA repair. Most of these cellular processes rely on the conformational heterogeneity of specific DNA sequences. Factors including those structural characteristics inherent in the particular base sequence as well as those induced through interaction with solvent components combine to produce fine DNA structural variation including helical flexibility and conformation. Cation-pi interactions between solvent cations or their first hydration shell waters and the faces of DNA bases form sequence selectively and contribute to DNA structural heterogeneity. In this paper, we detect and characterize the binding patterns found in cation-pi interactions between solvent cations and DNA bases in a set of high resolution x-ray crystal structures. Specifically, we found that monovalent cations (Tl⁺) and the polarized first hydration shell waters of divalent cations (Mg²⁺, Ca²⁺) form cation-pi interactions with DNA bases stabilizing unstacked conformations. When these cation-pi interactions are combined with electrostatic interactions a pattern of specific binding motifs is formed within the grooves.

  13. Dead bacteria reverse antibiotic-induced host defense impairment in burns.

    PubMed

    Chen, Lee-Wei; Chen, Pei-Hsuan; Fung, Chang-Phone; Hsu, Ching-Mei

    2014-10-01

    Burn patients can incur high rates of hospital-acquired infections. The mechanism of antibiotic exposure on inducing infection vulnerability has not been determined. This study aimed to examine the effects of antibiotic treatment on host defense mechanisms. First we treated C57/BL6 mice with combined antibiotic treatment after 30% to 35% total body surface area burn. Animals were sacrificed at 48 hours after sham or thermal injury treatment. Bacterial counts in intestinal lumen and mucosa were measured. Next, we treated animals with or without oral dead Escherichia coli or Staphylococcus aureus supplementation to stimulate Toll-like receptor in the intestinal mucosa. Toll-like receptor 4, antibacterial protein expression, nuclear factor (NF)-κB DNA-binding activity, and bacteria-killing activity in the intestinal mucosa; intestinal permeability; bacterial translocation to mesenteric lymph nodes; Klebsiella pneumoniae translocation; interleukin-6 in the blood; and phagocytic activity of alveolar macrophages, were assessed. Thermal injury increased microflora and NF-κB DNA-binding activity of the intestine. Systemic antibiotic treatment decreased gut microflora and increased bacterial translocation to mesenteric lymph nodes, intestinal permeability, and interleukin-6 levels in the blood. Antibiotic treatment also decreased bacteria-killing activity in intestinal mucosa and phagocytic activity of alveolar macrophages. Oral dead E coli and S aureus supplementation induced NF-κB DNA-binding activity, Toll-like receptor 4, and antibacterial protein expression of the intestinal mucosa. Taken together with the fact that dead bacteria reversed antibiotic-induced K pneumoniae translocation and intestinal and pulmonary defense impairment, we conclude that combined antibiotic treatment results in systemic host defense impairment in burns through the decrease in intestinal flora. We suggest that dead bacteria supplementation could induce nondefensin protein expression and reverse antibiotic-induced gut and lung defense impairment in burn patients. Copyright © 2014 American College of Surgeons. Published by Elsevier Inc. All rights reserved.

  14. B1-induced caspase-independent apoptosis in MCF-7 cells is mediated by down-regulation of Bcl-2 via p53 binding to P2 promoter TATA box

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liang Xin; Xu Ke; Xu Yufang

    The Bcl-2 family contains a panel of proteins which are conserved regulators of apoptosis in mammalian cells, like the anti-apoptotic protein Bcl-2. According to its significant role in altering susceptibility to apoptosis, the deciphering of the mechanism of Bcl-2 expression modulation may be crucial for identifying therapeutics strategies for cancer. Treatment with naphthalimide-based DNA intercalators, including M2-A and R16, generally leads to a decrease in Bcl-2 intracellular amounts. Whereas the interest for these chemotherapeutics is accompanied by advances in the fundamental understanding of their anticancer properties, the molecular mechanism underlying changes in Bcl-2 expression remains poorly understood. We report heremore » that p53 contributes to Bcl-2 down-regulation induced by B1, a novel naphthalimide-based DNA intercalating agent. Indeed, the decrease in Bcl-2 protein levels observed during B1-induced apoptosis was correlated to the decrease in mRNA levels, as a result of the inhibition of Bcl-2 transcription and promoter activity. In this context, we evaluated p53 contribution in the Bcl-2 transcriptional down-regulation. We found a significant increase of p53 binding to P{sub 2} promoter TATA box in MCF7 cells by chromatin immunoprecipitation. These data suggest that B1-induced caspase-independent apoptosis in MCF-7 cells is associated with the activation of p53 and the down-regulation of Bcl-2. Our study strengthens the links between p53 and Bcl-2 at a transcriptional level, upon naphthalimide-based DNA intercalator treatment. - Research Highlights: > B1 induced apoptosis in MCF-7 cells, following a transcriptional decrease in Bcl-2. > B1 treatment triggered p53 activation and leads to a p53-dependent down-regulation of Bcl-2. > B1 induced significant increase of p53 binding to Bcl-2 P{sub 2} promoter TATA box.« less

  15. Hydrogen Sulfide Suppresses Oxidized Low-density Lipoprotein (Ox-LDL)-stimulated Monocyte Chemoattractant Protein 1 generation from Macrophages via the Nuclear Factor κB (NF-κB) Pathway*

    PubMed Central

    Du, Junbao; Huang, Yaqian; Yan, Hui; Zhang, Qiaoli; Zhao, Manman; Zhu, Mingzhu; Liu, Jia; Chen, Stella X.; Bu, Dingfang; Tang, Chaoshu; Jin, Hongfang

    2014-01-01

    This study was designed to examine the role of hydrogen sulfide (H2S) in the generation of oxidized low-density lipoprotein (ox-LDL)-stimulated monocyte chemoattractant protein 1 (MCP-1) from macrophages and possible mechanisms. THP-1 cells and RAW macrophages were pretreated with sodium hydrosulfide (NaHS) and hexyl acrylate and then treated with ox-LDL. The results showed that ox-LDL treatment down-regulated the H2S/cystathionine-β-synthase pathway, with increased MCP-1 protein and mRNA expression in both THP-1 cells and RAW macrophages. Hexyl acrylate promoted ox-LDL-induced inflammation, whereas the H2S donor NaHS inhibited it. NaHS markedly suppressed NF-κB p65 phosphorylation, nuclear translocation, DNA binding activity, and recruitment to the MCP-1 promoter in ox-LDL-treated macrophages. Furthermore, NaHS decreased the ratio of free thiol groups in p65, whereas the thiol reductant DTT reversed the inhibiting effect of H2S on the p65 DNA binding activity. Most importantly, site-specific mutation of cysteine 38 to serine in p65 abolished the effect of H2S on the sulfhydration of NF-κB and ox-LDL-induced NF-κB activation. These results suggested that endogenous H2S inhibited ox-LDL-induced macrophage inflammation by suppressing NF-κB p65 phosphorylation, nuclear translocation, DNA binding activity, and recruitment to the MCP-1 promoter. The sulfhydration of free thiol group on cysteine 38 in p65 served as a molecular mechanism by which H2S inhibited NF-κB pathway activation in ox-LDL-induced macrophage inflammation. PMID:24550391

  16. An oxidative DNA “damage” and repair mechanism localized in the VEGF promoter is important for hypoxia-induced VEGF mRNA expression

    PubMed Central

    Pastukh, Viktor; Roberts, Justin T.; Clark, David W.; Bardwell, Gina C.; Patel, Mita; Al-Mehdi, Abu-Bakr; Borchert, Glen M.

    2015-01-01

    In hypoxia, mitochondria-generated reactive oxygen species not only stimulate accumulation of the transcriptional regulator of hypoxic gene expression, hypoxia inducible factor-1 (Hif-1), but also cause oxidative base modifications in hypoxic response elements (HREs) of hypoxia-inducible genes. When the hypoxia-induced base modifications are suppressed, Hif-1 fails to associate with the HRE of the VEGF promoter, and VEGF mRNA accumulation is blunted. The mechanism linking base modifications to transcription is unknown. Here we determined whether recruitment of base excision DNA repair (BER) enzymes in response to hypoxia-induced promoter modifications was required for transcription complex assembly and VEGF mRNA expression. Using chromatin immunoprecipitation analyses in pulmonary artery endothelial cells, we found that hypoxia-mediated formation of the base oxidation product 8-oxoguanine (8-oxoG) in VEGF HREs was temporally associated with binding of Hif-1α and the BER enzymes 8-oxoguanine glycosylase 1 (Ogg1) and redox effector factor-1 (Ref-1)/apurinic/apyrimidinic endonuclease 1 (Ape1) and introduction of DNA strand breaks. Hif-1α colocalized with HRE sequences harboring Ref-1/Ape1, but not Ogg1. Inhibition of BER by small interfering RNA-mediated reduction in Ogg1 augmented hypoxia-induced 8-oxoG accumulation and attenuated Hif-1α and Ref-1/Ape1 binding to VEGF HRE sequences and blunted VEGF mRNA expression. Chromatin immunoprecipitation-sequence analysis of 8-oxoG distribution in hypoxic pulmonary artery endothelial cells showed that most of the oxidized base was localized to promoters with virtually no overlap between normoxic and hypoxic data sets. Transcription of genes whose promoters lost 8-oxoG during hypoxia was reduced, while those gaining 8-oxoG was elevated. Collectively, these findings suggest that the BER pathway links hypoxia-induced introduction of oxidative DNA modifications in promoters of hypoxia-inducible genes to transcriptional activation. PMID:26432868

  17. Herpes simplex virus DNA packaging sequences adopt novel structures that are specifically recognized by a component of the cleavage and packaging machinery.

    PubMed

    Adelman, K; Salmon, B; Baines, J D

    2001-03-13

    The product of the herpes simplex virus type 1 U(L)28 gene is essential for cleavage of concatemeric viral DNA into genome-length units and packaging of this DNA into viral procapsids. To address the role of U(L)28 in this process, purified U(L)28 protein was assayed for the ability to recognize conserved herpesvirus DNA packaging sequences. We report that DNA fragments containing the pac1 DNA packaging motif can be induced by heat treatment to adopt novel DNA conformations that migrate faster than the corresponding duplex in nondenaturing gels. Surprisingly, these novel DNA structures are high-affinity substrates for U(L)28 protein binding, whereas double-stranded DNA of identical sequence composition is not recognized by U(L)28 protein. We demonstrate that only one strand of the pac1 motif is responsible for the formation of novel DNA structures that are bound tightly and specifically by U(L)28 protein. To determine the relevance of the observed U(L)28 protein-pac1 interaction to the cleavage and packaging process, we have analyzed the binding affinity of U(L)28 protein for pac1 mutants previously shown to be deficient in cleavage and packaging in vivo. Each of the pac1 mutants exhibited a decrease in DNA binding by U(L)28 protein that correlated directly with the reported reduction in cleavage and packaging efficiency, thereby supporting a role for the U(L)28 protein-pac1 interaction in vivo. These data therefore suggest that the formation of novel DNA structures by the pac1 motif confers added specificity on recognition of DNA packaging sequences by the U(L)28-encoded component of the herpesvirus cleavage and packaging machinery.

  18. Protective Mechanisms of Nitrone Antioxidants in Kanic Acid Induced Neurodegeneration

    DTIC Science & Technology

    2004-01-01

    Hong, Dextromethorphan modulates the AP-1 DNA bind- Med. 14 (1993) 633-642. ing activity induced by kainic acid, Brain Res. 824 (1999) 125-132. [71 S.C...Hong, The effect of dextromethorphan on kainic acid-induced after kainic acid-induced seizures, Free Radical Biol. Med. 18 seizures in the rat...Bing, G., Bronstein, D., McMillian, M., Hong, J.-S. (1996) the effects of dextromethorphan on kainic acid-induced seizures in the rat. J. Neurotoxic

  19. Interaction of acute-phase-inducible and liver-enriched nuclear factors with the promoter region of the mouse alpha sub 1 -acid glycoprotein gene-1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alam, T.; Papaconstantinou, J.

    1992-02-25

    The synthesis and secretion of several acute-phase proteins increases markedly following physiological stress. {alpha}{sub 1}-Acid glycoprotein (AGP), a major acute-phase reactant made by the liver, is strongly induced by inflammatory agents such as lipopolysaccharide (LPS). Nuclear run-on assay showed a 17-fold increase in the rate of AGP transcription 4 h following LPS injection. DNase I footprinting assays revealed multiple protein binding domains in the mouse AGP-1 promoter region. Region B ({minus}104 to {minus}91) is protected by a liver-enriched transcription factor that is heat labile and in limiting quantity. An adjacent region, C ({minus}125 to {minus}104), is well-protected by nuclear extractsmore » from hepatocytes. Electrophoretic mobility shift assays indicated that only one DNA-protein complex can form with an oligonucleotide corresponding to region B. However, nuclear proteins from untreated mouse liver can form three strong complexes (C1, C2, and C3) and a weak one (C4) with oligonucleotide C. An acute-phase-inducible DNA-binding protein (AP-DBP) forms complex 4. A dramatic increase (over 11-fold) in AP-DBP binding activity is seen with nuclear proteins from LPS-stimulated animals. Interestingly, AP-DBP, a heat-stable factor, can form heterodimers with the transcription factor CCAAT/enhancer binding protein (C/EBP). Furthermore, purified C/EBP also binds avidly to region C. The studies indicate that several liver-enriched nuclear factors can interact with AGP-1 promoter and that AP-DBP binds to the AGP-1 promoter with high affinity only during the acute-phase induction.« less

  20. Assessment of amsacrine binding with DNA using UV-visible, circular dichroism and Raman spectroscopic techniques.

    PubMed

    Jangir, Deepak Kumar; Dey, Sanjay Kumar; Kundu, Suman; Mehrotra, Ranjana

    2012-09-03

    Proper understanding of the mechanism of binding of drugs to their targets in cell is a fundamental requirement to develop new drug therapy regimen. Amsacrine is a rationally designed anticancer drug, used to treat leukemia and lymphoma. Binding with cellular DNA is a crucial step in its mechanism of cytotoxicity. Despite numerous studies, DNA binding properties of amsacrine are poorly understood. Its reversible binding with DNA does not permit X-ray crystallography or NMR spectroscopic evaluation of amsacrine-DNA complexes. In the present work, interaction of amsacrine with calf thymus DNA is investigated at physiological conditions. UV-visible, FT-Raman and circular dichroism spectroscopic techniques were employed to determine the binding mode, binding constant, sequence specificity and conformational effects of amsacrine binding to native calf thymus DNA. Our results illustrate that amsacrine interacts with DNA by and large through intercalation between base pairs. Binding constant of the amsacrine-DNA complex was found to be K=1.2±0.1×10(4) M(-1) which is indicative of moderate type of binding of amsacrine to DNA. Raman spectroscopic results suggest that amsacrine has a binding preference of intercalation between AT base pairs of DNA. Minor groove binding is also observed in amsacrine-DNA complexes. These results are in good agreement with in silico investigation of amsacrine binding to DNA and thus provide detailed insight into DNA binding properties of amsacrine, which could ultimately, renders its cytotoxic efficacy. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. Amelotin gene expression is temporarily being upregulated at the initiation of apoptosis induced by TGFβ1 in mouse gingival epithelial cells.

    PubMed

    Nakayama, Yohei; Matsui, Sari; Noda, Keisuke; Yamazaki, Mizuho; Iwai, Yasunobu; Matsumura, Hiroyoshi; Izawa, Takashi; Tanaka, Eiji; Ganss, Bernhard; Ogata, Yorimasa

    2016-10-01

    Amelotin (AMTN) is expressed and secreted by ameloblasts in the maturation stage of amelogenesis and persist with low levels in the junctional epithelium (JE) of erupted teeth. The purpose of this study is to investigate the transcriptional regulation of the AMTN gene by transforming growth factor beta1 (TGFβ1) in gingival epithelial (GE1) cells in the apoptosis phase. Apoptosis was evaluated by the fragmentation of chromosomal DNA and TUNEL staining. A real-time PCR was carried out to examine the AMTN mRNA levels induced by TGFβ1 and Smad3 overexpression. Transient transfection analyses were completed using the various lengths of mouse AMTN gene promoter constructs with or without TGFβ1. Chromatin immunoprecipitation (ChIP) assays were performed to investigate the Smad3 bindings to the AMTN gene promoter by TGFβ1. TGFβ1-induced apoptosis in GE1 cells were detected at 24 and 48 h by DNA fragmentation and TUNEL staining. AMTN mRNA levels increased at 6 h and reached maximum at 24 h in GE1 cells. Luciferase activities of the mouse AMTN gene promoter constructs were induced by TGFβ1. The results of the ChIP assays showed that there was an increase in Smad3 binding to Smad-binding element (SBE)#1 and SBE#2 after stimulation by TGFβ1. Immunohistochemical localization of AMTN was detected in the JE, and the AMTN protein levels in Smad3-deficient mice were decreased compared with wild-type mice. AMTN mRNA levels were induced at the initiation of apoptosis by TGFβ1, which mediated through the Smad3 bindings to SBEs in the mouse AMTN gene promoter.

  2. Cooperative Assembly of Co-Smad4 MH1 with R-Smad1/3 MH1 on DNA: A Molecular Dynamics Simulation Study

    PubMed Central

    Wang, Guihong; Li, Chaoqun; Wang, Yan; Chen, Guangju

    2013-01-01

    Background Smads, the homologs of Sma and MAD proteins, play a key role in gene expression regulation in the transforming growth factor-β (TGF-β) signaling pathway. Recent experimental studies have revealed that Smad4/R-Smad heterodimers bound on DNA are energetically more favorable than homodimeric R-Smad/R-Smad complexes bound on DNA, which indicates that Smad4 might act as binding vehicle to cooperatively assemble with activated R-Smads on DNA in the nucleus. However, the details of interaction mechanism for cooperative recruitment of Smad4 protein to R-Smad proteins on DNA, and allosteric communication between the Smad4-DNA and R-Smad-DNA interfaces via DNA mediating are not yet clear so far. Methodology In the present work, we have constructed a series of Smadn+DNA+Smadn (n = 1, 3, 4) models and carried out molecular dynamics simulations, free energy calculations and DNA dynamics analysis for them to study the interaction properties of Smadn (n = 1, 3, 4) with DNA molecule. Results The results revealed that the binding of Smad4 protein to DNA molecule facilitates energetically the formation of the heteromeric Smad4+DNA+Smad1/3 complex by increasing the affinity of Smad1/3 with DNA molecule. Further investigations through the residue/base motion correlation and DNA dynamics analyses predicted that the binding of Smad4 protein to DNA molecule in the heteromeric Smad4+DNA+Smad1/3 model induces an allosteric communication from the Smad4-DNA interface to Smad1/Smad3-DNA interface via DNA base-pair helical motions, surface conformation changes and new hydrogen bond formations. The present work theoretically explains the mechanism of cooperative recruitment of Smad4 protein to Smad1/3 protein via DNA-mediated indirect readout mode in the nucleus. PMID:23326519

  3. Structural integration in hypoxia-inducible factors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu, Dalei; Potluri, Nalini; Lu, Jingping

    The hypoxia-inducible factors (HIFs) coordinate cellular adaptations to low oxygen stress by regulating transcriptional programs in erythropoiesis, angiogenesis and metabolism. These programs promote the growth and progression of many tumours, making HIFs attractive anticancer targets. Transcriptionally active HIFs consist of HIF-alpha and ARNT (also called HIF-1 beta) subunits. Here we describe crystal structures for each of mouse HIF-2 alpha-ARNT and HIF-1 alpha-ARNT heterodimers in states that include bound small molecules and their hypoxia response element. A highly integrated quaternary architecture is shared by HIF-2 alpha-ARNT and HIF-1 alpha-ARNT, wherein ARNT spirals around the outside of each HIF-alpha subunit. Five distinctmore » pockets are observed that permit small-molecule binding, including PAS domain encapsulated sites and an interfacial cavity formed through subunit heterodimerization. The DNA-reading head rotates, extends and cooperates with a distal PAS domain to bind hypoxia response elements. HIF-alpha mutations linked to human cancers map to sensitive sites that establish DNA binding and the stability of PAS domains and pockets.« less

  4. Probing the dynamics of restriction endonuclease NgoMIV-DNA interaction by single-molecule FRET.

    PubMed

    Tutkus, Marijonas; Sasnauskas, Giedrius; Rutkauskas, Danielis

    2017-12-01

    Many type II restriction endonucleases require two copies of their recognition sequence for optimal activity. Concomitant binding of two DNA sites by such an enzyme produces a DNA loop. Here we exploit single-molecule Förster resonance energy transfer (smFRET) of surface-immobilized DNA fragments to study the dynamics of DNA looping induced by tetrameric endonuclease NgoMIV. We have employed a DNA fragment with two NgoMIV recognition sites and a FRET dye pair such that upon protein-induced DNA looping the dyes are brought to close proximity resulting in a FRET signal. The dynamics of DNA-NgoMIV interactions proved to be heterogeneous, with individual smFRET trajectories exhibiting broadly different average looped state durations. Distinct types of the dynamics were attributed to different types of DNA-protein complexes, mediated either by one NgoMIV tetramer simultaneously bound to two specific sites ("slow" trajectories) or by semi-specific interactions of two DNA-bound NgoMIV tetramers ("fast" trajectories), as well as to conformational heterogeneity of individual NgoMIV molecules. © 2017 Wiley Periodicals, Inc.

  5. Single-stranded DNA Binding by the Helix-Hairpin-Helix Domain of XPF Protein Contributes to the Substrate Specificity of the ERCC1-XPF Protein Complex*

    PubMed Central

    Das, Devashish; Faridounnia, Maryam; Kovacic, Lidija; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.

    2017-01-01

    The nucleotide excision repair protein complex ERCC1-XPF is required for incision of DNA upstream of DNA damage. Functional studies have provided insights into the binding of ERCC1-XPF to various DNA substrates. However, because no structure for the ERCC1-XPF-DNA complex has been determined, the mechanism of substrate recognition remains elusive. Here we biochemically characterize the substrate preferences of the helix-hairpin-helix (HhH) domains of XPF and ERCC-XPF and show that the binding to single-stranded DNA (ssDNA)/dsDNA junctions is dependent on joint binding to the DNA binding domain of ERCC1 and XPF. We reveal that the homodimeric XPF is able to bind various ssDNA sequences but with a clear preference for guanine-containing substrates. NMR titration experiments and in vitro DNA binding assays also show that, within the heterodimeric ERCC1-XPF complex, XPF specifically recognizes ssDNA. On the other hand, the HhH domain of ERCC1 preferentially binds dsDNA through the hairpin region. The two separate non-overlapping DNA binding domains in the ERCC1-XPF heterodimer jointly bind to an ssDNA/dsDNA substrate and, thereby, at least partially dictate the incision position during damage removal. Based on structural models, NMR titrations, DNA-binding studies, site-directed mutagenesis, charge distribution, and sequence conservation, we propose that the HhH domain of ERCC1 binds to dsDNA upstream of the damage, and XPF binds to the non-damaged strand within a repair bubble. PMID:28028171

  6. Deletion of transcription factor binding motifs using the CRISPR/spCas9 system in the β-globin LCR.

    PubMed

    Kim, Yea Woon; Kim, AeRi

    2017-07-20

    Transcription factors play roles in gene transcription through direct binding to their motifs in genome, and inhibiting this binding provides an effective strategy for studying their roles. Here we applied the CRISPR/spCas9 system to mutate the binding motifs of transcription factors. Binding motifs for erythroid specific transcription factors were mutated in the locus control region hypersensitive sites of the human β-globin locus. Guide RNAs targeting binding motifs were cloned into lentiviral CRISPR vector containing the spCas9 gene, and transduced into MEL/ch11 cells carrying a human chromosome 11. DNA mutations in clonal cells were initially screened by quantitative PCR in genomic DNA and then clarified by sequencing. Mutations in binding motifs reduced occupancy by transcription factors in a chromatin environment. Characterization of mutations revealed that the CRISPR/spCas9 system mainly induced deletions in short regions of <20 bp and preferentially deleted nucleotides around the fifth nucleotide upstream of Protospacer adjacent motifs. These results indicate that the CRISPR/Cas9 system is suitable for mutating the binding motifs of transcription factors, and, consequently, would contribute to elucidate the direct roles of transcription factors. ©2017 The Author(s).

  7. Role of UME6 in transcriptional regulation of a DNA repair gene in Saccharomyces cerevisiae.

    PubMed

    Sweet, D H; Jang, Y K; Sancar, G B

    1997-11-01

    In Saccharomyces cerevisiae UV radiation and a variety of chemical DNA-damaging agents induce the transcription of specific genes, including several involved in DNA repair. One of the best characterized of these genes is PHR1, which encodes the apoenzyme for DNA photolyase. Basal-level and damage-induced expression of PHR1 require an upstream activation sequence, UAS(PHR1), which has homology with DRC elements found upstream of at least 19 other DNA repair and DNA metabolism genes in yeast. Here we report the identification of the UME6 gene of S. cerevisiae as a regulator of UAS(PHR1) activity. Multiple copies of UME6 stimulate expression from UAS(PHR1) and the intact PHR1 gene. Surprisingly, the effect of deletion of UME6 is growth phase dependent. In wild-type cells PHR1 is induced in late exponential phase, concomitant with the initiation of glycogen accumulation that precedes the diauxic shift. Deletion of UME6 abolishes this induction, decreases the steady-state concentration of photolyase molecules and PHR1 mRNA, and increases the UV sensitivity of a rad2 mutant. Despite the fact that UAS(PHR1) does not contain the URS1 sequence, which has been previously implicated in UME6-mediated transcriptional regulation, we find that Ume6p binds to UAS(PHR1) with an affinity and a specificity similar to those seen for a URS1 site. Similar binding is also seen for DRC elements from RAD2, RAD7, and RAD53, suggesting that UME6 contributes to the regulated expression of a subset of damage-responsive genes in yeast.

  8. A programmable DNA origami nanospring that reveals force-induced adjacent binding of myosin VI heads

    PubMed Central

    Iwaki, M.; Wickham, S. F.; Ikezaki, K.; Yanagida, T.; Shih, W. M.

    2016-01-01

    Mechanosensitive biological nanomachines such as motor proteins and ion channels regulate diverse cellular behaviour. Combined optical trapping with single-molecule fluorescence imaging provides a powerful methodology to clearly characterize the mechanoresponse, structural dynamics and stability of such nanomachines. However, this system requires complicated experimental geometry, preparation and optics, and is limited by low data-acquisition efficiency. Here we develop a programmable DNA origami nanospring that overcomes these issues. We apply our nanospring to human myosin VI, a mechanosensory motor protein, and demonstrate nanometre-precision single-molecule fluorescence imaging of the individual motor domains (heads) under force. We observe force-induced transitions of myosin VI heads from non-adjacent to adjacent binding, which correspond to adapted roles for low-load and high-load transport, respectively. Our technique extends single-molecule studies under force and clarifies the effect of force on biological processes. PMID:27941751

  9. A programmable DNA origami nanospring that reveals force-induced adjacent binding of myosin VI heads.

    PubMed

    Iwaki, M; Wickham, S F; Ikezaki, K; Yanagida, T; Shih, W M

    2016-12-12

    Mechanosensitive biological nanomachines such as motor proteins and ion channels regulate diverse cellular behaviour. Combined optical trapping with single-molecule fluorescence imaging provides a powerful methodology to clearly characterize the mechanoresponse, structural dynamics and stability of such nanomachines. However, this system requires complicated experimental geometry, preparation and optics, and is limited by low data-acquisition efficiency. Here we develop a programmable DNA origami nanospring that overcomes these issues. We apply our nanospring to human myosin VI, a mechanosensory motor protein, and demonstrate nanometre-precision single-molecule fluorescence imaging of the individual motor domains (heads) under force. We observe force-induced transitions of myosin VI heads from non-adjacent to adjacent binding, which correspond to adapted roles for low-load and high-load transport, respectively. Our technique extends single-molecule studies under force and clarifies the effect of force on biological processes.

  10. Structural, conformational and thermodynamic aspects of groove-directed-intercalation of flavopiridol into DNA.

    PubMed

    Ray, Bhumika; Agarwal, Shweta; Lohani, Neelam; Rajeswari, Moganty R; Mehrotra, Ranjana

    2016-11-01

    Certain plant-derived alkaloids and flavonoids have shown propitious cytotoxic acitvity against different types of cancer, having deoxyribose nucleic acid (DNA) as their main cellular target. Flavopiridol, a semi-synthetic derivative of rohitukine (a natural compound isolated from Dysoxylum binectariferum plant), has attained much attention owing to its anticancer potential against various haematological malignancies and solid tumours. This work focuses on investigating interaction between flavopiridol and DNA at molecular level in order to decipher its underlying mechanism of action, which is not well understood. To define direct influence of flavopiridol on the structural, conformational and thermodynamic aspects of DNA, various spectroscopic and calorimetric techniques have been used. ATR-FTIR and SERS spectral outcomes indicate a novel insight into groove-directed-intercalation of flavopiridol into DNA via direct binding with nitrogenous bases guanine (C6=O6) and thymine (C2=O2) in DNA groove together with slight external binding to its sugar-phosphate backbone. Circular dichroism spectral analysis of flavopiridol-DNA complexes suggests perturbation in native B-conformation of DNA and its transition into C-form, which may be localized up to a few base pairs of DNA. UV-visible spectroscopic results illustrate dual binding mode of flavopiridol when interacts with DNA having association constant, Ka = 1.18 × 10(4) M(-1). This suggests moderate type of interaction between flavopiridol and DNA. Further, UV melting analysis also supports spectroscopic outcomes. Thermodynamically, flavopiridol-DNA complexation is an enthalpy-driven exothermic process. These conclusions drawn from this study could be helpful in unveiling mechanism of cytoxicity induced by flavopiridol that can be further applied in the development of flavonoid-based new chemotherapeutics with more specificity and better efficacy.

  11. Structure and Function of Lipopolysaccharide Binding Protein

    NASA Astrophysics Data System (ADS)

    Schumann, Ralf R.; Leong, Steven R.; Flaggs, Gail W.; Gray, Patrick W.; Wright, Samuel D.; Mathison, John C.; Tobias, Peter S.; Ulevitch, Richard J.

    1990-09-01

    The primary structure of lipopolysaccharide binding protein (LBP), a trace plasma protein that binds to the lipid A moiety of bacterial lipopolysaccharides (LPSs), was deduced by sequencing cloned complementary DNA. LBP shares sequence identity with another LPS binding protein found in granulocytes, bactericidal/permeability-increasing protein, and with cholesterol ester transport protein of the plasma. LBP may control the response to LPS under physiologic conditions by forming high-affinity complexes with LPS that bind to monocytes and macrophages, which then secrete tumor necrosis factor. The identification of this pathway for LPS-induced monocyte stimulation may aid in the development of treatments for diseases in which Gram-negative sepsis or endotoxemia are involved.

  12. Chemo-mechanical pushing of proteins along single-stranded DNA.

    PubMed

    Sokoloski, Joshua E; Kozlov, Alexander G; Galletto, Roberto; Lohman, Timothy M

    2016-05-31

    Single-stranded (ss)DNA binding (SSB) proteins bind with high affinity to ssDNA generated during DNA replication, recombination, and repair; however, these SSBs must eventually be displaced from or reorganized along the ssDNA. One potential mechanism for reorganization is for an ssDNA translocase (ATP-dependent motor) to push the SSB along ssDNA. Here we use single molecule total internal reflection fluorescence microscopy to detect such pushing events. When Cy5-labeled Escherichia coli (Ec) SSB is bound to surface-immobilized 3'-Cy3-labeled ssDNA, a fluctuating FRET signal is observed, consistent with random diffusion of SSB along the ssDNA. Addition of Saccharomyces cerevisiae Pif1, a 5' to 3' ssDNA translocase, results in the appearance of isolated, irregularly spaced saw-tooth FRET spikes only in the presence of ATP. These FRET spikes result from translocase-induced directional (5' to 3') pushing of the SSB toward the 3' ssDNA end, followed by displacement of the SSB from the DNA end. Similar ATP-dependent pushing events, but in the opposite (3' to 5') direction, are observed with EcRep and EcUvrD (both 3' to 5' ssDNA translocases). Simulations indicate that these events reflect active pushing by the translocase. The ability of translocases to chemo-mechanically push heterologous SSB proteins along ssDNA provides a potential mechanism for reorganization and clearance of tightly bound SSBs from ssDNA.

  13. Acute and Chronic Electroconvulsive Seizures (ECS) Differentially Regulate the Expression of Epigenetic Machinery in the Adult Rat Hippocampus.

    PubMed

    Pusalkar, Madhavi; Ghosh, Shreya; Jaggar, Minal; Husain, Basma Fatima Anwar; Galande, Sanjeev; Vaidya, Vidita A

    2016-09-01

    Electroconvulsive seizure treatment is a fast-acting antidepressant therapy that evokes rapid transcriptional, neurogenic, and behavioral changes. Epigenetic mechanisms contribute to altered gene regulation, which underlies the neurogenic and behavioral effects of electroconvulsive seizure. We hypothesized that electroconvulsive seizure may modulate the expression of epigenetic machinery, thus establishing potential alterations in the epigenetic landscape. We examined the influence of acute and chronic electroconvulsive seizure on the gene expression of histone modifiers, namely histone acetyltransferases, histone deacetylases, histone methyltransferases, and histone (lysine) demethylases as well as DNA modifying enzymes, including DNA methyltransferases, DNA demethylases, and methyl-CpG-binding proteins in the hippocampi of adult male Wistar rats using quantitative real time-PCR analysis. Further, we examined the influence of acute and chronic electroconvulsive seizure on global and residue-specific histone acetylation and methylation levels within the hippocampus, a brain region implicated in the cellular and behavioral effects of electroconvulsive seizure. Acute and chronic electroconvulsive seizure induced a primarily unique, and in certain cases bidirectional, regulation of histone and DNA modifiers, and methyl-CpG-binding proteins, with an overlapping pattern of gene regulation restricted to Sirt4, Mll3, Jmjd3, Gadd45b, Tet2, and Tet3. Global histone acetylation and methylation levels were predominantly unchanged, with the exception of a significant decline in H3K9 acetylation in the hippocampus following chronic electroconvulsive seizure. Electroconvulsive seizure treatment evokes the transcriptional regulation of several histone and DNA modifiers, and methyl-CpG-binding proteins within the hippocampus, with a predominantly distinct pattern of regulation induced by acute and chronic electroconvulsive seizure. © The Author 2016. Published by Oxford University Press on behalf of CINP.

  14. Acute and Chronic Electroconvulsive Seizures (ECS) Differentially Regulate the Expression of Epigenetic Machinery in the Adult Rat Hippocampus

    PubMed Central

    Pusalkar, Madhavi; Ghosh, Shreya; Jaggar, Minal; Husain, Basma Fatima Anwar; Galande, Sanjeev

    2016-01-01

    Background: Electroconvulsive seizure treatment is a fast-acting antidepressant therapy that evokes rapid transcriptional, neurogenic, and behavioral changes. Epigenetic mechanisms contribute to altered gene regulation, which underlies the neurogenic and behavioral effects of electroconvulsive seizure. We hypothesized that electroconvulsive seizure may modulate the expression of epigenetic machinery, thus establishing potential alterations in the epigenetic landscape. Methods: We examined the influence of acute and chronic electroconvulsive seizure on the gene expression of histone modifiers, namely histone acetyltransferases, histone deacetylases, histone methyltransferases, and histone (lysine) demethylases as well as DNA modifying enzymes, including DNA methyltransferases, DNA demethylases, and methyl-CpG-binding proteins in the hippocampi of adult male Wistar rats using quantitative real time-PCR analysis. Further, we examined the influence of acute and chronic electroconvulsive seizure on global and residue-specific histone acetylation and methylation levels within the hippocampus, a brain region implicated in the cellular and behavioral effects of electroconvulsive seizure. Results: Acute and chronic electroconvulsive seizure induced a primarily unique, and in certain cases bidirectional, regulation of histone and DNA modifiers, and methyl-CpG-binding proteins, with an overlapping pattern of gene regulation restricted to Sirt4, Mll3, Jmjd3, Gadd45b, Tet2, and Tet3. Global histone acetylation and methylation levels were predominantly unchanged, with the exception of a significant decline in H3K9 acetylation in the hippocampus following chronic electroconvulsive seizure. Conclusions: Electroconvulsive seizure treatment evokes the transcriptional regulation of several histone and DNA modifiers, and methyl-CpG-binding proteins within the hippocampus, with a predominantly distinct pattern of regulation induced by acute and chronic electroconvulsive seizure. PMID:27207907

  15. Ku must load directly onto the chromosome end in order to mediate its telomeric functions.

    PubMed

    Lopez, Christopher R; Ribes-Zamora, Albert; Indiviglio, Sandra M; Williams, Christopher L; Haricharan, Svasti; Bertuch, Alison A

    2011-08-01

    The Ku heterodimer associates with the Saccharomyces cerevisiae telomere, where it impacts several aspects of telomere structure and function. Although Ku avidly binds DNA ends via a preformed channel, its ability to associate with telomeres via this mechanism could be challenged by factors known to bind directly to the chromosome terminus. This has led to uncertainty as to whether Ku itself binds directly to telomeric ends and whether end association is crucial for Ku's telomeric functions. To address these questions, we constructed DNA end binding-defective Ku heterodimers by altering amino acid residues in Ku70 and Ku80 that were predicted to contact DNA. These mutants continued to associate with their known telomere-related partners, such as Sir4, a factor required for telomeric silencing, and TLC1, the RNA component of telomerase. Despite these interactions, we found that the Ku mutants had markedly reduced association with telomeric chromatin and null-like deficiencies for telomere end protection, length regulation, and silencing functions. In contrast to Ku null strains, the DNA end binding defective Ku mutants resulted in increased, rather than markedly decreased, imprecise end-joining proficiency at an induced double-strand break. This result further supports that it was the specific loss of Ku's telomere end binding that resulted in telomeric defects rather than global loss of Ku's functions. The extensive telomere defects observed in these mutants lead us to propose that Ku is an integral component of the terminal telomeric cap, where it promotes a specific architecture that is central to telomere function and maintenance.

  16. Recognition and Binding of Human Telomeric G-Quadruplex DNA by Unfolding Protein 1

    PubMed Central

    2015-01-01

    The specific recognition by proteins of G-quadruplex structures provides evidence of a functional role for in vivo G-quadruplex structures. As previously reported, the ribonucleoprotein, hnRNP Al, and it is proteolytic derivative, unwinding protein 1 (UP1), bind to and destabilize G-quadruplex structures formed by the human telomeric repeat d(TTAGGG)n. UP1 has been proposed to be involved in the recruitment of telomerase to telomeres for chain extension. In this study, a detailed thermodynamic characterization of the binding of UP1 to a human telomeric repeat sequence, the d[AGGG(TTAGGG)3] G-quadruplex, is presented and reveals key insights into the UP1-induced unfolding of the G-quadruplex structure. The UP1–G-quadruplex interactions are shown to be enthalpically driven, exhibiting large negative enthalpy changes for the formation of both the Na+ and K+ G-quadruplex–UP1 complexes (ΔH values of −43 and −19 kcal/mol, respectively). These data reveal three distinct enthalpic contributions from the interactions of UP1 with the Na+ form of G-quadruplex DNA. The initial interaction is characterized by a binding affinity of 8.5 × 108 M–1 (strand), 200 times stronger than the binding of UP1 to a single-stranded DNA with a comparable but non-quadruplex-forming sequence [4.1 × 106 M–1 (strand)]. Circular dichroism spectroscopy reveals the Na+ form of the G-quadruplex to be completely unfolded by UP1 at a binding ratio of 2:1 (UP1:G-quadruplex DNA). The data presented here demonstrate that the favorable energetics of the initial binding event are closely coupled with and drive the unfolding of the G-quadruplex structure. PMID:24831962

  17. A novel variant of DNA polymerase ζ, Rev3ΔC, highlights differential regulation of Pol32 as a subunit of polymerase δ versus ζ in Saccharomyces cerevisiae

    PubMed Central

    Siebler, Hollie M.; Lada, Artem G.; Baranovskiy, Andrey G.; Tahirov, Tahir H.; Pavlov, Youri I.

    2014-01-01

    Unrepaired DNA lesions often stall replicative DNA polymerases and are bypassed by translesion synthesis (TLS) to prevent replication fork collapse. Mechanisms of TLS are lesion- and species-specific, with a prominent role of specialized DNA polymerases with relaxed active sites. After nucleotide(s) are incorporated across from the altered base(s), the aberrant primer termini are typically extended by DNA polymerase ζ (pol ζ). As a result, pol ζ is responsible for most DNA damage-induced mutations. The mechanisms of sequential DNA polymerase switches in vivo remain unclear. The major replicative DNA polymerase δ (pol δ) shares two accessory subunits, called Pol31/Pol32 in yeast, with pol ζ. Inclusion of Pol31/Pol32 in the pol δ/pol ζ holoenzymes requires a [4Fe–4S] cluster in C-termini of the catalytic subunits. Disruption of this cluster in Pol ζ or deletion of POL32 attenuates induced mutagenesis. Here we describe a novel mutation affecting the catalytic subunit of pol ζ, rev3ΔC, which provides insight into the regulation of pol switches. Strains with Rev3ΔC, lacking the entire C-terminal domain and therefore the platform for Pol31/Pol32 binding, are partially proficient in Pol32-dependent UV-induced mutagenesis. This suggests an additional role of Pol32 in TLS, beyond being a pol ζ subunit, related to pol δ. In search for members of this regulatory pathway, we examined the effects of Maintenance of Genome Stability 1 (Mgs1) protein on mutagenesis in the absence of Rev3–Pol31/Pol32 interaction. Mgs1 may compete with Pol32 for binding to PCNA. Mgs1 overproduction suppresses induced mutagenesis, but had no effect on UV-mutagenesis in the rev3ΔC strain, suggesting that Mgs1 exerts its inhibitory effect by acting specifically on Pol32 bound to pol ζ. The evidence for differential regulation of Pol32 in pol δ and pol ζ emphasizes the complexity of polymerase switches. PMID:24819597

  18. Peptide-matrix-mediated gene transfer of an oxygen-insensitive hypoxia-inducible factor-1alpha variant for local induction of angiogenesis.

    PubMed

    Trentin, Diana; Hall, Heike; Wechsler, Sandra; Hubbell, Jeffrey A

    2006-02-21

    Hypoxia-inducible factor (HIF) constitutes a target in therapeutic angiogenesis. HIF-1alpha functions as a sensor of hypoxia and induces expression of vascular endothelial growth factor (VEGF), which then induces angiogenesis. To explore the potential of HIF-1alpha gene therapy in stimulating wound healing, we delivered a gene encoding a stabilized form of HIF-1alpha, lacking the oxygen-sensitive degradation domain, namely HIF-1alpha deltaODD, by using a previously characterized peptide-based gene delivery vector in fibrin as a surgical matrix. The peptide vector consisted of multiple domains: (i) A cysteine-flanked lysine hexamer provided DNA interactions that were stable extracellularly but destabilized intracellularly after reduction of the formed disulfide bonds. This DNA-binding domain was fused to either (ii) a fibrin-binding peptide for entrapment within the matrix or (iii) a nuclear localization sequence for efficient nuclear targeting. The HIF-1alpha deltaODD gene was expressed and translocated to the nucleus under normoxic conditions, leading to up-regulation of vascular endothelial growth factor (VEGF)-A165 mRNA and protein levels in vitro. When the peptide-DNA nanoparticles entrapped in fibrin matrices were applied to full-thickness dermal wounds in the mouse (10 microg per wound in 30 microl of fibrin), angiogenesis was increased comparably strongly to that induced by VEGF-A165 protein (1.25 microg per wound in 30 microl of fibrin). However, the maturity of the vessels induced by HIF-1alpha deltaODD was significantly higher than that induced by VEGF-A165 protein, as shown by stabilization of the neovessels with smooth muscle. Nonviral, local administration of this potent angiogenesis-inducing gene by using this peptide vector represents a powerful approach in tissue engineering and therapeutic angiogenesis.

  19. Crystal Structure of the Chromodomain Helicase DNA-binding Protein 1 (Chd1) DNA-binding Domain in Complex with DNA*

    PubMed Central

    Sharma, Amit; Jenkins, Katherine R.; Héroux, Annie; Bowman, Gregory D.

    2011-01-01

    Chromatin remodelers are ATP-dependent machines that dynamically alter the chromatin packaging of eukaryotic genomes by assembling, sliding, and displacing nucleosomes. The Chd1 chromatin remodeler possesses a C-terminal DNA-binding domain that is required for efficient nucleosome sliding and believed to be essential for sensing the length of DNA flanking the nucleosome core. The structure of the Chd1 DNA-binding domain was recently shown to consist of a SANT and SLIDE domain, analogous to the DNA-binding domain of the ISWI family, yet the details of how Chd1 recognized DNA were not known. Here we present the crystal structure of the Saccharomyces cerevisiae Chd1 DNA-binding domain in complex with a DNA duplex. The bound DNA duplex is straight, consistent with the preference exhibited by the Chd1 DNA-binding domain for extranucleosomal DNA. Comparison of this structure with the recently solved ISW1a DNA-binding domain bound to DNA reveals that DNA lays across each protein at a distinct angle, yet contacts similar surfaces on the SANT and SLIDE domains. In contrast to the minor groove binding seen for Isw1 and predicted for Chd1, the SLIDE domain of the Chd1 DNA-binding domain contacts the DNA major groove. The majority of direct contacts with the phosphate backbone occur only on one DNA strand, suggesting that Chd1 may not strongly discriminate between major and minor grooves. PMID:22033927

  20. Design, synthesis, molecular modeling and anti-proliferative evaluation of novel quinoxaline derivatives as potential DNA intercalators and topoisomerase II inhibitors.

    PubMed

    Ibrahim, M K; Taghour, M S; Metwaly, A M; Belal, A; Mehany, A B M; Elhendawy, M A; Radwan, M M; Yassin, A M; El-Deeb, N M; Hafez, E E; ElSohly, M A; Eissa, I H

    2018-06-04

    New series of [1,2,4]triazolo [4,3-a]quinoxaline and bis([1,2,4]triazolo)[4,3-a:3',4'-c]quinoxaline derivatives have been designed, synthesized and biologically evaluated for their cytotoxic activities against three tumor cell lines (HePG-2, Hep-2 and Caco-2). Compounds 16 e , 21, 25 a and 25 b exhibited the highest activities against the examined cell lines with IC 50 values ranging from 0.29 to 0.90 μM comparable to that of doxorubicin (IC 50 ranging from 0.51 to 0.73 μM). The most active members were further evaluated for their topoisomerase II (Topo II) inhibitory activities and DNA intercalating affinities as potential mechanisms for their anti-proliferative activities. Interestingly, the results of Topo II inhibition and DNA binding assays were consistent with that of the cytotoxicity data, where the most potent anti-proliferative derivatives exhibited good Topo II inhibitory activities and DNA binding affinities, comparable to that of doxorubicin. Moreover, the most active compound 25 a caused cell cycle arrest at G2/M phase and induced apoptosis in Caco-2 cells. In addition, Furthermore, molecular docking studies were performed for the novel compounds against DNA-Topo II complex to investigate their binding patterns. Based on these studies, it was concluded that DNA binding and/or Topo II inhibition may contribute to the observed cytotoxicity of the synthesized compounds. Copyright © 2018. Published by Elsevier Masson SAS.

  1. Atomic Simulation of Complex DNA DSBs and the Interactions with the Ku70/80 Heterodimer

    NASA Technical Reports Server (NTRS)

    Hu, Shaowen; Cucinotta, Francis A.

    2011-01-01

    DNA double strand breaks (DSBs) induced by ionizing radiation (IR) usually contain modified bases such as 8-oxo-7,8-dihydroguanine (8-oxoG) and thymine glycol, apurinic/apyrimidinic (AP) sites, 2-deoxyribonolactone, or single-strand breaks (SSBs). The presence of such lesions in close proximity to the DSB terminus makes the DNA nicks more difficult to repair and rejoin than endogenously induced simple DSBs, and as such a major determinant of the biological effects of high linear energy transfer (LET) radiation as encountered in space travel. In this study we conducted molecular dynamics simulations on a series of DNA duplexes with various complex lesions of 8-oxoG and AP sites, in an effort to investigate the effects of such lesions to the structural integrity and stability of DNA after insulted by IR. We also simulated the interaction of such complex DSBs with the Ku70/80 heterodimer, the first protein in mammalian cells to embark the non-homologous end joining (NHEJ) DNA repair pathway. The results indicate, compared to DNA with simple DSBs, the complex lesions can enhance the hydrogen bonds opening rate at the DNA terminus, and increase the mobility of the whole duplex, thus they present more deleterious effects to the genome integrity if not captured and repaired promptly in cells. Simulations also demonstrate the binding of Ku drastically reduces structural disruption and flexibility caused by the complex lesions, and the interactions of Ku with complex DSBs have a different potential energy landscape from the bound structure with simple DSB. In all complex DSBs systems, the binding of DSB terminus with Ku70 is softened while the binding of the middle duplex with Ku80 is tightened. This energy shift may help the Ku protein to secure at the DSB terminus for a longer time, so that other end processing factors or repair pathways can proceed at the lesions before NHEJ repair process starts. These atomic simulations may provide valuable new insight into the selective action of repair proteins on damaged DNA.

  2. Characterization of the DNA binding properties of polyomavirus capsid protein

    NASA Technical Reports Server (NTRS)

    Chang, D.; Cai, X.; Consigli, R. A.; Spooner, B. S. (Principal Investigator)

    1993-01-01

    The DNA binding properties of the polyomavirus structural proteins VP1, VP2, and VP3 were studied by Southwestern analysis. The major viral structural protein VP1 and host-contributed histone proteins of polyomavirus virions were shown to exhibit DNA binding activity, but the minor capsid proteins VP2 and VP3 failed to bind DNA. The N-terminal first five amino acids (Ala-1 to Lys-5) were identified as the VP1 DNA binding domain by genetic and biochemical approaches. Wild-type VP1 expressed in Escherichia coli (RK1448) exhibited DNA binding activity, but the N-terminal truncated VP1 mutants (lacking Ala-1 to Lys-5 and Ala-1 to Cys-11) failed to bind DNA. The synthetic peptide (Ala-1 to Cys-11) was also shown to have an affinity for DNA binding. Site-directed mutagenesis of the VP1 gene showed that the point mutations at Pro-2, Lys-3, and Arg-4 on the VP1 molecule did not affect DNA binding properties but that the point mutation at Lys-5 drastically reduced DNA binding affinity. The N-terminal (Ala-1 to Lys-5) region of VP1 was found to be essential and specific for DNA binding, while the DNA appears to be non-sequence specific. The DNA binding domain and the nuclear localization signal are located in the same N-terminal region.

  3. LINE-1 ORF1 protein localizes in stress granules with other RNA-binding proteins, including components of RNA interference RNA-induced silencing complex.

    PubMed

    Goodier, John L; Zhang, Lili; Vetter, Melissa R; Kazazian, Haig H

    2007-09-01

    LINE-1 retrotransposons constitute one-fifth of human DNA and have helped shape our genome. A full-length L1 encodes a 40-kDa RNA-binding protein (ORF1p) and a 150-kDa protein (ORF2p) with endonuclease and reverse transcriptase activities. ORF1p is distinctive in forming large cytoplasmic foci, which we identified as cytoplasmic stress granules. A phylogenetically conserved central region of the protein is critical for wild-type localization and retrotransposition. Yeast two-hybrid screens revealed several RNA-binding proteins that coimmunoprecipitate with ORF1p and colocalize with ORF1p in foci. Two of these proteins, YB-1 and hnRNPA1, were previously reported in stress granules. We identified additional proteins associated with stress granules, including DNA-binding protein A, 9G8, and plasminogen activator inhibitor RNA-binding protein 1 (PAI-RBP1). PAI-RBP1 is a homolog of VIG, a part of the Drosophila melanogaster RNA-induced silencing complex (RISC). Other RISC components, including Ago2 and FMRP, also colocalize with PAI-RBP1 and ORF1p. We suggest that targeting ORF1p, and possibly the L1 RNP, to stress granules is a mechanism for controlling retrotransposition and its associated genetic and cellular damage.

  4. Investigation of the interaction between berberine and nucleosomes in solution: Spectroscopic and equilibrium dialysis approach

    NASA Astrophysics Data System (ADS)

    Rabbani-Chadegani, Azra; Mollaei, Hossein; Sargolzaei, Javad

    2017-02-01

    Berberine is a natural plant alkaloid with high pharmacological potential. Although its interaction with free DNA has been the subject of several reports, to date there is no work concerning the effect of berberine on nucleoprotein structure of DNA, the nucleosomes. The present study focuses on the binding affinity of berberine to nucleosomes and histone H1 employing various spectroscopic techniques, fluorescence, circular dichroism, thermal denaturation as well as equilibrium dialysis. The results showed that the binding of berberine to nucleosomes is positive cooperative with Ka = 5.57 × 103 M- 1. Berberine quenched with the chromophores of protein moiety of nucleosomes and reduced fluorescence emission intensity at 335 nm with Ksv value of 0.135. Binding of berberine to nucleosomes decreased the absorbance at 210 and 260 nm, produced hypochromicity in thermal denaturation profiles and its affinity to nucleoprotein structure of nucleosomes was much higher than to free DNA. Berberine also exhibited high affinity to histone H1 in solution and the binding was positive cooperative with. Ka = 3.61 × 103 M- 1. Moreover berberine decreased fluorescence emission intensity of H1 by quenching with tyrosine residue in its globular core domain. The circular dichroism profiles demonstrated that the binding of drug induced secondary structural changes in both DNA stacking and histone H1. It is concluded that berberine is genotoxic drug, interacts with nucleosomes and in this process histone H1 is involved to exert its anticancer activity.

  5. RPA Stabilization of Single-Stranded DNA Is Critical for Break-Induced Replication.

    PubMed

    Ruff, Patrick; Donnianni, Roberto A; Glancy, Eleanor; Oh, Julyun; Symington, Lorraine S

    2016-12-20

    DNA double-strand breaks (DSBs) are cytotoxic lesions that must be accurately repaired to maintain genome stability. Replication protein A (RPA) plays an important role in homology-dependent repair of DSBs by protecting the single-stranded DNA (ssDNA) intermediates formed by end resection and by facilitating Rad51 loading. We found that hypomorphic mutants of RFA1 that support intra-chromosomal homologous recombination are profoundly defective for repair processes involving long tracts of DNA synthesis, in particular break-induced replication (BIR). The BIR defects of the rfa1 mutants could be partially suppressed by eliminating the Sgs1-Dna2 resection pathway, suggesting that Dna2 nuclease attacks the ssDNA formed during end resection when not fully protected by RPA. Overexpression of Rad51 was also found to suppress the rfa1 BIR defects. We suggest that Rad51 binding to the ssDNA formed by excessive end resection and during D-loop migration can partially compensate for dysfunctional RPA. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  6. The ATPase domain of the large terminase protein, gp17, from bacteriophage T4 binds DNA: implications to the DNA packaging mechanism.

    PubMed

    Alam, Tanfis I; Rao, Venigalla B

    2008-03-07

    Translocation of double-stranded DNA into a preformed capsid by tailed bacteriophages is driven by powerful motors assembled at the special portal vertex. The motor is thought to drive processive cycles of DNA binding, movement, and release to package the viral genome. In phage T4, there is evidence that the large terminase protein, gene product 17 (gp17), assembles into a multisubunit motor and translocates DNA by an inchworm mechanism. gp17 consists of two domains; an N-terminal ATPase domain (amino acids 1-360) that powers translocation of DNA, and a C-terminal nuclease domain (amino acids 361-610) that cuts concatemeric DNA to generate a headful-size viral genome. While the functional motifs of ATPase and nuclease have been well defined and the ATPase atomic structure has been solved, the DNA binding motif(s) responsible for viral DNA recognition, cutting, and translocation are unknown. Here we report the first evidence for the presence of a double-stranded DNA binding activity in the gp17 ATPase domain. Binding to DNA is sensitive to Mg(2+) and salt, but not the type of DNA used. DNA fragments as short as 20 bp can bind to the ATPase but preferential binding was observed to DNA greater than 1 kb. A high molecular weight ATPase-DNA complex was isolated by gel filtration, suggesting oligomerization of ATPase following DNA interaction. DNA binding was not observed with the full-length gp17, or the C-terminal nuclease domain. The small terminase protein, gp16, inhibited DNA binding, which was further accentuated by ATP. The presence of a DNA binding site in the ATPase domain and its binding properties implicate a role in the DNA packaging mechanism.

  7. Dynamic binding of replication protein a is required for DNA repair

    PubMed Central

    Chen, Ran; Subramanyam, Shyamal; Elcock, Adrian H.; Spies, Maria; Wold, Marc S.

    2016-01-01

    Replication protein A (RPA), the major eukaryotic single-stranded DNA (ssDNA) binding protein, is essential for replication, repair and recombination. High-affinity ssDNA-binding by RPA depends on two DNA binding domains in the large subunit of RPA. Mutation of the evolutionarily conserved aromatic residues in these two domains results in a separation-of-function phenotype: aromatic residue mutants support DNA replication but are defective in DNA repair. We used biochemical and single-molecule analyses, and Brownian Dynamics simulations to determine the molecular basis of this phenotype. Our studies demonstrated that RPA binds to ssDNA in at least two modes characterized by different dissociation kinetics. We also showed that the aromatic residues contribute to the formation of the longer-lived state, are required for stable binding to short ssDNA regions and are needed for RPA melting of partially duplex DNA structures. We conclude that stable binding and/or the melting of secondary DNA structures by RPA is required for DNA repair, including RAD51 mediated DNA strand exchange, but is dispensable for DNA replication. It is likely that the binding modes are in equilibrium and reflect dynamics in the RPA–DNA complex. This suggests that dynamic binding of RPA to DNA is necessary for different cellular functions. PMID:27131385

  8. The substrate binding interface of alkylpurine DNA glycosylase AlkD.

    PubMed

    Mullins, Elwood A; Rubinson, Emily H; Eichman, Brandt F

    2014-01-01

    Tandem helical repeats have emerged as an important DNA binding architecture. DNA glycosylase AlkD, which excises N3- and N7-alkylated nucleobases, uses repeating helical motifs to bind duplex DNA and to selectively pause at non-Watson-Crick base pairs. Remodeling of the DNA backbone promotes nucleotide flipping of the lesion and the complementary base into the solvent and toward the protein surface, respectively. The important features of this new DNA binding architecture that allow AlkD to distinguish between damaged and normal DNA without contacting the lesion are poorly understood. Here, we show through extensive mutational analysis that DNA binding and N3-methyladenine (3mA) and N7-methylguanine (7mG) excision are dependent upon each residue lining the DNA binding interface. Disrupting electrostatic or hydrophobic interactions with the DNA backbone substantially reduced binding affinity and catalytic activity. These results demonstrate that residues seemingly only involved in general DNA binding are important for catalytic activity and imply that base excision is driven by binding energy provided by the entire substrate interface of this novel DNA binding architecture. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Yeast Sub1 and human PC4 are G-quadruplex binding proteins that suppress genome instability at co-transcriptionally formed G4 DNA.

    PubMed

    Lopez, Christopher R; Singh, Shivani; Hambarde, Shashank; Griffin, Wezley C; Gao, Jun; Chib, Shubeena; Yu, Yang; Ira, Grzegorz; Raney, Kevin D; Kim, Nayun

    2017-06-02

    G-quadruplex or G4 DNA is a non-B secondary DNA structure consisting of a stacked array of guanine-quartets that can disrupt critical cellular functions such as replication and transcription. When sequences that can adopt Non-B structures including G4 DNA are located within actively transcribed genes, the reshaping of DNA topology necessary for transcription process stimulates secondary structure-formation thereby amplifying the potential for genome instability. Using a reporter assay designed to study G4-induced recombination in the context of an actively transcribed locus in Saccharomyces cerevisiae, we tested whether co-transcriptional activator Sub1, recently identified as a G4-binding factor, contributes to genome maintenance at G4-forming sequences. Our data indicate that, upon Sub1-disruption, genome instability linked to co-transcriptionally formed G4 DNA in Top1-deficient cells is significantly augmented and that its highly conserved DNA binding domain or the human homolog PC4 is sufficient to suppress G4-associated genome instability. We also show that Sub1 interacts specifically with co-transcriptionally formed G4 DNA in vivo and that yeast cells become highly sensitivity to G4-stabilizing chemical ligands by the loss of Sub1. Finally, we demonstrate the physical and genetic interaction of Sub1 with the G4-resolving helicase Pif1, suggesting a possible mechanism by which Sub1 suppresses instability at G4 DNA. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Stoichiometry of DNA binding by the bacteriophage SP01-encoded type II DNA-binding protein TF1.

    PubMed

    Schneider, G J; Geiduschek, E P

    1990-06-25

    The stoichiometry of DNA binding by the bacteriophage SP01-encoded type II DNA-binding protein TF1 has been determined. 3H-Labeled TF1 was allowed to bind to a 32P-labeled DNA fragment containing a TF1 binding site. Multiple TF1-DNA complexes were resolved from each other and from unbound DNA by native gel electrophoresis. DNA-protein complexes were cut from polyacrylamide gels, and the amounts of 3H and 32P contained in each slice were measured. A ratio of 1.12 +/- 0.06 TF1 dimer/DNA molecule was calculated for the fastest-migrating TF1-DNA complex. We conclude that TF1 has a DNA-binding unit of one dimer. More slowly migrating complexes are apparently formed by serial addition of single TF1 dimers.

  11. A variable DNA recognition site organization establishes the LiaR-mediated cell envelope stress response of enterococci to daptomycin

    DOE PAGES

    Davlieva, Milya; Shi, Yiwen; Leonard, Paul G.; ...

    2015-04-19

    LiaR is a ‘master regulator’ of the cell envelope stress response in enterococci and many other Gram-positive organisms. Mutations to liaR can lead to antibiotic resistance to a variety of antibiotics including the cyclic lipopeptide daptomycin. LiaR is phosphorylated in response to membrane stress to regulate downstream target operons. Using DNA footprinting of the regions upstream of the liaXYZ and liaFSR operons we show that LiaR binds an extended stretch of DNA that extends beyond the proposed canonical consensus sequence suggesting a more complex level of regulatory control of target operons. We go on to determine the biochemical and structuralmore » basis for increased resistance to daptomycin by the adaptive mutation to LiaR (D191N) first identified from the pathogen Enterococcus faecalis S613. LiaR D191N increases oligomerization of LiaR to form a constitutively activated tetramer that has high affinity for DNA even in the absence of phosphorylation leading to increased resistance. The crystal structures of the LiaR DNA binding domain complexed to the putative consensus sequence as well as an adjoining secondary sequence show that upon binding, LiaR induces DNA bending that is consistent with increased recruitment of RNA polymerase to the transcription start site and upregulation of target operons.« less

  12. A Novel Rrm3 Function in Restricting DNA Replication via an Orc5-Binding Domain Is Genetically Separable from Rrm3 Function as an ATPase/Helicase in Facilitating Fork Progression.

    PubMed

    Syed, Salahuddin; Desler, Claus; Rasmussen, Lene J; Schmidt, Kristina H

    2016-12-01

    In response to replication stress cells activate the intra-S checkpoint, induce DNA repair pathways, increase nucleotide levels, and inhibit origin firing. Here, we report that Rrm3 associates with a subset of replication origins and controls DNA synthesis during replication stress. The N-terminal domain required for control of DNA synthesis maps to residues 186-212 that are also critical for binding Orc5 of the origin recognition complex. Deletion of this domain is lethal to cells lacking the replication checkpoint mediator Mrc1 and leads to mutations upon exposure to the replication stressor hydroxyurea. This novel Rrm3 function is independent of its established role as an ATPase/helicase in facilitating replication fork progression through polymerase blocking obstacles. Using quantitative mass spectrometry and genetic analyses, we find that the homologous recombination factor Rdh54 and Rad5-dependent error-free DNA damage bypass act as independent mechanisms on DNA lesions that arise when Rrm3 catalytic activity is disrupted whereas these mechanisms are dispensable for DNA damage tolerance when the replication function is disrupted, indicating that the DNA lesions generated by the loss of each Rrm3 function are distinct. Although both lesion types activate the DNA-damage checkpoint, we find that the resultant increase in nucleotide levels is not sufficient for continued DNA synthesis under replication stress. Together, our findings suggest a role of Rrm3, via its Orc5-binding domain, in restricting DNA synthesis that is genetically and physically separable from its established catalytic role in facilitating fork progression through replication blocks.

  13. A Novel Rrm3 Function in Restricting DNA Replication via an Orc5-Binding Domain Is Genetically Separable from Rrm3 Function as an ATPase/Helicase in Facilitating Fork Progression

    PubMed Central

    Syed, Salahuddin; Desler, Claus; Rasmussen, Lene J.; Schmidt, Kristina H.

    2016-01-01

    In response to replication stress cells activate the intra-S checkpoint, induce DNA repair pathways, increase nucleotide levels, and inhibit origin firing. Here, we report that Rrm3 associates with a subset of replication origins and controls DNA synthesis during replication stress. The N-terminal domain required for control of DNA synthesis maps to residues 186–212 that are also critical for binding Orc5 of the origin recognition complex. Deletion of this domain is lethal to cells lacking the replication checkpoint mediator Mrc1 and leads to mutations upon exposure to the replication stressor hydroxyurea. This novel Rrm3 function is independent of its established role as an ATPase/helicase in facilitating replication fork progression through polymerase blocking obstacles. Using quantitative mass spectrometry and genetic analyses, we find that the homologous recombination factor Rdh54 and Rad5-dependent error-free DNA damage bypass act as independent mechanisms on DNA lesions that arise when Rrm3 catalytic activity is disrupted whereas these mechanisms are dispensable for DNA damage tolerance when the replication function is disrupted, indicating that the DNA lesions generated by the loss of each Rrm3 function are distinct. Although both lesion types activate the DNA-damage checkpoint, we find that the resultant increase in nucleotide levels is not sufficient for continued DNA synthesis under replication stress. Together, our findings suggest a role of Rrm3, via its Orc5-binding domain, in restricting DNA synthesis that is genetically and physically separable from its established catalytic role in facilitating fork progression through replication blocks. PMID:27923055

  14. Role of advanced glycation on aggregation and DNA binding properties of α-synuclein.

    PubMed

    Padmaraju, Vasudevaraju; Bhaskar, Jamuna J; Prasada Rao, Ummiti J S; Salimath, Paramahans V; Rao, K S

    2011-01-01

    Parkinson's disease (PD) is a neurodegenerative disease with multiple etiologies. Advanced glycation end products (AGEs) accumulate in the aging brain and could be one of the reasons for age-related diseases like PD. Oxidative stress also leads to the formation of AGEs and may be involved in neurodegeneration by altering the properties of proteins. α-Synuclein is involved in pathogenesis of PD and there are limited studies on the role of AGE-α-synuclein in neurodegeneration. We studied the aggregation and DNA binding ability of AGE-α-synuclein in vitro. α-Synuclein is glycated using methylglyoxal and formation of AGE-α-synuclein is characterized using fluorescence studies, intrinsic tyrosine fluorescence, and fructosamine estimation. The results indicated that AGE-α-synuclein aggregates into smaller globular-like aggregates compared to fibrils formed with native α-synuclein. Further, it is found that AGE-α-synuclein induced conformational changes in scDNA from B-form to B-C-A mixed conformation. Additionally, AGE-α-synuclein altered DNA integrity as evidenced by the melting temperature, ethidium bromide, and DNAse I sensitivity studies. AGE-α-synuclein converted biphasic Tm to higher monophasic Tm. The Tm of AGE-α-synuclein-scDNA complex is more than that of native α-synuclein-scDNA complex, indicating that AGE-α-synuclein stabilized the uncoiled scDNA. AGE-α-synuclein could stabilize the uncoiled scDNA, as shown by the decrease in the number of ethidium bromide binding molecules per base pair of DNA. DNAse I sensitive studies indicated that both AGE-α-synuclein-scDNA and α-synuclein-scDNA are resistant to DNAse I digestion. The relevance of these findings to neuronal cell death is discussed.

  15. Ski acts as a co-repressor with Smad2 and Smad3 to regulate the response to type β transforming growth factor

    PubMed Central

    Xu, Weidong; Angelis, Konstantina; Danielpour, David; Haddad, Maher M.; Bischof, Oliver; Campisi, Judith; Stavnezer, Ed; Medrano, Estela E.

    2000-01-01

    The c-ski protooncogene encodes a transcription factor that binds DNA only in association with other proteins. To identify co-binding proteins, we performed a yeast two-hybrid screen. The results of the screen and subsequent co-immunoprecipitation studies identified Smad2 and Smad3, two transcriptional activators that mediate the type β transforming growth factor (TGF-β) response, as Ski-interacting proteins. In Ski-transformed cells, all of the Ski protein was found in Smad3-containing complexes that accumulated in the nucleus in the absence of added TGF-β. DNA binding assays showed that Ski, Smad2, Smad3, and Smad4 form a complex with the Smad/Ski binding element GTCTAGAC (SBE). Ski repressed TGF-β-induced expression of 3TP-Lux, the natural plasminogen activator inhibitor 1 promoter and of reporter genes driven by the SBE and the related CAGA element. In addition, Ski repressed a TGF-β-inducible promoter containing AP-1 (TRE) elements activated by a combination of Smads, Fos, and/or Jun proteins. Ski also repressed synergistic activation of promoters by combinations of Smad proteins but failed to repress in the absence of Smad4. Thus, Ski acts in opposition to TGF-β-induced transcriptional activation by functioning as a Smad-dependent co-repressor. The biological relevance of this transcriptional repression was established by showing that overexpression of Ski abolished TGF-β-mediated growth inhibition in a prostate-derived epithelial cell line. PMID:10811875

  16. Ski acts as a co-repressor with Smad2 and Smad3 to regulate the response to type beta transforming growth factor.

    PubMed

    Xu, W; Angelis, K; Danielpour, D; Haddad, M M; Bischof, O; Campisi, J; Stavnezer, E; Medrano, E E

    2000-05-23

    The c-ski protooncogene encodes a transcription factor that binds DNA only in association with other proteins. To identify co-binding proteins, we performed a yeast two-hybrid screen. The results of the screen and subsequent co-immunoprecipitation studies identified Smad2 and Smad3, two transcriptional activators that mediate the type beta transforming growth factor (TGF-beta) response, as Ski-interacting proteins. In Ski-transformed cells, all of the Ski protein was found in Smad3-containing complexes that accumulated in the nucleus in the absence of added TGF-beta. DNA binding assays showed that Ski, Smad2, Smad3, and Smad4 form a complex with the Smad/Ski binding element GTCTAGAC (SBE). Ski repressed TGF-beta-induced expression of 3TP-Lux, the natural plasminogen activator inhibitor 1 promoter and of reporter genes driven by the SBE and the related CAGA element. In addition, Ski repressed a TGF-beta-inducible promoter containing AP-1 (TRE) elements activated by a combination of Smads, Fos, and/or Jun proteins. Ski also repressed synergistic activation of promoters by combinations of Smad proteins but failed to repress in the absence of Smad4. Thus, Ski acts in opposition to TGF-beta-induced transcriptional activation by functioning as a Smad-dependent co-repressor. The biological relevance of this transcriptional repression was established by showing that overexpression of Ski abolished TGF-beta-mediated growth inhibition in a prostate-derived epithelial cell line.

  17. Fanconi anaemia and the repair of Watson and Crick DNA crosslinks.

    PubMed

    Kottemann, Molly C; Smogorzewska, Agata

    2013-01-17

    The function of Fanconi anaemia proteins is to maintain genomic stability. Their main role is in the repair of DNA interstrand crosslinks, which, by covalently binding the Watson and the Crick strands of DNA, impede replication and transcription. Inappropriate repair of interstrand crosslinks causes genomic instability, leading to cancer; conversely, the toxicity of crosslinking agents makes them a powerful chemotherapeutic. Fanconi anaemia proteins can promote stem-cell function, prevent tumorigenesis, stabilize replication forks and inhibit inaccurate repair. Recent advances have identified endogenous aldehydes as possible culprits of DNA damage that may induce the phenotypes seen in patients with Fanconi anaemia.

  18. The emerging role of nuclear viral DNA sensors.

    PubMed

    Diner, Benjamin A; Lum, Krystal K; Cristea, Ileana M

    2015-10-30

    Detecting pathogenic DNA by intracellular receptors termed "sensors" is critical toward galvanizing host immune responses and eliminating microbial infections. Emerging evidence has challenged the dogma that sensing of viral DNA occurs exclusively in sub-cellular compartments normally devoid of cellular DNA. The interferon-inducible protein IFI16 was shown to bind nuclear viral DNA and initiate immune signaling, culminating in antiviral cytokine secretion. Here, we review the newly characterized nucleus-originating immune signaling pathways, their links to other crucial host defenses, and unique mechanisms by which viruses suppress their functions. We frame these findings in the context of human pathologies associated with nuclear replicating DNA viruses. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  19. Mapping the interactions of the single-stranded DNA binding protein of bacteriophage T4 (gp32) with DNA lattices at single nucleotide resolution: polynucleotide binding and cooperativity

    PubMed Central

    Jose, Davis; Weitzel, Steven E.; Baase, Walter A.; Michael, Miya M.; von Hippel, Peter H.

    2015-01-01

    We here use our site-specific base analog mapping approach to study the interactions and binding equilibria of cooperatively-bound clusters of the single-stranded DNA binding protein (gp32) of the T4 DNA replication complex with longer ssDNA (and dsDNA) lattices. We show that in cooperatively bound clusters the binding free energy appears to be equi-partitioned between the gp32 monomers of the cluster, so that all bind to the ssDNA lattice with comparable affinity, but also that the outer domains of the gp32 monomers at the ends of the cluster can fluctuate on and off the lattice and that the clusters of gp32 monomers can slide along the ssDNA. We also show that at very low binding densities gp32 monomers bind to the ssDNA lattice at random, but that cooperatively bound gp32 clusters bind preferentially at the 5′-end of the ssDNA lattice. We use these results and the gp32 monomer-binding results of the companion paper to propose a detailed model for how gp32 might bind to and interact with ssDNA lattices in its various binding modes, and also consider how these clusters might interact with other components of the T4 DNA replication complex. PMID:26275774

  20. Comparison between TRF2 and TRF1 of their telomeric DNA-bound structures and DNA-binding activities

    PubMed Central

    Hanaoka, Shingo; Nagadoi, Aritaka; Nishimura, Yoshifumi

    2005-01-01

    Mammalian telomeres consist of long tandem arrays of double-stranded telomeric TTAGGG repeats packaged by the telomeric DNA-binding proteins TRF1 and TRF2. Both contain a similar C-terminal Myb domain that mediates sequence-specific binding to telomeric DNA. In a DNA complex of TRF1, only the single Myb-like domain consisting of three helices can bind specifically to double-stranded telomeric DNA. TRF2 also binds to double-stranded telomeric DNA. Although the DNA binding mode of TRF2 is likely identical to that of TRF1, TRF2 plays an important role in the t-loop formation that protects the ends of telomeres. Here, to clarify the details of the double-stranded telomeric DNA-binding modes of TRF1 and TRF2, we determined the solution structure of the DNA-binding domain of human TRF2 bound to telomeric DNA; it consists of three helices, and like TRF1, the third helix recognizes TAGGG sequence in the major groove of DNA with the N-terminal arm locating in the minor groove. However, small but significant differences are observed; in contrast to the minor groove recognition of TRF1, in which an arginine residue recognizes the TT sequence, a lysine residue of TRF2 interacts with the TT part. We examined the telomeric DNA-binding activities of both DNA-binding domains of TRF1 and TRF2 and found that TRF1 binds more strongly than TRF2. Based on the structural differences of both domains, we created several mutants of the DNA-binding domain of TRF2 with stronger binding activities compared to the wild-type TRF2. PMID:15608118

  1. Differences in the Mechanism of the Allosteric L-Rhamnose Responses of the AraC/XylS Family Transcription Activators RhaS and RhaR

    PubMed Central

    Kolin, Ana; Balasubramaniam, Vinitha; Skredenske, Jeff; Wickstrum, Jason; Egan, Susan M.

    2008-01-01

    SUMMARY Proteins in the largest subset of AraC/XylS family transcription activators, including RhaS and RhaR, have C-terminal domains (CTDs) that mediate DNA-binding and transcription activation, and N-terminal domains (NTDs) that mediate dimerization and effector binding. The mechanism of the allosteric effector response in this family has been identified only for AraC. Here, we investigated the mechanism by which RhaS and RhaR respond to their effector, L-rhamnose. Unlike AraC, N-terminal truncations suggested that RhaS and RhaR don’t use an N-terminal arm to inhibit activity in the absence of effector. We used random mutagenesis to isolate RhaS and RhaR variants with enhanced activation in the absence of L-rhamnose. NTD substitutions largely clustered around the predicted L-rhamnose-binding pockets, suggesting that they mimic the structural outcome of effector binding to the wild-type proteins. RhaS-CTD substitutions clustered in the first HTH motif, and suggested that L-rhamnose induces improved DNA binding. In contrast, RhaR-CTD substitutions clustered at a single residue in the second HTH motif, at a position consistent with improved RNAP contacts. We propose separate allosteric mechanisms for the two proteins: Without L-rhamnose, RhaS doesn’t effectively bind DNA while RhaR doesn’t effectively contact RNAP. Upon L-rhamnose binding, both proteins undergo structural changes that enable transcription activation. PMID:18366439

  2. Endogenous Hot Spots of De Novo Telomere Addition in the Yeast Genome Contain Proximal Enhancers That Bind Cdc13

    PubMed Central

    Obodo, Udochukwu C.; Epum, Esther A.; Platts, Margaret H.; Seloff, Jacob; Dahlson, Nicole A.; Velkovsky, Stoycho M.; Paul, Shira R.

    2016-01-01

    DNA double-strand breaks (DSBs) pose a threat to genome stability and are repaired through multiple mechanisms. Rarely, telomerase, the enzyme that maintains telomeres, acts upon a DSB in a mutagenic process termed telomere healing. The probability of telomere addition is increased at specific genomic sequences termed sites of repair-associated telomere addition (SiRTAs). By monitoring repair of an induced DSB, we show that SiRTAs on chromosomes V and IX share a bipartite structure in which a core sequence (Core) is directly targeted by telomerase, while a proximal sequence (Stim) enhances the probability of de novo telomere formation. The Stim and Core sequences are sufficient to confer a high frequency of telomere addition to an ectopic site. Cdc13, a single-stranded DNA binding protein that recruits telomerase to endogenous telomeres, is known to stimulate de novo telomere addition when artificially recruited to an induced DSB. Here we show that the ability of the Stim sequence to enhance de novo telomere addition correlates with its ability to bind Cdc13, indicating that natural sites at which telomere addition occurs at high frequency require binding by Cdc13 to a sequence 20 to 100 bp internal from the site at which telomerase acts to initiate de novo telomere addition. PMID:27044869

  3. Genome-wide characterization reveals complex interplay between TP53 and TP63 in response to genotoxic stress

    PubMed Central

    McDade, Simon S.; Patel, Daksha; Moran, Michael; Campbell, James; Fenwick, Kerry; Kozarewa, Iwanka; Orr, Nicholas J.; Lord, Christopher J.; Ashworth, Alan A.; McCance, Dennis J.

    2014-01-01

    In response to genotoxic stress the TP53 tumour suppressor activates target gene expression to induce cell cycle arrest or apoptosis depending on the extent of DNA damage. These canonical activities can be repressed by TP63 in normal stratifying epithelia to maintain proliferative capacity or drive proliferation of squamous cell carcinomas, where TP63 is frequently overexpressed/amplified. Here we use ChIP-sequencing, integrated with microarray analysis, to define the genome-wide interplay between TP53 and TP63 in response to genotoxic stress in normal cells. We reveal that TP53 and TP63 bind to overlapping, but distinct cistromes of sites through utilization of distinctive consensus motifs and that TP53 is constitutively bound to a number of sites. We demonstrate that cisplatin and adriamycin elicit distinct effects on TP53 and TP63 binding events, through which TP53 can induce or repress transcription of an extensive network of genes by direct binding and/or modulation of TP63 activity. Collectively, this results in a global TP53-dependent repression of cell cycle progression, mitosis and DNA damage repair concomitant with activation of anti-proliferative and pro-apoptotic canonical target genes. Further analyses reveal that in the absence of genotoxic stress TP63 plays an important role in maintaining expression of DNA repair genes, loss of which results in defective repair. PMID:24823795

  4. Activation of peroxisome proliferator-activated receptor beta/delta inhibits lipopolysaccharide-induced cytokine production in adipocytes by lowering nuclear factor-kappaB activity via extracellular signal-related kinase 1/2.

    PubMed

    Rodríguez-Calvo, Ricardo; Serrano, Lucía; Coll, Teresa; Moullan, Norman; Sánchez, Rosa M; Merlos, Manuel; Palomer, Xavier; Laguna, Juan C; Michalik, Liliane; Wahli, Walter; Vázquez-Carrera, Manuel

    2008-08-01

    Chronic activation of the nuclear factor-kappaB (NF-kappaB) in white adipose tissue leads to increased production of pro-inflammatory cytokines, which are involved in the development of insulin resistance. It is presently unknown whether peroxisome proliferator-activated receptor (PPAR) beta/delta activation prevents inflammation in adipocytes. First, we examined whether the PPARbeta/delta agonist GW501516 prevents lipopolysaccharide (LPS)-induced cytokine production in differentiated 3T3-L1 adipocytes. Treatment with GW501516 blocked LPS-induced IL-6 expression and secretion by adipocytes and the subsequent activation of the signal transducer and activator of transcription 3 (STAT3)-Suppressor of cytokine signaling 3 (SOCS3) pathway. This effect was associated with the capacity of GW501516 to impede LPS-induced NF-kappaB activation. Second, in in vivo studies, white adipose tissue from Zucker diabetic fatty (ZDF) rats, compared with that of lean rats, showed reduced PPARbeta/delta expression and PPAR DNA-binding activity, which was accompanied by enhanced IL-6 expression and NF-kappaB DNA-binding activity. Furthermore, IL-6 expression and NF-kappaB DNA-binding activity was higher in white adipose tissue from PPARbeta/delta-null mice than in wild-type mice. Because mitogen-activated protein kinase-extracellular signal-related kinase (ERK)1/2 (MEK1/2) is involved in LPS-induced NF-kappaB activation in adipocytes, we explored whether PPARbeta/delta prevented NF-kappaB activation by inhibiting this pathway. Interestingly, GW501516 prevented ERK1/2 phosphorylation by LPS. Furthermore, white adipose tissue from animal showing constitutively increased NF-kappaB activity, such as ZDF rats and PPARbeta/delta-null mice, also showed enhanced phospho-ERK1/2 levels. These findings indicate that activation of PPARbeta/delta inhibits enhanced cytokine production in adipocytes by preventing NF-kappaB activation via ERK1/2, an effect that may help prevent insulin resistance.

  5. Nucleotide Excision Repair Lesion-Recognition Protein Rad4 Captures a Pre-Flipped Partner Base in a Benzo[a]pyrene-Derived DNA Lesion: How Structure Impacts the Binding Pathway.

    PubMed

    Mu, Hong; Geacintov, Nicholas E; Min, Jung-Hyun; Zhang, Yingkai; Broyde, Suse

    2017-06-19

    The xeroderma pigmentosum C protein complex (XPC) recognizes a variety of environmentally induced DNA lesions and is the key in initiating their repair by the nucleotide excision repair (NER) pathway. When bound to a lesion, XPC flips two nucleotide pairs that include the lesion out of the DNA duplex, yielding a productively bound complex that can lead to successful lesion excision. Interestingly, the efficiencies of NER vary greatly among different lesions, influencing their toxicity and mutagenicity in cells. Though differences in XPC binding may influence NER efficiency, it is not understood whether XPC utilizes different mechanisms to achieve productive binding with different lesions. Here, we investigated the well-repaired 10R-(+)-cis-anti-benzo[a]pyrene-N 2 -dG (cis-B[a]P-dG) DNA adduct in a duplex containing normal partner C opposite the lesion. This adduct is derived from the environmental pro-carcinogen benzo[a]pyrene and is likely to be encountered by NER in the cell. We have extensively investigated its binding to the yeast XPC orthologue, Rad4, using umbrella sampling with restrained molecular dynamics simulations and free energy calculations. The NMR solution structure of this lesion in duplex DNA has shown that the dC complementary to the adducted dG is flipped out of the DNA duplex in the absence of XPC. However, it is not known whether the "pre-flipped" base would play a role in its recognition by XPC. Our results show that Rad4 first captures the displaced dC, which is followed by a tightly coupled lesion-extruding pathway for productive binding. This binding path differs significantly from the one deduced for the small cis-syn cyclobutane pyrimidine dimer lesion opposite mismatched thymines [ Mu , H. , ( 2015 ) Biochemistry , 54 ( 34 ), 5263 - 7 ]. The possibility of multiple paths that lead to productive binding to XPC is consistent with the versatile lesion recognition by XPC that is required for successful NER.

  6. Nucleotide Excision Repair Lesion-Recognition Protein Rad4 Captures a Pre-Flipped Partner Base in a Benzo[a]pyrene-Derived DNA Lesion: How Structure Impacts the Binding Pathway

    PubMed Central

    2017-01-01

    The xeroderma pigmentosum C protein complex (XPC) recognizes a variety of environmentally induced DNA lesions and is the key in initiating their repair by the nucleotide excision repair (NER) pathway. When bound to a lesion, XPC flips two nucleotide pairs that include the lesion out of the DNA duplex, yielding a productively bound complex that can lead to successful lesion excision. Interestingly, the efficiencies of NER vary greatly among different lesions, influencing their toxicity and mutagenicity in cells. Though differences in XPC binding may influence NER efficiency, it is not understood whether XPC utilizes different mechanisms to achieve productive binding with different lesions. Here, we investigated the well-repaired 10R-(+)-cis-anti-benzo[a]pyrene-N2-dG (cis-B[a]P-dG) DNA adduct in a duplex containing normal partner C opposite the lesion. This adduct is derived from the environmental pro-carcinogen benzo[a]pyrene and is likely to be encountered by NER in the cell. We have extensively investigated its binding to the yeast XPC orthologue, Rad4, using umbrella sampling with restrained molecular dynamics simulations and free energy calculations. The NMR solution structure of this lesion in duplex DNA has shown that the dC complementary to the adducted dG is flipped out of the DNA duplex in the absence of XPC. However, it is not known whether the “pre-flipped” base would play a role in its recognition by XPC. Our results show that Rad4 first captures the displaced dC, which is followed by a tightly coupled lesion-extruding pathway for productive binding. This binding path differs significantly from the one deduced for the small cis-syn cyclobutane pyrimidine dimer lesion opposite mismatched thymines [MuH., (2015) Biochemistry, 54(34), 5263−726270861]. The possibility of multiple paths that lead to productive binding to XPC is consistent with the versatile lesion recognition by XPC that is required for successful NER. PMID:28460163

  7. Characterization of Short Range DNA Looping in Endotoxin-mediated Transcription of the Murine Inducible Nitric-oxide Synthase (iNOS) Gene*

    PubMed Central

    Guo, Hongtao; Mi, Zhiyong; Kuo, Paul C.

    2008-01-01

    The local structural properties and spatial conformations of chromosomes are intimately associated with gene expression. The spatial associations of critical genomic elements in inducible nitric-oxide synthase (iNOS) transcription have not been previously examined. In this regard, the murine iNOS promoter contains 2 NF-κB binding sites (nt –86 and nt –972) that are essential for maximal transactivation of iNOS by LPS. Although AP-1 is commonly listed as an essential transcription factor for LPS-mediated iNOS transactivation, the relationship between AP-1 and NF-κB in this setting is not well studied. In this study using a model of LPS-stimulated ANA-1 murine macrophages, we demonstrate that short range DNA looping occurs at the iNOS promoter. This looping requires the presence of AP-1, c-Jun, NF-κB p65, and p300-associated acetyltransferase activity. The distal AP-1 binding site interacts via p300 with the proximal NF-κB binding site to create this DNA loop to participate in iNOS transcription. Other geographically distant AP-1 and NF-κB sites are certainly occupied, but selected sites are critical for iNOS transcription and the formation of the c-Jun, p65, and p300 transcriptional complex. In this “simplified” model of murine iNOS promoter, numerous transcription factors recognize and bind to various response elements, but these locales do not equally contribute to iNOS gene transcription. PMID:18596035

  8. A simple model for DNA bridging proteins and bacterial or human genomes: bridging-induced attraction and genome compaction

    NASA Astrophysics Data System (ADS)

    Johnson, J.; Brackley, C. A.; Cook, P. R.; Marenduzzo, D.

    2015-02-01

    We present computer simulations of the phase behaviour of an ensemble of proteins interacting with a polymer, mimicking non-specific binding to a piece of bacterial DNA or eukaryotic chromatin. The proteins can simultaneously bind to the polymer in two or more places to create protein bridges. Despite the lack of any explicit interaction between the proteins or between DNA segments, our simulations confirm previous results showing that when the protein-polymer interaction is sufficiently strong, the proteins come together to form clusters. Furthermore, a sufficiently large concentration of bridging proteins leads to the compaction of the swollen polymer into a globular phase. Here we characterise both the formation of protein clusters and the polymer collapse as a function of protein concentration, protein-polymer affinity and fibre flexibility.

  9. Exploring DNA-binding Proteins with In Vivo Chemical Cross-linking and Mass Spectrometry

    PubMed Central

    Qiu, Haibo; Wang, Yinsheng

    2009-01-01

    DNA-binding proteins are very important constituents of proteomes of all species and play crucial roles in transcription, DNA replication, recombination, repair and other activities associated with DNA. Although a number of DNA-binding proteins have been identified, many proteins involved in gene regulation and DNA repair are likely still unknown because of their dynamic and/or weak interactions with DNA. In this report, we described an approach for the comprehensive identification of DNA-binding proteins with in vivo formaldehyde cross-linking and LC-MS/MS. DNA-binding proteins could be purified via the isolation of DNA-protein complexes and released from the complexes by reversing the cross-linking. By using this method, we were able to identify more than one hundred DNA-binding proteins, such as proteins involved in transcription, gene regulation, DNA replication and repair, and a large number of proteins which are potentially associated with DNA and DNA-binding proteins. This method should be generally applicable to the investigation of other nucleic acid-binding proteins, and hold great potential in the comprehensive study of gene regulation, DNA damage response and repair, as well as many other critical biological processes at proteomic level. PMID:19714816

  10. The thyroid hormone receptor β induces DNA damage and premature senescence.

    PubMed

    Zambrano, Alberto; García-Carpizo, Verónica; Gallardo, María Esther; Villamuera, Raquel; Gómez-Ferrería, Maria Ana; Pascual, Angel; Buisine, Nicolas; Sachs, Laurent M; Garesse, Rafael; Aranda, Ana

    2014-01-06

    There is increasing evidence that the thyroid hormone (TH) receptors (THRs) can play a role in aging, cancer and degenerative diseases. In this paper, we demonstrate that binding of TH T3 (triiodothyronine) to THRB induces senescence and deoxyribonucleic acid (DNA) damage in cultured cells and in tissues of young hyperthyroid mice. T3 induces a rapid activation of ATM (ataxia telangiectasia mutated)/PRKAA (adenosine monophosphate-activated protein kinase) signal transduction and recruitment of the NRF1 (nuclear respiratory factor 1) and THRB to the promoters of genes with a key role on mitochondrial respiration. Increased respiration leads to production of mitochondrial reactive oxygen species, which in turn causes oxidative stress and DNA double-strand breaks and triggers a DNA damage response that ultimately leads to premature senescence of susceptible cells. Our findings provide a mechanism for integrating metabolic effects of THs with the tumor suppressor activity of THRB, the effect of thyroidal status on longevity, and the occurrence of tissue damage in hyperthyroidism.

  11. GC-Rich Extracellular DNA Induces Oxidative Stress, Double-Strand DNA Breaks, and DNA Damage Response in Human Adipose-Derived Mesenchymal Stem Cells.

    PubMed

    Kostyuk, Svetlana; Smirnova, Tatiana; Kameneva, Larisa; Porokhovnik, Lev; Speranskij, Anatolij; Ershova, Elizaveta; Stukalov, Sergey; Izevskaya, Vera; Veiko, Natalia

    2015-01-01

    Cell free DNA (cfDNA) circulates throughout the bloodstream of both healthy people and patients with various diseases. CfDNA is substantially enriched in its GC-content as compared with human genomic DNA. Exposure of haMSCs to GC-DNA induces short-term oxidative stress (determined with H2DCFH-DA) and results in both single- and double-strand DNA breaks (comet assay and γH2AX, foci). As a result in the cells significantly increases the expression of repair genes (BRCA1 (RT-PCR), PCNA (FACS)) and antiapoptotic genes (BCL2 (RT-PCR and FACS), BCL2A1, BCL2L1, BIRC3, and BIRC2 (RT-PCR)). Under the action of GC-DNA the potential of mitochondria was increased. Here we show that GC-rich extracellular DNA stimulates adipocyte differentiation of human adipose-derived mesenchymal stem cells (haMSCs). Exposure to GC-DNA leads to an increase in the level of RNAPPARG2 and LPL (RT-PCR), in the level of fatty acid binding protein FABP4 (FACS analysis) and in the level of fat (Oil Red O). GC-rich fragments in the pool of cfDNA can potentially induce oxidative stress and DNA damage response and affect the direction of mesenchymal stem cells differentiation in human adipose-derived mesenchymal stem cells. Such a response may be one of the causes of obesity or osteoporosis.

  12. GC-Rich Extracellular DNA Induces Oxidative Stress, Double-Strand DNA Breaks, and DNA Damage Response in Human Adipose-Derived Mesenchymal Stem Cells

    PubMed Central

    Smirnova, Tatiana; Kameneva, Larisa; Porokhovnik, Lev; Speranskij, Anatolij; Ershova, Elizaveta; Stukalov, Sergey; Izevskaya, Vera; Veiko, Natalia

    2015-01-01

    Background. Cell free DNA (cfDNA) circulates throughout the bloodstream of both healthy people and patients with various diseases. CfDNA is substantially enriched in its GC-content as compared with human genomic DNA. Principal Findings. Exposure of haMSCs to GC-DNA induces short-term oxidative stress (determined with H2DCFH-DA) and results in both single- and double-strand DNA breaks (comet assay and γH2AX, foci). As a result in the cells significantly increases the expression of repair genes (BRCA1 (RT-PCR), PCNA (FACS)) and antiapoptotic genes (BCL2 (RT-PCR and FACS), BCL2A1, BCL2L1, BIRC3, and BIRC2 (RT-PCR)). Under the action of GC-DNA the potential of mitochondria was increased. Here we show that GC-rich extracellular DNA stimulates adipocyte differentiation of human adipose-derived mesenchymal stem cells (haMSCs). Exposure to GC-DNA leads to an increase in the level of RNAPPARG2 and LPL (RT-PCR), in the level of fatty acid binding protein FABP4 (FACS analysis) and in the level of fat (Oil Red O). Conclusions. GC-rich fragments in the pool of cfDNA can potentially induce oxidative stress and DNA damage response and affect the direction of mesenchymal stem cells differentiation in human adipose—derived mesenchymal stem cells. Such a response may be one of the causes of obesity or osteoporosis. PMID:26273425

  13. High Mobility Group A2 protects cancer cells against telomere dysfunction

    PubMed Central

    Natarajan, Suchitra; Begum, Farhana; Gim, Jeonga; Wark, Landon; Henderson, Dana; Davie, James R.

    2016-01-01

    The non-histone chromatin binding protein High Mobility Group AT-hook protein 2 (HMGA2) plays important roles in the repair and protection of genomic DNA in embryonic stem cells and cancer cells. Here we show that HMGA2 localizes to mammalian telomeres and enhances telomere stability in cancer cells. We present a novel interaction of HMGA2 with the key shelterin protein TRF2. We found that the linker (L1) region of HMGA2 contributes to this interaction but the ATI-L1-ATII molecular region of HMGA2 is required for strong interaction with TRF2. This interaction was independent of HMGA2 DNA-binding and did not require the TRF2 interacting partner RAP1 but involved the homodimerization and hinge regions of TRF2. HMGA2 retained TRF2 at telomeres and reduced telomere-dysfunction despite induced telomere stress. Silencing of HMGA2 resulted in (i) reduced binding of TRF2 to telomere DNA as observed by ChIP, (ii) increased telomere instability and (iii) the formation of telomere dysfunction-induced foci (TIF). This resulted in increased telomere aggregation, anaphase bridges and micronuclei. HMGA2 prevented ATM-dependent pTRF2T188 phosphorylation and attenuated signaling via the telomere specific ATM-CHK2-CDC25C DNA damage signaling axis. In summary, our data demonstrate a unique and novel role of HMGA2 in telomere protection and promoting telomere stability in cancer cells. This identifies HMGA2 as a new therapeutic target for the destabilization of telomeres in HMGA2+ cancer cells. PMID:26799419

  14. Effect of structure variation of the aptamer-DNA duplex probe on the performance of displacement-based electrochemical aptamer sensors.

    PubMed

    Pang, Jie; Zhang, Ziping; Jin, Haizhu

    2016-03-15

    Electrochemical aptamer-based (E-AB) sensors employing electrode-immobilized, redox-tagged aptamer probes have emerged as a promising platform for the sensitive and quick detection of target analytes ranging from small molecules to proteins. Signal generation in this class of sensor is linked to change in electron transfer efficiency upon binding-induced change in flexibility/conformation of the aptamer probe. Because of this signaling mechanism, signal gains of these sensors can be improved by employing a displacement-based recognition system, which links target binding with a large-scale flexibility/conformation shift from the aptamer-DNA duplex to the single-stranded DNA or the native aptamer. Despite the relatively large number of displacement-based E-AB sensor samples, little attention has been paid to the structure variation of the aptamer-DNA duplex probe. Here we detail the effects of complementary length and position of the aptamer-DNA duplex probe on the performance of a model displacement-based E-AB sensor for ATP. We find that, greater background suppression and signal gain are observed with longer complementary length of the aptamer-DNA duplex probe. However, sensor equilibration time slows monotonically with increasing complementary length; and with too many target binding sites in aptamer sequence being occupied by the complementary DNA, the aptamer-target binding does not occur and no signal gain observed. We also demonstrate that signal gain of the displacement-based E-AB sensor is strongly dependent on the complementary position of the aptamer-DNA duplex probe, with complementary position located at the electrode-attached or redox-tagged end of the duplex probe, larger background suppression and signal increase than that of the middle position are observed. These results highlight the importance of rational structure design of the aptamer-DNA duplex probe and provide new insights into the optimization of displacement-based E-AB sensors. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Exploring the DNA binding/cleavage, cellular accumulation and topoisomerase inhibition of 2-hydroxy-3-(aminomethyl)-1,4-naphthoquinone Mannich bases and their platinum(II) complexes.

    PubMed

    Neves, Amanda P; Pereira, Michelle X G; Peterson, Erica J; Kipping, Ralph; Vargas, Maria D; Silva, Floriano P; Carneiro, J Walkimar M; Farrell, Nicholas P

    2013-02-01

    Several chlorido and amino Pt(2+) complexes of 2-hydroxy-3-(aminomethyl)-1,4-naphthoquinone Mannich bases HL exhibiting moderate to high cytotoxicity against cancer cell lines were studied in order to investigate their modes of DNA binding, in vitro DNA strand breaks, mechanism of topoisomerase (Topo I) inhibition and cellular accumulation. DNA model base studies have shown that complex 1a [Pt(HL1)Cl(2)] was capable of binding covalently to 9-ethylguanine (9-EtG) and 5'-GMP. (1)H NMR and mass spectrometry studies have shown that both chlorides were substituted by 9-EtG ligands, whereas 5'-GMP was able to replace only one chlorido ligand, due to steric hindrance. The chlorido Pt(2+) complexes [Pt(HL)Cl(2)] highly accumulate in prostate (PC-3) and melanoma (MDA-MB-435) cell lines, being able to induce DNA strand breaks in vitro and inhibit Topo I by a catalytic mode. On the other hand, the free 2-hydroxy-3-(aminomethyl)-1,4-naphthoquinones HL and the amino Pt(2+) complexes [Pt(L(-))(NH(3))(2)]NO(3) neither cause DNA strand breakage nor exhibit strong DNA interaction, nevertheless the latter were also found to be catalytic inhibitors of Topo I at 100μM. Thus, coordination of the Mannich bases HL to the "PtCl(2)" fragment substantially affects the chemical and biophysical properties of the pro-ligands, leading to an improvement of their DNA binding properties and generating compounds that cleave DNA and catalytically inhibit Topo I. Finally, the high cytotoxicity exhibited by the free (uncomplexed) 2-hydroxy-3-(aminomethyl)-1,4-naphthoquinones might be associated with their decomposition in solution, which is not observed for the Pt(2+) complexes. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. The role of the C-domain of bacteriophage T4 gene 32 protein in ssDNA binding and dsDNA helix-destabilization: Kinetic, single-molecule, and cross-linking studies

    PubMed Central

    Pant, Kiran; Anderson, Brian; Perdana, Hendrik; Malinowski, Matthew A.; Win, Aye T.; Williams, Mark C.

    2018-01-01

    The model single-stranded DNA binding protein of bacteriophage T4, gene 32 protein (gp32) has well-established roles in DNA replication, recombination, and repair. gp32 is a single-chain polypeptide consisting of three domains. Based on thermodynamics and kinetics measurements, we have proposed that gp32 can undergo a conformational change where the acidic C-terminal domain binds internally to or near the single-stranded (ss) DNA binding surface in the core (central) domain, blocking ssDNA interaction. To test this model, we have employed a variety of experimental approaches and gp32 variants to characterize this conformational change. Utilizing stopped-flow methods, the association kinetics of wild type and truncated forms of gp32 with ssDNA were measured. When the C-domain is present, the log-log plot of k vs. [NaCl] shows a positive slope, whereas when it is absent (*I protein), there is little rate change with salt concentration, as expected for this model.A gp32 variant lacking residues 292–296 within the C-domain, ΔPR201, displays kinetic properties intermediate between gp32 and *I. The single molecule force-induced DNA helix-destabilizing activitiesas well as the single- and double-stranded DNA affinities of ΔPR201 and gp32 truncated at residue 295 also fall between full-length protein and *I. Finally, chemical cross-linking of recombinant C-domain and gp32 lacking both N- and C-terminal domains is inhibited by increasing concentrations of a short single-stranded oligonucleotide, and the salt dependence of cross-linking mirrors that expected for the model. Taken together, these results provide the first evidence in support of this model that have been obtained through structural probes. PMID:29634784

  17. The FANCJ/MutLα interaction is required for correction of the cross-link response in FA-J cells

    PubMed Central

    Peng, Min; Litman, Rachel; Xie, Jenny; Sharma, Sudha; Brosh, Robert M; Cantor, Sharon B

    2007-01-01

    FANCJ also called BACH1/BRIP1 was first linked to hereditary breast cancer through its direct interaction with BRCA1. FANCJ was also recently identified as a Fanconi anemia (FA) gene product, establishing FANCJ as an essential tumor suppressor. Similar to other FA cells, FANCJ-null (FA-J) cells accumulate 4N DNA content in response to DNA interstrand crosslinks (ICLs). This accumulation is corrected by reintroduction of wild-type FANCJ. Here, we show that FANCJ interacts with the mismatch repair complex MutLα, composed of PMS2 and MLH1. Specifically, FANCJ directly interacts with MLH1 independent of BRCA1, through its helicase domain. Genetic studies reveal that FANCJ helicase activity and MLH1 binding, but not BRCA1 binding, are essential to correct the FA-J cells' ICL-induced 4N DNA accumulation and sensitivity to ICLs. These results suggest that the FANCJ/MutLα interaction, but not FANCJ/BRCA1 interaction, is essential for establishment of a normal ICL-induced response. The functional role of the FANCJ/MutLα complex demonstrates a novel link between FA and MMR, and predicts a broader role for FANCJ in DNA damage signaling independent of BRCA1. PMID:17581638

  18. Replication Protein A (RPA) deficiency activates the Fanconi anemia DNA repair pathway.

    PubMed

    Jang, Seok-Won; Jung, Jin Ki; Kim, Jung Min

    2016-09-01

    The Fanconi anemia (FA) pathway regulates DNA inter-strand crosslink (ICL) repair. Despite our greater understanding of the role of FA in ICL repair, its function in the preventing spontaneous genome instability is not well understood. Here, we show that depletion of replication protein A (RPA) activates the FA pathway. RPA1 deficiency increases chromatin recruitment of FA core complex, leading to FANCD2 monoubiquitination (FANCD2-Ub) and foci formation in the absence of DNA damaging agents. Importantly, ATR depletion, but not ATM, abolished RPA1 depletion-induced FANCD2-Ub, suggesting that ATR activation mediated FANCD2-Ub. Interestingly, we found that depletion of hSSB1/2-INTS3, a single-stranded DNA-binding protein complex, induces FANCD2-Ub, like RPA1 depletion. More interestingly, depletion of either RPA1 or INTS3 caused increased accumulation of DNA damage in FA pathway deficient cell lines. Taken together, these results indicate that RPA deficiency induces activation of the FA pathway in an ATR-dependent manner, which may play a role in the genome maintenance.

  19. DDB2 promotes chromatin decondensation at UV-induced DNA damage

    PubMed Central

    Lindh, Michael; Acs, Klara; Vrouwe, Mischa G.; Pines, Alex; van Attikum, Haico; Mullenders, Leon H.

    2012-01-01

    Nucleotide excision repair (NER) is the principal pathway that removes helix-distorting deoxyribonucleic acid (DNA) damage from the mammalian genome. Recognition of DNA lesions by xeroderma pigmentosum group C (XPC) protein in chromatin is stimulated by the damaged DNA-binding protein 2 (DDB2), which is part of a CUL4A–RING ubiquitin ligase (CRL4) complex. In this paper, we report a new function of DDB2 in modulating chromatin structure at DNA lesions. We show that DDB2 elicits unfolding of large-scale chromatin structure independently of the CRL4 ubiquitin ligase complex. Our data reveal a marked adenosine triphosphate (ATP)–dependent reduction in the density of core histones in chromatin containing UV-induced DNA lesions, which strictly required functional DDB2 and involved the activity of poly(adenosine diphosphate [ADP]–ribose) polymerase 1. Finally, we show that lesion recognition by XPC, but not DDB2, was strongly reduced in ATP-depleted cells and was regulated by the steady-state levels of poly(ADP-ribose) chains. PMID:22492724

  20. 14-3-3ε Boosts Bleomycin-induced DNA Damage Response by Inhibiting the Drug-Resistant Activity of MVP

    PubMed Central

    Tang, Siwei; Bai, Chen; Yang, Pengyuan; Chen, Xian

    2013-01-01

    Major vault protein (MVP) is the predominant constituent of the vault particle, the largest known ribonuclear protein complex. Although emerging evidences have been establishing the links between MVP (vault) and multidrug resistance (MDR), little is known regarding exactly how the MDR activity of MVP is modulated during cellular response to drug-induced DNA damage (DDR). Bleomycin (BLM), an anti-cancer drug, induces DNA double-stranded breaks (DSBs) and consequently triggers the cellular DDR. Due to its physiological implications in hepatocellular carcinoma (HCC) and cell fate decision, 14-3-3ε was chosen as the pathway-specific bait protein to identify the critical target(s) responsible for HCC MDR. By using LC-MS/MS-based proteomic approach, MVP was first identified in the BLM-induced 14-3-3ε interactome formed in HCC cells. Biological characterization revealed that MVP possesses specific activity to promote the resistance to the BLM-induced DDR. On the other hand, 14-3-3ε enhances BLM-induced DDR by interacting with MVP. Mechanistic investigation further revealed that 14-3-3ε, in a phosphorylation-dependent manner, binds to the phosphorylated sites at both Thr52 and Ser864 of the monomer of MVP. Consequently, the phosphorylation-dependent binding between 14-3-3ε and MVP inhibits the drug-resistant activity of MVP for an enhanced DDR to BLM treatment. Our findings provide an insight into the mechanism underlying how the BLM-induced interaction between 14-3-3ε and MVP modulates MDR, implicating novel strategy to overcome the chemotherapeutic resistance through interfering specific protein-protein interactions. PMID:23590642

  1. Disruption of PCNA-lamins A/C interactions by prelamin A induces DNA replication fork stalling.

    PubMed

    Cobb, Andrew M; Murray, Thomas V; Warren, Derek T; Liu, Yiwen; Shanahan, Catherine M

    2016-09-02

    The accumulation of prelamin A is linked to disruption of cellular homeostasis, tissue degeneration and aging. Its expression is implicated in compromised genome stability and increased levels of DNA damage, but to date there is no complete explanation for how prelamin A exerts its toxic effects. As the nuclear lamina is important for DNA replication we wanted to investigate the relationship between prelamin A expression and DNA replication fork stability. In this study we report that the expression of prelamin A in U2OS cells induced both mono-ubiquitination of proliferating cell nuclear antigen (PCNA) and subsequent induction of Pol η, two hallmarks of DNA replication fork stalling. Immunofluorescence microscopy revealed that cells expressing prelamin A presented with high levels of colocalisation between PCNA and γH2AX, indicating collapse of stalled DNA replication forks into DNA double-strand breaks. Subsequent protein-protein interaction assays showed prelamin A interacted with PCNA and that its presence mitigated interactions between PCNA and the mature nuclear lamina. Thus, we propose that the cytotoxicity of prelamin A arises in part, from it actively competing against mature lamin A to bind PCNA and that this destabilises DNA replication to induce fork stalling which in turn contributes to genomic instability.

  2. Copper-mediated DNA damage by the neurotransmitter dopamine and L-DOPA: A pro-oxidant mechanism.

    PubMed

    Rehmani, Nida; Zafar, Atif; Arif, Hussain; Hadi, Sheikh Mumtaz; Wani, Altaf A

    2017-04-01

    Oxidative DNA damage has been implicated in the pathogenesis of neurological disorders, cancer and ageing. Owing to the established link between labile copper concentrations and neurological diseases, it is critical to explore the interactions of neurotransmitters and drug supplements with copper. Herein, we investigate the pro-oxidant DNA damage induced by the interaction of L-DOPA and dopamine (DA) with copper. The DNA binding affinity order of the compounds has been determined by in silico molecular docking. Agarose gel electrophoresis reveals that L-DOPA and DA are able to induce strand scission in plasmid pcDNA3.1 (+/-) in a copper dependent reaction. These metabolites also cause cellular DNA breakage in human lymphocytes by mobilizing endogenous copper, as assessed by comet assay. Further, L-DOPA and DA-mediated DNA breaks were detected by the appearance of post-DNA damage sensitive marker γH2AX in cancer cell lines accumulating high copper. Immunofluorescence demonstrated the co-localization of downstream repair factor 53BP1 at the damaged induced γH2AX foci in cancer cells. The present study corroborates and provides a mechanism to the hypothesis that suggests metal-mediated oxidation of catecholamines contributes to the pathogenesis of neurodegenerative diseases. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Effects of nucleoside analog incorporation on DNA binding to the DNA binding domain of the GATA-1 erythroid transcription factor.

    PubMed

    Foti, M; Omichinski, J G; Stahl, S; Maloney, D; West, J; Schweitzer, B I

    1999-02-05

    We investigate here the effects of the incorporation of the nucleoside analogs araC (1-beta-D-arabinofuranosylcytosine) and ganciclovir (9-[(1,3-dihydroxy-2-propoxy)methyl] guanine) into the DNA binding recognition sequence for the GATA-1 erythroid transcription factor. A 10-fold decrease in binding affinity was observed for the ganciclovir-substituted DNA complex in comparison to an unmodified DNA of the same sequence composition. AraC substitution did not result in any changes in binding affinity. 1H-15N HSQC and NOESY NMR experiments revealed a number of chemical shift changes in both DNA and protein in the ganciclovir-modified DNA-protein complex when compared to the unmodified DNA-protein complex. These changes in chemical shift and binding affinity suggest a change in the binding mode of the complex when ganciclovir is incorporated into the GATA DNA binding site.

  4. Analysis of DNA binding by human factor xeroderma pigmentosum complementation group A (XPA) provides insight into its interactions with nucleotide excision repair substrates.

    PubMed

    Sugitani, Norie; Voehler, Markus W; Roh, Michelle S; Topolska-Woś, Agnieszka M; Chazin, Walter J

    2017-10-13

    Xeroderma pigmentosum (XP) complementation group A (XPA) is an essential scaffolding protein in the multiprotein nucleotide excision repair (NER) machinery. The interaction of XPA with DNA is a core function of this protein; a number of mutations in the DNA-binding domain (DBD) are associated with XP disease. Although structures of the central globular domain of human XPA and data on binding of DNA substrates have been reported, the structural basis for XPA's DNA-binding activity remains unknown. X-ray crystal structures of the central globular domain of yeast XPA (Rad14) with lesion-containing DNA duplexes have provided valuable insights, but the DNA substrates used for this study do not correspond to the substrates of XPA as it functions within the NER machinery. To better understand the DNA-binding activity of human XPA in NER, we used NMR to investigate the interaction of its DBD with a range of DNA substrates. We found that XPA binds different single-stranded/double-stranded junction DNA substrates with a common surface. Comparisons of our NMR-based mapping of binding residues with the previously reported Rad14-DNA crystal structures revealed similarities and differences in substrate binding between XPA and Rad14. This includes direct evidence for DNA contacts to the residues extending C-terminally from the globular core, which are lacking in the Rad14 construct. Moreover, mutation of the XPA residue corresponding to Phe-262 in Rad14, previously reported as being critical for DNA binding, had only a moderate effect on the DNA-binding activity of XPA. The DNA-binding properties of several disease-associated mutations in the DBD were investigated. These results suggest that for XPA mutants exhibiting altered DNA-binding properties, a correlation exists between the extent of reduction in DNA-binding affinity and the severity of symptoms in XP patients. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xiong, Xiu-Fang; Li, Hui; Cao, En-Hua

    PIG11 (p53-induced protein 11), one of early transcriptional targets of tumor suppressor p53, was up-regulated in the induction of apoptosis or cell growth inhibition by multiple chemopreventive agents. However, its biological role remains unclear. Here, we expressed His{sub 6}-tagged PIG11 protein in Escherichia coli and demonstrated the recombinant His{sub 6}-tagged PIG11 protein could bind to supercoiled and relaxed closed circular plasmid DNA or linear DNA with different length using gel retardation assays in vitro. The interaction between DNA and PIG11 protein was sequence-independent and related to charge effect. The reducing thiol group in PIG11 protein was involved in the bindingmore » activity of PIG11 to DNA. Furthermore, the images of atomic force microscopy directly confirmed the binding of DNA and PIG11 protein and showed the PIG11-DNA complex formed a beads-on-a-string appearance in which PIG11 protein associated with DNA as polymer. These findings suggest that PIG11 protein may play an important role by interaction with other biological molecules in the regulation of apoptosis and provided us a novel angel of view to explore the possible function of PIG11 in vivo.« less

  6. Extracellular DNA Impedes the Transport of Vancomycin in Staphylococcus epidermidis Biofilms Preexposed to Subinhibitory Concentrations of Vancomycin

    PubMed Central

    Tseng, Boo Shan; Howlin, Robert P.; Deacon, Jill; Wharton, Julian A.; Thurner, Philipp J.; Gilmore, Brendan F.; Parsek, Matthew R.; Stoodley, Paul

    2014-01-01

    Staphylococcus epidermidis biofilm formation is responsible for the persistence of orthopedic implant infections. Previous studies have shown that exposure of S. epidermidis biofilms to sub-MICs of antibiotics induced an increased level of biofilm persistence. BODIPY FL-vancomycin (a fluorescent vancomycin conjugate) and confocal microscopy were used to show that the penetration of vancomycin through sub-MIC-vancomycin-treated S. epidermidis biofilms was impeded compared to that of control, untreated biofilms. Further experiments showed an increase in the extracellular DNA (eDNA) concentration in biofilms preexposed to sub-MIC vancomycin, suggesting a potential role for eDNA in the hindrance of vancomycin activity. Exogenously added, S. epidermidis DNA increased the planktonic vancomycin MIC and protected biofilm cells from lethal vancomycin concentrations. Finally, isothermal titration calorimetry (ITC) revealed that the binding constant of DNA and vancomycin was 100-fold higher than the previously reported binding constant of vancomycin and its intended cellular d-Ala-d-Ala peptide target. This study provides an explanation of the eDNA-based mechanism of antibiotic tolerance in sub-MIC-vancomycin-treated S. epidermidis biofilms, which might be an important factor for the persistence of biofilm infections. PMID:25267673

  7. Structural Mechanism behind Distinct Efficiency of Oct4/Sox2 Proteins in Differentially Spaced DNA Complexes

    PubMed Central

    Yesudhas, Dhanusha; Anwar, Muhammad Ayaz; Panneerselvam, Suresh; Durai, Prasannavenkatesh; Shah, Masaud; Choi, Sangdun

    2016-01-01

    The octamer-binding transcription factor 4 (Oct4) and sex-determining region Y (SRY)-box 2 (Sox2) proteins induce various transcriptional regulators to maintain cellular pluripotency. Most Oct4/Sox2 complexes have either 0 base pairs (Oct4/Sox20bp) or 3 base pairs (Oct4/Sox23bp) separation between their DNA-binding sites. Results from previous biochemical studies have shown that the complexes separated by 0 base pairs are associated with a higher pluripotency rate than those separated by 3 base pairs. Here, we performed molecular dynamics (MD) simulations and calculations to determine the binding free energy and per-residue free energy for the Oct4/Sox20bp and Oct4/Sox23bp complexes to identify structural differences that contribute to differences in induction rate. Our MD simulation results showed substantial differences in Oct4/Sox2 domain movements, as well as secondary-structure changes in the Oct4 linker region, suggesting a potential reason underlying the distinct efficiencies of these complexes during reprogramming. Moreover, we identified key residues and hydrogen bonds that potentially facilitate protein-protein and protein-DNA interactions, in agreement with previous experimental findings. Consequently, our results confess that differential spacing of the Oct4/Sox2 DNA binding sites can determine the magnitude of transcription of the targeted genes during reprogramming. PMID:26790000

  8. Crucial role of dynamic linker histone binding and divalent ions for DNA accessibility and gene regulation revealed by mesoscale modeling of oligonucleosomes

    PubMed Central

    Collepardo-Guevara, Rosana; Schlick, Tamar

    2012-01-01

    Monte Carlo simulations of a mesoscale model of oligonucleosomes are analyzed to examine the role of dynamic-linker histone (LH) binding/unbinding in high monovalent salt with divalent ions, and to further interpret noted chromatin fiber softening by dynamic LH in monovalent salt conditions. We find that divalent ions produce a fiber stiffening effect that competes with, but does not overshadow, the dramatic softening triggered by dynamic-LH behavior. Indeed, we find that in typical in vivo conditions, dynamic-LH binding/unbinding reduces fiber stiffening dramatically (by a factor of almost 5, as measured by the elasticity modulus) compared with rigidly fixed LH, and also the force needed to initiate chromatin unfolding, making it consistent with those of molecular motors. Our data also show that, during unfolding, divalent ions together with LHs induce linker-DNA bending and DNA–DNA repulsion screening, which guarantee formation of heteromorphic superbeads-on-a-string structures that combine regions of loose and compact fiber independently of the characteristics of the LH–core bond. These structures might be important for gene regulation as they expose regions of the DNA selectively. Dynamic control of LH binding/unbinding, either globally or locally, in the presence of divalent ions, might constitute a mechanism for regulation of gene expression. PMID:22790986

  9. Programmable Modulation of Copper Nanoclusters Electrochemiluminescence via DNA Nanocranes for Ultrasensitive Detection of microRNA.

    PubMed

    Zhou, Ying; Wang, Haijun; Zhang, Han; Chai, Yaqin; Yuan, Ruo

    2018-03-06

    The DNA nanocrane with functionalized manipulator and fixed-size base offered a programmable approach to modulate the luminous efficiency of copper nanoclusters (Cu NCs) for achieving remarkable electrochemiluminescence (ECL) enhancement, further the Cu NCs as signal label was constructed in biosensor for ultrasensitive detection of microRNA-155. Herein, the DNA nanocrane was first constructed by combining binding-induced DNA assembly as manipulator and tetrahedral DNA nanostructure (TDN) as base, which harnessed a small quantity of specific target (microRNA (miRNA)-155) binding to trigger assembly of separate DNA components for producing numerous AT-rich double-stranded DNA (dsDNA) on the vertex of TDN. Upon the incubation of Cu 2+ on the AT-rich dsDNA, each DNA-stabilized Cu NCs probe could be in situ electrochemically generated on an individual TDN owing to the A-Cu 2+ -T bond. Thus, the generation of Cu NCs was highly regulated with AT-rich dsDNA as the template, and its lateral distance was tuned by the TDN size, which were two key factors to influence the luminous efficiency of Cu NCs. By coordinate modulation, the detection limit of the ultrasensitive biosensor for miRNA-155 down to 36 aM and the programmable modulation strategy paved the way for comprehensive applications of DNA nanomachines and metal nanoclusters in biosensing and clinical diagnosis.

  10. Sulforaphane inhibits TNF-α-induced adhesion molecule expression through the Rho A/ROCK/NF-κB signaling pathway.

    PubMed

    Hung, Chi-Nan; Huang, Hui-Pei; Wang, Chau-Jong; Liu, Kai-Li; Lii, Chong-Kuei

    2014-10-01

    Endothelial dysfunction is an early indicator of cardiovascular diseases. Increased stimulation of tumor necrosis factor-α (TNF-α) triggers the inflammatory mediator secretion of endothelial cells, leading to atherosclerotic risk. In this study, we investigated whether sulforaphane (SFN) affected the expression of intracellular adhesion molecule-1 (ICAM-1) in TNF-α-induced ECV 304 endothelial cells. Our data showed that SFN attenuated TNF-α-induced expression of ICAM-1 in ECV 304 cells. Pretreatment of ECV 304 cells with SFN inhibited dose-dependently the secretion of proinflammatory cytokines, such as interleukin (IL)-1β, IL-6, and IL-8. SFN inhibited TNF-α-induced nuclear factor-κB (NF-κB) DNA binding activity. Furthermore, SFN decreased TNF-α-mediated phosphorylation of IκB kinase (IKK) and IκBα, Rho A, ROCK, ERK1/2, and plasminogen activator inhibitor-1 (PAI-1) levels. Collectively, SFN inhibited the NF-κB DNA binding activity and downregulated the TNF-α-mediated induction of ICAM-1 in endothelial cells by inhibiting the Rho A/ROCK/NF-κB signaling pathway, suggesting the beneficial effects of SFN on suppression of inflammation within the atherosclerotic lesion.

  11. Viral unmasking of cellular 5S rRNA pseudogene transcripts induces RIG-I-mediated immunity.

    PubMed

    Chiang, Jessica J; Sparrer, Konstantin M J; van Gent, Michiel; Lässig, Charlotte; Huang, Teng; Osterrieder, Nikolaus; Hopfner, Karl-Peter; Gack, Michaela U

    2018-01-01

    The sensor RIG-I detects double-stranded RNA derived from RNA viruses. Although RIG-I is also known to have a role in the antiviral response to DNA viruses, physiological RNA species recognized by RIG-I during infection with a DNA virus are largely unknown. Using next-generation RNA sequencing (RNAseq), we found that host-derived RNAs, most prominently 5S ribosomal RNA pseudogene 141 (RNA5SP141), bound to RIG-I during infection with herpes simplex virus 1 (HSV-1). Infection with HSV-1 induced relocalization of RNA5SP141 from the nucleus to the cytoplasm, and virus-induced shutoff of host protein synthesis downregulated the abundance of RNA5SP141-interacting proteins, which allowed RNA5SP141 to bind RIG-I and induce the expression of type I interferons. Silencing of RNA5SP141 strongly dampened the antiviral response to HSV-1 and the related virus Epstein-Barr virus (EBV), as well as influenza A virus (IAV). Our findings reveal that antiviral immunity can be triggered by host RNAs that are unshielded following depletion of their respective binding proteins by the virus.

  12. Estrogen receptor accessory proteins augment receptor-DNA interaction and DNA bending.

    PubMed

    Landel, C C; Potthoff, S J; Nardulli, A M; Kushner, P J; Greene, G L

    1997-01-01

    Increasing evidence suggests that accessory proteins play an important role in the ability of the estrogen receptor (ER) and other nuclear hormone receptors to modulate transcription when bound to cis-acting hormone response elements in target genes. We have previously shown that four proteins, hsp70, protein disulfide isomerase (PDI) and two unknown proteins (p48 and p45), copurify with ER that has been isolated by site-specific DNA chromatography (BERE) and influence the interaction of ER with DNA in vitro. To better define the nature of these effects, we used filter binding and electrophoretic mobility shift assays to study the ability of these proteins to alter the kinetics of ER-DNA interaction and to influence the ability of ER to bend DNA when bound to an estrogen response element (ERE). The results of both assays indicate that ERE-purified ER, with its four associated proteins (hsp70, PDI, p48, p45), has a greater ability to bind to the vitellogenin A2 ERE than ER purified by estradiol-Sepharose chromatography in the absence (ESeph) or presence (EATP) of ATP, in which p48, p45 (ESeph) and hsp70 (EATP) are removed. Surprisingly, the rates of association and dissociation of ER and ERE were essentially the same for all three mixtures, suggesting that one or more ER-associated proteins, especially p45 and p48, may be required for ER to attain maximum DNA binding activity. In addition, circular permutation and phasing analyses demonstrated that the same ER-associated proteins produced higher order ER-DNA complexes that significantly increased the magnitude of DNA distortion, but did not alter the direction of the ER-induced bend of ERE-containing DNA fragments, which was toward the major groove of the DNA helix. These results suggest that p45 and/or p48 and possibly hsp70, play an important role both in the specific DNA binding and bending activities of ER and thus contribute to the overall stimulation of transcription in target genes that contain cis-acting EREs.

  13. New paradigms in the repair of oxidative damage in human genome: mechanisms ensuring repair of mutagenic base lesions during replication and involvement of accessory proteins.

    PubMed

    Dutta, Arijit; Yang, Chunying; Sengupta, Shiladitya; Mitra, Sankar; Hegde, Muralidhar L

    2015-05-01

    Oxidized bases in the mammalian genome, which are invariably mutagenic due to their mispairing property, are continuously induced by endogenous reactive oxygen species and more abundantly after oxidative stress. Unlike bulky base adducts induced by UV and other environmental mutagens in the genome that block replicative DNA polymerases, oxidatively damaged bases such as 5-hydroxyuracil, produced by oxidative deamination of cytosine in the template strand, do not block replicative polymerases and thus need to be repaired prior to replication to prevent mutation. Following up our earlier studies, which showed that the Nei endonuclease VIII like 1 (NEIL1) DNA glycosylase, one of the five base excision repair (BER)-initiating enzymes in mammalian cells, has enhanced expression during the S-phase and higher affinity for replication fork-mimicking single-stranded (ss) DNA substrates, we recently provided direct experimental evidence for NEIL1's role in replicating template strand repair. The key requirement for this event, which we named as the 'cow-catcher' mechanism of pre-replicative BER, is NEIL1's non-productive binding (substrate binding without product formation) to the lesion base in ss DNA template to stall DNA synthesis, causing fork regression. Repair of the lesion in reannealed duplex is then carried out by NEIL1 in association with the DNA replication proteins. NEIL1 (and other BER-initiating enzymes) also interact with several accessory and non-canonical proteins including the heterogeneous nuclear ribonucleoprotein U and Y-box-binding protein 1 as well as high mobility group box 1 protein, whose precise roles in BER are still obscure. In this review, we have discussed the recent advances in our understanding of oxidative genome damage repair pathways with particular focus on the pre-replicative template strand repair and the role of scaffold factors like X-ray repairs cross-complementing protein 1 and poly (ADP-ribose) polymerase 1 and other accessory proteins guiding distinct BER sub-pathways.

  14. Isolation from genomic DNA of sequences binding specific regulatory proteins by the acceleration of protein electrophoretic mobility upon DNA binding.

    PubMed

    Subrahmanyam, S; Cronan, J E

    1999-01-21

    We report an efficient and flexible in vitro method for the isolation of genomic DNA sequences that are the binding targets of a given DNA binding protein. This method takes advantage of the fact that binding of a protein to a DNA molecule generally increases the rate of migration of the protein in nondenaturing gel electrophoresis. By the use of a radioactively labeled DNA-binding protein and nonradioactive DNA coupled with PCR amplification from gel slices, we show that specific binding sites can be isolated from Escherichia coli genomic DNA. We have applied this method to isolate a binding site for FadR, a global regulator of fatty acid metabolism in E. coli. We have also isolated a second binding site for BirA, the biotin operon repressor/biotin ligase, from the E. coli genome that has a very low binding efficiency compared with the bio operator region.

  15. DHX9 helicase is involved in preventing genomic instability induced by alternatively structured DNA in human cells

    PubMed Central

    Jain, Aklank; Bacolla, Albino; del Mundo, Imee M.; Zhao, Junhua; Wang, Guliang; Vasquez, Karen M.

    2013-01-01

    Sequences that have the capacity to adopt alternative (i.e. non-B) DNA structures in the human genome have been implicated in stimulating genomic instability. Previously, we found that a naturally occurring intra-molecular triplex (H-DNA) caused genetic instability in mammals largely in the form of DNA double-strand breaks. Thus, it is of interest to determine the mechanism(s) involved in processing H-DNA. Recently, we demonstrated that human DHX9 helicase preferentially unwinds inter-molecular triplex DNA in vitro. Herein, we used a mutation-reporter system containing H-DNA to examine the relevance of DHX9 activity on naturally occurring H-DNA structures in human cells. We found that H-DNA significantly increased mutagenesis in small-interfering siRNA-treated, DHX9-depleted cells, affecting mostly deletions. Moreover, DHX9 associated with H-DNA in the context of supercoiled plasmids. To further investigate the role of DHX9 in the recognition/processing of H-DNA, we performed binding assays in vitro and chromatin immunoprecipitation assays in U2OS cells. DHX9 recognized H-DNA, as evidenced by its binding to the H-DNA structure and enrichment at the H-DNA region compared with a control region in human cells. These composite data implicate DHX9 in processing H-DNA structures in vivo and support its role in the overall maintenance of genomic stability at sites of alternatively structured DNA. PMID:24049074

  16. DHX9 helicase is involved in preventing genomic instability induced by alternatively structured DNA in human cells.

    PubMed

    Jain, Aklank; Bacolla, Albino; Del Mundo, Imee M; Zhao, Junhua; Wang, Guliang; Vasquez, Karen M

    2013-12-01

    Sequences that have the capacity to adopt alternative (i.e. non-B) DNA structures in the human genome have been implicated in stimulating genomic instability. Previously, we found that a naturally occurring intra-molecular triplex (H-DNA) caused genetic instability in mammals largely in the form of DNA double-strand breaks. Thus, it is of interest to determine the mechanism(s) involved in processing H-DNA. Recently, we demonstrated that human DHX9 helicase preferentially unwinds inter-molecular triplex DNA in vitro. Herein, we used a mutation-reporter system containing H-DNA to examine the relevance of DHX9 activity on naturally occurring H-DNA structures in human cells. We found that H-DNA significantly increased mutagenesis in small-interfering siRNA-treated, DHX9-depleted cells, affecting mostly deletions. Moreover, DHX9 associated with H-DNA in the context of supercoiled plasmids. To further investigate the role of DHX9 in the recognition/processing of H-DNA, we performed binding assays in vitro and chromatin immunoprecipitation assays in U2OS cells. DHX9 recognized H-DNA, as evidenced by its binding to the H-DNA structure and enrichment at the H-DNA region compared with a control region in human cells. These composite data implicate DHX9 in processing H-DNA structures in vivo and support its role in the overall maintenance of genomic stability at sites of alternatively structured DNA.

  17. The helical structure of DNA facilitates binding

    NASA Astrophysics Data System (ADS)

    Berg, Otto G.; Mahmutovic, Anel; Marklund, Emil; Elf, Johan

    2016-09-01

    The helical structure of DNA imposes constraints on the rate of diffusion-limited protein binding. Here we solve the reaction-diffusion equations for DNA-like geometries and extend with simulations when necessary. We find that the helical structure can make binding to the DNA more than twice as fast compared to a case where DNA would be reactive only along one side. We also find that this rate advantage remains when the contributions from steric constraints and rotational diffusion of the DNA-binding protein are included. Furthermore, we find that the association rate is insensitive to changes in the steric constraints on the DNA in the helix geometry, while it is much more dependent on the steric constraints on the DNA-binding protein. We conclude that the helical structure of DNA facilitates the nonspecific binding of transcription factors and structural DNA-binding proteins in general.

  18. Coupled binding-bending-folding: The complex conformational dynamics of protein-DNA binding studied by atomistic molecular dynamics simulations.

    PubMed

    van der Vaart, Arjan

    2015-05-01

    Protein-DNA binding often involves dramatic conformational changes such as protein folding and DNA bending. While thermodynamic aspects of this behavior are understood, and its biological function is often known, the mechanism by which the conformational changes occur is generally unclear. By providing detailed structural and energetic data, molecular dynamics simulations have been helpful in elucidating and rationalizing protein-DNA binding. This review will summarize recent atomistic molecular dynamics simulations of the conformational dynamics of DNA and protein-DNA binding. A brief overview of recent developments in DNA force fields is given as well. Simulations have been crucial in rationalizing the intrinsic flexibility of DNA, and have been instrumental in identifying the sequence of binding events, the triggers for the conformational motion, and the mechanism of binding for a number of important DNA-binding proteins. Molecular dynamics simulations are an important tool for understanding the complex binding behavior of DNA-binding proteins. With recent advances in force fields and rapid increases in simulation time scales, simulations will become even more important for future studies. This article is part of a Special Issue entitled Recent developments of molecular dynamics. Copyright © 2014. Published by Elsevier B.V.

  19. Mechanism of Action of Novel Antiproliferative Oligonucleotides

    DTIC Science & Technology

    2002-05-01

    DNA replication , cell cycle regulation, and apoptosis, the overall goal of this study was to identify the functions of nucleolin that are affected by GRO binding. After the first year of this study, several significant results have emerged. We have shown that GROs cause cell cycle arrest and induce apoptosis in prostate cancer cells but not normal skin cells, and that this arrest is due to specific inhibition of DNA replication . We have further shown that the inhibition of DNA replication may be linked to the ability of GROs to

  20. Identification of transactivation-responsive DNA-binding protein 43 (TARDBP43; TDP-43) as a novel factor for TNF-α expression upon lipopolysaccharide stimulation in human monocytes.

    PubMed

    Murata, H; Hattori, T; Maeda, H; Takashiba, S; Takigawa, M; Kido, J; Nagata, T

    2015-08-01

    Tumor necrosis factor alpha (TNF-α) is a major cytokine implicated in various inflammatory diseases. The nature of the nuclear factors associated with human TNF-α gene regulation is not well elucidated. We previously identified a novel region located from -550 to -487 in human TNF-α promoter that did not contain the reported binding sites for nuclear factor kappa B (NF-κB) but showed lipopolysaccharide (LPS)-induced transcriptional activity. The purpose of this study is to identify novel factors that bind to the promoter region and regulate TNF-α expression. To identify DNA-binding proteins that bound to the target region of TNF-α promoter, a cDNA library from LPS-stimulated human monocytic cell line THP-1 was screened using a yeast one-hybrid system. Cellular localizations of the DNA-binding protein in the cells were examined by subcellular immunocytochemistry. Nuclear amounts of the protein in LPS-stimulated THP-1 cells were identified by western blot analysis. Expression of mRNA of the protein in the cells was quantified by real-time polymerase chain reaction. Electrophoretic mobility shift assays were performed to confirm the DNA-binding profile. Overexpression of the protein and knockdown of the gene were also performed to investigate the role for TNF-α expression. Several candidates were identified from the cDNA library and transactivation-responsive DNA-binding protein 43 (TARDBP43; TDP-43) was focused on. Western blot analysis revealed that nuclear TDP-43 protein was increased in the LPS-stimulated THP-1 cells. Expression of TDP-43 mRNA was already enhanced before TNF-α induction by LPS. Electrophoretic mobility shift assay analysis showed that nuclear extracts obtained by overexpressing FLAG-tagged TDP-43 bound to the -550 to -487 TNF-α promoter fragments. Overexpression of TDP-43 in THP-1 cells resulted in an increase of TNF-α expression. Knockdown of TDP-43 in THP-1 cells downregulated TNF-α expression. We identified TDP-43 as one of the novel TNF-α factors and found that it bound to the LPS-responsive element in the TNF-α promoter to increase TNF-α expression. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. Suppression of grp78 core promoter element-mediated stress induction by the dbpA and dbpB (YB-1) cold shock domain proteins.

    PubMed Central

    Li, W W; Hsiung, Y; Wong, V; Galvin, K; Zhou, Y; Shi, Y; Lee, A S

    1997-01-01

    The highly conserved grp78 core promoter element plays an important role in the induction of grp78 under diverse stress signals. Previous studies have established a functional region in the 3' half of the core (stress-inducible change region [SICR]) which exhibits stress-inducible changes in stressed nuclei. The human transcription factor YY1 is shown to bind the SICR and transactivate the core element under stress conditions. Here we report that expression library screening with the core element has identified two new core binding proteins, YB-1 and dbpA. Both proteins belong to the Y-box family of proteins characterized by an evolutionarily conserved DNA binding motif, the cold shock domain (CSD). In contrast to YY1, which binds only double-stranded SICR, the Y-box/CSD proteins much prefer the lower strand of the SICR. The Y-box proteins can repress the inducibility of the grp78 core element mediated by treatment of cells with A23187, thapsigargin, and tunicamycin. In gel shift assays, YY1 binding to the core element is inhibited by either YB-1 or dbpA. A yeast interaction trap screen using LexA-YY1 as a bait and a HeLa cell cDNA-acid patch fusion library identified YB-1 as a YY1-interacting protein. In cotransfection experiments, the Y-box proteins antagonize the YY1-mediated enhancement of transcription directed by the grp78 core in stressed cells. Thus, the CSD proteins may be part of the stress signal transduction mechanism in the mammalian system. PMID:8972186

  2. Genome-wide profiling identifies a subset of methamphetamine (METH)-induced genes associated with METH-induced increased H4K5Ac binding in the rat striatum

    PubMed Central

    2013-01-01

    Background METH is an illicit drug of abuse that influences gene expression in the rat striatum. Histone modifications regulate gene transcription. Methods We therefore used microarray analysis and genome-scale approaches to examine potential relationships between the effects of METH on gene expression and on DNA binding of histone H4 acetylated at lysine 4 (H4K5Ac) in the rat dorsal striatum of METH-naïve and METH-pretreated rats. Results Acute and chronic METH administration caused differential changes in striatal gene expression. METH also increased H4K5Ac binding around the transcriptional start sites (TSSs) of genes in the rat striatum. In order to relate gene expression to histone acetylation, we binned genes of similar expression into groups of 100 genes and proceeded to relate gene expression to H4K5Ac binding. We found a positive correlation between gene expression and H4K5Ac binding in the striatum of control rats. Similar correlations were observed in METH-treated rats. Genes that showed acute METH-induced increased expression in saline-pretreated rats also showed METH-induced increased H4K5Ac binding. The acute METH injection caused similar increases in H4K5Ac binding in METH-pretreated rats, without affecting gene expression to the same degree. Finally, genes that showed METH-induced decreased expression exhibited either decreases or no changes in H4K5Ac binding. Conclusion Acute METH injections caused increased gene expression of genes that showed increased H4K5Ac binding near their transcription start sites. PMID:23937714

  3. Genome-wide profiling identifies a subset of methamphetamine (METH)-induced genes associated with METH-induced increased H4K5Ac binding in the rat striatum.

    PubMed

    Cadet, Jean Lud; Jayanthi, Subramaniam; McCoy, Michael T; Ladenheim, Bruce; Saint-Preux, Fabienne; Lehrmann, Elin; De, Supriyo; Becker, Kevin G; Brannock, Christie

    2013-08-12

    METH is an illicit drug of abuse that influences gene expression in the rat striatum. Histone modifications regulate gene transcription. We therefore used microarray analysis and genome-scale approaches to examine potential relationships between the effects of METH on gene expression and on DNA binding of histone H4 acetylated at lysine 4 (H4K5Ac) in the rat dorsal striatum of METH-naïve and METH-pretreated rats. Acute and chronic METH administration caused differential changes in striatal gene expression. METH also increased H4K5Ac binding around the transcriptional start sites (TSSs) of genes in the rat striatum. In order to relate gene expression to histone acetylation, we binned genes of similar expression into groups of 100 genes and proceeded to relate gene expression to H4K5Ac binding. We found a positive correlation between gene expression and H4K5Ac binding in the striatum of control rats. Similar correlations were observed in METH-treated rats. Genes that showed acute METH-induced increased expression in saline-pretreated rats also showed METH-induced increased H4K5Ac binding. The acute METH injection caused similar increases in H4K5Ac binding in METH-pretreated rats, without affecting gene expression to the same degree. Finally, genes that showed METH-induced decreased expression exhibited either decreases or no changes in H4K5Ac binding. Acute METH injections caused increased gene expression of genes that showed increased H4K5Ac binding near their transcription start sites.

  4. Quantification of transcription factor-DNA binding affinity in a living cell

    PubMed Central

    Belikov, Sergey; Berg, Otto G.; Wrange, Örjan

    2016-01-01

    The apparent dissociation constant (Kd) for specific binding of glucocorticoid receptor (GR) and androgen receptor (AR) to DNA was determined in vivo in Xenopus oocytes. The total nuclear receptor concentration was quantified as specifically retained [3H]-hormone in manually isolated oocyte nuclei. DNA was introduced by nuclear microinjection of single stranded phagemid DNA, chromatin is then formed during second strand synthesis. The fraction of DNA sites occupied by the expressed receptor was determined by dimethylsulphate in vivo footprinting and used for calculation of the receptor-DNA binding affinity. The forkhead transcription factor FoxA1 enhanced the DNA binding by GR with an apparent Kd of ∼1 μM and dramatically stimulated DNA binding by AR with an apparent Kd of ∼0.13 μM at a composite androgen responsive DNA element containing one FoxA1 binding site and one palindromic hormone receptor binding site known to bind one receptor homodimer. FoxA1 exerted a weak constitutive- and strongly cooperative DNA binding together with AR but had a less prominent effect with GR, the difference reflecting the licensing function of FoxA1 at this androgen responsive DNA element. PMID:26657626

  5. Chemo-mechanical pushing of proteins along single-stranded DNA

    PubMed Central

    Sokoloski, Joshua E.; Kozlov, Alexander G.; Galletto, Roberto; Lohman, Timothy M.

    2016-01-01

    Single-stranded (ss)DNA binding (SSB) proteins bind with high affinity to ssDNA generated during DNA replication, recombination, and repair; however, these SSBs must eventually be displaced from or reorganized along the ssDNA. One potential mechanism for reorganization is for an ssDNA translocase (ATP-dependent motor) to push the SSB along ssDNA. Here we use single molecule total internal reflection fluorescence microscopy to detect such pushing events. When Cy5-labeled Escherichia coli (Ec) SSB is bound to surface-immobilized 3′-Cy3–labeled ssDNA, a fluctuating FRET signal is observed, consistent with random diffusion of SSB along the ssDNA. Addition of Saccharomyces cerevisiae Pif1, a 5′ to 3′ ssDNA translocase, results in the appearance of isolated, irregularly spaced saw-tooth FRET spikes only in the presence of ATP. These FRET spikes result from translocase-induced directional (5′ to 3′) pushing of the SSB toward the 3′ ssDNA end, followed by displacement of the SSB from the DNA end. Similar ATP-dependent pushing events, but in the opposite (3′ to 5′) direction, are observed with EcRep and EcUvrD (both 3′ to 5′ ssDNA translocases). Simulations indicate that these events reflect active pushing by the translocase. The ability of translocases to chemo-mechanically push heterologous SSB proteins along ssDNA provides a potential mechanism for reorganization and clearance of tightly bound SSBs from ssDNA. PMID:27185951

  6. Modulation of the Pyrococcus abyssi NucS Endonuclease Activity by Replication Clamp at Functional and Structural Levels*

    PubMed Central

    Creze, Christophe; Ligabue, Alessio; Laurent, Sébastien; Lestini, Roxane; Laptenok, Sergey P.; Khun, Joelle; Vos, Marten H.; Czjzek, Mirjam; Myllykallio, Hannu; Flament, Didier

    2012-01-01

    Pyrococcus abyssi NucS is the founding member of a new family of structure-specific DNA endonucleases that interact with the replication clamp proliferating cell nuclear antigen (PCNA). Using a combination of small angle x-ray scattering and surface plasmon resonance analyses, we demonstrate the formation of a stable complex in solution, in which one molecule of the PabNucS homodimer binds to the outside surface of the PabPCNA homotrimer. Using fluorescent labels, PCNA is shown to increase the binding affinity of NucS toward single-strand/double-strand junctions on 5′ and 3′ flaps, as well as to modulate the cleavage specificity on the branched DNA structures. Our results indicate that the presence of a single major contact between the PabNucS and PabPCNA proteins, together with the complex-induced DNA bending, facilitate conformational flexibility required for specific cleavage at the single-strand/double-strand DNA junction. PMID:22431731

  7. Modulation of the Pyrococcus abyssi NucS endonuclease activity by replication clamp at functional and structural levels.

    PubMed

    Creze, Christophe; Ligabue, Alessio; Laurent, Sébastien; Lestini, Roxane; Laptenok, Sergey P; Khun, Joelle; Vos, Marten H; Czjzek, Mirjam; Myllykallio, Hannu; Flament, Didier

    2012-05-04

    Pyrococcus abyssi NucS is the founding member of a new family of structure-specific DNA endonucleases that interact with the replication clamp proliferating cell nuclear antigen (PCNA). Using a combination of small angle x-ray scattering and surface plasmon resonance analyses, we demonstrate the formation of a stable complex in solution, in which one molecule of the PabNucS homodimer binds to the outside surface of the PabPCNA homotrimer. Using fluorescent labels, PCNA is shown to increase the binding affinity of NucS toward single-strand/double-strand junctions on 5' and 3' flaps, as well as to modulate the cleavage specificity on the branched DNA structures. Our results indicate that the presence of a single major contact between the PabNucS and PabPCNA proteins, together with the complex-induced DNA bending, facilitate conformational flexibility required for specific cleavage at the single-strand/double-strand DNA junction.

  8. Regulation of chromatin organization and inducible gene expression by a Drosophila insulator

    PubMed Central

    Wood, Ashley M.; Van Bortle, Kevin; Ramos, Edward; Takenaka, Naomi; Rohrbaugh, Margaret; Jones, Brian C.; Jones, Keith C.; Corces, Victor G.

    2011-01-01

    SUMMARY Insulators are multi-protein-DNA complexes thought to affect gene expression by mediating inter- and intra-chromosomal interactions. Drosophila insulators contain specific DNA binding proteins plus common components, such as CP190, that facilitate these interactions. Here we examine changes in the distribution of Drosophila insulator proteins during the heat-shock and ecdysone responses. We find that CP190 recruitment to insulator sites is the main regulatable step in controlling insulator function during heat shock. In contrast, both CP190 and DNA binding protein recruitment are regulated during the ecdysone response. CP190 is necessary to stabilize specific chromatin loops and for proper activation of transcription of genes regulated by this hormone. These findings suggest that cells may regulate recruitment of insulator proteins to the DNA in order to activate insulator activity at specific sites and create distinct patterns of nuclear organization that are necessary to achieve proper gene expression in response to different stimuli. PMID:21981916

  9. Regulation of chromatin organization and inducible gene expression by a Drosophila insulator.

    PubMed

    Wood, Ashley M; Van Bortle, Kevin; Ramos, Edward; Takenaka, Naomi; Rohrbaugh, Margaret; Jones, Brian C; Jones, Keith C; Corces, Victor G

    2011-10-07

    Insulators are multiprotein-DNA complexes thought to affect gene expression by mediating inter- and intrachromosomal interactions. Drosophila insulators contain specific DNA-binding proteins plus common components, such as CP190, that facilitate these interactions. Here, we examine changes in the distribution of Drosophila insulator proteins during the heat-shock and ecdysone responses. We find that CP190 recruitment to insulator sites is the main regulatable step in controlling insulator function during heat shock. In contrast, both CP190 and DNA-binding protein recruitment are regulated during the ecdysone response. CP190 is necessary to stabilize specific chromatin loops and for proper activation of transcription of genes regulated by this hormone. These findings suggest that cells may regulate recruitment of insulator proteins to DNA to activate insulator activity at specific sites and create distinct patterns of nuclear organization that are necessary to achieve proper gene expression in response to different stimuli. Copyright © 2011 Elsevier Inc. All rights reserved.

  10. Non-coding RNA generated following lariat-debranching mediates targeting of AID to DNA

    PubMed Central

    Zheng, Simin; Vuong, Bao Q.; Vaidyanathan, Bharat; Lin, Jia-Yu; Huang, Feng-Ting; Chaudhuri, Jayanta

    2015-01-01

    SUMMARY Transcription through immunoglobulin switch (S) regions is essential for class switch recombination (CSR) but no molecular function of the transcripts has been described. Likewise, recruitment of activation-induced cytidine deaminase (AID) to S regions is critical for CSR; however, the underlying mechanism has not been fully elucidated. Here, we demonstrate that intronic switch RNA acts in trans to target AID to S region DNA. AID binds directly to switch RNA through G-quadruplexes formed by the RNA molecules. Disruption of this interaction by mutation of a key residue in the putative RNA-binding domain of AID impairs recruitment of AID to S region DNA, thereby abolishing CSR. Additionally, inhibition of RNA lariat processing leads to loss of AID localization to S regions and compromises CSR; both defects can be rescued by exogenous expression of switch transcripts in a sequence-specific manner. These studies uncover an RNA-mediated mechanism of targeting AID to DNA. PMID:25957684

  11. IDN2 Interacts with RPA and Facilitates DNA Double-Strand Break Repair by Homologous Recombination in Arabidopsis.

    PubMed

    Liu, Mingming; Ba, Zhaoqing; Costa-Nunes, Pedro; Wei, Wei; Li, Lanxia; Kong, Fansi; Li, Yan; Chai, Jijie; Pontes, Olga; Qi, Yijun

    2017-03-01

    Repair of DNA double-strand breaks (DSBs) is critical for the maintenance of genome integrity. We previously showed that DSB-induced small RNAs (diRNAs) facilitate homologous recombination-mediated DSB repair in Arabidopsis thaliana Here, we show that INVOLVED IN DE NOVO2 (IDN2), a double-stranded RNA binding protein involved in small RNA-directed DNA methylation, is required for DSB repair in Arabidopsis. We find that IDN2 interacts with the heterotrimeric replication protein A (RPA) complex. Depletion of IDN2 or the diRNA binding ARGONAUTE2 leads to increased accumulation of RPA at DSB sites and mislocalization of the recombination factor RAD51. These findings support a model in which IDN2 interacts with RPA and facilitates the release of RPA from single-stranded DNA tails and subsequent recruitment of RAD51 at DSB sites to promote DSB repair. © 2017 American Society of Plant Biologists. All rights reserved.

  12. Streptococcus pneumoniae secretes hydrogen peroxide leading to DNA damage and apoptosis in lung cells.

    PubMed

    Rai, Prashant; Parrish, Marcus; Tay, Ian Jun Jie; Li, Na; Ackerman, Shelley; He, Fang; Kwang, Jimmy; Chow, Vincent T; Engelward, Bevin P

    2015-06-30

    Streptococcus pneumoniae is a leading cause of pneumonia and one of the most common causes of death globally. The impact of S. pneumoniae on host molecular processes that lead to detrimental pulmonary consequences is not fully understood. Here, we show that S. pneumoniae induces toxic DNA double-strand breaks (DSBs) in human alveolar epithelial cells, as indicated by ataxia telangiectasia mutated kinase (ATM)-dependent phosphorylation of histone H2AX and colocalization with p53-binding protein (53BP1). Furthermore, results show that DNA damage occurs in a bacterial contact-independent fashion and that Streptococcus pyruvate oxidase (SpxB), which enables synthesis of H2O2, plays a critical role in inducing DSBs. The extent of DNA damage correlates with the extent of apoptosis, and DNA damage precedes apoptosis, which is consistent with the time required for execution of apoptosis. Furthermore, addition of catalase, which neutralizes H2O2, greatly suppresses S. pneumoniae-induced DNA damage and apoptosis. Importantly, S. pneumoniae induces DSBs in the lungs of animals with acute pneumonia, and H2O2 production by S. pneumoniae in vivo contributes to its genotoxicity and virulence. One of the major DSBs repair pathways is nonhomologous end joining for which Ku70/80 is essential for repair. We find that deficiency of Ku80 causes an increase in the levels of DSBs and apoptosis, underscoring the importance of DNA repair in preventing S. pneumoniae-induced genotoxicity. Taken together, this study shows that S. pneumoniae-induced damage to the host cell genome exacerbates its toxicity and pathogenesis, making DNA repair a potentially important susceptibility factor in people who suffer from pneumonia.

  13. Effects of SCFA on the DNA methylation pattern of adiponectin and resistin in high-fat-diet-induced obese male mice.

    PubMed

    Lu, Yuanyuan; Fan, Chaonan; Liang, Aimin; Fan, Xiuqin; Wang, Rui; Li, Ping; Qi, Kemin

    2018-06-21

    Specific adipokines, such as adiponectin and resistin, are secreted from adipose tissue and are associated with the development of obesity. Supplementation of dietary SCFA can prevent and reverse high-fat-diet (HFD)-induced obesity. However, it is not clear whether SCFA ameliorate abnormal expression of adiponectin and resistin in the obese state. The aim of this study was to investigate the effects of SCFA on adiponectin and resistin's expressions in diet-induced obese mice, as well as the potential mechanisms associated with DNA methylation. C57BL/6J male mice were fed for 16 weeks with five types of HFD (34·9 % fat by wt., 60 % kJ) - a control HFD and four HFD with acetate (HFD-A), propionate (HFD-P), butyrate (HFD-B) and their admixture (HFD-SCFA). Meanwhile, a low-fat diet (4·3 % fat by wt., 10 % kJ) was used as the control group. The reduced mRNA levels of adiponectin and resistin in the adipose tissue of the HFD-fed mice were significantly reversed by dietary supplementation of acetate, propionate, butyrate or their admixture to the HFD. Moreover, the expressional changes of adiponectin and resistin induced by SCFA were associated with alterations in DNA methylation at their promoters, which was mediated by reducing the expressions of enzyme-catalysed DNA methyltransferase (DNMT1, 3a, 3b) and the methyl-CpG-binding domain protein 2 (MBD2) and suppressing the binding of these enzymes to the promoters of adiponectin and resistin. Our results indicate that SCFA may correct aberrant expressions of adiponectin and resistin in obesity by epigenetic regulation.

  14. Sequence Dependent Interactions Between DNA and Single-Walled Carbon Nanotubes

    NASA Astrophysics Data System (ADS)

    Roxbury, Daniel

    It is known that single-stranded DNA adopts a helical wrap around a single-walled carbon nanotube (SWCNT), forming a water-dispersible hybrid molecule. The ability to sort mixtures of SWCNTs based on chirality (electronic species) has recently been demonstrated using special short DNA sequences that recognize certain matching SWCNTs of specific chirality. This thesis investigates the intricacies of DNA-SWCNT sequence-specific interactions through both experimental and molecular simulation studies. The DNA-SWCNT binding strengths were experimentally quantified by studying the kinetics of DNA replacement by a surfactant on the surface of particular SWCNTs. Recognition ability was found to correlate strongly with measured binding strength, e.g. DNA sequence (TAT)4 was found to bind 20 times stronger to the (6,5)-SWCNT than sequence (TAT)4T. Next, using replica exchange molecular dynamics (REMD) simulations, equilibrium structures formed by (a) single-strands and (b) multiple-strands of 12-mer oligonucleotides adsorbed on various SWCNTs were explored. A number of structural motifs were discovered in which the DNA strand wraps around the SWCNT and 'stitches' to itself via hydrogen bonding. Great variability among equilibrium structures was observed and shown to be directly influenced by DNA sequence and SWCNT type. For example, the (6,5)-SWCNT DNA recognition sequence, (TAT)4, was found to wrap in a tight single-stranded right-handed helical conformation. In contrast, DNA sequence T12 forms a beta-barrel left-handed structure on the same SWCNT. These are the first theoretical indications that DNA-based SWCNT selectivity can arise on a molecular level. In a biomedical collaboration with the Mayo Clinic, pathways for DNA-SWCNT internalization into healthy human endothelial cells were explored. Through absorbance spectroscopy, TEM imaging, and confocal fluorescence microscopy, we showed that intracellular concentrations of SWCNTs far exceeded those of the incubation solution, which suggested an energy-dependent pathway. Additionally, by means of pharmacological inhibition and vector-induced gene knockout studies, the DNA-SWCNTs were shown to enter the cells via Rac1-mediated macropinocytosis.

  15. Increased global transcription activity as a mechanism of replication stress in cancer

    PubMed Central

    Kotsantis, Panagiotis; Silva, Lara Marques; Irmscher, Sarah; Jones, Rebecca M.; Folkes, Lisa; Gromak, Natalia; Petermann, Eva

    2016-01-01

    Cancer is a disease associated with genomic instability that often results from oncogene activation. This in turn leads to hyperproliferation and replication stress. However, the molecular mechanisms that underlie oncogene-induced replication stress are still poorly understood. Oncogenes such as HRASV12 promote proliferation by upregulating general transcription factors to stimulate RNA synthesis. Here we investigate whether this increase in transcription underlies oncogene-induced replication stress. We show that in cells overexpressing HRASV12, elevated expression of the general transcription factor TATA-box binding protein (TBP) leads to increased RNA synthesis, which together with R-loop accumulation results in replication fork slowing and DNA damage. Furthermore, overexpression of TBP alone causes the hallmarks of oncogene-induced replication stress, including replication fork slowing, DNA damage and senescence. Consequently, we reveal that increased transcription can be a mechanism of oncogene-induced DNA damage, providing a molecular link between upregulation of the transcription machinery and genomic instability in cancer. PMID:27725641

  16. Increased global transcription activity as a mechanism of replication stress in cancer.

    PubMed

    Kotsantis, Panagiotis; Silva, Lara Marques; Irmscher, Sarah; Jones, Rebecca M; Folkes, Lisa; Gromak, Natalia; Petermann, Eva

    2016-10-11

    Cancer is a disease associated with genomic instability that often results from oncogene activation. This in turn leads to hyperproliferation and replication stress. However, the molecular mechanisms that underlie oncogene-induced replication stress are still poorly understood. Oncogenes such as HRAS V12 promote proliferation by upregulating general transcription factors to stimulate RNA synthesis. Here we investigate whether this increase in transcription underlies oncogene-induced replication stress. We show that in cells overexpressing HRAS V12 , elevated expression of the general transcription factor TATA-box binding protein (TBP) leads to increased RNA synthesis, which together with R-loop accumulation results in replication fork slowing and DNA damage. Furthermore, overexpression of TBP alone causes the hallmarks of oncogene-induced replication stress, including replication fork slowing, DNA damage and senescence. Consequently, we reveal that increased transcription can be a mechanism of oncogene-induced DNA damage, providing a molecular link between upregulation of the transcription machinery and genomic instability in cancer.

  17. A role for the RNA pol II–associated PAF complex in AID-induced immune diversification

    PubMed Central

    Willmann, Katharina L.; Milosevic, Sara; Pauklin, Siim; Schmitz, Kerstin-Maike; Rangam, Gopinath; Simon, Maria T.; Maslen, Sarah; Skehel, Mark; Robert, Isabelle; Heyer, Vincent; Schiavo, Ebe; Reina-San-Martin, Bernardo

    2012-01-01

    Antibody diversification requires the DNA deaminase AID to induce DNA instability at immunoglobulin (Ig) loci upon B cell stimulation. For efficient cytosine deamination, AID requires single-stranded DNA and needs to gain access to Ig loci, with RNA pol II transcription possibly providing both aspects. To understand these mechanisms, we isolated and characterized endogenous AID-containing protein complexes from the chromatin of diversifying B cells. The majority of proteins associated with AID belonged to RNA polymerase II elongation and chromatin modification complexes. Besides the two core polymerase subunits, members of the PAF complex, SUPT5H, SUPT6H, and FACT complex associated with AID. We show that AID associates with RNA polymerase-associated factor 1 (PAF1) through its N-terminal domain, that depletion of PAF complex members inhibits AID-induced immune diversification, and that the PAF complex can serve as a binding platform for AID on chromatin. A model is emerging of how RNA polymerase II elongation and pausing induce and resolve AID lesions. PMID:23008333

  18. Monitoring ssDNA Binding to the DnaB Helicase from Helicobacter pylori by Solid-State NMR Spectroscopy.

    PubMed

    Wiegand, Thomas; Cadalbert, Riccardo; Gardiennet, Carole; Timmins, Joanna; Terradot, Laurent; Böckmann, Anja; Meier, Beat H

    2016-11-02

    DnaB helicases are bacterial, ATP-driven enzymes that unwind double-stranded DNA during DNA replication. Herein, we study the sequential binding of the "non-hydrolysable" ATP analogue AMP-PNP and of single-stranded (ss) DNA to the dodecameric DnaB helicase from Helicobacter pylori using solid-state NMR. Phosphorus cross-polarization experiments monitor the binding of AMP-PNP and DNA to the helicase. 13 C chemical-shift perturbations (CSPs) are used to detect conformational changes in the protein upon binding. The helicase switches upon AMP-PNP addition into a conformation apt for ssDNA binding, and AMP-PNP is hydrolyzed and released upon binding of ssDNA. Our study sheds light on the conformational changes which are triggered by the interaction with AMP-PNP and are needed for ssDNA binding of H. pylori DnaB in vitro. They also demonstrate the level of detail solid-state NMR can provide for the characterization of protein-DNA interactions and the interplay with ATP or its analogues. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. TLR9 Ligands Induce S100A8 in Macrophages via a STAT3-Dependent Pathway which Requires IL-10 and PGE2

    PubMed Central

    Hsu, Kenneth; Chung, Yuen Ming; Endoh, Yasumi; Geczy, Carolyn L.

    2014-01-01

    S100A8 and S100A9 are highly-expressed calcium-binding proteins in neutrophils and monocytes, and in subsets of macrophages in inflammatory lesions. Unmethylated CpG motifs found in bacterial and viral DNA are potent activators of innate immunity via Toll-like receptor 9 (TLR9). S100A8, but not S100A9, mRNA and protein was directly induced by CpG-DNA in murine and human macrophages. Induction in murine macrophages peaked at 16 h. CpG-DNA-induced S100A8 required de novo protein synthesis; IL-10 and Prostaglandin E2 (PGE2) synergistically enhanced expression and promoted earlier gene induction. Inhibitors of endogenous IL-10, PGE2, and the E prostanoid (EP) 4 receptor strongly suppressed S100A8 expression, particularly when combined. Thus, S100A8 induction by E. coli DNA required both IL-10 and PGE2/EP4 signaling. The MAPKs, PI3K and JAK pathways were essential, whereas ERK1/2 appeared to play a direct role. S100A8 induction by CpG-DNA was controlled at the transcriptional level. The promoter region responsible for activation, either directly, or indirectly via IL-10 and PGE2, was located within a −178 to −34-bp region and required STAT3 binding. Because of the robust links connecting IL-10 and PGE2 with an anti-inflammatory macrophage phenotype, the induction profile of S100A8 strongly indicates a role for this protein in resolution of inflammation. PMID:25098409

  20. TLR9 ligands induce S100A8 in macrophages via a STAT3-dependent pathway which requires IL-10 and PGE2.

    PubMed

    Hsu, Kenneth; Chung, Yuen Ming; Endoh, Yasumi; Geczy, Carolyn L

    2014-01-01

    S100A8 and S100A9 are highly-expressed calcium-binding proteins in neutrophils and monocytes, and in subsets of macrophages in inflammatory lesions. Unmethylated CpG motifs found in bacterial and viral DNA are potent activators of innate immunity via Toll-like receptor 9 (TLR9). S100A8, but not S100A9, mRNA and protein was directly induced by CpG-DNA in murine and human macrophages. Induction in murine macrophages peaked at 16 h. CpG-DNA-induced S100A8 required de novo protein synthesis; IL-10 and Prostaglandin E2 (PGE2) synergistically enhanced expression and promoted earlier gene induction. Inhibitors of endogenous IL-10, PGE2, and the E prostanoid (EP) 4 receptor strongly suppressed S100A8 expression, particularly when combined. Thus, S100A8 induction by E. coli DNA required both IL-10 and PGE2/EP4 signaling. The MAPKs, PI3K and JAK pathways were essential, whereas ERK1/2 appeared to play a direct role. S100A8 induction by CpG-DNA was controlled at the transcriptional level. The promoter region responsible for activation, either directly, or indirectly via IL-10 and PGE2, was located within a -178 to -34-bp region and required STAT3 binding. Because of the robust links connecting IL-10 and PGE2 with an anti-inflammatory macrophage phenotype, the induction profile of S100A8 strongly indicates a role for this protein in resolution of inflammation.

Top