Molecular modelling study of changes induced by netropsin binding to nucleosome core particles.

PubMed Central

Pérez, J J; Portugal, J

1990-01-01

It is well known that certain sequence-dependent modulators in structure appear to determine the rotational positioning of DNA on the nucleosome core particle. That preference is rather weak and could be modified by some ligands as netropsin, a minor-groove binding antibiotic. We have undertaken a molecular modelling approach to calculate the relative energy of interaction between a DNA molecule and the protein core particle. The histones particle is considered as a distribution of positive charges on the protein surface that interacts with the DNA molecule. The molecular electrostatic potentials for the DNA, simulated as a discontinuous cylinder, were calculated using the values for all the base pairs. Computing these parameters, we calculated the relative energy of interaction and the more stable rotational setting of DNA. The binding of four molecules of netropsin to this model showed that a new minimum of energy is obtained when the DNA turns toward the protein surface by about 180 degrees, so a new energetically favoured structure appears where netropsin binding sites are located facing toward the histones surface. The effect of netropsin could be explained in terms of an induced change in the phasing of DNA on the core particle. The induced rotation is considered to optimize non-bonded contacts between the netropsin molecules and the DNA backbone. PMID:2165249

Simultaneous Binding of Hybrid Molecules Constructed with Dual DNA-Binding Components to a G-Quadruplex and Its Proximal Duplex.

PubMed

Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

2018-03-20

A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Adsorption of plasmid DNA on anion exchange chromatography media.

PubMed

Tarmann, Christina; Jungbauer, Alois

2008-08-01

Anion exchange chromatography (AEC) is a useful and effective tool for DNA purification, but due to average pore sizes between 40 and 100 nm most AEC resins lack truly useful binding capacities for plasmid DNA (pDNA). Equilibrium binding capacities and uptake kinetics of AEC media including conventional media (Source 30 Q, Q Sepharose HP), a polymer grafted medium (Fractogel EMD DEAE (M)), media with large pores (Celbeads DEAE, PL SAX 4000 A 30 microm) and a monolithic medium (CIM-DEAE) were investigated by batch uptake or shallow bed experiments at two salt concentrations. Theoretical and experimental binding capacities suggest that the shape of the pDNA molecule can be described by a rod with a length to diameter ratio of 20:1 and that the molecule binds in upright position. The arrangement of DNA like a brush at the surface can be considered as entropy driven, kind of self-assembly process which is inherent to highly and uniformly charged DNA molecules. The initial phase of adsorption is very fast and levels off, associated with a change in mass transfer mechanism. Feed concentrations higher than 0.1 mg/mL pDNA pronounce this effect. Monolithic media showed the fastest adsorption rate and highest binding capacity with 13 mg pDNA per mL.

Changes in solvation during DNA binding and cleavage are critical to altered specificity of the EcoRI endonuclease

PubMed Central

Robinson, Clifford R.; Sligar, Stephen G.

1998-01-01

Restriction endonucleases such as EcoRI bind and cleave DNA with great specificity and represent a paradigm for protein–DNA interactions and molecular recognition. Using osmotic pressure to induce water release, we demonstrate the participation of bound waters in the sequence discrimination of substrate DNA by EcoRI. Changes in solvation can play a critical role in directing sequence-specific DNA binding by EcoRI and are also crucial in assisting site discrimination during catalysis. By measuring the volume change for complex formation, we show that at the cognate sequence (GAATTC) EcoRI binding releases about 70 fewer water molecules than binding at an alternate DNA sequence (TAATTC), which differs by a single base pair. EcoRI complexation with nonspecific DNA releases substantially less water than either of these specific complexes. In cognate substrates (GAATTC) kcat decreases as osmotic pressure is increased, indicating the binding of about 30 water molecules accompanies the cleavage reaction. For the alternate substrate (TAATTC), release of about 40 water molecules accompanies the reaction, indicated by a dramatic acceleration of the rate when osmotic pressure is raised. These large differences in solvation effects demonstrate that water molecules can be key players in the molecular recognition process during both association and catalytic phases of the EcoRI reaction, acting to change the specificity of the enzyme. For both the protein–DNA complex and the transition state, there may be substantial conformational differences between cognate and alternate sites, accompanied by significant alterations in hydration and solvent accessibility. PMID:9482860

Using Synthetic Nanopores for Single-Molecule Analyses: Detecting SNPs, Trapping DNA Molecules, and the Prospects for Sequencing DNA

ERIC Educational Resources Information Center

Dimitrov, Valentin V.

2009-01-01

This work focuses on studying properties of DNA molecules and DNA-protein interactions using synthetic nanopores, and it examines the prospects of sequencing DNA using synthetic nanopores. We have developed a method for discriminating between alleles that uses a synthetic nanopore to measure the binding of a restriction enzyme to DNA. There exists…

DNA-binding activity of TNF-{alpha} inducing protein from Helicobacter pylori

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuzuhara, T.; Suganuma, M.; Oka, K.

2007-11-03

Tumor necrosis factor-{alpha} (TNF-{alpha}) inducing protein (Tip{alpha}) is a carcinogenic factor secreted from Helicobacter pylori (H. pylori), mediated through both enhanced expression of TNF-{alpha} and chemokine genes and activation of nuclear factor-{kappa}B. Since Tip{alpha} enters gastric cancer cells, the Tip{alpha} binding molecules in the cells should be investigated. The direct DNA-binding activity of Tip{alpha} was observed by pull down assay using single- and double-stranded genomic DNA cellulose. The surface plasmon resonance assay, indicating an association between Tip{alpha} and DNA, revealed that the affinity of Tip{alpha} for (dGdC)10 is 2400 times stronger than that of del-Tip{alpha}, an inactive Tip{alpha}. This suggestsmore » a strong correlation between DNA-binding activity and carcinogenic activity of Tip{alpha}. And the DNA-binding activity of Tip{alpha} was first demonstrated with a molecule secreted from H. pylori.« less

Amino acids 16-275 of minute virus of mice NS1 include a domain that specifically binds (ACCA)2-3-containing DNA.

PubMed

Mouw, M; Pintel, D J

1998-11-10

GST-NS1 purified from Escherichia coli and insect cells binds double-strand DNA in an (ACCA)2-3-dependent fashion under similar ionic conditions, independent of the presence of anti-NS1 antisera or exogenously supplied ATP and interacts with single-strand DNA and RNA in a sequence-independent manner. An amino-terminal domain (amino acids 1-275) of NS1 [GST-NS1(1-275)], representing 41% of the full-length NS1 molecule, includes a domain that binds double-strand DNA in a sequence-specific manner at levels comparable to full-length GST-NS1, as well as single-strand DNA and RNA in a sequence-independent manner. The deletion of 15 additional amino-terminal amino acids yielded a molecule [GST-NS1(1-275)] that maintained (ACCA)2-3-specific double-strand DNA binding; however, this molecule was more sensitive to increasing ionic conditions than full-length GST-NS1 and GST-NS1(1-275) and could not be demonstrated to bind single-strand nucleic acids. A quantitative filter binding assay showed that E. coli- and baculovirus-expressed GST-NS1 and E. coli GST-NS1(1-275) specifically bound double-strand DNA with similar equilibrium kinetics [as measured by their apparent equilibrium DNA binding constants (KD)], whereas GST-NS1(16-275) bound 4- to 8-fold less well. Copyright 1998 Academic Press.

The interaction of DiaA and DnaA regulates the replication cycle in E. coli by directly promoting ATP–DnaA-specific initiation complexes

PubMed Central

Keyamura, Kenji; Fujikawa, Norie; Ishida, Takuma; Ozaki, Shogo; Su’etsugu, Masayuki; Fujimitsu, Kazuyuki; Kagawa, Wataru; Yokoyama, Shigeyuki; Kurumizaka, Hitoshi; Katayama, Tsutomu

2007-01-01

Escherichia coli DiaA is a DnaA-binding protein that is required for the timely initiation of chromosomal replication during the cell cycle. In this study, we determined the crystal structure of DiaA at 1.8 Å resolution. DiaA forms a homotetramer consisting of a symmetrical pair of homodimers. Mutational analysis revealed that the DnaA-binding activity and formation of homotetramers are required for the stimulation of initiation by DiaA. DiaA tetramers can bind multiple DnaA molecules simultaneously. DiaA stimulated the assembly of multiple DnaA molecules on oriC, conformational changes in ATP–DnaA-specific initiation complexes, and unwinding of oriC duplex DNA. The mutant DiaA proteins are defective in these stimulations. DiaA associated also with ADP–DnaA, and stimulated the assembly of inactive ADP–DnaA–oriC complexes. Specific residues in the putative phosphosugar-binding motif of DiaA were required for the stimulation of initiation and formation of ATP–DnaA-specific–oriC complexes. Our data indicate that DiaA regulates initiation by a novel mechanism, in which DiaA tetramers most likely bind to multiple DnaA molecules and stimulate the assembly of specific ATP–DnaA–oriC complexes. These results suggest an essential role for DiaA in the promotion of replication initiation in a cell cycle coordinated manner. PMID:17699754

Adsorption of DNA to mica mediated by divalent counterions: a theoretical and experimental study.

PubMed

Pastré, David; Piétrement, Olivier; Fusil, Stéphane; Landousy, Fabrice; Jeusset, Josette; David, Marie-Odile; Hamon, Loïc; Le Cam, Eric; Zozime, Alain

2003-10-01

The adsorption of DNA molecules onto a flat mica surface is a necessary step to perform atomic force microscopy studies of DNA conformation and observe DNA-protein interactions in physiological environment. However, the phenomenon that pulls DNA molecules onto the surface is still not understood. This is a crucial issue because the DNA/surface interactions could affect the DNA biological functions. In this paper we develop a model that can explain the mechanism of the DNA adsorption onto mica. This model suggests that DNA attraction is due to the sharing of the DNA and mica counterions. The correlations between divalent counterions on both the negatively charged DNA and the mica surface can generate a net attraction force whereas the correlations between monovalent counterions are ineffective in the DNA attraction. DNA binding is then dependent on the fractional surface densities of the divalent and monovalent cations, which can compete for the mica surface and DNA neutralizations. In addition, the attraction can be enhanced when the mica has been pretreated by transition metal cations (Ni(2+), Zn(2+)). Mica pretreatment simultaneously enhances the DNA attraction and reduces the repulsive contribution due to the electrical double-layer force. We also perform end-to-end distance measurement of DNA chains to study the binding strength. The DNA binding strength appears to be constant for a fixed fractional surface density of the divalent cations at low ionic strength (I < 0.1 M) as predicted by the model. However, at higher ionic strength, the binding is weakened by the screening effect of the ions. Then, some equations were derived to describe the binding of a polyelectrolyte onto a charged surface. The electrostatic attraction due to the sharing of counterions is particularly effective if the polyelectrolyte and the surface have nearly the same surface charge density. This characteristic of the attraction force can explain the success of mica for performing single DNA molecule observation by AFM. In addition, we explain how a reversible binding of the DNA molecules can be obtained with a pretreated mica surface.

β -Cyclodextrin polymer binding to DNA: Modulating the physicochemical parameters

NASA Astrophysics Data System (ADS)

Rocha, J. C. B.; Silva, E. F.; Oliveira, M. F.; Sousa, F. B.; Teixeira, A. V. N. C.; Rocha, M. S.

2017-05-01

Cyclodextrins and cyclodextrins-modified molecules have interesting and appealing properties due to their capacity to host components that are normally insoluble or poorly soluble in water. In this work, we investigate the interaction of a β -cyclodextrin polymer (poly-β -CD) with λ -DNA. The polymers are obtained by the reaction of β -CD with epichlorohydrin in alkaline conditions. We have used optical tweezers to characterize the changes of the mechanical properties of DNA molecules by increasing the concentration of poly-β -CD in the sample. The physical chemistry of the interaction is then deduced from these measurements by using a recently developed quenched-disorder statistical model. It is shown that the contour length of the DNA does not change in the whole range of poly-β -CD concentration (<300 μ M ). On the other hand, significant alterations were observed in the persistence length that identifies two binding modes corresponding to the clustering of ˜2.6 and ˜14 polymer molecules along the DNA double helix, depending on the polymer concentration. Comparing these results with the ones obtained for monomeric β -CD, it was observed that the concentration of CD that alters the DNA persistence length is considerably smaller when in the polymeric form. Also, the binding constant of the polymer-DNA interaction is three orders of magnitude higher than the one found for native (monomeric) β -CD. These results show that the polymerization of the β -CD strongly increases its binding affinity to the DNA molecule. This property can be wisely used to modulate the binding of cyclodextrins to the DNA double helix.

Triple Helix Formation in a Topologically Controlled DNA Nanosystem.

PubMed

Yamagata, Yutaro; Emura, Tomoko; Hidaka, Kumi; Sugiyama, Hiroshi; Endo, Masayuki

2016-04-11

In the present study, we demonstrate single-molecule imaging of triple helix formation in DNA nanostructures. The binding of the single-molecule third strand to double-stranded DNA in a DNA origami frame was examined using two different types of triplet base pairs. The target DNA strand and the third strand were incorporated into the DNA frame, and the binding of the third strand was controlled by the formation of Watson-Crick base pairing. Triple helix formation was monitored by observing the structural changes in the incorporated DNA strands. It was also examined using a photocaged third strand wherein the binding of the third strand was directly observed using high-speed atomic force microscopy during photoirradiation. We found that the binding of the third strand could be controlled by regulating duplex formation and the uncaging of the photocaged strands in the designed nanospace. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

New phthalimide-appended Schiff bases: Studies of DNA binding, molecular docking and antioxidant activities.

PubMed

Nayab, Pattan Sirajuddin; Akrema; Ansari, Istikhar A; Shahid, Mohammad; Rahisuddin

2017-08-01

Herein, we investigated new phthalimide-based Schiff base molecules as promising DNA-binding and free radical scavenging agents. Physicochemical properties of these molecules were demonstrated on the basis of elemental analysis, ultraviolet-visible (UV-Vis), infra-red (IR), 1 H and 13 C nuclear magnetic resonance (NMR) spectroscopy. All spectral data are agreed well with the proposed Schiff base framework. The DNA-binding potential of synthesized compounds were investigated by means of UV-visible, fluorescence, iodide quenching, circular dichroism, viscosity and thermal denaturation studies. The intrinsic binding constants (K b ) were calculated from absorption studies were found to be 1.1 × 10 4 and 1.0 × 10 4  M -1 for compounds 2a and 2b suggesting that compound 2a binding abilities with DNA were stronger than the compound 2b. Our studies showed that the presented compounds interact with DNA through groove binding. Molecular docking studies were carried out to predict the binding between Ct-DNA and test compounds. Interestingly, in silico predictions were corroborated with in vitro DNA-binding conclusions. Furthermore, the title compounds displayed remarkable antioxidant activity compared with reference standard. Copyright © 2016 John Wiley & Sons, Ltd.

Identification of DNA primase inhibitors via a combined fragment-based and virtual screening

NASA Astrophysics Data System (ADS)

Ilic, Stefan; Akabayov, Sabine R.; Arthanari, Haribabu; Wagner, Gerhard; Richardson, Charles C.; Akabayov, Barak

2016-11-01

The structural differences between bacterial and human primases render the former an excellent target for drug design. Here we describe a technique for selecting small molecule inhibitors of the activity of T7 DNA primase, an ideal model for bacterial primases due to their common structural and functional features. Using NMR screening, fragment molecules that bind T7 primase were identified and then exploited in virtual filtration to select larger molecules from the ZINC database. The molecules were docked to the primase active site using the available primase crystal structure and ranked based on their predicted binding energies to identify the best candidates for functional and structural investigations. Biochemical assays revealed that some of the molecules inhibit T7 primase-dependent DNA replication. The binding mechanism was delineated via NMR spectroscopy. Our approach, which combines fragment based and virtual screening, is rapid and cost effective and can be applied to other targets.

Synthesis, DNA binding and cytotoxic activity of pyrimido[4',5':4,5]thieno(2,3-b)quinoline with 9-hydroxy-4-(3-diethylaminopropylamino) and 8-methoxy-4-(3-diethylaminopropylamino) substitutions.

PubMed

KiranKumar, Hulihalli N; RohitKumar, Heggodu G; Advirao, Gopal M

2018-01-01

Two new derivatives of pyrimido[4',5';4,5]thieno(2,3-b)quinoline (PTQ), 9-hydroxy-4-(3-diethylaminopropylamino)pyrimido[4',5';4,5]thieno(2,3-b)quinoline (Hydroxy-DPTQ) and 8-methoxy-4-(3-diethylaminopropylamino)pyrimido[4',5';4,5]thieno(2,3-b)quinoline (Methoxy-DPTQ) were synthesized and their DNA binding ability was analyzed using spectroscopy (UV-visible, fluorescence and circular dichroism), ethidium bromide dye displacement assay, melting temperature (T m ) analysis and computational docking studies. The hypochromism in UV-visible spectrum and increased fluorescence emission of Hydroxy-DPTQ and Methoxy-DPTQ in the presence of DNA suggested the molecule-DNA interaction. The association constants calculated from UV-visible and spectral titrations were of the order 10 4 to 10 6 M -1 . Circular dichroism studies corroborated the induced conformational changes in DNA upon addition of molecules. The change in the ellipticity was observed both in negative and positive peak of DNA, thus, suggesting the intercalation of molecules. The observed displacement of ethidium bromide from the DNA and increased T m , upon addition of DNA confirmed the intercalative mode of binding. This was further validated by computational docking, which showed clear intercalation of molecules into the d(GpC)-d(CpG) site of the receptor DNA. Anticancer activities of these molecules are evaluated by using MTT assay. Both molecules showed antiproliferative activity against all the three cancer cells studied, with Hydroxy-DPTQ being more potential molecule among the two. IC 50 value of Hydroxy-DPTQ and Methoxy-DPTQ were in the range of 3-5μM and 130-250μM, respectively. Copyright © 2017 Elsevier B.V. All rights reserved.

Microarray Detection of Duplex and Triplex DNA Binders with DNA-Modified Gold Nanoparticles

PubMed Central

Lytton-Jean, Abigail K. R.; Han, Min Su; Mirkin, Chad A.

2008-01-01

We have designed a chip-based assay, using microarray technology, for determining the relative binding affinities of duplex and triplex DNA binders. This assay combines the high discrimination capabilities afforded by DNA-modified Au nanoparticles with the high-throughput capabilities of DNA microarrays. The detection and screening of duplex DNA binders are important because these molecules, in many cases, are potential anticancer agents as well as toxins. Triplex DNA binders are also promising drug candidates. These molecules, in conjunction with triplex forming oligonucleotides, could potentially be used to achieve control of gene expression by interfering with transcription factors that bind to DNA. Therefore, the ability to screen for these molecules in a high-throughput fashion could dramatically improve the drug screening process. The assay reported here provides excellent discrimination between strong, intermediate, and weak duplex and triplex DNA binders in a high-throughput fashion. PMID:17614366

May the Best Molecule Win: Competition ESI Mass Spectrometry

PubMed Central

Laughlin, Sarah; Wilson, W. David

2015-01-01

Electrospray ionization mass spectrometry has become invaluable in the characterization of macromolecular biological systems such as nucleic acids and proteins. Recent advances in the field of mass spectrometry and the soft conditions characteristic of electrospray ionization allow for the investigation of non-covalent interactions among large biomolecules and ligands. Modulation of genetic processes through the use of small molecule inhibitors with the DNA minor groove is gaining attention as a potential therapeutic approach. In this review, we discuss the development of a competition method using electrospray ionization mass spectrometry to probe the interactions of multiple DNA sequences with libraries of minor groove binding molecules. Such an approach acts as a high-throughput screening method to determine important information including the stoichiometry, binding mode, cooperativity, and relative binding affinity. In addition to small molecule-DNA complexes, we highlight other applications in which competition mass spectrometry has been used. A competitive approach to simultaneously investigate complex interactions promises to be a powerful tool in the discovery of small molecule inhibitors with high specificity and for specific, important DNA sequences. PMID:26501262

Fluorescence Microscopy of Nanochannel-Confined DNA.

PubMed

Westerlund, Fredrik; Persson, Fredrik; Fritzsche, Joachim; Beech, Jason P; Tegenfeldt, Jonas O

2018-01-01

Stretching of DNA in nanoscale confinement allows for several important studies. The genetic contents of the DNA can be visualized on the single DNA molecule level and both the polymer physics of confined DNA and also DNA/protein and other DNA/DNA-binding molecule interactions can be explored. This chapter describes the basic steps to fabricate the nanostructures, perform the experiments and analyze the data.

Design, synthesis and DNA-binding study of some novel morpholine linked thiazolidinone derivatives

NASA Astrophysics Data System (ADS)

War, Javeed Ahmad; Srivastava, Santosh Kumar; Srivastava, Savitri Devi

2017-02-01

The emergence of multiple drug resistance amongst bacterial strains resulted in many clinical drugs to be ineffective. Being vulnerable to bacterial infections any lack in the development of new antimicrobial drugs could pose a serious threat to public health. Here we report design and synthesis of a novel class of morpholine linked thiazolidinone hybrid molecules. The compounds were characterized by FT-IR, NMR and HRMS techniques. Susceptibility tests showed that most of the synthesized molecules were highly active against multiple bacterial strains. Compound 3f displayed MIC values which were better than the standard drug for most of the tested strains. DNA being a well defined target for many antimicrobial drugs was probed as possible target for these synthetic molecules. DNA-binding study of 3f with sm-DNA was probed through UV-vis absorption, fluorescence quenching, gel electrophoresis and molecular docking techniques. The studies revealed that compound 3f has strong affinity towards DNA and binds at the minor groove. The docking studies revealed that the compound 3f shows preferential binding towards A/T residues.

Design, synthesis and DNA-binding study of some novel morpholine linked thiazolidinone derivatives.

PubMed

War, Javeed Ahmad; Srivastava, Santosh Kumar; Srivastava, Savitri Devi

2017-02-15

The emergence of multiple drug resistance amongst bacterial strains resulted in many clinical drugs to be ineffective. Being vulnerable to bacterial infections any lack in the development of new antimicrobial drugs could pose a serious threat to public health. Here we report design and synthesis of a novel class of morpholine linked thiazolidinone hybrid molecules. The compounds were characterized by FT-IR, NMR and HRMS techniques. Susceptibility tests showed that most of the synthesized molecules were highly active against multiple bacterial strains. Compound 3f displayed MIC values which were better than the standard drug for most of the tested strains. DNA being a well defined target for many antimicrobial drugs was probed as possible target for these synthetic molecules. DNA-binding study of 3f with sm-DNA was probed through UV-vis absorption, fluorescence quenching, gel electrophoresis and molecular docking techniques. The studies revealed that compound 3f has strong affinity towards DNA and binds at the minor groove. The docking studies revealed that the compound 3f shows preferential binding towards A/T residues. Copyright © 2016 Elsevier B.V. All rights reserved.

Imaging chromatin nanostructure with binding-activated localization microscopy based on DNA structure fluctuations

PubMed Central

Szczurek, Aleksander; Klewes, Ludger; Xing, Jun; Gourram, Amine; Birk, Udo; Knecht, Hans; Dobrucki, Jurek W.; Mai, Sabine

2017-01-01

Abstract Advanced light microscopy is an important tool for nanostructure analysis of chromatin. In this report we present a general concept for Single Molecule localization Microscopy (SMLM) super-resolved imaging of DNA-binding dyes based on modifying the properties of DNA and the dye. By careful adjustment of the chemical environment leading to local, reversible DNA melting and hybridization control over the fluorescence signal of the DNA-binding dye molecules can be introduced. We postulate a transient binding as the basis for our variation of binding-activated localization microscopy (BALM). We demonstrate that several intercalating and minor-groove binding DNA dyes can be used to register (optically isolate) only a few DNA-binding dye signals at a time. To highlight this DNA structure fluctuation-assisted BALM (fBALM), we applied it to measure, for the first time, nanoscale differences in nuclear architecture in model ischemia with an anticipated structural resolution of approximately 50 nm. Our data suggest that this approach may open an avenue for the enhanced microscopic analysis of chromatin nano-architecture and hence the microscopic analysis of nuclear structure aberrations occurring in various pathological conditions. It may also become possible to analyse nuclear nanostructure differences in different cell types, stages of development or environmental stress conditions. PMID:28082388

Crystal Structure of Mycobacterium tuberculosis H37Rv AldR (Rv2779c), a Regulator of the ald Gene

PubMed Central

Dey, Abhishek; Shree, Sonal; Pandey, Sarvesh Kumar; Tripathi, Rama Pati; Ramachandran, Ravishankar

2016-01-01

Here we report the crystal structure of M. tuberculosis AldR (Rv2779c) showing that the N-terminal DNA-binding domains are swapped, forming a dimer, and four dimers are assembled into an octamer through crystal symmetry. The C-terminal domain is involved in oligomeric interactions that stabilize the oligomer, and it contains the effector-binding sites. The latter sites are 30–60% larger compared with homologs like MtbFFRP (Rv3291c) and can consequently accommodate larger molecules. MtbAldR binds to the region upstream to the ald gene that is highly up-regulated in nutrient-starved tuberculosis models and codes for l-alanine dehydrogenase (MtbAld; Rv2780). Further, the MtbAldR-DNA complex is inhibited upon binding of Ala, Tyr, Trp and Asp to the protein. Studies involving a ligand-binding site G131T mutant show that the mutant forms a DNA complex that cannot be inhibited by adding the amino acids. Comparative studies suggest that binding of the amino acids changes the relative spatial disposition of the DNA-binding domains and thereby disrupt the protein-DNA complex. Finally, we identified small molecules, including a tetrahydroquinoline carbonitrile derivative (S010-0261), that inhibit the MtbAldR-DNA complex. The latter molecules represent the very first inhibitors of a feast/famine regulatory protein from any source and set the stage for exploring MtbAldR as a potential anti-tuberculosis target. PMID:27006398

Deciphering the genomic targets of alkylating polyamide conjugates using high-throughput sequencing

PubMed Central

Chandran, Anandhakumar; Syed, Junetha; Taylor, Rhys D.; Kashiwazaki, Gengo; Sato, Shinsuke; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

2016-01-01

Chemically engineered small molecules targeting specific genomic sequences play an important role in drug development research. Pyrrole-imidazole polyamides (PIPs) are a group of molecules that can bind to the DNA minor-groove and can be engineered to target specific sequences. Their biological effects rely primarily on their selective DNA binding. However, the binding mechanism of PIPs at the chromatinized genome level is poorly understood. Herein, we report a method using high-throughput sequencing to identify the DNA-alkylating sites of PIP-indole-seco-CBI conjugates. High-throughput sequencing analysis of conjugate 2 showed highly similar DNA-alkylating sites on synthetic oligos (histone-free DNA) and on human genomes (chromatinized DNA context). To our knowledge, this is the first report identifying alkylation sites across genomic DNA by alkylating PIP conjugates using high-throughput sequencing. PMID:27098039

Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process.

PubMed

Reshetnikov, Roman V; Sponer, Jiri; Rassokhina, Olga I; Kopylov, Alexei M; Tsvetkov, Philipp O; Makarov, Alexander A; Golovin, Andrey V

2011-12-01

A combination of explicit solvent molecular dynamics simulation (30 simulations reaching 4 µs in total), hybrid quantum mechanics/molecular mechanics approach and isothermal titration calorimetry was used to investigate the atomistic picture of ion binding to 15-mer thrombin-binding quadruplex DNA (G-DNA) aptamer. Binding of ions to G-DNA is complex multiple pathway process, which is strongly affected by the type of the cation. The individual ion-binding events are substantially modulated by the connecting loops of the aptamer, which play several roles. They stabilize the molecule during time periods when the bound ions are not present, they modulate the route of the ion into the stem and they also stabilize the internal ions by closing the gates through which the ions enter the quadruplex. Using our extensive simulations, we for the first time observed full spontaneous exchange of internal cation between quadruplex molecule and bulk solvent at atomistic resolution. The simulation suggests that expulsion of the internally bound ion is correlated with initial binding of the incoming ion. The incoming ion then readily replaces the bound ion while minimizing any destabilization of the solute molecule during the exchange. © The Author(s) 2011. Published by Oxford University Press.

Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process

PubMed Central

Reshetnikov, Roman V.; Sponer, Jiri; Rassokhina, Olga I.; Kopylov, Alexei M.; Tsvetkov, Philipp O.; Makarov, Alexander A.; Golovin, Andrey V.

2011-01-01

A combination of explicit solvent molecular dynamics simulation (30 simulations reaching 4 µs in total), hybrid quantum mechanics/molecular mechanics approach and isothermal titration calorimetry was used to investigate the atomistic picture of ion binding to 15-mer thrombin-binding quadruplex DNA (G-DNA) aptamer. Binding of ions to G-DNA is complex multiple pathway process, which is strongly affected by the type of the cation. The individual ion-binding events are substantially modulated by the connecting loops of the aptamer, which play several roles. They stabilize the molecule during time periods when the bound ions are not present, they modulate the route of the ion into the stem and they also stabilize the internal ions by closing the gates through which the ions enter the quadruplex. Using our extensive simulations, we for the first time observed full spontaneous exchange of internal cation between quadruplex molecule and bulk solvent at atomistic resolution. The simulation suggests that expulsion of the internally bound ion is correlated with initial binding of the incoming ion. The incoming ion then readily replaces the bound ion while minimizing any destabilization of the solute molecule during the exchange. PMID:21893589

Stoichiometry of DNA binding by the bacteriophage SP01-encoded type II DNA-binding protein TF1.

PubMed

Schneider, G J; Geiduschek, E P

1990-06-25

The stoichiometry of DNA binding by the bacteriophage SP01-encoded type II DNA-binding protein TF1 has been determined. 3H-Labeled TF1 was allowed to bind to a 32P-labeled DNA fragment containing a TF1 binding site. Multiple TF1-DNA complexes were resolved from each other and from unbound DNA by native gel electrophoresis. DNA-protein complexes were cut from polyacrylamide gels, and the amounts of 3H and 32P contained in each slice were measured. A ratio of 1.12 +/- 0.06 TF1 dimer/DNA molecule was calculated for the fastest-migrating TF1-DNA complex. We conclude that TF1 has a DNA-binding unit of one dimer. More slowly migrating complexes are apparently formed by serial addition of single TF1 dimers.

Single-Molecule Counting of Point Mutations by Transient DNA Binding

NASA Astrophysics Data System (ADS)

Su, Xin; Li, Lidan; Wang, Shanshan; Hao, Dandan; Wang, Lei; Yu, Changyuan

2017-03-01

High-confidence detection of point mutations is important for disease diagnosis and clinical practice. Hybridization probes are extensively used, but are hindered by their poor single-nucleotide selectivity. Shortening the length of DNA hybridization probes weakens the stability of the probe-target duplex, leading to transient binding between complementary sequences. The kinetics of probe-target binding events are highly dependent on the number of complementary base pairs. Here, we present a single-molecule assay for point mutation detection based on transient DNA binding and use of total internal reflection fluorescence microscopy. Statistical analysis of single-molecule kinetics enabled us to effectively discriminate between wild type DNA sequences and single-nucleotide variants at the single-molecule level. A higher single-nucleotide discrimination is achieved than in our previous work by optimizing the assay conditions, which is guided by statistical modeling of kinetics with a gamma distribution. The KRAS c.34 A mutation can be clearly differentiated from the wild type sequence (KRAS c.34 G) at a relative abundance as low as 0.01% mutant to WT. To demonstrate the feasibility of this method for analysis of clinically relevant biological samples, we used this technology to detect mutations in single-stranded DNA generated from asymmetric RT-PCR of mRNA from two cancer cell lines.

Extracting physical chemistry from mechanics: a new approach to investigate DNA interactions with drugs and proteins in single molecule experiments.

PubMed

Rocha, M S

2015-09-01

In this review we focus on the idea of establishing connections between the mechanical properties of DNA-ligand complexes and the physical chemistry of DNA-ligand interactions. This type of connection is interesting because it opens the possibility of performing a robust characterization of such interactions by using only one experimental technique: single molecule stretching. Furthermore, it also opens new possibilities in comparing results obtained by very different approaches, in particular when comparing single molecule techniques to ensemble-averaging techniques. We start the manuscript reviewing important concepts of DNA mechanics, from the basic mechanical properties to the Worm-Like Chain model. Next we review the basic concepts of the physical chemistry of DNA-ligand interactions, revisiting the most important models used to analyze the binding data and discussing their binding isotherms. Then, we discuss the basic features of the single molecule techniques most used to stretch DNA-ligand complexes and to obtain "force × extension" data, from which the mechanical properties of the complexes can be determined. We also discuss the characteristics of the main types of interactions that can occur between DNA and ligands, from covalent binding to simple electrostatic driven interactions. Finally, we present a historical survey of the attempts to connect mechanics to physical chemistry for DNA-ligand systems, emphasizing a recently developed fitting approach useful to connect the persistence length of DNA-ligand complexes to the physicochemical properties of the interaction. Such an approach in principle can be used for any type of ligand, from drugs to proteins, even if multiple binding modes are present.

Single molecule analysis of Thermus thermophilus SSB protein dynamics on single-stranded DNA.

PubMed

Zhang, Jichuan; Zhou, Ruobo; Inoue, Jin; Mikawa, Tsutomu; Ha, Taekjip

2014-04-01

Single-stranded (ss) DNA binding (SSB) proteins play central roles in DNA replication, recombination and repair in all organisms. We previously showed that Escherichia coli (Eco) SSB, a homotetrameric bacterial SSB, undergoes not only rapid ssDNA-binding mode transitions but also one-dimensional diffusion (or migration) while remaining bound to ssDNA. Whereas the majority of bacterial SSB family members function as homotetramers, dimeric SSB proteins were recently discovered in a distinct bacterial lineage of extremophiles, the Thermus-Deinococcus group. Here we show, using single-molecule fluorescence resonance energy transfer (FRET), that homodimeric bacterial SSB from Thermus thermophilus (Tth) is able to diffuse spontaneously along ssDNA over a wide range of salt concentrations (20-500 mM NaCl), and that TthSSB diffusion can help transiently melt the DNA hairpin structures. Furthermore, we show that two TthSSB molecules undergo transitions among different DNA-binding modes while remaining bound to ssDNA. Our results extend our previous observations on homotetrameric SSBs to homodimeric SSBs, indicating that the dynamic features may be shared among different types of SSB proteins. These dynamic features of SSBs may facilitate SSB redistribution and removal on/from ssDNA, and help recruit other SSB-interacting proteins onto ssDNA for subsequent DNA processing in DNA replication, recombination and repair.

The human mitochondrial single-stranded DNA-binding protein displays distinct kinetics and thermodynamics of DNA binding and exchange

PubMed Central

Qian, Yufeng; Johnson, Kenneth A.

2017-01-01

The human mitochondrial ssDNA-binding protein (mtSSB) is a homotetrameric protein, involved in mtDNA replication and maintenance. Although mtSSB is structurally similar to SSB from Escherichia coli (EcoSSB), it lacks the C-terminal disordered domain, and little is known about the biophysics of mtSSB–ssDNA interactions. Here, we characterized the kinetics and thermodynamics of mtSSB binding to ssDNA by equilibrium titrations and stopped-flow kinetic measurements. We show that the mtSSB tetramer can bind to ssDNA in two distinct binding modes: (SSB)30 and (SSB)60, defined by DNA binding site sizes of 30 and 60 nucleotides, respectively. We found that the binding mode is modulated by magnesium ion and NaCl concentration, but unlike EcoSSB, the mtSSB does not show negative intersubunit cooperativity. Global fitting of both the equilibrium and kinetic data afforded estimates for the rate and equilibrium constants governing the formation of (SSB)60 and (SSB)30 complexes and for the transitions between the two binding modes. We found that the mtSSB tetramer binds to ssDNA with a rate constant near the diffusion limit (2 × 109 m−1 s−1) and that longer DNA (≥60 nucleotides) rapidly wraps around all four monomers, as revealed by FRET assays. We also show that the mtSSB tetramer can directly transfer from one ssDNA molecule to another via an intermediate with two DNA molecules bound to the mtSSB. In conclusion, our results indicate that human mtSSB shares many physicochemical properties with EcoSSB and that the differences may be explained by the lack of an acidic, disordered C-terminal tail in human mtSSB protein. PMID:28615444

DNA interactions with a Methylene Blue redox indicator depend on the DNA length and are sequence specific.

PubMed

Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt V; Ferapontova, Elena E

2010-06-01

A DNA molecular beacon approach was used for the analysis of interactions between DNA and Methylene Blue (MB) as a redox indicator of a hybridization event. DNA hairpin structures of different length and guanine (G) content were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 5'-end. Binding of MB to the folded hairpin DNA was electrochemically studied and compared with binding to the duplex structure formed by hybridization of the hairpin DNA to a complementary DNA strand. Variation of the electrochemical signal from the DNA-MB complex was shown to depend primarily on the DNA length and sequence used: the G-C base pairs were the preferential sites of MB binding in the duplex. For short 20 nts long DNA sequences, the increased electrochemical response from MB bound to the duplex structure was consistent with the increased amount of bound and electrochemically readable MB molecules (i.e. MB molecules that are available for the electron transfer (ET) reaction with the electrode). With longer DNA sequences, the balance between the amounts of the electrochemically readable MB molecules bound to the hairpin DNA and to the hybrid was opposite: a part of the MB molecules bound to the long-sequence DNA duplex seem to be electrochemically mute due to long ET distance. The increasing electrochemical response from MB bound to the short-length DNA hybrid contrasts with the decreasing signal from MB bound to the long-length DNA hybrid and allows an "off"-"on" genosensor development.

Thermodynamic and spectroscopic investigations of TMPyP4 association with guanine- and cytosine-rich DNA and RNA repeats of C9orf72.

PubMed

Alniss, Hasan; Zamiri, Bita; Khalaj, Melisa; Pearson, Christopher E; Macgregor, Robert B

2018-01-22

An expansion of the hexanucleotide repeat (GGGGCC)n·(GGCCCC)n in the C9orf72 promoter has been shown to be the cause of Amyotrophic lateral sclerosis and frontotemporal dementia (ALS-FTD). The C9orf72 repeat can form four-stranded structures; the cationic porphyrin (TMPyP4) binds and distorts these structures. Isothermal titration calorimetry (ITC), and circular dichroism (CD) were used to study the binding of TMPyP4 to the C-rich and G-rich DNA and RNA oligos containing the hexanucleotide repeat at pH 7.5 and 0.1 M K + . The CD spectra of G-rich DNA and RNA TMPyP4 complexes showed features of antiparallel and parallel G-quadruplexes, respectively. The shoulder at 260 nm in the CD spectrum becomes more intense upon formation of complexes between TMPyP4 and the C-rich DNA. The peak at 290 nm becomes more intense in the c-rich RNA molecules, suggesting induction of an i-motif structure. The ITC data showed that TMPyP4 binds at two independent sites for all DNA and RNA molecules. For DNA, the data are consistent with TMPyP4 stacking on the terminal tetrads and intercalation. For RNA, the thermodynamics of the two binding modes are consistent with groove binding and intercalation. In both cases, intercalation is the weaker binding mode. These findings are considered with respect to the structural differences of the folded DNA and RNA molecules and the energetics of the processes that drive site-specific recognition by TMPyP4; these data will be helpful in efforts to optimize the specificity and affinity of the binding of porphyrin-like molecules. Copyright © 2018 Elsevier Inc. All rights reserved.

The intervening domain from MeCP2 enhances the DNA affinity of the methyl binding domain and provides an independent DNA interaction site.

PubMed

Claveria-Gimeno, Rafael; Lanuza, Pilar M; Morales-Chueca, Ignacio; Jorge-Torres, Olga C; Vega, Sonia; Abian, Olga; Esteller, Manel; Velazquez-Campoy, Adrian

2017-01-31

Methyl-CpG binding protein 2 (MeCP2) preferentially interacts with methylated DNA and it is involved in epigenetic regulation and chromatin remodelling. Mutations in MeCP2 are linked to Rett syndrome, the leading cause of intellectual retardation in girls and causing mental, motor and growth impairment. Unstructured regions in MeCP2 provide the plasticity for establishing interactions with multiple binding partners. We present a biophysical characterization of the methyl binding domain (MBD) from MeCP2 reporting the contribution of flanking domains to its structural stability and dsDNA interaction. The flanking disordered intervening domain (ID) increased the structural stability of MBD, modified its dsDNA binding profile from an entropically-driven moderate-affinity binding to an overwhelmingly enthalpically-driven high-affinity binding. Additionally, ID provided an additional site for simultaneously and autonomously binding an independent dsDNA molecule, which is a key feature linked to the chromatin remodelling and looping activity of MeCP2, as well as its ability to interact with nucleosomes replacing histone H1. The dsDNA interaction is characterized by an unusually large heat capacity linked to a cluster of water molecules trapped within the binding interface. The dynamics of disordered regions together with extrinsic factors are key determinants of MeCP2 global structural properties and functional capabilities.

The intervening domain from MeCP2 enhances the DNA affinity of the methyl binding domain and provides an independent DNA interaction site

PubMed Central

Claveria-Gimeno, Rafael; Lanuza, Pilar M.; Morales-Chueca, Ignacio; Jorge-Torres, Olga C.; Vega, Sonia; Abian, Olga; Esteller, Manel; Velazquez-Campoy, Adrian

2017-01-01

Methyl-CpG binding protein 2 (MeCP2) preferentially interacts with methylated DNA and it is involved in epigenetic regulation and chromatin remodelling. Mutations in MeCP2 are linked to Rett syndrome, the leading cause of intellectual retardation in girls and causing mental, motor and growth impairment. Unstructured regions in MeCP2 provide the plasticity for establishing interactions with multiple binding partners. We present a biophysical characterization of the methyl binding domain (MBD) from MeCP2 reporting the contribution of flanking domains to its structural stability and dsDNA interaction. The flanking disordered intervening domain (ID) increased the structural stability of MBD, modified its dsDNA binding profile from an entropically-driven moderate-affinity binding to an overwhelmingly enthalpically-driven high-affinity binding. Additionally, ID provided an additional site for simultaneously and autonomously binding an independent dsDNA molecule, which is a key feature linked to the chromatin remodelling and looping activity of MeCP2, as well as its ability to interact with nucleosomes replacing histone H1. The dsDNA interaction is characterized by an unusually large heat capacity linked to a cluster of water molecules trapped within the binding interface. The dynamics of disordered regions together with extrinsic factors are key determinants of MeCP2 global structural properties and functional capabilities. PMID:28139759

Improved DNA hybridization parameters by Twisted Intercalating Nucleic Acid (TINA).

PubMed

Schneider, Uffe Vest

2012-01-01

This thesis establishes oligonucleotide design rules and applications of a novel group of DNA stabilizing molecules collectively called Twisted Intercalating Nucleic Acid - TINA. Three peer-reviewed publications form the basis for the thesis. One publication describes an improved and rapid method for determination of DNA melting points and two publications describe the effects of positioning TINA molecules in parallel triplex helix and antiparallel duplex helix forming DNA structures. The third publication establishes that TINA molecules containing oligonucleotides improve an antiparallel duplex hybridization based capture assay's analytical sensitivity compared to conventionel DNA oligonucleotides. Clinical microbiology is traditionally based on pathogenic microorganisms' culture and serological tests. The introduction of DNA target amplification methods like PCR has improved the analytical sensitivity and total turn around time involved in clinical diagnostics of infections. Due to the relatively weak hybridization between the two strands of double stranded DNA, a number of nucleic acid stabilizing molecules have been developed to improve the sensitivity of DNA based diagnostics through superior binding properties. A short introduction is given to Watson-Crick and Hoogsteen based DNA binding and the derived DNA structures. A number of other nucleic acid stabilizing molecules are described. The stabilizing effect of TINA molecules on different DNA structures is discussed and considered in relation to other nucleic acid stabilizing molecules and in relation to future use of TINA containing oligonucleotides in clinical diagnostics and therapy. In conclusion, design of TINA modified oligonucleotides for antiparallel duplex helixes and parallel triplex helixes follows simple purpose dependent rules. TINA molecules are well suited for improving multiplex PCR assays and can be used as part of novel technologies. Future research should test whether combinations of TINA molecules and other nucleic acid stabilizing molecules can increase analytical sensitivity whilst maintaining nucleobase mismatch discrimination in triplex helix based diagnostic assays.

Studies on the interaction of a synthetic nitro-flavone derivative with DNA: A multi-spectroscopic and molecular docking approach.

PubMed

Mitra, A; Saikh, F; Das, J; Ghosh, S; Ghosh, R

2018-05-22

Interaction of a ligand with DNA is often the basis of drug action of many molecules. Flavones are important in this regard as their structural features confer them the ability to bind to DNA. 2-(4-Nitrophenyl)-4H-chromen-4-one (4NCO) is an important biologically active synthetic flavone derivative. We are therefore interested in studying its interaction with DNA. Absorption spectroscopy studies included standard and reverse titration, effect of ionic strength on titration, determination of stoichiometry of binding and thermal denaturation. Spectrofluorimetry techniques included fluorimetric titration, quenching studies and fluorescence displacement assay. Assessment of relative viscosity and estimation of thermodynamic parameters from CD spectral studies were also undertaken. Furthermore, molecular docking analyses were also done with different short DNA sequences. The fluorescent flavone 4NCO reversibly interacted with DNA through partial intercalation as well as minor-groove binding. The binding constant and the number of binding sites were of the order 10 4  M -1 and 1 respectively. The binding stoichiometry with DNA was found to be 1:1. The nature of the interaction of 4NCO with DNA was hydrophobic in nature and the process of binding was spontaneous, endothermic and entropy-driven. The flavone also showed a preference for binding to GC rich sequences. The study presents a profile for structural and thermodynamic parameters, for the binding of 4NCO with DNA. DNA is an important target for ligands that are effective against cell proliferative disorders. In this regard, the molecule 4NCO is important since it can exert its biological activity through its DNA binding ability and can be a potential drug candidate. Copyright © 2018 Elsevier B.V. All rights reserved.

A force-based protein biochip

NASA Astrophysics Data System (ADS)

Blank, K.; Mai, T.; Gilbert, I.; Schiffmann, S.; Rankl, J.; Zivin, R.; Tackney, C.; Nicolaus, T.; Spinnler, K.; Oesterhelt, F.; Benoit, M.; Clausen-Schaumann, H.; Gaub, H. E.

2003-09-01

A parallel assay for the quantification of single-molecule binding forces was developed based on differential unbinding force measurements where ligand-receptor interactions are compared with the unzipping forces of DNA hybrids. Using the DNA zippers as molecular force sensors, the efficient discrimination between specific and nonspecific interactions was demonstrated for small molecules binding to specific receptors, as well as for protein-protein interactions on protein arrays. Finally, an antibody sandwich assay with different capture antibodies on one chip surface and with the detection antibodies linked to a congruent surface via the DNA zippers was used to capture and quantify a recombinant hepatitis C antigen from solution. In this case, the DNA zippers enable not only discrimination between specific and nonspecific binding, but also allow for the local application of detection antibodies, thereby eliminating false-positive results caused by cross-reactive antibodies and nonspecific binding.

Targeting of loaded Sendai virus envelopes by covalently attached insulin molecules to virus receptor-depleted cells: fusion-mediated microinjection of ricin A and simian virus 40 DNA.

PubMed

Gitman, A G; Graessmann, A; Loyter, A

1985-11-01

Insulin molecules were covalently attached to detergent-solubilized Sendai virus envelope glycoproteins (HN and F polypeptides) by the use of the crosslinking reagent succinimidyl 4-(p-maleimidophenyl)butyrate (SMPB). Reconstitution of modified viral glycoproteins (carrying covalently attached insulin) together with unmodified viral glycoproteins resulted in the formation of "fusogenic" viral envelopes bearing insulin molecules. Reconstitution of such fusogenic viral envelopes in the presence of ricin A or simian virus 40 (SV40) DNA resulted in the formation of viral envelopes bearing insulin molecules and loaded with ricin A or SV40 DNA. Such viral envelopes were able to bind to hepatoma tissue culture cells (HTCC) from which Sendai virus receptors were removed by treatment with neuraminidase. Incubation of viral envelopes loaded with ricin A with virus receptor-depleted HTCC resulted in fusion-mediated injection of the toxin, as inferred from inhibition of protein synthesis and decrease in cell viability of the microinjected cells. Fusion-mediated injection of SV40 DNA was inferred from the appearance of SV40 tumor antigen in microinjected cells. Binding and fusion of the loaded viral envelopes to neuraminidase-treated HTCC was mediated solely by the virus-associated insulin molecules. Addition of free insulin molecules inhibited binding of the viral envelopes and, consequently, the microinjection of ricin A and SV40 DNA.

Targeting of loaded Sendai virus envelopes by covalently attached insulin molecules to virus receptor-depleted cells: fusion-mediated microinjection of ricin A and simian virus 40 DNA.

PubMed Central

Gitman, A G; Graessmann, A; Loyter, A

1985-01-01

Insulin molecules were covalently attached to detergent-solubilized Sendai virus envelope glycoproteins (HN and F polypeptides) by the use of the crosslinking reagent succinimidyl 4-(p-maleimidophenyl)butyrate (SMPB). Reconstitution of modified viral glycoproteins (carrying covalently attached insulin) together with unmodified viral glycoproteins resulted in the formation of "fusogenic" viral envelopes bearing insulin molecules. Reconstitution of such fusogenic viral envelopes in the presence of ricin A or simian virus 40 (SV40) DNA resulted in the formation of viral envelopes bearing insulin molecules and loaded with ricin A or SV40 DNA. Such viral envelopes were able to bind to hepatoma tissue culture cells (HTCC) from which Sendai virus receptors were removed by treatment with neuraminidase. Incubation of viral envelopes loaded with ricin A with virus receptor-depleted HTCC resulted in fusion-mediated injection of the toxin, as inferred from inhibition of protein synthesis and decrease in cell viability of the microinjected cells. Fusion-mediated injection of SV40 DNA was inferred from the appearance of SV40 tumor antigen in microinjected cells. Binding and fusion of the loaded viral envelopes to neuraminidase-treated HTCC was mediated solely by the virus-associated insulin molecules. Addition of free insulin molecules inhibited binding of the viral envelopes and, consequently, the microinjection of ricin A and SV40 DNA. PMID:2997783

In vitro selection of shape-changing DNA nanostructures capable of binding-induced cargo release.

PubMed

Oh, Seung Soo; Plakos, Kory; Xiao, Yi; Eisenstein, Michael; Soh, H Tom

2013-11-26

Many biological systems employ allosteric regulatory mechanisms, which offer a powerful means of directly linking a specific binding event to a wide spectrum of molecular functionalities. There is considerable interest in generating synthetic allosteric regulators that can perform useful molecular functions for applications in diagnostics, imaging and targeted therapies, but generating such molecules through either rational design or directed evolution has proven exceptionally challenging. To address this need, we present an in vitro selection strategy for generating conformation-switching DNA nanostructures that selectively release a small-molecule payload in response to binding of a specific trigger molecule. As an exemplar, we have generated a DNA nanostructure that hybridizes with a separate 'cargo strand' containing an abasic site. This abasic site stably sequesters a fluorescent cargo molecule in an inactive state until the DNA nanostructure encounters an ATP trigger molecule. This ATP trigger causes the nanostructure to release the cargo strand, thereby liberating the fluorescent payload and generating a detectable fluorescent readout. Our DNA nanostructure is highly sensitive, with an EC50 of 30 μM, and highly specific, releasing its payload in response to ATP but not to other chemically similar nucleotide triphosphates. We believe that this selection approach could be generalized to generate synthetic nanostructures capable of selective and controlled release of other small-molecule cargos in response to a variety of triggers, for both research and clinical applications.

Specific and non-specific interactions of ParB with DNA: implications for chromosome segregation

PubMed Central

Taylor, James A.; Pastrana, Cesar L.; Butterer, Annika; Pernstich, Christian; Gwynn, Emma J.; Sobott, Frank; Moreno-Herrero, Fernando; Dillingham, Mark S.

2015-01-01

The segregation of many bacterial chromosomes is dependent on the interactions of ParB proteins with centromere-like DNA sequences called parS that are located close to the origin of replication. In this work, we have investigated the binding of Bacillus subtilis ParB to DNA in vitro using a variety of biochemical and biophysical techniques. We observe tight and specific binding of a ParB homodimer to the parS sequence. Binding of ParB to non-specific DNA is more complex and displays apparent positive co-operativity that is associated with the formation of larger, poorly defined, nucleoprotein complexes. Experiments with magnetic tweezers demonstrate that non-specific binding leads to DNA condensation that is reversible by protein unbinding or force. The condensed DNA structure is not well ordered and we infer that it is formed by many looping interactions between neighbouring DNA segments. Consistent with this view, ParB is also able to stabilize writhe in single supercoiled DNA molecules and to bridge segments from two different DNA molecules in trans. The experiments provide no evidence for the promotion of non-specific DNA binding and/or condensation events by the presence of parS sequences. The implications of these observations for chromosome segregation are discussed. PMID:25572315

Flow cytometric sex sorting affects CD4 membrane distribution and binding of exogenous DNA on bovine sperm cells.

PubMed

Domingues, William Borges; da Silveira, Tony Leandro Rezende; Komninou, Eliza Rossi; Monte, Leonardo Garcia; Remião, Mariana Härter; Dellagostin, Odir Antônio; Corcini, Carine Dahl; Varela Junior, Antônio Sergio; Seixas, Fabiana Kömmling; Collares, Tiago; Campos, Vinicius Farias

2017-08-01

Bovine sex-sorted sperm have been commercialized and successfully used for the production of transgenic embryos of the desired sex through the sperm-mediated gene transfer (SMGT) technique. However, sex-sorted sperm show a reduced ability to internalize exogenous DNA. The interaction between sperm cells and the exogenous DNA has been reported in other species to be a CD4-like molecule-dependent process. The flow cytometry-based sex-sorting process subjects the spermatozoa to different stresses causing changes in the cell membrane. The aim of this study was to elucidate the relationship between the redistribution of CD4-like molecules and binding of exogenous DNA to sex-sorted bovine sperm. In the first set of experiments, the membrane phospholipid disorder and the redistribution of the CD4 were evaluated. The second set of experiments was conducted to investigate the effect of CD4 redistribution on the mechanism of binding of exogenous DNA to sperm cells and the efficiency of lipofection in sex-sorted bovine sperm. Sex-sorting procedure increased the membrane phospholipid disorder and induced the redistribution of CD4-like molecules. Both X-sorted and Y-sorted sperm had decreased DNA bound to membrane in comparison with the unsorted sperm; however, the binding of the exogenous DNA was significantly increased with the addition of liposomes. Moreover, we demonstrated that the number of sperm-bound exogenous DNA was decreased when these cells were preincubated with anti-bovine CD4 monoclonal antibody, supporting our hypothesis that CD4-like molecules indeed play a crucial role in the process of exogenous DNA/bovine sperm cells interaction.

Quantitative analysis of small molecule-nucleic acid interactions with a biosensor surface and surface plasmon resonance detection.

PubMed

Liu, Yang; Wilson, W David

2010-01-01

Surface plasmon resonance (SPR) technology with biosensor surfaces has become a widely-used tool for the study of nucleic acid interactions without any labeling requirements. The method provides simultaneous kinetic and equilibrium characterization of the interactions of biomolecules as well as small molecule-biopolymer binding. SPR monitors molecular interactions in real time and provides significant advantages over optical or calorimetic methods for systems with strong binding coupled to small spectroscopic signals and/or reaction heats. A detailed and practical guide for nucleic acid interaction analysis using SPR-biosensor methods is presented. Details of the SPR technology and basic fundamentals are described with recommendations on the preparation of the SPR instrument, sensor chips, and samples, as well as extensive information on experimental design, quantitative and qualitative data analysis and presentation. A specific example of the interaction of a minor-groove-binding agent with DNA is evaluated by both kinetic and steady-state SPR methods to illustrate the technique. Since the molecules that bind cooperatively to specific DNA sequences are attractive for many applications, a cooperative small molecule-DNA interaction is also presented.

Direct Correlation of DNA Binding and Single Protein Domain Motion via Dual Illumination Fluorescence Microscopy

PubMed Central

2015-01-01

We report a dual illumination, single-molecule imaging strategy to dissect directly and in real-time the correlation between nanometer-scale domain motion of a DNA repair protein and its interaction with individual DNA substrates. The strategy was applied to XPD, an FeS cluster-containing DNA repair helicase. Conformational dynamics was assessed via FeS-mediated quenching of a fluorophore site-specifically incorporated into XPD. Simultaneously, binding of DNA molecules labeled with a spectrally distinct fluorophore was detected by colocalization of the DNA- and protein-derived signals. We show that XPD undergoes thermally driven conformational transitions that manifest in spatial separation of its two auxiliary domains. DNA binding does not strictly enforce a specific conformation. Interaction with a cognate DNA damage, however, stabilizes the compact conformation of XPD by increasing the weighted average lifetime of this state by 140% relative to an undamaged DNA. Our imaging strategy will be a valuable tool to study other FeS-containing nucleic acid processing enzymes. PMID:25204359

Visualization of nanoconstructions with DNA-Aptamers for targeted molecules binding on the surface of screen-printed electrodes

NASA Astrophysics Data System (ADS)

Lapin, Ivan N.; Shabalina, Anastasiia V.; Svetlichyi, Valery A.; Kolovskaya, Olga S.

2018-04-01

Nanoconstructions of gold nanoparticles (NPs) obtained via pulsed laser ablation in liquid with DNA-aptamer specific to protein tumor marker were visualized on the surface of screen-printed electrode using scanning electron microscopy (SEM) and confocal laser scanning microscopy (CLSM). AuNPs/aptamer nanoconstuctions distribution on the solid surface was studied. More uniform coverage of the carbon electrode surface with the nanoconstuctions was showed in comparison with DNA-aptamer alone on the golden electrode surface. Targeted binding of the tumor marker molecules with the AuNPs/DNA-aptamer nanoconstuctions was approved.

Protein Detection via Direct Enzymatic Amplification of Short DNA Aptamers

PubMed Central

Fischer, Nicholas O.; Tarasow, Theodore M.; Tok, Jeffrey B.-H.

2008-01-01

Aptamers are single-stranded nucleic acids that fold into defined tertiary structures to bind target molecules with high specificities and affinities. DNA aptamers have garnered much interest as recognition elements for biodetection and diagnostic applications due to their small size, ease of discovery and synthesis, and chemical and thermal stability. Herein, we describe the design and application of a short DNA molecule capable of both protein target binding and amplifiable bioreadout processes. As both recognition and readout capabilities are incorporated into a single DNA molecule, tedious conjugation procedures required for protein-DNA hybrids can be omitted. The DNA aptamer is designed to be amplified directly by either the polymerase chain reaction (PCR) or rolling circle amplification (RCA) processes, taking advantage of real-time amplification monitoring techniques for target detection. A combination of both RCA and PCR provides a wide protein target dynamic range (1 μM to 10 pM). PMID:17980857

Synergistic effect of ATP for RuvA-RuvB-Holliday junction DNA complex formation.

PubMed

Iwasa, Takuma; Han, Yong-Woon; Hiramatsu, Ryo; Yokota, Hiroaki; Nakao, Kimiko; Yokokawa, Ryuji; Ono, Teruo; Harada, Yoshie

2015-12-14

The Escherichia coli RuvB hexameric ring motor proteins, together with RuvAs, promote branch migration of Holliday junction DNA. Zero mode waveguides (ZMWs) constitute of nanosized holes and enable the visualization of a single fluorescent molecule under micromolar order of the molecules, which is applicable to characterize the formation of RuvA-RuvB-Holliday junction DNA complex. In this study, we used ZMWs and counted the number of RuvBs binding to RuvA-Holliday junction DNA complex. Our data demonstrated that different nucleotide analogs increased the amount of Cy5-RuvBs binding to RuvA-Holliday junction DNA complex in the following order: no nucleotide, ADP, ATPγS, and mixture of ADP and ATPγS. These results suggest that not only ATP binding to RuvB but also ATP hydrolysis by RuvB facilitates a stable RuvA-RuvB-Holliday junction DNA complex formation.

MMPP Attenuates Non-Small Cell Lung Cancer Growth by Inhibiting the STAT3 DNA-Binding Activity via Direct Binding to the STAT3 DNA-Binding Domain.

PubMed

Son, Dong Ju; Zheng, Jie; Jung, Yu Yeon; Hwang, Chul Ju; Lee, Hee Pom; Woo, Ju Rang; Baek, Song Yi; Ham, Young Wan; Kang, Min Woong; Shong, Minho; Kweon, Gi Ryang; Song, Min Jong; Jung, Jae Kyung; Han, Sang-Bae; Kim, Bo Yeon; Yoon, Do Young; Choi, Bu Young; Hong, Jin Tae

2017-01-01

Rationale: Signal transducer and activator of transcription-3 (STAT3) plays a pivotal role in cancer biology. Many small-molecule inhibitors that target STAT3 have been developed as potential anticancer drugs. While designing small-molecule inhibitors that target the SH2 domain of STAT3 remains the leading focus for drug discovery, there has been a growing interest in targeting the DNA-binding domain (DBD) of the protein. Methods: We demonstrated the potential antitumor activity of a novel, small-molecule (E)-2-methoxy-4-(3-(4-methoxyphenyl)prop-1-en-1-yl)phenol (MMPP) that directly binds to the DBD of STAT3, in patient-derived non-small cell lung cancer (NSCLC) xenograft model as well as in NCI-H460 cell xenograft model in nude mice. Results: MMPP effectively inhibited the phosphorylation of STAT3 and its DNA binding activity in vitro and in vivo . It induced G1-phase cell cycle arrest and apoptosis through the regulation of cell cycle- and apoptosis-regulating genes by directly binding to the hydroxyl residue of threonine 456 in the DBD of STAT3. Furthermore, MMPP showed a similar or better antitumor activity than that of docetaxel or cisplatin. Conclusion: MMPP is suggested to be a potential candidate for further development as an anticancer drug that targets the DBD of STAT3.

Isolation from genomic DNA of sequences binding specific regulatory proteins by the acceleration of protein electrophoretic mobility upon DNA binding.

PubMed

Subrahmanyam, S; Cronan, J E

1999-01-21

We report an efficient and flexible in vitro method for the isolation of genomic DNA sequences that are the binding targets of a given DNA binding protein. This method takes advantage of the fact that binding of a protein to a DNA molecule generally increases the rate of migration of the protein in nondenaturing gel electrophoresis. By the use of a radioactively labeled DNA-binding protein and nonradioactive DNA coupled with PCR amplification from gel slices, we show that specific binding sites can be isolated from Escherichia coli genomic DNA. We have applied this method to isolate a binding site for FadR, a global regulator of fatty acid metabolism in E. coli. We have also isolated a second binding site for BirA, the biotin operon repressor/biotin ligase, from the E. coli genome that has a very low binding efficiency compared with the bio operator region.

Determining the Specificity of Cascade Binding, Interference, and Primed Adaptation In Vivo in the Escherichia coli Type I-E CRISPR-Cas System.

PubMed

Cooper, Lauren A; Stringer, Anne M; Wade, Joseph T

2018-04-17

In clustered regularly interspaced short palindromic repeat (CRISPR)-Cas (CRISPR-associated) immunity systems, short CRISPR RNAs (crRNAs) are bound by Cas proteins, and these complexes target invading nucleic acid molecules for degradation in a process known as interference. In type I CRISPR-Cas systems, the Cas protein complex that binds DNA is known as Cascade. Association of Cascade with target DNA can also lead to acquisition of new immunity elements in a process known as primed adaptation. Here, we assess the specificity determinants for Cascade-DNA interaction, interference, and primed adaptation in vivo , for the type I-E system of Escherichia coli Remarkably, as few as 5 bp of crRNA-DNA are sufficient for association of Cascade with a DNA target. Consequently, a single crRNA promotes Cascade association with numerous off-target sites, and the endogenous E. coli crRNAs direct Cascade binding to >100 chromosomal sites. In contrast to the low specificity of Cascade-DNA interactions, >18 bp are required for both interference and primed adaptation. Hence, Cascade binding to suboptimal, off-target sites is inert. Our data support a model in which the initial Cascade association with DNA targets requires only limited sequence complementarity at the crRNA 5' end whereas recruitment and/or activation of the Cas3 nuclease, a prerequisite for interference and primed adaptation, requires extensive base pairing. IMPORTANCE Many bacterial and archaeal species encode CRISPR-Cas immunity systems that protect against invasion by foreign DNA. In the Escherichia coli CRISPR-Cas system, a protein complex, Cascade, binds 61-nucleotide (nt) CRISPR RNAs (crRNAs). The Cascade complex is directed to invading DNA molecules through base pairing between the crRNA and target DNA. This leads to recruitment of the Cas3 nuclease, which destroys the invading DNA molecule and promotes acquisition of new immunity elements. We made the first in vivo measurements of Cascade binding to DNA targets. Thus, we show that Cascade binding to DNA is highly promiscuous; endogenous E. coli crRNAs can direct Cascade binding to >100 chromosomal locations. In contrast, we show that targeted degradation and acquisition of new immunity elements require highly specific association of Cascade with DNA, limiting CRISPR-Cas function to the appropriate targets. Copyright © 2018 Cooper et al.

DNA Molecules Adsorbed on Rippled Supported Cationic Lipid Membranes -- A new way to stretch DNAs

NASA Astrophysics Data System (ADS)

Golubovic, Leonardo

2005-03-01

We discuss a novel approach to control to shapes of DNA molecules. We elucidate the recent experimental work of M. Hochrein, L. Golubovic and J. Raedler, on the conformational behavior of DNA molecules adsorbed on lipid membranes that are supported on grooved micro-structured surfaces. We explain the striking ability of the edges formed on these supported membranes to adsorb and completely orient (stretch) very long DNA molecules. Here we explain the experimentally observed DNA stretching effect in terms of the surface curvature dependent electrostatic potential seen by the adsorbed DNA molecules. On the curved, rippled membrane, we show that the DNA molecules undergo localization transitions causing them to stretch by binding to the ripple edges of the supported membrane. In the future, this stretching will allow to directly image, by the common fluorescence microscopy, fundamental biological processes of the interactions between DNA and single protein molecules.

Non-uniform binding of single-stranded DNA binding proteins to hybrids of single-stranded DNA and single-walled carbon nanotubes observed by atomic force microscopy in air and in liquid

NASA Astrophysics Data System (ADS)

Umemura, Kazuo; Ishizaka, Kei; Nii, Daisuke; Izumi, Katsuki

2016-12-01

Using atomic force spectroscopy (AFM), we observed hybrids of single-stranded DNA (ssDNA) and single-walled carbon nanotubes (SWNTs) with or without protein molecules in air and in an aqueous solution. This is the first report of ssDNA-SWNT hybrids with proteins in solution analyzed by AFM. In the absence of protein, the height of the ssDNA-SWNT hybrids was 1.1 ± 0.3 nm and 2.4 ± 0.6 nm in air and liquid, respectively, suggesting that the ssDNA molecules adopted a flexible structure on the SWNT surface. In the presence of single-stranded DNA binding (SSB) proteins, the heights of the hybrids in air and liquid increased to 6.4 ± 3.1 nm and 10.0 ± 4.5 nm, respectively. The AFM images clearly showed binding of the SSB proteins to the ssDNA-SWNT hybrids. The morphology of the SSB-ssDNA-SWNT hybrids was non-uniform, particularly in aqueous solution. The variance of hybrid height was quantitatively estimated by cross-section analysis along the long-axis of each hybrid. The SSB-ssDNA-SWNT hybrids showed much larger variance than the ssDNA-SWNT hybrids.

Switchable DNA interfaces for the highly sensitive detection of label-free DNA targets.

PubMed

Rant, Ulrich; Arinaga, Kenji; Scherer, Simon; Pringsheim, Erika; Fujita, Shozo; Yokoyama, Naoki; Tornow, Marc; Abstreiter, Gerhard

2007-10-30

We report a method to detect label-free oligonucleotide targets. The conformation of surface-tethered probe nucleic acids is modulated by alternating electric fields, which cause the molecules to extend away from or fold onto the biased surface. Binding (hybridization) of targets to the single-stranded probes results in a pronounced enhancement of the layer-height modulation amplitude, monitored optically in real time. The method features an exceptional detection limit of <3 x 10(8) bound targets per cm(2) sensor area. Single base-pair mismatches in the sequences of DNA complements may readily be identified; moreover, binding kinetics and binding affinities can be determined with high accuracy. When driving the DNA to oscillate at frequencies in the kHz regime, distinct switching kinetics are revealed for single- and double-stranded DNA. Molecular dynamics are used to identify the binding state of molecules according to their characteristic kinetic fingerprints by using a chip-compatible detection format.

Switchable DNA interfaces for the highly sensitive detection of label-free DNA targets

PubMed Central

Rant, Ulrich; Arinaga, Kenji; Scherer, Simon; Pringsheim, Erika; Fujita, Shozo; Yokoyama, Naoki; Tornow, Marc; Abstreiter, Gerhard

2007-01-01

We report a method to detect label-free oligonucleotide targets. The conformation of surface-tethered probe nucleic acids is modulated by alternating electric fields, which cause the molecules to extend away from or fold onto the biased surface. Binding (hybridization) of targets to the single-stranded probes results in a pronounced enhancement of the layer-height modulation amplitude, monitored optically in real time. The method features an exceptional detection limit of <3 × 108 bound targets per cm2 sensor area. Single base-pair mismatches in the sequences of DNA complements may readily be identified; moreover, binding kinetics and binding affinities can be determined with high accuracy. When driving the DNA to oscillate at frequencies in the kHz regime, distinct switching kinetics are revealed for single- and double-stranded DNA. Molecular dynamics are used to identify the binding state of molecules according to their characteristic kinetic fingerprints by using a chip-compatible detection format. PMID:17951434

DNA residence time is a regulatory factor of transcription repression

PubMed Central

Clauß, Karen; Popp, Achim P.; Schulze, Lena; Hettich, Johannes; Reisser, Matthias; Escoter Torres, Laura; Uhlenhaut, N. Henriette

2017-01-01

Abstract Transcription comprises a highly regulated sequence of intrinsically stochastic processes, resulting in bursts of transcription intermitted by quiescence. In transcription activation or repression, a transcription factor binds dynamically to DNA, with a residence time unique to each factor. Whether the DNA residence time is important in the transcription process is unclear. Here, we designed a series of transcription repressors differing in their DNA residence time by utilizing the modular DNA binding domain of transcription activator-like effectors (TALEs) and varying the number of nucleotide-recognizing repeat domains. We characterized the DNA residence times of our repressors in living cells using single molecule tracking. The residence times depended non-linearly on the number of repeat domains and differed by more than a factor of six. The factors provoked a residence time-dependent decrease in transcript level of the glucocorticoid receptor-activated gene SGK1. Down regulation of transcription was due to a lower burst frequency in the presence of long binding repressors and is in accordance with a model of competitive inhibition of endogenous activator binding. Our single molecule experiments reveal transcription factor DNA residence time as a regulatory factor controlling transcription repression and establish TALE-DNA binding domains as tools for the temporal dissection of transcription regulation. PMID:28977492

Time-Resolved Fluorescence Resonance Energy Transfer Assay for Discovery of Small-Molecule Inhibitors of Methyl-CpG Binding Domain Protein 2.

PubMed

Wyhs, Nicolas; Walker, David; Giovinazzo, Hugh; Yegnasubramanian, Srinivasan; Nelson, William G

2014-08-01

Methylated DNA binding proteins such as Methyl-CpG Binding Domain Protein 2 (MBD2) can transduce DNA methylation alterations into a repressive signal by recruiting transcriptional co-repressor complexes. Interfering with MBD2 could lead to reactivation of tumor suppressor genes and therefore represents an attractive strategy for epigenetic therapy. We developed and compared fluorescence polarization (FP) and time-resolved fluorescence resonance energy transfer (TR-FRET)-based high-throughput screening (HTS) assays to identify small-molecule inhibitors of the interaction between the methyl binding domain of MBD2 (MBD2-MBD) and methylated DNA. Although both assays performed well in 96-well format, the TR-FRET assay (Z' factor = 0.58) emerged as a superior screening strategy compared with FP (Z' factor = 0.08) when evaluated in an HTS 384-well plate format. Using TR-FRET, we screened the Sigma LOPAC library for MBD2-MBD inhibitors and identified four compounds that also validated in a dose-response series. This included two known DNA intercalators (mitoxantrone and idarubicin) among two other inhibitory compounds (NF449 and aurintricarboxylic acid). All four compounds also inhibited the binding of SP-1, a transcription factor with a GC-rich binding sequence, to a methylated oligonucleotide, demonstrating that the activity was nonspecific. Our results provide proof of principle for using TR-FRET-based HTS to identify small-molecule inhibitors of MBD2 and other DNA-protein interactions. © 2014 Society for Laboratory Automation and Screening.

Optical tweezers reveal how proteins alter replication

NASA Astrophysics Data System (ADS)

Chaurasiya, Kathy

Single molecule force spectroscopy is a powerful method that explores the DNA interaction properties of proteins involved in a wide range of fundamental biological processes such as DNA replication, transcription, and repair. We use optical tweezers to capture and stretch a single DNA molecule in the presence of proteins that bind DNA and alter its mechanical properties. We quantitatively characterize the DNA binding mechanisms of proteins in order to provide a detailed understanding of their function. In this work, we focus on proteins involved in replication of Escherichia coli (E. coli ), endogenous eukaryotic retrotransposons Ty3 and LINE-1, and human immunodeficiency virus (HIV). DNA polymerases replicate the entire genome of the cell, and bind both double-stranded DNA (dsDNA) and single-stranded DNA (ssDNA) during DNA replication. The replicative DNA polymerase in the widely-studied model system E. coli is the DNA polymerase III subunit alpha (DNA pol III alpha). We use optical tweezers to determine that UmuD, a protein that regulates bacterial mutagenesis through its interactions with DNA polymerases, specifically disrupts alpha binding to ssDNA. This suggests that UmuD removes alpha from its ssDNA template to allow DNA repair proteins access to the damaged DNA, and to facilitate exchange of the replicative polymerase for an error-prone translesion synthesis (TLS) polymerase that inserts nucleotides opposite the lesions, so that bacterial DNA replication may proceed. This work demonstrates a biophysical mechanism by which E. coli cells tolerate DNA damage. Retroviruses and retrotransposons reproduce by copying their RNA genome into the nuclear DNA of their eukaryotic hosts. Retroelements encode proteins called nucleic acid chaperones, which rearrange nucleic acid secondary structure and are therefore required for successful replication. The chaperone activity of these proteins requires strong binding affinity for both single- and double-stranded nucleic acids. We use single molecule DNA stretching to show that the nucleocapsid protein (NC) of the yeast retrotransposon Ty3, which is likely to be an ancestor of HIV NC, has optimal nucleic acid chaperone activity with only a single zinc finger. We also show that the chaperone activity of the ORF1 protein is responsible for successful replication of the mouse LINE-1 retrotransposon. LINE-1 is also 17% of the human genome, where it generates insertion mutations and alters gene expression. Retrotransposons such as LINE-1 and Ty3 are likely to be ancestors of retroviruses such as HIV. Human APOBEC3G (A3G) inhibits HIV-1 replication via cytidine deamination of the viral ssDNA genome, as well as via a distinct deamination-independent mechanism. Efficient deamination requires rapid on-off binding kinetics, but a slow dissociation rate is required for the proposed deaminase-independent mechanism. We resolve this apparent contradiction with a new quantitative single molecule method, which shows that A3G initially binds ssDNA with fast on-off rates and subsequently converts to a slow binding mode. This suggests that oligomerization transforms A3G from a fast enzyme to a slow binding protein, which is the biophysical mechanism that allows A3G to inhibit HIV replication. A complete understanding of the mechanism of A3G-mediated antiviral activity is required to design drugs that disrupt the viral response to A3G, enhance A3G packaging inside the viral core, and other potential strategies for long-term treatment of HIV infection. We use single molecule biophysics to explore the function of proteins involved in bacterial DNA replication, endogenous retrotransposition of retroelements in eukaryotic hosts such yeast and mice, and HIV replication in human cells. Our quantitative results provide insight into protein function in a range of complex biological systems and have wide-ranging implications for human health.

Selection and Characterization of Single Stranded DNA Aptamers for the Hormone Abscisic Acid

PubMed Central

Gonzalez, Victor M.; Millo, Enrico; Sturla, Laura; Vigliarolo, Tiziana; Bagnasco, Luca; Guida, Lucrezia; D'Arrigo, Cristina; De Flora, Antonio; Salis, Annalisa; Martin, Elena M.; Bellotti, Marta; Zocchi, Elena

2013-01-01

The hormone abscisic acid (ABA) is a small molecule involved in pivotal physiological functions in higher plants. Recently, ABA has been also identified as an endogenous hormone in mammals, regulating different cell functions including inflammatory processes, stem cell expansion, insulin release, and glucose uptake. Aptamers are short, single-stranded (ss) oligonucleotidesable to recognize target molecules with high affinity. The small size of the ABA molecule represented a challenge for aptamer development and the aim of this study was to develop specific anti-ABA DNA aptamers. Biotinylated abscisic acid (bio-ABA) was immobilized on streptavidin-coated magnetic beads. DNA aptamers against bio-ABA were selected with 7 iterative rounds of the systematic evolution of ligands by exponential enrichment method (SELEX), each round comprising incubation of the ABA-binding beads with the ssDNA sequences, DNA elution, electrophoresis, and polymerase chain reaction (PCR) amplification. The PCR product was cloned and sequenced. The binding affinity of several clones was determined using bio-ABA immobilized on streptavidin-coated plates. Aptamer 2 and aptamer 9 showed the highest binding affinity, with dissociation constants values of 0.98±0.14 μM and 0.80±0.07 μM, respectively. Aptamers 2 and 9 were also able to bind free, unmodified ABA and to discriminate between different ABA enantiomers and isomers. Our findings indicate that ssDNA aptamers can selectively bind ABA and could be used for the development of ABA quantitation assays. PMID:23971905

Scanning confocal fluorescence microscopy for single molecule analysis of nucleotide excision repair complexes.

PubMed

Segers-Nolten, G M J; Wyman, C; Wijgers, N; Vermeulen, W; Lenferink, A T M; Hoeijmakers, J H J; Greve, J; Otto, C

2002-11-01

We used scanning confocal fluorescence microscopy to observe and analyze individual DNA- protein complexes formed between human nucleotide excision repair (NER) proteins and model DNA substrates. For this purpose human XPA protein was fused to EGFP, purified and shown to be functional. Binding of EGFP-labeled XPA protein to a Cy3.5-labeled DNA substrate, in the presence and absence of RPA, was assessed quantitatively by simultaneous excitation and emission detection of both fluorophores. Co-localization of Cy3.5 and EGFP signals within one diffraction limited spot indicated complexes of XPA with DNA. Measurements were performed on samples in a 1% agarose matrix in conditions that are compatible with protein activity and where reactions can be studied under equilibrium conditions. In these samples DNA alone was freely diffusing and protein-bound DNA was immobile, whereby they could be discriminated resulting in quantitative data on DNA binding. On the single molecule level approximately 10% of XPA co-localized with DNA; this increased to 32% in the presence of RPA. These results, especially the enhanced binding of XPA in the presence of RPA, are similar to those obtained in bulk experiments, validating the utility of scanning confocal fluorescence microscopy for investigating functional interactions at the single molecule level.

Live-Cell Imaging of DNA Methylation Based on Synthetic-Molecule/Protein Hybrid Probe.

PubMed

Kumar, Naresh; Hori, Yuichiro; Kikuchi, Kazuya

2018-06-04

The epigenetic modification of DNA involves the conversion of cytosine to 5-methylcytosine, also known as DNA methylation. DNA methylation is important in modulating gene expression and thus, regulating genome and cellular functions. Recent studies have shown that aberrations in DNA methylation are associated with various epigenetic disorders or diseases including cancer. This stimulates great interest in the development of methods that can detect and visualize DNA methylation. For instance, fluorescent proteins (FPs) in conjugation with methyl-CpG-binding domain (MBD) have been employed for live-cell imaging of DNA methylation. However, the FP-based approach showed fluorescence signals for both the DNA-bound and -unbound states and thus differentiation between these states is difficult. Synthetic-molecule/protein hybrid probes can provide an alternative to overcome this restriction. In this article, we discuss the synthetic-molecule/protein hybrid probe that we developed recently for live-cell imaging of DNA methylation, which exhibited fluorescence enhancement only after binding to methylated DNA. © 2018 The Chemical Society of Japan & Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

An analysis of subunit exchange in the dimeric DNA-binding and DNA-bending protein, TF1.

PubMed

Andera, L; Schneider, G J; Geiduschek, E P

1994-01-01

TF1 is the Bacillus subtilis bacteriophage-encoded dimeric type II DNA-binding protein. This relative of the eubacterial HU proteins and of the Escherichia coli integration host factor binds preferentially to 5-(hydroxymethyluracil)-containing DNA. We have examined the dynamics of exchange of monomer subunits between molecules of dimeric TF1. The analysis takes advantage of the fact that replacement of phenylalanine with arginine at amino acid 61 in the beta-loop 'arm' of TF1 alters DNA-bending and -binding properties, generating DNA complexes with distinctively different mobilities in gel electrophoresis. New species of DNA-protein complexes were formed by mixtures of wild type and mutant TF1, reflecting the formation of heterodimeric TF1, and making the dynamics of monomer exchange between TF1 dimers accessible to a simple gel retardation analysis. Exchange was rapid at high protein concentrations, even at 0 degrees C, and is proposed to be capable of proceeding through an interaction of molecules of TF1 dimer rather than exclusively through dissociation into monomer subunits. Evidence suggesting that DNA-bound TF1 dimers do not exchange subunits readily is also presented.

Computational investigation of fullerene-DNA interactions: Implications of fullerene's size and functionalization on DNA structure and binding energetics.

PubMed

Papavasileiou, Konstantinos D; Avramopoulos, Aggelos; Leonis, Georgios; Papadopoulos, Manthos G

2017-06-01

DNA is the building block of life, as it carries the biological information controlling development, function and reproduction of all organisms. However, its central role in storing and transferring genetic information can be severely hindered by molecules with structure altering abilities. Fullerenes are nanoparticles that find a broad spectrum of uses, but their toxicological effects on living organisms upon exposure remain unclear. The present study examines the interactions of a diverse array of fullerenes with DNA, by means of Molecular Dynamics and MM-PBSA methodologies, with special focus on structural deformations that may hint toxicity implications. Our results show that pristine and hydroxylated fullerenes have no unwinding effects upon DNA structure, with the latter displaying binding preference to the DNA major groove, achieved by both direct formation of hydrogen bonds and water molecule mediation. Fluorinated derivatives are capable of penetrating DNA structure, forming intercalative complexes with high binding affinities. Copyright © 2017 Elsevier Inc. All rights reserved.

Cooperative Assembly of Co-Smad4 MH1 with R-Smad1/3 MH1 on DNA: A Molecular Dynamics Simulation Study

PubMed Central

Wang, Guihong; Li, Chaoqun; Wang, Yan; Chen, Guangju

2013-01-01

Background Smads, the homologs of Sma and MAD proteins, play a key role in gene expression regulation in the transforming growth factor-β (TGF-β) signaling pathway. Recent experimental studies have revealed that Smad4/R-Smad heterodimers bound on DNA are energetically more favorable than homodimeric R-Smad/R-Smad complexes bound on DNA, which indicates that Smad4 might act as binding vehicle to cooperatively assemble with activated R-Smads on DNA in the nucleus. However, the details of interaction mechanism for cooperative recruitment of Smad4 protein to R-Smad proteins on DNA, and allosteric communication between the Smad4-DNA and R-Smad-DNA interfaces via DNA mediating are not yet clear so far. Methodology In the present work, we have constructed a series of Smadn+DNA+Smadn (n = 1, 3, 4) models and carried out molecular dynamics simulations, free energy calculations and DNA dynamics analysis for them to study the interaction properties of Smadn (n = 1, 3, 4) with DNA molecule. Results The results revealed that the binding of Smad4 protein to DNA molecule facilitates energetically the formation of the heteromeric Smad4+DNA+Smad1/3 complex by increasing the affinity of Smad1/3 with DNA molecule. Further investigations through the residue/base motion correlation and DNA dynamics analyses predicted that the binding of Smad4 protein to DNA molecule in the heteromeric Smad4+DNA+Smad1/3 model induces an allosteric communication from the Smad4-DNA interface to Smad1/Smad3-DNA interface via DNA base-pair helical motions, surface conformation changes and new hydrogen bond formations. The present work theoretically explains the mechanism of cooperative recruitment of Smad4 protein to Smad1/3 protein via DNA-mediated indirect readout mode in the nucleus. PMID:23326519

Measurements of nonlinear Hall-driven reconnection in the reversed field pinch

NASA Astrophysics Data System (ADS)

Tharp, Timothy D.

Complex organisms are able to develop because of the complex regulatory systems that control their gene expression. The first step in this regulation, transcription initiation, is controlled by transcription factors. Transcription factors are modular proteins composed of two distinct domains, the DNA binding domain and the regulatory domain. These molecules are involved in a plethora of important biological processes including embryogenesis, development, cell health, and cancer. Tissue enriched transcription factors Nkx-2.5 and Gata4 are involved in cardiac development and cardiac health. In this thesis the DNA binding specificity of Nkx-2.5 will be analyzed using a high throughput double stranded DNA platform called Cognate Site Identifier (CSI) arrays (Chapter 2). The full DNA binding specificity of Nkx-2.5 and Nkx-2.5 mutants will be visualized using Sequence Specificity Landscapes (SSLs). In Chapter 3, the definition of binding specificity will be investigated by evaluating a number of different DNA binding folds by CSI and SSLs. CSI and SSLs will also be used to evaluate different pyrrole/imidazole hairpin polyamides in order to better characterize these small molecule DNA binding domains. CSI and SSL data will be applied to the genome in order to explain the biological function an artificial transcription factor. Chapter 4 will discuss the mechanism of nonspecific DNA binding. The historical means of predicting DNA binding will be challenged by utilizing high throughput experiments. The effect of salt concentration on both specific and nonspecific binding will also be investigated. Finally, in Chapter 5, a generation of Protein DNA Dimerizer will be discussed. A PDD that regulates transcription on genomic DNA by binding cooperatively with the heart IF Gata4 will be characterized. These studies provide understanding of, and a means to control, how transcription factors sample the endless sea of DNA in the genome in order to regulate gene expression with such wonderful specificity.

Simulation studies of DNA at the nanoscale: Interactions with proteins, polycations, and surfaces

NASA Astrophysics Data System (ADS)

Elder, Robert M.

Understanding the nanoscale interactions of DNA, a multifunctional biopolymer with sequence-dependent properties, with other biological and synthetic substrates and molecules is essential to advancing these technologies. This doctoral thesis research is aimed at understanding the thermodynamics and molecular-level structure when DNA interacts with proteins, polycations, and functionalized surfaces. First, we investigate the ability of a DNA damage recognition protein (HMGB1a) to bind to anti-cancer drug-induced DNA damage, seeking to explain how HMGB1a differentiates between the drugs in vivo. Using atomistic molecular dynamics simulations, we show that the structure of the drug-DNA molecule exhibits drug- and base sequence-dependence that explains some of the experimentally observed differential recognition of the drugs in various sequence contexts. Then, we show how steric hindrance from the drug decreases the deformability of the drug-DNA molecule, which decreases recognition by the protein, a concept that can be applied to rational drug design. Second, we study how polycation architecture and chemistry affect polycation-DNA binding so as to design optimal polycations for high efficiency gene (DNA) delivery. Using a multiscale computational approach involving atomistic and coarse-grained simulations, we examine how rearranging polylysine from a linear to a grafted architecture, and several aspects of the grafted architecture, affect polycation-DNA binding and the structure of polycation-DNA complexes. Next, going beyond lysine we examine how oligopeptide chemistry and sequence in the grafted architecture affects polycation-DNA binding and find that strategic placement of hydrophobic peptides might be used to tailor binding strength. Third, we study the adsorption and conformations of single-stranded DNA (an amphiphilic biopolymer) on model hydrophilic and hydrophobic surfaces. Short ssDNA oligomers adsorb to both surfaces with similar strength, with the strength of adsorption to the hydrophobic surface depending on the composition of the DNA strands, i.e. purine or pyrimidine bases. Additionally, DNA-surface and DNA-water interactions near the surfaces govern the adsorption. For longer ssDNA oligomers, the effects of surface chemistry and temperature on ssDNA conformations are rather small, but either the hydrophilic surface or increased temperature favor slightly more compact conformations due to energetic and entropic effects, respectively.

Structural basis of DNA folding and recognition in an AMP-DNA aptamer complex: distinct architectures but common recognition motifs for DNA and RNA aptamers complexed to AMP.

PubMed

Lin, C H; Patel, D J

1997-11-01

Structural studies by nuclear magnetic resonance (NMR) of RNA and DNA aptamer complexes identified through in vitro selection and amplification have provided a wealth of information on RNA and DNA tertiary structure and molecular recognition in solution. The RNA and DNA aptamers that target ATP (and AMP) with micromolar affinity exhibit distinct binding site sequences and secondary structures. We report below on the tertiary structure of the AMP-DNA aptamer complex in solution and compare it with the previously reported tertiary structure of the AMP-RNA aptamer complex in solution. The solution structure of the AMP-DNA aptamer complex shows, surprisingly, that two AMP molecules are intercalated at adjacent sites within a rectangular widened minor groove. Complex formation involves adaptive binding where the asymmetric internal bubble of the free DNA aptamer zippers up through formation of a continuous six-base mismatch segment which includes a pair of adjacent three-base platforms. The AMP molecules pair through their Watson-Crick edges with the minor groove edges of guanine residues. These recognition G.A mismatches are flanked by sheared G.A and reversed Hoogsteen G.G mismatch pairs. The AMP-DNA aptamer and AMP-RNA aptamer complexes have distinct tertiary structures and binding stoichiometries. Nevertheless, both complexes have similar structural features and recognition alignments in their binding pockets. Specifically, AMP targets both DNA and RNA aptamers by intercalating between purine bases and through identical G.A mismatch formation. The recognition G.A mismatch stacks with a reversed Hoogsteen G.G mismatch in one direction and with an adenine base in the other direction in both complexes. It is striking that DNA and RNA aptamers selected independently from libraries of 10(14) molecules in each case utilize identical mismatch alignments for molecular recognition with micromolar affinity within binding-site pockets containing common structural elements.

Strong DNA deformation required for extremely slow DNA threading intercalation by a binuclear ruthenium complex

PubMed Central

Almaqwashi, Ali A.; Paramanathan, Thayaparan; Lincoln, Per; Rouzina, Ioulia; Westerlund, Fredrik; Williams, Mark C.

2014-01-01

DNA intercalation by threading is expected to yield high affinity and slow dissociation, properties desirable for DNA-targeted therapeutics. To measure these properties, we utilize single molecule DNA stretching to quantify both the binding affinity and the force-dependent threading intercalation kinetics of the binuclear ruthenium complex Δ,Δ-[μ‐bidppz‐(phen)4Ru2]4+ (Δ,Δ-P). We measure the DNA elongation at a range of constant stretching forces using optical tweezers, allowing direct characterization of the intercalation kinetics as well as the amount intercalated at equilibrium. Higher forces exponentially facilitate the intercalative binding, leading to a profound decrease in the binding site size that results in one ligand intercalated at almost every DNA base stack. The zero force Δ,Δ-P intercalation Kd is 44 nM, 25-fold stronger than the analogous mono-nuclear ligand (Δ-P). The force-dependent kinetics analysis reveals a mechanism that requires DNA elongation of 0.33 nm for association, relaxation to an equilibrium elongation of 0.19 nm, and an additional elongation of 0.14 nm from the equilibrium state for dissociation. In cells, a molecule with binding properties similar to Δ,Δ-P may rapidly bind DNA destabilized by enzymes during replication or transcription, but upon enzyme dissociation it is predicted to remain intercalated for several hours, thereby interfering with essential biological processes. PMID:25245944

Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p: reinterpretation of recent single molecule experiments.

PubMed

Stigter, Dirk

2004-07-01

Brewer et al. (Biophys. J. 85 (2003) 2519-2524) have studied the compaction of dsDNA in a double flow cell by observing the extension of stained DNA tethered in buffer solutions with or without Abf2p. They use a Langmuir adsorption model in which one Abf2p molecule adsorbs on one site on the DNA, and the binding constant, K, is given as the ratio of the experimental rates of adsorption and desorption. This paper presents an improved interpretation. Instead of Langmuir adsorption we use the more appropriate McGhee-von Hippel (J. Mol. Biol. 86 (1974) 469-489) theory for the adsorption of large ligands to a one-dimensional lattice. We assume that each adsorbed molecule shortens the effective contour length of DNA by the foot print of Abf2p of 27 base pairs. When Abf2p adsorbs to DNA stretched in the flowing buffer solution, we account for a tension effect that decreases the adsorption rate and the binding constant by a factor of 2 to 4. The data suggest that the accessibility to Abf2p decreases significantly with increasing compaction of DNA, resulting in a lower adsorption rate and a lower binding constant. The kinetics reported by Brewer et al. (Biophys. J. 85 (2003) 2519-2524) lead to a binding constant K=3.6 x 10(6) M(-1) at the beginning, and to K=5 x 10(5) M(-1) near the end of a compaction run, more than an order of magnitude lower than the value K=2.57 x 10(7) M(-1) calculated by Brewer et al. (Biophys. J. 85 (2003) 2519-2524).

Interaction of small molecules with double-stranded RNA: spectroscopic, viscometric, and calorimetric study of hoechst and proflavine binding to PolyCG structures.

PubMed

Sinha, Rangana; Hossain, Maidul; Kumar, Gopinatha Suresh

2009-04-01

Design and synthesis of new small molecules binding to double-stranded RNA necessitate complete understanding of the molecular aspects of the binding of many existing molecules. Toward this goal, in this work we evaluated the biophysical aspects of the interaction of a DNA intercalator (proflavine) and a minor groove binder (hoechst 33258) with two polymorphic forms of polyCG, namely, the right-handed Watson-Crick base paired A-form and the left-handed Hoogsteen base paired H(L)-form, by absorption, fluorescence, and viscometry experiments. The energetics of the interaction of these molecules with the RNA structures has also been elucidated by isothermal titration calorimetry (ITC). Results suggest that proflavine strongly intercalates in both forms of polyCG, whereas hoechst shows mainly groove-binding modes. The binding of both drugs to both forms of RNA resulted in significant conformational change to the RNA structure with the bound molecules being placed in the chiral RNA helix. ITC profiles for both proflavine and hoechst show two binding sites. Binding of proflavine to both forms of RNA is endothermic and entropy driven in the first site and exothermic and enthalpy driven in the second site, whereas hoechst binding to both forms of RNA is exothermic and enthalpy driven in the first site and endothermic and entropy driven in the second site. This study suggests that the binding affinity characteristics and energetics of interaction of these DNA binding molecules with the RNA conformations are significantly different and may serve as data for future development of effective structure-selective RNA-based drugs.

Specificity of the weak binding between the phage SPO1 transcription-inhibitory protein, TF1, and SPO1 DNA.

PubMed

Johnson, G G; Geiduschek, E P

1977-04-05

The interaction of the phage SPO1 protein transcription factor 1 (TF1), with DNA has been analyzed by membrane filter binding and by sedimentation methods. Substantially specific binding of TF1 to helical SPO1 DNA can be demonstrated by nitrocellulose filter-binding assays at relatively low ionic strength (0.08). However, TF1-DNA complexes dissociate and reequilibrate relatively rapidly and this makes filter-binding assays unsuitable for quantitative measurements of binding equilibra. Accordingly, the sedimentation properties of TF1-DNA complexes have been explored and a short-column centrifugation assay has been elaborated for quantitative measurements. Preferential binding of TF1 to the hydroxymethyluracil-containing SPO1 DNA has also been demonstrated by short-column centrifugation. TF1 binds relatively weakly and somewhat cooperatively to SPO1 DNA at many sites; TF1-DNA complexes dissociate and reequilibrate rapidly. At 20 degrees C in 0.01 M phosphate, pH 7.5, 0.15 KC1, one molecule of TF1 can bind to approximately every 60 nucleotide pairs of SPO1 DNA.

Secondary structure prediction and structure-specific sequence analysis of single-stranded DNA.

PubMed

Dong, F; Allawi, H T; Anderson, T; Neri, B P; Lyamichev, V I

2001-08-01

DNA sequence analysis by oligonucleotide binding is often affected by interference with the secondary structure of the target DNA. Here we describe an approach that improves DNA secondary structure prediction by combining enzymatic probing of DNA by structure-specific 5'-nucleases with an energy minimization algorithm that utilizes the 5'-nuclease cleavage sites as constraints. The method can identify structural differences between two DNA molecules caused by minor sequence variations such as a single nucleotide mutation. It also demonstrates the existence of long-range interactions between DNA regions separated by >300 nt and the formation of multiple alternative structures by a 244 nt DNA molecule. The differences in the secondary structure of DNA molecules revealed by 5'-nuclease probing were used to design structure-specific probes for mutation discrimination that target the regions of structural, rather than sequence, differences. We also demonstrate the performance of structure-specific 'bridge' probes complementary to non-contiguous regions of the target molecule. The structure-specific probes do not require the high stringency binding conditions necessary for methods based on mismatch formation and permit mutation detection at temperatures from 4 to 37 degrees C. Structure-specific sequence analysis is applied for mutation detection in the Mycobacterium tuberculosis katG gene and for genotyping of the hepatitis C virus.

Dynamic binding of replication protein a is required for DNA repair

PubMed Central

Chen, Ran; Subramanyam, Shyamal; Elcock, Adrian H.; Spies, Maria; Wold, Marc S.

2016-01-01

Replication protein A (RPA), the major eukaryotic single-stranded DNA (ssDNA) binding protein, is essential for replication, repair and recombination. High-affinity ssDNA-binding by RPA depends on two DNA binding domains in the large subunit of RPA. Mutation of the evolutionarily conserved aromatic residues in these two domains results in a separation-of-function phenotype: aromatic residue mutants support DNA replication but are defective in DNA repair. We used biochemical and single-molecule analyses, and Brownian Dynamics simulations to determine the molecular basis of this phenotype. Our studies demonstrated that RPA binds to ssDNA in at least two modes characterized by different dissociation kinetics. We also showed that the aromatic residues contribute to the formation of the longer-lived state, are required for stable binding to short ssDNA regions and are needed for RPA melting of partially duplex DNA structures. We conclude that stable binding and/or the melting of secondary DNA structures by RPA is required for DNA repair, including RAD51 mediated DNA strand exchange, but is dispensable for DNA replication. It is likely that the binding modes are in equilibrium and reflect dynamics in the RPA–DNA complex. This suggests that dynamic binding of RPA to DNA is necessary for different cellular functions. PMID:27131385

Effect of Escherichia coli DNA binding protein on the transcription of single-stranded phage M13 DNA by Escherichia coli RNA polymerase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Niyogi, S.K.; Ratrie, H. III; Datta, A.K.

E. coli DNA binding protein strongly inhibits the transcription of single-stranded rather than double-stranded phage M13 DNA by E. coli RNA polymerase. This inhibition cannot be significantly overcome by increasing the concentration of RNA polymerase. Nor does the order of addition of binding protein affect its inhibitory property: inhibition is evident whether binding protein is added before or after the formation of the RNA polymerase--DNA complex. Inhibition is also observed if binding protein is added at various times after initiation of RNA synthesis. Maximal inhibition occurs at a binding protein-to-DNA ratio (w/w) of about 8:1. This corresponds to one bindingmore » protein molecule covering about 30 nucleotides, in good agreement with values obtained by physical measurements.« less

Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

DOEpatents

McCutchen-Maloney, Sandra L.

2002-01-01

DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

Spectroscopic and viscometric elucidation of the interaction between a potential chloride channel blocker and calf-thymus DNA: the effect of medium ionic strength on the binding mode.

PubMed

Ganguly, Aniruddha; Ghosh, Soumen; Guchhait, Nikhil

2015-01-07

The present study demonstrates a detailed characterization of the binding interaction of a potential chloride channel blocker 9-methyl anthroate (9-MA) with calf-thymus DNA. The modulated photophysical properties of the emissive molecule within the microheterogeneous bio-assembly have been spectroscopically exploited to monitor the drug-DNA binding interaction. Experimental results based on fluorescence and absorption spectroscopy aided with DNA-melting, viscometric and circular dichroism studies unambiguously establish the binding mode between the drug and DNA to be principally intercalative. Concomitantly, a discernible dependence of the mode of binding between the concerned moieties on the ionic strength of the medium is noteworthy. A dip-and-rise characteristic of the rotational relaxation profile of the drug within the DNA environment has been argued to be originating from a substantial difference in the lifetime as well as amplitude of the free and DNA bound drug molecule. In view of the prospective biological applications of the drug, the issue of facile dissociation of the intercalated drug from the DNA helix via a simple detergent-sequestration technique has also been unveiled. The utility of the present work resides in exploring the potential applicability of the fluorescence properties of 9-MA for studying its interactions with other relevant biological or biomimicking targets.

Control of DNA hybridization by photoswitchable molecular glue.

PubMed

Dohno, Chikara; Nakatani, Kazuhiko

2011-12-01

Hybridization of DNA is one of the most intriguing events in molecular recognition and is essential for living matter to inherit life beyond generations. In addition to the function of DNA as genetic material, DNA hybridization is a key to control the function of DNA-based materials in nanoscience. Since the hybridization of two single stranded DNAs is a thermodynamically favorable process, dissociation of the once formed DNA duplex is normally unattainable under isothermal conditions. As the progress of DNA-based nanoscience, methodology to control the DNA hybridization process has become increasingly important. Besides many reports using the chemically modified DNA for the regulation of hybridization, we focused our attention on the use of a small ligand as the molecular glue for the DNA. In 2001, we reported the first designed molecule that strongly and specifically bound to the mismatched base pairs in double stranded DNA. Further studies on the mismatch binding molecules provided us a key discovery of a novel mode of the binding of a mismatch binding ligand that induced the base flipping. With these findings we proposed the concept of molecular glue for DNA for the unidirectional control of DNA hybridization and, eventually photoswitchable molecular glue for DNA, which enabled the bidirectional control of hybridization under photoirradiation. In this tutorial review, we describe in detail how we integrated the mismatch binding ligand into photoswitchable molecular glue for DNA, and the application and perspective in DNA-based nanoscience.

The activity of CouR, a MarR family transcriptional regulator, is modulated through a novel molecular mechanism

DOE PAGES

Otani, Hiroshi; Stogios, Peter J.; Xu, Xiaohui; ...

2015-09-22

CouR, a MarR-type transcriptional repressor, regulates the cou genes, encoding p-hydroxycinnamate catabolism in the soil bacterium Rhodococcus jostii RHA1. The CouR dimer bound two molecules of the catabolite p-coumaroyl–CoA (K d = 11 ± 1 μM). The presence of p-coumaroyl–CoA, but neither p-coumarate nor CoASH, abrogated CouR's binding to its operator DNA in vitro. The crystal structures of ligand-free CouR and its p-coumaroyl–CoA-bound form showed no significant conformational differences, in contrast to other MarR regulators. The CouR– p-coumaroyl–CoA structure revealed two ligand molecules bound to the CouR dimer with their phenolic moieties occupying equivalent hydrophobic pockets in each protomer andmore » their CoA moieties adopting non-equivalent positions to mask the regulator's predicted DNA-binding surface. More specifically, the CoA phosphates formed salt bridges with predicted DNA-binding residues Arg36 and Arg38, changing the overall charge of the DNA-binding surface. The substitution of either arginine with alanine completely abrogated the ability of CouR to bind DNA. By contrast, the R36A/R38A double variant retained a relatively high affinity for p-coumaroyl–CoA (K d = 89 ± 6 μM). Altogether, our data point to a novel mechanism of action in which the ligand abrogates the repressor's ability to bind DNA by steric occlusion of key DNA-binding residues and charge repulsion of the DNA backbone.« less

Exploiting hydrogen bonding interactions to probe smaller linear and cyclic diamines binding to G-quadruplexes: a DFT and molecular dynamics study.

PubMed

Kanti Si, Mrinal; Sen, Anik; Ganguly, Bishwajit

2017-05-10

G-quadruplexes are formed by the association of four guanine bases through Hoogsteen hydrogen bonding in guanine-rich sequences of DNA and exist in the telomere as well as in promoter regions of certain oncogenes. The sequences of G-quadruplex-DNA are targets for the design of molecules that can bind and can be developed as anti-cancer drugs. The linear and cyclic protonated diamines have been explored to bind to G-quadruplex-DNA through hydrogen bonding interactions. The quadruplex-DNA binders exploit π-stacking and hydrogen bonding interactions with the phosphate backbone of loops and grooves. In this study, linear and cyclic protonated diamines showed remarkable binding affinity for G-tetrads using hydrogen bonding interactions. The DFT M06-2X/6-31G(d)//B3LYP/6-31+G(d) level of theory showed that the cyclic ee-1,2-CHDA (equatorial-equatorial form of 1,2-disubstituted cyclohexadiamine di-cation) binds to the G-tetrads very strongly (∼70.0 kcal mol -1 ), with a much higher binding energy than the linear protonated diamines. The binding affinity of ligands for G-tetrads with counterions has also been examined. The binding preference of these small ligands for G-tetrads is higher than for DNA-duplex. The binding affinity of an intercalated acridine-based ligand (BRACO-19) for G-quadruplexes has been examined and the binding energy is relatively lower than that for the 1,2 disubstituted cyclohexadiamine di-cation with G-tetrads. The atoms-in-molecules (AIM) analysis reveals that the hydrogen bonding interactions between the organic systems with G-tetrads are primarily electrostatic in nature. The molecular dynamics simulations performed using a classical force field (GROMACS) also supported the phosphate backbone sites of G-quadruplex-DNA to bind to these diamines. To mimic the structural pattern of BRACO-19, the designed inhibitor N,2-bis-2(3,4-aminocyclohexyl) acetamide (9) examined possesses two 1,2-CHDA moieties linked through an acetamide group. The molecular dynamics results showed that the designed molecule 9 can efficiently bind to the base-pairs and the phosphate backbone of G quadruplex-DNA using H-bonding interactions. The binding affinity calculated for the intercalated acridine-based drug (BRACO-19) with G-quadruplexes is weaker compared to ee-1,2-CHDA. These ligands deliver a different binding motif (hydrogen bonding) compared to the reported G-quadruplex binders of π-delocalized systems and will kindle interest in examining such scaffolds to stabilize DNA.

Structure of Escherichia coli dGTP Triphosphohydrolase: A Hexameric Enzyme with DNA Effector Molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singh, Deepa; Gawel, Damian; Itsko, Mark

The Escherichia coli dgt gene encodes a dGTP triphosphohydrolase whose detailed role still remains to be determined. Deletion of dgt creates a mutator phenotype, indicating that the dGTPase has a fidelity role, possibly by affecting the cellular dNTP pool. In the present paper, we have investigated the structure of the Dgt protein at 3.1-Å resolution. One of the obtained structures revealed a protein hexamer that contained two molecules of single-stranded DNA. The presence of DNA caused significant conformational changes in the enzyme, including in the catalytic site of the enzyme. Dgt preparations lacking DNA were able to bind single-stranded DNAmore » with high affinity (K d ~ 50 nM). DNA binding positively affected the activity of the enzyme: dGTPase activity displayed sigmoidal (cooperative) behavior without DNA but hyperbolic (Michaelis-Menten) kinetics in its presence, consistent with a specific lowering of the apparent K m for dGTP. A mutant Dgt enzyme was also created containing residue changes in the DNA binding cleft. This mutant enzyme, whereas still active, was incapable of DNA binding and could no longer be stimulated by addition of DNA. We also created an E. coli strain containing the mutant dgt gene on the chromosome replacing the wild-type gene. The mutant also displayed a mutator phenotype. Finally, our results provide insight into the allosteric regulation of the enzyme and support a physiologically important role of DNA binding.« less

Structure of Escherichia coli dGTP Triphosphohydrolase: A Hexameric Enzyme with DNA Effector Molecules

DOE PAGES

Singh, Deepa; Gawel, Damian; Itsko, Mark; ...

2015-02-18

The Escherichia coli dgt gene encodes a dGTP triphosphohydrolase whose detailed role still remains to be determined. Deletion of dgt creates a mutator phenotype, indicating that the dGTPase has a fidelity role, possibly by affecting the cellular dNTP pool. In the present paper, we have investigated the structure of the Dgt protein at 3.1-Å resolution. One of the obtained structures revealed a protein hexamer that contained two molecules of single-stranded DNA. The presence of DNA caused significant conformational changes in the enzyme, including in the catalytic site of the enzyme. Dgt preparations lacking DNA were able to bind single-stranded DNAmore » with high affinity (K d ~ 50 nM). DNA binding positively affected the activity of the enzyme: dGTPase activity displayed sigmoidal (cooperative) behavior without DNA but hyperbolic (Michaelis-Menten) kinetics in its presence, consistent with a specific lowering of the apparent K m for dGTP. A mutant Dgt enzyme was also created containing residue changes in the DNA binding cleft. This mutant enzyme, whereas still active, was incapable of DNA binding and could no longer be stimulated by addition of DNA. We also created an E. coli strain containing the mutant dgt gene on the chromosome replacing the wild-type gene. The mutant also displayed a mutator phenotype. Finally, our results provide insight into the allosteric regulation of the enzyme and support a physiologically important role of DNA binding.« less

On the origin of the decrease in stability of the DNA hairpin d(GCGAAGC) on complexation with aromatic drugs.

PubMed

Kostjukov, V V; Lantushenko, A O; Davies, D B; Evstigneev, M P

2007-08-01

Molecular dynamics simulations of drug-DNA complexes have been carried out in order to explain the experimentally observed decrease in thermal stability of the DNA hairpin d(GCGAAGC) on binding the aromatic drug molecules, daunomycin, ethidium bromide, novantrone and proflavine. This complexation behavior is in contrast to the stabilizing effect of the same aromatic drug molecules on DNA duplexes. Analysis of the energy parameters and the hydration properties of the complexes shows that the main factor correlating with the decrease in melting temperatures of the drug-hairpin complexes is the number of water bridges, with a reduction of at least 40% on ligand binding.

Single-Molecule Interactions of a Monoclonal Anti-DNA Antibody with DNA

PubMed Central

Nevzorova, Tatiana A.; Zhao, Qingze; Lomakin, Yakov A.; Ponomareva, Anastasia A.; Mukhitov, Alexander R.; Purohit, Prashant K.; Weisel, John W.; Litvinov, Rustem I.

2017-01-01

Interactions of DNA with proteins are essential for key biological processes and have both a fundamental and practical significance. In particular, DNA binding to anti-DNA antibodies is a pathogenic mechanism in autoimmune pathology, such as systemic lupus erythematosus. Here we measured at the single-molecule level binding and forced unbinding of surface-attached DNA and a monoclonal anti-DNA antibody MRL4 from a lupus erythematosus mouse. In optical trap-based force spectroscopy, a microscopic antibodycoated latex bead is trapped by a focused laser beam and repeatedly brought into contact with a DNA-coated surface. After careful discrimination of non-specific interactions, we showed that the DNA-antibody rupture force spectra had two regimes, reflecting formation of weaker (20–40 pN) and stronger (>40 pN) immune complexes that implies the existence of at least two bound states with different mechanical stability. The two-dimensional force-free off-rate for the DNA-antibody complexes was ~2.2 × 10−3 s−1, the transition state distance was ~0.94 nm, the apparent on-rate was ~5.26 s−1, and the stiffness of the DNA-antibody complex was characterized by a spring constant of 0.0021 pN/nm, suggesting that the DNA-antibody complex is a relatively stable, but soft and deformable macromolecular structure. The stretching elasticity of the DNA molecules was characteristic of single-stranded DNA, suggesting preferential binding of the MRL4 antibody to one strand of DNA. Collectively, the results provide fundamental characteristics of formation and forced dissociation of DNA-antibody complexes that help to understand principles of DNA-protein interactions and shed light on the molecular basis of autoimmune diseases accompanied by formation of anti-DNA antibodies. PMID:29104846

Characterization of the DNA binding properties of polyomavirus capsid protein

NASA Technical Reports Server (NTRS)

Chang, D.; Cai, X.; Consigli, R. A.; Spooner, B. S. (Principal Investigator)

1993-01-01

The DNA binding properties of the polyomavirus structural proteins VP1, VP2, and VP3 were studied by Southwestern analysis. The major viral structural protein VP1 and host-contributed histone proteins of polyomavirus virions were shown to exhibit DNA binding activity, but the minor capsid proteins VP2 and VP3 failed to bind DNA. The N-terminal first five amino acids (Ala-1 to Lys-5) were identified as the VP1 DNA binding domain by genetic and biochemical approaches. Wild-type VP1 expressed in Escherichia coli (RK1448) exhibited DNA binding activity, but the N-terminal truncated VP1 mutants (lacking Ala-1 to Lys-5 and Ala-1 to Cys-11) failed to bind DNA. The synthetic peptide (Ala-1 to Cys-11) was also shown to have an affinity for DNA binding. Site-directed mutagenesis of the VP1 gene showed that the point mutations at Pro-2, Lys-3, and Arg-4 on the VP1 molecule did not affect DNA binding properties but that the point mutation at Lys-5 drastically reduced DNA binding affinity. The N-terminal (Ala-1 to Lys-5) region of VP1 was found to be essential and specific for DNA binding, while the DNA appears to be non-sequence specific. The DNA binding domain and the nuclear localization signal are located in the same N-terminal region.

DNA molecules on periodically microstructured lipid membranes: Localization and coil stretching

NASA Astrophysics Data System (ADS)

Hochrein, Marion B.; Leierseder, Judith A.; Golubović, Leonardo; Rädler, Joachim O.

2007-02-01

We explore large scale conformations of DNA molecules adsorbed on curved surfaces. For that purpose, we investigate the behavior of DNA adsorbed on periodically shaped cationic lipid membranes. These unique membrane morphologies are supported on grooved, one-dimensionally periodic microstructured surfaces. Strikingly, we find that these periodically structured membranes are capable to stretch DNA coils. We elucidate this phenomenon in terms of surface curvature dependent potential energy attained by the adsorbed DNA molecules. Due to it, DNA molecules undergo a localization transition causing them to stretch by binding to highly curved sections (edges) of the supported membranes. This effect provides a new venue for controlling conformations of semiflexible polymers such as DNA by employing their interactions with specially designed biocompatible surfaces. We report the first experimental observation of semiflexible polymers unbinding transition in which DNA molecules unbind from one-dimensional manifolds (edges) while remaining bound to two-dimensional manifolds (cationic membranes).

Inhibition mechanisms of hemoglobin, immunoglobulin G, and whole blood in digital and real-time PCR.

PubMed

Sidstedt, Maja; Hedman, Johannes; Romsos, Erica L; Waitara, Leticia; Wadsö, Lars; Steffen, Carolyn R; Vallone, Peter M; Rådström, Peter

2018-04-01

Blood samples are widely used for PCR-based DNA analysis in fields such as diagnosis of infectious diseases, cancer diagnostics, and forensic genetics. In this study, the mechanisms behind blood-induced PCR inhibition were evaluated by use of whole blood as well as known PCR-inhibitory molecules in both digital PCR and real-time PCR. Also, electrophoretic mobility shift assay was applied to investigate interactions between inhibitory proteins and DNA, and isothermal titration calorimetry was used to directly measure effects on DNA polymerase activity. Whole blood caused a decrease in the number of positive digital PCR reactions, lowered amplification efficiency, and caused severe quenching of the fluorescence of the passive reference dye 6-carboxy-X-rhodamine as well as the double-stranded DNA binding dye EvaGreen. Immunoglobulin G was found to bind to single-stranded genomic DNA, leading to increased quantification cycle values. Hemoglobin affected the DNA polymerase activity and thus lowered the amplification efficiency. Hemoglobin and hematin were shown to be the molecules in blood responsible for the fluorescence quenching. In conclusion, hemoglobin and immunoglobulin G are the two major PCR inhibitors in blood, where the first affects amplification through a direct effect on the DNA polymerase activity and quenches the fluorescence of free dye molecules, and the latter binds to single-stranded genomic DNA, hindering DNA polymerization in the first few PCR cycles. Graphical abstract PCR inhibition mechanisms of hemoglobin and immunoglobulin G (IgG). Cq quantification cycle, dsDNA double-stranded DNA, ssDNA single-stranded DNA.

Nanopore sensing of individual transcription factors bound to DNA

PubMed Central

Squires, Allison; Atas, Evrim; Meller, Amit

2015-01-01

Transcription factor (TF)-DNA interactions are the primary control point in regulation of gene expression. Characterization of these interactions is essential for understanding genetic regulation of biological systems and developing novel therapies to treat cellular malfunctions. Solid-state nanopores are a highly versatile class of single-molecule sensors that can provide rich information about local properties of long charged biopolymers using the current blockage patterns generated during analyte translocation, and provide a novel platform for characterization of TF-DNA interactions. The DNA-binding domain of the TF Early Growth Response Protein 1 (EGR1), a prototypical zinc finger protein known as zif268, is used as a model system for this study. zif268 adopts two distinct bound conformations corresponding to specific and nonspecific binding, according to the local DNA sequence. Here we implement a solid-state nanopore platform for direct, label- and tether-free single-molecule detection of zif268 bound to DNA. We demonstrate detection of single zif268 TFs bound to DNA according to current blockage sublevels and duration of translocation through the nanopore. We further show that the nanopore can detect and discriminate both specific and nonspecific binding conformations of zif268 on DNA via the distinct current blockage patterns corresponding to each of these two known binding modes. PMID:26109509

Nanopore sensing of individual transcription factors bound to DNA

NASA Astrophysics Data System (ADS)

Squires, Allison; Atas, Evrim; Meller, Amit

2015-06-01

Transcription factor (TF)-DNA interactions are the primary control point in regulation of gene expression. Characterization of these interactions is essential for understanding genetic regulation of biological systems and developing novel therapies to treat cellular malfunctions. Solid-state nanopores are a highly versatile class of single-molecule sensors that can provide rich information about local properties of long charged biopolymers using the current blockage patterns generated during analyte translocation, and provide a novel platform for characterization of TF-DNA interactions. The DNA-binding domain of the TF Early Growth Response Protein 1 (EGR1), a prototypical zinc finger protein known as zif268, is used as a model system for this study. zif268 adopts two distinct bound conformations corresponding to specific and nonspecific binding, according to the local DNA sequence. Here we implement a solid-state nanopore platform for direct, label- and tether-free single-molecule detection of zif268 bound to DNA. We demonstrate detection of single zif268 TFs bound to DNA according to current blockage sublevels and duration of translocation through the nanopore. We further show that the nanopore can detect and discriminate both specific and nonspecific binding conformations of zif268 on DNA via the distinct current blockage patterns corresponding to each of these two known binding modes.

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

NASA Astrophysics Data System (ADS)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Acridine orange--its use in the specific staining of DNA in mammalian tissue sections.

PubMed

Dutt, M K

1981-01-01

This paper reports on a new method for the use of acridine orange (AO) in an aqueous solution at pH 4.5 for staining DNA of rat tissue sections from which RNA has been extracted selectively with cold phosphoric acid. Not only this, AO can also be used as dye-SO2 reagent, prepared with NHCl and potassium metabisulphite, for staining DNA-aldehyde molecules of acid-hydrolysed tissue sections. AO samples, manufactured by the National Aniline Division as well as by G. T. Gurr have been used with equal success. Studies of stained sections under light microscope reveal the presence of specifically stained yellowish-orange nuclei. Those sections under fluorescent microscope with proper exciter and barrier filters reveal nuclei of maroon colour. The in situ absorption spectra of nuclei stained with AO-SO2 following acid-hydrolysis of tissue sections as well as those of nuclei stained with an aqueous solution of the dye following extraction of RNA have been presented herein. The mode of binding in the former case has been considered to be due to binding of the teritary amino group of the dye molecules with the DNA-aldehyde molecules and in the latter case to be due to electrostatic binding between the positively charged dye molecules with negatively charged phosphate groups of DNA. Implications of all these findings have been discussed.

Electromagnetic and optical characteristics of Nb5+-doped double-crossover and salmon DNA thin films

NASA Astrophysics Data System (ADS)

Babu Mitta, Sekhar; Reddy Dugasani, Sreekantha; Jung, Soon-Gil; Vellampatti, Srivithya; Park, Tuson; Park, Sung Ha

2017-10-01

We report the fabrication and physical characteristics of niobium ion (Nb5+)-doped double-crossover DNA (DX-DNA) and salmon DNA (SDNA) thin films. Different concentrations of Nb5+ ([Nb5+]) are coordinated into the DNA molecules, and the thin films are fabricated via substrate-assisted growth (DX-DNA) and drop-casting (SDNA) on oxygen plasma treated substrates. We conducted atomic force microscopy to estimate the optimum concentration of Nb5+ ([Nb5+]O = 0.08 mM) in Nb5+-doped DX-DNA thin films, up to which the DX-DNA lattices maintain their structures without deformation. X-ray photoelectron spectroscopy (XPS) was performed to probe the chemical nature of the intercalated Nb5+ in the SDNA thin films. The change in peak intensities and the shift in binding energy were witnessed in XPS spectra to explicate the binding and charge transfer mechanisms between Nb5+ and SDNA molecules. UV-visible, Raman, and photoluminescence (PL) spectra were measured to determine the optical properties and thus investigate the binding modes, Nb5+ coordination sites in Nb5+-doped SDNA thin films, and energy transfer mechanisms, respectively. As [Nb5+] increases, the absorbance peak intensities monotonically increase until ˜[Nb5+]O and then decrease. However, from the Raman measurements, the peak intensities gradually decrease with an increase in [Nb5+] to reveal the binding mechanism and binding sites of metal ions in the SDNA molecules. From the PL, we observe the emission intensities to reduce them at up to ˜[Nb5+]O and then increase after that, expecting the energy transfer between the Nb5+ and SDNA molecules. The current-voltage measurement shows a significant increase in the current observed as [Nb5+] increases in the SDNA thin films when compared to that of pristine SDNA thin films. Finally, we investigate the temperature dependent magnetization in which the Nb5+-doped SDNA thin films reveal weak ferromagnetism due to the existence of tiny magnetic dipoles in the Nb5+-doped SDNA complex.

Deinococcus radiodurans RecA nucleoprotein filaments characterized at the single-molecule level with optical tweezers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pobegalov, Georgii, E-mail: george.pobegalov@nanobio.spbstu.ru; Cherevatenko, Galina; Alekseev, Aleksandr

2015-10-23

Deinococcus radiodurans can survive extreme doses of ionizing radiation due to the very efficient DNA repair mechanisms that are able to cope even with hundreds of double-strand breaks. RecA, the critical protein of homologous recombination in bacteria, is one of the key components of the DNA-repair system. Repair of double-strand breaks requires RecA binding to DNA and assembly of the RecA nucleoprotein helical filaments. The Escherichia coli RecA protein (EcRecA) and its interactions with DNA have been extensively studied using various approaches including single-molecule techniques, while the D. radiodurans RecA (DrRecA) remains much less characterized. However, DrRecA shows some remarkable differencesmore » from E. coli homolog. Here we combine microfluidics and single-molecule DNA manipulation with optical tweezers to follow the binding of DrRecA to long double-stranded DNA molecules and probe the mechanical properties of DrRecA nucleoprotein filaments at physiological pH. Our data provide a direct comparison of DrRecA and EcRecA binding to double-stranded DNA under identical conditions. We report a significantly faster filaments assembly as well as lower values of persistence length and contour length for DrRecA nucleoprotein filaments compared to EcRecA. Our results support the existing model of DrRecA forming more frequent and less continuous filaments relative to those of EcRecA. - Highlights: • We investigate Deinococcus radiodurans RecA interactions with long double-stranded DNA at the single-molecule level. • At physiological pH D. radiodurans RecA forms nucleoprotein filaments significantly faster relative to Escherichia coli RecA. • D. radiodurans RecA-dsDNA nucleoprotein filaments are more flexible and slightly shorter compared to those of E. coli RecA.« less

Analysis of DNA interactions using single-molecule force spectroscopy.

PubMed

Ritzefeld, Markus; Walhorn, Volker; Anselmetti, Dario; Sewald, Norbert

2013-06-01

Protein-DNA interactions are involved in many biochemical pathways and determine the fate of the corresponding cell. Qualitative and quantitative investigations on these recognition and binding processes are of key importance for an improved understanding of biochemical processes and also for systems biology. This review article focusses on atomic force microscopy (AFM)-based single-molecule force spectroscopy and its application to the quantification of forces and binding mechanisms that lead to the formation of protein-DNA complexes. AFM and dynamic force spectroscopy are exciting tools that allow for quantitative analysis of biomolecular interactions. Besides an overview on the method and the most important immobilization approaches, the physical basics of the data evaluation is described. Recent applications of AFM-based force spectroscopy to investigate DNA intercalation, complexes involving DNA aptamers and peptide- and protein-DNA interactions are given.

DNA Nanostructures as Models for Evaluating the Role of Enthalpy and Entropy in Polyvalent Binding

PubMed Central

Nangreave, Jeanette; Yan, Hao; Liu, Yan

2011-01-01

DNA nanotechnology allows the design and construction of nano-scale objects that have finely tuned dimensions, orientation, and structure with remarkable ease and convenience. Synthetic DNA nanostructures can be precisely engineered to model a variety of molecules and systems, providing the opportunity to probe very subtle biophysical phenomena. In this study, several such synthetic DNA nanostructures were designed to serve as models to study the binding behavior of polyvalent molecules and gain insight into how small changes to the ligand/receptor scaffolds, intended to vary their conformational flexibility, will affect their association equilibrium. This approach has yielded a quantitative identification of the roles of enthalpy and entropy in the affinity of polyvalent DNA nanostructure interactions, which exhibit an intriguing compensating effect. PMID:21381740

Sliding of proteins non-specifically bound to DNA: Brownian dynamics studies with coarse-grained protein and DNA models.

PubMed

Ando, Tadashi; Skolnick, Jeffrey

2014-12-01

DNA binding proteins efficiently search for their cognitive sites on long genomic DNA by combining 3D diffusion and 1D diffusion (sliding) along the DNA. Recent experimental results and theoretical analyses revealed that the proteins show a rotation-coupled sliding along DNA helical pitch. Here, we performed Brownian dynamics simulations using newly developed coarse-grained protein and DNA models for evaluating how hydrodynamic interactions between the protein and DNA molecules, binding affinity of the protein to DNA, and DNA fluctuations affect the one dimensional diffusion of the protein on the DNA. Our results indicate that intermolecular hydrodynamic interactions reduce 1D diffusivity by 30%. On the other hand, structural fluctuations of DNA give rise to steric collisions between the CG-proteins and DNA, resulting in faster 1D sliding of the protein. Proteins with low binding affinities consistent with experimental estimates of non-specific DNA binding show hopping along the CG-DNA. This hopping significantly increases sliding speed. These simulation studies provide additional insights into the mechanism of how DNA binding proteins find their target sites on the genome.

Protein dynamics during presynaptic complex assembly on individual ssDNA molecules

PubMed Central

Gibb, Bryan; Ye, Ling F.; Kwon, YoungHo; Niu, Hengyao; Sung, Patrick; Greene, Eric C.

2014-01-01

Homologous recombination is a conserved pathway for repairing double–stranded breaks, which are processed to yield single–stranded DNA overhangs that serve as platforms for presynaptic complex assembly. Here we use single–molecule imaging to reveal the interplay between Saccharomyce cerevisiae RPA, Rad52, and Rad51 during presynaptic complex assembly. We show that Rad52 binds RPA–ssDNA and suppresses RPA turnover, highlighting an unanticipated regulatory influence on protein dynamics. Rad51 binding extends the ssDNA, and Rad52–RPA clusters remain interspersed along the presynaptic complex. These clusters promote additional binding of RPA and Rad52. Together, our work illustrates the spatial and temporal progression of RPA and Rad52 association with the presynaptic complex, and reveals a novel RPA–Rad52–Rad51–ssDNA intermediate, which has implications for understanding how the activities of Rad52 and RPA are coordinated with Rad51 during the later stages recombination. PMID:25195049

Single molecule characterization of DNA binding and strand displacement reactions on lithographic DNA origami microarrays.

PubMed

Scheible, Max B; Pardatscher, Günther; Kuzyk, Anton; Simmel, Friedrich C

2014-03-12

The combination of molecular self-assembly based on the DNA origami technique with lithographic patterning enables the creation of hierarchically ordered nanosystems, in which single molecules are positioned at precise locations on multiple length scales. Based on a hybrid assembly protocol utilizing DNA self-assembly and electron-beam lithography on transparent glass substrates, we here demonstrate a DNA origami microarray, which is compatible with the requirements of single molecule fluorescence and super-resolution microscopy. The spatial arrangement allows for a simple and reliable identification of single molecule events and facilitates automated read-out and data analysis. As a specific application, we utilize the microarray to characterize the performance of DNA strand displacement reactions localized on the DNA origami structures. We find considerable variability within the array, which results both from structural variations and stochastic reaction dynamics prevalent at the single molecule level.

Small molecule and peptide-mediated inhibition of Epstein-Barr virus nuclear antigen 1 dimerization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Sun Young; Song, Kyung-A; Samsung Biomedical Research Institute

Highlights: Black-Right-Pointing-Pointer Evidence that targeting EBNA1 dimer, an EBV onco-antigen, can be achievable. Black-Right-Pointing-Pointer A small molecule and a peptide as EBNA1 dimerization inhibitors identified. Black-Right-Pointing-Pointer Both inhibitors associated with EBNA1 and blocked EBNA1 DNA binding activity. Black-Right-Pointing-Pointer Also, prevented its dimerization, and repressed viral gene transcription. -- Abstract: Latent Epstein-Barr virus (EBV) infection is associated with human B cell lymphomas and certain carcinomas. EBV episome persistence, replication, and gene expression are dependent on EBV-encoded nuclear antigen 1 (EBNA1)'s DNA binding domain (DBD)/dimerization domain (DD)-mediated sequence-specific DNA binding activity. Homodimerization of EBNA1 is essential for EBNA1 DNA binding and transactivation.more » In this study, we characterized a novel small molecule EBNA1 inhibitor EiK1, screened from the previous high throughput screening (HTS). The EiK1 compound specifically inhibited the EBNA1-dependent, OriP-enhanced transcription, but not EBNA1-independent transcription. A Surface Plasmon Resonance Biacore assay revealed that EiK1 associates with EBNA1 amino acid 459-607 DBD/DD. Consistent with the SPR data, in vitro gel shift assays showed that EiK1 suppressed the activity of EBNA1 binding to the cognate familial repeats (FR) sequence, but not control RBP-J{kappa} binding to the J{kappa} site. Subsequently, a cross-linker-mediated in vitro multimerization assay and EBNA1 homodimerization-dependent yeast two-hybrid assay showed that EiK1 significantly inhibited EBNA1 dimerization. In an attempt to identify more highly specific peptide inhibitors, small peptides encompassing the EBNA1 DBD/DD were screened for inhibition of EBNA1 DBD-mediated DNA binding function. The small peptide P85, covering EBNA1 a.a. 560-574, significantly blocked EBNA1 DNA binding activity in vitro, prevented dimerization in vitro and in vivo, associated with EBNA1 in vitro, and repressed EBNA1-dependent transcription in vivo. Collectively, this study describes two novel inhibitors of EBNA1 dimerization. This study demonstrates that EBNA1 homodimerization can be effectively targeted by a small molecule or peptide.« less

DNA condensation by partially acetylated poly(amido amine) dendrimers: effects of dendrimer charge density on complex formation.

PubMed

Yu, Shi; Li, Ming-Hsin; Choi, Seok Ki; Baker, James R; Larson, Ronald G

2013-09-03

The ability of poly(amido amine) (or PAMAM) dendrimers to condense semiflexible dsDNA and penetrate cell membranes gives them great potential in gene therapy and drug delivery but their high positive surface charge makes them cytotoxic. Here, we describe the effects of partial neutralization by acetylation on DNA condensation using light scattering, circular dichroism, and single molecule imaging of dendrimer-DNA complexes combed onto surfaces and tethered to those surfaces under flow. We find that DNA can be condensed by generation-five (G5) dendrimers even when the surface charges are more than 65% neutralized, but that such dendrimers bind negligibly when an end-tethered DNA is stretched in flow. We also find that when fully charged dendrimers are introduced by flow to end-tethered DNA, all DNA molecules become equally highly coated with dendrimers at a rate that becomes very fast at high dendrimer concentration, and that dendrimers remain bound during subsequent flow of dendrimer-free buffer. These results suggest that the presence of dendrimer-free DNA coexisting with dendrimer-bound DNA after bulk mixing of the two in solution may result from diffusion-limited irreversible dendrimer-DNA binding, rather than, or in addition to, the previously proposed cooperative binding mechanism of dendrimers to DNA.

Rolling Circle Amplification For Spatially Directed Synthesis Of A Solid Phase Anchored Single-Stranded DNA Molecule

NASA Astrophysics Data System (ADS)

Reiß, Edda; Hölzel, Ralph; von Nickisch-Rosenegk, Markus; Bier, Frank F.

2006-09-01

In this article the usefulness of the enzyme phi29 DNA polymerase and the principle of rolling circle amplification (RCA) for creating single-stranded DNA (ssDNA) nanostructures is described. Currently we are working on the spatial orientation of a growing ssDNA molecule during its RCA-based synthesis by the application of a hydrodynamic force. Starting at an immobilized primer at single molecule level, the aim is to construct a nanostructure of known location and orientation, providing multiple repeating binding sites that can be addressed via complementary base-pairing. Proof-of-principle experiments demonstrate the potential of the enzymatic reaction. ssDNA molecules of more than 20 μm length were created at an immobilized primer and detected by means of fluorescence microscopy.

RecA binding to a single double-stranded DNA molecule: A possible role of DNA conformational fluctuations

PubMed Central

Leger, J. F.; Robert, J.; Bourdieu, L.; Chatenay, D.; Marko, J. F.

1998-01-01

Most genetic regulatory mechanisms involve protein–DNA interactions. In these processes, the classical Watson–Crick DNA structure sometimes is distorted severely, which in turn enables the precise recognition of the specific sites by the protein. Despite its key importance, very little is known about such deformation processes. To address this general question, we have studied a model system, namely, RecA binding to double-stranded DNA. Results from micromanipulation experiments indicate that RecA binds strongly to stretched DNA; based on this observation, we propose that spontaneous thermal stretching fluctuations may play a role in the binding of RecA to DNA. This has fundamental implications for the protein–DNA binding mechanism, which must therefore rely in part on a combination of flexibility and thermal fluctuations of the DNA structure. We also show that this mechanism is sequence sensitive. Theoretical simulations support this interpretation of our experimental results, and it is argued that this is of broad relevance to DNA–protein interactions. PMID:9770480

Binding and thermodynamics of REV peptide-ctDNA interaction.

PubMed

Upadhyay, Santosh Kumar

2017-03-01

The thermodynamics of DNA-ligand binding is important as it provides useful information to understand the details of binding processes. HIV-1 REV response element (RRE) located in the env coding region of the viral genome is reported to be well conserved across different HIV-1 isolates. In this study, the binding characteristics of Calf thymus DNA (ctDNA) and REV peptide from HIV-1 were investigated using spectroscopic (UV-visible, fluorescence, and circular dichroism (CD)) and isothermal titration calorimetric (ITC) techniques. Thermal stability and ligand binding properties of the ctDNA revealed that native ctDNA had a T m of 75.5 °C, whereas the ctDNA-REV peptide complex exhibited an incremental shift in the T m by 8 °C, indicating thermal stability of the complex. CD data indicated increased ellipticity due to large conformational changes in ctDNA molecule upon binding with REV peptide and two binding stoichiometric modes are apparent. The ctDNA experienced condensation due to large conformational changes in the presence of REV peptide and positive B→Ψ transition was observed at higher molar charge ratios. Fluorescence studies performed at several ligand concentrations revealed a gradual decrease in the fluorescence intensity of EtBr-bound ctDNA in response to increasing ligand concentrations. The fluorescence data further confirmed two stoichiometric modes of binding for ctDNA-REV peptide complex as previously observed with CD studies. The binding enthalpies were determined using ITC in the temperature range of 293 K-308 K. The ITC binding isotherm was exothermic at all temperatures examined, with low ΔH values indicating that the ctDNA-REV peptide interaction is driven largely by entropy. The heat capacity change (ΔC p ) was insignificant, an unusual finding in the area of DNA-peptide interaction studies. The variation in the values obtained for ΔH, ΔS, and ΔG with temperature further suggests that ctDNA-REV peptide interaction is entropically driven. ITC based analysis of salt dependence of binding constant gave a charge value (Z) = +4.01, as determined for the δlnK/δln[Na + ] parameter, suggesting the participation of only 3-4 Arg out of 11 Arg charge from REV peptide. The stoichiometry observed for the complex was three molar charge of REV peptide binding per molar charge of ctDNA. ITC based analysis further confirmed that the binding between ctDNA and REV peptide is governed by electrostatic interaction. Molecular interactions including H-bonding, van der Waals forces, and solvent molecules rearrangement, underlie the binding of REV peptide to ctDNA. © 2016 Wiley Periodicals, Inc.

Torsional mechanics of DNA are regulated by small-molecule intercalation.

PubMed

Celedon, Alfredo; Wirtz, Denis; Sun, Sean

2010-12-23

Whether the bend and twist mechanics of DNA molecules are coupled is unclear. Here, we report the direct measurement of the resistive torque of single DNA molecules to study the effect of ethidium bromide (EtBr) intercalation and pulling force on DNA twist mechanics. DNA molecules were overwound and unwound using recently developed magnetic tweezers where the molecular resistive torque was obtained from Brownian angular fluctuations. The effect of EtBr intercalation on the twist stiffness was found to be significantly different from the effect on the bend persistence length. The twist stiffness of DNA was dramatically reduced at low intercalator concentration (<10 nM); however, it did not decrease further when the intercalator concentration was increased by 3 orders of magnitude. We also determined the dependence of EtBr intercalation on the torque applied to DNA. We propose a model for the elasticity of DNA base pairs with intercalated EtBr molecules to explain the abrupt decrease of twist stiffness at low EtBr concentration. These results indicate that the bend and twist stiffnesses of DNA are independent and can be differently affected by small-molecule binding.

Sequence Dependencies of DNA Deformability and Hydration in the Minor Groove

PubMed Central

Yonetani, Yoshiteru; Kono, Hidetoshi

2009-01-01

Abstract DNA deformability and hydration are both sequence-dependent and are essential in specific DNA sequence recognition by proteins. However, the relationship between the two is not well understood. Here, systematic molecular dynamics simulations of 136 DNA sequences that differ from each other in their central tetramer revealed that sequence dependence of hydration is clearly correlated with that of deformability. We show that this correlation can be illustrated by four typical cases. Most rigid basepair steps are highly likely to form an ordered hydration pattern composed of one water molecule forming a bridge between the bases of distinct strands, but a few exceptions favor another ordered hydration composed of two water molecules forming such a bridge. Steps with medium deformability can display both of these hydration patterns with frequent transition. Highly flexible steps do not have any stable hydration pattern. A detailed picture of this correlation demonstrates that motions of hydration water molecules and DNA bases are tightly coupled with each other at the atomic level. These results contribute to our understanding of the entropic contribution from water molecules in protein or drug binding and could be applied for the purpose of predicting binding sites. PMID:19686662

Actinomycin D binding mode reveals the basis for its potent HIV-1 and cancer activity

NASA Astrophysics Data System (ADS)

Paramanathan, Thayaparan; Vladescu, Ioana D.; McCauley, Micah J.; Rouzina, Ioulia; Williams, Mark C.

2011-03-01

Actinomycin D (ActD) is one of the most studied antibiotics, which has been used as an anti-cancer agent and also shown to inhibit HIV reverse transcription. Initial studies with ActD established that it intercalates double stranded DNA (dsDNA). However, recent studies have shown that ActD binds with even higher affinity to single stranded DNA (ssDNA). In our studies we use optical tweezers to stretch and hold single dsDNA molecule at constant force in the presence of varying ActD concentrations until the binding reaches equilibrium. The change in dsDNA length upon ActD binding measured as a function of time yields the rate of binding in addition to the equilibrium lengthening of DNA. The results suggest extremely slow kinetics, on the order of several minutes and 0.52 +/- 0.06 μ M binding affinity. Holding DNA at constant force while stretching and relaxing suggests that ActD binds to two single strands that are close to each other rather than to pure dsDNA or ssDNA. This suggests that biological activity of ActD that contributes towards the inhibition of cellular replication is due to its ability to bind at DNA bubbles during RNA transcription, thereby stalling the transcription process.

Force determination in lateral magnetic tweezers combined with TIRF microscopy.

PubMed

Madariaga-Marcos, J; Hormeño, S; Pastrana, C L; Fisher, G L M; Dillingham, M S; Moreno-Herrero, F

2018-03-01

Combining single-molecule techniques with fluorescence microscopy has attracted much interest because it allows the correlation of mechanical measurements with directly visualized DNA : protein interactions. In particular, its combination with total internal reflection fluorescence microscopy (TIRF) is advantageous because of the high signal-to-noise ratio this technique achieves. This, however, requires stretching long DNA molecules across the surface of a flow cell to maximize polymer exposure to the excitation light. In this work, we develop a module to laterally stretch DNA molecules at a constant force, which can be easily implemented in regular or combined magnetic tweezers (MT)-TIRF setups. The pulling module is further characterized in standard flow cells of different thicknesses and glass capillaries, using two types of micrometer size superparamagnetic beads, long DNA molecules, and a home-built device to rotate capillaries with mrad precision. The force range achieved by the magnetic pulling module was between 0.1 and 30 pN. A formalism for estimating forces in flow-stretched tethered beads is also proposed, and the results compared with those of lateral MT, demonstrating that lateral MT achieve higher forces with lower dispersion. Finally, we show the compatibility with TIRF microscopy and the parallelization of measurements by characterizing DNA binding by the centromere-binding protein ParB from Bacillus subtilis. Simultaneous MT pulling and fluorescence imaging demonstrate the non-specific binding of BsParB on DNA under conditions restrictive to condensation.

Genetics Home Reference: Warsaw breakage syndrome

MedlinePlus

... helicase. Helicases are enzymes that attach (bind) to DNA and temporarily unwind the two spiral strands (double helix) of the DNA molecule. This unwinding is necessary for copying ( replicating ) ...

Atomic Force Microscopy Studies on DNA Structural Changes Induced by Vincristine Sulfate and Aspirin

NASA Astrophysics Data System (ADS)

Zhu, Yi; Zeng, Hu; Xie, Jianming; Ba, Long; Gao, Xiang; Lu, Zuhong

2004-04-01

We report that atomic force microscopy (AFM) studies on structural variations of a linear plasmid DNA interact with various concentrations of vincristine sulfate and aspirin. The different binding images show that vincrinstine sulfate binding DNA chains caused some loops and cleavages of the DNA fragments, whereas aspirin interaction caused the width changes and conformational transition of the DNA fragments. Two different DNA structural alternations could be explained by the different mechanisms of the interactions with these two components. Our work indicates that the AFM is a powerful tool in studying the interaction between DNA and small molecules.

Molecular simulations of polycation-DNA binding exploring the effect of peptide chemistry and sequence in nuclear localization sequence based polycations.

PubMed

Elder, Robert M; Jayaraman, Arthi

2013-10-10

Gene therapy relies on the delivery of DNA into cells, and polycations are one class of vectors enabling efficient DNA delivery. Nuclear localization sequences (NLS), cationic oligopeptides that target molecules for nuclear entry, can be incorporated into polycations to improve their gene delivery efficiency. We use simulations to study the effect of peptide chemistry and sequence on the DNA-binding behavior of NLS-grafted polycations by systematically mutating the residues in the grafts, which are based on the SV40 NLS (peptide sequence PKKKRKV). Replacing arginine (R) with lysine (K) reduces binding strength by eliminating arginine-DNA interactions, but placing R in a less hindered location (e.g., farther from the grafting point to the polycation backbone) has surprisingly little effect on polycation-DNA binding strength. Changing the positions of the hydrophobic proline (P) and valine (V) residues relative to the polycation backbone changes hydrophobic aggregation within the polycation and, consequently, changes the conformational entropy loss that occurs upon polycation-DNA binding. Since conformational entropy loss affects the free energy of binding, the positions of P and V in the grafts affect DNA binding affinity. The insight from this work guides synthesis of polycations with tailored DNA binding affinity and, in turn, efficient DNA delivery.

In vitro DNA binding studies of Aspartame, an artificial sweetener.

PubMed

Kashanian, Soheila; Khodaei, Mohammad Mehdi; Kheirdoosh, Fahimeh

2013-03-05

A number of small molecules bind directly and selectively to DNA, by inhibiting replication, transcription or topoisomerase activity. In this work the interaction of native calf thymus DNA (CT-DNA) with Aspartame (APM), an artificial sweeteners was studied at physiological pH. DNA binding study of APM is useful to understand APM-DNA interaction mechanism and to provide guidance for the application and design of new and safer artificial sweeteners. The interaction was investigated using spectrophotometric, spectrofluorometric competition experiment and circular dichroism (CD). Hypochromism and red shift are shown in UV absorption band of APM. A strong fluorescence quenching reaction of DNA to APM was observed and the binding constants (Kf) of DNA with APM and corresponding number of binding sites (n) were calculated at different temperatures. Thermodynamic parameters, enthalpy changes (ΔH) and entropy changes (ΔS) were calculated to be +181kJmol(-1) and +681Jmol(-1)K(-1) according to Van't Hoff equation, which indicated that reaction is predominantly entropically driven. Moreover, spectrofluorometric competition experiment and circular dichroism (CD) results are indicative of non-intercalative DNA binding nature of APM. We suggest that APM interacts with calf thymus DNA via groove binding mode with an intrinsic binding constant of 5×10(+4)M(-1). Copyright © 2013 Elsevier B.V. All rights reserved.

Scraping and stapling of end-grafted DNA chains by a bioadhesive spreading vesicle to reveal chain internal friction and topological complexity.

PubMed

Nam, Gimoon; Hisette, Marie Laure; Sun, Yuting Liang; Gisler, Thomas; Johner, Albert; Thalmann, Fabrice; Schröder, André Pierre; Marques, Carlos Manuel; Lee, Nam-Kyung

2010-08-20

Stained end-grafted DNA molecules about 20 μm long are scraped away and stretched out by the spreading front of a bioadhesive vesicle. Tethered biotin ligands bind the vesicle bilayer to a streptavidin substrate, stapling the DNAs into frozen confinement paths. Image analysis of the stapled DNA gives access, within optical resolution, to the local stretching values of individual DNA molecules swept by the spreading front, and provides evidence of self-entanglements.

Interaction investigations of HipA binding to HipB dimer and HipB dimer + DNA complex: a molecular dynamics simulation study.

PubMed

Li, Chaoqun; Wang, Yaru; Wang, Yan; Chen, Guangju

2013-11-01

We carried out molecular dynamics simulations and free energy calculations for a series of ternary and diplex models for the HipA protein, HipB dimer, and DNA molecule to address the mechanism of HipA sequestration and the binding order of events from apo HipB/HipA to 2HipA + HipB dimer + DNA complex. The results revealed that the combination of DNA with the HipB dimer is energetically favorable for the combination of HipB dimer with HipA protein. The binding of DNA to HipB dimer induces a long-range allosteric communication from the HipB2 -DNA interface to the HipA-HipB2 interface, which involves the closeness of α1 helices of HipB dimer to HipA protein and formations of extra hydrogen bonds in the HipA-HipB2 interface through the extension of α2/3 helices in the HipB dimer. These simulated results suggested that the DNA molecule, as a regulative media, modulates the HipB dimer conformation, consequently increasing the interactions of HipB dimer with the HipA proteins, which explains the mechanism of HipA sequestration reported by the previous experiment. Simultaneously, these simulations also explored that the thermodynamic binding order in a simulated physiological environment, that is, the HipB dimer first bind to DNA to form HipB dimer + DNA complex, then capturing strongly the HipA proteins to form a ternary complex, 2HipA + HipB dimer + DNA, for sequestrating HipA in the nucleoid. Copyright © 2013 John Wiley & Sons, Ltd.

Binding of DNA-binding alkaloids berberine and palmatine to tRNA and comparison to ethidium: Spectroscopic and molecular modeling studies

NASA Astrophysics Data System (ADS)

Islam, Md. Maidul; Pandya, Prateek; Chowdhury, Sebanti Roy; Kumar, Surat; Kumar, Gopinatha Suresh

2008-11-01

The interaction of two natural protoberberine plant alkaloids berberine and palmatine with tRNA phe was studied using various biophysical techniques and molecular modeling and the data were compared with the binding of the classical DNA intercalator, ethidium. Circular dichroic studies revealed that the tRNA conformation was moderately perturbed on binding of the alkaloids. The cooperative binding of both the alkaloids and ethidium to tRNA was revealed from absorbance and fluorescence studies. Fluorescence quenching studies advanced a conclusion that while berberine and palmatine are partially intercalated, ethidium is fully intercalated on the tRNA molecule. The binding of the alkaloids as well as ethidium stabilized the tRNA melting, and the binding constant evaluated from the averaged optical melting temperature data was in agreement with fluorescence spectral-binding data. Differential scanning calorimetry revealed that the tRNA melting showed three close transitions that were affected on binding of these small molecules. Molecular docking calculations performed showed the preferred regions of binding of these small molecules on the tRNA. Taken together, the results suggest that the binding of the alkaloids berberine and palmatine on the tRNA structure appears to be mostly by partial intercalation while ethidium intercalates fully on the tRNA. These results further advance our knowledge on the molecular aspects on the interaction of these alkaloids to tRNA.

Allosteric control of transcription in GntR family of transcription regulators: A structural overview.

PubMed

Jain, Deepti

2015-07-01

The GntR family of transcription regulators constitutes one of the most abundant family of transcription factors. These modulators are involved in a variety of mechanisms controlling various metabolic processes. GntR family members are typically two domain proteins with a smaller N-terminus domain (NTD) with conserved architecture of winged-helix-turn-helix (wHTH) for DNA binding and a larger C-terminus domain (CTD) or the effector binding domain which is also involved in oligomerization. Interestingly, the CTD shows structural heterogeneity depending upon the type of effector molecule that it binds and displays structural homology to various classes of proteins. Binding of the effector molecule to the CTD brings about a conformational change in the transcription factor such that its affinity for its cognate DNA sequence is altered. This review summarizes the structural information available on the members of GntR family and discusses the common features of the DNA binding and operator recognition within the family. The variation in the allosteric mechanism employed by the members of this family is also discussed. © 2015 International Union of Biochemistry and Molecular Biology.

DNA origami as biocompatible surface to match single-molecule and ensemble experiments

PubMed Central

Gietl, Andreas; Holzmeister, Phil; Grohmann, Dina; Tinnefeld, Philip

2012-01-01

Single-molecule experiments on immobilized molecules allow unique insights into the dynamics of molecular machines and enzymes as well as their interactions. The immobilization, however, can invoke perturbation to the activity of biomolecules causing incongruities between single molecule and ensemble measurements. Here we introduce the recently developed DNA origami as a platform to transfer ensemble assays to the immobilized single molecule level without changing the nano-environment of the biomolecules. The idea is a stepwise transfer of common functional assays first to the surface of a DNA origami, which can be checked at the ensemble level, and then to the microscope glass slide for single-molecule inquiry using the DNA origami as a transfer platform. We studied the structural flexibility of a DNA Holliday junction and the TATA-binding protein (TBP)-induced bending of DNA both on freely diffusing molecules and attached to the origami structure by fluorescence resonance energy transfer. This resulted in highly congruent data sets demonstrating that the DNA origami does not influence the functionality of the biomolecule. Single-molecule data collected from surface-immobilized biomolecule-loaded DNA origami are in very good agreement with data from solution measurements supporting the fact that the DNA origami can be used as biocompatible surface in many fluorescence-based measurements. PMID:22523083

Metal binding proteins, recombinant host cells and methods

DOEpatents

Summers, Anne O.; Caguiat, Jonathan J.

2004-06-15

The present disclosure provides artificial heavy metal binding proteins termed chelons by the inventors. These chelons bind cadmium and/or mercuric ions with relatively high affinity. Also disclosed are coding sequences, recombinant DNA molecules and recombinant host cells comprising those recombinant DNA molecules for expression of the chelon proteins. In the recombinant host cells or transgenic plants, the chelons can be used to bind heavy metals taken up from contaminated soil, groundwater or irrigation water and to concentrate and sequester those ions. Recombinant enteric bacteria can be used within the gastrointestinal tracts of animals or humans exposed to toxic metal ions such as mercury and/or cadmium, where the chelon recombinantly expressed in chosen in accordance with the ion to be rededicated. Alternatively, the chelons can be immobilized to solid supports to bind and concentrate heavy metals from a contaminated aqueous medium including biological fluids.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Akabayov, B.; Akabayov, S; Lee , S

Gene 5 of bacteriophage T7 encodes a DNA polymerase (gp5) responsible for the replication of the phage DNA. Gp5 polymerizes nucleotides with low processivity, dissociating after the incorporation of 1 to 50 nucleotides. Thioredoxin (trx) of Escherichia coli binds tightly (Kd = 5 nM) to a unique segment in the thumb subdomain of gp5 and increases processivity. We have probed the molecular basis for the increase in processivity. A single-molecule experiment reveals differences in rates of enzymatic activity and processivity between gp5 and gp5/trx. Small angle X-ray scattering studies combined with nuclease footprinting reveal two conformations of gp5, one inmore » the free state and one upon binding to trx. Comparative analysis of the DNA binding clefts of DNA polymerases and DNA binding proteins show that the binding surface contains more hydrophobic residues than other DNA binding proteins. The balanced composition between hydrophobic and charged residues of the binding site allows for efficient sliding of gp5/trx on the DNA. We propose a model for trx-induced conformational changes in gp5 that enhance the processivity by increasing the interaction of gp5 with DNA.« less

DNA binding and biological studies of some novel water-soluble polymer-copper(II)-phenanthroline complexes.

PubMed

Kumar, Rajendran Senthil; Arunachalam, Sankaralingam; Periasamy, Vaiyapuri Subbarayan; Preethy, Christo Paul; Riyasdeen, Anvarbatcha; Akbarsha, Mohammad Abdulkader

2008-10-01

Some novel water-soluble polymer-copper(II)-phenanthroline complex samples, [Cu(phen)2(BPEI)]Cl(2).4H2O (phen=1,10-phenanthroline, BPEI=branched polyethyleneimine), with different degrees of copper complex content in the polymer chain have been prepared by ligand substitution method in water-ethanol medium and characterized by infrared, UV-visible, EPR spectral and elemental analysis methods. The binding of these complex samples with DNA has been investigated by electronic absorption spectroscopy, emission spectroscopy and gel retardation assay. Electrostatic interactions between DNA molecule and polymer-copper(II) complex molecule containing many high positive charges have been observed. Besides these ionic interactions, van der Waals interactions, hydrogen bonding and other partial intercalation binding modes may also exist in this system. The polymer-copper(II) complex with higher degree of copper complex content was screened for its antimicrobial activity and antitumor activity.

Phyloscan: locating transcription-regulating binding sites in mixed aligned and unaligned sequence data.

PubMed

Palumbo, Michael J; Newberg, Lee A

2010-07-01

The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).

DNA interrogation by the CRISPR RNA-guided endonuclease Cas9.

PubMed

Sternberg, Samuel H; Redding, Sy; Jinek, Martin; Greene, Eric C; Doudna, Jennifer A

2014-03-06

The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.

DNA interrogation by the CRISPR RNA-guided endonuclease Cas9

NASA Astrophysics Data System (ADS)

Sternberg, Samuel H.; Redding, Sy; Jinek, Martin; Greene, Eric C.; Doudna, Jennifer A.

2014-03-01

The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schellenberg, Matthew J; Appel, C Denise; Adhikari, Sanjay

The topoisomerase II (topo II) DNA incision-and-ligation cycle can be poisoned (for example following treatment with cancer chemotherapeutics) to generate cytotoxic DNA double-strand breaks (DSBs) with topo II covalently conjugated to DNA. Tyrosyl-DNA phosphodiesterase 2 (Tdp2) protects genomic integrity by reversing 5'-phosphotyrosyl–linked topo II–DNA adducts. Here, X-ray structures of mouse Tdp2–DNA complexes reveal that Tdp2 β–2-helix–β DNA damage–binding 'grasp', helical 'cap' and DNA lesion–binding elements fuse to form an elongated protein-DNA conjugate substrate-interaction groove. The Tdp2 DNA-binding surface is highly tailored for engagement of 5'-adducted single-stranded DNA ends and restricts nonspecific endonucleolytic or exonucleolytic processing. Structural, mutational and functional analysesmore » support a single–metal ion catalytic mechanism for the exonuclease-endonuclease-phosphatase (EEP) nuclease superfamily and establish a molecular framework for targeted small-molecule blockade of Tdp2-mediated resistance to anticancer topoisomerase drugs.« less

Searching target sites on DNA by proteins: Role of DNA dynamics under confinement

PubMed Central

Mondal, Anupam; Bhattacherjee, Arnab

2015-01-01

DNA-binding proteins (DBPs) rapidly search and specifically bind to their target sites on genomic DNA in order to trigger many cellular regulatory processes. It has been suggested that the facilitation of search dynamics is achieved by combining 3D diffusion with one-dimensional sliding and hopping dynamics of interacting proteins. Although, recent studies have advanced the knowledge of molecular determinants that affect one-dimensional search efficiency, the role of DNA molecule is poorly understood. In this study, by using coarse-grained simulations, we propose that dynamics of DNA molecule and its degree of confinement due to cellular crowding concertedly regulate its groove geometry and modulate the inter-communication with DBPs. Under weak confinement, DNA dynamics promotes many short, rotation-decoupled sliding events interspersed by hopping dynamics. While this results in faster 1D diffusion, associated probability of missing targets by jumping over them increases. In contrast, strong confinement favours rotation-coupled sliding to locate targets but lacks structural flexibility to achieve desired specificity. By testing under physiological crowding, our study provides a plausible mechanism on how DNA molecule may help in maintaining an optimal balance between fast hopping and rotation-coupled sliding dynamics, to locate target sites rapidly and form specific complexes precisely. PMID:26400158

Influence of Ionic Liquids on Thermodynamics of Small Molecule-DNA Interaction: The Binding of Ethidium Bromide to Calf Thymus DNA.

PubMed

Mishra, Arpit; Ekka, Mary Krishna; Maiti, Souvik

2016-03-17

Ionic liquids (ILs) are salts with poor ionic coordination, resultantly remaining in liquid state below 100 °C and some may retain liquid state even at room temperature. ILs are known to provide a conducive environment for many biological enzymatic reactions, but their interaction with biomacromolecules are poorly understood. In the present study, we investigate the effect of various ionic liquids on DNA-small molecule interaction using calf thymus DNA (ctDNA)-ethidium bromide (EB) as a model system. The effect of various ionic liquids on these interactions is studied by an array of techniques such as circular dichroism (CD), UV melting, fluorescence exclusion and isothermal titration calorimetry. Interestingly, we observed that presence of IL increased the stability of ctDNA without altering its structure. The binding affinities Kbs for EB binding to ctDNA in the presence of 300 mM ILs are about half order of magnitude smaller than the Kbs in absence of ILs and correspond to a less favorable free energy. We noted that, when adjusted to corresponding buffer condition, the unfavorable shift in ΔG of ctDNA-EB interaction is attributed to decreased entropy in the case of ILs, whereas the same effect by NaCl was due to increased enthalpy.

A small-molecule-linked DNA-graphene oxide-based fluorescence-sensing system for detection of biotin.

PubMed

Zhang, Hao; Li, Yan; Su, Xingguang

2013-11-15

In this paper, we establish a novel fluorescence-sensing system for the detection of biotin based on the interaction between DNA and graphene oxide and on protection of the terminal of the biotinylated single-stranded DNA fluorescent probe by streptavidin. In this system, streptavidin binds to the biotinylated DNA, which protects the DNA from hydrolysis by exonuclease I. The streptavidin-DNA conjugate is then adsorbed to the graphene oxide resulting in the fluorescence being quenched. Upon the addition of free biotin, it competes with the labeled biotin for the binding sites of streptavidin and then the exonuclease I digests the unbound DNA probe from the 3' to the 5' terminal, releasing the fluorophore from the DNA. Because of the weak affinity between the fluorophore and graphene oxide, the fluorescence is recovered. Under optimal conditions, the fluorescence intensity is proportional to the concentration of biotin in the concentration range of 0.5-20nmol/L. The detection limit for biotin is 0.44nmol/L. The proposed fluorescence-sensing system was applied to the determination of biotin in some real samples with satisfactory reproducibility and accuracy. This work could provide a common platform for detecting small biomolecules based on protein-small molecule ligand binding. Copyright © 2013 Elsevier Inc. All rights reserved.

Shikonin, a natural product from the root of Lithospermum erythrorhizon, is a cytotoxic DNA-binding agent.

PubMed

Chen, Changmin; Shanmugasundaram, Kumaran; Rigby, Alan C; Kung, Andrew L

2013-04-11

To search for compounds that disrupt binding of the EWS-FLI1 fusion protein to its cognate targets, we developed a homogeneous high-throughput proximity assay and screened 5200 small molecule compounds. Many well-known DNA-binding chemotherapeutic agents, such as actinomycin D, cisplatin, doxorubicin, daunorubicin, and epirubicin scored in the assay and not surprising also disrupted the binding of other transcription factors. Unexpectedly, we found that Shikonin, a natural product from the root of Lithospermum erythrorhizon, similarly disrupted protein-DNA interactions. Mechanistic studies demonstrated that Shikonin displaces SYBR green from binding to the minor groove of DNA and is able to inhibit topoisomerase mediated DNA relaxation. In cells, Shikonin blocked the binding of EWS-FLI1 to the NR0B1 promoter, and attenuated gene expression. Shikonin rapidly induced G2/M arrest and apoptosis in Ewing sarcoma cells. These results demonstrate that contrary to other purported mechanisms of action, Shikonin is a DNA-binding cytotoxic agent. Copyright © 2013 Elsevier B.V. All rights reserved.

Small-Molecule Inhibitors Targeting DNA Repair and DNA Repair Deficiency in Research and Cancer Therapy.

PubMed

Hengel, Sarah R; Spies, M Ashley; Spies, Maria

2017-09-21

To maintain stable genomes and to avoid cancer and aging, cells need to repair a multitude of deleterious DNA lesions, which arise constantly in every cell. Processes that support genome integrity in normal cells, however, allow cancer cells to develop resistance to radiation and DNA-damaging chemotherapeutics. Chemical inhibition of the key DNA repair proteins and pharmacologically induced synthetic lethality have become instrumental in both dissecting the complex DNA repair networks and as promising anticancer agents. The difficulty in capitalizing on synthetically lethal interactions in cancer cells is that many potential targets do not possess well-defined small-molecule binding determinates. In this review, we discuss several successful campaigns to identify and leverage small-molecule inhibitors of the DNA repair proteins, from PARP1, a paradigm case for clinically successful small-molecule inhibitors, to coveted new targets, such as RAD51 recombinase, RAD52 DNA repair protein, MRE11 nuclease, and WRN DNA helicase. Copyright © 2017 Elsevier Ltd. All rights reserved.

Investigation of the complex structure, comparative DNA-binding and DNA cleavage of two water-soluble mono-nuclear lanthanum(III) complexes and cytotoxic activity of chitosan-coated magnetic nanoparticles as drug delivery for the complexes

NASA Astrophysics Data System (ADS)

Asadi, Zahra; Nasrollahi, Neda; Karbalaei-Heidari, Hamidreza; Eigner, Vaclav; Dusek, Michal; Mobaraki, Nabiallah; Pournejati, Roya

2017-05-01

Two water-soluble mono-nuclear macrocyclic lanthanum(III) complexes of 2,6-diformyl-4-methylphenol with 1,3-diamino-2-propanol (C1) or 1,3-propylenediamine (C2) were synthesized and characterized by UV-Vis, FT-IR, 13C and 1H NMR spectroscopy and elemental analysis. C1 complex was structurally characterized by single-crystal X-ray diffraction, which revealed that the complex was mononuclear and ten-coordinated. The coordination sites around lanthanum(III) were occupied with a five-dentate ligand, two bidentate nitrates, and one water molecule. The interaction of complexes with DNA was studied in buffered aqueous solution at pH 7.4. UV-Vis absorption spectroscopy, emission spectroscopy, circular dichroism (CD) and viscometric measurements provided clear evidence of the intercalation mechanism of binding. The obtained intrinsic binding constants (Kb) 9.3 × 103 and 1.2 × 103 M- 1 for C1 and C2, respectively confirmed that C1 is better intercalator than C2. The DNA docking studies suggested that the complexes bind with DNA in a groove binding mode with the binding affinity of C1 > C2. Moreover, agarose gel electrophoresis study of the DNA-complex for both compounds revealed that the C1 intercalation cause ethidium bromide replacement in a competitive manner which confirms the suggested mechanism of binding. Finally, the anticancer experiments for the treated cancerous cell lines with both synthesized compounds show that these hydrophilic molecules need a suitable carrier to pass through the hydrophobic nature of cell membrane efficiently.

Single molecule tracking of Ace1p in Saccharomyces cerevisiae defines a characteristic residence time for non-specific interactions of transcription factors with chromatin

PubMed Central

Ball, David A.; Mehta, Gunjan D.; Salomon-Kent, Ronit; Mazza, Davide; Morisaki, Tatsuya; Mueller, Florian; McNally, James G.; Karpova, Tatiana S.

2016-01-01

In vivo single molecule tracking has recently developed into a powerful technique for measuring and understanding the transient interactions of transcription factors (TF) with their chromatin response elements. However, this method still lacks a solid foundation for distinguishing between specific and non-specific interactions. To address this issue, we took advantage of the power of molecular genetics of yeast. Yeast TF Ace1p has only five specific sites in the genome and thus serves as a benchmark to distinguish specific from non-specific binding. Here, we show that the estimated residence time of the short-residence molecules is essentially the same for Hht1p, Ace1p and Hsf1p, equaling 0.12–0.32 s. These three DNA-binding proteins are very different in their structure, function and intracellular concentration. This suggests that (i) short-residence molecules are bound to DNA non-specifically, and (ii) that non-specific binding shares common characteristics between vastly different DNA-bound proteins and thus may have a common underlying mechanism. We develop new and robust procedure for evaluation of adverse effects of labeling, and new quantitative analysis procedures that significantly improve residence time measurements by accounting for fluorophore blinking. Our results provide a framework for the reliable performance and analysis of single molecule TF experiments in yeast. PMID:27566148

Development of programmable small DNA-binding molecules with epigenetic activity for induction of core pluripotency genes.

PubMed

Pandian, Ganesh N; Ohtsuki, Akimichi; Bando, Toshikazu; Sato, Shinsuke; Hashiya, Kaori; Sugiyama, Hiroshi

2012-04-15

Epigenetic modifications that govern the gene expression are often overlooked with the design of artificial genetic switches. N-Methylpyrrole-N-methylimidazole (PI) hairpin polyamides are programmable small DNA binding molecules that have been studied in the context of gene regulation. Recently, we synthesized a library of compounds by conjugating PI polyamides with SAHA, a chromatin-modifier. Among these novel compounds, PI polyamide-SAHA conjugate 1 was shown to epigenetically activate pluripotency genes in mouse embryonic fibroblasts. Here, we report the synthesis of the derivatives of conjugate 1 and demonstrate that these epigenetically active molecules could be developed to improve the induction of pluripotency factors. Copyright © 2012 Elsevier Ltd. All rights reserved.

Macroscopic modeling and simulations of supercoiled DNA with bound proteins

NASA Astrophysics Data System (ADS)

Huang, Jing; Schlick, Tamar

2002-11-01

General methods are presented for modeling and simulating DNA molecules with bound proteins on the macromolecular level. These new approaches are motivated by the need for accurate and affordable methods to simulate slow processes (on the millisecond time scale) in DNA/protein systems, such as the large-scale motions involved in the Hin-mediated inversion process. Our approaches, based on the wormlike chain model of long DNA molecules, introduce inhomogeneous potentials for DNA/protein complexes based on available atomic-level structures. Electrostatically, treat those DNA/protein complexes as sets of effective charges, optimized by our discrete surface charge optimization package, in which the charges are distributed on an excluded-volume surface that represents the macromolecular complex. We also introduce directional bending potentials as well as non-identical bead hydrodynamics algorithm to further mimic the inhomogeneous effects caused by protein binding. These models thus account for basic elements of protein binding effects on DNA local structure but remain computational tractable. To validate these models and methods, we reproduce various properties measured by both Monte Carlo methods and experiments. We then apply the developed models to study the Hin-mediated inversion system in long DNA. By simulating supercoiled, circular DNA with or without bound proteins, we observe significant effects of protein binding on global conformations and long-time dynamics of the DNA on the kilo basepair length.

Progressing single biomolecule force spectroscopy measurements for the screening of DNA binding agents

NASA Astrophysics Data System (ADS)

Zhang, Wenke; Barbagallo, Romina; Madden, Claire; Roberts, Clive J.; Woolford, Alison; Allen, Stephanie

2005-10-01

Recent studies have indicated that the force-extension properties of single molecules of double stranded (ds) DNA are sensitive to the presence of small molecule DNA binding agents, and also to their mode of binding. These observations raise the possibility of using this approach as a highly sensitive tool for the screening of such agents. However, particularly for studies employing the atomic force microscope (AFM), several non-trivial barriers hinder the progress of this approach to the non-specialist arena and hence also the full realization of this possibility. In this paper, we therefore address a series of key reproducibility and metrological issues associated with this type of measurement. Specifically, we present an improved immobilization method that covalently anchors one end (5' end) of a dual labelled (5'-thiol, 3'-biotin) p53 DNA molecule onto a gold substrate via gold-thiol chemistry, whilst the biotinylated 3' end is available for 'pick-up' using a streptavidin modified AFM tip. We also show that co-surface immobilization of DNA with 6-mercapto-1-hexanol (MCH) can also lead to a further increase the measured contour length. We demonstrate the impact of these improved protocols through the observation of the cooperative transition plateau in a DNA fragment of approximately 118 bp, a significantly smaller fragment than previously investigated. The results of a comparative study of the effects of a model minor groove binder (Hoechst 33258) and an intercalating drug (proflavine), alone, as a mixture and under different buffer conditions, are also presented.

Highly parallel single-molecule amplification approach based on agarose droplet polymerase chain reaction for efficient and cost-effective aptamer selection.

PubMed

Zhang, Wei Yun; Zhang, Wenhua; Liu, Zhiyuan; Li, Cong; Zhu, Zhi; Yang, Chaoyong James

2012-01-03

We have developed a novel method for efficiently screening affinity ligands (aptamers) from a complex single-stranded DNA (ssDNA) library by employing single-molecule emulsion polymerase chain reaction (PCR) based on the agarose droplet microfluidic technology. In a typical systematic evolution of ligands by exponential enrichment (SELEX) process, the enriched library is sequenced first, and tens to hundreds of aptamer candidates are analyzed via a bioinformatic approach. Possible candidates are then chemically synthesized, and their binding affinities are measured individually. Such a process is time-consuming, labor-intensive, inefficient, and expensive. To address these problems, we have developed a highly efficient single-molecule approach for aptamer screening using our agarose droplet microfluidic technology. Statistically diluted ssDNA of the pre-enriched library evolved through conventional SELEX against cancer biomarker Shp2 protein was encapsulated into individual uniform agarose droplets for droplet PCR to generate clonal agarose beads. The binding capacity of amplified ssDNA from each clonal bead was then screened via high-throughput fluorescence cytometry. DNA clones with high binding capacity and low K(d) were chosen as the aptamer and can be directly used for downstream biomedical applications. We have identified an ssDNA aptamer that selectively recognizes Shp2 with a K(d) of 24.9 nM. Compared to a conventional sequencing-chemical synthesis-screening work flow, our approach avoids large-scale DNA sequencing and expensive, time-consuming DNA synthesis of large populations of DNA candidates. The agarose droplet microfluidic approach is thus highly efficient and cost-effective for molecular evolution approaches and will find wide application in molecular evolution technologies, including mRNA display, phage display, and so on. © 2011 American Chemical Society

Multiplex single-molecule interaction profiling of DNA-barcoded proteins.

PubMed

Gu, Liangcai; Li, Chao; Aach, John; Hill, David E; Vidal, Marc; Church, George M

2014-11-27

In contrast with advances in massively parallel DNA sequencing, high-throughput protein analyses are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule protein detection using optical methods is limited by the number of spectrally non-overlapping chromophores. Here we introduce a single-molecular-interaction sequencing (SMI-seq) technology for parallel protein interaction profiling leveraging single-molecule advantages. DNA barcodes are attached to proteins collectively via ribosome display or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide thin film to construct a random single-molecule array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies) and analysed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimetre. Furthermore, protein interactions can be measured on the basis of the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor and antibody-binding profiling, are demonstrated. SMI-seq enables 'library versus library' screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity.

Identification of a Hydrophobic Cleft in the LytTR Domain of AgrA as a Locus for Small Molecule Interactions that Inhibit DNA Binding

PubMed Central

Leonard, Paul G.; Bezar, Ian F.; Sidote, David J.; Stock, Ann M.

2012-01-01

The AgrA transcription factor regulates the quorum-sensing response in Staphylococcus aureus, controlling the production of hemolysins and other virulence factors. AgrA binds to DNA via its C-terminal LytTR domain, a domain not found in humans but common in many pathogenic bacteria, making it a potential target for antimicrobial development. We have determined the crystal structure of the apo AgrA LytTR domain and screened a library of 500 fragment compounds to find inhibitors of AgrA DNA-binding activity. Using NMR, the binding site for five compounds has been mapped to a common locus at the C-terminal end of the LytTR domain, a site known to be important for DNA-binding activity. Three of these compounds inhibit AgrA DNA binding. These results provide the first evidence that LytTR domains can be targeted by small organic compounds. PMID:23181972

N-acyl homoserine lactone binding to the CarR receptor determines quorum-sensing specificity in Erwinia.

PubMed

Welch, M; Todd, D E; Whitehead, N A; McGowan, S J; Bycroft, B W; Salmond, G P

2000-02-15

Quorum sensing via an N-acyl homoserine lactone (HSL) pheromone controls the biosynthesis of a carbapenem antibiotic in Erwinia carotovora. Transcription of the carbapenem biosynthetic genes is dependent on the LuxR-type activator protein, CarR. Equilibrium binding of a range of HSL molecules, which are thought to activate CarR to bind to its DNA target sequence, was examined using fluorescence quenching, DNA bandshift analysis, limited proteolysis and reporter gene assays. CarR bound the most physiologically relevant ligand, N-(3-oxohexanoyl)-L-homoserine lactone, with a stoichiometry of two molecules of ligand per dimer of protein and a dissociation constant of 1.8 microM, in good agreement with the concentration of HSL required to activate carbapenem production in vivo. In the presence of HSL, CarR formed a very high molecular weight complex with its target DNA, indicating that the ligand causes the protein to multimerize. Chemical cross-linking analysis supported this interpretation. Our data show that the ability of a given HSL to facilitate CarR binding to its target DNA sequence is directly proportional to the affinity of the HSL for the protein.

Binding of sulphonated indigo derivatives to RepA-WH1 inhibits DNA-induced protein amyloidogenesis

PubMed Central

Gasset-Rosa, Fátima; Maté, María Jesús; Dávila-Fajardo, Cristina; Bravo, Jerónimo; Giraldo, Rafael

2008-01-01

The quest for inducers and inhibitors of protein amyloidogenesis is of utmost interest, since they are key tools to understand the molecular bases of proteinopathies such as Alzheimer, Parkinson, Huntington and Creutzfeldt–Jakob diseases. It is also expected that such molecules could lead to valid therapeutic agents. In common with the mammalian prion protein (PrP), the N-terminal Winged-Helix (WH1) domain of the pPS10 plasmid replication protein (RepA) assembles in vitro into a variety of amyloid nanostructures upon binding to different specific dsDNA sequences. Here we show that di- (S2) and tetra-sulphonated (S4) derivatives of indigo stain dock at the DNA recognition interface in the RepA-WH1 dimer. They compete binding of RepA to its natural target dsDNA repeats, found at the repA operator and at the origin of replication of the plasmid. Calorimetry points to the existence of a major site, with micromolar affinity, for S4-indigo in RepA-WH1 dimers. As revealed by electron microscopy, in the presence of inducer dsDNA, both S2/S4 stains inhibit the assembly of RepA-WH1 into fibres. These results validate the concept that DNA can promote protein assembly into amyloids and reveal that the binding sites of effector molecules can be targeted to inhibit amyloidogenesis. PMID:18285361

Structure and specificity of the RNA-guided endonuclease Cas9 during DNA interrogation, target binding and cleavage

PubMed Central

Josephs, Eric A.; Kocak, D. Dewran; Fitzgibbon, Christopher J.; McMenemy, Joshua; Gersbach, Charles A.; Marszalek, Piotr E.

2015-01-01

CRISPR-associated endonuclease Cas9 cuts DNA at variable target sites designated by a Cas9-bound RNA molecule. Cas9's ability to be directed by single ‘guide RNA’ molecules to target nearly any sequence has been recently exploited for a number of emerging biological and medical applications. Therefore, understanding the nature of Cas9's off-target activity is of paramount importance for its practical use. Using atomic force microscopy (AFM), we directly resolve individual Cas9 and nuclease-inactive dCas9 proteins as they bind along engineered DNA substrates. High-resolution imaging allows us to determine their relative propensities to bind with different guide RNA variants to targeted or off-target sequences. Mapping the structural properties of Cas9 and dCas9 to their respective binding sites reveals a progressive conformational transformation at DNA sites with increasing sequence similarity to its target. With kinetic Monte Carlo (KMC) simulations, these results provide evidence of a ‘conformational gating’ mechanism driven by the interactions between the guide RNA and the 14th–17th nucleotide region of the targeted DNA, the stabilities of which we find correlate significantly with reported off-target cleavage rates. KMC simulations also reveal potential methodologies to engineer guide RNA sequences with improved specificity by considering the invasion of guide RNAs into targeted DNA duplex. PMID:26384421

Spectroscopic profiling and computational study of the binding of tschimgine: A natural monoterpene derivative, with calf thymus DNA

NASA Astrophysics Data System (ADS)

Khajeh, Masoumeh Ashrafi; Dehghan, Gholamreza; Dastmalchi, Siavoush; Shaghaghi, Masoomeh; Iranshahi, Mehrdad

2018-03-01

DNA is a major target for a number of anticancer substances. Interaction studies between small molecules and DNA are essential for rational drug designing to influence main biological processes and also introducing new probes for the assay of DNA. Tschimgine (TMG) is a monoterpene derivative with anticancer properties. In the present study we tried to elucidate the interaction of TMG with calf thymus DNA (CT-DNA) using different spectroscopic methods. UV-visible absorption spectrophotometry, fluorescence and circular dichroism (CD) spectroscopies as well as molecular docking study revealed formation of complex between TMG and CT-DNA. Binding constant (Kb) between TMG and DNA was 2.27 × 104 M- 1, that is comparable to groove binding agents. The fluorescence spectroscopic data revealed that the quenching mechanism of fluorescence of TMG by CT-DNA is static quenching. Thermodynamic parameters (ΔH < 0 and ΔS < 0) at different temperatures indicated that van der Waals forces and hydrogen bonds were involved in the binding process of TMG with CT-DNA. Competitive binding assay with methylene blue (MB) and Hoechst 33258 using fluorescence spectroscopy displayed that TMG possibly binds to the minor groove of CT-DNA. These observations were further confirmed by CD spectral analysis, viscosity measurements and molecular docking.

Design, synthesis, and functional testing of recombinant cell penetrating peptides

NASA Astrophysics Data System (ADS)

Widyaningtyas, S. T.; Soebandrio, A.; Ibrahim, F.; Bela, B.

2017-08-01

Cell penetrating peptides (CPP) are one of the most attractive DNA delivery systems currently in development. In this research, in silico CPP development was performed based on a literature study to look for peptides that induce endosome escape, have the ability to bind DNA, and pass through cell membranes and/or nuclear membranes with a final goal of creating a new CPP to be used as a DNA delivery system. We report herein the successful isolation of three candidate CPP molecules, which have all been successfully expressed and purified by NiNTA. One of the determinants of CPP success as a DNA carrier is the ability of the CPP to bind and protect DNA from the effects of nucleases. The DNA binding test results show that all three CPPs can bind to DNA and protect it from the effects of serum nucleases. These three CPP candidates designed in silico and synthesized in the prokaryote system are eligible candidates for further testing of their ability to deliver DNA in vitro and in vivo.

Single helically folded aromatic oligoamides that mimic the charge surface of double-stranded B-DNA

NASA Astrophysics Data System (ADS)

Ziach, Krzysztof; Chollet, Céline; Parissi, Vincent; Prabhakaran, Panchami; Marchivie, Mathieu; Corvaglia, Valentina; Bose, Partha Pratim; Laxmi-Reddy, Katta; Godde, Frédéric; Schmitter, Jean-Marie; Chaignepain, Stéphane; Pourquier, Philippe; Huc, Ivan

2018-05-01

Numerous essential biomolecular processes require the recognition of DNA surface features by proteins. Molecules mimicking these features could potentially act as decoys and interfere with pharmacologically or therapeutically relevant protein-DNA interactions. Although naturally occurring DNA-mimicking proteins have been described, synthetic tunable molecules that mimic the charge surface of double-stranded DNA are not known. Here, we report the design, synthesis and structural characterization of aromatic oligoamides that fold into single helical conformations and display a double helical array of negatively charged residues in positions that match the phosphate moieties in B-DNA. These molecules were able to inhibit several enzymes possessing non-sequence-selective DNA-binding properties, including topoisomerase 1 and HIV-1 integrase, presumably through specific foldamer-protein interactions, whereas sequence-selective enzymes were not inhibited. Such modular and synthetically accessible DNA mimics provide a versatile platform to design novel inhibitors of protein-DNA interactions.

Regulation of a Viral Proteinase by a Peptide and DNA in One-dimensional Space

PubMed Central

Graziano, Vito; Luo, Guobin; Blainey, Paul C.; Pérez-Berná, Ana J.; McGrath, William J.; Flint, S. Jane; San Martín, Carmen; Xie, X. Sunney; Mangel, Walter F.

2013-01-01

Late in an adenovirus infection, the viral proteinase (AVP) becomes activated to process virion precursor proteins used in virus assembly. AVP is activated by two cofactors, the viral DNA and pVIc, an 11-amino acid peptide originating from the C terminus of the precursor protein pVI. There is a conundrum in the activation of AVP in that AVP and pVI are sequence-independent DNA-binding proteins with nm equilibrium dissociation constants such that in the virus particle, they are predicted to be essentially irreversibly bound to the viral DNA. Here, we resolve that conundrum by showing that activation of AVP takes place on the one-dimensional contour of DNA. In vitro, pVI, a substrate, slides on DNA via one-dimensional diffusion, D1 = 1.45 × 106 bp2/s, until it binds to AVP also on the same DNA molecule. AVP, partially activated by being bound to DNA, excises pVIc, which binds to the AVP molecule that cut it out. pVIc then forms a disulfide bond with AVP forming the fully active AVP-pVIc complex bound to DNA. In vivo, in heat-disrupted immature virus, AVP was also activated by pVI in DNA-dependent reactions. This activation mechanism illustrates a new paradigm for virion maturation and a new way, by sliding on DNA, for bimolecular complexes to form among proteins not involved in DNA metabolism. PMID:23043137

The Activation Domain of the Bovine Papillomavirus E2 Protein Mediates Association of DNA-Bound Dimers to form DNA Loops

NASA Astrophysics Data System (ADS)

Knight, Jonathan D.; Li, Rong; Botchan, Michael

1991-04-01

The E2 transactivator protein of bovine papillomavirus binds its specific DNA target sequence as a dimer. We have found that E2 dimers, performed in solution independent of DNA, exhibit substantial cooperativity of DNA binding as detected by both nitrocellulose filter retention and footprint analysis techniques. If the binding sites are widely spaced, E2 forms stable DNA loops visible by electron microscopy. When three widely separated binding sites reside on te DNA, E2 condenses the molecule into a bow-tie structure. This implies that each E2 dimer has at least two independent surfaces for multimerization. Two naturally occurring shorter forms of the protein, E2C and D8/E2, which function in vivo as repressors of transcription, do not form such loops. Thus, the looping function of E2 maps to the 161-amino acid activation domain. These results support the looping model of transcription activation by enhancers.

Circadian clock protein KaiC forms ATP-dependent hexameric rings and binds DNA

PubMed Central

Mori, Tetsuya; Saveliev, Sergei V.; Xu, Yao; Stafford, Walter F.; Cox, Michael M.; Inman, Ross B.; Johnson, Carl H.

2002-01-01

KaiC from Synechococcus elongatus PCC 7942 (KaiC) is an essential circadian clock protein in cyanobacteria. Previous sequence analyses suggested its inclusion in the RecA/DnaB superfamily. A characteristic of the proteins of this superfamily is that they form homohexameric complexes that bind DNA. We show here that KaiC also forms ring complexes with a central pore that can be visualized by electron microscopy. A combination of analytical ultracentrifugation and chromatographic analyses demonstrates that these complexes are hexameric. The association of KaiC molecules into hexamers depends on the presence of ATP. The KaiC sequence does not include the obvious DNA-binding motifs found in RecA or DnaB. Nevertheless, KaiC binds forked DNA substrates. These data support the inclusion of KaiC into the RecA/DnaB superfamily and have important implications for enzymatic activity of KaiC in the circadian clock mechanism that regulates global changes in gene expression patterns. PMID:12477935

Direct observation of transcription activator-like effector (TALE) protein dynamics

NASA Astrophysics Data System (ADS)

Cuculis, Luke; Abil, Zhanar; Zhao, Huimin; Schroeder, Charles M.

2014-03-01

In this work, we describe a single molecule assay to probe the site-search dynamics of transcription activator-like effector (TALE) proteins along DNA. In modern genetics, the ability to selectively edit the human genome is an unprecedented development, driven by recent advances in targeted nuclease proteins. Specific gene editing can be accomplished using TALE proteins, which are programmable DNA-binding proteins that can be fused to a nuclease domain. In this way, TALENs are a leading technology that has shown great success in the genomic editing of pluripotent stem cells. A major hurdle facing clinical implementation, however, is the potential for deleterious off-target binding events. For these reasons, a molecular-level understanding of TALE binding and target sequence search on DNA is essential. To this end, we developed a single-molecule fluorescence imaging assay that provides a first-of-its-kind view of the 1-D diffusion of TALE proteins along stretched DNA. Taken together with co-crystal structures of DNA-bound TALEs, our results suggest a rotationally-coupled, major groove tracking model for diffusion. We further report diffusion constants for TALE proteins as a function of salt concentration, consistent with previously described models of 1-D protein diffusion.

STAT1:DNA sequence-dependent binding modulation by phosphorylation, protein:protein interactions and small-molecule inhibition

PubMed Central

Bonham, Andrew J.; Wenta, Nikola; Osslund, Leah M.; Prussin, Aaron J.; Vinkemeier, Uwe; Reich, Norbert O.

2013-01-01

The DNA-binding specificity and affinity of the dimeric human transcription factor (TF) STAT1, were assessed by total internal reflectance fluorescence protein-binding microarrays (TIRF-PBM) to evaluate the effects of protein phosphorylation, higher-order polymerization and small-molecule inhibition. Active, phosphorylated STAT1 showed binding preferences consistent with prior characterization, whereas unphosphorylated STAT1 showed a weak-binding preference for one-half of the GAS consensus site, consistent with recent models of STAT1 structure and function in response to phosphorylation. This altered-binding preference was further tested by use of the inhibitor LLL3, which we show to disrupt STAT1 binding in a sequence-dependent fashion. To determine if this sequence-dependence is specific to STAT1 and not a general feature of human TF biology, the TF Myc/Max was analysed and tested with the inhibitor Mycro3. Myc/Max inhibition by Mycro3 is sequence independent, suggesting that the sequence-dependent inhibition of STAT1 may be specific to this system and a useful target for future inhibitor design. PMID:23180800

Quantitative Assessment of the Interplay Between DNA Elasticity and Cooperative Binding of Ligands

NASA Astrophysics Data System (ADS)

Siman, L.; Carrasco, I. S. S.; da Silva, J. K. L.; de Oliveira, M. C.; Rocha, M. S.; Mesquita, O. N.

2012-12-01

Binding of ligands to DNA can be studied by measuring the change of the persistence length of the complex formed, in single-molecule assays. We propose a methodology for persistence length data analysis based on a quenched disorder statistical model and describing the binding isotherm by a Hill-type equation. We obtain an expression for the effective persistence length as a function of the total ligand concentration, which we apply to our data of the DNA-cationic β-cyclodextrin and to the DNA-HU protein data available in the literature, determining the values of the local persistence lengths, the dissociation constant, and the degree of cooperativity for each set of data. In both cases the persistence length behaves nonmonotonically as a function of ligand concentration and based on the results obtained we discuss some physical aspects of the interplay between DNA elasticity and cooperative binding of ligands.

Role of Nucleoid Associated Proteins in Stabilizing Supercoils

NASA Astrophysics Data System (ADS)

Dahlke, Katelyn; Sing, Charles

Nucleoid associated proteins (NAPs) play an important role in prokaryotic cells by manipulating the shape and structure of the DNA. These NAPs act by bending or twisting DNA, and there are indications that NAPs bind preferentially to DNA that is already bent or twisted. We hypothesize that these binding behaviors strongly impact the stability and structure of DNA. We use coarse-grained simulation of NAPs and DNA that allow us to achieve the time and length scales where DNA supercoiling occurs. Supercoils are twist-induced structures that are the result of relaxing highly-twisted DNA by inducing higher degrees of bending and writhe. We are able to reproduce experimental observations, such as the extension of a DNA molecule as a function of force, linking number, and NAP concentration. Building upon these test cases, we allow the binding and unbinding energy of the simulated NAPs to be a function of the bending angle of the DNA at the site of binding (ΔEB (θ)). Consequently, NAPs localize along the contour of the supercoil, and this binding preference is capable of stabilizing supercoils that form within the nucleoid. National Institute Of General Medical Sciences of the National Institutes of Health under Award Number T32GM070421.

Solution structure and intramolecular exchange of methyl-cytosine binding domain protein 4 (MBD4) on DNA suggests a mechanism to scan for mCpG/TpG mismatches

PubMed Central

Walavalkar, Ninad M.; Cramer, Jason M.; Buchwald, William A.; Scarsdale, J. Neel; Williams, David C.

2014-01-01

Unlike other members of the methyl-cytosine binding domain (MBD) family, MBD4 serves as a potent DNA glycosylase in DNA mismatch repair specifically targeting mCpG/TpG mismatches arising from spontaneous deamination of methyl-cytosine. The protein contains an N-terminal MBD (MBD4MBD) and a C-terminal glycosylase domain (MBD4GD) separated by a long linker. This arrangement suggests that the MBD4MBD either directly augments enzymatic catalysis by the MBD4GD or targets the protein to regions enriched for mCpG/TpG mismatches. Here we present structural and dynamic studies of MBD4MBD bound to dsDNA. We show that MBD4MBD binds with a modest preference formCpG as compared to mismatch, unmethylated and hydroxymethylated DNA. We find that while MBD4MBD exhibits slow exchange between molecules of DNA (intermolecular exchange), the domain exhibits fast exchange between two sites in the same molecule of dsDNA (intramolecular exchange). Introducing a single-strand defect between binding sites does not greatly reduce the intramolecular exchange rate, consistent with a local hopping mechanism for moving along the DNA. These results support a model in which the MBD4MBD4 targets the intact protein to mCpG islands and promotes scanning by rapidly exchanging between successive mCpG sites which facilitates repair of nearby mCpG/TpG mismatches by the glycosylase domain. PMID:25183517

Probing the electrostatics and pharmacologic modulation of sequence-specific binding by the DNA-binding domain of the ETS-family transcription factor PU.1: a binding affinity and kinetics investigation

PubMed Central

Munde, Manoj; Poon, Gregory M. K.; Wilson, W. David

2013-01-01

Members of the ETS family of transcription factors regulate a functionally diverse array of genes. All ETS proteins share a structurally-conserved but sequence-divergent DNA-binding domain, known as the ETS domain. Although the structure and thermodynamics of the ETS-DNA complexes are well known, little is known about the kinetics of sequence recognition, a facet that offers potential insight into its molecular mechanism. We have characterized DNA binding by the ETS domain of PU.1 by biosensor-surface plasmon resonance (SPR). SPR analysis revealed a striking kinetic profile for DNA binding by the PU.1 ETS domain. At low salt concentrations, it binds high-affinity cognate DNA with a very slow association rate constant (≤105 M−1 s−1), compensated by a correspondingly small dissociation rate constant. The kinetics are strongly salt-dependent but mutually balance to produce a relatively weak dependence in the equilibrium constant. This profile contrasts sharply with reported data for other ETS domains (e.g., Ets-1, TEL) for which high-affinity binding is driven by rapid association (>107 M−1 s−1). We interpret this difference in terms of the hydration properties of ETS-DNA binding and propose that at least two mechanisms of sequence recognition are employed by this family of DNA-binding domain. Additionally, we use SPR to demonstrate the potential for pharmacological inhibition of sequence-specific ETS-DNA binding, using the minor groove-binding distamycin as a model compound. Our work establishes SPR as a valuable technique for extending our understanding of the molecular mechanisms of ETS-DNA interactions as well as developing potential small-molecule agents for biotechnological and therapeutic purposes. PMID:23416556

NMR studies of DNA oligomers and their interactions with minor groove binding ligands

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fagan, Patricia A.

1996-05-01

The cationic peptide ligands distamycin and netropsin bind noncovalently to the minor groove of DNA. The binding site, orientation, stoichiometry, and qualitative affinity of distamycin binding to several short DNA oligomers were investigated by NMR spectroscopy. The oligomers studied contain A,T-rich or I,C-rich binding sites, where I = 2-desaminodeoxyguanosine. I•C base pairs are functional analogs of A•T base pairs in the minor groove. The different behaviors exhibited by distamycin and netropsin binding to various DNA sequences suggested that these ligands are sensitive probes of DNA structure. For sites of five or more base pairs, distamycin can form 1:1 or 2:1more » ligand:DNA complexes. Cooperativity in distamycin binding is low in sites such as AAAAA which has narrow minor grooves, and is higher in sites with wider minor grooves such as ATATAT. The distamycin binding and base pair opening lifetimes of I,C-containing DNA oligomers suggest that the I,C minor groove is structurally different from the A,T minor groove. Molecules which direct chemistry to a specific DNA sequence could be used as antiviral compounds, diagnostic probes, or molecular biology tools. The author studied two ligands in which reactive groups were tethered to a distamycin to increase the sequence specificity of the reactive agent.« less

G-Quadruplex Induction by the Hairpin Pyrrole-Imidazole Polyamide Dimer.

PubMed

Obata, Shunsuke; Asamitsu, Sefan; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

2018-02-06

The G-quadruplex (G4) is one type of higher-order structure of nucleic acids and is thought to play important roles in various biological events such as regulation of transcription and inhibition of DNA replication. Pyrrole-imidazole polyamides (PIPs) are programmable small molecules that can sequence-specifically bind with high affinity to the minor groove of double-stranded DNA (dsDNA). Herein, we designed head-to-head hairpin PIP dimers and their target dsDNA in a model G4-forming sequence. Using an electrophoresis mobility shift assay and transcription arrest assay, we found that PIP dimers could induce the structural change to G4 DNA from dsDNA through the recognition by one PIP dimer molecule of two duplex-binding sites flanking both ends of the G4-forming sequence. This induction ability was dependent on linker length. This is the first study to induce G4 formation using PIPs, which are known to be dsDNA binders. The results reported here suggest that selective G4 induction in native sequences may be achieved with PIP dimers by applying the same design strategy.

Interaction of HIV-1 Gag protein components with single DNA molecules

NASA Astrophysics Data System (ADS)

Cruceanu, Margareta; Gorelick, Robert J.; Williams, Mark C.

2003-03-01

The Gag protein of the HIV-1 retrovirus is cleaved into three major proteins as part of viral maturation: nucleocapsid (NC), capsid, and matrix. NC is the first of these proteins to be cleaved, and it is cleaved in three stages into NCp15, followed by NCp9, and finally NCp7. In this study, we use optical tweezers to investigate the capability of these NC proteins to alter the helix-coil transition of single DNA molecules. We have previously shown that the capability to alter the DNA helix-coil transition is an excellent probe of the nucleic acid chaperone activity of NC proteins, in which the secondary structure of nucleic acids is rearranged to facilitate reverse transcription. By examining the capability of NCp15, NCp9, and NCp7 to alter DNA stretching, the current studies will test the role of proteolytic cleavage of Gag in regulating the nucleic acid chaperone activity of NC. Whereas binding studies suggest that NCp9 and NCp15 bind more strongly to DNA than NCp7, our DNA stretching results indicate that these proteins all have similar effects on DNA stretching.

Investigations of the CLOCK and BMAL1 Proteins Binding to DNA: A Molecular Dynamics Simulation Study.

PubMed

Xue, Tuo; Song, Chunnian; Wang, Qing; Wang, Yan; Chen, Guangju

2016-01-01

The circadian locomotor output cycles kaput (CLOCK), and brain and muscle ARNT-like 1 (BMAL1) proteins are important transcriptional factors of the endogenous circadian clock. The CLOCK and BMAL1 proteins can regulate the transcription-translation activities of the clock-related genes through the DNA binding. The hetero-/homo-dimerization and DNA combination of the CLOCK and BMAL1 proteins play a key role in the positive and negative transcriptional feedback processes. In the present work, we constructed a series of binary and ternary models for the bHLH/bHLH-PAS domains of the CLOCK and BMAL1 proteins, and the DNA molecule, and carried out molecular dynamics simulations, free energy calculations and conformational analysis to explore the interaction properties of the CLOCK and BMAL1 proteins with DNA. The results show that the bHLH domains of CLOCK and BMAL1 can favorably form the heterodimer of the bHLH domains of CLOCK and BMAL1 and the homodimer of the bHLH domains of BMAL1. And both dimers could respectively bind to DNA at its H1-H1 interface. The DNA bindings of the H1 helices in the hetero- and homo-bHLH dimers present the rectangular and diagonal binding modes, respectively. Due to the function of the α-helical forceps in these dimers, the tight gripping of the H1 helices to the major groove of DNA would cause the decrease of interactions at the H1-H2 interfaces in the CLOCK and BMAL1 proteins. The additional PAS domains in the CLOCK and BMAL1 proteins affect insignificantly the interactions of the CLOCK and BMAL1 proteins with the DNA molecule due to the flexible and long loop linkers located at the middle of the PAS and bHLH domains. The present work theoretically explains the interaction mechanisms of the bHLH domains of the CLOCK and BMAL1 proteins with DNA.

Structural Analysis of HMGD-DNA Complexes Reveal Influence of Intercalation on Sequence Selectivity and DNA Bending

PubMed Central

Churchill, Mair E.A.; Klass, Janet; Zoetewey, David L.

2010-01-01

The ubiquitous eukaryotic High-Mobility-Group-Box (HMGB) chromosomal proteins promote many chromatin-mediated cellular activities through their non-sequence-specific binding and bending of DNA. Minor groove DNA binding by the HMG box results in substantial DNA bending toward the major groove owing to electrostatic interactions, shape complementarity and DNA intercalation that occurs at two sites. Here, the structures of the complexes formed with DNA by a partially DNA intercalation-deficient mutant of Drosophila melanogaster HMGD have been determined by X-ray crystallography at a resolution of 2.85 Å. The six proteins and fifty base pairs of DNA in the crystal structure revealed a variety of bound conformations. All of the proteins bound in the minor groove, bridging DNA molecules, presumably because these DNA regions are easily deformed. The loss of the primary site of DNA intercalation decreased overall DNA bending and shape complementarity. However, DNA bending at the secondary site of intercalation was retained and most protein-DNA contacts were preserved. The mode of binding resembles the HMGB1-boxA-cisplatin-DNA complex, which also lacks a primary intercalating residue. This study provides new insights into the binding mechanisms used by HMG boxes to recognize varied DNA structures and sequences as well as modulate DNA structure and DNA bending. PMID:20800069

A Synthetic DNA-Binding Domain Guides Distinct Chromatin-Modifying Small Molecules to Activate an Identical Gene Network.

PubMed

Han, Le; Pandian, Ganesh N; Chandran, Anandhakumar; Sato, Shinsuke; Taniguchi, Junichi; Kashiwazaki, Gengo; Sawatani, Yoshito; Hashiya, Kaori; Bando, Toshikazu; Xu, Yufang; Qian, Xuhong; Sugiyama, Hiroshi

2015-07-20

Synthetic dual-function ligands targeting specific DNA sequences and histone-modifying enzymes were applied to achieve regulatory control over multi-gene networks in living cells. Unlike the broad array of targeting small molecules for histone deacetylases (HDACs), few modulators are known for histone acetyltransferases (HATs), which play a central role in transcriptional control. As a novel chemical approach to induce selective HAT-regulated genes, we conjugated a DNA-binding domain (DBD) "I" to N-(4-chloro-3-trifluoromethyl-phenyl)-2-ethoxy-benzamide (CTB), an artificial HAT activator. In vitro enzyme activity assays and microarray studies were used to demonstrate that distinct functional small molecules could be transformed to have identical bioactivity when conjugated with a targeting DBD. This proof-of-concept synthetic strategy validates the switchable functions of HDACs and HATs in gene regulation and provides a molecular basis for developing versatile bioactive ligands. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Spectroscopic profiling and computational study of the binding of tschimgine: A natural monoterpene derivative, with calf thymus DNA.

PubMed

Khajeh, Masoumeh Ashrafi; Dehghan, Gholamreza; Dastmalchi, Siavoush; Shaghaghi, Masoomeh; Iranshahi, Mehrdad

2018-03-05

DNA is a major target for a number of anticancer substances. Interaction studies between small molecules and DNA are essential for rational drug designing to influence main biological processes and also introducing new probes for the assay of DNA. Tschimgine (TMG) is a monoterpene derivative with anticancer properties. In the present study we tried to elucidate the interaction of TMG with calf thymus DNA (CT-DNA) using different spectroscopic methods. UV-visible absorption spectrophotometry, fluorescence and circular dichroism (CD) spectroscopies as well as molecular docking study revealed formation of complex between TMG and CT-DNA. Binding constant (K b ) between TMG and DNA was 2.27×10 4 M -1 , that is comparable to groove binding agents. The fluorescence spectroscopic data revealed that the quenching mechanism of fluorescence of TMG by CT-DNA is static quenching. Thermodynamic parameters (ΔH<0 and ΔS<0) at different temperatures indicated that van der Waals forces and hydrogen bonds were involved in the binding process of TMG with CT-DNA. Competitive binding assay with methylene blue (MB) and Hoechst 33258 using fluorescence spectroscopy displayed that TMG possibly binds to the minor groove of CT-DNA. These observations were further confirmed by CD spectral analysis, viscosity measurements and molecular docking. Copyright © 2017 Elsevier B.V. All rights reserved.

Plasmid DNA Delivery: Nanotopography Matters.

PubMed

Song, Hao; Yu, Meihua; Lu, Yao; Gu, Zhengying; Yang, Yannan; Zhang, Min; Fu, Jianye; Yu, Chengzhong

2017-12-20

Plasmid DNA molecules with unique loop structures have widespread bioapplications, in many cases relying heavily on delivery vehicles to introduce them into cells and achieve their functions. Herein, we demonstrate that control over delicate nanotopography of silica nanoparticles as plasmid DNA vectors has significant impact on the transfection efficacy. For silica nanoparticles with rambutan-, raspberry-, and flower-like morphologies composed of spike-, hemisphere-, and bowl-type subunit nanotopographies, respectively, the rambutan-like nanoparticles with spiky surfaces demonstrate the highest plasmid DNA binding capability and transfection efficacy of 88%, higher than those reported for silica-based nanovectors. Moreover, it is shown that the surface spikes of rambutan nanoparticles provide a continuous open space to bind DNA chains via multivalent interactions and protect the gene molecules sheltered in the spiky layer against nuclease degradation, exhibiting no significant transfection decay. This unique protection feature is in great contrast to a commercial transfection agent with similar transfection performance but poor protection capability against enzymatic cleavage. Our study provides new understandings in the rational design of nonviral vectors for efficient gene delivery.

Srs2 prevents Rad51 filament formation by repetitive motion on DNA.

PubMed

Qiu, Yupeng; Antony, Edwin; Doganay, Sultan; Koh, Hye Ran; Lohman, Timothy M; Myong, Sua

2013-01-01

Srs2 dismantles presynaptic Rad51 filaments and prevents its re-formation as an anti-recombinase. However, the molecular mechanism by which Srs2 accomplishes these tasks remains unclear. Here we report a single-molecule fluorescence study of the dynamics of Rad51 filament formation and its disruption by Srs2. Rad51 forms filaments on single-stranded DNA by sequential binding of primarily monomers and dimers in a 5'-3' direction. One Rad51 molecule binds to three nucleotides, and six monomers are required to achieve a stable nucleation cluster. Srs2 exhibits ATP-dependent repetitive motion on single-stranded DNA and this activity prevents re-formation of the Rad51 filament. The same activity of Srs2 cannot prevent RecA filament formation, indicating its specificity for Rad51. Srs2's DNA-unwinding activity is greatly suppressed when Rad51 filaments form on duplex DNA. Taken together, our results reveal an exquisite and highly specific mechanism by which Srs2 regulates the Rad51 filament formation.

Single-molecule multiparameter fluorescence spectroscopy reveals directional MutS binding to mismatched bases in DNA

PubMed Central

Cristóvão, Michele; Sisamakis, Evangelos; Hingorani, Manju M.; Marx, Andreas D.; Jung, Caroline P.; Rothwell, Paul J.; Seidel, Claus A. M.; Friedhoff, Peter

2012-01-01

Mismatch repair (MMR) corrects replication errors such as mismatched bases and loops in DNA. The evolutionarily conserved dimeric MMR protein MutS recognizes mismatches by stacking a phenylalanine of one subunit against one base of the mismatched pair. In all crystal structures of G:T mismatch-bound MutS, phenylalanine is stacked against thymine. To explore whether these structures reflect directional mismatch recognition by MutS, we monitored the orientation of Escherichia coli MutS binding to mismatches by FRET and anisotropy with steady state, pre-steady state and single-molecule multiparameter fluorescence measurements in a solution. The results confirm that specifically bound MutS bends DNA at the mismatch. We found additional MutS–mismatch complexes with distinct conformations that may have functional relevance in MMR. The analysis of individual binding events reveal significant bias in MutS orientation on asymmetric mismatches (G:T versus T:G, A:C versus C:A), but not on symmetric mismatches (G:G). When MutS is blocked from binding a mismatch in the preferred orientation by positioning asymmetric mismatches near the ends of linear DNA substrates, its ability to authorize subsequent steps of MMR, such as MutH endonuclease activation, is almost abolished. These findings shed light on prerequisites for MutS interactions with other MMR proteins for repairing the appropriate DNA strand. PMID:22367846

Multi-spectroscopic and molecular docking studies on the interaction of darunavir, a HIV protease inhibitor with calf thymus DNA

NASA Astrophysics Data System (ADS)

Shi, Jie-Hua; Zhou, Kai-Li; Lou, Yan-Yue; Pan, Dong-Qi

2018-03-01

Molecular interaction of darunavir (DRV), a HIV protease inhibitor with calf thymus deoxyribonucleic acid (ct-DNA) was studied in physiological buffer (pH 7.4) by multi-spectroscopic approaches hand in hand with viscosity measurements and molecular docking technique. The UV absorption and fluorescence results together revealed the formation of a DRV-ct-DNA complex having binding affinities of the order of 103 M- 1, which was more in keeping with the groove binding. The results that DRV bound to ct-DNA via groove binding mode was further evidenced by KI quenching studies, viscosity measurements, competitive binding investigations with EB and Rhodamine B and CD spectral analysis. The effect of ionic strength indicated the negligible involvement of electrostatic interaction between DRV and ct-DNA. The thermodynamic parameters regarding the binding interaction of DRV with ct-DNA in terms of enthalpy change (ΔH0) and entropy change (ΔS0) were - 63.19 kJ mol- 1 and - 141.92 J mol- 1 K- 1, indicating that hydrogen bonds and van der Waals forces played a predominant role in the binding process. Furthermore, molecular simulation studies suggested that DRV molecule was prone to bind in the A-T rich region of the minor groove of DNA.

Fixed-Gap Tunnel Junction for Reading DNA Nucleotides

PubMed Central

2015-01-01

Previous measurements of the electronic conductance of DNA nucleotides or amino acids have used tunnel junctions in which the gap is mechanically adjusted, such as scanning tunneling microscopes or mechanically controllable break junctions. Fixed-junction devices have, at best, detected the passage of whole DNA molecules without yielding chemical information. Here, we report on a layered tunnel junction in which the tunnel gap is defined by a dielectric layer, deposited by atomic layer deposition. Reactive ion etching is used to drill a hole through the layers so that the tunnel junction can be exposed to molecules in solution. When the metal electrodes are functionalized with recognition molecules that capture DNA nucleotides via hydrogen bonds, the identities of the individual nucleotides are revealed by characteristic features of the fluctuating tunnel current associated with single-molecule binding events. PMID:25380505

Enhancement of the thermoelectric figure of merit in DNA-like systems induced by Fano and Dicke effects.

PubMed

Fu, Hua-Hua; Gu, Lei; Wu, Dan-Dan; Zhang, Zu-Quan

2015-04-28

We report a theoretical study highlighting the thermoelectric properties of biological and synthetic DNA molecules. Based on an effective tight-binding model of duplex DNA and by using the nonequilibrium Green's function technique, the thermal conductance, electrical conductance, Seebeck coefficient and thermoelectric figure of merit in the system are numerically calculated by varying the asymmetries of energies and electronic hoppings in the backbone sites to simulate the environmental complications and fluctuations. We find that due to the multiple transport paths in the DNA molecule, the Fano antiresonance occurs, and enhances the Seebeck coefficient and the figure of merit. When the energy difference is produced in every opposite backbone site, the Dicke effect appears. This effect gives rise to a semiconducting-metallic transition, and enhances the thermoelectric efficiency of the DNA molecule remarkably. Moreover, as the Fano antiresonance point is close to the Dicke resonance one, a giant enhancement in the thermoelectric figure of merit in the DNA molecule has been found. These results provide a scenario to obtain effective routes to enhance the thermoelectric efficiency in the DNA molecules, and suggest perspectives for future experiments intending to control the thermoelectric transport in DNA-like nanodevices.

Dynamic DNA binding licenses a repair factor to bypass roadblocks in search of DNA lesions.

PubMed

Brown, Maxwell W; Kim, Yoori; Williams, Gregory M; Huck, John D; Surtees, Jennifer A; Finkelstein, Ilya J

2016-02-03

DNA-binding proteins search for specific targets via facilitated diffusion along a crowded genome. However, little is known about how crowded DNA modulates facilitated diffusion and target recognition. Here we use DNA curtains and single-molecule fluorescence imaging to investigate how Msh2-Msh3, a eukaryotic mismatch repair complex, navigates on crowded DNA. Msh2-Msh3 hops over nucleosomes and other protein roadblocks, but maintains sufficient contact with DNA to recognize a single lesion. In contrast, Msh2-Msh6 slides without hopping and is largely blocked by protein roadblocks. Remarkably, the Msh3-specific mispair-binding domain (MBD) licences a chimeric Msh2-Msh6(3MBD) to bypass nucleosomes. Our studies contrast how Msh2-Msh3 and Msh2-Msh6 navigate on a crowded genome and suggest how Msh2-Msh3 locates DNA lesions outside of replication-coupled repair. These results also provide insights into how DNA repair factors search for DNA lesions in the context of chromatin.

HARP preferentially co-purifies with RPA bound to DNA-PK and blocks RPA phosphorylation.

PubMed

Quan, Jinhua; Yusufzai, Timur

2014-05-01

The HepA-related protein (HARP/SMARCAL1) is an ATP-dependent annealing helicase that is capable of rewinding DNA structures that are stably unwound due to binding of the single-stranded DNA (ssDNA)-binding protein Replication Protein A (RPA). HARP has been implicated in maintaining genome integrity through its role in DNA replication and repair, two processes that generate RPA-coated ssDNA. In addition, mutations in HARP cause a rare disease known as Schimke immuno-osseous dysplasia. In this study, we purified HARP containing complexes with the goal of identifying the predominant factors that stably associate with HARP. We found that HARP preferentially interacts with RPA molecules that are bound to the DNA-dependent protein kinase (DNA-PK). We also found that RPA is phosphorylated by DNA-PK in vitro, while the RPA-HARP complexes are not. Our results suggest that, in addition to its annealing helicase activity, which eliminates the natural binding substrate for RPA, HARP blocks the phosphorylation of RPA by DNA-PK.

A DNA sequence obtained by replacement of the dopamine RNA aptamer bases is not an aptamer.

PubMed

Álvarez-Martos, Isabel; Ferapontova, Elena E

2017-08-05

A unique specificity of the aptamer-ligand biorecognition and binding facilitates bioanalysis and biosensor development, contributing to discrimination of structurally related molecules, such as dopamine and other catecholamine neurotransmitters. The aptamer sequence capable of specific binding of dopamine is a 57 nucleotides long RNA sequence reported in 1997 (Biochemistry, 1997, 36, 9726). Later, it was suggested that the DNA homologue of the RNA aptamer retains the specificity of dopamine binding (Biochem. Biophys. Res. Commun., 2009, 388, 732). Here, we show that the DNA sequence obtained by the replacement of the RNA aptamer bases for their DNA analogues is not able of specific biorecognition of dopamine, in contrast to the original RNA aptamer sequence. This DNA sequence binds dopamine and structurally related catecholamine neurotransmitters non-specifically, as any DNA sequence, and, thus, is not an aptamer and cannot be used neither for in vivo nor in situ analysis of dopamine in the presence of structurally related neurotransmitters. Copyright © 2017 Elsevier Inc. All rights reserved.

Probing the size of proteins with glass nanopores

NASA Astrophysics Data System (ADS)

Steinbock, L. J.; Krishnan, S.; Bulushev, R. D.; Borgeaud, S.; Blokesch, M.; Feletti, L.; Radenovic, A.

2014-11-01

Single molecule studies using nanopores have gained attention due to the ability to sense single molecules in aqueous solution without the need to label them. In this study, short DNA molecules and proteins were detected with glass nanopores, whose sensitivity was enhanced by electron reshaping which decreased the nanopore diameter and created geometries with a reduced sensing length. Further, proteins having molecular weights (MW) ranging from 12 kDa to 480 kDa were detected, which showed that their corresponding current peak amplitude changes according to their MW. In the case of the 12 kDa ComEA protein, its DNA-binding properties to an 800 bp long DNA molecule was investigated. Moreover, the influence of the pH on the charge of the protein was demonstrated by showing a change in the translocation direction. This work emphasizes the wide spectrum of detectable molecules using nanopores from glass nanocapillaries, which stand out because of their inexpensive, lithography-free, and rapid manufacturing process.Single molecule studies using nanopores have gained attention due to the ability to sense single molecules in aqueous solution without the need to label them. In this study, short DNA molecules and proteins were detected with glass nanopores, whose sensitivity was enhanced by electron reshaping which decreased the nanopore diameter and created geometries with a reduced sensing length. Further, proteins having molecular weights (MW) ranging from 12 kDa to 480 kDa were detected, which showed that their corresponding current peak amplitude changes according to their MW. In the case of the 12 kDa ComEA protein, its DNA-binding properties to an 800 bp long DNA molecule was investigated. Moreover, the influence of the pH on the charge of the protein was demonstrated by showing a change in the translocation direction. This work emphasizes the wide spectrum of detectable molecules using nanopores from glass nanocapillaries, which stand out because of their inexpensive, lithography-free, and rapid manufacturing process. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr05001k

Facilitated dissociation of transcription factors from single DNA binding sites

PubMed Central

Kamar, Ramsey I.; Banigan, Edward J.; Erbas, Aykut; Giuntoli, Rebecca D.; Olvera de la Cruz, Monica; Johnson, Reid C.; Marko, John F.

2017-01-01

The binding of transcription factors (TFs) to DNA controls most aspects of cellular function, making the understanding of their binding kinetics imperative. The standard description of bimolecular interactions posits that TF off rates are independent of TF concentration in solution. However, recent observations have revealed that proteins in solution can accelerate the dissociation of DNA-bound proteins. To study the molecular basis of facilitated dissociation (FD), we have used single-molecule imaging to measure dissociation kinetics of Fis, a key Escherichia coli TF and major bacterial nucleoid protein, from single dsDNA binding sites. We observe a strong FD effect characterized by an exchange rate ∼1×104 M−1s−1, establishing that FD of Fis occurs at the single-binding site level, and we find that the off rate saturates at large Fis concentrations in solution. Although spontaneous (i.e., competitor-free) dissociation shows a strong salt dependence, we find that FD depends only weakly on salt. These results are quantitatively explained by a model in which partially dissociated bound proteins are susceptible to invasion by competitor proteins in solution. We also report FD of NHP6A, a yeast TF with structure that differs significantly from Fis. We further perform molecular dynamics simulations, which indicate that FD can occur for molecules that interact far more weakly than those that we have studied. Taken together, our results indicate that FD is a general mechanism assisting in the local removal of TFs from their binding sites and does not necessarily require cooperativity, clustering, or binding site overlap. PMID:28364020

Acemannan increases NF-κB/DNA binding and IL-6/-8 expression by selectively binding Toll-like receptor-5 in human gingival fibroblasts.

PubMed

Thunyakitpisal, Pasutha; Ruangpornvisuti, Vithaya; Kengkwasing, Pattrawadee; Chokboribal, Jaroenporn; Sangvanich, Polkit

2017-04-01

Acemannan, an acetylated polymannose from Aloe vera, has immunomodulatory effects. We investigated whether acemannan induces IL-6 and -8 expression and NF-κB/DNA binding in human gingival fibroblasts. IL-6 and -8 expression levels were assessed via RT-PCR and ELISA. The NF-κB p50/p65-DNA binding was determined. The structures of acemannan mono-pentamers and Toll-like receptor 5 (TLR5) were simulated. The binding energies between acemannan and TLR5 were identified. We found that acemannan significantly stimulated IL-6/-8 expression at both the mRNA and protein level and significantly increased p50/DNA binding. Preincubation with an anti-TLR5 neutralizing antibody abolished acemannan-induced IL-6/-8 expression and p50/DNA binding, and co-incubation of acemannan with Bay11-7082, a specific NF- κB inhibitor, abolished IL-6/-8 expression. The computer modeling indicated that monomeric/dimeric single stranded acemannan molecules interacted with the TLR5 flagellin recognition sites with a high binding affinity. We conclude that acemannan induces IL-6/-8 expression, and p50/DNA binding in gingival fibroblasts, at least partly, via a TLR5/NF-κB-dependent signaling pathway. Furthermore, acemannan selectively binds with TLR5 ectodomain flagellin recognition sites. Copyright © 2017 Elsevier Ltd. All rights reserved.

Rupture of DNA aptamer: New insights from simulations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mishra, Rakesh Kumar; Nath, Shesh; Kumar, Sanjay

2015-10-28

Base-pockets (non-complementary base-pairs) in a double-stranded DNA play a crucial role in biological processes. Because of thermal fluctuations, it can lower the stability of DNA, whereas, in case of DNA aptamer, small molecules, e.g., adenosinemonophosphate and adenosinetriphosphate, form additional hydrogen bonds with base-pockets termed as “binding-pockets,” which enhance the stability. Using the Langevin dynamics simulations of coarse grained model of DNA followed by atomistic simulations, we investigated the influence of base-pocket and binding-pocket on the stability of DNA aptamer. Striking differences have been reported here for the separation induced by temperature and force, which require further investigation by single moleculemore » experiments.« less

Modification-dependent restriction endonuclease, MspJI, flips 5-methylcytosine out of the DNA helix

DOE PAGES

Horton, J. R.; Wang, H.; Mabuchi, M. Y.; ...

2014-09-27

MspJI belongs to a family of restriction enzymes that cleave DNA containing 5-methylcytosine (5mC) or 5-hydroxymethylcytosine (5hmC). MspJI is specific for the sequence 5(h)mC-N-N-G or A and cleaves with some variability 9/13 nucleotides downstream. Earlier, we reported the crystal structure of MspJI without DNA and proposed how it might recognize this sequence and catalyze cleavage. Here we report its co-crystal structure with a 27-base pair oligonucleotide containing 5mC. This structure confirms that MspJI acts as a homotetramer and that the modified cytosine is flipped from the DNA helix into an SRA-like-binding pocket. We expected the structure to reveal two DNAmore » molecules bound specifically to the tetramer and engaged with the enzyme's two DNA-cleavage sites. A coincidence of crystal packing precluded this organization, however. We found that each DNA molecule interacted with two adjacent tetramers, binding one specifically and the other non-specifically. The latter interaction, which prevented cleavage-site engagement, also involved base flipping and might represent the sequence-interrogation phase that precedes specific recognition. MspJI is unusual in that DNA molecules are recognized and cleaved by different subunits. Such interchange of function might explain how other complex multimeric restriction enzymes act.« less

Spectroscopic and microcalorimetric studies on the molecular binding of food colorant acid red 27 with deoxyribonucleic acid.

PubMed

Basu, Anirban; Kumar, Gopinatha Suresh

2016-08-01

Interaction of the food colorant acid red 27 with double stranded DNA was investigated using spectroscopic and calorimetric methods. Absorbance and fluorescence studies suggested an intimate binding interaction between the dye and DNA. The quantum efficiency value testified an effective energy transfer from the DNA base pairs to the dye molecules. Minor groove displacement assay with Hoechst 33258 revealed that the binding occurs in the minor groove of DNA. Circular dichroism studies revealed that acid red 27 induces moderate conformational perturbations in DNA. Results of calorimetric studies suggested that the complexation process was driven largely by positive entropic contribution with a smaller favorable enthalpy contribution. The equilibrium constant of the binding was calculated to be (3.04 ± 0.09) × 10(4)  M(-1) at 298.15 K. Negative heat capacity value along with the enthalpy-entropy compensation phenomenon established the involvement of dominant hydrophobic forces in the binding process. Differential scanning calorimetry studies presented evidence for an increased thermal stability of DNA on binding of acid red 27. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

Conformation of nanoconfined DNA as a function of ATP, AMP, CTP, Mg2+, and dye binding

NASA Astrophysics Data System (ADS)

Roushan, Maedeh; Riehn, Robert

2014-03-01

DNA molecules stretch in nanochannels with a channel cross-section of 100x100 nm2, thereby allowing analysis by observation of a fluorescent dye. The length and configuration of DNA can be directly observed, and the effect of different DNA-binding proteins on DNA configuration can be studied. Recently, we reported on the ability of T4 ligase to transiently manipulate DNA as a function of ATP and magnesium exposure. In this process we have extensively probed the interactions of dyes and enzyme co-factors with DNA under nanoconfinement. We find negligible effects if DNA is visualized using groove-binding dyes such as DAPI. However, if an intercalating dye (YOYO-1) is used, we find a significant shortening of the DNA in the presence of ATP that we attribute to an interaction of dye and ATP (as well as AMP and CTP). We did not record a noticeable effect due to Mg2+.

Study of intermolecular contacts in the proline-rich homeodomain (PRH)-DNA complex using molecular dynamics simulations.

PubMed

Jalili, Seifollah; Karami, Leila

2012-03-01

The proline-rich homeodomain (PRH)-DNA complex consists of a protein with 60 residues and a 13-base-pair DNA. The PRH protein is a transcription factor that plays a key role in the regulation of gene expression. PRH is a significant member of the Q50 class of homeodomain proteins. The homeodomain section of PRH is essential for binding to DNA and mediates sequence-specific DNA binding. Three 20-ns molecular dynamics (MD) simulations (free protein, free DNA and protein-DNA complex) in explicit solvent water were performed to elucidate the intermolecular contacts in the PRH-DNA complex and the role of dynamics of water molecules forming water-mediated contacts. The simulation provides a detailed explanation of the trajectory of hydration water molecules. The simulations show that some water molecules in the protein-DNA interface exchange with bulk waters. The simulation identifies that most of the contacts consisted of direct interactions between the protein and DNA including specific and non-specific contacts, but several water-mediated polar contacts were also observed. The specific interaction between Gln50 and C18 and water-mediated hydrogen bond between Gln50 and T7 were found to be present during almost the entire time of the simulation. These results show good consistency with experimental and previous computational studies. Structural properties such as root-mean-square deviations (RMSD), root-mean-square fluctuations (RMSF) and secondary structure were also analyzed as a function of time. Analyses of the trajectories showed that the dynamic fluctuations of both the protein and the DNA were lowered by the complex formation.

Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus.

PubMed

Duan, Nuo; Wu, Shijia; Chen, Xiujuan; Huang, Yukun; Wang, Zhouping

2012-04-25

A whole-bacterium systemic evolution of ligands by exponential enrichment (SELEX) method was applied to a combinatorial library of FAM-labeled single-stranded DNA molecules to identify DNA aptamers demonstrating specific binding to Vibrio parahemolyticus . FAM-labeled aptamer sequences with high binding affinity to V. parahemolyticus were identified by flow cytometric analysis. Aptamer A3P, which showed a particularly high binding affinity in preliminary studies, was chosen for further characterization. This aptamer displayed a dissociation constant (K(d)) of 16.88 ± 1.92 nM. Binding assays to assess the specificity of aptamer A3P showed a high binding affinity (76%) for V. parahemolyticus and a low apparent binding affinity (4%) for other bacteria. Whole-bacterium SELEX is a promising technique for the design of aptamer-based molecular probes for microbial pathogens that does not require the labor-intensive steps of isolating and purifying complex markers or targets.

DNA sequences, recombinant DNA molecules and processes for producing the A and B subunits of cholera toxin and preparations containing so-obtained subunit or subunits

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harford, N.; De Wilde, M.

1987-05-19

A recombinant DNA molecule is described comprising at least a portion coding for subunits A and B of cholera toxin, or a fragment or derivative of the portion wherein the fragment or derivative codes for a polypeptide have an activity which can induce an immune response to subunit A; can induce an immune response to subunit A and cause epithelial cell penetration and the enzymatic effect leading to net loss of fluid into the gut lumen; can bind to the membrane receptor for the B subunit of cholera toxin; can induce an immune response to subunit B; can induce anmore » immune response to subunit B and bind to the membrane receptor; or has a combination of the activities.« less

Molecular mechanisms by which oxidative DNA damage promotes telomerase activity.

PubMed

Lee, Hui-Ting; Bose, Arindam; Lee, Chun-Ying; Opresko, Patricia L; Myong, Sua

2017-11-16

Telomeres are highly susceptible to oxidative DNA damage, which if left unrepaired can lead to dysregulation of telomere length homeostasis. Here we employed single molecule FRET, single molecule pull-down and biochemical analysis to investigate how the most common oxidative DNA lesions, 8-oxoguanine (8oxoG) and thymine glycol (Tg), regulate the structural properties of telomeric DNA and telomerase extension activity. In contrast to 8oxoG which disrupts the telomeric DNA structure, Tg exhibits substantially reduced perturbation of G-quadruplex folding. As a result, 8oxoG induces high accessibility, whereas Tg retains limited accessibility, of telomeric G-quadruplex DNA to complementary single stranded DNA and to telomere binding protein POT1. Surprisingly, the Tg lesion stimulates telomerase loading and activity to a similar degree as an 8oxoG lesion. We demonstrate that this unexpected stimulation arises from Tg-induced conformational alterations and dynamics in telomeric DNA. Despite impacting structure by different mechanisms, both 8oxoG and Tg enhance telomerase binding and extension activity to the same degree, potentially contributing to oncogenesis. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Computational design of co-assembling protein-DNA nanowires

NASA Astrophysics Data System (ADS)

Mou, Yun; Yu, Jiun-Yann; Wannier, Timothy M.; Guo, Chin-Lin; Mayo, Stephen L.

2015-09-01

Biomolecular self-assemblies are of great interest to nanotechnologists because of their functional versatility and their biocompatibility. Over the past decade, sophisticated single-component nanostructures composed exclusively of nucleic acids, peptides and proteins have been reported, and these nanostructures have been used in a wide range of applications, from drug delivery to molecular computing. Despite these successes, the development of hybrid co-assemblies of nucleic acids and proteins has remained elusive. Here we use computational protein design to create a protein-DNA co-assembling nanomaterial whose assembly is driven via non-covalent interactions. To achieve this, a homodimerization interface is engineered onto the Drosophila Engrailed homeodomain (ENH), allowing the dimerized protein complex to bind to two double-stranded DNA (dsDNA) molecules. By varying the arrangement of protein-binding sites on the dsDNA, an irregular bulk nanoparticle or a nanowire with single-molecule width can be spontaneously formed by mixing the protein and dsDNA building blocks. We characterize the protein-DNA nanowire using fluorescence microscopy, atomic force microscopy and X-ray crystallography, confirming that the nanowire is formed via the proposed mechanism. This work lays the foundation for the development of new classes of protein-DNA hybrid materials. Further applications can be explored by incorporating DNA origami, DNA aptamers and/or peptide epitopes into the protein-DNA framework presented here.

Determination of adsorption and desorption of DNA molecules on freshwater and marine sediments.

PubMed

Xue, J; Feng, Y

2018-06-01

Free DNA and its adsorption by sediment in the aquatic environment lead to ambiguity in the identification of recent faecal pollution sources. The goal of this study was to understand the mechanisms of DNA adsorption and desorption on aquatic sediment under various conditions using quantitative polymerase chain reaction (qPCR). Both raw sewage (RS) DNA and purified PCR product (PPP) were used in adsorption and desorption experiments; autoclaved freshwater and marine sediments served as sorbents. Thirty-six hours were needed for adsorption to reach equilibrium. More DNA was adsorbed on both sediments in stream water than in 5 mmol l -1 NaCl and DNA adsorption increased in the presence of Ca 2+ and Mg 2+ . Successive desorption experiments showed that between 5% and 22% of adsorbed DNA was desorbed. Organic matter and clay played a significant role in determining the DNA adsorption capacity on sediment. The data suggest the presence of multilayer adsorption. DNA molecules on sediments were mostly adsorbed through ligand binding rather than electrostatic binding. Quantitative polymerase chain reaction assays provide a better way to investigate the DNA adsorption and desorption mechanisms by sediment. DNA desorption can potentially complicate the outcomes of microbial source tracking studies. © 2018 The Society for Applied Microbiology.

Changes in the zero-point energy of the protons as the source of the binding energy of water to A-phase DNA.

PubMed

Reiter, G F; Senesi, R; Mayers, J

2010-10-01

The measured changes in the zero-point kinetic energy of the protons are entirely responsible for the binding energy of water molecules to A phase DNA at the concentration of 6  water molecules/base pair. The changes in kinetic energy can be expected to be a significant contribution to the energy balance in intracellular biological processes and the properties of nano-confined water. The shape of the momentum distribution in the dehydrated A phase is consistent with coherent delocalization of some of the protons in a double well potential, with a separation of the wells of 0.2 Å.

A new cationic porphyrin derivative (TMPipEOPP) with large side arm substituents: a highly selective G-quadruplex optical probe.

PubMed

Zhu, Li-Na; Zhao, Shu-Juan; Wu, Bin; Li, Xiao-Zeng; Kong, De-Ming

2012-01-01

The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA) sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl)-21H,23H-porphyrin (TMPyP4), interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinyl)ethoxy]phenyl} porphyrin (TMPipEOPP), with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.

Single-Molecule Methods for Nucleotide Excision Repair: Building a System to Watch Repair in Real Time.

PubMed

Kong, Muwen; Beckwitt, Emily C; Springall, Luke; Kad, Neil M; Van Houten, Bennett

2017-01-01

Single-molecule approaches to solving biophysical problems are powerful tools that allow static and dynamic real-time observations of specific molecular interactions of interest in the absence of ensemble-averaging effects. Here, we provide detailed protocols for building an experimental system that employs atomic force microscopy and a single-molecule DNA tightrope assay based on oblique angle illumination fluorescence microscopy. Together with approaches for engineering site-specific lesions into DNA substrates, these complementary biophysical techniques are well suited for investigating protein-DNA interactions that involve target-specific DNA-binding proteins, such as those engaged in a variety of DNA repair pathways. In this chapter, we demonstrate the utility of the platform by applying these techniques in the studies of proteins participating in nucleotide excision repair. © 2017 Elsevier Inc. All rights reserved.

Biosensing via light scattering from plasmonic core-shell nanospheres coated with DNA molecules

NASA Astrophysics Data System (ADS)

Xie, Huai-Yi; Chen, Minfeng; Chang, Yia-Chung; Moirangthem, Rakesh Singh

2017-05-01

We present both experimental and theoretical studies for investigating DNA molecules attached on metallic nanospheres. We have developed an efficient and accurate numerical method to investigate light scattering from plasmonic nanospheres on a substrate covered by a shell, based on the Green's function approach with suitable spherical harmonic basis. Next, we use this method to study optical scattering from DNA molecules attached to metallic nanoparticles placed on a substrate and compare with experimental results. We obtain fairly good agreement between theoretical predictions and the measured ellipsometric spectra. The metallic nanoparticles were used to detect the binding with DNA molecules in a microfluidic setup via spectroscopic ellipsometry (SE), and a detectable change in ellipsometric spectra was found when DNA molecules are captured on Au nanoparticles. Our theoretical simulation indicates that the coverage of Au nanosphere by a submonolayer of DNA molecules, which is modeled by a thin layer of dielectric material (which may absorb light), can lead to a small but detectable spectroscopic shift in both the Ψ and Δ spectra with more significant change in Δ spectra in agreement with experimental results. Our studies demonstrated the ultrasensitive capability of SE for sensing submonolayer coverage of DNA molecules on Au nanospheres. Hence the spectroscopic ellipsometric measurements coupled with theoretical analysis via an efficient computation method can be an effective tool for detecting DNA molecules attached on Au nanoparticles, thus achieving label-free, non-destructive, and high-sensitivity biosensing with nanoscale resolution.

Inhibition of HMGA2 binding to DNA by netropsin

PubMed Central

Miao, Yi; Cui, Tengjiao; Leng, Fenfei; Wilson, W. David

2008-01-01

The design of small synthetic molecules that can be used to affect gene expression is an area of active interest for development of agents in therapeutic and biotechnology applications. Many compounds that target the minor groove in AT sequences in DNA are well characterized and are promising reagents for use as modulators of protein-DNA complexes. The mammalian high mobility group transcriptional factor, HMGA2, also targets the DNA minor groove and plays critical roles in disease processes from cancer to obesity. Biosensor-surface plasmon resonance methods were used to monitor HMGA2 binding to target sites on immobilized DNA and a competition assay for inhibition of the HMGA2-DNA complex was designed. HMGA2 binds strongly to the DNA through AT hook domains with KD values of 20 - 30 nM depending on the DNA sequence. The well-characterized minor groove binder, netropsin, was used to develop and test the assay. The compound has two binding sites in the protein-DNA interaction sequence and this provides an advantage for inhibition. An equation for analysis of results when the inhibitor has two binding sites in the biopolymer recognition surface is presented with the results. The assay provides a platform for discovery of HMGA2 inhibitors. PMID:18023407

Simple horizontal magnetic tweezers for micromanipulation of single DNA molecules and DNA–protein complexes

PubMed Central

McAndrew, Christopher P.; Tyson, Christopher; Zischkau, Joseph; Mehl, Patrick; Tuma, Pamela L.; Pegg, Ian L.; Sarkar, Abhijit

2016-01-01

We report the development of a simple-to-implement magnetic force transducer that can apply a wide range of piconewton (pN) scale forces on single DNA molecules and DNA–protein complexes in the horizontal plane. The resulting low-noise force-extension data enable very high-resolution detection of changes in the DNA tether’s extension: ~0.05 pN in force and <10 nm change in extension. We have also verified that we can manipulate DNA in near equilibrium conditions through the wide range of forces by ramping the force from low to high and back again, and observing minimal hysteresis in the molecule’s force response. Using a calibration technique based on Stokes’ drag law, we have confirmed our force measurements from DNA force-extension experiments obtained using the fluctuation-dissipation theorem applied to transverse fluctuations of the magnetic microsphere. We present data on the force-distance characteristics of a DNA molecule complexed with histones. The results illustrate how the tweezers can be used to study DNA binding proteins at the single molecule level. PMID:26757808

Self-Assembled Multivalent (SAMul) Polyanion Binding-Impact of Hydrophobic Modifications in the Micellar Core on DNA and Heparin Binding at the Peripheral Cationic Ligands.

PubMed

Albanyan, Buthaina; Laurini, Erik; Posocco, Paola; Pricl, Sabrina; Smith, David K

2017-05-05

This paper reports a small family of cationic surfactants designed to bind polyanions such as DNA and heparin. Each molecule has the same hydrophilic cationic ligand and a hydrophobic aliphatic group with eighteen carbon atoms with one, two, or three alkene groups within the hydrophobic chain (C18-1, C18-2 and C18-3). Dynamic light scattering indicates that more alkenes lead to geometric distortion, giving rise to larger self-assembled multivalent (SAMul) nanostructures. Mallard Blue and Ethidium Bromide dye displacement assays demonstrate that heparin and DNA have markedly different binding preferences, with heparin binding most effectively to C18-1, and DNA to C18-3, even though the molecular structural differences of these SAMul systems are buried in the hydrophobic core. Multiscale modelling suggests that adaptive heparin maximises enthalpically favourable interactions with C18-1, while shape-persistent DNA forms a similar number of interactions with each ligand display, but with slightly less entropic cost for binding to C18-3-fundamental thermodynamic differences in SAMul binding of heparin or DNA. This study therefore provides unique insight into electrostatic molecular recognition between highly charged nanoscale surfaces in biologically relevant systems. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Discovery and characterization of small molecules targeting the DNA-binding ETS domain of ERG in prostate cancer

PubMed Central

Kim, Ari; Yen, Paul; Mroczek, Marta; Nouri, Mannan; Lien, Scott; Axerio-Cilies, Peter; Dalal, Kush; Yau, Clement; Ghaidi, Fariba; Guo, Yubin; Yamazaki, Takeshi; Lawn, Sam; Gleave, Martin E.; Gregory-Evans, Cheryl Y.

2017-01-01

Genomic alterations involving translocations of the ETS-related gene ERG occur in approximately half of prostate cancer cases. These alterations result in aberrant, androgen-regulated production of ERG protein variants that directly contribute to disease development and progression. This study describes the discovery and characterization of a new class of small molecule ERG antagonists identified through rational in silico methods. These antagonists are designed to sterically block DNA binding by the ETS domain of ERG and thereby disrupt transcriptional activity. We confirmed the direct binding of a lead compound, VPC-18005, with the ERG-ETS domain using biophysical approaches. We then demonstrated VPC-18005 reduced migration and invasion rates of ERG expressing prostate cancer cells, and reduced metastasis in a zebrafish xenograft model. These results demonstrate proof-of-principal that small molecule targeting of the ERG-ETS domain can suppress transcriptional activity and reverse transformed characteristics of prostate cancers aberrantly expressing ERG. Clinical advancement of the developed small molecule inhibitors may provide new therapeutic agents for use as alternatives to, or in combination with, current therapies for men with ERG-expressing metastatic castration-resistant prostate cancer. PMID:28465491

Combining H/D exchange mass spectroscopy and computational docking reveals extended DNA-binding surface on uracil-DNA glycosylase

PubMed Central

Roberts, Victoria A.; Pique, Michael E.; Hsu, Simon; Li, Sheng; Slupphaug, Geir; Rambo, Robert P.; Jamison, Jonathan W.; Liu, Tong; Lee, Jun H.; Tainer, John A.; Ten Eyck, Lynn F.; Woods, Virgil L.

2012-01-01

X-ray crystallography provides excellent structural data on protein–DNA interfaces, but crystallographic complexes typically contain only small fragments of large DNA molecules. We present a new approach that can use longer DNA substrates and reveal new protein–DNA interactions even in extensively studied systems. Our approach combines rigid-body computational docking with hydrogen/deuterium exchange mass spectrometry (DXMS). DXMS identifies solvent-exposed protein surfaces; docking is used to create a 3-dimensional model of the protein–DNA interaction. We investigated the enzyme uracil-DNA glycosylase (UNG), which detects and cleaves uracil from DNA. UNG was incubated with a 30 bp DNA fragment containing a single uracil, giving the complex with the abasic DNA product. Compared with free UNG, the UNG–DNA complex showed increased solvent protection at the UNG active site and at two regions outside the active site: residues 210–220 and 251–264. Computational docking also identified these two DNA-binding surfaces, but neither shows DNA contact in UNG–DNA crystallographic structures. Our results can be explained by separation of the two DNA strands on one side of the active site. These non-sequence-specific DNA-binding surfaces may aid local uracil search, contribute to binding the abasic DNA product and help present the DNA product to APE-1, the next enzyme on the DNA-repair pathway. PMID:22492624

Illegitimate recombination mediated by calf thymus DNA topoisomerase II in vitro.

PubMed Central

Bae, Y S; Kawasaki, I; Ikeda, H; Liu, L F

1988-01-01

We have found that purified calf thymus DNA topoisomerase II mediates recombination between two phage lambda DNA molecules in an in vitro system. The enzyme mainly produced a linear monomer recombinant DNA that can be packaged in vitro. Novobiocin and anti-calf thymus DNA topoisomerase II antibody inhibit this ATP-dependent recombination. The recombinant molecules contain duplications or deletions, and most crossovers take place between nonhomologous sequences of lambda DNA, as judged by the sequences of recombination junctions. Therefore, the recombination mediated by the calf thymus DNA topoisomerase II is an illegitimate recombination that is similar to recombination mediated by Escherichia coli DNA gyrase or phage T4 DNA topoisomerase. The subunit exchange model, which has been suggested for the DNA gyrase-mediated recombination, is now generalized as follows: DNA topoisomerase II molecules bind to DNAs, associate with each other, and lead to the exchange of DNA strands through the exchange of topoisomerase II subunits. Illegitimate recombination might be carried out by a general mechanism in organisms ranging from prokaryotes to higher eukaryotes. Images PMID:2832845

Insights into finding a mismatch through the structure of a mispaired DNA bound by a rhodium intercalator

PubMed Central

Pierre, Valérie C.; Kaiser, Jens T.; Barton, Jacqueline K.

2007-01-01

We report the 1.1-Å resolution crystal structure of a bulky rhodium complex bound to two different DNA sites, mismatched and matched in the oligonucleotide 5′-(dCGGAAATTCCCG)2-3′. At the AC mismatch site, the structure reveals ligand insertion from the minor groove with ejection of both mismatched bases and elucidates how destabilized mispairs in DNA may be recognized. This unique binding mode contrasts with major groove intercalation, observed at a matched site, where doubling of the base pair rise accommodates stacking of the intercalator. Mass spectral analysis reveals different photocleavage products associated with the two binding modes in the crystal, with only products characteristic of mismatch binding in solution. This structure, illustrating two clearly distinct binding modes for a molecule with DNA, provides a rationale for the interrogation and detection of mismatches. PMID:17194756

Fluorescence correlation spectroscopy study of the complexation of DNA hybrids, IgG antibody, and a chimeric protein of IgG-binding ZZ domains fused with a carbohydrate binding module.

PubMed

Rosa, A M M; Prazeres, D M F; Paulo, P M R

2017-06-28

Fluorescence correlation spectroscopy (FCS) was used to characterize the molecular interactions between the four components of a DNA recognition system. A fluorescent DNA probe was used to assess: (i) the hybridization with a complementary biotin-labeled target, (ii) the complexation of the resulting hybrid and an anti-biotin antibody, and (iii) the binding of the latter complex to a ZZ-CBM fusion protein that combines small synthetic IgG Fc-binding Z domains with a carbohydrate binding module (CBM). These binding interactions were monitored by exposing the fluorescent DNA probe to different amounts and combinations of the other molecules in solution. Through the analysis of FCS autocorrelation curves, an association constant (K a ) of 2.9 × 10 7 M -1 was estimated for DNA·DNA hybridization, and the presence of (non-) complementary target DNA in solution could be discriminated. The specific capture of biotinylated DNA hybrids by anti-biotin IgG was verified, with an apparent K a of 2.5 × 10 6 M -1 . The increment in the diffusion time measured when the DNA·DNA:antibody complexes were in contact with the ZZ-CBM fusion protein suggested that the binding occurs at a stoichiometric ratio of DNA/antibody complex to fusion larger than 1 : 1. The FCS-derived information obtained is useful to gain insight into molecular interactions involved in diagnostic assays.

A ruthenium dimer complex with a flexible linker slowly threads between DNA bases in two distinct steps.

PubMed

Bahira, Meriem; McCauley, Micah J; Almaqwashi, Ali A; Lincoln, Per; Westerlund, Fredrik; Rouzina, Ioulia; Williams, Mark C

2015-10-15

Several multi-component DNA intercalating small molecules have been designed around ruthenium-based intercalating monomers to optimize DNA binding properties for therapeutic use. Here we probe the DNA binding ligand [μ-C4(cpdppz)2(phen)4Ru2](4+), which consists of two Ru(phen)2dppz(2+) moieties joined by a flexible linker. To quantify ligand binding, double-stranded DNA is stretched with optical tweezers and exposed to ligand under constant applied force. In contrast to other bis-intercalators, we find that ligand association is described by a two-step process, which consists of fast bimolecular intercalation of the first dppz moiety followed by ∼10-fold slower intercalation of the second dppz moiety. The second step is rate-limited by the requirement for a DNA-ligand conformational change that allows the flexible linker to pass through the DNA duplex. Based on our measured force-dependent binding rates and ligand-induced DNA elongation measurements, we are able to map out the energy landscape and structural dynamics for both ligand binding steps. In addition, we find that at zero force the overall binding process involves fast association (∼10 s), slow dissociation (∼300 s), and very high affinity (Kd ∼10 nM). The methodology developed in this work will be useful for studying the mechanism of DNA binding by other multi-step intercalating ligands and proteins. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Hybrid Methods Reveal Multiple Flexibly Linked DNA Polymerases within the Bacteriophage T7 Replisome

DOE PAGES

Wallen, Jamie R.; Zhang, Hao; Weis, Caroline; ...

2017-01-03

The physical organization of DNA enzymes at a replication fork enables efficient copying of two antiparallel DNA strands, yet dynamic protein interactions within the replication complex complicate replisome structural studies. We employed a combination of crystallographic, native mass spectrometry and small-angle X-ray scattering experiments to capture alternative structures of a model replication system encoded by bacteriophage T7. then, the two molecules of DNA polymerase bind the ring-shaped primase-helicase in a conserved orientation and provide structural insight into how the acidic C-terminal tail of the primase-helicase contacts the DNA polymerase to facilitate loading of the polymerase onto DNA. A third DNA polymerasemore » binds the ring in an offset manner that may enable polymerase exchange during replication. Alternative polymerase binding modes are also detected by small-angle X-ray scattering with DNA substrates present. The collective results unveil complex motions within T7 replisome higher-order structures that are underpinned by multivalent protein-protein interactions with functional implications.« less

Hybrid Methods Reveal Multiple Flexibly Linked DNA Polymerases within the Bacteriophage T7 Replisome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wallen, Jamie R.; Zhang, Hao; Weis, Caroline

The physical organization of DNA enzymes at a replication fork enables efficient copying of two antiparallel DNA strands, yet dynamic protein interactions within the replication complex complicate replisome structural studies. We employed a combination of crystallographic, native mass spectrometry and small-angle X-ray scattering experiments to capture alternative structures of a model replication system encoded by bacteriophage T7. then, the two molecules of DNA polymerase bind the ring-shaped primase-helicase in a conserved orientation and provide structural insight into how the acidic C-terminal tail of the primase-helicase contacts the DNA polymerase to facilitate loading of the polymerase onto DNA. A third DNA polymerasemore » binds the ring in an offset manner that may enable polymerase exchange during replication. Alternative polymerase binding modes are also detected by small-angle X-ray scattering with DNA substrates present. The collective results unveil complex motions within T7 replisome higher-order structures that are underpinned by multivalent protein-protein interactions with functional implications.« less

Single molecule tracking of Ace1p in Saccharomyces cerevisiae defines a characteristic residence time for non-specific interactions of transcription factors with chromatin.

PubMed

Ball, David A; Mehta, Gunjan D; Salomon-Kent, Ronit; Mazza, Davide; Morisaki, Tatsuya; Mueller, Florian; McNally, James G; Karpova, Tatiana S

2016-12-01

In vivo single molecule tracking has recently developed into a powerful technique for measuring and understanding the transient interactions of transcription factors (TF) with their chromatin response elements. However, this method still lacks a solid foundation for distinguishing between specific and non-specific interactions. To address this issue, we took advantage of the power of molecular genetics of yeast. Yeast TF Ace1p has only five specific sites in the genome and thus serves as a benchmark to distinguish specific from non-specific binding. Here, we show that the estimated residence time of the short-residence molecules is essentially the same for Hht1p, Ace1p and Hsf1p, equaling 0.12-0.32 s. These three DNA-binding proteins are very different in their structure, function and intracellular concentration. This suggests that (i) short-residence molecules are bound to DNA non-specifically, and (ii) that non-specific binding shares common characteristics between vastly different DNA-bound proteins and thus may have a common underlying mechanism. We develop new and robust procedure for evaluation of adverse effects of labeling, and new quantitative analysis procedures that significantly improve residence time measurements by accounting for fluorophore blinking. Our results provide a framework for the reliable performance and analysis of single molecule TF experiments in yeast. Published by Oxford University Press on behalf of Nucleic Acids Research 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.

Organization of inorganic nanomaterials via programmable DNA self-assembly and peptide molecular recognition.

PubMed

Carter, Joshua D; LaBean, Thomas H

2011-03-22

An interesting alternative to top-down nanofabrication is to imitate biology, where nanoscale materials frequently integrate organic molecules for self-assembly and molecular recognition with ordered, inorganic minerals to achieve mechanical, sensory, or other advantageous functions. Using biological systems as inspiration, researchers have sought to mimic the nanoscale composite materials produced in nature. Here, we describe a combination of self-assembly, molecular recognition, and templating, relying on an oligonucleotide covalently conjugated to a high-affinity gold-binding peptide. After integration of the peptide-coupled DNA into a self-assembling superstructure, the templated peptides recognize and bind gold nanoparticles. In addition to providing new ways of building functional multinanoparticle systems, this work provides experimental proof that a single peptide molecule is sufficient for immobilization of a nanoparticle. This molecular construction strategy, combining DNA assembly and peptide recognition, can be thought of as programmable, granular, artificial biomineralization. We also describe the important observation that the addition of 1-2% Tween 20 surfactant to the solution during gold particle binding allows the gold nanoparticles to remain soluble within the magnesium-containing DNA assembly buffer under conditions that usually lead to the aggregation and precipitation of the nanoparticles.

Conformational changes of the phenyl and naphthyl isocyanate-DNA adducts during DNA replication and by minor groove binding molecules

PubMed Central

Nakano, Shu-ichi; Uotani, Yuuki; Sato, Yuichi; Oka, Hirohito; Fujii, Masayuki; Sugimoto, Naoki

2013-01-01

DNA lesions produced by aromatic isocyanates have an extra bulky group on the nucleotide bases, with the capability of forming stacking interaction within a DNA helix. In this work, we investigated the conformation of the 2′-deoxyadenosine and 2′-deoxycytidine derivatives tethering a phenyl or naphthyl group, introduced in a DNA duplex. The chemical modification experiments using KMnO4 and 1-cyclohexyl-3 -(2-morpholinoethyl) carbodiimide metho-p-toluenesulfonate have shown that the 2′-deoxycytidine lesions form the base pair with guanine while the 2′-deoxyadenosine lesions have less ability of forming the base pair with thymine in solution. Nevertheless, the kinetic analysis shows that these DNA lesions are compatible with DNA ligase and DNA polymerase reactions, as much as natural DNA bases. We suggest that the adduct lesions have a capability of adopting dual conformations, depending on the difference in their interaction energies between stacking of the attached aromatic group and base pairing through hydrogen bonds. It is also presented that the attached aromatic groups change their orientation by interacting with the minor groove binding netropsin, distamycin and synthetic polyamide. The nucleotide derivatives would be useful for enhancing the phenotypic diversity of DNA molecules and for exploring new non-natural nucleotides. PMID:23873956

Identification of small molecules capable of regulating conformational changes of telomeric G-quadruplex

NASA Astrophysics Data System (ADS)

Chen, Shuo-Bin; Liu, Guo-Cai; Gu, Lian-Quan; Huang, Zhi-Shu; Tan, Jia-Heng

2018-02-01

Design of small molecules targeted at human telomeric G-quadruplex DNA is an extremely active research area. Interestingly, the telomeric G-quadruplex is a highly polymorphic structure. Changes in its conformation upon small molecule binding may be a powerful method to achieve a desired biological effect. However, the rational development of small molecules capable of regulating conformational change of telomeric G-quadruplex structures is still challenging. In this study, we developed a reliable ligand-based pharmacophore model based on isaindigotone derivatives with conformational change activity toward telomeric G-quadruplex DNA. Furthermore, virtual screening of database was conducted using this pharmacophore model and benzopyranopyrimidine derivatives in the database were identified as a strong inducer of the telomeric G-quadruplex DNA conformation, transforming it from hybrid-type structure to parallel structure.

A crystal structure of the bifunctional antibiotic simocyclinone D8, bound to DNA gyrase.

PubMed

Edwards, Marcus J; Flatman, Ruth H; Mitchenall, Lesley A; Stevenson, Clare E M; Le, Tung B K; Clarke, Thomas A; McKay, Adam R; Fiedler, Hans-Peter; Buttner, Mark J; Lawson, David M; Maxwell, Anthony

2009-12-04

Simocyclinones are bifunctional antibiotics that inhibit bacterial DNA gyrase by preventing DNA binding to the enzyme. We report the crystal structure of the complex formed between the N-terminal domain of the Escherichia coli gyrase A subunit and simocyclinone D8, revealing two binding pockets that separately accommodate the aminocoumarin and polyketide moieties of the antibiotic. These are close to, but distinct from, the quinolone-binding site, consistent with our observations that several mutations in this region confer resistance to both agents. Biochemical studies show that the individual moieties of simocyclinone D8 are comparatively weak inhibitors of gyrase relative to the parent compound, but their combination generates a more potent inhibitor. Our results should facilitate the design of drug molecules that target these unexploited binding pockets.

Molecular traffic jams on DNA.

PubMed

Finkelstein, Ilya J; Greene, Eric C

2013-01-01

All aspects of DNA metabolism-including transcription, replication, and repair-involve motor enzymes that move along genomic DNA. These processes must all take place on chromosomes that are occupied by a large number of other proteins. However, very little is known regarding how nucleic acid motor proteins move along the crowded DNA substrates that are likely to exist in physiological settings. This review summarizes recent progress in understanding how DNA-binding motor proteins respond to the presence of other proteins that lie in their paths. We highlight recent single-molecule biophysical experiments aimed at addressing this question, with an emphasis placed on analyzing the single-molecule, ensemble biochemical, and in vivo data from a mechanistic perspective.

Application of encoded library technology (ELT) to a protein-protein interaction target: discovery of a potent class of integrin lymphocyte function-associated antigen 1 (LFA-1) antagonists.

PubMed

Kollmann, Christopher S; Bai, Xiaopeng; Tsai, Ching-Hsuan; Yang, Hongfang; Lind, Kenneth E; Skinner, Steven R; Zhu, Zhengrong; Israel, David I; Cuozzo, John W; Morgan, Barry A; Yuki, Koichi; Xie, Can; Springer, Timothy A; Shimaoka, Motomu; Evindar, Ghotas

2014-04-01

The inhibition of protein-protein interactions remains a challenge for traditional small molecule drug discovery. Here we describe the use of DNA-encoded library technology for the discovery of small molecules that are potent inhibitors of the interaction between lymphocyte function-associated antigen 1 and its ligand intercellular adhesion molecule 1. A DNA-encoded library with a potential complexity of 4.1 billion compounds was exposed to the I-domain of the target protein and the bound ligands were affinity selected, yielding an enriched small-molecule hit family. Compounds representing this family were synthesized without their DNA encoding moiety and found to inhibit the lymphocyte function-associated antigen 1/intercellular adhesion molecule-1 interaction with submicromolar potency in both ELISA and cell adhesion assays. Re-synthesized compounds conjugated to DNA or a fluorophore were demonstrated to bind to cells expressing the target protein. Copyright © 2014 Elsevier Ltd. All rights reserved.

Studies on interaction of an intramolecular charge transfer fluorescence probe: 4'-dimethylamino-2,5-dihydroxychalcone with DNA.

PubMed

Xu, Zhicheng; Bai, Guan; Dong, Chuan

2005-10-15

The interaction of a new intramolecular charge transfer probe, namely 4'-dimethylamino-2,5-dihydroxychalcone (DMADHC), with calf thymus DNA has been studied. Compared to the spectral characteristics of the free form in aqueous solution, the fluorescence of DMADHC enhanced dramatically accompanying a blueshift of the emission maxima in the presence of DNA. The absorption and fluorescence spectra, salt concentration effect, KI quenching, fluorescence polarization, and DNA denaturation experiments were given. These results give evidence that the DMADHC molecule is inserted into the base-stacking domain of the DNA double helix. The intrinsic binding constant and the binding site number were estimated. The analytical characteristics were also given.

Prospects of nanoparticle-DNA binding and its implications in medical biotechnology.

PubMed

An, Hongjie; Jin, Bo

2012-01-01

Bio-nanotechnology is a new interdisciplinary R&D area that integrates engineering and physical science with biology through the development of multifunctional devices and systems, focusing biology inspired processes or their applications, in particular in medical biotechnology. DNA based nanotechnology, in many ways, has been one of the most intensively studied fields in recent years that involves the use and the creation of bio-inspired materials and their technologies for highly selective biosensing, nanoarchitecture engineering and nanoelectronics. Increasing researches have been offered to a fundamental understanding how the interactions between the nanoparticles and DNA molecules could alter DNA molecular structure and its biochemical activities. This minor review describes the mechanisms of the nanoparticle-DNA binding and molecular interactions. We present recent discoveries and research progresses how the nanoparticle-DNA binding could vary DNA molecular structure, DNA detection, and gene therapy. We report a few case studies associated with the application of the nanoparticle-DNA binding devices in medical detection and biotechnology. The potential impacts of the nanoparticles via DNA binding on toxicity of the microorganisms are briefly discussed. The nanoparticle-DNA interactions and their impact on molecular and microbial functionalities have only drown attention in recent a few years. The information presented in this review can provide useful references for further studies on biomedical science and technology. Copyright © 2012 Elsevier Inc. All rights reserved.

Single Molecule Visualization of Protein-DNA Complexes: Watching Machines at Work

NASA Astrophysics Data System (ADS)

Kowalczykowski, Stephen

2013-03-01

We can now watch individual proteins acting on single molecules of DNA. Such imaging provides unprecedented interrogation of fundamental biophysical processes. Visualization is achieved through the application of two complementary procedures. In one, single DNA molecules are attached to a polystyrene bead and are then captured by an optical trap. The DNA, a worm-like coil, is extended either by the force of solution flow in a micro-fabricated channel, or by capturing the opposite DNA end in a second optical trap. In the second procedure, DNA is attached by one end to a glass surface. The coiled DNA is elongated either by continuous solution flow or by subsequently tethering the opposite end to the surface. Protein action is visualized by fluorescent reporters: fluorescent dyes that bind double-stranded DNA (dsDNA), fluorescent biosensors for single-stranded DNA (ssDNA), or fluorescently-tagged proteins. Individual molecules are imaged using either epifluorescence microscopy or total internal reflection fluorescence (TIRF) microscopy. Using these approaches, we imaged the search for DNA sequence homology conducted by the RecA-ssDNA filament. The manner by which RecA protein finds a single homologous sequence in the genome had remained undefined for almost 30 years. Single-molecule imaging revealed that the search occurs through a mechanism termed ``intersegmental contact sampling,'' in which the randomly coiled structure of DNA is essential for reiterative sampling of DNA sequence identity: an example of parallel processing. In addition, the assembly of RecA filaments on single molecules of single-stranded DNA was visualized. Filament assembly requires nucleation of a protein dimer on DNA, and subsequent growth occurs via monomer addition. Furthermore, we discovered a class of proteins that catalyzed both nucleation and growth of filaments, revealing how the cell controls assembly of this protein-DNA complex.

Multi-spectroscopic and molecular docking studies on the interaction of darunavir, a HIV protease inhibitor with calf thymus DNA.

PubMed

Shi, Jie-Hua; Zhou, Kai-Li; Lou, Yan-Yue; Pan, Dong-Qi

2018-03-15

Molecular interaction of darunavir (DRV), a HIV protease inhibitor with calf thymus deoxyribonucleic acid (ct-DNA) was studied in physiological buffer (pH7.4) by multi-spectroscopic approaches hand in hand with viscosity measurements and molecular docking technique. The UV absorption and fluorescence results together revealed the formation of a DRV-ct-DNA complex having binding affinities of the order of 10 3 M -1 , which was more in keeping with the groove binding. The results that DRV bound to ct-DNA via groove binding mode was further evidenced by KI quenching studies, viscosity measurements, competitive binding investigations with EB and Rhodamine B and CD spectral analysis. The effect of ionic strength indicated the negligible involvement of electrostatic interaction between DRV and ct-DNA. The thermodynamic parameters regarding the binding interaction of DRV with ct-DNA in terms of enthalpy change (ΔH 0 ) and entropy change (ΔS 0 ) were -63.19kJ mol -1 and -141.92J mol -1 K -1 , indicating that hydrogen bonds and van der Waals forces played a predominant role in the binding process. Furthermore, molecular simulation studies suggested that DRV molecule was prone to bind in the A-T rich region of the minor groove of DNA. Copyright © 2017 Elsevier B.V. All rights reserved.

The Kinetic Mechanism for DNA Unwinding by Multiple Molecules of Dda Helicase Aligned on DNA†

PubMed Central

Eoff, Robert L.; Raney, Kevin D.

2010-01-01

Helicases catalyze the separation of double-stranded nucleic acids to form single-stranded intermediates. Using transient state kinetic methods we have determined the kinetic properties of DNA unwinding under conditions that favor a monomeric form of the Dda helicase as well as conditions that allow multiple molecules to function on the same substrate. Multiple helicase molecules can align like a train on the DNA track. The number of base pairs unwound in a single binding event for Dda is increased from ~19 bp for the monomeric form to ~64 bp when as many as four Dda molecules are aligned on the same substrate, while the kinetic step-size (3.2 ± 0.7 bp) and unwinding rate (242 ± 25 bp s−1) appear to be independent of the number of Dda molecules present on a given substrate. The data support a model in which the helicase molecules bound to the same substrate move along the DNA track independently during DNA unwinding. The observed increase in processivity arises from the increased probability that at least one of the helicases will completely unwind the DNA prior to dissociation. These results are in contrast to previous reports in which multiple Dda molecules on the same track greatly enhanced the rate and amplitude for displacement of protein blocks on the track. Therefore, only when the progress of the lead molecule in the train is impeded by some type of block, such as a protein bound to DNA, do the trailing molecules interact with the lead molecule in order to overcome the block. The fact that trailing helicase molecules have little impact on the lead molecule in the train during routine DNA unwinding suggests that the trailing molecules are moving at similar rates as the lead molecule. This result implicates a step in the translocation mechanism as contributing greatly to the overall rate-limiting step for unwinding of duplex DNA. PMID:20408588

Circadian clock protein KaiC forms ATP-dependent hexameric rings and binds DNA.

PubMed

Mori, Tetsuya; Saveliev, Sergei V; Xu, Yao; Stafford, Walter F; Cox, Michael M; Inman, Ross B; Johnson, Carl H

2002-12-24

KaiC from Synechococcus elongatus PCC 7942 (KaiC) is an essential circadian clock protein in cyanobacteria. Previous sequence analyses suggested its inclusion in the RecADnaB superfamily. A characteristic of the proteins of this superfamily is that they form homohexameric complexes that bind DNA. We show here that KaiC also forms ring complexes with a central pore that can be visualized by electron microscopy. A combination of analytical ultracentrifugation and chromatographic analyses demonstrates that these complexes are hexameric. The association of KaiC molecules into hexamers depends on the presence of ATP. The KaiC sequence does not include the obvious DNA-binding motifs found in RecA or DnaB. Nevertheless, KaiC binds forked DNA substrates. These data support the inclusion of KaiC into the RecADnaB superfamily and have important implications for enzymatic activity of KaiC in the circadian clock mechanism that regulates global changes in gene expression patterns.

Investigating the impacts of DNA binding mode and sequence on thermodynamic quantities and water exchange values for two small molecule drugs.

PubMed

Kenney, Rachael M; Buxton, Katherine E; Glazier, Samantha

2016-09-01

Doxorubicin and nogalamycin are antitumor antibiotics that interact with DNA via intercalation and threading mechanisms, respectively. Because the importance of water, particularly its impact on entropy changes, has been established in other biological processes, we investigated the role of water in these two drug-DNA binding events. We used the osmotic stress method to calculate the number of water molecules exchanged (Δnwater), and isothermal titration calorimetry to measure Kbinding, ΔH, and ΔS for two synthetic DNAs, poly(dA·dT) and poly(dG·dC), and calf thymus DNA (CT DNA). For nogalamycin, Δnwater<0 for CT DNA and poly(dG·dC). For doxorubicin, Δnwater>0 for CT DNA and Δnwater<0 for poly(dG·dC). For poly(dA·dT), Δnwater~0 with both drugs. Net enthalpy changes were always negative, but net entropy changes depended on the drug. The effect of water exchange on the overall sign of entropy change appears to be smaller than other contributions. Copyright © 2016 Elsevier B.V. All rights reserved.

Thermodynamic characterization of binding Oxytricha nova single strand telomere DNA with the alpha protein N-terminal domain.

PubMed

Buczek, Pawel; Horvath, Martin P

2006-06-23

The Oxytricha nova telemere binding protein alpha subunit binds single strand DNA and participates in a nucleoprotein complex that protects the very ends of chromosomes. To understand how the N-terminal, DNA binding domain of alpha interacts with DNA we measured the stoichiometry, enthalpy (DeltaH), entropy (DeltaS), and dissociation constant (K(D-DNA)) for binding telomere DNA fragments at different temperatures and salt concentrations using native gel electrophoresis and isothermal titration calorimetry (ITC). About 85% of the total free energy of binding corresponded with non-electrostatic interactions for all DNAs. Telomere DNA fragments d(T(2)G(4)), d(T(4)G(4)), d(G(3)T(4)G(4)), and d(G(4)T(4)G(4)) each formed monovalent protein complexes. In the case of d(T(4)G(4)T(4)G(4)), which has two tandemly repeated d(TTTTTGGGG) telomere motifs, two binding sites were observed. The high-affinity "A site" has a dissociation constant, K(D-DNA(A)) = 13(+/-4) nM, while the low-affinity "B site" is characterized by K(D-DNA(B)) = 5600(+/-600) nM at 25 degrees C. Nucleotide substitution variants verified that the A site corresponds principally with the 3'-terminal portion of d(T(4)G(4)T(4)G(4)). The relative contributions of entropy (DeltaS) and enthalpy (DeltaH) for binding reactions were DNA length-dependent as was heat capacity (DeltaCp). These trends with respect to DNA length likely reflect structural transitions in the DNA molecule that are coupled with DNA-protein association. Results presented here are important for understanding early intermediates and subsequent stages in the assembly of the full telomere nucleoprotein complex and how binding events can prepare the telomere DNA for extension by telomerase, a critical event in telomere biology.

Statistical-Mechanical Studies of the Collective Binding of Proteins to DNA

NASA Astrophysics Data System (ADS)

Zhang, Houyin

My dissertation work focuses on the microscopic statistical-mechanical studies of DNA-protein interactions and mainly comprises of three projects. In living cells, binding of proteins to DNA controls gene expression and packaging of the genome. Single-DNA stretching and twisting experiments provide a powerful tool to detect binding of proteins, via detection of their modification of DNA mechanical properties. However, it is often difficult or impossible to determine the numbers of proteins bound in such experiments, especially when the proteins interact nonspecifically with DNA. In the first project, we developed single-molecule versions of classical thermodynamic Maxwell relations and proposed that these relations could be used to measure DNA-bound protein numbers, changes in DNA double-helix torque with force, and many other quantities which are hard to directly measure. This approach does not need any theoretical assumptions beyond the existence of thermodynamic equilibrium and has been used in single-DNA experiments. Many single-molecule experiments associated with DNA-bending proteins suggest the existence of cooperative interactions between adjacent DNA-bound proteins. In the second project, we studied a statistical-mechanical worm-like chain model including binding cooperativity effects and found that the intrinsic cooperativity of binding sharpens force-extension curves and causes enhancement of fluctuation of extension and protein occupation. This model also allows us to estimate the intrinsic cooperativity in experiments. We also analyzed force-generated cooperativity and found that the related interaction between proteins is always attractive. This suggests that tension in DNA in vivo could alter the distribution of proteins bound along DNA, causing chromosome refolding, or changes in gene expression. In the third project, we investigated the correlations along DNA-protein complexes. We found there are two different correlation lengths corrected to the geometry of DNA bending - the shorter “longitudinal” correlation length ξ∥(f, μ) and the longer “transverse” correlation length ξ⊥( f, μ). In the high-force limit, ξ∥(f, μ) = ξ⊥(f, μ)/2 = A/4bf . Surprisingly, the range of the interaction between DNA-bending proteins is controlled by the second-longest correlation length. The effect arises from the protein-bend contribution to the Hamiltonian having an axial rotational symmetry which eliminates its coupling to the transverse bending fluctuations.

Molecular sled sequences are common in mammalian proteins.

PubMed

Xiong, Kan; Blainey, Paul C

2016-03-18

Recent work revealed a new class of molecular machines called molecular sleds, which are small basic molecules that bind and slide along DNA with the ability to carry cargo along DNA. Here, we performed biochemical and single-molecule flow stretching assays to investigate the basis of sliding activity in molecular sleds. In particular, we identified the functional core of pVIc, the first molecular sled characterized; peptide functional groups that control sliding activity; and propose a model for the sliding activity of molecular sleds. We also observed widespread DNA binding and sliding activity among basic polypeptide sequences that implicate mammalian nuclear localization sequences and many cell penetrating peptides as molecular sleds. These basic protein motifs exhibit weak but physiologically relevant sequence-nonspecific DNA affinity. Our findings indicate that many mammalian proteins contain molecular sled sequences and suggest the possibility that substantial undiscovered sliding activity exists among nuclear mammalian proteins. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Synthesis and characterization of 6,6’-bis(2-hydroxyphenyl)-2,2’-bipyridine ligand and its interaction with ct-DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Selamat, Norhidayah; Heng, Lee Yook; Hassan, Nurul Izzaty

2015-09-25

The tetradentate ligand with four donor atoms OONN was synthesized. Bis(phenoxy)bipyridine ligand was prepared by Suzuki coupling reaction between 6,6’-dibromo-2,2’-bipyridyl and 2-hydroxyphenylboronic acid with presence of palladium (II) acetate. Bis(phenoxy)bipyridine ligand was also synthesized by demethylating of 6,6’-bis(2-methoxyphenyl)-2,2’-bipyridyl ligand through solvent free reaction using pyridine hydrocloride. The formation of both phenoxy and methoxy ligands was confirmed by {sup 1}H, 2D cosy and {sup 13}C NMR spectroscopy, ESI-MS spectrometry, FTIR spectroscopy. The purity of the ligand was confirmed by melting point. Binding studies of small molecules with DNA are useful to understand the reaction mechanism and to provide guidance for themore » application and design of new and more efficient drugs targeted to DNA. In this study, the binding interaction between the synthesized ligand with calf thymus-DNA (ct-DNA) has been investigated by UV/Vis DNA titration study. From the UV/Vis DNA study, it shows that bis(phenoxy)bipyridine ligand bind with ct-DNA via outside binding with binding contant K{sub b} = 1.19 × 10{sup 3} ± 0.08 M{sup −1}.« less

PriC-mediated DNA replication restart requires PriC complex formation with the single-stranded DNA-binding protein.

PubMed

Wessel, Sarah R; Marceau, Aimee H; Massoni, Shawn C; Zhou, Ruobo; Ha, Taekjip; Sandler, Steven J; Keck, James L

2013-06-14

Frequent collisions between cellular DNA replication complexes (replisomes) and obstacles such as damaged DNA or frozen protein complexes make DNA replication fork progression surprisingly sporadic. These collisions can lead to the ejection of replisomes prior to completion of replication, which, if left unrepaired, results in bacterial cell death. As such, bacteria have evolved DNA replication restart mechanisms that function to reload replisomes onto abandoned DNA replication forks. Here, we define a direct interaction between PriC, a key Escherichia coli DNA replication restart protein, and the single-stranded DNA-binding protein (SSB), a protein that is ubiquitously associated with DNA replication forks. PriC/SSB complex formation requires evolutionarily conserved residues from both proteins, including a pair of Arg residues from PriC and the C terminus of SSB. In vitro, disruption of the PriC/SSB interface by sequence changes in either protein blocks the first step of DNA replication restart, reloading of the replicative DnaB helicase onto an abandoned replication fork. Consistent with the critical role of PriC/SSB complex formation in DNA replication restart, PriC variants that cannot bind SSB are non-functional in vivo. Single-molecule experiments demonstrate that PriC binding to SSB alters SSB/DNA complexes, exposing single-stranded DNA and creating a platform for other proteins to bind. These data lead to a model in which PriC interaction with SSB remodels SSB/DNA structures at abandoned DNA replication forks to create a DNA structure that is competent for DnaB loading.

Multitargeting by curcumin as revealed by molecular interaction studies

PubMed Central

Gupta, Subash C.; Prasad, Sahdeo; Kim, Ji Hye; Patchva, Sridevi; Webb, Lauren J.; Priyadarsini, Indira K.

2012-01-01

Curcumin (diferuloylmethane), the active ingredient in turmeric (Curcuma longa), is a highly pleiotropic molecule with anti-inflammatory, anti-oxidant, chemopreventive, chemosensitization, and radiosensitization activities. The pleiotropic activities attributed to curcumin come from its complex molecular structure and chemistry, as well as its ability to influence multiple signaling molecules. Curcumin has been shown to bind by multiple forces directly to numerous signaling molecules, such as inflammatory molecules, cell survival proteins, protein kinases, protein reductases, histone acetyltransferase, histone deacetylase, glyoxalase I, xanthine oxidase, proteasome, HIV1 integrase, HIV1 protease, sarco (endo) plasmic reticulum Ca2+ ATPase, DNA methyltransferases 1, FtsZ protofilaments, carrier proteins, and metal ions. Curcumin can also bind directly to DNA and RNA. Owing to its β-diketone moiety, curcumin undergoes keto–enol tautomerism that has been reported as a favorable state for direct binding. The functional groups on curcumin found suitable for interaction with other macromolecules include the α, β-unsaturated β-diketone moiety, carbonyl and enolic groups of the β-diketone moiety, methoxy and phenolic hydroxyl groups, and the phenyl rings. Various biophysical tools have been used to monitor direct interaction of curcumin with other proteins, including absorption, fluorescence, Fourier transform infrared (FTIR) and circular dichroism (CD) spectroscopy, surface plasmon resonance, competitive ligand binding, Forster type fluorescence resonance energy transfer (FRET), radiolabeling, site-directed mutagenesis, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS), immunoprecipitation, phage display biopanning, electron microscopy, 1-anilino-8-naphthalene-sulfonate (ANS) displacement, and co-localization. Molecular docking, the most commonly employed computational tool for calculating binding affinities and predicting binding sites, has also been used to further characterize curcumin’s binding sites. Furthermore, the ability of curcumin to bind directly to carrier proteins improves its solubility and bioavailability. In this review, we focus on how curcumin directly targets signaling molecules, as well as the different forces that bind the curcumin–protein complex and how this interaction affects the biological properties of proteins. We will also discuss various analogues of curcumin designed to bind selective targets with increased affinity. PMID:21979811

A programmable DNA origami nanospring that reveals force-induced adjacent binding of myosin VI heads

PubMed Central

Iwaki, M.; Wickham, S. F.; Ikezaki, K.; Yanagida, T.; Shih, W. M.

2016-01-01

Mechanosensitive biological nanomachines such as motor proteins and ion channels regulate diverse cellular behaviour. Combined optical trapping with single-molecule fluorescence imaging provides a powerful methodology to clearly characterize the mechanoresponse, structural dynamics and stability of such nanomachines. However, this system requires complicated experimental geometry, preparation and optics, and is limited by low data-acquisition efficiency. Here we develop a programmable DNA origami nanospring that overcomes these issues. We apply our nanospring to human myosin VI, a mechanosensory motor protein, and demonstrate nanometre-precision single-molecule fluorescence imaging of the individual motor domains (heads) under force. We observe force-induced transitions of myosin VI heads from non-adjacent to adjacent binding, which correspond to adapted roles for low-load and high-load transport, respectively. Our technique extends single-molecule studies under force and clarifies the effect of force on biological processes. PMID:27941751

A programmable DNA origami nanospring that reveals force-induced adjacent binding of myosin VI heads.

PubMed

Iwaki, M; Wickham, S F; Ikezaki, K; Yanagida, T; Shih, W M

2016-12-12

Mechanosensitive biological nanomachines such as motor proteins and ion channels regulate diverse cellular behaviour. Combined optical trapping with single-molecule fluorescence imaging provides a powerful methodology to clearly characterize the mechanoresponse, structural dynamics and stability of such nanomachines. However, this system requires complicated experimental geometry, preparation and optics, and is limited by low data-acquisition efficiency. Here we develop a programmable DNA origami nanospring that overcomes these issues. We apply our nanospring to human myosin VI, a mechanosensory motor protein, and demonstrate nanometre-precision single-molecule fluorescence imaging of the individual motor domains (heads) under force. We observe force-induced transitions of myosin VI heads from non-adjacent to adjacent binding, which correspond to adapted roles for low-load and high-load transport, respectively. Our technique extends single-molecule studies under force and clarifies the effect of force on biological processes.

3' Homologous Free Ends are Required for Stable Joint Molecule Formation by the RecA and Single-Stranded Binding Proteins of Escherichia coli

NASA Astrophysics Data System (ADS)

Konforti, Boyana B.; Davis, Ronald W.

1987-02-01

The RecA protein of Escherichia coli is important for genetic recombination in vivo and can promote synapsis and strand exchange in vitro. The DNA pairing and strand exchange reactions have been well characterized in reactions with circular single strands and linear duplexes, but little is known about these two processes using substrates more characteristic of those likely to exist in the cell. Single-stranded linear DNAs were prepared by separating strands of duplex molecules or by cleaving single-stranded circles at a unique restriction site created by annealing a short defined oligonucleotide to the circle. Analysis by gel electrophoresis and electron microscopy revealed that, in the presence of RecA and single-stranded binding proteins, a free 3' homologous end is essential for stable joint molecule formation between linear single-stranded and circular duplex DNA.

Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

NASA Astrophysics Data System (ADS)

Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

2018-04-01

We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

Probing the dynamics of restriction endonuclease NgoMIV-DNA interaction by single-molecule FRET.

PubMed

Tutkus, Marijonas; Sasnauskas, Giedrius; Rutkauskas, Danielis

2017-12-01

Many type II restriction endonucleases require two copies of their recognition sequence for optimal activity. Concomitant binding of two DNA sites by such an enzyme produces a DNA loop. Here we exploit single-molecule Förster resonance energy transfer (smFRET) of surface-immobilized DNA fragments to study the dynamics of DNA looping induced by tetrameric endonuclease NgoMIV. We have employed a DNA fragment with two NgoMIV recognition sites and a FRET dye pair such that upon protein-induced DNA looping the dyes are brought to close proximity resulting in a FRET signal. The dynamics of DNA-NgoMIV interactions proved to be heterogeneous, with individual smFRET trajectories exhibiting broadly different average looped state durations. Distinct types of the dynamics were attributed to different types of DNA-protein complexes, mediated either by one NgoMIV tetramer simultaneously bound to two specific sites ("slow" trajectories) or by semi-specific interactions of two DNA-bound NgoMIV tetramers ("fast" trajectories), as well as to conformational heterogeneity of individual NgoMIV molecules. © 2017 Wiley Periodicals, Inc.

Spectrophotometric study on binding of 2-thioxanthone acetic acid with ct-DNA.

PubMed

Ataci, Nese; Ozcelik, Elif; Arsu, Nergis

2018-06-02

Thioxanthone and its derivatives are the most remarkable molecules due to their vast variety of application such as radiation curing that is, until using them as a therapeutic drug. Therefore, in this study it was intended to use 2-Thioxanthone acetic acid with and without NaCl in Tris HCl buffer solution (pH:7.0) to represent the interaction with ct-DNA. The UV-vis absorption spectra of TXCH 2 COOH in the presence of ct-DNA showed hypochromism and the intrinstic binding constant (K b ) was determined as 6 × 10 3  L mol -1 . The fluoresence intensity of TXCH 2 COOH with ct-DNA clearly increased up to 101% which indicated that the fluorescence intensity was very sensitive to ct-DNA concentration. The binding constant (K) and the values of number of binding sites (n) and were calculated as 1.8 × 10 3  L mol -1 and 0.69, respectively. When the quenching constants (K sv ) of free TXCH 2 COOH and TXCH 2 COOH, which were bonded with ct-DNA were compared, slightly changed values of Ksv were seen. Moreover, displacement assay with Hoechst 33,258 and viscosity measurements in the presence and absence of NaCl salt also confirmed the binding mode which noted the electrostatic interaction following groove binding between TXCH 2 COOH and ct-DNA. Last but not least, the salt effect was examined on ct-DNA binding with TXCH 2 COOH. The results of the experiments indicated that the groove binding was strengthened by NaCl whereas in the high NaCl concentration, the binding ability of TXCH 2 COOH to ct-DNA was inversely affected. Copyright © 2018 Elsevier B.V. All rights reserved.

Discovery of DNA repair inhibitors by combinatorial library profiling

PubMed Central

Moeller, Benjamin J.; Sidman, Richard L.; Pasqualini, Renata; Arap, Wadih

2011-01-01

Small molecule inhibitors of DNA repair are emerging as potent and selective anti-cancer therapies, but the sheer magnitude of the protein networks involved in DNA repair processes poses obstacles to discovery of effective candidate drugs. To address this challenge, we used a subtractive combinatorial selection approach to identify a panel of peptide ligands that bind DNA repair complexes. Supporting the concept that these ligands have therapeutic potential, we show that one selected peptide specifically binds and non-competitively inactivates DNA-PKcs, a protein kinase critical in double-strand DNA break repair. In doing so, this ligand sensitizes BRCA-deficient tumor cells to genotoxic therapy. Our findings establish a platform for large-scale parallel screening for ligand-directed DNA repair inhibitors, with immediate applicability to cancer therapy. PMID:21343400

Structure and mechanism of the UvrA-UvrB DNA damage sensor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pakotiprapha, Danaya; Samuels, Martin; Shen, Koning

2012-04-17

Nucleotide excision repair (NER) is used by all organisms to eliminate DNA lesions. We determined the structure of the Geobacillus stearothermophilus UvrA-UvrB complex, the damage-sensor in bacterial NER and a new structure of UvrA. We observe that the DNA binding surface of UvrA, previously found in an open shape that binds damaged DNA, also exists in a closed groove shape compatible with native DNA only. The sensor contains two UvrB molecules that flank the UvrA dimer along the predicted path for DNA, ~80 Å from the lesion. We show that the conserved signature domain II of UvrA mediates a nexusmore » of contacts among UvrA, UvrB and DNA. Further, in our new structure of UvrA, this domain adopts an altered conformation while an adjacent nucleotide binding site is vacant. Our findings raise unanticipated questions about NER and also suggest a revised picture of its early stages.« less

Dynamic DNA binding licenses a repair factor to bypass roadblocks in search of DNA lesions

PubMed Central

Brown, Maxwell W.; Kim, Yoori; Williams, Gregory M.; Huck, John D.; Surtees, Jennifer A.; Finkelstein, Ilya J.

2016-01-01

DNA-binding proteins search for specific targets via facilitated diffusion along a crowded genome. However, little is known about how crowded DNA modulates facilitated diffusion and target recognition. Here we use DNA curtains and single-molecule fluorescence imaging to investigate how Msh2–Msh3, a eukaryotic mismatch repair complex, navigates on crowded DNA. Msh2–Msh3 hops over nucleosomes and other protein roadblocks, but maintains sufficient contact with DNA to recognize a single lesion. In contrast, Msh2–Msh6 slides without hopping and is largely blocked by protein roadblocks. Remarkably, the Msh3-specific mispair-binding domain (MBD) licences a chimeric Msh2–Msh6(3MBD) to bypass nucleosomes. Our studies contrast how Msh2–Msh3 and Msh2–Msh6 navigate on a crowded genome and suggest how Msh2–Msh3 locates DNA lesions outside of replication-coupled repair. These results also provide insights into how DNA repair factors search for DNA lesions in the context of chromatin. PMID:26837705

Thermodynamic Characterization of Binding Oxytricha nova Single Strand Telomere DNA with the Alpha Protein N-terminal Domain

PubMed Central

Buczek, Pawel; Horvath, Martin P.

2010-01-01

The Oxytricha nova telomere binding protein alpha subunit binds single strand DNA and participates in a nucleoprotein complex that protects the very ends of chromosomes. To understand how the N-terminal, DNA binding domain of alpha interacts with DNA we measured the stoichiometry, enthalpy (ΔH), entropy (ΔS), and dissociation constant (KD-DNA) for binding telomere DNA fragments at different temperatures and salt concentrations using native gel electrophoresis and isothermal titration calorimetry (ITC). About 85% of the total free energy of binding corresponded with non-electrostatic interactions for all DNAs. Telomere DNA fragments d(T2G4), d(T4G4), d(G3T4G4), and d(G4T4G4) each formed monovalent protein complexes. In the case of d(T4G4T4G4), which has two tandemly repeated d(TTTTTGGGG) telomere motifs, two binding sites were observed. The high-affinity “A site” has a dissociation constant, KD-DNA(A)=13(±4) nM, while the low-affinity “B site” is characterized by KD-DNA(B)=5600(±600) nM at 25 °C. Nucleotide substitution variants verified that the A site corresponds principally with the 3′-terminal portion of d(T4G4T4G4). The relative contributions of entropy (ΔS) and enthalpy (ΔH) for binding reactions were DNA length-dependent as was heat capacity (ΔCp). These trends with respect to DNA length likely reflect structural transitions in the DNA molecule that are coupled with DNA–protein association. Results presented here are important for understanding early intermediates and subsequent stages in the assembly of the full telomere nucleoprotein complex and how binding events can prepare the telomere DNA for extension by telomerase, a critical event in telomere biology. PMID:16678852

Surface reengineering of RPA70N enables cocrystallization with an inhibitor of the replication protein A interaction motif of ATR interacting protein.

PubMed

Feldkamp, Michael D; Frank, Andreas O; Kennedy, J Phillip; Patrone, James D; Vangamudi, Bhavatarini; Waterson, Alex G; Fesik, Stephen W; Chazin, Walter J

2013-09-17

Replication protein A (RPA) is the primary single-stranded DNA (ssDNA) binding protein in eukaryotes. The N-terminal domain of the RPA70 subunit (RPA70N) interacts via a basic cleft with a wide range of DNA processing proteins, including several that regulate DNA damage response and repair. Small molecule inhibitors that disrupt these protein-protein interactions are therefore of interest as chemical probes of these critical DNA processing pathways and as inhibitors to counter the upregulation of DNA damage response and repair associated with treatment of cancer patients with radiation or DNA-damaging agents. Determination of three-dimensional structures of protein-ligand complexes is an important step for elaboration of small molecule inhibitors. However, although crystal structures of free RPA70N and an RPA70N-peptide fusion construct have been reported, RPA70N-inhibitor complexes have been recalcitrant to crystallization. Analysis of the P61 lattice of RPA70N crystals led us to hypothesize that the ligand-binding surface was occluded. Surface reengineering to alter key crystal lattice contacts led to the design of RPA70N E7R, E100R, and E7R/E100R mutants. These mutants crystallized in a P212121 lattice that clearly had significant solvent channels open to the critical basic cleft. Analysis of X-ray crystal structures, target peptide binding affinities, and (15)N-(1)H heteronuclear single-quantum coherence nuclear magnetic resonance spectra showed that the mutations do not result in perturbations of the RPA70N ligand-binding surface. The success of the design was demonstrated by determining the structure of RPA70N E7R soaked with a ligand discovered in a previously reported molecular fragment screen. A fluorescence anisotropy competition binding assay revealed this compound can inhibit the interaction of RPA70N with the peptide binding motif from the DNA damage response protein ATRIP. The implications of the results are discussed in the context of ongoing efforts to design RPA70N inhibitors.

Anthraquinones quinizarin and danthron unwind negatively supercoiled DNA and lengthen linear DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Verebová, Valéria; Adamcik, Jozef; Danko, Patrik

2014-01-31

Highlights: • Anthraquinones quinizarin and danthron unwind negatively supercoiled DNA. • Anthraquinones quinizarin and danthron lengthen linear DNA. • Anthraquinones quinizarin and danthron possess middle binding affinity to DNA. • Anthraquinones quinizarin and danthron interact with DNA by intercalating mode. - Abstract: The intercalating drugs possess a planar aromatic chromophore unit by which they insert between DNA bases causing the distortion of classical B-DNA form. The planar tricyclic structure of anthraquinones belongs to the group of chromophore units and enables anthraquinones to bind to DNA by intercalating mode. The interactions of simple derivatives of anthraquinone, quinizarin (1,4-dihydroxyanthraquinone) and danthron (1,8-dihydroxyanthraquinone),more » with negatively supercoiled and linear DNA were investigated using a combination of the electrophoretic methods, fluorescence spectrophotometry and single molecule technique an atomic force microscopy. The detection of the topological change of negatively supercoiled plasmid DNA, unwinding of negatively supercoiled DNA, corresponding to appearance of DNA topoisomers with the low superhelicity and an increase of the contour length of linear DNA in the presence of quinizarin and danthron indicate the binding of both anthraquinones to DNA by intercalating mode.« less

Knowledge-Based Elastic Potentials for Docking Drugs or Proteins with Nucleic Acids

PubMed Central

Ge, Wei; Schneider, Bohdan; Olson, Wilma K.

2005-01-01

Elastic ellipsoidal functions defined by the observed hydration patterns around the DNA bases provide a new basis for measuring the recognition of ligands in the grooves of double-helical structures. Here a set of knowledge-based potentials suitable for quantitative description of such behavior is extracted from the observed positions of water molecules and amino acid atoms that form hydrogen bonds with the nitrogenous bases in high resolution crystal structures. Energies based on the displacement of hydrogen-bonding sites on drugs in DNA-crystal complexes relative to the preferred locations of water binding around the heterocyclic bases are low, pointing to the reliability of the potentials and the apparent displacement of water molecules by drug atoms in these structures. The validity of the energy functions has been further examined in a series of sequence substitution studies based on the structures of DNA bound to polyamides that have been designed to recognize the minor-groove edges of Watson-Crick basepairs. The higher energies of binding to incorrect sequences superimposed (without conformational adjustment or displacement of polyamide ligands) on observed high resolution structures confirm the hypothesis that the drug subunits associate with specific DNA bases. The knowledge-based functions also account satisfactorily for the measured free energies of DNA-polyamide association in solution and the observed sites of polyamide binding on nucleosomal DNA. The computations are generally consistent with mechanisms by which minor-groove binding ligands are thought to recognize DNA basepairs. The calculations suggest that the asymmetric distributions of hydrogen-bond-forming atoms on the minor-groove edge of the basepairs may underlie ligand discrimination of G·C from C·G pairs, in addition to the commonly believed role of steric hindrance. The analysis of polyamide-bound nucleosomal structures reveals other discrepancies in the expected chemical design, including unexpected contacts to DNA and modified basepair targets of some ligands. The ellipsoidal potentials thus appear promising as a mathematical tool for the study of drug- and protein-DNA interactions and for gaining new insights into DNA-binding mechanisms. PMID:15501936

Transcription through the roadblocks: the role of RNA polymerase cooperation

PubMed Central

Epshtein, Vitaly; Toulmé, Francine; Rahmouni, A.Rachid; Borukhov, Sergei; Nudler, Evgeny

2003-01-01

During transcription, cellular RNA polymerases (RNAP) have to deal with numerous potential roadblocks imposed by various DNA binding proteins. Many such proteins partially or completely interrupt a single round of RNA chain elongation in vitro. Here we demonstrate that Escherichia coli RNAP can effectively read through the site-specific DNA-binding proteins in vitro and in vivo if more than one RNAP molecule is allowed to initiate from the same promoter. The anti-roadblock activity of the trailing RNAP does not require transcript cleavage activity but relies on forward translocation of roadblocked complexes. These results support a cooperation model of transcription whereby RNAP molecules behave as ‘partners’ helping one another to traverse intrinsic and extrinsic obstacles. PMID:12970184

MicroCantilever (MC) based nanomechanical sensor for detection of molecular interactions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kang, Kyung

Specific aims of this study are to investigate the mechanism governing surface stress generation associated with chemical or molecular binding on functionalized microcantilevers. Formation of affinity complexes on cantilever surfaces leads to charge redistribution, configurational change and steric hindrance between neighboring molecules resulting in surface stress change and measureable cantilever deformation. A novel interferometry technique employing two adjacent micromachined cantilevers (a sensing/reference pair) was utilized to measure the cantilever deformation. The sensing principle is that binding/reaction of specific chemical or biological species on the sensing cantilever transduces to mechanical deformation. The differential bending of the sensing cantilever respect to themore » reference cantilever ensures that measured response is insensitive to environmental disturbances. As a proof of principle for the measurement technique, surface stress changes associated with: self-assembly of alkanethiol, hybridization of ssDNA, and the formation of cocaine-aptamer complexes were measured. Dissociation constant (K d) for each molecular reaction was utilized to estimate the surface coverage of affinity complexes. In the cases of DNA hybridization and cocaine-aptamer binding, measured surface stress was found to be dependent on the surface coverage of the affinity complexes. In order to achieve a better sensitivity for DNA hybridization, immobilization of receptor molecules was modified to enhance the deformation of underlying surface. Single-stranded DNA (ssDNA) strands with thiol-modification on both 3-foot and 5-foot ends were immobilized on the gold surface such that both ends are attached to the gold surface. Immobilization condition was controlled to obtain similar receptor density as single-thiolated DNA strands. Hybridization of double-thiolated DNA strands leads to an almost two orders of magnitude increase in cantilever deformation. In both DNA hybridization and the conventional mode for cocaine detection, the lowest detectable concentration was determined by binding activity between the ligand and receptor molecules. In order to overcome this limitation for cocaine detection, a novel competition sensing mode that relies on rate of aptamers unbinding from the cantilever due to either diffusion or reaction with cocaine as target ligands in solution was investigated. The rate of unbinding is found to be dependent on the concentration of cocaine molecules. A model based on diffusion-reaction equation was developed to explain the experimental observation. Experimental results indicate that the competition mode reduces the lowest detectable threshold to 200 nM which is comparable to that achieved analytical techniques such as mass spectrometry.« less

Binding mode and thermodynamic studies on the interaction of the anticancer drug dacarbazine and dacarbazine-Cu(II) complex with single and double stranded DNA.

PubMed

Temerk, Yassien; Ibrahim, Hossieny

2014-07-01

The binding mode and thermodynamic characteristics of the anticancer drug dacarbazine (Dac) with double and single stranded DNA were investigated in the absence and presence of Cu(II) using cyclic voltammetry, square wave voltammetry and fluorescence spectroscopy. The interaction of Dac and Dac-Cu(II) complex with dsDNA indicated their intercalation into the base stacking domain of dsDNA double helix and the strength of interaction is independent on the ionic strength. The interaction of Dac with dsDNA in the presence of Cu(II) leads to a much stronger intercalation. The interaction mode of Dac molecules with ssDNA is electrostatic attraction via negative phosphate on the exterior of the ssDNA with Dac. The binding constants, stoichiometric coefficients and thermodynamic parameters of Dac and Dac-Cu(II) complex with dsDNA and ssDNA were evaluated. Comparison of the mode interaction of Dac with dsDNA and ssDNA was discussed. The decrease of peak current of Dac was proportional to DNA concentration, which was applied for determination of dsDNA and ssDNA concentration. Copyright © 2014 Elsevier B.V. All rights reserved.

DNA Binding Mode Transitions of Escherichia coli HUαβ: Evidence for Formation of a Bent DNA – Protein Complex on Intact, Linear Duplex DNA

PubMed Central

Koh, Junseock; Saecker, Ruth M.; Record, M. Thomas

2008-01-01

Escherichia coli HUαβ, a major nucleoid associated protein (NAP), organizes the DNA chromosome and facilitates numerous DNA transactions. Using isothermal titration calorimetry (ITC), fluorescence resonance energy transfer (FRET) and a series of DNA lengths (8, 15, 34, 38 and 160 base pairs) we establish that HUαβ interacts with duplex DNA using three different nonspecific binding modes. Both the HU to DNA mole ratio ([HU]/[DNA]) and DNA length dictate the dominant HU binding mode. On sufficiently long DNA (≥ 34 base pairs), at low [HU]/[DNA], HU populates a noncooperative 34 bp binding mode with a binding constant of 2.1 (± 0.4) × 106 M−1, and a binding enthalpy of +7.7 (± 0.6) kcal/mol at 15 °C and 0.15 M Na+. With increasing [HU]/[DNA], HU bound in the noncooperative 34 bp mode progressively converts to two cooperative (ω ~ 20) modes with site sizes of 10 bp and 6 bp. These latter modes exhibit smaller binding constants (1.1 (± 0.2) × 105 M−1 for the 10 bp mode, 3.5 (± 1.4) × 104 M−1 for the 6 bp mode) and binding enthalpies (4.2 (± 0.3) kcal/mol for the 10 bp mode, −1.6 (±0.3) kcal/mol for the 6 bp mode). As DNA length increases to 34 bp or more at low [HU]/[DNA], the small modes are replaced by the 34 bp binding mode. FRET data demonstrate that the 34 bp mode bends DNA by 143 ± 6° whereas the 6 and 10 bp modes do not. The model proposed in this study provides a novel quantitative and comprehensive framework for reconciling previous structural and solution studies of HU, including single molecule (force extension measurement, AFM), fluorescence, and electrophoretic gel mobility shift assays. In particular, it explains how HU condenses or extends DNA depending on the relative concentrations of HU and DNA. PMID:18657548

Monitoring conformational heterogeneity of the lid of DnaK substrate-binding domain during its chaperone cycle.

PubMed

Banerjee, Rupa; Jayaraj, Gopal Gunanathan; Peter, Joshua Jebakumar; Kumar, Vignesh; Mapa, Koyeli

2016-08-01

DnaK or Hsp70 of Escherichia coli is a master regulator of the bacterial proteostasis network. Allosteric communication between the two functional domains of DnaK, the N-terminal nucleotide-binding domain (NBD) and the C-terminal substrate- or peptide-binding domain (SBD) regulate its activity. X-ray crystallography and NMR studies have provided snapshots of distinct conformations of Hsp70 proteins in various physiological states; however, the conformational heterogeneity and dynamics of allostery-driven Hsp70 activity remains underexplored. In this work, we employed single-molecule Förster resonance energy transfer (sm-FRET) measurements to capture distinct intradomain conformational states of a region within the DnaK-SBD known as the lid. Our data conclusively demonstrate prominent conformational heterogeneity of the DnaK lid in ADP-bound states; in contrast, the ATP-bound open conformations are homogeneous. Interestingly, a nonhydrolysable ATP analogue, AMP-PNP, imparts heterogeneity to the lid conformations mimicking the ADP-bound state. The cochaperone DnaJ confers ADP-like heterogeneous lid conformations to DnaK, although the presence of the cochaperone accelerates the substrate-binding rate by a hitherto unknown mechanism. Irrespective of the presence of DnaJ, binding of a peptide substrate to the DnaK-SBD leads to prominent lid closure. Lid closure is only partial upon binding to molten globule-like authentic cellular substrates, probably to accommodate non-native substrate proteins of varied structures. © 2016 Federation of European Biochemical Societies.

Investigation of the electrostatic and hydration properties of DNA minor groove-binding by a heterocyclic diamidine by osmotic pressure.

PubMed

Erlitzki, Noa; Huang, Kenneth; Xhani, Suela; Farahat, Abdelbasset A; Kumar, Arvind; Boykin, David W; Poon, Gregory M K

2017-12-01

Previous investigations of sequence-specific DNA binding by model minor groove-binding compounds showed that the ligand/DNA complex was destabilized in the presence of compatible co-solutes. Inhibition was interpreted in terms of osmotic stress theory as the uptake of significant numbers of excess water molecules from bulk solvent upon complex formation. Here, we interrogated the AT-specific DNA complex formed with the symmetric heterocyclic diamidine DB1976 as a model for minor groove DNA recognition using both ionic (NaCl) and non-ionic cosolutes (ethylene glycol, glycine betaine, maltose, nicotinamide, urea). While the non-ionic cosolutes all destabilized the ligand/DNA complex, their quantitative effects were heterogeneous in a cosolute- and salt-dependent manner. Perturbation with NaCl in the absence of non-ionic cosolute showed that preferential hydration water was released upon formation of the DB1976/DNA complex. As salt probes counter-ion release from charged groups such as the DNA backbone, we propose that the preferential hydration uptake in DB1976/DNA binding observed in the presence of osmolytes reflects the exchange of preferentially bound cosolute with hydration water in the environs of the bound DNA, rather than a net uptake of hydration waters by the complex. Copyright © 2017 Elsevier B.V. All rights reserved.

Toehold-Mediated Displacement of an Adenosine-Binding Aptamer from a DNA Duplex by its Ligand.

PubMed

Monserud, Jon H; Macri, Katherine M; Schwartz, Daniel K

2016-10-24

DNA is increasingly used to engineer dynamic nanoscale circuits, structures, and motors, many of which rely on DNA strand-displacement reactions. The use of functional DNA sequences (e.g., aptamers, which bind to a wide range of ligands) in these reactions would potentially confer responsiveness on such devices, and integrate DNA computation with highly varied molecular stimuli. By using high-throughput single-molecule FRET methods, we compared the kinetics of a putative aptamer-ligand and aptamer-complement strand-displacement reaction. We found that the ligands actively disrupted the DNA duplex in the presence of a DNA toehold in a similar manner to complementary DNA, with kinetic details specific to the aptamer structure, thus suggesting that the DNA strand-displacement concept can be extended to functional DNA-ligand systems. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Effects of mutations at amino acid 61 in the arm of TF1 on its DNA-binding properties.

PubMed

Sayre, M H; Geiduschek, E P

1990-12-20

Transcription factor 1 (TF1) is the Bacillus subtilis phage SPO1-encoded member of the family of bacterial DNA-binding proteins that includes Escherichia coli HU and integration host factor (IHF). We have initiated a mutational analysis of the TF1 molecule to understand better its unique DNA-binding properties and to investigate its physiological function. We report here the consequences of mutating the putative DNA-binding "arms" of TF1. At position 61 in its primary sequence, TF1 contains a Phe residue in place of the Arg residue found in all other known members of the HU family. Substituting polar, uncharged residues for Phe61 substantially reduced the DNA-binding affinity and site-selectivity of TF1 in vitro, whereas the substitution of Tyr had no effect. Substituting Trp or Arg for Phe61 had little effect on the affinity of TF1 for SPO1 DNA, but altered the electrophoretic mobilities of protein-DNA complexes in non-denaturing gels. The Arg61 substitution increased the affinity of the protein for non-specific sites on thymine-containing DNA, thus reducing the natural preference of TF1 for (5-hydroxymethyluracil)-containing DNA. The Phe61-to-Arg mutation was also correlated with decreased phage yield and aberrant regulation of viral protein synthesis in vivo.

Evolution of a Histone H4-K16 Acetyl-Specific DNA Aptamer

PubMed Central

Williams, Berea A. R.; Lin, Liyun; Lindsay, Stuart M.; Chaput, John C.

2009-01-01

We report the in vitro selection of DNA aptamers that bind to histone H4 proteins acetylated at lysine 16. The best aptamer identified in this selection binds to the target protein with a Kd of 21 nM, and discriminates against both the non-acetylated protein and histone H4 proteins acetylated at lysine 8. Comparative binding assays performed with a chip-quality antibody reveal that this aptamer binds to the acetylated histone target with similar affinity to a commercial antibody, but shows significantly greater specificity (15-fold versus 2,400-fold) for the target molecule. This result demonstrates that aptamers that are both modification and location specific can be generated to bind specific protein post-translational modifications. PMID:19385619

Sequence-selective binding of C8-conjugated pyrrolobenzodiazepines (PBDs) to DNA.

PubMed

Basher, Mohammad A; Rahman, Khondaker Miraz; Jackson, Paul J M; Thurston, David E; Fox, Keith R

2017-11-01

DNA footprinting and melting experiments have been used to examine the sequence-specific binding of C8-conjugates of pyrrolobenzodiazepines (PBDs) and benzofused rings including benzothiophene and benzofuran, which are attached using pyrrole- or imidazole-containing linkers. The conjugates modulate the covalent attachment points of the PBDs, so that they bind best to guanines flanked by A/T-rich sequences on either the 5'- or 3'-side. The linker affects the binding, and pyrrole produces larger changes than imidazole. Melting studies with 14-mer oligonucleotide duplexes confirm covalent attachment of the conjugates, which show a different selectivity to anthramycin and reveal that more than one ligand molecule can bind to each duplex. Copyright © 2017 Elsevier B.V. All rights reserved.

Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

DNA complexes with dyes designed for energy transfer as fluorescent markers

DOEpatents

Glazer, Alexander M.; Benson, Scott C.

1999-01-01

Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated.

DNA complexes with dyes designed for energy transfer as fluorescent markers

DOEpatents

Glazer, Alexander M.; Benson, Scott C.

1998-01-01

Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated.

DNA complexes with dyes designed for energy transfer as fluorescent markers

DOEpatents

Glazer, Alexander N.; Benson, Scott C.

1995-01-01

Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated.

DNA complexes with dyes designed for energy transfer as fluorescent markers

DOEpatents

Glazer, Alexander N.; Benson, Scott C.

1997-01-01

Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated.

Synthesis and DNA interaction of a mixed proflavine-phenanthroline Tröger base.

PubMed

Baldeyrou, Brigitte; Tardy, Christelle; Bailly, Christian; Colson, Pierre; Houssier, Claude; Charmantray, Franck; Demeunynck, Martine

2002-04-01

We report the synthesis of an asymmetric Tröger base containing the two well characterised DNA binding chromophores, proflavine and phenanthroline. The mode of interaction of the hybrid molecule was investigated by circular and linear dichroism experiments and a biochemical assay using DNA topoisomerase I. The data are compatible with a model in which the proflavine moiety intercalates between DNA base pairs and the phenanthroline ring occupies the DNA groove. DNase I cleavage experiments were carried out to investigate the sequence preference of the hybrid ligand and a well resolved footprint was detected at a site encompassing two adjacent 5'-GTC.5-GAC triplets. The sequence preference of the asymmetric molecule is compared to that of the symmetric analogues.

The role of the C-domain of bacteriophage T4 gene 32 protein in ssDNA binding and dsDNA helix-destabilization: Kinetic, single-molecule, and cross-linking studies

PubMed Central

Pant, Kiran; Anderson, Brian; Perdana, Hendrik; Malinowski, Matthew A.; Win, Aye T.; Williams, Mark C.

2018-01-01

The model single-stranded DNA binding protein of bacteriophage T4, gene 32 protein (gp32) has well-established roles in DNA replication, recombination, and repair. gp32 is a single-chain polypeptide consisting of three domains. Based on thermodynamics and kinetics measurements, we have proposed that gp32 can undergo a conformational change where the acidic C-terminal domain binds internally to or near the single-stranded (ss) DNA binding surface in the core (central) domain, blocking ssDNA interaction. To test this model, we have employed a variety of experimental approaches and gp32 variants to characterize this conformational change. Utilizing stopped-flow methods, the association kinetics of wild type and truncated forms of gp32 with ssDNA were measured. When the C-domain is present, the log-log plot of k vs. [NaCl] shows a positive slope, whereas when it is absent (*I protein), there is little rate change with salt concentration, as expected for this model.A gp32 variant lacking residues 292–296 within the C-domain, ΔPR201, displays kinetic properties intermediate between gp32 and *I. The single molecule force-induced DNA helix-destabilizing activitiesas well as the single- and double-stranded DNA affinities of ΔPR201 and gp32 truncated at residue 295 also fall between full-length protein and *I. Finally, chemical cross-linking of recombinant C-domain and gp32 lacking both N- and C-terminal domains is inhibited by increasing concentrations of a short single-stranded oligonucleotide, and the salt dependence of cross-linking mirrors that expected for the model. Taken together, these results provide the first evidence in support of this model that have been obtained through structural probes. PMID:29634784

DNA-encoded libraries - an efficient small molecule discovery technology for the biomedical sciences.

PubMed

Kunig, Verena; Potowski, Marco; Gohla, Anne; Brunschweiger, Andreas

2018-06-27

DNA-encoded compound libraries are a highly attractive technology for the discovery of small molecule protein ligands. These compound collections consist of small molecules covalently connected to individual DNA sequences carrying readable information about the compound structure. DNA-tagging allows for efficient synthesis, handling and interrogation of vast numbers of chemically synthesized, drug-like compounds. They are screened on proteins by an efficient, generic assay based on Darwinian principles of selection. To date, selection of DNA-encoded libraries allowed for the identification of numerous bioactive compounds. Some of these compounds uncovered hitherto unknown allosteric binding sites on target proteins; several compounds proved their value as chemical biology probes unraveling complex biology; and the first examples of clinical candidates that trace their ancestry to a DNA-encoded library were reported. Thus, DNA-encoded libraries proved their value for the biomedical sciences as a generic technology for the identification of bioactive drug-like molecules numerous times. However, large scale experiments showed that even the selection of billions of compounds failed to deliver bioactive compounds for the majority of proteins in an unbiased panel of target proteins. This raises the question of compound library design.

Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

NASA Astrophysics Data System (ADS)

Risqi, A. M.; Yudiarsah, E.

2017-07-01

Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

Synthesis, characterization and biological evaluation of novel α, β unsaturated amides.

PubMed

Esmailzadeh, K; Housaindokht, M R; Moradi, A; Esmaeili, A A; Sharifi, Z

2016-05-15

Three derivatives of α,β unsaturated amides have been successfully synthesized via Ugi-four component (U-4CR) reaction. The interactions of the amides with calf thymus deoxyribonucleic acid (ct-DNA) have been investigated in the Tris-HCl buffer (pH=7.4) using viscometric, spectroscopic, thermal denaturation studies, and also molecular docking. By UV-Vis absorption spectroscopy studies, adding CT-DNA to the compound solution caused the hypochromism indicates that there are interactions between the compounds and DNA base pairs. In competitive fluorescence with methylene blue as an intercalator probe, adding compounds to DNA-MB solution caused an increase in emission spectra of the complex. This could be because of compound replacing, with similar binding mode of MB, between the DNA base pairs due to release of bonded MB molecules from DNA-MB complex. Thermal denaturation studies and viscometric experiments also indicated that all three investigated compounds bind to CT-DNA by non-classical intercalation mode. Additionally, molecular docking technique predicted partial intercalation binding mode for the compounds. Also, the highest binding energy was obtained for compound 5a. These results are in agreement with results obtained by empirical methods. Copyright © 2016 Elsevier B.V. All rights reserved.

BclxL changes conformation upon binding to wild-type but not mutant p53 DNA binding domain.

PubMed

Hagn, Franz; Klein, Christian; Demmer, Oliver; Marchenko, Natasha; Vaseva, Angelina; Moll, Ute M; Kessler, Horst

2010-01-29

p53 can induce apoptosis through mitochondrial membrane permeabilization by interaction of its DNA binding region with the anti-apoptotic proteins BclxL and Bcl2. However, little is known about the action of p53 at the mitochondria in molecular detail. By using NMR spectroscopy and fluorescence polarization we characterized the binding of wild-type and mutant p53 DNA binding domains to BclxL and show that the wild-type p53 DNA binding domain leads to structural changes in the BH3 binding region of BclxL, whereas mutants fail to induce such effects due to reduced affinity. This was probed by induced chemical shift and residual dipolar coupling data. These data imply that p53 partly achieves its pro-apoptotic function at the mitochondria by facilitating interaction between BclxL and BH3-only proteins in an allosteric mode of action. Furthermore, we characterize for the first time the binding behavior of Pifithrin-mu, a specific small molecule inhibitor of the p53-BclxL interaction, and present a structural model of the protein-ligand complex. A rather unusual behavior is revealed whereby Pifithrin-mu binds to both sides of the protein-protein complex. These data should facilitate the rational design of more potent specific BclxL-p53 inhibitors.

Two-stage DNA compaction induced by silver ions suggests a cooperative binding mechanism

NASA Astrophysics Data System (ADS)

Jiang, Wen-Yan; Ran, Shi-Yong

2018-05-01

The interaction between silver ions and DNA plays an important role in the therapeutic use of silver ions and in related technologies such as DNA sensors. However, the underlying mechanism has not been fully understood. In this study, the dynamics of Ag+-DNA interaction at a single-molecule level was studied using magnetic tweezers. AgNO3 solutions with concentrations ranging from 1 μM to 20 μM led to a 1.4-1.8 μm decrease in length of a single λ-DNA molecule, indicating that Ag+ has a strong binding with DNA, causing the DNA conformational change. The compaction process comprises one linear declining stage and another sigmoid-shaped stage, which can be attributed to the interaction mechanism. Considering the cooperative effect, the sigmoid trend was well explained using a phenomenological model. By contrast, addition of silver nanoparticle solution induced no detectable transition of DNA. The dependence of the interaction on ionic strength and DNA concentration was examined via morphology characterization and particle size distribution measurement. The size of the Ag+-DNA complex decreased with an increase in Ag+ ionic strength ranging from 1 μM to 1 mM. Morphology characterization confirmed that silver ions induced DNA to adopt a compacted globular conformation. At a fixed [AgNO3]:[DNA base pairs] ratio, increasing DNA concentration led to increased sizes of the complexes. Intermolecular interaction is believed to affect the Ag+-DNA complex formation to a large extent.

Protein complexes formed during the incision reaction catalyzed by the Escherichia coli UvrABC endonuclease.

PubMed Central

Yeung, A T; Mattes, W B; Grossman, L

1986-01-01

An examination has been made into the nature of the nucleoprotein complexes formed during the incision reaction catalyzed by the Escherichia coli UvrABC endonuclease when acting on a pyrimidine dimer-containing fd RF-I DNA species. The complexes of proteins and DNA form in unique stages. The first stage of binding involves an ATP-stimulated interaction of the UvrA protein with duplex DNA containing pyrimidine dimer sites. The UvrB protein significantly stabilizes the UvrA-pyrimidine dimer containing DNA complex which, in turn, provides a foundation for the binding of UvrC to activate the UvrABC endonuclease. The binding of one molecule of UvrC to each UvrAB-damaged DNA complex is needed to catalyze incision in the vicinity of pyrimidine dimer sites. The UvrABC-DNA complex persists after the incision event suggesting that the lack of UvrABC turnover may be linked to other activities in the excision-repair pathway beyond the initial incision reaction. PMID:3960727

Spectroscopic investigation on the interaction of copper porphyrazines and phthalocyanine with human telomeric G-quadruplex DNA.

PubMed

Hassani, Leila; Hakimian, Fatemeh; Safaei, Elham

2014-01-01

The G-quadruplex DNA is a novel target for anticancer drug discovery and many scientific groups are investigating interaction of small molecules with G-quadruplex DNA to discover therapeutic agents for cancer. Here, interaction of a phthalocyanine (Cu(PcTs)) and two tetrapyridinoporphyrazines ([Cu(2,3-tmtppa)](4+) and [Cu(3,4-tmtppa)](4+)) with Na(+) and K(+) forms of human telomeric G-quadruplex DNA has been investigated by spectroscopic techniques. The results indicated that interaction of the cationic porphyrazines is remarkably stronger than the anionic phthalocyanine and they presumably bind to the G-quadruplex DNA through end-stacking. Fluorescent intercalator displacement assay implied the displacement ability of the complexes with thiazole orange. In addition, circular dichroism spectra of both quadruplex forms converge to the Na(+) isoform after binding to the porphyrazines. In conclusion, the porphyrazines as the complexes that bind to the G-quadruplex DNA, could be suitable candidates for further investigations about inhibition of telomerase enzyme. Copyright © 2013 Elsevier B.V. All rights reserved.

Hydration Changes upon DNA Folding Studied by Osmotic Stress Experiments

PubMed Central

Nakano, Shu-ichi; Yamaguchi, Daisuke; Tateishi-Karimata, Hisae; Miyoshi, Daisuke; Sugimoto, Naoki

2012-01-01

The thermal stability of nucleic acid structures is perturbed under the conditions that mimic the intracellular environment, typically rich in inert components and under osmotic stress. We now describe the thermodynamic stability of DNA oligonucleotide structures in the presence of high background concentrations of neutral cosolutes. Small cosolutes destabilize the basepair structures, and the DNA structures consisting of the same nearest-neighbor composition show similar thermodynamic parameters in the presence of various types of cosolutes. The osmotic stress experiments reveal that water binding to flexible loops, unstable mismatches, and an abasic site upon DNA folding are almost negligible, whereas the binding to stable mismatch pairs is significant. The studies using the basepair-mimic nucleosides and the peptide nucleic acid suggest that the sugar-phosphate backbone and the integrity of the basepair conformation make important contributions to the binding of water molecules to the DNA bases and helical grooves. The study of the DNA hydration provides the basis for understanding and predicting nucleic acid structures in nonaqueous solvent systems. PMID:22735531

Highly sensitive sites for guanine-O6 ethylation in rat brain DNA exposed to N-ethyl-N-nitrosourea in vivo.

PubMed Central

Nehls, P; Rajewsky, M F; Spiess, E; Werner, D

1984-01-01

Brain chromosomal DNA isolated from fetal BDIX-rats 1 h after i.v. administration of the ethylating N-nitroso carcinogen N-ethyl-N-nitrosourea (75 micrograms/g body weight), statistically contained one molecule of O6-ethyl-2'-deoxyguanosine (O6-EtdGuo) per 81 micron of DNA, as determined in enzymatic DNA hydrolysates by competitive radio-immunoassay using a high-affinity anti-(O6-EtdGuo) monoclonal antibody (ER-6). After fragmentation of the DNA by the restriction enzyme AluI (average fragment length, Lav = 0.28 micron = 970 bp; length range, Lr = 1.87-0.02 micron = 6540 - 60 bp), a small (approximately 2%) fraction of DNA enriched in specific polypeptides tightly associated with DNA was separated from the bulk DNA by a glass fiber binding technique. As analyzed by immune electron microscopy, approximately 1% of the DNA molecules in this fraction contained clusters of 2-10 (O6-EtdGuo)-antibody binding sites (ABS). On the cluster-bearing fragments (Lav, 0.85 micron +/- 0.50 micron S.D.; corresponding to 2970 +/- 1760 bp) the average ABS-ABS interspace distance was 110 nm (= 390 bp; range approximately 9-600 nm), indicating a highly non-random distribution of O6-EtdGuo in target cell DNA. Images Fig. 2. PMID:6370677

Binding of resveratrol to the minor groove of DNA sequences with AATT and TTAA segments induces differential stability.

PubMed

Nair, Maya S; D'Mello, Samar; Pant, Rashmi; Poluri, Krishna Mohan

2017-05-01

Interactions of a natural stilbene compound, resveratrol with two DNA sequences containing AATT/TTAA segments have been studied. Resveratrol is found to interact with both the sequences. The mode of interaction has been studied using absorption, steady state fluorescence and circular dichroism spectroscopic techniques. UV-visible absorption and fluorescence studies provided the information regarding the binding constants and the stoichiometry of binding, whereas circular dichroism studies depicted the structural changes in DNA upon resveratrol binding. Our results evidenced that, though resveratrol showed similar affinity to both the sequences, the mode of interactions was different. The binding constants of resveratrol to AATT/TTAA sequences were found to be 7.55×10 5 M -1 and 5.42×10 5 M -1 respectively. Spectroscopic data evidenced for a groove binding interaction. Melting studies showed that the binding of resveratrol induces differential stability to the DNA sequences d(CGTTAACG) 2 and d(CGAATTCG) 2 . Fluorescence data showed a stoichiometry of 1:1 for d(CGAATTCG) 2 -resveratrol complex and 1:4 for d(CGTTAACG) 2 -resveratrol complex. Molecular docking studies demonstrated that resveratrol binds to the minor groove region of both the sequences to form stable complexes with varied atomic contacts to the DNA bases or backbone. Both the complexes are stabilized by hydrogen bond formation. Our results evidenced that modulation of DNA sequence within the same bases can greatly alter the binding geometry and stability of the complex upon binding to small molecule inhibitor compounds like resveratrol. Copyright © 2017 Elsevier B.V. All rights reserved.

Recycling of protein subunits during DNA translocation and cleavage by Type I restriction-modification enzymes

PubMed Central

Simons, Michelle; Szczelkun, Mark D.

2011-01-01

The Type I restriction-modification enzymes comprise three protein subunits; HsdS and HsdM that form a methyltransferase (MTase) and HsdR that associates with the MTase and catalyses Adenosine-5′-triphosphate (ATP)-dependent DNA translocation and cleavage. Here, we examine whether the MTase and HsdR components can ‘turnover’ in vitro, i.e. whether they can catalyse translocation and cleavage events on one DNA molecule, dissociate and then re-bind a second DNA molecule. Translocation termination by both EcoKI and EcoR124I leads to HsdR dissociation from linear DNA but not from circular DNA. Following DNA cleavage, the HsdR subunits appear unable to dissociate even though the DNA is linear, suggesting a tight interaction with the cleaved product. The MTases of EcoKI and EcoAI can dissociate from DNA following either translocation or cleavage and can initiate reactions on new DNA molecules as long as free HsdR molecules are available. In contrast, the MTase of EcoR124I does not turnover and additional cleavage of circular DNA is not observed by inclusion of RecBCD, a helicase–nuclease that degrades the linear DNA product resulting from Type I cleavage. Roles for Type I restriction endonuclease subunit dynamics in restriction alleviation in the cell are discussed. PMID:21712244

Influence of structural variation on nuclear localization of DNA-binding polyamide-fluorophore conjugates.

PubMed

Edelson, Benjamin S; Best, Timothy P; Olenyuk, Bogdan; Nickols, Nicholas G; Doss, Raymond M; Foister, Shane; Heckel, Alexander; Dervan, Peter B

2004-01-01

A pivotal step forward in chemical approaches to controlling gene expression is the development of sequence-specific DNA-binding molecules that can enter live cells and traffic to nuclei unaided. DNA-binding polyamides are a class of programmable, sequence-specific small molecules that have been shown to influence a wide variety of protein-DNA interactions. We have synthesized over 100 polyamide-fluorophore conjugates and assayed their nuclear uptake profiles in 13 mammalian cell lines. The compiled dataset, comprising 1300 entries, establishes a benchmark for the nuclear localization of polyamide-dye conjugates. Compounds in this series were chosen to provide systematic variation in several structural variables, including dye composition and placement, molecular weight, charge, ordering of the aromatic and aliphatic amino-acid building blocks and overall shape. Nuclear uptake does not appear to be correlated with polyamide molecular weight or with the number of imidazole residues, although the positions of imidazole residues affect nuclear access properties significantly. Generally negative determinants for nuclear access include the presence of a beta-Ala-tail residue and the lack of a cationic alkyl amine moiety, whereas the presence of an acetylated 2,4-diaminobutyric acid-turn is a positive factor for nuclear localization. We discuss implications of these data on the design of polyamide-dye conjugates for use in biological systems.

A General Method for Discovering Inhibitors of Protein–DNA Interactions Using Photonic Crystal Biosensors

PubMed Central

Chan, Leo L.; Pineda, Maria; Heeres, James T.; Hergenrother, Paul J.; Cunningham, Brian T.

2009-01-01

Protein–DNA interactions are essential for fundamental cellular processes such as transcription, DNA damage repair, and apoptosis. As such, small molecule disruptors of these interactions could be powerful tools for investigation of these biological processes, and such compounds would have great potential as therapeutics. Unfortunately, there are few methods available for the rapid identification of compounds that disrupt protein–DNA interactions. Here we show that photonic crystal (PC) technology can be utilized to detect protein–DNA interactions, and can be used in a high-throughput screening mode to identify compounds that prevent protein–DNA binding. The PC technology is used to detect binding between protein–DNA interactions that are DNA-sequence-dependent (the bacterial toxin–antitoxin system MazEF) and those that are DNA-sequence-independent (the human apoptosis inducing factor (AIF)). The PC technology was further utilized in a screen for inhibitors of the AIF–DNA interaction, and through this screen aurin tricarboxylic acid was identified as the first in vitro inhibitor of AIF. The generality and simplicity of the photonic crystal method should enable this technology to find broad utility for identification of compounds that inhibit protein–DNA binding. PMID:18582039

Exploring the Interactions of the Dietary Plant Flavonoids Fisetin and Naringenin with G-Quadruplex and Duplex DNA, Showing Contrasting Binding Behavior: Spectroscopic and Molecular Modeling Approaches.

PubMed

Bhattacharjee, Snehasish; Chakraborty, Sandipan; Sengupta, Pradeep K; Bhowmik, Sudipta

2016-09-01

Guanine-rich sequences have the propensity to fold into a four-stranded DNA structure known as a G-quadruplex (G4). G4 forming sequences are abundant in the promoter region of several oncogenes and become a key target for anticancer drug binding. Here we have studied the interactions of two structurally similar dietary plant flavonoids fisetin and naringenin with G4 as well as double stranded (duplex) DNA by using different spectroscopic and modeling techniques. Our study demonstrates the differential binding ability of the two flavonoids with G4 and duplex DNA. Fisetin more strongly interacts with parallel G4 structure than duplex DNA, whereas naringenin shows stronger binding affinity to duplex rather than G4 DNA. Molecular docking results also corroborate our spectroscopic results, and it was found that both of the ligands are stacked externally in the G4 DNA structure. C-ring planarity of the flavonoid structure appears to be a crucial factor for preferential G4 DNA recognition of flavonoids. The goal of this study is to explore the critical effects of small differences in the structure of closely similar chemical classes of such small molecules (flavonoids) which lead to the contrasting binding properties with the two different forms of DNA. The resulting insights may be expected to facilitate the designing of the highly selective G4 DNA binders based on flavonoid scaffolds.

Internal twisting motion dependent conductance of an aperiodic DNA molecule

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

Reactivation of mutant p53: Constraints on mechanism highlighted by principal component analysis of the DNA binding domain.

PubMed

Ouaray, Zahra; ElSawy, Karim M; Lane, David P; Essex, Jonathan W; Verma, Chandra

2016-10-01

Most p53 mutations associated with cancer are located in its DNA binding domain (DBD). Many structures (X-ray and NMR) of this domain are available in the protein data bank (PDB) and a vast conformational heterogeneity characterizes the various free and complexed states. The major difference between the apo and the holo-complexed states appears to lie in the L1 loop. In particular, the conformations of this loop appear to depend intimately on the sequence of DNA to which it binds. This conclusion builds upon recent observations that implicate the tetramerization and the C-terminal domains (respectively TD and Cter) in DNA binding specificity. Detailed PCA analysis of the most recent collection of DBD structures from the PDB have been carried out. In contrast to recommendations that small molecules/drugs stabilize the flexible L1 loop to rescue mutant p53, our study highlights a need to retain the flexibility of the p53 DNA binding surface (DBS). It is the adaptability of this region that enables p53 to engage in the diverse interactions responsible for its functionality. Proteins 2016; 84:1443-1461. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Molecularly Imprinted Polymers with DNA Aptamer Fragments as Macromonomers.

PubMed

Zhang, Zijie; Liu, Juewen

2016-03-01

Molecularly imprinted polymers (MIPs) are produced in the presence of a template molecule. After removing the template, the cavity can selectively rebind the template. MIPs are attractive functional materials with a low cost and high stability, but traditional MIPs often suffer from low binding affinity. This study employs DNA aptamer fragments as macromonomers to improve MIPs. The DNA aptamer for adenosine was first split into two halves, fluorescently labeled, and copolymerized into MIPs. With a fluorescence quenching assay, the importance of imprinting was confirmed. Further studies were carried out using isothermal titration calorimetry (ITC). Compared to the mixture of the free aptamer fragments, their MIPs doubled the binding affinity. Each free aptamer fragment alone cannot bind adenosine, whereas MIPs containing each fragment are effective binders. We further shortened one of the aptamer fragments, and the DNA length was pushed to as short as six nucleotides, yielding MIPs with a dissociation constant of 27 μM adenosine. This study provides a new method for preparing functional MIP materials by combining high-affinity biopolymer fragments with low-cost synthetic monomers, allowing higher binding affinity and providing a method for signaling binding based on DNA chemistry.

Structure and dynamics of proflavine association around DNA.

PubMed

Sasikala, Wilbee D; Mukherjee, Arnab

2016-04-21

Proflavine is a small molecule that intercalates into DNA and, thereby, acts as an anticancer agent. Intercalation of proflavine is shown to be a two-step process in which the first step is believed to be the formation of a pre-intercalative outside bound state. Experimental studies so far have been unable to capture the nature of the outside bound state. However, the sub-millisecond timescale observed in fluorescence kinetic experiments is often attributed to the binding of proflavine outside of DNA. Here, we have performed molecular dynamics simulations with multiple proflavine molecules to study the structure and dynamics of the formation of the outside bound state of DNA at different ion concentrations. We observed that the timescale of the outside bound state formation is, at least, five orders of magnitude faster (in nanoseconds) than the experimentally reported timescale (sub-milliseconds) attributed to binding outside DNA. Moreover, we also observed the stacked arrangement of proflavine all around DNA, which is different from the experimentally predicted stacking arrangement perpendicular to the helical axis of DNA in the close vicinity of the phosphate groups. This study, therefore, provides insight into the molecular structure and dynamics of the pre-intercalative outside bound state and will help in understanding the overall intercalation mechanism.

Binding regularities in complexes of transcription factors with operator DNA: homeodomain family.

PubMed

Chirgadze, Yu N; Zheltukhin, E I; Polozov, R V; Sivozhelezov, V S; Ivanov, V V

2009-06-01

In order to disclose general regularities of binding in homeodomain-DNA complexes we considered five of them and extended the observed regularities over the entire homeodomain family. The five complexes have been selected by similarity of protein structures and patterns of contacting residues. Their long range interactions and interfaces were compared. The long-range stage of the recognition process was characterized by electrostatic potentials about 5 Angstrom away from molecular surfaces of protein or DNA. For proteins, clear positive potential is displayed only at the side contacting the DNA. The double-chained DNA molecule displays a rather strong negative potential, especially in their grooves. Thus, a functional role of electrostatics is a guiding of the protein into the DNA major groove, so the protein and DNA could form a loose non-specific complex. At the close-range stage, neutralization of the phosphate charges by positively charged residues is necessary for decreasing the strong electrostatic potential of DNA, allowing nucleotide bases to participate in the formation of protein-DNA atomic contacts in the interface. The recognizing alpha-helix of protein was shown to form both invariant and variable groups of contacts with DNA by means of certain specific side groups. The invariant contacts included highly specific protein-DNA hydrogen bonds between asparagine and adenine, nonpolar contacts of hydrophobic amino acids serving as a stereochemical barrier for fixing the protein factor on DNA, and an interface cluster of water molecules providing local conformational mobility necessary for the dissociation process. There is a unique water molecule within the interface that is conservative and located at the interface center. Invariant contacts of the proteins are mostly formed with the TAAT motif of the promoter DNA forward strand. While the invariant contacts specify the family of homeodomains, the variable contacts that are formed with the reverse strand of DNA provide specificity of individual complexes within the homeodomain family.

Interaction of cationic surfactants with DNA: a single-molecule study

PubMed Central

Husale, Sudhir; Grange, Wilfried; Karle, Marc; Bürgi, Stephan; Hegner, Martin

2008-01-01

The interaction of cationic surfactants with single dsDNA molecules has been studied using force-measuring optical tweezers. For hydrophobic chains of length 12 and greater, pulling experiments show characteristic features (e.g. hysteresis between the pulling and relaxation curves, force-plateau along the force curves), typical of a condensed phase (compaction of a long DNA into a micron-sized particle). Depending on the length of the hydrophobic chain of the surfactant, we observe different mechanical behaviours of the complex (DNA-surfactants), which provide evidence for different binding modes. Taken together, our measurements suggest that short-chain surfactants, which do not induce any condensation, could lie down on the DNA surface and directly interact with the DNA grooves through hydrophobic–hydrophobic interactions. In contrast, long-chain surfactants could have their aliphatic tails pointing away from the DNA surface, which could promote inter-molecular interactions between hydrophobic chains and subsequently favour DNA condensation. PMID:18203749

Modified naphthalene diimide as a suitable tetraplex DNA ligand: application to cancer diagnosis and anti-cancer drug

NASA Astrophysics Data System (ADS)

Takenaka, Shigeori

2017-07-01

It is known that naphthalene diimide carrying two substituents binds to DNA duplex with threading intercalation. Naphthalene diimide carrying ferrocene moieties, ferrocenylnaphthalene diimide (FND), formed a stable complex with DNA duplex and an electrochemical gene detection was achieved with current signal generated from FND bound to the DNA duplex between target DNA and DNA probe immobilized electrode. FND couldn't bind to the mismatched and its surrounding region of DNA duplex and thus FND was applied to the precision detection of single nucleotide polymorphisms (SNPs) using the improved discrimination ability between fully matched and mismatched DNA hybrids and multi-electrode chip. Some of FND derivatives bound to telomere DNA tetraplex stronger than to DNA duplex and was applied to cancer diagnosis as a measure of the elongated telomere DNA with telomerase as a suitable maker of cancer. Furthermore, cyclic naphthalene diimides realized the extremely high preference for DNA tetraplex over DNA duplex. Such molecules will open an effective anti-cancer drug based on telomerase specific inhibitor.

DNA complexes with dyes designed for energy transfer as fluorescent markers

DOEpatents

Glazer, A.N.; Benson, S.C.

1997-07-08

Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated. 4 figs.

DNA complexes with dyes designed for energy transfer as fluorescent markers

DOEpatents

Glazer, A.M.; Benson, S.C.

1998-06-16

Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated. 4 figs.

DNA complexes with dyes designed for energy transfer as fluorescent markers

DOEpatents

Glazer, A.N.; Benson, S.C.

1995-03-28

Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated. 4 figures.

DNA Photo Lithography with Cinnamate-based Photo-Bio-Nano-Glue

NASA Astrophysics Data System (ADS)

Feng, Lang; Li, Minfeng; Romulus, Joy; Sha, Ruojie; Royer, John; Wu, Kun-Ta; Xu, Qin; Seeman, Nadrian; Weck, Marcus; Chaikin, Paul

2013-03-01

We present a technique to make patterned functional surfaces, using a cinnamate photo cross-linker and photolithography. We have designed and modified a complementary set of single DNA strands to incorporate a pair of opposing cinnamate molecules. On exposure to 360nm UV, the cinnamate makes a highly specific covalent bond permanently linking only the complementary strands containing the cinnamates. We have studied this specific and efficient crosslinking with cinnamate-containing DNA in solution and on particles. UV addressability allows us to pattern surfaces functionally. The entire surface is coated with a DNA sequence A incorporating cinnamate. DNA strands A'B with one end containing a complementary cinnamated sequence A' attached to another sequence B, are then hybridized to the surface. UV photolithography is used to bind the A'B strand in a specific pattern. The system is heated and the unbound DNA is washed away. The pattern is then observed by thermo-reversibly hybridizing either fluorescently dyed B' strands complementary to B, or colloids coated with B' strands. Our techniques can be used to reversibly and/or permanently bind, via DNA linkers, an assortment of molecules, proteins and nanostructures. Potential applications range from advanced self-assembly, such as templated self-replication schemes recently reported, to designed physical and chemical patterns, to high-resolution multi-functional DNA surfaces for genetic detection or DNA computing.

Conjugates of classical DNA/RNA binder with nucleobase: chemical, biochemical and biomedical applications.

PubMed

Saftic, Dijana; Ban, Zeljka; Matic, Josipa; Tumir, Lidija-Marija; Piantanida, Ivo

2018-05-07

Among the most intensively studied classes of small molecules (molecular weight < 650) in biomedical research are small molecules that non-covalently bind to DNA/RNA, and another intensively studied class are nucleobase derivatives. Both classes have been intensively elaborated in many books and reviews. However, conjugates consisting of DNA/RNA binder covalently linked to nucleobase are much less studied and have not been reviewed in the last two decades. Therefore, this review summarized reports on the design of classical DNA/RNA binder - nucleobase conjugates, as well as data about their interactions with various DNA or RNA targets, and even in some cases protein targets involved. According to these data, the most important structural aspects of selective or even specific recognition between small molecule and target are proposed, and where possible related biochemical and biomedical aspects were discussed. The general conclusion is that this, rather new class of molecules showed an amazing set of recognition tools for numerous DNA or RNA targets in the last two decades, as well as few intriguing in vitro and in vivo selectivities. Several lead research lines show promising advancements toward either novel, highly selective markers or bioactive, potentially druggable molecules. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Mechanistic insight into ligand binding to G-quadruplex DNA

PubMed Central

Di Leva, Francesco Saverio; Novellino, Ettore; Cavalli, Andrea; Parrinello, Michele; Limongelli, Vittorio

2014-01-01

Specific guanine-rich regions in human genome can form higher-order DNA structures called G-quadruplexes, which regulate many relevant biological processes. For instance, the formation of G-quadruplex at telomeres can alter cellular functions, inducing apoptosis. Thus, developing small molecules that are able to bind and stabilize the telomeric G-quadruplexes represents an attractive strategy for antitumor therapy. An example is 3-(benzo[d]thiazol-2-yl)-7-hydroxy-8-((4-(2-hydroxyethyl)piperazin-1-yl)methyl)-2H-chromen-2-one (compound 1), recently identified as potent ligand of the G-quadruplex [d(TGGGGT)]4 with promising in vitro antitumor activity. The experimental observations are suggestive of a complex binding mechanism that, despite efforts, has defied full characterization. Here, we provide through metadynamics simulations a comprehensive understanding of the binding mechanism of 1 to the G-quadruplex [d(TGGGGT)]4. In our calculations, the ligand explores all the available binding sites on the DNA structure and the free-energy landscape of the whole binding process is computed. We have thus disclosed a peculiar hopping binding mechanism whereas 1 is able to bind both to the groove and to the 3’ end of the G-quadruplex. Our results fully explain the available experimental data, rendering our approach of great value for further ligand/DNA studies. PMID:24753420

DNA as a Target for Anticancer Phen-Imidazole Pd(II) Complexes.

PubMed

Heydari, Maryam; Moghadam, Mahboube Eslami; Tarlani, AliAkbar; Farhangian, Hossein

2017-05-01

Imidazole ring is a known structure in many natural or synthetic drug molecules and its metal complexes can interact with DNA and do the cleavage. Hence, to study the influence of the structure and size of the ligand on biological behavior of metal complexes, two water-soluble Pd(II) complexes of phen and FIP ligands (where phen is 1,10-phenanthroline and FIP is 2-(Furan-2-yl)-1H-Imidazo[4,5-f][1, 10]phenanthroline) with the formula of [Pd(phen)(FIP)](NO 3 ) 2 and [Pd(FIP) 2 ]Cl 2 , that were activated against chronic myelogenous leukemia cell line, K562, were selected. Also, the interaction of these anticancer Pd(II) complexes with highly polymerized calf thymus DNA was extensively studied by means of electronic absorption, fluorescence, and circular dichroism in Tris-buffer. The results showed that the binding was positive cooperation and [Pd(phen)(FIP)](NO 3 ) 2 (K f  = 127 M -1 G = 1.2) exhibited higher binding constant and number of binding sites than [Pd(FIP) 2 ]Cl 2 (K f  = 13 M -1 G = 1.03) upon binding to DNA. The fluorescence data indicates that quenching effect for [Pd(phen)(FIP)](NO 3 ) 2 (K SV  = 58 mM -1 ) was higher than [Pd(FIP) 2 ]Cl 2 (K SV  = 12 mM -1 ). Also, [Pd(FIP) 2 ]Cl 2 interacts with ethidium bromide-DNA, as non-competitive inhibition, and can bind to DNA via groove binding and [Pd(phen)(FIP)](NO 3 ) 2 can intercalate in DNA. These results were confirmed by circular dichroism spectra. Docking data revealed that longer complexes have higher interaction energy and bind to DNA via groove binding. Graphical Abstract Two anticancer Pd(II) complexes of imidazole derivative have been synthesized and interacted with calf thymus DNA. Modes of binding have been studied by electronic absorption, fluorescence, and CD measurements. [Pd(FIP) 2 ]Cl 2 can bind to DNA via groove binding while intercalation mode of binding is observed for [Pd(phen)(FIP)](NO 3 ) 2 .

Activation-induced deoxycytidine deaminase (AID) co-transcriptional scanning at single-molecule resolution

NASA Astrophysics Data System (ADS)

Senavirathne, Gayan; Bertram, Jeffrey G.; Jaszczur, Malgorzata; Chaurasiya, Kathy R.; Pham, Phuong; Mak, Chi H.; Goodman, Myron F.; Rueda, David

2015-12-01

Activation-induced deoxycytidine deaminase (AID) generates antibody diversity in B cells by initiating somatic hypermutation (SHM) and class-switch recombination (CSR) during transcription of immunoglobulin variable (IgV) and switch region (IgS) DNA. Using single-molecule FRET, we show that AID binds to transcribed dsDNA and translocates unidirectionally in concert with RNA polymerase (RNAP) on moving transcription bubbles, while increasing the fraction of stalled bubbles. AID scans randomly when constrained in an 8 nt model bubble. When unconstrained on single-stranded (ss) DNA, AID moves in random bidirectional short slides/hops over the entire molecule while remaining bound for ~5 min. Our analysis distinguishes dynamic scanning from static ssDNA creasing. That AID alone can track along with RNAP during transcription and scan within stalled transcription bubbles suggests a mechanism by which AID can initiate SHM and CSR when properly regulated, yet when unregulated can access non-Ig genes and cause cancer.

Studies on the interaction of apigenin with calf thymus DNA by spectroscopic methods

NASA Astrophysics Data System (ADS)

Zhang, Shufang; Sun, Xuejun; Kong, Rongmei; Xu, Mingming

2015-02-01

The interaction between apigenin and calf thymus deoxyribonucleic acid (ctDNA) in a pH 7.4 Tris-HCl buffer solution was investigated by UV-Vis spectroscopy, fluorescence spectroscopy, DNA melting techniques, and viscosity measurements. It was found that apigenin molecules could intercalate into the base pairs of DNA, forming a apigenin-DNA complex with a binding constant of K310K = 6.4 × 104 L mol-1. The thermodynamic parameters enthalpy change (ΔH), entropy change (ΔS) and Gibbs free energy (ΔG) were calculated to be 7.36 × 104 J mol-1, 329 J K-1 mol-1 and -2.84 × 104 J mol-1 at 310 K, respectively. Hydrophobic interaction was the predominant intermolecular force in stabilizing the apigenin-DNA complex. Thermal denaturation study suggested that the stabilization of the ctDNA helix was increased when the apigenin binding to ctDNA as indicated by the increase in thermal denaturation temperature of ctDNA at around 5.0 °C in the presence of apigenin. Spectroscopic techniques together with melting techniques and viscosity determination provided evidences of intercalation mode of binding for the interaction between apigenin and ctDNA.

The DnaA Tale

PubMed Central

Hansen, Flemming G.; Atlung, Tove

2018-01-01

More than 50 years have passed since the presentation of the Replicon Model which states that a positively acting initiator interacts with a specific site on a circular chromosome molecule to initiate DNA replication. Since then, the origin of chromosome replication, oriC, has been determined as a specific region that carries sequences required for binding of positively acting initiator proteins, DnaA-boxes and DnaA proteins, respectively. In this review we will give a historical overview of significant findings which have led to the very detailed knowledge we now possess about the initiation process in bacteria using Escherichia coli as the model organism, but emphasizing that virtually all bacteria have DnaA proteins that interacts with DnaA boxes to initiate chromosome replication. We will discuss the dnaA gene regulation, the special features of the dnaA gene expression, promoter strength, and translation efficiency, as well as, the DnaA protein, its concentration, its binding to DnaA-boxes, and its binding of ATP or ADP. Furthermore, we will discuss the different models for regulation of initiation which have been proposed over the years, with particular emphasis on the Initiator Titration Model. PMID:29541066

Targeting Mycobacterium tuberculosis Topoisomerase I by Small-Molecule Inhibitors

PubMed Central

Godbole, Adwait Anand; Ahmed, Wareed; Bhat, Rajeshwari Subray; Bradley, Erin K.; Ekins, Sean

2014-01-01

We describe inhibition of Mycobacterium tuberculosis topoisomerase I (MttopoI), an essential mycobacterial enzyme, by two related compounds, imipramine and norclomipramine, of which imipramine is clinically used as an antidepressant. These molecules showed growth inhibition of both Mycobacterium smegmatis and M. tuberculosis cells. The mechanism of action of these two molecules was investigated by analyzing the individual steps of the topoisomerase I (topoI) reaction cycle. The compounds stimulated cleavage, thereby perturbing the cleavage-religation equilibrium. Consequently, these molecules inhibited the growth of the cells overexpressing topoI at a low MIC. Docking of the molecules on the MttopoI model suggested that they bind near the metal binding site of the enzyme. The DNA relaxation activity of the metal binding mutants harboring mutations in the DxDxE motif was differentially affected by the molecules, suggesting that the metal coordinating residues contribute to the interaction of the enzyme with the drug. Taken together, the results highlight the potential of these small molecules, which poison the M. tuberculosis and M. smegmatis topoisomerase I, as leads for the development of improved molecules to combat mycobacterial infections. Moreover, targeting metal coordination in topoisomerases might be a general strategy to develop new lead molecules. PMID:25534741

Structure-activity studies of dicationically substituted bis-benzimidazoles against Giardia lamblia: correlation of antigiardial activity with DNA binding affinity and giardial topoisomerase II inhibition.

PubMed Central

Bell, C A; Dykstra, C C; Naiman, N A; Cory, M; Fairley, T A; Tidwell, R R

1993-01-01

Nine dicationically substituted bis-benzimidazoles were examined for their in vitro activities against Giardia lamblia WB (ATCC 30957). The potential mechanisms of action of these compounds were evaluated by investigating the relationship among in vitro antigiardial activity and the affinity of the molecules for DNA and their ability to inhibit the activity of giardial topoisomerase II. Each compound demonstrated antigiardial activity, as measured by assessing the incorporation of [methyl-3H]thymidine by giardial trophozoites exposed to the test agents. Three compounds exhibited excellent in vitro antigiardial activities, with 50% inhibitory concentrations which compared very favorably with those of two currently used drugs, quinacrine HCl and metronidazole. Putative mechanisms of action for these compounds were suggested by the strong correlation observed among in vitro antigiardial activity and the affinity of the molecules for natural and synthetic DNA and their ability to inhibit the relaxation activity of giardial topoisomerase II. A strong correlation between the DNA binding affinity of these compounds and their inhibition of giardial topoisomerase II activity was also observed. Images PMID:8109934

Synthesis of galactosyl compounds for targeted gene delivery.

PubMed

Ren, T; Zhang, G; Liu, D

2001-11-01

Cell-specific DNA delivery offers a great potential for targeted gene therapy. Toward this end, we have synthesized a series of compounds carrying galactose residues as a targeting ligand for asialoglycoprotein receptors of hepatocytes and primary amine groups as a functional domain for DNA binding. Biological activity of these galactosyl compounds in DNA delivery was evaluated in HepG2 and BL-6 cells and compared with respect to the number of galactose residues as well as primary amine groups in each molecule. Transfection experiments using a firefly luciferase gene as a reporter revealed that compounds with multivalent binding properties were more active in DNA delivery. An optimal transfection activity in HepG2 cells requires seven primary amine groups and a minimum of two galactose residues in each molecule. The transfection activity of compounds carrying multi-galactose residues can be inhibited by asialofetuin, a natural substrate for asialoglycoprotein receptors of hepatocytes, suggesting that gene transfer by these galactosyl compounds is asialoglycoprotein receptor-mediated. These results provide direct evidence in support of our new strategy for the use of small and synthetic compounds for cell specific and targeted gene delivery.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Changela, Anita; DiGate, Russell J.; Mondragon, Alfonso

Escherichia coli DNA topoisomerase III belongs to the type IA family of DNA topoisomerases, which transiently cleave single-stranded DNA (ssDNA) via a 5{prime} phosphotyrosine intermediate. We have solved crystal structures of wild-type E. coli topoisomerase III bound to an eight-base ssDNA molecule in three different pH environments. The structures reveal the enzyme in three distinct conformational states while bound to DNA. One conformation resembles the one observed previously with a DNA-bound, catalytically inactive mutant of topoisomerase III where DNA binding realigns catalytic residues to form a functional active site. Another conformation represents a novel intermediate in which DNA is boundmore » along the ssDNA-binding groove but does not enter the active site, which remains in a catalytically inactive, closed state. A third conformation shows an intermediate state where the enzyme is still in a closed state, but the ssDNA is starting to invade the active site. For the first time, the active site region in the presence of both the catalytic tyrosine and ssDNA substrate is revealed for a type IA DNA topoisomerase, although there is no evidence of ssDNA cleavage. Comparative analysis of the various conformational states suggests a sequence of domain movements undertaken by the enzyme upon substrate binding.« less

AgI -Induced Switching of DNA Binding Modes via Formation of a Supramolecular Metallacycle.

PubMed

Basak, Shibaji; Léon, J Christian; Ferranco, Annaleizle; Sharma, Renu; Hebenbrock, Marian; Lough, Alan; Müller, Jens; Kraatz, Heinz-Bernhard

2018-03-12

The histidine derivative L1 of the DNA intercalator naphthalenediimide (NDI) forms a triangular Ag I complex (C2). The interactions of L1 and of C2 with DNA were studied by circular dichroism (CD) and UV/Vis spectroscopy and by viscosity studies. Different binding modes were observed for L1 and for C2, as the Ag I complex C2 is too large in size to act as an intercalator. If Ag I is added to the NDI molecule that is already intercalated into a duplex, higher order complexes are formed within the DNA duplex and cause disruptions in the helical duplex structure, which leads to a significant decrease in the characteristic CD features of B-DNA. Thus, via addition of a metal we show how a classic and well-known organic intercalator unit can be turned into a partial metallo insertor. We also show how electrochemical impedance spectroscopy (EIS) can be used to probe DNA binding modes on DNA films that are immobilized on gold surfaces. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Zn2+ selectively stabilizes FdU-substituted DNA through a unique major groove binding motif

PubMed Central

Ghosh, Supratim; Salsbury, Freddie R.; Horita, David A.; Gmeiner, William H.

2011-01-01

We report, based on semi-empirical calculations, that Zn2+ binds duplex DNA containing consecutive FdU–dA base pairs in the major groove with distorted trigonal bipyramidal geometry. In this previously uncharacterized binding motif, O4 and F5 on consecutive FdU are axial ligands while three water molecules complete the coordination sphere. NMR spectroscopy confirmed Zn2+ complexation occurred with maintenance of base pairing while a slight hypsochromic shift in circular dichroism (CD) spectra indicated moderate structural distortion relative to B-form DNA. Zn2+ complexation inhibited ethidium bromide (EtBr) intercalation and stabilized FdU-substituted duplex DNA (ΔTm > 15°C). Mg2+ neither inhibited EtBr complexation nor had as strong of a stabilizing effect. DNA sequences that did not contain consecutive FdU were not stabilized by Zn2+. A lipofectamine preparation of the Zn2+–DNA complex displayed enhanced cytotoxicity toward prostate cancer cells relative to the individual components prepared as lipofectamine complexes indicating the potential utility of Zn2+–DNA complexes for cancer treatment. PMID:21296761

Force-extension behavior of DNA in the presence of DNA-bending nucleoid associated proteins

NASA Astrophysics Data System (ADS)

Dahlke, K.; Sing, C. E.

2018-02-01

Interactions between nucleoid associated proteins (NAPs) and DNA affect DNA polymer conformation, leading to phenomena such as concentration dependent force-extension behavior. These effects, in turn, also impact the local binding behavior of the protein, such as high forces causing proteins to unbind, or proteins binding favorably to locally bent DNA. We develop a coarse-grained NAP-DNA simulation model that incorporates both force- and concentration-dependent behaviors, in order to study the interplay between NAP binding and DNA conformation. This model system includes multi-state protein binding and unbinding, motivated by prior work, but is now dependent on the local structure of the DNA, which is related to external forces acting on the DNA strand. We observe the expected qualitative binding behavior, where more proteins are bound at lower forces than at higher forces. Our model also includes NAP-induced DNA bending, which affects DNA elasticity. We see semi-quantitative matching of our simulated force-extension behavior to the reported experimental data. By using a coarse-grained simulation, we are also able to look at non-equilibrium behaviors, such as dynamic extension of a DNA strand. We stretch a DNA strand at different rates and at different NAP concentrations to observe how the time scales of the system (such as pulling time and unbinding time) work in concert. When these time scales are similar, we observe measurable rate-dependent changes in the system, which include the number of proteins bound and the force required to extend the DNA molecule. This suggests that the relative time scales of different dynamic processes play an important role in the behavior of NAP-DNA systems.

A calmodulin-binding/CGCG box DNA-binding protein family involved in multiple signaling pathways in plants

NASA Technical Reports Server (NTRS)

Yang, Tianbao; Poovaiah, B. W.

2002-01-01

We reported earlier that the tobacco early ethylene-responsive gene NtER1 encodes a calmodulin-binding protein (Yang, T., and Poovaiah, B. W. (2000) J. Biol. Chem. 275, 38467-38473). Here we demonstrate that there is one NtER1 homolog as well as five related genes in Arabidopsis. These six genes are rapidly and differentially induced by environmental signals such as temperature extremes, UVB, salt, and wounding; hormones such as ethylene and abscisic acid; and signal molecules such as methyl jasmonate, H(2)O(2), and salicylic acid. Hence, they were designated as AtSR1-6 (Arabidopsis thaliana signal-responsive genes). Ca(2+)/calmodulin binds to all AtSRs, and their calmodulin-binding regions are located on a conserved basic amphiphilic alpha-helical motif in the C terminus. AtSR1 targets the nucleus and specifically recognizes a novel 6-bp CGCG box (A/C/G)CGCG(G/T/C). The multiple CGCG cis-elements are found in promoters of genes such as those involved in ethylene signaling, abscisic acid signaling, and light signal perception. The DNA-binding domain in AtSR1 is located on the N-terminal 146 bp where all AtSR1-related proteins share high similarity but have no similarity to other known DNA-binding proteins. The calmodulin-binding nuclear proteins isolated from wounded leaves exhibit specific CGCG box DNA binding activities. These results suggest that the AtSR gene family encodes a family of calmodulin-binding/DNA-binding proteins involved in multiple signal transduction pathways in plants.

Visualizing Chemical Interaction Dynamics of Confined DNA Molecules

NASA Astrophysics Data System (ADS)

Henkin, Gilead; Berard, Daniel; Stabile, Frank; Leslie, Sabrina

We present a novel nanofluidic approach to controllably introducing reagent molecules to interact with confined biopolymers and visualizing the reaction dynamics in real time. By dynamically deforming a flow cell using CLiC (Convex Lens-induced Confinement) microscopy, we are able to tune reaction chamber dimensions from micrometer to nanometer scales. We apply this gentle deformation to load and extend DNA polymers within embedded nanotopographies and visualize their interactions with other molecules in solution. Quantifying the change in configuration of polymers within embedded nanotopographies in response to binding/unbinding of reagent molecules provides new insights into their consequent change in physical properties. CLiC technology enables an ultra sensitive, massively parallel biochemical analysis platform which can acces a broader range of interaction parameters than existing devices.

Theoretical study on the binding mechanism between N6-methyladenine and natural DNA bases.

PubMed

Song, Qi-Xia; Ding, Zhen-Dong; Liu, Jian-Hua; Li, Yan; Wang, Hai-Jun

2013-03-01

N6-methyladenine (m(6)A) is a rare base naturally occurring in DNA. It is different from the base adenine due to its N-CH(3). Therefore, the base not only pairs with thymine, but also with other DNA bases (cytosine, adenine and guanine). In this work, Møller-Plesset second-order (MP2) method has been used to investigate the binding mechanism between m(6)A and natural DNA bases in gas phase and in aqueous solution. The results show that N-CH(3) changed the way of N6-methyladenine binding to natural DNA bases. The binding style significantly influences the stability of base pairs. The trans-m(6)A:G and trans-m(6)A:C conformers are the most stable among all the base pairs. The existence of solvent can remarkably reduce the stability of the base pairs, and the DNA bases prefer pairing with trans-m(6)A to cis-m(6)A. Besides, the properties of these hydrogen bonds have been analyzed by atom in molecules (AIM) theory, natural bond orbital (NBO) analysis and Wiberg bond indexes (WBI). In addition, pairing with m(6)A decreases the binding energies compared to the normal Watson-Crick base pairs, it may explain the instability of the N6 site methylated DNA in theory.

The force-dependent mechanism of DnaK-mediated mechanical folding

PubMed Central

Perales-Calvo, Judit; Giganti, David; Stirnemann, Guillaume; Garcia-Manyes, Sergi

2018-01-01

It is well established that chaperones modulate the protein folding free-energy landscape. However, the molecular determinants underlying chaperone-mediated mechanical folding remain largely elusive, primarily because the force-extended unfolded conformation fundamentally differs from that characterized in biochemistry experiments. We use single-molecule force-clamp spectroscopy, combined with molecular dynamics simulations, to study the effect that the Hsp70 system has on the mechanical folding of three mechanically stiff model proteins. Our results demonstrate that, when working independently, DnaJ (Hsp40) and DnaK (Hsp70) work as holdases, blocking refolding by binding to distinct substrate conformations. Whereas DnaK binds to molten globule–like forms, DnaJ recognizes a cryptic sequence in the extended state in an unanticipated force-dependent manner. By contrast, the synergetic coupling of the Hsp70 system exhibits a marked foldase behavior. Our results offer unprecedented molecular and kinetic insights into the mechanisms by which mechanical force finely regulates chaperone binding, directly affecting protein elasticity. PMID:29487911

Highly sensitive self-complementary DNA nanoswitches triggered by polyelectrolytes.

PubMed

Wu, Jincai; Yu, Feng; Zhang, Zheng; Chen, Yong; Du, Jie; Maruyama, Atsushi

2016-01-07

Dimerization of two homologous strands of genomic DNA/RNA is an essential feature of retroviral replication. Herein we show that a cationic comb-type copolymer (CCC), poly(L-lysine)-graft-dextran, accelerates the dimerization of self-complementary stem-loop DNA, frequently found in functional DNA/RNA molecules, such as aptamers. Furthermore, an anionic polymer poly(sodium vinylsulfonate) (PVS) dissociates CCC from the duplex shortly within a few seconds. Then single stem-loop DNA spontaneously transforms from its dimer. Thus we can easily control the dimer and stem-loop DNA by switching on/off CCC activity. Both polyelectrolytes and DNA concentrations are in the nanomole per liter range. The polyelectrolyte-assisted transconformation and sequences design strategy ensures the reversible state control with rapid response and effective switching under physiologically relevant conditions. A further application of this sensitive assembly is to construct an aptamer-type drug delivery system, bind or release functional molecules responding to its transconformation.

Small-Molecule-Based Self-Assembled Ligands for G-Quadruplex DNA Surface Recognition.

PubMed

Rivera-Sánchez, María Del C; García-Arriaga, Marilyn; Hobley, Gerard; Morales-de-Echegaray, Ana V; Rivera, José M

2017-10-31

Most drugs are small molecules because of their attractive pharmacokinetics, manageable development and manufacturing, and effective binding into the concave crevices of bio-macromolecules. Despite these features, they often fall short when it comes to effectively recognizing the surfaces of bio-macromolecules. One way to overcome the challenge of biomolecular surface recognition is to develop small molecules that become self-assembled ligands (SALs) prior to binding. Herein, we report SALs made from 8-aryl-2'-deoxyguanosine derivatives forming precise hydrophilic supramolecular G-quadruplexes (SGQs) with excellent size, shape, and charge complementarity to G-quadruplex DNA (QDNA). We show that only those compounds forming SGQs act as SALs, which in turn differentially stabilize QDNAs from selected oncogene promoters and the human telomeric regions. Fluorescence resonance energy-transfer melting assays are consistent with spectroscopic, calorimetric, and light scattering studies, showing the formation of a "sandwichlike" complex QDNA·SGQ·QDNA. These results open the door for the advent of SALs that recognize QDNAs and potentially the surfaces of other bio-macromolecules such as proteins.

TALE proteins search DNA using a rotationally decoupled mechanism.

PubMed

Cuculis, Luke; Abil, Zhanar; Zhao, Huimin; Schroeder, Charles M

2016-10-01

Transcription activator-like effector (TALE) proteins are a class of programmable DNA-binding proteins used extensively for gene editing. Despite recent progress, however, little is known about their sequence search mechanism. Here, we use single-molecule experiments to study TALE search along DNA. Our results show that TALEs utilize a rotationally decoupled mechanism for nonspecific search, despite remaining associated with DNA templates during the search process. Our results suggest that the protein helical structure enables TALEs to adopt a loosely wrapped conformation around DNA templates during nonspecific search, facilitating rapid one-dimensional (1D) diffusion under a range of solution conditions. Furthermore, this model is consistent with a previously reported two-state mechanism for TALE search that allows these proteins to overcome the search speed-stability paradox. Taken together, our results suggest that TALE search is unique among the broad class of sequence-specific DNA-binding proteins and supports efficient 1D search along DNA.

“Ultra-high resolution optical trap with single fluorophore sensitivity”

PubMed Central

Comstock, Matthew J; Ha, Taekjip; Chemla, Yann R

2013-01-01

We present a single-molecule instrument that combines a timeshared ultra-high resolution dual optical trap interlaced with a confocal fluorescence microscope. In a demonstration experiment, individual single-fluorophore labeled DNA oligonucleotides were observed to bind and unbind to complementary DNA suspended between two trapped beads. Simultaneous with the single-fluorophore detection, coincident angstrom-scale changes in tether extension could be clearly observed. Fluorescence readout allowed us to determine the duplex melting rate as a function of force. The new instrument will enable the simultaneous measurement of angstrom-scale mechanical motion of individual DNA-binding proteins (e.g., single base pair stepping of DNA translocases) along with the detection of fluorescently labeled protein properties (e.g., internal configuration). PMID:21336286

Molecular analyses of dinosaur osteocytes support the presence of endogenous molecules.

PubMed

Schweitzer, Mary Higby; Zheng, Wenxia; Cleland, Timothy P; Bern, Marshall

2013-01-01

The discovery of soft, transparent microstructures in dinosaur bone consistent in morphology with osteocytes was controversial. We hypothesize that, if original, these microstructures will have molecular features in common with extant osteocytes. We present immunological and mass spectrometry evidence for preservation of proteins comprising extant osteocytes (Actin, Tubulin, PHEX, Histone H4) in osteocytes recovered from two non-avian dinosaurs. Furthermore, antibodies to DNA show localized binding to these microstructures, which also react positively with DNA intercalating stains propidium iodide (PI) and 4',6'-diamidino-2-phenylindole dihydrochloride (DAPI). Each antibody binds dinosaur cells in patterns similar to extant cells. These data are the first to support preservation of multiple proteins and to present multiple lines of evidence for material consistent with DNA in dinosaurs, supporting the hypothesis that these structures were part of the once living animals. We propose mechanisms for preservation of cells and component molecules, and discuss implications for dinosaurian cellular biology. Copyright © 2012 Elsevier Inc. All rights reserved.

Aminoglycosylation Can Enhance the G-Quadruplex Binding Activity of Epigallocatechin

PubMed Central

Bai, Li-Ping; Ho, Hing-Man; Ma, Dik-Lung; Yang, Hui; Fu, Wai-Chung; Jiang, Zhi-Hong

2013-01-01

With the aim of enhancing G-quadruplex binding activity, two new glucosaminosides (16, 18) of penta-methylated epigallocatechin were synthesized by chemical glycosylation. Subsequent ESI-TOF-MS analysis demonstrated that these two glucosaminoside derivatives exhibit much stronger binding activity to human telomeric DNA and RNA G-quadruplexes than their parent structure (i.e., methylated EGC) (14) as well as natural epigallocatechin (EGC, 6). The DNA G-quadruplex binding activity of 16 and 18 is even more potent than strong G-quadruplex binder quercetin, which has a more planar structure. These two synthetic compounds also showed a higher binding strength to human telomeric RNA G-quadruplex than its DNA counterpart. Analysis of the structure-activity relationship revealed that the more basic compound, 16, has a higher binding capacity with DNA and RNA G-quadruplexes than its N-acetyl derivative, 18, suggesting the importance of the basicity of the aminoglycoside for G-quadruplex binding activity. Molecular docking simulation predicted that the aromatic ring of 16 π-stacks with the aromatic ring of guanine nucleotides, with the glucosamine moiety residing in the groove of G-quadruplex. This research indicates that glycosylation of natural products with aminosugar can significantly enhance their G-quadruplex binding activities, thus is an effective way to generate small molecules targeting G-quadruplexes in nucleic acids. In addition, this is the first report that green tea catechin can bind to nucleic acid G-quadruplex structures. PMID:23335983

The nature of the force-induced conformation transition of dsDNA studied by using single molecule force spectroscopy.

PubMed

Liu, Ningning; Bu, Tianjia; Song, Yu; Zhang, Wei; Li, Jinjing; Zhang, Wenke; Shen, Jiacong; Li, Hongbin

2010-06-15

Single-stranded DNA binding proteins (SSB) interact with single-stranded DNA (ssDNA) specifically. Taking advantage of this character, we have employed Bacillus subtilis SSB protein to investigate the nature of force-induced conformation transition of double-stranded DNA (dsDNA) by using AFM-based single molecule force spectroscopy (SMFS) technique. Our results show that, when a dsDNA is stretched beyond its contour length, the dsDNA is partially melted, producing some ssDNA segments which can be captured by SSB proteins. We have also systematically investigated the effects of stretching length, waiting time, and salt concentration on the conformation transition of dsDNA and SSB-ssDNA interactions, respectively. Furthermore, the effect of proflavine, a DNA intercalator, on the SSB-DNA interactions has been investigated, and the results indicate that the proflavine-saturated dsDNA can be stabilized to the extent that the dsDNA will no longer melt into ssDNA under the mechanical force even up to 150 pN, and no SSB-DNA interactions are detectable.

Spermine Condenses DNA, but Not RNA Duplexes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Katz, Andrea M.; Tolokh, Igor S.; Pabit, Suzette A.

Interactions between the polyamine spermine and nucleic acids drive important cellular processes. Spermine condenses DNA, and some RNAs such as poly(rA):poly(rU). A large fraction of the spermine present in cells is bound to RNA, but apparently does not condense it. Here, we study the effect of spermine binding to short duplex RNA and DNA and compare our findings with predictions of molecular dynamics simulations. When small numbers of spermine are introduced, RNA with a designed sequence, containing a mixture of 14 GC pairs and 11 AU pairs, resists condensation relative to DNA of an equivalent sequence or to 25 basemore » pair poly(rA):poly(rU) RNA. Comparison of wide-angle x-ray scattering profiles with simulation suggests that spermine is sequestered deep within the major groove of mixed sequence RNA, preventing condensation by limiting opportunities to bridge to other molecules as well as stabilizing the RNA by locking it into a particular conformation. In contrast, for DNA, simulations suggest that spermine binds external to the duplex, offering opportunities for intermolecular interaction. The goal of this study is to explain how RNA can remain soluble, and available for interaction with other molecules in the cell, despite the presence of spermine at concentrations high enough to precipitate DNA.« less

Spectroscopic studies of the interaction of aspirin and its important metabolite, salicylate ion, with DNA, A·T and G·C rich sequences

NASA Astrophysics Data System (ADS)

Bathaie, S. Z.; Nikfarjam, L.; Rahmanpour, R.; Moosavi-Movahedi, A. A.

2010-12-01

Among different biological effects of acetylsalicylic acid (ASA), its anticancer property is controversial. Since ASA hydrolyzes rapidly to salicylic acid (SA), especially in the blood, interaction of both ASA and SA (as the small molecules) with ctDNA, oligo(dA·dT) 15 and oligo(dG·dC) 15, as a possible mechanism of their action, is investigated here. The results show that the rate of ASA hydrolysis in the absence and presence of ctDNA is similar. The spectrophotometric results indicate that both ASA and SA cooperatively bind to ctDNA. The binding constants ( K) are (1.7 ± 0.7) × 10 3 M -1 and (6.7 ± 0.2) × 10 3 M -1 for ASA and SA, respectively. Both ligands quench the fluorescence emission of ethidium bromide (Et)-ctDNA complex. The Scatchard plots indicate the non-displacement based quenching (non-intercalative binding). The circular dichroism (CD) spectra of ASA- or SA-ctDsNA complexes show the minor distortion of ctDNA structure, with no characteristic peaks for intercalation of ligands. Tm of ctDNA is decreased up to 3 °C upon ASA binding. The CD results also indicate more distortions on oligo(dG·dC) 15 structure due to the binding of both ASA and SA in comparison with oligo(dA·dT) 15. All data indicate the more affinity for SA binding with DNA minor groove in comparison with ASA which has more hydrophobic character.

Interaction of the alpha-subunit of Escherichia coli RNA polymerase with DNA: rigid body nature of the protein-DNA contact.

PubMed

Heyduk, E; Baichoo, N; Heyduk, T

2001-11-30

The alpha-subunit of Escherichia coli RNA polymerase plays an important role in the activity of many promoters by providing a direct protein-DNA contact with a specific sequence (UP element) located upstream of the core promoter sequence. To obtain insight into the nature of thermodynamic forces involved in the formation of this protein-DNA contact, the binding of the alpha-subunit of E. coli RNA polymerase to a fluorochrome-labeled DNA fragment containing the rrnB P1 promoter UP element sequence was quantitatively studied using fluorescence polarization. The alpha dimer and DNA formed a 1:1 complex in solution. Complex formation at 25 degrees C was enthalpy-driven, the binding was accompanied by a net release of 1-2 ions, and no significant specific ion effects were observed. The van't Hoff plot of temperature dependence of binding was linear suggesting that the heat capacity change (Deltac(p)) was close to zero. Protein footprinting with hydroxyradicals showed that the protein did not change its conformation upon protein-DNA contact formation. No conformational changes in the DNA molecule were detected by CD spectroscopy upon protein-DNA complex formation. The thermodynamic characteristics of the binding together with the lack of significant conformational changes in the protein and in the DNA suggested that the alpha-subunit formed a rigid body-like contact with the DNA in which a tight complementary recognition interface between alpha-subunit and DNA was not formed.

[Single-molecule detection and characterization of DNA replication based on DNA origami].

PubMed

Wang, Qi; Fan, Youjie; Li, Bin

2014-08-01

To investigate single-molecule detection and characterization of DNA replication. Single-stranded DNA (ssDNA) as the template of DNA replication was attached to DNA origami by a hybridization reaction based on the complementary base-pairing principle. DNA replication catalyzed by E.coli DNA polymerase I Klenow Fragment (KF) was detected using atomic force microscopy (AFM). The height variations between the ssDNA and the double-stranded DNA (dsDNA), the distribution of KF during DNA replication and biotin-streptavidin (BA) complexes on the DNA strand after replication were detected. Agarose gel electrophoresis was employed to analyze the changes in the DNA after replication. The designed ssDNA could be anchored on the target positions of over 50% of the DNA origami. The KF was capable of binding to the ssDNA fixed on DNA origami and performing its catalytic activities, and was finally dissociated from the DNA after replication. The height of DNA strand increased by about 0.7 nm after replication. The addition of streptavidin also resulted in an DNA height increase to about 4.9 nm due to the formation of BA complexes on the biotinylated dsDNA. The resulting dsDNA and BA complex were subsequently confirmed by agarose gel electrophoresis. The combination of AFM and DNA origami allows detection and characterization of DNA replication at the single molecule level, and this approach provides better insights into the mechanism of DNA polymerase and the factors affecting DNA replication.

A graphene-based biosensing platform based on the release of DNA probes and rolling circle amplification.

PubMed

Liu, Meng; Song, Jinping; Shuang, Shaomin; Dong, Chuan; Brennan, John D; Li, Yingfu

2014-06-24

We report a versatile biosensing platform capable of achieving ultrasensitive detection of both small-molecule and macromolecular targets. The system features three components: reduced graphene oxide for its ability to adsorb single-stranded DNA molecules nonspecifically, DNA aptamers for their ability to bind reduced graphene oxide but undergo target-induced conformational changes that facilitate their release from the reduced graphene oxide surface, and rolling circle amplification (RCA) for its ability to amplify a primer-template recognition event into repetitive sequence units that can be easily detected. The key to the design is the tagging of a short primer to an aptamer sequence, which results in a small DNA probe that allows for both effective probe adsorption onto the reduced graphene oxide surface to mask the primer domain in the absence of the target, as well as efficient probe release in the presence of the target to make the primer available for template binding and RCA. We also made an observation that the circular template, which on its own does not cause a detectable level of probe release from the reduced graphene oxide, augments target-induced probe release. The synergistic release of DNA probes is interpreted to be a contributing factor for the high detection sensitivity. The broad utility of the platform is illustrated though engineering three different sensors that are capable of achieving ultrasensitive detection of a protein target, a DNA sequence and a small-molecule analyte. We envision that the approach described herein will find useful applications in the biological, medical, and environmental fields.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Caberoy, Nora B.; Zhou, Yixiong; Alvarado, Gabriela

To efficiently elucidate the biological roles of phosphatidylserine (PS), we developed open-reading-frame (ORF) phage display to identify PS-binding proteins. The procedure of phage panning was optimized with a phage clone expressing MFG-E8, a well-known PS-binding protein. Three rounds of phage panning with ORF phage display cDNA library resulted in {approx}300-fold enrichment in PS-binding activity. A total of 17 PS-binding phage clones were identified. Unlike phage display with conventional cDNA libraries, all 17 PS-binding clones were ORFs encoding 13 real proteins. Sequence analysis revealed that all identified PS-specific phage clones had dimeric basic amino acid residues. GST fusion proteins were expressedmore » for 3 PS-binding proteins and verified for their binding activity to PS liposomes, but not phosphatidylcholine liposomes. These results elucidated previously unknown PS-binding proteins and demonstrated that ORF phage display is a versatile technology capable of efficiently identifying binding proteins for non-protein molecules like PS.« less

Protein associations in DnaA-ATP hydrolysis mediated by the Hda-replicase clamp complex.

PubMed

Su'etsugu, Masayuki; Shimuta, Toh-Ru; Ishida, Takuma; Kawakami, Hironori; Katayama, Tsutomu

2005-02-25

In Escherichia coli, the activity of ATP-bound DnaA protein in initiating chromosomal replication is negatively controlled in a replication-coordinated manner. The RIDA (regulatory inactivation of DnaA) system promotes DnaA-ATP hydrolysis to produce the inactivated form DnaA-ADP in a manner depending on the Hda protein and the DNA-loaded form of the beta-sliding clamp, a subunit of the replicase holoenzyme. A highly functional form of Hda was purified and shown to form a homodimer in solution, and two Hda dimers were found to associate with a single clamp molecule. Purified mutant Hda proteins were used in a staged in vitro RIDA system followed by a pull-down assay to show that Hda-clamp binding is a prerequisite for DnaA-ATP hydrolysis and that binding is mediated by an Hda N-terminal motif. Arg(168) in the AAA(+) Box VII motif of Hda plays a role in stable homodimer formation and in DnaA-ATP hydrolysis, but not in clamp binding. Furthermore, the DnaA N-terminal domain is required for the functional interaction of DnaA with the Hda-clamp complex. Single cells contain approximately 50 Hda dimers, consistent with the results of in vitro experiments. These findings and the features of AAA(+) proteins, including DnaA, suggest the following model. DnaA-ATP is hydrolyzed at a binding interface between the AAA(+) domains of DnaA and Hda; the DnaA N-terminal domain supports this interaction; and the interaction of DnaA-ATP with the Hda-clamp complex occurs in a catalytic mode.

Twenty-five Years of DNA-Encoded Chemical Libraries.

PubMed

Neri, Dario

2017-05-04

Reference library: The availability of DNA-encoded chemical libraries containing billions of compounds facilitates the discovery of binding molecules for pharmaceutical applications and for investigating biological processes. This Special Issue highlights the use of this library technology and some of the latest developments in the field. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Computer-Aided Drug Discovery: Molecular Docking of Diminazene Ligands to DNA Minor Groove

ERIC Educational Resources Information Center

Kholod, Yana; Hoag, Erin; Muratore, Katlynn; Kosenkov, Dmytro

2018-01-01

The reported project-based laboratory unit introduces upper-division undergraduate students to the basics of computer-aided drug discovery as a part of a computational chemistry laboratory course. The students learn to perform model binding of organic molecules (ligands) to the DNA minor groove with computer-aided drug discovery (CADD) tools. The…

Direct Single-Molecule Observation of Mode and Geometry of RecA-Mediated Homology Search.

PubMed

Lee, Andrew J; Endo, Masayuki; Hobbs, Jamie K; Wälti, Christoph

2018-01-23

Genomic integrity, when compromised by accrued DNA lesions, is maintained through efficient repair via homologous recombination. For this process the ubiquitous recombinase A (RecA), and its homologues such as the human Rad51, are of central importance, able to align and exchange homologous sequences within single-stranded and double-stranded DNA in order to swap out defective regions. Here, we directly observe the widely debated mechanism of RecA homology searching at a single-molecule level using high-speed atomic force microscopy (HS-AFM) in combination with tailored DNA origami frames to present the reaction targets in a way suitable for AFM-imaging. We show that RecA nucleoprotein filaments move along DNA substrates via short-distance facilitated diffusions, or slides, interspersed with longer-distance random moves, or hops. Importantly, from the specific interaction geometry, we find that the double-stranded substrate DNA resides in the secondary DNA binding-site within the RecA nucleoprotein filament helical groove during the homology search. This work demonstrates that tailored DNA origami, in conjunction with HS-AFM, can be employed to reveal directly conformational and geometrical information on dynamic protein-DNA interactions which was previously inaccessible at an individual single-molecule level.

Structural Studies of E. coli Topoisomerase III-DNA Complexes Reveal A Novel Type IA Topoisomerase-DNA Conformational Intermediate

PubMed Central

Changela, Anita; DiGate, Russell J.; Mondragón, Alfonso

2007-01-01

Summary E. coli DNA topoisomerase III belongs to the type IA family of DNA topoisomerases, which transiently cleave single-stranded DNA (ssDNA) via a 5′ phosphotyrosine intermediate. We have solved crystal structures of wild-type E. coli topoisomerase III bound to an 8-base ssDNA molecule in three different pH environments. The structures reveal the enzyme in three distinct conformational states while bound to DNA. One conformation resembles the one observed previously with a DNA-bound, catalytically inactive mutant of topoisomerase III where DNA binding realigns catalytic residues to form a functional active site. Another conformation represents a novel intermediate in which DNA is bound along the ssDNA-binding groove but does not enter the active site, which remains in a catalytically inactive, closed state. A third conformation shows an intermediate state where the enzyme is still in a closed state, but the ssDNA is starting to invade the active site. For the first time, the active site region in the presence of both the catalytic tyrosine and ssDNA substrate is revealed for a type IA DNA topoisomerase, although there is no evidence of ssDNA cleavage. Comparative analysis of the various conformational states suggests a sequence of domain movements undertaken by the enzyme upon substrate binding. PMID:17331537

Conditional sterility in plants

DOEpatents

Meagher, Richard B.; McKinney, Elizabeth; Kim, Tehryung

2010-02-23

The present disclosure provides methods, recombinant DNA molecules, recombinant host cells containing the DNA molecules, and transgenic plant cells, plant tissue and plants which contain and express at least one antisense or interference RNA specific for a thiamine biosynthetic coding sequence or a thiamine binding protein or a thiamine-degrading protein, wherein the RNA or thiamine binding protein is expressed under the regulatory control of a transcription regulatory sequence which directs expression in male and/or female reproductive tissue. These transgenic plants are conditionally sterile; i.e., they are fertile only in the presence of exogenous thiamine. Such plants are especially appropriate for use in the seed industry or in the environment, for example, for use in revegetation of contaminated soils or phytoremediation, especially when those transgenic plants also contain and express one or more chimeric genes which confer resistance to contaminants.

Arsenic Directly Binds to and Activates the Yeast AP-1-Like Transcription Factor Yap8

PubMed Central

Kumar, Nallani Vijay; Yang, Jianbo; Pillai, Jitesh K.; Rawat, Swati; Solano, Carlos; Kumar, Abhay; Grøtli, Morten; Stemmler, Timothy L.; Rosen, Barry P.

2015-01-01

The AP-1-like transcription factor Yap8 is critical for arsenic tolerance in the yeast Saccharomyces cerevisiae. However, the mechanism by which Yap8 senses the presence of arsenic and activates transcription of detoxification genes is unknown. Here we demonstrate that Yap8 directly binds to trivalent arsenite [As(III)] in vitro and in vivo and that approximately one As(III) molecule is bound per molecule of Yap8. As(III) is coordinated by three sulfur atoms in purified Yap8, and our genetic and biochemical data identify the cysteine residues that form the binding site as Cys132, Cys137, and Cys274. As(III) binding by Yap8 does not require an additional yeast protein, and Yap8 is regulated neither at the level of localization nor at the level of DNA binding. Instead, our data are consistent with a model in which a DNA-bound form of Yap8 acts directly as an As(III) sensor. Binding of As(III) to Yap8 triggers a conformational change that in turn brings about a transcriptional response. Thus, As(III) binding to Yap8 acts as a molecular switch that converts inactive Yap8 into an active transcriptional regulator. This is the first report to demonstrate how a eukaryotic protein couples arsenic sensing to transcriptional activation. PMID:26711267

Arsenic Directly Binds to and Activates the Yeast AP-1-Like Transcription Factor Yap8

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kumar, Nallani Vijay; Yang, Jianbo; Pillai, Jitesh K.

The AP-1-like transcription factor Yap8 is critical for arsenic tolerance in the yeastSaccharomyces cerevisiae. However, the mechanism by which Yap8 senses the presence of arsenic and activates transcription of detoxification genes is unknown. Here we demonstrate that Yap8 directly binds to trivalent arsenite [As(III)]in vitroandin vivoand that approximately one As(III) molecule is bound per molecule of Yap8. As(III) is coordinated by three sulfur atoms in purified Yap8, and our genetic and biochemical data identify the cysteine residues that form the binding site as Cys132, Cys137, and Cys274. As(III) binding by Yap8 does not require an additional yeast protein, and Yap8more » is regulated neither at the level of localization nor at the level of DNA binding. Instead, our data are consistent with a model in which a DNA-bound form of Yap8 acts directly as an As(III) sensor. Binding of As(III) to Yap8 triggers a conformational change that in turn brings about a transcriptional response. Thus, As(III) binding to Yap8 acts as a molecular switch that converts inactive Yap8 into an active transcriptional regulator. This is the first report to demonstrate how a eukaryotic protein couples arsenic sensing to transcriptional activation.« less

Two- and three-body interatomic dispersion energy contributions to binding in molecules and solids

NASA Astrophysics Data System (ADS)

Anatole von Lilienfeld, O.; Tkatchenko, Alexandre

2010-06-01

We present numerical estimates of the leading two- and three-body dispersion energy terms in van der Waals interactions for a broad variety of molecules and solids. The calculations are based on London and Axilrod-Teller-Muto expressions where the required interatomic dispersion energy coefficients, C6 and C9, are computed "on the fly" from the electron density. Inter- and intramolecular energy contributions are obtained using the Tang-Toennies (TT) damping function for short interatomic distances. The TT range parameters are equally extracted on the fly from the electron density using their linear relationship to van der Waals radii. This relationship is empiricially determined for all the combinations of He-Xe rare gas dimers, as well as for the He and Ar trimers. The investigated systems include the S22 database of noncovalent interactions, Ar, benzene and ice crystals, bilayer graphene, C60 dimer, a peptide (Ala10), an intercalated drug-DNA model [ellipticine-d(CG)2], 42 DNA base pairs, a protein (DHFR, 2616 atoms), double stranded DNA (1905 atoms), and 12 molecular crystal polymorphs from crystal structure prediction blind test studies. The two- and three-body interatomic dispersion energies are found to contribute significantly to binding and cohesive energies, for bilayer graphene the latter reaches 50% of experimentally derived binding energy. These results suggest that interatomic three-body dispersion potentials should be accounted for in atomistic simulations when modeling bulky molecules or condensed phase systems.

Two and three-body interatomic dispersion energy contributions to binding in molecules and solids.

DOE Office of Scientific and Technical Information (OSTI.GOV)

von Lilienfeld-Toal, Otto Anatole; Tkatchenko, Alexandre

We present numerical estimates of the leading two- and three-body dispersion energy terms in van der Waals interactions for a broad variety of molecules and solids. The calculations are based on London and Axilrod-Teller-Muto expressions where the required interatomic dispersion energy coefficients, C{sub 6} and C{sub 9}, are computed 'on the fly' from the electron density. Inter- and intramolecular energy contributions are obtained using the Tang-Toennies (TT) damping function for short interatomic distances. The TT range parameters are equally extracted on the fly from the electron density using their linear relationship to van der Waals radii. This relationship is empiriciallymore » determined for all the combinations of He-Xe rare gas dimers, as well as for the He and Ar trimers. The investigated systems include the S22 database of noncovalent interactions, Ar, benzene and ice crystals, bilayer graphene, C{sub 60} dimer, a peptide (Ala{sub 10}), an intercalated drug-DNA model [ellipticine-d(CG){sub 2}], 42 DNA base pairs, a protein (DHFR, 2616 atoms), double stranded DNA (1905 atoms), and 12 molecular crystal polymorphs from crystal structure prediction blind test studies. The two- and three-body interatomic dispersion energies are found to contribute significantly to binding and cohesive energies, for bilayer graphene the latter reaches 50% of experimentally derived binding energy. These results suggest that interatomic three-body dispersion potentials should be accounted for in atomistic simulations when modeling bulky molecules or condensed phase systems.« less

Screening of E. coli β-clamp Inhibitors Revealed that Few Inhibit Helicobacter pylori More Effectively: Structural and Functional Characterization.

PubMed

Pandey, Preeti; Verma, Vijay; Dhar, Suman Kumar; Gourinath, Samudrala

2018-01-11

The characteristic of interaction with various enzymes and processivity-promoting nature during DNA replication makes β-clamp an important drug target. Helicobacter pylori ( H. pylori ) have several unique features in DNA replication machinery that makes it different from other microorganisms. To find out whether difference in DNA replication proteins behavior accounts for any difference in drug response when compared to E. coli , in the present study, we have tested E. coli β-clamp inhibitor molecules against H. pylori β-clamp. Various approaches were used to test the binding of inhibitors to H. pylori β-clamp including docking, surface competition assay, complex structure determination, as well as antimicrobial assay. Out of five shortlisted inhibitor molecules on the basis of docking score, three molecules, 5-chloroisatin, carprofen, and 3,4-difluorobenzamide were co-crystallized with H. pylori β-clamp and the structures show that they bind at the protein-protein interaction site as expected. In vivo studies showed only two molecules, 5-chloroisatin, and 3,4-difluorobenzamide inhibited the growth of the pylori with MIC values in micro molar range, which is better than the inhibitory effect of the same drugs on E. coli . Therefore, the evaluation of such drugs against H. pylori may explore the possibility to use to generate species-specific pharmacophore for development of new drugs against H. pylori .

Concentration-Dependent Exchange of Replication Protein A on Single-Stranded DNA Revealed by Single-Molecule Imaging

PubMed Central

Gibb, Bryan; Ye, Ling F.; Gergoudis, Stephanie C.; Kwon, YoungHo; Niu, Hengyao; Sung, Patrick; Greene, Eric C.

2014-01-01

Replication protein A (RPA) is a ubiquitous eukaryotic single-stranded DNA (ssDNA) binding protein necessary for all aspects of DNA metabolism involving an ssDNA intermediate, including DNA replication, repair, recombination, DNA damage response and checkpoint activation, and telomere maintenance [1], [2], [3]. The role of RPA in most of these reactions is to protect the ssDNA until it can be delivered to downstream enzymes. Therefore a crucial feature of RPA is that it must bind very tightly to ssDNA, but must also be easily displaced from ssDNA to allow other proteins to gain access to the substrate. Here we use total internal reflection fluorescence microscopy and nanofabricated DNA curtains to visualize the behavior of Saccharomyces cerevisiae RPA on individual strands of ssDNA in real-time. Our results show that RPA remains bound to ssDNA for long periods of time when free protein is absent from solution. In contrast, RPA rapidly dissociates from ssDNA when free RPA is present in solution allowing rapid exchange between the free and bound states. In addition, the S. cerevisiae DNA recombinase Rad51 and E. coli single-stranded binding protein (SSB) also promote removal of RPA from ssDNA. These results reveal an unanticipated exchange between bound and free RPA suggesting a binding mechanism that can confer exceptionally slow off rates, yet also enables rapid displacement through a direct exchange mechanism that is reliant upon the presence of free ssDNA-binding proteins in solution. Our results indicate that RPA undergoes constant microscopic dissociation under all conditions, but this is only manifested as macroscopic dissociation (i.e. exchange) when free proteins are present in solution, and this effect is due to mass action. We propose that the dissociation of RPA from ssDNA involves a partially dissociated intermediate, which exposes a small section of ssDNA allowing other proteins to access to the DNA. PMID:24498402

Regulation of Response Regulator Autophosphorylation through Interdomain Contacts*♦

PubMed Central

Barbieri, Christopher M.; Mack, Timothy R.; Robinson, Victoria L.; Miller, Matthew T.; Stock, Ann M.

2010-01-01

DNA-binding response regulators (RRs) of the OmpR/PhoB subfamily alternate between inactive and active conformational states, with the latter having enhanced DNA-binding affinity. Phosphorylation of an aspartate residue in the receiver domain, usually via phosphotransfer from a cognate histidine kinase, stabilizes the active conformation. Many of the available structures of inactive OmpR/PhoB family proteins exhibit extensive interfaces between the N-terminal receiver and C-terminal DNA-binding domains. These interfaces invariably involve the α4-β5-α5 face of the receiver domain, the locus of the largest differences between inactive and active conformations and the surface that mediates dimerization of receiver domains in the active state. Structures of receiver domain dimers of DrrB, DrrD, and MtrA have been determined, and phosphorylation kinetics were analyzed. Analysis of phosphotransfer from small molecule phosphodonors has revealed large differences in autophosphorylation rates among OmpR/PhoB RRs. RRs with substantial domain interfaces exhibit slow rates of phosphorylation. Rates are greatly increased in isolated receiver domain constructs. Such differences are not observed between autophosphorylation rates of full-length and isolated receiver domains of a RR that lacks interdomain interfaces, and they are not observed in histidine kinase-mediated phosphotransfer. These findings suggest that domain interfaces restrict receiver domain conformational dynamics, stabilizing an inactive conformation that is catalytically incompetent for phosphotransfer from small molecule phosphodonors. Inhibition of phosphotransfer by domain interfaces provides an explanation for the observation that some RRs cannot be phosphorylated by small molecule phosphodonors in vitro and provides a potential mechanism for insulating some RRs from small molecule-mediated phosphorylation in vivo. PMID:20702407

Impact of pyrrolidine-bispyrrole DNA minor groove binding agents and chirality on global proteomic profile in Escherichia Coli.

PubMed

Yang, Ya-Ting; Lin, Chun-Yu; Jeng, Jingyueh; Ong, Chi-Wi

2013-05-23

There is great interest in the design of small molecules that selectively target minor grooves of duplex DNA for controlling specific gene expression implicated in a disease. The design of chiral small molecules for rational drug design has attracted increasing attention due to the chirality of DNA. Yet, there is limited research on the chirality effect of minor groove binders on DNA interaction, especially at the protein expression level. This paper is an attempt to illustrate that DNA binding affinity might not provide a full picture on the biological activities. Drug interacting at the genomic level can be translated to the proteomic level. Here we have illustrated that although the chiral bispyrrole-pyrrolidine-oligoamides, PySSPy and PyRSPy, showed low binding affinity to DNA, their influence at the proteomic level is significant. More importantly, the chirality also plays a role. Two-dimensional proteomic profile to identify the differentially expressed protein in Escherichia coli DH5α (E coli DH5α) were investigated. E coli DH5α incubated with the chiral PySSPy and PyRSPy, diastereomeric at the pyrrolidine ring, showed differential expression of eighteen proteins as observed through two dimensional proteomic profiling. These eighteen proteins identified by MALDI_TOF/TOF MS include antioxidant defense, DNA protection, protein synthesis, chaperone, and stress response proteins. No statistically significant toxicity was observed at the tested drug concentrations as measured via MTT assay. The current results showed that the chiral PySSPy and PyRSPy impact on the proteomic profiling of E coli DH5α, implicating the importance of drug chirality on biological activities at the molecular level.

Studying DNA looping by single-molecule FRET.

PubMed

Le, Tung T; Kim, Harold D

2014-06-28

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA.

Studying DNA Looping by Single-Molecule FRET

PubMed Central

Le, Tung T.; Kim, Harold D.

2014-01-01

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA. PMID:24998459

Sepiolite as a New Nanocarrier for DNA Transfer into Mammalian Cells: Proof of Concept, Issues and Perspectives.

PubMed

Piétrement, Olivier; Castro-Smirnov, Fidel Antonio; Le Cam, Eric; Aranda, Pilar; Ruiz-Hitzky, Eduardo; Lopez, Bernard S

2017-12-29

Sepiolite is a nanofibrous natural silicate that can be used as a nanocarrier for DNA transfer thanks to its strong interaction with DNA molecules and its ability to be naturally internalized into mammalian cells through both non-endocytic and endocytic pathways. Sepiolite, due to its ability to bind various biomolecules, could be a good candidate for use as a nanocarrier for the simultaneous vectorization of diverse biological molecules. In this paper, we review our recent work, issued from a starting collaboration with Prof. Ruiz-Hitzky, that includes diverse aspects on the characterization and main features of sepiolite/DNA nanohybrids, and we present an outlook for the further development of sepiolite for DNA transfer. © 2017 The Chemical Society of Japan & Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Urate is a ligand for the transcriptional regulator PecS.

PubMed

Perera, Inoka C; Grove, Anne

2010-09-24

PecS is a member of the MarR (multiple antibiotic resistance regulator) family, which has been shown in Erwinia to regulate the expression of virulence genes. MarR homologs typically bind a small molecule ligand, resulting in attenuated DNA binding. For PecS, the natural ligand has not been identified. We have previously shown that urate is a ligand for the Deinococcus radiodurans-encoded MarR homolog HucR (hypothetical uricase regulator) and identified residues responsible for ligand binding. We show here that all four residues involved in urate binding and propagation of conformational changes to DNA recognition helices are conserved in PecS homologs, suggesting that urate is the ligand for PecS. Consistent with this prediction, Agrobacterium tumefaciens PecS specifically binds urate, and urate attenuates DNA binding in vitro. PecS binds two operator sites in the intergenic region between the divergent pecS gene and pecM genes, one of which features two partially overlapping repeats to which PecS binds as a dimer on opposite faces of the duplex. Notably, urate dissociates PecS from cognate DNA, allowing transcription of both genes in vivo. Taken together, our data show that urate is a ligand for PecS and suggest that urate serves a novel function in signaling the colonization of a host plant. Copyright © 2010 Elsevier Ltd. All rights reserved.

DNA binding by a new metallointercalator that contains a proflavine group bearing a hanging chelating unit.

PubMed

Bazzicalupi, Carla; Bencini, Andrea; Bianchi, Antonio; Biver, Tarita; Boggioni, Alessia; Bonacchi, Sara; Danesi, Andrea; Giorgi, Claudia; Gratteri, Paola; Ingraín, Antonio Marchal; Secco, Fernando; Sissi, Claudia; Valtancoli, Barbara; Venturini, Marcella

2008-01-01

The new bifunctional molecule 3,6-diamine-9-[6,6-bis(2-aminoethyl)-1,6-diaminohexyl]acridine (D), which is characterised by both an aromatic moiety and a separate metal-complexing polyamine centre, has been synthesised. The characteristics of D and its ZnII complex ([ZnD]) (protonation and metal-complexing constants, optical properties and self-aggregation phenomena) have been analysed by means of NMR spectroscopy, potentiometric, spectrophotometric and spectrofluorimetric techniques. The equilibria and kinetics of the binding process of D and [ZnD] to calf thymus DNA have been investigated at I=0.11 M (NaCl) and 298.1 K by using spectroscopic methods and the stopped-flow technique. Static measurements show biphasic behaviour for both D-DNA and [ZnD]-DNA systems; this reveals the occurrence of two different binding processes depending on the polymer-to-dye molar ratio (P/D). The binding mode that occurs at low P/D values is interpreted in terms of external binding with a notable contribution from the polyamine residue. The binding mode at high P/D values corresponds to intercalation of the proflavine residue. Stopped-flow, circular dichroism and supercoiled-DNA unwinding experiments corroborate the proposed mechanism. Molecular-modelling studies support the intercalative process and evidence the influence of NH+...O interactions between the protonated acridine nitrogen atom and the oxygen atoms of the polyanion; these interactions play a key role in determining the conformation of DNA adducts.

Single-molecule comparison of DNA Pol I activity with native and analog nucleotides

NASA Astrophysics Data System (ADS)

Gul, Osman; Olsen, Tivoli; Choi, Yongki; Corso, Brad; Weiss, Gregory; Collins, Philip

2014-03-01

DNA polymerases are critical enzymes for DNA replication, and because of their complex catalytic cycle they are excellent targets for investigation by single-molecule experimental techniques. Recently, we studied the Klenow fragment (KF) of DNA polymerase I using a label-free, electronic technique involving single KF molecules attached to carbon nanotube transistors. The electronic technique allowed long-duration monitoring of a single KF molecule while processing thousands of template strands. Processivity of up to 42 nucleotide bases was directly observed, and statistical analysis of the recordings determined key kinetic parameters for the enzyme's open and closed conformations. Subsequently, we have used the same technique to compare the incorporation of canonical nucleotides like dATP to analogs like 1-thio-2'-dATP. The analog had almost no affect on duration of the closed conformation, during which the nucleotide is incorporated. On the other hand, the analog increased the rate-limiting duration of the open conformation by almost 40%. We propose that the thiolated analog interferes with KF's recognition and binding, two key steps that determine its ensemble turnover rate.

Ligand binding to telomeric G-quadruplex DNA investigated by funnel-metadynamics simulations

PubMed Central

Moraca, Federica; Amato, Jussara; Ortuso, Francesco; Artese, Anna; Novellino, Ettore; Alcaro, Stefano; Parrinello, Michele; Limongelli, Vittorio

2017-01-01

G-quadruplexes (G4s) are higher-order DNA structures typically present at promoter regions of genes and telomeres. Here, the G4 formation decreases the replicative DNA at each cell cycle, finally leading to apoptosis. The ability to control this mitotic clock, particularly in cancer cells, is fascinating and passes through a rational understanding of the ligand/G4 interaction. We demonstrate that an accurate description of the ligand/G4 binding mechanism is possible using an innovative free-energy method called funnel-metadynamics (FM), which we have recently developed to investigate ligand/protein interaction. Using FM simulations, we have elucidated the binding mechanism of the anticancer alkaloid berberine to the human telomeric G4 (d[AG3(T2AG3)3]), computing also the binding free-energy landscape. Two ligand binding modes have been identified as the lowest energy states. Furthermore, we have found prebinding sites, which are preparatory to reach the final binding mode. In our simulations, the ions and the water molecules have been explicitly represented and the energetic contribution of the solvent during ligand binding evaluated. Our theoretical results provide an accurate estimate of the absolute ligand/DNA binding free energy (ΔGb0 = −10.3 ± 0.5 kcal/mol) that we validated through steady-state fluorescence binding assays. The good agreement between the theoretical and experimental value demonstrates that FM is a most powerful method to investigate ligand/DNA interaction and can be a useful tool for the rational design also of G4 ligands. PMID:28232513

PHF1 Tudor and N-terminal domains synergistically target partially unwrapped nucleosomes to increase DNA accessibility

PubMed Central

Gibson, Matthew D.; Gatchalian, Jovylyn; Slater, Andrew; Kutateladze, Tatiana G.

2017-01-01

Abstract The Tudor domain of human PHF1 recognizes trimethylated lysine 36 on histone H3 (H3K36me3). PHF1 relies on this interaction to regulate PRC2 methyltransferase activity, localize to DNA double strand breaks and mediate nucleosome accessibility. Here, we investigate the impact of the PHF1 N-terminal domain (NTD) on the Tudor domain interaction with the nucleosome. We show that the NTD is partially ordered when it is natively attached to the Tudor domain. Through a combination of FRET and single molecule studies, we find that the increase of DNA accessibility within the H3K36me3-containing nucleosome, instigated by the Tudor binding to H3K36me3, is dramatically enhanced by the NTD. We demonstrate that this nearly order of magnitude increase is due to preferential binding of PHF1 to partially unwrapped nucleosomes, and that PHF1 alters DNA–protein binding within the nucleosome by decreasing dissociation rates. These results highlight the potency of a PTM-binding protein to regulate DNA accessibility and underscores the role of the novel mechanism by which nucleosomes control DNA–protein binding through increasing protein dissociation rates. PMID:28082396

Mutation-Induced Population Shift in the MexR Conformational Ensemble Disengages DNA Binding: A Novel Mechanism for MarR Family Derepression.

PubMed

Anandapadamanaban, Madhanagopal; Pilstål, Robert; Andresen, Cecilia; Trewhella, Jill; Moche, Martin; Wallner, Björn; Sunnerhagen, Maria

2016-08-02

MexR is a repressor of the MexAB-OprM multidrug efflux pump operon of Pseudomonas aeruginosa, where DNA-binding impairing mutations lead to multidrug resistance (MDR). Surprisingly, the crystal structure of an MDR-conferring MexR mutant R21W (2.19 Å) presented here is closely similar to wild-type MexR. However, our extended analysis, by molecular dynamics and small-angle X-ray scattering, reveals that the mutation stabilizes a ground state that is deficient of DNA binding and is shared by both mutant and wild-type MexR, whereas the DNA-binding state is only transiently reached by the more flexible wild-type MexR. This population shift in the conformational ensemble is effected by mutation-induced allosteric coupling of contact networks that are independent in the wild-type protein. We propose that the MexR-R21W mutant mimics derepression by small-molecule binding to MarR proteins, and that the described allosteric model based on population shifts may also apply to other MarR family members. Copyright © 2016 Elsevier Ltd. All rights reserved.

Controlling gene networks and cell fate with precision-targeted DNA-binding proteins and small-molecule-based genome readers

PubMed Central

Eguchi, Asuka; Lee, Garrett O.; Wan, Fang; Erwin, Graham S.; Ansari, Aseem Z.

2014-01-01

Transcription factors control the fate of a cell by regulating the expression of genes and regulatory networks. Recent successes in inducing pluripotency in terminally differentiated cells as well as directing differentiation with natural transcription factors has lent credence to the efforts that aim to direct cell fate with rationally designed transcription factors. Because DNA-binding factors are modular in design, they can be engineered to target specific genomic sequences and perform pre-programmed regulatory functions upon binding. Such precision-tailored factors can serve as molecular tools to reprogramme or differentiate cells in a targeted manner. Using different types of engineered DNA binders, both regulatory transcriptional controls of gene networks, as well as permanent alteration of genomic content, can be implemented to study cell fate decisions. In the present review, we describe the current state of the art in artificial transcription factor design and the exciting prospect of employing artificial DNA-binding factors to manipulate the transcriptional networks as well as epigenetic landscapes that govern cell fate. PMID:25145439

Conformational heterogeneity in the Hsp70 chaperone-substrate ensemble identified from analysis of NMR-detected titration data.

PubMed

Sekhar, Ashok; Nagesh, Jayashree; Rosenzweig, Rina; Kay, Lewis E

2017-11-01

The Hsp70 chaperone system plays a critical role in cellular homeostasis by binding to client protein molecules. We have recently shown by methyl-TROSY NMR methods that the Escherichia coli Hsp70, DnaK, can form multiple bound complexes with a small client protein, hTRF1. In an effort to characterize the interactions further we report here the results of an NMR-based titration study of hTRF1 and DnaK, where both molecular components are monitored simultaneously, leading to a binding model. A central finding is the formation of a previously undetected 3:1 hTRF1-DnaK complex, suggesting that under heat shock conditions, DnaK might be able to protect cytosolic proteins whose net concentrations would exceed that of the chaperone. Moreover, these results provide new insight into the heterogeneous ensemble of complexes formed by DnaK chaperones and further emphasize the unique role of NMR spectroscopy in obtaining information about individual events in a complex binding scheme by exploiting a large number of probes that report uniquely on distinct binding processes. © 2017 The Protein Society.

Carbazole ligands as c-myc G-quadruplex binders.

PubMed

Głuszyńska, Agata; Juskowiak, Bernard; Kuta-Siejkowska, Martyna; Hoffmann, Marcin; Haider, Shozeb

2018-07-15

The interactions of c-myc G-quadruplex with three carbazole derivatives were investigated by UV-Vis spectrophotometry, fluorescence, CD spectroscopy, and molecular modeling. The results showed that a combination of carbazole scaffold functionalized with ethyl, triazole and imidazole groups resulted in stabilization of the intramolecular G-quadruplex formed by the DNA sequence derived from the NHE III 1 region of c-myc oncogene (Pu22). Binding to the G-quadruplex Pu22 resulted in the significant increase in fluorescence intensity of complexed ligands 1-3. All ligands were capable of interacting with G4 DNA with binding stoichiometry indicating that two ligand molecules bind to G-quadruplex with comparable affinity, which agrees with binding model of end-stacking on terminal G-tetrads. Copyright © 2018 Elsevier B.V. All rights reserved.

Enhancement of anion-exchange chromatography of DNA using compaction agents

NASA Technical Reports Server (NTRS)

Murphy, Jason C.; Fox, George E.; Willson, Richard C.

2003-01-01

The use of adsorptive chromatography for preparative nucleic acid separations is often limited by low capacity. The possibility that the adsorbent surface area sterically accessible to nucleic acid molecules could be increased by reducing their radius of gyration with compaction agents has been investigated. The equilibrium adsorption capacity of Q Sepharose anion-exchange matrix for plasmid DNA at 600 mM NaCl was enhanced by up to ca. 40% in the presence of 2.5 mM spermine. In addition, compaction agent selectivity has been demonstrated. Spermine, for example, enhances the adsorption of both plasmid and genomic DNA, spermidine enhances binding only of plasmid, and hexamine cobalt enhances only the binding of genomic DNA. Compaction may be generally useful for enhancing adsorptive separations of nucleic acids.

Binding of radiation-induced phenylalanine radicals to DNA: influence on the biological activity of the DNA and on its sensitivity to the induction of breaks by gamma rays

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vanderschans, G.P.; Vanrijn, C.J.S.; Bleichrodt, J.F.

1975-11-01

When an aqueous solution of double-stranded deoxyribonucleic acid (DNA) of bacteriophage PM2 containing phenylalanine and saturated with N2O is irradiated with gamma rays, radiation induced phenylalanine radicals are bound covalently. Under the conditions used about 25 phenylalanine molecules may be bound per lethal hit. Also for single-stranded PM2 DNA most of the phenylalanine radicals bound are nonlethal. Evidence is presented that in double-stranded DNA an appreciable fraction of the single-strand breaks is induced by phenylalanine radicals. Radiation products of phenylalanine and the phenylalanine bound to the DNA decrease the sensitivity of the DNA to the induction of single-strand breaks. Theremore » are indications that the high efficiency of protection by radiation products of phenylalanine is due to their positive charge, which will result in a relatively high concentration of these compounds in the vicinity of the negatively charged DNA molecules. (Author) (GRA)« less

Mutation detection by mismatch binding protein, MutS, in amplified DNA: Application to the cystic fibrosis gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lishanski, A.; Ostrander, E.A.; Rine, J.

1994-03-29

An experimental strategy for detecting heterozygosity in genomic DNA has been developed based on preferential binding of Escherichia coli MutS protein to DNA molecules containing mismatched bases. The binding was detected by a gel mobility-shift assay. This approach was tested by using as a model the most commonly occurring mutations within the cystic fibrosis (CFTR) gene. Genomic DNA samples were amplified with 5{prime}-end-labeled primers that bracket the site of the {Delta}F508 3-bp deletion in exon 10 of the CFTR gene. The renatured PCR products from homozygotes produced homoduplexes; the PCR products from heterozygotes produced heteroduplexes and homoduplexes (1:1). MutS proteinmore » bound more strongly to heteroduplexes that correspond to heterozygous carriers of {Delta}F508 and contain a CTT or a GAA loop in one of the strands than to homoduplexes corresponding to homozygotes. The ability of MutS protein to detect heteroduplexes in PCR-amplified DNA extended to fragments {approximately} 500 bp long. The method was also able to detect carriers of the point mutations in exon 11 of the CFTR gene by a preferential binding of MutS to single-base mismatches in PCR-amplified DNA.« less

Hysteresis in DNA compaction by Dps is described by an Ising model

PubMed Central

Vtyurina, Natalia N.; Dulin, David; Docter, Margreet W.; Meyer, Anne S.; Dekker, Nynke H.; Abbondanzieri, Elio A.

2016-01-01

In all organisms, DNA molecules are tightly compacted into a dynamic 3D nucleoprotein complex. In bacteria, this compaction is governed by the family of nucleoid-associated proteins (NAPs). Under conditions of stress and starvation, an NAP called Dps (DNA-binding protein from starved cells) becomes highly up-regulated and can massively reorganize the bacterial chromosome. Although static structures of Dps–DNA complexes have been documented, little is known about the dynamics of their assembly. Here, we use fluorescence microscopy and magnetic-tweezers measurements to resolve the process of DNA compaction by Dps. Real-time in vitro studies demonstrated a highly cooperative process of Dps binding characterized by an abrupt collapse of the DNA extension, even under applied tension. Surprisingly, we also discovered a reproducible hysteresis in the process of compaction and decompaction of the Dps–DNA complex. This hysteresis is extremely stable over hour-long timescales despite the rapid binding and dissociation rates of Dps. A modified Ising model is successfully applied to fit these kinetic features. We find that long-lived hysteresis arises naturally as a consequence of protein cooperativity in large complexes and provides a useful mechanism for cells to adopt unique epigenetic states. PMID:27091987

Metabolic activation and nucleic acid binding of acetaminophen and related arylamine substrates by the respiratory burst of human granulocytes.

PubMed

Corbett, M D; Corbett, B R; Hannothiaux, M H; Quintana, S J

1989-01-01

Following stimulation with phorbol myristate acetate, human granulocytes were found to incorporate acetaminophen, p-phenetidine, p-aminophenol, and p-chloroaniline into cellular DNA and RNA. Phenacetin was not incorporated into nucleic acid or metabolized by such activated granulocytes. None of the substrates gave nucleic acid binding if the granulocyte cultures were not induced to undergo the respiratory burst. Additional studies on the binding of acetaminophen to DNA and RNA were made by use of both ring-14C-labeled and carbonyl-14C-labeled forms of this substrate. The finding that equivalent amounts of these two labeled acetaminophen substrates were bound to cellular DNA demonstrated that the intact acetaminophen molecule was incorporated into DNA. On the other hand, the finding that excess ring-14C-labeled acetaminophen was incorporated into cellular RNA implies partial hydrolysis of the acetaminophen substrate prior to RNA binding. Evidence was presented which strongly indicates that the nucleic acid binding of the substrates was covalent in nature. The inability of the respiratory burst to result in the binding of phenacetin to nucleic acid suggests that arylamides are not normally activated or metabolized by activated granulocytes. Acetaminophen is an exception to the recalcitrance of arylamides to such bioactivation processes because it also possesses the phenolic functional group, which, like the arylamine group, is oxidized by certain reactive oxygen species. Myeloperoxidase appears to be much more important in the binding of acetaminophen to DNA than it is in the DNA binding of arylamines in general. The role of the respiratory burst in causing the bioactivation of certain arylamines, which are not normally genotoxic via the more usual microsomal activation pathways, was extended to include certain amide substrates such as acetaminophen.

Multiplex single-molecule interaction profiling of DNA barcoded proteins

PubMed Central

Gu, Liangcai; Li, Chao; Aach, John; Hill, David E.; Vidal, Marc; Church, George M.

2014-01-01

In contrast with advances in massively parallel DNA sequencing1, high-throughput protein analyses2-4 are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule (SM) protein detection achieved using optical methods5 is limited by the number of spectrally nonoverlapping chromophores. Here, we introduce a single molecular interaction-sequencing (SMI-Seq) technology for parallel protein interaction profiling leveraging SM advantages. DNA barcodes are attached to proteins collectively via ribosome display6 or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide (PAA) thin film to construct a random SM array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies)7 and analyzed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimeter. Furthermore, protein interactions can be measured based on the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor (GPCR) and antibody binding profiling, were demonstrated. SMI-Seq enables “library vs. library” screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity. PMID:25252978

The role of solitons on the tunneling magnetoresistance through a double-stranded DNA molecule

NASA Astrophysics Data System (ADS)

Ashhadi, M.

2018-07-01

We have studied the role of solitons on the spin-dependent transport properties of through a double-stranded DNA (dsDNA) molecule attached to two the semi-infinite ferromagnetic (FM) electrodes. The work is based on a tight-binding Hamiltonian model within the framework of a generalized Green's function technique and relies on the Landauer-Bütikker formalism as the basis for studying the current-voltage characteristic of this system. The conductance properties of the spin system are studied for a ladder model for poly (dG)-poly (dC) DNA molecule. Our calculations indicate that the presence of a homogeneous distribution of the solitons along the molecular, as a sublattice of the correlated solitons, gives rise to significant enhancement in the density of states within the bandgap and large enhancement in conductance and the current-voltage characteristic. It is also shown that tunnel magnetoresistance (TMR) decreases in compared with TMR obtained in the absence of solitons.

Activation-induced deoxycytidine deaminase (AID) co-transcriptional scanning at single-molecule resolution

PubMed Central

Senavirathne, Gayan; Bertram, Jeffrey G.; Jaszczur, Malgorzata; Chaurasiya, Kathy R.; Pham, Phuong; Mak, Chi H.; Goodman, Myron F.; Rueda, David

2015-01-01

Activation-induced deoxycytidine deaminase (AID) generates antibody diversity in B cells by initiating somatic hypermutation (SHM) and class-switch recombination (CSR) during transcription of immunoglobulin variable (IgV) and switch region (IgS) DNA. Using single-molecule FRET, we show that AID binds to transcribed dsDNA and translocates unidirectionally in concert with RNA polymerase (RNAP) on moving transcription bubbles, while increasing the fraction of stalled bubbles. AID scans randomly when constrained in an 8 nt model bubble. When unconstrained on single-stranded (ss) DNA, AID moves in random bidirectional short slides/hops over the entire molecule while remaining bound for ∼5 min. Our analysis distinguishes dynamic scanning from static ssDNA creasing. That AID alone can track along with RNAP during transcription and scan within stalled transcription bubbles suggests a mechanism by which AID can initiate SHM and CSR when properly regulated, yet when unregulated can access non-Ig genes and cause cancer. PMID:26681117

Thermodynamics of complex structures formed between single-stranded DNA oligomers and the KH domains of the far upstream element binding protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in

The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitablemore » statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4–DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3–DNA complex.« less

Spectroscopic and thermodynamic insights into the interaction between proflavine and human telomeric G-quadruplex DNA.

PubMed

Kumar, Vivek; Sengupta, Abhigyan; Gavvala, Krishna; Koninti, Raj Kumar; Hazra, Partha

2014-09-25

The G-quadruplex (GQ-DNA), an alternative structure motif of DNA, has emerged as a novel and exciting target for anticancer drug discovery. GQ-DNA formed in the presence of monovalent cations (Na(+)/K(+)) by human telomeric DNA is a point of interest due to their direct relevance for cellular aging and abnormal cell growths. Small molecules that selectively target and stabilize G-quadruplex structures are considered to be potential therapeutic anticancer agents. Herein, we probe G-quadruplex and proflavine (a well-known DNA intercalator, hence acting as an anticarcinogen) association through steady state and time-resolved fluorescence spectroscopy to explore the effect of stabilization of GQ-DNA by this well-known DNA intercalator. The structural modifications of G-quadruplex upon binding are highlighted through circular dichroism (CD) spectra. Moreover, a detailed insight into the thermodynamics of this interaction has been provided though isothermal titration calorimetry (ITC) studies. The thermodynamic parameters obtained from ITC help to gain knowledge about the nature as well as the driving forces of binding. This present study shows that proflavine (PF) can act as a stabilizer of telomeric GQ-DNA through an entropically as well as enthalpically feasible process with high binding affinity and thereby can be considered as a potential telomerase inhibitor.

Binding-induced DNA walker for signal amplification in highly selective electrochemical detection of protein.

PubMed

Ji, Yuhang; Zhang, Lei; Zhu, Longyi; Lei, Jianping; Wu, Jie; Ju, Huangxian

2017-10-15

A binding-induced DNA walker-assisted signal amplification was developed for highly selective electrochemical detection of protein. Firstly, the track of DNA walker was constructed by self-assembly of the high density ferrocene (Fc)-labeled anchor DNA and aptamer 1 on the gold electrode surface. Sequentially, a long swing-arm chain containing aptamer 2 and walking strand DNA was introduced onto gold electrode through aptamers-target specific recognition, and thus initiated walker strand sequences to hybridize with anchor DNA. Then, the DNA walker was activated by the stepwise cleavage of the hybridized anchor DNA by nicking endonuclease to release multiple Fc molecules for signal amplification. Taking thrombin as the model target, the Fc-generated electrochemical signal decreased linearly with logarithm value of thrombin concentration ranging from 10pM to 100nM with a detection limit of 2.5pM under the optimal conditions. By integrating the specific recognition of aptamers to target with the enzymatic cleavage of nicking endonuclease, the aptasensor showed the high selectivity. The binding-induced DNA walker provides a promising strategy for signal amplification in electrochemical biosensor, and has the extensive applications in sensitive and selective detection of the various targets. Copyright © 2017 Elsevier B.V. All rights reserved.

Arginine homopeptides for plasmid DNA purification using monolithic supports.

PubMed

Cardoso, Sara; Sousa, Ângela; Queiroz, João A; Azzoni, Adriano R; Sousa, Fani

2018-06-15

Purification of plasmid DNA targeting therapeutic applications still presents many challenges, namely on supports and specific ligand development. Monolithic supports have emerged as interesting approaches for purifying pDNA due to its excellent mass transfer properties and higher binding capacity values. Moreover, arginine ligands were already described to establish specific and preferential interactions with pDNA. Additionally, some studies revealed the ability of arginine based cationic peptides to condense plasmid DNA, which increased lengthening can result in strongest interactions with higher binding capacities for chromatographic purposes of large molecules such as pDNA. In this work, arginine homopeptides were immobilized in monolithic supports and their performance was evaluated and compared with a single arginine monolithic column regarding supercoiled (sc) plasmid DNA purification. Specific interactions of arginine based peptides with several nucleic acids present in a clarified Escherichia coli lysate sample showed potential for the sc pDNA purification. Effectively, the immobilization of the arginine homopeptides became more functional compared with the single arginine amino acid, showing higher binding capacities, which was also reflected in the intensity of the interactions. The combination of structural versatilities of monoliths with the specificity of arginine peptides raised as a promising strategy for sc pDNA purification. Copyright © 2018 Elsevier B.V. All rights reserved.

Computational analysis of EBNA1 ``druggability'' suggests novel insights for Epstein-Barr virus inhibitor design

NASA Astrophysics Data System (ADS)

Gianti, Eleonora; Messick, Troy E.; Lieberman, Paul M.; Zauhar, Randy J.

2016-04-01

The Epstein-Barr Nuclear Antigen 1 (EBNA1) is a critical protein encoded by the Epstein-Barr Virus (EBV). During latent infection, EBNA1 is essential for DNA replication and transcription initiation of viral and cellular genes and is necessary to immortalize primary B-lymphocytes. Nonetheless, the concept of EBNA1 as drug target is novel. Two EBNA1 crystal structures are publicly available and the first small-molecule EBNA1 inhibitors were recently discovered. However, no systematic studies have been reported on the structural details of EBNA1 "druggable" binding sites. We conducted computational identification and structural characterization of EBNA1 binding pockets, likely to accommodate ligand molecules (i.e. "druggable" binding sites). Then, we validated our predictions by docking against a set of compounds previously tested in vitro for EBNA1 inhibition (PubChem AID-2381). Finally, we supported assessments of pocket druggability by performing induced fit docking and molecular dynamics simulations paired with binding affinity predictions by Molecular Mechanics Generalized Born Surface Area calculations for a number of hits belonging to druggable binding sites. Our results establish EBNA1 as a target for drug discovery, and provide the computational evidence that active AID-2381 hits disrupt EBNA1:DNA binding upon interacting at individual sites. Lastly, structural properties of top scoring hits are proposed to support the rational design of the next generation of EBNA1 inhibitors.

Synthesis of novel coumarin nucleus-based DPA drug-like molecular entity: In vitro DNA/Cu(II) binding, DNA cleavage and pro-oxidant mechanism for anticancer action

PubMed Central

Khan, Saman; Malla, Ali Mohammed; Zafar, Atif

2017-01-01

Despite substantial research on cancer therapeutics, systemic toxicity and drug-resistance limits the clinical application of many drugs like cisplatin. Therefore, new chemotherapeutic strategies against different malignancies are needed. Targeted cancer therapy is a new paradigm for cancer therapeutics which targets pathways or chemical entities specific to cancer cells than normal ones. Unlike normal cells, cancer cells contain elevated copper which plays an integral role in angiogenesis. Copper is an important metal ion associated with chromatin DNA, particularly with guanine. Thus, targeting copper via copper-specific chelators in cancer cells can serve as an effective anticancer strategy. New pharmacophore di(2-picolyl)amine (DPA)-3(bromoacetyl) coumarin (ligand-L) was synthesized and characterized by IR, ESI-MS, 1H- and 13C-NMR. Binding ability of ligand-L to DNA/Cu(II) was evaluated using a plethora of biophysical techniques which revealed ligand-L-DNA and ligand-L-Cu(II) interaction. Competitive displacement assay and docking confirmed non-intercalative binding mode of ligand-L with ctDNA. Cyclic voltammetry confirmed ligand-L causes quasi reversible Cu(II)/Cu(I) conversion. Further, acute toxicity studies revealed no toxic effects of ligand-L on mice. To evaluate the chemotherapeutic potential and anticancer mechanism of ligand-L, DNA damage via pBR322 cleavage assay and reactive oxygen species (ROS) generation were studied. Results demonstrate that ligand-L causes DNA cleavage involving ROS generation in the presence of Cu(II). In conclusion, ligand-L causes redox cycling of Cu(II) to generate ROS which leads to oxidative DNA damage and pro-oxidant cancer cell death. These findings will establish ligand-L as a lead molecule to synthesize new molecules with better copper chelating and pro-oxidant properties against different malignancies. PMID:28763458

Investigations of the Binding of [Pt2(DTBPA)Cl2](II) and [Pt2(TPXA)Cl2](II) to DNA via Various Cross-Linking Modes

PubMed Central

Yue, Hongwei; Yang, Bo; Wang, Yan; Chen, Guangju

2013-01-01

We have constructed models for a series of platinum-DNA adducts that represent the binding of two agents, [Pt2(DTBPA)Cl2](II) and [Pt2(TPXA)Cl2](II), to DNA via inter- and intra-strand cross-linking, and carried out molecular dynamics simulations and DNA conformational dynamics calculations. The effects of trans- and cis-configurations of the centers of these di-nuclear platinum agents, and of different bridging linkers, have been investigated on the conformational distortions of platinum-DNA adducts formed via inter- and intra-strand cross-links. The results demonstrate that the DNA conformational distortions for the various platinum-DNA adducts with differing cross-linking modes are greatly influenced by the difference between the platinum-platinum distance for the platinum agent and the platinum-bound N7–N7 distance for the DNA molecule, and by the flexibility of the bridging linkers in the platinum agent. However, the effects of trans/cis-configurations of the platinum-centers on the DNA conformational distortions in the platinum-DNA adducts depend on the inter- and intra-strand cross-linking modes. In addition, we discuss the relevance of DNA base motions, including opening, shift and roll, to the changes in the parameters of the DNA major and minor grooves caused by binding of the platinum agent. PMID:24077126

Probabilistic switching circuits in DNA

PubMed Central

Wilhelm, Daniel; Bruck, Jehoshua

2018-01-01

A natural feature of molecular systems is their inherent stochastic behavior. A fundamental challenge related to the programming of molecular information processing systems is to develop a circuit architecture that controls the stochastic states of individual molecular events. Here we present a systematic implementation of probabilistic switching circuits, using DNA strand displacement reactions. Exploiting the intrinsic stochasticity of molecular interactions, we developed a simple, unbiased DNA switch: An input signal strand binds to the switch and releases an output signal strand with probability one-half. Using this unbiased switch as a molecular building block, we designed DNA circuits that convert an input signal to an output signal with any desired probability. Further, this probability can be switched between 2n different values by simply varying the presence or absence of n distinct DNA molecules. We demonstrated several DNA circuits that have multiple layers and feedback, including a circuit that converts an input strand to an output strand with eight different probabilities, controlled by the combination of three DNA molecules. These circuits combine the advantages of digital and analog computation: They allow a small number of distinct input molecules to control a diverse signal range of output molecules, while keeping the inputs robust to noise and the outputs at precise values. Moreover, arbitrarily complex circuit behaviors can be implemented with just a single type of molecular building block. PMID:29339484

Biomimetic glass nanopores employing aptamer gates responsive to a small molecule†

PubMed Central

Abelow, Alexis E.; Schepelina, Olga; White, Ryan J.; Vallée-Bélisle, Alexis

2011-01-01

We report the preparation of 20 and 65 nm radii glass nanopores whose surface is modified with DNA aptamers controlling the molecular transport through the nanopores in response to small molecule binding. PMID:20865192

DNA Physical Mapping via the Controlled Translocation of Single Molecules through a 5-10nm Silicon Nitride Nanopore

NASA Astrophysics Data System (ADS)

Stein, Derek; Reisner, Walter; Jiang, Zhijun; Hagerty, Nick; Wood, Charles; Chan, Jason

2009-03-01

The ability to map the binding position of sequence-specific markers, including transcription-factors, protein-nucleic acids (PNAs) or deactivated restriction enzymes, along a single DNA molecule in a nanofluidic device would be of key importance for the life-sciences. Such markers could give an indication of the active genes at particular stage in a cell's transcriptional cycle, pinpoint the location of mutations or even provide a DNA barcode that could aid in genomics applications. We have developed a setup consisting of a 5-10 nm nanopore in a 20nm thick silicon nitride film coupled to an optical tweezer setup. The translocation of DNA across the nanopore can be detected via blockades in the electrical current through the pore. By anchoring one end of the translocating DNA to an optically trapped microsphere, we hope to stretch out the molecule in the nanopore and control the translocation speed, enabling us to slowly scan across the genome and detect changes in the baseline current due to the presence of bound markers.

TRF1 and TRF2 use different mechanisms to find telomeric DNA but share a novel mechanism to search for protein partners at telomeres.

PubMed

Lin, Jiangguo; Countryman, Preston; Buncher, Noah; Kaur, Parminder; E, Longjiang; Zhang, Yiyun; Gibson, Greg; You, Changjiang; Watkins, Simon C; Piehler, Jacob; Opresko, Patricia L; Kad, Neil M; Wang, Hong

2014-02-01

Human telomeres are maintained by the shelterin protein complex in which TRF1 and TRF2 bind directly to duplex telomeric DNA. How these proteins find telomeric sequences among a genome of billions of base pairs and how they find protein partners to form the shelterin complex remains uncertain. Using single-molecule fluorescence imaging of quantum dot-labeled TRF1 and TRF2, we study how these proteins locate TTAGGG repeats on DNA tightropes. By virtue of its basic domain TRF2 performs an extensive 1D search on nontelomeric DNA, whereas TRF1's 1D search is limited. Unlike the stable and static associations observed for other proteins at specific binding sites, TRF proteins possess reduced binding stability marked by transient binding (∼ 9-17 s) and slow 1D diffusion on specific telomeric regions. These slow diffusion constants yield activation energy barriers to sliding ∼ 2.8-3.6 κ(B)T greater than those for nontelomeric DNA. We propose that the TRF proteins use 1D sliding to find protein partners and assemble the shelterin complex, which in turn stabilizes the interaction with specific telomeric DNA. This 'tag-team proofreading' represents a more general mechanism to ensure a specific set of proteins interact with each other on long repetitive specific DNA sequences without requiring external energy sources.

Inactive DNMT3B Splice Variants Modulate De Novo DNA Methylation

PubMed Central

Gordon, Catherine A.; Hartono, Stella R.; Chédin, Frédéric

2013-01-01

Inactive DNA methyltransferase (DNMT) 3B splice isoforms are associated with changes in DNA methylation, yet the mechanisms by which they act remain largely unknown. Using biochemical and cell culture assays, we show here that the inactive DNMT3B3 and DNMT3B4 isoforms bind to and regulate the activity of catalytically competent DNMT3A or DNMT3B molecules. DNMT3B3 modestly stimulated the de novo methylation activity of DNMT3A and also counteracted the stimulatory effects of DNMT3L, therefore leading to subtle and contrasting effects on activity. DNMT3B4, by contrast, significantly inhibited de novo DNA methylation by active DNMT3 molecules, most likely due to its ability to reduce the DNA binding affinity of co-complexes, thereby sequestering them away from their substrate. Immunocytochemistry experiments revealed that in addition to their effects on the intrinsic catalytic function of active DNMT3 enzymes, DNMT3B3 and DNMT34 drive distinct types of chromatin compaction and patterns of histone 3 lysine 9 tri-methylation (H3K9me3) deposition. Our findings suggest that regulation of active DNMT3 members through the formation of co-complexes with inactive DNMT3 variants is a general mechanism by which DNMT3 variants function. This may account for some of the changes in DNA methylation patterns observed during development and disease. PMID:23894490

Chromatic shifts in the fluorescence emitted by murine thymocytes stained with Hoechst 33342.

PubMed

Petersen, Timothy W; Ibrahim, Sherrif F; Diercks, Alan H; van den Engh, Ger

2004-08-01

Many methods in flow cytometry rely on staining DNA with a fluorescent dye to gauge DNA content. From the relative intensity of the fluorescence signature, one can then infer position in cell cycle, amount of DNA (i.e., for sperm selection), or, as in the case of flow karyotyping, to distinguish individual chromosomes. This work examines the staining of murine thymocytes with a common DNA dye, Hoechst 33342, to investigate nonlinearities in the florescence intensity as well as chromatic shifts. Murine thymocytes were stained with Hoechst 33342 and measured in a flow cytometer at two fluorescence emission bands. In other measurements, cells were stained at different dye concentrations, and then centrifuged. The supernatant was then used for a second round of staining to test the amount of dye uptake. Finally, to test for resonant energy transfer, we measured fluorescence anisotropy at two different wavelengths. The fluorescence of cells stained with Hoechst 33342 is a nonlinear process that shows an overall decrease in intensity with increased dye uptake, and spectral shift to the red. Along with the spectral shift of the fluorescence to the longer wavelengths, we document decreases in the fluorescence anisotropy that may indicate resonant energy transfer. At low concentrations, Hoechst 33342 binds to the minor groove of DNA and shows an increase in fluorescence and a blue shift upon binding. At higher concentrations, at which the dye molecules can no longer bind without overlapping, the blue fluorescence decreases and the red fluorescence increases until there is approximately one dye molecule per DNA base pair. The ratio of the blue fluorescence to the red fluorescence is an accurate indicator of the cellular dye concentration.

Quantification of DNA-associated proteins inside eukaryotic cells using single-molecule localization microscopy

PubMed Central

Etheridge, Thomas J.; Boulineau, Rémi L.; Herbert, Alex; Watson, Adam T.; Daigaku, Yasukazu; Tucker, Jem; George, Sophie; Jönsson, Peter; Palayret, Matthieu; Lando, David; Laue, Ernest; Osborne, Mark A.; Klenerman, David; Lee, Steven F.; Carr, Antony M.

2014-01-01

Development of single-molecule localization microscopy techniques has allowed nanometre scale localization accuracy inside cells, permitting the resolution of ultra-fine cell structure and the elucidation of crucial molecular mechanisms. Application of these methodologies to understanding processes underlying DNA replication and repair has been limited to defined in vitro biochemical analysis and prokaryotic cells. In order to expand these techniques to eukaryotic systems, we have further developed a photo-activated localization microscopy-based method to directly visualize DNA-associated proteins in unfixed eukaryotic cells. We demonstrate that motion blurring of fluorescence due to protein diffusivity can be used to selectively image the DNA-bound population of proteins. We designed and tested a simple methodology and show that it can be used to detect changes in DNA binding of a replicative helicase subunit, Mcm4, and the replication sliding clamp, PCNA, between different stages of the cell cycle and between distinct genetic backgrounds. PMID:25106872

Microfabricated, flowthrough porous apparatus for discrete detection of binding reactions

DOEpatents

Beattie, Kenneth L.

1998-01-01

An improved microfabricated apparatus for conducting a multiplicity of individual and simultaneous binding reactions is described. The apparatus comprises a substrate on which are located discrete and isolated sites for binding reactions. The apparatus is characterized by discrete and isolated regions that extend through said substrate and terminate on a second surface thereof such that when a test sample is allowed to the substrate, it is capable of penetrating through each such region during the course of said binding reaction. The apparatus is especially useful for sequencing by hybridization of DNA molecules.

Theoretical modeling of masking DNA application in aptamer-facilitated biomarker discovery.

PubMed

Cherney, Leonid T; Obrecht, Natalia M; Krylov, Sergey N

2013-04-16

In aptamer-facilitated biomarker discovery (AptaBiD), aptamers are selected from a library of random DNA (or RNA) sequences for their ability to specifically bind cell-surface biomarkers. The library is incubated with intact cells, and cell-bound DNA molecules are separated from those unbound and amplified by the polymerase chain reaction (PCR). The partitioning/amplification cycle is repeated multiple times while alternating target cells and control cells. Efficient aptamer selection in AptaBiD relies on the inclusion of masking DNA within the cell and library mixture. Masking DNA lacks primer regions for PCR amplification and is typically taken in excess to the library. The role of masking DNA within the selection mixture is to outcompete any nonspecific binding sequences within the initial library, thus allowing specific DNA sequences (i.e., aptamers) to be selected more efficiently. Efficient AptaBiD requires an optimum ratio of masking DNA to library DNA, at which aptamers still bind specific binding sites but nonaptamers within the library do not bind nonspecific binding sites. Here, we have developed a mathematical model that describes the binding processes taking place within the equilibrium mixture of masking DNA, library DNA, and target cells. An obtained mathematical solution allows one to estimate the concentration of masking DNA that is required to outcompete the library DNA at a desirable ratio of bound masking DNA to bound library DNA. The required concentration depends on concentrations of the library and cells as well as on unknown cell characteristics. These characteristics include the concentration of total binding sites on the cell surface, N, and equilibrium dissociation constants, K(nsL) and K(nsM), for nonspecific binding of the library DNA and masking DNA, respectively. We developed a theory that allows the determination of N, K(nsL), and K(nsM) based on measurements of EC50 values for cells mixed separately with the library and masking DNA (EC50 is the concentration of fluorescently labeled DNA at which half of the maximum fluorescence signal from DNA-bound cells is reached). We also obtained expressions for signals from bound DNA (measured by flow cytometry) in terms of N, K(nsL), and K(nsM). These expressions can be used for the verification of N, K(nsL), and K(nsM) values found from EC50 measurements. The developed procedure was applied to MCF-7 breast cancer cells, and corresponding values of N, K(nsL), and K(nsM) were established for the first time. The concentration of masking DNA required for AptaBiD with MCF-7 breast cancer cells was also estimated.

Structural integration in hypoxia-inducible factors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Dalei; Potluri, Nalini; Lu, Jingping

The hypoxia-inducible factors (HIFs) coordinate cellular adaptations to low oxygen stress by regulating transcriptional programs in erythropoiesis, angiogenesis and metabolism. These programs promote the growth and progression of many tumours, making HIFs attractive anticancer targets. Transcriptionally active HIFs consist of HIF-alpha and ARNT (also called HIF-1 beta) subunits. Here we describe crystal structures for each of mouse HIF-2 alpha-ARNT and HIF-1 alpha-ARNT heterodimers in states that include bound small molecules and their hypoxia response element. A highly integrated quaternary architecture is shared by HIF-2 alpha-ARNT and HIF-1 alpha-ARNT, wherein ARNT spirals around the outside of each HIF-alpha subunit. Five distinctmore » pockets are observed that permit small-molecule binding, including PAS domain encapsulated sites and an interfacial cavity formed through subunit heterodimerization. The DNA-reading head rotates, extends and cooperates with a distal PAS domain to bind hypoxia response elements. HIF-alpha mutations linked to human cancers map to sensitive sites that establish DNA binding and the stability of PAS domains and pockets.« less

Biochemistry of homologous recombination in Escherichia coli.

PubMed Central

Kowalczykowski, S C; Dixon, D A; Eggleston, A K; Lauder, S D; Rehrauer, W M

1994-01-01

Homologous recombination is a fundamental biological process. Biochemical understanding of this process is most advanced for Escherichia coli. At least 25 gene products are involved in promoting genetic exchange. At present, this includes the RecA, RecBCD (exonuclease V), RecE (exonuclease VIII), RecF, RecG, RecJ, RecN, RecOR, RecQ, RecT, RuvAB, RuvC, SbcCD, and SSB proteins, as well as DNA polymerase I, DNA gyrase, DNA topoisomerase I, DNA ligase, and DNA helicases. The activities displayed by these enzymes include homologous DNA pairing and strand exchange, helicase, branch migration, Holliday junction binding and cleavage, nuclease, ATPase, topoisomerase, DNA binding, ATP binding, polymerase, and ligase, and, collectively, they define biochemical events that are essential for efficient recombination. In addition to these needed proteins, a cis-acting recombination hot spot known as Chi (chi: 5'-GCTGGTGG-3') plays a crucial regulatory function. The biochemical steps that comprise homologous recombination can be formally divided into four parts: (i) processing of DNA molecules into suitable recombination substrates, (ii) homologous pairing of the DNA partners and the exchange of DNA strands, (iii) extension of the nascent DNA heteroduplex; and (iv) resolution of the resulting crossover structure. This review focuses on the biochemical mechanisms underlying these steps, with particular emphases on the activities of the proteins involved and on the integration of these activities into likely biochemical pathways for recombination. Images PMID:7968921

Promiscuous binding by Hsp70 results in conformational heterogeneity and fuzzy chaperone-substrate ensembles

PubMed Central

Rosenzweig, Rina; Sekhar, Ashok; Nagesh, Jayashree; Kay, Lewis E

2017-01-01

The Hsp70 chaperone system is integrated into a myriad of biochemical processes that are critical for cellular proteostasis. Although detailed pictures of Hsp70 bound with peptides have emerged, correspondingly detailed structural information on complexes with folding-competent substrates remains lacking. Here we report a methyl-TROSY based solution NMR study showing that the Escherichia coli version of Hsp70, DnaK, binds to as many as four distinct sites on a small 53-residue client protein, hTRF1. A fraction of hTRF1 chains are also bound to two DnaK molecules simultaneously, resulting in a mixture of DnaK-substrate sub-ensembles that are structurally heterogeneous. The interactions of Hsp70 with a client protein at different sites results in a fuzzy chaperone-substrate ensemble and suggests a mechanism for Hsp70 function whereby the structural heterogeneity of released substrate molecules enables them to circumvent kinetic traps in their conformational free energy landscape and fold efficiently to the native state. DOI: http://dx.doi.org/10.7554/eLife.28030.001 PMID:28708484

Capture-SELEX: Selection of DNA Aptamers for Aminoglycoside Antibiotics

PubMed Central

2012-01-01

Small organic molecules are challenging targets for an aptamer selection using the SELEX technology (SELEX—Systematic Evolution of Ligans by EXponential enrichment). Often they are not suitable for immobilization on solid surfaces, which is a common procedure in known aptamer selection methods. The Capture-SELEX procedure allows the selection of DNA aptamers for solute targets. A special SELEX library was constructed with the aim to immobilize this library on magnetic beads or other surfaces. For this purpose a docking sequence was incorporated into the random region of the library enabling hybridization to a complementary oligo fixed on magnetic beads. Oligonucleotides of the library which exhibit high affinity to the target and a secondary structure fitting to the target are released from the beads for binding to the target during the aptamer selection process. The oligonucleotides of these binding complexes were amplified, purified, and immobilized via the docking sequence to the magnetic beads as the starting point of the following selection round. Based on this Capture-SELEX procedure, the successful DNA aptamer selection for the aminoglycoside antibiotic kanamycin A as a small molecule target is described. PMID:23326761

Dissociation free-energy profiles of specific and nonspecific DNA-protein complexes.

PubMed

Yonetani, Yoshiteru; Kono, Hidetoshi

2013-06-27

DNA-binding proteins recognize DNA sequences with at least two different binding modes: specific and nonspecific. Experimental structures of such complexes provide us a static view of the bindings. However, it is difficult to reveal further mechanisms of their target-site search and recognition only from static information because the transition process between the bound and unbound states is not clarified by static information. What is the difference between specific and nonspecific bindings? Here we performed adaptive biasing force molecular dynamics simulations with the specific and nonspecific structures of DNA-Lac repressor complexes to investigate the dissociation process. The resultant free-energy profiles showed that the specific complex has a sharp, deep well consistent with tight binding, whereas the nonspecific complex has a broad, shallow well consistent with loose binding. The difference in the well depth, ~5 kcal/mol, was in fair agreement with the experimentally obtained value and was found to mainly come from the protein conformational difference, particularly in the C-terminal tail. Also, the free-energy profiles were found to be correlated with changes in the number of protein-DNA contacts and that of surface water molecules. The derived protein spatial distributions around the DNA indicate that any large dissociation occurs rarely, regardless of the specific and nonspecific sites. Comparison of the free-energy barrier for sliding [~8.7 kcal/mol; Furini J. Phys. Chem. B 2010, 114, 2238] and that for dissociation (at least ~16 kcal/mol) calculated in this study suggests that sliding is much preferred to dissociation.

Synthesis and characterization of azo-guanidine based alcoholic media naked eye DNA sensor

PubMed Central

Hashmat, Uzma; Yousaf, Muhammad; Lal, Bhajan; Ullah, Shafiq; Holder, Alvin A.; Badshah, Amin

2016-01-01

DNA sensing always has an open meadow of curiosity for biotechnologists and other researchers. Recently, in this field, we have introduced an emerging class of molecules containing azo and guanidine functionalities. In this study, we have synthesized three new compounds (UA1, UA6 and UA7) for potential application in DNA sensing in alcoholic medium. The synthesized materials were characterized by elemental analysis, FTIR, UV-visible, 1H NMR and 13C NMR spectroscopies. Their DNA sensing potential were investigated by UV-visible spectroscopy. The insight of interaction with DNA was further investigated by electrochemical (cyclic voltammetry) and hydrodynamic (viscosity) studies. The results showed that compounds have moderate DNA binding properties, with the binding constants range being 7.2 × 103, 2.4 × 103 and 0.2 × 103 M−1, for UA1, UA6 and UA7, respectively. Upon binding with DNA, there was a change in colour (a blue shift in the λmax value) which was observable with a naked eye. These results indicated the potential of synthesized compounds as DNA sensors with detection limit 1.8, 5.8 and 4.0 ng µl−1 for UA1, UA6 and UA7, respectively. PMID:28018613

Profiling cellular protein complexes by proximity ligation with dual tag microarray readout.

PubMed

Hammond, Maria; Nong, Rachel Yuan; Ericsson, Olle; Pardali, Katerina; Landegren, Ulf

2012-01-01

Patterns of protein interactions provide important insights in basic biology, and their analysis plays an increasing role in drug development and diagnostics of disease. We have established a scalable technique to compare two biological samples for the levels of all pairwise interactions among a set of targeted protein molecules. The technique is a combination of the proximity ligation assay with readout via dual tag microarrays. In the proximity ligation assay protein identities are encoded as DNA sequences by attaching DNA oligonucleotides to antibodies directed against the proteins of interest. Upon binding by pairs of antibodies to proteins present in the same molecular complexes, ligation reactions give rise to reporter DNA molecules that contain the combined sequence information from the two DNA strands. The ligation reactions also serve to incorporate a sample barcode in the reporter molecules to allow for direct comparison between pairs of samples. The samples are evaluated using a dual tag microarray where information is decoded, revealing which pairs of tags that have become joined. As a proof-of-concept we demonstrate that this approach can be used to detect a set of five proteins and their pairwise interactions both in cellular lysates and in fixed tissue culture cells. This paper provides a general strategy to analyze the extent of any pairwise interactions in large sets of molecules by decoding reporter DNA strands that identify the interacting molecules.

Conformation-dependent DNA attraction

NASA Astrophysics Data System (ADS)

Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang

2014-05-01

Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg2+ ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg2+ or Na+, benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg2+ bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg2+ ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg2+ or Na+, benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg2+ bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription. Electronic supplementary information (ESI) available. See DOI: 10.1039/c3nr03235c

Tethered particle analysis of supercoiled circular DNA using peptide nucleic acid handles.

PubMed

Norregaard, Kamilla; Andersson, Magnus; Nielsen, Peter Eigil; Brown, Stanley; Oddershede, Lene B

2014-09-01

This protocol describes how to monitor individual naturally supercoiled circular DNA plasmids bound via peptide nucleic acid (PNA) handles between a bead and a surface. The protocol was developed for single-molecule investigation of the dynamics of supercoiled DNA, and it allows the investigation of both the dynamics of the molecule itself and of its interactions with a regulatory protein. Two bis-PNA clamps designed to bind with extremely high affinity to predetermined homopurine sequence sites in supercoiled DNA are prepared: one conjugated with digoxigenin for attachment to an anti-digoxigenin-coated glass cover slide, and one conjugated with biotin for attachment to a submicron-sized streptavidin-coated polystyrene bead. Plasmids are constructed, purified and incubated with the PNA handles. The dynamics of the construct is analyzed by tracking the tethered bead using video microscopy: less supercoiling results in more movement, and more supercoiling results in less movement. In contrast to other single-molecule methodologies, the current methodology allows for studying DNA in its naturally supercoiled state with constant linking number and constant writhe. The protocol has potential for use in studying the influence of supercoils on the dynamics of DNA and its associated proteins, e.g., topoisomerase. The procedure takes ~4 weeks.

Investigating Deinococcus radiodurans RecA protein filament formation on dsDNA by a real-time single-molecule approach

PubMed Central

Hsu, Hsin-Fang; Ngo, Khanh V.; Chitteni-Pattu, Sindhu; Cox, Michael M.; Li, Hung-Wen

2011-01-01

With the aid of an efficient, precise, and almost error-free DNA repair system, Deinococcus radiodurans can survive hundreds of double strand breaks inflicted by high doses of irradiation or desiccation. The RecA of Deinococcus radiodurans (DrRecA) plays a central role both in the early phase of repair by an extended synthesis-dependent strand annealing process and in the later more general homologous recombination phase. Both roles likely require DrRecA filament formation on duplex DNA. We have developed single-molecule tethered particle motion (TPM) experiments to study the assembly dynamics of RecA proteins on individual duplex DNA molecules by observing changes in DNA tether length resulting from RecA binding. We demonstrate that DrRecA nucleation on dsDNA is much faster than Escherichia coli (Ec) RecA protein, but the extension is slower. This combination of attributes would tend to increase the number and decrease the length of DrRecA filaments relative to those of EcRecA, a feature that may reflect the requirement to repair hundreds of genomic double strand breaks concurrently in irradiated Deinococcus cells. PMID:21853996

Single DNA molecules on freestanding and supported cationic lipid bilayers: diverse conformational dynamics controlled by the local bilayer properties

NASA Astrophysics Data System (ADS)

Herold, Christoph; Schwille, Petra; Petrov, Eugene P.

2016-02-01

We present experimental results on the interaction of DNA macromolecules with cationic lipid membranes with different properties, including freestanding membranes in the fluid and gel state, and supported lipid membranes in the fluid state and under conditions of fluid-gel phase coexistence. We observe diverse conformational dynamics of membrane-bound DNA molecules controlled by the local properties of the lipid bilayer. In case of fluid-state freestanding lipid membranes, the behaviour of DNA on the membrane is controlled by the membrane charge density: whereas DNA bound to weakly charged membranes predominantly behaves as a 2D random coil, an increase in the membrane charge density leads to membrane-driven irreversible DNA collapse and formation of subresolution-sized DNA globules. On the other hand, electrostatic binding of DNA macromolecules to gel-state freestanding membranes leads to completely arrested diffusion and conformational dynamics of membrane-adsorbed DNA. A drastically different picture is observed in case of DNA interaction with supported cationic lipid bilayers: When the supported bilayer is in the fluid state, membrane-bound DNA molecules undergo 2D translational Brownian motion and conformational fluctuations, irrespectively of the charge density of the supported bilayer. At the same time, when the supported cationic membrane shows fluid-gel phase coexistence, membrane-bound DNA molecules are strongly attracted to micrometre-sized gel-phase domains enriched with the cationic lipid, which results in 2D compaction of the membrane-bound macromolecules. This DNA compaction, however, is fully reversible, and disappears as soon as the membrane is heated above the fluid-gel coexistence. We also discuss possible biological implications of our experimental findings.

An affinity-structure database of helix-turn-helix: DNA complexes with a universal coordinate system.

PubMed

AlQuraishi, Mohammed; Tang, Shengdong; Xia, Xide

2015-11-19

Molecular interactions between proteins and DNA molecules underlie many cellular processes, including transcriptional regulation, chromosome replication, and nucleosome positioning. Computational analyses of protein-DNA interactions rely on experimental data characterizing known protein-DNA interactions structurally and biochemically. While many databases exist that contain either structural or biochemical data, few integrate these two data sources in a unified fashion. Such integration is becoming increasingly critical with the rapid growth of structural and biochemical data, and the emergence of algorithms that rely on the synthesis of multiple data types to derive computational models of molecular interactions. We have developed an integrated affinity-structure database in which the experimental and quantitative DNA binding affinities of helix-turn-helix proteins are mapped onto the crystal structures of the corresponding protein-DNA complexes. This database provides access to: (i) protein-DNA structures, (ii) quantitative summaries of protein-DNA binding affinities using position weight matrices, and (iii) raw experimental data of protein-DNA binding instances. Critically, this database establishes a correspondence between experimental structural data and quantitative binding affinity data at the single basepair level. Furthermore, we present a novel alignment algorithm that structurally aligns the protein-DNA complexes in the database and creates a unified residue-level coordinate system for comparing the physico-chemical environments at the interface between complexes. Using this unified coordinate system, we compute the statistics of atomic interactions at the protein-DNA interface of helix-turn-helix proteins. We provide an interactive website for visualization, querying, and analyzing this database, and a downloadable version to facilitate programmatic analysis. This database will facilitate the analysis of protein-DNA interactions and the development of programmatic computational methods that capitalize on integration of structural and biochemical datasets. The database can be accessed at http://ProteinDNA.hms.harvard.edu.

Facilitated Diffusion of Transcription Factor Proteins with Anomalous Bulk Diffusion.

PubMed

Liu, Lin; Cherstvy, Andrey G; Metzler, Ralf

2017-02-16

What are the physical laws of the diffusive search of proteins for their specific binding sites on DNA in the presence of the macromolecular crowding in cells? We performed extensive computer simulations to elucidate the protein target search on DNA. The novel feature is the viscoelastic non-Brownian protein bulk diffusion recently observed experimentally. We examine the influence of the protein-DNA binding affinity and the anomalous diffusion exponent on the target search time. In all cases an optimal search time is found. The relative contribution of intermittent three-dimensional bulk diffusion and one-dimensional sliding of proteins along the DNA is quantified. Our results are discussed in the light of recent single molecule tracking experiments, aiming at a better understanding of the influence of anomalous kinetics of proteins on the facilitated diffusion mechanism.

Effect of a Dual Charge on the DNA-Conjugated Redox Probe on DNA Sensing by Short Hairpin Beacons Tethered to Gold Electrodes.

PubMed

Kékedy-Nagy, László; Shipovskov, Stepan; Ferapontova, Elena E

2016-08-16

Charges of redox species can critically affect both the interfacial state of DNA and electrochemistry of DNA-conjugated redox labels and, as a result, the electroanalytical performance of those systems. Here, we show that the kinetics of electron transfer (ET) between the gold electrode and methylene blue (MB) label conjugated to a double-stranded (ds) DNA tethered to gold strongly depend on the charge of the MB molecule, and that affects the performance of genosensors exploiting MB-labeled hairpin DNA beacons. Positively charged MB binds to dsDNA via electrostatic and intercalative/groove binding, and this binding allows the DNA-mediated electrochemistry of MB intercalated into the duplex and, as a result, a complex mode of the electrochemical signal change upon hairpin hybridization to the target DNA, dominated by the "on-off" signal change mode at nanomolar levels of the analyzed DNA. When MB bears an additional carboxylic group, the negative charge provided by this group prevents intimate interactions between MB and DNA, and then the ET in duplexes is limited by the diffusion of the MB-conjugated dsDNA (the phenomenon first shown in Farjami , E. ; Clima , L. ; Gothelf , K. ; Ferapontova , E. E. Anal. Chem. 2011 , 83 , 1594 ) providing the robust "off-on" nanomolar DNA sensing. Those results can be extended to other intercalating redox probes and are of strategic importance for design and development of electrochemical hybridization sensors exploiting DNA nanoswitchable architectures.

Rapid detection of a cocaine-binding aptamer using biological nanopores on a chip.

PubMed

Kawano, Ryuji; Osaki, Toshihisa; Sasaki, Hirotaka; Takinoue, Masahiro; Yoshizawa, Satoko; Takeuchi, Shoji

2011-06-08

This paper describes a methodology for the rapid and highly selective detection of cocaine using a membrane protein channel combined with a DNA aptamer. The DNA aptamer recognizes the cocaine molecule with high selectivity. We successfully detected a low concentration of cocaine (300 ng/mL, the drug test cutoff limit) within 60 s using a biological nanopore embedded in a microchip.

Single Molecule Study of DNA Organization and Recombination

NASA Astrophysics Data System (ADS)

Xiao, Botao

We have studied five projects related to DNA organization and recombination using mainly single molecule force-spectroscopy and statistical tools. First, HU is one of the most abundant DNA-organizing proteins in bacterial chromosomes and participates in gene regulation. We report experiments that study the dependence of DNA condensation by HU on force, salt and HU concentration. A first important result is that at physiological salt levels, HU only bends DNA, resolving a previous paradox of why a chromosome-compacting protein should have a DNA-stiffening function. A second major result is quantitative demonstration of strong dependencies of HU-DNA dissociation on both salt concentration and force. Second, we have used a thermodynamic Maxwell relation to count proteins driven off large DNAs by tension, an effect important to understanding DNA organization. Our results compare well with estimates of numbers of proteins HU and Fis in previous studies. We have also shown that a semi-flexible polymer model describes our HU experimental data well. The force-dependent binding suggests mechano-chemical mechanisms for gene regulation. Third, the elusive role of protein H1 in chromatin has been clarified with purified H1 and Xenopus extracts. We find that H1 compacts DNA by both bending and looping. Addition of H1 enhances chromatin formation and maintains the plasticity of the chromatin. Fourth, the topology and mechanics of DNA twisting are critical to DNA organization and recombination. We have systematically measured DNA extension as a function of linking number density from 0.08 to -2 with holding forces from 0.2 to 2.4 pN. Unlike previous proposals, the DNA extension decreases with negative linking number. Finally, DNA recombination is a dynamic process starting from enzyme-DNA binding. We report that the Int-DBD domain of lambda integrase binds to DNA without compaction at low Int-DBD concentration. High concentration of Int-DBD loops DNA below a threshold force, which depends on salt concentration. We also report experiments with the recombinase Hin mutant H107Y. The synapse formation is demonstrated with single DNA containing two hix sites. We further show preliminary data for cleavage and subunit rotation from a braiding assay. These direct observations elucidate the recombination mechanism.

SA1 and TRF1 synergistically bind to telomeric DNA and promote DNA-DNA pairing

NASA Astrophysics Data System (ADS)

Wang, Hong; Lin, Jiangguo; Countryman, Preston; Pan, Hai; Parminder Kaur Team; Robert Riehn Team; Patricia Opresko Team; Jane Tao Team; Susan Smith Team

Impaired telomere cohesion leads to increased aneuploidy and early onset of tumorigenesis. Cohesion is thought to occur through the entrapment of two DNA strands within tripartite cohesin ring(s), along with a fourth subunit (SA1/SA2). Surprisingly, cohesion rings are not essential for telomere cohesion, which instead requires SA1 and shelterin proteins including TRF1. However, neither this unique cohesion mechanism at telomeres or DNA-binding properties of SA1 is understood. Here, using single-molecule fluorescence imaging of quantum dot-labeled proteins on DNA we discover that while SA1 diffuses across multiple telomeric and non-telomeric regions, the diffusion mediated through its N-terminal domain is slower at telomeric regions. However, addition of TRF1 traps SA1 within telomeric regions, which form longer DNA-DNA pairing tracts than with TRF1 alone, as revealed by atomic force microscopy. Together, these experimental results and coarse-grained molecular dynamics simulations suggest that TRF1 and SA1 synergistically interact with DNA to support telomere cohesion without cohesin rings.

The nucleotide binding dynamics of human MSH2-MSH3 are lesion dependent.

PubMed

Owen, Barbara A L; H Lang, Walter; McMurray, Cynthia T

2009-05-01

Here we report that the human DNA mismatch complex MSH2-MSH3 recognizes small loops by a mechanism different from that of MSH2-MSH6 for single-base mismatches. The subunits MSH2 and MSH3 can bind either ADP or ATP with similar affinities. Upon binding to a DNA loop, however, MSH2-MSH3 adopts a single 'nucleotide signature', in which the MSH2 subunit is occupied by an ADP molecule and the MSH3 subunit is empty. Subsequent ATP binding and hydrolysis in the MSH3 subunit promote ADP-ATP exchange in the MSH2 subunit to yield a hydrolysis-independent ATP-MSH2-MSH3-ADP intermediate. Human MSH2-MSH3 and yeast Msh2-Msh6 both undergo ADP-ATP exchange in the Msh2 subunit but, apparently, have opposite requirements for ATP hydrolysis: ADP release from DNA-bound Msh2-Msh6 requires ATP stabilization in the Msh6 subunit, whereas ADP release from DNA-bound MSH2-MSH3 requires ATP hydrolysis in the MSH3 subunit. We propose a model in which lesion binding converts MSH2-MSH3 into a distinct nucleotide-bound form that is poised to be a molecular sensor for lesion specificity.

The TubR-centromere complex adopts a double-ring segrosome structure in Type III partition systems.

PubMed

Martín-García, Bárbara; Martín-González, Alejandro; Carrasco, Carolina; Hernández-Arriaga, Ana M; Ruíz-Quero, Rubén; Díaz-Orejas, Ramón; Aicart-Ramos, Clara; Moreno-Herrero, Fernando; Oliva, María A

2018-05-14

In prokaryotes, the centromere is a specialized segment of DNA that promotes the assembly of the segrosome upon binding of the Centromere Binding Protein (CBP). The segrosome structure exposes a specific surface for the interaction of the CBP with the motor protein that mediates DNA movement during cell division. Additionally, the CBP usually controls the transcriptional regulation of the segregation system as a cell cycle checkpoint. Correct segrosome functioning is therefore indispensable for accurate DNA segregation. Here, we combine biochemical reconstruction and structural and biophysical analysis to bring light to the architecture of the segrosome complex in Type III partition systems. We present the particular features of the centromere site, tubC, of the model system encoded in Clostridium botulinum prophage c-st. We find that the split centromere site contains two different iterons involved in the binding and spreading of the CBP, TubR. The resulting nucleoprotein complex consists of a novel double-ring structure that covers part of the predicted promoter. Single molecule data provides a mechanism for the formation of the segrosome structure based on DNA bending and unwinding upon TubR binding.

Recognition of chromatin by the plant alkaloid, ellipticine as a dual binder

DOE Office of Scientific and Technical Information (OSTI.GOV)

Banerjee, Amrita; Sanyal, Sulagna; Majumder, Parijat

Recognition of core histone components of chromatin along with chromosomal DNA by a class of small molecule modulators is worth examining to evaluate their intracellular mode of action. A plant alkaloid ellipticine (ELP) which is a putative anticancer agent has so far been reported to function via DNA intercalation, association with topoisomerase II and binding to telomere region. However, its effect upon the potential intracellular target, chromatin is hitherto unreported. Here we have characterized the biomolecular recognition between ELP and different hierarchical levels of chromatin. The significant result is that in addition to DNA, it binds to core histone(s) andmore » can be categorized as a ‘dual binder’. As a sequel to binding with histone(s) and core octamer, it alters post-translational histone acetylation marks. We have further demonstrated that it has the potential to modulate gene expression thereby regulating several key biological processes such as nuclear organization, transcription, translation and histone modifications. - Highlights: • Ellipticine acts a dual binder binding to both DNA and core histone(s). • It induces structural perturbations in chromatin, chromatosome and histone octamer. • It alters histones acetylation and affects global gene expression.« less

Preferential recognition of auto-antibodies against 4-hydroxynonenal modified DNA in the cancer patients.

PubMed

Faisal, Mohammad; Shahab, Uzma; Alatar, Abdulrahman A; Ahmad, Saheem

2017-11-01

The structural perturbations in DNA molecule may be caused by a break in a strand, a missing base from the backbone, or a chemically changed base. These alterations in DNA that occurs naturally can result from metabolic or hydrolytic processes. DNA damage plays a major role in the mutagenesis, carcinogenesis, aging and various other patho-physiological conditions. DNA damage can be induced through hydrolysis, exposure to reactive oxygen species (ROS) and other reactive carbonyl metabolites including 4-hydroxynonenal (HNE). 4-HNE is an important lipid peroxidation product which has been implicated in the mutagenesis and carcinogenesis processes. The present study examines to probe the presence of auto-antibodies against 4-hydroxynonenal damaged DNA (HNE-DNA) in various cancer subjects. In this study, the purified calf thymus DNA was damaged by the action of 4-HNE. The DNA was incubated with 4-HNE for 24 h at 37°C temperature. The binding characteristics of cancer auto-antibodies were assessed by direct binding and competitive inhibition ELISA. DNA modifications produced hyperchromicity in UV spectrum and decreased fluorescence intensity. Cancer sera exhibited enhanced binding with the 4-HNE modified calf thymus DNA as compared to its native conformer. The 4-HNE modified DNA presents unique epitopes which may be one of the factors for the auto-antibody induction in cancer patients. The HNE modified DNA presents unique epitopes which may be one of the factors for the autoantibody induction in cancer patients. © 2017 Wiley Periodicals, Inc.

Stable nanoconjugates of transferrin with alloyed quaternary nanocrystals Ag-In-Zn-S as a biological entity for tumor recognition.

PubMed

Matysiak-Brynda, Edyta; Bujak, Piotr; Augustin, Ewa; Kowalczyk, Agata; Mazerska, Zofia; Pron, Adam; Nowicka, Anna M

2018-01-18

One way to limit the negative effects of anti-tumor drugs on healthy cells is targeted therapy employing functionalized drug carriers. Here we present a biocompatible and stable nanoconjugate of transferrin anchored to Ag-In-Zn-S quantum dots modified with 11-mercaptoundecanoic acid (Tf-QD) as a drug carrier versus typical anticancer drug, doxorubicin. Detailed investigations of Tf-QD nanoconjugates without and with doxorubicin by fluorescence studies and cytotoxic measurements showed that the biological activity of both the transferrin and doxorubicin was fully retained in the nanoconjugate. In particular, the intercalation capabilities of free doxorubicin versus ctDNA remained essentially intact upon its binding to the nanoconjugate. In order to evaluate these capabilities, we studied the binding constant of doxorubicin attached to Tf-QDs with ctDNA as well as the binding site size on the ctDNA molecule. The binding constant slightly decreased compared to that of free doxorubicin while the binding site size, describing the number of consecutive DNA lattice residues involved in the binding, increased. It was also demonstrated that the QDs alone and in the form of a nanoconjugate with Tf were not cytotoxic towards human non-small cell lung carcinoma (H460 cell line) and the tumor cell sensitivity of the DOX-Tf-QD nanoconjugate was comparable to that of doxorubicin alone.

Gene Transfer in Eukaryotic Cells Using Activated Dendrimers

NASA Astrophysics Data System (ADS)

Dennig, Jörg

Gene transfer into eukaryotic cells plays an important role in cell biology. Over the last 30 years a number of transfection methods have been developed to mediate gene transfer into eukaryotic cells. Classical methods include co-precipitation of DNA with calcium phosphate, charge-dependent precipitation of DNA with DEAE-dextran, electroporation of nucleic acids, and formation of transfection complexes between DNA and cationic liposomes. Gene transfer technologies based on activated PAMAM-dendrimers provide another class of transfection reagents. PAMAM-dendrimers are highly branched, spherical molecules. Activation of newly synthesized dendrimers involves hydrolytic removal of some of the branches, and results in a molecule with a higher degree of flexibility. Activated dendrimers assemble DNA into compact structures via charge interactions. Activated dendrimer - DNA complexes bind to the cell membrane of eukaryotic cells, and are transported into the cell by non-specific endocytosis. A structural model of the activated dendrimer - DNA complex and a potential mechanism for its uptake into cells will be discussed.

DNA concentration modulation on supported lipid bilayers switched by surface acoustic waves.

PubMed

Hennig, Martin; Wolff, Manuel; Neumann, Jürgen; Wixforth, Achim; Schneider, Matthias F; Rädler, Joachim O

2011-12-20

Spatially addressable arrays of molecules embedded in or anchored to supported lipid bilayers are important for on-chip screening and binding assays; however, methods to sort or accumulate components in a fluid membrane on demand are still limited. Here we apply in-plane surface acoustic shear waves (SAWs) to laterally accumulate double-stranded DNA segments electrostatically bound to a cationic supported lipid bilayer. The fluorescently labeled DNA segments are found to segregate into stripe patterns with a spatial frequency corresponding to the periodicity of the standing SAW wave (~10 μm). The DNA molecules are accumulated 10-fold in the regions of SAW antinodes. The superposition of two orthogonal sets of SAW sources creates checkerboard like arrays of DNA demonstrating the potential to generate arrayed fields dynamically. The pattern relaxation time of 0.58 s, which is independent of the segment length, indicates a sorting and relaxation mechanism dominated by lipid diffusion rather than DNA self-diffusion. © 2011 American Chemical Society

The Incorporation of Ribonucleotides Induces Structural and Conformational Changes in DNA.

PubMed

Meroni, Alice; Mentegari, Elisa; Crespan, Emmanuele; Muzi-Falconi, Marco; Lazzaro, Federico; Podestà, Alessandro

2017-10-03

Ribonucleotide incorporation is the most common error occurring during DNA replication. Cells have hence developed mechanisms to remove ribonucleotides from the genome and restore its integrity. Indeed, the persistence of ribonucleotides into DNA leads to severe consequences, such as genome instability and replication stress. Thus, it becomes important to understand the effects of ribonucleotides incorporation, starting from their impact on DNA structure and conformation. Here we present a systematic study of the effects of ribonucleotide incorporation into DNA molecules. We have developed, to our knowledge, a new method to efficiently synthesize long DNA molecules (hundreds of basepairs) containing ribonucleotides, which is based on a modified protocol for the polymerase chain reaction. By means of atomic force microscopy, we could therefore investigate the changes, upon ribonucleotide incorporation, of the structural and conformational properties of numerous DNA populations at the single-molecule level. Specifically, we characterized the scaling of the contour length with the number of basepairs and the scaling of the end-to-end distance with the curvilinear distance, the bending angle distribution, and the persistence length. Our results revealed that ribonucleotides affect DNA structure and conformation on scales that go well beyond the typical dimension of the single ribonucleotide. In particular, the presence of ribonucleotides induces a systematic shortening of the molecules, together with a decrease of the persistence length. Such structural changes are also likely to occur in vivo, where they could directly affect the downstream DNA transactions, as well as interfere with protein binding and recognition. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.

New Approaches Towards Recognition of Nucleic Acid Triple Helices

PubMed Central

Arya, Dev P.

2012-01-01

We show that groove recognition of nucleic acid triple helices can be achieved with aminosugars. Among these aminosugars, neomycin is the most effective aminoglycoside (groove binder) for stabilizing a DNA triple helix. It stabilizes both the T·A·T triplex and mixed-base DNA triplexes better than known DNA minor groove binders (which usually destabilize the triplex) and polyamines. Neomycin selectively stabilizes the triplex (T·A·T and mixed base) without any effect on the DNA duplex. The selectivity of neomycin likely originates from its potential and shape complementarity to the triplex Watson–Hoogsteen groove, making it the first molecule that selectively recognizes a triplex groove over a duplex groove. The groove recognition of aminoglycosides is not limited to DNA triplexes, but also extends to RNA and hybrid triple helical structures. Intercalator–neomycin conjugates are shown to simultaneously probe the base stacking and groove surface in the DNA triplex. Calorimetric and spectrosocopic studies allow the quantification of the effect of surface area of the intercalating moiety on binding to the triplex. These studies outline a novel approach to the recognition of DNA triplexes that incorporates the use of non-competing binding sites. These principles of dual recognition should be applicable to the design of ligands that can bind any given nucleic acid target with nanomolar affinities and with high selectivity. PMID:21073199

Dissociation from DNA of Type III Restriction–Modification enzymes during helicase-dependent motion and following endonuclease activity

PubMed Central

Tóth, Júlia; van Aelst, Kara; Salmons, Hannah; Szczelkun, Mark D.

2012-01-01

DNA cleavage by the Type III Restriction–Modification (RM) enzymes requires the binding of a pair of RM enzymes at two distant, inversely orientated recognition sequences followed by helicase-catalysed ATP hydrolysis and long-range communication. Here we addressed the dissociation from DNA of these enzymes at two stages: during long-range communication and following DNA cleavage. First, we demonstrated that a communicating species can be trapped in a DNA domain without a recognition site, with a non-specific DNA association lifetime of ∼200 s. If free DNA ends were present the lifetime became too short to measure, confirming that ends accelerate dissociation. Secondly, we observed that Type III RM enzymes can dissociate upon DNA cleavage and go on to cleave further DNA molecules (they can ‘turnover’, albeit inefficiently). The relationship between the observed cleavage rate and enzyme concentration indicated independent binding of each site and a requirement for simultaneous interaction of at least two enzymes per DNA to achieve cleavage. In light of various mechanisms for helicase-driven motion on DNA, we suggest these results are most consistent with a thermally driven random 1D search model (i.e. ‘DNA sliding’). PMID:22523084

Biorecognition by DNA oligonucleotides after Exposure to Photoresists and Resist Removers

PubMed Central

Dean, Stacey L.; Morrow, Thomas J.; Patrick, Sue; Li, Mingwei; Clawson, Gary; Mayer, Theresa S.; Keating, Christine D.

2013-01-01

Combining biological molecules with integrated circuit technology is of considerable interest for next generation sensors and biomedical devices. Current lithographic microfabrication methods, however, were developed for compatibility with silicon technology rather than bioorganic molecules and consequently it cannot be assumed that biomolecules will remain attached and intact during on-chip processing. Here, we evaluate the effects of three common photoresists (Microposit S1800 series, PMGI SF6, and Megaposit SPR 3012) and two photoresist removers (acetone and 1165 remover) on the ability of surface-immobilized DNA oligonucleotides to selectively recognize their reverse-complementary sequence. Two common DNA immobilization methods were compared: adsorption of 5′-thiolated sequences directly to gold nanowires and covalent attachment of 5′-thiolated sequences to surface amines on silica coated nanowires. We found that acetone had deleterious effects on selective hybridization as compared to 1165 remover, presumably due to incomplete resist removal. Use of the PMGI photoresist, which involves a high temperature bake step, was detrimental to the later performance of nanowire-bound DNA in hybridization assays, especially for DNA attached via thiol adsorption. The other three photoresists did not substantially degrade DNA binding capacity or selectivity for complementary DNA sequences. To determine if the lithographic steps caused more subtle damage, we also tested oligonucleotides containing a single base mismatch. Finally, a two-step photolithographic process was developed and used in combination with dielectrophoretic nanowire assembly to produce an array of doubly-contacted, electrically isolated individual nanowire components on a chip. Post-fabrication fluorescence imaging indicated that nanowire-bound DNA was present and able to selectively bind complementary strands. PMID:23952639

Structure and decoy-mediated inhibition of the SOX18/Prox1-DNA interaction

PubMed Central

Klaus, Miriam; Prokoph, Nina; Girbig, Mathias; Wang, Xuecong; Huang, Yong-Heng; Srivastava, Yogesh; Hou, Linlin; Narasimhan, Kamesh; Kolatkar, Prasanna R.; Francois, Mathias; Jauch, Ralf

2016-01-01

The transcription factor (TF) SOX18 drives lymphatic vessel development in both embryogenesis and tumour-induced neo-lymphangiogenesis. Genetic disruption of Sox18 in a mouse model protects from tumour metastasis and established the SOX18 protein as a molecular target. Here, we report the crystal structure of the SOX18 DNA binding high-mobility group (HMG) box bound to a DNA element regulating Prox1 transcription. The crystals diffracted to 1.75Å presenting the highest resolution structure of a SOX/DNA complex presently available revealing water structure, structural adjustments at the DNA contact interface and non-canonical conformations of the DNA backbone. To explore alternatives to challenging small molecule approaches for targeting the DNA-binding activity of SOX18, we designed a set of five decoys based on modified Prox1-DNA. Four decoys potently inhibited DNA binding of SOX18 in vitro and did not interact with non-SOX TFs. Serum stability, nuclease resistance and thermal denaturation assays demonstrated that a decoy circularized with a hexaethylene glycol linker and terminal phosphorothioate modifications is most stable. This SOX decoy also interfered with the expression of a luciferase reporter under control of a SOX18-dependent VCAM1 promoter in COS7 cells. Collectively, we propose SOX decoys as potential strategy for inhibiting SOX18 activity to disrupt tumour-induced neo-lymphangiogenesis. PMID:26939885

DNA-templated synthesis of Pt nanoparticles on single-walled carbon nanotubes.

PubMed

Dong, Lifeng

2009-11-18

A series of electron microscopy characterizations demonstrate that single-stranded deoxyribonucleic acid (ssDNA) can bind to nanotube surfaces and disperse bundled single-walled carbon nanotubes (SWCNTs) into individual tubes. The ssDNA molecules on the nanotube surfaces demonstrate various morphologies, such as aggregated clusters and spiral wrapping around a nanotube with different pitches and spaces, indicating that the morphology of the SWCNT/DNA hybrids is not related solely to the base sequence of the ssDNA or the chirality or the diameter of the nanotubes. In addition to serving as a non-covalent dispersion agent, the ssDNA molecules bonded to the nanotube surface can provide addresses for localizing Pt(II) complexes along the nanotubes. The Pt nanoparticles obtained by a reduction of the Pt2+-DNA adducts are crystals with a size of < or =1-2 nm. These results expand our understanding of the interactions between ssDNA and SWCNTs and provide an efficient approach for positioning Pt and other metal particles, with uniform sizes and without aggregations, along the nanotube surfaces for applications in direct ethanol/methanol fuel cells and nanoscale electronics.

Two-Way Gold Nanoparticle Label-Free Sensing of Specific Sequence and Small Molecule Targets Using Switchable Concatemers.

PubMed

Zhu, Longjiao; Shao, Xiangli; Luo, Yunbo; Huang, Kunlung; Xu, Wentao

2017-05-19

A two-way colorimetric biosensor based on unmodified gold nanoparticles (GNPs) and a switchable double-stranded DNA (dsDNA) concatemer have been demonstrated. Two hairpin probes (H1 and H2) were first designed that provided the fuels to assemble the dsDNA concatemers via hybridization chain reaction (HCR). A functional hairpin (FH) was rationally designed to recognize the target sequences. All the hairpins contained a single-stranded DNA (ssDNA) loop and sticky end to prevent GNPs from salt-induced aggregation. In the presence of target sequence, the capture probe blocked in the FH recognizes the target to form a duplex DNA, which causes the release of the initiator probe by FH conformational change. This process then starts the alternate-opening of H1 and H2 through HCR, and dsDNA concatemers grow from the target sequence. As a result, unmodified GNPs undergo salt-induced aggregation because the formed dsDNA concatemers are stiffer and provide less stabilization. A light purple-to-blue color variation was observed in the bulk solution, termed the light-off sensing way. Furthermore, H1 ingeniously inserted an aptamer sequence to generate dsDNA concatemers with multiple small molecule binding sites. In the presence of small molecule targets, concatemers can be disassembled into mixtures with ssDNA sticky ends. A blue-to-purple reverse color variation was observed due to the regeneration of the ssDNA, termed the light-on way. The two-way biosensor can detect both nucleic acids and small molecule targets with one sensing device. This switchable sensing element is label-free, enzyme-free, and sophisticated-instrumentation-free. The detection limits of both targets were below nanomolar.

DNA interaction studies of sesamol (3,4-methylenedioxyphenol) food additive.

PubMed

Kashanian, Soheila; Tahmasian Ghobadi, Ameneh; Roshanfekr, Hamideh; Shariati, Zohreh

2013-02-01

The interaction of native calf thymus DNA (CT-DNA) with sesamol (3,4-methylenedioxyphenol) in Tris-HCl buffer at neutral pH 7.4 was monitored by absorption spectrophotometry, viscometry and spectrofluorometry. It is found that sesamol molecules could interact with DNA outside and/or groove binding modes, as are evidenced by: hyperchromism in UV absorption band, very slow decrease in specific viscosity of DNA, and small increase in the fluorescence of methylene blue (MB)-DNA solutions in the presence of increasing amounts of sesamol, which indicates that it is able to partially release the bound MB. Furthermore, the enthalpy and entropy of the reaction between sesamol and CT-DNA showed that the reaction is enthalpy-favored and entropy-disfavored (ΔH = -174.08 kJ mol(-1); ΔS = -532.92 J mol(-1) K(-1)). The binding constant was determined using absorption measurement and found to be 2.7 × 10(4) M(-1); its magnitude suggests that sesamol interacts to DNA with a high affinity.

Dynamic and Progressive Control of DNA Origami Conformation by Modulating DNA Helicity with Chemical Adducts.

PubMed

Chen, Haorong; Zhang, Hanyu; Pan, Jing; Cha, Tae-Gon; Li, Shiming; Andréasson, Joakim; Choi, Jong Hyun

2016-05-24

DNA origami has received enormous attention for its ability to program complex nanostructures with a few nanometer precision. Dynamic origami structures that change conformation in response to environmental cues or external signals hold great promises in sensing and actuation at the nanoscale. The reconfiguration mechanism of existing dynamic origami structures is mostly limited to single-stranded hinges and relies almost exclusively on DNA hybridization or strand displacement. Here, we show an alternative approach by demonstrating on-demand conformation changes with DNA-binding molecules, which intercalate between base pairs and unwind DNA double helices. The unwinding effect modulates the helicity mismatch in DNA origami, which significantly influences the internal stress and the global conformation of the origami structure. We demonstrate the switching of a polymerized origami nanoribbon between different twisting states and a well-constrained torsional deformation in a monomeric origami shaft. The structural transformation is shown to be reversible, and binding isotherms confirm the reconfiguration mechanism. This approach provides a rapid and reversible means to change DNA origami conformation, which can be used for dynamic and progressive control at the nanoscale.

The nucleoid protein Dps binds genomic DNA of Escherichia coli in a non-random manner

PubMed Central

Kondrashov, F. A.; Toshchakov, S. V.; Dominova, I.; Shvyreva, U. S.; Vrublevskaya, V. V.; Morenkov, O. S.; Panyukov, V. V.

2017-01-01

Dps is a multifunctional homododecameric protein that oxidizes Fe2+ ions accumulating them in the form of Fe2O3 within its protein cavity, interacts with DNA tightly condensing bacterial nucleoid upon starvation and performs some other functions. During the last two decades from discovery of this protein, its ferroxidase activity became rather well studied, but the mechanism of Dps interaction with DNA still remains enigmatic. The crucial role of lysine residues in the unstructured N-terminal tails led to the conventional point of view that Dps binds DNA without sequence or structural specificity. However, deletion of dps changed the profile of proteins in starved cells, SELEX screen revealed genomic regions preferentially bound in vitro and certain affinity of Dps for artificial branched molecules was detected by atomic force microscopy. Here we report a non-random distribution of Dps binding sites across the bacterial chromosome in exponentially growing cells and show their enrichment with inverted repeats prone to form secondary structures. We found that the Dps-bound regions overlap with sites occupied by other nucleoid proteins, and contain overrepresented motifs typical for their consensus sequences. Of the two types of genomic domains with extensive protein occupancy, which can be highly expressed or transcriptionally silent only those that are enriched with RNA polymerase molecules were preferentially occupied by Dps. In the dps-null mutant we, therefore, observed a differentially altered expression of several targeted genes and found suppressed transcription from the dps promoter. In most cases this can be explained by the relieved interference with Dps for nucleoid proteins exploiting sequence-specific modes of DNA binding. Thus, protecting bacterial cells from different stresses during exponential growth, Dps can modulate transcriptional integrity of the bacterial chromosome hampering RNA biosynthesis from some genes via competition with RNA polymerase or, vice versa, competing with inhibitors to activate transcription. PMID:28800583

Super-resolution binding activated localization microscopy through reversible change of DNA conformation.

PubMed

Szczurek, Aleksander; Birk, Udo; Knecht, Hans; Dobrucki, Jurek; Mai, Sabine; Cremer, Christoph

2018-01-01

Methods of super-resolving light microscopy (SRM) have found an exponentially growing range of applications in cell biology, including nuclear structure analyses. Recent developments have proven that Single Molecule Localization Microscopy (SMLM), a type of SRM, is particularly useful for enhanced spatial analysis of the cell nucleus due to its highest resolving capability combined with very specific fluorescent labeling. In this commentary we offer a brief review of the latest methodological development in the field of SMLM of chromatin designated DNA Structure Fluctuation Assisted Binding Activated Localization Microscopy (abbreviated as fBALM) as well as its potential future applications in biology and medicine.

Physicist's simple access to protein structures: the computer program WHAT IF

NASA Astrophysics Data System (ADS)

Altenberg-Greulich, Brigitte; Zech, Stephan G.; Stehlik, Dietmar; Vriend, Gert

2001-06-01

We describe the computer program WHAT IF and its application to two physical examples. For the DNA binding protein, OCT-1 (pou domain) the location of amino acids with a sidechain amino group is shown. Such knowledge is required when staining this molecule with a fluorescence dye, which binds chemically to the amino terminus as well as amino groups in sidechains. The program shows that most sidechain amino groups are protected when DNA is bound to OCT-1, allowing selective staining of the amino terminal NH2 group. A protein stained this way can be used in fluorescence spectroscopic studies on function aspects of OCT-1.

Super-resolution binding activated localization microscopy through reversible change of DNA conformation

PubMed Central

Knecht, Hans; Dobrucki, Jurek; Mai, Sabine

2018-01-01

ABSTRACT Methods of super-resolving light microscopy (SRM) have found an exponentially growing range of applications in cell biology, including nuclear structure analyses. Recent developments have proven that Single Molecule Localization Microscopy (SMLM), a type of SRM, is particularly useful for enhanced spatial analysis of the cell nucleus due to its highest resolving capability combined with very specific fluorescent labeling. In this commentary we offer a brief review of the latest methodological development in the field of SMLM of chromatin designated DNA Structure Fluctuation Assisted Binding Activated Localization Microscopy (abbreviated as fBALM) as well as its potential future applications in biology and medicine. PMID:29297245

Aptamer Recognition of Multiplexed Small-Molecule-Functionalized Substrates.

PubMed

Nakatsuka, Nako; Cao, Huan H; Deshayes, Stephanie; Melkonian, Arin Lucy; Kasko, Andrea M; Weiss, Paul S; Andrews, Anne M

2018-05-31

Aptamers are chemically synthesized oligonucleotides or peptides with molecular recognition capabilities. We investigated recognition of substrate-tethered small-molecule targets, using neurotransmitters as examples, and fluorescently labeled DNA aptamers. Substrate regions patterned via microfluidic channels with dopamine or L-tryptophan were selectively recognized by previously identified dopamine or L-tryptophan aptamers, respectively. The on-substrate dissociation constant determined for the dopamine aptamer was comparable to, though slightly greater than the previously determined solution dissociation constant. Using pre-functionalized neurotransmitter-conjugated oligo(ethylene glycol) alkanethiols and microfluidics patterning, we produced multiplexed substrates to capture and to sort aptamers. Substrates patterned with L-DOPA, L-DOPS, and L-5-HTP enabled comparison of the selectivity of the dopamine aptamer for different targets via simultaneous determination of in situ binding constants. Thus, beyond our previous demonstrations of recognition by protein binding partners (i.e., antibodies and G-protein-coupled receptors), strategically optimized small-molecule-functionalized substrates show selective recognition of nucleic acid binding partners. These substrates are useful for side-by-side target comparisons, and future identification and characterization of novel aptamers targeting neurotransmitters or other important small-molecules.

Measuring protein-protein and protein-nucleic Acid interactions by biolayer interferometry.

PubMed

Sultana, Azmiri; Lee, Jeffrey E

2015-02-02

Biolayer interferometry (BLI) is a simple, optical dip-and-read system useful for measuring interactions between proteins, peptides, nucleic acids, small molecules, and/or lipids in real time. In BLI, a biomolecular bait is immobilized on a matrix at the tip of a fiber-optic sensor. The binding between the immobilized ligand and another molecule in an analyte solution produces a change in optical thickness at the tip and results in a wavelength shift proportional to binding. BLI provides direct binding affinities and rates of association and dissociation. This unit describes an efficient approach using streptavidin-based BLI to analyze DNA-protein and protein-protein interactions. A quantitative set of equilibrium binding affinities (K(d)) and rates of association and dissociation (k(a)/k(d)) can be measured in minutes using nanomole quantities of sample. Copyright © 2015 John Wiley & Sons, Inc.

Generalized theory on the mechanism of site-specific DNA-protein interactions

NASA Astrophysics Data System (ADS)

Niranjani, G.; Murugan, R.

2016-05-01

We develop a generalized theoretical framework on the binding of transcription factor proteins (TFs) with specific sites on DNA that takes into account the interplay of various factors regarding overall electrostatic potential at the DNA-protein interface, occurrence of kinetic traps along the DNA sequence, presence of other roadblock protein molecules along DNA and crowded environment, conformational fluctuations in the DNA binding domains (DBDs) of TFs, and the conformational state of the DNA. Starting from a Smolochowski type theoretical framework on site-specific binding of TFs we logically build our model by adding the effects of these factors one by one. Our generalized two-step model suggests that the electrostatic attractive forces present inbetween the positively charged DBDs of TFs and the negatively charged phosphate backbone of DNA, along with the counteracting shielding effects of solvent ions, is the core factor that creates a fluidic type environment at the DNA-protein interface. This in turn facilitates various one-dimensional diffusion (1Dd) processes such as sliding, hopping and intersegmental transfers. These facilitating processes as well as flipping dynamics of conformational states of DBDs of TFs between stationary and mobile states can enhance the 1Dd coefficient on a par with three-dimensional diffusion (3Dd). The random coil conformation of DNA also plays critical roles in enhancing the site-specific association rate. The extent of enhancement over the 3Dd controlled rate seems to be directly proportional to the maximum possible 1Dd length. We show that the overall site-specific binding rate scales with the length of DNA in an asymptotic way. For relaxed DNA, the specific binding rate will be independent of the length of DNA as length increases towards infinity. For condensed DNA as in in vivo conditions, the specific binding rate depends on the length of DNA in a turnover way with a maximum. This maximum rate seems to scale with the maximum possible 1Dd length of TFs in a square root manner. Results suggest that 1Dd processes contribute much less to the enhancement of specific binding rate under in vivo conditions for condensed DNA. There exists a critical length of binding stretch of TFs beyond which the probability associated with the random occurrence of similar specific binding sites will be close to zero. TFs in natural systems from prokaryotes to eukaryotes seem to handle sequence-mediated kinetic traps via increasing the length of their recognition stretch or combinatorial binding. TFs overcome the hurdles of roadblocks via switching efficiently between sliding, hopping and intersegmental transfer modes. The site-specific binding rate as well as the maximum possible 1Dd length seem to be directly proportional to the square root of the probability (p R) of finding a nonspecific binding site to be free from dynamic roadblocks. Here p R seems to be a function of the number of nsbs available per DNA binding protein (ϕ) inside the living cell. It seems that p R  >  0.8 when ϕ  >  10 which is true for the Escherichia coli cell system.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kitchin, Kirk T.; Wallace, Kathleen

A large amount of evidence suggests that arsenicals act via oxidative stress in causing cancer in humans and experimental animals. It is possible that arsenicals could bind in situ close to nuclear DNA followed by Haber-Weiss type oxidative DNA damage. Therefore, we tested this hypothesis by using radioactive {sup 73}As labeled arsenite and vacuum filtration methodology to determine the binding affinity and capacity of {sup 73}As arsenite to calf thymus DNA and Type 2A unfractionated histones, histone H3, H4 and horse spleen ferritin. Arsenicals are known to release redox active Fe from ferritin. At concentrations up to about 1 mM,more » neither DNA nor any of the three proteins studied, Type II-A histones, histone H3, H4 or ferritin, bound radioactive arsenite in a specific manner. Therefore, it appears highly unlikely that initial in situ binding of trivalent arsenicals, followed by in situ oxidative DNA damage, can account for arsenic's carcinogenicity. This experimental evidence (lack of arsenite binding to DNA, histone Type II-A and histone H3, H4) does not rule out other possible oxidative stress modes of action for arsenic such as (a) diffusion of longer lived oxidative stress molecules, such as H{sub 2}O{sub 2} into the nucleus and ensuing oxidative damage, (b) redox chemistry by unbound arsenicals in the nucleus, or (c) arsenical-induced perturbations in Fe, Cu or other metals which are already known to oxidize DNA in vitro and in vivo.« less

Determining the Specificity of Cascade Binding, Interference, and Primed Adaptation In Vivo in the Escherichia coli Type I-E CRISPR-Cas System

PubMed Central

Cooper, Lauren A.; Stringer, Anne M.

2018-01-01

ABSTRACT In clustered regularly interspaced short palindromic repeat (CRISPR)-Cas (CRISPR-associated) immunity systems, short CRISPR RNAs (crRNAs) are bound by Cas proteins, and these complexes target invading nucleic acid molecules for degradation in a process known as interference. In type I CRISPR-Cas systems, the Cas protein complex that binds DNA is known as Cascade. Association of Cascade with target DNA can also lead to acquisition of new immunity elements in a process known as primed adaptation. Here, we assess the specificity determinants for Cascade-DNA interaction, interference, and primed adaptation in vivo, for the type I-E system of Escherichia coli. Remarkably, as few as 5 bp of crRNA-DNA are sufficient for association of Cascade with a DNA target. Consequently, a single crRNA promotes Cascade association with numerous off-target sites, and the endogenous E. coli crRNAs direct Cascade binding to >100 chromosomal sites. In contrast to the low specificity of Cascade-DNA interactions, >18 bp are required for both interference and primed adaptation. Hence, Cascade binding to suboptimal, off-target sites is inert. Our data support a model in which the initial Cascade association with DNA targets requires only limited sequence complementarity at the crRNA 5′ end whereas recruitment and/or activation of the Cas3 nuclease, a prerequisite for interference and primed adaptation, requires extensive base pairing. PMID:29666291

Single-molecule DNA unzipping reveals asymmetric modulation of a transcription factor by its binding site sequence and context

PubMed Central

Rudnizky, Sergei; Khamis, Hadeel; Malik, Omri; Squires, Allison H; Meller, Amit; Melamed, Philippa

2018-01-01

Abstract Most functional transcription factor (TF) binding sites deviate from their ‘consensus’ recognition motif, although their sites and flanking sequences are often conserved across species. Here, we used single-molecule DNA unzipping with optical tweezers to study how Egr-1, a TF harboring three zinc fingers (ZF1, ZF2 and ZF3), is modulated by the sequence and context of its functional sites in the Lhb gene promoter. We find that both the core 9 bp bound to Egr-1 in each of the sites, and the base pairs flanking them, modulate the affinity and structure of the protein–DNA complex. The effect of the flanking sequences is asymmetric, with a stronger effect for the sequence flanking ZF3. Characterization of the dissociation time of Egr-1 revealed that a local, mechanical perturbation of the interactions of ZF3 destabilizes the complex more effectively than a perturbation of the ZF1 interactions. Our results reveal a novel role for ZF3 in the interaction of Egr-1 with other proteins and the DNA, providing insight on the regulation of Lhb and other genes by Egr-1. Moreover, our findings reveal the potential of small changes in DNA sequence to alter transcriptional regulation, and may shed light on the organization of regulatory elements at promoters. PMID:29253225

Development of Single-Stranded DNA Aptamers for Specific Bisphenol A Detection

PubMed Central

Jo, Minjoung; Ahn, Ji-Young; Lee, Joohyung; Lee, Seram; Hong, Sun Woo; Yoo, Jae-Wook; Kang, Jeehye; Dua, Pooja

2011-01-01

The development of reagents with high affinity and specificity to small molecules is crucial for the high-throughput detection of chemical compounds, such as toxicants or pollutants. Aptamers are short and single-stranded (ss) oligonucleotides able to recognize target molecules with high affinity. Here, we report the selection of ssDNA aptamers that bind to Bisphenol A (BPA), an environmental hormone. Using SELEX process, we isolated high affinity aptamers to BPA from a 1015 random library of 60 mer ssDNAs. The selected aptamers bound specifically to BPA, but not to structurally similar molecules, such as Bisphenol B with one methyl group difference, or 4,4′-Bisphenol with 2 methyl groups difference. Using these aptamers, we developed an aptamer-based sol–gel biochip and detected BPA dissolved in water. This novel BPA aptamer-based detection can be further applied to the universal and high-specificity detection of small molecules. PMID:21413891

Gel Electrophoresis of Gold-DNA Nano-Conjugates

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pellegrino, T.; Sperling, R.A.; Alivisatos, A.P.

2006-01-10

Single stranded DNA of different lengths and different amounts was attached to colloidal phosphine stabilized Au nanoparticles. The resulting conjugates were investigated in detail by a gel electrophoresis study based on 1200 gels. We demonstrate how these experiments help to understand the binding of DNA to Au particles. In particular we compare specific attachment of DNA via gold-thiol bonds with nonspecific adsorption of DNA. The maximum number of DNA molecules that can be bound per particle was determined. We also compare several methods to used gel electrophoresis for investigating the effective diameter of DNA-Au conjugates, such as using a calibrationmore » curve of particles with known diameters and Ferguson plots.« less

The Mitochondrial Transcription Factor TFAM Coordinates the Assembly of Multiple DNA Molecules into Nucleoid-like Structures

PubMed Central

Kaufman, Brett A.; Durisic, Nela; Mativetsky, Jeffrey M.; Costantino, Santiago; Hancock, Mark A.; Grutter, Peter

2007-01-01

Packaging DNA into condensed structures is integral to the transmission of genomes. The mammalian mitochondrial genome (mtDNA) is a high copy, maternally inherited genome in which mutations cause a variety of multisystem disorders. In all eukaryotic cells, multiple mtDNAs are packaged with protein into spheroid bodies called nucleoids, which are the fundamental units of mtDNA segregation. The mechanism of nucleoid formation, however, remains unknown. Here, we show that the mitochondrial transcription factor TFAM, an abundant and highly conserved High Mobility Group box protein, binds DNA cooperatively with nanomolar affinity as a homodimer and that it is capable of coordinating and fully compacting several DNA molecules together to form spheroid structures. We use noncontact atomic force microscopy, which achieves near cryo-electron microscope resolution, to reveal the structural details of protein–DNA compaction intermediates. The formation of these complexes involves the bending of the DNA backbone, and DNA loop formation, followed by the filling in of proximal available DNA sites until the DNA is compacted. These results indicate that TFAM alone is sufficient to organize mitochondrial chromatin and provide a mechanism for nucleoid formation. PMID:17581862

Live-cell single-molecule tracking reveals co-recognition of H3K27me3 and DNA targets polycomb Cbx7-PRC1 to chromatin

PubMed Central

Zhen, Chao Yu; Tatavosian, Roubina; Huynh, Thao Ngoc; Duc, Huy Nguyen; Das, Raibatak; Kokotovic, Marko; Grimm, Jonathan B; Lavis, Luke D; Lee, Jun; Mejia, Frances J; Li, Yang; Yao, Tingting; Ren, Xiaojun

2016-01-01

The Polycomb PRC1 plays essential roles in development and disease pathogenesis. Targeting of PRC1 to chromatin is thought to be mediated by the Cbx family proteins (Cbx2/4/6/7/8) binding to histone H3 with a K27me3 modification (H3K27me3). Despite this prevailing view, the molecular mechanisms of targeting remain poorly understood. Here, by combining live-cell single-molecule tracking (SMT) and genetic engineering, we reveal that H3K27me3 contributes significantly to the targeting of Cbx7 and Cbx8 to chromatin, but less to Cbx2, Cbx4, and Cbx6. Genetic disruption of the complex formation of PRC1 facilitates the targeting of Cbx7 to chromatin. Biochemical analyses uncover that the CD and AT-hook-like (ATL) motif of Cbx7 constitute a functional DNA-binding unit. Live-cell SMT of Cbx7 mutants demonstrates that Cbx7 is targeted to chromatin by co-recognizing of H3K27me3 and DNA. Our data suggest a novel hierarchical cooperation mechanism by which histone modifications and DNA coordinate to target chromatin regulatory complexes. DOI: http://dx.doi.org/10.7554/eLife.17667.001 PMID:27723458

DNA-based Nanoconstructs for the Detection of Ions and Biomolecules with Related Raman/SERS Signature Studies

NASA Astrophysics Data System (ADS)

Brenneman, Kimber L.

The utilization of DNA aptamers and semiconductor quantum dots (QDs) for the detection of ions and biomolecules was investigated. In recent years, there have been many studies based on the use of DNA and RNA aptamers, which are single stranded oligonucleotides capable of binding to biomolecules, other molecules, and ions. In many of these cases, the conformational changes of these DNA and RNA aptamers are suitable to use fluorescence resonant energy transfer (FRET) or nanometal surface energy transfer (NSET) techniques to detect such analytes. Coupled with this growth in such uses of aptamers, there has been an expanded use of semiconductor quantum dots as brighter, longer-lasting alternatives to fluorescent dyes in labeling and detection techniques of interest in biomedicine and environmental monitoring. Thrombin binding aptamer (TBA) and a zinc aptamer were used to detect mercury, lead, zinc, and cadmium. These probes were tested in a liquid assay as well as on a filter paper coupon. Biomolecules were also studied and detected using surface-enhanced Raman spectroscopy (SERS), including DNA aptamers and C-reactive protein (CRP). Raman spectroscopy is a useful tool for sensor development, label-free detection, and has the potential for remote sensing. Raman spectra provide information on the vibrational modes or phonons, between and within molecules. Therefore, unique spectral fingerprints for single molecules can be obtained. SERS is accomplished through the use of substrates with nanometer scale geometries made of metals with many free electrons, such as silver, gold, or copper. In this research silver SERS substrates were used to study the SERS signature of biomolecules that typically produce very weak Raman signals.

The use of molecular dynamics simulations to evaluate the DNA sequence-selectivity of G-A cross-linking PBD-duocarmycin dimers.

PubMed

Jackson, Paul J M; Rahman, Khondaker M; Thurston, David E

2017-01-01

The pyrrolobenzodiazepine (PBD) and duocarmycin families are DNA-interactive agents that covalently bond to guanine (G) and adenine (A) bases, respectively, and that have been joined together to create synthetic dimers capable of cross-linking G-G, A-A, and G-A bases. Three G-A alkylating dimers have been reported in publications to date, with defined DNA-binding sites proposed for two of them. In this study we have used molecular dynamics simulations to elucidate preferred DNA-binding sites for the three published molecular types. For the PBD-CPI dimer UTA-6026 (1), our simulations correctly predicted its favoured binding site (i.e., 5'-C(G)AATTA-3') as identified by DNA cleavage studies. However, for the PBD-CI molecule ('Compound 11', 3), we were unable to reconcile the results of our simulations with the reported preferred cross-linking sequence (5'-ATTTTCC(G)-3'). We found that the molecule is too short to span the five base pairs between the A and G bases as claimed, but should target instead a sequence such as 5'-ATTTC(G)-3' with two less base pairs between the reacting G and A residues. Our simulation results for this hybrid dimer are also in accord with the very low interstrand cross-linking and in vitro cytotoxicity activities reported for it. Although a preferred cross-linking sequence was not reported for the third hybrid dimer ('27eS', 2), our simulations predict that it should span two base pairs between covalently reacting G and A bases (e.g., 5'-GTAT(A)-3'). Copyright © 2016. Published by Elsevier Ltd.

Targeting Mycobacterium tuberculosis nucleoid-associated protein HU with structure-based inhibitors

NASA Astrophysics Data System (ADS)

Bhowmick, Tuhin; Ghosh, Soumitra; Dixit, Karuna; Ganesan, Varsha; Ramagopal, Udupi A.; Dey, Debayan; Sarma, Siddhartha P.; Ramakumar, Suryanarayanarao; Nagaraja, Valakunja

2014-06-01

The nucleoid-associated protein HU plays an important role in maintenance of chromosomal architecture and in global regulation of DNA transactions in bacteria. Although HU is essential for growth in Mycobacterium tuberculosis (Mtb), there have been no reported attempts to perturb HU function with small molecules. Here we report the crystal structure of the N-terminal domain of HU from Mtb. We identify a core region within the HU-DNA interface that can be targeted using stilbene derivatives. These small molecules specifically inhibit HU-DNA binding, disrupt nucleoid architecture and reduce Mtb growth. The stilbene inhibitors induce gene expression changes in Mtb that resemble those induced by HU deficiency. Our results indicate that HU is a potential target for the development of therapies against tuberculosis.

Unusually Strong Binding to the DNA Minor Groove by a Highly Twisted Benzimidazole-Diphenylether: Induced Fit and Bound Water†

PubMed Central

Tanious, Farial A.; Laine, William; Peixoto, Paul; Bailly, Christian; Goodwin, Kristie D.; Lewis, Mark A.; Long, Eric C.; Georgiadis, Millie M.; Tidwell, Richard R.; Wilson, W. David

2008-01-01

RT29 is a dicationic diamidine derivative that does not obey the classical “rules” for shape and functional group placement that are expected to result in strong binding and specific recognition of the DNA minor groove. The compound contains a benzimidazole-diphenyl ether core that is flanked by the amidine cations. The diphenyl ether is highly twisted and gives the entire compound too much curvature to fit well to the shape of the minor groove. DNaseI footprinting, fluorescence intercalator displacement studies and circular dichroism spectra, however, indicate that the compound is an AT specific minor groove binding agent. Even more surprisingly, quantitative biosensor-surface plasmon resonance and isothermal titration calorimetric results indicate that the compound binds with exceptional strength to certain AT sequences in DNA with a large negative enthalpy of binding. Crystallographic results for the DNA complex of RT29 compared to calculated results for the free compound show that the compound undergoes significant conformational changes to enhance its minor groove interactions. In addition, a water molecule is incorporated directly into the complex to complete the compound-DNA interface and it forms an essential link between the compound and base pair edges at the floor of the minor groove. The calculated ΔCp value for complex formation is substantially less than the experimentally observed value in support of water being an intrinsic part of the complex with a major contribution to the ΔCp value. Both the induced fit conformational changes of the compound and the bound water are essential for strong binding to DNA by RT29. PMID:17506529

Specific interactions between DNA and regulatory protein controlled by ligand-binding: Ab initio molecular simulation

NASA Astrophysics Data System (ADS)

Matsushita, Y.; Murakawa, T.; Shimamura, K.; Oishi, M.; Ohyama, T.; Kurita, N.

2015-02-01

The catabolite activator protein (CAP) is one of the regulatory proteins controlling the transcription mechanism of gene. Biochemical experiments elucidated that the complex of CAP with cyclic AMP (cAMP) is indispensable for controlling the mechanism, while previous molecular simulations for the monomer of CAP+cAMP complex revealed the specific interactions between CAP and cAMP. However, the effect of cAMP-binding to CAP on the specific interactions between CAP and DNA is not elucidated at atomic and electronic levels. We here considered the ternary complex of CAP, cAMP and DNA in solvating water molecules and investigated the specific interactions between them at atomic and electronic levels using ab initio molecular simulations based on classical molecular dynamics and ab initio fragment molecular orbital methods. The results highlight the important amino acid residues of CAP for the interactions between CAP and cAMP and between CAP and DNA.

CENP-C directs a structural transition of the CENP-A nucleosome mainly through sliding of DNA gyres

PubMed Central

Sekulic, Nikolina; Sennett, Michael A.; Lee, Tae-Hee; Black, Ben E.

2016-01-01

The histone H3 variant, CENP-A, is incorporated into nucleosomes that mark centromere location. We recently reported that CENP-A confers an altered nucleosome shape relative to its counterparts containing conventional H3. Using a single molecule fluorescence resonance energy transfer (FRET) approach with recombinant human histones and centromere DNA, we now find that the nucleosome shape change that CENP-A directs is dominated by lateral passing of the two DNA gyres (gyre sliding). A non-histone centromere protein, CENP-C, binds to and reshapes the nucleosome, sliding the DNA gyres back to positions similar to those in canonical nucleosomes containing conventional histone H3. The model we generate to explain the CENP-A nucleosome transition provides an example of a shape change imposed by external binding proteins, and has important implications for understanding the epigenetic basis for the faithful inheritance of centromere location on the chromosome. PMID:26878239

Direct observation of TALE protein dynamics reveals a two-state search mechanism

PubMed Central

Cuculis, Luke; Abil, Zhanar; Zhao, Huimin; Schroeder, Charles M.

2015-01-01

Transcription activator-like effector (TALE) proteins are a class of programmable DNA-binding proteins for which the fundamental mechanisms governing the search process are not fully understood. Here we use single-molecule techniques to directly observe TALE search dynamics along DNA templates. We find that TALE proteins are capable of rapid diffusion along DNA using a combination of sliding and hopping behaviour, which suggests that the TALE search process is governed in part by facilitated diffusion. We also observe that TALE proteins exhibit two distinct modes of action during the search process—a search state and a recognition state—facilitated by different subdomains in monomeric TALE proteins. Using TALE truncation mutants, we further demonstrate that the N-terminal region of TALEs is required for the initial non-specific binding and subsequent rapid search along DNA, whereas the central repeat domain is required for transitioning into the site-specific recognition state. PMID:26027871

Direct observation of TALE protein dynamics reveals a two-state search mechanism.

PubMed

Cuculis, Luke; Abil, Zhanar; Zhao, Huimin; Schroeder, Charles M

2015-06-01

Transcription activator-like effector (TALE) proteins are a class of programmable DNA-binding proteins for which the fundamental mechanisms governing the search process are not fully understood. Here we use single-molecule techniques to directly observe TALE search dynamics along DNA templates. We find that TALE proteins are capable of rapid diffusion along DNA using a combination of sliding and hopping behaviour, which suggests that the TALE search process is governed in part by facilitated diffusion. We also observe that TALE proteins exhibit two distinct modes of action during the search process-a search state and a recognition state-facilitated by different subdomains in monomeric TALE proteins. Using TALE truncation mutants, we further demonstrate that the N-terminal region of TALEs is required for the initial non-specific binding and subsequent rapid search along DNA, whereas the central repeat domain is required for transitioning into the site-specific recognition state.

Proteome-wide Identification of Novel Ceramide-binding Proteins by Yeast Surface cDNA Display and Deep Sequencing.

PubMed

Bidlingmaier, Scott; Ha, Kevin; Lee, Nam-Kyung; Su, Yang; Liu, Bin

2016-04-01

Although the bioactive sphingolipid ceramide is an important cell signaling molecule, relatively few direct ceramide-interacting proteins are known. We used an approach combining yeast surface cDNA display and deep sequencing technology to identify novel proteins binding directly to ceramide. We identified 234 candidate ceramide-binding protein fragments and validated binding for 20. Most (17) bound selectively to ceramide, although a few (3) bound to other lipids as well. Several novel ceramide-binding domains were discovered, including the EF-hand calcium-binding motif, the heat shock chaperonin-binding motif STI1, the SCP2 sterol-binding domain, and the tetratricopeptide repeat region motif. Interestingly, four of the verified ceramide-binding proteins (HPCA, HPCAL1, NCS1, and VSNL1) and an additional three candidate ceramide-binding proteins (NCALD, HPCAL4, and KCNIP3) belong to the neuronal calcium sensor family of EF hand-containing proteins. We used mutagenesis to map the ceramide-binding site in HPCA and to create a mutant HPCA that does not bind to ceramide. We demonstrated selective binding to ceramide by mammalian cell-produced wild type but not mutant HPCA. Intriguingly, we also identified a fragment from prostaglandin D2synthase that binds preferentially to ceramide 1-phosphate. The wide variety of proteins and domains capable of binding to ceramide suggests that many of the signaling functions of ceramide may be regulated by direct binding to these proteins. Based on the deep sequencing data, we estimate that our yeast surface cDNA display library covers ∼60% of the human proteome and our selection/deep sequencing protocol can identify target-interacting protein fragments that are present at extremely low frequency in the starting library. Thus, the yeast surface cDNA display/deep sequencing approach is a rapid, comprehensive, and flexible method for the analysis of protein-ligand interactions, particularly for the study of non-protein ligands. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Nucleolin forms a specific complex with a fragment of the viral (minus) strand of minute virus of mice DNA.

PubMed Central

Barrijal, S; Perros, M; Gu, Z; Avalosse, B L; Belenguer, P; Amalric, F; Rommelaere, J

1992-01-01

Nucleolin, a major nucleolar protein, forms a specific complex with the genome (a single-stranded DNA molecule of minus polarity) of parvovirus MVMp in vitro. By means of South-western blotting experiments, we mapped the binding site to a 222-nucleotide motif within the non-structural transcription unit, referred to as NUBE (nucleolin-binding element). The specificity of the interaction was confirmed by competitive gel retardation assays. DNaseI and nuclease S1 probing showed that NUBE folds into a secondary structure, in agreement with a computer-assisted conformational prediction. The whole NUBE may be necessary for the interaction with nucleolin, as suggested by the failure of NUBE subfragments to bind the protein and by the nuclease footprinting experiments. The present work extends the previously reported ability of nucleolin to form a specific complex with ribosomal RNA, to a defined DNA substrate. Considering the tropism of MVMp DNA replication for host cell nucleoli, these data raise the possibility that nucleolin may contribute to the regulation of the parvoviral life-cycle. Images PMID:1408821

The structural basis of actinomycin D–binding induces nucleotide flipping out, a sharp bend and a left-handed twist in CGG triplet repeats

PubMed Central

Lo, Yu-Sheng; Tseng, Wen-Hsuan; Chuang, Chien-Ying; Hou, Ming-Hon

2013-01-01

The potent anticancer drug actinomycin D (ActD) functions by intercalating into DNA at GpC sites, thereby interrupting essential biological processes including replication and transcription. Certain neurological diseases are correlated with the expansion of (CGG)n trinucleotide sequences, which contain many contiguous GpC sites separated by a single G:G mispair. To characterize the binding of ActD to CGG triplet repeat sequences, the structural basis for the strong binding of ActD to neighbouring GpC sites flanking a G:G mismatch has been determined based on the crystal structure of ActD bound to ATGCGGCAT, which contains a CGG triplet sequence. The binding of ActD molecules to GCGGC causes many unexpected conformational changes including nucleotide flipping out, a sharp bend and a left-handed twist in the DNA helix via a two site-binding model. Heat denaturation, circular dichroism and surface plasmon resonance analyses showed that adjacent GpC sequences flanking a G:G mismatch are preferred ActD-binding sites. In addition, ActD was shown to bind the hairpin conformation of (CGG)16 in a pairwise combination and with greater stability than that of other DNA intercalators. Our results provide evidence of a possible biological consequence of ActD binding to CGG triplet repeat sequences. PMID:23408860

DNA capture elements for rapid detection and identification of biological agents

NASA Astrophysics Data System (ADS)

Kiel, Johnathan L.; Parker, Jill E.; Holwitt, Eric A.; Vivekananda, Jeeva

2004-08-01

DNA capture elements (DCEs; aptamers) are artificial DNA sequences, from a random pool of sequences, selected for their specific binding to potential biological warfare agents. These sequences were selected by an affinity method using filters to which the target agent was attached and the DNA isolated and amplified by polymerase chain reaction (PCR) in an iterative, increasingly stringent, process. Reporter molecules were attached to the finished sequences. To date, we have made DCEs to Bacillus anthracis spores, Shiga toxin, Venezuelan Equine Encephalitis (VEE) virus, and Francisella tularensis. These DCEs have demonstrated specificity and sensitivity equal to or better than antibody.

One-step selection of Vaccinia virus-binding DNA aptamers by MonoLEX

PubMed Central

Nitsche, Andreas; Kurth, Andreas; Dunkhorst, Anna; Pänke, Oliver; Sielaff, Hendrik; Junge, Wolfgang; Muth, Doreen; Scheller, Frieder; Stöcklein, Walter; Dahmen, Claudia; Pauli, Georg; Kage, Andreas

2007-01-01

Background As a new class of therapeutic and diagnostic reagents, more than fifteen years ago RNA and DNA aptamers were identified as binding molecules to numerous small compounds, proteins and rarely even to complete pathogen particles. Most aptamers were isolated from complex libraries of synthetic nucleic acids by a process termed SELEX based on several selection and amplification steps. Here we report the application of a new one-step selection method (MonoLEX) to acquire high-affinity DNA aptamers binding Vaccinia virus used as a model organism for complex target structures. Results The selection against complete Vaccinia virus particles resulted in a 64-base DNA aptamer specifically binding to orthopoxviruses as validated by dot blot analysis, Surface Plasmon Resonance, Fluorescence Correlation Spectroscopy and real-time PCR, following an aptamer blotting assay. The same oligonucleotide showed the ability to inhibit in vitro infection of Vaccinia virus and other orthopoxviruses in a concentration-dependent manner. Conclusion The MonoLEX method is a straightforward procedure as demonstrated here for the identification of a high-affinity DNA aptamer binding Vaccinia virus. MonoLEX comprises a single affinity chromatography step, followed by subsequent physical segmentation of the affinity resin and a single final PCR amplification step of bound aptamers. Therefore, this procedure improves the selection of high affinity aptamers by reducing the competition between aptamers of different affinities during the PCR step, indicating an advantage for the single-round MonoLEX method. PMID:17697378

The Saccharomyces cerevisiae Mlh1-Mlh3 Heterodimer Is an Endonuclease That Preferentially Binds to Holliday Junctions*

PubMed Central

Ranjha, Lepakshi; Anand, Roopesh; Cejka, Petr

2014-01-01

MutLγ, a heterodimer of the MutL homologues Mlh1 and Mlh3, plays a critical role during meiotic homologous recombination. The meiotic function of Mlh3 is fully dependent on the integrity of a putative nuclease motif DQHAX2EX4E, inferring that the anticipated nuclease activity of Mlh1-Mlh3 is involved in the processing of joint molecules to generate crossover recombination products. Although a vast body of genetic and cell biological data regarding Mlh1-Mlh3 is available, mechanistic insights into its function have been lacking due to the unavailability of the recombinant protein complex. Here we expressed the yeast Mlh1-Mlh3 heterodimer and purified it into near homogeneity. We show that recombinant MutLγ is a nuclease that nicks double-stranded DNA. We demonstrate that MutLγ binds DNA with a high affinity and shows a marked preference for Holliday junctions. We also expressed the human MLH1-MLH3 complex and show that preferential binding to Holliday junctions is a conserved capacity of eukaryotic MutLγ complexes. Specific DNA recognition has never been observed with any other eukaryotic MutL homologue. MutLγ thus represents a new paradigm for the function of the eukaryotic MutL protein family. We provide insights into the mode of Holliday junction recognition and show that Mlh1-Mlh3 prefers to bind the open unstacked Holliday junction form. This further supports the model where MutLγ is part of a complex acting on joint molecules to generate crossovers in meiosis. PMID:24443562

The Saccharomyces cerevisiae Mlh1-Mlh3 heterodimer is an endonuclease that preferentially binds to Holliday junctions.

PubMed

Ranjha, Lepakshi; Anand, Roopesh; Cejka, Petr

2014-02-28

MutLγ, a heterodimer of the MutL homologues Mlh1 and Mlh3, plays a critical role during meiotic homologous recombination. The meiotic function of Mlh3 is fully dependent on the integrity of a putative nuclease motif DQHAX2EX4E, inferring that the anticipated nuclease activity of Mlh1-Mlh3 is involved in the processing of joint molecules to generate crossover recombination products. Although a vast body of genetic and cell biological data regarding Mlh1-Mlh3 is available, mechanistic insights into its function have been lacking due to the unavailability of the recombinant protein complex. Here we expressed the yeast Mlh1-Mlh3 heterodimer and purified it into near homogeneity. We show that recombinant MutLγ is a nuclease that nicks double-stranded DNA. We demonstrate that MutLγ binds DNA with a high affinity and shows a marked preference for Holliday junctions. We also expressed the human MLH1-MLH3 complex and show that preferential binding to Holliday junctions is a conserved capacity of eukaryotic MutLγ complexes. Specific DNA recognition has never been observed with any other eukaryotic MutL homologue. MutLγ thus represents a new paradigm for the function of the eukaryotic MutL protein family. We provide insights into the mode of Holliday junction recognition and show that Mlh1-Mlh3 prefers to bind the open unstacked Holliday junction form. This further supports the model where MutLγ is part of a complex acting on joint molecules to generate crossovers in meiosis.

Structural Insights into the Quadruplex-Duplex 3' Interface Formed from a Telomeric Repeat: A Potential Molecular Target.

PubMed

Russo Krauss, Irene; Ramaswamy, Sneha; Neidle, Stephen; Haider, Shozeb; Parkinson, Gary N

2016-02-03

We report here on an X-ray crystallographic and molecular modeling investigation into the complex 3' interface formed between putative parallel stranded G-quadruplexes and a duplex DNA sequence constructed from the human telomeric repeat sequence TTAGGG. Our crystallographic approach provides a detailed snapshot of a telomeric 3' quadruplex-duplex junction: a junction that appears to have the potential to form a unique molecular target for small molecule binding and interference with telomere-related functions. This unique target is particularly relevant as current high-affinity compounds that bind putative G-quadruplex forming sequences only rarely have a high degree of selectivity for a particular quadruplex. Here DNA junctions were assembled using different putative quadruplex-forming scaffolds linked at the 3' end to a telomeric duplex sequence and annealed to a complementary strand. We successfully generated a series of G-quadruplex-duplex containing crystals, both alone and in the presence of ligands. The structures demonstrate the formation of a parallel folded G-quadruplex and a B-form duplex DNA stacked coaxially. Most strikingly, structural data reveals the consistent formation of a TAT triad platform between the two motifs. This triad allows for a continuous stack of bases to link the quadruplex motif with the duplex region. For these crystal structures formed in the absence of ligands, the TAT triad interface occludes ligand binding at the 3' quadruplex-duplex interface, in agreement with in silico docking predictions. However, with the rearrangement of a single nucleotide, a stable pocket can be produced, thus providing an opportunity for the binding of selective molecules at the interface.

A Sensitive DNA Capacitive Biosensor Using Interdigitated Electrodes

PubMed Central

Wang, Lei; Veselinovic, Milena; Yang, Lang; Geiss, Brian J.; Dandy, David S.; Chen, Tom

2017-01-01

This paper presents a label-free affinity-based capacitive biosensor using interdigitated electrodes. Using an optimized process of DNA probe preparation to minimize the effect of contaminants in commercial thiolated DNA probe, the electrode surface was functionalized with the 24-nucleotide DNA probes based on the West Nile virus sequence (Kunjin strain). The biosensor has the ability to detect complementary DNA fragments with a detection limit down to 20 DNA target molecules (1.5 aM range), making it suitable for a practical point-of-care (POC) platform for low target count clinical applications without the need for amplification. The reproducibility of the biosensor detection was improved with efficient covalent immobilization of purified single-stranded DNA probe oligomers on cleaned gold microelectrodes. In addition to the low detection limit, the biosensor showed a dynamic range of detection from 1 μL−1 to 105 μL−1 target molecules (20 to 2 million targets), making it suitable for sample analysis in a typical clinical application environment. The binding results presented in this paper were validated using fluorescent oligomers. PMID:27619528

The G-quadruplex DNA stabilizing drug pyridostatin promotes DNA damage and downregulates transcription of Brca1 in neurons.

PubMed

Moruno-Manchon, Jose F; Koellhoffer, Edward C; Gopakumar, Jayakrishnan; Hambarde, Shashank; Kim, Nayun; McCullough, Louise D; Tsvetkov, Andrey S

2017-09-12

The G-quadruplex is a non-canonical DNA secondary structure formed by four DNA strands containing multiple runs of guanines. G-quadruplexes play important roles in DNA recombination, replication, telomere maintenance, and regulation of transcription. Small molecules that stabilize the G-quadruplexes alter gene expression in cancer cells. Here, we hypothesized that the G-quadruplexes regulate transcription in neurons. We discovered that pyridostatin, a small molecule that specifically stabilizes G-quadruplex DNA complexes, induced neurotoxicity and promoted the formation of DNA double-strand breaks (DSBs) in cultured neurons. We also found that pyridostatin downregulated transcription of the Brca1 gene, a gene that is critical for DSB repair. Importantly, in an in vitro gel shift assay, we discovered that an antibody specific to the G-quadruplex structure binds to a synthetic oligonucleotide, which corresponds to the first putative G-quadruplex in the Brca1 gene promoter. Our results suggest that the G-quadruplex complexes regulate transcription in neurons. Studying the G-quadruplexes could represent a new avenue for neurodegeneration and brain aging research.

System and method for a parallel immunoassay system

DOEpatents

Stevens, Fred J.

2002-01-01

A method and system for detecting a target antigen using massively parallel immunoassay technology. In this system, high affinity antibodies of the antigen are covalently linked to small beads or particles. The beads are exposed to a solution containing DNA-oligomer-mimics of the antigen. The mimics which are reactive with the covalently attached antibody or antibodies will bind to the appropriate antibody molecule on the bead. The particles or beads are then washed to remove any unbound DNA-oligomer-mimics and are then immobilized or trapped. The bead-antibody complexes are then exposed to a test solution which may contain the targeted antigens. If the antigen is present it will replace the mimic since it has a greater affinity for the respective antibody. The particles are then removed from the solution leaving a residual solution. This residual solution is applied a DNA chip containing many samples of complimentary DNA. If the DNA tag from a mimic binds with its complimentary DNA, it indicates the presence of the target antigen. A flourescent tag can be used to more easily identify the bound DNA tag.

Histone Hl-DNA interaction. Influence of phosphorylation on the interaction of histone Hl with linear fragmented DNA.

PubMed Central

Glotov, B O; Nikolaev, L G; Kurochkin, S N; Severin, E S

1977-01-01

By measuring the fluorescence polarization of fluorescent histone H1 derivatives complexed with DNA, binding of the histone to DNA was studied as a function of ionic strength in the solution prior to and after the H1 phosphorylation on Ser-37 residue. Fluorescent labels were covalently linked either specifically to Tyr-72 residues or unspecifically to lysine residues in the H1 polypeptide chain. The values of the corresponding rotational relaxation times showed that at low ionic strength all the segments of the H1 molecule were immobilized on binding to DNA. The gradual increasing NaC1 concentration in the solution of H1-DNA complex was accompanied at first by additional retardation of the histone mobility in the complex, and then by progressive release of histone H1 from from the complex which was completed at 0.5-0.6 M NaC1 irrespective of phosphorylation. tat the same time the phosphorylation of histone H1 led to removal of the central and, presumably, N-terminal regions of H1 from DNA. PMID:194228

Synthesis, photophysical and cytotoxicity evaluations of DNA targeting agents based on 3-amino-1,8-naphthalimide derived Tröger's bases.

PubMed

Murphy, Samantha; Bright, Sandra A; Poynton, Fergus E; McCabe, Thomas; Kitchen, Jonathan A; Veale, Emma B; Williams, D Clive; Gunnlaugsson, Thorfinnur

2014-09-14

The synthesis and characterisation of five bis-1,8-naphthalimide containing Tröger's bases 1–5 formed from their corresponding 3-amino-1,8-naphthalimide precursors 6–10 is described. The photophysical investigations of 1–5 and 6–10 were carried out in several organic solvents as well as in water and as a function of pH using UV-Vis absorption and fluorescence spectroscopies. The DNA binding affinities of 1–5 in aqueous solution at pH 7.4 were also investigated using several UV-Vis absorption and fluorescence experiments by using calf thymus DNA (ct-DNA). These molecules exhibited significant DNA binding affinities; where large binding values (Kb) in the range of 10(6) M(−1) were determined, even in competitive media (50 mM and 160 mM NaCl at pH 7.4). Thermal denaturation measurements also showed that 1–5 significantly stabilised the DNA helix. Using linear and circular dichroism we further demonstrated that the DNA binding interaction occurs both by intercalation and by groove binding. The Tröger's bases were further shown to be rapidly taken up into cells using confocal fluorescence spectroscopy; and cytotoxic studies in HeLa and MCF-7 cells showed that most of the Tröger's bases were effective cytotoxic agents with EC50 values of between 1.1–12 μM and that all the active compounds induced programmed cell death by apoptosis, where up to 70% cellular death was observed after 24 h of incubation for 4.

Promoter-proximal rDNA terminator augments initiation by preventing disruption of the stable transcription complex caused by polymerase read-in

DOE Office of Scientific and Technical Information (OSTI.GOV)

Henderson, S.L.; Ryan, K.; Sollner-Webb, B.

1989-02-01

We have examined the mechanism by which transcriptional initiation at the mouse rDNA promoter is augmented by the RNA polymerase I terminator element that resides just upstream of it. Using templates in which terminator elements are instead positioned at the opposite side of the plasmid rather than proximal to the promoter, or conditions where transcription is terminated elsewhere in the plasmid by UV-induced lesions, we show that the terminator's stimulatory effect is not position dependent. Mouse terminator elements therefore do not stimulate via the previously postulated 'read-through enhancement' model in which terminated polymerases are handed off to an adjacent promotermore » in a concerted reaction. The position independence and orientation dependence of the terminator also makes it unlikely that the terminator functions as a promoter element or as an enhancer. Instead, terminators serve to augment initiation by preventing polymerases from reading completely around the plasmid and through the promoter from upstream, an event which we show interferes with subsequent rounds of initiation. Notably, this transcriptional interference arises because polymerase passage across a promoter disrupts the otherwise stable transcription complex, specifically releasing the bound transcription factor D. These liberated D molecules can then bind to other templates and activate their expression. The rDNA transcriptional interference is not due to a steric impediment to the binding of new polymerase molecules, and it does not similarly liberate the initiation-competent polymerase (factor C). These studies have also convincingly demonstrated that multiple rounds of transcription are obtained from rDNA template molecules in vitro.« less

Proposed Ancestors of Phage Nucleic Acid Packaging Motors (and Cells)

PubMed Central

Serwer, Philip

2011-01-01

I present a hypothesis that begins with the proposal that abiotic ancestors of phage RNA and DNA packaging systems (and cells) include mobile shells with an internal, molecule-transporting cavity. The foundations of this hypothesis include the conjecture that current nucleic acid packaging systems have imprints from abiotic ancestors. The abiotic shells (1) initially imbibe and later also bind and transport organic molecules, thereby providing a means for producing molecular interactions that are links in the chain of events that produces ancestors to the first molecules that are both information carrying and enzymatically active, and (2) are subsequently scaffolds on which proteins assemble to form ancestors common to both shells of viral capsids and cell membranes. Emergence of cells occurs via aggregation and merger of shells and internal contents. The hypothesis continues by using proposed imprints of abiotic and biotic ancestors to deduce an ancestral thermal ratchet-based DNA packaging motor that subsequently evolves to integrate a DNA packaging ATPase that provides a power stroke. PMID:21994778

Target guided synthesis using DNA nano-templates for selectively assembling a G-quadruplex binding c-MYC inhibitor

NASA Astrophysics Data System (ADS)

Panda, Deepanjan; Saha, Puja; Das, Tania; Dash, Jyotirmayee

2017-07-01

The development of small molecules is essential to modulate the cellular functions of biological targets in living system. Target Guided Synthesis (TGS) approaches have been used for the identification of potent small molecules for biological targets. We herein demonstrate an innovative example of TGS using DNA nano-templates that promote Huisgen cycloaddition from an array of azide and alkyne fragments. A G-quadruplex and a control duplex DNA nano-template have been prepared by assembling the DNA structures on gold-coated magnetic nanoparticles. The DNA nano-templates facilitate the regioselective formation of 1,4-substituted triazole products, which are easily isolated by magnetic decantation. The G-quadruplex nano-template can be easily recovered and reused for five reaction cycles. The major triazole product, generated by the G-quadruplex inhibits c-MYC expression by directly targeting the c-MYC promoter G-quadruplex. This work highlights that the nano-TGS approach may serve as a valuable strategy to generate target-selective ligands for drug discovery.

Probing the target search of DNA-binding proteins in mammalian cells using TetR as model searcher

NASA Astrophysics Data System (ADS)

Normanno, Davide; Boudarène, Lydia; Dugast-Darzacq, Claire; Chen, Jiji; Richter, Christian; Proux, Florence; Bénichou, Olivier; Voituriez, Raphaël; Darzacq, Xavier; Dahan, Maxime

2015-07-01

Many cellular functions rely on DNA-binding proteins finding and associating to specific sites in the genome. Yet the mechanisms underlying the target search remain poorly understood, especially in the case of the highly organized mammalian cell nucleus. Using as a model Tet repressors (TetRs) searching for a multi-array locus, we quantitatively analyse the search process in human cells with single-molecule tracking and single-cell protein-DNA association measurements. We find that TetRs explore the nucleus and reach their target by 3D diffusion interspersed with transient interactions with non-cognate sites, consistent with the facilitated diffusion model. Remarkably, nonspecific binding times are broadly distributed, underlining a lack of clear delimitation between specific and nonspecific interactions. However, the search kinetics is not determined by diffusive transport but by the low association rate to nonspecific sites. Altogether, our results provide a comprehensive view of the recruitment dynamics of proteins at specific loci in mammalian cells.

Membrane Destruction and DNA Binding of Staphylococcus aureus Cells Induced by Carvacrol and Its Combined Effect with a Pulsed Electric Field.

PubMed

Wang, Lang-Hong; Wang, Man-Sheng; Zeng, Xin-An; Zhang, Zhi-Hong; Gong, De-Ming; Huang, Yan-Bo

2016-08-17

Carvacrol (5-isopropyl-2-methylphenol, CAR) is an antibacterial ingredient that occurs naturally in the leaves of the plant Origanum vulgare. The antimicrobial mechanism of CAR against Staphylococcus aureus ATCC 43300 was investigated in the study. Analysis of the membrane fatty acids by gas chromatography-mass spectrometry (GC-MS) showed that exposure to CAR at low concentrations induced a marked increase in the level of unbranched fatty acids (from 34.90 ± 1.77% to 62.37 ± 4.26%). Moreover, CAR at higher levels severely damaged the integrity and morphologies of the S. aureus cell membrane. The DNA-binding properties of CAR were also investigated using fluorescence, circular dichroism, molecular modeling, and atomic-force microscopy. The results showed that CAR bound to DNA via the minor-groove mode, mildly perturbed the DNA secondary structure, and induced DNA molecules to be aggregated. Furthermore, a combination of CAR with a pulsed-electric field was found to exhibit strong synergistic effects on S. aureus.

Small-Molecule Inhibitors of the SOX18 Transcription Factor.

PubMed

Fontaine, Frank; Overman, Jeroen; Moustaqil, Mehdi; Mamidyala, Sreeman; Salim, Angela; Narasimhan, Kamesh; Prokoph, Nina; Robertson, Avril A B; Lua, Linda; Alexandrov, Kirill; Koopman, Peter; Capon, Robert J; Sierecki, Emma; Gambin, Yann; Jauch, Ralf; Cooper, Matthew A; Zuegg, Johannes; Francois, Mathias

2017-03-16

Pharmacological modulation of transcription factors (TFs) has only met little success over the past four decades. This is mostly due to standard drug discovery approaches centered on blocking protein/DNA binding or interfering with post-translational modifications. Recent advances in the field of TF biology have revealed a central role of protein-protein interaction in their mode of action. In an attempt to modulate the activity of SOX18 TF, a known regulator of vascular growth in development and disease, we screened a marine extract library for potential small-molecule inhibitors. We identified two compounds, which inspired a series of synthetic SOX18 inhibitors, able to interfere with the SOX18 HMG DNA-binding domain, and to disrupt HMG-dependent protein-protein interaction with RBPJ. These compounds also perturbed SOX18 transcriptional activity in a cell-based reporter gene system. This approach may prove useful in developing a new class of anti-angiogenic compounds based on the inhibition of TF activity. Copyright © 2017 Elsevier Ltd. All rights reserved.

Inhibiting NF-κB Activation by Small Molecules As a Therapeutic Strategy

PubMed Central

Gupta, Subash C; Sundaram, Chitra; Reuter, Simone; Aggarwal, Bharat B

2010-01-01

Because nuclear factor-κB (NF-κB) is a ubiquitously expressed proinflammatory transcription factor that regulates the expression of over 500 genes involved in cellular transformation, survival, proliferation, invasion, angiogenesis, metastasis, and inflammation, the NF-κB signaling pathway has become a potential target for pharmacological intervention. A wide variety of agents can activate NF-κB through canonical and noncanonical pathways. Canonical pathway involves various steps including the phosphorylation, ubiquitnation, and degradation of the inhibitor of NF-κB (IκBα), which leads to the nuclear translocation of the p50- p65 subunits of NF-κB followed by p65 phosphorylation, acetylation and methylation, DNA binding, and gene transcription. Thus, agents that can inhibit protein kinases, protein phosphatases, proteasomes, ubiquitnation, acetylation, methylation, and DNA binding steps have been identified as NF-κB inhibitors. Here, we review the small molecules that suppress NF-κB activation and thus may have therapeutic potential. PMID:20493977

The use of carrier RNA to enhance DNA extraction from microfluidic-based silica monoliths.

PubMed

Shaw, Kirsty J; Thain, Lauren; Docker, Peter T; Dyer, Charlotte E; Greenman, John; Greenway, Gillian M; Haswell, Stephen J

2009-10-12

DNA extraction was carried out on silica-based monoliths within a microfluidic device. Solid-phase DNA extraction methodology was applied in which the DNA binds to silica in the presence of a chaotropic salt, such as guanidine hydrochloride, and is eluted in a low ionic strength solution, such as water. The addition of poly-A carrier RNA to the chaotropic salt solution resulted in a marked increase in the effective amount of DNA that could be recovered (25ng) compared to the absence of RNA (5ng) using the silica-based monolith. These findings confirm that techniques utilising nucleic acid carrier molecules can enhance DNA extraction methodologies in microfluidic applications.

Rapid isolation of novel FK506 binding proteins from multiple organisms using gDNA and cDNA T7 phage display.

PubMed

Piggott, Andrew M; Kriegel, Alison M; Willows, Robert D; Karuso, Peter

2009-10-01

Reverse chemical proteomics using T7 phage display is a powerful technique for identifying cellular receptors of biologically active small molecules. However, to date this method has generally been limited to cDNA libraries constructed from mRNA isolated from eukaryotes. In this paper, we describe the construction of the first prokaryotic T7 phage display libraries from randomly digested Pseudomonas stutzeri and Vibrio fischeri gDNA, as well as a plant cDNA library from Arabidopsis thaliana. We also describe the use of T7 phage display to identify novel proteins from environmental DNA samples using biotinylated FK506 as a model affinity probe.

Manipulative interplay of two adozelesin molecules with d(ATTAAT)₂achieving ligand-stacked Watson-Crick and Hoogsteen base-paired duplex adducts.

PubMed

Hopton, Suzanne R; Thompson, Andrew S

2011-05-17

Previous structural studies of the cyclopropapyrroloindole (CPI) antitumor antibiotics have shown that these ligands bind covalently edge-on into the minor groove of double-stranded DNA. Reversible covalent modification of the DNA via N3 of adenine occurs in a sequence-specific fashion. Early nuclear magnetic resonance and molecular modeling studies with both mono- and bis-alkylating ligands indicated that the ligands fit tightly within the minor groove, causing little distortion of the helix. In this study, we propose a new binding model for several of the CPI-based analogues, in which the aromatic secondary rings form π-stacked complexes within the minor groove. One of the adducts, formed with adozelesin and the d(ATTAAT)(2) sequence, also demonstrates the ability of these ligands to manipulate the DNA of the binding site, resulting in a Hoogsteen base-paired adduct. Although this type of base pairing has been previously observed with the bisfunctional CPI analogue bizelesin, this is the first time that such an observation has been made with a monoalkylating nondimeric analogue. Together, these results provide a new model for the design of CPI-based antitumor antibiotics, which also has a significant bearing on other structurally related and structurally unrelated minor groove-binding ligands. They indicate the dynamic nature of ligand-DNA interactions, demonstrating both DNA conformational flexibility and the ability of two DNA-bound ligands to interact to form stable covalent modified complexes.

Light-Triggered Release of DNA from Plasmon-Resonant Nanoparticles

NASA Astrophysics Data System (ADS)

Huschka, Ryan

Plasmon-resonant nanoparticle complexes show promising potential for lighttriggered, controllable delivery of deoxyribonucleic acids (DNA) for research and therapeutic purposes. For example, the approach of RNA interference (RNAi) . using antisense DNA or RNA oligonucleotides to silence activity of a specific pathogenic gene transcript and reduce expression of the encoded protein . is very useful in dissecting genetic function and holds promise as a molecular therapeutic. Herein, we investigate the mechanism and probe the in vitro therapeutic potential of DNA light-triggered release from plasmonic nanoparticles. First, we investigate the mechanism of light-triggered release by dehybridizing double-stranded (dsDNA) via laser illumination from two types of nanoparticle substrates: gold (Au) nanoshells and Au nanorods. Both light-triggered and thermally induced releases are distinctly observable from nanoshell-based complexes. Surprisingly, no analogous measurable light-triggered release was observable from nanorod-based complexes below the DNA melting temperature. These results suggest that a nonthermal mechanism may play a role in light-triggered DNA release. Second, we demonstrate the in vitro light-triggered release of molecules noncovalently attached within dsDNA bound to the Au nanoshell surface. DAPI (4',6- diamidino-2-phenylindole), a bright blue fluorescent molecule that binds reversibly to double-stranded DNA, was chosen to visualize this intracellular light-induced release process. Illumination through the cell membrane of the nanoshell-dsDNA-DAPI complexes dehybridizes the DNA and releases the DAPI molecules within living cells. The DAPI molecules diffuse to the nucleus and associate with the cell's endogenous DNA. This work could have future applications towards drug delivery of molecules that associate with dsDNA. Finally, we demonstrate an engineered Au nanoshell (AuNS)-based therapeutic oligonucleotide delivery vehicle, designed to release its cargo on demand upon illumination with a near-infrared (NIR) laser. A poly(L)lysine peptide (PLL) epilayer coated onto the AuNS surface (AuNS-PLL) is used to capture intact, single-stranded antisense DNA oligonucleotide, or alternatively, double-stranded short-interfering RNA (siRNA) molecules. A green fluorescent protein (GFP)-expressing human lung cancer H1299 cell line was used to determine cellular uptake and GFP gene silencing mediated by AuNS-PLL delivery vector. The light-triggered release of oligonucleotides could have broad applications in the study of cellular processes and in the development of intracellular targeted therapies.

A Method for Selecting Structure-switching Aptamers Applied to a Colorimetric Gold Nanoparticle Assay

PubMed Central

Martin, Jennifer A.; Smith, Joshua E.; Warren, Mercedes; Chávez, Jorge L.; Hagen, Joshua A.; Kelley-Loughnane, Nancy

2015-01-01

Small molecules provide rich targets for biosensing applications due to their physiological implications as biomarkers of various aspects of human health and performance. Nucleic acid aptamers have been increasingly applied as recognition elements on biosensor platforms, but selecting aptamers toward small molecule targets requires special design considerations. This work describes modification and critical steps of a method designed to select structure-switching aptamers to small molecule targets. Binding sequences from a DNA library hybridized to complementary DNA capture probes on magnetic beads are separated from nonbinders via a target-induced change in conformation. This method is advantageous because sequences binding the support matrix (beads) will not be further amplified, and it does not require immobilization of the target molecule. However, the melting temperature of the capture probe and library is kept at or slightly above RT, such that sequences that dehybridize based on thermodynamics will also be present in the supernatant solution. This effectively limits the partitioning efficiency (ability to separate target binding sequences from nonbinders), and therefore many selection rounds will be required to remove background sequences. The reported method differs from previous structure-switching aptamer selections due to implementation of negative selection steps, simplified enrichment monitoring, and extension of the length of the capture probe following selection enrichment to provide enhanced stringency. The selected structure-switching aptamers are advantageous in a gold nanoparticle assay platform that reports the presence of a target molecule by the conformational change of the aptamer. The gold nanoparticle assay was applied because it provides a simple, rapid colorimetric readout that is beneficial in a clinical or deployed environment. Design and optimization considerations are presented for the assay as proof-of-principle work in buffer to provide a foundation for further extension of the work toward small molecule biosensing in physiological fluids. PMID:25870978

Nanosensors based on functionalized nanoparticles and surface enhanced raman scattering

DOEpatents

Talley, Chad E.; Huser, Thomas R.; Hollars, Christopher W.; Lane, Stephen M.; Satcher, Jr., Joe H.; Hart, Bradley R.; Laurence, Ted A.

2007-11-27

Surface-Enhanced Raman Spectroscopy (SERS) is a vibrational spectroscopic technique that utilizes metal surfaces to provide enhanced signals of several orders of magnitude. When molecules of interest are attached to designed metal nanoparticles, a SERS signal is attainable with single molecule detection limits. This provides an ultrasensitive means of detecting the presence of molecules. By using selective chemistries, metal nanoparticles can be functionalized to provide a unique signal upon analyte binding. Moreover, by using measurement techniques, such as, ratiometric received SERS spectra, such metal nanoparticles can be used to monitor dynamic processes in addition to static binding events. Accordingly, such nanoparticles can be used as nanosensors for a wide range of chemicals in fluid, gaseous and solid form, environmental sensors for pH, ion concentration, temperature, etc., and biological sensors for proteins, DNA, RNA, etc.

Molecular Recognition of Azelaic Acid and Related Molecules with DNA Polymerase I Investigated by Molecular Modeling Calculations.

PubMed

Shawon, Jakaria; Khan, Akib Mahmud; Rahman, Adhip; Hoque, Mohammad Mazharol; Khan, Mohammad Abdul Kader; Sarwar, Mohammed G; Halim, Mohammad A

2016-10-01

Molecular recognition has central role on the development of rational drug design. Binding affinity and interactions are two key components which aid to understand the molecular recognition in drug-receptor complex and crucial for structure-based drug design in medicinal chemistry. Herein, we report the binding affinity and the nonbonding interactions of azelaic acid and related compounds with the receptor DNA polymerase I (2KFN). Quantum mechanical calculation was employed to optimize the modified drugs using B3LYP/6-31G(d,p) level of theory. Charge distribution, dipole moment and thermodynamic properties such as electronic energy, enthalpy and free energy of these optimized drugs are also explored to evaluate how modifications impact the drug properties. Molecular docking calculation was performed to evaluate the binding affinity and nonbonding interactions between designed molecules and the receptor protein. We notice that all modified drugs are thermodynamically more stable and some of them are more chemically reactive than the unmodified drug. Promise in enhancing hydrogen bonds is found in case of fluorine-directed modifications as well as in the addition of trifluoroacetyl group. Fluorine participates in forming fluorine bonds and also stimulates alkyl, pi-alkyl interactions in some drugs. Designed drugs revealed increased binding affinity toward 2KFN. A1, A2 and A3 showed binding affinities of -8.7, -8.6 and -7.9 kcal/mol, respectively against 2KFN compared to the binding affinity -6.7 kcal/mol of the parent drug. Significant interactions observed between the drugs and Thr358 and Asp355 residues of 2KFN. Moreover, designed drugs demonstrated improved pharmacokinetic properties. This study disclosed that 9-octadecenoic acid and drugs containing trifluoroacetyl and trifluoromethyl groups are the best 2KFN inhibitors. Overall, these results can be useful for the design of new potential candidates against DNA polymerase I.

The synthesis and host-guest applications of synthetic receptor molecules

NASA Astrophysics Data System (ADS)

Osner, Zachary R.

2011-12-01

Host-guest chemistry involves the complimentary binding between two molecules. Host molecules have been synthesized to bind negative, positive, and neutral molecules such as proteins and enzymes, and have been used as optical sensors, electrochemical sensors, supramolecular catalysts, and in the pharmaceutical industry as anti-cancer agents.1 The field of nanoscience has exploited guest-host interactions to create optical sensors with colloidal gold and Dip-Pen nanolithography technologies. Gold nanoparticles, have been functionalized with DNA, and have been developed as a selective colorimetric detection system, that upon binding turns the solution from a red to blue in color.2 Cyclotriveratrylene (CTV) 1 is a common supramolecular scaffold that has been previously employed in guest-host chemistry, and the construction of CTV involves the cyclic trimerization of veratryl alcohol via the veratryl cation.3 Due to the rigid bowl shaped structure of CTV, CTV has been shown to act as a host molecule for fullerene-C60.4 Lectin binding receptor proteins are a specific class of proteins found in bacteria, viruses, plants, and animals that can bind to complimentary carbohydrates. It is these lectins that are believed to be responsible for cell-cell interactions and the formation of biofilms in pathenogenic bacteria.5 P. aeruginosa is a pathenogenic bacterium, shown to have a high resistance to many antibiotics, which can form biofilms in human lung tissue, causing respiratory tract infections in patients with compromised immune systems. 5 I will exploit guest-host interactions to create synthetic supramolecular and carbohydrate receptor molecules to that will be of use as biological sensing devices via self-assembled monolayers on solid surfaces and nanoparticle technologies. *Please refer to dissertation for references/footnotes.

Minor Groove Binder Distamycin Remodels Chromatin but Inhibits Transcription

PubMed Central

Majumder, Parijat; Banerjee, Amrita; Shandilya, Jayasha; Senapati, Parijat; Chatterjee, Snehajyoti; Kundu, Tapas K.; Dasgupta, Dipak

2013-01-01

The condensed structure of chromatin limits access of cellular machinery towards template DNA. This in turn represses essential processes like transcription, replication, repair and recombination. The repression is alleviated by a variety of energy dependent processes, collectively known as “chromatin remodeling”. In a eukaryotic cell, a fine balance between condensed and de-condensed states of chromatin helps to maintain an optimum level of gene expression. DNA binding small molecules have the potential to perturb such equilibrium. We present herein the study of an oligopeptide antibiotic distamycin, which binds to the minor groove of B-DNA. Chromatin mobility assays and circular dichroism spectroscopy have been employed to study the effect of distamycin on chromatosomes, isolated from the liver of Sprague-Dawley rats. Our results show that distamycin is capable of remodeling both chromatosomes and reconstituted nucleosomes, and the remodeling takes place in an ATP-independent manner. Binding of distamycin to the linker and nucleosomal DNA culminates in eviction of the linker histone and the formation of a population of off-centered nucleosomes. This hints at a possible corkscrew type motion of the DNA with respect to the histone octamer. Our results indicate that distamycin in spite of remodeling chromatin, inhibits transcription from both DNA and chromatin templates. Therefore, the DNA that is made accessible due to remodeling is either structurally incompetent for transcription, or bound distamycin poses a roadblock for the transcription machinery to advance. PMID:23460895

Recognition of AT-Rich DNA Binding Sites by the MogR Repressor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shen, Aimee; Higgins, Darren E.; Panne, Daniel

2009-07-22

The MogR transcriptional repressor of the intracellular pathogen Listeria monocytogenes recognizes AT-rich binding sites in promoters of flagellar genes to downregulate flagellar gene expression during infection. We describe here the 1.8 A resolution crystal structure of MogR bound to the recognition sequence 5' ATTTTTTAAAAAAAT 3' present within the flaA promoter region. Our structure shows that MogR binds as a dimer. Each half-site is recognized in the major groove by a helix-turn-helix motif and in the minor groove by a loop from the symmetry-related molecule, resulting in a 'crossover' binding mode. This oversampling through minor groove interactions is important for specificity.more » The MogR binding site has structural features of A-tract DNA and is bent by approximately 52 degrees away from the dimer. The structure explains how MogR achieves binding specificity in the AT-rich genome of L. monocytogenes and explains the evolutionary conservation of A-tract sequence elements within promoter regions of MogR-regulated flagellar genes.« less

The NS1 polypeptide of the murine parvovirus minute virus of mice binds to DNA sequences containing the motif [ACCA]2-3.

PubMed Central

Cotmore, S F; Christensen, J; Nüesch, J P; Tattersall, P

1995-01-01

A DNA fragment containing the minute virus of mice 3' replication origin was specifically coprecipitated in immune complexes containing the virally coded NS1, but not the NS2, polypeptide. Antibodies directed against the amino- or carboxy-terminal regions of NS1 precipitated the NS1-origin complexes, but antibodies directed against NS1 amino acids 284 to 459 blocked complex formation. Using affinity-purified histidine-tagged NS1 preparations, we have shown that the specific protein-DNA interaction is of moderate affinity, being stable in 0.1 M salt but rapidly lost at higher salt concentrations. In contrast, generalized (or nonspecific) DNA binding by NS1 could be demonstrated only in low salt. Addition of ATP or gamma S-ATP enhanced specific DNA binding by wild-type NS1 severalfold, but binding was lost under conditions which favored ATP hydrolysis. NS1 molecules with mutations in a critical lysine residue (amino acid 405) in the consensus ATP-binding site bound to the origin, but this binding could not be enhanced by ATP addition. DNase I protection assays carried out with wild-type NS1 in the presence of gamma S-ATP gave footprints which extended over 43 nucleotides on both DNA strands, from the middle of the origin bubble sequence to a position some 14 bp beyond the nick site. The DNA-binding site for NS1 was mapped to a 22-bp fragment from the middle of the 3' replication origin which contains the sequence ACCAACCA. This conforms to a reiterated motif (ACCA)2-3, which occurs, in more or less degenerate form, at many sites throughout the minute virus of mice genome (J. W. Bodner, Virus Genes 2:167-182, 1989). Insertion of a single copy of the sequence (ACCA)3 was shown to be sufficient to confer NS1 binding on an otherwise unrecognized plasmid fragment. The functions of NS1 in the viral life cycle are reevaluated in the light of this result. PMID:7853501

The NS1 polypeptide of the murine parvovirus minute virus of mice binds to DNA sequences containing the motif [ACCA]2-3.

PubMed

Cotmore, S F; Christensen, J; Nüesch, J P; Tattersall, P

1995-03-01

A DNA fragment containing the minute virus of mice 3' replication origin was specifically coprecipitated in immune complexes containing the virally coded NS1, but not the NS2, polypeptide. Antibodies directed against the amino- or carboxy-terminal regions of NS1 precipitated the NS1-origin complexes, but antibodies directed against NS1 amino acids 284 to 459 blocked complex formation. Using affinity-purified histidine-tagged NS1 preparations, we have shown that the specific protein-DNA interaction is of moderate affinity, being stable in 0.1 M salt but rapidly lost at higher salt concentrations. In contrast, generalized (or nonspecific) DNA binding by NS1 could be demonstrated only in low salt. Addition of ATP or gamma S-ATP enhanced specific DNA binding by wild-type NS1 severalfold, but binding was lost under conditions which favored ATP hydrolysis. NS1 molecules with mutations in a critical lysine residue (amino acid 405) in the consensus ATP-binding site bound to the origin, but this binding could not be enhanced by ATP addition. DNase I protection assays carried out with wild-type NS1 in the presence of gamma S-ATP gave footprints which extended over 43 nucleotides on both DNA strands, from the middle of the origin bubble sequence to a position some 14 bp beyond the nick site. The DNA-binding site for NS1 was mapped to a 22-bp fragment from the middle of the 3' replication origin which contains the sequence ACCAACCA. This conforms to a reiterated motif (ACCA)2-3, which occurs, in more or less degenerate form, at many sites throughout the minute virus of mice genome (J. W. Bodner, Virus Genes 2:167-182, 1989). Insertion of a single copy of the sequence (ACCA)3 was shown to be sufficient to confer NS1 binding on an otherwise unrecognized plasmid fragment. The functions of NS1 in the viral life cycle are reevaluated in the light of this result.

Selecting Fully-Modified XNA Aptamers Using Synthetic Genetics.

PubMed

Taylor, Alexander I; Holliger, Philipp

2018-06-01

This unit describes the application of "synthetic genetics," i.e., the replication of xeno nucleic acids (XNAs), artificial analogs of DNA and RNA bearing alternative backbone or sugar congeners, to the directed evolution of synthetic oligonucleotide ligands (XNA aptamers) specific for target proteins or nucleic acid motifs, using a cross-chemistry selective exponential enrichment (X-SELEX) approach. Protocols are described for synthesis of diverse-sequence XNA repertoires (typically 10 14 molecules) using DNA templates, isolation and panning for functional XNA sequences using targets immobilized on solid phase or gel shift induced by target binding in solution, and XNA reverse transcription to allow cDNA amplification or sequencing. The method may be generally applied to select fully-modified XNA aptamers specific for a wide range of target molecules. © 2018 by John Wiley & Sons, Inc. Copyright © 2018 John Wiley & Sons, Inc.

In and out of the minor groove: interaction of an AT-rich DNA with the drug CD27

DOE Office of Scientific and Technical Information (OSTI.GOV)

Acosta-Reyes, Francisco J.; Dardonville, Christophe; Koning, Harry P. de

New features of an antiprotozoal DNA minor-groove binding drug, which acts as a cross-linking agent, are presented. It also fills the minor groove of DNA completely and prevents the access of proteins. These features are also expected for other minor-groove binding drugs when associated with suitable DNA targets. The DNA of several pathogens is very rich in AT base pairs. Typical examples include the malaria parasite Plasmodium falciparum and the causative agents of trichomoniasis and trypanosomiases. This fact has prompted studies of drugs which interact with the minor groove of DNA, some of which are used in medical practice. Previousmore » studies have been performed almost exclusively with the AATT sequence. New features should be uncovered through the study of different DNA sequences. In this paper, the crystal structure of the complex of the DNA duplex d(AAAATTTT){sub 2} with the dicationic drug 4, 4′-bis(imidazolinylamino)diphenylamine (CD27) is presented. The drug binds to the minor groove of DNA as expected, but it shows two new features that have not previously been described: (i) the drugs protrude from the DNA and interact with neighbouring molecules, so that they may act as cross-linking agents, and (ii) the drugs completely cover the whole minor groove of DNA and displace bound water. Thus, they may prevent the access to DNA of proteins such as AT-hook proteins. These features are also expected for other minor-groove binding drugs when associated with all-AT DNA. These findings allow a better understanding of this family of compounds and will help in the development of new, more effective drugs. New data on the biological interaction of CD27 with the causative agent of trichomoniasis, Trichomonas vaginalis, are also reported.« less

An affinity-structure database of helix-turn-helix: DNA complexes with a universal coordinate system

DOE Office of Scientific and Technical Information (OSTI.GOV)

AlQuraishi, Mohammed; Tang, Shengdong; Xia, Xide

Molecular interactions between proteins and DNA molecules underlie many cellular processes, including transcriptional regulation, chromosome replication, and nucleosome positioning. Computational analyses of protein-DNA interactions rely on experimental data characterizing known protein-DNA interactions structurally and biochemically. While many databases exist that contain either structural or biochemical data, few integrate these two data sources in a unified fashion. Such integration is becoming increasingly critical with the rapid growth of structural and biochemical data, and the emergence of algorithms that rely on the synthesis of multiple data types to derive computational models of molecular interactions. We have developed an integrated affinity-structure database inmore » which the experimental and quantitative DNA binding affinities of helix-turn-helix proteins are mapped onto the crystal structures of the corresponding protein-DNA complexes. This database provides access to: (i) protein-DNA structures, (ii) quantitative summaries of protein-DNA binding affinities using position weight matrices, and (iii) raw experimental data of protein-DNA binding instances. Critically, this database establishes a correspondence between experimental structural data and quantitative binding affinity data at the single basepair level. Furthermore, we present a novel alignment algorithm that structurally aligns the protein-DNA complexes in the database and creates a unified residue-level coordinate system for comparing the physico-chemical environments at the interface between complexes. Using this unified coordinate system, we compute the statistics of atomic interactions at the protein-DNA interface of helix-turn-helix proteins. We provide an interactive website for visualization, querying, and analyzing this database, and a downloadable version to facilitate programmatic analysis. Lastly, this database will facilitate the analysis of protein-DNA interactions and the development of programmatic computational methods that capitalize on integration of structural and biochemical datasets. The database can be accessed at http://ProteinDNA.hms.harvard.edu.« less

An affinity-structure database of helix-turn-helix: DNA complexes with a universal coordinate system

DOE PAGES

AlQuraishi, Mohammed; Tang, Shengdong; Xia, Xide

2015-11-19

Molecular interactions between proteins and DNA molecules underlie many cellular processes, including transcriptional regulation, chromosome replication, and nucleosome positioning. Computational analyses of protein-DNA interactions rely on experimental data characterizing known protein-DNA interactions structurally and biochemically. While many databases exist that contain either structural or biochemical data, few integrate these two data sources in a unified fashion. Such integration is becoming increasingly critical with the rapid growth of structural and biochemical data, and the emergence of algorithms that rely on the synthesis of multiple data types to derive computational models of molecular interactions. We have developed an integrated affinity-structure database inmore » which the experimental and quantitative DNA binding affinities of helix-turn-helix proteins are mapped onto the crystal structures of the corresponding protein-DNA complexes. This database provides access to: (i) protein-DNA structures, (ii) quantitative summaries of protein-DNA binding affinities using position weight matrices, and (iii) raw experimental data of protein-DNA binding instances. Critically, this database establishes a correspondence between experimental structural data and quantitative binding affinity data at the single basepair level. Furthermore, we present a novel alignment algorithm that structurally aligns the protein-DNA complexes in the database and creates a unified residue-level coordinate system for comparing the physico-chemical environments at the interface between complexes. Using this unified coordinate system, we compute the statistics of atomic interactions at the protein-DNA interface of helix-turn-helix proteins. We provide an interactive website for visualization, querying, and analyzing this database, and a downloadable version to facilitate programmatic analysis. Lastly, this database will facilitate the analysis of protein-DNA interactions and the development of programmatic computational methods that capitalize on integration of structural and biochemical datasets. The database can be accessed at http://ProteinDNA.hms.harvard.edu.« less

Intercalation of XR5944 with the estrogen response element is modulated by the tri-nucleotide spacer sequence between half-sites

PubMed Central

Sidell, Neil; Mathad, Raveendra I.; Shu, Feng-jue; Zhang, Zhenjiang; Kallen, Caleb B.; Yang, Danzhou

2011-01-01

DNA-intercalating molecules can impair DNA replication, DNA repair, and gene transcription. We previously demonstrated that XR5944, a DNA bis-intercalator, specifically blocks binding of estrogen receptor-α (ERα) to the consensus estrogen response element (ERE). The consensus ERE sequence is AGGTCAnnnTGACCT, where nnn is known as the tri-nucleotide spacer. Recent work has shown that the tri-nucleotide spacer can modulate ERα-ERE binding affinity and ligand-mediated transcriptional responses. To further understand the mechanism by which XR5944 inhibits ERα-ERE binding, we tested its ability to interact with consensus EREs with variable tri-nucleotide spacer sequences and with natural but non-consensus ERE sequences using one dimensional nuclear magnetic resonance (1D 1H NMR) titration studies. We found that the tri-nucleotide spacer sequence significantly modulates the binding of XR5944 to EREs. Of the sequences that were tested, EREs with CGG and AGG spacers showed the best binding specificity with XR5944, while those spaced with TTT demonstrated the least specific binding. The binding stoichiometry of XR5944 with EREs was 2:1, which can explain why the spacer influences the drug-DNA interaction; each XR5944 spans four nucleotides (including portions of the spacer) when intercalating with DNA. To validate our NMR results, we conducted functional studies using reporter constructs containing consensus EREs with tri-nucleotide spacers CGG, CTG, and TTT. Results of reporter assays in MCF-7 cells indicated that XR5944 was significantly more potent in inhibiting the activity of CGG- than TTT-spaced EREs, consistent with our NMR results. Taken together, these findings predict that the anti-estrogenic effects of XR5944 will depend not only on ERE half-site composition but also on the tri-nucleotide spacer sequence of EREs located in the promoters of estrogen-responsive genes. PMID:21333738

The Alarmin Properties of DNA and DNA-associated Nuclear Proteins.

PubMed

Magna, Melinda; Pisetsky, David S

2016-05-01

The communication of cell injury and death is a critical element in host defense. Although immune cells can serve this function by elaborating cytokines and chemokines, somatic cells can repurpose nuclear macromolecules to function as damage-associated molecular patterns (DAMPs) or alarmins to exert similar activity. Among these molecules, DNA, high-mobility group box-1, and histone proteins can all act as DAMPs once they are in an extracellular location. This review describes current information on the role of the nuclear DAMPs, their translocation to the outside of cells, and pathways of activation after uptake into the inside of immune cells. MEDLINE and PubMed databases were searched for citations (1990-2016) in English related to the following terms: DAMPs, high-mobility group box-1, DNA, histones, cell death, danger, and immune activation. Selected articles with the most relevant studies were included for a more detailed consideration. Although nuclear molecules have important structural and genetic regulatory roles inside the cell nucleus, when released into the extracellular space during cell death, these molecules can acquire immune activity and serve as alarmins or DAMPs. Although apoptosis is generally considered the source of extracellular nuclear material, other cell death pathways such as necroptosis, NETosis, and pyroptosis can contribute to the release of nuclear molecules. Importantly, the release of nuclear DAMPs occurs with both soluble and particulate forms of these molecules. The activity of nuclear molecules may depend on posttranslational modifications, redox changes, and the binding of other molecules. Once in an extracellular location, nuclear DAMPs can engage the same pattern recognition receptors as do pathogen-associated molecular patterns. These interactions can activate immune cells and lead to cytokine and chemokine production. Among these receptors, internal receptors for DNA are key to the response to this molecule; the likely function of these internal sensors is the recognition of DNA from intracellular infection by bacteria or viruses. Activation of these receptors requires translocation of extracellular DNA into specialized compartments. In addition to nuclear DNA, mitochondrial DNA can also serve as a DAMP. The communication of cell injury and death is a critical element in host defense and involves the repurposing of nuclear molecules as immune triggers. As such, the presence of extracellular nuclear material can serve as novel biomarkers for conditions involving cell injury and death. Targeting of these molecules may also represent an important new approach to therapy. Published by Elsevier Inc.

Highly sensitive self-complementary DNA nanoswitches triggered by polyelectrolytes

NASA Astrophysics Data System (ADS)

Wu, Jincai; Yu, Feng; Zhang, Zheng; Chen, Yong; Du, Jie; Maruyama, Atsushi

2015-12-01

Dimerization of two homologous strands of genomic DNA/RNA is an essential feature of retroviral replication. Herein we show that a cationic comb-type copolymer (CCC), poly(l-lysine)-graft-dextran, accelerates the dimerization of self-complementary stem-loop DNA, frequently found in functional DNA/RNA molecules, such as aptamers. Furthermore, an anionic polymer poly(sodium vinylsulfonate) (PVS) dissociates CCC from the duplex shortly within a few seconds. Then single stem-loop DNA spontaneously transforms from its dimer. Thus we can easily control the dimer and stem-loop DNA by switching on/off CCC activity. Both polyelectrolytes and DNA concentrations are in the nanomole per liter range. The polyelectrolyte-assisted transconformation and sequences design strategy ensures the reversible state control with rapid response and effective switching under physiologically relevant conditions. A further application of this sensitive assembly is to construct an aptamer-type drug delivery system, bind or release functional molecules responding to its transconformation.Dimerization of two homologous strands of genomic DNA/RNA is an essential feature of retroviral replication. Herein we show that a cationic comb-type copolymer (CCC), poly(l-lysine)-graft-dextran, accelerates the dimerization of self-complementary stem-loop DNA, frequently found in functional DNA/RNA molecules, such as aptamers. Furthermore, an anionic polymer poly(sodium vinylsulfonate) (PVS) dissociates CCC from the duplex shortly within a few seconds. Then single stem-loop DNA spontaneously transforms from its dimer. Thus we can easily control the dimer and stem-loop DNA by switching on/off CCC activity. Both polyelectrolytes and DNA concentrations are in the nanomole per liter range. The polyelectrolyte-assisted transconformation and sequences design strategy ensures the reversible state control with rapid response and effective switching under physiologically relevant conditions. A further application of this sensitive assembly is to construct an aptamer-type drug delivery system, bind or release functional molecules responding to its transconformation. Electronic supplementary information (ESI) available: I. Sequences of DIS25, DIS25-2a and DIS25-3a. II. Structural formula of poly(l-lysine)-graft-dextran (PLL-g-Dex). 1H-NMR spectra of PLL-g-Dex in D2O. III. Gel electrophoretic analysis of dimerization of DIS25 with various N/P ratios. IV. The effect of polyelectrolyte on the fluorescence polarity of TAMRA-labeled duplex. V. UV absorption/Tm profiles of DIS25. VI. Arrhenius plots for spontaneous dissociation of the DIS25 dimer and PLL-g-Dex-assisted dimerization of DIS25.VII. Switching between double stem-loop DIS42 and extended multiplex drived by PLL-g-Dex and PVS. See DOI: 10.1039/c5nr05193b

Novel, fluorescent, SSB protein chimeras with broad utility

PubMed Central

Liu, Juan; Choi, Meerim; Stanenas, Adam G; Byrd, Alicia K; Raney, Kevin D; Cohan, Christopher; Bianco, Piero R

2011-01-01

The Escherichia coli single-stranded DNA binding protein (SSB) is a central player in DNA metabolism where it organizes genome maintenance complexes and stabilizes single-stranded DNA (ssDNA) intermediates generated during DNA processing. Due to the importance of SSB and to facilitate real-time studies, we developed a dual plasmid expression system to produce novel, chimeric SSB proteins. These chimeras, which contain mixtures of histidine-tagged and fluorescent protein(FP)-fusion subunits, are easily purified in milligram quantities and used without further modification, a significant enhancement over previous methods to produce fluorescent SSB. Chimeras retain the functionality of wild type in all assays, demonstrating that SSB function is unaffected by the FPs. We demonstrate the power and utility of these chimeras in single molecule studies providing a great level of insight into the biochemical mechanism of RecBCD. We also utilized the chimeras to show for the first time that RecG and SSB interact in vivo. Consequently, we anticipate that the chimeras described herein will facilitate in vivo, in vitro and single DNA molecule studies using proteins that do not require further modification prior to use. PMID:21462278

Study on performance of magnetic fluorescent nanoparticles as gene carrier and location in pig kidney cells

NASA Astrophysics Data System (ADS)

Wang, Yan; Cui, Haixin; Sun, Changjiao; Du, Wei; Cui, Jinhui; Zhao, Xiang

2013-03-01

We evaluated the performance of green fluorescent magnetic Fe3O4 nanoparticles (NPs) as gene carrier and location in pig kidney cells. When the mass ratio of NPs to green fluorescent protein plasmid DNA reached 1:16 or above, DNA molecules can be combined completely with NPs, which indicates that the NPs have good ability to bind negative DNA. Atomic force microscopy (AFM) experiments were carried out to investigate the binding mechanism between NPs and DNA. AFM images show that individual DNA strands come off of larger pieces of netlike agglomerations and several spherical nanoparticles are attached to each individual DNA strand and interact with each other. The pig kidney cells were labelled with membrane-specific red fluorescent dye 1,1'-dioctadecyl-3,3,3',3'-tetramethylindocarbocyanine perchlorate and nucleus-specific blue fluorescent dye 4',6-diamidino-2-phenylindole dihydrochloride. We found that green fluorescent nanoparticles can past the cell membrane and spread throughout the interior of the cell. The NPs seem to locate more frequently in the cytoplasm than in the nucleus.

Conformation-dependent DNA attraction.

PubMed

Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang

2014-06-21

Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg(2+) ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg(2+) or Na(+), benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg(2+) bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.

Downstream DNA Tension Regulates the Stability of the T7 RNA Polymerase Initiation Complex

PubMed Central

Skinner, Gary M.; Kalafut, Bennett S.; Visscher, Koen

2011-01-01

Gene transcription by the enzyme RNA polymerase is tightly regulated. In many cases, such as in the lac operon in Escherichia coli, this regulation is achieved through the action of protein factors on DNA. Because DNA is an elastic polymer, its response to enzymatic processing can lead to mechanical perturbations (e.g., linear stretching and supercoiling) that can affect the operation of other DNA processing complexes acting elsewhere on the same substrate molecule. Using an optical-tweezers assay, we measured the binding kinetics between single molecules of bacteriophage T7 RNA polymerase and DNA, as a function of tension. We found that increasing DNA tension under conditions that favor formation of the open complex results in destabilization of the preinitiation complex. Furthermore, with zero ribonucleotides present, when the closed complex is favored, we find reduced tension sensitivity, implying that it is predominantly the open complex that is sensitive. This result strongly supports the “scrunching” model for T7 transcription initiation, as the applied tension acts against the movement of the DNA into the scrunched state, and introduces linear DNA tension as a potential regulatory quantity for transcription initiation. PMID:21320448

Triplex technology in studies of DNA damage, DNA repair, and mutagenesis.

PubMed

Mukherjee, Anirban; Vasquez, Karen M

2011-08-01

Triplex-forming oligonucleotides (TFOs) can bind to the major groove of homopurine-homopyrimidine stretches of double-stranded DNA in a sequence-specific manner through Hoogsteen hydrogen bonding to form DNA triplexes. TFOs by themselves or conjugated to reactive molecules can be used to direct sequence-specific DNA damage, which in turn results in the induction of several DNA metabolic activities. Triplex technology is highly utilized as a tool to study gene regulation, molecular mechanisms of DNA repair, recombination, and mutagenesis. In addition, TFO targeting of specific genes has been exploited in the development of therapeutic strategies to modulate DNA structure and function. In this review, we discuss advances made in studies of DNA damage, DNA repair, recombination, and mutagenesis by using triplex technology to target specific DNA sequences. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

DNA Knots: Theory and Experiments

NASA Astrophysics Data System (ADS)

Sumners, D. W.

Cellular DNA is a long, thread-like molecule with remarkably complex topology. Enzymes that manipulate the geometry and topology of cellular DNA perform many vital cellular processes (including segregation of daughter chromosomes, gene regulation, DNA repair, and generation of antibody diversity). Some enzymes pass DNA through itself via enzyme-bridged transient breaks in the DNA; other enzymes break the DNA apart and reconnect it to different ends. In the topological approach to enzymology, circular DNA is incubated with an enzyme, producing an enzyme signature in the form of DNA knots and links. By observing the changes in DNA geometry (supercoiling) and topology (knotting and linking) due to enzyme action, the enzyme binding and mechanism can often be characterized. This paper will discuss some personal research history, and the tangle model for the analysis of site-specific recombination experiments on circular DNA.

Structure-Function Based Molecular Relationships in Ewing's Sarcoma

PubMed Central

2015-01-01

Ewing's Sarcoma Oncogene (ews) on chromosome 22q12 is encoding a ubiquitously expressed RNA-binding protein (EWS) with unknown function that is target of tumor-specific chromosomal translocations in Ewing's sarcoma family of tumors. A model of transcription complex was proposed in which the heterodimer Rpb4/7 binds to EAD, connecting it to Core RNA Pol II. The DNA-binding domain, provided by EFP, is bound to the promoter. Rpb4/7 binds RNA, stabilizing the transcription complex. The complex Rpb4/7 can stabilize the preinitiation complexes by converting the conformation of RNA Pol II. EWS may change its conformation, so that NTD becomes accessible. Two different mechanisms of interaction between EWS and RNA Pol II are proposed: (I) an intermolecular EWS-EWS interaction between two molecules, pushing conformation from “closed” to “open” state, or (II) an intramolecular interaction inside the molecule of EWS, pushing conformation of the molecule from “closed” to “open” state. The modified forms of EWS may interact with Pol II subunits hsRpb5 and hsRpb7. The EWS and EFPs binding partners are described schematically in a model, an attempt to link the transcription with the splicing. The proposed model helps to understand the functional molecular interactions in cancer, to find new partners and ways to treat cancer. PMID:25688366

Torsional stress in DNA limits collaboration among reverse gyrase molecules.

PubMed

Ogawa, Taisaku; Sutoh, Kazuo; Kikuchi, Akihiko; Kinosita, Kazuhiko

2016-04-01

Reverse gyrase is an enzyme that can overwind (introduce positive supercoils into) DNA using the energy obtained from ATP hydrolysis. The enzyme is found in hyperthermophiles, and the overwinding reaction generally requires a temperature above 70 °C. In a previous study using microscopy, we have shown that 30 consecutive mismatched base pairs (a bubble) in DNA serve as a well-defined substrate site for reverse gyrase, warranting the processive overwinding activity down to 50 °C. Here, we inquire how multiple reverse gyrase molecules may collaborate with each other in overwinding one DNA molecule. We introduced one, two, or four bubbles in a linear DNA that tethered a magnetic bead to a coverslip surface. At 40-71 °C in the presence of reverse gyrase, the bead rotated clockwise as viewed from above, to relax the DNA twisted by reverse gyrase. Dependence on the enzyme concentration indicated that each bubble binds reverse gyrase tightly (dissociation constant < 0.1 nm) and that bound enzyme continuously overwinds DNA for > 5 min. Rotation with two bubbles was significantly faster compared with one bubble, indicating that overwinding actions are basically additive, but four bubbles did not show further acceleration except at 40 °C where the activity was very low. The apparent saturation is due to the hydrodynamic friction against the rotating bead, as confirmed by increasing the medium viscosity. When torsional stress in the DNA, determined by the friction, approaches ~ 7 pN·nm (at 71 °C), the overwinding activity of reverse gyrase drops sharply. Multiple molecules of reverse gyrase collaborate additively within this limit. © 2016 The Authors. The FEBS Journal published by John Wiley & Sons Ltd on behalf of Federation of European Biochemical Societies.

Salmonella typhimurium PtsJ is a novel MocR-like transcriptional repressor involved in regulating the vitamin B6 salvage pathway.

PubMed

Tramonti, Angela; Milano, Teresa; Nardella, Caterina; di Salvo, Martino L; Pascarella, Stefano; Contestabile, Roberto

2017-02-01

The vitamin B 6 salvage pathway, involving pyridoxine 5'-phosphate oxidase (PNPOx) and pyridoxal kinase (PLK), recycles B 6 vitamers from nutrients and protein turnover to produce pyridoxal 5'-phosphate (PLP), the catalytically active form of the vitamin. Regulation of this pathway, widespread in living organisms including humans and many bacteria, is very important to vitamin B 6 homeostasis but poorly understood. Although some information is available on the enzymatic regulation of PNPOx and PLK, little is known on their regulation at the transcriptional level. In the present work, we identified a new MocR-like regulator, PtsJ from Salmonella typhimurium, which controls the expression of the pdxK gene encoding one of the two PLKs expressed in this organism (PLK1). Analysis of pdxK expression in a ptsJ knockout strain demonstrated that PtsJ acts as a transcriptional repressor. This is the first case of a MocR-like regulator acting as repressor of its target gene. Expression and purification of PtsJ allowed a detailed characterisation of its effector and DNA-binding properties. PLP is the only B 6 vitamer acting as effector molecule for PtsJ. A DNA-binding region composed of four repeated nucleotide sequences is responsible for binding of PtsJ to its target promoter. Analysis of binding stoichiometry revealed that protein subunits/DNA molar ratio varies from 4 : 1 to 2 : 1, depending on the presence or absence of PLP. Structural characteristics of DNA transcriptional factor-binding sites suggest that PtsJ binds DNA according to a different model with respect to other characterised members of the MocR subgroup. © 2016 Federation of European Biochemical Societies.

Crystal Structure of the Arginine Repressor Protein in Complex With the DNA Operator From Mycobacterium Tuberculosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cherney, L.T.; Cherney, M.M.; Garen, C.R.

2009-05-12

The Mycobacterium tuberculosis (Mtb) gene product encoded by open reading frame Rv1657 is an arginine repressor (ArgR). All genes involved in the L-arginine (hereafter arginine) biosynthetic pathway are essential for optimal growth of the Mtb pathogen, thus making MtbArgR a potential target for drug design. The C-terminal domains of arginine repressors (CArgR) participate in oligomerization and arginine binding. Several crystal forms of CArgR from Mtb (MtbCArgR) have been obtained. The X-ray crystal structures of MtbCArgR were determined at 1.85 {angstrom} resolution with bound arginine and at 2.15 {angstrom} resolution in the unliganded form. These structures show that six molecules ofmore » MtbCArgR are arranged into a hexamer having approximate 32 point symmetry that is formed from two trimers. The trimers rotate relative to each other by about 11{sup o} upon binding arginine. All residues in MtbCArgR deemed to be important for hexamer formation and for arginine binding have been identified from the experimentally determined structures presented. The hexamer contains six regular sites in which the arginine molecules have one common binding mode and three sites in which the arginine molecules have two overlapping binding modes. The latter sites only bind the ligand at high (200 mM) arginine concentrations.« less

Using Multiorder Time-Correlation Functions (TCFs) To Elucidate Biomolecular Reaction Pathways from Microsecond Single-Molecule Fluorescence Experiments.

PubMed

Phelps, Carey; Israels, Brett; Marsh, Morgan C; von Hippel, Peter H; Marcus, Andrew H

2016-12-29

Recent advances in single-molecule fluorescence imaging have made it possible to perform measurements on microsecond time scales. Such experiments have the potential to reveal detailed information about the conformational changes in biological macromolecules, including the reaction pathways and dynamics of the rearrangements involved in processes, such as sequence-specific DNA "breathing" and the assembly of protein-nucleic acid complexes. Because microsecond-resolved single-molecule trajectories often involve "sparse" data, that is, they contain relatively few data points per unit time, they cannot be easily analyzed using the standard protocols that were developed for single-molecule experiments carried out with tens-of-millisecond time resolution and high "data density." Here, we describe a generalized approach, based on time-correlation functions, to obtain kinetic information from microsecond-resolved single-molecule fluorescence measurements. This approach can be used to identify short-lived intermediates that lie on reaction pathways connecting relatively long-lived reactant and product states. As a concrete illustration of the potential of this methodology for analyzing specific macromolecular systems, we accompany the theoretical presentation with the description of a specific biologically relevant example drawn from studies of reaction mechanisms of the assembly of the single-stranded DNA binding protein of the T4 bacteriophage replication complex onto a model DNA replication fork.

Chemo-mechanical pushing of proteins along single-stranded DNA.

PubMed

Sokoloski, Joshua E; Kozlov, Alexander G; Galletto, Roberto; Lohman, Timothy M

2016-05-31

Single-stranded (ss)DNA binding (SSB) proteins bind with high affinity to ssDNA generated during DNA replication, recombination, and repair; however, these SSBs must eventually be displaced from or reorganized along the ssDNA. One potential mechanism for reorganization is for an ssDNA translocase (ATP-dependent motor) to push the SSB along ssDNA. Here we use single molecule total internal reflection fluorescence microscopy to detect such pushing events. When Cy5-labeled Escherichia coli (Ec) SSB is bound to surface-immobilized 3'-Cy3-labeled ssDNA, a fluctuating FRET signal is observed, consistent with random diffusion of SSB along the ssDNA. Addition of Saccharomyces cerevisiae Pif1, a 5' to 3' ssDNA translocase, results in the appearance of isolated, irregularly spaced saw-tooth FRET spikes only in the presence of ATP. These FRET spikes result from translocase-induced directional (5' to 3') pushing of the SSB toward the 3' ssDNA end, followed by displacement of the SSB from the DNA end. Similar ATP-dependent pushing events, but in the opposite (3' to 5') direction, are observed with EcRep and EcUvrD (both 3' to 5' ssDNA translocases). Simulations indicate that these events reflect active pushing by the translocase. The ability of translocases to chemo-mechanically push heterologous SSB proteins along ssDNA provides a potential mechanism for reorganization and clearance of tightly bound SSBs from ssDNA.

Erythroblast Transformation by the Friend Spleen Focus-Forming Virus Is Associated with a Block in Erythropoietin-Induced STAT1 Phosphorylation and DNA Binding and Correlates with High Expression of the Hematopoietic Phosphatase SHP-1

PubMed Central

Nishigaki, Kazuo; Hanson, Charlotte; Ohashi, Takashi; Spadaccini, Angelo; Ruscetti, Sandra

2006-01-01

Infection of mice with Friend spleen focus-forming virus (SFFV) results in a multistage erythroleukemia. In the first stage, the SFFV envelope glycoprotein interacts with the erythropoietin receptor and a short form of the receptor tyrosine kinase sf-Stk, resulting in constitutive activation of signal transducing molecules and the development of erythropoietin (Epo)-independent erythroid hyperplasia and polycythemia. The second stage results from the outgrowth of a rare virus-infected erythroid cell that expresses nonphysiological levels of the myeloid transcription factor PU.1. These cells exhibit a differentiation block and can be grown as murine erythroleukemia (MEL) cell lines. In this study, we examined SFFV MEL cells to determine whether their transformed phenotype was associated with a block in the activation of any Epo signal-transducing molecules. Our studies indicate that Epo- or SFFV-induced activation of STAT1/3 DNA binding activity is blocked in SFFV MEL cells. The block is at the level of tyrosine phosphorylation of STAT1, although Jak2 phosphorylation is not blocked in these cells. In contrast to Epo, alpha interferon can induce STAT1 phosphorylation and DNA binding in SFFV MEL cells. The SFFV-transformed cells were shown to express elevated levels of the hematopoietic phosphatase SHP-1, and treatment of the cells with a phosphatase inhibitor restored STAT1 tyrosine phosphorylation. MEL cells derived from Friend murine leukemia virus (MuLV) or ME26 MuLV-infected mice, which do not express PU.1, express lower levels of SHP-1 and are not blocked in STAT1/3 DNA-binding activity. Our studies suggest that SFFV-infected erythroid cells become transformed when differentiation signals activated by STAT1/3 are blocked due to high SHP-1 levels induced by inappropriate expression of the PU.1 protein. PMID:16731906

Fidelity by design: Yoctoreactor and binder trap enrichment for small-molecule DNA-encoded libraries and drug discovery.

PubMed

Blakskjaer, Peter; Heitner, Tara; Hansen, Nils Jakob Vest

2015-06-01

DNA-encoded small-molecule library (DEL) technology allows vast drug-like small molecule libraries to be efficiently synthesized in a combinatorial fashion and screened in a single tube method for binding, with an assay readout empowered by advances in next generation sequencing technology. This approach has increasingly been applied as a viable technology for the identification of small-molecule modulators to protein targets and as precursors to drugs in the past decade. Several strategies for producing and for screening DELs have been devised by both academic and industrial institutions. This review highlights some of the most significant and recent strategies along with important results. A special focus on the production of high fidelity DEL technologies with the ability to eliminate screening noise and false positives is included: using a DNA junction called the Yoctoreactor, building blocks (BBs) are spatially confined at the center of the junction facilitating both the chemical reaction between BBs and encoding of the synthetic route. A screening method, known as binder trap enrichment, permits DELs to be screened robustly in a homogeneous manner delivering clean data sets and potent hits for even the most challenging targets. Copyright © 2015 Elsevier Ltd. All rights reserved.

Interaction of vasicine with calf thymus DNA: Molecular docking, spectroscopic and differential scanning calorimetric insights

NASA Astrophysics Data System (ADS)

R. S., Sai Murali; R. S., Sai Siddhardha; Rajesh Babu, D.; Venketesh, S.; Basavaraju, R.; Nageswara Rao, G.

2017-06-01

The present study brings out the interaction between vasicine, an alkaloid and Adhatoda vasica Nees with double stranded DNA. The physico-chemical interaction between small molecules and nucleic acids is a major area of focus in screening drugs against various cancers. Molecular probing in our study using Molecular Operating Environment (MOE) has revealed interaction of vasicine with DNA double helix. Here we report the interaction of vasicine with Calf thymus DNA. We present for the first time the results obtained from UV-visible, fluorescence spectroscopic and differential scanning calorimetric techniques that suggest a moderate to strong electrostatic, hydrophobic and van der Waals interactions mediating the DNA binding properties of vasicine, leading to disruption of DNA secondary structure.

Single-molecule imaging at high fluorophore concentrations by local activation of dye

DOE Office of Scientific and Technical Information (OSTI.GOV)

Geertsema, Hylkje J.; Mangel, Walter F.; Schulte, Aartje C.

Single-molecule fluorescence microscopy is a powerful approach to observe biomolecular interactions with high spatial and temporal resolution. Detecting fluorescent signals from individual, labeled proteins above high levels of background fluorescence remains challenging, however. For this reason, the concentrations of labeled proteins in in vitro assays are often kept low compared to their in vivo concentrations. Here, we present a new fluorescence imaging technique by which single fluorescent molecules can be observed in real time at high, physiologically relevant concentrations. The technique requires a protein and its macromolecular substrate to be labeled each with a different fluorophore. Then, making use ofmore » short-distance energy-transfer mechanisms, the fluorescence from only those proteins bound to their substrate are selectively activated. This approach is demonstrated by labeling a DNA substrate with an intercalating stain, exciting the stain, and using energy transfer from the stain to activate the fluorescence of only those labeled DNA-binding proteins bound to the DNA. Such an experimental design allowed us to observe the sequence-independent interaction of Cy5-labeled interferon-inducible protein 16 (IFI16) with DNA and the sliding via one-dimensional diffusion of Cy5-labeled adenovirus protease (pVIc-AVP) on DNA in the presence of a background of hundreds of nM Cy5 fluorophore.« less

Single-molecule imaging at high fluorophore concentrations by local activation of dye

DOE PAGES

Geertsema, Hylkje J.; Mangel, Walter F.; Schulte, Aartje C.; ...

2015-02-17

Single-molecule fluorescence microscopy is a powerful approach to observe biomolecular interactions with high spatial and temporal resolution. Detecting fluorescent signals from individual, labeled proteins above high levels of background fluorescence remains challenging, however. For this reason, the concentrations of labeled proteins in in vitro assays are often kept low compared to their in vivo concentrations. Here, we present a new fluorescence imaging technique by which single fluorescent molecules can be observed in real time at high, physiologically relevant concentrations. The technique requires a protein and its macromolecular substrate to be labeled each with a different fluorophore. Then, making use ofmore » short-distance energy-transfer mechanisms, the fluorescence from only those proteins bound to their substrate are selectively activated. This approach is demonstrated by labeling a DNA substrate with an intercalating stain, exciting the stain, and using energy transfer from the stain to activate the fluorescence of only those labeled DNA-binding proteins bound to the DNA. Such an experimental design allowed us to observe the sequence-independent interaction of Cy5-labeled interferon-inducible protein 16 (IFI16) with DNA and the sliding via one-dimensional diffusion of Cy5-labeled adenovirus protease (pVIc-AVP) on DNA in the presence of a background of hundreds of nM Cy5 fluorophore.« less

The C2'- and C3'-endo equilibrium for AMP molecules bound in the cystathionine-beta-synthase domain.

PubMed

Feng, Na; Qi, Chao; Hou, Yan-Jie; Zhang, Ying; Wang, Da-Cheng; Li, De-Feng

2018-03-04

The equilibrium between C2'- and C3'-endo conformations of nucleotides in solution, as well as their polymers DNA and RNA, has been well studied in previous work. However, this equilibrium of nucleotides in their binding state remains unclear. We observed two AMP molecules, in C3'- and C2'-endo conformations respectively, simultaneously bound to a cystathionine-beta-synthase (CBS) domain dimer of the magnesium and cobalt efflux protein CorC in the crystallographic study. The C2'-endo AMP molecule assumes the higher sugar pucker energy and one more hydrogen bond with the protein than the C3'-endo molecule does. The balance between the high sugar pucker energy and the low binding energy suggests an equilibrium or switch between C2'- and C3'-endo conformations of the bound nucleotides. Our work challenge the previous hypothesis that the ribose of the bound nucleotides would be locked in a fixed conformation. Copyright © 2018 Elsevier Inc. All rights reserved.

Discovery of a Potent BTK Inhibitor with a Novel Binding Mode by Using Parallel Selections with a DNA-Encoded Chemical Library.

PubMed

Cuozzo, John W; Centrella, Paolo A; Gikunju, Diana; Habeshian, Sevan; Hupp, Christopher D; Keefe, Anthony D; Sigel, Eric A; Soutter, Holly H; Thomson, Heather A; Zhang, Ying; Clark, Matthew A

2017-05-04

We have identified and characterized novel potent inhibitors of Bruton's tyrosine kinase (BTK) from a single DNA-encoded library of over 110 million compounds by using multiple parallel selection conditions, including variation in target concentration and addition of known binders to provide competition information. Distinct binding profiles were observed by comparing enrichments of library building block combinations under these conditions; one enriched only at high concentrations of BTK and was competitive with ATP, and another enriched at both high and low concentrations of BTK and was not competitive with ATP. A compound representing the latter profile showed low nanomolar potency in biochemical and cellular BTK assays. Results from kinetic mechanism of action studies were consistent with the selection profiles. Analysis of the co-crystal structure of the most potent compound demonstrated a novel binding mode that revealed a new pocket in BTK. Our results demonstrate that profile-based selection strategies using DNA-encoded libraries form the basis of a new methodology to rapidly identify small molecule inhibitors with novel binding modes to clinically relevant targets. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Solution structure of a DNA mimicking motif of an RNA aptamer against transcription factor AML1 Runt domain.

PubMed

Nomura, Yusuke; Tanaka, Yoichiro; Fukunaga, Jun-ichi; Fujiwara, Kazuya; Chiba, Manabu; Iibuchi, Hiroaki; Tanaka, Taku; Nakamura, Yoshikazu; Kawai, Gota; Kozu, Tomoko; Sakamoto, Taiichi

2013-12-01

AML1/RUNX1 is an essential transcription factor involved in the differentiation of hematopoietic cells. AML1 binds to the Runt-binding double-stranded DNA element (RDE) of target genes through its N-terminal Runt domain. In a previous study, we obtained RNA aptamers against the AML1 Runt domain by systematic evolution of ligands by exponential enrichment and revealed that RNA aptamers exhibit higher affinity for the Runt domain than that for RDE and possess the 5'-GCGMGNN-3' and 5'-N'N'CCAC-3' conserved motif (M: A or C; N and N' form Watson-Crick base pairs) that is important for Runt domain binding. In this study, to understand the structural basis of recognition of the Runt domain by the aptamer motif, the solution structure of a 22-mer RNA was determined using nuclear magnetic resonance. The motif contains the AH(+)-C mismatch and base triple and adopts an unusual backbone structure. Structural analysis of the aptamer motif indicated that the aptamer binds to the Runt domain by mimicking the RDE sequence and structure. Our data should enhance the understanding of the structural basis of DNA mimicry by RNA molecules.

Selection of DNA aptamers against Human Cardiac Troponin I for colorimetric sensor based dot blot application.

PubMed

Dorraj, Ghamar Soltan; Rassaee, Mohammad Javad; Latifi, Ali Mohammad; Pishgoo, Bahram; Tavallaei, Mahmood

2015-08-20

Troponin T and I are ideal markers which are highly sensitive and specific for myocardial injury and have shown better efficacy than earlier markers. Since aptamers are ssDNA or RNA that bind to a wide variety of target molecules, the purpose of this research was to select an aptamer from a 79bp single-stranded DNA (ssDNA) random library that was used to bind the Human Cardiac Troponin I from a synthetic nucleic acids library by systematic evolution of ligands exponential enrichment (Selex) based on several selection and amplification steps. Human Cardiac Troponin I protein was coated onto the surface of streptavidin magnetic beads to extract specific aptamer from a large and diverse random ssDNA initial oligonucleotide library. As a result, several aptamers were selected and further examined for binding affinity and specificity. Finally TnIApt 23 showed beast affinity in nanomolar range (2.69nM) toward the target protein. A simple and rapid colorimetric detection assay for Human Cardiac Troponin I using the novel and specific aptamer-AuNPs conjugates based on dot blot assay was developed. The detection limit for this protein using aptamer-AuNPs-based assay was found to be 5ng/ml. Copyright © 2015 Elsevier B.V. All rights reserved.

Dihydroxo-bridged dimeric Cu(II) system containing sandwiched non-coordinating phenylacetate anion: Crystal structure, spectroscopic, anti-bacterial, anti-fungal and DNA-binding studies of [(phen)(H2O)Cu(OH)2Cu(H2O)(phen)]2L.6H2O: (HL = phenylacetic acid; phen = 1,10-phenanthroline)

NASA Astrophysics Data System (ADS)

Iqbal, Muhammad; Ali, Saqib; Tahir, Muhammad Nawaz; Shah, Naseer Ali

2017-09-01

This paper reports the synthesis, X-ray crystal structure, DNA-binding, antibacterial and antifungal studies of a rare dihydroxo-bridged dinuclear copper(II) complex including 1,10-phenanthroline (Phen) ligands and phenylacetate (L) anions, [Cu2(Phen)2(OH)2(H2O)2].2L.6H2O. Structural data revealed distorted square-pyramidal geometry for each copper(II) atom with the basal plane formed by the two nitrogen atoms of the phenantroline ligand and the oxygen atoms of two bridging hydroxyl groups. The apical positions are filled by the oxygen atom from a water molecule. This forms a centrosymmetric cationic dimer where the uncoordinated phenylacetate ligands serve to balance the electrical charge. The dimers interact by means of hydrogen bonds aided by the coordinated as well as uncoordinated water molecules and phenyl-acetate moieties in the crystal lattice. The binding ability of the complex with salmon sperm DNA was determined using cyclic voltammetry and absorption spectroscopy yielding binding constants 2.426 × 104 M-1 and 1.399 × 104 M-1, respectively. The complex was screened against two Gram-positive (Micrococcus luteus and Bacillus subtilis) and one Gram-negative (Escherichia coli) bacterial strains exhibiting significant activity against all the three strains. The complex exhibited significant, moderate and no activity against fungal strains Mucor piriformis, Helminthosporium solani and Aspergillus Niger, respectively. These preliminary tests indicate the competence of the complex towards the development of a potent biological drug.

New orally active DNA minor groove binding small molecule CT-1 acts against breast cancer by targeting tumor DNA damage leading to p53-dependent apoptosis.

PubMed

Saini, Karan Singh; Hamidullah; Ashraf, Raghib; Mandalapu, Dhanaraju; Das, Sharmistha; Siddiqui, Mohd Quadir; Dwivedi, Sonam; Sarkar, Jayanta; Sharma, Vishnu Lal; Konwar, Rituraj

2017-04-01

Targeting tumor DNA damage and p53 pathway is a clinically established strategy in the development of cancer chemotherapeutics. Majority of anti-cancer drugs are delivered through parenteral route for reasons like severe toxicity, lack of stability, and poor enteral absorption. Current DNA targeting drugs in clinical like anthracycline suffers from major drawbacks like cardiotoxicity. Here, we report identification of a new orally active small molecule curcumin-triazole conjugate (CT-1) with significant anti-breast cancer activity in vitro and in vivo. CT-1 selectively and significantly inhibits viability of breast cancer cell lines; retards cells cycle progression at S phase and induce mitochondrial-mediated cell apoptosis. CT-1 selectively binds to minor groove of DNA and induces DNA damage leading to increase in p53 along with decrease in its ubiquitination. Inhibition of p53 with pharmacological inhibitor as well as siRNA revealed the necessity of p53 in CT-1-mediated anti-cancer effects in breast cancer cells. Studies using several other intact p53 and deficient p53 cancer cell lines further confirmed necessity of p53 in CT-1-mediated anti-cancer response. Pharmacological inhibition of pan-caspase showed CT-1 induces caspase-dependent cell death in breast cancer cells. Most interestingly, oral administration of CT-1 induces significant inhibition of tumor growth in LA-7 syngeneic orthotropic rat mammary tumor model. CT-1 treated mammary tumor shows enhancement in DNA damage, p53 upregulation, and apoptosis. Collectively, CT-1 exhibits potent anti-cancer effect both in vitro and in vivo and could serve as a safe orally active lead for anti-cancer drug development. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

G-quadruplex formation in telomeres enhances POT1/TPP1 protection against RPA binding

PubMed Central

Ray, Sujay; Bandaria, Jigar N.; Qureshi, Mohammad H.; Yildiz, Ahmet; Balci, Hamza

2014-01-01

Human telomeres terminate with a single-stranded 3′ G overhang, which can be recognized as a DNA damage site by replication protein A (RPA). The protection of telomeres (POT1)/POT1-interacting protein 1 (TPP1) heterodimer binds specifically to single-stranded telomeric DNA (ssTEL) and protects G overhangs against RPA binding. The G overhang spontaneously folds into various G-quadruplex (GQ) conformations. It remains unclear whether GQ formation affects the ability of POT1/TPP1 to compete against RPA to access ssTEL. Using single-molecule Förster resonance energy transfer, we showed that POT1 stably loads to a minimal DNA sequence adjacent to a folded GQ. At 150 mM K+, POT1 loading unfolds the antiparallel GQ, as the parallel conformation remains folded. POT1/TPP1 loading blocks RPA’s access to both folded and unfolded telomeres by two orders of magnitude. This protection is not observed at 150 mM Na+, in which ssTEL forms only a less-stable antiparallel GQ. These results suggest that GQ formation of telomeric overhangs may contribute to suppression of DNA damage signals. PMID:24516170

Transportin mediates nuclear entry of DNA in vertebrate systems.

PubMed

Lachish-Zalait, Aurelie; Lau, Corine K; Fichtman, Boris; Zimmerman, Ella; Harel, Amnon; Gaylord, Michelle R; Forbes, Douglass J; Elbaum, Michael

2009-10-01

Delivery of DNA to the cell nucleus is an essential step in many types of viral infection, transfection, gene transfer by the plant pathogen Agrobacterium tumefaciens and in strategies for gene therapy. Thus, the mechanism by which DNA crosses the nuclear pore complex (NPC) is of great interest. Using nuclei reconstituted in vitro in Xenopus egg extracts, we previously studied DNA passage through the nuclear pores using a single-molecule approach based on optical tweezers. Fluorescently labeled DNA molecules were also seen to accumulate within nuclei. Here we find that this import of DNA relies on a soluble protein receptor of the importin family. To identify this receptor, we used different pathway-specific cargoes in competition studies as well as pathway-specific dominant negative inhibitors derived from the nucleoporin Nup153. We found that inhibition of the receptor transportin suppresses DNA import. In contrast, inhibition of importin beta has little effect on the nuclear accumulation of DNA. The dependence on transportin was fully confirmed in assays using permeabilized HeLa cells and a mammalian cell extract. We conclude that the nuclear import of DNA observed in these different vertebrate systems is largely mediated by the receptor transportin. We further report that histones, a known cargo of transportin, can act as an adaptor for the binding of transportin to DNA.

DNA-aptamers binding aminoglycoside antibiotics.

PubMed

Nikolaus, Nadia; Strehlitz, Beate

2014-02-21

Aptamers are short, single stranded DNA or RNA oligonucleotides that are able to bind specifically and with high affinity to their non-nucleic acid target molecules. This binding reaction enables their application as biorecognition elements in biosensors and assays. As antibiotic residues pose a problem contributing to the emergence of antibiotic-resistant pathogens and thereby reducing the effectiveness of the drug to fight human infections, we selected aptamers targeted against the aminoglycoside antibiotic kanamycin A with the aim of constructing a robust and functional assay that can be used for water analysis. With this work we show that aptamers that were derived from a Capture-SELEX procedure targeting against kanamycin A also display binding to related aminoglycoside antibiotics. The binding patterns differ among all tested aptamers so that there are highly substance specific aptamers and more group specific aptamers binding to a different variety of aminoglycoside antibiotics. Also the region of the aminoglycoside antibiotics responsible for aptamer binding can be estimated. Affinities of the different aptamers for their target substance, kanamycin A, are measured with different approaches and are in the micromolar range. Finally, the proof of principle of an assay for detection of kanamycin A in a real water sample is given.

In Vitro Selection for Small-Molecule-Triggered Strand Displacement and Riboswitch Activity.

PubMed

Martini, Laura; Meyer, Adam J; Ellefson, Jared W; Milligan, John N; Forlin, Michele; Ellington, Andrew D; Mansy, Sheref S

2015-10-16

An in vitro selection method for ligand-responsive RNA sensors was developed that exploited strand displacement reactions. The RNA library was based on the thiamine pyrophosphate (TPP) riboswitch, and RNA sequences capable of hybridizing to a target duplex DNA in a TPP regulated manner were identified. After three rounds of selection, RNA molecules that mediated a strand exchange reaction upon TPP binding were enriched. The enriched sequences also showed riboswitch activity. Our results demonstrated that small-molecule-responsive nucleic acid sensors can be selected to control the activity of target nucleic acid circuitry.

The properties of small Ag clusters bound to DNA bases.

PubMed

Soto-Verdugo, Víctor; Metiu, Horia; Gwinn, Elisabeth

2010-05-21

We study the binding of neutral silver clusters, Ag(n) (n=1-6), to the DNA bases adenine (A), cytosine (C), guanine (G), and thymine (T) and the absorption spectra of the silver cluster-base complexes. Using density functional theory (DFT), we find that the clusters prefer to bind to the doubly bonded ring nitrogens and that binding to T is generally much weaker than to C, G, and A. Ag(3) and Ag(4) make the stronger bonds. Bader charge analysis indicates a mild electron transfer from the base to the clusters for all bases, except T. The donor bases (C, G, and A) bind to the sites on the cluster where the lowest unoccupied molecular orbital has a pronounced protrusion. The site where cluster binds to the base is controlled by the shape of the higher occupied states of the base. Time-dependent DFT calculations show that different base-cluster isomers may have very different absorption spectra. In particular, we find new excitations in base-cluster molecules, at energies well below those of the isolated components, and with strengths that depend strongly on the orientations of planar clusters with respect to the base planes. Our results suggest that geometric constraints on binding, imposed by designed DNA structures, may be a feasible route to engineering the selection of specific cluster-base assemblies.

Conserved RNA binding activity of a Yin-Yang 1 homologue in the ova of the purple sea urchin Strongylocentrotus purpuratus.

PubMed

Belak, Zachery R; Ovsenek, Nicholas; Eskiw, Christopher H

2018-05-23

Yin-Yang 1 (YY1) is a highly conserved transcription factor possessing RNA-binding activity. A putative YY1 homologue was previously identified in the developmental model organism Strongylocentrotus purpuratus (the purple sea urchin) by genomic sequencing. We identified a high degree of sequence similarity with YY1 homologues of vertebrate origin which shared 100% protein sequence identity over the DNA- and RNA-binding zinc-finger region with high similarity in the N-terminal transcriptional activation domain. SpYY1 demonstrated identical DNA- and RNA-binding characteristics between Xenopus laevis and S. purpuratus indicating that it maintains similar functional and biochemical properties across widely divergent deuterostome species. SpYY1 binds to the consensus YY1 DNA element, and also to U-rich RNA sequences. Although we detected SpYY1 RNA-binding activity in ova lysates and observed cytoplasmic localization, SpYY1 was not associated with maternal mRNA in ova. SpYY1 expressed in Xenopus oocytes was excluded from the nucleus and associated with maternally expressed cytoplasmic mRNA molecules. These data demonstrate the existence of an YY1 homologue in S. purpuratus with similar structural and biochemical features to those of the well-studied vertebrate YY1; however, the data reveal major differences in the biological role of YY1 in the regulation of maternally expressed mRNA in the two species.

NPAS1-ARNT and NPAS3-ARNT crystal structures implicate the bHLH-PAS family as multi-ligand binding transcription factors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Dalei; Su, Xiaoyu; Potluri, Nalini

Here, the neuronal PAS domain proteins NPAS1 and NPAS3 are members of the basic helix-loop-helix-PER-ARNT-SIM (bHLH-PAS) family, and their genetic deficiencies are linked to a variety of human psychiatric disorders including schizophrenia, autism spectrum disorders and bipolar disease. NPAS1 and NPAS3 must each heterodimerize with the aryl hydrocarbon receptor nuclear translocator (ARNT), to form functional transcription complexes capable of DNA binding and gene regulation. Here we examined the crystal structures of multi-domain NPAS1-ARNT and NPAS3-ARNT-DNA complexes, discovering each to contain four putative ligand-binding pockets. Through expanded architectural comparisons between these complexes and HIF-1α-ARNT, HIF-2α-ARNT and CLOCK-BMAL1, we show the widermore » mammalian bHLH-PAS family is capable of multi-ligand-binding and presents as an ideal class of transcription factors for direct targeting by small-molecule drugs.« less

NPAS1-ARNT and NPAS3-ARNT crystal structures implicate the bHLH-PAS family as multi-ligand binding transcription factors

DOE PAGES

Wu, Dalei; Su, Xiaoyu; Potluri, Nalini; ...

2016-10-26

Here, the neuronal PAS domain proteins NPAS1 and NPAS3 are members of the basic helix-loop-helix-PER-ARNT-SIM (bHLH-PAS) family, and their genetic deficiencies are linked to a variety of human psychiatric disorders including schizophrenia, autism spectrum disorders and bipolar disease. NPAS1 and NPAS3 must each heterodimerize with the aryl hydrocarbon receptor nuclear translocator (ARNT), to form functional transcription complexes capable of DNA binding and gene regulation. Here we examined the crystal structures of multi-domain NPAS1-ARNT and NPAS3-ARNT-DNA complexes, discovering each to contain four putative ligand-binding pockets. Through expanded architectural comparisons between these complexes and HIF-1α-ARNT, HIF-2α-ARNT and CLOCK-BMAL1, we show the widermore » mammalian bHLH-PAS family is capable of multi-ligand-binding and presents as an ideal class of transcription factors for direct targeting by small-molecule drugs.« less

DNA/RNA transverse current sequencing: intrinsic structural noise from neighboring bases

PubMed Central

Alvarez, Jose R.; Skachkov, Dmitry; Massey, Steven E.; Kalitsov, Alan; Velev, Julian P.

2015-01-01

Nanopore DNA sequencing via transverse current has emerged as a promising candidate for third-generation sequencing technology. It produces long read lengths which could alleviate problems with assembly errors inherent in current technologies. However, the high error rates of nanopore sequencing have to be addressed. A very important source of the error is the intrinsic noise in the current arising from carrier dispersion along the chain of the molecule, i.e., from the influence of neighboring bases. In this work we perform calculations of the transverse current within an effective multi-orbital tight-binding model derived from first-principles calculations of the DNA/RNA molecules, to study the effect of this structural noise on the error rates in DNA/RNA sequencing via transverse current in nanopores. We demonstrate that a statistical technique, utilizing not only the currents through the nucleotides but also the correlations in the currents, can in principle reduce the error rate below any desired precision. PMID:26150827

Release of specific proteins from nuclei of HL-60 and MOLT-4 cells by antitumor drugs having affinity to nucleic acids.

PubMed

Lassota, P; Melamed, M R; Darzynkiewicz, Z

The binding sites for mitoxantrone (MIT), Ametantrone (AMT), doxorubicin (DOX), actinomycin D (AMD) and ethidium bromide (EB) in nuclei from exponentially growing and differentiating human promyelocytic HL-60 and lymphocytic leukemic MOLT-4 cells were studied by gel electrophoresis of proteins selectively released during titration of these nuclei with the drugs. Each drug at different drug: DNA binding ratios resulted in a characteristic pattern of protein elution and/or retention. For example, in nuclei from exponentially growing HL-60 cells, MIT affected 44 nuclear proteins that were different from those affected by EB; of these 29 were progressively released at increasing MIT:DNA ratios, 11 were transiently released (i.e. only at a low MIT:DNA ratio) and 4 entrapped. Patterns of proteins displaced from nuclei of exponentially growing HL-60 cells differed from those of cells undergoing myeloid differentiation as well as from those of exponentially growing MOLT-4 cells. The first effects were seen at a binding density of approximately one drug molecule per 10-50 base pairs of DNA. The observed selective displacement of proteins may reflect drug-altered affinity of the binding sites for those proteins, for example due to a change of nucleic acid or protein conformation upon binding the ligand. The data show that the binding site(s) for each of the ligands studied is different and the differences correlate with variability in chemical structure between the ligands. The nature of the drug-affected proteins may provide clues regarding antitumor or cytotoxic mechanisms of drug action.

QSAR and molecular modelling studies on B-DNA recognition of minor groove binders.

PubMed

de Oliveira, André Mauricio; Custódio, Flávia Beatriz; Donnici, Cláudio Luis; Montanari, Carlos Alberto

2003-02-01

Aromatic bisamidines have been proved to be efficient compounds against Leishmania spp. and Pneumocystis carinii. Although the mode of action is still not known, these molecules are supposed to be DNA minor groove binders (MGBs). This paper describes a molecular modelling study for a set of MGBs in order to rank them through their complementarity to the Dickerson Drew Dodecamer (DDD) according to their interaction energies with B-DNA. A comparative molecular field analysis (CoMFA) has shown the importance of relatively bulky positively charged groups attached to the MGB aromatic rings, and small and negatively charged substituents into the middle chain. Models were obtained for DNA denaturation related to H-bonding processes of binding modes. Validation of the model demonstrated the robustness of CoMFA in terms of independent test set of similar MGBs. GRID results allotted bioisosteric substitution of z.sbnd;Oz.sbnd; by z.sbnd;NHz.sbnd; in furan ring of furamidine and related compounds as being capable to enhance the binding to DDD.

Structure and Mechanism of Action of the BRCA2 Breast Cancer Tumor Suppressor

PubMed Central

Malivert, Laurent; McIlwraith, Michael J.; Pape, Tillman; West, Stephen C.; Zhang, Xiaodong

2014-01-01

Mutations in BRCA2 increase susceptibility to breast, ovarian and prostate cancers. The product of human BRCA2, BRCA2 protein, plays a key role in the repair of DNA double strand breaks and interstrand crosslinks by RAD51-mediated homologous recombination. Here, we present a biochemical and structural characterization of full length (3,418 amino acid) BRCA2, alone and in complex with RAD51. We show that BRCA2 facilitates nucleation of RAD51 filaments at multiple sites on single-stranded DNA. Three-dimensional electron microscopy reconstructions revealed that BRCA2 exists as a dimer and that two oppositely-oriented sets of RAD51 molecules bind the dimer. Single stranded DNA binds along the long axis of BRCA2, such that only one set of RAD51 monomers can form a productive complex with DNA and establish filament formation. Our data define the molecular mechanism by which this tumor suppressor facilitates RAD51-mediated homologous recombinational repair. PMID:25282148

AzaHx, a novel fluorescent, DNA minor groove and G·C recognition element: Synthesis and DNA binding properties of a p-anisyl-4-aza-benzimidazole-pyrrole-imidazole (azaHx-PI) polyamide.

PubMed

Satam, Vijay; Babu, Balaji; Patil, Pravin; Brien, Kimberly A; Olson, Kevin; Savagian, Mia; Lee, Megan; Mepham, Andrew; Jobe, Laura Beth; Bingham, John P; Pett, Luke; Wang, Shuo; Ferrara, Maddi; Bruce, Chrystal D; Wilson, W David; Lee, Moses; Hartley, John A; Kiakos, Konstantinos

2015-09-01

The design, synthesis, and DNA binding properties of azaHx-PI or p-anisyl-4-aza-benzimidazole-pyrrole-imidazole (5) are described. AzaHx, 2-(p-anisyl)-4-aza-benzimidazole-5-carboxamide, is a novel, fluorescent DNA recognition element, derived from Hoechst 33258 to recognize G·C base pairs. Supported by theoretical data, the results from DNase I footprinting, CD, ΔT(M), and SPR studies provided evidence that an azaHx/IP pairing, formed from antiparallel stacking of two azaHx-PI molecules in a side-by-side manner in the minor groove, selectively recognized a C-G doublet. AzaHx-PI was found to target 5'-ACGCGT-3', the Mlu1 Cell Cycle Box (MCB) promoter sequence with specificity and significant affinity (K(eq) 4.0±0.2×10(7) M(-1)). Copyright © 2015 Elsevier Ltd. All rights reserved.

Isolation of a cDNA for a Growth Factor of Vascular Endothelial Cells from Human Lung Cancer Cells: Its Identity with Insulin‐like Growth Factor II

PubMed Central

Hagiwara, Koichi; Kobayashi, Tatsuo; Tobita, Masato; Kikyo, Nobuaki; Yazaki, Yoshio

1995-01-01

We have found growth‐promoting activity for vascular endothelial cells in the conditioned medium of a human lung cancer cell line, T3M‐11. Purification and characterization of the growth‐promoting activity have been carried out using ammonium sulfate precipitation and gel‐exclusion chromatography. The activity migrated as a single peak just after ribonuclease. It did not bind to a heparin affinity column. These results suggest that the activity is not a heparin‐binding growth factor (including fibroblast growth factors) or a vascular endothelial growth factor. To identify the molecule exhibiting the growth‐promoting activity, a cDNA encoding the growth factor was isolated through functional expression cloning in COS‐1 cells from a cDNA library prepared from T3M‐11 cells. The nucleotide sequence encoded by the cDNA proved to be identical with that of insulin‐like growth factor II. PMID:7730145

Optimized assembly and covalent coupling of single-molecule DNA origami nanoarrays.

PubMed

Gopinath, Ashwin; Rothemund, Paul W K

2014-12-23

Artificial DNA nanostructures, such as DNA origami, have great potential as templates for the bottom-up fabrication of both biological and nonbiological nanodevices at a resolution unachievable by conventional top-down approaches. However, because origami are synthesized in solution, origami-templated devices cannot easily be studied or integrated into larger on-chip architectures. Electrostatic self-assembly of origami onto lithographically defined binding sites on Si/SiO2 substrates has been achieved, but conditions for optimal assembly have not been characterized, and the method requires high Mg2+ concentrations at which most devices aggregate. We present a quantitative study of parameters affecting origami placement, reproducibly achieving single-origami binding at 94±4% of sites, with 90% of these origami having an orientation within ±10° of their target orientation. Further, we introduce two techniques for converting electrostatic DNA-surface bonds to covalent bonds, allowing origami arrays to be used under a wide variety of Mg2+-free solution conditions.

Modulation of the Pyrococcus abyssi NucS Endonuclease Activity by Replication Clamp at Functional and Structural Levels*

PubMed Central

Creze, Christophe; Ligabue, Alessio; Laurent, Sébastien; Lestini, Roxane; Laptenok, Sergey P.; Khun, Joelle; Vos, Marten H.; Czjzek, Mirjam; Myllykallio, Hannu; Flament, Didier

2012-01-01

Pyrococcus abyssi NucS is the founding member of a new family of structure-specific DNA endonucleases that interact with the replication clamp proliferating cell nuclear antigen (PCNA). Using a combination of small angle x-ray scattering and surface plasmon resonance analyses, we demonstrate the formation of a stable complex in solution, in which one molecule of the PabNucS homodimer binds to the outside surface of the PabPCNA homotrimer. Using fluorescent labels, PCNA is shown to increase the binding affinity of NucS toward single-strand/double-strand junctions on 5′ and 3′ flaps, as well as to modulate the cleavage specificity on the branched DNA structures. Our results indicate that the presence of a single major contact between the PabNucS and PabPCNA proteins, together with the complex-induced DNA bending, facilitate conformational flexibility required for specific cleavage at the single-strand/double-strand DNA junction. PMID:22431731