Sample records for dna binding region

  1. Multiple Intrinsically Disordered Sequences Alter DNA Binding by the Homeodomain of the Drosophila Hox Protein Ultrabithorax*S⃞

    PubMed Central

    Liu, Ying; Matthews, Kathleen S.; Bondos, Sarah E.

    2008-01-01

    During animal development, distinct tissues, organs, and appendages are specified through differential gene transcription by Hox transcription factors. However, the conserved Hox homeodomains bind DNA with high affinity yet low specificity. We have therefore explored the structure of the Drosophila melanogaster Hox protein Ultrabithorax and the impact of its nonhomeodomain regions on DNA binding properties. Computational and experimental approaches identified several conserved, intrinsically disordered regions outside the homeodomain of Ultrabithorax that impact DNA binding by the homeodomain. Full-length Ultrabithorax bound to target DNA 2.5-fold weaker than its isolated homeodomain. Using N-terminal and C-terminal deletion mutants, we demonstrate that the YPWM region and the disordered microexons (termed the I1 region) inhibit DNA binding ∼2-fold, whereas the disordered I2 region inhibits homeodomain-DNA interaction a further ∼40-fold. Binding is restored almost to homeodomain affinity by the mostly disordered N-terminal 174 amino acids (R region) in a length-dependent manner. Both the I2 and R regions contain portions of the activation domain, functionally linking DNA binding and transcription regulation. Given that (i) the I1 region and a portion of the R region alter homeodomain-DNA binding as a function of pH and (ii) an internal deletion within I1 increases Ultrabithorax-DNA affinity, I1 must directly impact homeodomain-DNA interaction energetics. However, I2 appears to indirectly affect DNA binding in a manner countered by the N terminus. The amino acid sequences of I2 and much of the I1 and R regions vary significantly among Ultrabithorax orthologues, potentially diversifying Hox-DNA interactions. PMID:18508761

  2. Site-directed mutagenesis study on DNA binding regions of the mouse homologue of Suppressor of Hairless, RBP-J kappa.

    PubMed Central

    Chung, C N; Hamaguchi, Y; Honjo, T; Kawaichi, M

    1994-01-01

    To map regions important for DNA binding of the mouse homologue of Suppressor of Hairless or RBP-J kappa protein, mutated mouse RBP-J kappa cDNAs were made by insertion of oligonucleotide linkers or base replacement. DNA binding assays using the mutated proteins expressed in COS cells showed that various mutations between 218 Arg and 227 Arg decreased the DNA binding activity drastically. The DNA binding activity was not affected by amino acid replacements within the integrase motif of the RBP-J kappa protein (230His-269His). Replacements between 291Arg and 323Tyr affected the DNA binding activity slightly but reproducibly. These results indicate that the region encompassing 218Arg-227Arg is critical for the DNA binding activity of RBP-J kappa. This region did not show any significant homology to motifs or domains of the previously described DNA binding proteins. Using a truncation mutant protein RBP-J kappa was shown to associate with DNA as a monomer. Images PMID:8065905

  3. A Novel DNA Binding Mechanism for maf Basic Region-Leucine Zipper Factors Inferred from a MafA-DNA Complex Structure and Binding Specificities

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lu, Xun; Guanga, Gerald P; Wan, Cheng

    2012-11-13

    MafA is a proto-oncoprotein and is critical for insulin gene expression in pancreatic β-cells. Maf proteins belong to the AP1 superfamily of basic region-leucine zipper (bZIP) transcription factors. Residues in the basic helix and an ancillary N-terminal domain, the Extended Homology Region (EHR), endow maf proteins with unique DNA binding properties: binding a 13 bp consensus site consisting of a core AP1 site (TGACTCA) flanked by TGC sequences and binding DNA stably as monomers. To further characterize maf DNA binding, we determined the structure of a MafA–DNA complex. MafA forms base-specific hydrogen bonds with the flanking G –5C –4 andmore » central C 0/G 0 bases, but not with the core-TGA bases. However, in vitro binding studies utilizing a pulse–chase electrophoretic mobility shift assay protocol revealed that mutating either the core-TGA or flanking-TGC bases dramatically increases the binding off rate. Comparing the known maf structures, we propose that DNA binding specificity results from positioning the basic helix through unique phosphate contacts. The EHR does not contact DNA directly but stabilizes DNA binding by contacting the basic helix. Collectively, these results suggest a novel multistep DNA binding process involving a conformational change from contacting the core-TGA to contacting the flanking-TGC bases.« less

  4. The constant region affects antigen binding of antibodies to DNA by altering secondary structure.

    PubMed

    Xia, Yumin; Janda, Alena; Eryilmaz, Ertan; Casadevall, Arturo; Putterman, Chaim

    2013-11-01

    We previously demonstrated an important role of the constant region in the pathogenicity of anti-DNA antibodies. To determine the mechanisms by which the constant region affects autoantibody binding, a panel of isotype-switch variants (IgG1, IgG2a, IgG2b) was generated from the murine PL9-11 IgG3 autoantibody. The affinity of the PL9-11 antibody panel for histone was measured by surface plasmon resonance (SPR). Tryptophan fluorescence was used to determine wavelength shifts of the antibody panel upon binding to DNA and histone. Finally, circular dichroism spectroscopy was used to measure changes in secondary structure. SPR analysis revealed significant differences in histone binding affinity between members of the PL9-11 panel. The wavelength shifts of tryptophan fluorescence emission were found to be dependent on the antibody isotype, while circular dichroism analysis determined that changes in antibody secondary structure content differed between isotypes upon antigen binding. Thus, the antigen binding affinity is dependent on the particular constant region expressed. Moreover, the effects of antibody binding to antigen were also constant region dependent. Alteration of secondary structures influenced by constant regions may explain differences in fine specificity of anti-DNA antibodies between antibodies with similar variable regions, as well as cross-reactivity of anti-DNA antibodies with non-DNA antigens. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. Characterization of the DNA binding properties of polyomavirus capsid protein

    NASA Technical Reports Server (NTRS)

    Chang, D.; Cai, X.; Consigli, R. A.; Spooner, B. S. (Principal Investigator)

    1993-01-01

    The DNA binding properties of the polyomavirus structural proteins VP1, VP2, and VP3 were studied by Southwestern analysis. The major viral structural protein VP1 and host-contributed histone proteins of polyomavirus virions were shown to exhibit DNA binding activity, but the minor capsid proteins VP2 and VP3 failed to bind DNA. The N-terminal first five amino acids (Ala-1 to Lys-5) were identified as the VP1 DNA binding domain by genetic and biochemical approaches. Wild-type VP1 expressed in Escherichia coli (RK1448) exhibited DNA binding activity, but the N-terminal truncated VP1 mutants (lacking Ala-1 to Lys-5 and Ala-1 to Cys-11) failed to bind DNA. The synthetic peptide (Ala-1 to Cys-11) was also shown to have an affinity for DNA binding. Site-directed mutagenesis of the VP1 gene showed that the point mutations at Pro-2, Lys-3, and Arg-4 on the VP1 molecule did not affect DNA binding properties but that the point mutation at Lys-5 drastically reduced DNA binding affinity. The N-terminal (Ala-1 to Lys-5) region of VP1 was found to be essential and specific for DNA binding, while the DNA appears to be non-sequence specific. The DNA binding domain and the nuclear localization signal are located in the same N-terminal region.

  6. A novel class of plant-specific zinc-dependent DNA-binding protein that binds to A/T-rich DNA sequences

    PubMed Central

    Nagano, Yukio; Furuhashi, Hirofumi; Inaba, Takehito; Sasaki, Yukiko

    2001-01-01

    Complementary DNA encoding a DNA-binding protein, designated PLATZ1 (plant AT-rich sequence- and zinc-binding protein 1), was isolated from peas. The amino acid sequence of the protein is similar to those of other uncharacterized proteins predicted from the genome sequences of higher plants. However, no paralogous sequences have been found outside the plant kingdom. Multiple alignments among these paralogous proteins show that several cysteine and histidine residues are invariant, suggesting that these proteins are a novel class of zinc-dependent DNA-binding proteins with two distantly located regions, C-x2-H-x11-C-x2-C-x(4–5)-C-x2-C-x(3–7)-H-x2-H and C-x2-C-x(10–11)-C-x3-C. In an electrophoretic mobility shift assay, the zinc chelator 1,10-o-phenanthroline inhibited DNA binding, and two distant zinc-binding regions were required for DNA binding. A protein blot with 65ZnCl2 showed that both regions are required for zinc-binding activity. The PLATZ1 protein non-specifically binds to A/T-rich sequences, including the upstream region of the pea GTPase pra2 and plastocyanin petE genes. Expression of the PLATZ1 repressed those of the reporter constructs containing the coding sequence of luciferase gene driven by the cauliflower mosaic virus (CaMV) 35S90 promoter fused to the tandem repeat of the A/T-rich sequences. These results indicate that PLATZ1 is a novel class of plant-specific zinc-dependent DNA-binding protein responsible for A/T-rich sequence-mediated transcriptional repression. PMID:11600698

  7. TAF(II)170 interacts with the concave surface of TATA-binding protein to inhibit its DNA binding activity.

    PubMed

    Pereira, L A; van der Knaap, J A; van den Boom, V; van den Heuvel, F A; Timmers, H T

    2001-11-01

    The human RNA polymerase II transcription factor B-TFIID consists of TATA-binding protein (TBP) and the TBP-associated factor (TAF) TAF(II)170 and can rapidly redistribute over promoter DNA. Here we report the identification of human TBP-binding regions in human TAF(II)170. We have defined the TBP interaction domain of TAF(II)170 within three amino-terminal regions: residues 2 to 137, 290 to 381, and 380 to 460. Each region contains a pair of Huntington-elongation-A subunit-Tor repeats and exhibits species-specific interactions with TBP family members. Remarkably, the altered-specificity TBP mutant (TBP(AS)) containing a triple mutation in the concave surface is defective for binding the TAF(II)170 amino-terminal region of residues 1 to 504. Furthermore, within this region the TAF(II)170 residues 290 to 381 can inhibit the interaction between Drosophila TAF(II)230 (residues 2 to 81) and TBP through competition for the concave surface of TBP. Biochemical analyses of TBP binding to the TATA box indicated that TAF(II)170 region 290-381 inhibits TBP-DNA complex formation. Importantly, the TBP(AS) mutant is less sensitive to TAF(II)170 inhibition. Collectively, our results support a mechanism in which TAF(II)170 induces high-mobility DNA binding by TBP through reversible interactions with its concave DNA binding surface.

  8. Determination of DNA Binding Behavior of FoxA1 Constructs Using a Gold Nanoparticle-Based High Throughput Assay

    NASA Astrophysics Data System (ADS)

    Aung, Khin Moh Moh; Lim, Michelle Gek Liang; Hong, Shuzhen; Cheung, Edwin; Su, Xiaodi

    Forkhead box protein 1 (FoxA1) is a member of the forkhead family of winged-helix transcription factors. It plays crucial roles in the development and differentiation of multiple organs and in the regulation of estrogen-stimulated genes. In this study, in order to determine the regions of FoxA1 necessary for efficient Deoxyribonucleic Acid (DNA) binding, we cloned, expressed and purified a series of FoxA1 constructs that contain either the DNA Binding Domain (DBD), the Transcription Activation Domain (TAD), or both. We determined the DNA binding behavior of these constructs using traditional electrophoretic mobility shift assay (EMSA) and a recently developed gold nanoparticles (AuNPs)-based fast screening method. We conclude that just the DBD region alone is not sufficient for protein-DNA binding activity. Amino acids flanking the upstream of the DBD region are required for maximal DNA binding activity. Through this study, we have also further validated the AuNPs assay for its generality and expanded the existing protocol for comparing the DNA binding behavior of multiple proteins of different charge properties and molecular weights.

  9. Structural basis of DNA bending and oriented heterodimer binding by the basic leucine zipper domains of Fos and Jun.

    PubMed

    Leonard, D A; Rajaram, N; Kerppola, T K

    1997-05-13

    Interactions among transcription factors that bind to separate sequence elements require bending of the intervening DNA and juxtaposition of interacting molecular surfaces in an appropriate orientation. Here, we examine the effects of single amino acid substitutions adjacent to the basic regions of Fos and Jun as well as changes in sequences flanking the AP-1 site on DNA bending. Substitution of charged amino acid residues at positions adjacent to the basic DNA-binding domains of Fos and Jun altered DNA bending. The change in DNA bending was directly proportional to the change in net charge for all heterodimeric combinations between these proteins. Fos and Jun induced distinct DNA bends at different binding sites. Exchange of a single base pair outside of the region contacted in the x-ray crystal structure altered DNA bending. Substitution of base pairs flanking the AP-1 site had converse effects on the opposite directions of DNA bending induced by homodimers and heterodimers. These results suggest that Fos and Jun induce DNA bending in part through electrostatic interactions between amino acid residues adjacent to the basic region and base pairs flanking the AP-1 site. DNA bending by Fos and Jun at inverted binding sites indicated that heterodimers bind to the AP-1 site in a preferred orientation. Mutation of a conserved arginine within the basic regions of Fos and transversion of the central C:G base pair in the AP-1 site to G:C had complementary effects on the orientation of heterodimer binding and DNA bending. The conformational variability of the Fos-Jun-AP-1 complex may contribute to its functional versatility at different promoters.

  10. Comparison of specific binding sites for Escherichia coli RNA polymerase with naturally occurring hairpin regions in single-stranded DNA of coliphage M13. [Aspergillus oryzae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Niyogi, S.K.; Mitra, S.

    Escherichia coli RNA polymerase binds specifically to the single-stranded circular DNA of coliphage M13 in the presence of a saturating concentration of the bacterial DNA binding protein presumably as an essential step in the synthesis of the RNA primer required for synthesizing the complementary DNA strand in parental replicative-form DNA. The RNA polymerase-protected DNA regions were isolated after extensive digestion with pancreatic DNase, S1 endonuclease of Aspergillus oryzae, and exonuclease I of E. coli. The physicochemical properties of the RNA polymerase-protected segments (called PI and PII) were compared with those of the naturally occurring hairpin regions.

  11. FACT is a sensor of DNA torsional stress in eukaryotic cells

    PubMed Central

    Safina, Alfiya; Cheney, Peter; Pal, Mahadeb; Brodsky, Leonid; Ivanov, Alexander; Kirsanov, Kirill; Lesovaya, Ekaterina; Naberezhnov, Denis; Nesher, Elimelech; Koman, Igor; Wang, Dan; Wang, Jianming; Yakubovskaya, Marianna; Winkler, Duane

    2017-01-01

    Abstract Transitions of B-DNA to alternative DNA structures (ADS) can be triggered by negative torsional strain, which occurs during replication and transcription, and may lead to genomic instability. However, how ADS are recognized in cells is unclear. We found that the binding of candidate anticancer drug, curaxin, to cellular DNA results in uncoiling of nucleosomal DNA, accumulation of negative supercoiling and conversion of multiple regions of genomic DNA into left-handed Z-form. Histone chaperone FACT binds rapidly to the same regions via the SSRP1 subunit in curaxin-treated cells. In vitro binding of purified SSRP1 or its isolated CID domain to a methylated DNA fragment containing alternating purine/pyrimidines, which is prone to Z-DNA transition, is much stronger than to other types of DNA. We propose that FACT can recognize and bind Z-DNA or DNA in transition from a B to Z form. Binding of FACT to these genomic regions triggers a p53 response. Furthermore, FACT has been shown to bind to other types of ADS through a different structural domain, which also leads to p53 activation. Thus, we propose that FACT acts as a sensor of ADS formation in cells. Recognition of ADS by FACT followed by a p53 response may explain the role of FACT in DNA damage prevention. PMID:28082391

  12. Human immunodeficiency virus type 1 LTR TATA and TAR region sequences required for transcriptional regulation.

    PubMed Central

    Garcia, J A; Harrich, D; Soultanakis, E; Wu, F; Mitsuyasu, R; Gaynor, R B

    1989-01-01

    The human immunodeficiency virus (HIV) type 1 LTR is regulated at the transcriptional level by both cellular and viral proteins. Using HeLa cell extracts, multiple regions of the HIV LTR were found to serve as binding sites for cellular proteins. An untranslated region binding protein UBP-1 has been purified and fractions containing this protein bind to both the TAR and TATA regions. To investigate the role of cellular proteins binding to both the TATA and TAR regions and their potential interaction with other HIV DNA binding proteins, oligonucleotide-directed mutagenesis of both these regions was performed followed by DNase I footprinting and transient expression assays. In the TATA region, two direct repeats TC/AAGC/AT/AGCTGC surround the TATA sequence. Mutagenesis of both of these direct repeats or of the TATA sequence interrupted binding over the TATA region on the coding strand, but only a mutation of the TATA sequence affected in vivo assays for tat-activation. In addition to TAR serving as the site of binding of cellular proteins, RNA transcribed from TAR is capable of forming a stable stem-loop structure. To determine the relative importance of DNA binding proteins as compared to secondary structure, oligonucleotide-directed mutations in the TAR region were studied. Local mutations that disrupted either the stem or loop structure were defective in gene expression. However, compensatory mutations which restored base pairing in the stem resulted in complete tat-activation. This indicated a significant role for the stem-loop structure in HIV gene expression. To determine the role of TAR binding proteins, mutations were constructed which extensively changed the primary structure of the TAR region, yet left stem base pairing, stem energy and the loop sequence intact. These mutations resulted in decreased protein binding to TAR DNA and defects in tat-activation, and revealed factor binding specifically to the loop DNA sequence. Further mutagenesis which inverted this stem and loop mutation relative to the HIV LTR mRNA start site resulted in even larger decreases in tat-activation. This suggests that multiple determinants, including protein binding, the loop sequence, and RNA or DNA secondary structure, are important in tat-activation and suggests that tat may interact with cellular proteins binding to DNA to increase HIV gene expression. Images PMID:2721501

  13. Functional analysis of CedA based on its structure: residues important in binding of DNA and RNA polymerase and in the cell division regulation

    PubMed Central

    Abe, Yoshito; Fujisaki, Naoki; Miyoshi, Takanori; Watanabe, Noriko; Katayama, Tsutomu; Ueda, Tadashi

    2016-01-01

    DnaAcos, a mutant of the initiator DnaA, causes overinitiation of chromosome replication in Escherichia coli, resulting in inhibition of cell division. CedA was found to be a multi-copy suppressor which represses the dnaAcos inhibition of cell division. However, functional mechanism of CedA remains elusive except for previously indicated possibilities in binding to DNA and RNA polymerase. In this study, we searched for the specific sites of CedA in binding of DNA and RNA polymerase and in repression of cell division inhibition. First, DNA sequence to which CedA preferentially binds was determined. Next, the several residues and β4 region in CedA C-terminal domain was suggested to specifically interact with the DNA. Moreover, we found that the flexible N-terminal region was required for tight binding to longer DNA as well as interaction with RNA polymerase. Based on these results, several cedA mutants were examined in ability for repressing dnaAcos cell division inhibition. We found that the N-terminal region was dispensable and that Glu32 in the C-terminal domain was required for the repression. These results suggest that CedA has multiple roles and residues with different functions are positioned in the two regions. PMID:26400504

  14. BAF57 Modulation of Androgen Receptor Action and Prostate Cancer Progression

    DTIC Science & Technology

    2007-12-01

    mapped the AR binding site on BAF57 to the N-terminus (proline-rich region). Furthermore, the DBD and hinge region of AR also appear to play a...Accomplishments of Task 1: BAF57 binds to DNA binding domain ( DBD ) and hinge region of AR As outlined in the initial proposal, the first task...the above construct are the well-characterized zinc finger DNA binding domain ( DBD ) and the hinge region. Given the significant role of these two

  15. BAF57 Modulation of Androgen Receptor Action and Prostate Cancer Progression

    DTIC Science & Technology

    2006-12-01

    has fine mapped the AR binding site on BAF57 to the N-terminus (proline-rich region). Furthermore, the DBD and hinge region of AR also appear to...Accomplishments of Task 1: BAF57 binds to DNA binding domain ( DBD ) and hinge region of AR As outlined in the initial proposal, the first task was to...construct are the well-characterized zinc finger DNA binding domain ( DBD ) and the hinge region. Given the significant role of these two domains in AR

  16. DNA Binding of Centromere Protein C (CENPC) Is Stabilized by Single-Stranded RNA

    PubMed Central

    Du, Yaqing; Topp, Christopher N.; Dawe, R. Kelly

    2010-01-01

    Centromeres are the attachment points between the genome and the cytoskeleton: centromeres bind to kinetochores, which in turn bind to spindles and move chromosomes. Paradoxically, the DNA sequence of centromeres has little or no role in perpetuating kinetochores. As such they are striking examples of genetic information being transmitted in a manner that is independent of DNA sequence (epigenetically). It has been found that RNA transcribed from centromeres remains bound within the kinetochore region, and this local population of RNA is thought to be part of the epigenetic marking system. Here we carried out a genetic and biochemical study of maize CENPC, a key inner kinetochore protein. We show that DNA binding is conferred by a localized region 122 amino acids long, and that the DNA-binding reaction is exquisitely sensitive to single-stranded RNA. Long, single-stranded nucleic acids strongly promote the binding of CENPC to DNA, and the types of RNAs that stabilize DNA binding match in size and character the RNAs present on kinetochores in vivo. Removal or replacement of the binding module with HIV integrase binding domain causes a partial delocalization of CENPC in vivo. The data suggest that centromeric RNA helps to recruit CENPC to the inner kinetochore by altering its DNA binding characteristics. PMID:20140237

  17. Two residues in the basic region of the yeast transcription factor Yap8 are crucial for its DNA-binding specificity.

    PubMed

    Amaral, Catarina; Pimentel, Catarina; Matos, Rute G; Arraiano, Cecília M; Matzapetakis, Manolis; Rodrigues-Pousada, Claudina

    2013-01-01

    In Saccharomyces cerevisiae, the transcription factor Yap8 is a key determinant in arsenic stress response. Contrary to Yap1, another basic region-leucine zipper (bZIP) yeast regulator, Yap8 has a very restricted DNA-binding specificity and only orchestrates the expression of ACR2 and ACR3 genes. In the DNA-binding basic region, Yap8 has three distinct amino acids residues, Leu26, Ser29 and Asn31, at sites of highly conserved positions in the other Yap family of transcriptional regulators and Pap1 of Schizosaccharomyces pombe. To evaluate whether these residues are relevant to Yap8 specificity, we first built a homology model of the complex Yap8bZIP-DNA based on Pap1-DNA crystal structure. Several Yap8 mutants were then generated in order to confirm the contribution of the residues predicted to interact with DNA. Using bioinformatics analysis together with in vivo and in vitro approaches, we have identified several conserved residues critical for Yap8-DNA binding. Moreover, our data suggest that Leu26 is required for Yap8 binding to DNA and that this residue together with Asn31, hinder Yap1 response element recognition by Yap8, thus narrowing its DNA-binding specificity. Furthermore our results point to a role of these two amino acids in the stability of the Yap8-DNA complex.

  18. Different domains of the murine RNA polymerase I-specific termination factor mTTF-I serve distinct functions in transcription termination.

    PubMed

    Evers, R; Smid, A; Rudloff, U; Lottspeich, F; Grummt, I

    1995-03-15

    Termination of mouse ribosomal gene transcription by RNA polymerase I (Pol I) requires the specific interaction of a DNA binding protein, mTTF-I, with an 18 bp sequence element located downstream of the rRNA coding region. Here we describe the molecular cloning and functional characterization of the cDNA encoding this transcription termination factor. Recombinant mTTF-I binds specifically to the murine terminator elements and terminates Pol I transcription in a reconstituted in vitro system. Deletion analysis has defined a modular structure of mTTF-I comprising a dispensable N-terminal half, a large C-terminal DNA binding region and an internal domain which is required for transcription termination. Significantly, the C-terminal region of mTTF-I reveals striking homology to the DNA binding domains of the proto-oncogene c-Myb and the yeast transcription factor Reb1p. Site-directed mutagenesis of one of the tryptophan residues that is conserved in the homology region of c-Myb, Reb1p and mTTF-I abolishes specific DNA binding, a finding which underscores the functional relevance of these residues in DNA-protein interactions.

  19. Different domains of the murine RNA polymerase I-specific termination factor mTTF-I serve distinct functions in transcription termination.

    PubMed Central

    Evers, R; Smid, A; Rudloff, U; Lottspeich, F; Grummt, I

    1995-01-01

    Termination of mouse ribosomal gene transcription by RNA polymerase I (Pol I) requires the specific interaction of a DNA binding protein, mTTF-I, with an 18 bp sequence element located downstream of the rRNA coding region. Here we describe the molecular cloning and functional characterization of the cDNA encoding this transcription termination factor. Recombinant mTTF-I binds specifically to the murine terminator elements and terminates Pol I transcription in a reconstituted in vitro system. Deletion analysis has defined a modular structure of mTTF-I comprising a dispensable N-terminal half, a large C-terminal DNA binding region and an internal domain which is required for transcription termination. Significantly, the C-terminal region of mTTF-I reveals striking homology to the DNA binding domains of the proto-oncogene c-Myb and the yeast transcription factor Reb1p. Site-directed mutagenesis of one of the tryptophan residues that is conserved in the homology region of c-Myb, Reb1p and mTTF-I abolishes specific DNA binding, a finding which underscores the functional relevance of these residues in DNA-protein interactions. Images PMID:7720715

  20. Zinc-binding Domain of the Bacteriophage T7 DNA Primase Modulates Binding to the DNA Template*

    PubMed Central

    Lee, Seung-Joo; Zhu, Bin; Akabayov, Barak; Richardson, Charles C.

    2012-01-01

    The zinc-binding domain (ZBD) of prokaryotic DNA primases has been postulated to be crucial for recognition of specific sequences in the single-stranded DNA template. To determine the molecular basis for this role in recognition, we carried out homolog-scanning mutagenesis of the zinc-binding domain of DNA primase of bacteriophage T7 using a bacterial homolog from Geobacillus stearothermophilus. The ability of T7 DNA primase to catalyze template-directed oligoribonucleotide synthesis is eliminated by substitution of any five-amino acid residue-long segment within the ZBD. The most significant defect occurs upon substitution of a region (Pro-16 to Cys-20) spanning two cysteines that coordinate the zinc ion. The role of this region in primase function was further investigated by generating a protein library composed of multiple amino acid substitutions for Pro-16, Asp-18, and Asn-19 followed by genetic screening for functional proteins. Examination of proteins selected from the screening reveals no change in sequence-specific recognition. However, the more positively charged residues in the region facilitate DNA binding, leading to more efficient oligoribonucleotide synthesis on short templates. The results suggest that the zinc-binding mode alone is not responsible for sequence recognition, but rather its interaction with the RNA polymerase domain is critical for DNA binding and for sequence recognition. Consequently, any alteration in the ZBD that disturbs its conformation leads to loss of DNA-dependent oligoribonucleotide synthesis. PMID:23024359

  1. Expression of simian virus 40 T antigen in Escherichia coli: localization of T-antigen origin DNA-binding domain to within 129 amino acids.

    PubMed Central

    Arthur, A K; Höss, A; Fanning, E

    1988-01-01

    The genomic coding sequence of the large T antigen of simian virus 40 (SV40) was cloned into an Escherichia coli expression vector by joining new restriction sites, BglII and BamHI, introduced at the intron boundaries of the gene. Full-length large T antigen, as well as deletion and amino acid substitution mutants, were inducibly expressed from the lac promoter of pUC9, albeit with different efficiencies and protein stabilities. Specific interaction with SV40 origin DNA was detected for full-length T antigen and certain mutants. Deletion mutants lacking T-antigen residues 1 to 130 and 260 to 708 retained specific origin-binding activity, demonstrating that the region between residues 131 and 259 must carry the essential binding domain for DNA-binding sites I and II. A sequence between residues 302 and 320 homologous to a metal-binding "finger" motif is therefore not required for origin-specific binding. However, substitution of serine for either of two cysteine residues in this motif caused a dramatic decrease in origin DNA-binding activity. This region, as well as other regions of the full-length protein, may thus be involved in stabilizing the DNA-binding domain and altering its preference for binding to site I or site II DNA. Images PMID:2835505

  2. Functional analysis of CedA based on its structure: residues important in binding of DNA and RNA polymerase and in the cell division regulation.

    PubMed

    Abe, Yoshito; Fujisaki, Naoki; Miyoshi, Takanori; Watanabe, Noriko; Katayama, Tsutomu; Ueda, Tadashi

    2016-02-01

    DnaAcos, a mutant of the initiator DnaA, causes overinitiation of chromosome replication in Escherichia coli, resulting in inhibition of cell division. CedA was found to be a multi-copy suppressor which represses the dnaAcos inhibition of cell division. However, functional mechanism of CedA remains elusive except for previously indicated possibilities in binding to DNA and RNA polymerase. In this study, we searched for the specific sites of CedA in binding of DNA and RNA polymerase and in repression of cell division inhibition. First, DNA sequence to which CedA preferentially binds was determined. Next, the several residues and β4 region in CedA C-terminal domain was suggested to specifically interact with the DNA. Moreover, we found that the flexible N-terminal region was required for tight binding to longer DNA as well as interaction with RNA polymerase. Based on these results, several cedA mutants were examined in ability for repressing dnaAcos cell division inhibition. We found that the N-terminal region was dispensable and that Glu32 in the C-terminal domain was required for the repression. These results suggest that CedA has multiple roles and residues with different functions are positioned in the two regions. © The Authors 2015. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  3. Nucleic acid is a novel ligand for innate, immune pattern recognition collectins surfactant proteins A and D and mannose-binding lectin.

    PubMed

    Palaniyar, Nades; Nadesalingam, Jeya; Clark, Howard; Shih, Michael J; Dodds, Alister W; Reid, Kenneth B M

    2004-07-30

    Collectins are a family of innate immune proteins that contain fibrillar collagen-like regions and globular carbohydrate recognition domains (CRDs). The CRDs of these proteins recognize various microbial surface-specific carbohydrate patterns, particularly hexoses. We hypothesized that collectins, such as pulmonary surfactant proteins (SPs) SP-A and SP-D and serum protein mannose-binding lectin, could recognize nucleic acids, pentose-based anionic phosphate polymers. Here we show that collectins bind DNA from a variety of origins, including bacteria, mice, and synthetic oligonucleotides. Pentoses, such as arabinose, ribose, and deoxyribose, inhibit the interaction between SP-D and mannan, one of the well-studied hexose ligands for SP-D, and biologically relevant d-forms of the pentoses are better competitors than the l-forms. In addition, DNA and RNA polymer-related compounds, such as nucleotide diphosphates and triphosphates, also inhibit the carbohydrate binding ability of SP-D, or approximately 60 kDa trimeric recombinant fragments of SP-D that are composed of the alpha-helical coiled-coil neck region and three CRDs (SP-D(n/CRD)) or SP-D(n/CRD) with eight GXY repeats (SPD(GXY)(8)(n/CRD)). Direct binding and competition studies suggest that collectins bind nucleic acid via their CRDs as well as by their collagen-like regions, and that SP-D binds DNA more effectively than do SP-A and mannose-binding lectin at physiological salt conditions. Furthermore, the SP-D(GXY)(8)(n/CRD) fragments co-localize with DNA, and the protein competes the interaction between propidium iodide, a DNA-binding dye, and apoptotic cells. In conclusion, we show that collectins are a new class of proteins that bind free DNA and the DNA present on apoptotic cells by both their globular CRDs and collagen-like regions. Collectins may therefore play an important role in decreasing the inflammation caused by DNA in lungs and other tissues.

  4. Identifying DNA-binding proteins using structural motifs and the electrostatic potential

    PubMed Central

    Shanahan, Hugh P.; Garcia, Mario A.; Jones, Susan; Thornton, Janet M.

    2004-01-01

    Robust methods to detect DNA-binding proteins from structures of unknown function are important for structural biology. This paper describes a method for identifying such proteins that (i) have a solvent accessible structural motif necessary for DNA-binding and (ii) a positive electrostatic potential in the region of the binding region. We focus on three structural motifs: helix–turn-helix (HTH), helix–hairpin–helix (HhH) and helix–loop–helix (HLH). We find that the combination of these variables detect 78% of proteins with an HTH motif, which is a substantial improvement over previous work based purely on structural templates and is comparable to more complex methods of identifying DNA-binding proteins. Similar true positive fractions are achieved for the HhH and HLH motifs. We see evidence of wide evolutionary diversity for DNA-binding proteins with an HTH motif, and much smaller diversity for those with an HhH or HLH motif. PMID:15356290

  5. pUL34 binding near the human cytomegalovirus origin of lytic replication enhances DNA replication and viral growth.

    PubMed

    Slayton, Mark; Hossain, Tanvir; Biegalke, Bonita J

    2018-05-01

    The human cytomegalovirus (HCMV) UL34 gene encodes sequence-specific DNA-binding proteins (pUL34) which are required for viral replication. Interactions of pUL34 with DNA binding sites represses transcription of two viral immune evasion genes, US3 and US9. 12 additional predicted pUL34-binding sites are present in the HCMV genome (strain AD169) with three binding sites concentrated near the HCMV origin of lytic replication (oriLyt). We used ChIP-seq analysis of pUL34-DNA interactions to confirm that pUL34 binds to the oriLyt region during infection. Mutagenesis of the UL34-binding sites in an oriLyt-containing plasmid significantly reduced viral-mediated oriLyt-dependent DNA replication. Mutagenesis of these sites in the HCMV genome reduced the replication efficiencies of the resulting viruses. Protein-protein interaction analyses demonstrated that pUL34 interacts with the viral proteins IE2, UL44, and UL84, that are essential for viral DNA replication, suggesting that pUL34-DNA interactions in the oriLyt region are involved in the DNA replication cascade. Copyright © 2018 Elsevier Inc. All rights reserved.

  6. Role for a region of helically unstable DNA within the Epstein-Barr virus latent cycle origin of DNA replication oriP in origin function

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Polonskaya, Zhanna; Benham, Craig J.; Hearing, Janet

    The minimal replicator of the Epstein-Barr virus (EBV) latent cycle origin of DNA replication oriP is composed of two binding sites for the Epstein-Barr virus nuclear antigen-1 (EBNA-1) and flanking inverted repeats that bind the telomere repeat binding factor TRF2. Although not required for minimal replicator activity, additional binding sites for EBNA-1 and TRF2 and one or more auxiliary elements located to the right of the EBNA-1/TRF2 sites are required for the efficient replication of oriP plasmids. Another region of oriP that is predicted to be destabilized by DNA supercoiling is shown here to be an important functional component ofmore » oriP. The ability of DNA fragments of unrelated sequence and possessing supercoiled-induced DNA duplex destabilized (SIDD) structures, but not fragments characterized by helically stable DNA, to substitute for this component of oriP demonstrates a role for the SIDD region in the initiation of oriP-plasmid DNA replication.« less

  7. DNA/RNA hybrid substrates modulate the catalytic activity of purified AID.

    PubMed

    Abdouni, Hala S; King, Justin J; Ghorbani, Atefeh; Fifield, Heather; Berghuis, Lesley; Larijani, Mani

    2018-01-01

    Activation-induced cytidine deaminase (AID) converts cytidine to uridine at Immunoglobulin (Ig) loci, initiating somatic hypermutation and class switching of antibodies. In vitro, AID acts on single stranded DNA (ssDNA), but neither double-stranded DNA (dsDNA) oligonucleotides nor RNA, and it is believed that transcription is the in vivo generator of ssDNA targeted by AID. It is also known that the Ig loci, particularly the switch (S) regions targeted by AID are rich in transcription-generated DNA/RNA hybrids. Here, we examined the binding and catalytic behavior of purified AID on DNA/RNA hybrid substrates bearing either random sequences or GC-rich sequences simulating Ig S regions. If substrates were made up of a random sequence, AID preferred substrates composed entirely of DNA over DNA/RNA hybrids. In contrast, if substrates were composed of S region sequences, AID preferred to mutate DNA/RNA hybrids over substrates composed entirely of DNA. Accordingly, AID exhibited a significantly higher affinity for binding DNA/RNA hybrid substrates composed specifically of S region sequences, than any other substrates composed of DNA. Thus, in the absence of any other cellular processes or factors, AID itself favors binding and mutating DNA/RNA hybrids composed of S region sequences. AID:DNA/RNA complex formation and supporting mutational analyses suggest that recognition of DNA/RNA hybrids is an inherent structural property of AID. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Study of DNA binding sites using the Rényi parametric entropy measure.

    PubMed

    Krishnamachari, A; moy Mandal, Vijnan; Karmeshu

    2004-04-07

    Shannon's definition of uncertainty or surprisal has been applied extensively to measure the information content of aligned DNA sequences and characterizing DNA binding sites. In contrast to Shannon's uncertainty, this study investigates the applicability and suitability of a parametric uncertainty measure due to Rényi. It is observed that this measure also provides results in agreement with Shannon's measure, pointing to its utility in analysing DNA binding site region. For facilitating the comparison between these uncertainty measures, a dimensionless quantity called "redundancy" has been employed. It is found that Rényi's measure at low parameter values possess a better delineating feature of binding sites (of binding regions) than Shannon's measure. The critical value of the parameter is chosen with an outlier criterion.

  9. Specific interaction of mutant p53 with regions of matrix attachment region DNA elements (MARs) with a high potential for base-unpairing

    PubMed Central

    Will, Katrin; Warnecke, Gabriele; Wiesmüller, Lisa; Deppert, Wolfgang

    1998-01-01

    Mutant, but not wild-type p53 binds with high affinity to a variety of MAR-DNA elements (MARs), suggesting that MAR-binding of mutant p53 relates to the dominant-oncogenic activities proposed for mutant p53. MARs recognized by mutant p53 share AT richness and contain variations of an AATATATTT “DNA-unwinding motif,” which enhances the structural dynamics of chromatin and promotes regional DNA base-unpairing. Mutant p53 specifically interacted with MAR-derived oligonucleotides carrying such unwinding motifs, catalyzing DNA strand separation when this motif was located within a structurally labile sequence environment. Addition of GC-clamps to the respective MAR-oligonucleotides or introducing mutations into the unwinding motif strongly reduced DNA strand separation, but supported the formation of tight complexes between mutant p53 and such oligonucleotides. We conclude that the specific interaction of mutant p53 with regions of MAR-DNA with a high potential for base-unpairing provides the basis for the high-affinity binding of mutant p53 to MAR-DNA. PMID:9811860

  10. Isolation from genomic DNA of sequences binding specific regulatory proteins by the acceleration of protein electrophoretic mobility upon DNA binding.

    PubMed

    Subrahmanyam, S; Cronan, J E

    1999-01-21

    We report an efficient and flexible in vitro method for the isolation of genomic DNA sequences that are the binding targets of a given DNA binding protein. This method takes advantage of the fact that binding of a protein to a DNA molecule generally increases the rate of migration of the protein in nondenaturing gel electrophoresis. By the use of a radioactively labeled DNA-binding protein and nonradioactive DNA coupled with PCR amplification from gel slices, we show that specific binding sites can be isolated from Escherichia coli genomic DNA. We have applied this method to isolate a binding site for FadR, a global regulator of fatty acid metabolism in E. coli. We have also isolated a second binding site for BirA, the biotin operon repressor/biotin ligase, from the E. coli genome that has a very low binding efficiency compared with the bio operator region.

  11. Regulation of TCF ETS-domain transcription factors by helix-loop-helix motifs.

    PubMed

    Stinson, Julie; Inoue, Toshiaki; Yates, Paula; Clancy, Anne; Norton, John D; Sharrocks, Andrew D

    2003-08-15

    DNA binding by the ternary complex factor (TCF) subfamily of ETS-domain transcription factors is tightly regulated by intramolecular and intermolecular interactions. The helix-loop-helix (HLH)-containing Id proteins are trans-acting negative regulators of DNA binding by the TCFs. In the TCF, SAP-2/Net/ERP, intramolecular inhibition of DNA binding is promoted by the cis-acting NID region that also contains an HLH-like motif. The NID also acts as a transcriptional repression domain. Here, we have studied the role of HLH motifs in regulating DNA binding and transcription by the TCF protein SAP-1 and how Cdk-mediated phosphorylation affects the inhibitory activity of the Id proteins towards the TCFs. We demonstrate that the NID region of SAP-1 is an autoinhibitory motif that acts to inhibit DNA binding and also functions as a transcription repression domain. This region can be functionally replaced by fusion of Id proteins to SAP-1, whereby the Id moiety then acts to repress DNA binding in cis. Phosphorylation of the Ids by cyclin-Cdk complexes results in reduction in protein-protein interactions between the Ids and TCFs and relief of their DNA-binding inhibitory activity. In revealing distinct mechanisms through which HLH motifs modulate the activity of TCFs, our results therefore provide further insight into the role of HLH motifs in regulating TCF function and how the inhibitory properties of the trans-acting Id HLH proteins are themselves regulated by phosphorylation.

  12. Eukaryotic DNA Ligases: Structural and Functional Insights

    PubMed Central

    Ellenberger, Tom; Tomkinson, Alan E.

    2010-01-01

    DNA ligases are required for DNA replication, repair, and recombination. In eukaryotes, there are three families of ATP-dependent DNA ligases. Members of the DNA ligase I and IV families are found in all eukaryotes, whereas DNA ligase III family members are restricted to vertebrates. These enzymes share a common catalytic region comprising a DNA-binding domain, a nucleotidyltransferase (NTase) domain, and an oligonucleotide/oligosaccharide binding (OB)-fold domain. The catalytic region encircles nicked DNA with each of the domains contacting the DNA duplex. The unique segments adjacent to the catalytic region of eukaryotic DNA ligases are involved in specific protein-protein interactions with a growing number of DNA replication and repair proteins. These interactions determine the specific cellular functions of the DNA ligase isozymes. In mammals, defects in DNA ligation have been linked with an increased incidence of cancer and neurodegeneration. PMID:18518823

  13. Interaction of Zn(II)bleomycin-A2 and Zn(II)peplomycin with a DNA hairpin containing the 5'-GT-3' binding site in comparison with the 5'-GC-3' binding site studied by NMR spectroscopy.

    PubMed

    Follett, Shelby E; Ingersoll, Azure D; Murray, Sally A; Reilly, Teresa M; Lehmann, Teresa E

    2017-10-01

    Bleomycins are a group of glycopeptide antibiotics synthesized by Streptomyces verticillus that are widely used for the treatment of various neoplastic diseases. These antibiotics have the ability to chelate a metal center, mainly Fe(II), and cause site-specific DNA cleavage. Bleomycins are differentiated by their C-terminal regions. Although this antibiotic family is a successful course of treatment for some types of cancers, it is known to cause pulmonary fibrosis. Previous studies have identified that bleomycin-related pulmonary toxicity is linked to the C-terminal region of these drugs. This region has been shown to closely interact with DNA. We examined the binding of Zn(II)peplomycin and Zn(II)bleomycin-A 2 to a DNA hairpin of sequence 5'-CCAGTATTTTTACTGG-3', containing the binding site 5'-GT-3', and compared the results with those obtained from our studies of the same MBLMs bound to a DNA hairpin containing the binding site 5'-GC-3'. We provide evidence that the DNA base sequence has a strong impact in the final structure of the drug-target complex.

  14. Extended HSR/CARD domain mediates AIRE binding to DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maslovskaja, Julia, E-mail: julia.maslovskaja@ut.ee; Saare, Mario; Liiv, Ingrid

    Autoimmune regulator (AIRE) activates the transcription of many genes in an unusual promiscuous and stochastic manner. The mechanism by which AIRE binds to the chromatin and DNA is not fully understood, and the regulatory elements that AIRE target genes possess are not delineated. In the current study, we demonstrate that AIRE activates the expression of transiently transfected luciferase reporters that lack defined promoter regions, as well as intron and poly(A) signal sequences. Our protein-DNA interaction experiments with mutated AIRE reveal that the intact homogeneously staining region/caspase recruitment domain (HSR/CARD) and amino acids R113 and K114 are key elements involved inmore » AIRE binding to DNA. - Highlights: • Promoter and mRNA processing elements are not important for AIRE to activate gene expression from reporter plasmids. • AIRE protein fragment aa 1–138 mediates direct binding to DNA. • Integrity of the HSR/CARD domain is needed for AIRE binding to DNA.« less

  15. The intervening domain from MeCP2 enhances the DNA affinity of the methyl binding domain and provides an independent DNA interaction site.

    PubMed

    Claveria-Gimeno, Rafael; Lanuza, Pilar M; Morales-Chueca, Ignacio; Jorge-Torres, Olga C; Vega, Sonia; Abian, Olga; Esteller, Manel; Velazquez-Campoy, Adrian

    2017-01-31

    Methyl-CpG binding protein 2 (MeCP2) preferentially interacts with methylated DNA and it is involved in epigenetic regulation and chromatin remodelling. Mutations in MeCP2 are linked to Rett syndrome, the leading cause of intellectual retardation in girls and causing mental, motor and growth impairment. Unstructured regions in MeCP2 provide the plasticity for establishing interactions with multiple binding partners. We present a biophysical characterization of the methyl binding domain (MBD) from MeCP2 reporting the contribution of flanking domains to its structural stability and dsDNA interaction. The flanking disordered intervening domain (ID) increased the structural stability of MBD, modified its dsDNA binding profile from an entropically-driven moderate-affinity binding to an overwhelmingly enthalpically-driven high-affinity binding. Additionally, ID provided an additional site for simultaneously and autonomously binding an independent dsDNA molecule, which is a key feature linked to the chromatin remodelling and looping activity of MeCP2, as well as its ability to interact with nucleosomes replacing histone H1. The dsDNA interaction is characterized by an unusually large heat capacity linked to a cluster of water molecules trapped within the binding interface. The dynamics of disordered regions together with extrinsic factors are key determinants of MeCP2 global structural properties and functional capabilities.

  16. The intervening domain from MeCP2 enhances the DNA affinity of the methyl binding domain and provides an independent DNA interaction site

    PubMed Central

    Claveria-Gimeno, Rafael; Lanuza, Pilar M.; Morales-Chueca, Ignacio; Jorge-Torres, Olga C.; Vega, Sonia; Abian, Olga; Esteller, Manel; Velazquez-Campoy, Adrian

    2017-01-01

    Methyl-CpG binding protein 2 (MeCP2) preferentially interacts with methylated DNA and it is involved in epigenetic regulation and chromatin remodelling. Mutations in MeCP2 are linked to Rett syndrome, the leading cause of intellectual retardation in girls and causing mental, motor and growth impairment. Unstructured regions in MeCP2 provide the plasticity for establishing interactions with multiple binding partners. We present a biophysical characterization of the methyl binding domain (MBD) from MeCP2 reporting the contribution of flanking domains to its structural stability and dsDNA interaction. The flanking disordered intervening domain (ID) increased the structural stability of MBD, modified its dsDNA binding profile from an entropically-driven moderate-affinity binding to an overwhelmingly enthalpically-driven high-affinity binding. Additionally, ID provided an additional site for simultaneously and autonomously binding an independent dsDNA molecule, which is a key feature linked to the chromatin remodelling and looping activity of MeCP2, as well as its ability to interact with nucleosomes replacing histone H1. The dsDNA interaction is characterized by an unusually large heat capacity linked to a cluster of water molecules trapped within the binding interface. The dynamics of disordered regions together with extrinsic factors are key determinants of MeCP2 global structural properties and functional capabilities. PMID:28139759

  17. Dynamic binding of replication protein a is required for DNA repair

    PubMed Central

    Chen, Ran; Subramanyam, Shyamal; Elcock, Adrian H.; Spies, Maria; Wold, Marc S.

    2016-01-01

    Replication protein A (RPA), the major eukaryotic single-stranded DNA (ssDNA) binding protein, is essential for replication, repair and recombination. High-affinity ssDNA-binding by RPA depends on two DNA binding domains in the large subunit of RPA. Mutation of the evolutionarily conserved aromatic residues in these two domains results in a separation-of-function phenotype: aromatic residue mutants support DNA replication but are defective in DNA repair. We used biochemical and single-molecule analyses, and Brownian Dynamics simulations to determine the molecular basis of this phenotype. Our studies demonstrated that RPA binds to ssDNA in at least two modes characterized by different dissociation kinetics. We also showed that the aromatic residues contribute to the formation of the longer-lived state, are required for stable binding to short ssDNA regions and are needed for RPA melting of partially duplex DNA structures. We conclude that stable binding and/or the melting of secondary DNA structures by RPA is required for DNA repair, including RAD51 mediated DNA strand exchange, but is dispensable for DNA replication. It is likely that the binding modes are in equilibrium and reflect dynamics in the RPA–DNA complex. This suggests that dynamic binding of RPA to DNA is necessary for different cellular functions. PMID:27131385

  18. A single amino-acid substitution in the Ets domain alters core DNA binding specificity of Ets1 to that of the related transcription factors Elf1 and E74.

    PubMed

    Bosselut, R; Levin, J; Adjadj, E; Ghysdael, J

    1993-11-11

    Ets proteins form a family of sequence specific DNA binding proteins which bind DNA through a 85 aminoacids conserved domain, the Ets domain, whose sequence is unrelated to any other characterized DNA binding domain. Unlike all other known Ets proteins, which bind specific DNA sequences centered over either GGAA or GGAT core motifs, E74 and Elf1 selectively bind to GGAA corecontaining sites. Elf1 and E74 differ from other Ets proteins in three residues located in an otherwise highly conserved region of the Ets domain, referred to as conserved region III (CRIII). We show that a restricted selectivity for GGAA core-containing sites could be conferred to Ets1 upon changing a single lysine residue within CRIII to the threonine found in Elf1 and E74 at this position. Conversely, the reciprocal mutation in Elf1 confers to this protein the ability to bind to GGAT core containing EBS. This, together with the fact that mutation of two invariant arginine residues in CRIII abolishes DNA binding, indicates that CRIII plays a key role in Ets domain recognition of the GGAA/T core motif and lead us to discuss a model of Ets proteins--core motif interaction.

  19. Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites

    PubMed Central

    Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot

    2013-01-01

    Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958

  20. Identification of DNA-Binding Proteins Using Structural, Electrostatic and Evolutionary Features

    PubMed Central

    Nimrod, Guy; Szilágyi, András; Leslie, Christina; Ben-Tal, Nir

    2009-01-01

    Summary DNA binding proteins (DBPs) often take part in various crucial processes of the cell's life cycle. Therefore, the identification and characterization of these proteins are of great importance. We present here a random forests classifier for identifying DBPs among proteins with known three-dimensional structures. First, clusters of evolutionarily conserved regions (patches) on the protein's surface are detected using the PatchFinder algorithm; previous studies showed that these regions are typically the proteins' functionally important regions. Next, we train a classifier using features like the electrostatic potential, cluster-based amino acid conservation patterns and the secondary structure content of the patches, as well as features of the whole protein including its dipole moment. Using 10-fold cross validation on a dataset of 138 DNA-binding proteins and 110 proteins which do not bind DNA, the classifier achieved a sensitivity and a specificity of 0.90, which is overall better than the performance of previously published methods. Furthermore, when we tested 5 different methods on 11 new DBPs which did not appear in the original dataset, only our method annotated all correctly. The resulting classifier was applied to a collection of 757 proteins of known structure and unknown function. Of these proteins, 218 were predicted to bind DNA, and we anticipate that some of them interact with DNA using new structural motifs. The use of complementary computational tools supports the notion that at least some of them do bind DNA. PMID:19233205

  1. Solution structure of CEH-37 homeodomain of the nematode Caenorhabditis elegans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Moon, Sunjin; Lee, Yong Woo; Kim, Woo Taek

    Highlights: •We have determined solution structures of CEH-37 homedomain. •CEH-37 HD has a compact α-helical structure with HTH DNA binding motif. •Solution structure of CEH-37 HD shares its molecular topology with that of the homeodomain proteins. •Residues in the N-terminal region and HTH motif are important in binding to Caenorhabditis elegans telomeric DNA. •CEH-37 could play an important role in telomere function via DNA binding. -- Abstract: The nematode Caenorhabditis elegans protein CEH-37 belongs to the paired OTD/OTX family of homeobox-containing homeodomain proteins. CEH-37 shares sequence similarity with homeodomain proteins, although it specifically binds to double-stranded C. elegans telomeric DNA,more » which is unusual to homeodomain proteins. Here, we report the solution structure of CEH-37 homeodomain and molecular interaction with double-stranded C. elegans telomeric DNA using nuclear magnetic resonance (NMR) spectroscopy. NMR structure shows that CEH-37 homeodomain is composed of a flexible N-terminal region and three α-helices with a helix-turn-helix (HTH) DNA binding motif. Data from size-exclusion chromatography and fluorescence spectroscopy reveal that CEH-37 homeodomain interacts strongly with double-stranded C. elegans telomeric DNA. NMR titration experiments identified residues responsible for specific binding to nematode double-stranded telomeric DNA. These results suggest that C. elegans homeodomain protein, CEH-37 could play an important role in telomere function via DNA binding.« less

  2. Identification of the DNA-Binding Domains of Human Replication Protein A That Recognize G-Quadruplex DNA

    PubMed Central

    Prakash, Aishwarya; Natarajan, Amarnath; Marky, Luis A.; Ouellette, Michel M.; Borgstahl, Gloria E. O.

    2011-01-01

    Replication protein A (RPA), a key player in DNA metabolism, has 6 single-stranded DNA-(ssDNA-) binding domains (DBDs) A-F. SELEX experiments with the DBDs-C, -D, and -E retrieve a 20-nt G-quadruplex forming sequence. Binding studies show that RPA-DE binds preferentially to the G-quadruplex DNA, a unique preference not observed with other RPA constructs. Circular dichroism experiments show that RPA-CDE-core can unfold the G-quadruplex while RPA-DE stabilizes it. Binding studies show that RPA-C binds pyrimidine- and purine-rich sequences similarly. This difference between RPA-C and RPA-DE binding was also indicated by the inability of RPA-CDE-core to unfold an oligonucleotide containing a TC-region 5′ to the G-quadruplex. Molecular modeling studies of RPA-DE and telomere-binding proteins Pot1 and Stn1 reveal structural similarities between the proteins and illuminate potential DNA-binding sites for RPA-DE and Stn1. These data indicate that DBDs of RPA have different ssDNA recognition properties. PMID:21772997

  3. Specialized nucleoprotein structures at the origin of replication of bacteriophage lambda: localized unwinding of duplex DNA by a six-protein reaction.

    PubMed Central

    Dodson, M; Echols, H; Wickner, S; Alfano, C; Mensa-Wilmot, K; Gomes, B; LeBowitz, J; Roberts, J D; McMacken, R

    1986-01-01

    The O protein of bacteriophage lambda localizes the initiation of DNA replication to a unique site on the lambda genome, ori lambda. By means of electron microscopy, we infer that the binding of O to ori lambda initiates a series of protein addition and transfer reactions that culminate in localized unwinding of the origin DNA, generating a prepriming structure for the initiation of DNA replication. We can define three stages of this prepriming reaction, the first two of which we have characterized previously. First, dimeric O protein binds to multiple DNA binding sites and self-associates to form a nucleoprotein structure, the O-some. Second, lambda P and host DnaB proteins interact with the O-some to generate a larger complex that includes additional DNA from an A + T-rich region adjacent to the O binding sites. Third, the addition of the DnaJ, DnaK, and Ssb proteins and ATP results in an origin-specific unwinding reaction, probably catalyzed by the helicase activity of DnaB. The unwinding reaction is unidirectional, proceeding "rightward" from the origin. The minimal DNA sequence competent for unwinding consists of two O binding sites and the adjacent A + T-rich region to the right of the binding sites. We conclude that the lambda O protein localizes and initiates a six-protein sequential reaction responsible for but preceding the precise initiation of DNA replication. Specialized nucleoprotein structures similar to the O-some may be a general feature of DNA transactions requiring extraordinary precision in localization and control. Images PMID:3020552

  4. Deciphering the mechanism of interaction of edifenphos with calf thymus DNA

    NASA Astrophysics Data System (ADS)

    Ahmad, Ajaz; Ahmad, Masood

    2018-01-01

    Edifenphos is an important organophosphate pesticide with many antifungal and anti-insecticidal properties but it may cause potential hazards to human health. In this work, we have tried to explore the binding mode of action and mechanism of edifenphos to calf thymus DNA (CT-DNA). Several experiments such as ultraviolet-visible absorption spectra and emission spectroscopy showed complex formation between edifenphos and CT-DNA and low binding constant values supporting groove binding mode. These results were further confirmed by circular dichroism (CD), CT-DNA melting studies, viscosity measurements, density functional theory and molecular docking. CD study suggests that edifenphos does not alter native structure of CT-DNA. Isothermal calorimetry reveals that binding of edifenphos with CT-DNA is enthalpy driven process. Competitive binding assay and effect of ionic strength showed that edifenphos binds to CT-DNA via groove binding manner. Hence, edifenphos is a minor groove binder preferably interacting with A-T regions with docking score - 6.84 kJ/mol.

  5. The bZIP dimer localizes at DNA full-sites where each basic region can alternately translocate and bind to subsites at the half-site

    PubMed Central

    Chan, I-San; Al-Sarraj, Taufik; Shahravan, S. Hesam; Fedorova, Anna V.; Shin, Jumi A.

    2012-01-01

    Crystal structures of the GCN4 bZIP (basic region/leucine zipper) with the AP-1 or CRE site show how each GCN4 basic region binds to a 4-bp cognate half-site as a single DNA target; however, this may not always fully describe how bZIP proteins interact with their target sites. Previously, we showed that the GCN4 basic region interacts with all 5 bp in half-site TTGCG (termed 5H-LR), and that 5H-LR comprises two 4-bp subsites, TTGC and TGCG, which individually are also target sites of the basic region. In this work, we explored how the basic region interacts with 5H-LR when the bZIP dimer localizes to full-sites. Using AMBER molecular modeling, we simulated GCN4 bZIP complexes with full-sites containing 5H-LR to investigate in silico the interface between the basic region and 5H-LR. We also performed in vitro investigation of bZIP–DNA interactions at a number of full-sites that contain 5H-LR vs. either subsite: we analyzed results from DNase I footprinting and electrophoretic mobility shift assay (EMSA) and from EMSA titrations to quantify binding affinities. Our computational and experimental results together support a highly dynamic DNA-binding model: when a bZIP dimer localizes to its target full-site, the basic region can alternately recognize either subsite as a distinct target at 5H-LR and translocate between the subsites, potentially by sliding and hopping. This model provides added insights into how α-helical DNA-binding domains of transcription factors can localize to their gene regulatory sequences in vivo. PMID:22856882

  6. The bZIP dimer localizes at DNA full-sites where each basic region can alternately translocate and bind to subsites at the half-site.

    PubMed

    Chan, I-San; Al-Sarraj, Taufik; Shahravan, S Hesam; Fedorova, Anna V; Shin, Jumi A

    2012-08-21

    Crystal structures of the GCN4 bZIP (basic region/leucine zipper) with the AP-1 or CRE site show how each GCN4 basic region binds to a 4 bp cognate half-site as a single DNA target; however, this may not always fully describe how bZIP proteins interact with their target sites. Previously, we showed that the GCN4 basic region interacts with all 5 bp in half-site TTGCG (termed 5H-LR) and that 5H-LR comprises two 4 bp subsites, TTGC and TGCG, which individually are also target sites of the basic region. In this work, we explore how the basic region interacts with 5H-LR when the bZIP dimer localizes to full-sites. Using AMBER molecular modeling, we simulated GCN4 bZIP complexes with full-sites containing 5H-LR to investigate in silico the interface between the basic region and 5H-LR. We also performed in vitro investigation of bZIP-DNA interactions at a number of full-sites that contain 5H-LR versus either subsite: we analyzed results from DNase I footprinting and electrophoretic mobility shift assay (EMSA) and from EMSA titrations to quantify binding affinities. Our computational and experimental results together support a highly dynamic DNA-binding model: when a bZIP dimer localizes to its target full-site, the basic region can alternately recognize either subsite as a distinct target at 5H-LR and translocate between the subsites, potentially by sliding and hopping. This model provides added insights into how α-helical DNA-binding domains of transcription factors can localize to their gene regulatory sequences in vivo.

  7. Sa-Lrp from Sulfolobus acidocaldarius is a versatile, glutamine-responsive, and architectural transcriptional regulator

    PubMed Central

    Vassart, Amelia; Wolferen, Marleen; Orell, Alvaro; Hong, Ye; Peeters, Eveline; Albers, Sonja-Verena; Charlier, Daniel

    2013-01-01

    Sa-Lrp is a member of the leucine-responsive regulatory protein (Lrp)-like family of transcriptional regulators in Sulfolobus acidocaldarius. Previously, we demonstrated the binding of Sa-Lrp to the control region of its own gene in vitro. However, the function and cofactor of Sa-Lrp remained an enigma. In this work, we demonstrate that glutamine is the cofactor of Sa-Lrp by inducing the formation of octamers and increasing the DNA-binding affinity and sequence specificity. In vitro protein-DNA interaction assays indicate that Sa-Lrp binds to promoter regions of genes with a variety of functions including ammonia assimilation, transcriptional control, and UV-induced pili synthesis. DNA binding occurs with a specific affinity for AT-rich binding sites, and the protein induces DNA bending and wrapping upon binding, indicating an architectural role of the regulator. Furthermore, by analyzing an Sa-lrp deletion mutant, we demonstrate that the protein affects transcription of some of the genes of which the promoter region is targeted and that it is an important determinant of the cellular aggregation phenotype. Taking all these results into account, we conclude that Sa-Lrp is a glutamine-responsive global transcriptional regulator with an additional architectural role. PMID:23255531

  8. Single-stranded DNA Binding by the Helix-Hairpin-Helix Domain of XPF Protein Contributes to the Substrate Specificity of the ERCC1-XPF Protein Complex*

    PubMed Central

    Das, Devashish; Faridounnia, Maryam; Kovacic, Lidija; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.

    2017-01-01

    The nucleotide excision repair protein complex ERCC1-XPF is required for incision of DNA upstream of DNA damage. Functional studies have provided insights into the binding of ERCC1-XPF to various DNA substrates. However, because no structure for the ERCC1-XPF-DNA complex has been determined, the mechanism of substrate recognition remains elusive. Here we biochemically characterize the substrate preferences of the helix-hairpin-helix (HhH) domains of XPF and ERCC-XPF and show that the binding to single-stranded DNA (ssDNA)/dsDNA junctions is dependent on joint binding to the DNA binding domain of ERCC1 and XPF. We reveal that the homodimeric XPF is able to bind various ssDNA sequences but with a clear preference for guanine-containing substrates. NMR titration experiments and in vitro DNA binding assays also show that, within the heterodimeric ERCC1-XPF complex, XPF specifically recognizes ssDNA. On the other hand, the HhH domain of ERCC1 preferentially binds dsDNA through the hairpin region. The two separate non-overlapping DNA binding domains in the ERCC1-XPF heterodimer jointly bind to an ssDNA/dsDNA substrate and, thereby, at least partially dictate the incision position during damage removal. Based on structural models, NMR titrations, DNA-binding studies, site-directed mutagenesis, charge distribution, and sequence conservation, we propose that the HhH domain of ERCC1 binds to dsDNA upstream of the damage, and XPF binds to the non-damaged strand within a repair bubble. PMID:28028171

  9. Solution structure and DNA-binding properties of the C-terminal domain of UvrC from E.coli

    PubMed Central

    Singh, S.; Folkers, G.E.; Bonvin, A.M.J.J.; Boelens, R.; Wechselberger, R.; Niztayev, A.; Kaptein, R.

    2002-01-01

    The C-terminal domain of the UvrC protein (UvrC CTD) is essential for 5′ incision in the prokaryotic nucleotide excision repair process. We have determined the three-dimensional structure of the UvrC CTD using heteronuclear NMR techniques. The structure shows two helix–hairpin–helix (HhH) motifs connected by a small connector helix. The UvrC CTD is shown to mediate structure-specific DNA binding. The domain binds to a single-stranded–double-stranded junction DNA, with a strong specificity towards looped duplex DNA that contains at least six unpaired bases per loop (‘bubble DNA’). Using chemical shift perturbation experiments, the DNA-binding surface is mapped to the first hairpin region encompassing the conserved glycine–valine–glycine residues followed by lysine–arginine–arginine, a positively charged surface patch and the second hairpin region consisting of glycine–isoleucine–serine. A model for the protein– DNA complex is proposed that accounts for this specificity. PMID:12426397

  10. Function and horizontal transfer of the small terminase subunit of the tailed bacteriophage Sf6 DNA packaging nanomotor

    PubMed Central

    Leavitt, Justin C.; Gilcrease, Eddie B.; Wilson, Kassandra; Casjens, Sherwood R.

    2013-01-01

    Bacteriophage Sf6 DNA packaging series initiate at many locations across a 2 kbp region. Our in vivo studies that show that Sf6 small terminase subunit (TerS) protein recognizes a specific packaging (pac) site near the center of this region, that this site lies within the portion of the Sf6 gene that encodes the DNA-binding domain of TerS protein, that this domain of the TerS protein is responsible for the imprecision in Sf6 packaging initiation, and that the DNA-binding domain of TerS must be covalently attached to the domain that interacts with the rest of the packaging motor. The TerS DNA-binding domain is self-contained in that it apparently does not interact closely with the rest of the motor and it binds to a recognition site that lies within the DNA that encodes the domain. This arrangement has allowed the horizontal exchange of terS genes among phages to be very successful. PMID:23562538

  11. Mechanism of the formation of the RecA-ssDNA nucleoprotein filament structure: a coarse-grained approach.

    PubMed

    Mukherjee, Goutam; Pal, Arumay; Levy, Yaakov

    2017-11-21

    In prokaryotes, the RecA protein catalyzes the repair and strand exchange of double-stranded DNA. RecA binds to single-stranded DNA (ssDNA) and forms a presynaptic complex in which the protein polymerizes around the ssDNA to form a right-handed helical nucleoprotein filament structure. In the present work, the mechanism for the formation of the RecA-ssDNA filament structure is modeled using coarse-grained molecular dynamics simulations. Information from the X-ray structure was used to model the protein itself but not its interactions; the interactions between the protein and the ssDNA were modeled solely by electrostatic, aromatic, and repulsive energies. For the present study, the monomeric, dimeric, and trimeric units of RecA and 4, 8, and 11 NT-long ssDNA, respectively, were studied. Our results indicate that monomeric RecA is not sufficient for nucleoprotein filament formation; rather, dimeric RecA is the elementary binding unit, with higher multimeric units of RecA facilitating filament formation. Our results reveal that loop region flexibility at the primary binding site of RecA is essential for it to bind the incoming ssDNA, that the aromatic residues present in the loop region play an important role in ssDNA binding, and that ATP may play a role in guiding the ssDNA by changing the electrostatic potential of the RecA protein.

  12. DNA-binding protects p53 from interactions with cofactors involved in transcription-independent functions

    PubMed Central

    Lambrughi, Matteo; De Gioia, Luca; Gervasio, Francesco Luigi; Lindorff-Larsen, Kresten; Nussinov, Ruth; Urani, Chiara; Bruschi, Maurizio; Papaleo, Elena

    2016-01-01

    Binding-induced conformational changes of a protein at regions distant from the binding site may play crucial roles in protein function and regulation. The p53 tumour suppressor is an example of such an allosterically regulated protein. Little is known, however, about how DNA binding can affect distal sites for transcription factors. Furthermore, the molecular details of how a local perturbation is transmitted through a protein structure are generally elusive and occur on timescales hard to explore by simulations. Thus, we employed state-of-the-art enhanced sampling atomistic simulations to unveil DNA-induced effects on p53 structure and dynamics that modulate the recruitment of cofactors and the impact of phosphorylation at Ser215. We show that DNA interaction promotes a conformational change in a region 3 nm away from the DNA binding site. Specifically, binding to DNA increases the population of an occluded minor state at this distal site by more than 4-fold, whereas phosphorylation traps the protein in its major state. In the minor conformation, the interface of p53 that binds biological partners related to p53 transcription-independent functions is not accessible. Significantly, our study reveals a mechanism of DNA-mediated protection of p53 from interactions with partners involved in the p53 transcription-independent signalling. This also suggests that conformational dynamics is tightly related to p53 signalling. PMID:27604871

  13. Structure-Based Mutational Analysis of the C-Terminal DNA-Binding Domain of Human Immunodeficiency Virus Type 1 Integrase: Critical Residues for Protein Oligomerization and DNA Binding

    PubMed Central

    Lutzke, Ramon A. Puras; Plasterk, Ronald H. A.

    1998-01-01

    The C-terminal domain of human immunodeficiency virus type 1 (HIV-1) integrase (IN) is a dimer that binds to DNA in a nonspecific manner. The structure of the minimal region required for DNA binding (IN220–270) has been solved by nuclear magnetic resonance spectroscopy. The overall fold of the C-terminal domain of HIV-1 IN is similar to those of Src homology region 3 domains. Based on the structure of IN220–270, we studied the role of 15 amino acid residues potentially involved in DNA binding and oligomerization by mutational analysis. We found that two amino acid residues, arginine 262 and leucine 234, contribute to DNA binding in the context of IN220–270, as indicated by protein-DNA UV cross-link analysis. We also analyzed mutant proteins representing portions of the full-length IN protein. Amino acid substitution of residues located in the hydrophobic dimer interface, such as L241A and L242A, results in the loss of oligomerization of IN; consequently, the levels of 3′ processing, DNA strand transfer, and intramolecular disintegration are strongly reduced. These results suggest that dimerization of the C-terminal domain of IN is important for correct multimerization of IN. PMID:9573250

  14. Differences in DNA Binding Specificity of Floral Homeotic Protein Complexes Predict Organ-Specific Target Genes.

    PubMed

    Smaczniak, Cezary; Muiño, Jose M; Chen, Dijun; Angenent, Gerco C; Kaufmann, Kerstin

    2017-08-01

    Floral organ identities in plants are specified by the combinatorial action of homeotic master regulatory transcription factors. However, how these factors achieve their regulatory specificities is still largely unclear. Genome-wide in vivo DNA binding data show that homeotic MADS domain proteins recognize partly distinct genomic regions, suggesting that DNA binding specificity contributes to functional differences of homeotic protein complexes. We used in vitro systematic evolution of ligands by exponential enrichment followed by high-throughput DNA sequencing (SELEX-seq) on several floral MADS domain protein homo- and heterodimers to measure their DNA binding specificities. We show that specification of reproductive organs is associated with distinct binding preferences of a complex formed by SEPALLATA3 and AGAMOUS. Binding specificity is further modulated by different binding site spacing preferences. Combination of SELEX-seq and genome-wide DNA binding data allows differentiation between targets in specification of reproductive versus perianth organs in the flower. We validate the importance of DNA binding specificity for organ-specific gene regulation by modulating promoter activity through targeted mutagenesis. Our study shows that intrafamily protein interactions affect DNA binding specificity of floral MADS domain proteins. Differential DNA binding of MADS domain protein complexes plays a role in the specificity of target gene regulation. © 2017 American Society of Plant Biologists. All rights reserved.

  15. The NMR solution structure of a mutant of the Max b/HLH/LZ free of DNA: insights into the specific and reversible DNA binding mechanism of dimeric transcription factors.

    PubMed

    Sauvé, Simon; Tremblay, Luc; Lavigne, Pierre

    2004-09-17

    Basic region-helix1-loop-helix2-leucine zipper (b/H(1)LH(2)/LZ) transcription factors bind specific DNA sequence in their target gene promoters as dimers. Max, a b/H(1)LH(2)/LZ transcription factor, is the obligate heterodimeric partner of the related b/H(1)LH(2)/LZ proteins of the Myc and Mad families. These heterodimers specifically bind E-box DNA sequence (CACGTG) to activate (e.g. c-Myc/Max) and repress (e.g. Mad1/Max) transcription. Max can also homodimerize and bind E-box sequences in c-Myc target gene promoters. While the X-ray structure of the Max b/H(1)LH(2)/LZ/DNA complex and that of others have been reported, the precise sequence of events leading to the reversible and specific binding of these important transcription factors is still largely unknown. In order to provide insights into the DNA binding mechanism, we have solved the NMR solution structure of a covalently homodimerized version of a Max b/H(1)LH(2)/LZ protein with two stabilizing mutations in the LZ, and characterized its backbone dynamics from (15)N spin-relaxation measurements in the absence of DNA. Apart from minor differences in the pitch of the LZ, possibly resulting from the mutations in the construct, we observe that the packing of the helices in the H(1)LH(2) domain is almost identical to that of the two crystal structures, indicating that no important conformational change in these helices occurs upon DNA binding. Conversely to the crystal structures of the DNA complexes, the first 14 residues of the basic region are found to be mostly unfolded while the loop is observed to be flexible. This indicates that these domains undergo conformational changes upon DNA binding. On the other hand, we find the last four residues of the basic region form a persistent helical turn contiguous to H(1). In addition, we provide evidence of the existence of internal motions in the backbone of H(1) that are of larger amplitude and longer time-scale (nanoseconds) than the ones in the H(2) and LZ domain. Most interestingly, we note that conformers in the ensemble of calculated structures have highly conserved basic residues (located in the persistent helical turn of the basic region and in the loop) known to be important for specific binding in a conformation that matches that of the DNA-bound state. These partially prefolded conformers can directly fit into the major groove of DNA and as such are proposed to lie on the pathway leading to the reversible and specific DNA binding. In these conformers, the conserved basic side-chains form a cluster that elevates the local electrostatic potential and could provide the necessary driving force for the generation of the internal motions localized in the H(1) and therefore link structural determinants with the DNA binding function. Overall, our results suggests that the Max homodimeric b/H(1)LH(2)/LZ can rapidly and preferentially bind DNA sequence through transient and partially prefolded states and subsequently, adopt the fully helical bound state in a DNA-assisted mechanism or induced-fit.

  16. 5-Hydroxymethylcytosine in E-box motifs ACAT|GTG and ACAC|GTG increases DNA-binding of the B-HLH transcription factor TCF4.

    PubMed

    Khund-Sayeed, Syed; He, Ximiao; Holzberg, Timothy; Wang, Jun; Rajagopal, Divya; Upadhyay, Shriyash; Durell, Stewart R; Mukherjee, Sanjit; Weirauch, Matthew T; Rose, Robert; Vinson, Charles

    2016-09-12

    We evaluated DNA binding of the B-HLH family members TCF4 and USF1 using protein binding microarrays (PBMs) containing double-stranded DNA probes with cytosine on both strands or 5-methylcytosine (5mC) or 5-hydroxymethylcytosine (5hmC) on one DNA strand and cytosine on the second strand. TCF4 preferentially bound the E-box motif (CAN|NTG) with strongest binding to the 8-mer CAG|GTGGT. 5mC uniformly decreases DNA binding of both TCF4 and USF1. The bulkier 5hmC also inhibited USF1 binding to DNA. In contrast, 5hmC dramatically enhanced TCF4 binding to E-box motifs ACAT|GTG and ACAC|GTG, being better bound than any 8-mer containing cytosine. Examination of X-ray structures of the closely related TCF3 and USF1 bound to DNA suggests TCF3 can undergo a conformational shift to preferentially bind to 5hmC while the USF1 basic region is bulkier and rigid precluding a conformation shift to bind 5hmC. These results greatly expand the regulatory DNA sequence landscape bound by TCF4.

  17. Functional specificity of a Hox protein mediated by the recognition of minor groove structure.

    PubMed

    Joshi, Rohit; Passner, Jonathan M; Rohs, Remo; Jain, Rinku; Sosinsky, Alona; Crickmore, Michael A; Jacob, Vinitha; Aggarwal, Aneel K; Honig, Barry; Mann, Richard S

    2007-11-02

    The recognition of specific DNA-binding sites by transcription factors is a critical yet poorly understood step in the control of gene expression. Members of the Hox family of transcription factors bind DNA by making nearly identical major groove contacts via the recognition helices of their homeodomains. In vivo specificity, however, often depends on extended and unstructured regions that link Hox homeodomains to a DNA-bound cofactor, Extradenticle (Exd). Using a combination of structure determination, computational analysis, and in vitro and in vivo assays, we show that Hox proteins recognize specific Hox-Exd binding sites via residues located in these extended regions that insert into the minor groove but only when presented with the correct DNA sequence. Our results suggest that these residues, which are conserved in a paralog-specific manner, confer specificity by recognizing a sequence-dependent DNA structure instead of directly reading a specific DNA sequence.

  18. Structural basis for DNA binding by replication initiator Mcm10

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Warren, Eric M.; Vaithiyalingam, Sivaraja; Haworth, Justin

    2009-06-30

    Mcm10 is an essential eukaryotic DNA replication protein required for assembly and progression of the replication fork. The highly conserved internal domain (Mcm10-ID) has been shown to physically interact with single-stranded (ss) DNA, DNA polymerase alpha, and proliferating cell nuclear antigen (PCNA). The crystal structure of Xenopus laevis Mcm10-ID presented here reveals a DNA binding architecture composed of an oligonucleotide/oligosaccharide-fold followed in tandem by a variant and highly basic zinc finger. NMR chemical shift perturbation and mutational studies of DNA binding activity in vitro reveal how Mcm10 uses this unique surface to engage ssDNA. Corresponding mutations in Saccharomyces cerevisiae resultmore » in increased sensitivity to replication stress, demonstrating the functional importance of DNA binding by this region of Mcm10 to replication. In addition, mapping Mcm10 mutations known to disrupt PCNA, polymerase alpha, and DNA interactions onto the crystal structure provides insight into how Mcm10 might coordinate protein and DNA binding within the replisome.« less

  19. DNA Length Modulates the Affinity of Fragments of Genomic DNA for the Nuclear Matrix In Vitro.

    PubMed

    García-Vilchis, David; Aranda-Anzaldo, Armando

    2017-12-01

    Classical observations have shown that during the interphase the chromosomal DNA of metazoans is organized in supercoiled loops attached to a compartment known as the nuclear matrix (NM). Fragments of chromosomal DNA able to bind the isolated NM in vitro are known as matrix associated/attachment/addressed regions or MARs. No specific consensus sequence or motif has been found that may constitute a universal, defining feature of MARs. On the other hand, high-salt resistant DNA-NM interactions in situ define true DNA loop anchorage regions or LARs, that might correspond to a subset of the potential MARs but are not necessarily identical to MARs characterized in vitro, since there are several examples of MARs able to bind the NM in vitro but which are not actually bound to the NM in situ. In the present work we assayed the capacity of two LARs, as well as of shorter fragments within such LARs, for binding to the NM in vitro. Paradoxically the isolated (≈2 kb) LARs cannot bind to the NM in vitro while their shorter (≈300 pb) sub-fragments and other non-related but equally short DNA fragments, bind to the NM in a high-salt resistant fashion. Our results suggest that the ability of a given DNA fragment for binding to the NM in vitro primarily depends on the length of the fragment, suggesting that binding to the NM is modulated by the local topology of the DNA fragment in suspension that it is known to depend on the DNA length. J. Cell. Biochem. 118: 4487-4497, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  20. ATM Protein Physically and Functionally Interacts with Proliferating Cell Nuclear Antigen to Regulate DNA Synthesis*

    PubMed Central

    Gamper, Armin M.; Choi, Serah; Matsumoto, Yoshihiro; Banerjee, Dibyendu; Tomkinson, Alan E.; Bakkenist, Christopher J.

    2012-01-01

    Ataxia telangiectasia (A-T) is a pleiotropic disease, with a characteristic hypersensitivity to ionizing radiation that is caused by biallelic mutations in A-T mutated (ATM), a gene encoding a protein kinase critical for the induction of cellular responses to DNA damage, particularly to DNA double strand breaks. A long known characteristic of A-T cells is their ability to synthesize DNA even in the presence of ionizing radiation-induced DNA damage, a phenomenon termed radioresistant DNA synthesis. We previously reported that ATM kinase inhibition, but not ATM protein disruption, blocks sister chromatid exchange following DNA damage. We now show that ATM kinase inhibition, but not ATM protein disruption, also inhibits DNA synthesis. Investigating a potential physical interaction of ATM with the DNA replication machinery, we found that ATM co-precipitates with proliferating cell nuclear antigen (PCNA) from cellular extracts. Using bacterially purified ATM truncation mutants and in vitro translated PCNA, we showed that the interaction is direct and mediated by the C terminus of ATM. Indeed, a 20-amino acid region close to the kinase domain is sufficient for strong binding to PCNA. This binding is specific to ATM, because the homologous regions of other PIKK members, including the closely related kinase A-T and Rad3-related (ATR), did not bind PCNA. ATM was found to bind two regions in PCNA. To examine the functional significance of the interaction between ATM and PCNA, we tested the ability of ATM to stimulate DNA synthesis by DNA polymerase δ, which is implicated in both DNA replication and DNA repair processes. ATM was observed to stimulate DNA polymerase activity in a PCNA-dependent manner. PMID:22362778

  1. Developmental roles of 21 Drosophila transcription factors are determined by quantitative differences in binding to an overlapping set of thousands of genomic regions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    MacArthur, Stewart; Li, Xiao-Yong; Li, Jingyi

    2009-05-15

    BACKGROUND: We previously established that six sequence-specific transcription factors that initiate anterior/posterior patterning in Drosophila bind to overlapping sets of thousands of genomic regions in blastoderm embryos. While regions bound at high levels include known and probable functional targets, more poorly bound regions are preferentially associated with housekeeping genes and/or genes not transcribed in the blastoderm, and are frequently found in protein coding sequences or in less conserved non-coding DNA, suggesting that many are likely non-functional. RESULTS: Here we show that an additional 15 transcription factors that regulate other aspects of embryo patterning show a similar quantitative continuum of functionmore » and binding to thousands of genomic regions in vivo. Collectively, the 21 regulators show a surprisingly high overlap in the regions they bind given that they belong to 11 DNA binding domain families, specify distinct developmental fates, and can act via different cis-regulatory modules. We demonstrate, however, that quantitative differences in relative levels of binding to shared targets correlate with the known biological and transcriptional regulatory specificities of these factors. CONCLUSIONS: It is likely that the overlap in binding of biochemically and functionally unrelated transcription factors arises from the high concentrations of these proteins in nuclei, which, coupled with their broad DNA binding specificities, directs them to regions of open chromatin. We suggest that most animal transcription factors will be found to show a similar broad overlapping pattern of binding in vivo, with specificity achieved by modulating the amount, rather than the identity, of bound factor.« less

  2. Specific DNA binding of the two chicken Deformed family homeodomain proteins, Chox-1.4 and Chox-a.

    PubMed Central

    Sasaki, H; Yokoyama, E; Kuroiwa, A

    1990-01-01

    The cDNA clones encoding two chicken Deformed (Dfd) family homeobox containing genes Chox-1.4 and Chox-a were isolated. Comparison of their amino acid sequences with another chicken Dfd family homeodomain protein and with those of mouse homologues revealed that strong homologies are located in the amino terminal regions and around the homeodomains. Although homologies in other regions were relatively low, some short conserved sequences were also identified. E. coli-made full length proteins were purified and used for the production of specific antibodies and for DNA binding studies. The binding profiles of these proteins to the 5'-leader and 5'-upstream sequences of Chox-1.4 and Chox-a coding regions were analyzed by immunoprecipitation and DNase I footprint assays. These two Chox proteins bound to the same sites in the 5'-flanking sequences of their coding regions with various affinities and their binding affinities to each site were nearly the same. The consensus sequences of the high and low affinity binding sites were TAATGA(C/G) and CTAATTTT, respectively. A clustered binding site was identified in the 5'-upstream of the Chox-a gene, suggesting that this clustered binding site works as a cis-regulatory element for auto- and/or cross-regulation of Chox-a gene expression. Images PMID:1970866

  3. DNA-binding protects p53 from interactions with cofactors involved in transcription-independent functions.

    PubMed

    Lambrughi, Matteo; De Gioia, Luca; Gervasio, Francesco Luigi; Lindorff-Larsen, Kresten; Nussinov, Ruth; Urani, Chiara; Bruschi, Maurizio; Papaleo, Elena

    2016-11-02

    Binding-induced conformational changes of a protein at regions distant from the binding site may play crucial roles in protein function and regulation. The p53 tumour suppressor is an example of such an allosterically regulated protein. Little is known, however, about how DNA binding can affect distal sites for transcription factors. Furthermore, the molecular details of how a local perturbation is transmitted through a protein structure are generally elusive and occur on timescales hard to explore by simulations. Thus, we employed state-of-the-art enhanced sampling atomistic simulations to unveil DNA-induced effects on p53 structure and dynamics that modulate the recruitment of cofactors and the impact of phosphorylation at Ser215. We show that DNA interaction promotes a conformational change in a region 3 nm away from the DNA binding site. Specifically, binding to DNA increases the population of an occluded minor state at this distal site by more than 4-fold, whereas phosphorylation traps the protein in its major state. In the minor conformation, the interface of p53 that binds biological partners related to p53 transcription-independent functions is not accessible. Significantly, our study reveals a mechanism of DNA-mediated protection of p53 from interactions with partners involved in the p53 transcription-independent signalling. This also suggests that conformational dynamics is tightly related to p53 signalling. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Binding of high mobility group A proteins to the mammalian genome occurs as a function of AT-content

    PubMed Central

    Schübeler, Dirk

    2017-01-01

    Genomic location can inform on potential function and recruitment signals for chromatin-associated proteins. High mobility group (Hmg) proteins are of similar size as histones with Hmga1 and Hmga2 being particularly abundant in replicating normal tissues and in cancerous cells. While several roles for Hmga proteins have been proposed we lack a comprehensive description of their genomic location as a function of chromatin, DNA sequence and functional domains. Here we report such a characterization in mouse embryonic stem cells in which we introduce biotin-tagged constructs of wild-type and DNA-binding domain mutants. Comparative analysis of the genome-wide distribution of Hmga proteins reveals pervasive binding, a feature that critically depends on a functional DNA-binding domain and which is shared by both Hmga proteins. Assessment of the underlying queues instructive for this binding modality identifies AT richness, defined as high frequency of A or T bases, as the major criterion for local binding. Additionally, we show that other chromatin states such as those linked to cis-regulatory regions have little impact on Hmga binding both in stem and differentiated cells. As a consequence, Hmga proteins are preferentially found at AT-rich regions such as constitutively heterochromatic regions but are absent from enhancers and promoters arguing for a limited role in regulating individual genes. In line with this model, we show that genetic deletion of Hmga proteins in stem cells causes limited transcriptional effects and that binding is conserved in neuronal progenitors. Overall our comparative study describing the in vivo binding modality of Hmga1 and Hmga2 identifies the proteins’ preference for AT-rich DNA genome-wide and argues against a suggested function of Hmga at regulatory regions. Instead we discover pervasive binding with enrichment at regions of higher AT content irrespective of local variation in chromatin modifications. PMID:29267285

  5. Phenazine virulence factor binding to extracellular DNA is important for Pseudomonas aeruginosa biofilm formation.

    PubMed

    Das, Theerthankar; Kutty, Samuel K; Tavallaie, Roya; Ibugo, Amaye I; Panchompoo, Janjira; Sehar, Shama; Aldous, Leigh; Yeung, Amanda W S; Thomas, Shane R; Kumar, Naresh; Gooding, J Justin; Manefield, Mike

    2015-02-11

    Bacterial resistance to conventional antibiotics necessitates the identification of novel leads for infection control. Interference with extracellular phenomena, such as quorum sensing, extracellular DNA integrity and redox active metabolite release, represents a new frontier to control human pathogens such as Pseudomonas aeruginosa and hence reduce mortality. Here we reveal that the extracellular redox active virulence factor pyocyanin produced by P. aeruginosa binds directly to the deoxyribose-phosphate backbone of DNA and intercalates with DNA nitrogenous base pair regions. Binding results in local perturbations of the DNA double helix structure and enhanced electron transfer along the nucleic acid polymer. Pyocyanin binding to DNA also increases DNA solution viscosity. In contrast, antioxidants interacting with DNA and pyocyanin decrease DNA solution viscosity. Biofilms deficient in pyocyanin production and biofilms lacking extracellular DNA show similar architecture indicating the interaction is important in P. aeruginosa biofilm formation.

  6. Phenazine virulence factor binding to extracellular DNA is important for Pseudomonas aeruginosa biofilm formation

    PubMed Central

    Das, Theerthankar; Kutty, Samuel K.; Tavallaie, Roya; Ibugo, Amaye I.; Panchompoo, Janjira; Sehar, Shama; Aldous, Leigh; Yeung, Amanda W. S.; Thomas, Shane R.; Kumar, Naresh; Gooding, J. Justin; Manefield, Mike

    2015-01-01

    Bacterial resistance to conventional antibiotics necessitates the identification of novel leads for infection control. Interference with extracellular phenomena, such as quorum sensing, extracellular DNA integrity and redox active metabolite release, represents a new frontier to control human pathogens such as Pseudomonas aeruginosa and hence reduce mortality. Here we reveal that the extracellular redox active virulence factor pyocyanin produced by P. aeruginosa binds directly to the deoxyribose-phosphate backbone of DNA and intercalates with DNA nitrogenous base pair regions. Binding results in local perturbations of the DNA double helix structure and enhanced electron transfer along the nucleic acid polymer. Pyocyanin binding to DNA also increases DNA solution viscosity. In contrast, antioxidants interacting with DNA and pyocyanin decrease DNA solution viscosity. Biofilms deficient in pyocyanin production and biofilms lacking extracellular DNA show similar architecture indicating the interaction is important in P. aeruginosa biofilm formation. PMID:25669133

  7. Binding of undamaged double stranded DNA to vaccinia virus uracil-DNA glycosylase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schormann, Norbert; Banerjee, Surajit; Ricciardi, Robert

    Background: Uracil-DNA glycosylases are evolutionarily conserved DNA repair enzymes. However, vaccinia virus uracil-DNA glycosylase (known as D4), also serves as an intrinsic and essential component of the processive DNA polymerase complex during DNA replication. In this complex D4 binds to a unique poxvirus specific protein A20 which tethers it to the DNA polymerase. At the replication fork the DNA scanning and repair function of D4 is coupled with DNA replication. So far, DNA-binding to D4 has not been structurally characterized. Results: This manuscript describes the first structure of a DNA-complex of a uracil-DNA glycosylase from the poxvirus family. This alsomore » represents the first structure of a uracil DNA glycosylase in complex with an undamaged DNA. In the asymmetric unit two D4 subunits bind simultaneously to complementary strands of the DNA double helix. Each D4 subunit interacts mainly with the central region of one strand. DNA binds to the opposite side of the A20-binding surface on D4. In comparison of the present structure with the structure of uracil-containing DNA-bound human uracil-DNA glycosylase suggests that for DNA binding and uracil removal D4 employs a unique set of residues and motifs that are highly conserved within the poxvirus family but different in other organisms. Conclusion: The first structure of D4 bound to a truly non-specific undamaged double-stranded DNA suggests that initial binding of DNA may involve multiple non-specific interactions between the protein and the phosphate backbone.« less

  8. Binding of undamaged double stranded DNA to vaccinia virus uracil-DNA glycosylase

    DOE PAGES

    Schormann, Norbert; Banerjee, Surajit; Ricciardi, Robert; ...

    2015-06-02

    Background: Uracil-DNA glycosylases are evolutionarily conserved DNA repair enzymes. However, vaccinia virus uracil-DNA glycosylase (known as D4), also serves as an intrinsic and essential component of the processive DNA polymerase complex during DNA replication. In this complex D4 binds to a unique poxvirus specific protein A20 which tethers it to the DNA polymerase. At the replication fork the DNA scanning and repair function of D4 is coupled with DNA replication. So far, DNA-binding to D4 has not been structurally characterized. Results: This manuscript describes the first structure of a DNA-complex of a uracil-DNA glycosylase from the poxvirus family. This alsomore » represents the first structure of a uracil DNA glycosylase in complex with an undamaged DNA. In the asymmetric unit two D4 subunits bind simultaneously to complementary strands of the DNA double helix. Each D4 subunit interacts mainly with the central region of one strand. DNA binds to the opposite side of the A20-binding surface on D4. In comparison of the present structure with the structure of uracil-containing DNA-bound human uracil-DNA glycosylase suggests that for DNA binding and uracil removal D4 employs a unique set of residues and motifs that are highly conserved within the poxvirus family but different in other organisms. Conclusion: The first structure of D4 bound to a truly non-specific undamaged double-stranded DNA suggests that initial binding of DNA may involve multiple non-specific interactions between the protein and the phosphate backbone.« less

  9. In silico modeling of epigenetic-induced changes in photoreceptor cis-regulatory elements.

    PubMed

    Hossain, Reafa A; Dunham, Nicholas R; Enke, Raymond A; Berndsen, Christopher E

    2018-01-01

    DNA methylation is a well-characterized epigenetic repressor of mRNA transcription in many plant and vertebrate systems. However, the mechanism of this repression is not fully understood. The process of transcription is controlled by proteins that regulate recruitment and activity of RNA polymerase by binding to specific cis-regulatory sequences. Cone-rod homeobox (CRX) is a well-characterized mammalian transcription factor that controls photoreceptor cell-specific gene expression. Although much is known about the functions and DNA binding specificity of CRX, little is known about how DNA methylation modulates CRX binding affinity to genomic cis-regulatory elements. We used bisulfite pyrosequencing of human ocular tissues to measure DNA methylation levels of the regulatory regions of RHO , PDE6B, PAX6 , and LINE1 retrotransposon repeats. To describe the molecular mechanism of repression, we used molecular modeling to illustrate the effect of DNA methylation on human RHO regulatory sequences. In this study, we demonstrate an inverse correlation between DNA methylation in regulatory regions adjacent to the human RHO and PDE6B genes and their subsequent transcription in human ocular tissues. Docking of CRX to the DNA models shows that CRX interacts with the grooves of these sequences, suggesting changes in groove structure could regulate binding. Molecular dynamics simulations of the RHO promoter and enhancer regions show changes in the flexibility and groove width upon epigenetic modification. Models also demonstrate changes in the local dynamics of CRX binding sites within RHO regulatory sequences which may account for the repression of CRX-dependent transcription. Collectively, these data demonstrate epigenetic regulation of CRX binding sites in human retinal tissue and provide insight into the mechanism of this mode of epigenetic regulation to be tested in future experiments.

  10. Role of DNA conformation & energetic insights in Msx-1-DNA recognition as revealed by molecular dynamics studies on specific and nonspecific complexes.

    PubMed

    Kachhap, Sangita; Singh, Balvinder

    2015-01-01

    In most of homeodomain-DNA complexes, glutamine or lysine is present at 50th position and interacts with 5th and 6th nucleotide of core recognition region. Molecular dynamics simulations of Msx-1-DNA complex (Q50-TG) and its variant complexes, that is specific (Q50K-CC), nonspecific (Q50-CC) having mutation in DNA and (Q50K-TG) in protein, have been carried out. Analysis of protein-DNA interactions and structure of DNA in specific and nonspecific complexes show that amino acid residues use sequence-dependent shape of DNA to interact. The binding free energies of all four complexes were analysed to define role of amino acid residue at 50th position in terms of binding strength considering the variation in DNA on stability of protein-DNA complexes. The order of stability of protein-DNA complexes shows that specific complexes are more stable than nonspecific ones. Decomposition analysis shows that N-terminal amino acid residues have been found to contribute maximally in binding free energy of protein-DNA complexes. Among specific protein-DNA complexes, K50 contributes more as compared to Q50 towards binding free energy in respective complexes. The sequence dependence of local conformation of DNA enables Q50/Q50K to make hydrogen bond with nucleotide(s) of DNA. The changes in amino acid sequence of protein are accommodated and stabilized around TAAT core region of DNA having variation in nucleotides.

  11. BclxL changes conformation upon binding to wild-type but not mutant p53 DNA binding domain.

    PubMed

    Hagn, Franz; Klein, Christian; Demmer, Oliver; Marchenko, Natasha; Vaseva, Angelina; Moll, Ute M; Kessler, Horst

    2010-01-29

    p53 can induce apoptosis through mitochondrial membrane permeabilization by interaction of its DNA binding region with the anti-apoptotic proteins BclxL and Bcl2. However, little is known about the action of p53 at the mitochondria in molecular detail. By using NMR spectroscopy and fluorescence polarization we characterized the binding of wild-type and mutant p53 DNA binding domains to BclxL and show that the wild-type p53 DNA binding domain leads to structural changes in the BH3 binding region of BclxL, whereas mutants fail to induce such effects due to reduced affinity. This was probed by induced chemical shift and residual dipolar coupling data. These data imply that p53 partly achieves its pro-apoptotic function at the mitochondria by facilitating interaction between BclxL and BH3-only proteins in an allosteric mode of action. Furthermore, we characterize for the first time the binding behavior of Pifithrin-mu, a specific small molecule inhibitor of the p53-BclxL interaction, and present a structural model of the protein-ligand complex. A rather unusual behavior is revealed whereby Pifithrin-mu binds to both sides of the protein-protein complex. These data should facilitate the rational design of more potent specific BclxL-p53 inhibitors.

  12. Analysis of autoimmune bone marrow by antibody-phage display: somatic mutations and third complementarity-determining region arginines in anti-DNA gamma and kappa V genes.

    PubMed

    Seal, S N; Hoet, R M; Raats, J M; Radic, M Z

    2000-09-01

    To examine anti-double-stranded DNA (anti-dsDNA) IgG autoantibodies from the bone marrow of individuals with systemic lupus erythematosus (SLE). A library of single-chain variable fragments (scFv) was constructed from SLE bone marrow complementary DNA of gamma, kappa, and lambda isotype by cloning into the pHENIX phagemid vector. The library was screened with dsDNA in solution, and 2 anti-DNA phage, DNA1 and DNA4, were isolated and their Ig V genes sequenced. Soluble scFv corresponding to DNA1 and DNA4, and their heavy (H)- and light (L)-chain recombinants, were prepared, purified, and analyzed for binding to DNA by enzyme-linked immunosorbent assay. DNA1 and DNA4 used different Ig H-chain (3-30 and 5-51, respectively) and L-chain (DPK15 and DPK22, respectively) V genes. The ratios of replacement mutations to silent mutations in DNA1 and DNA4 suggest that their V genes were selected for improved antigen binding in vivo. The recombinant between DNA4VH and DNA1VL showed the highest relative affinity for both single-stranded DNA and dsDNA. These 2 Ig subunits contained third complementarity-determining region arginines and had acquired the majority of replacement mutations. Anti-dsDNA IgG autoantibodies from the bone marrow of SLE patients exploit diverse V genes and cationic V-D-J and V-J junctions for DNA binding, and accumulate replacement mutations that enhance binding.

  13. Crystal structure of the DNA-binding domain of the LysR-type transcriptional regulator CbnR in complex with a DNA fragment of the recognition-binding site in the promoter region.

    PubMed

    Koentjoro, Maharani Pertiwi; Adachi, Naruhiko; Senda, Miki; Ogawa, Naoto; Senda, Toshiya

    2018-03-01

    LysR-type transcriptional regulators (LTTRs) are among the most abundant transcriptional regulators in bacteria. CbnR is an LTTR derived from Cupriavidus necator (formerly Alcaligenes eutrophus or Ralstonia eutropha) NH9 and is involved in transcriptional activation of the cbnABCD genes encoding chlorocatechol degradative enzymes. CbnR interacts with a cbnA promoter region of approximately 60 bp in length that contains the recognition-binding site (RBS) and activation-binding site (ABS). Upon inducer binding, CbnR seems to undergo conformational changes, leading to the activation of the transcription. Since the interaction of an LTTR with RBS is considered to be the first step of the transcriptional activation, the CbnR-RBS interaction is responsible for the selectivity of the promoter to be activated. To understand the sequence selectivity of CbnR, we determined the crystal structure of the DNA-binding domain of CbnR in complex with RBS of the cbnA promoter at 2.55 Å resolution. The crystal structure revealed details of the interactions between the DNA-binding domain and the promoter DNA. A comparison with the previously reported crystal structure of the DNA-binding domain of BenM in complex with its cognate RBS showed several differences in the DNA interactions, despite the structural similarity between CbnR and BenM. These differences explain the observed promoter sequence selectivity between CbnR and BenM. Particularly, the difference between Thr33 in CbnR and Ser33 in BenM appears to affect the conformations of neighboring residues, leading to the selective interactions with DNA. Atomic coordinates and structure factors for the DNA-binding domain of Cupriavidus necatorNH9 CbnR in complex with RBS are available in the Protein Data Bank under the accession code 5XXP. © 2018 Federation of European Biochemical Societies.

  14. Identification of DNA-binding proteins using structural, electrostatic and evolutionary features.

    PubMed

    Nimrod, Guy; Szilágyi, András; Leslie, Christina; Ben-Tal, Nir

    2009-04-10

    DNA-binding proteins (DBPs) participate in various crucial processes in the life-cycle of the cells, and the identification and characterization of these proteins is of great importance. We present here a random forests classifier for identifying DBPs among proteins with known 3D structures. First, clusters of evolutionarily conserved regions (patches) on the surface of proteins were detected using the PatchFinder algorithm; earlier studies showed that these regions are typically the functionally important regions of proteins. Next, we trained a classifier using features like the electrostatic potential, cluster-based amino acid conservation patterns and the secondary structure content of the patches, as well as features of the whole protein, including its dipole moment. Using 10-fold cross-validation on a dataset of 138 DBPs and 110 proteins that do not bind DNA, the classifier achieved a sensitivity and a specificity of 0.90, which is overall better than the performance of published methods. Furthermore, when we tested five different methods on 11 new DBPs that did not appear in the original dataset, only our method annotated all correctly. The resulting classifier was applied to a collection of 757 proteins of known structure and unknown function. Of these proteins, 218 were predicted to bind DNA, and we anticipate that some of them interact with DNA using new structural motifs. The use of complementary computational tools supports the notion that at least some of them do bind DNA.

  15. DNA-binding mechanism of the Escherichia coli Ada O6-alkylguanine–DNA alkyltransferase

    PubMed Central

    Verdemato, Philip E.; Brannigan, James A.; Damblon, Christian; Zuccotto, Fabio; Moody, Peter C. E.; Lian, Lu-Yun

    2000-01-01

    The C-terminal domain of the Escherichia coli Ada protein (Ada-C) aids in the maintenance of genomic integrity by efficiently repairing pre-mutagenic O6-alkylguanine lesions in DNA. Structural and thermodynamic studies were carried out to obtain a model of the DNA-binding process. Nuclear magnetic resonance (NMR) studies map the DNA-binding site to helix 5, and a loop region (residues 151–160) which form the recognition helix and the ‘wing’ of a helix–turn–wing motif, respectively. The NMR data also suggest the absence of a large conformational change in the protein upon binding to DNA. Hence, an O6-methylguanine (O6meG) lesion would be inaccessible to active site nucleophile Cys146 if the modified base remained stacked within the DNA duplex. The experimentally determined DNA-binding face of Ada-C was used in combination with homology modelling, based on the catabolite activator protein, and the accepted base-flipping mechanism, to construct a model of how Ada-C binds to DNA in a productive manner. To complement the structural studies, thermodynamic data were obtained which demonstrate that binding to unmethylated DNA was entropically driven, whilst the demethylation reaction provoked an exothermic heat change. Methylation of Cys146 leads to a loss of structural integrity of the DNA-binding subdomain. PMID:11000262

  16. The Fanconi anemia associated protein FAAP24 uses two substrate specific binding surfaces for DNA recognition

    PubMed Central

    Wienk, Hans; Slootweg, Jack C.; Speerstra, Sietske; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.

    2013-01-01

    To maintain the integrity of the genome, multiple DNA repair systems exist to repair damaged DNA. Recognition of altered DNA, including bulky adducts, pyrimidine dimers and interstrand crosslinks (ICL), partially depends on proteins containing helix-hairpin-helix (HhH) domains. To understand how ICL is specifically recognized by the Fanconi anemia proteins FANCM and FAAP24, we determined the structure of the HhH domain of FAAP24. Although it resembles other HhH domains, the FAAP24 domain contains a canonical hairpin motif followed by distorted motif. The HhH domain can bind various DNA substrates; using nuclear magnetic resonance titration experiments, we demonstrate that the canonical HhH motif is required for double-stranded DNA (dsDNA) binding, whereas the unstructured N-terminus can interact with single-stranded DNA. Both DNA binding surfaces are used for binding to ICL-like single/double-strand junction-containing DNA substrates. A structural model for FAAP24 bound to dsDNA has been made based on homology with the translesion polymerase iota. Site-directed mutagenesis, sequence conservation and charge distribution support the dsDNA-binding model. Analogous to other HhH domain-containing proteins, we suggest that multiple FAAP24 regions together contribute to binding to single/double-strand junction, which could contribute to specificity in ICL DNA recognition. PMID:23661679

  17. Functional interaction of CCAAT/enhancer-binding-protein-α basic region mutants with E2F transcription factors and DNA.

    PubMed

    Kowenz-Leutz, Elisabeth; Schuetz, Anja; Liu, Qingbin; Knoblich, Maria; Heinemann, Udo; Leutz, Achim

    2016-07-01

    The transcription factor CCAAT/enhancer-binding protein α (C/EBPα) regulates cell cycle arrest and terminal differentiation of neutrophils and adipocytes. Mutations in the basic leucine zipper domain (bZip) of C/EBPα are associated with acute myeloid leukemia. A widely used murine transforming C/EBPα basic region mutant (BRM2) entails two bZip point mutations (I294A/R297A). BRM2 has been discordantly described as defective for DNA binding or defective for interaction with E2F. We have separated the two BRM2 mutations to shed light on the intertwined reciprocity between C/EBPα-E2F-DNA interactions. Both, C/EBPα I294A and R297A retain transactivation capacity and interaction with E2F-DP. The C/EBPα R297A mutation destabilized DNA binding, whereas the C/EBPα I294A mutation enhanced binding to DNA. The C/EBPα R297A mutant, like BRM2, displayed enhanced interaction with E2F-DP but failed to repress E2F-dependent transactivation although both mutants were readily suppressed by E2F1 for transcription through C/EBP cis-regulatory sites. In contrast, the DNA binding enhanced C/EBPα I294A mutant displayed increased repression of E2F-DP mediated transactivation and resisted E2F-DP mediated repression. Thus, the efficient repression of E2F dependent S-phase genes and the activation of differentiation genes reside in the balanced DNA binding capacity of C/EBPα. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Alternative Use of DNA Binding Domains by the Neurospora White Collar Complex Dictates Circadian Regulation and Light Responses

    PubMed Central

    Wang, Bin; Zhou, Xiaoying; Loros, Jennifer J.

    2015-01-01

    In the Neurospora circadian system, the White Collar complex (WCC) of WC-1 and WC-2 drives transcription of the circadian pacemaker gene frequency (frq), whose gene product, FRQ, as a part of the FRQ-FRH complex (FFC), inhibits its own expression. The WCC is also the principal Neurospora photoreceptor; WCC-mediated light induction of frq resets the clock, and all acute light induction is triggered by WCC binding to promoters of light-induced genes. However, not all acutely light-induced genes are also clock regulated, and conversely, not all clock-regulated direct targets of WCC are light induced; the structural determinants governing the shift from WCC's dark circadian role to its light activation role are poorly described. We report that the DBD region (named for being defective in binding DNA), a basic region in WC-1 proximal to the DNA-binding zinc finger (ZnF) whose function was previously ascribed to nuclear localization, instead plays multiple essential roles assisting in DNA binding and mediating interactions with the FFC. DNA binding for light induction by the WCC requires only WC-2, whereas DNA binding for circadian functions requires WC-2 as well as the ZnF and DBD motif of WC-1. The data suggest a means by which alterations in the tertiary and quaternary structures of the WCC can lead to its distinct functions in the dark and in the light. PMID:26711258

  19. The human haptoglobin gene promoter: interleukin-6-responsive elements interact with a DNA-binding protein induced by interleukin-6.

    PubMed Central

    Oliviero, S; Cortese, R

    1989-01-01

    Transcription of the human haptoglobin (Hp) gene is induced by interleukin-6 (IL-6) in the human hepatoma cell line Hep3B. Cis-acting elements responsible for this response are localized within the first 186 bp of the 5'-flanking region. Site-specific mutants of the Hp promoter fused to the chloramphenicol acetyl transferase (CAT) gene were analysed by transient transfection into uninduced and IL-6-treated Hep3B cells. We identified three regions, A, B and C, defined by mutation, which are important for the IL-6 response. Band shift experiments using nuclear extracts from untreated or IL-6-treated cells revealed the presence of IL-6-inducible DNA binding activities when DNA fragments containing the A or the C sequences were used. Competition experiments showed that both sequences bind to the same nuclear factors. Polymers of oligonucleotides containing either the A or the C regions confer IL-6 responsiveness to a truncated SV40 promoter. The B region forms several complexes with specific DNA-binding proteins different from those which bind to the A and C region. The B region complexes are identical in nuclear extracts from IL-6-treated and untreated cells. While important for IL-6 induction in the context of the haptoglobin promoter, the B site does not confer IL-6 inducibility to the SV40 promoter. Our results indicate that the IL-6 response of the haptoglobin promoter is dependent on the presence of multiple, partly redundant, cis-acting elements. Images PMID:2787245

  20. Identification and positional distribution analysis of transcription factor binding sites for genes from the wheat fl-cDNA sequences.

    PubMed

    Chen, Zhen-Yong; Guo, Xiao-Jiang; Chen, Zhong-Xu; Chen, Wei-Ying; Wang, Ji-Rui

    2017-06-01

    The binding sites of transcription factors (TFs) in upstream DNA regions are called transcription factor binding sites (TFBSs). TFBSs are important elements for regulating gene expression. To date, there have been few studies on the profiles of TFBSs in plants. In total, 4,873 sequences with 5' upstream regions from 8530 wheat fl-cDNA sequences were used to predict TFBSs. We found 4572 TFBSs for the MADS TF family, which was twice as many as for bHLH (1951), B3 (1951), HB superfamily (1914), ERF (1820), and AP2/ERF (1725) TFs, and was approximately four times higher than the remaining TFBS types. The percentage of TFBSs and TF members showed a distinct distribution in different tissues. Overall, the distribution of TFBSs in the upstream regions of wheat fl-cDNA sequences had significant difference. Meanwhile, high frequencies of some types of TFBSs were found in specific regions in the upstream sequences. Both TFs and fl-cDNA with TFBSs predicted in the same tissues exhibited specific distribution preferences for regulating gene expression. The tissue-specific analysis of TFs and fl-cDNA with TFBSs provides useful information for functional research, and can be used to identify relationships between tissue-specific TFs and fl-cDNA with TFBSs. Moreover, the positional distribution of TFBSs indicates that some types of wheat TFBS have different positional distribution preferences in the upstream regions of genes.

  1. Crystal Structure of the Minimalist Max-E47 Protein Chimera

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ahmadpour, Faraz; Ghirlando, Rodolfo; De Jong, Antonia T.

    Max-E47 is a protein chimera generated from the fusion of the DNA-binding basic region of Max and the dimerization region of E47, both members of the basic region/helix-loop-helix (bHLH) superfamily of transcription factors. Like native Max, Max-E47 binds with high affinity and specificity to the E-box site, 5'-CACGTG, both in vivo and in vitro. We have determined the crystal structure of Max-E47 at 1.7 Å resolution, and found that it associates to form a well-structured dimer even in the absence of its cognate DNA. Analytical ultracentrifugation confirms that Max-E47 is dimeric even at low micromolar concentrations, indicating that the Max-E47more » dimer is stable in the absence of DNA. Circular dichroism analysis demonstrates that both non-specific DNA and the E-box site induce similar levels of helical secondary structure in Max-E47. These results suggest that Max-E47 may bind to the E-box following the two-step mechanism proposed for other bHLH proteins. In this mechanism, a rapid step where protein binds to DNA without sequence specificity is followed by a slow step where specific protein:DNA interactions are fine-tuned, leading to sequence-specific recognition. Collectively, these results show that the designed Max-E47 protein chimera behaves both structurally and functionally like its native counterparts.« less

  2. The GAGA protein of Drosophila is phosphorylated by CK2.

    PubMed

    Bonet, Carles; Fernández, Irene; Aran, Xavier; Bernués, Jordi; Giralt, Ernest; Azorín, Fernando

    2005-08-19

    The GAGA factor of Drosophila is a sequence-specific DNA-binding protein that contributes to multiple processes from the regulation of gene expression to the structural organisation of heterochromatin and chromatin remodelling. GAGA is known to interact with various other proteins (tramtrack, pipsqueak, batman and dSAP18) and protein complexes (PRC1, NURF and FACT). GAGA functions are likely regulated at the level of post-translational modifications. Little is known, however, about its actual pattern of modification. It was proposed that GAGA can be O-glycosylated. Here, we report that GAGA519 isoform is a phosphoprotein that is phosphorylated by CK2 at the region of the DNA-binding domain. Our results indicate that phosphorylation occurs at S388 and, to a lesser extent, at S378. These two residues are located in a region of the DNA-binding domain that makes no direct contact with DNA, being dispensable for sequence-specific recognition. Phosphorylation at these sites does not abolish DNA binding but reduces the affinity of the interaction. These results are discussed in the context of the various functions and interactions that GAGA supports.

  3. Multiple structure-intrinsic disorder interactions regulate and coordinate Hox protein function

    NASA Astrophysics Data System (ADS)

    Bondos, Sarah

    During animal development, Hox transcription factors determine fate of developing tissues to generate diverse organs and appendages. Hox proteins are famous for their bizarre mutant phenotypes, such as replacing antennae with legs. Clearly, the functions of individual Hox proteins must be distinct and reliable in vivo, or the organism risks malformation or death. However, within the Hox protein family, the DNA-binding homeodomains are highly conserved and the amino acids that contact DNA are nearly invariant. These observations raise the question: How do different Hox proteins correctly identify their distinct target genes using a common DNA binding domain? One possible means to modulate DNA binding is through the influence of the non-homeodomain protein regions, which differ significantly among Hox proteins. However genetic approaches never detected intra-protein interactions, and early biochemical attempts were hindered because the special features of ``intrinsically disordered'' sequences were not appreciated. We propose the first-ever structural model of a Hox protein to explain how specific contacts between distant, intrinsically disordered regions of the protein and the homeodomain regulate DNA binding and coordinate this activity with other Hox molecular functions.

  4. The evaluation of anoxia responsive E2F DNA binding activity in the red eared slider turtle, Trachemys scripta elegans.

    PubMed

    Biggar, Kyle K; Storey, Kenneth B

    2018-01-01

    In many cases, the DNA-binding activity of a transcription factor does not change, while its transcriptional activity is greatly influenced by the make-up of bound proteins. In this study, we assessed the protein composition and DNA-binding ability of the E2F transcription factor complex to provide insight into cell cycle control in an anoxia tolerant turtle through the use of a modified ELISA protocol. This modification also permits the use of custom DNA probes that are tailored to a specific DNA binding region, introducing the ability to design capture probes for non-model organisms. Through the use of EMSA and ELISA DNA binding assays, we have successfully determined the in vitro DNA binding activity and complex dynamics of the Rb/E2F cell cycle regulatory mechanisms in an anoxic turtle, Trachemys scripta elegans . Repressive cell cycle proteins (E2F4, Rb, HDAC4 and Suv39H1) were found to significantly increase at E2F DNA-binding sites upon anoxic exposure in anoxic turtle liver. The lack of p130 involvement in the E2F DNA-bound complex indicates that anoxic turtle liver may maintain G 1 arrest for the duration of stress survival.

  5. The evaluation of anoxia responsive E2F DNA binding activity in the red eared slider turtle, Trachemys scripta elegans

    PubMed Central

    Biggar, Kyle K.

    2018-01-01

    In many cases, the DNA-binding activity of a transcription factor does not change, while its transcriptional activity is greatly influenced by the make-up of bound proteins. In this study, we assessed the protein composition and DNA-binding ability of the E2F transcription factor complex to provide insight into cell cycle control in an anoxia tolerant turtle through the use of a modified ELISA protocol. This modification also permits the use of custom DNA probes that are tailored to a specific DNA binding region, introducing the ability to design capture probes for non-model organisms. Through the use of EMSA and ELISA DNA binding assays, we have successfully determined the in vitro DNA binding activity and complex dynamics of the Rb/E2F cell cycle regulatory mechanisms in an anoxic turtle, Trachemys scripta elegans. Repressive cell cycle proteins (E2F4, Rb, HDAC4 and Suv39H1) were found to significantly increase at E2F DNA-binding sites upon anoxic exposure in anoxic turtle liver. The lack of p130 involvement in the E2F DNA-bound complex indicates that anoxic turtle liver may maintain G1 arrest for the duration of stress survival. PMID:29770276

  6. Novel structural features drive DNA binding properties of Cmr, a CRP family protein in TB complex mycobacteria.

    PubMed

    Ranganathan, Sridevi; Cheung, Jonah; Cassidy, Michael; Ginter, Christopher; Pata, Janice D; McDonough, Kathleen A

    2018-01-09

    Mycobacterium tuberculosis (Mtb) encodes two CRP/FNR family transcription factors (TF) that contribute to virulence, Cmr (Rv1675c) and CRPMt (Rv3676). Prior studies identified distinct chromosomal binding profiles for each TF despite their recognizing overlapping DNA motifs. The present study shows that Cmr binding specificity is determined by discriminator nucleotides at motif positions 4 and 13. X-ray crystallography and targeted mutational analyses identified an arginine-rich loop that expands Cmr's DNA interactions beyond the classical helix-turn-helix contacts common to all CRP/FNR family members and facilitates binding to imperfect DNA sequences. Cmr binding to DNA results in a pronounced asymmetric bending of the DNA and its high level of cooperativity is consistent with DNA-facilitated dimerization. A unique N-terminal extension inserts between the DNA binding and dimerization domains, partially occluding the site where the canonical cAMP binding pocket is found. However, an unstructured region of this N-terminus may help modulate Cmr activity in response to cellular signals. Cmr's multiple levels of DNA interaction likely enhance its ability to integrate diverse gene regulatory signals, while its novel structural features establish Cmr as an atypical CRP/FNR family member. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. The identification of FANCD2 DNA binding domains reveals nuclear localization sequences.

    PubMed

    Niraj, Joshi; Caron, Marie-Christine; Drapeau, Karine; Bérubé, Stéphanie; Guitton-Sert, Laure; Coulombe, Yan; Couturier, Anthony M; Masson, Jean-Yves

    2017-08-21

    Fanconi anemia (FA) is a recessive genetic disorder characterized by congenital abnormalities, progressive bone-marrow failure, and cancer susceptibility. The FA pathway consists of at least 21 FANC genes (FANCA-FANCV), and the encoded protein products interact in a common cellular pathway to gain resistance against DNA interstrand crosslinks. After DNA damage, FANCD2 is monoubiquitinated and accumulates on chromatin. FANCD2 plays a central role in the FA pathway, using yet unidentified DNA binding regions. By using synthetic peptide mapping and DNA binding screen by electromobility shift assays, we found that FANCD2 bears two major DNA binding domains predominantly consisting of evolutionary conserved lysine residues. Furthermore, one domain at the N-terminus of FANCD2 bears also nuclear localization sequences for the protein. Mutations in the bifunctional DNA binding/NLS domain lead to a reduction in FANCD2 monoubiquitination and increase in mitomycin C sensitivity. Such phenotypes are not fully rescued by fusion with an heterologous NLS, which enable separation of DNA binding and nuclear import functions within this domain that are necessary for FANCD2 functions. Collectively, our results enlighten the importance of DNA binding and NLS residues in FANCD2 to activate an efficient FA pathway. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. Specific minor groove solvation is a crucial determinant of DNA binding site recognition

    PubMed Central

    Harris, Lydia-Ann; Williams, Loren Dean; Koudelka, Gerald B.

    2014-01-01

    The DNA sequence preferences of nearly all sequence specific DNA binding proteins are influenced by the identities of bases that are not directly contacted by protein. Discrimination between non-contacted base sequences is commonly based on the differential abilities of DNA sequences to allow narrowing of the DNA minor groove. However, the factors that govern the propensity of minor groove narrowing are not completely understood. Here we show that the differential abilities of various DNA sequences to support formation of a highly ordered and stable minor groove solvation network are a key determinant of non-contacted base recognition by a sequence-specific binding protein. In addition, disrupting the solvent network in the non-contacted region of the binding site alters the protein's ability to recognize contacted base sequences at positions 5–6 bases away. This observation suggests that DNA solvent interactions link contacted and non-contacted base recognition by the protein. PMID:25429976

  9. iDBPs: a web server for the identification of DNA binding proteins.

    PubMed

    Nimrod, Guy; Schushan, Maya; Szilágyi, András; Leslie, Christina; Ben-Tal, Nir

    2010-03-01

    The iDBPs server uses the three-dimensional (3D) structure of a query protein to predict whether it binds DNA. First, the algorithm predicts the functional region of the protein based on its evolutionary profile; the assumption is that large clusters of conserved residues are good markers of functional regions. Next, various characteristics of the predicted functional region as well as global features of the protein are calculated, such as the average surface electrostatic potential, the dipole moment and cluster-based amino acid conservation patterns. Finally, a random forests classifier is used to predict whether the query protein is likely to bind DNA and to estimate the prediction confidence. We have trained and tested the classifier on various datasets and shown that it outperformed related methods. On a dataset that reflects the fraction of DNA binding proteins (DBPs) in a proteome, the area under the ROC curve was 0.90. The application of the server to an updated version of the N-Func database, which contains proteins of unknown function with solved 3D-structure, suggested new putative DBPs for experimental studies. http://idbps.tau.ac.il/

  10. DNA binding by the ribosomal DNA transcription factor rrn3 is essential for ribosomal DNA transcription.

    PubMed

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I

    2013-03-29

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.

  11. DNA Binding by the Ribosomal DNA Transcription Factor Rrn3 Is Essential for Ribosomal DNA Transcription*

    PubMed Central

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.

    2013-01-01

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135

  12. The key DNA-binding residues in the C-terminal domain of Mycobacterium tuberculosis DNA gyrase A subunit (GyrA)

    PubMed Central

    Huang, You-Yi; Deng, Jiao-Yu; Gu, Jing; Zhang, Zhi-Ping; Maxwell, Anthony; Bi, Li-Jun; Chen, Yuan-Yuan; Zhou, Ya-Feng; Yu, Zi-Niu; Zhang, Xian-En

    2006-01-01

    As only the type II topoisomerase is capable of introducing negative supercoiling, DNA gyrase is involved in crucial cellular processes. Although the other domains of DNA gyrase are better understood, the mechanism of DNA binding by the C-terminal domain of the DNA gyrase A subunit (GyrA-CTD) is less clear. Here, we investigated the DNA-binding sites in the GyrA-CTD of Mycobacterium tuberculosis gyrase through site-directed mutagenesis. The results show that Y577, R691 and R745 are among the key DNA-binding residues in M.tuberculosis GyrA-CTD, and that the third blade of the GyrA-CTD is the main DNA-binding region in M.tuberculosis DNA gyrase. The substitutions of Y577A, D669A, R691A, R745A and G729W led to the loss of supercoiling and relaxation activities, although they had a little effect on the drug-dependent DNA cleavage and decatenation activities, and had no effect on the ATPase activity. Taken together, these results showed that the GyrA-CTD is essential to DNA gyrase of M.tuberculosis, and promote the idea that the M.tuberculosis GyrA-CTD is a new potential target for drug design. It is the first time that the DNA-binding sites in GyrA-CTD have been identified. PMID:17038336

  13. Nonspecific DNA Binding and Bending by HUαβ: Interfaces of the Three Binding Modes Characterized by Salt Dependent Thermodynamics

    PubMed Central

    Koh, Junseock; Shkel, Irina; Saecker, Ruth M.; Record, M. Thomas

    2011-01-01

    Previous ITC and FRET studies demonstrated that Escherichia coli HUαβ binds nonspecifically to duplex DNA in three different binding modes: a tighter-binding 34 bp mode which interacts with DNA in large (>34 bp) gaps between bound proteins, reversibly bending it 140° and thereby increasing its flexibility, and two weaker, modestly cooperative small-site-size modes (10 bp, 6 bp) useful for filling gaps between bound proteins shorter than 34 bp. Here we use ITC to determine the thermodynamics of these binding modes as a function of salt concentration, and deduce that DNA in the 34 bp mode is bent around but not wrapped on the body of HU, in contrast to specific binding of IHF. Analyses of binding isotherms (8, 15, 34 bp DNA) and initial binding heats (34, 38, 160 bp DNA) reveal that all three modes have similar log-log salt concentration derivatives of the binding constants (Ski) even though their binding site sizes differ greatly; most probable values of Ski on 34 bp or larger DNA are − 7.5 ± 0.5. From the similarity of Ski values, we conclude that binding interfaces of all three modes involve the same region of the arms and saddle of HU. All modes are entropy-driven, as expected for nonspecific binding driven by the polyelectrolyte effect. The bent-DNA 34 bp mode is most endothermic, presumably because of the cost of HU-induced DNA bending, while the 6 bp mode is modestly exothermic at all salt concentrations examined. Structural models consistent with the observed Ski values are proposed. PMID:21513716

  14. The N-terminal Region of the DNA-dependent Protein Kinase Catalytic Subunit Is Required for Its DNA Double-stranded Break-mediated Activation*

    PubMed Central

    Davis, Anthony J.; Lee, Kyung-Jong; Chen, David J.

    2013-01-01

    DNA-dependent protein kinase (DNA-PK) plays an essential role in the repair of DNA double-stranded breaks (DSBs) mediated by the nonhomologous end-joining pathway. DNA-PK is a holoenzyme consisting of a DNA-binding (Ku70/Ku80) and catalytic (DNA-PKcs) subunit. DNA-PKcs is a serine/threonine protein kinase that is recruited to DSBs via Ku70/80 and is activated once the kinase is bound to the DSB ends. In this study, two large, distinct fragments of DNA-PKcs, consisting of the N terminus (amino acids 1–2713), termed N-PKcs, and the C terminus (amino acids 2714–4128), termed C-PKcs, were produced to determine the role of each terminal region in regulating the activity of DNA-PKcs. N-PKcs but not C-PKcs interacts with the Ku-DNA complex and is required for the ability of DNA-PKcs to localize to DSBs. C-PKcs has increased basal kinase activity compared with DNA-PKcs, suggesting that the N-terminal region of DNA-PKcs keeps basal activity low. The kinase activity of C-PKcs is not stimulated by Ku70/80 and DNA, further supporting that the N-terminal region is required for binding to the Ku-DNA complex and full activation of kinase activity. Collectively, the results show the N-terminal region mediates the interaction between DNA-PKcs and the Ku-DNA complex and is required for its DSB-induced enzymatic activity. PMID:23322783

  15. Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively.

    PubMed

    Clifford, Jacob; Adami, Christoph

    2015-09-02

    Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

  16. SA1 and TRF1 synergistically bind to telomeric DNA and promote DNA-DNA pairing

    NASA Astrophysics Data System (ADS)

    Wang, Hong; Lin, Jiangguo; Countryman, Preston; Pan, Hai; Parminder Kaur Team; Robert Riehn Team; Patricia Opresko Team; Jane Tao Team; Susan Smith Team

    Impaired telomere cohesion leads to increased aneuploidy and early onset of tumorigenesis. Cohesion is thought to occur through the entrapment of two DNA strands within tripartite cohesin ring(s), along with a fourth subunit (SA1/SA2). Surprisingly, cohesion rings are not essential for telomere cohesion, which instead requires SA1 and shelterin proteins including TRF1. However, neither this unique cohesion mechanism at telomeres or DNA-binding properties of SA1 is understood. Here, using single-molecule fluorescence imaging of quantum dot-labeled proteins on DNA we discover that while SA1 diffuses across multiple telomeric and non-telomeric regions, the diffusion mediated through its N-terminal domain is slower at telomeric regions. However, addition of TRF1 traps SA1 within telomeric regions, which form longer DNA-DNA pairing tracts than with TRF1 alone, as revealed by atomic force microscopy. Together, these experimental results and coarse-grained molecular dynamics simulations suggest that TRF1 and SA1 synergistically interact with DNA to support telomere cohesion without cohesin rings.

  17. The Intrinsically Disordered Regions of the Drosophila melanogaster Hox Protein Ultrabithorax Select Interacting Proteins Based on Partner Topology

    PubMed Central

    Hsiao, Hao-Ching; Gonzalez, Kim L.; Catanese, Daniel J.; Jordy, Kristopher E.; Matthews, Kathleen S.; Bondos, Sarah E.

    2014-01-01

    Interactions between structured proteins require a complementary topology and surface chemistry to form sufficient contacts for stable binding. However, approximately one third of protein interactions are estimated to involve intrinsically disordered regions of proteins. The dynamic nature of disordered regions before and, in some cases, after binding calls into question the role of partner topology in forming protein interactions. To understand how intrinsically disordered proteins identify the correct interacting partner proteins, we evaluated interactions formed by the Drosophila melanogaster Hox transcription factor Ultrabithorax (Ubx), which contains both structured and disordered regions. Ubx binding proteins are enriched in specific folds: 23 of its 39 partners include one of 7 folds, out of the 1195 folds recognized by SCOP. For the proteins harboring the two most populated folds, DNA-RNA binding 3-helical bundles and α-α superhelices, the regions of the partner proteins that exhibit these preferred folds are sufficient for Ubx binding. Three disorder-containing regions in Ubx are required to bind these partners. These regions are either alternatively spliced or multiply phosphorylated, providing a mechanism for cellular processes to regulate Ubx-partner interactions. Indeed, partner topology correlates with the ability of individual partner proteins to bind Ubx spliceoforms. Partners bind different disordered regions within Ubx to varying extents, creating the potential for competition between partners and cooperative binding by partners. The ability of partners to bind regions of Ubx that activate transcription and regulate DNA binding provides a mechanism for partners to modulate transcription regulation by Ubx, and suggests that one role of disorder in Ubx is to coordinate multiple molecular functions in response to tissue-specific cues. PMID:25286318

  18. p48 Activates a UV-Damaged-DNA Binding Factor and Is Defective in Xeroderma Pigmentosum Group E Cells That Lack Binding Activity

    PubMed Central

    Hwang, Byung Joon; Toering, Stephanie; Francke, Uta; Chu, Gilbert

    1998-01-01

    A subset of xeroderma pigmentosum (XP) group E cells lack a factor that binds to DNA damaged by UV radiation. This factor can be purified to homogeneity as p125, a 125-kDa polypeptide. However, when cDNA encoding p125 is translated in vitro, only a small fraction binds to UV-damaged DNA, suggesting that a second factor is required for the activation of p125. We discovered that most hamster cell lines expressed inactive p125, which was activated in somatic cell hybrids containing human chromosome region 11p11.2-11cen. This region excluded p125 but included p48, which encodes a 48-kDa polypeptide known to copurify with p125 under some conditions. Expression of human p48 activated p125 binding in hamster cells and increased p125 binding in human cells. No such effects were observed from expression of p48 containing single amino acid substitutions from XP group E cells that lacked binding activity, demonstrating that the p48 gene is defective in those cells. Activation of p125 occurred by a “hit-and-run” mechanism, since the presence of p48 was not required for subsequent binding. Nevertheless, p48 was capable of forming a complex with p125 either bound to UV-damaged DNA or in free solution. It is notable that hamster cells fail to efficiently repair cyclobutane pyrimidine dimers in nontranscribed DNA and fail to express p48, which contains a WD motif with homology to proteins that reorganize chromatin. We propose that p48 plays a role in repairing lesions that would otherwise remain inaccessible in nontranscribed chromatin. PMID:9632823

  19. Deciphering the groove binding modes of tau-fluvalinate and flumethrin with calf thymus DNA

    NASA Astrophysics Data System (ADS)

    Tao, Mo; Zhang, Guowen; Pan, Junhui; Xiong, Chunhong

    2016-02-01

    Tau-fluvalinate (TFL) and flumethrin (FL), widely used in agriculture and a class of synthetic pyrethroid pesticides with a similar structure, may cause a potential security risk. Herein, the modes of binding in vitro of TFL and FL with calf thymus DNA (ctDNA) were characterized by fluorescence, UV-vis absorption, circular dichroism (CD) and Fourier transform infrared (FT-IR) spectroscopy with the aid of viscosity measurements, melting analyses and molecular docking studies. The fluorescence titration indicated that both TFL and FL bound to ctDNA forming complexes through hydrogen bonding and van der Waals forces. The binding constants of TFL and FL with ctDNA were in the range of 104 L mol- 1, and FL exhibited a higher binding propensity than TFL. The iodide quenching effect, single/double-stranded DNA effects, and ctDNA melting and viscosity measurements demonstrated that the binding of both TFL and FL to ctDNA was groove mode. The FT-IR analyses suggested the A-T region of the minor groove of ctDNA as the preferential binding for TFL and FL, which was confirmed by the displacement assays with Hoechst 33258 probe, and the molecular docking visualized the specific binding. The changes in CD spectra indicated that both FL and TFL induced the perturbation on the base stacking and helicity of B-DNA, but the disturbance caused by FL was more obvious. Gel electrophoresis analyses indicated that both TFL and FL did not cause significant DNA cleavage. This study provides novel insights into the binding properties of TFL/FL with ctDNA and its toxic mechanisms.

  20. The type III effector HsvG of the gall-forming Pantoea agglomerans mediates expression of the host gene HSVGT.

    PubMed

    Nissan, Gal; Manulis-Sasson, Shulamit; Chalupowicz, Laura; Teper, Doron; Yeheskel, Adva; Pasmanik-Chor, Metsada; Sessa, Guido; Barash, Isaac

    2012-02-01

    The type III effector HsvG of the gall-forming Pantoea agglomerans pv. gypsophilae is a DNA-binding protein that is imported to the host nucleus and involved in host specificity. The DNA-binding region of HsvG was delineated to 266 amino acids located within a secondary structure region near the N-terminus of the protein but did not display any homology to canonical DNA-binding motifs. A binding site selection procedure was used to isolate a target gene of HsvG, named HSVGT, in Gypsophila paniculata. HSVGT is a predicted acidic protein of the DnaJ family with 244 amino acids. It harbors characteristic conserved motifs of a eukaryotic transcription factor, including a bipartite nuclear localization signal, zinc finger, and leucine zipper DNA-binding motifs. Quantitative real-time polymerase chain reaction analysis demonstrated that HSVGT transcription is specifically induced in planta within 2 h after inoculation with the wild-type P. agglomerans pv. gypsophilae compared with the hsvG mutant. Induction of HSVGT reached a peak of sixfold at 4 h after inoculation and progressively declined thereafter. Gel-shift assay demonstrated that HsvG binds to the HSVGT promoter, indicating that HSVGT is a direct target of HsvG. Our results support the hypothesis that HsvG functions as a transcription factor in gypsophila.

  1. Screening the sequence selectivity of DNA-binding molecules using a gold nanoparticle-based colorimetric approach.

    PubMed

    Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A

    2007-09-15

    We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.

  2. Conformational control and DNA-binding mechanism of the metazoan origin recognition complex.

    PubMed

    Bleichert, Franziska; Leitner, Alexander; Aebersold, Ruedi; Botchan, Michael R; Berger, James M

    2018-06-26

    In eukaryotes, the heterohexameric origin recognition complex (ORC) coordinates replication onset by facilitating the recruitment and loading of the minichromosome maintenance 2-7 (Mcm2-7) replicative helicase onto DNA to license origins. Drosophila ORC can adopt an autoinhibited configuration that is predicted to prevent Mcm2-7 loading; how the complex is activated and whether other ORC homologs can assume this state are not known. Using chemical cross-linking and mass spectrometry, biochemical assays, and electron microscopy (EM), we show that the autoinhibited state of Drosophila ORC is populated in solution, and that human ORC can also adopt this form. ATP binding to ORC supports a transition from the autoinhibited state to an active configuration, enabling the nucleotide-dependent association of ORC with both DNA and Cdc6. An unstructured N-terminal region adjacent to the conserved ATPase domain of Orc1 is shown to be required for high-affinity ORC-DNA interactions, but not for activation. ORC optimally binds DNA duplexes longer than the predicted footprint of the ORC ATPases associated with a variety of cellular activities (AAA + ) and winged-helix (WH) folds; cryo-EM analysis of Drosophila ORC bound to DNA and Cdc6 indicates that ORC contacts DNA outside of its central core region, bending the DNA away from its central DNA-binding channel. Our findings indicate that ORC autoinhibition may be common to metazoans and that ORC-Cdc6 remodels origin DNA before Mcm2-7 recruitment and loading.

  3. Purification and DNA binding properties of the blaI gene product, repressor for the beta-lactamase gene, blaP, of Bacillus licheniformis.

    PubMed Central

    Grossman, M J; Lampen, J O

    1987-01-01

    The location of the repressor gene, blaI, for the beta-lactamase gene blaP of Bacillus licheniformis 749, on the 5' side of blaP, was confirmed by sequencing the bla region of the constitutive mutant 749/C. An amber stop codon, likely to result in a nonfunctional truncated repressor, was found at codon 32 of the 128 codon blaI open reading frame (ORF) located 5' to blaP. In order to study the DNA binding activity of the repressor, the structural gene for blaI, from strain 749, with its ribosome binding site was expressed using a two plasmid T7 RNA polymerase/promotor system (S. Tabor and C. C. Richardson. Proc. Natl. Acad. Sci. 82, 1074-1078 (1985). Heat induction of this system in Escherichia coli K38 resulted in the production of BlaI as 5-10% of the soluble cell protein. Repressor protein was then purified by ammonium sulfate fractionation and cation exchange chromatography. The sequence of the N-terminal 28 amino acid residues was determined and was as predicted from the DNA. Binding of BlaI to DNA was detected by the slower migration of protein DNA complexes during polyacrylamide gel electrophoresis. BlaI was shown to selectively bind DNA fragments carrying the promoter regions of blaI and blaP. Images PMID:3498148

  4. Activator Protein-1: redox switch controlling structure and DNA-binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yin, Zhou; Machius, Mischa; Nestler, Eric J.

    The transcription factor, activator protein-1 (AP-1), binds to cognate DNA under redox control; yet, the underlying mechanism has remained enigmatic. A series of crystal structures of the AP-1 FosB/JunD bZIP domains reveal ordered DNA-binding regions in both FosB and JunD even in absence DNA. However, while JunD is competent to bind DNA, the FosB bZIP domain must undergo a large conformational rearrangement that is controlled by a ‘redox switch’ centered on an inter-molecular disulfide bond. Solution studies confirm that FosB/JunD cannot undergo structural transition and bind DNA when the redox-switch is in the ‘OFF’ state, and show that the mid-pointmore » redox potential of the redox switch affords it sensitivity to cellular redox homeostasis. The molecular and structural studies presented here thus reveal the mechanism underlying redox-regulation of AP-1 Fos/Jun transcription factors and provide structural insight for therapeutic interventions targeting AP-1 proteins.« less

  5. Studies of Xenopus laevis mitochondrial DNA: D-loop mapping and characterization of DNA-binding proteins

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cairns, S.S.

    1987-01-01

    In X. laevis oocytes, mitochondrial DNA accumulates to 10/sup 5/ times the somatic cell complement, and is characterized by a high frequency of a triple-stranded displacement hoop structure at the origin of replication. To map the termini of the single strands, it was necessary to correct the nucleotide sequence of the D-loop region. The revised sequence of 2458 nucleotides contains 54 discrepancies in comparison to a previously published sequence. Radiolabeling of the nascent strands of the D-loop structure either at the 5' end or at the 3' end identifies a major species with a length of 1670 nucleotides. Cleavage ofmore » the 5' labeled strands reveals two families of ends located near several matches to an element, designated CSB-1, that is conserved in this location in several vertebrate genomes. Cleavage of 3' labeled strands produced one fragment. The unique 3' end maps to about 15 nucleotides preceding the tRNA/sup Pro/ gene. A search for proteins which may bind to mtDNA in this region to regulate nucleic acid synthesis has identified three activities in lysates of X. laevis mitochondria. The DNA-binding proteins were assayed by monitoring their ability to retard the migration of labeled double- or single-stranded DNA fragments in polyacrylamide gels. The DNA binding preference was determined by competition with an excess of either ds- or ssDNA.« less

  6. Genome-wide DNA methylation measurements in prostate tissues uncovers novel prostate cancer diagnostic biomarkers and transcription factor binding patterns.

    PubMed

    Kirby, Marie K; Ramaker, Ryne C; Roberts, Brian S; Lasseigne, Brittany N; Gunther, David S; Burwell, Todd C; Davis, Nicholas S; Gulzar, Zulfiqar G; Absher, Devin M; Cooper, Sara J; Brooks, James D; Myers, Richard M

    2017-04-17

    Current diagnostic tools for prostate cancer lack specificity and sensitivity for detecting very early lesions. DNA methylation is a stable genomic modification that is detectable in peripheral patient fluids such as urine and blood plasma that could serve as a non-invasive diagnostic biomarker for prostate cancer. We measured genome-wide DNA methylation patterns in 73 clinically annotated fresh-frozen prostate cancers and 63 benign-adjacent prostate tissues using the Illumina Infinium HumanMethylation450 BeadChip array. We overlaid the most significantly differentially methylated sites in the genome with transcription factor binding sites measured by the Encyclopedia of DNA Elements consortium. We used logistic regression and receiver operating characteristic curves to assess the performance of candidate diagnostic models. We identified methylation patterns that have a high predictive power for distinguishing malignant prostate tissue from benign-adjacent prostate tissue, and these methylation signatures were validated using data from The Cancer Genome Atlas Project. Furthermore, by overlaying ENCODE transcription factor binding data, we observed an enrichment of enhancer of zeste homolog 2 binding in gene regulatory regions with higher DNA methylation in malignant prostate tissues. DNA methylation patterns are greatly altered in prostate cancer tissue in comparison to benign-adjacent tissue. We have discovered patterns of DNA methylation marks that can distinguish prostate cancers with high specificity and sensitivity in multiple patient tissue cohorts, and we have identified transcription factors binding in these differentially methylated regions that may play important roles in prostate cancer development.

  7. From face to interface recognition: a differential geometric approach to distinguish DNA from RNA binding surfaces.

    PubMed

    Shazman, Shula; Elber, Gershon; Mandel-Gutfreund, Yael

    2011-09-01

    Protein nucleic acid interactions play a critical role in all steps of the gene expression pathway. Nucleic acid (NA) binding proteins interact with their partners, DNA or RNA, via distinct regions on their surface that are characterized by an ensemble of chemical, physical and geometrical properties. In this study, we introduce a novel methodology based on differential geometry, commonly used in face recognition, to characterize and predict NA binding surfaces on proteins. Applying the method on experimentally solved three-dimensional structures of proteins we successfully classify double-stranded DNA (dsDNA) from single-stranded RNA (ssRNA) binding proteins, with 83% accuracy. We show that the method is insensitive to conformational changes that occur upon binding and can be applicable for de novo protein-function prediction. Remarkably, when concentrating on the zinc finger motif, we distinguish successfully between RNA and DNA binding interfaces possessing the same binding motif even within the same protein, as demonstrated for the RNA polymerase transcription-factor, TFIIIA. In conclusion, we present a novel methodology to characterize protein surfaces, which can accurately tell apart dsDNA from an ssRNA binding interfaces. The strength of our method in recognizing fine-tuned differences on NA binding interfaces make it applicable for many other molecular recognition problems, with potential implications for drug design.

  8. The basic helix-loop-helix region of the transcriptional repressor hairy and enhancer of split 1 is preorganized to bind DNA.

    PubMed

    Popovic, Matija; Wienk, Hans; Coglievina, Maristella; Boelens, Rolf; Pongor, Sándor; Pintar, Alessandro

    2014-04-01

    Hairy and enhancer of split 1, one of the main downstream effectors in Notch signaling, is a transcriptional repressor of the basic helix-loop-helix (bHLH) family. Using nuclear magnetic resonance methods, we have determined the structure and dynamics of a recombinant protein, H1H, which includes an N-terminal segment, b1, containing functionally important phosphorylation sites, the basic region b2, required for binding to DNA, and the HLH domain. We show that a proline residue in the sequence divides the protein in two parts, a flexible and disordered N-terminal region including b1 and a structured, mainly helical region comprising b2 and the HLH domain. Binding of H1H to a double strand DNA oligonucleotide was monitored through the chemical shift perturbation of backbone amide resonances, and showed that the interaction surface involves not only the b2 segment but also several residues in the b1 and HLH regions. Copyright © 2014 Wiley Periodicals, Inc.

  9. Internal Associations of the Acidic Region of Upstream Binding Factor Control Its Nucleolar Localization.

    PubMed

    Ueshima, Shuhei; Nagata, Kyosuke; Okuwaki, Mitsuru

    2017-11-15

    Upstream binding factor (UBF) is a member of the high-mobility group (HMG) box protein family, characterized by multiple HMG boxes and a C-terminal acidic region (AR). UBF is an essential transcription factor for rRNA genes and mediates the formation of transcriptionally active chromatin in the nucleolus. However, it remains unknown how UBF is specifically localized to the nucleolus. Here, we examined the molecular mechanisms that localize UBF to the nucleolus. We found that the first HMG box (HMG box 1), the linker region (LR), and the AR cooperatively regulate the nucleolar localization of UBF1. We demonstrated that the AR intramolecularly associates with and attenuates the DNA binding activity of HMG boxes and confers the structured DNA preference to HMG box 1. In contrast, the LR was found to serve as a nuclear localization signal and compete with HMG boxes to bind the AR, permitting nucleolar localization of UBF1. The LR sequence binds DNA and assists the stable chromatin binding of UBF. We also showed that the phosphorylation status of the AR does not clearly affect the localization of UBF1. Our results strongly suggest that associations of the AR with HMG boxes and the LR regulate UBF nucleolar localization. Copyright © 2017 American Society for Microbiology.

  10. Studies on DNA-binding selectivity of WRKY transcription factors lend structural clues into WRKY-domain function.

    PubMed

    Ciolkowski, Ingo; Wanke, Dierk; Birkenbihl, Rainer P; Somssich, Imre E

    2008-09-01

    WRKY transcription factors have been shown to play a major role in regulating, both positively and negatively, the plant defense transcriptome. Nearly all studied WRKY factors appear to have a stereotypic binding preference to one DNA element termed the W-box. How specificity for certain promoters is accomplished therefore remains completely unknown. In this study, we tested five distinct Arabidopsis WRKY transcription factor subfamily members for their DNA binding selectivity towards variants of the W-box embedded in neighboring DNA sequences. These studies revealed for the first time differences in their binding site preferences, which are partly dependent on additional adjacent DNA sequences outside of the TTGACY-core motif. A consensus WRKY binding site derived from these studies was used for in silico analysis to identify potential target genes within the Arabidopsis genome. Furthermore, we show that even subtle amino acid substitutions within the DNA binding region of AtWRKY11 strongly impinge on its binding activity. Additionally, all five factors were found localized exclusively to the plant cell nucleus and to be capable of trans-activating expression of a reporter gene construct in vivo.

  11. Non-coding RNA generated following lariat-debranching mediates targeting of AID to DNA

    PubMed Central

    Zheng, Simin; Vuong, Bao Q.; Vaidyanathan, Bharat; Lin, Jia-Yu; Huang, Feng-Ting; Chaudhuri, Jayanta

    2015-01-01

    SUMMARY Transcription through immunoglobulin switch (S) regions is essential for class switch recombination (CSR) but no molecular function of the transcripts has been described. Likewise, recruitment of activation-induced cytidine deaminase (AID) to S regions is critical for CSR; however, the underlying mechanism has not been fully elucidated. Here, we demonstrate that intronic switch RNA acts in trans to target AID to S region DNA. AID binds directly to switch RNA through G-quadruplexes formed by the RNA molecules. Disruption of this interaction by mutation of a key residue in the putative RNA-binding domain of AID impairs recruitment of AID to S region DNA, thereby abolishing CSR. Additionally, inhibition of RNA lariat processing leads to loss of AID localization to S regions and compromises CSR; both defects can be rescued by exogenous expression of switch transcripts in a sequence-specific manner. These studies uncover an RNA-mediated mechanism of targeting AID to DNA. PMID:25957684

  12. HMG-D is an architecture-specific protein that preferentially binds to DNA containing the dinucleotide TG.

    PubMed Central

    Churchill, M E; Jones, D N; Glaser, T; Hefner, H; Searles, M A; Travers, A A

    1995-01-01

    The high mobility group (HMG) protein HMG-D from Drosophila melanogaster is a highly abundant chromosomal protein that is closely related to the vertebrate HMG domain proteins HMG1 and HMG2. In general, chromosomal HMG domain proteins lack sequence specificity. However, using both NMR spectroscopy and standard biochemical techniques we show that binding of HMG-D to a single DNA site is sequence selective. The preferred duplex DNA binding site comprises at least 5 bp and contains the deformable dinucleotide TG embedded in A/T-rich sequences. The TG motif constitutes a common core element in the binding sites of the well-characterized sequence-specific HMG domain proteins. We show that a conserved aromatic residue in helix 1 of the HMG domain may be involved in recognition of this core sequence. In common with other HMG domain proteins HMG-D binds preferentially to DNA sites that are stably bent and underwound, therefore HMG-D can be considered an architecture-specific protein. Finally, we show that HMG-D bends DNA and may confer a superhelical DNA conformation at a natural DNA binding site in the Drosophila fushi tarazu scaffold-associated region. Images PMID:7720717

  13. Structure, mechanics, and binding mode heterogeneity of LEDGF/p75-DNA nucleoprotein complexes revealed by scanning force microscopy

    NASA Astrophysics Data System (ADS)

    Vanderlinden, Willem; Lipfert, Jan; Demeulemeester, Jonas; Debyser, Zeger; de Feyter, Steven

    2014-04-01

    LEDGF/p75 is a transcriptional coactivator implicated in the pathogenesis of AIDS and leukemia. In these contexts, LEDGF/p75 acts as a cofactor by tethering protein cargo to transcriptionally active regions in the human genome. Our study - based on scanning force microscopy (SFM) imaging - is the first to provide structural information on the interaction of LEDGF/p75 with DNA. Two novel approaches that allow obtaining insights into the DNA conformation inside nucleoprotein complexes revealed (1) that LEDGF/p75 can bind at least in three different binding modes, (2) how DNA topology and protein dimerization affect these binding modes, and (3) geometrical and mechanical aspects of the nucleoprotein complexes. These structural and mechanical details will help us to better understand the cellular mechanisms of LEDGF/p75 as a transcriptional coactivator and as a cofactor in disease.LEDGF/p75 is a transcriptional coactivator implicated in the pathogenesis of AIDS and leukemia. In these contexts, LEDGF/p75 acts as a cofactor by tethering protein cargo to transcriptionally active regions in the human genome. Our study - based on scanning force microscopy (SFM) imaging - is the first to provide structural information on the interaction of LEDGF/p75 with DNA. Two novel approaches that allow obtaining insights into the DNA conformation inside nucleoprotein complexes revealed (1) that LEDGF/p75 can bind at least in three different binding modes, (2) how DNA topology and protein dimerization affect these binding modes, and (3) geometrical and mechanical aspects of the nucleoprotein complexes. These structural and mechanical details will help us to better understand the cellular mechanisms of LEDGF/p75 as a transcriptional coactivator and as a cofactor in disease. Electronic supplementary information (ESI) available: SFM topographs of phage lambda DNA in situ, in the absence and presence of LEDGF/p75; model-independent tests for DNA chain equilibration in 2D; SFM topographs of plasmid DNA substrates I-IV in the absence of LEDGF/p75; proof-of-principle of bend angle determination on supercoiled plasmid DNA-EcoRV binding to cognate and non-cognate sites in pBR322 plasmid DNA. See DOI: 10.1039/c4nr00022f

  14. In vitro fluorescence studies of transcription factor IIB-DNA interaction.

    PubMed

    Górecki, Andrzej; Figiel, Małgorzata; Dziedzicka-Wasylewska, Marta

    2015-01-01

    General transcription factor TFIIB is one of the basal constituents of the preinitiation complex of eukaryotic RNA polymerase II, acting as a bridge between the preinitiation complex and the polymerase, and binding promoter DNA in an asymmetric manner, thereby defining the direction of the transcription. Methods of fluorescence spectroscopy together with circular dichroism spectroscopy were used to observe conformational changes in the structure of recombinant human TFIIB after binding to specific DNA sequence. To facilitate the exploration of the structural changes, several site-directed mutations have been introduced altering the fluorescence properties of the protein. Our observations showed that binding of specific DNA sequences changed the protein structure and dynamics, and TFIIB may exist in two conformational states, which can be described by a different microenvironment of W52. Fluorescence studies using both intrinsic and exogenous fluorophores showed that these changes significantly depended on the recognition sequence and concerned various regions of the protein, including those interacting with other transcription factors and RNA polymerase II. DNA binding can cause rearrangements in regions of proteins interacting with the polymerase in a manner dependent on the recognized sequences, and therefore, influence the gene expression.

  15. Structural Analysis of HMGD-DNA Complexes Reveal Influence of Intercalation on Sequence Selectivity and DNA Bending

    PubMed Central

    Churchill, Mair E.A.; Klass, Janet; Zoetewey, David L.

    2010-01-01

    The ubiquitous eukaryotic High-Mobility-Group-Box (HMGB) chromosomal proteins promote many chromatin-mediated cellular activities through their non-sequence-specific binding and bending of DNA. Minor groove DNA binding by the HMG box results in substantial DNA bending toward the major groove owing to electrostatic interactions, shape complementarity and DNA intercalation that occurs at two sites. Here, the structures of the complexes formed with DNA by a partially DNA intercalation-deficient mutant of Drosophila melanogaster HMGD have been determined by X-ray crystallography at a resolution of 2.85 Å. The six proteins and fifty base pairs of DNA in the crystal structure revealed a variety of bound conformations. All of the proteins bound in the minor groove, bridging DNA molecules, presumably because these DNA regions are easily deformed. The loss of the primary site of DNA intercalation decreased overall DNA bending and shape complementarity. However, DNA bending at the secondary site of intercalation was retained and most protein-DNA contacts were preserved. The mode of binding resembles the HMGB1-boxA-cisplatin-DNA complex, which also lacks a primary intercalating residue. This study provides new insights into the binding mechanisms used by HMG boxes to recognize varied DNA structures and sequences as well as modulate DNA structure and DNA bending. PMID:20800069

  16. Multi-spectroscopic and molecular docking studies on the interaction of darunavir, a HIV protease inhibitor with calf thymus DNA

    NASA Astrophysics Data System (ADS)

    Shi, Jie-Hua; Zhou, Kai-Li; Lou, Yan-Yue; Pan, Dong-Qi

    2018-03-01

    Molecular interaction of darunavir (DRV), a HIV protease inhibitor with calf thymus deoxyribonucleic acid (ct-DNA) was studied in physiological buffer (pH 7.4) by multi-spectroscopic approaches hand in hand with viscosity measurements and molecular docking technique. The UV absorption and fluorescence results together revealed the formation of a DRV-ct-DNA complex having binding affinities of the order of 103 M- 1, which was more in keeping with the groove binding. The results that DRV bound to ct-DNA via groove binding mode was further evidenced by KI quenching studies, viscosity measurements, competitive binding investigations with EB and Rhodamine B and CD spectral analysis. The effect of ionic strength indicated the negligible involvement of electrostatic interaction between DRV and ct-DNA. The thermodynamic parameters regarding the binding interaction of DRV with ct-DNA in terms of enthalpy change (ΔH0) and entropy change (ΔS0) were - 63.19 kJ mol- 1 and - 141.92 J mol- 1 K- 1, indicating that hydrogen bonds and van der Waals forces played a predominant role in the binding process. Furthermore, molecular simulation studies suggested that DRV molecule was prone to bind in the A-T rich region of the minor groove of DNA.

  17. Electrostatic interactions during acidic phospholipid reactivation of DnaA protein, the Escherichia coli initiator of chromosomal replication.

    PubMed

    Kitchen, J L; Li, Z; Crooke, E

    1999-05-11

    The initiation of Escherichia coli chromosomal replication by DnaA protein is strongly influenced by the tight binding of the nucleotides ATP and ADP. Anionic phospholipids in a fluid bilayer promote the conversion of inactive ADP-DnaA protein to replicatively active ATP-DnaA protein in vitro, and thus likely play a key role in regulating DnaA activity. Previous studies have revealed that, during this reactivation, a specific region of DnaA protein inserts into the hydrophobic portion of the lipid bilayer in an acidic phospholipid-dependent manner. To elucidate the requirement for acidic phospholipids in the reactivation process, the contribution of electrostatic forces in the interaction of DnaA and lipid was examined. DnaA-lipid binding required anionic phospholipids, and DnaA-lipid binding as well as lipid-mediated release of DnaA-bound nucleotide were inhibited by increased ionic strength, suggesting the involvement of electrostatic interactions in these processes. As the vesicular content of acidic phospholipids was increased, both nucleotide release and DnaA-lipid binding increased in a linear, parallel manner. Given that DnaA-membrane binding, the insertion of DnaA into the membrane, and the consequent nucleotide release all require anionic phospholipids, the acidic headgroup may be necessary to recruit DnaA protein to the membrane for insertion and subsequent reactivation for replication.

  18. The centromeric nucleosome-like CENP–T–W–S–X complex induces positive supercoils into DNA

    PubMed Central

    Takeuchi, Kozo; Nishino, Tatsuya; Mayanagi, Kouta; Horikoshi, Naoki; Osakabe, Akihisa; Tachiwana, Hiroaki; Hori, Tetsuya; Kurumizaka, Hitoshi; Fukagawa, Tatsuo

    2014-01-01

    The centromere is a specific genomic region upon which the kinetochore is formed to attach to spindle microtubules for faithful chromosome segregation. To distinguish this chromosomal region from other genomic loci, the centromere contains a specific chromatin structure including specialized nucleosomes containing the histone H3 variant CENP–A. In addition to CENP–A nucleosomes, we have found that centromeres contain a nucleosome-like structure comprised of the histone-fold CENP–T–W–S–X complex. However, it is unclear how the CENP–T–W–S–X complex associates with centromere chromatin. Here, we demonstrate that the CENP–T–W–S–X complex binds preferentially to ∼100 bp of linker DNA rather than nucleosome-bound DNA. In addition, we find that the CENP–T–W–S–X complex primarily binds to DNA as a (CENP–T–W–S–X)2 structure. Interestingly, in contrast to canonical nucleosomes that negatively supercoil DNA, the CENP–T–W–S–X complex induces positive DNA supercoils. We found that the DNA-binding regions in CENP–T or CENP–W, but not CENP–S or CENP–X, are required for this positive supercoiling activity and the kinetochore targeting of the CENP–T–W–S–X complex. In summary, our work reveals the structural features and properties of the CENP–T–W–S–X complex for its localization to centromeres. PMID:24234442

  19. Molecular determinants of the DprA−RecA interaction for nucleation on ssDNA

    PubMed Central

    Lisboa, Johnny; Andreani, Jessica; Sanchez, Dyana; Boudes, Marion; Collinet, Bruno; Liger, Dominique; van Tilbeurgh, Herman; Guérois, Raphael; Quevillon-Cheruel, Sophie

    2014-01-01

    Natural transformation is a major mechanism of horizontal gene transfer in bacteria that depends on DNA recombination. RecA is central to the homologous recombination pathway, catalyzing DNA strand invasion and homology search. DprA was shown to be a key binding partner of RecA acting as a specific mediator for its loading on the incoming exogenous ssDNA. Although the 3D structures of both RecA and DprA have been solved, the mechanisms underlying their cross-talk remained elusive. By combining molecular docking simulations and experimental validation, we identified a region on RecA, buried at its self-assembly interface and involving three basic residues that contact an acidic triad of DprA previously shown to be crucial for the interaction. At the core of these patches, DprAM238 and RecAF230 are involved in the interaction. The other DprA binding regions of RecA could involve the N-terminal α-helix and a DNA-binding region. Our data favor a model of DprA acting as a cap of the RecA filament, involving a DprA−RecA interplay at two levels: their own oligomeric states and their respective interaction with DNA. Our model forms the basis for a mechanistic explanation of how DprA can act as a mediator for the loading of RecA on ssDNA. PMID:24782530

  20. Mapping of transcription factor binding regions in mammalian cells by ChIP: Comparison of array- and sequencing-based technologies

    PubMed Central

    Euskirchen, Ghia M.; Rozowsky, Joel S.; Wei, Chia-Lin; Lee, Wah Heng; Zhang, Zhengdong D.; Hartman, Stephen; Emanuelsson, Olof; Stolc, Viktor; Weissman, Sherman; Gerstein, Mark B.; Ruan, Yijun; Snyder, Michael

    2007-01-01

    Recent progress in mapping transcription factor (TF) binding regions can largely be credited to chromatin immunoprecipitation (ChIP) technologies. We compared strategies for mapping TF binding regions in mammalian cells using two different ChIP schemes: ChIP with DNA microarray analysis (ChIP-chip) and ChIP with DNA sequencing (ChIP-PET). We first investigated parameters central to obtaining robust ChIP-chip data sets by analyzing STAT1 targets in the ENCODE regions of the human genome, and then compared ChIP-chip to ChIP-PET. We devised methods for scoring and comparing results among various tiling arrays and examined parameters such as DNA microarray format, oligonucleotide length, hybridization conditions, and the use of competitor Cot-1 DNA. The best performance was achieved with high-density oligonucleotide arrays, oligonucleotides ≥50 bases (b), the presence of competitor Cot-1 DNA and hybridizations conducted in microfluidics stations. When target identification was evaluated as a function of array number, 80%–86% of targets were identified with three or more arrays. Comparison of ChIP-chip with ChIP-PET revealed strong agreement for the highest ranked targets with less overlap for the low ranked targets. With advantages and disadvantages unique to each approach, we found that ChIP-chip and ChIP-PET are frequently complementary in their relative abilities to detect STAT1 targets for the lower ranked targets; each method detected validated targets that were missed by the other method. The most comprehensive list of STAT1 binding regions is obtained by merging results from ChIP-chip and ChIP-sequencing. Overall, this study provides information for robust identification, scoring, and validation of TF targets using ChIP-based technologies. PMID:17568005

  1. Structural Reorganization and the Cooperative Binding of Single-stranded Telomere DNA in Sterkiella nova*

    PubMed Central

    Buczek, Pawel; Horvath, Martin P.

    2009-01-01

    In Sterkiella nova, α and β telomere proteins bind cooperatively with single-stranded DNA to form a ternary α·β·DNA complex. Association of telomere protein subunits is DNA-dependent, and α-β association enhances DNA affinity. To further understand the molecular basis for binding cooperativity, we characterized several possible stepwise assembly pathways using isothermal titration calorimetry. In one path, α and DNA first form a stable α·DNA complex followed by addition of β in a second step. Binding energy accumulates with nearly equal free energy of association for each of these steps. Heat capacity is nonetheless dramatically different with ΔCp = −305 ± 3 cal mol−1 K−1 for α binding with DNA and ΔCp = −2010 ± 20 cal mol−1 K−1 for addition of β to complete the α·β·DNA complex. By examining alternate routes including titration of single-stranded DNA with a preformed α·β complex, a significant portion of binding energy and heat capacity could be assigned to structural reorganization involving protein-protein interactions and repositioning of the DNA. Structural reorganization probably affords a mechanism to regulate high affinity binding of telomere single-stranded DNA with important implications for telomere biology. Regulation of telomere complex dissociation is thought to involve post-translational modifications in the lysine-rich C-terminal portion of β. We observed no difference in binding energetics or crystal structure when comparing complexes prepared with full-length β or a C-terminally truncated form, supporting interesting parallels between the intrinsically disordered regions of histones and this portion of β. PMID:17082188

  2. Tetrameric Ctp1 coordinates DNA binding and DNA bridging in DNA double-strand-break repair

    DOE PAGES

    Andres, Sara N.; Appel, C. Denise; Westmoreland, James W.; ...

    2015-01-12

    Ctp1 (also known as CtIP or Sae2) collaborates with Mre11-Rad50-Nbs1 to initiate repair of DNA double-strand breaks (DSBs), but its functions remain enigmatic. In this paper, we report that tetrameric Schizosaccharomyces pombe Ctp1 contains multivalent DNA-binding and DNA-bridging activities. Through structural and biophysical analyses of the Ctp1 tetramer, we define the salient features of Ctp1 architecture: an N-terminal interlocking tetrameric helical dimer-of-dimers (THDD) domain and a central intrinsically disordered region (IDR) linked to C-terminal 'RHR' DNA-interaction motifs. The THDD, IDR and RHR are required for Ctp1 DNA-bridging activity in vitro, and both the THDD and RHR are required for efficientmore » DSB repair in S. pombe. Finally, our results establish non-nucleolytic roles of Ctp1 in binding and coordination of DSB-repair intermediates and suggest that ablation of human CtIP DNA binding by truncating mutations underlie the CtIP-linked Seckel and Jawad syndromes.« less

  3. iDBPs: a web server for the identification of DNA binding proteins

    PubMed Central

    Nimrod, Guy; Schushan, Maya; Szilágyi, András; Leslie, Christina; Ben-Tal, Nir

    2010-01-01

    Summary: The iDBPs server uses the three-dimensional (3D) structure of a query protein to predict whether it binds DNA. First, the algorithm predicts the functional region of the protein based on its evolutionary profile; the assumption is that large clusters of conserved residues are good markers of functional regions. Next, various characteristics of the predicted functional region as well as global features of the protein are calculated, such as the average surface electrostatic potential, the dipole moment and cluster-based amino acid conservation patterns. Finally, a random forests classifier is used to predict whether the query protein is likely to bind DNA and to estimate the prediction confidence. We have trained and tested the classifier on various datasets and shown that it outperformed related methods. On a dataset that reflects the fraction of DNA binding proteins (DBPs) in a proteome, the area under the ROC curve was 0.90. The application of the server to an updated version of the N-Func database, which contains proteins of unknown function with solved 3D-structure, suggested new putative DBPs for experimental studies. Availability: http://idbps.tau.ac.il/ Contact: NirB@tauex.tau.ac.il Supplementary information: Supplementary data are available at Bioinformatics online. PMID:20089514

  4. Systematic Evaluation of the Dependence of Deoxyribozyme Catalysis on Random Region Length

    PubMed Central

    Velez, Tania E.; Singh, Jaydeep; Xiao, Ying; Allen, Emily C.; Wong, On Yi; Chandra, Madhavaiah; Kwon, Sarah C.; Silverman, Scott K.

    2012-01-01

    Functional nucleic acids are DNA and RNA aptamers that bind targets, or they are deoxyribozymes and ribozymes that have catalytic activity. These functional DNA and RNA sequences can be identified from random-sequence pools by in vitro selection, which requires choosing the length of the random region. Shorter random regions allow more complete coverage of sequence space but may not permit the structural complexity necessary for binding or catalysis. In contrast, longer random regions are sampled incompletely but may allow adoption of more complicated structures that enable function. In this study, we systematically examined random region length (N20 through N60) for two particular deoxyribozyme catalytic activities, DNA cleavage and tyrosine-RNA nucleopeptide linkage formation. For both activities, we previously identified deoxyribozymes using only N40 regions. In the case of DNA cleavage, here we found that shorter N20 and N30 regions allowed robust catalytic function, either by DNA hydrolysis or by DNA deglycosylation and strand scission via β-elimination, whereas longer N50 and N60 regions did not lead to catalytically active DNA sequences. Follow-up selections with N20, N30, and N40 regions revealed an interesting interplay of metal ion cofactors and random region length. Separately, for Tyr-RNA linkage formation, N30 and N60 regions provided catalytically active sequences, whereas N20 was unsuccessful, and the N40 deoxyribozymes were functionally superior (in terms of rate and yield) to N30 and N60. Collectively, the results indicate that with future in vitro selection experiments for DNA and RNA catalysts, and by extension for aptamers, random region length should be an important experimental variable. PMID:23088677

  5. Development of an electrochemical detection system for measuring DNA methylation levels using methyl CpG-binding protein and glucose dehydrogenase-fused zinc finger protein.

    PubMed

    Lee, Jinhee; Yoshida, Wataru; Abe, Koichi; Nakabayashi, Kazuhiko; Wakeda, Hironobu; Hata, Kenichiro; Marquette, Christophe A; Blum, Loïc J; Sode, Koji; Ikebukuro, Kazunori

    2017-07-15

    DNA methylation level at a certain gene region is considered as a new type of biomarker for diagnosis and its miniaturized and rapid detection system is required for diagnosis. Here we have developed a simple electrochemical detection system for DNA methylation using methyl CpG-binding domain (MBD) and a glucose dehydrogenase (GDH)-fused zinc finger protein. This analytical system consists of three steps: (1) methylated DNA collection by MBD, (2) PCR amplification of a target genomic region among collected methylated DNA, and (3) electrochemical detection of the PCR products using a GDH-fused zinc finger protein. With this system, we have successfully measured the methylation levels at the promoter region of the androgen receptor gene in 10 6 copies of genomic DNA extracted from PC3 and TSU-PR1 cancer cell lines. Since no sequence analysis or enzymatic digestion is required for this detection system, DNA methylation levels can be measured within 3h with a simple procedure. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Electrostatic study of Alanine mutational effects on transcription: application to GATA-3:DNA interaction complex.

    PubMed

    El-Assaad, Atlal; Dawy, Zaher; Nemer, Georges

    2015-01-01

    Protein-DNA interaction is of fundamental importance in molecular biology, playing roles in functions as diverse as DNA transcription, DNA structure formation, and DNA repair. Protein-DNA association is also important in medicine; understanding Protein-DNA binding kinetics can assist in identifying disease root causes which can contribute to drug development. In this perspective, this work focuses on the transcription process by the GATA Transcription Factor (TF). GATA TF binds to DNA promoter region represented by `G,A,T,A' nucleotides sequence, and initiates transcription of target genes. When proper regulation fails due to some mutations on the GATA TF protein sequence or on the DNA promoter sequence (weak promoter), deregulation of the target genes might lead to various disorders. In this study, we aim to understand the electrostatic mechanism behind GATA TF and DNA promoter interactions, in order to predict Protein-DNA binding in the presence of mutations, while elaborating on non-covalent binding kinetics. To generate a family of mutants for the GATA:DNA complex, we replaced every charged amino acid, one at a time, with a neutral amino acid like Alanine (Ala). We then applied Poisson-Boltzmann electrostatic calculations feeding into free energy calculations, for each mutation. These calculations delineate the contribution to binding from each Ala-replaced amino acid in the GATA:DNA interaction. After analyzing the obtained data in view of a two-step model, we are able to identify potential key amino acids in binding. Finally, we applied the model to GATA-3:DNA (crystal structure with PDB-ID: 3DFV) binding complex and validated it against experimental results from the literature.

  7. Modeling of the structure and interactions of the B. anthracis antitoxin, MoxX: deletion mutant studies highlight its modular structure and repressor function

    NASA Astrophysics Data System (ADS)

    Chopra, Nikita; Agarwal, Shivangi; Verma, Shashikala; Bhatnagar, Sonika; Bhatnagar, Rakesh

    2011-03-01

    Our previous report on Bacillus anthracis toxin-antitoxin module (MoxXT) identified it to be a two component system wherein, PemK-like toxin (MoxT) functions as a ribonuclease (Agarwal S et al. JBC 285:7254-7270, 2010). The labile antitoxin (MoxX) can bind to/neutralize the action of the toxin and is also a DNA-binding protein mediating autoregulation. In this study, molecular modeling of MoxX in its biologically active dimeric form was done. It was found that it contains a conserved Ribbon-Helix-Helix (RHH) motif, consistent with its DNA-binding function. The modeled MoxX monomers dimerize to form a two-stranded antiparallel ribbon, while the C-terminal region adopts an extended conformation. Knowledge guided protein-protein docking, molecular dynamics simulation, and energy minimization was performed to obtain the structure of the MoxXT complex, which was exploited for the de novo design of a peptide capable of binding to MoxT. It was found that the designed peptide caused a decrease in MoxX binding to MoxT by 42% at a concentration of 2 μM in vitro. We also show that MoxX mediates negative transcriptional autoregulation by binding to its own upstream DNA. The interacting regions of both MoxX and DNA were identified in order to model their complex. The repressor activity of MoxX was found to be mediated by the 16 N-terminal residues that contains the ribbon of the RHH motif. Based on homology with other RHH proteins and deletion mutant studies, we propose a model of the MoxX-DNA interaction, with the antiparallel β-sheet of the MoxX dimer inserted into the major groove of its cognate DNA. The structure of the complex of MoxX with MoxT and its own upstream regulatory region will facilitate design of molecules that can disrupt these interactions, a strategy for development of novel antibacterials.

  8. Favorable 2'-substitution in the loop region of a thrombin-binding DNA aptamer.

    PubMed

    Awachat, Ragini; Wagh, Atish A; Aher, Manisha; Fernandes, Moneesha; Kumar, Vaijayanti A

    2018-06-01

    Simple 2'-OMe-chemical modification in the loop region of the 15mer G-rich DNA sequence GGTTGGTGTGGTTGG is reported. The G-quadruplex structure of this thrombin-binding aptamer (TBA), is stabilized by single modifications (T → 2'-OMe-U), depending on the position of the modification. The structural stability also renders significantly increased inhibition of thrombin-induced fibrin polymerization, a process closely associated with blood-clotting. Copyright © 2018 Elsevier Ltd. All rights reserved.

  9. Analysis of the Intrinsically Disordered N-Terminus of the DNA Junction-Resolving Enzyme T7 Endonuclease I: Identification of Structure Formed upon DNA Binding

    PubMed Central

    2016-01-01

    The four-way (Holliday) DNA junction of homologous recombination is processed by the symmetrical cleavage of two strands by a nuclease. These junction-resolving enzymes bind to four-way junctions in dimeric form, distorting the structure of the junction in the process. Crystal structures of T7 endonuclease I have been determined as free protein, and the complex with a DNA junction. In neither crystal structure was the N-terminal 16-amino acid peptide visible, yet deletion of this peptide has a marked effect on the resolution process. Here we have investigated the N-terminal peptide by inclusion of spin-label probes at unique sites within this region, studied by electron paramagnetic resonance. Continuous wave experiments show that these labels are mobile in the free protein but become constrained on binding a DNA junction, with the main interaction occurring for residues 7–10 and 12. Distance measurements between equivalent positions within the two peptides of a dimer using PELDOR showed that the intermonomeric distances for residues 2–12 are long and broadly distributed in the free protein but are significantly shortened and become more defined on binding to DNA. These results suggest that the N-terminal peptides become more organized on binding to the DNA junction and nestle into the minor grooves at the branchpoint, consistent with the biochemical data indicating an important role in the resolution process. This study demonstrates the presence of structure within a protein region that cannot be viewed by crystallography. PMID:27387136

  10. Solution structure of the DNA-binding domain of RPA from Saccharomyces cerevisiae and its interaction with single-stranded DNA and SV40 T antigen

    PubMed Central

    Park, Chin-Ju; Lee, Joon-Hwa; Choi, Byong-Seok

    2005-01-01

    Replication protein A (RPA) is a three-subunit complex with multiple roles in DNA metabolism. DNA-binding domain A in the large subunit of human RPA (hRPA70A) binds to single-stranded DNA (ssDNA) and is responsible for the species-specific RPA–T antigen (T-ag) interaction required for Simian virus 40 replication. Although Saccharomyces cerevisiae RPA70A (scRPA70A) shares high sequence homology with hRPA70A, the two are not functionally equivalent. To elucidate the similarities and differences between these two homologous proteins, we determined the solution structure of scRPA70A, which closely resembled the structure of hRPA70A. The structure of ssDNA-bound scRPA70A, as simulated by residual dipolar coupling-based homology modeling, suggested that the positioning of the ssDNA is the same for scRPA70A and hRPA70A, although the conformational changes that occur in the two proteins upon ssDNA binding are not identical. NMR titrations of hRPA70A with T-ag showed that the T-ag binding surface is separate from the ssDNA-binding region and is more neutral than the corresponding part of scRPA70A. These differences might account for the species-specific nature of the hRPA70A–T-ag interaction. Our results provide insight into how these two homologous RPA proteins can exhibit functional differences, but still both retain their ability to bind ssDNA. PMID:16043636

  11. From face to interface recognition: a differential geometric approach to distinguish DNA from RNA binding surfaces

    PubMed Central

    Shazman, Shula; Elber, Gershon; Mandel-Gutfreund, Yael

    2011-01-01

    Protein nucleic acid interactions play a critical role in all steps of the gene expression pathway. Nucleic acid (NA) binding proteins interact with their partners, DNA or RNA, via distinct regions on their surface that are characterized by an ensemble of chemical, physical and geometrical properties. In this study, we introduce a novel methodology based on differential geometry, commonly used in face recognition, to characterize and predict NA binding surfaces on proteins. Applying the method on experimentally solved three-dimensional structures of proteins we successfully classify double-stranded DNA (dsDNA) from single-stranded RNA (ssRNA) binding proteins, with 83% accuracy. We show that the method is insensitive to conformational changes that occur upon binding and can be applicable for de novo protein-function prediction. Remarkably, when concentrating on the zinc finger motif, we distinguish successfully between RNA and DNA binding interfaces possessing the same binding motif even within the same protein, as demonstrated for the RNA polymerase transcription-factor, TFIIIA. In conclusion, we present a novel methodology to characterize protein surfaces, which can accurately tell apart dsDNA from an ssRNA binding interfaces. The strength of our method in recognizing fine-tuned differences on NA binding interfaces make it applicable for many other molecular recognition problems, with potential implications for drug design. PMID:21693557

  12. The artificial zinc finger coding gene 'Jazz' binds the utrophin promoter and activates transcription.

    PubMed

    Corbi, N; Libri, V; Fanciulli, M; Tinsley, J M; Davies, K E; Passananti, C

    2000-06-01

    Up-regulation of utrophin gene expression is recognized as a plausible therapeutic approach in the treatment of Duchenne muscular dystrophy (DMD). We have designed and engineered new zinc finger-based transcription factors capable of binding and activating transcription from the promoter of the dystrophin-related gene, utrophin. Using the recognition 'code' that proposes specific rules between zinc finger primary structure and potential DNA binding sites, we engineered a new gene named 'Jazz' that encodes for a three-zinc finger peptide. Jazz belongs to the Cys2-His2 zinc finger type and was engineered to target the nine base pair DNA sequence: 5'-GCT-GCT-GCG-3', present in the promoter region of both the human and mouse utrophin gene. The entire zinc finger alpha-helix region, containing the amino acid positions that are crucial for DNA binding, was specifically chosen on the basis of the contacts more frequently represented in the available list of the 'code'. Here we demonstrate that Jazz protein binds specifically to the double-stranded DNA target, with a dissociation constant of about 32 nM. Band shift and super-shift experiments confirmed the high affinity and specificity of Jazz protein for its DNA target. Moreover, we show that chimeric proteins, named Gal4-Jazz and Sp1-Jazz, are able to drive the transcription of a test gene from the human utrophin promoter.

  13. Activator Protein-1: redox switch controlling structure and DNA-binding.

    PubMed

    Yin, Zhou; Machius, Mischa; Nestler, Eric J; Rudenko, Gabby

    2017-11-02

    The transcription factor, activator protein-1 (AP-1), binds to cognate DNA under redox control; yet, the underlying mechanism has remained enigmatic. A series of crystal structures of the AP-1 FosB/JunD bZIP domains reveal ordered DNA-binding regions in both FosB and JunD even in absence DNA. However, while JunD is competent to bind DNA, the FosB bZIP domain must undergo a large conformational rearrangement that is controlled by a 'redox switch' centered on an inter-molecular disulfide bond. Solution studies confirm that FosB/JunD cannot undergo structural transition and bind DNA when the redox-switch is in the 'OFF' state, and show that the mid-point redox potential of the redox switch affords it sensitivity to cellular redox homeostasis. The molecular and structural studies presented here thus reveal the mechanism underlying redox-regulation of AP-1 Fos/Jun transcription factors and provide structural insight for therapeutic interventions targeting AP-1 proteins. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Diverse patterns of genomic targeting by transcriptional regulators in Drosophila melanogaster.

    PubMed

    Slattery, Matthew; Ma, Lijia; Spokony, Rebecca F; Arthur, Robert K; Kheradpour, Pouya; Kundaje, Anshul; Nègre, Nicolas; Crofts, Alex; Ptashkin, Ryan; Zieba, Jennifer; Ostapenko, Alexander; Suchy, Sarah; Victorsen, Alec; Jameel, Nader; Grundstad, A Jason; Gao, Wenxuan; Moran, Jennifer R; Rehm, E Jay; Grossman, Robert L; Kellis, Manolis; White, Kevin P

    2014-07-01

    Annotation of regulatory elements and identification of the transcription-related factors (TRFs) targeting these elements are key steps in understanding how cells interpret their genetic blueprint and their environment during development, and how that process goes awry in the case of disease. One goal of the modENCODE (model organism ENCyclopedia of DNA Elements) Project is to survey a diverse sampling of TRFs, both DNA-binding and non-DNA-binding factors, to provide a framework for the subsequent study of the mechanisms by which transcriptional regulators target the genome. Here we provide an updated map of the Drosophila melanogaster regulatory genome based on the location of 84 TRFs at various stages of development. This regulatory map reveals a variety of genomic targeting patterns, including factors with strong preferences toward proximal promoter binding, factors that target intergenic and intronic DNA, and factors with distinct chromatin state preferences. The data also highlight the stringency of the Polycomb regulatory network, and show association of the Trithorax-like (Trl) protein with hotspots of DNA binding throughout development. Furthermore, the data identify more than 5800 instances in which TRFs target DNA regions with demonstrated enhancer activity. Regions of high TRF co-occupancy are more likely to be associated with open enhancers used across cell types, while lower TRF occupancy regions are associated with complex enhancers that are also regulated at the epigenetic level. Together these data serve as a resource for the research community in the continued effort to dissect transcriptional regulatory mechanisms directing Drosophila development. © 2014 Slattery et al.; Published by Cold Spring Harbor Laboratory Press.

  15. Combining H/D exchange mass spectroscopy and computational docking reveals extended DNA-binding surface on uracil-DNA glycosylase

    PubMed Central

    Roberts, Victoria A.; Pique, Michael E.; Hsu, Simon; Li, Sheng; Slupphaug, Geir; Rambo, Robert P.; Jamison, Jonathan W.; Liu, Tong; Lee, Jun H.; Tainer, John A.; Ten Eyck, Lynn F.; Woods, Virgil L.

    2012-01-01

    X-ray crystallography provides excellent structural data on protein–DNA interfaces, but crystallographic complexes typically contain only small fragments of large DNA molecules. We present a new approach that can use longer DNA substrates and reveal new protein–DNA interactions even in extensively studied systems. Our approach combines rigid-body computational docking with hydrogen/deuterium exchange mass spectrometry (DXMS). DXMS identifies solvent-exposed protein surfaces; docking is used to create a 3-dimensional model of the protein–DNA interaction. We investigated the enzyme uracil-DNA glycosylase (UNG), which detects and cleaves uracil from DNA. UNG was incubated with a 30 bp DNA fragment containing a single uracil, giving the complex with the abasic DNA product. Compared with free UNG, the UNG–DNA complex showed increased solvent protection at the UNG active site and at two regions outside the active site: residues 210–220 and 251–264. Computational docking also identified these two DNA-binding surfaces, but neither shows DNA contact in UNG–DNA crystallographic structures. Our results can be explained by separation of the two DNA strands on one side of the active site. These non-sequence-specific DNA-binding surfaces may aid local uracil search, contribute to binding the abasic DNA product and help present the DNA product to APE-1, the next enzyme on the DNA-repair pathway. PMID:22492624

  16. Hemi-methylated DNA opens a closed conformation of UHRF1 to facilitate its histone recognition

    NASA Astrophysics Data System (ADS)

    Fang, Jian; Cheng, Jingdong; Wang, Jiaolong; Zhang, Qiao; Liu, Mengjie; Gong, Rui; Wang, Ping; Zhang, Xiaodan; Feng, Yangyang; Lan, Wenxian; Gong, Zhou; Tang, Chun; Wong, Jiemin; Yang, Huirong; Cao, Chunyang; Xu, Yanhui

    2016-04-01

    UHRF1 is an important epigenetic regulator for maintenance DNA methylation. UHRF1 recognizes hemi-methylated DNA (hm-DNA) and trimethylation of histone H3K9 (H3K9me3), but the regulatory mechanism remains unknown. Here we show that UHRF1 adopts a closed conformation, in which a C-terminal region (Spacer) binds to the tandem Tudor domain (TTD) and inhibits H3K9me3 recognition, whereas the SET-and-RING-associated (SRA) domain binds to the plant homeodomain (PHD) and inhibits H3R2 recognition. Hm-DNA impairs the intramolecular interactions and promotes H3K9me3 recognition by TTD-PHD. The Spacer also facilitates UHRF1-DNMT1 interaction and enhances hm-DNA-binding affinity of the SRA. When TTD-PHD binds to H3K9me3, SRA-Spacer may exist in a dynamic equilibrium: either recognizes hm-DNA or recruits DNMT1 to chromatin. Our study reveals the mechanism for regulation of H3K9me3 and hm-DNA recognition by URHF1.

  17. The Arabidopsis acetylated histone-binding protein BRAT1 forms a complex with BRP1 and prevents transcriptional silencing

    PubMed Central

    Zhang, Cui-Jun; Hou, Xiao-Mei; Tan, Lian-Mei; Shao, Chang-Rong; Huang, Huan-Wei; Li, Yong-Qiang; Li, Lin; Cai, Tao; Chen, She; He, Xin-Jian

    2016-01-01

    Transposable elements and other repetitive DNA sequences are usually subject to DNA methylation and transcriptional silencing. However, anti-silencing mechanisms that promote transcription in these regions are not well understood. Here, we describe an anti-silencing factor, Bromodomain and ATPase domain-containing protein 1 (BRAT1), which we identified by a genetic screen in Arabidopsis thaliana. BRAT1 interacts with an ATPase domain-containing protein, BRP1 (BRAT1 Partner 1), and both prevent transcriptional silencing at methylated genomic regions. Although BRAT1 mediates DNA demethylation at a small set of loci targeted by the 5-methylcytosine DNA glycosylase ROS1, the involvement of BRAT1 in anti-silencing is largely independent of DNA demethylation. We also demonstrate that the bromodomain of BRAT1 binds to acetylated histone, which may facilitate the prevention of transcriptional silencing. Thus, BRAT1 represents a potential link between histone acetylation and transcriptional anti-silencing at methylated genomic regions, which may be conserved in eukaryotes. PMID:27273316

  18. Switching bonds in a DNA gel: an all-DNA vitrimer.

    PubMed

    Romano, Flavio; Sciortino, Francesco

    2015-02-20

    We design an all-DNA system that behaves like vitrimers, innovative plastics with self-healing and stress-releasing properties. The DNA sequences are engineered to self-assemble first into tetra- and bifunctional units which, upon further cooling, bind to each other forming a fully bonded network gel. An innovative design of the binding regions of the DNA sequences, exploiting a double toehold-mediated strand displacement, generates a network gel which is able to reshuffle its bonds, retaining at all times full bonding. As in vitrimers, the rate of bond switching can be controlled via a thermally activated catalyst, which in the present design is very short DNA strands.

  19. Multi-spectroscopic and molecular docking studies on the interaction of darunavir, a HIV protease inhibitor with calf thymus DNA.

    PubMed

    Shi, Jie-Hua; Zhou, Kai-Li; Lou, Yan-Yue; Pan, Dong-Qi

    2018-03-15

    Molecular interaction of darunavir (DRV), a HIV protease inhibitor with calf thymus deoxyribonucleic acid (ct-DNA) was studied in physiological buffer (pH7.4) by multi-spectroscopic approaches hand in hand with viscosity measurements and molecular docking technique. The UV absorption and fluorescence results together revealed the formation of a DRV-ct-DNA complex having binding affinities of the order of 10 3 M -1 , which was more in keeping with the groove binding. The results that DRV bound to ct-DNA via groove binding mode was further evidenced by KI quenching studies, viscosity measurements, competitive binding investigations with EB and Rhodamine B and CD spectral analysis. The effect of ionic strength indicated the negligible involvement of electrostatic interaction between DRV and ct-DNA. The thermodynamic parameters regarding the binding interaction of DRV with ct-DNA in terms of enthalpy change (ΔH 0 ) and entropy change (ΔS 0 ) were -63.19kJ mol -1 and -141.92J mol -1 K -1 , indicating that hydrogen bonds and van der Waals forces played a predominant role in the binding process. Furthermore, molecular simulation studies suggested that DRV molecule was prone to bind in the A-T rich region of the minor groove of DNA. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Study on the interaction of the drug mesalamine with calf thymus DNA using molecular docking and spectroscopic techniques.

    PubMed

    Shahabadi, Nahid; Fili, Soraya Moradi; Kheirdoosh, Fahimeh

    2013-11-05

    The interaction of CT-DNA with the drug mesalamine (5-ASA) at physiological pH has been investigated by absorption, emission, circular dichroism (CD), cyclic voltammetry (CV), viscosity studies and molecular modeling. Thermodynamic parameters (ΔH>0 and ΔS<0) indicated that hydrogen bond and van der Waals play main roles in the binding of 5-ASA to CT-DNA. Ethidium bromide (EB) displacement studies revealed that 5-ASA did not have any effect on ethidium bromide (EB) bound DNA which is indicative of groove binding. The results obtained from experimental and molecular modeling showed that 5-ASA is a minor groove binder of DNA and preferentially binds to GC rich regions. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. Reverse transcription of phage RNA and its fragment directed by synthetic heteropolymeric primers

    PubMed Central

    Frolova, L. Yu.; Metelyev, V. G.; Ratmanova, K. I.; Smirnov, V. D.; Shabarova, Z. A.; Prokofyev, M. A.; Berzin, V. M.; Jansone, I. V.; Gren, E. J.; Kisselev, L. L.

    1977-01-01

    DNA synthesis catalysed by RNA-directed DNA-polymerase (reverse transcriptase) was found to proceed on the RNA template of an MS2 phage in the presence of heteropolymeric synthetic octa- and nonadeoxyribonucleotide primers complementary to the intercistronic region (coat protein binding site) and the region of the coat protein cistron, respectively. The product of synthesis consists of discrete DNA fractions of different length, including transcripts longer than 1,000 nucleotides. The coat protein inhibits DNA synthesis if it is initiated at its binding site, but has no effect on DNA synthesis initiated at the coat protein cistron. It has been suggested that, in this system, the initiation of DNA synthesis by synthetic primers is topographically specific. The MS2 coat protein binding site (an RNA fragment of 59 nucleotides) serves as a template for polydeoxyribonucleotide synthesis in the presence of octanucleotide primer and reverse transcriptase. The product of synthesis is homogenous and its length corresponds to the length of the template. The effective and complete copying of the fragment having a distinct secondary structure proves that the secondary structure does not interfere, in principle, with RNA being a template in the system of reverse transcription. PMID:71713

  2. Molecular determinants of the DprA-RecA interaction for nucleation on ssDNA.

    PubMed

    Lisboa, Johnny; Andreani, Jessica; Sanchez, Dyana; Boudes, Marion; Collinet, Bruno; Liger, Dominique; van Tilbeurgh, Herman; Guérois, Raphael; Quevillon-Cheruel, Sophie

    2014-06-01

    Natural transformation is a major mechanism of horizontal gene transfer in bacteria that depends on DNA recombination. RecA is central to the homologous recombination pathway, catalyzing DNA strand invasion and homology search. DprA was shown to be a key binding partner of RecA acting as a specific mediator for its loading on the incoming exogenous ssDNA. Although the 3D structures of both RecA and DprA have been solved, the mechanisms underlying their cross-talk remained elusive. By combining molecular docking simulations and experimental validation, we identified a region on RecA, buried at its self-assembly interface and involving three basic residues that contact an acidic triad of DprA previously shown to be crucial for the interaction. At the core of these patches, (DprA)M238 and (RecA)F230 are involved in the interaction. The other DprA binding regions of RecA could involve the N-terminal α-helix and a DNA-binding region. Our data favor a model of DprA acting as a cap of the RecA filament, involving a DprA-RecA interplay at two levels: their own oligomeric states and their respective interaction with DNA. Our model forms the basis for a mechanistic explanation of how DprA can act as a mediator for the loading of RecA on ssDNA. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Murine glomerulotropic monoclonal antibodies are highly oligoclonal and exhibit distinctive molecular features.

    PubMed

    Lefkowith, J B; Di Valerio, R; Norris, J; Glick, G D; Alexander, A L; Jackson, L; Gilkeson, G S

    1996-08-01

    We recently produced a panel of seven glomerular-binding mAbs from a nephritic MRL-lpr mouse that bind to histones/nucleosomes (group I) or DNA (group II) adherent to glomerular basement membrane. To elucidate the molecular basis of their binding and ontogeny, we sequenced their variable (V) regions, analyzed the apparent somatic mutations, and predicted their three-dimensional structures. There were two clonally related sets (3 of 4 in group I, 3 of 3 in group II) both of the VHJ1558 family, and one mAb of the VH 7183 family. V region somatic mutations within clonally related sets had little effect on glomerular binding and did not appear to be selected for based on glomerular binding. The VH regions were most homologous with those from autoantibodies to histones, DNA, or IgG (i.e., rheumatoid factors), the Vkappa regions, with those from autoantibodies to small nuclear ribonucleoproteins (snRNP). The VH regions also exhibited an unusual VD junction (in the group I clonally related set) and an overall high content of charged amino acids (arginine, aspartic acid) in complementarity-determining regions (CDRs), particularly in CDR3. Molecular modeling studies suggested that the Fv regions of these mAbs converge to form a flat, open surface with a net positive charge. The CDR arginines in group I mAbs; appear to be located in Ag contact regions of the binding cleft. In sum, these data suggest that glomerulotropic mAbs are a highly restricted set of Abs with distinctive molecular features that may mediate their binding to glomeruli.

  4. DIVERSITY in binding, regulation, and evolution revealed from high-throughput ChIP.

    PubMed

    Mitra, Sneha; Biswas, Anushua; Narlikar, Leelavati

    2018-04-01

    Genome-wide in vivo protein-DNA interactions are routinely mapped using high-throughput chromatin immunoprecipitation (ChIP). ChIP-reported regions are typically investigated for enriched sequence-motifs, which are likely to model the DNA-binding specificity of the profiled protein and/or of co-occurring proteins. However, simple enrichment analyses can miss insights into the binding-activity of the protein. Note that ChIP reports regions making direct contact with the protein as well as those binding through intermediaries. For example, consider a ChIP experiment targeting protein X, which binds DNA at its cognate sites, but simultaneously interacts with four other proteins. Each of these proteins also binds to its own specific cognate sites along distant parts of the genome, a scenario consistent with the current view of transcriptional hubs and chromatin loops. Since ChIP will pull down all X-associated regions, the final reported data will be a union of five distinct sets of regions, each containing binding sites of one of the five proteins, respectively. Characterizing all five different motifs and the corresponding sets is important to interpret the ChIP experiment and ultimately, the role of X in regulation. We present diversity which attempts exactly this: it partitions the data so that each partition can be characterized with its own de novo motif. Diversity uses a Bayesian approach to identify the optimal number of motifs and the associated partitions, which together explain the entire dataset. This is in contrast to standard motif finders, which report motifs individually enriched in the data, but do not necessarily explain all reported regions. We show that the different motifs and associated regions identified by diversity give insights into the various complexes that may be forming along the chromatin, something that has so far not been attempted from ChIP data. Webserver at http://diversity.ncl.res.in/; standalone (Mac OS X/Linux) from https://github.com/NarlikarLab/DIVERSITY/releases/tag/v1.0.0.

  5. Biochemical analyses indicate that binding and cleavage specificities define the ordered processing of human Okazaki fragments by Dna2 and FEN1.

    PubMed

    Gloor, Jason W; Balakrishnan, Lata; Campbell, Judith L; Bambara, Robert A

    2012-08-01

    In eukaryotic Okazaki fragment processing, the RNA primer is displaced into a single-stranded flap prior to removal. Evidence suggests that some flaps become long before they are cleaved, and that this cleavage involves the sequential action of two nucleases. Strand displacement characteristics of the polymerase show that a short gap precedes the flap during synthesis. Using biochemical techniques, binding and cleavage assays presented here indicate that when the flap is ∼ 30 nt long the nuclease Dna2 can bind with high affinity to the flap and downstream double strand and begin cleavage. When the polymerase idles or dissociates the Dna2 can reorient for additional contacts with the upstream primer region, allowing the nuclease to remain stably bound as the flap is further shortened. The DNA can then equilibrate to a double flap that can bind Dna2 and flap endonuclease (FEN1) simultaneously. When Dna2 shortens the flap even more, FEN1 can displace the Dna2 and cleave at the flap base to make a nick for ligation.

  6. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging themore » ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.« less

  7. Evidence for glucocorticoid receptor binding to a site(s) in a remote region of the 5' flanking sequences of the human proopiomelanocortin gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tully, D.B.; Hillman, D.; Herbert, E.

    1986-05-01

    Glucocorticoids negatively regulate expression of the human proopiomelanocortin (POMC) gene. It has been postulated that this effect may be modulated by a direct interaction of the glucocorticoid receptor (GR) with DNA in the vicinity of the POMC promoter. In order to investigate interactions of GR with POMC DNA, DNA-cellulose competitive binding assays have been performed using isolated fragments of cloned POMC DNA to compete with calf thymus DNA-cellulose for binding of triamcinolone acetonide affinity-labelled GR prepared from HeLa S/sub 3/ cells. In these assays, two fragments isolated from the 5' flanking sequences of POMC DNA (Fragment 3,-1765 to -677 andmore » Fragment 4, -676 to +125 with respect to the mRNA cap site) have competed favorably, with Fragment 3 consistently competing more strongly than Fragment 4. Additional studies have been conducted utilizing a newly developed South-western Blot procedure in which specific /sup 32/P-labelled DNA fragments are allowed to bind to dexamethasone mesylate labelled GR immobilized on nitrocellulose filters. Results from these studies have also shown preferential binding by POMC DNA fragments 3 and 4. DNA footprinting and gene transfer experiments are now being conducted to further characterize the nature of GR interaction with POMC DNA.« less

  8. Identification of transactivation-responsive DNA-binding protein 43 (TARDBP43; TDP-43) as a novel factor for TNF-α expression upon lipopolysaccharide stimulation in human monocytes.

    PubMed

    Murata, H; Hattori, T; Maeda, H; Takashiba, S; Takigawa, M; Kido, J; Nagata, T

    2015-08-01

    Tumor necrosis factor alpha (TNF-α) is a major cytokine implicated in various inflammatory diseases. The nature of the nuclear factors associated with human TNF-α gene regulation is not well elucidated. We previously identified a novel region located from -550 to -487 in human TNF-α promoter that did not contain the reported binding sites for nuclear factor kappa B (NF-κB) but showed lipopolysaccharide (LPS)-induced transcriptional activity. The purpose of this study is to identify novel factors that bind to the promoter region and regulate TNF-α expression. To identify DNA-binding proteins that bound to the target region of TNF-α promoter, a cDNA library from LPS-stimulated human monocytic cell line THP-1 was screened using a yeast one-hybrid system. Cellular localizations of the DNA-binding protein in the cells were examined by subcellular immunocytochemistry. Nuclear amounts of the protein in LPS-stimulated THP-1 cells were identified by western blot analysis. Expression of mRNA of the protein in the cells was quantified by real-time polymerase chain reaction. Electrophoretic mobility shift assays were performed to confirm the DNA-binding profile. Overexpression of the protein and knockdown of the gene were also performed to investigate the role for TNF-α expression. Several candidates were identified from the cDNA library and transactivation-responsive DNA-binding protein 43 (TARDBP43; TDP-43) was focused on. Western blot analysis revealed that nuclear TDP-43 protein was increased in the LPS-stimulated THP-1 cells. Expression of TDP-43 mRNA was already enhanced before TNF-α induction by LPS. Electrophoretic mobility shift assay analysis showed that nuclear extracts obtained by overexpressing FLAG-tagged TDP-43 bound to the -550 to -487 TNF-α promoter fragments. Overexpression of TDP-43 in THP-1 cells resulted in an increase of TNF-α expression. Knockdown of TDP-43 in THP-1 cells downregulated TNF-α expression. We identified TDP-43 as one of the novel TNF-α factors and found that it bound to the LPS-responsive element in the TNF-α promoter to increase TNF-α expression. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. A calmodulin binding protein from Arabidopsis is induced by ethylene and contains a DNA-binding motif

    NASA Technical Reports Server (NTRS)

    Reddy, A. S.; Reddy, V. S.; Golovkin, M.

    2000-01-01

    Calmodulin (CaM), a key calcium sensor in all eukaryotes, regulates diverse cellular processes by interacting with other proteins. To isolate CaM binding proteins involved in ethylene signal transduction, we screened an expression library prepared from ethylene-treated Arabidopsis seedlings with 35S-labeled CaM. A cDNA clone, EICBP (Ethylene-Induced CaM Binding Protein), encoding a protein that interacts with activated CaM was isolated in this screening. The CaM binding domain in EICBP was mapped to the C-terminus of the protein. These results indicate that calcium, through CaM, could regulate the activity of EICBP. The EICBP is expressed in different tissues and its expression in seedlings is induced by ethylene. The EICBP contains, in addition to a CaM binding domain, several features that are typical of transcription factors. These include a DNA-binding domain at the N terminus, an acidic region at the C terminus, and nuclear localization signals. In database searches a partial cDNA (CG-1) encoding a DNA-binding motif from parsley and an ethylene up-regulated partial cDNA from tomato (ER66) showed significant similarity to EICBP. In addition, five hypothetical proteins in the Arabidopsis genome also showed a very high sequence similarity with EICBP, indicating that there are several EICBP-related proteins in Arabidopsis. The structural features of EICBP are conserved in all EICBP-related proteins in Arabidopsis, suggesting that they may constitute a new family of DNA binding proteins and are likely to be involved in modulating gene expression in the presence of ethylene.

  10. Distinct DNA-binding surfaces in the ATPase and linker domains of MutLγ determine its substrate specificities and exert separable functions in meiotic recombination and mismatch repair

    PubMed Central

    2017-01-01

    Mlh1-Mlh3 (MutLγ) is a mismatch repair factor with a central role in formation of meiotic crossovers, presumably through resolution of double Holliday junctions. MutLγ has DNA-binding, nuclease, and ATPase activities, but how these relate to one another and to in vivo functions are unclear. Here, we combine biochemical and genetic analyses to characterize Saccharomyces cerevisiae MutLγ. Limited proteolysis and atomic force microscopy showed that purified recombinant MutLγ undergoes ATP-driven conformational changes. In vitro, MutLγ displayed separable DNA-binding activities toward Holliday junctions (HJ) and, surprisingly, single-stranded DNA (ssDNA), which was not predicted from current models. MutLγ bound DNA cooperatively, could bind multiple substrates simultaneously, and formed higher-order complexes. FeBABE hydroxyl radical footprinting indicated that the DNA-binding interfaces of MutLγ for ssDNA and HJ substrates only partially overlap. Most contacts with HJ substrates were located in the linker regions of MutLγ, whereas ssDNA contacts mapped within linker regions as well as the N-terminal ATPase domains. Using yeast genetic assays for mismatch repair and meiotic recombination, we found that mutations within different DNA-binding surfaces exert separable effects in vivo. For example, mutations within the Mlh1 linker conferred little or no meiotic phenotype but led to mismatch repair deficiency. Interestingly, mutations in the N-terminal domain of Mlh1 caused a stronger meiotic defect than mlh1Δ, suggesting that the mutant proteins retain an activity that interferes with alternative recombination pathways. Furthermore, mlh3Δ caused more chromosome missegregation than mlh1Δ, whereas mlh1Δ but not mlh3Δ partially alleviated meiotic defects of msh5Δ mutants. These findings illustrate functional differences between Mlh1 and Mlh3 during meiosis and suggest that their absence impinges on chromosome segregation not only via reduced formation of crossovers. Taken together, our results offer insights into the structure-function relationships of the MutLγ complex and reveal unanticipated genetic relationships between components of the meiotic recombination machinery. PMID:28505149

  11. Identification of functional domains of the IR2 protein of equine herpesvirus 1 required for inhibition of viral gene expression and replication

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Seong K., E-mail: skim1@lsuhsc.edu; Kim, Seongman; Dai Gan

    2011-09-01

    The equine herpesvirus 1 (EHV-1) negative regulatory IR2 protein (IR2P), an early 1,165-amino acid (aa) truncated form of the 1487-aa immediate-early protein (IEP), lacks the trans-activation domain essential for IEP activation functions but retains domains for binding DNA, TFIIB, and TBP and the nuclear localization signal. IR2P mutants of the N-terminal region which lack either DNA-binding activity or TFIIB-binding activity were unable to down-regulate EHV-1 promoters. In EHV-1-infected cells expressing full-length IR2P, transcription and protein expression of viral regulatory IE, early EICP0, IR4, and UL5, and late ETIF genes were dramatically inhibited. Viral DNA levels were reduced to 2.1% ofmore » control infected cells, but were vey weakly affected in cells that express the N-terminal 706 residues of IR2P. These results suggest that IR2P function requires the two N-terminal domains for binding DNA and TFIIB as well as the C-terminal residues 707 to 1116 containing the TBP-binding domain. - Highlights: > We examine the functional domains of IR2P that mediates negative regulation. > IR2P inhibits at the transcriptional level. > DNA-binding mutant or TFIIB-binding mutant fails to inhibit. > C-terminal aa 707 to 1116 are required for full inhibition. > Inhibition requires the DNA-binding domain, TFIIB-binding domain, and C-terminus.« less

  12. Dissection of the methyl-CpG binding domain from the chromosomal protein MeCP2.

    PubMed Central

    Nan, X; Meehan, R R; Bird, A

    1993-01-01

    MeCP2 is a chromosomal protein which binds to DNA that is methylated at CpG. In situ immunofluorescence in mouse cells has shown that the protein is most concentrated in pericentromeric heterochromatin, suggesting that MeCP2 may play a role in the formation of inert chromatin. Here we have isolated a minimal methyl-CpG binding domain (MBD) from MeCP2. MBD is 85 amino acids in length, and binds exclusively to DNA that contains one or more symmetrically methylated CpGs. MBD has negligable non-specific affinity for DNA, confirming that non-specific and methyl-CpG specific binding domains of MeCP2 are distinct. In vitro footprinting indicates that MBD binding can protect a 12 nucleotide region surrounding a methyl-CpG pair, with an approximate dissociation constant of 10(-9) M. Images PMID:8177735

  13. Secondary structure prediction and structure-specific sequence analysis of single-stranded DNA.

    PubMed

    Dong, F; Allawi, H T; Anderson, T; Neri, B P; Lyamichev, V I

    2001-08-01

    DNA sequence analysis by oligonucleotide binding is often affected by interference with the secondary structure of the target DNA. Here we describe an approach that improves DNA secondary structure prediction by combining enzymatic probing of DNA by structure-specific 5'-nucleases with an energy minimization algorithm that utilizes the 5'-nuclease cleavage sites as constraints. The method can identify structural differences between two DNA molecules caused by minor sequence variations such as a single nucleotide mutation. It also demonstrates the existence of long-range interactions between DNA regions separated by >300 nt and the formation of multiple alternative structures by a 244 nt DNA molecule. The differences in the secondary structure of DNA molecules revealed by 5'-nuclease probing were used to design structure-specific probes for mutation discrimination that target the regions of structural, rather than sequence, differences. We also demonstrate the performance of structure-specific 'bridge' probes complementary to non-contiguous regions of the target molecule. The structure-specific probes do not require the high stringency binding conditions necessary for methods based on mismatch formation and permit mutation detection at temperatures from 4 to 37 degrees C. Structure-specific sequence analysis is applied for mutation detection in the Mycobacterium tuberculosis katG gene and for genotyping of the hepatitis C virus.

  14. Monitoring conformational heterogeneity of the lid of DnaK substrate-binding domain during its chaperone cycle.

    PubMed

    Banerjee, Rupa; Jayaraj, Gopal Gunanathan; Peter, Joshua Jebakumar; Kumar, Vignesh; Mapa, Koyeli

    2016-08-01

    DnaK or Hsp70 of Escherichia coli is a master regulator of the bacterial proteostasis network. Allosteric communication between the two functional domains of DnaK, the N-terminal nucleotide-binding domain (NBD) and the C-terminal substrate- or peptide-binding domain (SBD) regulate its activity. X-ray crystallography and NMR studies have provided snapshots of distinct conformations of Hsp70 proteins in various physiological states; however, the conformational heterogeneity and dynamics of allostery-driven Hsp70 activity remains underexplored. In this work, we employed single-molecule Förster resonance energy transfer (sm-FRET) measurements to capture distinct intradomain conformational states of a region within the DnaK-SBD known as the lid. Our data conclusively demonstrate prominent conformational heterogeneity of the DnaK lid in ADP-bound states; in contrast, the ATP-bound open conformations are homogeneous. Interestingly, a nonhydrolysable ATP analogue, AMP-PNP, imparts heterogeneity to the lid conformations mimicking the ADP-bound state. The cochaperone DnaJ confers ADP-like heterogeneous lid conformations to DnaK, although the presence of the cochaperone accelerates the substrate-binding rate by a hitherto unknown mechanism. Irrespective of the presence of DnaJ, binding of a peptide substrate to the DnaK-SBD leads to prominent lid closure. Lid closure is only partial upon binding to molten globule-like authentic cellular substrates, probably to accommodate non-native substrate proteins of varied structures. © 2016 Federation of European Biochemical Societies.

  15. Interactions of the Metalloregulatory Protein SloR from Streptococcus mutans with Its Metal Ion Effectors and DNA Binding Site

    PubMed Central

    Corbett, John; Cornacchione, Louis; Daly, William; Galan, Diego; Wysota, Michael; Tivnan, Patrick; Collins, Justin; Nye, Dillon; Levitz, Talya; Breyer, Wendy A.; Glasfeld, Arthur

    2015-01-01

    ABSTRACT Streptococcus mutans is the causative agent of dental caries, a significant concern for human health, and therefore an attractive target for therapeutics development. Previous work in our laboratory has identified a homodimeric, manganese-dependent repressor protein, SloR, as an important regulator of cariogenesis and has used site-directed mutagenesis to map functions to specific regions of the protein. Here we extend those studies to better understand the structural interaction between SloR and its operator and its effector metal ions. The results of DNase I assays indicate that SloR protects a 42-bp region of DNA that overlaps the sloABC promoter on the S. mutans UA159 chromosome, while electrophoretic mobility shift and solution binding assays indicate that each of two SloR dimers binds to this region. Real-time semiquantitative reverse transcriptase PCR (real-time semi-qRT-PCR) experiments were used to determine the individual base pairs that contribute to SloR-DNA binding specificity. Solution studies indicate that Mn2+ is better than Zn2+ at specifically activating SloR to bind DNA, and yet the 2.8-Å resolved crystal structure of SloR bound to Zn2+ provides insight into the means by which selective activation by Mn2+ may be achieved and into how SloR may form specific interactions with its operator. Taken together, these experimental observations are significant because they can inform rational drug design aimed at alleviating and/or preventing S. mutans-induced caries formation. IMPORTANCE This report focuses on investigating the SloR protein as a regulator of essential metal ion transport and virulence gene expression in the oral pathogen Streptococcus mutans and on revealing the details of SloR binding to its metal ion effectors and binding to DNA that together facilitate this expression. We used molecular and biochemical approaches to characterize the interaction of SloR with Mn2+ and with its SloR recognition element to gain a clearer picture of the regulatory networks that optimize SloR-mediated metal ion homeostasis and virulence gene expression in S. mutans. These experiments can have a significant impact on caries treatment and/or prevention by revealing the S. mutans SloR-DNA binding interface as an appropriate target for the development of novel therapeutic interventions. PMID:26350131

  16. Binding and thermodynamics of REV peptide-ctDNA interaction.

    PubMed

    Upadhyay, Santosh Kumar

    2017-03-01

    The thermodynamics of DNA-ligand binding is important as it provides useful information to understand the details of binding processes. HIV-1 REV response element (RRE) located in the env coding region of the viral genome is reported to be well conserved across different HIV-1 isolates. In this study, the binding characteristics of Calf thymus DNA (ctDNA) and REV peptide from HIV-1 were investigated using spectroscopic (UV-visible, fluorescence, and circular dichroism (CD)) and isothermal titration calorimetric (ITC) techniques. Thermal stability and ligand binding properties of the ctDNA revealed that native ctDNA had a T m of 75.5 °C, whereas the ctDNA-REV peptide complex exhibited an incremental shift in the T m by 8 °C, indicating thermal stability of the complex. CD data indicated increased ellipticity due to large conformational changes in ctDNA molecule upon binding with REV peptide and two binding stoichiometric modes are apparent. The ctDNA experienced condensation due to large conformational changes in the presence of REV peptide and positive B→Ψ transition was observed at higher molar charge ratios. Fluorescence studies performed at several ligand concentrations revealed a gradual decrease in the fluorescence intensity of EtBr-bound ctDNA in response to increasing ligand concentrations. The fluorescence data further confirmed two stoichiometric modes of binding for ctDNA-REV peptide complex as previously observed with CD studies. The binding enthalpies were determined using ITC in the temperature range of 293 K-308 K. The ITC binding isotherm was exothermic at all temperatures examined, with low ΔH values indicating that the ctDNA-REV peptide interaction is driven largely by entropy. The heat capacity change (ΔC p ) was insignificant, an unusual finding in the area of DNA-peptide interaction studies. The variation in the values obtained for ΔH, ΔS, and ΔG with temperature further suggests that ctDNA-REV peptide interaction is entropically driven. ITC based analysis of salt dependence of binding constant gave a charge value (Z) = +4.01, as determined for the δlnK/δln[Na + ] parameter, suggesting the participation of only 3-4 Arg out of 11 Arg charge from REV peptide. The stoichiometry observed for the complex was three molar charge of REV peptide binding per molar charge of ctDNA. ITC based analysis further confirmed that the binding between ctDNA and REV peptide is governed by electrostatic interaction. Molecular interactions including H-bonding, van der Waals forces, and solvent molecules rearrangement, underlie the binding of REV peptide to ctDNA. © 2016 Wiley Periodicals, Inc.

  17. Vsx2 Controls Eye Organogenesis and Retinal Progenitor Identity Via Homeodomain and Non-Homeodomain Residues Required for High Affinity DNA Binding

    PubMed Central

    Zou, Changjiang; Levine, Edward M.

    2012-01-01

    The homeodomain and adjacent CVC domain in the visual system homeobox (VSX) proteins are conserved from nematodes to humans. Humans with missense mutations in these regions of VSX2 have microphthalmia, suggesting both regions are critical for function. To assess this, we generated the corresponding mutations in mouse Vsx2. The homeodomain mutant protein lacked DNA binding activity and the knock-in mutant phenocopied the null mutant, ocular retardation J. The CVC mutant protein exhibited weakened DNA binding; and, although the corresponding knock-in allele was recessive, it unexpectedly caused the strongest phenotype, as indicated by severe microphthalmia and hyperpigmentation of the neural retina. This occurred through a cryptic transcriptional feedback loop involving the transcription factors Mitf and Otx1 and the Cdk inhibitor p27Kip1. Our data suggest that the phenotypic severity of the CVC mutant depends on the weakened DNA binding activity elicited by the CVC mutation and a previously unknown protein interaction between Vsx2 and its regulatory target Mitf. Our data also suggest that an essential function of the CVC domain is to assist the homeodomain in high-affinity DNA binding, which is required for eye organogenesis and unhindered execution of the retinal progenitor program in mammals. Finally, the genetic and phenotypic behaviors of the CVC mutation suggest it has the characteristics of a recessive neomorph, a rare type of genetic allele. PMID:23028343

  18. The basic leucine zipper domain of c-Jun functions in transcriptional activation through interaction with the N terminus of human TATA-binding protein-associated factor-1 (human TAF(II)250).

    PubMed

    Lively, Tricia N; Nguyen, Tuan N; Galasinski, Shelly K; Goodrich, James A

    2004-06-18

    We previously reported that c-Jun binds directly to the N-terminal 163 amino acids of Homo sapiens TATA-binding protein-associated factor-1 (hsTAF1), causing a derepression of transcription factor IID (TFIID)-driven transcription (Lively, T. N., Ferguson, H. A., Galasinski, S. K., Seto, A. G., and Goodrich, J. A. (2001) J. Biol. Chem. 276, 25582-25588). This region of hsTAF1 binds TATA-binding protein to repress TFIID DNA binding and transcription. Here we show that the basic leucine zipper domain of c-Jun, which allows for DNA binding and homodimerization, is necessary and sufficient for interaction with hsTAF1. Interestingly, the isolated basic leucine zipper domain of c-Jun was able to derepress TFIID-directed basal transcription in vitro. Moreover, when the N-terminal region of hsTAF1 was added to in vitro transcription reactions and overexpressed in cells, it blocked c-Jun activation. c-Fos, another basic leucine zipper protein, did not interact with hsTAF1, but c-Fos/c-Jun heterodimers did bind the N terminus of hsTAF1. Our studies show that, in addition to dimerization and DNA binding, the well characterized basic leucine zipper domain of c-Jun functions in transcriptional activation by binding to the N terminus of hsTAF1 to derepress transcription.

  19. Rad52 competes with Ku70/Ku86 for binding to S-region DSB ends to modulate antibody class-switch DNA recombination

    PubMed Central

    Zan, Hong; Tat, Connie; Qiu, Zhifang; Taylor, Julia R.; Guerrero, Justin A.; Shen, Tian; Casali, Paolo

    2017-01-01

    Antibody class-switch DNA recombination (CSR) is initiated by AID-introduced DSBs in the switch (S) regions targeted for recombination, as effected by Ku70/Ku86-mediated NHEJ. Ku-deficient B cells, however, undergo (reduced) CSR through an alternative(A)-NHEJ pathway, which introduces microhomologies in S–S junctions. As microhomology-mediated end-joining requires annealing of single-strand DNA ends, we addressed the contribution of single-strand annealing factors HR Rad52 and translesion DNA polymerase θ to CSR. Compared with their Rad52+/+ counterparts, which display normal CSR, Rad52−/− B cells show increased CSR, fewer intra-Sμ region recombinations, no/minimal microhomologies in S–S junctions, decreased c-Myc/IgH translocations and increased Ku70/Ku86 recruitment to S-region DSB ends. Rad52 competes with Ku70/Ku86 for binding to S-region DSB ends. It also facilitates a Ku-independent DSB repair, which favours intra-S region recombination and mediates, particularly in Ku absence, inter-S–S recombination, as emphasized by the significantly greater CSR reduction in Rad52−/− versus Rad52+/+ B cells on Ku86 knockdown. PMID:28176781

  20. Rad52 competes with Ku70/Ku86 for binding to S-region DSB ends to modulate antibody class-switch DNA recombination.

    PubMed

    Zan, Hong; Tat, Connie; Qiu, Zhifang; Taylor, Julia R; Guerrero, Justin A; Shen, Tian; Casali, Paolo

    2017-02-08

    Antibody class-switch DNA recombination (CSR) is initiated by AID-introduced DSBs in the switch (S) regions targeted for recombination, as effected by Ku70/Ku86-mediated NHEJ. Ku-deficient B cells, however, undergo (reduced) CSR through an alternative(A)-NHEJ pathway, which introduces microhomologies in S-S junctions. As microhomology-mediated end-joining requires annealing of single-strand DNA ends, we addressed the contribution of single-strand annealing factors HR Rad52 and translesion DNA polymerase θ to CSR. Compared with their Rad52 +/+ counterparts, which display normal CSR, Rad52 -/- B cells show increased CSR, fewer intra-Sμ region recombinations, no/minimal microhomologies in S-S junctions, decreased c-Myc/IgH translocations and increased Ku70/Ku86 recruitment to S-region DSB ends. Rad52 competes with Ku70/Ku86 for binding to S-region DSB ends. It also facilitates a Ku-independent DSB repair, which favours intra-S region recombination and mediates, particularly in Ku absence, inter-S-S recombination, as emphasized by the significantly greater CSR reduction in Rad52 -/- versus Rad52 +/+ B cells on Ku86 knockdown.

  1. DNA condensing effects and sequence selectivity of DNA binding of antitumor noncovalent polynuclear platinum complexes.

    PubMed

    Malina, Jaroslav; Farrell, Nicholas P; Brabec, Viktor

    2014-02-03

    The noncovalent analogues of antitumor polynuclear platinum complexes represent a structurally discrete class of platinum drugs. Their chemical and biological properties differ significantly from those of most platinum chemotherapeutics, which bind to DNA in a covalent manner by formation of Pt-DNA adducts. In spite of the fact that these noncovalent polynuclear platinum complexes contain no leaving groups, they have been shown to bind to DNA with high affinity. We report here on the DNA condensation properties of a series of noncovalent analogues of antitumor polynuclear platinum complexes described by biophysical and biochemical methods. The results demonstrate that these polynuclear platinum compounds are capable of inducing DNA condensation at more than 1 order of magnitude lower concentrations than conventional spermine. Atomic force microscopy studies of DNA condensation confined to a mica substrate have revealed that the DNA morphologies become more compact with increasing concentration of the platinum complexes. Moreover, we also found that the noncovalent polynuclear platinum complex [{Pt(NH3)3}2-μ-{trans-Pt(NH3)2(NH2(CH2)6NH2)2}](6+) (TriplatinNC-A) binds to DNA in a sequence-dependent manner, namely, to A/T-rich sequences and A-tract regions, and that noncovalent polynuclear platinum complexes protect DNA from enzymatic cleavage by DNase I. The results suggest that mechanisms of antitumor and cytotoxic activities of these complexes may be associated with their unique ability to condense DNA along with their sequence-specific DNA binding. Owing to their high cellular accumulation, it is also reasonable to suggest that their mechanism of action is based on the competition with naturally occurring DNA condensing agents, such as polyamines spermine, spermidine, and putrescine, for intracellular binding sites, resulting in the disturbance of the correct binding of regulatory proteins initiating the onset of apoptosis.

  2. BLM and RMI1 alleviate RPA inhibition of TopoIIIα decatenase activity.

    PubMed

    Yang, Jay; Bachrati, Csanad Z; Hickson, Ian D; Brown, Grant W

    2012-01-01

    RPA is a single-stranded DNA binding protein that physically associates with the BLM complex. RPA stimulates BLM helicase activity as well as the double Holliday junction dissolution activity of the BLM-topoisomerase IIIα complex. We investigated the effect of RPA on the ssDNA decatenase activity of topoisomerase IIIα. We found that RPA and other ssDNA binding proteins inhibit decatenation by topoisomerase IIIα. Complex formation between BLM, TopoIIIα, and RMI1 ablates inhibition of decatenation by ssDNA binding proteins. Together, these data indicate that inhibition by RPA does not involve species-specific interactions between RPA and BLM-TopoIIIα-RMI1, which contrasts with RPA modulation of double Holliday junction dissolution. We propose that topoisomerase IIIα and RPA compete to bind to single-stranded regions of catenanes. Interactions with BLM and RMI1 enhance toposiomerase IIIα activity, promoting decatenation in the presence of RPA.

  3. Binding of resveratrol to the minor groove of DNA sequences with AATT and TTAA segments induces differential stability.

    PubMed

    Nair, Maya S; D'Mello, Samar; Pant, Rashmi; Poluri, Krishna Mohan

    2017-05-01

    Interactions of a natural stilbene compound, resveratrol with two DNA sequences containing AATT/TTAA segments have been studied. Resveratrol is found to interact with both the sequences. The mode of interaction has been studied using absorption, steady state fluorescence and circular dichroism spectroscopic techniques. UV-visible absorption and fluorescence studies provided the information regarding the binding constants and the stoichiometry of binding, whereas circular dichroism studies depicted the structural changes in DNA upon resveratrol binding. Our results evidenced that, though resveratrol showed similar affinity to both the sequences, the mode of interactions was different. The binding constants of resveratrol to AATT/TTAA sequences were found to be 7.55×10 5 M -1 and 5.42×10 5 M -1 respectively. Spectroscopic data evidenced for a groove binding interaction. Melting studies showed that the binding of resveratrol induces differential stability to the DNA sequences d(CGTTAACG) 2 and d(CGAATTCG) 2 . Fluorescence data showed a stoichiometry of 1:1 for d(CGAATTCG) 2 -resveratrol complex and 1:4 for d(CGTTAACG) 2 -resveratrol complex. Molecular docking studies demonstrated that resveratrol binds to the minor groove region of both the sequences to form stable complexes with varied atomic contacts to the DNA bases or backbone. Both the complexes are stabilized by hydrogen bond formation. Our results evidenced that modulation of DNA sequence within the same bases can greatly alter the binding geometry and stability of the complex upon binding to small molecule inhibitor compounds like resveratrol. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Cryptic MCAT enhancer regulation in fibroblasts and smooth muscle cells. Suppression of TEF-1 mediated activation by the single-stranded DNA-binding proteins, Pur alpha, Pur beta, and MSY1.

    PubMed

    Carlini, Leslie E; Getz, Michael J; Strauch, Arthur R; Kelm, Robert J

    2002-03-08

    An asymmetric polypurine-polypyrimidine cis-element located in the 5' region of the mouse vascular smooth muscle alpha-actin gene serves as a binding site for multiple proteins with specific affinity for either single- or double-stranded DNA. Here, we test the hypothesis that single-stranded DNA-binding proteins are responsible for preventing a cryptic MCAT enhancer centered within this element from cooperating with a nearby serum response factor-interacting CArG motif to trans-activate the minimal promoter in fibroblasts and smooth muscle cells. DNA binding studies revealed that the core MCAT sequence mediates binding of transcription enhancer factor-1 to the double-stranded polypurine-polypyrimidine element while flanking nucleotides account for interaction of Pur alpha and Pur beta with the purine-rich strand and MSY1 with the complementary pyrimidine-rich strand. Mutations that selectively impaired high affinity single-stranded DNA binding by fibroblast or smooth muscle cell-derived Pur alpha, Pur beta, and MSY1 in vitro, released the cryptic MCAT enhancer from repression in transfected cells. Additional experiments indicated that Pur alpha, Pur beta, and MSY1 also interact specifically, albeit weakly, with double-stranded DNA and with transcription enhancer factor-1. These results are consistent with two plausible models of cryptic MCAT enhancer regulation by Pur alpha, Pur beta, and MSY1 involving either competitive single-stranded DNA binding or masking of MCAT-bound transcription enhancer factor-1.

  5. Structure and DNA-Binding Sites of the SWI1 AT-rich Interaction Domain (ARID) Suggest Determinants for Sequence-Specific DNA Recognition

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Suhkmann; Zhang, Ziming; Upchurch, Sean

    2004-04-16

    2 ARID is a homologous family of DNA-binding domains that occur in DNA binding proteins from a wide variety of species, ranging from yeast to nematodes, insects, mammals and plants. SWI1, a member of the SWI/SNF protein complex that is involved in chromatin remodeling during transcription, contains the ARID motif. The ARID domain of human SWI1 (also known as p270) does not select for a specific DNA sequence from a random sequence pool. The lack of sequence specificity shown by the SWI1 ARID domain stands in contrast to the other characterized ARID domains, which recognize specific AT-rich sequences. We havemore » solved the three-dimensional structure of human SWI1 ARID using solution NMR methods. In addition, we have characterized non-specific DNA-binding by the SWI1 ARID domain. Results from this study indicate that a flexible long internal loop in ARID motif is likely to be important for sequence specific DNA-recognition. The structure of human SWI1 ARID domain also represents a distinct structural subfamily. Studies of ARID indicate that boundary of the DNA binding structural and functional domains can extend beyond the sequence homologous region in a homologous family of proteins. Structural studies of homologous domains such as ARID family of DNA-binding domains should provide information to better predict the boundary of structural and functional domains in structural genomic studies. Key Words: ARID, SWI1, NMR, structural genomics, protein-DNA interaction.« less

  6. Transcription Factors Bind Thousands of Active and InactiveRegions in the Drosophila Blastoderm

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Xiao-Yong; MacArthur, Stewart; Bourgon, Richard

    2008-01-10

    Identifying the genomic regions bound by sequence-specific regulatory factors is central both to deciphering the complex DNA cis-regulatory code that controls transcription in metazoans and to determining the range of genes that shape animal morphogenesis. Here, we use whole-genome tiling arrays to map sequences bound in Drosophila melanogaster embryos by the six maternal and gap transcription factors that initiate anterior-posterior patterning. We find that these sequence-specific DNA binding proteins bind with quantitatively different specificities to highly overlapping sets of several thousand genomic regions in blastoderm embryos. Specific high- and moderate-affinity in vitro recognition sequences for each factor are enriched inmore » bound regions. This enrichment, however, is not sufficient to explain the pattern of binding in vivo and varies in a context-dependent manner, demonstrating that higher-order rules must govern targeting of transcription factors. The more highly bound regions include all of the over forty well-characterized enhancers known to respond to these factors as well as several hundred putative new cis-regulatory modules clustered near developmental regulators and other genes with patterned expression at this stage of embryogenesis. The new targets include most of the microRNAs (miRNAs) transcribed in the blastoderm, as well as all major zygotically transcribed dorsal-ventral patterning genes, whose expression we show to be quantitatively modulated by anterior-posterior factors. In addition to these highly bound regions, there are several thousand regions that are reproducibly bound at lower levels. However, these poorly bound regions are, collectively, far more distant from genes transcribed in the blastoderm than highly bound regions; are preferentially found in protein-coding sequences; and are less conserved than highly bound regions. Together these observations suggest that many of these poorly-bound regions are not involved in early-embryonic transcriptional regulation, and a significant proportion may be nonfunctional. Surprisingly, for five of the six factors, their recognition sites are not unambiguously more constrained evolutionarily than the immediate flanking DNA, even in more highly bound and presumably functional regions, indicating that comparative DNA sequence analysis is limited in its ability to identify functional transcription factor targets.« less

  7. Solution structure of telomere binding domain of AtTRB2 derived from Arabidopsis thaliana

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yun, Ji-Hye; Lee, Won Kyung; Kim, Heeyoun

    Highlights: • We have determined solution structure of Myb domain of AtTRB2. • The Myb domain of AtTRB2 is located in the N-terminal region. • The Myb domain of AtTRB2 binds to plant telomeric DNA without fourth helix. • Helix 2 and 3 of the Myb domain of AtTRB2 are involved in DNA recognition. • AtTRB2 is a novel protein distinguished from other known plant TBP. - Abstract: Telomere homeostasis is regulated by telomere-associated proteins, and the Myb domain is well conserved for telomere binding. AtTRB2 is a member of the SMH (Single-Myb-Histone)-like family in Arabidopsis thaliana, having an N-terminalmore » Myb domain, which is responsible for DNA binding. The Myb domain of AtTRB2 contains three α-helices and loops for DNA binding, which is unusual given that other plant telomere-binding proteins have an additional fourth helix that is essential for DNA binding. To understand the structural role for telomeric DNA binding of AtTRB2, we determined the solution structure of the Myb domain of AtTRB2 (AtTRB2{sub 1–64}) using nuclear magnetic resonance (NMR) spectroscopy. In addition, the inter-molecular interaction between AtTRB2{sub 1–64} and telomeric DNA has been characterized by the electrophoretic mobility shift assay (EMSA) and NMR titration analyses for both plant (TTTAGGG)n and human (TTAGGG)n telomere sequences. Data revealed that Trp28, Arg29, and Val47 residues located in Helix 2 and Helix 3 are crucial for DNA binding, which are well conserved among other plant telomere binding proteins. We concluded that although AtTRB2 is devoid of the additional fourth helix in the Myb-extension domain, it is able to bind to plant telomeric repeat sequences as well as human telomeric repeat sequences.« less

  8. The global repressor FliZ antagonizes gene expression by σS-containing RNA polymerase due to overlapping DNA binding specificity.

    PubMed

    Pesavento, Christina; Hengge, Regine

    2012-06-01

    FliZ, a global regulatory protein under the control of the flagellar master regulator FlhDC, was shown to antagonize σ(S)-dependent gene expression in Escherichia coli. Thereby it plays a pivotal role in the decision between alternative life-styles, i.e. FlhDC-controlled flagellum-based motility or σ(S)-dependent curli fimbriae-mediated adhesion and biofilm formation. Here, we show that FliZ is an abundant DNA-binding protein that inhibits gene expression mediated by σ(S) by recognizing operator sequences that resemble the -10 region of σ(S)-dependent promoters. FliZ does so with a structural element that is similar to region 3.0 of σ(S). Within this element, R108 in FliZ corresponds to K173 in σ(S), which contacts a conserved cytosine at the -13 promoter position that is specific for σ(S)-dependent promoters. R108 as well as C(-13) are also crucial for DNA binding by FliZ. However, while a number of FliZ binding sites correspond to known σ(S)-dependent promoters, promoter activity is not a prerequisite for FliZ binding and repressor function. Thus, we demonstrate that FliZ also feedback-controls flagellar gene expression by binding to a site in the flhDC control region that shows similarity only to a -10 element of a σ(S)-dependent promoter, but does not function as a promoter.

  9. MIRA: An R package for DNA methylation-based inference of regulatory activity.

    PubMed

    Lawson, John T; Tomazou, Eleni M; Bock, Christoph; Sheffield, Nathan C

    2018-03-01

    DNA methylation contains information about the regulatory state of the cell. MIRA aggregates genome-scale DNA methylation data into a DNA methylation profile for independent region sets with shared biological annotation. Using this profile, MIRA infers and scores the collective regulatory activity for each region set. MIRA facilitates regulatory analysis in situations where classical regulatory assays would be difficult and allows public sources of open chromatin and protein binding regions to be leveraged for novel insight into the regulatory state of DNA methylation datasets. R package available on Bioconductor: http://bioconductor.org/packages/release/bioc/html/MIRA.html. nsheffield@virginia.edu.

  10. Identification and verification of hybridoma-derived monoclonal antibody variable region sequences using recombinant DNA technology and mass spectrometry

    USDA-ARS?s Scientific Manuscript database

    Antibody engineering requires the identification of antigen binding domains or variable regions (VR) unique to each antibody. It is the VR that define the unique antigen binding properties and proper sequence identification is essential for functional evaluation and performance of recombinant antibo...

  11. Crystal Structure of Mycobacterium tuberculosis H37Rv AldR (Rv2779c), a Regulator of the ald Gene: DNA BINDING AND IDENTIFICATION OF SMALL MOLECULE INHIBITORS.

    PubMed

    Dey, Abhishek; Shree, Sonal; Pandey, Sarvesh Kumar; Tripathi, Rama Pati; Ramachandran, Ravishankar

    2016-06-03

    Here we report the crystal structure of M. tuberculosis AldR (Rv2779c) showing that the N-terminal DNA-binding domains are swapped, forming a dimer, and four dimers are assembled into an octamer through crystal symmetry. The C-terminal domain is involved in oligomeric interactions that stabilize the oligomer, and it contains the effector-binding sites. The latter sites are 30-60% larger compared with homologs like MtbFFRP (Rv3291c) and can consequently accommodate larger molecules. MtbAldR binds to the region upstream to the ald gene that is highly up-regulated in nutrient-starved tuberculosis models and codes for l-alanine dehydrogenase (MtbAld; Rv2780). Further, the MtbAldR-DNA complex is inhibited upon binding of Ala, Tyr, Trp and Asp to the protein. Studies involving a ligand-binding site G131T mutant show that the mutant forms a DNA complex that cannot be inhibited by adding the amino acids. Comparative studies suggest that binding of the amino acids changes the relative spatial disposition of the DNA-binding domains and thereby disrupt the protein-DNA complex. Finally, we identified small molecules, including a tetrahydroquinoline carbonitrile derivative (S010-0261), that inhibit the MtbAldR-DNA complex. The latter molecules represent the very first inhibitors of a feast/famine regulatory protein from any source and set the stage for exploring MtbAldR as a potential anti-tuberculosis target. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

    PubMed Central

    Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

    1998-01-01

    The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery. PMID:9811800

  13. Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

    PubMed

    Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

    1998-11-01

    The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery.

  14. Comparison of Genome-Wide Binding of MyoD in Normal Human Myogenic Cells and Rhabdomyosarcomas Identifies Regional and Local Suppression of Promyogenic Transcription Factors

    PubMed Central

    MacQuarrie, Kyle L.; Yao, Zizhen; Fong, Abraham P.; Diede, Scott J.; Rudzinski, Erin R.; Hawkins, Douglas S.

    2013-01-01

    Rhabdomyosarcoma is a pediatric tumor of skeletal muscle that expresses the myogenic basic helix-loop-helix protein MyoD but fails to undergo terminal differentiation. Prior work has determined that DNA binding by MyoD occurs in the tumor cells, but myogenic targets fail to activate. Using MyoD chromatin immunoprecipitation coupled to high-throughput sequencing and gene expression analysis in both primary human muscle cells and RD rhabdomyosarcoma cells, we demonstrate that MyoD binds in a similar genome-wide pattern in both tumor and normal cells but binds poorly at a subset of myogenic genes that fail to activate in the tumor cells. Binding differences are found both across genomic regions and locally at specific sites that are associated with binding motifs for RUNX1, MEF2C, JDP2, and NFIC. These factors are expressed at lower levels in RD cells than muscle cells and rescue myogenesis when expressed in RD cells. MEF2C is located in a genomic region that exhibits poor MyoD binding in RD cells, whereas JDP2 exhibits local DNA hypermethylation in its promoter in both RD cells and primary tumor samples. These results demonstrate that regional and local silencing of differentiation factors contributes to the differentiation defect in rhabdomyosarcomas. PMID:23230269

  15. Specific DNA binding of a potential transcriptional regulator, inosine 5'-monophosphate dehydrogenase-related protein VII, to the promoter region of a methyl coenzyme m reductase I-encoding operon retrieved from Methanothermobacter thermautotrophicus strain DeltaH.

    PubMed

    Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi

    2008-10-01

    Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus DeltaH are expressed in response to H(2) availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cultures restricted them to 46- and 41-bp-long mcr and mrt upstream regions, respectively. Affinity particle purification of DNA-binding proteins conjugated with putative operator regions resulted in the retrieval of a protein attributed to IMP dehydrogenase-related protein VII (IMPDH VII). IMPDH VII is predicted to have a winged helix-turn-helix DNA-binding motif and two cystathionine beta-synthase domains, and it has been suspected to be an energy-sensing module. EMSA with oligonucleotide probes with unusual sequences showed that the binding site of IMPDH VII mostly overlaps the factor B-responsible element-TATA box of the mcr operon. The results presented here suggest that IMPDH VII encoded by MTH126 is a plausible candidate for the transcriptional regulator of the mcr operon in this methanogen.

  16. Phyloscan: locating transcription-regulating binding sites in mixed aligned and unaligned sequence data.

    PubMed

    Palumbo, Michael J; Newberg, Lee A

    2010-07-01

    The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).

  17. Structure-based Analysis to Hu-DNA Binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Swinger,K.; Rice, P.

    2007-01-01

    HU and IHF are prokaryotic proteins that induce very large bends in DNA. They are present in high concentrations in the bacterial nucleoid and aid in chromosomal compaction. They also function as regulatory cofactors in many processes, such as site-specific recombination and the initiation of replication and transcription. HU and IHF have become paradigms for understanding DNA bending and indirect readout of sequence. While IHF shows significant sequence specificity, HU binds preferentially to certain damaged or distorted DNAs. However, none of the structurally diverse HU substrates previously studied in vitro is identical with the distorted substrates in the recently publishedmore » Anabaena HU(AHU)-DNA cocrystal structures. Here, we report binding affinities for AHU and the DNA in the cocrystal structures. The binding free energies for formation of these AHU-DNA complexes range from 10-14.5 kcal/mol, representing K{sub d} values in the nanomolar to low picomolar range, and a maximum stabilization of at least 6.3 kcal/mol relative to complexes with undistorted, non-specific DNA. We investigated IHF binding and found that appropriate structural distortions can greatly enhance its affinity. On the basis of the coupling of structural and relevant binding data, we estimate the amount of conformational strain in an IHF-mediated DNA kink that is relieved by a nick (at least 0.76 kcal/mol) and pinpoint the location of the strain. We show that AHU has a sequence preference for an A+T-rich region in the center of its DNA-binding site, correlating with an unusually narrow minor groove. This is similar to sequence preferences shown by the eukaryotic nucleosome.« less

  18. Exploring the Interactions of the Dietary Plant Flavonoids Fisetin and Naringenin with G-Quadruplex and Duplex DNA, Showing Contrasting Binding Behavior: Spectroscopic and Molecular Modeling Approaches.

    PubMed

    Bhattacharjee, Snehasish; Chakraborty, Sandipan; Sengupta, Pradeep K; Bhowmik, Sudipta

    2016-09-01

    Guanine-rich sequences have the propensity to fold into a four-stranded DNA structure known as a G-quadruplex (G4). G4 forming sequences are abundant in the promoter region of several oncogenes and become a key target for anticancer drug binding. Here we have studied the interactions of two structurally similar dietary plant flavonoids fisetin and naringenin with G4 as well as double stranded (duplex) DNA by using different spectroscopic and modeling techniques. Our study demonstrates the differential binding ability of the two flavonoids with G4 and duplex DNA. Fisetin more strongly interacts with parallel G4 structure than duplex DNA, whereas naringenin shows stronger binding affinity to duplex rather than G4 DNA. Molecular docking results also corroborate our spectroscopic results, and it was found that both of the ligands are stacked externally in the G4 DNA structure. C-ring planarity of the flavonoid structure appears to be a crucial factor for preferential G4 DNA recognition of flavonoids. The goal of this study is to explore the critical effects of small differences in the structure of closely similar chemical classes of such small molecules (flavonoids) which lead to the contrasting binding properties with the two different forms of DNA. The resulting insights may be expected to facilitate the designing of the highly selective G4 DNA binders based on flavonoid scaffolds.

  19. A crystal structure of the bifunctional antibiotic simocyclinone D8, bound to DNA gyrase.

    PubMed

    Edwards, Marcus J; Flatman, Ruth H; Mitchenall, Lesley A; Stevenson, Clare E M; Le, Tung B K; Clarke, Thomas A; McKay, Adam R; Fiedler, Hans-Peter; Buttner, Mark J; Lawson, David M; Maxwell, Anthony

    2009-12-04

    Simocyclinones are bifunctional antibiotics that inhibit bacterial DNA gyrase by preventing DNA binding to the enzyme. We report the crystal structure of the complex formed between the N-terminal domain of the Escherichia coli gyrase A subunit and simocyclinone D8, revealing two binding pockets that separately accommodate the aminocoumarin and polyketide moieties of the antibiotic. These are close to, but distinct from, the quinolone-binding site, consistent with our observations that several mutations in this region confer resistance to both agents. Biochemical studies show that the individual moieties of simocyclinone D8 are comparatively weak inhibitors of gyrase relative to the parent compound, but their combination generates a more potent inhibitor. Our results should facilitate the design of drug molecules that target these unexploited binding pockets.

  20. Analysis of DNA-binding sites on Mhr1, a yeast mitochondrial ATP-independent homologous pairing protein.

    PubMed

    Masuda, Tokiha; Ling, Feng; Shibata, Takehiko; Mikawa, Tsutomu

    2010-03-01

    The Mhr1 protein is necessary for mtDNA homologous recombination in Saccharomyces cerevisiae. Homologous pairing (HP) is an essential reaction during homologous recombination, and is generally catalyzed by the RecA/Rad51 family of proteins in an ATP-dependent manner. Mhr1 catalyzes HP through a mechanism similar, at the DNA level, to that of the RecA/Rad51 proteins, but without utilizing ATP. However, it has no sequence homology with the RecA/Rad51 family proteins or with other ATP-independent HP proteins, and exhibits different requirements for DNA topology. We are interested in the structural features of the functional domains of Mhr1. In this study, we employed the native fluorescence of Mhr1's Trp residues to examine the energy transfer from the Trp residues to etheno-modified ssDNA bound to Mhr1. Our results showed that two of the seven Trp residues (Trp71 and Trp165) are spatially close to the bound DNA. A systematic analysis of mutant Mhr1 proteins revealed that Asp69 is involved in Mg(2+)-dependent DNA binding, and that multiple Lys and Arg residues located around Trp71 and Trp165 are involved in the DNA-binding activity of Mhr1. In addition, in vivo complementation analyses showed that a region around Trp165 is important for the maintenance of mtDNA. On the basis of these results, we discuss the function of the region surrounding Trp165.

  1. Novel TDP2-ubiquitin interactions and their importance for the repair of topoisomerase II-mediated DNA damage

    PubMed Central

    Rao, Timsi; Gao, Rui; Takada, Saeko; Al Abo, Muthana; Chen, Xiang; Walters, Kylie J.; Pommier, Yves; Aihara, Hideki

    2016-01-01

    Tyrosyl DNA phosphodiesterase 2 (TDP2) is a multifunctional protein implicated in DNA repair, signal transduction and transcriptional regulation. In its DNA repair role, TDP2 safeguards genome integrity by hydrolyzing 5′-tyrosyl DNA adducts formed by abortive topoisomerase II (Top2) cleavage complexes to allow error-free repair of DNA double-strand breaks, thereby conferring cellular resistance against Top2 poisons. TDP2 consists of a C-terminal catalytic domain responsible for its phosphodiesterase activity, and a functionally uncharacterized N-terminal region. Here, we demonstrate that this N-terminal region contains a ubiquitin (Ub)-associated (UBA) domain capable of binding multiple forms of Ub with distinct modes of interactions and preference for either K48- or K63-linked polyUbs over monoUb. The structure of TDP2 UBA bound to monoUb shows a canonical mode of UBA-Ub interaction. However, the absence of the highly conserved MGF motif and the presence of a fourth α-helix make TDP2 UBA distinct from other known UBAs. Mutations in the TDP2 UBA-Ub binding interface do not affect nuclear import of TDP2, but severely compromise its ability to repair Top2-mediated DNA damage, thus establishing the importance of the TDP2 UBA–Ub interaction in DNA repair. The differential binding to multiple Ub forms could be important for responding to DNA damage signals under different contexts or to support the multi-functionality of TDP2. PMID:27543075

  2. Study on the interaction of triadimenol with calf thymus DNA by multispectroscopic methods and molecular modeling

    NASA Astrophysics Data System (ADS)

    Zhang, Yepeng; Zhang, Guowen; Fu, Peng; Ma, Yadi; Zhou, Jia

    2012-10-01

    The binding mechanism of triadimenol (NOL) to calf thymus DNA (ctDNA) in physiological buffer (pH 7.4) was investigated by multispectroscopic methods including UV-vis absorption, fluorescence, circular dichroism (CD), Fourier transform infrared (FT-IR), and nuclear magnetic resonance (1H NMR) spectroscopy, coupled with viscosity measurements and atomic force microscopy (AFM) technique. The results suggested that NOL interacted with ctDNA by intercalation mode. CD and AFM assays showed that NOL can damage the base stacking of ctDNA and result in regional cleavage of the two DNA strands. FT-IR and 1H NMR spectra coupled with molecular docking revealed that a specific binding mainly exists between NOL and G-C base pairs of the ctDNA where two hydrogen bonds form. Moreover, the association constants of NOL with DNA at three different temperatures were determined to be in the 103 L mol-1 range. The calculated thermodynamic parameters suggested that the binding of NOL to ctDNA was driven mainly by hydrogen bond and van der Waals.

  3. Topography of the ISW2–nucleosome complex: insights into nucleosome spacing and chromatin remodeling

    PubMed Central

    Kagalwala, Mohamedi N; Glaus, Benjamin J; Dang, Weiwei; Zofall, Martin; Bartholomew, Blaine

    2004-01-01

    Linker DNA was found to be critical for the specific docking of ISW2 with nucleosomes as shown by mapping the physical contacts of ISW2 with nucleosomes at base-pair resolution. Hydroxyl radical footprinting revealed that ISW2 not only extensively interacts with the linker DNA, but also approaches the nucleosome from the side perpendicular to the axis of the DNA superhelix and contacts two disparate sites on the nucleosomal DNA from opposite sides of the superhelix. The topography of the ISW2–nucleosome was further delineated by finding which of the ISW2 subunits are proximal to specific sites within the linker and nucleosomal DNA regions by site-directed DNA photoaffinity labeling. Although ISW2 was shown to contact ∼63 bp of linker DNA, a minimum of 20 bp of linker DNA was required for stable binding of ISW2 to nucleosomes. The remaining ∼43 bp of flanking linker DNA promoted more efficient binding under competitive binding conditions and was functionally important for enhanced sliding of nucleosomes when ISW2 was significantly limiting. PMID:15131696

  4. The Kaposi Sarcoma Herpesvirus Latency-associated Nuclear Antigen DNA Binding Domain Dorsal Positive Electrostatic Patch Facilitates DNA Replication and Episome Persistence*

    PubMed Central

    Li, Shijun; Tan, Min; Juillard, Franceline; Ponnusamy, Rajesh; Correia, Bruno; Simas, J. Pedro; Carrondo, Maria A.; McVey, Colin E.; Kaye, Kenneth M.

    2015-01-01

    Kaposi sarcoma-associated herpesvirus (KSHV) has a causative role in several human malignancies. KSHV latency-associated nuclear antigen (LANA) mediates persistence of viral episomes in latently infected cells. LANA mediates KSHV DNA replication and segregates episomes to progeny nuclei. The structure of the LANA DNA binding domain was recently solved, revealing a positive electrostatic patch opposite the DNA binding surface, which is the site of BET protein binding. Here we investigate the functional role of the positive patch in LANA-mediated episome persistence. As expected, LANA mutants with alanine or glutamate substitutions in the central, peripheral, or lateral portions of the positive patch maintained the ability to bind DNA by EMSA. However, all of the substitution mutants were deficient for LANA DNA replication and episome maintenance. Mutation of the peripheral region generated the largest deficiencies. Despite these deficiencies, all positive patch mutants concentrated to dots along mitotic chromosomes in cells containing episomes, similar to LANA. The central and peripheral mutants, but not the lateral mutants, were reduced for BET protein interaction as assessed by co-immunoprecipitation. However, defects in BET protein binding were independent of episome maintenance function. Overall, the reductions in episome maintenance closely correlated with DNA replication deficiencies, suggesting that the replication defects account for the reduced episome persistence. Therefore, the electrostatic patch exerts a key role in LANA-mediated DNA replication and episome persistence and may act through a host cell partner(s) other than a BET protein or by inducing specific structures or complexes. PMID:26420481

  5. Asymmetric Assembly of Merkel Cell Polyomavirus Large T-Antigen Origin Binding Domains at the Viral Origin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    C Harrison; G Meinke; H Kwun

    2011-12-31

    The double-stranded DNA polyomavirus Merkel cell polyomavirus (MCV) causes Merkel cell carcinoma, an aggressive but rare human skin cancer that most often affects immunosuppressed and elderly persons. As in other polyomaviruses, the large T-antigen of MCV recognizes the viral origin of replication by binding repeating G(A/G)GGC pentamers. The spacing, number, orientation, and necessity of repeats for viral replication differ, however, from other family members such as SV40 and murine polyomavirus. We report here the 2.9 {angstrom} crystal structure of the MCV large T-antigen origin binding domain (OBD) in complex with a DNA fragment from the MCV origin of replication. Consistentmore » with replication data showing that three of the G(A/G)GGC-like binding sites near the center of the origin are required for replication, the crystal structure contains three copies of the OBD. This stoichiometry was verified using isothermal titration calorimetry. The affinity for G(A/G)GGC-containing double-stranded DNA was found to be {approx} 740 nM, approximately 8-fold weaker than the equivalent domain in SV40 for the analogous region of the SV40 origin. The difference in affinity is partially attributable to DNA-binding residue Lys331 (Arg154 in SV40). In contrast to SV40, a small protein-protein interface is observed between MCV OBDs when bound to the central region of the origin. This protein-protein interface is reminiscent of that seen in bovine papilloma virus E1 protein. Mutational analysis indicates, however, that this interface contributes little to DNA binding energy.« less

  6. Generation of Aptamers from A Primer-Free Randomized ssDNA Library Using Magnetic-Assisted Rapid Aptamer Selection

    NASA Astrophysics Data System (ADS)

    Tsao, Shih-Ming; Lai, Ji-Ching; Horng, Horng-Er; Liu, Tu-Chen; Hong, Chin-Yih

    2017-04-01

    Aptamers are oligonucleotides that can bind to specific target molecules. Most aptamers are generated using random libraries in the standard systematic evolution of ligands by exponential enrichment (SELEX). Each random library contains oligonucleotides with a randomized central region and two fixed primer regions at both ends. The fixed primer regions are necessary for amplifying target-bound sequences by PCR. However, these extra-sequences may cause non-specific bindings, which potentially interfere with good binding for random sequences. The Magnetic-Assisted Rapid Aptamer Selection (MARAS) is a newly developed protocol for generating single-strand DNA aptamers. No repeat selection cycle is required in the protocol. This study proposes and demonstrates a method to isolate aptamers for C-reactive proteins (CRP) from a randomized ssDNA library containing no fixed sequences at 5‧ and 3‧ termini using the MARAS platform. Furthermore, the isolated primer-free aptamer was sequenced and binding affinity for CRP was analyzed. The specificity of the obtained aptamer was validated using blind serum samples. The result was consistent with monoclonal antibody-based nephelometry analysis, which indicated that a primer-free aptamer has high specificity toward targets. MARAS is a feasible platform for efficiently generating primer-free aptamers for clinical diagnoses.

  7. BayesPI-BAR: a new biophysical model for characterization of regulatory sequence variations

    PubMed Central

    Wang, Junbai; Batmanov, Kirill

    2015-01-01

    Sequence variations in regulatory DNA regions are known to cause functionally important consequences for gene expression. DNA sequence variations may have an essential role in determining phenotypes and may be linked to disease; however, their identification through analysis of massive genome-wide sequencing data is a great challenge. In this work, a new computational pipeline, a Bayesian method for protein–DNA interaction with binding affinity ranking (BayesPI-BAR), is proposed for quantifying the effect of sequence variations on protein binding. BayesPI-BAR uses biophysical modeling of protein–DNA interactions to predict single nucleotide polymorphisms (SNPs) that cause significant changes in the binding affinity of a regulatory region for transcription factors (TFs). The method includes two new parameters (TF chemical potentials or protein concentrations and direct TF binding targets) that are neglected by previous methods. The new method is verified on 67 known human regulatory SNPs, of which 47 (70%) have predicted true TFs ranked in the top 10. Importantly, the performance of BayesPI-BAR, which uses principal component analysis to integrate multiple predictions from various TF chemical potentials, is found to be better than that of existing programs, such as sTRAP and is-rSNP, when evaluated on the same SNPs. BayesPI-BAR is a publicly available tool and is able to carry out parallelized computation, which helps to investigate a large number of TFs or SNPs and to detect disease-associated regulatory sequence variations in the sea of genome-wide noncoding regions. PMID:26202972

  8. Promoter selection in human mitochondria involves binding of a transcription factor to orientation-independent upstream regulatory elements.

    PubMed

    Fisher, R P; Topper, J N; Clayton, D A

    1987-07-17

    Selective transcription of human mitochondrial DNA requires a transcription factor (mtTF) in addition to an essentially nonselective RNA polymerase. Partially purified mtTF is able to sequester promoter-containing DNA in preinitiation complexes in the absence of mitochondrial RNA polymerase, suggesting a DNA-binding mechanism for factor activity. Functional domains, required for positive transcriptional regulation by mtTF, are identified within both major promoters of human mtDNA through transcription of mutant promoter templates in a reconstituted in vitro system. These domains are essentially coextensive with DNA sequences protected from nuclease digestion by mtTF-binding. Comparison of the sequences of the two mtTF-responsive elements reveals significant homology only when one sequence is inverted; the binding sites are in opposite orientations with respect to the predominant direction of transcription. Thus mtTF may function bidirectionally, requiring additional protein-DNA interactions to dictate transcriptional polarity. The mtTF-responsive elements are arrayed as direct repeats, separated by approximately 80 bp within the displacement-loop region of human mitochondrial DNA; this arrangement may reflect duplication of an ancestral bidirectional promoter, giving rise to separate, unidirectional promoters for each strand.

  9. Comparative analyses of CTCF and BORIS occupancies uncover two distinct classes of CTCF binding genomic regions.

    PubMed

    Pugacheva, Elena M; Rivero-Hinojosa, Samuel; Espinoza, Celso A; Méndez-Catalá, Claudia Fabiola; Kang, Sungyun; Suzuki, Teruhiko; Kosaka-Suzuki, Natsuki; Robinson, Susan; Nagarajan, Vijayaraj; Ye, Zhen; Boukaba, Abdelhalim; Rasko, John E J; Strunnikov, Alexander V; Loukinov, Dmitri; Ren, Bing; Lobanenkov, Victor V

    2015-08-14

    CTCF and BORIS (CTCFL), two paralogous mammalian proteins sharing nearly identical DNA binding domains, are thought to function in a mutually exclusive manner in DNA binding and transcriptional regulation. Here we show that these two proteins co-occupy a specific subset of regulatory elements consisting of clustered CTCF binding motifs (termed 2xCTSes). BORIS occupancy at 2xCTSes is largely invariant in BORIS-positive cancer cells, with the genomic pattern recapitulating the germline-specific BORIS binding to chromatin. In contrast to the single-motif CTCF target sites (1xCTSes), the 2xCTS elements are preferentially found at active promoters and enhancers, both in cancer and germ cells. 2xCTSes are also enriched in genomic regions that escape histone to protamine replacement in human and mouse sperm. Depletion of the BORIS gene leads to altered transcription of a large number of genes and the differentiation of K562 cells, while the ectopic expression of this CTCF paralog leads to specific changes in transcription in MCF7 cells. We discover two functionally and structurally different classes of CTCF binding regions, 2xCTSes and 1xCTSes, revealed by their predisposition to bind BORIS. We propose that 2xCTSes play key roles in the transcriptional program of cancer and germ cells.

  10. Suppression of genetic recombination in the pseudoautosomal region and at subtelomeres in mice with a hypomorphic Spo11 allele.

    PubMed

    Smagulova, Fatima; Brick, Kevin; Pu, Yongmei; Sengupta, Uttara; Camerini-Otero, R Daniel; Petukhova, Galina V

    2013-07-22

    Homologous recombination is the key process that generates genetic diversity and drives evolution. SPO11 protein triggers recombination by introducing DNA double stranded breaks at discreet areas of the genome called recombination hotspots. The hotspot locations are largely determined by the DNA binding specificity of the PRDM9 protein in human, mice and most other mammals. In budding yeast Saccharomyces cerevisae, which lacks a Prdm9 gene, meiotic breaks are formed opportunistically in the regions of accessible chromatin, primarily at gene promoters. The genome-wide distribution of hotspots in this organism can be altered by tethering Spo11 protein to Gal4 recognition sequences in the strain expressing Spo11 attached to the DNA binding domain of the Gal4 transcription factor. To establish whether similar re-targeting of meiotic breaks can be achieved in PRDM9-containing organisms we have generated a Gal4BD-Spo11 mouse that expresses SPO11 protein joined to the DNA binding domain of yeast Gal4. We have mapped the genome-wide distribution of the recombination initiation sites in the Gal4BD-Spo11 mice. More than two hundred of the hotspots in these mice were novel and were likely defined by Gal4BD, as the Gal4 consensus motif was clustered around the centers in these hotspots. Surprisingly, meiotic DNA breaks in the Gal4BD-Spo11 mice were significantly depleted near the ends of chromosomes. The effect is particularly striking at the pseudoautosomal region of the X and Y chromosomes - normally the hottest region in the genome. Our data suggest that specific, yet-unidentified factors influence the initiation of meiotic recombination at subtelomeric chromosomal regions.

  11. A calmodulin-binding/CGCG box DNA-binding protein family involved in multiple signaling pathways in plants

    NASA Technical Reports Server (NTRS)

    Yang, Tianbao; Poovaiah, B. W.

    2002-01-01

    We reported earlier that the tobacco early ethylene-responsive gene NtER1 encodes a calmodulin-binding protein (Yang, T., and Poovaiah, B. W. (2000) J. Biol. Chem. 275, 38467-38473). Here we demonstrate that there is one NtER1 homolog as well as five related genes in Arabidopsis. These six genes are rapidly and differentially induced by environmental signals such as temperature extremes, UVB, salt, and wounding; hormones such as ethylene and abscisic acid; and signal molecules such as methyl jasmonate, H(2)O(2), and salicylic acid. Hence, they were designated as AtSR1-6 (Arabidopsis thaliana signal-responsive genes). Ca(2+)/calmodulin binds to all AtSRs, and their calmodulin-binding regions are located on a conserved basic amphiphilic alpha-helical motif in the C terminus. AtSR1 targets the nucleus and specifically recognizes a novel 6-bp CGCG box (A/C/G)CGCG(G/T/C). The multiple CGCG cis-elements are found in promoters of genes such as those involved in ethylene signaling, abscisic acid signaling, and light signal perception. The DNA-binding domain in AtSR1 is located on the N-terminal 146 bp where all AtSR1-related proteins share high similarity but have no similarity to other known DNA-binding proteins. The calmodulin-binding nuclear proteins isolated from wounded leaves exhibit specific CGCG box DNA binding activities. These results suggest that the AtSR gene family encodes a family of calmodulin-binding/DNA-binding proteins involved in multiple signal transduction pathways in plants.

  12. H-2RIIBP, a member of the nuclear hormone receptor superfamily that binds to both the regulatory element of major histocompatibility class I genes and the estrogen response element.

    PubMed

    Hamada, K; Gleason, S L; Levi, B Z; Hirschfeld, S; Appella, E; Ozato, K

    1989-11-01

    Transcription of major histocompatibility complex (MHC) class I genes is regulated by the conserved MHC class I regulatory element (CRE). The CRE has two factor-binding sites, region I and region II, both of which elicit enhancer function. By screening a mouse lambda gt 11 library with the CRE as a probe, we isolated a cDNA clone that encodes a protein capable of binding to region II of the CRE. This protein, H-2RIIBP (H-2 region II binding protein), bound to the native region II sequence, but not to other MHC cis-acting sequences or to mutant region II sequences, similar to the naturally occurring region II factor in mouse cells. The deduced amino acid sequence of H-2RIIBP revealed two putative zinc fingers homologous to the DNA-binding domain of steroid/thyroid hormone receptors. Although sequence similarity in other regions was minimal, H-2RIIBP has apparent modular domains characteristic of the nuclear hormone receptors. Further analyses showed that both H-2RIIBP and the natural region II factor bind to the estrogen response element (ERE) of the vitellogenin A2 gene. The ERE is composed of a palindrome, and half of this palindrome resembles the region II binding site of the MHC CRE. These results indicate that H-2RIIBP (i) is a member of the superfamily of nuclear hormone receptors and (ii) may regulate not only MHC class I genes but also genes containing the ERE and related sequences. Sequences homologous to the H-2RIIBP gene are widely conserved in the animal kingdom. H-2RIIBP mRNA is expressed in many mouse tissues, in agreement with the distribution of the natural region II factor.

  13. Crystal Structure of Mycobacterium tuberculosis H37Rv AldR (Rv2779c), a Regulator of the ald Gene

    PubMed Central

    Dey, Abhishek; Shree, Sonal; Pandey, Sarvesh Kumar; Tripathi, Rama Pati; Ramachandran, Ravishankar

    2016-01-01

    Here we report the crystal structure of M. tuberculosis AldR (Rv2779c) showing that the N-terminal DNA-binding domains are swapped, forming a dimer, and four dimers are assembled into an octamer through crystal symmetry. The C-terminal domain is involved in oligomeric interactions that stabilize the oligomer, and it contains the effector-binding sites. The latter sites are 30–60% larger compared with homologs like MtbFFRP (Rv3291c) and can consequently accommodate larger molecules. MtbAldR binds to the region upstream to the ald gene that is highly up-regulated in nutrient-starved tuberculosis models and codes for l-alanine dehydrogenase (MtbAld; Rv2780). Further, the MtbAldR-DNA complex is inhibited upon binding of Ala, Tyr, Trp and Asp to the protein. Studies involving a ligand-binding site G131T mutant show that the mutant forms a DNA complex that cannot be inhibited by adding the amino acids. Comparative studies suggest that binding of the amino acids changes the relative spatial disposition of the DNA-binding domains and thereby disrupt the protein-DNA complex. Finally, we identified small molecules, including a tetrahydroquinoline carbonitrile derivative (S010-0261), that inhibit the MtbAldR-DNA complex. The latter molecules represent the very first inhibitors of a feast/famine regulatory protein from any source and set the stage for exploring MtbAldR as a potential anti-tuberculosis target. PMID:27006398

  14. Modulating the DNA affinity of Elk-1 with computationally selected mutations.

    PubMed

    Park, Sheldon; Boder, Eric T; Saven, Jeffery G

    2005-04-22

    In order to regulate gene expression, transcription factors must first bind their target DNA sequences. The affinity of this binding is determined by both the network of interactions at the interface and the entropy change associated with the complex formation. To study the role of structural fluctuation in fine-tuning DNA affinity, we performed molecular dynamics simulations of two highly homologous proteins, Elk-1 and SAP-1, that exhibit different sequence specificity. Simulation studies show that several residues in Elk have significantly higher main-chain root-mean-square deviations than their counterparts in SAP. In particular, a single residue, D69, may contribute to Elk's lower DNA affinity for P(c-fos) by structurally destabilizing the carboxy terminus of the recognition helix. While D69 does not contact DNA directly, the increased mobility in the region may contribute to its weaker binding. We measured the ability of single point mutants of Elk to bind P(c-fos) in a reporter assay, in which D69 of wild-type Elk has been mutated to other residues with higher helix propensity in order to stabilize the local conformation. The gains in transcriptional activity and the free energy of binding suggested from these measurements correlate well with stability gains computed from helix propensity and charge-macrodipole interactions. The study suggests that residues that are distal to the binding interface may indirectly modulate the binding affinity by stabilizing the protein scaffold required for efficient DNA interaction.

  15. The mCpG-binding domain of human MBD3 does not bind to mCpG but interacts with NuRD/Mi2 components HDAC1 and MTA2.

    PubMed

    Saito, Motoki; Ishikawa, Fuyuki

    2002-09-20

    Although mammalian MBD3 contains the mCpG-binding domain (MBD) and is highly homologous with the authentic mCpG-binding protein MBD2, it was reported that the protein does not bind to mCpG specifically. Using recombinant human wild type and mutant MBD3 proteins, we demonstrated that atypical amino acids found in MBD3 MBD, namely, His-30 and Phe-34, are responsible for the inability of MBD3 to bind to mCpG. Interestingly, although H30K/F34Y MBD3 mutant protein binds to mCpG efficiently in vitro, it was not localized at the mCpG-rich pericentromeric regions in mouse cells. We also showed that Y34F MBD2b MBD, which possesses not the mCpG-specific DNA-binding activity but the nonspecific DNA-binding activity, was localized at the pericentromeric regions. These results suggested that the mCpG-specific DNA-binding activity is largely dispensable, and another factor(s) is required for the localization of MBD proteins in vivo. MBD3 was identified as a component of the NuRD/Mi2 complex that shows chromatin remodeling and histone deacetylase activities. We demonstrated that MBD3 MBD is necessary and sufficient for binding to HDAC1 and MTA2, two components of the NuRD/Mi2 complex. It was therefore suggested that mCpG-binding-defective MBD3 has evolutionarily conserved its MBD because of the secondary role played by the MBD in protein-protein interactions.

  16. p53 Specifically Binds Triplex DNA In Vitro and in Cells

    PubMed Central

    Brázdová, Marie; Tichý, Vlastimil; Helma, Robert; Bažantová, Pavla; Polášková, Alena; Krejčí, Aneta; Petr, Marek; Navrátilová, Lucie; Tichá, Olga; Nejedlý, Karel; Bennink, Martin L.; Subramaniam, Vinod; Bábková, Zuzana; Martínek, Tomáš; Lexa, Matej; Adámik, Matej

    2016-01-01

    Triplex DNA is implicated in a wide range of biological activities, including regulation of gene expression and genomic instability leading to cancer. The tumor suppressor p53 is a central regulator of cell fate in response to different type of insults. Sequence and structure specific modes of DNA recognition are core attributes of the p53 protein. The focus of this work is the structure-specific binding of p53 to DNA containing triplex-forming sequences in vitro and in cells and the effect on p53-driven transcription. This is the first DNA binding study of full-length p53 and its deletion variants to both intermolecular and intramolecular T.A.T triplexes. We demonstrate that the interaction of p53 with intermolecular T.A.T triplex is comparable to the recognition of CTG-hairpin non-B DNA structure. Using deletion mutants we determined the C-terminal DNA binding domain of p53 to be crucial for triplex recognition. Furthermore, strong p53 recognition of intramolecular T.A.T triplexes (H-DNA), stabilized by negative superhelicity in plasmid DNA, was detected by competition and immunoprecipitation experiments, and visualized by AFM. Moreover, chromatin immunoprecipitation revealed p53 binding T.A.T forming sequence in vivo. Enhanced reporter transactivation by p53 on insertion of triplex forming sequence into plasmid with p53 consensus sequence was observed by luciferase reporter assays. In-silico scan of human regulatory regions for the simultaneous presence of both consensus sequence and T.A.T motifs identified a set of candidate p53 target genes and p53-dependent activation of several of them (ABCG5, ENOX1, INSR, MCC, NFAT5) was confirmed by RT-qPCR. Our results show that T.A.T triplex comprises a new class of p53 binding sites targeted by p53 in a DNA structure-dependent mode in vitro and in cells. The contribution of p53 DNA structure-dependent binding to the regulation of transcription is discussed. PMID:27907175

  17. Mechanistic insight into ligand binding to G-quadruplex DNA

    PubMed Central

    Di Leva, Francesco Saverio; Novellino, Ettore; Cavalli, Andrea; Parrinello, Michele; Limongelli, Vittorio

    2014-01-01

    Specific guanine-rich regions in human genome can form higher-order DNA structures called G-quadruplexes, which regulate many relevant biological processes. For instance, the formation of G-quadruplex at telomeres can alter cellular functions, inducing apoptosis. Thus, developing small molecules that are able to bind and stabilize the telomeric G-quadruplexes represents an attractive strategy for antitumor therapy. An example is 3-(benzo[d]thiazol-2-yl)-7-hydroxy-8-((4-(2-hydroxyethyl)piperazin-1-yl)methyl)-2H-chromen-2-one (compound 1), recently identified as potent ligand of the G-quadruplex [d(TGGGGT)]4 with promising in vitro antitumor activity. The experimental observations are suggestive of a complex binding mechanism that, despite efforts, has defied full characterization. Here, we provide through metadynamics simulations a comprehensive understanding of the binding mechanism of 1 to the G-quadruplex [d(TGGGGT)]4. In our calculations, the ligand explores all the available binding sites on the DNA structure and the free-energy landscape of the whole binding process is computed. We have thus disclosed a peculiar hopping binding mechanism whereas 1 is able to bind both to the groove and to the 3’ end of the G-quadruplex. Our results fully explain the available experimental data, rendering our approach of great value for further ligand/DNA studies. PMID:24753420

  18. Reactivation of mutant p53: Constraints on mechanism highlighted by principal component analysis of the DNA binding domain.

    PubMed

    Ouaray, Zahra; ElSawy, Karim M; Lane, David P; Essex, Jonathan W; Verma, Chandra

    2016-10-01

    Most p53 mutations associated with cancer are located in its DNA binding domain (DBD). Many structures (X-ray and NMR) of this domain are available in the protein data bank (PDB) and a vast conformational heterogeneity characterizes the various free and complexed states. The major difference between the apo and the holo-complexed states appears to lie in the L1 loop. In particular, the conformations of this loop appear to depend intimately on the sequence of DNA to which it binds. This conclusion builds upon recent observations that implicate the tetramerization and the C-terminal domains (respectively TD and Cter) in DNA binding specificity. Detailed PCA analysis of the most recent collection of DBD structures from the PDB have been carried out. In contrast to recommendations that small molecules/drugs stabilize the flexible L1 loop to rescue mutant p53, our study highlights a need to retain the flexibility of the p53 DNA binding surface (DBS). It is the adaptability of this region that enables p53 to engage in the diverse interactions responsible for its functionality. Proteins 2016; 84:1443-1461. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  19. MotifMark: Finding regulatory motifs in DNA sequences.

    PubMed

    Hassanzadeh, Hamid Reza; Kolhe, Pushkar; Isbell, Charles L; Wang, May D

    2017-07-01

    The interaction between proteins and DNA is a key driving force in a significant number of biological processes such as transcriptional regulation, repair, recombination, splicing, and DNA modification. The identification of DNA-binding sites and the specificity of target proteins in binding to these regions are two important steps in understanding the mechanisms of these biological activities. A number of high-throughput technologies have recently emerged that try to quantify the affinity between proteins and DNA motifs. Despite their success, these technologies have their own limitations and fall short in precise characterization of motifs, and as a result, require further downstream analysis to extract useful and interpretable information from a haystack of noisy and inaccurate data. Here we propose MotifMark, a new algorithm based on graph theory and machine learning, that can find binding sites on candidate probes and rank their specificity in regard to the underlying transcription factor. We developed a pipeline to analyze experimental data derived from compact universal protein binding microarrays and benchmarked it against two of the most accurate motif search methods. Our results indicate that MotifMark can be a viable alternative technique for prediction of motif from protein binding microarrays and possibly other related high-throughput techniques.

  20. Intramolecular control of transcriptional activity by the NK2-specific domain in NK-2 homeodomain proteins

    PubMed Central

    Watada, Hirotaka; Mirmira, Raghavendra G.; Kalamaras, Julie; German, Michael S.

    2000-01-01

    The developmentally important homeodomain transcription factors of the NK-2 class contain a highly conserved region, the NK2-specific domain (NK2-SD). The function of this domain, however, remains unknown. The primary structure of the NK2-SD suggests that it might function as an accessory DNA-binding domain or as a protein–protein interaction interface. To assess the possibility that the NK2-SD may contribute to DNA-binding specificity, we used a PCR-based approach to identify a consensus DNA-binding sequences for Nkx2.2, an NK-2 family member involved in pancreas and central nervous system development. The consensus sequence (TCTAAGTGAGCTT) is similar to the known binding sequences for other NK-2 homeodomain proteins, but we show that the NK2-SD does not contribute significantly to specific DNA binding to this sequence. To determine whether the NK2-SD contributes to transactivation, we used GAL4-Nkx2.2 fusion constructs to map a powerful transcriptional activation domain in the C-terminal region beyond the conserved NK2-SD. Interestingly, this C-terminal region functions as a transcriptional activator only in the absence of an intact NK2-SD. The NK2-SD also can mask transactivation from the paired homeodomain transcription factor Pax6, but it has no effect on transcription by itself. These results demonstrate that the NK2-SD functions as an intramolecular regulator of the C-terminal activation domain in Nkx2.2 and support a model in which interactions through the NK2-SD regulate the ability of NK-2-class proteins to activate specific genes during development. PMID:10944215

  1. Microfabricated, flowthrough porous apparatus for discrete detection of binding reactions

    DOEpatents

    Beattie, Kenneth L.

    1998-01-01

    An improved microfabricated apparatus for conducting a multiplicity of individual and simultaneous binding reactions is described. The apparatus comprises a substrate on which are located discrete and isolated sites for binding reactions. The apparatus is characterized by discrete and isolated regions that extend through said substrate and terminate on a second surface thereof such that when a test sample is allowed to the substrate, it is capable of penetrating through each such region during the course of said binding reaction. The apparatus is especially useful for sequencing by hybridization of DNA molecules.

  2. Two synthetic Sp1-binding sites functionally substitute for the 21-base-pair repeat region to activate simian virus 40 growth in CV-1 cells.

    PubMed Central

    Lednicky, J; Folk, W R

    1992-01-01

    The 21-bp repeat region of simian virus 40 (SV40) activates viral transcription and DNA replication and contains binding sites for many cellular proteins, including Sp1, LSF, ETF, Ap2, Ap4, GT-1B, H16, and p53, and for the SV40 large tumor antigen. We have attempted to reduce the complexity of this region while maintaining its growth-promoting capacity. Deletion of the 21-bp repeat region from the SV40 genome delays the expression of viral early proteins and DNA replication and reduces virus production in CV-1 cells. Replacement of the 21-bp repeat region with two copies of DNA sequence motifs bound with high affinities by Sp1 promotes SV40 growth in CV-1 cells to nearly wild-type levels, but substitution by motifs bound less avidly by Sp1 or bound by other activator proteins does not restore growth. This indicates that Sp1 or a protein with similar sequence specificity is primarily responsible for the function of the 21-bp repeat region. We speculate about how Sp1 activates both SV40 transcription and DNA replication. Images PMID:1328672

  3. ChIP-PaM: an algorithm to identify protein-DNA interaction using ChIP-Seq data.

    PubMed

    Wu, Song; Wang, Jianmin; Zhao, Wei; Pounds, Stanley; Cheng, Cheng

    2010-06-03

    ChIP-Seq is a powerful tool for identifying the interaction between genomic regulators and their bound DNAs, especially for locating transcription factor binding sites. However, high cost and high rate of false discovery of transcription factor binding sites identified from ChIP-Seq data significantly limit its application. Here we report a new algorithm, ChIP-PaM, for identifying transcription factor target regions in ChIP-Seq datasets. This algorithm makes full use of a protein-DNA binding pattern by capitalizing on three lines of evidence: 1) the tag count modelling at the peak position, 2) pattern matching of a specific tag count distribution, and 3) motif searching along the genome. A novel data-based two-step eFDR procedure is proposed to integrate the three lines of evidence to determine significantly enriched regions. Our algorithm requires no technical controls and efficiently discriminates falsely enriched regions from regions enriched by true transcription factor (TF) binding on the basis of ChIP-Seq data only. An analysis of real genomic data is presented to demonstrate our method. In a comparison with other existing methods, we found that our algorithm provides more accurate binding site discovery while maintaining comparable statistical power.

  4. DNA cytosine methylation in the bovine leukemia virus promoter is associated with latency in a lymphoma-derived B-cell line: potential involvement of direct inhibition of cAMP-responsive element (CRE)-binding protein/CRE modulator/activation transcription factor binding.

    PubMed

    Pierard, Valérie; Guiguen, Allan; Colin, Laurence; Wijmeersch, Gaëlle; Vanhulle, Caroline; Van Driessche, Benoît; Dekoninck, Ann; Blazkova, Jana; Cardona, Christelle; Merimi, Makram; Vierendeel, Valérie; Calomme, Claire; Nguyên, Thi Liên-Anh; Nuttinck, Michèle; Twizere, Jean-Claude; Kettmann, Richard; Portetelle, Daniel; Burny, Arsène; Hirsch, Ivan; Rohr, Olivier; Van Lint, Carine

    2010-06-18

    Bovine leukemia virus (BLV) proviral latency represents a viral strategy to escape the host immune system and allow tumor development. Besides the previously demonstrated role of histone deacetylation in the epigenetic repression of BLV expression, we showed here that BLV promoter activity was induced by several DNA methylation inhibitors (such as 5-aza-2'-deoxycytidine) and that overexpressed DNMT1 and DNMT3A, but not DNMT3B, down-regulated BLV promoter activity. Importantly, cytosine hypermethylation in the 5'-long terminal repeat (LTR) U3 and R regions was associated with true latency in the lymphoma-derived B-cell line L267 but not with defective latency in YR2 cells. Moreover, the virus-encoded transactivator Tax(BLV) decreased DNA methyltransferase expression levels, which could explain the lower level of cytosine methylation observed in the L267(LTaxSN) 5'-LTR compared with the L267 5'-LTR. Interestingly, DNA methylation inhibitors and Tax(BLV) synergistically activated BLV promoter transcriptional activity in a cAMP-responsive element (CRE)-dependent manner. Mechanistically, methylation at the -154 or -129 CpG position (relative to the transcription start site) impaired in vitro binding of CRE-binding protein (CREB) transcription factors to their respective CRE sites. Methylation at -129 CpG alone was sufficient to decrease BLV promoter-driven reporter gene expression by 2-fold. We demonstrated in vivo the recruitment of CREB/CRE modulator (CREM) and to a lesser extent activating transcription factor-1 (ATF-1) to the hypomethylated CRE region of the YR2 5'-LTR, whereas we detected no CREB/CREM/ATF recruitment to the hypermethylated corresponding region in the L267 cells. Altogether, these findings suggest that site-specific DNA methylation of the BLV promoter represses viral transcription by directly inhibiting transcription factor binding, thereby contributing to true proviral latency.

  5. Deletion of transcription factor binding motifs using the CRISPR/spCas9 system in the β-globin LCR.

    PubMed

    Kim, Yea Woon; Kim, AeRi

    2017-07-20

    Transcription factors play roles in gene transcription through direct binding to their motifs in genome, and inhibiting this binding provides an effective strategy for studying their roles. Here we applied the CRISPR/spCas9 system to mutate the binding motifs of transcription factors. Binding motifs for erythroid specific transcription factors were mutated in the locus control region hypersensitive sites of the human β-globin locus. Guide RNAs targeting binding motifs were cloned into lentiviral CRISPR vector containing the spCas9 gene, and transduced into MEL/ch11 cells carrying a human chromosome 11. DNA mutations in clonal cells were initially screened by quantitative PCR in genomic DNA and then clarified by sequencing. Mutations in binding motifs reduced occupancy by transcription factors in a chromatin environment. Characterization of mutations revealed that the CRISPR/spCas9 system mainly induced deletions in short regions of <20 bp and preferentially deleted nucleotides around the fifth nucleotide upstream of Protospacer adjacent motifs. These results indicate that the CRISPR/Cas9 system is suitable for mutating the binding motifs of transcription factors, and, consequently, would contribute to elucidate the direct roles of transcription factors. ©2017 The Author(s).

  6. Changes in the DNA methylation profile of the rat H19 gene upstream region during development and transgenic hepatocarcinogenesis and its role in the imprinted transcriptional regulation of the H19 gene.

    PubMed

    Manoharan, Herbert; Babcock, Karlee; Pitot, Henry C

    2004-09-01

    Monoallelic expression of the imprinted H19 and insulin-like growth factor-2 (Igf2) genes depends on the hypomethylation of the maternal allele and hypermethylation of the paternal allele of the H19 upstream region. Previous studies from our laboratory on liver carcinogenesis in the F1 hybrid of Fischer 344 (F344) and Sprague-Dawley Alb SV40 T Ag transgenic rat (SD) strains revealed the biallelic expression of H19 in hepatomas. We undertook a comparative study of the DNA methylation status of the upstream region of H19 in fetal, adult, and neoplastic liver. Bisulfite DNA sequencing analysis of a 3.745-kb DNA segment extending from 2950 to 6695 bp of the H19 upstream region revealed marked variations in the methylation patterns in fetal, adult, and neoplastic liver. In the fetal liver, equal proportions of hyper- and hypomethylated strands revealed the differentially methylated status of the parental alleles, but in neoplastic liver a pronounced change in the pattern of methylation was observed with a distinct change to hypomethylation in the short segments between 2984 and 3301 bp, 6033-6123 bp, and 6518-6548 bp. These results indicated that methylation of all cytosines in this region may contribute to the imprinting status of the rat H19 gene. This phenomenon of differential methylation-related epigenetic alteration in the key cis-regulatory domains of the H19 promoter influences switching to biallelic expression in hepatocellular carcinogenesis. Similar to mouse and human, we showed that the zinc-finger CCTCC binding factor (CTCF) binds to the unmethylated CTCF binding site in the upstream region to influence monoallelic imprinted expression in fetal liver. CTCF does not appear to be rate limiting in fetal, normal, and neoplastic liver. 3' to the CTCF binding sites, another DNA region exhibits methylation of CpG's in both DNA strands in adult liver, retention of the imprint in fetal liver, and complete demethylation in neoplastic liver. In this region is also a putative binding site for a basic helix-loop-helix leucine-zipper transcription factor, TFEB. The differential CpG methylation seen in the adult that involves the TFEB binding site may explain the lack of expression of the H19 gene in adult normal liver. Furthermore, these findings demonstrate that the loss of imprinting of the H19 gene in hepatic neoplasms of the SD Alb SV40 T Ag transgenic rat is directly correlated with and probably the result of differential methylation of CpG dinucleotides in two distinct regions of the gene that are within 4 kb 5' of the transcription start site. Cytogenetic analysis of hepatocytes in the transgenic animal prior to the appearance of nodules or neoplasms indicates a role of such loss of imprinting in the very early period of neoplastic development, possibly the transition from the stage of promotion to that of progression. Copyright 2004 Wiley-Liss, Inc.

  7. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Changela, Anita; DiGate, Russell J.; Mondragon, Alfonso

    Escherichia coli DNA topoisomerase III belongs to the type IA family of DNA topoisomerases, which transiently cleave single-stranded DNA (ssDNA) via a 5{prime} phosphotyrosine intermediate. We have solved crystal structures of wild-type E. coli topoisomerase III bound to an eight-base ssDNA molecule in three different pH environments. The structures reveal the enzyme in three distinct conformational states while bound to DNA. One conformation resembles the one observed previously with a DNA-bound, catalytically inactive mutant of topoisomerase III where DNA binding realigns catalytic residues to form a functional active site. Another conformation represents a novel intermediate in which DNA is boundmore » along the ssDNA-binding groove but does not enter the active site, which remains in a catalytically inactive, closed state. A third conformation shows an intermediate state where the enzyme is still in a closed state, but the ssDNA is starting to invade the active site. For the first time, the active site region in the presence of both the catalytic tyrosine and ssDNA substrate is revealed for a type IA DNA topoisomerase, although there is no evidence of ssDNA cleavage. Comparative analysis of the various conformational states suggests a sequence of domain movements undertaken by the enzyme upon substrate binding.« less

  8. A new method for the construction of a mutant library with a predictable occurrence rate using Poisson distribution.

    PubMed

    Seong, Ki Moon; Park, Hweon; Kim, Seong Jung; Ha, Hyo Nam; Lee, Jae Yung; Kim, Joon

    2007-06-01

    A yeast transcriptional activator, Gcn4p, induces the expression of genes that are involved in amino acid and purine biosynthetic pathways under amino acid starvation. Gcn4p has an acidic activation domain in the central region and a bZIP domain in the C-terminus that is divided into the DNA-binding motif and dimerization leucine zipper motif. In order to identify amino acids in the DNA-binding motif of Gcn4p which are involved in transcriptional activation, we constructed mutant libraries in the DNA-binding motif through an innovative application of random mutagenesis. Mutant library made by oligonucleotides which were mutated randomly using the Poisson distribution showed that the actual mutation frequency was in good agreement with expected values. This method could save the time and effort to create a mutant library with a predictable mutation frequency. Based on the studies using the mutant libraries constructed by the new method, the specific residues of the DNA-binding domain in Gcn4p appear to be involved in the transcriptional activities on a conserved binding site.

  9. A rapid, generally applicable method to engineer zinc fingers illustrated by targeting the HIV-1 promoter.

    PubMed

    Isalan, M; Klug, A; Choo, Y

    2001-07-01

    DNA-binding domains with predetermined sequence specificity are engineered by selection of zinc finger modules using phage display, allowing the construction of customized transcription factors. Despite remarkable progress in this field, the available protein-engineering methods are deficient in many respects, thus hampering the applicability of the technique. Here we present a rapid and convenient method that can be used to design zinc finger proteins against a variety of DNA-binding sites. This is based on a pair of pre-made zinc finger phage-display libraries, which are used in parallel to select two DNA-binding domains each of which recognizes given 5 base pair sequences, and whose products are recombined to produce a single protein that recognizes a composite (9 base pair) site of predefined sequence. Engineering using this system can be completed in less than two weeks and yields proteins that bind sequence-specifically to DNA with Kd values in the nanomolar range. To illustrate the technique, we have selected seven different proteins to bind various regions of the human immunodeficiency virus 1 (HIV-1) promoter.

  10. Profiles of embryonic nuclear protein binding to the proximal promoter region of the soybean β-conglycinin α subunit gene.

    PubMed

    Yoshino, M; Tsutsumi, K; Kanazawa, A

    2015-01-01

    β-Conglycinin, a major component of seed storage protein in soybean, comprises three subunits: α, α' and β. The expression of genes for these subunits is strictly controlled during embryogenesis. The proximal promoter region up to 245 bp upstream of the transcription start site of the α subunit gene sufficiently confers spatial and temporal control of transcription in embryos. Here, the binding profile of nuclear proteins in the proximal promoter region of the α subunit gene was analysed. DNase I footprinting analysis indicated binding of proteins to the RY element and DNA regions including box I, a region conserved in cognate gene promoters. An electrophoretic mobility shift assay (EMSA) using different portions of box I as a probe revealed that multiple portions of box I bind to nuclear proteins. In addition, an EMSA using nuclear proteins extracted from embryos at different developmental stages indicated that the levels of major DNA-protein complexes on box I increased during embryo maturation. These results are consistent with the notion that box I is important for the transcriptional control of seed storage protein genes. Furthermore, the present data suggest that nuclear proteins bind to novel motifs in box I including 5'-TCAATT-3' rather than to predicted cis-regulatory elements. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

  11. The DnaA Tale

    PubMed Central

    Hansen, Flemming G.; Atlung, Tove

    2018-01-01

    More than 50 years have passed since the presentation of the Replicon Model which states that a positively acting initiator interacts with a specific site on a circular chromosome molecule to initiate DNA replication. Since then, the origin of chromosome replication, oriC, has been determined as a specific region that carries sequences required for binding of positively acting initiator proteins, DnaA-boxes and DnaA proteins, respectively. In this review we will give a historical overview of significant findings which have led to the very detailed knowledge we now possess about the initiation process in bacteria using Escherichia coli as the model organism, but emphasizing that virtually all bacteria have DnaA proteins that interacts with DnaA boxes to initiate chromosome replication. We will discuss the dnaA gene regulation, the special features of the dnaA gene expression, promoter strength, and translation efficiency, as well as, the DnaA protein, its concentration, its binding to DnaA-boxes, and its binding of ATP or ADP. Furthermore, we will discuss the different models for regulation of initiation which have been proposed over the years, with particular emphasis on the Initiator Titration Model. PMID:29541066

  12. The UL5 and UL52 subunits of the herpes simplex virus type 1 helicase-primase subcomplex exhibit a complex interdependence for DNA binding.

    PubMed

    Biswas, N; Weller, S K

    2001-05-18

    Herpes simplex virus type 1 encodes a heterotrimeric helicase-primase complex composed of the products of the UL5, UL52, and UL8 genes. The UL5 protein contains seven motifs found in all members of helicase Superfamily 1 (SF1), and the UL52 protein contains several conserved motifs found in primases; however, the contributions of each subunit to the biochemical activities of the subcomplex are not clear. In this work, the DNA binding properties of wild type and mutant subcomplexes were examined using single-stranded, duplex, and forked substrates. A gel mobility shift assay indicated that the UL5-UL52 subcomplex binds more efficiently to the forked substrate than to either single strand or duplex DNA. Although nucleotides are not absolutely required for DNA binding, ADP stimulated the binding of UL5-UL52 to single strand DNA whereas ATP, ADP, and adenosine 5'-O-(thiotriphosphate) stimulated the binding to a forked substrate. We have previously shown that both subunits contact single-stranded DNA in a photocross-linking assay (Biswas, N., and Weller, S. K. (1999) J. Biol. Chem. 274, 8068-8076). In this study, photocross-linking assays with forked substrates indicate that the UL5 and UL52 subunits contact the forked substrates at different positions, UL52 at the single-stranded DNA tail and UL5 near the junction between single-stranded and double-stranded DNA. Neither subunit was able to cross-link a forked substrate when 5-iododeoxyuridine was located within the duplex portion. Photocross-linking experiments with subcomplexes containing mutant versions of UL5 and wild type UL52 indicated that the integrity of the ATP binding region is important for DNA binding of both subunits. These results support our previous proposal that UL5 and UL52 exhibit a complex interdependence for DNA binding (Biswas, N., and Weller, S. K. (1999) J. Biol. Chem. 274, 8068-8076) and indicate that the UL52 subunit may play a more active role in helicase activity than had previously been thought.

  13. Theoretical modeling of masking DNA application in aptamer-facilitated biomarker discovery.

    PubMed

    Cherney, Leonid T; Obrecht, Natalia M; Krylov, Sergey N

    2013-04-16

    In aptamer-facilitated biomarker discovery (AptaBiD), aptamers are selected from a library of random DNA (or RNA) sequences for their ability to specifically bind cell-surface biomarkers. The library is incubated with intact cells, and cell-bound DNA molecules are separated from those unbound and amplified by the polymerase chain reaction (PCR). The partitioning/amplification cycle is repeated multiple times while alternating target cells and control cells. Efficient aptamer selection in AptaBiD relies on the inclusion of masking DNA within the cell and library mixture. Masking DNA lacks primer regions for PCR amplification and is typically taken in excess to the library. The role of masking DNA within the selection mixture is to outcompete any nonspecific binding sequences within the initial library, thus allowing specific DNA sequences (i.e., aptamers) to be selected more efficiently. Efficient AptaBiD requires an optimum ratio of masking DNA to library DNA, at which aptamers still bind specific binding sites but nonaptamers within the library do not bind nonspecific binding sites. Here, we have developed a mathematical model that describes the binding processes taking place within the equilibrium mixture of masking DNA, library DNA, and target cells. An obtained mathematical solution allows one to estimate the concentration of masking DNA that is required to outcompete the library DNA at a desirable ratio of bound masking DNA to bound library DNA. The required concentration depends on concentrations of the library and cells as well as on unknown cell characteristics. These characteristics include the concentration of total binding sites on the cell surface, N, and equilibrium dissociation constants, K(nsL) and K(nsM), for nonspecific binding of the library DNA and masking DNA, respectively. We developed a theory that allows the determination of N, K(nsL), and K(nsM) based on measurements of EC50 values for cells mixed separately with the library and masking DNA (EC50 is the concentration of fluorescently labeled DNA at which half of the maximum fluorescence signal from DNA-bound cells is reached). We also obtained expressions for signals from bound DNA (measured by flow cytometry) in terms of N, K(nsL), and K(nsM). These expressions can be used for the verification of N, K(nsL), and K(nsM) values found from EC50 measurements. The developed procedure was applied to MCF-7 breast cancer cells, and corresponding values of N, K(nsL), and K(nsM) were established for the first time. The concentration of masking DNA required for AptaBiD with MCF-7 breast cancer cells was also estimated.

  14. MGMT DNA repair gene promoter/enhancer haplotypes alter transcription factor binding and gene expression.

    PubMed

    Xu, Meixiang; Cross, Courtney E; Speidel, Jordan T; Abdel-Rahman, Sherif Z

    2016-10-01

    The O 6 -methylguanine-DNA methyltransferase (MGMT) protein removes O 6 -alkyl-guanine adducts from DNA. MGMT expression can thus alter the sensitivity of cells and tissues to environmental and chemotherapeutic alkylating agents. Previously, we defined the haplotype structure encompassing single nucleotide polymorphisms (SNPs) in the MGMT promoter/enhancer (P/E) region and found that haplotypes, rather than individual SNPs, alter MGMT promoter activity. The exact mechanism(s) by which these haplotypes exert their effect on MGMT promoter activity is currently unknown, but we noted that many of the SNPs comprising the MGMT P/E haplotypes are located within or in close proximity to putative transcription factor binding sites. Thus, these haplotypes could potentially affect transcription factor binding and, subsequently, alter MGMT promoter activity. In this study, we test the hypothesis that MGMT P/E haplotypes affect MGMT promoter activity by altering transcription factor (TF) binding to the P/E region. We used a promoter binding TF profiling array and a reporter assay to evaluate the effect of different P/E haplotypes on TF binding and MGMT expression, respectively. Our data revealed a significant difference in TF binding profiles between the different haplotypes evaluated. We identified TFs that consistently showed significant haplotype-dependent binding alterations (p ≤ 0.01) and revealed their role in regulating MGMT expression using siRNAs and a dual-luciferase reporter assay system. The data generated support our hypothesis that promoter haplotypes alter the binding of TFs to the MGMT P/E and, subsequently, affect their regulatory function on MGMT promoter activity and expression level.

  15. Lead inhibition of DNA-binding mechanism of Cys(2)His(2) zinc finger proteins.

    PubMed

    Hanas, J S; Rodgers, J S; Bantle, J A; Cheng, Y G

    1999-11-01

    The association of lead with chromatin in cells suggests that deleterious metal effects may in part be mediated through alterations in gene function. To elucidate if and how lead may alter DNA binding of cysteine-rich zinc finger proteins, lead ions were analyzed for their ability to alter the DNA binding mechanism of the Cys(2)His(2) zinc finger protein transcription factor IIIA (TFIIIA). As assayed by DNase I protection, the interaction of TFIIIA with the 50-bp internal control region of the 5S ribosomal gene was partially inhibited by 5 microM lead ions and completely inhibited by 10 to 20 microM lead ions. Preincubation of free TFIIIA with lead resulted in DNA-binding inhibition, whereas preincubation of a TFIIIA/5S RNA complex with lead did not result in DNA-binding inhibition. Because 5S RNA binds TFIIIA zinc fingers, this result is consistent with an inhibition mechanism via lead binding to zinc fingers. The complete loss of DNase I protection on the 5S gene indicates the mechanism of inhibition minimally involves the N-terminal fingers of TFIIIA. Inhibition was not readily reversible and occurred in the presence of an excess of beta-mercaptoethanol. Inhibition kinetics were fast, progressing to completion in approximately 5 min. Millimolar concentrations of sulfhydryl-specific arsenic ions were not inhibitory for TFIIIA binding. Micromolar concentrations of lead inhibited DNA binding by Sp1, another Cys(2)His(2) finger protein, but not by the nonfinger protein AP2. Inhibition of Cys(2)His(2) zinc finger transcription factors by lead ions at concentrations near those known to have deleterious physiological effects points to new molecular mechanisms for lead toxicity in promoting disease.

  16. Recognition of AT-Rich DNA Binding Sites by the MogR Repressor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shen, Aimee; Higgins, Darren E.; Panne, Daniel

    2009-07-22

    The MogR transcriptional repressor of the intracellular pathogen Listeria monocytogenes recognizes AT-rich binding sites in promoters of flagellar genes to downregulate flagellar gene expression during infection. We describe here the 1.8 A resolution crystal structure of MogR bound to the recognition sequence 5' ATTTTTTAAAAAAAT 3' present within the flaA promoter region. Our structure shows that MogR binds as a dimer. Each half-site is recognized in the major groove by a helix-turn-helix motif and in the minor groove by a loop from the symmetry-related molecule, resulting in a 'crossover' binding mode. This oversampling through minor groove interactions is important for specificity.more » The MogR binding site has structural features of A-tract DNA and is bent by approximately 52 degrees away from the dimer. The structure explains how MogR achieves binding specificity in the AT-rich genome of L. monocytogenes and explains the evolutionary conservation of A-tract sequence elements within promoter regions of MogR-regulated flagellar genes.« less

  17. Computational Model for DNA Organization Mediated by Protein Interaction in Prokaryotes

    NASA Astrophysics Data System (ADS)

    Garimella, Karthik; Kharel, Savan

    2016-03-01

    In Escherichia Coli, there are several mechanisms that drive chromosomal organization. We know through experiments that the E. Coli chromosome is condensed into highly structured regions known as macrodomains (MDs). One of the regions known as the Terminus undergoes DNA-bridging condensation that form loops between distant DNA sites and it is known to be mediated by a Terminus specific protein, which binds to specific markers within the Terminus region. In the absence of Terminus specific protein, however, the Terminus region is known to not condense nearly as much, which will likely impede several biological processes including DNA replication. In order to understand the molecular basis of protein mediation in vivo several models of Terminus specific segregation have been constructed in silico which model DNA as polymer chains.

  18. AP1 Keeps Chromatin Poised for Action | Center for Cancer Research

    Cancer.gov

    The human genome harbors gene-encoding DNA, the blueprint for building proteins that regulate cellular function. Embedded across the genome, in non-coding regions, are DNA elements to which regulatory factors bind. The interaction of regulatory factors with DNA at these sites modifies gene expression to modulate cell activity. In cells, DNA exists in a complex with proteins

  19. Genome-wide specificity of DNA binding, gene regulation, and chromatin remodeling by TALE- and CRISPR/Cas9-based transcriptional activators

    PubMed Central

    Polstein, Lauren R.; Perez-Pinera, Pablo; Kocak, D. Dewran; Vockley, Christopher M.; Bledsoe, Peggy; Song, Lingyun; Safi, Alexias; Crawford, Gregory E.; Reddy, Timothy E.; Gersbach, Charles A.

    2015-01-01

    Genome engineering technologies based on the CRISPR/Cas9 and TALE systems are enabling new approaches in science and biotechnology. However, the specificity of these tools in complex genomes and the role of chromatin structure in determining DNA binding are not well understood. We analyzed the genome-wide effects of TALE- and CRISPR-based transcriptional activators in human cells using ChIP-seq to assess DNA-binding specificity and RNA-seq to measure the specificity of perturbing the transcriptome. Additionally, DNase-seq was used to assess genome-wide chromatin remodeling that occurs as a result of their action. Our results show that these transcription factors are highly specific in both DNA binding and gene regulation and are able to open targeted regions of closed chromatin independent of gene activation. Collectively, these results underscore the potential for these technologies to make precise changes to gene expression for gene and cell therapies or fundamental studies of gene function. PMID:26025803

  20. The Kaposi Sarcoma Herpesvirus Latency-associated Nuclear Antigen DNA Binding Domain Dorsal Positive Electrostatic Patch Facilitates DNA Replication and Episome Persistence.

    PubMed

    Li, Shijun; Tan, Min; Juillard, Franceline; Ponnusamy, Rajesh; Correia, Bruno; Simas, J Pedro; Carrondo, Maria A; McVey, Colin E; Kaye, Kenneth M

    2015-11-20

    Kaposi sarcoma-associated herpesvirus (KSHV) has a causative role in several human malignancies. KSHV latency-associated nuclear antigen (LANA) mediates persistence of viral episomes in latently infected cells. LANA mediates KSHV DNA replication and segregates episomes to progeny nuclei. The structure of the LANA DNA binding domain was recently solved, revealing a positive electrostatic patch opposite the DNA binding surface, which is the site of BET protein binding. Here we investigate the functional role of the positive patch in LANA-mediated episome persistence. As expected, LANA mutants with alanine or glutamate substitutions in the central, peripheral, or lateral portions of the positive patch maintained the ability to bind DNA by EMSA. However, all of the substitution mutants were deficient for LANA DNA replication and episome maintenance. Mutation of the peripheral region generated the largest deficiencies. Despite these deficiencies, all positive patch mutants concentrated to dots along mitotic chromosomes in cells containing episomes, similar to LANA. The central and peripheral mutants, but not the lateral mutants, were reduced for BET protein interaction as assessed by co-immunoprecipitation. However, defects in BET protein binding were independent of episome maintenance function. Overall, the reductions in episome maintenance closely correlated with DNA replication deficiencies, suggesting that the replication defects account for the reduced episome persistence. Therefore, the electrostatic patch exerts a key role in LANA-mediated DNA replication and episome persistence and may act through a host cell partner(s) other than a BET protein or by inducing specific structures or complexes. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. NFκB- and AP-1-mediated DNA looping regulates matrix metalloproteinase-9 transcription in TNF-α-treated human leukemia U937 cells.

    PubMed

    Chen, Ying-Jung; Chang, Long-Sen

    2015-10-01

    The aim of this study is to explore the spatial association of critical genomic elements in the effect of TNF-α on matrix metalloproteinase-9 (MMP-9) expression in human leukemia U937 cells. TNF-α up-regulated MMP-9 protein expression and mRNA level in U937 cells, and Akt-mediated-NFκB/p65 activation and JNK-mediated c-Jun activation were proven to be involved in TNF-α-induced MMP-9 up-regulation. Promoter luciferase activity assay revealed that NFκB (nt-600) and AP-1 (nt-79) binding sites were crucial for TNF-α-induced transcription of MMP-9 gene. The results of a chromatin immunoprecipitation assay indicated that TNF-α reduced histone deacetylase-1 (HDAC-1) recruitment but increased p300 (a histone acetyltransferase) recruitment to MMP-9 promoter regions surrounding NFκB and AP-1 binding sites. Consistently, TNF-α increased enrichment of the acetylated histone H3 mark on MMP-9 promoter regions. DNA affinity purification assay revealed that p300 and HDAC1 could bind oligonucleotides containing AP-1/c-Jun and NFκB/p65 binding sites. Chromosome conformation capture assay showed that TNF-α stimulated chromosomal loops in the MMP-9 promoter via NFκB/p65 and AP-1/c-Jun. The p300-associated acetyltransferase activity was crucial for p65/c-Jun-mediated DNA looping, and inhibition of HDAC activity increased the level of DNA looping. Reduction in the level of DNA looping eliminated all TNF-α-stimulated MMP-9 up-regulation. Taken together, our data suggest that p65/c-Jun-mediated DNA looping is involved in TNF-α-induced MMP-9 up-regulation and that the recruitment of p300 or HDAC1 to NFκB and AP-1 binding sites modifies the level of DNA looping. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Spatial Organization of the Core Region of Yeast TFIIIB-DNA Complexes

    PubMed Central

    Persinger, Jim; Sengupta, Sarojini M.; Bartholomew, Blaine

    1999-01-01

    The interaction of yeast TFIIIB with the region upstream of the SUP4 tRNATyr gene was extensively probed by use of photoreactive phosphodiesters, deoxyuridines, and deoxycytidines that are site specifically incorporated into DNA. The TATA binding protein (TBP) was found to be in close proximity to the minor groove of a TATA-like DNA sequence that starts 30 nucleotides upstream of the start site of transcription. TBP was cross-linked to the phosphate backbone of DNA from bp −30 to −20 in the nontranscribed strand and from bp −28 to −24 in the transcribed strand (+1 denotes the start site of transcription). Most of the major groove of DNA in this region was shown not to be in close proximity to TBP, thus resembling the binding of TBP to the TATA box, with one notable exception. TBP was shown to interact with the major groove of DNA primarily at bp −23 and to a lesser degree at bp −25 in the transcribed strand. The stable interaction of TBP with the major groove at bp −23 was shown to require the B" subunit of TFIIIB. The S4 helix and flanking region of TBP were shown to be proximal to the major groove of DNA by peptide mapping of the region of TBP cross-linked at bp −23. Thus, TBP in the TFIIIB-SUP4 gene promoter region is bound in the same direction as TBP bound to the TATA box with respect to the transcription start site. The B" and TFIIB-related factor (BRF) subunits of TFIIIB are positioned on opposite sides of the TBP-DNA core of the TFIIIB complex, as indicated by correlation of cross-linking data to the crystal structure of the TBP-TATA box complex. Evidence is given for BRF binding near the C-terminal stirrup of TBP, similar to that of TFIIB near the TBP-TATA box complex. The protein clamp formed around the TBP-DNA complex by BRF and B" would help explain the long half-life of the TFIIIB-DNA complex and its resistance to polyanions and high salt. The path of DNA traversing the surface of TBP at the 3′ end of the TATA-like element in the SUP4 tRNA gene is not the same as that of TBP bound to a TATA box element, as shown by the cross-linking of TBP at bp −23. PMID:10373570

  3. Identification and preliminary characterization of a protein motif related to the zinc finger.

    PubMed Central

    Lovering, R; Hanson, I M; Borden, K L; Martin, S; O'Reilly, N J; Evan, G I; Rahman, D; Pappin, D J; Trowsdale, J; Freemont, P S

    1993-01-01

    We have identified a protein motif, related to the zinc finger, which defines a newly discovered family of proteins. The motif was found in the sequence of the human RING1 gene, which is proximal to the major histocompatibility complex region on chromosome six. We propose naming this motif the "RING finger" and it is found in 27 proteins, all of which have putative DNA binding functions. We have synthesized a peptide corresponding to the RING1 motif and examined a number of properties, including metal and DNA binding. We provide evidence to support the suggestion that the RING finger motif is the DNA binding domain of this newly defined family of proteins. Images Fig. 1 Fig. 4 PMID:7681583

  4. Scaffold Functions of 14-3-3 Adaptors in B Cell Immunoglobulin Class Switch DNA Recombination

    PubMed Central

    White, Clayton A.; Li, Guideng; Pone, Egest J.; Xu, Zhenming; Casali, Paolo

    2013-01-01

    Class switch DNA recombination (CSR) of the immunoglobulin heavy chain (IgH) locus crucially diversifies antibody biological effector functions. CSR involves the induction of activation-induced cytidine deaminase (AID) expression and AID targeting to switch (S) regions by 14-3-3 adaptors. 14-3-3 adaptors specifically bind to 5′-AGCT-3′ repeats, which make up for the core of all IgH locus S regions. They selectively target the upstream and downstream S regions that are set to undergo S–S DNA recombination. We hypothesized that 14-3-3 adaptors function as scaffolds to stabilize CSR enzymatic elements on S regions. Here we demonstrate that all seven 14-3-3β, 14-3-3ε, 14-3-3γ, 14-3-3η, 14-3-3σ, 14-3-3τ and 14-3-3ζ adaptors directly interacted with AID, PKA-Cα (catalytic subunit) and PKA-RIα (regulatory inhibitory subunit) and uracil DNA glycosylase (Ung). 14-3-3 adaptors, however, did not interact with AID C-terminal truncation mutant AIDΔ(180–198) or AIDF193A and AIDL196A point-mutants (which have been shown not to bind to S region DNA and fail to mediate CSR). 14-3-3 adaptors colocalized with AID and replication protein A (RPA) in B cells undergoing CSR. 14-3-3 and AID binding to S region DNA was disrupted by viral protein R (Vpr), an accessory protein of human immunodeficiency virus type-1 (HIV-1), which inhibited CSR without altering AID expression or germline IH-CH transcription. Accordingly, we demonstrated that 14-3-3 directly interact with Vpr, which in turn, also interact with AID, PKA-Cα and Ung. Altogether, our findings suggest that 14-3-3 adaptors play important scaffold functions and nucleate the assembly of multiple CSR factors on S regions. They also show that such assembly can be disrupted by a viral protein, thereby allowing us to hypothesize that small molecule compounds that specifically block 14-3-3 interactions with AID, PKA and/or Ung can be used to inhibit unwanted CSR. PMID:24282540

  5. Binding Sites Analyser (BiSA): Software for Genomic Binding Sites Archiving and Overlap Analysis

    PubMed Central

    Khushi, Matloob; Liddle, Christopher; Clarke, Christine L.; Graham, J. Dinny

    2014-01-01

    Genome-wide mapping of transcription factor binding and histone modification reveals complex patterns of interactions. Identifying overlaps in binding patterns by different factors is a major objective of genomic studies, but existing methods to archive large numbers of datasets in a personalised database lack sophistication and utility. Therefore we have developed transcription factor DNA binding site analyser software (BiSA), for archiving of binding regions and easy identification of overlap with or proximity to other regions of interest. Analysis results can be restricted by chromosome or base pair overlap between regions or maximum distance between binding peaks. BiSA is capable of reporting overlapping regions that share common base pairs; regions that are nearby; regions that are not overlapping; and average region sizes. BiSA can identify genes located near binding regions of interest, genomic features near a gene or locus of interest and statistical significance of overlapping regions can also be reported. Overlapping results can be visualized as Venn diagrams. A major strength of BiSA is that it is supported by a comprehensive database of publicly available transcription factor binding sites and histone modifications, which can be directly compared to user data. The documentation and source code are available on http://bisa.sourceforge.net PMID:24533055

  6. Wnt5a Signals through DVL1 to Repress Ribosomal DNA Transcription by RNA Polymerase I.

    PubMed

    Dass, Randall A; Sarshad, Aishe A; Carson, Brittany B; Feenstra, Jennifer M; Kaur, Amanpreet; Obrdlik, Ales; Parks, Matthew M; Prakash, Varsha; Love, Damon K; Pietras, Kristian; Serra, Rosa; Blanchard, Scott C; Percipalle, Piergiorgio; Brown, Anthony M C; Vincent, C Theresa

    2016-08-01

    Ribosome biogenesis is essential for cell growth and proliferation and is commonly elevated in cancer. Accordingly, numerous oncogene and tumor suppressor signaling pathways target rRNA synthesis. In breast cancer, non-canonical Wnt signaling by Wnt5a has been reported to antagonize tumor growth. Here, we show that Wnt5a rapidly represses rDNA gene transcription in breast cancer cells and generates a chromatin state with reduced transcription of rDNA by RNA polymerase I (Pol I). These effects were specifically dependent on Dishevelled1 (DVL1), which accumulates in nucleolar organizer regions (NORs) and binds to rDNA regions of the chromosome. Upon DVL1 binding, the Pol I transcription activator and deacetylase Sirtuin 7 (SIRT7) releases from rDNA loci, concomitant with disassembly of Pol I transcription machinery at the rDNA promoter. These findings reveal that Wnt5a signals through DVL1 to suppress rRNA transcription. This provides a novel mechanism for how Wnt5a exerts tumor suppressive effects and why disruption of Wnt5a signaling enhances mammary tumor growth in vivo.

  7. USF-related transcription factor, HIV-TF1, stimulates transcription of human immunodeficiency virus-1.

    PubMed

    Maekawa, T; Sudo, T; Kurimoto, M; Ishii, S

    1991-09-11

    The transcription factor HIV-TF1, which binds to a region about 60 bp upstream from the enhancer of the human immunodeficiency virus-1 (HIV-1), was purified from human B cells. HIV-TF1 had a molecular weight of 39,000. Binding of HIV-TF1 to the HIV long terminal repeat (LTR) activated transcription from the HIV promoter in vitro. The HIV-TF1-binding site in HIV LTR was similar to the site recognized by upstream stimulatory factor (USF) in the adenovirus major late promoter. DNA-binding properties of HIV-TF1 suggested that HIV-TF1 might be identical or related to USF. Interestingly, treatment of purified HIV-TF1 by phosphatase greatly reduced its DNA-binding activity, suggesting that phosphorylation of HIV-TF1 was essential for DNA binding. The disruption of HIV-TF1-binding site induced a 60% decrease in the level of transcription from the HIV promoter in vivo. These results suggest that HIV-TF1 is involved in transcriptional regulation of HIV-1.

  8. The region of CQQQKPQRRP of PGC-1{alpha} interacts with the DNA-binding complex of FXR/RXR{alpha}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kanaya, Eiko; Jingami, Hisato

    2006-04-14

    PGC-1{alpha} co-activates transcription by several nuclear receptors. To study the interaction among PGC-1{alpha}, RXR{alpha}/FXR, and DNA, we performed electrophoresis mobility shift assays. The RXR{alpha}/FXR proteins specifically bound to DNA containing the IR-1 sequence in the absence of ligand. When the fusion protein of GST-PGC-1{alpha} was added to the mixture of RXR{alpha}/FXR/DNA, the ligand-influenced retardation of the mobility was observed. The ligand for RXR{alpha} (9-cis-retinoic acid) was necessary for this retardation, whereas, the ligand for FXR, chenodeoxycholic acid, barely had an effect. The results obtained using truncated PGC-1{alpha} proteins suggested that two regions are necessary for PGC-1{alpha} to interact with themore » DNA-binding complex of RXR{alpha}/FXR. One is the region of the second leucine-rich motif, and the other is that of the amino acid sequence CQQQKPQRRP, present between the second and third leucine-rich motifs. The results obtained with the SPQSS mutation for KPQRR suggested that the basic amino acids are important for the interaction.« less

  9. Molecular determinants of origin discrimination by Orc1 initiators in archaea.

    PubMed

    Dueber, Erin C; Costa, Alessandro; Corn, Jacob E; Bell, Stephen D; Berger, James M

    2011-05-01

    Unlike bacteria, many eukaryotes initiate DNA replication from genomic sites that lack apparent sequence conservation. These loci are identified and bound by the origin recognition complex (ORC), and subsequently activated by a cascade of events that includes recruitment of an additional factor, Cdc6. Archaeal organisms generally possess one or more Orc1/Cdc6 homologs, belonging to the Initiator clade of ATPases associated with various cellular activities (AAA(+)) superfamily; however, these proteins recognize specific sequences within replication origins. Atomic resolution studies have shown that archaeal Orc1 proteins contact double-stranded DNA through an N-terminal AAA(+) domain and a C-terminal winged-helix domain (WHD), but use remarkably few base-specific contacts. To investigate the biochemical effects of these associations, we mutated the DNA-interacting elements of the Orc1-1 and Orc1-3 paralogs from the archaeon Sulfolobus solfataricus, and tested their effect on origin binding and deformation. We find that the AAA(+) domain has an unpredicted role in controlling the sequence selectivity of DNA binding, despite an absence of base-specific contacts to this region. Our results show that both the WHD and ATPase region influence origin recognition by Orc1/Cdc6, and suggest that not only DNA sequence, but also local DNA structure help define archaeal initiator binding sites. © The Author(s) 2011. Published by Oxford University Press.

  10. Modified naphthalene diimide as a suitable tetraplex DNA ligand: application to cancer diagnosis and anti-cancer drug

    NASA Astrophysics Data System (ADS)

    Takenaka, Shigeori

    2017-07-01

    It is known that naphthalene diimide carrying two substituents binds to DNA duplex with threading intercalation. Naphthalene diimide carrying ferrocene moieties, ferrocenylnaphthalene diimide (FND), formed a stable complex with DNA duplex and an electrochemical gene detection was achieved with current signal generated from FND bound to the DNA duplex between target DNA and DNA probe immobilized electrode. FND couldn't bind to the mismatched and its surrounding region of DNA duplex and thus FND was applied to the precision detection of single nucleotide polymorphisms (SNPs) using the improved discrimination ability between fully matched and mismatched DNA hybrids and multi-electrode chip. Some of FND derivatives bound to telomere DNA tetraplex stronger than to DNA duplex and was applied to cancer diagnosis as a measure of the elongated telomere DNA with telomerase as a suitable maker of cancer. Furthermore, cyclic naphthalene diimides realized the extremely high preference for DNA tetraplex over DNA duplex. Such molecules will open an effective anti-cancer drug based on telomerase specific inhibitor.

  11. Ionic modulation of QPX stability as a nano-switch regulating gene expression in neurons

    NASA Astrophysics Data System (ADS)

    Baghaee Ravari, Soodeh

    G-quadruplexes (G-QPX) have been the subject of intense research due to their unique structural configuration and potential applications, particularly their functionality in biological process as a novel type of nano--switch. They have been found in critical regions of the human genome such as telomeres, promoter regions, and untranslated regions of RNA. About 50% of human DNA in promoters has G-rich regions with the potential to form G-QPX structures. A G-QPX might act mechanistically as an ON/OFF switch, regulating gene expression, meaning that the formation of G-QPX in a single strand of DNA disrupts double stranded DNA, prevents the binding of transcription factors (TF) to their recognition sites, resulting in gene down-regulation. Although there are numerous studies on biological roles of G-QPXs in oncogenes, their potential formation in neuronal cells, in particular upstream of transcription start sites, is poorly investigated. The main focus of this research is to identify stable G-QPXs in the 97bp active promoter region of the choline acetyltransferase (ChAT) gene, the terminal enzyme involved in synthesis of the neurotransmitter acetylcholine, and to clarify ionic modulation of G-QPX nanostructures through the mechanism of neural action potentials. Different bioinformatics analyses (in silico), including the QGRS, quadparser and G4-Calculator programs, have been used to predict stable G-QPX in the active promoter region of the human ChAT gene, located 1000bp upstream from the TATA box. The results of computational studies (using those three different algorithms) led to the identification of three consecutive intramolecular G-QPX structures in the negative strand (ChAT G17-2, ChAT G17, and ChAT G29) and one intramolecular G-QPX structure in the positive strand (ChAT G30). Also, the results suggest the possibility that nearby G-runs in opposed DNA strands with a short distance of each other may be able to form a stable intermolecular G-QPX involving two DNA complementary strands (ds ChAT G21). Formation of G-QPX structures, by blocking the availability of the transcription factor binding site (TFBS) on double stranded DNA, can interfere with transcriptional activation. This suggests that there is competition between TFBS binding to dsDNA and the conversion to high order non-B form secondary structures (G-QPXs) in the active promoter region. TFBS mapping analysis of the active promoter region of the human ChAT gene revealed that it contains multiple consensus AP-2alpha and Sp1 binding sites and consensus sites for other TF, including multiple sites for GR-alpha, Pax-5, p53 and GC box proteins. (Abstract shortened by ProQuest.).

  12. Targeting G-quadruplex DNA structures in the telomere and oncogene promoter regions by benzimidazole‒carbazole ligands.

    PubMed

    Kaulage, Mangesh H; Maji, Basudeb; Pasadi, Sanjeev; Ali, Asfa; Bhattacharya, Santanu; Muniyappa, K

    2018-03-25

    Recent studies support the idea that G-quadruplex structures in the promoter regions of oncogenes and telomere DNA can serve as potential therapeutic targets in the treatment of cancer. Accordingly, several different types of organic small molecules that stabilize G-quadruplex structures and inhibit telomerase activity have been discerned. Here, we describe the binding of benzimidazole-carbazole ligands to G-quadruplex structures formed in G-rich DNA sequences containing the promoter regions of human c-MYC, c-KIT1, c-KIT2, VEGF and BCL2 proto-oncogenes. The fluorescence spectroscopic data indicate that benzimidazole-carbazole ligands bind and stabilize the G-quadruplexes in the promoter region of oncogenes. The molecular docking studies provide insights into the mode and extent of binding of this class of ligands to the G-quadruplexes formed in oncogene promoters. The high stability of these G-quadruplex structures was validated by thermal denaturation and telomerase-catalyzed extension of the 3' end. Notably, benzimidazole-carbazole ligands suppress the expression of oncogenes in cancer cells in a dose-dependent manner. We anticipate that benzimidazole-carbazole ligands, by virtue of their ability to stabilize G-quadruplex structures in the promoter regions of oncogenes, might reduce the risk of cancer through the loss of function in the proteins encoded by these genes. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  13. DNA-PK/Ku complex binds to latency-associated nuclear antigen and negatively regulates Kaposi's sarcoma-associated herpesvirus latent replication

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cha, Seho; Lim, Chunghun; Lee, Jae Young

    2010-04-16

    During latent infection, latency-associated nuclear antigen (LANA) of Kaposi's sarcoma-associated herpesvirus (KSHV) plays important roles in episomal persistence and replication. Several host factors are associated with KSHV latent replication. Here, we show that the catalytic subunit of DNA protein kinase (DNA-PKcs), Ku70, and Ku86 bind the N-terminal region of LANA. LANA was phosphorylated by DNA-PK and overexpression of Ku70, but not Ku86, impaired transient replication. The efficiency of transient replication was significantly increased in the HCT116 (Ku86 +/-) cell line, compared to the HCT116 (Ku86 +/+) cell line, suggesting that the DNA-PK/Ku complex negatively regulates KSHV latent replication.

  14. TRX-LOGOS - a graphical tool to demonstrate DNA information content dependent upon backbone dynamics in addition to base sequence.

    PubMed

    Fortin, Connor H; Schulze, Katharina V; Babbitt, Gregory A

    2015-01-01

    It is now widely-accepted that DNA sequences defining DNA-protein interactions functionally depend upon local biophysical features of DNA backbone that are important in defining sites of binding interaction in the genome (e.g. DNA shape, charge and intrinsic dynamics). However, these physical features of DNA polymer are not directly apparent when analyzing and viewing Shannon information content calculated at single nucleobases in a traditional sequence logo plot. Thus, sequence logos plots are severely limited in that they convey no explicit information regarding the structural dynamics of DNA backbone, a feature often critical to binding specificity. We present TRX-LOGOS, an R software package and Perl wrapper code that interfaces the JASPAR database for computational regulatory genomics. TRX-LOGOS extends the traditional sequence logo plot to include Shannon information content calculated with regard to the dinucleotide-based BI-BII conformation shifts in phosphate linkages on the DNA backbone, thereby adding a visual measure of intrinsic DNA flexibility that can be critical for many DNA-protein interactions. TRX-LOGOS is available as an R graphics module offered at both SourceForge and as a download supplement at this journal. To demonstrate the general utility of TRX logo plots, we first calculated the information content for 416 Saccharomyces cerevisiae transcription factor binding sites functionally confirmed in the Yeastract database and matched to previously published yeast genomic alignments. We discovered that flanking regions contain significantly elevated information content at phosphate linkages than can be observed at nucleobases. We also examined broader transcription factor classifications defined by the JASPAR database, and discovered that many general signatures of transcription factor binding are locally more information rich at the level of DNA backbone dynamics than nucleobase sequence. We used TRX-logos in combination with MEGA 6.0 software for molecular evolutionary genetics analysis to visually compare the human Forkhead box/FOX protein evolution to its binding site evolution. We also compared the DNA binding signatures of human TP53 tumor suppressor determined by two different laboratory methods (SELEX and ChIP-seq). Further analysis of the entire yeast genome, center aligned at the start codon, also revealed a distinct sequence-independent 3 bp periodic pattern in information content, present only in coding region, and perhaps indicative of the non-random organization of the genetic code. TRX-LOGOS is useful in any situation in which important information content in DNA can be better visualized at the positions of phosphate linkages (i.e. dinucleotides) where the dynamic properties of the DNA backbone functions to facilitate DNA-protein interaction.

  15. Electrostatic field of the large fragment of Escherichia coli DNA polymerase I.

    PubMed

    Warwicker, J; Ollis, D; Richards, F M; Steitz, T A

    1985-12-05

    The electrostatic field of the large fragment of Escherichia coli DNA polymerase I (Klenow fragment) has been calculated by the finite difference procedure on a 2 A grid. The potential field is substantially negative at physiological pH (reflecting the net negative charge at this pH). The largest regions of positive potential are in the deep crevice of the C-terminal domain, which is the proposed binding site for the DNA substrate. Within the crevice, the electrostatic potential has a partly helical form. If the DNA is positioned to fulfil stereochemical requirements, then the positive potential generally follows the major groove and (to a lesser extent) the negative potential is in the minor groove. Such an arrangement could stabilize DNA configurations related by screw symmetry. The histidine residues of the Klenow fragment give the positive field of the groove a sensitivity to relatively small pH changes around neutrality. We suggest that the histidine residues could change their ionization states in response to DNA binding, and that this effect could contribute to the protein-DNA binding energy.

  16. AP1 Keeps Chromatin Poised for Action | Center for Cancer Research

    Cancer.gov

    The human genome harbors gene-encoding DNA, the blueprint for building proteins that regulate cellular function. Embedded across the genome, in non-coding regions, are DNA elements to which regulatory factors bind. The interaction of regulatory factors with DNA at these sites modifies gene expression to modulate cell activity. In cells, DNA exists in a complex with proteins called chromatin that compacts the DNA in the nucleus, strongly restricting access to DNA sequences. As a result, regulatory factors only interact with a small subset of their potential binding elements in a given cell to regulate genes. How factors recognize and select sites in chromatin across the genome is not well understood -- but several discoveries in CCR’s Laboratory of Receptor Biology and Gene Expression (LRBGE) have shed light on the mechanisms that direct factors to DNA.

  17. c-Jun binds the N terminus of human TAF(II)250 to derepress RNA polymerase II transcription in vitro.

    PubMed

    Lively, T N; Ferguson, H A; Galasinski, S K; Seto, A G; Goodrich, J A

    2001-07-06

    c-Jun is an oncoprotein that activates transcription of many genes involved in cell growth and proliferation. We studied the mechanism of transcriptional activation by human c-Jun in a human RNA polymerase II transcription system composed of highly purified recombinant and native transcription factors. Transcriptional activation by c-Jun depends on the TATA-binding protein (TBP)-associated factor (TAF) subunits of transcription factor IID (TFIID). Protein-protein interaction assays revealed that c-Jun binds with high specificity to the largest subunit of human TFIID, TAF(II)250. The region of TAF(II)250 bound by c-Jun lies in the N-terminal 163 amino acids. This same region of TAF(II)250 binds to TBP and represses its interaction with TATA boxes, thereby decreasing DNA binding by TFIID. We hypothesized that c-Jun is capable of derepressing the effect of the TAF(II)250 N terminus on TFIID-driven transcription. In support of this hypothesis, we found that c-Jun increased levels of TFIID-driven transcription in vitro when added at high concentrations to a DNA template lacking activator protein 1 (AP-1) sites. Moreover, c-Jun blocked the repression of TBP DNA binding caused by the N terminus of TAF(II)250. In addition to revealing a mechanism by which c-Jun activates transcription, our studies provide the first evidence that an activator can bind directly to the N terminus of TAF(II)250 to derepress RNA polymerase II transcription in vitro.

  18. A dual switch controls bacterial enhancer-dependent transcription

    PubMed Central

    Wiesler, Simone C.; Burrows, Patricia C.; Buck, Martin

    2012-01-01

    Bacterial RNA polymerases (RNAPs) are targets for antibiotics. Myxopyronin binds to the RNAP switch regions to block structural rearrangements needed for formation of open promoter complexes. Bacterial RNAPs containing the major variant σ54 factor are activated by enhancer-binding proteins (bEBPs) and transcribe genes whose products are needed in pathogenicity and stress responses. We show that (i) enhancer-dependent RNAPs help Escherichia coli to survive in the presence of myxopyronin, (ii) enhancer-dependent RNAPs partially resist inhibition by myxopyronin and (iii) ATP hydrolysis catalysed by bEBPs is obligatory for functional interaction of the RNAP switch regions with the transcription start site. We demonstrate that enhancer-dependent promoters contain two barriers to full DNA opening, allowing tight regulation of transcription initiation. bEBPs engage in a dual switch to (i) allow propagation of nucleated DNA melting from an upstream DNA fork junction and (ii) complete the formation of the transcription bubble and downstream DNA fork junction at the RNA synthesis start site, resulting in switch region-dependent RNAP clamp closure and open promoter complex formation. PMID:22965125

  19. Ligand binding to telomeric G-quadruplex DNA investigated by funnel-metadynamics simulations

    PubMed Central

    Moraca, Federica; Amato, Jussara; Ortuso, Francesco; Artese, Anna; Novellino, Ettore; Alcaro, Stefano; Parrinello, Michele; Limongelli, Vittorio

    2017-01-01

    G-quadruplexes (G4s) are higher-order DNA structures typically present at promoter regions of genes and telomeres. Here, the G4 formation decreases the replicative DNA at each cell cycle, finally leading to apoptosis. The ability to control this mitotic clock, particularly in cancer cells, is fascinating and passes through a rational understanding of the ligand/G4 interaction. We demonstrate that an accurate description of the ligand/G4 binding mechanism is possible using an innovative free-energy method called funnel-metadynamics (FM), which we have recently developed to investigate ligand/protein interaction. Using FM simulations, we have elucidated the binding mechanism of the anticancer alkaloid berberine to the human telomeric G4 (d[AG3(T2AG3)3]), computing also the binding free-energy landscape. Two ligand binding modes have been identified as the lowest energy states. Furthermore, we have found prebinding sites, which are preparatory to reach the final binding mode. In our simulations, the ions and the water molecules have been explicitly represented and the energetic contribution of the solvent during ligand binding evaluated. Our theoretical results provide an accurate estimate of the absolute ligand/DNA binding free energy (ΔGb0 = −10.3 ± 0.5 kcal/mol) that we validated through steady-state fluorescence binding assays. The good agreement between the theoretical and experimental value demonstrates that FM is a most powerful method to investigate ligand/DNA interaction and can be a useful tool for the rational design also of G4 ligands. PMID:28232513

  20. Structure of homeodomain-leucine zipper/DNA complexes studied using hydroxyl radical cleavage of DNA and methylation interference.

    PubMed

    Tron, Adriana E; Comelli, Raúl N; Gonzalez, Daniel H

    2005-12-27

    Homeodomain-leucine zipper (HD-Zip) proteins, unlike most homeodomain proteins, bind a pseudopalindromic DNA sequence as dimers. We have investigated the structure of the DNA complexes formed by two HD-Zip proteins with different nucleotide preferences at the central position of the binding site using footprinting and interference methods. The results indicate that the respective complexes are not symmetric, with the strand bearing a central purine (top strand) showing higher protection around the central region and the bottom strand protected toward the 3' end. Binding to a sequence with a nonpreferred central base pair produces a decrease in protection in either the top or the bottom strand, depending upon the protein. Modeling studies derived from the complex formed by the monomeric Antennapedia homeodomain with DNA indicate that in the HD-Zip/DNA complex the recognition helix of one of the monomers is displaced within the major groove respective to the other one. This monomer seems to lose contacts with a part of the recognition sequence upon binding to the nonpreferred site. The results show that the structure of the complex formed by HD-Zip proteins with DNA is dependent upon both protein intrinsic characteristics and the nucleotides present at the central position of the recognition sequence.

  1. Modular structural elements in the replication origin region of Tetrahymena rDNA.

    PubMed Central

    Du, C; Sanzgiri, R P; Shaiu, W L; Choi, J K; Hou, Z; Benbow, R M; Dobbs, D L

    1995-01-01

    Computer analyses of the DNA replication origin region in the amplified rRNA genes of Tetrahymena thermophila identified a potential initiation zone in the 5'NTS [Dobbs, Shaiu and Benbow (1994), Nucleic Acids Res. 22, 2479-2489]. This region consists of a putative DNA unwinding element (DUE) aligned with predicted bent DNA segments, nuclear matrix or scaffold associated region (MAR/SAR) consensus sequences, and other common modular sequence elements previously shown to be clustered in eukaryotic chromosomal origin regions. In this study, two mung bean nuclease-hypersensitive sites in super-coiled plasmid DNA were localized within the major DUE-like element predicted by thermodynamic analyses. Three restriction fragments of the 5'NTS region predicted to contain bent DNA segments exhibited anomalous migration characteristic of bent DNA during electrophoresis on polyacrylamide gels. Restriction fragments containing the 5'NTS region bound Tetrahymena nuclear matrices in an in vitro binding assay, consistent with an association of the replication origin region with the nuclear matrix in vivo. The direct demonstration in a protozoan origin region of elements previously identified in Drosophila, chick and mammalian origin regions suggests that clusters of modular structural elements may be a conserved feature of eukaryotic chromosomal origins of replication. Images PMID:7784181

  2. Birth, evolution, and transmission of satellite-free mammalian centromeric domains.

    PubMed

    Nergadze, Solomon G; Piras, Francesca M; Gamba, Riccardo; Corbo, Marco; Cerutti, Federico; McCarter, Joseph G W; Cappelletti, Eleonora; Gozzo, Francesco; Harman, Rebecca M; Antczak, Douglas F; Miller, Donald; Scharfe, Maren; Pavesi, Giulio; Raimondi, Elena; Sullivan, Kevin F; Giulotto, Elena

    2018-06-01

    Mammalian centromeres are associated with highly repetitive DNA (satellite DNA), which has so far hindered molecular analysis of this chromatin domain. Centromeres are epigenetically specified, and binding of the CENPA protein is their main determinant. In previous work, we described the first example of a natural satellite-free centromere on Equus caballus Chromosome 11. Here, we investigated the satellite-free centromeres of Equus asinus by using ChIP-seq with anti-CENPA antibodies. We identified an extraordinarily high number of centromeres lacking satellite DNA (16 of 31). All of them lay in LINE- and AT-rich regions. A subset of these centromeres is associated with DNA amplification. The location of CENPA binding domains can vary in different individuals, giving rise to epialleles. The analysis of epiallele transmission in hybrids (three mules and one hinny) showed that centromeric domains are inherited as Mendelian traits, but their position can slide in one generation. Conversely, centromere location is stable during mitotic propagation of cultured cells. Our results demonstrate that the presence of more than half of centromeres void of satellite DNA is compatible with genome stability and species survival. The presence of amplified DNA at some centromeres suggests that these arrays may represent an intermediate stage toward satellite DNA formation during evolution. The fact that CENPA binding domains can move within relatively restricted regions (a few hundred kilobases) suggests that the centromeric function is physically limited by epigenetic boundaries. © 2018 Nergadze et al.; Published by Cold Spring Harbor Laboratory Press.

  3. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development

    PubMed Central

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh

    2013-01-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein–protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action. PMID:23847101

  4. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development.

    PubMed

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A; Brodsky, Michael H; Sinha, Saurabh

    2013-09-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein-protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action.

  5. Structural Studies of E. coli Topoisomerase III-DNA Complexes Reveal A Novel Type IA Topoisomerase-DNA Conformational Intermediate

    PubMed Central

    Changela, Anita; DiGate, Russell J.; Mondragón, Alfonso

    2007-01-01

    Summary E. coli DNA topoisomerase III belongs to the type IA family of DNA topoisomerases, which transiently cleave single-stranded DNA (ssDNA) via a 5′ phosphotyrosine intermediate. We have solved crystal structures of wild-type E. coli topoisomerase III bound to an 8-base ssDNA molecule in three different pH environments. The structures reveal the enzyme in three distinct conformational states while bound to DNA. One conformation resembles the one observed previously with a DNA-bound, catalytically inactive mutant of topoisomerase III where DNA binding realigns catalytic residues to form a functional active site. Another conformation represents a novel intermediate in which DNA is bound along the ssDNA-binding groove but does not enter the active site, which remains in a catalytically inactive, closed state. A third conformation shows an intermediate state where the enzyme is still in a closed state, but the ssDNA is starting to invade the active site. For the first time, the active site region in the presence of both the catalytic tyrosine and ssDNA substrate is revealed for a type IA DNA topoisomerase, although there is no evidence of ssDNA cleavage. Comparative analysis of the various conformational states suggests a sequence of domain movements undertaken by the enzyme upon substrate binding. PMID:17331537

  6. The adenovirus L4-22K protein regulates transcription and RNA splicing via a sequence-specific single-stranded RNA binding.

    PubMed

    Lan, Susan; Kamel, Wael; Punga, Tanel; Akusjärvi, Göran

    2017-02-28

    The adenovirus L4-22K protein both activates and suppresses transcription from the adenovirus major late promoter (MLP) by binding to DNA elements located downstream of the MLP transcriptional start site: the so-called DE element (positive) and the R1 region (negative). Here we show that L4-22K preferentially binds to the RNA form of the R1 region, both to the double-stranded RNA and the single-stranded RNA of the same polarity as the nascent MLP transcript. Further, L4-22K binds to a 5΄-CAAA-3΄ motif in the single-stranded RNA, which is identical to the sequence motif characterized for L4-22K DNA binding. L4-22K binding to single-stranded RNA results in an enhancement of U1 snRNA recruitment to the major late first leader 5΄ splice site. This increase in U1 snRNA binding results in a suppression of MLP transcription and a concurrent stimulation of major late first intron splicing. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. AmrZ Beta-Sheet Residues Are Essential for DNA Binding and Transcriptional Control of Pseudomonas aeruginosa Virulence Genes ▿ †

    PubMed Central

    Waligora, Elizabeth A.; Ramsey, Deborah M.; Pryor, Edward E.; Lu, Haiping; Hollis, Thomas; Sloan, Gina P.; Deora, Rajendar; Wozniak, Daniel J.

    2010-01-01

    AmrZ is a putative ribbon-helix-helix (RHH) transcriptional regulator. RHH proteins utilize residues within the β-sheet for DNA binding, while the α-helices promote oligomerization. AmrZ is of interest due to its dual roles as a transcriptional activator and as a repressor, regulating genes encoding virulence factors associated with both chronic and acute Pseudomonas aeruginosa infection. In this study, cross-linking revealed that AmrZ forms oligomers in solution but that the amino terminus, containing an unordered region and a β-sheet, were not required for oligomerization. The first 12 unordered residues (extended amino terminus) contributed minimally to DNA binding. Mutagenesis of the AmrZ β-sheet demonstrated that residues 18, 20, and 22 were essential for DNA binding at both activation and repressor sites, suggesting that AmrZ utilizes a similar mechanism for binding to these sites. Mice infected with amrZ mutants exhibited reduced bacterial burden, morbidity, and mortality. Direct in vivo competition assays showed a 5-fold competitive advantage for the wild type over an isogenic amrZ mutant. Finally, the reduced infection phenotype of the amrZ-null strain was similar to that of a strain expressing a DNA-binding-deficient AmrZ variant, indicating that DNA binding and transcriptional regulation by AmrZ is responsible for the in vivo virulence defect. These recent infection data, along with previously identified AmrZ-regulated virulence factors, suggest the necessity of AmrZ transcriptional regulation for optimal virulence during acute infection. PMID:20709902

  8. Three SRA-Domain Methylcytosine-Binding Proteins Cooperate to Maintain Global CpG Methylation and Epigenetic Silencing in Arabidopsis

    PubMed Central

    Woo, Hye Ryun; Dittmer, Travis A.; Richards, Eric J.

    2008-01-01

    Methylcytosine-binding proteins decipher the epigenetic information encoded by DNA methylation and provide a link between DNA methylation, modification of chromatin structure, and gene silencing. VARIANT IN METHYLATION 1 (VIM1) encodes an SRA (SET- and RING-associated) domain methylcytosine-binding protein in Arabidopsis thaliana, and loss of VIM1 function causes centromere DNA hypomethylation and centromeric heterochromatin decondensation in interphase. In the Arabidopsis genome, there are five VIM genes that share very high sequence similarity and encode proteins containing a PHD domain, two RING domains, and an SRA domain. To gain further insight into the function and potential redundancy among the VIM proteins, we investigated strains combining different vim mutations and transgenic vim knock-down lines that down-regulate multiple VIM family genes. The vim1 vim3 double mutant and the transgenic vim knock-down lines showed decreased DNA methylation primarily at CpG sites in genic regions, as well as repeated sequences in heterochromatic regions. In addition, transcriptional silencing was released in these plants at most heterochromatin regions examined. Interestingly, the vim1 vim3 mutant and vim knock-down lines gained ectopic CpHpH methylation in the 5S rRNA genes against a background of CpG hypomethylation. The vim1 vim2 vim3 triple mutant displayed abnormal morphological phenotypes including late flowering, which is associated with DNA hypomethylation of the 5′ region of FWA and release of FWA gene silencing. Our findings demonstrate that VIM1, VIM2, and VIM3 have overlapping functions in maintenance of global CpG methylation and epigenetic transcriptional silencing. PMID:18704160

  9. Mapping and mutagenesis of the amino-terminal transcriptional repression domain of the Drosophila Krüppel protein.

    PubMed Central

    Licht, J D; Hanna-Rose, W; Reddy, J C; English, M A; Ro, M; Grossel, M; Shaknovich, R; Hansen, U

    1994-01-01

    We previously demonstrated that the Drosophila Krüppel protein is a transcriptional repressor with separable DNA-binding and transcriptional repression activities. In this study, the minimal amino (N)-terminal repression region of the Krüppel protein was defined by transferring regions of the Krüppel protein to a heterologous DNA-binding protein, the lacI protein. Fusion of a predicted alpha-helical region from amino acids 62 to 92 in the N terminus of the Krüppel protein was sufficient to transfer repression activity. This putative alpha-helix has several hydrophobic surfaces, as well as a glutamine-rich surface. Mutants containing multiple amino acid substitutions of the glutamine residues demonstrated that this putative alpha-helical region is essential for repression activity of a Krüppel protein containing the entire N-terminal and DNA-binding regions. Furthermore, one point mutant with only a single glutamine on this surface altered to lysine abolished the ability of the Krüppel protein to repress, indicating the importance of the amino acid at residue 86 for repression. The N terminus also contained an adjacent activation region localized between amino acids 86 and 117. Finally, in accordance with predictions from primary amino acid sequence similarity, a repression region from the Drosophila even-skipped protein, which was six times more potent than that of the Krüppel protein in the mammalian cells, was characterized. This segment included a hydrophobic stretch of 11 consecutive alanine residues and a proline-rich region. Images PMID:8196644

  10. Structural Mechanism behind Distinct Efficiency of Oct4/Sox2 Proteins in Differentially Spaced DNA Complexes

    PubMed Central

    Yesudhas, Dhanusha; Anwar, Muhammad Ayaz; Panneerselvam, Suresh; Durai, Prasannavenkatesh; Shah, Masaud; Choi, Sangdun

    2016-01-01

    The octamer-binding transcription factor 4 (Oct4) and sex-determining region Y (SRY)-box 2 (Sox2) proteins induce various transcriptional regulators to maintain cellular pluripotency. Most Oct4/Sox2 complexes have either 0 base pairs (Oct4/Sox20bp) or 3 base pairs (Oct4/Sox23bp) separation between their DNA-binding sites. Results from previous biochemical studies have shown that the complexes separated by 0 base pairs are associated with a higher pluripotency rate than those separated by 3 base pairs. Here, we performed molecular dynamics (MD) simulations and calculations to determine the binding free energy and per-residue free energy for the Oct4/Sox20bp and Oct4/Sox23bp complexes to identify structural differences that contribute to differences in induction rate. Our MD simulation results showed substantial differences in Oct4/Sox2 domain movements, as well as secondary-structure changes in the Oct4 linker region, suggesting a potential reason underlying the distinct efficiencies of these complexes during reprogramming. Moreover, we identified key residues and hydrogen bonds that potentially facilitate protein-protein and protein-DNA interactions, in agreement with previous experimental findings. Consequently, our results confess that differential spacing of the Oct4/Sox2 DNA binding sites can determine the magnitude of transcription of the targeted genes during reprogramming. PMID:26790000

  11. Domain architectures of the Scm3p protein provide insights into centromere function and evolution.

    PubMed

    Aravind, L; Iyer, Lakshminarayan M; Wu, Carl

    2007-10-15

    Recently, Scm3p has been shown to be a nonhistone component of centromeric chromatin that binds stoichiometrically to CenH3-H4 histones, and to be required for the assembly of kinetochores in Saccharomyces cerevisiae. Scm3p is conserved across fungi, and displays a remarkable variation in protein size, ranging from approximately 200 amino acids in S. cerevisiae to approximately 1300 amino acids in Neurospora crassa. This is primarily due a variable C-terminal segment that is linked to a conserved N-terminal, CenH3-interacting domain. We have discovered that the extended C-terminal region of Scm3p is strikingly characterized by lineage-specific fusions of single or multiple predicted DNA-binding domains different versions of the MYB and C2H2 zinc finger domains, AT-hooks, and a novel cysteine-rich metal-chelating cluster that are absent from the small versions of Scm3. Instead, S. cerevisiae point centromeres are recognized by components of the CBF3 DNA binding complex, which are conserved amongst close relatives of budding yeast, but are correspondingly absent from more distant fungi that possess regional centromeres. Hence, the C-terminal DNA binding motifs found in large Scm3p proteins may, along with CenH3, serve as a key epigenetic signal by recognizing and accommodating the lineage-specific diversity of centromere DNA in course of evolution.

  12. Crucial role of dynamic linker histone binding and divalent ions for DNA accessibility and gene regulation revealed by mesoscale modeling of oligonucleosomes

    PubMed Central

    Collepardo-Guevara, Rosana; Schlick, Tamar

    2012-01-01

    Monte Carlo simulations of a mesoscale model of oligonucleosomes are analyzed to examine the role of dynamic-linker histone (LH) binding/unbinding in high monovalent salt with divalent ions, and to further interpret noted chromatin fiber softening by dynamic LH in monovalent salt conditions. We find that divalent ions produce a fiber stiffening effect that competes with, but does not overshadow, the dramatic softening triggered by dynamic-LH behavior. Indeed, we find that in typical in vivo conditions, dynamic-LH binding/unbinding reduces fiber stiffening dramatically (by a factor of almost 5, as measured by the elasticity modulus) compared with rigidly fixed LH, and also the force needed to initiate chromatin unfolding, making it consistent with those of molecular motors. Our data also show that, during unfolding, divalent ions together with LHs induce linker-DNA bending and DNA–DNA repulsion screening, which guarantee formation of heteromorphic superbeads-on-a-string structures that combine regions of loose and compact fiber independently of the characteristics of the LH–core bond. These structures might be important for gene regulation as they expose regions of the DNA selectively. Dynamic control of LH binding/unbinding, either globally or locally, in the presence of divalent ions, might constitute a mechanism for regulation of gene expression. PMID:22790986

  13. The increasing diversity of functions attributed to the SAFB family of RNA-/DNA-binding proteins.

    PubMed

    Norman, Michael; Rivers, Caroline; Lee, Youn-Bok; Idris, Jalilah; Uney, James

    2016-12-01

    RNA-binding proteins play a central role in cellular metabolism by orchestrating the complex interactions of coding, structural and regulatory RNA species. The SAFB (scaffold attachment factor B) proteins (SAFB1, SAFB2 and SAFB-like transcriptional modulator, SLTM), which are highly conserved evolutionarily, were first identified on the basis of their ability to bind scaffold attachment region DNA elements, but attention has subsequently shifted to their RNA-binding and protein-protein interactions. Initial studies identified the involvement of these proteins in the cellular stress response and other aspects of gene regulation. More recently, the multifunctional capabilities of SAFB proteins have shown that they play crucial roles in DNA repair, processing of mRNA and regulatory RNA, as well as in interaction with chromatin-modifying complexes. With the advent of new techniques for identifying RNA-binding sites, enumeration of individual RNA targets has now begun. This review aims to summarise what is currently known about the functions of SAFB proteins. © 2016 The Author(s).

  14. Urate is a ligand for the transcriptional regulator PecS.

    PubMed

    Perera, Inoka C; Grove, Anne

    2010-09-24

    PecS is a member of the MarR (multiple antibiotic resistance regulator) family, which has been shown in Erwinia to regulate the expression of virulence genes. MarR homologs typically bind a small molecule ligand, resulting in attenuated DNA binding. For PecS, the natural ligand has not been identified. We have previously shown that urate is a ligand for the Deinococcus radiodurans-encoded MarR homolog HucR (hypothetical uricase regulator) and identified residues responsible for ligand binding. We show here that all four residues involved in urate binding and propagation of conformational changes to DNA recognition helices are conserved in PecS homologs, suggesting that urate is the ligand for PecS. Consistent with this prediction, Agrobacterium tumefaciens PecS specifically binds urate, and urate attenuates DNA binding in vitro. PecS binds two operator sites in the intergenic region between the divergent pecS gene and pecM genes, one of which features two partially overlapping repeats to which PecS binds as a dimer on opposite faces of the duplex. Notably, urate dissociates PecS from cognate DNA, allowing transcription of both genes in vivo. Taken together, our data show that urate is a ligand for PecS and suggest that urate serves a novel function in signaling the colonization of a host plant. Copyright © 2010 Elsevier Ltd. All rights reserved.

  15. DHX9 helicase is involved in preventing genomic instability induced by alternatively structured DNA in human cells

    PubMed Central

    Jain, Aklank; Bacolla, Albino; del Mundo, Imee M.; Zhao, Junhua; Wang, Guliang; Vasquez, Karen M.

    2013-01-01

    Sequences that have the capacity to adopt alternative (i.e. non-B) DNA structures in the human genome have been implicated in stimulating genomic instability. Previously, we found that a naturally occurring intra-molecular triplex (H-DNA) caused genetic instability in mammals largely in the form of DNA double-strand breaks. Thus, it is of interest to determine the mechanism(s) involved in processing H-DNA. Recently, we demonstrated that human DHX9 helicase preferentially unwinds inter-molecular triplex DNA in vitro. Herein, we used a mutation-reporter system containing H-DNA to examine the relevance of DHX9 activity on naturally occurring H-DNA structures in human cells. We found that H-DNA significantly increased mutagenesis in small-interfering siRNA-treated, DHX9-depleted cells, affecting mostly deletions. Moreover, DHX9 associated with H-DNA in the context of supercoiled plasmids. To further investigate the role of DHX9 in the recognition/processing of H-DNA, we performed binding assays in vitro and chromatin immunoprecipitation assays in U2OS cells. DHX9 recognized H-DNA, as evidenced by its binding to the H-DNA structure and enrichment at the H-DNA region compared with a control region in human cells. These composite data implicate DHX9 in processing H-DNA structures in vivo and support its role in the overall maintenance of genomic stability at sites of alternatively structured DNA. PMID:24049074

  16. DHX9 helicase is involved in preventing genomic instability induced by alternatively structured DNA in human cells.

    PubMed

    Jain, Aklank; Bacolla, Albino; Del Mundo, Imee M; Zhao, Junhua; Wang, Guliang; Vasquez, Karen M

    2013-12-01

    Sequences that have the capacity to adopt alternative (i.e. non-B) DNA structures in the human genome have been implicated in stimulating genomic instability. Previously, we found that a naturally occurring intra-molecular triplex (H-DNA) caused genetic instability in mammals largely in the form of DNA double-strand breaks. Thus, it is of interest to determine the mechanism(s) involved in processing H-DNA. Recently, we demonstrated that human DHX9 helicase preferentially unwinds inter-molecular triplex DNA in vitro. Herein, we used a mutation-reporter system containing H-DNA to examine the relevance of DHX9 activity on naturally occurring H-DNA structures in human cells. We found that H-DNA significantly increased mutagenesis in small-interfering siRNA-treated, DHX9-depleted cells, affecting mostly deletions. Moreover, DHX9 associated with H-DNA in the context of supercoiled plasmids. To further investigate the role of DHX9 in the recognition/processing of H-DNA, we performed binding assays in vitro and chromatin immunoprecipitation assays in U2OS cells. DHX9 recognized H-DNA, as evidenced by its binding to the H-DNA structure and enrichment at the H-DNA region compared with a control region in human cells. These composite data implicate DHX9 in processing H-DNA structures in vivo and support its role in the overall maintenance of genomic stability at sites of alternatively structured DNA.

  17. Dual DNA binding property of ABA insensitive 3 like factors targeted to promoters responsive to ABA and auxin.

    PubMed

    Nag, Ronita; Maity, Manas Kanti; Dasgupta, Maitrayee

    2005-11-01

    The ABA responsive ABI3 and the auxin responsive ARF family of transcription factors bind the CATGCATG (Sph) and TGTCTC core motifs in ABA and auxin response elements (ABRE and AuxRE), respectively. Several evidences indicate ABI3s to act downstream to auxin too. Because DNA binding domain of ABI3s shows significant overlap with ARFs we enquired whether auxin responsiveness through ABI3s could be mediated by their binding to canonical AuxREs. Investigations were undertaken through in vitro gel mobility shift assays (GMSA) using the DNA binding domain B3 of PvAlf (Phaseolus vulgaris ABI3 like factor) and upstream regions of auxin responsive gene GH3 (-267 to -141) and ABA responsive gene Em (-316 to -146) harboring AuxRE and ABRE, respectively. We demonstrate that B3 domain of PvAlf could bind AuxRE only when B3 was associated with its flanking domain B2 (B2B3). Such strict requirement of B2 domain was not observed with ABRE, where B3 could bind with or without being associated with B2. This dual specificity in DNA binding of ABI3s was also demonstrated with nuclear extracts of cultured cells of Arachis hypogea. Supershift analysis of ABRE and AuxRE bound nuclear proteins with antibodies raised against B2B3 domains of PvAlf revealed that ABI3 associated complexes were detectable in association with both cis elements. Competition GMSA confirmed the same complexes to bind ABRE and AuxRE. This dual specificity of ABI3 like factors in DNA binding targeted to natural promoters responsive to ABA and auxin suggests them to have a potential role in conferring crosstalk between these two phytohormones.

  18. Charged residues in the H-NS linker drive DNA binding and gene silencing in single cells.

    PubMed

    Gao, Yunfeng; Foo, Yong Hwee; Winardhi, Ricksen S; Tang, Qingnan; Yan, Jie; Kenney, Linda J

    2017-11-21

    Nucleoid-associated proteins (NAPs) facilitate chromosome organization in bacteria, but the precise mechanism remains elusive. H-NS is a NAP that also plays a major role in silencing pathogen genes. We used genetics, single-particle tracking in live cells, superresolution microscopy, atomic force microscopy, and molecular dynamics simulations to examine H-NS/DNA interactions in single cells. We discovered a role for the unstructured linker region connecting the N-terminal oligomerization and C-terminal DNA binding domains. In the present work we demonstrate that linker amino acids promote engagement with DNA. In the absence of linker contacts, H-NS binding is significantly reduced, although no change in chromosome compaction is observed. H-NS is not localized to two distinct foci; rather, it is scattered all around the nucleoid. The linker makes DNA contacts that are required for gene silencing, while chromosome compaction does not appear to be an important H-NS function.

  19. The Staphylococcus aureus pSK41 plasmid-encoded ArtA protein is a master regulator of plasmid transmission genes and contains a RHH motif used in alternate DNA-binding modes.

    PubMed

    Ni, Lisheng; Jensen, Slade O; Ky Tonthat, Nam; Berg, Tracey; Kwong, Stephen M; Guan, Fiona H X; Brown, Melissa H; Skurray, Ronald A; Firth, Neville; Schumacher, Maria A

    2009-11-01

    Plasmids harbored by Staphylococcus aureus are a major contributor to the spread of bacterial multi-drug resistance. Plasmid conjugation and partition are critical to the dissemination and inheritance of such plasmids. Here, we demonstrate that the ArtA protein encoded by the S. aureus multi-resistance plasmid pSK41 is a global transcriptional regulator of pSK41 genes, including those involved in conjugation and segregation. ArtA shows no sequence homology to any structurally characterized DNA-binding protein. To elucidate the mechanism by which it specifically recognizes its DNA site, we obtained the structure of ArtA bound to its cognate operator, ACATGACATG. The structure reveals that ArtA is representative of a new family of ribbon-helix-helix (RHH) DNA-binding proteins that contain extended, N-terminal basic motifs. Strikingly, unlike most well-studied RHH proteins ArtA binds its cognate operators as a dimer. However, we demonstrate that it is also able to recognize an atypical operator site by binding as a dimer-of-dimers and the extended N-terminal regions of ArtA were shown to be essential for this dimer-of-dimer binding mode. Thus, these data indicate that ArtA is a master regulator of genes critical for both horizontal and vertical transmission of pSK41 and that it can recognize DNA utilizing alternate binding modes.

  20. The Staphylococcus aureus pSK41 plasmid-encoded ArtA protein is a master regulator of plasmid transmission genes and contains a RHH motif used in alternate DNA-binding modes

    PubMed Central

    Ni, Lisheng; Jensen, Slade O.; Ky Tonthat, Nam; Berg, Tracey; Kwong, Stephen M.; Guan, Fiona H. X.; Brown, Melissa H.; Skurray, Ronald A.; Firth, Neville; Schumacher, Maria A.

    2009-01-01

    Plasmids harbored by Staphylococcus aureus are a major contributor to the spread of bacterial multi-drug resistance. Plasmid conjugation and partition are critical to the dissemination and inheritance of such plasmids. Here, we demonstrate that the ArtA protein encoded by the S. aureus multi-resistance plasmid pSK41 is a global transcriptional regulator of pSK41 genes, including those involved in conjugation and segregation. ArtA shows no sequence homology to any structurally characterized DNA-binding protein. To elucidate the mechanism by which it specifically recognizes its DNA site, we obtained the structure of ArtA bound to its cognate operator, ACATGACATG. The structure reveals that ArtA is representative of a new family of ribbon–helix–helix (RHH) DNA-binding proteins that contain extended, N-terminal basic motifs. Strikingly, unlike most well-studied RHH proteins ArtA binds its cognate operators as a dimer. However, we demonstrate that it is also able to recognize an atypical operator site by binding as a dimer-of-dimers and the extended N-terminal regions of ArtA were shown to be essential for this dimer-of-dimer binding mode. Thus, these data indicate that ArtA is a master regulator of genes critical for both horizontal and vertical transmission of pSK41 and that it can recognize DNA utilizing alternate binding modes. PMID:19759211

  1. Lune/eye gone, a Pax-like protein, uses a partial paired domain and a homeodomain for DNA recognition.

    PubMed

    Jun, S; Wallen, R V; Goriely, A; Kalionis, B; Desplan, C

    1998-11-10

    Pax proteins, characterized by the presence of a paired domain, play key regulatory roles during development. The paired domain is a bipartite DNA-binding domain that contains two helix-turn-helix domains joined by a linker region. Each of the subdomains, the PAI and RED domains, has been shown to be a distinct DNA-binding domain. The PAI domain is the most critical, but in specific circumstances, the RED domain is involved in DNA recognition. We describe a Pax protein, originally called Lune, that is the product of the Drosophila eye gone gene (eyg). It is unique among Pax proteins, because it contains only the RED domain. eyg seems to play a role both in the organogenesis of the salivary gland during embryogenesis and in the development of the eye. A high-affinity binding site for the Eyg RED domain was identified by using systematic evolution of ligands by exponential enrichment techniques. This binding site is related to a binding site previously identified for the RED domain of the Pax-6 5a isoform. Eyg also contains another DNA-binding domain, a Prd-class homeodomain (HD), whose palindromic binding site is similar to other Prd-class HDs. The ability of Pax proteins to use the PAI, RED, and HD, or combinations thereof, may be one mechanism that allows them to be used at different stages of development to regulate various developmental processes through the activation of specific target genes.

  2. Lune/eye gone, a Pax-like protein, uses a partial paired domain and a homeodomain for DNA recognition

    PubMed Central

    Jun, Susie; Wallen, Robert V.; Goriely, Anne; Kalionis, Bill; Desplan, Claude

    1998-01-01

    Pax proteins, characterized by the presence of a paired domain, play key regulatory roles during development. The paired domain is a bipartite DNA-binding domain that contains two helix–turn–helix domains joined by a linker region. Each of the subdomains, the PAI and RED domains, has been shown to be a distinct DNA-binding domain. The PAI domain is the most critical, but in specific circumstances, the RED domain is involved in DNA recognition. We describe a Pax protein, originally called Lune, that is the product of the Drosophila eye gone gene (eyg). It is unique among Pax proteins, because it contains only the RED domain. eyg seems to play a role both in the organogenesis of the salivary gland during embryogenesis and in the development of the eye. A high-affinity binding site for the Eyg RED domain was identified by using systematic evolution of ligands by exponential enrichment techniques. This binding site is related to a binding site previously identified for the RED domain of the Pax-6 5a isoform. Eyg also contains another DNA-binding domain, a Prd-class homeodomain (HD), whose palindromic binding site is similar to other Prd-class HDs. The ability of Pax proteins to use the PAI, RED, and HD, or combinations thereof, may be one mechanism that allows them to be used at different stages of development to regulate various developmental processes through the activation of specific target genes. PMID:9811867

  3. Prospect of Bioflavonoid Fisetin as a Quadruplex DNA Ligand: A Biophysical Approach

    PubMed Central

    Sengupta, Bidisha; Pahari, Biswapathik; Blackmon, Laura; Sengupta, Pradeep K.

    2013-01-01

    Quadruplex (G4) forming sequences in telomeric DNA and c-myc promoter regions of human DNA are associated with tumorogenesis. Ligands that can facilitate or stabilize the formation and increase the stabilization of G4 can prevent tumor cell proliferation and have been regarded as potential anti-cancer drugs. In the present study, steady state and time-resolved fluorescence measurements provide important structural and dynamical insights into the free and bound states of the therapeutically potent plant flavonoid fisetin (3,3′,4′,7-tetrahydroxyflavone) in a G4 DNA matrix. The excited state intra-molecular proton transfer (ESPT) of fisetin plays an important role in observing and understanding the binding of fisetin with the G4 DNA. Differential absorption spectra, thermal melting, and circular dichroism spectroscopic studies provide evidences for the formation of G4 DNA and size exclusion chromatography (SEC) proves the binding and 1∶1 stoichiometry of fisetin in the DNA matrix. Comparative analysis of binding in the presence of EtBr proves that fisetin favors binding at the face of the G-quartet, mostly along the diagonal loop. Time resolved fluorescence anisotropy decay analysis indicates the increase in the restrictions in motion from the free to bound fisetin. We have also investigated the fingerprints of the binding of fisetin in the antiparallel quadruplex using Raman spectroscopy. Preliminary results indicate fisetin to be a prospective candidate as a G4 ligand. PMID:23785423

  4. Molecular Control of Polyene Macrolide Biosynthesis

    PubMed Central

    Santos-Aberturas, Javier; Vicente, Cláudia M.; Guerra, Susana M.; Payero, Tamara D.; Martín, Juan F.; Aparicio, Jesús F.

    2011-01-01

    Control of polyene macrolide production in Streptomyces natalensis is mediated by the transcriptional activator PimM. This regulator, which combines an N-terminal PAS domain with a C-terminal helix-turn-helix motif, is highly conserved among polyene biosynthetic gene clusters. PimM, truncated forms of the protein without the PAS domain (PimMΔPAS), and forms containing just the DNA-binding domain (DBD) (PimMDBD) were overexpressed in Escherichia coli as GST-fused proteins. GST-PimM binds directly to eight promoters of the pimaricin cluster, as demonstrated by electrophoretic mobility shift assays. Assays with truncated forms of the protein revealed that the PAS domain does not mediate specificity or the distinct recognition of target genes, which rely on the DBD domain, but significantly reduces binding affinity up to 500-fold. Transcription start points were identified by 5′-rapid amplification of cDNA ends, and the binding regions of PimMDBD were investigated by DNase I protection studies. In all cases, binding took place covering the −35 hexamer box of each promoter, suggesting an interaction of PimM and RNA polymerase to cause transcription activation. Information content analysis of the 16 sequences protected in target promoters was used to deduce the structure of the PimM-binding site. This site displays dyad symmetry, spans 14 nucleotides, and adjusts to the consensus TVGGGAWWTCCCBA. Experimental validation of this binding site was performed by using synthetic DNA duplexes. Binding of PimM to the promoter region of one of the polyketide synthase genes from the Streptomyces nodosus amphotericin cluster containing the consensus binding site was also observed, thus proving the applicability of the findings reported here to other antifungal polyketides. PMID:21187288

  5. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  6. Structural Insights into the HIV-1 Minus-strand Strong-stop DNA*

    PubMed Central

    Chen, Yingying; Maskri, Ouerdia; Chaminade, Françoise; René, Brigitte; Benkaroun, Jessica; Godet, Julien; Mély, Yves; Mauffret, Olivier; Fossé, Philippe

    2016-01-01

    An essential step of human immunodeficiency virus type 1 (HIV-1) reverse transcription is the first strand transfer that requires base pairing of the R region at the 3′-end of the genomic RNA with the complementary r region at the 3′-end of minus-strand strong-stop DNA (ssDNA). HIV-1 nucleocapsid protein (NC) facilitates this annealing process. Determination of the ssDNA structure is needed to understand the molecular basis of NC-mediated genomic RNA-ssDNA annealing. For this purpose, we investigated ssDNA using structural probes (nucleases and potassium permanganate). This study is the first to determine the secondary structure of the full-length HIV-1 ssDNA in the absence or presence of NC. The probing data and phylogenetic analysis support the folding of ssDNA into three stem-loop structures and the presence of four high-affinity binding sites for NC. Our results support a model for the NC-mediated annealing process in which the preferential binding of NC to four sites triggers unfolding of the three-dimensional structure of ssDNA, thus facilitating interaction of the r sequence of ssDNA with the R sequence of the genomic RNA. In addition, using gel retardation assays and ssDNA mutants, we show that the NC-mediated annealing process does not rely on a single pathway (zipper intermediate or kissing complex). PMID:26668324

  7. The LINE-1 DNA sequences in four mammalian orders predict proteins that conserve homologies to retrovirus proteins.

    PubMed Central

    Fanning, T; Singer, M

    1987-01-01

    Recent work suggests that one or more members of the highly repeated LINE-1 (L1) DNA family found in all mammals may encode one or more proteins. Here we report the sequence of a portion of an L1 cloned from the domestic cat (Felis catus). These data permit comparison of the L1 sequences in four mammalian orders (Carnivore, Lagomorph, Rodent and Primate) and the comparison supports the suggested coding potential. In two separate, noncontiguous regions in the carboxy terminal half of the proteins predicted from the DNA sequences, there are several strongly conserved segments. In one region, these share homology with known or suspected reverse transcriptases, as described by others in rodents and primates. In the second region, closer to the carboxy terminus, the strongly conserved segments are over 90% homologous among the four orders. One of the latter segments is cysteine rich and resembles the putative metal binding domains of nucleic acid binding proteins, including those of TFIIIA and retroviruses. PMID:3562227

  8. Interaction of acute-phase-inducible and liver-enriched nuclear factors with the promoter region of the mouse alpha sub 1 -acid glycoprotein gene-1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alam, T.; Papaconstantinou, J.

    1992-02-25

    The synthesis and secretion of several acute-phase proteins increases markedly following physiological stress. {alpha}{sub 1}-Acid glycoprotein (AGP), a major acute-phase reactant made by the liver, is strongly induced by inflammatory agents such as lipopolysaccharide (LPS). Nuclear run-on assay showed a 17-fold increase in the rate of AGP transcription 4 h following LPS injection. DNase I footprinting assays revealed multiple protein binding domains in the mouse AGP-1 promoter region. Region B ({minus}104 to {minus}91) is protected by a liver-enriched transcription factor that is heat labile and in limiting quantity. An adjacent region, C ({minus}125 to {minus}104), is well-protected by nuclear extractsmore » from hepatocytes. Electrophoretic mobility shift assays indicated that only one DNA-protein complex can form with an oligonucleotide corresponding to region B. However, nuclear proteins from untreated mouse liver can form three strong complexes (C1, C2, and C3) and a weak one (C4) with oligonucleotide C. An acute-phase-inducible DNA-binding protein (AP-DBP) forms complex 4. A dramatic increase (over 11-fold) in AP-DBP binding activity is seen with nuclear proteins from LPS-stimulated animals. Interestingly, AP-DBP, a heat-stable factor, can form heterodimers with the transcription factor CCAAT/enhancer binding protein (C/EBP). Furthermore, purified C/EBP also binds avidly to region C. The studies indicate that several liver-enriched nuclear factors can interact with AGP-1 promoter and that AP-DBP binds to the AGP-1 promoter with high affinity only during the acute-phase induction.« less

  9. Modeling chain folding in protein-constrained circular DNA.

    PubMed Central

    Martino, J A; Olson, W K

    1998-01-01

    An efficient method for sampling equilibrium configurations of DNA chains binding one or more DNA-bending proteins is presented. The technique is applied to obtain the tertiary structures of minimal bending energy for a selection of dinucleosomal minichromosomes that differ in degree of protein-DNA interaction, protein spacing along the DNA chain contour, and ring size. The protein-bound portions of the DNA chains are represented by tight, left-handed supercoils of fixed geometry. The protein-free regions are modeled individually as elastic rods. For each random spatial arrangement of the two nucleosomes assumed during a stochastic search for the global minimum, the paths of the flexible connecting DNA segments are determined through a numerical solution of the equations of equilibrium for torsionally relaxed elastic rods. The minimal energy forms reveal how protein binding and spacing and plasmid size differentially affect folding and offer new insights into experimental minichromosome systems. PMID:9591675

  10. NMR Structure and Dynamics of the C-terminal Domain from Human Rev1 and its Complex with Rev1 Interacting Region of DNA Polymerase η

    PubMed Central

    Pozhidaeva, Alexandra; Pustovalova, Yulia; D'Souza, Sanjay; Bezsonova, Irina; Walker, Graham C.; Korzhnev, Dmitry M.

    2013-01-01

    Rev1 is a translesion synthesis (TLS) DNA polymerase essential for DNA damage tolerance in eukaryotes. In the process of TLS stalled high-fidelity replicative DNA polymerases are temporarily replaced by specialized TLS enzymes that can bypass sites of DNA damage (lesions), thus allowing replication to continue or postreplicational gaps to be filled. Despite its limited catalytic activity, human Rev1 plays a key role in TLS by serving as a scaffold that provides an access of Y-family TLS polymerases polη, ι, and κ to their cognate DNA lesions and facilitates their subsequent exchange to polζ that extends the distorted DNA primer-template. Rev1 interaction with the other major human TLS polymerases, polη, ι, κ and the regulatory subunit Rev7 of polζ, is mediated by Rev1 C-terminal domain (Rev1-CT). We used NMR spectroscopy to determine the spatial structure of the Rev1-CT domain (residues 1157-1251) and its complex with Rev1 interacting region (RIR) from polη (residues 524-539). The domain forms a four-helix bundle with a well-structured N-terminal β-hairpin docking against helices 1 and 2, creating a binding pocket for the two conserved Phe residues of the RIR motif that upon binding folds into an α-helix. NMR spin-relaxation and NMR relaxation dispersion measurements suggest that free Rev1-CT and Rev1-CT/polη-RIR complex exhibit μs-ms conformational dynamics encompassing the RIR binding site, which might facilitate selection of the molecular configuration optimal for binding. These results offer new insights into the control of TLS in human cells by providing a structural basis for understanding the recognition of the Rev1-CT by Y-family DNA polymerases. PMID:22691049

  11. Identification of functional domains of the IR2 protein of equine herpesvirus 1 required for inhibition of viral gene expression and replication

    PubMed Central

    Kim, Seong K.; Kim, Seongman; Dai, Gan; Zhang, Yunfei; Ahn, Byung C.; O'Callaghan, Dennis J.

    2012-01-01

    The equine herpesvirus 1 (EHV-1) negative regulatory IR2 protein (IR2P), an early 1,165-amino acid (aa) truncated form of the 1,487-aa immediate-early protein (IEP), lacks the trans-activation domain essential for IEP activation functions but retains domains for binding DNA, TFIIB, and TBP and the nuclear localization signal. IR2P mutants of the N-terminal region which lack either DNA-binding activity or TFIIB-binding activity were unable to down-regulate EHV-1 promoters. In EHV-1-infected cells expressing full-length IR2P, transcription and protein expression of viral regulatory IE, early EICP0, IR4, and UL5, and late ETIF genes were dramatically inhibited. Viral DNA levels were reduced to 2.1% of control infected cells, but were vey weakly affected in cells that express the N-terminal 706 residues of IR2P. These results suggest that IR2P function requires the two N-terminal domains for binding DNA and TFIIB as well as the C-terminal residues 707 to 1116 containing the TBP-binding domain. PMID:21794889

  12. Electrophoretic mobility shift assay reveals a novel recognition sequence for Setaria italica NAC protein.

    PubMed

    Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S; Prasad, Manoj

    2011-10-01

    The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncations of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T][T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein.

  13. Electrophoretic mobility shift assay reveals a novel recognition sequence for Setaria italica NAC protein

    PubMed Central

    Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S

    2011-01-01

    The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncation of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T] [T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein. PMID:21918373

  14. Functional analysis of the plant disease resistance gene Pto using DNA shuffling.

    PubMed

    Bernal, Adriana J; Pan, Qilin; Pollack, Jeff; Rose, Laura; Kozik, Alexander; Willits, Neil; Luo, Yao; Guittet, Muriel; Kochetkova, Elena; Michelmore, Richard W

    2005-06-17

    Pto is a serine/threonine kinase that mediates resistance in tomato to strains of Pseudomonas syringae pv. tomato expressing the (a)virulence proteins AvrPto or AvrPtoB. DNA shuffling was used as a combinatorial in vitro genetic approach to dissect the functional regions of Pto. The Pto gene was shuffled with four of its paralogs from a resistant haplotype to create a library of recombinant products that was screened for interaction with AvrPto in yeast. All interacting clones and a representative sample of noninteracting clones were sequenced, and their ability to signal downstream was tested by the elicitation of a hypersensitive response in an AvrPto-dependent or -independent manner in planta. Eight candidate regions important for binding to AvrPto or for downstream signaling were identified by statistical correlations between individual amino acid positions and phenotype. A subset of the regions had previously been identified as important for recognition, confirming the validity of the shuffling approach. Three novel regions important for Pto function were validated by site-directed mutagenesis. Several chimeras and point mutants exhibited a differential interaction with (a)virulence proteins in the AvrPto and VirPphA family, demonstrating distinct binding requirements for different ligands. Additionally, the identification of chimeras that are both constitutively active as well as capable of binding AvrPto indicates that elicitation of downstream signaling does not involve a conformational change that precludes binding of AvrPto, as previously hypothesized. The correlations between phenotypes and variation generated by DNA shuffling paralleled natural variation observed between orthologs of Pto from Lycopersicon spp.

  15. The Hsp70 interdomain linker is a dynamic switch that enables allosteric communication between two structured domains.

    PubMed

    English, Charles A; Sherman, Woody; Meng, Wenli; Gierasch, Lila M

    2017-09-08

    Hsp70 molecular chaperones play key roles in cellular protein homeostasis by binding to exposed hydrophobic regions of incompletely folded or aggregated proteins. This crucial Hsp70 function relies on allosteric communication between two well-structured domains: an N-terminal nucleotide-binding domain (NBD) and a C-terminal substrate-binding domain (SBD), which are tethered by an interdomain linker. ATP or ADP binding to the NBD alters the substrate-binding affinity of the SBD, triggering functionally essential cycles of substrate binding and release. The interdomain linker is a well-structured participant in the interdomain interface in ATP-bound Hsp70s. By contrast, in the ADP-bound state, exemplified by the Escherichia coli Hsp70 DnaK, the interdomain linker is flexible. Hsp70 interdomain linker sequences are highly conserved; moreover, mutations in this region compromise interdomain allostery. To better understand the role of this region in Hsp70 allostery, we used molecular dynamics simulations to explore the conformational landscape of the interdomain linker in ADP-bound DnaK and supported our simulations by strategic experimental data. We found that while the interdomain linker samples many conformations, it behaves as three relatively ordered segments connected by hinges. As a consequence, the distances and orientations between the NBD and SBD are limited. Additionally, the C-terminal region of the linker forms previously unreported, transient interactions with the SBD, and the predominant linker-docking site is available in only one allosteric state, that with high affinity for substrate. This preferential binding implicates the interdomain linker as a dynamic allosteric switch. The linker-binding site on the SBD is a potential target for small molecule modulators of the Hsp70 allosteric cycle. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Indirect DNA Readout by an H-NS Related Protein: Structure of the DNA Complex of the C-Terminal Domain of Ler

    PubMed Central

    Cordeiro, Tiago N.; Schmidt, Holger; Madrid, Cristina; Juárez, Antonio; Bernadó, Pau; Griesinger, Christian; García, Jesús; Pons, Miquel

    2011-01-01

    Ler, a member of the H-NS protein family, is the master regulator of the LEE pathogenicity island in virulent Escherichia coli strains. Here, we determined the structure of a complex between the DNA-binding domain of Ler (CT-Ler) and a 15-mer DNA duplex. CT-Ler recognizes a preexisting structural pattern in the DNA minor groove formed by two consecutive regions which are narrower and wider, respectively, compared with standard B-DNA. The compressed region, associated with an AT-tract, is sensed by the side chain of Arg90, whose mutation abolishes the capacity of Ler to bind DNA. The expanded groove allows the approach of the loop in which Arg90 is located. This is the first report of an experimental structure of a DNA complex that includes a protein belonging to the H-NS family. The indirect readout mechanism not only explains the capacity of H-NS and other H-NS family members to modulate the expression of a large number of genes but also the origin of the specificity displayed by Ler. Our results point to a general mechanism by which horizontally acquired genes may be specifically recognized by members of the H-NS family. PMID:22114557

  17. Indirect DNA readout by an H-NS related protein: structure of the DNA complex of the C-terminal domain of Ler.

    PubMed

    Cordeiro, Tiago N; Schmidt, Holger; Madrid, Cristina; Juárez, Antonio; Bernadó, Pau; Griesinger, Christian; García, Jesús; Pons, Miquel

    2011-11-01

    Ler, a member of the H-NS protein family, is the master regulator of the LEE pathogenicity island in virulent Escherichia coli strains. Here, we determined the structure of a complex between the DNA-binding domain of Ler (CT-Ler) and a 15-mer DNA duplex. CT-Ler recognizes a preexisting structural pattern in the DNA minor groove formed by two consecutive regions which are narrower and wider, respectively, compared with standard B-DNA. The compressed region, associated with an AT-tract, is sensed by the side chain of Arg90, whose mutation abolishes the capacity of Ler to bind DNA. The expanded groove allows the approach of the loop in which Arg90 is located. This is the first report of an experimental structure of a DNA complex that includes a protein belonging to the H-NS family. The indirect readout mechanism not only explains the capacity of H-NS and other H-NS family members to modulate the expression of a large number of genes but also the origin of the specificity displayed by Ler. Our results point to a general mechanism by which horizontally acquired genes may be specifically recognized by members of the H-NS family.

  18. DNA hypomethylation of a transcription factor binding site within the promoter of a gout risk gene NRBP1 upregulates its expression by inhibition of TFAP2A binding.

    PubMed

    Zhu, Zaihua; Meng, Weida; Liu, Peiru; Zhu, Xiaoxia; Liu, Yun; Zou, Hejian

    2017-01-01

    Genome-wide association studies (GWASs) have identified dozens of loci associated with gout, but for most cases, the risk genes and the underlying molecular mechanisms contributing to these associations are unknown. This study sought to understand the molecular mechanism of a common genetic variant, rs780093, in the development of gout, both in vitro and in vivo. Nuclear receptor binding protein 1 ( NRBP1 ), as a gout risk gene, and its regulatory region, 72 bp upstream of the transcription start site, designated as B1, were identified through integrative analyses of genome-wide genotype and DNA methylation data. We observed elevated NRBP1 expression in human peripheral blood mononuclear cells (PBMCs) from gout patients. In vitro luciferase reporter and protein pulldown assay results showed that DNA methylation could increase the binding of the transcription factor TFAP2A to B1, leading to suppressed gene expression. There results were further confirmed by in vivo bisulfite pyrosequencing showing that hypomethylation on B1 is associated with increased NRBP1 expression in gout patients. Hypomethylation at the promoter region of NRBP1 reduces the binding of TFAP2A and thus leads to elevated NRBP1 expression, which might contribute to the development of gout.

  19. Paradoxical Role of DNA Methylation in Activation of FoxA2 Gene Expression during Endoderm Development*

    PubMed Central

    Bahar Halpern, Keren; Vana, Tal; Walker, Michael D.

    2014-01-01

    The transcription factor FoxA2 is a master regulator of endoderm development and pancreatic beta cell gene expression. To elucidate the mechanisms underlying the activation of the FoxA2 gene during differentiation, we have compared the epigenetic status of undifferentiated human embryonic stem cells (hESCs), hESC-derived early endoderm stage cells (CXCR4+ cells), and pancreatic islet cells. Unexpectedly, a CpG island in the promoter region of the FoxA2 gene displayed paradoxically high levels of DNA methylation in expressing tissues (CXCR4+, islets) and low levels in nonexpressing tissues. This CpG island region was found to repress reporter gene expression and bind the Polycomb group protein SUZ12 and the DNA methyltransferase (DNMT)3b preferentially in undifferentiated hESCs as compared with CXCR4+ or islets cells. Consistent with this, activation of FoxA2 gene expression, but not CXCR4 or SOX17, was strongly inhibited by 5-aza-2′-deoxycytidine and by knockdown of DNMT3b. We hypothesize that in nonexpressing tissues, the lack of DNA methylation allows the binding of DNA methyltransferases and repressing proteins, such as Polycomb group proteins; upon differentiation, DNMT activation leads to CpG island methylation, causing loss of repressor protein binding. These results suggest a novel and unexpected role for DNA methylation in the activation of FoxA2 gene expression during differentiation. PMID:25016019

  20. Neuropathologic features of frontotemporal lobar degeneration with ubiquitin-positive inclusions visualized with ubiquitin-binding protein p62 immunohistochemistry.

    PubMed

    Pikkarainen, Maria; Hartikainen, Päivi; Alafuzoff, Irina

    2008-04-01

    Genetic, clinical, and neuropathologic heterogeneity have been observed in frontotemporal lobar degeneration with ubiquitin (Ubq)-positive inclusions (FTLD-U) and FTLD-U with motor neuron disease. Here, the distribution and morphologic features of neuronal and glial inclusions in the brains of 20 FTLD-U and 2 FTLD-U/motor neuron disease cases were assessed using immunohistochemistry for Ubq-binding protein p62. Eighteen cases displayed TAR DNA-binding protein 43-immunoreactive lesions and were classified as Types 3 (neuronal cytoplasmic inclusions and neurites; 72%), 2 (primarily neuronal cytoplasmic inclusions; 17%), or 1 (primarily neurites; 11%) FTLD-U. The distribution of p62-immunoreactivity varied considerably in each type. Of 4 unclassifiable cases, 2 displayed p62-immunoreactive lesions suggestive of FTLD-U with a mutation in the charged multivesicular body protein 2B gene; 1 suggested basophilic inclusion body disease, and 1 was of a type not previously described. By immunohistochemistry for Ubq-binding protein p62, the distribution of abnormalities was wider than expected; in approximately half of the cases, there were p62-positive but TAR DNA-binding protein 43-negative inclusions in the cerebellum, a region not previously considered to be affected. In other regions, TAR DNA-binding protein 43-, Ubq-, and Ubq-binding protein p62 labeling of inclusions was variable. Whether variations in inclusion morphologies, immunoreactivity, and topographic distribution are due to methodologic factors, different stages of inclusion and disease evolution, different disease entities or biologic modifications of the same disease are presently unclear.

  1. Genome-wide specificity of DNA binding, gene regulation, and chromatin remodeling by TALE- and CRISPR/Cas9-based transcriptional activators.

    PubMed

    Polstein, Lauren R; Perez-Pinera, Pablo; Kocak, D Dewran; Vockley, Christopher M; Bledsoe, Peggy; Song, Lingyun; Safi, Alexias; Crawford, Gregory E; Reddy, Timothy E; Gersbach, Charles A

    2015-08-01

    Genome engineering technologies based on the CRISPR/Cas9 and TALE systems are enabling new approaches in science and biotechnology. However, the specificity of these tools in complex genomes and the role of chromatin structure in determining DNA binding are not well understood. We analyzed the genome-wide effects of TALE- and CRISPR-based transcriptional activators in human cells using ChIP-seq to assess DNA-binding specificity and RNA-seq to measure the specificity of perturbing the transcriptome. Additionally, DNase-seq was used to assess genome-wide chromatin remodeling that occurs as a result of their action. Our results show that these transcription factors are highly specific in both DNA binding and gene regulation and are able to open targeted regions of closed chromatin independent of gene activation. Collectively, these results underscore the potential for these technologies to make precise changes to gene expression for gene and cell therapies or fundamental studies of gene function. © 2015 Polstein et al.; Published by Cold Spring Harbor Laboratory Press.

  2. Identification of DNA-binding proteins that interact with the 5'-flanking region of the human D-amino acid oxidase gene by pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry.

    PubMed

    Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi

    2015-12-10

    D-Amino acid oxidase (DAO) is a flavoenzyme that metabolizes D-amino acids and is expected to be a promising therapeutic target of schizophrenia and glioblastoma. The study of DNA-binding proteins has yielded much information in the regulation of transcription and other biological processes. However, proteins interacting with DAO gene have not been elucidated. Our assessment of human DAO promoter activity using luciferase reporter system indicated the 5'-flanking region of this gene (-4289 bp from transcription initiation site) has a regulatory sequence for gene expression, which is regulated by multi-protein complexes interacting with this region. By using pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry, we identified six proteins binding to the 5'-flanking region of the human DAO gene (zinc finger C2HC domain-containing protein 1A; histidine-tRNA ligase, cytoplasmic; molybdenum cofactor biosynthesis protein; 60S ribosomal protein L37; calponin-1; calmodulin binding protein and heterogeneous nuclear ribonucleoprotein A2/B1). These preliminary results will contribute to the advance in the understanding of the potential factors associated with the regulatory mechanism of DAO expression. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Transcriptional activation of the Escherichia coli adaptive response gene aidB is mediated by binding of methylated Ada protein. Evidence for a new consensus sequence for Ada-binding sites.

    PubMed

    Landini, P; Volkert, M R

    1995-04-07

    The Escherichia coli aidB gene is part of the adaptive response to DNA methylation damage. Genes belonging to the adaptive response are positively regulated by the ada gene; the Ada protein acts as a transcriptional activator when methylated in one of its cysteine residues at position 69. Through DNaseI protection assays, we show that methylated Ada (meAda) is able to bind a DNA sequence between 40 and 60 base pairs upstream of the aidB transcriptional startpoint. Binding of meAda is necessary to activate transcription of the adaptive response genes; accordingly, in vitro transcription of aidB is dependent on the presence of meAda. Unmethylated Ada protein shows no protection against DNaseI digestion in the aidB promoter region nor does it promote aidB in vitro transcription. The aidB Ada-binding site shows only weak homology to the proposed consensus sequences for Ada-binding sites in E. coli (AAANNAA and AAAGCGCA) but shares a higher degree of similarity with the Ada-binding regions from other bacterial species, such as Salmonella typhimurium and Bacillus subtilis. Based on the comparison of five different Ada-dependent promoter regions, we suggest that a possible recognition sequence for meAda might be AATnnnnnnG-CAA. Higher concentrations of Ada are required for the binding of aidB than for the ada promoter, suggesting lower affinity of the protein for the aidB Ada-binding site. Common features in the Ada-binding regions of ada and aidB are a high A/T content, the presence of an inverted repeat structure, and their position relative to the transcriptional start site. We propose that these elements, in addition to the proposed recognition sequence, are important for binding of the Ada protein.

  4. Interplay between Ku and Replication Protein A in the Restriction of Exo1-mediated DNA Break End Resection*

    PubMed Central

    Krasner, Danielle S.; Daley, James M.; Sung, Patrick; Niu, Hengyao

    2015-01-01

    DNA double-strand breaks can be eliminated via non-homologous end joining or homologous recombination. Non-homologous end joining is initiated by the association of Ku with DNA ends. In contrast, homologous recombination entails nucleolytic resection of the 5′-strands, forming 3′-ssDNA tails that become coated with replication protein A (RPA). Ku restricts end access by the resection nuclease Exo1. It is unclear how partial resection might affect Ku engagement and Exo1 restriction. Here, we addressed these questions in a reconstituted system with yeast proteins. With blunt-ended DNA, Ku protected against Exo1 in a manner that required its DNA end-binding activity. Despite binding poorly to ssDNA, Ku could nonetheless engage a 5′-recessed DNA end with a 40-nucleotide (nt) ssDNA overhang, where it localized to the ssDNA-dsDNA junction and efficiently blocked resection by Exo1. Interestingly, RPA could exclude Ku from a partially resected structure with a 22-nt ssDNA tail and thus restored processing by Exo1. However, at a 40-nt tail, Ku remained stably associated at the ssDNA-dsDNA junction, and RPA simultaneously engaged the ssDNA region. We discuss a model in which the dynamic equilibrium between Ku and RPA binding to a partially resected DNA end influences the timing and efficiency of the resection process. PMID:26067273

  5. Protection of CpG islands from DNA methylation is DNA-encoded and evolutionarily conserved

    PubMed Central

    Long, Hannah K.; King, Hamish W.; Patient, Roger K.; Odom, Duncan T.; Klose, Robert J.

    2016-01-01

    DNA methylation is a repressive epigenetic modification that covers vertebrate genomes. Regions known as CpG islands (CGIs), which are refractory to DNA methylation, are often associated with gene promoters and play central roles in gene regulation. Yet how CGIs in their normal genomic context evade the DNA methylation machinery and whether these mechanisms are evolutionarily conserved remains enigmatic. To address these fundamental questions we exploited a transchromosomic animal model and genomic approaches to understand how the hypomethylated state is formed in vivo and to discover whether mechanisms governing CGI formation are evolutionarily conserved. Strikingly, insertion of a human chromosome into mouse revealed that promoter-associated CGIs are refractory to DNA methylation regardless of host species, demonstrating that DNA sequence plays a central role in specifying the hypomethylated state through evolutionarily conserved mechanisms. In contrast, elements distal to gene promoters exhibited more variable methylation between host species, uncovering a widespread dependence on nucleotide frequency and occupancy of DNA-binding transcription factors in shaping the DNA methylation landscape away from gene promoters. This was exemplified by young CpG rich lineage-restricted repeat sequences that evaded DNA methylation in the absence of co-evolved mechanisms targeting methylation to these sequences, and species specific DNA binding events that protected against DNA methylation in CpG poor regions. Finally, transplantation of mouse chromosomal fragments into the evolutionarily distant zebrafish uncovered the existence of a mechanistically conserved and DNA-encoded logic which shapes CGI formation across vertebrate species. PMID:27084945

  6. Exploiting hydrogen bonding interactions to probe smaller linear and cyclic diamines binding to G-quadruplexes: a DFT and molecular dynamics study.

    PubMed

    Kanti Si, Mrinal; Sen, Anik; Ganguly, Bishwajit

    2017-05-10

    G-quadruplexes are formed by the association of four guanine bases through Hoogsteen hydrogen bonding in guanine-rich sequences of DNA and exist in the telomere as well as in promoter regions of certain oncogenes. The sequences of G-quadruplex-DNA are targets for the design of molecules that can bind and can be developed as anti-cancer drugs. The linear and cyclic protonated diamines have been explored to bind to G-quadruplex-DNA through hydrogen bonding interactions. The quadruplex-DNA binders exploit π-stacking and hydrogen bonding interactions with the phosphate backbone of loops and grooves. In this study, linear and cyclic protonated diamines showed remarkable binding affinity for G-tetrads using hydrogen bonding interactions. The DFT M06-2X/6-31G(d)//B3LYP/6-31+G(d) level of theory showed that the cyclic ee-1,2-CHDA (equatorial-equatorial form of 1,2-disubstituted cyclohexadiamine di-cation) binds to the G-tetrads very strongly (∼70.0 kcal mol -1 ), with a much higher binding energy than the linear protonated diamines. The binding affinity of ligands for G-tetrads with counterions has also been examined. The binding preference of these small ligands for G-tetrads is higher than for DNA-duplex. The binding affinity of an intercalated acridine-based ligand (BRACO-19) for G-quadruplexes has been examined and the binding energy is relatively lower than that for the 1,2 disubstituted cyclohexadiamine di-cation with G-tetrads. The atoms-in-molecules (AIM) analysis reveals that the hydrogen bonding interactions between the organic systems with G-tetrads are primarily electrostatic in nature. The molecular dynamics simulations performed using a classical force field (GROMACS) also supported the phosphate backbone sites of G-quadruplex-DNA to bind to these diamines. To mimic the structural pattern of BRACO-19, the designed inhibitor N,2-bis-2(3,4-aminocyclohexyl) acetamide (9) examined possesses two 1,2-CHDA moieties linked through an acetamide group. The molecular dynamics results showed that the designed molecule 9 can efficiently bind to the base-pairs and the phosphate backbone of G quadruplex-DNA using H-bonding interactions. The binding affinity calculated for the intercalated acridine-based drug (BRACO-19) with G-quadruplexes is weaker compared to ee-1,2-CHDA. These ligands deliver a different binding motif (hydrogen bonding) compared to the reported G-quadruplex binders of π-delocalized systems and will kindle interest in examining such scaffolds to stabilize DNA.

  7. TRF1 and TRF2 use different mechanisms to find telomeric DNA but share a novel mechanism to search for protein partners at telomeres.

    PubMed

    Lin, Jiangguo; Countryman, Preston; Buncher, Noah; Kaur, Parminder; E, Longjiang; Zhang, Yiyun; Gibson, Greg; You, Changjiang; Watkins, Simon C; Piehler, Jacob; Opresko, Patricia L; Kad, Neil M; Wang, Hong

    2014-02-01

    Human telomeres are maintained by the shelterin protein complex in which TRF1 and TRF2 bind directly to duplex telomeric DNA. How these proteins find telomeric sequences among a genome of billions of base pairs and how they find protein partners to form the shelterin complex remains uncertain. Using single-molecule fluorescence imaging of quantum dot-labeled TRF1 and TRF2, we study how these proteins locate TTAGGG repeats on DNA tightropes. By virtue of its basic domain TRF2 performs an extensive 1D search on nontelomeric DNA, whereas TRF1's 1D search is limited. Unlike the stable and static associations observed for other proteins at specific binding sites, TRF proteins possess reduced binding stability marked by transient binding (∼ 9-17 s) and slow 1D diffusion on specific telomeric regions. These slow diffusion constants yield activation energy barriers to sliding ∼ 2.8-3.6 κ(B)T greater than those for nontelomeric DNA. We propose that the TRF proteins use 1D sliding to find protein partners and assemble the shelterin complex, which in turn stabilizes the interaction with specific telomeric DNA. This 'tag-team proofreading' represents a more general mechanism to ensure a specific set of proteins interact with each other on long repetitive specific DNA sequences without requiring external energy sources.

  8. Proteolytic dissection of Zab, the Z-DNA-binding domain of human ADAR1

    NASA Technical Reports Server (NTRS)

    Schwartz, T.; Lowenhaupt, K.; Kim, Y. G.; Li, L.; Brown, B. A. 2nd; Herbert, A.; Rich, A.

    1999-01-01

    Zalpha is a peptide motif that binds to Z-DNA with high affinity. This motif binds to alternating dC-dG sequences stabilized in the Z-conformation by means of bromination or supercoiling, but not to B-DNA. Zalpha is part of the N-terminal region of double-stranded RNA adenosine deaminase (ADAR1), a candidate enzyme for nuclear pre-mRNA editing in mammals. Zalpha is conserved in ADAR1 from many species; in each case, there is a second similar motif, Zbeta, separated from Zalpha by a more divergent linker. To investigate the structure-function relationship of Zalpha, its domain structure was studied by limited proteolysis. Proteolytic profiles indicated that Zalpha is part of a domain, Zab, of 229 amino acids (residues 133-361 in human ADAR1). This domain contains both Zalpha and Zbeta as well as a tandem repeat of a 49-amino acid linker module. Prolonged proteolysis revealed a minimal core domain of 77 amino acids (positions 133-209), containing only Zalpha, which is sufficient to bind left-handed Z-DNA; however, the substrate binding is strikingly different from that of Zab. The second motif, Zbeta, retains its structural integrity only in the context of Zab and does not bind Z-DNA as a separate entity. These results suggest that Zalpha and Zbeta act as a single bipartite domain. In the presence of substrate DNA, Zab becomes more resistant to proteases, suggesting that it adopts a more rigid structure when bound to its substrate, possibly with conformational changes in parts of the protein.

  9. Wnt5a Signals through DVL1 to Repress Ribosomal DNA Transcription by RNA Polymerase I

    PubMed Central

    Dass, Randall A.; Sarshad, Aishe A.; Feenstra, Jennifer M.; Kaur, Amanpreet; Pietras, Kristian; Serra, Rosa; Blanchard, Scott C.; Percipalle, Piergiorgio; Brown, Anthony M. C.; Vincent, C. Theresa

    2016-01-01

    Ribosome biogenesis is essential for cell growth and proliferation and is commonly elevated in cancer. Accordingly, numerous oncogene and tumor suppressor signaling pathways target rRNA synthesis. In breast cancer, non-canonical Wnt signaling by Wnt5a has been reported to antagonize tumor growth. Here, we show that Wnt5a rapidly represses rDNA gene transcription in breast cancer cells and generates a chromatin state with reduced transcription of rDNA by RNA polymerase I (Pol I). These effects were specifically dependent on Dishevelled1 (DVL1), which accumulates in nucleolar organizer regions (NORs) and binds to rDNA regions of the chromosome. Upon DVL1 binding, the Pol I transcription activator and deacetylase Sirtuin 7 (SIRT7) releases from rDNA loci, concomitant with disassembly of Pol I transcription machinery at the rDNA promoter. These findings reveal that Wnt5a signals through DVL1 to suppress rRNA transcription. This provides a novel mechanism for how Wnt5a exerts tumor suppressive effects and why disruption of Wnt5a signaling enhances mammary tumor growth in vivo. PMID:27500936

  10. The C terminus of Ku80 activates the DNA-dependent protein kinase catalytic subunit.

    PubMed

    Singleton, B K; Torres-Arzayus, M I; Rottinghaus, S T; Taccioli, G E; Jeggo, P A

    1999-05-01

    Ku is a heterodimeric protein with double-stranded DNA end-binding activity that operates in the process of nonhomologous end joining. Ku is thought to target the DNA-dependent protein kinase (DNA-PK) complex to the DNA and, when DNA bound, can interact and activate the DNA-PK catalytic subunit (DNA-PKcs). We have carried out a 3' deletion analysis of Ku80, the larger subunit of Ku, and shown that the C-terminal 178 amino acid residues are dispensable for DNA end-binding activity but are required for efficient interaction of Ku with DNA-PKcs. Cells expressing Ku80 proteins that lack the terminal 178 residues have low DNA-PK activity, are radiation sensitive, and can recombine the signal junctions but not the coding junctions during V(D)J recombination. These cells have therefore acquired the phenotype of mouse SCID cells despite expressing DNA-PKcs protein, suggesting that an interaction between DNA-PKcs and Ku, involving the C-terminal region of Ku80, is required for DNA double-strand break rejoining and coding but not signal joint formation. To gain further insight into important domains in Ku80, we report a point mutational change in Ku80 in the defective xrs-2 cell line. This residue is conserved among species and lies outside of the previously reported Ku70-Ku80 interaction domain. The mutational change nonetheless abrogates the Ku70-Ku80 interaction and DNA end-binding activity.

  11. RNA from the 5' end of the R2 retrotransposon controls R2 protein binding to and cleavage of its DNA target site.

    PubMed

    Christensen, Shawn M; Ye, Junqiang; Eickbush, Thomas H

    2006-11-21

    Non-LTR retrotransposons insert into eukaryotic genomes by target-primed reverse transcription (TPRT), a process in which cleaved DNA targets are used to prime reverse transcription of the element's RNA transcript. Many of the steps in the integration pathway of these elements can be characterized in vitro for the R2 element because of the rigid sequence specificity of R2 for both its DNA target and its RNA template. R2 retrotransposition involves identical subunits of the R2 protein bound to different DNA sequences upstream and downstream of the insertion site. The key determinant regulating which DNA-binding conformation the protein adopts was found to be a 320-nt RNA sequence from near the 5' end of the R2 element. In the absence of this 5' RNA the R2 protein binds DNA sequences upstream of the insertion site, cleaves the first DNA strand, and conducts TPRT when RNA containing the 3' untranslated region of the R2 transcript is present. In the presence of the 320-nt 5' RNA, the R2 protein binds DNA sequences downstream of the insertion site. Cleavage of the second DNA strand by the downstream subunit does not appear to occur until after the 5' RNA is removed from this subunit. We postulate that the removal of the 5' RNA normally occurs during reverse transcription, and thus provides a critical temporal link to first- and second-strand DNA cleavage in the R2 retrotransposition reaction.

  12. Heterogeneous RNA-binding protein M4 is a receptor for carcinoembryonic antigen in Kupffer cells.

    PubMed

    Bajenova, O V; Zimmer, R; Stolper, E; Salisbury-Rowswell, J; Nanji, A; Thomas, P

    2001-08-17

    Here we report the isolation of the recombinant cDNA clone from rat macrophages, Kupffer cells (KC) that encodes a protein interacting with carcinoembryonic antigen (CEA). To isolate and identify the CEA receptor gene we used two approaches: screening of a KC cDNA library with a specific antibody and the yeast two-hybrid system for protein interaction using as a bait the N-terminal part of the CEA encoding the binding site. Both techniques resulted in the identification of the rat heterogeneous RNA-binding protein (hnRNP) M4 gene. The rat ortholog cDNA sequence has not been previously described. The open reading frame for this gene contains a 2351-base pair sequence with the polyadenylation signal AATAAA and a termination poly(A) tail. The mRNA shows ubiquitous tissue expression as a 2.4-kilobase transcript. The deduced amino acid sequence comprised a 78-kDa membrane protein with 3 putative RNA-binding domains, arginine/methionine/glutamine-rich C terminus and 3 potential membrane spanning regions. When hnRNP M4 protein is expressed in pGEX4T-3 vector system in Escherichia coli it binds (125)I-labeled CEA in a Ca(2+)-dependent fashion. Transfection of rat hnRNP M4 cDNA into a non-CEA binding mouse macrophage cell line p388D1 resulted in CEA binding. These data provide evidence for a new function of hnRNP M4 protein as a CEA-binding protein in Kupffer cells.

  13. ExpandplusCrystal Structures of Poly(ADP-ribose) Polymerase-1 (PARP-1) Zinc Fingers Bound to DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    M Langelier; J Planck; S Roy

    2011-12-31

    Poly(ADP-ribose) polymerase-1 (PARP-1) has two homologous zinc finger domains, Zn1 and Zn2, that bind to a variety of DNA structures to stimulate poly(ADP-ribose) synthesis activity and to mediate PARP-1 interaction with chromatin. The structural basis for interaction with DNA is unknown, which limits our understanding of PARP-1 regulation and involvement in DNA repair and transcription. Here, we have determined crystal structures for the individual Zn1 and Zn2 domains in complex with a DNA double strand break, providing the first views of PARP-1 zinc fingers bound to DNA. The Zn1-DNA and Zn2-DNA structures establish a novel, bipartite mode of sequence-independent DNAmore » interaction that engages a continuous region of the phosphodiester backbone and the hydrophobic faces of exposed nucleotide bases. Biochemical and cell biological analysis indicate that the Zn1 and Zn2 domains perform distinct functions. The Zn2 domain exhibits high binding affinity to DNA compared with the Zn1 domain. However, the Zn1 domain is essential for DNA-dependent PARP-1 activity in vitro and in vivo, whereas the Zn2 domain is not strictly required. Structural differences between the Zn1-DNA and Zn2-DNA complexes, combined with mutational and structural analysis, indicate that a specialized region of the Zn1 domain is re-configured through the hydrophobic interaction with exposed nucleotide bases to initiate PARP-1 activation.« less

  14. cDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  15. cDNA encoding a polypeptide including a hev ein sequence

    DOEpatents

    Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

    2000-07-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  16. cDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.

  17. cDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1995-03-21

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.

  18. Enzyme-adenylate structure of a bacterial ATP-dependent DNA ligase with a minimized DNA-binding surface.

    PubMed

    Williamson, Adele; Rothweiler, Ulli; Leiros, Hanna Kirsti Schrøder

    2014-11-01

    DNA ligases are a structurally diverse class of enzymes which share a common catalytic core and seal breaks in the phosphodiester backbone of double-stranded DNA via an adenylated intermediate. Here, the structure and activity of a recombinantly produced ATP-dependent DNA ligase from the bacterium Psychromonas sp. strain SP041 is described. This minimal-type ligase, like its close homologues, is able to ligate singly nicked double-stranded DNA with high efficiency and to join cohesive-ended and blunt-ended substrates to a more limited extent. The 1.65 Å resolution crystal structure of the enzyme-adenylate complex reveals no unstructured loops or segments, and suggests that this enzyme binds the DNA without requiring full encirclement of the DNA duplex. This is in contrast to previously characterized minimal DNA ligases from viruses, which use flexible loop regions for DNA interaction. The Psychromonas sp. enzyme is the first structure available for the minimal type of bacterial DNA ligases and is the smallest DNA ligase to be crystallized to date.

  19. A cDNA from a mouse pancreatic beta cell encoding a putative transcription factor of the insulin gene.

    PubMed Central

    Walker, M D; Park, C W; Rosen, A; Aronheim, A

    1990-01-01

    Cell specific expression of the insulin gene is achieved through transcriptional mechanisms operating on multiple DNA sequence elements located in the 5' flanking region of the gene. Of particular importance in the rat insulin I gene are two closely similar 9 bp sequences (IEB1 and IEB2): mutation of either of these leads to 5-10 fold reduction in transcriptional activity. We have screened an expression cDNA library derived from mouse pancreatic endocrine beta cells with a radioactive DNA probe containing multiple copies of the IEB1 sequence. A cDNA clone (A1) isolated by this procedure encodes a protein which shows efficient binding to the IEB1 probe, but much weaker binding to either an unrelated DNA probe or to a probe bearing a single base pair insertion within the recognition sequence. DNA sequence analysis indicates a protein belonging to the helix-loop-helix family of DNA-binding proteins. The ability of the protein encoded by clone A1 to recognize a number of wild type and mutant DNA sequences correlates closely with the ability of each sequence element to support transcription in vivo in the context of the insulin 5' flanking DNA. We conclude that the isolated cDNA may encode a transcription factor that participates in control of insulin gene expression. Images PMID:2181401

  20. Genome-wide analysis of day/night DNA methylation differences in Populus nigra.

    PubMed

    Ding, Chang-Jun; Liang, Li-Xiong; Diao, Shu; Su, Xiao-Hua; Zhang, Bing-Yu

    2018-01-01

    DNA methylation is an important mechanism of epigenetic modification. Methylation changes during stress responses and developmental processes have been well studied; however, their role in plant adaptation to the day/night cycle is poorly understood. In this study, we detected global methylation patterns in leaves of the black poplar Populus nigra 'N46' at 8:00 and 24:00 by methylated DNA immunoprecipitation sequencing (MeDIP-seq). We found 10,027 and 10,242 genes to be methylated in the 8:00 and 24:00 samples, respectively. The methylated genes appeared to be involved in multiple biological processes, molecular functions, and cellular components, suggesting important roles for DNA methylation in poplar cells. Comparing the 8:00 and 24:00 samples, only 440 differentially methylated regions (DMRs) overlapped with genic regions, including 193 hyper- and 247 hypo-methylated DMRs, and may influence the expression of 137 downstream genes. Most hyper-methylated genes were associated with transferase activity, kinase activity, and phosphotransferase activity, whereas most hypo-methylated genes were associated with protein binding, ATP binding, and adenyl ribonucleotide binding, suggesting that different biological processes were activated during the day and night. Our results indicated that methylated genes were prevalent in the poplar genome, but that only a few of these participated in diurnal gene expression regulation.

  1. Cloning of an SNF2/SWI2-related protein that binds specifically to the SPH motifs of the SV40 enhancer and to the HIV-1 promoter.

    PubMed

    Sheridan, P L; Schorpp, M; Voz, M L; Jones, K A

    1995-03-03

    We have isolated a human cDNA clone encoding HIP116, a protein that binds to the SPH repeats of the SV40 enhancer and to the TATA/inhibitor region of the human immunodeficiency virus (HIV)-1 promoter. The predicted HIP116 protein is related to the yeast SNF2/SWI2 transcription factor and to other members of this extended family and contains seven domains similar to those found in the vaccinia NTP1 ATPase. Interestingly, HIP116 also contains a C3HC4 zinc-binding motif (RING finger) interspersed between the ATPase motifs in an arrangement similar to that found in the yeast RAD5 and RAD16 proteins. The HIP116 amino terminus is unique among the members of this family, and houses a specific DNA-binding domain. Antiserum raised against HIP116 recognizes a 116-kDa nuclear protein in Western blots and specifically supershifts SV40 and HIV-1 protein-DNA complexes in gel shift experiments. The binding site for HIP116 on the SV40 enhancer directly overlaps the site for TEF-1, and like TEF-1, binding of HIP116 to the SV40 enhancer is destroyed by mutations that inhibit SPH enhancer activity in vivo. Purified fractions of HIP116 display strong ATPase activity that is preferentially stimulated by SPH DNA and can be inhibited specifically by antibodies to HIP116. These findings suggest that HIP116 might affect transcription, directly or indirectly, by acting as a DNA binding site-specific ATPase.

  2. Non-Enzymatic Detection of Bacterial Genomic DNA Using the Bio-Barcode Assay

    PubMed Central

    Hill, Haley D.; Vega, Rafael A.; Mirkin, Chad A.

    2011-01-01

    The detection of bacterial genomic DNA through a non-enzymatic nanomaterials based amplification method, the bio-barcode assay, is reported. The assay utilizes oligonucleotide functionalized magnetic microparticles to capture the target of interest from the sample. A critical step in the new assay involves the use of blocking oligonucleotides during heat denaturation of the double stranded DNA. These blockers bind to specific regions of the target DNA upon cooling, and prevent the duplex DNA from re-hybridizing, which allows the particle probes to bind. Following target isolation using the magnetic particles, oligonucleotide functionalized gold nanoparticles act as target recognition agents. The oligonucleotides on the nanoparticle (barcodes) act as amplification surrogates. The barcodes are then detected using the Scanometric method. The limit of detection for this assay was determined to be 2.5 femtomolar, and this is the first demonstration of a barcode type assay for the detection of double stranded, genomic DNA. PMID:17927207

  3. Structure of transcription factor HetR required for heterocyst differentiation in cyanobacteria

    PubMed Central

    Kim, Youngchang; Joachimiak, Grazyna; Ye, Zi; Binkowski, T. Andrew; Zhang, Rongguang; Gornicki, Piotr; Callahan, Sean M.; Hess, Wolfgang R.; Haselkorn, Robert; Joachimiak, Andrzej

    2011-01-01

    HetR is an essential regulator of heterocyst development in cyanobacteria. HetR binds to a DNA palindrome upstream of the hetP gene. We report the crystal structure of HetR from Fischerella at 3.0 Å. The protein is a dimer comprised of a central DNA-binding unit containing the N-terminal regions of the two subunits organized with two helix-turn-helix motifs; two globular flaps extending in opposite directions; and a hood over the central core formed from the C-terminal subdomains. The flaps and hood have no structural precedent in the protein database, therefore representing new folds. The structural assignments are supported by site-directed mutagenesis and DNA-binding studies. We suggest that HetR serves as a scaffold for assembly of transcription components critical for heterocyst development. PMID:21628585

  4. A DNA-binding protein from Candida albicans that binds to the RPG box of Saccharomyces cerevisiae and the telomeric repeat sequence of C. albicans.

    PubMed

    Ishii, N; Yamamoto, M; Lahm, H W; Iizumi, S; Yoshihara, F; Nakayama, H; Arisawa, M; Aoki, Y

    1997-02-01

    Electromobility shift assays with a DNA probe containing the Saccharomyces cerevisiae ENO1 RPG box identified a specific DNA-binding protein in total protein extracts of Candida albicans. The protein, named Rbf1p (RPG-box-binding protein 1), bound to other S. cerevisiae RPG boxes, although the nucleotide recognition profile was not completely the same as that of S. cerevisiae Rap 1p (repressor-activator protein 1), an RPG-box-binding protein. The repetitive sequence of the C. albicans chromosomal telomere also competed with RPG-box binding to Rbf1p. For further analysis, we purified Rbf1p 57,600-fold from C. albicans total protein extracts, raised mAbs against the purified protein and immunologically cloned the gene, whose ORF specified a protein of 527 aa. The bacterially expressed protein showed RPG-box-binding activity with the same profile as that of the purified one. The Rbf1p, containing two glutamine-rich regions that are found in many transcription factors, showed transcriptional activation capability in S. cerevisiae and was predominantly observed in nuclei. These results suggest that Rbf1p is a transcription factor with telomere-binding activity in C. albicans.

  5. Disruption of Higher Order DNA Structures in Friedreich’s Ataxia (GAA)n Repeats by PNA or LNA Targeting

    PubMed Central

    Bergquist, Helen; Rocha, Cristina S. J.; Álvarez-Asencio, Rubén; Nguyen, Chi-Hung; Rutland, Mark. W.; Smith, C. I. Edvard; Good, Liam; Nielsen, Peter E.; Zain, Rula

    2016-01-01

    Expansion of (GAA)n repeats in the first intron of the Frataxin gene is associated with reduced mRNA and protein levels and the development of Friedreich’s ataxia. (GAA)n expansions form non-canonical structures, including intramolecular triplex (H-DNA), and R-loops and are associated with epigenetic modifications. With the aim of interfering with higher order H-DNA (like) DNA structures within pathological (GAA)n expansions, we examined sequence-specific interaction of peptide nucleic acid (PNA) with (GAA)n repeats of different lengths (short: n=9, medium: n=75 or long: n=115) by chemical probing of triple helical and single stranded regions. We found that a triplex structure (H-DNA) forms at GAA repeats of different lengths; however, single stranded regions were not detected within the medium size pathological repeat, suggesting the presence of a more complex structure. Furthermore, (GAA)4-PNA binding of the repeat abolished all detectable triplex DNA structures, whereas (CTT)5-PNA did not. We present evidence that (GAA)4-PNA can invade the DNA at the repeat region by binding the DNA CTT strand, thereby preventing non-canonical-DNA formation, and that triplex invasion complexes by (CTT)5-PNA form at the GAA repeats. Locked nucleic acid (LNA) oligonucleotides also inhibited triplex formation at GAA repeat expansions, and atomic force microscopy analysis showed significant relaxation of plasmid morphology in the presence of GAA-LNA. Thus, by inhibiting disease related higher order DNA structures in the Frataxin gene, such PNA and LNA oligomers may have potential for discovery of drugs aiming at recovering Frataxin expression. PMID:27846236

  6. Naturally occurring mutations in the human 5-lipoxygenase gene promoter that modify transcription factor binding and reporter gene transcription.

    PubMed Central

    In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M

    1997-01-01

    Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation. PMID:9062372

  7. Naturally occurring mutations in the human 5-lipoxygenase gene promoter that modify transcription factor binding and reporter gene transcription.

    PubMed

    In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M

    1997-03-01

    Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation.

  8. The kinetoplast DNA of the Australian trypanosome, Trypanosoma copemani, shares features with Trypanosoma cruzi and Trypanosoma lewisi.

    PubMed

    Botero, Adriana; Kapeller, Irit; Cooper, Crystal; Clode, Peta L; Shlomai, Joseph; Thompson, R C Andrew

    2018-05-17

    Kinetoplast DNA (kDNA) is the mitochondrial genome of trypanosomatids. It consists of a few dozen maxicircles and several thousand minicircles, all catenated topologically to form a two-dimensional DNA network. Minicircles are heterogeneous in size and sequence among species. They present one or several conserved regions that contain three highly conserved sequence blocks. CSB-1 (10 bp sequence) and CSB-2 (8 bp sequence) present lower interspecies homology, while CSB-3 (12 bp sequence) or the Universal Minicircle Sequence is conserved within most trypanosomatids. The Universal Minicircle Sequence is located at the replication origin of the minicircles, and is the binding site for the UMS binding protein, a protein involved in trypanosomatid survival and virulence. Here, we describe the structure and organisation of the kDNA of Trypanosoma copemani, a parasite that has been shown to infect mammalian cells and has been associated with the drastic decline of the endangered Australian marsupial, the woylie (Bettongia penicillata). Deep genomic sequencing showed that T. copemani presents two classes of minicircles that share sequence identity and organisation in the conserved sequence blocks with those of Trypanosoma cruzi and Trypanosoma lewisi. A 19,257 bp partial region of the maxicircle of T. copemani that contained the entire coding region was obtained. Comparative analysis of the T. copemani entire maxicircle coding region with the coding regions of T. cruzi and T. lewisi showed they share 71.05% and 71.28% identity, respectively. The shared features in the maxicircle/minicircle organisation and sequence between T. copemani and T. cruzi/T. lewisi suggest similarities in their process of kDNA replication, and are of significance in understanding the evolution of Australian trypanosomes. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  9. A close relative of the nuclear, chromosomal high-mobility group protein HMG1 in yeast mitochondria.

    PubMed Central

    Diffley, J F; Stillman, B

    1991-01-01

    ABF2 (ARS-binding factor 2), a small, basic DNA-binding protein that binds specifically to the autonomously replicating sequence ARS1, is located primarily in the mitochondria of the yeast Saccharomyces cerevisiae. The abundance of ABF2 and the phenotype of abf2- null mutants argue that this protein plays a key role in the structure, maintenance, and expression of the yeast mitochondrial genome. The predicted amino acid sequence of ABF2 is closely related to the high-mobility group proteins HMG1 and HMG2 from vertebrate cell nuclei and to several other DNA-binding proteins. Additionally, ABF2 and the other HMG-related proteins are related to a globular domain from the heat shock protein hsp70 family. ABF2 interacts with DNA both nonspecifically and in a specific manner within regulatory regions, suggesting a mechanism whereby it may aid in compacting the mitochondrial genome without interfering with expression. Images PMID:1881919

  10. Loss of Hda activity stimulates replication initiation from I-box, but not R4 mutant origins in Escherichia coli.

    PubMed

    Riber, Leise; Fujimitsu, Kazuyuki; Katayama, Tsutomu; Løbner-Olesen, Anders

    2009-01-01

    Initiation of chromosome replication in Escherichia coli is limited by the initiator protein DnaA associated with ATP. Within the replication origin, binding sites for DnaA associated with ATP or ADP (R boxes) and the DnaA(ATP) specific sites (I-boxes, tau-boxes and 6-mer sites) are found. We analysed chromosome replication of cells carrying mutations in conserved regions of oriC. Cells carrying mutations in DnaA-boxes I2, I3, R2, R3 and R5 as well as FIS and IHF binding sites resembled wild-type cells with respect to origin concentration. Initiation of replication in these mutants occurred in synchrony or with slight asynchrony only. Furthermore, lack of Hda stimulated initiation in all these mutants. The DnaA(ATP) containing complex that leads to initiation can therefore be formed in the absence of several of the origin DnaA binding sites including both DnaA(ATP) specific I-boxes. However, competition between I-box mutant and wild-type origins, revealed a positive role of I-boxes on initiation. On the other hand, mutations affecting DnaA-box R4 were found to be compromised for initiation and could not be augmented by an increase in cellular DnaA(ATP)/DnaA(ADP) ratio. Compared with the sites tested here, R4 therefore seems to contribute to initiation most critically.

  11. BuD, a helix–loop–helix DNA-binding domain for genome modification

    PubMed Central

    Stella, Stefano; Molina, Rafael; López-Méndez, Blanca; Juillerat, Alexandre; Bertonati, Claudia; Daboussi, Fayza; Campos-Olivas, Ramon; Duchateau, Phillippe; Montoya, Guillermo

    2014-01-01

    DNA editing offers new possibilities in synthetic biology and biomedicine for modulation or modification of cellular functions to organisms. However, inaccuracy in this process may lead to genome damage. To address this important problem, a strategy allowing specific gene modification has been achieved through the addition, removal or exchange of DNA sequences using customized proteins and the endogenous DNA-repair machinery. Therefore, the engineering of specific protein–DNA interactions in protein scaffolds is key to providing ‘toolkits’ for precise genome modification or regulation of gene expression. In a search for putative DNA-binding domains, BurrH, a protein that recognizes a 19 bp DNA target, was identified. Here, its apo and DNA-bound crystal structures are reported, revealing a central region containing 19 repeats of a helix–loop–helix modular domain (BurrH domain; BuD), which identifies the DNA target by a single residue-to-nucleotide code, thus facilitating its redesign for gene targeting. New DNA-binding specificities have been engineered in this template, showing that BuD-derived nucleases (BuDNs) induce high levels of gene targeting in a locus of the human haemoglobin β (HBB) gene close to mutations responsible for sickle-cell anaemia. Hence, the unique combination of high efficiency and specificity of the BuD arrays can push forward diverse genome-modification approaches for cell or organism redesign, opening new avenues for gene editing. PMID:25004980

  12. Evolutionary and biophysical relationships among the papillomavirus E2 proteins.

    PubMed

    Blakaj, Dukagjin M; Fernandez-Fuentes, Narcis; Chen, Zigui; Hegde, Rashmi; Fiser, Andras; Burk, Robert D; Brenowitz, Michael

    2009-01-01

    Infection by human papillomavirus (HPV) may result in clinical conditions ranging from benign warts to invasive cancer. The HPV E2 protein represses oncoprotein transcription and is required for viral replication. HPV E2 binds to palindromic DNA sequences of highly conserved four base pair sequences flanking an identical length variable 'spacer'. E2 proteins directly contact the conserved but not the spacer DNA. Variation in naturally occurring spacer sequences results in differential protein affinity that is dependent on their sensitivity to the spacer DNA's unique conformational and/or dynamic properties. This article explores the biophysical character of this core viral protein with the goal of identifying characteristics that associated with risk of virally caused malignancy. The amino acid sequence, 3d structure and electrostatic features of the E2 protein DNA binding domain are highly conserved; specific interactions with DNA binding sites have also been conserved. In contrast, the E2 protein's transactivation domain does not have extensive surfaces of highly conserved residues. Rather, regions of high conservation are localized to small surface patches. Implications to cancer biology are discussed.

  13. Proteome-wide Identification of Novel Ceramide-binding Proteins by Yeast Surface cDNA Display and Deep Sequencing.

    PubMed

    Bidlingmaier, Scott; Ha, Kevin; Lee, Nam-Kyung; Su, Yang; Liu, Bin

    2016-04-01

    Although the bioactive sphingolipid ceramide is an important cell signaling molecule, relatively few direct ceramide-interacting proteins are known. We used an approach combining yeast surface cDNA display and deep sequencing technology to identify novel proteins binding directly to ceramide. We identified 234 candidate ceramide-binding protein fragments and validated binding for 20. Most (17) bound selectively to ceramide, although a few (3) bound to other lipids as well. Several novel ceramide-binding domains were discovered, including the EF-hand calcium-binding motif, the heat shock chaperonin-binding motif STI1, the SCP2 sterol-binding domain, and the tetratricopeptide repeat region motif. Interestingly, four of the verified ceramide-binding proteins (HPCA, HPCAL1, NCS1, and VSNL1) and an additional three candidate ceramide-binding proteins (NCALD, HPCAL4, and KCNIP3) belong to the neuronal calcium sensor family of EF hand-containing proteins. We used mutagenesis to map the ceramide-binding site in HPCA and to create a mutant HPCA that does not bind to ceramide. We demonstrated selective binding to ceramide by mammalian cell-produced wild type but not mutant HPCA. Intriguingly, we also identified a fragment from prostaglandin D2synthase that binds preferentially to ceramide 1-phosphate. The wide variety of proteins and domains capable of binding to ceramide suggests that many of the signaling functions of ceramide may be regulated by direct binding to these proteins. Based on the deep sequencing data, we estimate that our yeast surface cDNA display library covers ∼60% of the human proteome and our selection/deep sequencing protocol can identify target-interacting protein fragments that are present at extremely low frequency in the starting library. Thus, the yeast surface cDNA display/deep sequencing approach is a rapid, comprehensive, and flexible method for the analysis of protein-ligand interactions, particularly for the study of non-protein ligands. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. CasA mediates Cas3-catalyzed target degradation during CRISPR RNA-guided interference.

    PubMed

    Hochstrasser, Megan L; Taylor, David W; Bhat, Prashant; Guegler, Chantal K; Sternberg, Samuel H; Nogales, Eva; Doudna, Jennifer A

    2014-05-06

    In bacteria, the clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) DNA-targeting complex Cascade (CRISPR-associated complex for antiviral defense) uses CRISPR RNA (crRNA) guides to bind complementary DNA targets at sites adjacent to a trinucleotide signature sequence called the protospacer adjacent motif (PAM). The Cascade complex then recruits Cas3, a nuclease-helicase that catalyzes unwinding and cleavage of foreign double-stranded DNA (dsDNA) bearing a sequence matching that of the crRNA. Cascade comprises the CasA-E proteins and one crRNA, forming a structure that binds and unwinds dsDNA to form an R loop in which the target strand of the DNA base pairs with the 32-nt RNA guide sequence. Single-particle electron microscopy reconstructions of dsDNA-bound Cascade with and without Cas3 reveal that Cascade positions the PAM-proximal end of the DNA duplex at the CasA subunit and near the site of Cas3 association. The finding that the DNA target and Cas3 colocalize with CasA implicates this subunit in a key target-validation step during DNA interference. We show biochemically that base pairing of the PAM region is unnecessary for target binding but critical for Cas3-mediated degradation. In addition, the L1 loop of CasA, previously implicated in PAM recognition, is essential for Cas3 activation following target binding by Cascade. Together, these data show that the CasA subunit of Cascade functions as an essential partner of Cas3 by recognizing DNA target sites and positioning Cas3 adjacent to the PAM to ensure cleavage.

  15. DNA Double-Strand Breaks Coupled with PARP1 and HNRNPA2B1 Binding Sites Flank Coordinately Expressed Domains in Human Chromosomes

    PubMed Central

    Fedoseeva, Daria M.; Sosin, Dmitri V.; Grachev, Sergei A.; Serebraykova, Marina V.; Romanenko, Svetlana A.; Vorobieva, Nadezhda V.; Kravatsky, Yuri V.

    2013-01-01

    Genome instability plays a key role in multiple biological processes and diseases, including cancer. Genome-wide mapping of DNA double-strand breaks (DSBs) is important for understanding both chromosomal architecture and specific chromosomal regions at DSBs. We developed a method for precise genome-wide mapping of blunt-ended DSBs in human chromosomes, and observed non-random fragmentation and DSB hot spots. These hot spots are scattered along chromosomes and delimit protected 50–250 kb DNA domains. We found that about 30% of the domains (denoted forum domains) possess coordinately expressed genes and that PARP1 and HNRNPA2B1 specifically bind DNA sequences at the forum domain termini. Thus, our data suggest a novel type of gene regulation: a coordinated transcription or silencing of gene clusters delimited by DSB hot spots as well as PARP1 and HNRNPa2B1 binding sites. PMID:23593027

  16. Regulation of expression of the ada gene controlling the adaptive response. Interactions with the ada promoter of the Ada protein and RNA polymerase.

    PubMed

    Sakumi, K; Sekiguchi, M

    1989-01-20

    The Ada protein of Escherichia coli catalyzes transfer of methyl groups from methylated DNA to its own molecule, and the methylated form of Ada protein promotes transcription of its own gene, ada. Using an in vitro reconstituted system, we found that both the sigma factor and the methylated Ada protein are required for transcription of the ada gene. To elucidate molecular mechanisms involved in the regulation of the ada transcription, we investigated interactions of the non-methylated and methylated forms of Ada protein and the RNA polymerase holo enzyme (the core enzyme and sigma factor) with a DNA fragment carrying the ada promoter region. Footprinting analyses revealed that the methylated Ada protein binds to a region from positions -63 to -31, which includes the ada regulatory sequence AAAGCGCA. No firm binding was observed with the non-methylated Ada protein, although some DNase I-hypersensitive sites were produced in the promoter by both types of Ada protein. RNA polymerase did bind to the promoter once the methylated Ada protein had bound to the upstream sequence. To correlate these phenomena with the process in vivo, we used the DNAs derived from promoter-defective mutants. No binding of Ada protein nor of RNA polymerase occurred with a mutant DNA having a C to G substitution at position -47 within the ada regulatory sequence. In the case of a -35 box mutant with a T to A change at position -34, the methylated Ada protein did bind to the ada regulatory sequence, yet there was no RNA polymerase binding. Thus, the binding of the methylated Ada protein to the upstream region apparently facilitates binding of the RNA polymerase to the proper region of the promoter. The Ada protein possesses two known methyl acceptor sites, Cys69 and Cys321. The role of methylation of each cysteine residue was investigated using mutant forms of the Ada protein. The Ada protein with the cysteine residue at position 69 replaced by alanine was incapable of binding to the ada promoter even when the cysteine residue at position 321 of the protein was methylated. When the Ada protein with alanine at position 321 was methylated, it acquired the potential to bind to the ada promoter. These results are compatible with the notion that methylation of the cysteine residue at position 69 causes a conformational change of the Ada protein, thereby facilitating binding of the protein to the upstream regulatory sequence.

  17. VIH from the mud crab is specifically expressed in the eyestalk and potentially regulated by transactivator of Sox9/Oct4/Oct1.

    PubMed

    Liu, Chunyun; Jia, Xiwei; Zou, Zhihua; Wang, Xiaowei; Wang, Yilei; Zhang, Ziping

    2018-01-01

    Vitellogenesis-inhibiting hormone (VIH) is known to regulate ovarian maturation by suppressing the synthesis of vitellogenin (Vtg) in crustaceans, which belongs to a member of crustacean hyperglycemic hormone (CHH) family synthesized and secreted from the X-organ/sinus gland complex of eyestalks. In this study, the cDNA, genomic DNA (gDNA) and the 5'-upstream regulatory (promoter region) sequences of VIH gene were obtained by conventional PCR, genome walker and tail-PCR techniques according to our transcriptomic database of Scylla paramamosain. The full-length cDNA of SpVIH is 634bp including 105bp 5'UTR, 151bp 3'UTR and 378bp ORF that encodes a peptide of 125 amino acids. The full length gDNA of SpVIH is 790bp containing two exons and one intron. The 5'-flanking promoter regions of SpVIH we isolated are 3070bp from the translation initiation (ATG) and 2398bp from the predicted transcription initiation (A), which consists of putative core promoter region and multiple potential transcription factor binding sites. SpVIH was only expressed in eyestalk. The expression level of SpVIH in eyestalk of female crab decreased gradually along with the development of ovary. As there is not cell line of crabs available, we chose the mature transfection system HEK293FT cell lines to explore the mechanism of transcription regulation of SpVIH in crabs. Sequential deletion assays using luciferase reporter gene in HEK293FT cells revealed that the possible promoter activity regions (including positive and negative transcription factors binding sites simultaneously) presented between pSpVIH-4 and pSpVIH-6. In order to further identify the crucial transcription factors binding site in this region, the site-directed mutagenesis of Sox9/Oct4/Oct1 binding site of pSpVIH-4 was created. The results demonstrated that the transcriptional activity of pSpVIH-4△ decreased significantly (p<0.05). Thus, it is reasonable to deduce that the Sox9/Oct4/Oct1 may be the essential positive transcription factors which regulate the expression of SpVIH. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Characterisation of a DNA sequence element that directs Dictyostelium stalk cell-specific gene expression.

    PubMed

    Ceccarelli, A; Zhukovskaya, N; Kawata, T; Bozzaro, S; Williams, J

    2000-12-01

    The ecmB gene of Dictyostelium is expressed at culmination both in the prestalk cells that enter the stalk tube and in ancillary stalk cell structures such as the basal disc. Stalk tube-specific expression is regulated by sequence elements within the cap-site proximal part of the promoter, the stalk tube (ST) promoter region. Dd-STATa, a member of the STAT transcription factor family, binds to elements present in the ST promoter-region and represses transcription prior to entry into the stalk tube. We have characterised an activatory DNA sequence element, that lies distal to the repressor elements and that is both necessary and sufficient for expression within the stalk tube. We have mapped this activator to a 28 nucleotide region (the 28-mer) within which we have identified a GA-containing sequence element that is required for efficient gene transcription. The Dd-STATa protein binds to the 28-mer in an in vitro binding assay, and binding is dependent upon the GA-containing sequence. However, the ecmB gene is expressed in a Dd-STATa null mutant, therefore Dd-STATa cannot be responsible for activating the 28-mer in vivo. Instead, we identified a distinct 28-mer binding activity in nuclear extracts from the Dd-STATa null mutant, the activity of this GA binding activity being largely masked in wild type extracts by the high affinity binding of the Dd-STATa protein. We suggest, that in addition to the long range repression exerted by binding to the two known repressor sites, Dd-STATa inhibits transcription by direct competition with this putative activator for binding to the GA sequence.

  19. Carbazole ligands as c-myc G-quadruplex binders.

    PubMed

    Głuszyńska, Agata; Juskowiak, Bernard; Kuta-Siejkowska, Martyna; Hoffmann, Marcin; Haider, Shozeb

    2018-07-15

    The interactions of c-myc G-quadruplex with three carbazole derivatives were investigated by UV-Vis spectrophotometry, fluorescence, CD spectroscopy, and molecular modeling. The results showed that a combination of carbazole scaffold functionalized with ethyl, triazole and imidazole groups resulted in stabilization of the intramolecular G-quadruplex formed by the DNA sequence derived from the NHE III 1 region of c-myc oncogene (Pu22). Binding to the G-quadruplex Pu22 resulted in the significant increase in fluorescence intensity of complexed ligands 1-3. All ligands were capable of interacting with G4 DNA with binding stoichiometry indicating that two ligand molecules bind to G-quadruplex with comparable affinity, which agrees with binding model of end-stacking on terminal G-tetrads. Copyright © 2018 Elsevier B.V. All rights reserved.

  20. Comprehensive analysis of RNA-protein interactions by high-throughput sequencing-RNA affinity profiling.

    PubMed

    Tome, Jacob M; Ozer, Abdullah; Pagano, John M; Gheba, Dan; Schroth, Gary P; Lis, John T

    2014-06-01

    RNA-protein interactions play critical roles in gene regulation, but methods to quantitatively analyze these interactions at a large scale are lacking. We have developed a high-throughput sequencing-RNA affinity profiling (HiTS-RAP) assay by adapting a high-throughput DNA sequencer to quantify the binding of fluorescently labeled protein to millions of RNAs anchored to sequenced cDNA templates. Using HiTS-RAP, we measured the affinity of mutagenized libraries of GFP-binding and NELF-E-binding aptamers to their respective targets and identified critical regions of interaction. Mutations additively affected the affinity of the NELF-E-binding aptamer, whose interaction depended mainly on a single-stranded RNA motif, but not that of the GFP aptamer, whose interaction depended primarily on secondary structure.

  1. Quantifying the Effect of DNA Packaging on Gene Expression Level

    NASA Astrophysics Data System (ADS)

    Kim, Harold

    2010-10-01

    Gene expression, the process by which the genetic code comes alive in the form of proteins, is one of the most important biological processes in living cells, and begins when transcription factors bind to specific DNA sequences in the promoter region upstream of a gene. The relationship between gene expression output and transcription factor input which is termed the gene regulation function is specific to each promoter, and predicting this gene regulation function from the locations of transcription factor binding sites is one of the challenges in biology. In eukaryotic organisms (for example, animals, plants, fungi etc), DNA is highly compacted into nucleosomes, 147-bp segments of DNA tightly wrapped around histone protein core, and therefore, the accessibility of transcription factor binding sites depends on their locations with respect to nucleosomes - sites inside nucleosomes are less accessible than those outside nucleosomes. To understand how transcription factor binding sites contribute to gene expression in a quantitative manner, we obtain gene regulation functions of promoters with various configurations of transcription factor binding sites by using fluorescent protein reporters to measure transcription factor input and gene expression output in single yeast cells. In this talk, I will show that the affinity of a transcription factor binding site inside and outside the nucleosome controls different aspects of the gene regulation function, and explain this finding based on a mass-action kinetic model that includes competition between nucleosomes and transcription factors.

  2. Structure and specificity of the RNA-guided endonuclease Cas9 during DNA interrogation, target binding and cleavage

    PubMed Central

    Josephs, Eric A.; Kocak, D. Dewran; Fitzgibbon, Christopher J.; McMenemy, Joshua; Gersbach, Charles A.; Marszalek, Piotr E.

    2015-01-01

    CRISPR-associated endonuclease Cas9 cuts DNA at variable target sites designated by a Cas9-bound RNA molecule. Cas9's ability to be directed by single ‘guide RNA’ molecules to target nearly any sequence has been recently exploited for a number of emerging biological and medical applications. Therefore, understanding the nature of Cas9's off-target activity is of paramount importance for its practical use. Using atomic force microscopy (AFM), we directly resolve individual Cas9 and nuclease-inactive dCas9 proteins as they bind along engineered DNA substrates. High-resolution imaging allows us to determine their relative propensities to bind with different guide RNA variants to targeted or off-target sequences. Mapping the structural properties of Cas9 and dCas9 to their respective binding sites reveals a progressive conformational transformation at DNA sites with increasing sequence similarity to its target. With kinetic Monte Carlo (KMC) simulations, these results provide evidence of a ‘conformational gating’ mechanism driven by the interactions between the guide RNA and the 14th–17th nucleotide region of the targeted DNA, the stabilities of which we find correlate significantly with reported off-target cleavage rates. KMC simulations also reveal potential methodologies to engineer guide RNA sequences with improved specificity by considering the invasion of guide RNAs into targeted DNA duplex. PMID:26384421

  3. The crystal structure of the Sox4 HMG domain-DNA complex suggests a mechanism for positional interdependence in DNA recognition.

    PubMed

    Jauch, Ralf; Ng, Calista K L; Narasimhan, Kamesh; Kolatkar, Prasanna R

    2012-04-01

    It has recently been proposed that the sequence preferences of DNA-binding TFs (transcription factors) can be well described by models that include the positional interdependence of the nucleotides of the target sites. Such binding models allow for multiple motifs to be invoked, such as principal and secondary motifs differing at two or more nucleotide positions. However, the structural mechanisms underlying the accommodation of such variant motifs by TFs remain elusive. In the present study we examine the crystal structure of the HMG (high-mobility group) domain of Sox4 [Sry (sex-determining region on the Y chromosome)-related HMG box 4] bound to DNA. By comparing this structure with previously solved structures of Sox17 and Sox2, we observed subtle conformational differences at the DNA-binding interface. Furthermore, using quantitative electrophoretic mobility-shift assays we validated the positional interdependence of two nucleotides and the presence of a secondary Sox motif in the affinity landscape of Sox4. These results suggest that a concerted rearrangement of two interface amino acids enables Sox4 to accommodate primary and secondary motifs. The structural adaptations lead to altered dinucleotide preferences that mutually reinforce each other. These analyses underline the complexity of the DNA recognition by TFs and provide an experimental validation for the conceptual framework of positional interdependence and secondary binding motifs.

  4. Mononuclear zinc(II) complexes of 2-((2-(piperazin-1-yl)ethylimino)methyl)-4-substituted phenols: Synthesis, structural characterization, DNA binding and cheminuclease activities

    NASA Astrophysics Data System (ADS)

    Ravichandran, J.; Gurumoorthy, P.; Karthick, C.; Kalilur Rahiman, A.

    2014-03-01

    Four new zinc(II) complexes [Zn(HL1-4)Cl2] (1-4), where HL1-4 = 2-((2-(piperazin-1-yl)ethylimino)methyl)-4-substituted phenols, have been isolated and fully characterized using various spectro-analytical techniques. The X-ray crystal structure of complex 4 shows the distorted trigonal-bipyramidal coordination geometry around zinc(II) ion. The crystal packing is stabilized by intermolecular NH⋯O hydrogen bonding interaction. The complexes display no d-d electronic band in the visible region due to d10 electronic configuration of zinc(II) ion. The electrochemical properties of the synthesized ligands and their complexes exhibit similar voltammogram at reduction potential due to electrochemically innocent Zn(II) ion, which evidenced that the electron transfer is due to the nature of the ligand. Binding interaction of complexes with calf thymus DNA was studied by UV-Vis absorption titration, viscometric titration and cyclic voltammetry. All complexes bind with CT DNA by intercalation, giving the binding affinity in the order of 2 > 1 ≫ 3 > 4. The prominent cheminuclease activity of complexes on plasmid DNA (pBR322 DNA) was observed in the absence and presence of H2O2. Oxidative pathway reveals that the underlying mechanism involves hydroxyl radical.

  5. Isolation of a thyroid hormone-responsive gene by immunoprecipitation of thyroid hormone receptor-DNA complexes.

    PubMed Central

    Bigler, J; Eisenman, R N

    1994-01-01

    Thyroid hormone (T3) receptor (TR) is a ligand-dependent transcription factor that acts through specific binding sites in the promoter region of target genes. In order to identify new genes that are regulated by T3, we used anti-TR antiserum to immunoprecipitate TR-DNA complexes from GH4 cell nuclei that had previously been treated with a restriction enzyme. Screening of the immunopurified, cloned DNA for TR binding sites by electrophoretic mobility shift assay yielded 53 positive clones. A subset of these clones was specifically immunoprecipitated with anti-TR antiserum and may therefore represent biologically significant binding sites. One of these clones, clone 122, was characterized in detail. It includes sequences highly related to the NICER long terminal repeat-like element and contains three TR binding sites as determined by DNase I footprinting. Two of the clone 122 TR binding sites are located upstream of the TATA box, and one is located downstream. The TR binding site downstream from the promoter was necessary and sufficient to confer T3-dependent regulation in transient transfection experiments. Expression of a reporter construct under the control of the clone 122 promoter region was activated by TR in the absence of ligand and returned to basal levels after T3 addition. Clone 122 sequences hybridize to at least two different mRNAs of approximately 6 and 10 kb from GH4 cells. The levels of both of these mRNAs increased upon removal of T3. Our studies suggest that specific immunoprecipitation of chromatin allows identification of binding sites and target genes for transcription factors. Images PMID:7935476

  6. The C-terminal region of translesion synthesis DNA polymerase η is partially unstructured and has high conformational flexibility

    PubMed Central

    Powers, Kyle T; Washington, M Todd

    2018-01-01

    Abstract Eukaryotic DNA polymerase η catalyzes translesion synthesis of thymine dimers and 8-oxoguanines. It is comprised of a polymerase domain and a C-terminal region, both of which are required for its biological function. The C-terminal region mediates interactions with proliferating cell nuclear antigen (PCNA) and other translesion synthesis proteins such as Rev1. This region contains a ubiquitin-binding/zinc-binding (UBZ) motif and a PCNA-interacting protein (PIP) motif. Currently little structural information is available for this region of polymerase η. Using a combination of approaches—including genetic complementation assays, X-ray crystallography, Langevin dynamics simulations, and small-angle X-ray scattering—we show that the C-terminal region is partially unstructured and has high conformational flexibility. This implies that the C-terminal region acts as a flexible tether linking the polymerase domain to PCNA thereby increasing its local concentration. Such tethering would facilitate the sampling of translesion synthesis polymerases to ensure that the most appropriate one is selected to bypass the lesion. PMID:29385534

  7. Interaction of the Tumor Suppressor p53 with Replication Protein A.

    DTIC Science & Technology

    1996-08-01

    The DNA replication factor RPA physically associates with the tumor suppressor protein p53, an interaction that could be important for the function...binding single-stranded DNA, this mutant of RPA fails to support DNA replication . Therefore the region of RPA which interacts with p53 is essential for...of p53, p21/WAFl/CIPl, inhibits the cell-cycle by associating with cyclin-cdk kinases. It also inhibits DNA replication by interacting with a

  8. Protection of CpG islands from DNA methylation is DNA-encoded and evolutionarily conserved.

    PubMed

    Long, Hannah K; King, Hamish W; Patient, Roger K; Odom, Duncan T; Klose, Robert J

    2016-08-19

    DNA methylation is a repressive epigenetic modification that covers vertebrate genomes. Regions known as CpG islands (CGIs), which are refractory to DNA methylation, are often associated with gene promoters and play central roles in gene regulation. Yet how CGIs in their normal genomic context evade the DNA methylation machinery and whether these mechanisms are evolutionarily conserved remains enigmatic. To address these fundamental questions we exploited a transchromosomic animal model and genomic approaches to understand how the hypomethylated state is formed in vivo and to discover whether mechanisms governing CGI formation are evolutionarily conserved. Strikingly, insertion of a human chromosome into mouse revealed that promoter-associated CGIs are refractory to DNA methylation regardless of host species, demonstrating that DNA sequence plays a central role in specifying the hypomethylated state through evolutionarily conserved mechanisms. In contrast, elements distal to gene promoters exhibited more variable methylation between host species, uncovering a widespread dependence on nucleotide frequency and occupancy of DNA-binding transcription factors in shaping the DNA methylation landscape away from gene promoters. This was exemplified by young CpG rich lineage-restricted repeat sequences that evaded DNA methylation in the absence of co-evolved mechanisms targeting methylation to these sequences, and species specific DNA binding events that protected against DNA methylation in CpG poor regions. Finally, transplantation of mouse chromosomal fragments into the evolutionarily distant zebrafish uncovered the existence of a mechanistically conserved and DNA-encoded logic which shapes CGI formation across vertebrate species. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. CTCF regulates the human p53 gene through direct interaction with its natural antisense transcript, Wrap53

    PubMed Central

    Saldaña-Meyer, Ricardo; González-Buendía, Edgar; Guerrero, Georgina; Narendra, Varun; Bonasio, Roberto; Recillas-Targa, Félix; Reinberg, Danny

    2014-01-01

    The multifunctional CCCTC-binding factor (CTCF) protein exhibits a broad range of functions, including that of insulator and higher-order chromatin organizer. We found that CTCF comprises a previously unrecognized region that is necessary and sufficient to bind RNA (RNA-binding region [RBR]) and is distinct from its DNA-binding domain. Depletion of cellular CTCF led to a decrease in not only levels of p53 mRNA, as expected, but also those of Wrap53 RNA, an antisense transcript originated from the p53 locus. PAR-CLIP-seq (photoactivatable ribonucleoside-enhanced cross-linking and immunoprecipitation [PAR-CLIP] combined with deep sequencing) analyses indicate that CTCF binds a multitude of transcripts genome-wide as well as to Wrap53 RNA. Apart from its established role at the p53 promoter, CTCF regulates p53 expression through its physical interaction with Wrap53 RNA. Cells harboring a CTCF mutant in its RBR exhibit a defective p53 response to DNA damage. Moreover, the RBR facilitates CTCF multimerization in an RNA-dependent manner, which may bear directly on its role in establishing higher-order chromatin structures in vivo. PMID:24696455

  10. The Cac2 subunit is essential for productive histone binding and nucleosome assembly in CAF-1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mattiroli, Francesca; Gu, Yajie; Balsbaugh, Jeremy L.

    Nucleosome assembly following DNA replication controls epigenome maintenance and genome integrity. Chromatin assembly factor 1 (CAF-1) is the histone chaperone responsible for histone (H3-H4)2 deposition following DNA synthesis. Structural and functional details for this chaperone complex and its interaction with histones are slowly emerging. Using hydrogen-deuterium exchange coupled to mass spectrometry, combined with in vitro and in vivo mutagenesis studies, we identified the regions involved in the direct interaction between the yeast CAF-1 subunits, and mapped the CAF-1 domains responsible for H3-H4 binding. The large subunit, Cac1 organizes the assembly of CAF-1. Strikingly, H3-H4 binding is mediated by a compositemore » interface, shaped by Cac1-bound Cac2 and the Cac1 acidic region. Cac2 is indispensable for productive histone binding, while deletion of Cac3 has only moderate effects on H3-H4 binding and nucleosome assembly. These results define direct structural roles for yeast CAF-1 subunits and uncover a previously unknown critical function of the middle subunit in CAF-1.« less

  11. Human HMG box transcription factor HBP1: a role in hCD2 LCR function.

    PubMed Central

    Zhuma, T; Tyrrell, R; Sekkali, B; Skavdis, G; Saveliev, A; Tolaini, M; Roderick, K; Norton, T; Smerdon, S; Sedgwick, S; Festenstein, R; Kioussis, D

    1999-01-01

    The locus control region (LCR) of the human CD2 gene (hCD2) confers T cell-specific, copy-dependent and position-independent gene expression in transgenic mice. This LCR consists of a strong T cell-specific enhancer and an element without enhancer activity (designated HSS3), which is required for prevention of position effect variegation (PEV) in transgenic mice. Here, we identified the HMG box containing protein-1 (HBP1) as a factor binding to HSS3 of the hCD2 LCR. Within the LCR, HBP1 binds to a novel TTCATTCATTCA sequence that is higher in affinity than other recently reported HBP1-binding sites. Mice transgenic for a hCD2 LCR construct carrying a deletion of the HBP1-binding sequences show a propensity for PEV if the transgene integrates in a heterochromatic region of the chromosome such as the centromere or telomere. We propose that HBP1 plays an important role in chromatin opening and remodelling activities by binding to and bending the DNA, thus allowing DNA-protein and/or protein-protein interactions, which increase the probability of establishing an active locus. PMID:10562551

  12. The Verrucomicrobia LexA-Binding Motif: Insights into the Evolutionary Dynamics of the SOS Response.

    PubMed

    Erill, Ivan; Campoy, Susana; Kılıç, Sefa; Barbé, Jordi

    2016-01-01

    The SOS response is the primary bacterial mechanism to address DNA damage, coordinating multiple cellular processes that include DNA repair, cell division, and translesion synthesis. In contrast to other regulatory systems, the composition of the SOS genetic network and the binding motif of its transcriptional repressor, LexA, have been shown to vary greatly across bacterial clades, making it an ideal system to study the co-evolution of transcription factors and their regulons. Leveraging comparative genomics approaches and prior knowledge on the core SOS regulon, here we define the binding motif of the Verrucomicrobia, a recently described phylum of emerging interest due to its association with eukaryotic hosts. Site directed mutagenesis of the Verrucomicrobium spinosum recA promoter confirms that LexA binds a 14 bp palindromic motif with consensus sequence TGTTC-N4-GAACA. Computational analyses suggest that recognition of this novel motif is determined primarily by changes in base-contacting residues of the third alpha helix of the LexA helix-turn-helix DNA binding motif. In conjunction with comparative genomics analysis of the LexA regulon in the Verrucomicrobia phylum, electrophoretic shift assays reveal that LexA binds to operators in the promoter region of DNA repair genes and a mutagenesis cassette in this organism, and identify previously unreported components of the SOS response. The identification of tandem LexA-binding sites generating instances of other LexA-binding motifs in the lexA gene promoter of Verrucomicrobia species leads us to postulate a novel mechanism for LexA-binding motif evolution. This model, based on gene duplication, successfully addresses outstanding questions in the intricate co-evolution of the LexA protein, its binding motif and the regulatory network it controls.

  13. Triple helical DNA in a duplex context and base pair opening

    PubMed Central

    Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra

    2014-01-01

    It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466

  14. Interference of transcription across H-NS binding sites and repression by H-NS.

    PubMed

    Rangarajan, Aathmaja Anandhi; Schnetz, Karin

    2018-05-01

    Nucleoid-associated protein H-NS represses transcription by forming extended DNA-H-NS complexes. Repression by H-NS operates mostly at the level of transcription initiation. Less is known about how DNA-H-NS complexes interfere with transcription elongation. In vitro H-NS has been shown to enhance RNA polymerase pausing and to promote Rho-dependent termination, while in vivo inhibition of Rho resulted in a decrease of the genome occupancy by H-NS. Here we show that transcription directed across H-NS binding regions relieves H-NS (and H-NS/StpA) mediated repression of promoters in these regions. Further, we observed a correlation of transcription across the H-NS-bound region and de-repression. The data suggest that the transcribing RNA polymerase is able to remodel the H-NS complex and/or dislodge H-NS from the DNA and thus relieve repression. Such an interference of transcription and H-NS mediated repression may imply that poorly transcribed AT-rich loci are prone to be repressed by H-NS, while efficiently transcribed loci escape repression. © 2018 John Wiley & Sons Ltd.

  15. Specific interaction of the nonstructural protein NS1 of minute virus of mice (MVM) with [ACCA](2) motifs in the centre of the right-end MVM DNA palindrome induces hairpin-primed viral DNA replication.

    PubMed

    Willwand, Kurt; Moroianu, Adela; Hörlein, Rita; Stremmel, Wolfgang; Rommelaere, Jean

    2002-07-01

    The linear single-stranded DNA genome of minute virus of mice (MVM) is replicated via a double-stranded replicative form (RF) intermediate DNA. Amplification of viral RF DNA requires the structural transition of the right-end palindrome from a linear duplex into a double-hairpin structure, which serves for the repriming of unidirectional DNA synthesis. This conformational transition was found previously to be induced by the MVM nonstructural protein NS1. Elimination of the cognate NS1-binding sites, [ACCA](2), from the central region of the right-end palindrome next to the axis of symmetry was shown to markedly reduce the efficiency of hairpin-primed DNA replication, as measured in a reconstituted in vitro replication system. Thus, [ACCA](2) sequence motifs are essential as NS1-binding elements in the context of the structural transition of the right-end MVM palindrome.

  16. Functional organization of DNA elements regulating SM30alpha, a spicule matrix gene of sea urchin embryos.

    PubMed

    Yamasu, K; Wilt, F H

    1999-02-01

    The SM30a gene encodes a protein in the embryonic endoskeleton of the sea urchin Strongylocentrotus purpuratus, and is specifically expressed in the skeletogenic primary mesenchyme cell lineage. To clarify the mechanism for the differentiation of this cell lineage, which proceeds rather autonomously in the embryo, regulation of the SM30alpha gene was investigated previously and it was shown that the distal DNA region upstream of this gene from - 1.6 to - 1.0 kb contained numerous negative regulatory elements that suppressed the ectopic expression of the gene in the gut. Here we study the influence of the proximal region from - 303 to + 104 bp. Analysis of the expression of reporter constructs indicated that a strong positive enhancer element existed in the region from -142 to -105bp. This element worked both in forward and reverse orientations and additively when placed tandemly upstream to the reporter gene. In addition, other weaker positive and negative regulatory sites were also detected throughout the proximal region. Electrophoretic gel mobility shift analyses showed that multiple nuclear proteins were bound to the putative strong enhancer region. One of the proteins binding to this region was present in ear y blastulae, a time when the SM30 gene was still silent, but it was not in prism embryos actively expressing the gene. The binding region for this blastula-specific protein was narrowed down to the region from - 132 to -122 bp, which included the consensus binding site for the mammalian proto-oncogene product, Ets. Two possible SpGCF1 binding sites were identified in the vicinity of the enhancer region. This information was used to make a comparison of the general regulatory architecture of genes that contribute to the formation of the skeletal spicule.

  17. A Heterogeneous Nuclear Ribonucleoprotein A/B-Related Protein Binds to Single-Stranded DNA near the 5′ End or within the Genome of Feline Parvovirus and Can Modify Virus Replication

    PubMed Central

    Wang, Dai; Parrish, Colin R.

    1999-01-01

    Phage display of cDNA clones prepared from feline cells was used to identify host cell proteins that bound to DNA-containing feline panleukopenia virus (FPV) capsids but not to empty capsids. One gene found in several clones encoded a heterogeneous nuclear ribonucleoprotein (hnRNP)-related protein (DBP40) that was very similar in sequence to the A/B-type hnRNP proteins. DBP40 bound specifically to oligonucleotides representing a sequence near the 5′ end of the genome which is exposed on the outside of the full capsid but did not bind most other terminal sequences. Adding purified DBP40 to an in vitro fill-in reaction using viral DNA as a template inhibited the production of the second strand after nucleotide (nt) 289 but prior to nt 469. DBP40 bound to various regions of the viral genome, including a region between nt 295 and 330 of the viral genome which has been associated with transcriptional attenuation of the parvovirus minute virus of mice, which is mediated by a stem-loop structure of the DNA and cellular proteins. Overexpression of the protein in feline cells from a plasmid vector made them largely resistant to FPV infection. Mutagenesis of the protein binding site within the 5′ end viral genome did not affect replication of the virus. PMID:10438866

  18. The high mobility group protein 1 enhances binding of the estrogen receptor DNA binding domain to the estrogen response element.

    PubMed

    Romine, L E; Wood, J R; Lamia, L A; Prendergast, P; Edwards, D P; Nardulli, A M

    1998-05-01

    We have examined the ability of the high-mobility group protein 1 (HMG1) to alter binding of the estrogen receptor DNA-binding domain (DBD) to the estrogen response element (ERE). HMG1 dramatically enhanced binding of purified, bacterially expressed DBD to the consensus vitellogenin A2 ERE in a dose-dependent manner. The ability of HMG1 to stabilize the DBD-ERE complex resulted in part from a decrease in the dissociation rate of the DBD from the ERE. Antibody supershift experiments demonstrated that HMG1 was also capable of forming a ternary complex with the ERE-bound DBD in the presence of HMG1-specific antibody. HMG1 did not substantially affect DBD-ERE contacts as assessed by methylation interference assays, nor did it alter the ability of the DBD to induce distortion in ERE-containing DNA fragments. Because HMG1 dramatically enhanced estrogen receptor DBD binding to the ERE, and the DBD is the most highly conserved region among the nuclear receptor superfamily members, HMG1 may function to enhance binding of other nuclear receptors to their respective response elements and act in concert with coactivator proteins to regulate expression of hormone-responsive genes.

  19. Insulator protein Su(Hw) recruits SAGA and Brahma complexes and constitutes part of Origin Recognition Complex-binding sites in the Drosophila genome

    PubMed Central

    Vorobyeva, Nadezhda E.; Mazina, Marina U.; Golovnin, Anton K.; Kopytova, Daria V.; Gurskiy, Dmitriy Y.; Nabirochkina, Elena N.; Georgieva, Sofia G.; Georgiev, Pavel G.; Krasnov, Aleksey N.

    2013-01-01

    Despite increasing data on the properties of replication origins, molecular mechanisms underlying origin recognition complex (ORC) positioning in the genome are still poorly understood. The Su(Hw) protein accounts for the activity of best-studied Drosophila insulators. Here, we show that Su(Hw) recruits the histone acetyltransferase complex SAGA and chromatin remodeler Brahma to Su(Hw)-dependent insulators, which gives rise to regions with low nucleosome density and creates conditions for ORC binding. Depletion in Su(Hw) leads to a dramatic drop in the levels of SAGA, Brahma and ORC subunits and a significant increase in nucleosome density on Su(Hw)-dependent insulators, whereas artificial Su(Hw) recruitment itself is sufficient for subsequent SAGA, Brahma and ORC binding. In contrast to the majority of replication origins that associate with promoters of active genes, Su(Hw)-binding sites constitute a small proportion (6%) of ORC-binding sites that are localized preferentially in transcriptionally inactive chromatin regions termed BLACK and BLUE chromatin. We suggest that the key determinants of ORC positioning in the genome are DNA-binding proteins that constitute different DNA regulatory elements, including insulators, promoters and enhancers. Su(Hw) is the first example of such a protein. PMID:23609538

  20. Conservation of Matrix Attachment Region-Binding Filament-Like Protein 1 among Higher Plants1

    PubMed Central

    Harder, Patricia A.; Silverstein, Rebecca A.; Meier, Iris

    2000-01-01

    The interaction of chromatin with the nuclear matrix via matrix attachment regions (MARs) on the DNA is considered to be of fundamental importance for higher-order chromatin organization and the regulation of gene expression. We have previously isolated a novel nuclear matrix-localized protein (MFP1) from tomato (Lycopersicon esculentum) that preferentially binds to MAR DNA. Tomato MFP1 has a predicted filament-protein-like structure and is associated with the nuclear envelope via an N-terminal targeting domain. Based on the antigenic relationship, we report here that MFP1 is conserved in a large number of dicot and monocot species. Several cDNAs were cloned from tobacco (Nicotiana tabacum) and shown to correspond to two tobacco MFP1 genes. Comparison of the primary and predicted secondary structures of MFP1 from tomato, tobacco, and Arabidopsis indicates a high degree of conservation of the N-terminal targeting domain, the overall putative coiled-coil structure of the protein, and the C-terminal DNA-binding domain. In addition, we show that tobacco MFP1 is regulated in an organ-specific and developmental fashion, and that this regulation occurs at the level of transcription or RNA stability. PMID:10631266

  1. Methylation Analysis of the BMPR2 Gene Promoter Region in Patients With Pulmonary Arterial Hypertension.

    PubMed

    Pousada, Guillermo; Baloira, Adolfo; Valverde, Diana

    2016-06-01

    Pulmonary arterial hypertension is characterizated by obstruction of the pulmonary arteries. The gene mainly related to pathology is the bone morphogenetic protein receptor type II (BMPR2). The aim of this study was to analyze the methylation pattern of the BMPR2 promoter region in patients and controls. We used Methyl Primer Express(®) v.1.0 and MatInspector softwares to analyze this region. Genomic DNA obtained from the peripheral blood of patients and controls was modified with sodium bisulphite. Methylation was analyzed using methylation-specific PCR. DNA treated with CpG methyltransferase was used as a positive control for methylation and H1299 cell culture DNA was used as positive control for gene expression. We identified a CpG island, which may have been methylated, in the BMPR2 promoter region, in addition to NIT-2 (global-acting regulatory protein), sex-determining region Y) and heat shock factor transcription factor binding sites. We found no evidence of methylation in patients and controls. No methylated CpG sites were identified in H1299 cells expressing the BMPR2 gene. The BMPR2 promoter region is the most suitable for study because of the high number of transcription factor binding sites that could alter gene function. No evidence of methylation was detected in this region in patients and controls. Copyright © 2015 SEPAR. Published by Elsevier Espana. All rights reserved.

  2. An immunoassay for the study of DNA-binding activities of herpes simplex virus protein ICP8.

    PubMed

    Lee, C K; Knipe, D M

    1985-06-01

    An immunoassay was used to examine the interaction between a herpes simplex virus protein, ICP8, and various types of DNA. The advantage of this assay is that the protein is not subjected to harsh purification procedures. We characterized the binding of ICP8 to both single-stranded (ss) and double-stranded (ds) DNA. ICP8 bound ss DNA fivefold more efficiently than ds DNA, and both binding activities were most efficient in 150 mM NaCl. Two lines of evidence indicate that the binding activities were not identical: (i) ds DNA failed to complete with ss DNA binding even with a large excess of ds DNA; (ii) Scatchard plots of DNA binding with various amounts of DNA were fundamentally different for ss DNA and ds DNA. However, the two activities were related in that ss DNA efficiently competed with the binding of ds DNA. We conclude that the ds DNA-binding activity of ICP8 is probably distinct from the ss DNA-binding activity. No evidence for sequence-specific ds DNA binding was obtained for either the entire herpes simplex virus genome or cloned viral sequences.

  3. Ets-1 interacts through a similar binding interface with Ku70 and Poly (ADP-Ribose) Polymerase-1.

    PubMed

    Choul-Li, Souhaila; Legrand, Arnaud J; Vicogne, Dorothée; Villeret, Vincent; Aumercier, Marc

    2018-06-18

    The Ets-1 transcription factor plays an important role in various physiological and pathological processes. These diverse roles of Ets-1 are likely to depend on its interaction proteins. We have previously showed that Ets-1 interacted with DNA-dependent protein kinase (DNA-PK) complex including its regulatory subunits, Ku70 and Ku86 and with poly (ADP-ribose) polymerase-1 (PARP-1). In this study, the binding domains for the interaction between Ets-1 and these proteins were reported. We demonstrated that the interaction of Ets-1 with DNA-PK was mediated through the Ku70 subunit and was mapped to the C-terminal region of Ets-1 and the C-terminal part of Ku70 including SAP domain. The interactive domains between Ets-1 and PARP-1 have been mapped to the C-terminal region of Ets-1 and the BRCA1 carboxy-terminal (BRCT) domain of PARP-1. The results presented in this study may advance our understanding of the functional link between Ets-1 and its interaction partners, DNA-PK and PARP-1.

  4. Conformational plasticity of RepB, the replication initiator protein of promiscuous streptococcal plasmid pMV158

    PubMed Central

    Boer, D. Roeland; Ruiz-Masó, José Angel; Rueda, Manuel; Petoukhov, Maxim V.; Machón, Cristina; Svergun, Dmitri I.; Orozco, Modesto; del Solar, Gloria; Coll, Miquel

    2016-01-01

    DNA replication initiation is a vital and tightly regulated step in all replicons and requires an initiator factor that specifically recognizes the DNA replication origin and starts replication. RepB from the promiscuous streptococcal plasmid pMV158 is a hexameric ring protein evolutionary related to viral initiators. Here we explore the conformational plasticity of the RepB hexamer by i) SAXS, ii) sedimentation experiments, iii) molecular simulations and iv) X-ray crystallography. Combining these techniques, we derive an estimate of the conformational ensemble in solution showing that the C-terminal oligomerisation domains of the protein form a rigid cylindrical scaffold to which the N-terminal DNA-binding/catalytic domains are attached as highly flexible appendages, featuring multiple orientations. In addition, we show that the hinge region connecting both domains plays a pivotal role in the observed plasticity. Sequence comparisons and a literature survey show that this hinge region could exists in other initiators, suggesting that it is a common, crucial structural element for DNA binding and manipulation. PMID:26875695

  5. Recognition of chromatin by the plant alkaloid, ellipticine as a dual binder

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Banerjee, Amrita; Sanyal, Sulagna; Majumder, Parijat

    Recognition of core histone components of chromatin along with chromosomal DNA by a class of small molecule modulators is worth examining to evaluate their intracellular mode of action. A plant alkaloid ellipticine (ELP) which is a putative anticancer agent has so far been reported to function via DNA intercalation, association with topoisomerase II and binding to telomere region. However, its effect upon the potential intracellular target, chromatin is hitherto unreported. Here we have characterized the biomolecular recognition between ELP and different hierarchical levels of chromatin. The significant result is that in addition to DNA, it binds to core histone(s) andmore » can be categorized as a ‘dual binder’. As a sequel to binding with histone(s) and core octamer, it alters post-translational histone acetylation marks. We have further demonstrated that it has the potential to modulate gene expression thereby regulating several key biological processes such as nuclear organization, transcription, translation and histone modifications. - Highlights: • Ellipticine acts a dual binder binding to both DNA and core histone(s). • It induces structural perturbations in chromatin, chromatosome and histone octamer. • It alters histones acetylation and affects global gene expression.« less

  6. Conformation switching of AIM2 PYD domain revealed by NMR relaxation and MD simulation.

    PubMed

    Wang, Haobo; Yang, Lijiang; Niu, Xiaogang

    2016-04-29

    Protein absent in melanoma 2 (AIM2) is a double-strand DNA (ds DNA) sensor mainly located in cytoplasm of cell. It includes one N terminal PYD domain and one C terminal HIN domain. When the ds DNA such as DNA viruses and bacteria entered cytoplasm, the HIN domain of AIM2 will recognize and bind to DNA, and the PYD domain will bind to ASC protein which will result in the formation of AIM2 inflammasome. Three AIM2 PYD domain structures have been solved, but every structure yields a unique conformation around the α3 helix region. To understand why different AIM2 PYD structures show different conformations in this region, we use NMR relaxation techniques to study the backbone dynamics of mouse AIM2 PYD domain and perform molecular dynamics (MD) simulations on both mouse and human AIM2 PYD structures. Our results indicate that this region is highly flexible in both mouse and human AIM2 PYD domains, and the PYD domain may exist as a conformation ensemble in solution. Different environment makes the population vary among pre-existing conformational substrates of the ensemble, which may be the reason why different AIM2 PYD structures were observed under different conditions. Further docking analysis reveals that the conformation switching may be important for the autoinhibition of the AIM2 protein. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Deciphering the Binding between Nupr1 and MSL1 and Their DNA-Repairing Activity

    PubMed Central

    Doménech, Rosa; Pantoja-Uceda, David; Gironella, Meritxell; Santoro, Jorge; Velázquez-Campoy, Adrián; Neira, José L.; Iovanna, Juan L.

    2013-01-01

    The stress protein Nupr1 is a highly basic, multifunctional, intrinsically disordered protein (IDP). MSL1 is a histone acetyl transferase-associated protein, known to intervene in the dosage compensation complex (DCC). In this work, we show that both Nupr1 and MSL1 proteins were recruited and formed a complex into the nucleus in response to DNA-damage, which was essential for cell survival in reply to cisplatin damage. We studied the interaction of Nupr1 and MSL1, and their binding affinities to DNA by spectroscopic and biophysical methods. The MSL1 bound to Nupr1, with a moderate affinity (2.8 µM) in an entropically-driven process. MSL1 did not bind to non-damaged DNA, but it bound to chemically-damaged-DNA with a moderate affinity (1.2 µM) also in an entropically-driven process. The Nupr1 protein bound to chemically-damaged-DNA with a slightly larger affinity (0.4 µM), but in an enthalpically-driven process. Nupr1 showed different interacting regions in the formed complexes with Nupr1 or DNA; however, they were always disordered (“fuzzy”), as shown by NMR. These results underline a stochastic description of the functionality of the Nupr1 and its other interacting partners. PMID:24205110

  8. The Gam protein of bacteriophage Mu is an orthologue of eukaryotic Ku

    PubMed Central

    di Fagagna, Fabrizio d'Adda; Weller, Geoffrey R.; Doherty, Aidan J.; Jackson, Stephen P.

    2003-01-01

    Mu bacteriophage inserts its DNA into the genome of host bacteria and is used as a model for DNA transposition events in other systems. The eukaryotic Ku protein has key roles in DNA repair and in certain transposition events. Here we show that the Gam protein of phage Mu is conserved in bacteria, has sequence homology with both subunits of Ku, and has the potential to adopt a similar architecture to the core DNA-binding region of Ku. Through biochemical studies, we demonstrate that Gam and the related protein of Haemophilus influenzae display DNA binding characteristics remarkably similar to those of human Ku. In addition, we show that Gam can interfere with Ty1 retrotransposition in Saccharomyces cerevisiae. These data reveal structural and functional parallels between bacteriophage Gam and eukaryotic Ku and suggest that their functions have been evolutionarily conserved. PMID:12524520

  9. Program Specificity for Ptf1a in Pancreas versus Neural Tube Development Correlates with Distinct Collaborating Cofactors and Chromatin Accessibility

    PubMed Central

    Meredith, David M.; Borromeo, Mark D.; Deering, Tye G.; Casey, Bradford H.; Savage, Trisha K.; Mayer, Paul R.; Hoang, Chinh; Tung, Kuang-Chi; Kumar, Manonmani; Shen, Chengcheng; Swift, Galvin H.

    2013-01-01

    The lineage-specific basic helix-loop-helix transcription factor Ptf1a is a critical driver for development of both the pancreas and nervous system. How one transcription factor controls diverse programs of gene expression is a fundamental question in developmental biology. To uncover molecular strategies for the program-specific functions of Ptf1a, we identified bound genomic regions in vivo during development of both tissues. Most regions bound by Ptf1a are specific to each tissue, lie near genes needed for proper formation of each tissue, and coincide with regions of open chromatin. The specificity of Ptf1a binding is encoded in the DNA surrounding the Ptf1a-bound sites, because these regions are sufficient to direct tissue-restricted reporter expression in transgenic mice. Fox and Sox factors were identified as potential lineage-specific modifiers of Ptf1a binding, since binding motifs for these factors are enriched in Ptf1a-bound regions in pancreas and neural tube, respectively. Of the Fox factors expressed during pancreatic development, Foxa2 plays a major role. Indeed, Ptf1a and Foxa2 colocalize in embryonic pancreatic chromatin and can act synergistically in cell transfection assays. Together, these findings indicate that lineage-specific chromatin landscapes likely constrain the DNA binding of Ptf1a, and they identify Fox and Sox gene families as part of this process. PMID:23754747

  10. Binding of anticancer drug daunomycin to a TGGGGT G-quadruplex DNA probed by all-atom molecular dynamics simulations: additional pure groove binding mode and implications on designing more selective G-quadruplex ligands.

    PubMed

    Shen, Zhanhang; Mulholland, Kelly A; Zheng, Yujun; Wu, Chun

    2017-09-01

    DNA G-quadruplex structures are emerging cancer-specific targets for chemotherapeutics. Ligands that bind to and stabilize DNA G-quadruplexes have the potential to be anti-cancer drugs. Lack of binding selectivity to DNA G-quadruplex over DNA duplex remains a major challenge when attempting to develop G-quadruplex ligands into successful anti-cancer drugs. Thorough understanding of the binding nature of existing non-selective ligands that bind to both DNA quadruplex and DNA duplex will help to address this challenge. Daunomycin and doxorubicin, two commonly used anticancer drugs, are examples of non-selective DNA ligands. In this study, we extended our early all-atom binding simulation studies between doxorubicin and a DNA duplex (d(CGATCG) 2 ) to probe the binding between daunomycin and a parallel DNA quadruplex (d(TGGGGT) 4 ) and DNA duplex. In addition to the end stacking mode, which mimics the mode in the crystal structure, a pure groove binding mode was observed in our free binding simulations. The dynamic and energetic properties of these two binding modes are thoroughly examined, and a detailed comparison is made between DNA quadruplex binding modes and DNA duplex binding modes. Implications on the design of more selective DNA quadruplex ligands are also discussed. Graphical abstract Top stacking and groov binding modes from the MD simulations.

  11. Small RNA-mediated repair of UV-induced DNA lesions by the DNA DAMAGE-BINDING PROTEIN 2 and ARGONAUTE 1

    PubMed Central

    Schalk, Catherine; Cognat, Valérie; Graindorge, Stéfanie; Vincent, Timothée; Voinnet, Olivier; Molinier, Jean

    2017-01-01

    As photosynthetic organisms, plants need to prevent irreversible UV-induced DNA lesions. Through an unbiased, genome-wide approach, we have uncovered a previously unrecognized interplay between Global Genome Repair and small interfering RNAs (siRNAs) in the recognition of DNA photoproducts, prevalently in intergenic regions. Genetic and biochemical approaches indicate that, upon UV irradiation, the DNA DAMAGE-BINDING PROTEIN 2 (DDB2) and ARGONAUTE 1 (AGO1) of Arabidopsis thaliana form a chromatin-bound complex together with 21-nt siRNAs, which likely facilitates recognition of DNA damages in an RNA/DNA complementary strand-specific manner. The biogenesis of photoproduct-associated siRNAs involves the noncanonical, concerted action of RNA POLYMERASE IV, RNA-DEPENDENT RNA POLYMERASE-2, and DICER-LIKE-4. Furthermore, the chromatin association/dissociation of the DDB2-AGO1 complex is under the control of siRNA abundance and DNA damage signaling. These findings reveal unexpected nuclear functions for DCL4 and AGO1, and shed light on the interplay between small RNAs and DNA repair recognition factors at damaged sites. PMID:28325872

  12. Solution structure and intramolecular exchange of methyl-cytosine binding domain protein 4 (MBD4) on DNA suggests a mechanism to scan for mCpG/TpG mismatches

    PubMed Central

    Walavalkar, Ninad M.; Cramer, Jason M.; Buchwald, William A.; Scarsdale, J. Neel; Williams, David C.

    2014-01-01

    Unlike other members of the methyl-cytosine binding domain (MBD) family, MBD4 serves as a potent DNA glycosylase in DNA mismatch repair specifically targeting mCpG/TpG mismatches arising from spontaneous deamination of methyl-cytosine. The protein contains an N-terminal MBD (MBD4MBD) and a C-terminal glycosylase domain (MBD4GD) separated by a long linker. This arrangement suggests that the MBD4MBD either directly augments enzymatic catalysis by the MBD4GD or targets the protein to regions enriched for mCpG/TpG mismatches. Here we present structural and dynamic studies of MBD4MBD bound to dsDNA. We show that MBD4MBD binds with a modest preference formCpG as compared to mismatch, unmethylated and hydroxymethylated DNA. We find that while MBD4MBD exhibits slow exchange between molecules of DNA (intermolecular exchange), the domain exhibits fast exchange between two sites in the same molecule of dsDNA (intramolecular exchange). Introducing a single-strand defect between binding sites does not greatly reduce the intramolecular exchange rate, consistent with a local hopping mechanism for moving along the DNA. These results support a model in which the MBD4MBD4 targets the intact protein to mCpG islands and promotes scanning by rapidly exchanging between successive mCpG sites which facilitates repair of nearby mCpG/TpG mismatches by the glycosylase domain. PMID:25183517

  13. The NS1 polypeptide of the murine parvovirus minute virus of mice binds to DNA sequences containing the motif [ACCA]2-3.

    PubMed Central

    Cotmore, S F; Christensen, J; Nüesch, J P; Tattersall, P

    1995-01-01

    A DNA fragment containing the minute virus of mice 3' replication origin was specifically coprecipitated in immune complexes containing the virally coded NS1, but not the NS2, polypeptide. Antibodies directed against the amino- or carboxy-terminal regions of NS1 precipitated the NS1-origin complexes, but antibodies directed against NS1 amino acids 284 to 459 blocked complex formation. Using affinity-purified histidine-tagged NS1 preparations, we have shown that the specific protein-DNA interaction is of moderate affinity, being stable in 0.1 M salt but rapidly lost at higher salt concentrations. In contrast, generalized (or nonspecific) DNA binding by NS1 could be demonstrated only in low salt. Addition of ATP or gamma S-ATP enhanced specific DNA binding by wild-type NS1 severalfold, but binding was lost under conditions which favored ATP hydrolysis. NS1 molecules with mutations in a critical lysine residue (amino acid 405) in the consensus ATP-binding site bound to the origin, but this binding could not be enhanced by ATP addition. DNase I protection assays carried out with wild-type NS1 in the presence of gamma S-ATP gave footprints which extended over 43 nucleotides on both DNA strands, from the middle of the origin bubble sequence to a position some 14 bp beyond the nick site. The DNA-binding site for NS1 was mapped to a 22-bp fragment from the middle of the 3' replication origin which contains the sequence ACCAACCA. This conforms to a reiterated motif (ACCA)2-3, which occurs, in more or less degenerate form, at many sites throughout the minute virus of mice genome (J. W. Bodner, Virus Genes 2:167-182, 1989). Insertion of a single copy of the sequence (ACCA)3 was shown to be sufficient to confer NS1 binding on an otherwise unrecognized plasmid fragment. The functions of NS1 in the viral life cycle are reevaluated in the light of this result. PMID:7853501

  14. The NS1 polypeptide of the murine parvovirus minute virus of mice binds to DNA sequences containing the motif [ACCA]2-3.

    PubMed

    Cotmore, S F; Christensen, J; Nüesch, J P; Tattersall, P

    1995-03-01

    A DNA fragment containing the minute virus of mice 3' replication origin was specifically coprecipitated in immune complexes containing the virally coded NS1, but not the NS2, polypeptide. Antibodies directed against the amino- or carboxy-terminal regions of NS1 precipitated the NS1-origin complexes, but antibodies directed against NS1 amino acids 284 to 459 blocked complex formation. Using affinity-purified histidine-tagged NS1 preparations, we have shown that the specific protein-DNA interaction is of moderate affinity, being stable in 0.1 M salt but rapidly lost at higher salt concentrations. In contrast, generalized (or nonspecific) DNA binding by NS1 could be demonstrated only in low salt. Addition of ATP or gamma S-ATP enhanced specific DNA binding by wild-type NS1 severalfold, but binding was lost under conditions which favored ATP hydrolysis. NS1 molecules with mutations in a critical lysine residue (amino acid 405) in the consensus ATP-binding site bound to the origin, but this binding could not be enhanced by ATP addition. DNase I protection assays carried out with wild-type NS1 in the presence of gamma S-ATP gave footprints which extended over 43 nucleotides on both DNA strands, from the middle of the origin bubble sequence to a position some 14 bp beyond the nick site. The DNA-binding site for NS1 was mapped to a 22-bp fragment from the middle of the 3' replication origin which contains the sequence ACCAACCA. This conforms to a reiterated motif (ACCA)2-3, which occurs, in more or less degenerate form, at many sites throughout the minute virus of mice genome (J. W. Bodner, Virus Genes 2:167-182, 1989). Insertion of a single copy of the sequence (ACCA)3 was shown to be sufficient to confer NS1 binding on an otherwise unrecognized plasmid fragment. The functions of NS1 in the viral life cycle are reevaluated in the light of this result.

  15. Conjugation of Benzylvanillin and Benzimidazole Structure Improves DNA Binding with Enhanced Antileukemic Properties

    PubMed Central

    Al-Mudarris, Ban A.; Chen, Shih-Hsun; Liang, Po-Huang; Osman, Hasnah; Jamal Din, Shah Kamal Khan; Abdul Majid, Amin M. S.

    2013-01-01

    Benzyl-o-vanillin and benzimidazole nucleus serve as important pharmacophore in drug discovery. The benzyl vanillin (2-(benzyloxy)-3-methoxybenzaldehyde) compound shows anti-proliferative activity in HL60 leukemia cancer cells and can effect cell cycle progression at G2/M phase. Its apoptosis activity was due to disruption of mitochondrial functioning. In this study, we have studied a series of compounds consisting of benzyl vanillin and benzimidazole structures. We hypothesize that by fusing these two structures we can produce compounds that have better anticancer activity with improved specificity particularly towards the leukemia cell line. Here we explored the anticancer activity of three compounds namely 2-(2-benzyloxy-3-methoxyphenyl)-1H-benzimidazole, 2MP, N-1-(2-benzyloxy-3-methoxybenzyl)-2-(2-benzyloxy-3-methoxyphenyl)-1H-benzimidazole, 2XP, and (R) and (S)-1-(2-benzyloxy-3-methoxyphenyl)-2, 2, 2-trichloroethyl benzenesulfonate, 3BS and compared their activity to 2-benzyloxy-3-methoxybenzaldehyde, (Bn1), the parent compound. 2XP and 3BS induces cell death of U937 leukemic cell line through DNA fragmentation that lead to the intrinsic caspase 9 activation. DNA binding study primarily by the equilibrium binding titration assay followed by the Viscosity study reveal the DNA binding through groove region with intrinsic binding constant 7.39 µM/bp and 6.86 µM/bp for 3BS and 2XP respectively. 2XP and 3BS showed strong DNA binding activity by the UV titration method with the computational drug modeling showed that both 2XP and 3BS failed to form any electrostatic linkages except via hydrophobic interaction through the minor groove region of the nucleic acid. The benzylvanillin alone (Bn1) has weak anticancer activity even after it was combined with the benzimidazole (2MP), but after addition of another benzylvanillin structure (2XP), stronger activity was observed. Also, the combination of benzylvanillin with benzenesulfonate (3BS) significantly improved the anticancer activity of Bn1. The present study provides a new insight of benzyl vanillin derivatives as potential anti-leukemic agent. PMID:24260527

  16. High Mobility Group A2 protects cancer cells against telomere dysfunction

    PubMed Central

    Natarajan, Suchitra; Begum, Farhana; Gim, Jeonga; Wark, Landon; Henderson, Dana; Davie, James R.

    2016-01-01

    The non-histone chromatin binding protein High Mobility Group AT-hook protein 2 (HMGA2) plays important roles in the repair and protection of genomic DNA in embryonic stem cells and cancer cells. Here we show that HMGA2 localizes to mammalian telomeres and enhances telomere stability in cancer cells. We present a novel interaction of HMGA2 with the key shelterin protein TRF2. We found that the linker (L1) region of HMGA2 contributes to this interaction but the ATI-L1-ATII molecular region of HMGA2 is required for strong interaction with TRF2. This interaction was independent of HMGA2 DNA-binding and did not require the TRF2 interacting partner RAP1 but involved the homodimerization and hinge regions of TRF2. HMGA2 retained TRF2 at telomeres and reduced telomere-dysfunction despite induced telomere stress. Silencing of HMGA2 resulted in (i) reduced binding of TRF2 to telomere DNA as observed by ChIP, (ii) increased telomere instability and (iii) the formation of telomere dysfunction-induced foci (TIF). This resulted in increased telomere aggregation, anaphase bridges and micronuclei. HMGA2 prevented ATM-dependent pTRF2T188 phosphorylation and attenuated signaling via the telomere specific ATM-CHK2-CDC25C DNA damage signaling axis. In summary, our data demonstrate a unique and novel role of HMGA2 in telomere protection and promoting telomere stability in cancer cells. This identifies HMGA2 as a new therapeutic target for the destabilization of telomeres in HMGA2+ cancer cells. PMID:26799419

  17. Regulation of the Myxococcus xanthus C-Signal-Dependent Ω4400 Promoter by the Essential Developmental Protein FruA

    PubMed Central

    Yoder-Himes, Deborah R.; Kroos, Lee

    2006-01-01

    The bacterium Myxococcus xanthus employs extracellular signals to coordinate aggregation and sporulation during multicellular development. Extracellular, contact-dependent signaling that involves the CsgA protein (called C-signaling) activates FruA, a putative response regulator that governs a branched signaling pathway inside cells. One branch regulates cell movement, leading to aggregation. The other branch regulates gene expression, leading to sporulation. C-signaling is required for full expression of most genes induced after 6 h into development, including the gene identified by Tn5 lac insertion Ω4400. To determine if FruA is a direct regulator of Ω4400 transcription, a combination of in vivo and in vitro experiments was performed. Ω4400 expression was abolished in a fruA mutant. The DNA-binding domain of FruA bound specifically to DNA upstream of the promoter −35 region in vitro. Mutations between bp −86 and −77 greatly reduced binding. One of these mutations had been shown previously to reduce Ω4400 expression in vivo and make it independent of C-signaling. For the first time, chromatin immunoprecipitation (ChIP) experiments were performed on M. xanthus. The ChIP experiments demonstrated that FruA is associated with the Ω4400 promoter region late in development, even in the absence of C-signaling. Based on these results, we propose that FruA directly activates Ω4400 transcription to a moderate level prior to C-signaling and, in response to C-signaling, binds near bp −80 and activates transcription to a higher level. Also, the highly localized effects of mutations between bp −86 and −77 on DNA binding in vitro, together with recently published footprints, allow us to predict a consensus binding site of GTCG/CGA/G for the FruA DNA-binding domain. PMID:16816188

  18. Computational approach to analyze isolated ssDNA aptamers against angiotensin II.

    PubMed

    Heiat, Mohammad; Najafi, Ali; Ranjbar, Reza; Latifi, Ali Mohammad; Rasaee, Mohammad Javad

    2016-07-20

    Aptamers are oligonucleotides with highly structured molecules that can bind to their targets through specific 3-D conformation. Commonly, not all the nucleotides such as primer binding fixed region and some other sequences are vital for aptamers folding and interaction. Elimination of unnecessary regions needs trustworthy prediction tools to reduce experimental efforts and errors. Here we introduced a manipulated in-silico approach to predict the 3-D structure of aptamers and their target interactions. To design an approach for computational analysis of isolated ssDNA aptamers (FLC112, FLC125 and their truncated core region including CRC112 and CRC125), their secondary and tertiary structures were modeled by Mfold and RNA composer respectively. Output PDB files were modified from RNA to DNA in the discovery studio visualizer software. Using ZDOCK server, the aptamer-target interactions were predicted. Finally, the interaction scores were compared with the experimental results. In-silico interaction scores and the experimental outcomes were in the same descending arrangement of FLC112>CRC125>CRC112>FLC125 with similar intensity. The consistent results of innovative in-silico method with experimental outputs, affirmed that the present method may be a reliable approach. Also, it showed that the exact in-silico predictions can be utilized as a credible reference to find aptameric fragments binding potency. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Mechanisms of radiation-induced gene responses

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Woloschak, G.E.; Paunesku, T.

    1996-10-01

    In the process of identifying genes differentially expressed in cells exposed ultraviolet radiation, we have identified a transcript having a 26-bp region that is highly conserved in a variety of species including Bacillus circulans, yeast, pumpkin, Drosophila, mouse, and man. When the 5` region (flanking region or UTR) of a gene, the sequence is predominantly in +/+ orientation with respect to the coding DNA strand; while in the coding region and the 3` region (UTR), the sequence is most frequently in the +/-orientation with respect to the coding DNA strand. In two genes, the element is split into two parts;more » however, in most cases, it is found only once but with a minimum of 11 consecutive nucleotides precisely depicting the original sequence. The element is found in a large number of different genes with diverse functions (from human ras p21 to B. circulans chitonase). Gel shift assays demonstrated the presence of a protein in HeLa cell extracts that binds to the sense and antisense single-stranded consensus oligomers, as well as to the double- stranded oligonucleotide. When double-stranded oligomer was used, the size shift demonstrated as additional protein-oligomer complex larger than the one bound to either sense or antisense single-stranded consensus oligomers alone. It is speculated either that this element binds to protein(s) important in maintaining DNA is a single-stranded orientation for transcription or, alternatively that this element is important in the transcription-coupled DNA repair process.« less

  20. DNA synthesis arrest sites at the right terminus of rat long interspersed repeated (LINE or L1Rn) DNA family members.

    PubMed Central

    d'Ambrosio, E; Furano, A V

    1987-01-01

    An approximately equal to 150-bp GC-rich (approximately equal to 60%) region is at the right end of rat long interspersed repeated DNA (LINE or L1Rn) family members. We report here that one of the DNA strands from this region contains several non-palindromic sites that strongly arrest DNA synthesis in vitro by the prokaryotic Klenow and T4 DNA polymerases, the eukaryotic alpha polymerase, and AMV reverse transcriptase. The strongest arrest sites are G-rich (approximately equal to 70%) homopurine stretches of 18 or more residues. Shorter homopurine stretches (12 residues or fewer) did not arrest DNA synthesis even if the stretch contains 11/12 G residues. Arrest of the prokaryotic polymerases was not affected by their respective single strand binding proteins or polymerase accessory proteins. The region of duplex DNA which contains DNA synthesis arrest sites reacts with bromoacetaldehyde when present in negatively supercoiled molecules. By contrast, homopurine stretches that do not arrest DNA synthesis do not react with bromoacetaldehyde. The presence of bromoacetaldehyde-reactive bases in a G-rich homopurine-containing duplex under torsional stress is thought to be caused by base stacking in the homopurine strand. Therefore, we suggest that base-stacked regions of the template arrest DNA synthesis. Images PMID:2436148

  1. Localized DNA melting and structural pertubations in the origin of replication, oriC, of Escherichia coli in vitro and in vivo.

    PubMed Central

    Gille, H; Messer, W

    1991-01-01

    The leftmost region of the Escherichia coli origin of DNA replication (oriC) contains three tandemly repeated AT-rich 13mers which have been shown to become single-stranded during the early stages of initiation in vitro. Melting is induced by the ATP form of DnaA, the initiator protein of DNA replication. KMnO4 was used to probe for single-stranded regions and altered DNA conformation during the initiation of DNA replication at oriC in vitro and in vivo. Unpairing in the AT-rich 13mer region is thermodynamically stable even in the absence of DnaA protein, but only when divalent cations are omitted from the reaction. In the presence of Mg2+, oriC melting is strictly DnaA dependent. The sensitive region is distinct from that detected in the absence of DnaA as it is located further to the left within the minimal origin. In addition, the DNA is severely distorted between the three 13mers and the IHF binding site in oriC. A change of conformation can also be observed during the initiation of DNA replication in vivo. This is the first in vivo evidence for a structural change at the 13mers during initiation complex formation. Images PMID:2026151

  2. A combinatorial approach to synthetic transcription factor-promoter combinations for yeast strain engineering

    DOE PAGES

    Dossani, Zain Y.; Reider Apel, Amanda; Szmidt-Middleton, Heather; ...

    2017-10-30

    Despite the need for inducible promoters in strain development efforts, the majority of engineering in Saccharomyces cerevisiae continues to rely on a few constitutively active or inducible promoters. Building on advances that use the modular nature of both transcription factors and promoter regions, we have built a library of hybrid promoters that are regulated by a synthetic transcription factor. The hybrid promoters consist of native S. cerevisiae promoters, in which the operator regions have been replaced with sequences that are recognized by the bacterial LexA DNA binding protein. Correspondingly, the synthetic transcription factor (TF) consists of the DNA binding domainmore » of the LexA protein, fused with the human estrogen binding domain and the viral activator domain, VP16. The resulting system with a bacterial DNA binding domain avoids the transcription of native S. cerevisiae genes, and the hybrid promoters can be induced using estradiol, a compound with no detectable impact on S. cerevisiae physiology. Using combinations of one, two or three operator sequence repeats and a set of native S. cerevisiae promoters, we obtained a series of hybrid promoters that can be induced to different levels, using the same synthetic TF and a given estradiol. Finally, this set of promoters, in combination with our synthetic TF, has the potential to regulate numerous genes or pathways simultaneously, to multiple desired levels, in a single strain.« less

  3. A combinatorial approach to synthetic transcription factor‐promoter combinations for yeast strain engineering

    PubMed Central

    Dossani, Zain Y.; Reider Apel, Amanda; Szmidt‐Middleton, Heather; Hillson, Nathan J.; Deutsch, Samuel; Keasling, Jay D.

    2017-01-01

    Abstract Despite the need for inducible promoters in strain development efforts, the majority of engineering in Saccharomyces cerevisiae continues to rely on a few constitutively active or inducible promoters. Building on advances that use the modular nature of both transcription factors and promoter regions, we have built a library of hybrid promoters that are regulated by a synthetic transcription factor. The hybrid promoters consist of native S. cerevisiae promoters, in which the operator regions have been replaced with sequences that are recognized by the bacterial LexA DNA binding protein. Correspondingly, the synthetic transcription factor (TF) consists of the DNA binding domain of the LexA protein, fused with the human estrogen binding domain and the viral activator domain, VP16. The resulting system with a bacterial DNA binding domain avoids the transcription of native S. cerevisiae genes, and the hybrid promoters can be induced using estradiol, a compound with no detectable impact on S. cerevisiae physiology. Using combinations of one, two or three operator sequence repeats and a set of native S. cerevisiae promoters, we obtained a series of hybrid promoters that can be induced to different levels, using the same synthetic TF and a given estradiol. This set of promoters, in combination with our synthetic TF, has the potential to regulate numerous genes or pathways simultaneously, to multiple desired levels, in a single strain. PMID:29084380

  4. A combinatorial approach to synthetic transcription factor-promoter combinations for yeast strain engineering

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dossani, Zain Y.; Reider Apel, Amanda; Szmidt-Middleton, Heather

    Despite the need for inducible promoters in strain development efforts, the majority of engineering in Saccharomyces cerevisiae continues to rely on a few constitutively active or inducible promoters. Building on advances that use the modular nature of both transcription factors and promoter regions, we have built a library of hybrid promoters that are regulated by a synthetic transcription factor. The hybrid promoters consist of native S. cerevisiae promoters, in which the operator regions have been replaced with sequences that are recognized by the bacterial LexA DNA binding protein. Correspondingly, the synthetic transcription factor (TF) consists of the DNA binding domainmore » of the LexA protein, fused with the human estrogen binding domain and the viral activator domain, VP16. The resulting system with a bacterial DNA binding domain avoids the transcription of native S. cerevisiae genes, and the hybrid promoters can be induced using estradiol, a compound with no detectable impact on S. cerevisiae physiology. Using combinations of one, two or three operator sequence repeats and a set of native S. cerevisiae promoters, we obtained a series of hybrid promoters that can be induced to different levels, using the same synthetic TF and a given estradiol. Finally, this set of promoters, in combination with our synthetic TF, has the potential to regulate numerous genes or pathways simultaneously, to multiple desired levels, in a single strain.« less

  5. 'Mitominis': multiplex PCR analysis of reduced size amplicons for compound sequence analysis of the entire mtDNA control region in highly degraded samples.

    PubMed

    Eichmann, Cordula; Parson, Walther

    2008-09-01

    The traditional protocol for forensic mitochondrial DNA (mtDNA) analyses involves the amplification and sequencing of the two hypervariable segments HVS-I and HVS-II of the mtDNA control region. The primers usually span fragment sizes of 300-400 bp each region, which may result in weak or failed amplification in highly degraded samples. Here we introduce an improved and more stable approach using shortened amplicons in the fragment range between 144 and 237 bp. Ten such amplicons were required to produce overlapping fragments that cover the entire human mtDNA control region. These were co-amplified in two multiplex polymerase chain reactions and sequenced with the individual amplification primers. The primers were carefully selected to minimize binding on homoplasic and haplogroup-specific sites that would otherwise result in loss of amplification due to mis-priming. The multiplexes have successfully been applied to ancient and forensic samples such as bones and teeth that showed a high degree of degradation.

  6. The effect of preconception paternal alcohol exposure on epigenetic remodeling of the h19 and rasgrf1 imprinting control regions in mouse offspring.

    PubMed

    Knezovich, Jaysen Gregory; Ramsay, Michèle

    2012-01-01

    Imprinted loci play a critical role in fetal development. Their expression is often regulated by CCCTC-binding factor (CTCF) protein binding at imprinting control regions (ICRs). Prenatal alcohol exposure has been shown to reduce global DNA methylation in the developing mouse fetus. This study explored the effect of preconception paternal alcohol exposure on DNA methylation at two paternally methylated ICRs (H19 and Rasgrf1) in the sperm of exposed males and somatic DNA of sired offspring. Significant reductions at the H19 CTCF 1 (p = 0.0027) and CTCF 2 (p = 0.0009) binding sites were observed in the offspring of ethanol-treated sires, which was significantly correlated with reduced weight at postnatal days 35-42 (p < 0.05). As birth weight was unaffected and growth was only delayed during the postnatal weaning period, with subsequent re-convergence, we hypothesize that this may be the result of a mental deficit causing delayed establishment of independent feeding following weaning and would explain why this effect is transient. No difference in DNA methylation was observed in the sperm of alcohol-exposed males, indicating that the transmission of the epigenetic signal at conception is not due to altered methylation, but may be the result of an RNA-mediated mechanism or altered chromatin remodeling.

  7. Definition of a consensus DNA-binding site for PecS, a global regulator of virulence gene expression in Erwinia chrysanthemi and identification of new members of the PecS regulon.

    PubMed

    Rouanet, Carine; Reverchon, Sylvie; Rodionov, Dmitry A; Nasser, William

    2004-07-16

    In Erwinia chrysanthemi, production of pectic enzymes is modulated by a complex network involving several regulators. One of them, PecS, which belongs to the MarR family, also controls the synthesis of various other virulence factors, such as cellulases and indigoidine. Here, the PecS consensus-binding site is defined by combining a systematic evolution of ligands by an exponential enrichment approach and mutational analyses. The consensus consists of a 23-base pair palindromic-like sequence (C(-11)G(-10)A(-9)N(-8)W(-7)T(-6)C(-5)G(-4)T(-3)A(-2))T(-1)A(0)T(1)(T(2)A(3)C(4)G(5)A(6)N(7)N(8)N(9)C(10)G(11)). Mutational experiments revealed that (i) the palindromic organization is required for the binding of PecS, (ii) the very conserved part of the consensus (-6 to 6) allows for a specific interaction with PecS, but the presence of the relatively degenerated bases located apart significantly increases PecS affinity, (iii) the four bases G, A, T, and C are required for efficient binding of PecS, and (iv) the presence of several binding sites on the same promoter increases the affinity of PecS. This consensus is detected in the regions involved in PecS binding on the previously characterized target genes. This variable consensus is in agreement with the observation that the members of the MarR family are able to bind various DNA targets as dimers by means of a winged helix DNA-binding motif. Binding of PecS on a promoter region containing the defined consensus results in a repression of gene transcription in vitro. Preliminary scanning of the E. chrysanthemi genome sequence with the consensus revealed the presence of strong PecS-binding sites in the intergenic region between fliE and fliFGHIJKLMNOPQR which encode proteins involved in the biogenesis of flagellum. Accordingly, PecS directly represses fliE expression. Thus, PecS seems to control the synthesis of virulence factors required for the key steps of plant infection.

  8. Sedimentation properties in density gradients correspond with levels of sperm DNA fragmentation, chromatin compaction and binding affinity to hyaluronic acid.

    PubMed

    Torabi, Forough; Binduraihem, Adel; Miller, David

    2017-03-01

    Mature spermatozoa bind hyaluronic acid in the extracellular matrix via hyaladherins. Immature spermatozoa may be unable to interact because they do not express the appropriate hyaladherins on their surface. Fresh human semen samples were fractionated using differential density gradient centrifugation (DDGC) and the ability of these fractions to bind hyaluronic acid was evaluated. The presence of sperm hyaladherins was also assessed. CD44 was located mainly on the acrosome and equatorial segment and became more restricted to the equatorial segment in capacitated spermatozoa. Hyaluronic acid-TRITC (hyaluronic acid conjugated with tetramethylrhodamine isothiocyanante), a generic hyaluronic-acid-binding reagent, labelled the membrane and the neck region, particularly after capacitation. Sperm populations obtained after DDGC or after interaction with hyaluronic acid were assessed for DNA fragmentation and chromatin maturity. Strong relationships between both measures and sperm sedimentation and hyaluronic-acid-binding profiles were revealed. Capacitation enhanced hyaluronic acid binding of both DDGC-pelleted sperm and sperm washed free of seminal fluid. In conclusion, hyaladherins were detected on human sperm and a higher capacity for sperm hyaluronic-acid-binding was shown to correspond with their DDGC sedimentation profiles and with lower levels of DNA fragmentation and better chromatin maturity. Capacitation induced changes in the distribution and presence of hyaladherins may enhance hyaluronic-acid-binding. Copyright © 2016 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.

  9. Assessment of amsacrine binding with DNA using UV-visible, circular dichroism and Raman spectroscopic techniques.

    PubMed

    Jangir, Deepak Kumar; Dey, Sanjay Kumar; Kundu, Suman; Mehrotra, Ranjana

    2012-09-03

    Proper understanding of the mechanism of binding of drugs to their targets in cell is a fundamental requirement to develop new drug therapy regimen. Amsacrine is a rationally designed anticancer drug, used to treat leukemia and lymphoma. Binding with cellular DNA is a crucial step in its mechanism of cytotoxicity. Despite numerous studies, DNA binding properties of amsacrine are poorly understood. Its reversible binding with DNA does not permit X-ray crystallography or NMR spectroscopic evaluation of amsacrine-DNA complexes. In the present work, interaction of amsacrine with calf thymus DNA is investigated at physiological conditions. UV-visible, FT-Raman and circular dichroism spectroscopic techniques were employed to determine the binding mode, binding constant, sequence specificity and conformational effects of amsacrine binding to native calf thymus DNA. Our results illustrate that amsacrine interacts with DNA by and large through intercalation between base pairs. Binding constant of the amsacrine-DNA complex was found to be K=1.2±0.1×10(4) M(-1) which is indicative of moderate type of binding of amsacrine to DNA. Raman spectroscopic results suggest that amsacrine has a binding preference of intercalation between AT base pairs of DNA. Minor groove binding is also observed in amsacrine-DNA complexes. These results are in good agreement with in silico investigation of amsacrine binding to DNA and thus provide detailed insight into DNA binding properties of amsacrine, which could ultimately, renders its cytotoxic efficacy. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. pH-Dependent DNA Distortion and Repression of Gene Expression by Pectobacterium atrosepticum PecS.

    PubMed

    Deochand, Dinesh K; Meariman, Jacob K; Grove, Anne

    2016-07-15

    Transcriptional activity is exquisitely sensitive to changes in promoter DNA topology. Transcription factors may therefore control gene activity by modulating the relative positioning of -10 and -35 promoter elements. The plant pathogen Pectobacterium atrosepticum, which causes soft rot in potatoes, must alter gene expression patterns to ensure growth in planta. In the related soft-rot enterobacterium Dickeya dadantii, PecS functions as a master regulator of virulence gene expression. Here, we report that P. atrosepticum PecS controls gene activity by altering promoter DNA topology in response to pH. While PecS binds the pecS promoter with high affinity regardless of pH, it induces significant DNA distortion only at neutral pH, the pH at which the pecS promoter is repressed in vivo. At pH ∼8, DNA distortions are attenuated, and PecS no longer represses the pecS promoter. A specific histidine (H142) located in a crevice between the dimerization- and DNA-binding regions is required for pH-dependent changes in DNA distortion and repression of gene activity, and mutation of this histidine renders the mutant protein incapable of repressing the pecS promoter. We propose that protonated PecS induces a DNA conformation at neutral pH in which -10 and -35 promoter elements are suboptimally positioned for RNA polymerase binding; on deprotonation of PecS, binding is no longer associated with significant changes in DNA conformation, allowing gene expression. We suggest that this mode of gene regulation leads to differential expression of the PecS regulon in response to alkalinization of the plant apoplast.

  11. Characterization of Ofloxacin Interaction with Mutated (A91V) Quinolone Resistance Determining Region of DNA Gyrase in Mycobacterium Leprae through Computational Simulation.

    PubMed

    Nisha, J; Shanthi, V

    2018-06-01

    Mycobacterium leprae, the causal agent of leprosy is non-cultivable in vitro. Thus, the assessment of antibiotic activity against Mycobacterium leprae depends primarily upon the time-consuming mouse footpad system. The GyrA protein of Mycobacterium leprae is the target of the antimycobacterial drug, Ofloxacin. In recent times, the GyrA mutation (A91V) has been found to be resistant to Ofloxacin. This phenomenon has necessitated the development of new, long-acting antimycobacterial compounds. The underlying mechanism of drug resistance is not completely known. Currently, experimentally crystallized GyrA-DNA-OFLX models are not available for highlighting the binding and mechanism of Ofloxacin resistance. Hence, we employed computational approaches to characterize the Ofloxacin interaction with both the native and mutant forms of GyrA complexed with DNA. Binding energy measurements obtained from molecular docking studies highlights hydrogen bond-mediated efficient binding of Ofloxacin to Asp47 in the native GyrA-DNA complex in comparison with that of the mutant GyrA-DNA complex. Further, molecular dynamics studies highlighted the stable binding of Ofloxacin with native GyrA-DNA complex than with the mutant GyrA-DNA complex. This mechanism provided a plausible reason for the reported, reduced effect of Ofloxacin to control leprosy in individuals with the A91V mutation. Our report is the first of its kind wherein the basis for the Ofloxacin drug resistance mechanism has been explored with the help of ternary Mycobacterium leprae complex, GyrA-DNA-OFLX. These structural insights will provide useful information for designing new drugs to target the Ofloxacin-resistant DNA gyrase.

  12. Effect of magnesium ions on the structure of DNA thin films: an infrared spectroscopy study

    PubMed Central

    Serec, Kristina; Babić, Sanja Dolanski; Podgornik, Rudolf; Tomić, Silvia

    2016-01-01

    Utilizing Fourier transform infrared spectroscopy we have investigated the vibrational spectrum of thin dsDNA films in order to track the structural changes upon addition of magnesium ions. In the range of low magnesium concentration ([magnesium]/[phosphate] = [Mg]/[P] < 0.5), both the red shift and the intensity of asymmetric PO2 stretching band decrease, indicating an increase of magnesium-phosphate binding in the backbone region. Vibration characteristics of the A conformation of the dsDNA vanish, whereas those characterizing the B conformation become fully stabilized. In the crossover range with comparable Mg and intrinsic Na DNA ions ([Mg]/[P] ≈ 1) B conformation remains stable; vibrational spectra show moderate intensity changes and a prominent blue shift, indicating a reinforcement of the bonds and binding in both the phosphate and the base regions. The obtained results reflect the modified screening and local charge neutralization of the dsDNA backbone charge, thus consistently demonstrating that the added Mg ions interact with DNA via long-range electrostatic forces. At high Mg contents ([Mg]/[P] > 10), the vibrational spectra broaden and show a striking intensity rise, while the base stacking remains unaffected. We argue that at these extreme conditions, where a charge compensation by vicinal counterions reaches 92–94%, DNA may undergo a structural transition into a more compact form. PMID:27484473

  13. MCM interference during licensing of DNA replication in Xenopus egg extracts-Possible Role of a C-terminal region of MCM3.

    PubMed

    Mimura, Satoru; Kubota, Yumiko; Takisawa, Haruhiko

    2018-01-01

    The minichromosome maintenance (MCM) complex, consisting of six subunits, Mcm2-7, is loaded onto replication origins through loading factors (origin recognition complex [ORC], Cdc6, and Cdt1) and forms an MCM double hexamer that licenses the initiation of DNA replication. Previous studies with Xenopus egg extracts showed that loading factors, especially Cdc6, dissociate from chromatin on MCM loading, but the molecular mechanism and physiological significance remain largely unknown. Using a cell-free system for MCM loading onto plasmid DNA in Xenopus egg extracts, we found that MCM loaded onto DNA prevents DNA binding of the loading factors ORC, Cdc6, and Cdt1. We further report that a peptide of the C-terminal region of MCM3 (MCM3-C), previously implicated in the initial association with ORC/Cdc6 in budding yeast, prevents ORC/Cdc6/Cdt1 binding to DNA in the absence of MCM loading. ATP-γ-S suppresses inhibitory activities of both the MCM loaded onto DNA and the MCM3-C peptide. Other soluble factors in the extract, but neither MCM nor Cdt1, are required for the activity. Conservation of the amino acid sequences of MCM3-C and its activity in vertebrates implies a novel negative autoregulatory mechanism that interferes with MCM loading in the vicinity of licensed origins to ensure proper origin licensing.

  14. Expression of the leukemia-associated CBF{beta}/SMMHC chimeric gene causes transformation of 3T3 cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hajra, A.; Liu, P.; Collins, E.S.

    1994-09-01

    A pericentric inversion of chromosome 16 (inv(16)(p13;q22)) is consistently seen in acute myeloid leukemia of the M4Eo subtype. This inversion fuses almost the entire coding region of the gene encoding of the {beta} subunit of the heterodimeric transcription factor CBF/PEBP2 to the region of the MYH11 gene encoding the rod domain for the smooth muscle myosin heavy chain (SMMHC). To investigate the biological properties of the CBF{beta}/SMMHC fusion protein, we have generated 3T3 cell lines that stably express the CBF{beta}/SMMHC chimeric cDNA or the normal, nonchimeric CBF{beta} and SMMHC cDNAs. 3T3 cells expressing CBF{beta}/SMMHC acquire a transformed phenotype, as indicatedmore » by altered cell morphology, formation of foci, and growth in soft agar. Cells constitutively overexpressing the normal CBF{beta} cDNA or the rod region of SMMHC remain nontransformed. Western blot analysis using antibodies to CBF{beta} and the SMMHC rod demonstrates that stably transfected cells express the appropriate chimeric or normal protein. Electrophoretic mobility shift assays reveal that cells transformed by the chimeric cDNA do not have a CBF-DNA complex of the expected mobility, but instead contain a large complex with CBF DNA-binding activity that fails to migrate out of the gel wells. In order to define the regions of CBF{beta}/SMMHC necessary for 3T3 transformation, we have stably transfected cells with mutant CBF{beta}/SMMHC cDNAs containing various deletions of the coding region. Analysis of these cell lines indicates that the transformation property of CBF{beta}/SMMHC requires regions of CBF{beta} known to be necessary for association with the DNA-binding CBF{alpha} subunit, and also requires an intact SMMHC carboxyl terminus, which is necessary for formation of the coiled coil domain of the myosin rod.« less

  15. Replication of alpha-satellite DNA arrays in endogenous human centromeric regions and in human artificial chromosome

    PubMed Central

    Erliandri, Indri; Fu, Haiqing; Nakano, Megumi; Kim, Jung-Hyun; Miga, Karen H.; Liskovykh, Mikhail; Earnshaw, William C.; Masumoto, Hiroshi; Kouprina, Natalay; Aladjem, Mirit I.; Larionov, Vladimir

    2014-01-01

    In human chromosomes, centromeric regions comprise megabase-size arrays of 171 bp alpha-satellite DNA monomers. The large distances spanned by these arrays preclude their replication from external sites and imply that the repetitive monomers contain replication origins. However, replication within these arrays has not previously been profiled and the role of alpha-satellite DNA in initiation of DNA replication has not yet been demonstrated. Here, replication of alpha-satellite DNA in endogenous human centromeric regions and in de novo formed Human Artificial Chromosome (HAC) was analyzed. We showed that alpha-satellite monomers could function as origins of DNA replication and that replication of alphoid arrays organized into centrochromatin occurred earlier than those organized into heterochromatin. The distribution of inter-origin distances within centromeric alphoid arrays was comparable to the distribution of inter-origin distances on randomly selected non-centromeric chromosomal regions. Depletion of CENP-B, a kinetochore protein that binds directly to a 17 bp CENP-B box motif common to alpha-satellite DNA, resulted in enrichment of alpha-satellite sequences for proteins of the ORC complex, suggesting that CENP-B may have a role in regulating the replication of centromeric regions. Mapping of replication initiation sites in the HAC revealed that replication preferentially initiated in transcriptionally active regions. PMID:25228468

  16. Nuclear factors that bind to the enhancer region of nondefective Friend murine leukemia virus.

    PubMed Central

    Manley, N R; O'Connell, M A; Sharp, P A; Hopkins, N

    1989-01-01

    Nondefective Friend murine leukemia virus (MuLV) causes erythroleukemia when injected into newborn NFS mice, while Moloney MuLV causes T-cell lymphoma. Exchange of the Friend virus enhancer region, a sequence of about 180 nucleotides including the direct repeat and a short 3'-adjacent segment, for the corresponding region in Moloney MuLV confers the ability to cause erythroid disease on Moloney MuLV. We have used the electrophoretic mobility shift assay and methylation interference analysis to identify cellular factors which bind to the Friend virus enhancer region and compared these with factors, previously identified, that bind to the Moloney virus direct repeat (N. A. Speck and D. Baltimore, Mol. Cell. Biol. 7:1101-1110, 1987). We identified five binding sites for sequence-specific DNA-binding proteins in the Friend virus enhancer region. While some binding sites are present in both the Moloney and Friend virus enhancers, both viruses contain unique sites not present in the other. Although none of the factors identified in this report which bind to these unique sites are present exclusively in T cells or erythroid cells, they bind to three regions of the enhancer shown by genetic analysis to encode disease specificity and thus are candidates to mediate the tissue-specific expression and distinct disease specificities encoded by these virus enhancer elements. Images PMID:2778872

  17. Evolution of the herpes thymidine kinase: identification and comparison of the equine herpesvirus 1 thymidine kinase gene reveals similarity to a cell-encoded thymidylate kinase.

    PubMed Central

    Robertson, G R; Whalley, J M

    1988-01-01

    We have identified the equine herpesvirus 1 (EHV-1) thymidine kinase gene (TK) by DNA-mediated transformation and by DNA sequencing. Alignment of the amino acid sequence of the EHV-1 TK with the TKs from 3 other herpesviruses revealed regions of homology, some of which correspond to the previously identified substrate binding sites, while others have as yet, no assigned function. In particular, the strict conservation of an aspartate within the proposed nucleoside binding site suggests a role in ATP binding for this residue. Comparison of 5 herpes TKs with the thymidylate kinase of yeast revealed significant similarity which was strongest in those regions important to catalytic activity of the herpes TKs, and, therefore we propose that the herpes TK may be derived from a cellular thymidylate kinase. The implications for the evolution of enzyme activities within a pathway of nucleotide metabolism are discussed. PMID:2849761

  18. The complex between a four-way DNA junction and T7 endonuclease I

    PubMed Central

    Déclais, Anne-Cécile; Fogg, Jonathan M.; Freeman, Alasdair D.J.; Coste, Franck; Hadden, Jonathan M.; Phillips, Simon E.V.; Lilley, David M.J.

    2003-01-01

    The junction-resolving enzyme endonuclease I is selective for the structure of the DNA four-way (Holliday) junction. The enzyme binds to a four-way junction in two possible orientations, with a 4:1 ratio, opening the DNA structure at the centre and changing the global structure into a 90° cross of approximately coaxial helices. The nuclease cleaves the continuous strands of the junction in each orientation. Binding leads to pronounced regions of protection of the DNA against hydroxyl radical attack. Using all this information together with the known structure of the enzyme and the structure of the BglI–DNA complex, we have constructed a model of the complex of endonuclease I and a DNA junction. This shows how the enzyme is selective for the structure of a four-way junction, such that both continuous strands can be accommodated into the two active sites so that a productive resolution event is possible. PMID:12628932

  19. Architecture and DNA Recognition Elements of the Fanconi Anemia FANCM-FAAP24 Complex

    PubMed Central

    Coulthard, Rachel; Deans, Andrew J.; Swuec, Paolo; Bowles, Maureen; Costa, Alessandro; West, Stephen C.; McDonald, Neil Q.

    2013-01-01

    Summary Fanconi anemia (FA) is a disorder associated with a failure in DNA repair. FANCM (defective in FA complementation group M) and its partner FAAP24 target other FA proteins to sites of DNA damage. FANCM-FAAP24 is related to XPF/MUS81 endonucleases but lacks endonucleolytic activity. We report a structure of an FANCM C-terminal fragment (FANCMCTD) bound to FAAP24 and DNA. This S-shaped structure reveals the FANCM (HhH)2 domain is buried, whereas the FAAP24 (HhH)2 domain engages DNA. We identify a second DNA contact and a metal center within the FANCM pseudo-nuclease domain and demonstrate that mutations in either region impair double-stranded DNA binding in vitro and FANCM-FAAP24 function in vivo. We show the FANCM translocase domain lies in proximity to FANCMCTD by electron microscopy and that binding fork DNA structures stimulate its ATPase activity. This suggests a tracking model for FANCM-FAAP24 until an encounter with a stalled replication fork triggers ATPase-mediated fork remodeling. PMID:23932590

  20. The interaction of E. coli integration host factor and lambda cos DNA: multiple complex formation and protein-induced bending.

    PubMed Central

    Kosturko, L D; Daub, E; Murialdo, H

    1989-01-01

    The interaction of E. coli's integration Host Factor (IHF) with fragments of lambda DNA containing the cos site has been studied by gel-mobility retardation and electron microscopy. The cos fragment used in the mobility assays is 398 bp and spans a region from 48,298 to 194 on the lambda chromosome. Several different complexes of IHF with this fragment can be distinguished by their differential mobility on polyacrylamide gels. Relative band intensities indicate that the formation of a complex between IHF and this DNA fragment has an equilibrium binding constant of the same magnitude as DNA fragments containing lambda's attP site. Gel-mobility retardation and electron microscopy have been employed to show that IHF sharply bends DNA near cos and to map the bending site. The protein-induced bend is near an intrinsic bend due to DNA sequence. The position of the bend suggests that IHF's role in lambda DNA packaging may be the enhancement of terminase binding/cos cutting by manipulating DNA structure. Images PMID:2521383

  1. Characterization of mutations in the FOXE1 gene in a cohort of unrelated Malaysian patients with congenital hypothyroidism and thyroid dysgenesis.

    PubMed

    Kang, In-Nee; Musa, Maslinda; Harun, Fatimah; Junit, Sarni Mat

    2010-02-01

    The FOXE1 gene was screened for mutations in a cohort of 34 unrelated patients with congenital hypothyroidism, 14 of whom had thyroid dysgenesis and 18 were normal (the thyroid status for 2 patients was unknown). The entire coding region of the FOXE1 gene was PCR-amplified, then analyzed using single-stranded conformational polymorphism, followed by confirmation by direct DNA sequencing. DNA sequencing analysis revealed a heterozygous A>G transition at nucleotide position 394 in one of the patients. The nucleotide transition changed asparagine to aspartate at codon 132 in the highly conserved region of the forkhead DNA binding domain of the FOXE1 gene. This mutation was not detected in a total of 104 normal healthy individuals screened. The binding ability of the mutant FOXE1 protein to the human thyroperoxidase (TPO) promoter was slightly reduced compared with the wild-type FOXE1. The mutation also caused a 5% loss of TPO transcriptional activity.

  2. Specific binding of the Xanthomonas campestris pv. vesicatoria AraC-type transcriptional activator HrpX to plant-inducible promoter boxes.

    PubMed

    Koebnik, Ralf; Krüger, Antje; Thieme, Frank; Urban, Alexander; Bonas, Ulla

    2006-11-01

    The pathogenicity of the plant-pathogenic bacterium Xanthomonas campestris pv. vesicatoria depends on a type III secretion system which is encoded by the 23-kb hrp (hypersensitive response and pathogenicity) gene cluster. Expression of the hrp operons is strongly induced in planta and in a special minimal medium and depends on two regulatory proteins, HrpG and HrpX. In this study, DNA affinity enrichment was used to demonstrate that the AraC-type transcriptional activator HrpX binds to a conserved cis-regulatory element, the plant-inducible promoter (PIP) box (TTCGC-N(15)-TTCGC), present in the promoter regions of four hrp operons. No binding of HrpX was observed when DNA fragments lacking a PIP box were used. HrpX also bound to a DNA fragment containing an imperfect PIP box (TTCGC-N(8)-TTCGT). Dinucleotide replacements in each half-site of the PIP box strongly decreased binding of HrpX, while simultaneous dinucleotide replacements in both half-sites completely abolished binding. Based on the complete genome sequence of Xanthomonas campestris pv. vesicatoria, putative plant-inducible promoters consisting of a PIP box and a -10 promoter motif were identified in the promoter regions of almost all HrpX-activated genes. Bioinformatic analyses and reverse transcription-PCR experiments revealed novel HrpX-dependent genes, among them a NUDIX hydrolase gene and several genes with a predicted role in the degradation of the plant cell wall. We conclude that HrpX is the most downstream component of the hrp regulatory cascade, which is proposed to directly activate most genes of the hrpX regulon via binding to corresponding PIP boxes.

  3. Theoretical estimates of exposure timescales of protein binding sites on DNA regulated by nucleosome kinetics.

    PubMed

    Parmar, Jyotsana J; Das, Dibyendu; Padinhateeri, Ranjith

    2016-02-29

    It is being increasingly realized that nucleosome organization on DNA crucially regulates DNA-protein interactions and the resulting gene expression. While the spatial character of the nucleosome positioning on DNA has been experimentally and theoretically studied extensively, the temporal character is poorly understood. Accounting for ATPase activity and DNA-sequence effects on nucleosome kinetics, we develop a theoretical method to estimate the time of continuous exposure of binding sites of non-histone proteins (e.g. transcription factors and TATA binding proteins) along any genome. Applying the method to Saccharomyces cerevisiae, we show that the exposure timescales are determined by cooperative dynamics of multiple nucleosomes, and their behavior is often different from expectations based on static nucleosome occupancy. Examining exposure times in the promoters of GAL1 and PHO5, we show that our theoretical predictions are consistent with known experiments. We apply our method genome-wide and discover huge gene-to-gene variability of mean exposure times of TATA boxes and patches adjacent to TSS (+1 nucleosome region); the resulting timescale distributions have non-exponential tails. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Expression, purification, and DNA-binding activity of the solubilized NtrC protein of Herbaspirillum seropedicae.

    PubMed

    Twerdochlib, Adriana L; Chubatsu, Leda S; Souza, Emanuel M; Pedrosa, Fábio O; Steffens, M Berenice R; Yates, M Geoffrey; Rigo, Liu U

    2003-07-01

    NtrC is a bacterial enhancer-binding protein (EBP) that activates transcription by the sigma54 RNA polymerase holoenzyme. NtrC has a three domain structure typical of EBP family. In Herbaspirillum seropedicae, an endophytic diazotroph, NtrC regulates several operons involved in nitrogen assimilation, including glnAntrBC. In order to over-express and purify the NtrC protein, DNA fragments containing the complete structural gene for the whole protein, and for the N-terminal+Central and Central+C-terminal domains were cloned into expression vectors. The NtrC and NtrC(N-terminal+Central) proteins were over-expressed as His-tag fusion proteins upon IPTG addition, solubilized using N-lauryl-sarcosyl and purified by metal affinity chromatography. The over-expressed His-tag-NtrC(Central+C-terminal) fusion protein was partially soluble and was also purified by affinity chromatography. DNA band-shift assays showed that the NtrC protein and the Central+C-terminal domains bound specifically to the H. seropedicae glnA promoter region. The C-terminal domain is presumably necessary for DNA-protein interaction and DNA-binding does not require a phosphorylated protein.

  5. Blue light-induced LOV domain dimerization enhances the affinity of Aureochrome 1a for its target DNA sequence

    PubMed Central

    Heintz, Udo; Schlichting, Ilme

    2016-01-01

    The design of synthetic optogenetic tools that allow precise spatiotemporal control of biological processes previously inaccessible to optogenetic control has developed rapidly over the last years. Rational design of such tools requires detailed knowledge of allosteric light signaling in natural photoreceptors. To understand allosteric communication between sensor and effector domains, characterization of all relevant signaling states is required. Here, we describe the mechanism of light-dependent DNA binding of the light-oxygen-voltage (LOV) transcription factor Aureochrome 1a from Phaeodactylum tricornutum (PtAu1a) and present crystal structures of a dark state LOV monomer and a fully light-adapted LOV dimer. In combination with hydrogen/deuterium-exchange, solution scattering data and DNA-binding experiments, our studies reveal a light-sensitive interaction between the LOV and basic region leucine zipper DNA-binding domain that together with LOV dimerization results in modulation of the DNA affinity of PtAu1a. We discuss the implications of these results for the design of synthetic LOV-based photosensors with application in optogenetics. DOI: http://dx.doi.org/10.7554/eLife.11860.001 PMID:26754770

  6. Electrostatics, structure prediction, and the energy landscapes for protein folding and binding.

    PubMed

    Tsai, Min-Yeh; Zheng, Weihua; Balamurugan, D; Schafer, Nicholas P; Kim, Bobby L; Cheung, Margaret S; Wolynes, Peter G

    2016-01-01

    While being long in range and therefore weakly specific, electrostatic interactions are able to modulate the stability and folding landscapes of some proteins. The relevance of electrostatic forces for steering the docking of proteins to each other is widely acknowledged, however, the role of electrostatics in establishing specifically funneled landscapes and their relevance for protein structure prediction are still not clear. By introducing Debye-Hückel potentials that mimic long-range electrostatic forces into the Associative memory, Water mediated, Structure, and Energy Model (AWSEM), a transferable protein model capable of predicting tertiary structures, we assess the effects of electrostatics on the landscapes of thirteen monomeric proteins and four dimers. For the monomers, we find that adding electrostatic interactions does not improve structure prediction. Simulations of ribosomal protein S6 show, however, that folding stability depends monotonically on electrostatic strength. The trend in predicted melting temperatures of the S6 variants agrees with experimental observations. Electrostatic effects can play a range of roles in binding. The binding of the protein complex KIX-pKID is largely assisted by electrostatic interactions, which provide direct charge-charge stabilization of the native state and contribute to the funneling of the binding landscape. In contrast, for several other proteins, including the DNA-binding protein FIS, electrostatics causes frustration in the DNA-binding region, which favors its binding with DNA but not with its protein partner. This study highlights the importance of long-range electrostatics in functional responses to problems where proteins interact with their charged partners, such as DNA, RNA, as well as membranes. © 2015 The Protein Society.

  7. Binding sites for abundant nuclear factors modulate RNA polymerase I-dependent enhancer function in Saccharomyces cerevisiae.

    PubMed

    Kang, J J; Yokoi, T J; Holland, M J

    1995-12-01

    The 190-base pair (bp) rDNA enhancer within the intergenic spacer sequences of Saccharomyces cerevisiae rRNA cistrons activates synthesis of the 35S-rRNA precursor about 20-fold in vivo (Mestel,, R., Yip, M., Holland, J. P., Wang, E., Kang, J., and Holland, M. J. (1989) Mol. Cell. Biol. 9, 1243-1254). We now report identification and analysis of transcriptional activities mediated by three cis-acting sites within a 90-bp portion of the rDNA enhancer designated the modulator region. In vivo, these sequences mediated termination of transcription by RNA polymerase I and potentiated the activity of the rDNA enhancer element. Two trans-acting factors, REB1 and REB2, bind independently to sites within the modulator region (Morrow, B. E., Johnson, S. P., and Warner, J. R. (1989) J. Biol. Chem. 264, 9061-9068). We show that REB2 is identical to the ABF1 protien. Site-directed mutagenesis of REB1 and ABF1 binding sites demonstrated uncoupling of RNA polymerase I-dependent termination from transcriptional activation in vivo. We conclude that REB1 and ABF1 are required for RNA polymerase I-dependent termination and enhancer function, respectively, Since REB1 and ABF1 proteins also regulate expression of class II genes and other nuclear functions, our results suggest further similarities between RNA polymerase I and II regulatory mechanisms. Two rDNA enhancers flanking a rDNA minigene stimulated RNA polymerase I transcription in a "multiplicative" fashion. Deletion mapping analysis showed that similar cis-acting sequences were required for enhancer function when positioned upstream or downstream from a rDNA minigene.

  8. In vitro selection of DNA elements highly responsive to the human T-cell lymphotropic virus type I transcriptional activator, Tax.

    PubMed

    Paca-Uccaralertkun, S; Zhao, L J; Adya, N; Cross, J V; Cullen, B R; Boros, I M; Giam, C Z

    1994-01-01

    The human T-cell lymphotropic virus type I (HTLV-I) transactivator, Tax, the ubiquitous transcriptional factor cyclic AMP (cAMP) response element-binding protein (CREB protein), and the 21-bp repeats in the HTLV-I transcriptional enhancer form a ternary nucleoprotein complex (L. J. Zhao and C. Z. Giam, Proc. Natl. Acad. Sci. USA 89:7070-7074, 1992). Using an antibody directed against the COOH-terminal region of Tax along with purified Tax and CREB proteins, we selected DNA elements bound specifically by the Tax-CREB complex in vitro. Two distinct but related groups of sequences containing the cAMP response element (CRE) flanked by long runs of G and C residues in the 5' and 3' regions, respectively, were preferentially recognized by Tax-CREB. In contrast, CREB alone binds only to CRE motifs (GNTGACG[T/C]) without neighboring G- or C-rich sequences. The Tax-CREB-selected sequences bear a striking resemblance to the 5' or 3' two-thirds of the HTLV-I 21-bp repeats and are highly inducible by Tax. Gel electrophoretic mobility shift assays, DNA transfection, and DNase I footprinting analyses indicated that the G- and C-rich sequences flanking the CRE motif are crucial for Tax-CREB-DNA ternary complex assembly and Tax transactivation but are not in direct contact with the Tax-CREB complex. These data show that Tax recruits CREB to form a multiprotein complex that specifically recognizes the viral 21-bp repeats. The expanded DNA binding specificity of Tax-CREB and the obligatory role the ternary Tax-CREB-DNA complex plays in transactivation reveal a novel mechanism for regulating the transcriptional activity of leucine zipper proteins like CREB.

  9. Arabidopsis SEPALLATA proteins differ in cooperative DNA-binding during the formation of floral quartet-like complexes

    PubMed Central

    Jetha, Khushboo; Theißen, Günter; Melzer, Rainer

    2014-01-01

    The SEPALLATA (SEP) genes of Arabidopsis thaliana encode MADS-domain transcription factors that specify the identity of all floral organs. The four Arabidopsis SEP genes function in a largely yet not completely redundant manner. Here, we analysed interactions of the SEP proteins with DNA. All of the proteins were capable of forming tetrameric quartet-like complexes on DNA fragments carrying two sequence elements termed CArG-boxes. Distances between the CArG-boxes for strong cooperative DNA-binding were in the range of 4–6 helical turns. However, SEP1 also bound strongly to CArG-box pairs separated by smaller or larger distances, whereas SEP2 preferred large and SEP4 preferred small inter-site distances for binding. Cooperative binding of SEP3 was comparatively weak for most of the inter-site distances tested. All SEP proteins constituted floral quartet-like complexes together with the floral homeotic proteins APETALA3 (AP3) and PISTILLATA (PI) on the target genes AP3 and SEP3. Our results suggest an important part of an explanation for why the different SEP proteins have largely, but not completely redundant functions in determining floral organ identity: they may bind to largely overlapping, but not identical sets of target genes that differ in the arrangement and spacing of the CArG-boxes in their cis-regulatory regions. PMID:25183521

  10. Genome-wide Expression Profiling, In Vivo DNA Binding Analysis, and Probabilistic Motif Prediction Reveal Novel Abf1 Target Genes during Fermentation, Respiration, and Sporulation in Yeast

    PubMed Central

    Schlecht, Ulrich; Erb, Ionas; Demougin, Philippe; Robine, Nicolas; Borde, Valérie; van Nimwegen, Erik; Nicolas, Alain

    2008-01-01

    The autonomously replicating sequence binding factor 1 (Abf1) was initially identified as an essential DNA replication factor and later shown to be a component of the regulatory network controlling mitotic and meiotic cell cycle progression in budding yeast. The protein is thought to exert its functions via specific interaction with its target site as part of distinct protein complexes, but its roles during mitotic growth and meiotic development are only partially understood. Here, we report a comprehensive approach aiming at the identification of direct Abf1-target genes expressed during fermentation, respiration, and sporulation. Computational prediction of the protein's target sites was integrated with a genome-wide DNA binding assay in growing and sporulating cells. The resulting data were combined with the output of expression profiling studies using wild-type versus temperature-sensitive alleles. This work identified 434 protein-coding loci as being transcriptionally dependent on Abf1. More than 60% of their putative promoter regions contained a computationally predicted Abf1 binding site and/or were bound by Abf1 in vivo, identifying them as direct targets. The present study revealed numerous loci previously unknown to be under Abf1 control, and it yielded evidence for the protein's variable DNA binding pattern during mitotic growth and meiotic development. PMID:18305101

  11. Isolation and characterization of a novel calmodulin-binding protein from potato

    NASA Technical Reports Server (NTRS)

    Reddy, Anireddy S N.; Day, Irene S.; Narasimhulu, S. B.; Safadi, Farida; Reddy, Vaka S.; Golovkin, Maxim; Harnly, Melissa J.

    2002-01-01

    Tuberization in potato is controlled by hormonal and environmental signals. Ca(2+), an important intracellular messenger, and calmodulin (CaM), one of the primary Ca(2+) sensors, have been implicated in controlling diverse cellular processes in plants including tuberization. The regulation of cellular processes by CaM involves its interaction with other proteins. To understand the role of Ca(2+)/CaM in tuberization, we have screened an expression library prepared from developing tubers with biotinylated CaM. This screening resulted in isolation of a cDNA encoding a novel CaM-binding protein (potato calmodulin-binding protein (PCBP)). Ca(2+)-dependent binding of the cDNA-encoded protein to CaM is confirmed by (35)S-labeled CaM. The full-length cDNA is 5 kb long and encodes a protein of 1309 amino acids. The deduced amino acid sequence showed significant similarity with a hypothetical protein from another plant, Arabidopsis. However, no homologs of PCBP are found in nonplant systems, suggesting that it is likely to be specific to plants. Using truncated versions of the protein and a synthetic peptide in CaM binding assays we mapped the CaM-binding region to a 20-amino acid stretch (residues 1216-1237). The bacterially expressed protein containing the CaM-binding domain interacted with three CaM isoforms (CaM2, CaM4, and CaM6). PCBP is encoded by a single gene and is expressed differentially in the tissues tested. The expression of CaM, PCBP, and another CaM-binding protein is similar in different tissues and organs. The predicted protein contained seven putative nuclear localization signals and several strong PEST motifs. Fusion of the N-terminal region of the protein containing six of the seven nuclear localization signals to the reporter gene beta-glucuronidase targeted the reporter gene to the nucleus, suggesting a nuclear role for PCBP.

  12. Crystal Structure of the Chromodomain Helicase DNA-binding Protein 1 (Chd1) DNA-binding Domain in Complex with DNA*

    PubMed Central

    Sharma, Amit; Jenkins, Katherine R.; Héroux, Annie; Bowman, Gregory D.

    2011-01-01

    Chromatin remodelers are ATP-dependent machines that dynamically alter the chromatin packaging of eukaryotic genomes by assembling, sliding, and displacing nucleosomes. The Chd1 chromatin remodeler possesses a C-terminal DNA-binding domain that is required for efficient nucleosome sliding and believed to be essential for sensing the length of DNA flanking the nucleosome core. The structure of the Chd1 DNA-binding domain was recently shown to consist of a SANT and SLIDE domain, analogous to the DNA-binding domain of the ISWI family, yet the details of how Chd1 recognized DNA were not known. Here we present the crystal structure of the Saccharomyces cerevisiae Chd1 DNA-binding domain in complex with a DNA duplex. The bound DNA duplex is straight, consistent with the preference exhibited by the Chd1 DNA-binding domain for extranucleosomal DNA. Comparison of this structure with the recently solved ISW1a DNA-binding domain bound to DNA reveals that DNA lays across each protein at a distinct angle, yet contacts similar surfaces on the SANT and SLIDE domains. In contrast to the minor groove binding seen for Isw1 and predicted for Chd1, the SLIDE domain of the Chd1 DNA-binding domain contacts the DNA major groove. The majority of direct contacts with the phosphate backbone occur only on one DNA strand, suggesting that Chd1 may not strongly discriminate between major and minor grooves. PMID:22033927

  13. Activation of both acfA and acfD transcription by Vibrio cholerae ToxT requires binding to two centrally located DNA sites in an inverted repeat conformation.

    PubMed

    Withey, Jeffrey H; DiRita, Victor J

    2005-05-01

    The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.

  14. Physical signals for protein-DNA recognition

    NASA Astrophysics Data System (ADS)

    Cao, Xiao-Qin; Zeng, Jia; Yan, Hong

    2009-09-01

    This paper discovers consensus physical signals around eukaryotic splice sites, transcription start sites, and replication origin start and end sites on a genome-wide scale based on their DNA flexibility profiles calculated by three different flexibility models. These salient physical signals are localized highly rigid and flexible DNAs, which may play important roles in protein-DNA recognition by the sliding search mechanism. The found physical signals lead us to a detailed hypothetical view of the search process in which a DNA-binding protein first finds a genomic region close to the target site from an arbitrary starting location by three-dimensional (3D) hopping and intersegment transfer mechanisms for long distances, and subsequently uses the one-dimensional (1D) sliding mechanism facilitated by the localized highly rigid DNAs to accurately locate the target flexible binding site within 30 bp (base pair) short distances. Guided by these physical signals, DNA-binding proteins rapidly search the entire genome to recognize a specific target site from the 3D to 1D pathway. Our findings also show that current promoter prediction programs (PPPs) based on DNA physical properties may suffer from lots of false positives because other functional sites such as splice sites and replication origins have similar physical signals as promoters do.

  15. Improved exogenous DNA uptake in bovine spermatozoa and gene expression in embryos using membrane destabilizing agents in ICSI-SMGT.

    PubMed

    Sánchez-Villalba, Esther; Arias, María Elena; Zambrano, Fabiola; Loren, Pía; Felmer, Ricardo

    2018-02-01

    Sperm-mediated gene transfer (SMGT) is a simple, fast, and economical biotechnological tool for producing transgenic animals. However, transgene expression with this technique in bovine embryos is still inefficient due to low uptake and binding of exogenous DNA in spermatozoa. The present study evaluated the effects of sperm membrane destabilization on the binding capacity, location and quantity of bound exogenous DNA in cryopreserved bovine spermatozoa using Triton X-100 (TX-100), lysolecithin (LL) and sodium hydroxide (NaOH). Effects of these treatments were also evaluated by intracytoplasmic sperm injection (ICSI)-SMGT. Results showed that all treatments bound exogenous DNA to spermatozoa including the control. Spermatozoa treated with different membrane destabilizing agents bound the exogenous DNA throughout the head and tail of spermatozoa, compared with the control, in which binding occurred mainly in the post-acrosomal region and tail. The amount of exogenous DNA bound to spermatozoa was much higher for the different sperm treatments than the control (P < 0.05), most likely due to the damage induced by these treatments to the plasma and acrosomal membranes. Exogenous gene expression in embryos was also improved by these treatments. These results demonstrated that sperm membrane destabilization could be a novel strategy in bovine SMGT protocols for the generation of transgenic embryos by ICSI.

  16. FAAP20: a novel ubiquitin-binding FA nuclear core-complex protein required for functional integrity of the FA-BRCA DNA repair pathway

    PubMed Central

    Ali, Abdullah Mahmood; Pradhan, Arun; Singh, Thiyam Ramsingh; Du, Changhu; Li, Jie; Wahengbam, Kebola; Grassman, Elke; Auerbach, Arleen D.; Pang, Qishen

    2012-01-01

    Fanconi anemia (FA) nuclear core complex is a multiprotein complex required for the functional integrity of the FA-BRCA pathway regulating DNA repair. This pathway is inactivated in FA, a devastating genetic disease, which leads to hematologic defects and cancer in patients. Here we report the isolation and characterization of a novel 20-kDa FANCA-associated protein (FAAP20). We show that FAAP20 is an integral component of the FA nuclear core complex. We identify a region on FANCA that physically interacts with FAAP20, and show that FANCA regulates stability of this protein. FAAP20 contains a conserved ubiquitin-binding zinc-finger domain (UBZ), and binds K-63–linked ubiquitin chains in vitro. The FAAP20-UBZ domain is not required for interaction with FANCA, but is required for DNA-damage–induced chromatin loading of FANCA and the functional integrity of the FA pathway. These findings reveal critical roles for FAAP20 in the FA-BRCA pathway of DNA damage repair and genome maintenance. PMID:22343915

  17. Human PrimPol activity is enhanced by RPA.

    PubMed

    Martínez-Jiménez, María I; Lahera, Antonio; Blanco, Luis

    2017-04-10

    Human PrimPol is a primase belonging to the AEP superfamily with the unique ability to synthesize DNA primers de novo, and a non-processive DNA polymerase able to bypass certain DNA lesions. PrimPol facilitates both mitochondrial and nuclear replication fork progression either acting as a conventional TLS polymerase, or repriming downstream of blocking lesions. In vivo assays have shown that PrimPol is rapidly recruited to sites of DNA damage by interaction with the human replication protein A (RPA). In agreement with previous findings, we show here that the higher affinity of RPA for ssDNA inhibits PrimPol activities in short ssDNA templates. In contrast, once the amount of ssDNA increases up to a length in which both proteins can simultaneously bind ssDNA, as expected during replicative stress conditions, PrimPol and RPA functionally interact, and their binding capacities are mutually enhanced. When using M13 ssDNA as template, RPA stimulated both the primase and polymerase activities of PrimPol, either alone or in synergy with Polε. These new findings supports the existence of a functional PrimPol/RPA association that allows repriming at the exposed ssDNA regions formed in the leading strand upon replicase stalling.

  18. Quantitative characterization of conformational-specific protein-DNA binding using a dual-spectral interferometric imaging biosensor

    NASA Astrophysics Data System (ADS)

    Zhang, Xirui; Daaboul, George G.; Spuhler, Philipp S.; Dröge, Peter; Ünlü, M. Selim

    2016-03-01

    DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are not fully understood. Recently, it was discovered that DNA-binding proteins recognize specific binding sites to carry out their functions through an indirect readout mechanism by recognizing and capturing DNA conformational flexibility and deformation. High-throughput DNA microarray-based methods that provide large-scale protein-DNA binding information have shown effective and comprehensive analysis of protein-DNA binding affinities, but do not provide information of DNA conformational changes in specific protein-DNA complexes. Building on the high-throughput capability of DNA microarrays, we demonstrate a quantitative approach that simultaneously measures the amount of protein binding to DNA and nanometer-scale DNA conformational change induced by protein binding in a microarray format. Both measurements rely on spectral interferometry on a layered substrate using a single optical instrument in two distinct modalities. In the first modality, we quantitate the amount of binding of protein to surface-immobilized DNA in each DNA spot using a label-free spectral reflectivity technique that accurately measures the surface densities of protein and DNA accumulated on the substrate. In the second modality, for each DNA spot, we simultaneously measure DNA conformational change using a fluorescence vertical sectioning technique that determines average axial height of fluorophores tagged to specific nucleotides of the surface-immobilized DNA. The approach presented in this paper, when combined with current high-throughput DNA microarray-based technologies, has the potential to serve as a rapid and simple method for quantitative and large-scale characterization of conformational specific protein-DNA interactions.DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are not fully understood. Recently, it was discovered that DNA-binding proteins recognize specific binding sites to carry out their functions through an indirect readout mechanism by recognizing and capturing DNA conformational flexibility and deformation. High-throughput DNA microarray-based methods that provide large-scale protein-DNA binding information have shown effective and comprehensive analysis of protein-DNA binding affinities, but do not provide information of DNA conformational changes in specific protein-DNA complexes. Building on the high-throughput capability of DNA microarrays, we demonstrate a quantitative approach that simultaneously measures the amount of protein binding to DNA and nanometer-scale DNA conformational change induced by protein binding in a microarray format. Both measurements rely on spectral interferometry on a layered substrate using a single optical instrument in two distinct modalities. In the first modality, we quantitate the amount of binding of protein to surface-immobilized DNA in each DNA spot using a label-free spectral reflectivity technique that accurately measures the surface densities of protein and DNA accumulated on the substrate. In the second modality, for each DNA spot, we simultaneously measure DNA conformational change using a fluorescence vertical sectioning technique that determines average axial height of fluorophores tagged to specific nucleotides of the surface-immobilized DNA. The approach presented in this paper, when combined with current high-throughput DNA microarray-based technologies, has the potential to serve as a rapid and simple method for quantitative and large-scale characterization of conformational specific protein-DNA interactions. Electronic supplementary information (ESI) available: DNA sequences and nomenclature (Table 1S); SDS-PAGE assay of IHF stock solution (Fig. 1S); determination of the concentration of IHF stock solution by Bradford assay (Fig. 2S); equilibrium binding isotherm fitting results of other DNA sequences (Table 2S); calculation of dissociation constants (Fig. 3S, 4S; Table 2S); geometric model for quantitation of DNA bending angle induced by specific IHF binding (Fig. 4S); customized flow cell assembly (Fig. 5S); real-time measurement of average fluorophore height change by SSFM (Fig. 6S); summary of binding parameters obtained from additive isotherm model fitting (Table 3S); average surface densities of 10 dsDNA spots and bound IHF at equilibrium (Table 4S); effects of surface densities on the binding and bending of dsDNA (Tables 5S, 6S and Fig. 7S-10S). See DOI: 10.1039/c5nr06785e

  19. The ATPase domain of the large terminase protein, gp17, from bacteriophage T4 binds DNA: implications to the DNA packaging mechanism.

    PubMed

    Alam, Tanfis I; Rao, Venigalla B

    2008-03-07

    Translocation of double-stranded DNA into a preformed capsid by tailed bacteriophages is driven by powerful motors assembled at the special portal vertex. The motor is thought to drive processive cycles of DNA binding, movement, and release to package the viral genome. In phage T4, there is evidence that the large terminase protein, gene product 17 (gp17), assembles into a multisubunit motor and translocates DNA by an inchworm mechanism. gp17 consists of two domains; an N-terminal ATPase domain (amino acids 1-360) that powers translocation of DNA, and a C-terminal nuclease domain (amino acids 361-610) that cuts concatemeric DNA to generate a headful-size viral genome. While the functional motifs of ATPase and nuclease have been well defined and the ATPase atomic structure has been solved, the DNA binding motif(s) responsible for viral DNA recognition, cutting, and translocation are unknown. Here we report the first evidence for the presence of a double-stranded DNA binding activity in the gp17 ATPase domain. Binding to DNA is sensitive to Mg(2+) and salt, but not the type of DNA used. DNA fragments as short as 20 bp can bind to the ATPase but preferential binding was observed to DNA greater than 1 kb. A high molecular weight ATPase-DNA complex was isolated by gel filtration, suggesting oligomerization of ATPase following DNA interaction. DNA binding was not observed with the full-length gp17, or the C-terminal nuclease domain. The small terminase protein, gp16, inhibited DNA binding, which was further accentuated by ATP. The presence of a DNA binding site in the ATPase domain and its binding properties implicate a role in the DNA packaging mechanism.

  20. The substrate binding interface of alkylpurine DNA glycosylase AlkD.

    PubMed

    Mullins, Elwood A; Rubinson, Emily H; Eichman, Brandt F

    2014-01-01

    Tandem helical repeats have emerged as an important DNA binding architecture. DNA glycosylase AlkD, which excises N3- and N7-alkylated nucleobases, uses repeating helical motifs to bind duplex DNA and to selectively pause at non-Watson-Crick base pairs. Remodeling of the DNA backbone promotes nucleotide flipping of the lesion and the complementary base into the solvent and toward the protein surface, respectively. The important features of this new DNA binding architecture that allow AlkD to distinguish between damaged and normal DNA without contacting the lesion are poorly understood. Here, we show through extensive mutational analysis that DNA binding and N3-methyladenine (3mA) and N7-methylguanine (7mG) excision are dependent upon each residue lining the DNA binding interface. Disrupting electrostatic or hydrophobic interactions with the DNA backbone substantially reduced binding affinity and catalytic activity. These results demonstrate that residues seemingly only involved in general DNA binding are important for catalytic activity and imply that base excision is driven by binding energy provided by the entire substrate interface of this novel DNA binding architecture. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Monte, D.; Coutte, L.; Dewitte, F.

    The ERM protein belongs to the family of Ets transcription factors. We show here that the human ERM gene is organized into 14 exons distributed along 65 kb of genomic DNA on chromosome 3. The two main functional domains of ERM, the acidic domain and the DNA-binding ETS domain, are overlapped by three different exons each. The 3{prime}-untranslated region of ERM is 2.1 kb, whereas the 5{prime}-untranslated region is about 0.3 kb; this allows the transcription of ERM transcripts of approximately 4 kb. The human ERM gene is localized to the q27-q29 region of chromosome 3. 17 refs., 3 figs.

  2. Salmonella typhimurium PtsJ is a novel MocR-like transcriptional repressor involved in regulating the vitamin B6 salvage pathway.

    PubMed

    Tramonti, Angela; Milano, Teresa; Nardella, Caterina; di Salvo, Martino L; Pascarella, Stefano; Contestabile, Roberto

    2017-02-01

    The vitamin B 6 salvage pathway, involving pyridoxine 5'-phosphate oxidase (PNPOx) and pyridoxal kinase (PLK), recycles B 6 vitamers from nutrients and protein turnover to produce pyridoxal 5'-phosphate (PLP), the catalytically active form of the vitamin. Regulation of this pathway, widespread in living organisms including humans and many bacteria, is very important to vitamin B 6 homeostasis but poorly understood. Although some information is available on the enzymatic regulation of PNPOx and PLK, little is known on their regulation at the transcriptional level. In the present work, we identified a new MocR-like regulator, PtsJ from Salmonella typhimurium, which controls the expression of the pdxK gene encoding one of the two PLKs expressed in this organism (PLK1). Analysis of pdxK expression in a ptsJ knockout strain demonstrated that PtsJ acts as a transcriptional repressor. This is the first case of a MocR-like regulator acting as repressor of its target gene. Expression and purification of PtsJ allowed a detailed characterisation of its effector and DNA-binding properties. PLP is the only B 6 vitamer acting as effector molecule for PtsJ. A DNA-binding region composed of four repeated nucleotide sequences is responsible for binding of PtsJ to its target promoter. Analysis of binding stoichiometry revealed that protein subunits/DNA molar ratio varies from 4 : 1 to 2 : 1, depending on the presence or absence of PLP. Structural characteristics of DNA transcriptional factor-binding sites suggest that PtsJ binds DNA according to a different model with respect to other characterised members of the MocR subgroup. © 2016 Federation of European Biochemical Societies.

  3. Max-E47, a Designed Minimalist Protein that Targets the E-Box DNA Site In Vivo and In Vitro

    PubMed Central

    Xu, Jing; Chen, Gang; De Jong, Antonia T.; Shahravan, S. Hesam; Shin, Jumi A.

    2009-01-01

    Max-E47 is a designed hybrid protein comprising the Max DNA-binding basic region and E47 HLH dimerization subdomain. In the yeast one-hybrid system (Y1H), Max-E47 shows strong transcriptional activation from the E-box site, 5'-CACGTG, targeted by the Myc/Max/Mad network of transcription factors; two mutants, Max-E47Y and Max-E47YF, activate more weakly from the E-box in the Y1H. Quantitative fluorescence anisotropy titrations to gain free energies of protein:DNA binding gave low nM Kd values for the native MaxbHLHZ, Max-E47, and the Y and YF mutants binding to the E-box site (14 nM, 15 nM, 9 nM, and 6 nM, respectively), with no detectable binding to a nonspecific control duplex. Because these minimalist, E-box-binding hybrids have no activation domain and no interactions with the c-MycbHLHZ, as shown by the yeast two-hybrid assay, they can potentially serve as dominant-negative inhibitors that suppress activation of E-box-responsive genes targeted by transcription factors including the c-Myc/Max complex. As proof-of-principle, we used our modified Y1H, which allows direct competition between two proteins vying for a DNA target, to show that Max-E47 effectively outcompetes the native MaxbHLHZ for the E-box; weaker competition is observed from the two mutants, consistent with Y1H results. These hybrids provide a minimalist scaffold for further exploration of the relationship between protein structure and DNA-binding function and may have applications as protein therapeutics or biochemical probes capable of targeting the E-box site. PMID:19449889

  4. Stoichiometry of DNA binding by the bacteriophage SP01-encoded type II DNA-binding protein TF1.

    PubMed

    Schneider, G J; Geiduschek, E P

    1990-06-25

    The stoichiometry of DNA binding by the bacteriophage SP01-encoded type II DNA-binding protein TF1 has been determined. 3H-Labeled TF1 was allowed to bind to a 32P-labeled DNA fragment containing a TF1 binding site. Multiple TF1-DNA complexes were resolved from each other and from unbound DNA by native gel electrophoresis. DNA-protein complexes were cut from polyacrylamide gels, and the amounts of 3H and 32P contained in each slice were measured. A ratio of 1.12 +/- 0.06 TF1 dimer/DNA molecule was calculated for the fastest-migrating TF1-DNA complex. We conclude that TF1 has a DNA-binding unit of one dimer. More slowly migrating complexes are apparently formed by serial addition of single TF1 dimers.

  5. A new cationic porphyrin derivative (TMPipEOPP) with large side arm substituents: a highly selective G-quadruplex optical probe.

    PubMed

    Zhu, Li-Na; Zhao, Shu-Juan; Wu, Bin; Li, Xiao-Zeng; Kong, De-Ming

    2012-01-01

    The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA) sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl)-21H,23H-porphyrin (TMPyP4), interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinyl)ethoxy]phenyl} porphyrin (TMPipEOPP), with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.

  6. Structural determinants of HIV-1 nucleocapsid protein for cTAR DNA binding and destabilization, and correlation with inhibition of self-primed DNA synthesis.

    PubMed

    Beltz, Hervé; Clauss, Céline; Piémont, Etienne; Ficheux, Damien; Gorelick, Robert J; Roques, Bernard; Gabus, Caroline; Darlix, Jean-Luc; de Rocquigny, Hugues; Mély, Yves

    2005-05-20

    The nucleocapsid protein (NC) of human immunodeficiency virus type 1 (HIV-1) is formed of two highly conserved CCHC zinc fingers flanked by small basic domains. NC is required for the two obligatory strand transfers in viral DNA synthesis through its nucleic acid chaperoning properties. The first DNA strand transfer relies on NC's ability to bind and destabilize the secondary structure of complementary transactivation response region (cTAR) DNA, to inhibit self-priming, and to promote the annealing of cTAR to TAR RNA. To further investigate NC chaperone properties, our aim was to identify by fluorescence spectroscopy and gel electrophoresis, the NC structural determinants for cTAR binding and destabilization, and for the inhibition of self-primed DNA synthesis on a model system using a series of NC mutants and HIV-1 reverse transcriptase. NC destabilization and self-priming inhibition properties were found to be supported by the two fingers in their proper context and the basic (29)RAPRKKG(35) linker. The strict requirement of the native proximal finger suggests that its hydrophobic platform (Val13, Phe16, Thr24 and Ala25) is crucial for binding, destabilization and inhibition of self-priming. In contrast, only partial folding of the distal finger is required, probably for presenting the Trp37 residue in an appropriate orientation. Also, Trp37 and the hydrophobic residues of the proximal finger appear to be essential for the propagation of the melting from the cTAR ends up to the middle of the stem. Finally, both N-terminal and C-terminal basic domains contribute to cTAR binding but not to its destabilization.

  7. Association of Many Regions of the Bacillus subtilis Chromosome with the Cell Membrane

    PubMed Central

    Ivarie, Robert D.; Pène, Jacques J.

    1973-01-01

    Unsheared lysates of Bacillus subtilis 168T− containing uniformly labeled deoxyribonucleic acid (DNA) were exposed to varying doses of gamma rays to introduce double-strand scissions in the chromosome. From an estimate of the number-average molecular weight and the amount of DNA bound to membrane after irradiation, about 70 to 90 regions of the bacterial chromosome were detected in membrane fractions. Since this number was independent of the molecular weight of the DNA (i.e., the extent of fragmentation of the chromosome), it is thought to represent an upper limit in the number of membrane-binding sites per chromosome. PMID:4196245

  8. Interactions between the R2R3-MYB Transcription Factor, AtMYB61, and Target DNA Binding Sites

    PubMed Central

    Prouse, Michael B.; Campbell, Malcolm M.

    2013-01-01

    Despite the prominent roles played by R2R3-MYB transcription factors in the regulation of plant gene expression, little is known about the details of how these proteins interact with their DNA targets. For example, while Arabidopsis thaliana R2R3-MYB protein AtMYB61 is known to alter transcript abundance of a specific set of target genes, little is known about the specific DNA sequences to which AtMYB61 binds. To address this gap in knowledge, DNA sequences bound by AtMYB61 were identified using cyclic amplification and selection of targets (CASTing). The DNA targets identified using this approach corresponded to AC elements, sequences enriched in adenosine and cytosine nucleotides. The preferred target sequence that bound with the greatest affinity to AtMYB61 recombinant protein was ACCTAC, the AC-I element. Mutational analyses based on the AC-I element showed that ACC nucleotides in the AC-I element served as the core recognition motif, critical for AtMYB61 binding. Molecular modelling predicted interactions between AtMYB61 amino acid residues and corresponding nucleotides in the DNA targets. The affinity between AtMYB61 and specific target DNA sequences did not correlate with AtMYB61-driven transcriptional activation with each of the target sequences. CASTing-selected motifs were found in the regulatory regions of genes previously shown to be regulated by AtMYB61. Taken together, these findings are consistent with the hypothesis that AtMYB61 regulates transcription from specific cis-acting AC elements in vivo. The results shed light on the specifics of DNA binding by an important family of plant-specific transcriptional regulators. PMID:23741471

  9. Mapping the interactions of the single-stranded DNA binding protein of bacteriophage T4 (gp32) with DNA lattices at single nucleotide resolution: polynucleotide binding and cooperativity

    PubMed Central

    Jose, Davis; Weitzel, Steven E.; Baase, Walter A.; Michael, Miya M.; von Hippel, Peter H.

    2015-01-01

    We here use our site-specific base analog mapping approach to study the interactions and binding equilibria of cooperatively-bound clusters of the single-stranded DNA binding protein (gp32) of the T4 DNA replication complex with longer ssDNA (and dsDNA) lattices. We show that in cooperatively bound clusters the binding free energy appears to be equi-partitioned between the gp32 monomers of the cluster, so that all bind to the ssDNA lattice with comparable affinity, but also that the outer domains of the gp32 monomers at the ends of the cluster can fluctuate on and off the lattice and that the clusters of gp32 monomers can slide along the ssDNA. We also show that at very low binding densities gp32 monomers bind to the ssDNA lattice at random, but that cooperatively bound gp32 clusters bind preferentially at the 5′-end of the ssDNA lattice. We use these results and the gp32 monomer-binding results of the companion paper to propose a detailed model for how gp32 might bind to and interact with ssDNA lattices in its various binding modes, and also consider how these clusters might interact with other components of the T4 DNA replication complex. PMID:26275774

  10. Comparison between TRF2 and TRF1 of their telomeric DNA-bound structures and DNA-binding activities

    PubMed Central

    Hanaoka, Shingo; Nagadoi, Aritaka; Nishimura, Yoshifumi

    2005-01-01

    Mammalian telomeres consist of long tandem arrays of double-stranded telomeric TTAGGG repeats packaged by the telomeric DNA-binding proteins TRF1 and TRF2. Both contain a similar C-terminal Myb domain that mediates sequence-specific binding to telomeric DNA. In a DNA complex of TRF1, only the single Myb-like domain consisting of three helices can bind specifically to double-stranded telomeric DNA. TRF2 also binds to double-stranded telomeric DNA. Although the DNA binding mode of TRF2 is likely identical to that of TRF1, TRF2 plays an important role in the t-loop formation that protects the ends of telomeres. Here, to clarify the details of the double-stranded telomeric DNA-binding modes of TRF1 and TRF2, we determined the solution structure of the DNA-binding domain of human TRF2 bound to telomeric DNA; it consists of three helices, and like TRF1, the third helix recognizes TAGGG sequence in the major groove of DNA with the N-terminal arm locating in the minor groove. However, small but significant differences are observed; in contrast to the minor groove recognition of TRF1, in which an arginine residue recognizes the TT sequence, a lysine residue of TRF2 interacts with the TT part. We examined the telomeric DNA-binding activities of both DNA-binding domains of TRF1 and TRF2 and found that TRF1 binds more strongly than TRF2. Based on the structural differences of both domains, we created several mutants of the DNA-binding domain of TRF2 with stronger binding activities compared to the wild-type TRF2. PMID:15608118

  11. B-DNA to Z-DNA structural transitions in the SV40 enhancer: stabilization of Z-DNA in negatively supercoiled DNA minicircles

    NASA Technical Reports Server (NTRS)

    Gruskin, E. A.; Rich, A.

    1993-01-01

    During replication and transcription, the SV40 control region is subjected to significant levels of DNA unwinding. There are three, alternating purine-pyrimidine tracts within this region that can adopt the Z-DNA conformation in response to negative superhelix density: a single copy of ACACACAT and two copies of ATGCATGC. Since the control region is essential for both efficient transcription and replication, B-DNA to Z-DNA transitions in these vital sequence tracts may have significant biological consequences. We have synthesized DNA minicircles to detect B-DNA to Z-DNA transitions in the SV40 enhancer, and to determine the negative superhelix density required to stabilize the Z-DNA. A variety of DNA sequences, including the entire SV40 enhancer and the two segments of the enhancer with alternating purine-pyrimidine tracts, were incorporated into topologically relaxed minicircles. Negative supercoils were generated, and the resulting topoisomers were resolved by electrophoresis. Using an anti-Z-DNA Fab and an electrophoretic mobility shift assay, Z-DNA was detected in the enhancer-containing minicircles at a superhelix density of -0.05. Fab saturation binding experiments demonstrated that three, independent Z-DNA tracts were stabilized in the supercoiled minicircles. Two other minicircles, each with one of the two alternating purine-pyrimidine tracts, also contained single Z-DNA sites. These results confirm the identities of the Z-DNA-forming sequences within the control region. Moreover, the B-DNA to Z-DNA transitions were detected at superhelix densities observed during normal replication and transcription processes in the SV40 life cycle.

  12. Post-ExSELEX stabilization of an unnatural-base DNA aptamer targeting VEGF165 toward pharmaceutical applications.

    PubMed

    Kimoto, Michiko; Nakamura, Mana; Hirao, Ichiro

    2016-09-06

    A new technology, genetic alphabet expansion using artificial bases (unnatural bases), has created high-affinity DNA ligands (aptamers) that specifically bind to target proteins by ExSELEX (genetic alphabet Expansion for Systematic Evolution of Ligands by EXponential enrichment). We recently found that the unnatural-base DNA aptamers can be stabilized against nucleases, by introducing an extraordinarily stable, unique hairpin DNA (mini-hairpin DNA) and by reinforcing the stem region with G-C pairs. Here, to establish this aptamer generation method, we examined the stabilization of a high-affinity anti-VEGF165 unnatural-base DNA aptamer. The stabilized aptamers displayed significantly increased thermal and nuclease stabilities, and furthermore, exhibited higher affinity to the target. As compared to the well-known anti-VEGF165 RNA aptamer, pegaptanib (Macugen), our aptamers did not require calcium ions for binding to VEGF165 Biological experiments using cultured cells revealed that our stabilized aptamers efficiently inhibited the interaction between VEGF165 and its receptor, with the same or slightly higher efficiency than that of the pegaptanib RNA aptamer. The development of cost-effective and calcium ion-independent high-affinity anti-VEGF165 DNA aptamers encourages further progress in diagnostic and therapeutic applications. In addition, the stabilization process provided additional information about the key elements required for aptamer binding to VEGF165. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Histone Hl-DNA interaction. Influence of phosphorylation on the interaction of histone Hl with linear fragmented DNA.

    PubMed Central

    Glotov, B O; Nikolaev, L G; Kurochkin, S N; Severin, E S

    1977-01-01

    By measuring the fluorescence polarization of fluorescent histone H1 derivatives complexed with DNA, binding of the histone to DNA was studied as a function of ionic strength in the solution prior to and after the H1 phosphorylation on Ser-37 residue. Fluorescent labels were covalently linked either specifically to Tyr-72 residues or unspecifically to lysine residues in the H1 polypeptide chain. The values of the corresponding rotational relaxation times showed that at low ionic strength all the segments of the H1 molecule were immobilized on binding to DNA. The gradual increasing NaC1 concentration in the solution of H1-DNA complex was accompanied at first by additional retardation of the histone mobility in the complex, and then by progressive release of histone H1 from from the complex which was completed at 0.5-0.6 M NaC1 irrespective of phosphorylation. tat the same time the phosphorylation of histone H1 led to removal of the central and, presumably, N-terminal regions of H1 from DNA. PMID:194228

  14. CDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

    1995-03-21

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  15. Mitochondrial telomerase reverse transcriptase binds to and protects mitochondrial DNA and function from damage.

    PubMed

    Haendeler, Judith; Dröse, Stefan; Büchner, Nicole; Jakob, Sascha; Altschmied, Joachim; Goy, Christine; Spyridopoulos, Ioakim; Zeiher, Andreas M; Brandt, Ulrich; Dimmeler, Stefanie

    2009-06-01

    The enzyme telomerase and its catalytic subunit the telomerase reverse transcriptase (TERT) are important for maintenance of telomere length in the nucleus. Recent studies provided evidence for a mitochondrial localization of TERT. Therefore, we investigated the exact localization of TERT within the mitochondria and its function. Here, we demonstrate that TERT is localized in the matrix of the mitochondria. TERT binds to mitochondrial DNA at the coding regions for ND1 and ND2. Binding of TERT to mitochondrial DNA protects against ethidium bromide-induced damage. TERT increases overall respiratory chain activity, which is most pronounced at complex I and dependent on the reverse transcriptase activity of the enzyme. Moreover, mitochondrial reactive oxygen species are increased after genetic ablation of TERT by shRNA. Mitochondrially targeted TERT and not wild-type TERT revealed the most prominent protective effect on H(2)O(2)-induced apoptosis. Lung fibroblasts from 6-month-old TERT(-/-) mice (F2 generation) showed increased sensitivity toward UVB radiation and heart mitochondria exhibited significantly reduced respiratory chain activity already under basal conditions, demonstrating the protective function of TERT in vivo. Mitochondrial TERT exerts a novel protective function by binding to mitochondrial DNA, increasing respiratory chain activity and protecting against oxidative stress-induced damage.

  16. Leptospira interrogans serovar copenhageni harbors two lexA genes involved in SOS response.

    PubMed

    Fonseca, Luciane S; da Silva, Josefa B; Milanez, Juliana S; Monteiro-Vitorello, Claudia B; Momo, Leonardo; de Morais, Zenaide M; Vasconcellos, Silvio A; Marques, Marilis V; Ho, Paulo L; da Costa, Renata M A

    2013-01-01

    Bacteria activate a regulatory network in response to the challenges imposed by DNA damage to genetic material, known as the SOS response. This system is regulated by the RecA recombinase and by the transcriptional repressor lexA. Leptospira interrogans is a pathogen capable of surviving in the environment for weeks, being exposed to a great variety of stress agents and yet retaining its ability to infect the host. This study aims to investigate the behavior of L. interrogans serovar Copenhageni after the stress induced by DNA damage. We show that L. interrogans serovar Copenhageni genome contains two genes encoding putative LexA proteins (lexA1 and lexA2) one of them being potentially acquired by lateral gene transfer. Both genes are induced after DNA damage, but the steady state levels of both LexA proteins drop, probably due to auto-proteolytic activity triggered in this condition. In addition, seven other genes were up-regulated following UV-C irradiation, recA, recN, dinP, and four genes encoding hypothetical proteins. This set of genes is potentially regulated by LexA1, as it showed binding to their promoter regions. All these regions contain degenerated sequences in relation to the previously described SOS box, TTTGN 5CAAA. On the other hand, LexA2 was able to bind to the palindrome TTGTAN10TACAA, found in its own promoter region, but not in the others. Therefore, the L. interrogans serovar Copenhageni SOS regulon may be even more complex, as a result of LexA1 and LexA2 binding to divergent motifs. New possibilities for DNA damage response in Leptospira are expected, with potential influence in other biological responses such as virulence.

  17. Leptospira interrogans serovar Copenhageni Harbors Two lexA Genes Involved in SOS Response

    PubMed Central

    Fonseca, Luciane S.; da Silva, Josefa B.; Milanez, Juliana S.; Monteiro-Vitorello, Claudia B.; Momo, Leonardo; de Morais, Zenaide M.; Vasconcellos, Silvio A.; Marques, Marilis V.; Ho, Paulo L.; da Costa, Renata M. A.

    2013-01-01

    Bacteria activate a regulatory network in response to the challenges imposed by DNA damage to genetic material, known as the SOS response. This system is regulated by the RecA recombinase and by the transcriptional repressor lexA. Leptospira interrogans is a pathogen capable of surviving in the environment for weeks, being exposed to a great variety of stress agents and yet retaining its ability to infect the host. This study aims to investigate the behavior of L. interrogans serovar Copenhageni after the stress induced by DNA damage. We show that L. interrogans serovar Copenhageni genome contains two genes encoding putative LexA proteins (lexA1 and lexA2) one of them being potentially acquired by lateral gene transfer. Both genes are induced after DNA damage, but the steady state levels of both LexA proteins drop, probably due to auto-proteolytic activity triggered in this condition. In addition, seven other genes were up-regulated following UV-C irradiation, recA, recN, dinP, and four genes encoding hypothetical proteins. This set of genes is potentially regulated by LexA1, as it showed binding to their promoter regions. All these regions contain degenerated sequences in relation to the previously described SOS box, TTTGN 5CAAA. On the other hand, LexA2 was able to bind to the palindrome TTGTAN 10TACAA, found in its own promoter region, but not in the others. Therefore, the L. interrogans serovar Copenhageni SOS regulon may be even more complex, as a result of LexA1 and LexA2 binding to divergent motifs. New possibilities for DNA damage response in Leptospira are expected, with potential influence in other biological responses such as virulence. PMID:24098496

  18. Exploring DNA-binding Proteins with In Vivo Chemical Cross-linking and Mass Spectrometry

    PubMed Central

    Qiu, Haibo; Wang, Yinsheng

    2009-01-01

    DNA-binding proteins are very important constituents of proteomes of all species and play crucial roles in transcription, DNA replication, recombination, repair and other activities associated with DNA. Although a number of DNA-binding proteins have been identified, many proteins involved in gene regulation and DNA repair are likely still unknown because of their dynamic and/or weak interactions with DNA. In this report, we described an approach for the comprehensive identification of DNA-binding proteins with in vivo formaldehyde cross-linking and LC-MS/MS. DNA-binding proteins could be purified via the isolation of DNA-protein complexes and released from the complexes by reversing the cross-linking. By using this method, we were able to identify more than one hundred DNA-binding proteins, such as proteins involved in transcription, gene regulation, DNA replication and repair, and a large number of proteins which are potentially associated with DNA and DNA-binding proteins. This method should be generally applicable to the investigation of other nucleic acid-binding proteins, and hold great potential in the comprehensive study of gene regulation, DNA damage response and repair, as well as many other critical biological processes at proteomic level. PMID:19714816

  19. Structural and Functional Analysis of the Signal-Transducing Linker in the pH-Responsive One-Component System CadC of Escherichia coli.

    PubMed

    Buchner, Sophie; Schlundt, Andreas; Lassak, Jürgen; Sattler, Michael; Jung, Kirsten

    2015-07-31

    The pH-responsive one-component signaling system CadC in Escherichia coli belongs to the family of ToxR-like proteins, whose members share a conserved modular structure, with an N-terminal cytoplasmic winged helix-turn-helix DNA-binding domain being followed by a single transmembrane helix and a C-terminal periplasmic pH-sensing domain. In E. coli CadC, a cytoplasmic linker comprising approximately 50 amino acids is essential for transmission of the signal from the sensor to the DNA-binding domain. However, the mechanism of transduction is poorly understood. Using NMR spectroscopy, we demonstrate here that the linker region is intrinsically disordered in solution. Furthermore, mutational analyses showed that it tolerates a range of amino acid substitutions (altering polarity, rigidity and α-helix-forming propensity), is robust to extension but is sensitive to truncation. Indeed, truncations either reversed the expression profile of the target operon cadBA or decoupled expression from external pH altogether. CadC dimerizes via its periplasmic domain, but light-scattering analysis provided no evidence for dimerization of the isolated DNA-binding domain, with or without the linker region. However, bacterial two-hybrid analysis revealed that CadC forms stable dimers in a stimulus- and linker-dependent manner, interacting only at pH<6.8. Strikingly, a variant with inversed cadBA expression profile, which lacks most of the linker, dimerizes preferentially at higher pH. Thus, we propose that the disordered CadC linker is required for transducing the pH-dependent response of the periplasmic sensor into a structural rearrangement that facilitates dimerization of the cytoplasmic CadC DNA-binding domain. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Investigation on biomolecular interactions of nickel(II) complexes with monoanionic bidentate ligands

    NASA Astrophysics Data System (ADS)

    Jayamani, Arumugam; Sethupathi, Murugan; Ojwach, Stephen O.; Sengottuvelan, Nallathambi

    2018-01-01

    Reactions of monoanionic bidentate ligands 5-methylsalicylaldehyde (5-msal), 5-bromosalicylaldehyde (5-brsal), 5-nitrosalicylaldehyde (5-nsal) and 2-hydroxy-1-naphthaldehyde (2-hnap) with nickel perchlorate hexahydrate produced nickel(II) complexes 1-4, respectively. Single crystal X-ray analyses of complexes 1 and 2 confirmed bidentate mode of the ligands with O˄O coordination to give square planar geometry around nickel atoms. Complexes 1-4 showed one quasi-reversible redox peak at cathodic region (-0.67 to -0.80 V) and one redox peak at anodic region (+1.08 to +1.44 V) assignable to the Ni(II)/Ni(I) and Ni(II)/Ni(III) redox couples, respectively. The complexes exhibited good bovine serum albumin (BSA) binding abilities with a maximum binding constant of 1.96 × 105 M-1. The binding of complexes with calf thymus DNA (ctDNA) showed that the binding affinity is consistent with an increase in steric bulk of the ligands. The nuclease activity of the complexes showed efficient oxidative cleavage in the presence of hydrogen peroxide as an oxidizing agent. The complexes showed higher zone of inhibition when screened for antimicrobial activity against bacteria and human pathogenic fungi.

  1. Organization of the human gene for nucleobindin (NUC) and its chromosomal assignment to 19q13.2-q13.4

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miura, Keiji; Kurosawa, Yoshikazu; Hirai, Momoki

    1996-06-01

    Nucleobindin (Nuc) was first identified as a secreted protein of 55 kDa that promotes production of DNA-specific antibodies in lupus-prone MRL/lpr mice. Analysis of cDNA that encoded Nuc revealed that the protein is composed of a signal peptide, a DNA-binding site, two calcium-binding motifs (EF-hand motifs), and a leucine zipper. In the present study, we analysed the organization of the human gene for Nuc (NUC). It consists of 13 exons that are distributed in a region of 32 kb. The functional motifs listed above are encoded in corresponding exons. NUC was expressed in all organs examined. Comparison of nucleotide sequencesmore » in the promotre regions between human and mouse NCU genes revealed several conserved sequences. Among them, two Sp1-binding sites and a CCAAT box are of particular interest. The promoter is of the TATA-less type, and transcription starts at multiple sites in both the human and the mouse genes. These features suggest that NUC might normally play a role as a housekeeping gene. NUC was located at human chromosome 19q13.2-q13.4. 25 refs., 4 figs., 1 tab.« less

  2. High Fractional Occupancy of a Tandem Maf Recognition Element and Its Role in Long-Range β-Globin Gene Regulation

    PubMed Central

    Stees, Jared R.; Hossain, Mir A.; Sunose, Tomoki; Kudo, Yasushi; Pardo, Carolina E.; Nabilsi, Nancy H.; Darst, Russell P.; Poudyal, Rosha; Igarashi, Kazuhiko; Kladde, Michael P.

    2015-01-01

    Enhancers and promoters assemble protein complexes that ultimately regulate the recruitment and activity of RNA polymerases. Previous work has shown that at least some enhancers form stable protein complexes, leading to the formation of enhanceosomes. We analyzed protein-DNA interactions in the murine β-globin gene locus using the methyltransferase accessibility protocol for individual templates (MAPit). The data show that a tandem Maf recognition element (MARE) in locus control region (LCR) hypersensitive site 2 (HS2) reveals a remarkably high degree of occupancy during differentiation of mouse erythroleukemia cells. Most of the other transcription factor binding sites in LCR HS2 or in the adult β-globin gene promoter regions exhibit low fractional occupancy, suggesting highly dynamic protein-DNA interactions. Targeting of an artificial zinc finger DNA-binding domain (ZF-DBD) to the HS2 tandem MARE caused a reduction in the association of MARE-binding proteins and transcription complexes at LCR HS2 and the adult βmajor-globin gene promoter but did not affect expression of the βminor-globin gene. The data demonstrate that a stable MARE-associated footprint in LCR HS2 is important for the recruitment of transcription complexes to the adult βmajor-globin gene promoter during erythroid cell differentiation. PMID:26503787

  3. Direct observation of TALE protein dynamics reveals a two-state search mechanism

    PubMed Central

    Cuculis, Luke; Abil, Zhanar; Zhao, Huimin; Schroeder, Charles M.

    2015-01-01

    Transcription activator-like effector (TALE) proteins are a class of programmable DNA-binding proteins for which the fundamental mechanisms governing the search process are not fully understood. Here we use single-molecule techniques to directly observe TALE search dynamics along DNA templates. We find that TALE proteins are capable of rapid diffusion along DNA using a combination of sliding and hopping behaviour, which suggests that the TALE search process is governed in part by facilitated diffusion. We also observe that TALE proteins exhibit two distinct modes of action during the search process—a search state and a recognition state—facilitated by different subdomains in monomeric TALE proteins. Using TALE truncation mutants, we further demonstrate that the N-terminal region of TALEs is required for the initial non-specific binding and subsequent rapid search along DNA, whereas the central repeat domain is required for transitioning into the site-specific recognition state. PMID:26027871

  4. Direct observation of TALE protein dynamics reveals a two-state search mechanism.

    PubMed

    Cuculis, Luke; Abil, Zhanar; Zhao, Huimin; Schroeder, Charles M

    2015-06-01

    Transcription activator-like effector (TALE) proteins are a class of programmable DNA-binding proteins for which the fundamental mechanisms governing the search process are not fully understood. Here we use single-molecule techniques to directly observe TALE search dynamics along DNA templates. We find that TALE proteins are capable of rapid diffusion along DNA using a combination of sliding and hopping behaviour, which suggests that the TALE search process is governed in part by facilitated diffusion. We also observe that TALE proteins exhibit two distinct modes of action during the search process-a search state and a recognition state-facilitated by different subdomains in monomeric TALE proteins. Using TALE truncation mutants, we further demonstrate that the N-terminal region of TALEs is required for the initial non-specific binding and subsequent rapid search along DNA, whereas the central repeat domain is required for transitioning into the site-specific recognition state.

  5. Effects of nucleoside analog incorporation on DNA binding to the DNA binding domain of the GATA-1 erythroid transcription factor.

    PubMed

    Foti, M; Omichinski, J G; Stahl, S; Maloney, D; West, J; Schweitzer, B I

    1999-02-05

    We investigate here the effects of the incorporation of the nucleoside analogs araC (1-beta-D-arabinofuranosylcytosine) and ganciclovir (9-[(1,3-dihydroxy-2-propoxy)methyl] guanine) into the DNA binding recognition sequence for the GATA-1 erythroid transcription factor. A 10-fold decrease in binding affinity was observed for the ganciclovir-substituted DNA complex in comparison to an unmodified DNA of the same sequence composition. AraC substitution did not result in any changes in binding affinity. 1H-15N HSQC and NOESY NMR experiments revealed a number of chemical shift changes in both DNA and protein in the ganciclovir-modified DNA-protein complex when compared to the unmodified DNA-protein complex. These changes in chemical shift and binding affinity suggest a change in the binding mode of the complex when ganciclovir is incorporated into the GATA DNA binding site.

  6. Analysis of DNA binding by human factor xeroderma pigmentosum complementation group A (XPA) provides insight into its interactions with nucleotide excision repair substrates.

    PubMed

    Sugitani, Norie; Voehler, Markus W; Roh, Michelle S; Topolska-Woś, Agnieszka M; Chazin, Walter J

    2017-10-13

    Xeroderma pigmentosum (XP) complementation group A (XPA) is an essential scaffolding protein in the multiprotein nucleotide excision repair (NER) machinery. The interaction of XPA with DNA is a core function of this protein; a number of mutations in the DNA-binding domain (DBD) are associated with XP disease. Although structures of the central globular domain of human XPA and data on binding of DNA substrates have been reported, the structural basis for XPA's DNA-binding activity remains unknown. X-ray crystal structures of the central globular domain of yeast XPA (Rad14) with lesion-containing DNA duplexes have provided valuable insights, but the DNA substrates used for this study do not correspond to the substrates of XPA as it functions within the NER machinery. To better understand the DNA-binding activity of human XPA in NER, we used NMR to investigate the interaction of its DBD with a range of DNA substrates. We found that XPA binds different single-stranded/double-stranded junction DNA substrates with a common surface. Comparisons of our NMR-based mapping of binding residues with the previously reported Rad14-DNA crystal structures revealed similarities and differences in substrate binding between XPA and Rad14. This includes direct evidence for DNA contacts to the residues extending C-terminally from the globular core, which are lacking in the Rad14 construct. Moreover, mutation of the XPA residue corresponding to Phe-262 in Rad14, previously reported as being critical for DNA binding, had only a moderate effect on the DNA-binding activity of XPA. The DNA-binding properties of several disease-associated mutations in the DBD were investigated. These results suggest that for XPA mutants exhibiting altered DNA-binding properties, a correlation exists between the extent of reduction in DNA-binding affinity and the severity of symptoms in XP patients. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Quantitative characterization of conformational-specific protein-DNA binding using a dual-spectral interferometric imaging biosensor.

    PubMed

    Zhang, Xirui; Daaboul, George G; Spuhler, Philipp S; Dröge, Peter; Ünlü, M Selim

    2016-03-14

    DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are not fully understood. Recently, it was discovered that DNA-binding proteins recognize specific binding sites to carry out their functions through an indirect readout mechanism by recognizing and capturing DNA conformational flexibility and deformation. High-throughput DNA microarray-based methods that provide large-scale protein-DNA binding information have shown effective and comprehensive analysis of protein-DNA binding affinities, but do not provide information of DNA conformational changes in specific protein-DNA complexes. Building on the high-throughput capability of DNA microarrays, we demonstrate a quantitative approach that simultaneously measures the amount of protein binding to DNA and nanometer-scale DNA conformational change induced by protein binding in a microarray format. Both measurements rely on spectral interferometry on a layered substrate using a single optical instrument in two distinct modalities. In the first modality, we quantitate the amount of binding of protein to surface-immobilized DNA in each DNA spot using a label-free spectral reflectivity technique that accurately measures the surface densities of protein and DNA accumulated on the substrate. In the second modality, for each DNA spot, we simultaneously measure DNA conformational change using a fluorescence vertical sectioning technique that determines average axial height of fluorophores tagged to specific nucleotides of the surface-immobilized DNA. The approach presented in this paper, when combined with current high-throughput DNA microarray-based technologies, has the potential to serve as a rapid and simple method for quantitative and large-scale characterization of conformational specific protein-DNA interactions.

  8. Architecture of the ParF*ParG protein complex involved in prokaryotic DNA segregation.

    PubMed

    Barillà, Daniela; Hayes, Finbarr

    2003-07-01

    The mechanism by which low copy number plasmids are segregated at cell division involves the concerted action of two plasmid-encoded proteins that assemble on a centromere-like site. This study explores the topology of the DNA segregation machinery specified by the parFG locus of TP228, a partition system which is phylogenetically distinct from more well-characterized archetypes. A variety of genetic, biochemical and biophysical strategies revealed that the ParG protein is dimeric. ParF, which is more closely related to the cell division regulator MinD than to the prototypical ParA partition protein of plasmid P1, is instead multimeric and its polymeric state appears to be modulated by ATP which correlates with the proposed ATP-binding activity of ParF. ParG interacts in a sequence-specific manner with the DNA region upstream of the parFG locus and this binding is modulated by ParF. Intriguingly, the ParF and ParG proteins form at least two types of discrete complex in the absence of this region suggesting that the assembly dynamics of these proteins onto DNA is intricate.

  9. Patterns of DNA Methylation Across the Leptin Core Promoter in Four Diverse Asian and North American Populations.

    PubMed

    Mosher, M J; Melton, P E; Stapleton, P; Schanfield, M S; Crawford, M H

    2016-04-01

    DNA methylation is the most widely studied of epigenetic mechanisms, with environmental effects recorded through patterned attachments of methyl groups along the DNA that are capable of modifying gene expression without altering the DNA sequencing. The degree to which these patterns of DNA methylation are heritable, the expected range of normality across populations, and the phenotypic relevance of pattern variation remain unclear. Genes regulating metabolic pathways appear to be vulnerable to ongoing nutritional programming over the life course, as dietary nutrients are significant environmental determinants of DNA methylation, supplying both the methyl groups and energy to generate the methylation process. Here we examine methylation patterns along a region of the metabolic gene leptin (LEP). LEP's putative functions include regulation of energy homeostasis, with its signals affecting energy intake and expenditure, adipogenesis and energy storage, lipid and glucose metabolism, bone metabolism, and reproductive endocrine function. A pattern of differential methylation across CpG sites of the LEP core promoter has been previously identified; however, any consistency of pattern or its phenotypic significance is not fully elucidated among populations. Using DNA extracted from unfractionated white blood cells of peripheral blood samples, our pilot study, divided into two parts, examined the significance of variation in DNA methylation patterns along the leptin core promoter in four populations (phase 1) and used biomarkers reflecting leptin's functional process in two of those populations, western Buryat of Siberia and the Mennonite of central Kansas, to investigate the relevance of the ethnic variation identified in the DNA methylation (phase 2). LEP's core promoter region contains both the binding site for C/EBPα (CCAAT/enhancer binding protein alpha), which tempers the final step in adipocyte maturity and capacity to synthesize leptin, and the TATA motif controlling leptin synthesis. Previous studies report that increased methylation in this region is correlated to decreased gene expression, suggesting tissue-specific methylation variation at this region ( Melzner et al. 2002 ). We hypothesized that evidence of nutritional epigenetic programming would be identified through variation in patterns of DNA methylation and that functional relevance of that variation among populations would be identified through biomarkers that reflect leptin's metabolic signals: serum leptin levels, lipoproteins of the lipid transport system, and anthropometric measures. In phase 1, our combined analyses of 313 individuals documented a distinct and consistent overall pattern of differential DNA methylation across seven CpG sites of LEP core promoter in all ethnicities and both sexes. This pattern replicates those identified in previous studies, suggesting a conserved core promoter region across populations. Phase 2 analyses of two of the four populations (n = 239), correlating methylation at the C/EBPα transcription binding site (TBS) with metabolic and anthropometric biomarkers reflecting LEP roles, showed that stature, which reflects bone growth and remodeling, was significantly and inversely correlated with the percentage of DNA methylation at this site in both sexes. We suggest that variation in DNA methylation along the LEP core promoter plays a substantial role in energy signals affecting both adipogenesis and bone metabolism.

  10. Functional Domains of the TOL Plasmid Transcription Factor XylS

    PubMed Central

    Kaldalu, Niilo; Toots, Urve; de Lorenzo, Victor; Ustav, Mart

    2000-01-01

    The alkylbenzoate degradation genes of Pseudomonas putida TOL plasmid are positively regulated by XylS, an AraC family protein, in a benzoate-dependent manner. In this study, we used deletion mutants and hybrid proteins to identify which parts of XylS are responsible for the DNA binding, transcriptional activation, and benzoate inducibility. We found that a 112-residue C-terminal fragment of XylS binds specifically to the Pm operator in vitro, protects this sequence from DNase I digestion identically to the wild-type (wt) protein, and activates the Pm promoter in vivo. When overexpressed, that C-terminal fragment could activate transcription as efficiently as wt XylS. All the truncations, which incorporated these 112 C-terminal residues, were able to activate transcription at least to some extent when overproduced. Intactness of the 210-residue N-terminal portion was found to be necessary for benzoate responsiveness of XylS. Deletions in the N-terminal and central regions seriously reduced the activity of XylS and caused the loss of effector control, whereas insertions into the putative interdomain region did not change the basic features of the XylS protein. Our results confirm that XylS consists of two parts which probably interact with each other. The C-terminal domain carries DNA-binding and transcriptional activation abilities, while the N-terminal region carries effector-binding and regulatory functions. PMID:10648539

  11. The nucleoid protein Dps binds genomic DNA of Escherichia coli in a non-random manner

    PubMed Central

    Kondrashov, F. A.; Toshchakov, S. V.; Dominova, I.; Shvyreva, U. S.; Vrublevskaya, V. V.; Morenkov, O. S.; Panyukov, V. V.

    2017-01-01

    Dps is a multifunctional homododecameric protein that oxidizes Fe2+ ions accumulating them in the form of Fe2O3 within its protein cavity, interacts with DNA tightly condensing bacterial nucleoid upon starvation and performs some other functions. During the last two decades from discovery of this protein, its ferroxidase activity became rather well studied, but the mechanism of Dps interaction with DNA still remains enigmatic. The crucial role of lysine residues in the unstructured N-terminal tails led to the conventional point of view that Dps binds DNA without sequence or structural specificity. However, deletion of dps changed the profile of proteins in starved cells, SELEX screen revealed genomic regions preferentially bound in vitro and certain affinity of Dps for artificial branched molecules was detected by atomic force microscopy. Here we report a non-random distribution of Dps binding sites across the bacterial chromosome in exponentially growing cells and show their enrichment with inverted repeats prone to form secondary structures. We found that the Dps-bound regions overlap with sites occupied by other nucleoid proteins, and contain overrepresented motifs typical for their consensus sequences. Of the two types of genomic domains with extensive protein occupancy, which can be highly expressed or transcriptionally silent only those that are enriched with RNA polymerase molecules were preferentially occupied by Dps. In the dps-null mutant we, therefore, observed a differentially altered expression of several targeted genes and found suppressed transcription from the dps promoter. In most cases this can be explained by the relieved interference with Dps for nucleoid proteins exploiting sequence-specific modes of DNA binding. Thus, protecting bacterial cells from different stresses during exponential growth, Dps can modulate transcriptional integrity of the bacterial chromosome hampering RNA biosynthesis from some genes via competition with RNA polymerase or, vice versa, competing with inhibitors to activate transcription. PMID:28800583

  12. The helical structure of DNA facilitates binding

    NASA Astrophysics Data System (ADS)

    Berg, Otto G.; Mahmutovic, Anel; Marklund, Emil; Elf, Johan

    2016-09-01

    The helical structure of DNA imposes constraints on the rate of diffusion-limited protein binding. Here we solve the reaction-diffusion equations for DNA-like geometries and extend with simulations when necessary. We find that the helical structure can make binding to the DNA more than twice as fast compared to a case where DNA would be reactive only along one side. We also find that this rate advantage remains when the contributions from steric constraints and rotational diffusion of the DNA-binding protein are included. Furthermore, we find that the association rate is insensitive to changes in the steric constraints on the DNA in the helix geometry, while it is much more dependent on the steric constraints on the DNA-binding protein. We conclude that the helical structure of DNA facilitates the nonspecific binding of transcription factors and structural DNA-binding proteins in general.

  13. Coupled binding-bending-folding: The complex conformational dynamics of protein-DNA binding studied by atomistic molecular dynamics simulations.

    PubMed

    van der Vaart, Arjan

    2015-05-01

    Protein-DNA binding often involves dramatic conformational changes such as protein folding and DNA bending. While thermodynamic aspects of this behavior are understood, and its biological function is often known, the mechanism by which the conformational changes occur is generally unclear. By providing detailed structural and energetic data, molecular dynamics simulations have been helpful in elucidating and rationalizing protein-DNA binding. This review will summarize recent atomistic molecular dynamics simulations of the conformational dynamics of DNA and protein-DNA binding. A brief overview of recent developments in DNA force fields is given as well. Simulations have been crucial in rationalizing the intrinsic flexibility of DNA, and have been instrumental in identifying the sequence of binding events, the triggers for the conformational motion, and the mechanism of binding for a number of important DNA-binding proteins. Molecular dynamics simulations are an important tool for understanding the complex binding behavior of DNA-binding proteins. With recent advances in force fields and rapid increases in simulation time scales, simulations will become even more important for future studies. This article is part of a Special Issue entitled Recent developments of molecular dynamics. Copyright © 2014. Published by Elsevier B.V.

  14. Informative priors based on transcription factor structural class improve de novo motif discovery.

    PubMed

    Narlikar, Leelavati; Gordân, Raluca; Ohler, Uwe; Hartemink, Alexander J

    2006-07-15

    An important problem in molecular biology is to identify the locations at which a transcription factor (TF) binds to DNA, given a set of DNA sequences believed to be bound by that TF. In previous work, we showed that information in the DNA sequence of a binding site is sufficient to predict the structural class of the TF that binds it. In particular, this suggests that we can predict which locations in any DNA sequence are more likely to be bound by certain classes of TFs than others. Here, we argue that traditional methods for de novo motif finding can be significantly improved by adopting an informative prior probability that a TF binding site occurs at each sequence location. To demonstrate the utility of such an approach, we present priority, a powerful new de novo motif finding algorithm. Using data from TRANSFAC, we train three classifiers to recognize binding sites of basic leucine zipper, forkhead, and basic helix loop helix TFs. These classifiers are used to equip priority with three class-specific priors, in addition to a default prior to handle TFs of other classes. We apply priority and a number of popular motif finding programs to sets of yeast intergenic regions that are reported by ChIP-chip to be bound by particular TFs. priority identifies motifs the other methods fail to identify, and correctly predicts the structural class of the TF recognizing the identified binding sites. Supplementary material and code can be found at http://www.cs.duke.edu/~amink/.

  15. Direct interaction of SRY-related protein SOX9 and steroidogenic factor 1 regulates transcription of the human anti-Müllerian hormone gene.

    PubMed

    De Santa Barbara, P; Bonneaud, N; Boizet, B; Desclozeaux, M; Moniot, B; Sudbeck, P; Scherer, G; Poulat, F; Berta, P

    1998-11-01

    For proper male sexual differentiation, anti-Müllerian hormone (AMH) must be tightly regulated during embryonic development to promote regression of the Müllerian duct. However, the molecular mechanisms specifying the onset of AMH in male mammals are not yet clearly defined. A DNA-binding element for the steroidogenic factor 1 (SF-1), a member of the orphan nuclear receptor family, located in the AMH proximal promoter has recently been characterized and demonstrated as being essential for AMH gene activation. However, the requirement for a specific promoter environment for SF-1 activation as well as the presence of conserved cis DNA-binding elements in the AMH promoter suggest that SF-1 is a member of a combinatorial protein-protein and protein-DNA complex. In this study, we demonstrate that the canonical SOX-binding site within the human AMH proximal promoter can bind the transcription factor SOX9, a Sertoli cell factor closely associated with Sertoli cell differentiation and AMH expression. Transfection studies with COS-7 cells revealed that SOX9 can cooperate with SF-1 in this activation process. In vitro and in vivo protein-binding studies indicate that SOX9 and SF-1 interact directly via the SOX9 DNA-binding domain and the SF-1 C-terminal region, respectively. We propose that the two transcription factors SOX9 and SF-1 could both be involved in the expression of the AMH gene, in part as a result of their respective binding to the AMH promoter and in part because of their ability to interact with each other. Our work thus identifies SOX9 as an interaction partner of SF-1 that could be involved in the Sertoli cell-specific expression of AMH during embryogenesis.

  16. Direct Interaction of SRY-Related Protein SOX9 and Steroidogenic Factor 1 Regulates Transcription of the Human Anti-Müllerian Hormone Gene

    PubMed Central

    De Santa Barbara, Pascal; Bonneaud, Nathalie; Boizet, Brigitte; Desclozeaux, Marion; Moniot, Brigitte; Sudbeck, Peter; Scherer, Gerd; Poulat, Francis; Berta, Philippe

    1998-01-01

    For proper male sexual differentiation, anti-Müllerian hormone (AMH) must be tightly regulated during embryonic development to promote regression of the Müllerian duct. However, the molecular mechanisms specifying the onset of AMH in male mammals are not yet clearly defined. A DNA-binding element for the steroidogenic factor 1 (SF-1), a member of the orphan nuclear receptor family, located in the AMH proximal promoter has recently been characterized and demonstrated as being essential for AMH gene activation. However, the requirement for a specific promoter environment for SF-1 activation as well as the presence of conserved cis DNA-binding elements in the AMH promoter suggest that SF-1 is a member of a combinatorial protein-protein and protein-DNA complex. In this study, we demonstrate that the canonical SOX-binding site within the human AMH proximal promoter can bind the transcription factor SOX9, a Sertoli cell factor closely associated with Sertoli cell differentiation and AMH expression. Transfection studies with COS-7 cells revealed that SOX9 can cooperate with SF-1 in this activation process. In vitro and in vivo protein-binding studies indicate that SOX9 and SF-1 interact directly via the SOX9 DNA-binding domain and the SF-1 C-terminal region, respectively. We propose that the two transcription factors SOX9 and SF-1 could both be involved in the expression of the AMH gene, in part as a result of their respective binding to the AMH promoter and in part because of their ability to interact with each other. Our work thus identifies SOX9 as an interaction partner of SF-1 that could be involved in the Sertoli cell-specific expression of AMH during embryogenesis. PMID:9774680

  17. Quantification of transcription factor-DNA binding affinity in a living cell

    PubMed Central

    Belikov, Sergey; Berg, Otto G.; Wrange, Örjan

    2016-01-01

    The apparent dissociation constant (Kd) for specific binding of glucocorticoid receptor (GR) and androgen receptor (AR) to DNA was determined in vivo in Xenopus oocytes. The total nuclear receptor concentration was quantified as specifically retained [3H]-hormone in manually isolated oocyte nuclei. DNA was introduced by nuclear microinjection of single stranded phagemid DNA, chromatin is then formed during second strand synthesis. The fraction of DNA sites occupied by the expressed receptor was determined by dimethylsulphate in vivo footprinting and used for calculation of the receptor-DNA binding affinity. The forkhead transcription factor FoxA1 enhanced the DNA binding by GR with an apparent Kd of ∼1 μM and dramatically stimulated DNA binding by AR with an apparent Kd of ∼0.13 μM at a composite androgen responsive DNA element containing one FoxA1 binding site and one palindromic hormone receptor binding site known to bind one receptor homodimer. FoxA1 exerted a weak constitutive- and strongly cooperative DNA binding together with AR but had a less prominent effect with GR, the difference reflecting the licensing function of FoxA1 at this androgen responsive DNA element. PMID:26657626

  18. Identification of Human Lineage-Specific Transcriptional Coregulators Enabled by a Glossary of Binding Modules and Tunable Genomic Backgrounds.

    PubMed

    Mariani, Luca; Weinand, Kathryn; Vedenko, Anastasia; Barrera, Luis A; Bulyk, Martha L

    2017-09-27

    Transcription factors (TFs) control cellular processes by binding specific DNA motifs to modulate gene expression. Motif enrichment analysis of regulatory regions can identify direct and indirect TF binding sites. Here, we created a glossary of 108 non-redundant TF-8mer "modules" of shared specificity for 671 metazoan TFs from publicly available and new universal protein binding microarray data. Analysis of 239 ENCODE TF chromatin immunoprecipitation sequencing datasets and associated RNA sequencing profiles suggest the 8mer modules are more precise than position weight matrices in identifying indirect binding motifs and their associated tethering TFs. We also developed GENRE (genomically equivalent negative regions), a tunable tool for construction of matched genomic background sequences for analysis of regulatory regions. GENRE outperformed four state-of-the-art approaches to background sequence construction. We used our TF-8mer glossary and GENRE in the analysis of the indirect binding motifs for the co-occurrence of tethering factors, suggesting novel TF-TF interactions. We anticipate that these tools will aid in elucidating tissue-specific gene-regulatory programs. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. ATM activation and its recruitment to damaged DNA require binding to the C terminus of Nbs1.

    PubMed

    You, Zhongsheng; Chahwan, Charly; Bailis, Julie; Hunter, Tony; Russell, Paul

    2005-07-01

    ATM has a central role in controlling the cellular responses to DNA damage. It and other phosphoinositide 3-kinase-related kinases (PIKKs) have giant helical HEAT repeat domains in their amino-terminal regions. The functions of these domains in PIKKs are not well understood. ATM activation in response to DNA damage appears to be regulated by the Mre11-Rad50-Nbs1 (MRN) complex, although the exact functional relationship between the MRN complex and ATM is uncertain. Here we show that two pairs of HEAT repeats in fission yeast ATM (Tel1) interact with an FXF/Y motif at the C terminus of Nbs1. This interaction resembles nucleoporin FXFG motif binding to HEAT repeats in importin-beta. Budding yeast Nbs1 (Xrs2) appears to have two FXF/Y motifs that interact with Tel1 (ATM). In Xenopus egg extracts, the C terminus of Nbs1 recruits ATM to damaged DNA, where it is subsequently autophosphorylated. This interaction is essential for ATM activation. A C-terminal 147-amino-acid fragment of Nbs1 that has the Mre11- and ATM-binding domains can restore ATM activation in an Nbs1-depleted extract. We conclude that an interaction between specific HEAT repeats in ATM and the C-terminal FXF/Y domain of Nbs1 is essential for ATM activation. We propose that conformational changes in the MRN complex that occur upon binding to damaged DNA are transmitted through the FXF/Y-HEAT interface to activate ATM. This interaction also retains active ATM at sites of DNA damage.

  20. Architecture of a Fur Binding Site: a Comparative Analysis

    PubMed Central

    Lavrrar, Jennifer L.; McIntosh, Mark A.

    2003-01-01

    Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489

  1. DNA sequence determinants controlling affinity, stability and shape of DNA complexes bound by the nucleoid protein Fis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio

    The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less

  2. DNA sequence determinants controlling affinity, stability and shape of DNA complexes bound by the nucleoid protein Fis

    DOE PAGES

    Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio; ...

    2016-03-09

    The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less

  3. TRANSFAC: an integrated system for gene expression regulation.

    PubMed

    Wingender, E; Chen, X; Hehl, R; Karas, H; Liebich, I; Matys, V; Meinhardt, T; Prüss, M; Reuter, I; Schacherer, F

    2000-01-01

    TRANSFAC is a database on transcription factors, their genomic binding sites and DNA-binding profiles (http://transfac.gbf.de/TRANSFAC/). Its content has been enhanced, in particular by information about training sequences used for the construction of nucleotide matrices as well as by data on plant sites and factors. Moreover, TRANSFAC has been extended by two new modules: PathoDB provides data on pathologically relevant mutations in regulatory regions and transcription factor genes, whereas S/MARt DB compiles features of scaffold/matrix attached regions (S/MARs) and the proteins binding to them. Additionally, the databases TRANSPATH, about signal transduction, and CYTOMER, about organs and cell types, have been extended and are increasingly integrated with the TRANSFAC data sources.

  4. Method for promoting specific alignment of short oligonucleotides on nucleic acids

    DOEpatents

    Studier, F. William; Kieleczawa, Jan; Dunn, John J.

    1996-01-01

    Disclosed is a method for promoting specific alignment of short oligonucleotides on a nucleic acid polymer. The nucleic acid polymer is incubated in a solution containing a single-stranded DNA-binding protein and a plurality of oligonucleotides which are perfectly complementary to distinct but adjacent regions of a predetermined contiguous nucleotide sequence in the nucleic acid polymer. The plurality of oligonucleotides anneal to the nucleic acid polymer to form a contiguous region of double stranded nucleic acid. Specific application of the methods disclosed include priming DNA synthesis and template-directed ligation.

  5. Monitoring ssDNA Binding to the DnaB Helicase from Helicobacter pylori by Solid-State NMR Spectroscopy.

    PubMed

    Wiegand, Thomas; Cadalbert, Riccardo; Gardiennet, Carole; Timmins, Joanna; Terradot, Laurent; Böckmann, Anja; Meier, Beat H

    2016-11-02

    DnaB helicases are bacterial, ATP-driven enzymes that unwind double-stranded DNA during DNA replication. Herein, we study the sequential binding of the "non-hydrolysable" ATP analogue AMP-PNP and of single-stranded (ss) DNA to the dodecameric DnaB helicase from Helicobacter pylori using solid-state NMR. Phosphorus cross-polarization experiments monitor the binding of AMP-PNP and DNA to the helicase. 13 C chemical-shift perturbations (CSPs) are used to detect conformational changes in the protein upon binding. The helicase switches upon AMP-PNP addition into a conformation apt for ssDNA binding, and AMP-PNP is hydrolyzed and released upon binding of ssDNA. Our study sheds light on the conformational changes which are triggered by the interaction with AMP-PNP and are needed for ssDNA binding of H. pylori DnaB in vitro. They also demonstrate the level of detail solid-state NMR can provide for the characterization of protein-DNA interactions and the interplay with ATP or its analogues. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Ku proteins function as corepressors to regulate farnesoid X receptor-mediated gene expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ohno, Masae; Kunimoto, Masaaki; Nishizuka, Makoto

    2009-12-18

    The farnesoid X receptor (FXR; NR1H4) is a member of the nuclear receptor superfamily and regulates the expression of genes involved in enterohepatic circulation and the metabolism of bile acids. Based on functional analyses, nuclear receptors are divided into regions A-F. To explore the cofactors interacting with FXR, we performed a pull-down assay using GST-fused to the N-terminal A/B region and the C region, which are required for the ligand-independent transactivation and DNA-binding, respectively, of FXR, and nuclear extracts from HeLa cells. We identified DNA-dependent protein kinase catalytic subunit (DNA-PKcs), Ku80, and Ku70 as FXR associated factors. These proteins aremore » known to have an important role in DNA repair, recombination, and transcription. DNA-PKcs mainly interacted with the A/B region of FXR, whereas the Ku proteins interacted with the C region and with the D region (hinge region). Chromatin immunoprecipitation assays revealed that the Ku proteins associated with FXR on the bile salt export pump (BSEP) promoter. Furthermore, we demonstrated that ectopic expression of the Ku proteins decreased the promoter activity and expression of BSEP gene mediated by FXR. These results suggest that the Ku proteins function as corepressors for FXR.« less

  7. Mouse Mesenchyme forkhead 2 (Mf2): expression, DNA binding and induction by sonic hedgehog during somitogenesis.

    PubMed

    Wu, S C; Grindley, J; Winnier, G E; Hargett, L; Hogan, B L

    1998-01-01

    Cloning and sequencing of mouse Mf2 (mesoderm/mesenchyme forkhead 2) cDNAs revealed an open reading frame encoding a putative protein of 492 amino acids which, after in vitro translation, binds to a DNA consensus sequence. Mf2 is expressed at high levels in the ventral region of newly formed somites, in sclerotomal derivatives, in lateral plate and cephalic mesoderm and in the first and second branchial arches. Other regions of mesodermal expression include the developing tongue, meninges, nose, whiskers, kidney, genital tubercule and limb joints. In the nervous system Mf2 is transcribed in restricted regions of the mid- and forebrain. In several tissues, including the early somite, Mf2 is expressed in cell populations adjacent to regions expressing sonic hedgehog (Shh) and in explant cultures of presomitic mesoderm Mf2 is induced by Shh secreted by COS cells. These results suggest that Mf2, like other murine forkhead genes, has multiple roles in embryogenesis, possibly mediating the response of cells to signaling molecules such as SHH.

  8. Structural basis for autoantibody recognition of phosphatidylserine-β2 glycoprotein I and apoptotic cells

    PubMed Central

    Cocca, Brian A.; Seal, Samarendra N.; D'Agnillo, Paolo; Mueller, Yvonne M.; Katsikis, Peter D.; Rauch, Joyce; Weigert, Martin; Radic, Marko Z.

    2001-01-01

    Apoptotic cells contain nuclear autoantigens that may initiate a systemic autoimmune response. To explore the mechanism of antibody binding to apoptotic cells, 3H9, a murine autoantibody with dual specificity for phospholipids and DNA, was used. H chain mutants of 3H9 were constructed, expressed as single-chain Fv (scFv) in Escherichia coli, and assessed for binding to phosphatidylserine, an antigen expressed on apoptotic cells. Both 3H9 and its germline revertant bound to dioleoyl phosphatidylserine in ELISA, and binding was enhanced by β2 glycoprotein I (β2GPI), a plasma protein that selectively binds to apoptotic cells. Higher relative affinity for DOPS-β2GPI was achieved by the introduction of Arg residues into the 3H9 H chain variable region at positions previously shown to mediate DNA binding. Specificity of the two structurally most diverse scFv for apoptotic cells was shown by flow cytometry, and two populations of scFv-bound cells were identified by differences in propidium iodide staining. The results suggest that, in autoimmunity, B cells with Ig receptors for apoptotic cells and DNA are positively selected, and that the antibodies they produce have the potential to affect the clearance and processing of apoptotic cells. PMID:11717440

  9. Role of conserved cysteine residues in Herbaspirillum seropedicae NifA activity.

    PubMed

    Oliveira, Marco A S; Baura, Valter A; Aquino, Bruno; Huergo, Luciano F; Kadowaki, Marco A S; Chubatsu, Leda S; Souza, Emanuel M; Dixon, Ray; Pedrosa, Fábio O; Wassem, Roseli; Monteiro, Rose A

    2009-01-01

    Herbaspirillum seropedicae is an endophytic diazotrophic bacterium that associates with economically important crops. NifA protein, the transcriptional activator of nif genes in H. seropedicae, binds to nif promoters and, together with RNA polymerase-sigma(54) holoenzyme, catalyzes the formation of open complexes to allow transcription initiation. The activity of H. seropedicae NifA is controlled by ammonium and oxygen levels, but the mechanisms of such control are unknown. Oxygen sensitivity is attributed to a conserved motif of cysteine residues in NifA that spans the central AAA+ domain and the interdomain linker that connects the AAA+ domain to the C-terminal DNA binding domain. Here we mutagenized this conserved motif of cysteines and assayed the activity of mutant proteins in vivo. We also purified the mutant variants of NifA and tested their capacity to bind to the nifB promoter region. Chimeric proteins between H. seropedicae NifA, an oxygen-sensitive protein, and Azotobacter vinelandii NifA, an oxygen-tolerant protein, were constructed and showed that the oxygen response is conferred by the central AAA+ and C-terminal DNA binding domains of H. seropedicae NifA. We conclude that the conserved cysteine motif is essential for NifA activity, although single cysteine-to-serine mutants are still competent at binding DNA.

  10. Involvement of a bifunctional, paired-like DNA-binding domain and a transpositional enhancer in Sleeping Beauty transposition.

    PubMed

    Izsvák, Zsuzsanna; Khare, Dheeraj; Behlke, Joachim; Heinemann, Udo; Plasterk, Ronald H; Ivics, Zoltán

    2002-09-13

    Sleeping Beauty (SB) is the most active Tc1/mariner-like transposon in vertebrate species. Each of the terminal inverted repeats (IRs) of SB contains two transposase-binding sites (DRs). This feature, termed the IR/DR structure, is conserved in a group of Tc1-like transposons. The DNA-binding region of SB transposase, similar to the paired domain of Pax proteins, consists of two helix-turn-helix subdomains (PAI + RED = PAIRED). The N-terminal PAI subdomain was found to play a dominant role in contacting the DRs. Transposase was able to bind to mutant sites retaining the 3' part of the DRs; thus, primary DNA binding is not sufficient to determine the specificity of the transposition reaction. The PAI subdomain was also found to bind to a transpositional enhancer-like sequence within the left IR of SB, and to mediate protein-protein interactions between transposase subunits. A tetrameric form of the transposase was detected in solution, consistent with an interaction between the IR/DR structure and a transposase tetramer. We propose a model in which the transpositional enhancer and the PAI subdomain stabilize complexes formed by a transposase tetramer bound at the IR/DR. These interactions may result in enhanced stability of synaptic complexes, which might explain the efficient transposition of Sleeping Beauty in vertebrate cells.

  11. Conserved RNA binding activity of a Yin-Yang 1 homologue in the ova of the purple sea urchin Strongylocentrotus purpuratus.

    PubMed

    Belak, Zachery R; Ovsenek, Nicholas; Eskiw, Christopher H

    2018-05-23

    Yin-Yang 1 (YY1) is a highly conserved transcription factor possessing RNA-binding activity. A putative YY1 homologue was previously identified in the developmental model organism Strongylocentrotus purpuratus (the purple sea urchin) by genomic sequencing. We identified a high degree of sequence similarity with YY1 homologues of vertebrate origin which shared 100% protein sequence identity over the DNA- and RNA-binding zinc-finger region with high similarity in the N-terminal transcriptional activation domain. SpYY1 demonstrated identical DNA- and RNA-binding characteristics between Xenopus laevis and S. purpuratus indicating that it maintains similar functional and biochemical properties across widely divergent deuterostome species. SpYY1 binds to the consensus YY1 DNA element, and also to U-rich RNA sequences. Although we detected SpYY1 RNA-binding activity in ova lysates and observed cytoplasmic localization, SpYY1 was not associated with maternal mRNA in ova. SpYY1 expressed in Xenopus oocytes was excluded from the nucleus and associated with maternally expressed cytoplasmic mRNA molecules. These data demonstrate the existence of an YY1 homologue in S. purpuratus with similar structural and biochemical features to those of the well-studied vertebrate YY1; however, the data reveal major differences in the biological role of YY1 in the regulation of maternally expressed mRNA in the two species.

  12. Purification and DNA-binding properties of the cro-type regulatory repressor protein cng encoded by the Lactobacillus plantarum phage phi g1e.

    PubMed

    Kakikawa, M; Ohkubo, S; Sakate, T; Sayama, M; Taketo, A; Kodaira, K

    2000-05-16

    The putative repressor protein Cng (10kDa on an SDS gel) for the lytic pathway of Lactobacillus plantarum phage φg1e was purified using the Escherichia coli Pt7 system, and its DNA-binding ability for the seven operator-like sequences, the GATAC-boxes (Gb1 to Gb7), was investigated in vitro. In gel-shift assays, Cng selectively bound to the DNA fragments containing the GATAC-box(es). In addition, DNase I footprinting analysis with supercoiled DNA demonstrated that Cng can specifically cover about a 25bp region centered around each of the GATAC-boxes, although two boxes, Gb4 and Gb6, were only partially protected. Moreover, protein crosslinking experiments using glutaraldehyde suggested that Cng most likely functions as a dimer. On the other hand, the binding ability of Cpg for the GATAC-boxes in supercoiled DNA was also examined under the same conditions as in Cng; unlike Cng, Cpg covered Gb4 and Gb6 completely sufficiently as well as the other five boxes. Thus, the present and previous [Kakikawa et al., Gene 215 (1998) 371-379; 242 (2000) 155-166] results indicate a possibility that the two proteins Cng and Cpg selectively bind to the GATAC-boxes that act as operators, and can decide between the lytic or lysogenic pathways through repression of the promoter activity of P(R) as well as P(L).

  13. DNA Interactions Probed by Hydrogen-Deuterium Exchange (HDX) Fourier Transform Ion Cyclotron Resonance Mass Spectrometry Confirm External Binding Sites on the Minichromosomal Maintenance (MCM) Helicase*

    PubMed Central

    Graham, Brian W.; Tao, Yeqing; Dodge, Katie L.; Thaxton, Carly T.; Olaso, Danae; Young, Nicolas L.; Marshall, Alan G.

    2016-01-01

    The archaeal minichromosomal maintenance (MCM) helicase from Sulfolobus solfataricus (SsoMCM) is a model for understanding structural and mechanistic aspects of DNA unwinding. Although interactions of the encircled DNA strand within the central channel provide an accepted mode for translocation, interactions with the excluded strand on the exterior surface have mostly been ignored with regard to DNA unwinding. We have previously proposed an extension of the traditional steric exclusion model of unwinding to also include significant contributions with the excluded strand during unwinding, termed steric exclusion and wrapping (SEW). The SEW model hypothesizes that the displaced single strand tracks along paths on the exterior surface of hexameric helicases to protect single-stranded DNA (ssDNA) and stabilize the complex in a forward unwinding mode. Using hydrogen/deuterium exchange monitored by Fourier transform ion cyclotron resonance MS, we have probed the binding sites for ssDNA, using multiple substrates targeting both the encircled and excluded strand interactions. In each experiment, we have obtained >98.7% sequence coverage of SsoMCM from >650 peptides (5–30 residues in length) and are able to identify interacting residues on both the interior and exterior of SsoMCM. Based on identified contacts, positively charged residues within the external waist region were mutated and shown to generally lower DNA unwinding without negatively affecting the ATP hydrolysis. The combined data globally identify binding sites for ssDNA during SsoMCM unwinding as well as validating the importance of the SEW model for hexameric helicase unwinding. PMID:27044751

  14. Mms1 is an assistant for regulating G-quadruplex DNA structures.

    PubMed

    Schwindt, Eike; Paeschke, Katrin

    2018-06-01

    The preservation of genome stability is fundamental for every cell. Genomic integrity is constantly challenged. Among those challenges are also non-canonical nucleic acid structures. In recent years, scientists became aware of the impact of G-quadruplex (G4) structures on genome stability. It has been shown that folded G4-DNA structures cause changes in the cell, such as transcriptional up/down-regulation, replication stalling, or enhanced genome instability. Multiple helicases have been identified to regulate G4 structures and by this preserve genome stability. Interestingly, although these helicases are mostly ubiquitous expressed, they show specificity for G4 regulation in certain cellular processes (e.g., DNA replication). To this date, it is not clear how this process and target specificity of helicases are achieved. Recently, Mms1, an ubiquitin ligase complex protein, was identified as a novel G4-DNA-binding protein that supports genome stability by aiding Pif1 helicase binding to these regions. In this perspective review, we discuss the question if G4-DNA interacting proteins are fundamental for helicase function and specificity at G4-DNA structures.

  15. NLRC3, a member of the NLR family of proteins, is a negative regulator of innate immune signaling induced by the DNA sensor STING

    PubMed Central

    Zhang, Lu; Mo, Jinyao; Swanson, Karen V.; Wen, Haitao; Petrucelli, Alex; Gregory, Sean M.; Zhang, Zhigang; Schneider, Monika; Jiang, Yan; Fitzgerald, Katherine A.; Ouyang, Songying; Liu, Zhi-Jie; Damania, Blossom A; Shu, Hong-Bing; Duncan, Joseph A.; Ting, Jenny P-Y.

    2014-01-01

    SUMMARY Stimulator of interferon genes (STING, also named MITA, MYPS or ERIS) is an intracellular DNA sensor that induces type I interferon through its interaction with TANK-binding kinase 1 (TBK1). Here we found that the nucleotide-binding, leucine-rich repeat containing protein, NLRC3, reduced STING-dependent innate immune activation in response to cytosolic DNA, cyclic di-GMP (c-di-GMP) and DNA viruses. NLRC3 associated with both STING and TBK1, and impeded STING-TBK1 interaction and downstream type I interferon production. Using purified recombinant proteins NLRC3 was found to interact directly with STING. Furthermore, NLRC3 prevented proper trafficking of STING to perinuclear and punctated region, known to be important for its activation. In animals, herpes simplex virus 1 (HSV-1)-infected Nlrc3−/− mice exhibited enhanced innate immunity, reduced morbidity and viral load. This demonstrates the intersection of two key pathways of innate immune regulation, NLR and STING, to fine tune host response to intracellular DNA, DNA virus and c-di-GMP PMID:24560620

  16. Curated collection of yeast transcription factor DNA binding specificity data reveals novel structural and gene regulatory insights

    PubMed Central

    2011-01-01

    Background Transcription factors (TFs) play a central role in regulating gene expression by interacting with cis-regulatory DNA elements associated with their target genes. Recent surveys have examined the DNA binding specificities of most Saccharomyces cerevisiae TFs, but a comprehensive evaluation of their data has been lacking. Results We analyzed in vitro and in vivo TF-DNA binding data reported in previous large-scale studies to generate a comprehensive, curated resource of DNA binding specificity data for all characterized S. cerevisiae TFs. Our collection comprises DNA binding site motifs and comprehensive in vitro DNA binding specificity data for all possible 8-bp sequences. Investigation of the DNA binding specificities within the basic leucine zipper (bZIP) and VHT1 regulator (VHR) TF families revealed unexpected plasticity in TF-DNA recognition: intriguingly, the VHR TFs, newly characterized by protein binding microarrays in this study, recognize bZIP-like DNA motifs, while the bZIP TF Hac1 recognizes a motif highly similar to the canonical E-box motif of basic helix-loop-helix (bHLH) TFs. We identified several TFs with distinct primary and secondary motifs, which might be associated with different regulatory functions. Finally, integrated analysis of in vivo TF binding data with protein binding microarray data lends further support for indirect DNA binding in vivo by sequence-specific TFs. Conclusions The comprehensive data in this curated collection allow for more accurate analyses of regulatory TF-DNA interactions, in-depth structural studies of TF-DNA specificity determinants, and future experimental investigations of the TFs' predicted target genes and regulatory roles. PMID:22189060

  17. A novel mode for transcription inhibition mediated by PNA-induced R-loops with a model in vitro system.

    PubMed

    D'Souza, Alicia D; Belotserkovskii, Boris P; Hanawalt, Philip C

    2018-02-01

    The selective inhibition of transcription of a chosen gene by an artificial agent has numerous applications. Usually, these agents are designed to bind a specific nucleotide sequence in the promoter or within the transcribed region of the chosen gene. However, since optimal binding sites might not exist within the gene, it is of interest to explore the possibility of transcription inhibition when the agent is designed to bind at other locations. One of these possibilities arises when an additional transcription initiation site (e.g. secondary promoter) is present upstream from the primary promoter of the target gene. In this case, transcription inhibition might be achieved by inducing the formation of an RNA-DNA hybrid (R-loop) upon transcription from the secondary promoter. The R-loop could extend into the region of the primary promoter, to interfere with promoter recognition by RNA polymerase and thereby inhibit transcription. As a sequence-specific R-loop-inducing agent, a peptide nucleic acid (PNA) could be designed to facilitate R-loop formation by sequestering the non-template DNA strand. To investigate this mode for transcription inhibition, we have employed a model system in which a PNA binding site is localized between the T3 and T7 phage RNA polymerase promoters, which respectively assume the roles of primary and secondary promoters. In accord with our model, we have demonstrated that with PNA-bound DNA substrates, transcription from the T7 promoter reduces transcription from the T3 promoter by 30-fold, while in the absence of PNA binding there is no significant effect of T7 transcription upon T3 transcription. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. Specificity of the weak binding between the phage SPO1 transcription-inhibitory protein, TF1, and SPO1 DNA.

    PubMed

    Johnson, G G; Geiduschek, E P

    1977-04-05

    The interaction of the phage SPO1 protein transcription factor 1 (TF1), with DNA has been analyzed by membrane filter binding and by sedimentation methods. Substantially specific binding of TF1 to helical SPO1 DNA can be demonstrated by nitrocellulose filter-binding assays at relatively low ionic strength (0.08). However, TF1-DNA complexes dissociate and reequilibrate relatively rapidly and this makes filter-binding assays unsuitable for quantitative measurements of binding equilibra. Accordingly, the sedimentation properties of TF1-DNA complexes have been explored and a short-column centrifugation assay has been elaborated for quantitative measurements. Preferential binding of TF1 to the hydroxymethyluracil-containing SPO1 DNA has also been demonstrated by short-column centrifugation. TF1 binds relatively weakly and somewhat cooperatively to SPO1 DNA at many sites; TF1-DNA complexes dissociate and reequilibrate rapidly. At 20 degrees C in 0.01 M phosphate, pH 7.5, 0.15 KC1, one molecule of TF1 can bind to approximately every 60 nucleotide pairs of SPO1 DNA.

  19. Interaction of DNA with Simple and Mixed Ligand Copper(II) Complexes of 1,10-Phenanthrolines as Studied by DNA-Fiber EPR Spectroscopy

    PubMed Central

    Chikira, Makoto; Ng, Chew Hee; Palaniandavar, Mallayan

    2015-01-01

    The interaction of simple and ternary Cu(II) complexes of 1,10-phenanthrolines with DNA has been studied extensively because of their various interesting and important functions such as DNA cleavage activity, cytotoxicity towards cancer cells, and DNA based asymmetric catalysis. Such functions are closely related to the DNA binding modes of the complexes such as intercalation, groove binding, and electrostatic surface binding. A variety of spectroscopic methods have been used to study the DNA binding mode of the Cu(II) complexes. Of all these methods, DNA-fiber electron paramagnetic resonance (EPR) spectroscopy affords unique information on the DNA binding structures of the complexes. In this review we summarize the results of our DNA-fiber EPR studies on the DNA binding structure of the complexes and discuss them together with the data accumulated by using other measurements. PMID:26402668

  20. Engineering DNA Backbone Interactions Results in TALE Scaffolds with Enhanced 5-Methylcytosine Selectivity.

    PubMed

    Rathi, Preeti; Witte, Anna; Summerer, Daniel

    2017-11-08

    Transcription activator-like effectors (TALEs) are DNA major-groove binding proteins widely used for genome targeting. TALEs contain an N-terminal region (NTR) and a central repeat domain (CRD). Repeats of the CRD selectively recognize each one DNA nucleobase, offering programmability. Moreover, repeats with selectivity for 5-methylcytosine (5mC) and its oxidized derivatives can be designed for analytical applications. However, both TALE domains also nonspecifically interact with DNA phosphates via basic amino acids. To enhance the 5mC selectivity of TALEs, we aimed to decrease the nonselective binding energy of TALEs. We substituted basic amino acids with alanine in the NTR and identified TALE mutants with increased selectivity. We then analysed conserved, DNA phosphate-binding KQ diresidues in CRD repeats and identified further improved mutants. Combination of mutations in the NTR and CRD was highly synergetic and resulted in TALE scaffolds with up to 4.3-fold increased selectivity in genomic 5mC analysis via affinity enrichment. Moreover, transcriptional activation in HEK293T cells by a TALE-VP64 construct based on this scaffold design exhibited a 3.5-fold increased 5mC selectivity. This provides perspectives for improved 5mC analysis and for the 5mC-conditional control of TALE-based editing constructs in vivo.

  1. A variable DNA recognition site organization establishes the LiaR-mediated cell envelope stress response of enterococci to daptomycin

    DOE PAGES

    Davlieva, Milya; Shi, Yiwen; Leonard, Paul G.; ...

    2015-04-19

    LiaR is a ‘master regulator’ of the cell envelope stress response in enterococci and many other Gram-positive organisms. Mutations to liaR can lead to antibiotic resistance to a variety of antibiotics including the cyclic lipopeptide daptomycin. LiaR is phosphorylated in response to membrane stress to regulate downstream target operons. Using DNA footprinting of the regions upstream of the liaXYZ and liaFSR operons we show that LiaR binds an extended stretch of DNA that extends beyond the proposed canonical consensus sequence suggesting a more complex level of regulatory control of target operons. We go on to determine the biochemical and structuralmore » basis for increased resistance to daptomycin by the adaptive mutation to LiaR (D191N) first identified from the pathogen Enterococcus faecalis S613. LiaR D191N increases oligomerization of LiaR to form a constitutively activated tetramer that has high affinity for DNA even in the absence of phosphorylation leading to increased resistance. The crystal structures of the LiaR DNA binding domain complexed to the putative consensus sequence as well as an adjoining secondary sequence show that upon binding, LiaR induces DNA bending that is consistent with increased recruitment of RNA polymerase to the transcription start site and upregulation of target operons.« less

  2. The Dengue Vector Aedes aegypti Contains a Functional High Mobility Group Box 1 (HMGB1) Protein with a Unique Regulatory C-Terminus

    PubMed Central

    Ribeiro, Fabio Schneider; de Abreu da Silva, Isabel Caetano; Carneiro, Vitor Coutinho; Belgrano, Fabrício dos Santos; Mohana-Borges, Ronaldo; de Andrade Rosa, Ivone; Benchimol, Marlene; Souza, Nathalia Rocha Quintino; Mesquita, Rafael Dias; Sorgine, Marcos Henrique Ferreira; Gazos-Lopes, Felipe; Vicentino, Amanda Roberta Revoredo; Wu, Wenjie; de Moraes Maciel, Renata; da Silva-Neto, Mario Alberto Cardoso; Fantappié, Marcelo Rosado

    2012-01-01

    The mosquito Aedes aegypti can spread the dengue, chikungunya and yellow fever viruses. Thus, the search for key molecules involved in the mosquito survival represents today a promising vector control strategy. High Mobility Group Box (HMGB) proteins are essential nuclear factors that maintain the high-order structure of chromatin, keeping eukaryotic cells viable. Outside the nucleus, secreted HMGB proteins could alert the innate immune system to foreign antigens and trigger the initiation of host defenses. In this work, we cloned and functionally characterized the HMGB1 protein from Aedes aegypti (AaHMGB1). The AaHMGB1 protein typically consists of two HMG-box DNA binding domains and an acidic C-terminus. Interestingly, AaHMGB1 contains a unique alanine/glutamine-rich (AQ-rich) C-terminal region that seems to be exclusive of dipteran HMGB proteins. AaHMGB1 is localized to the cell nucleus, mainly associated with heterochromatin. Circular dichroism analyses of AaHMGB1 or the C-terminal truncated proteins revealed α-helical structures. We showed that AaHMGB1 can effectively bind and change the topology of DNA, and that the AQ-rich and the C-terminal acidic regions can modulate its ability to promote DNA supercoiling, as well as its preference to bind supercoiled DNA. AaHMGB1 is phosphorylated by PKA and PKC, but not by CK2. Importantly, phosphorylation of AaHMGB1 by PKA or PKC completely abolishes its DNA bending activity. Thus, our study shows that a functional HMGB1 protein occurs in Aedes aegypt and we provide the first description of a HMGB1 protein containing an AQ-rich regulatory C-terminus. PMID:22802955

  3. Cloning and expression of a nuclear encoded plastid specific 33 kDa ribonucleoprotein gene (33RNP) from pea that is light stimulated.

    PubMed

    Reddy, M K; Nair, S; Singh, B N; Mudgil, Y; Tewari, K K; Sopory, S K

    2001-01-24

    We report the cloning and sequencing of both cDNA and genomic DNA of a 33 kDa chloroplast ribonucleoprotein (33RNP) from pea. The analysis of the predicted amino acid sequence of the cDNA clone revealed that the encoded protein contains two RNA binding domains, including the conserved consensus ribonucleoprotein sequences CS-RNP1 and CS-RNP2, on the C-terminus half and the presence of a putative transit peptide sequence in the N-terminus region. The phylogenetic and multiple sequence alignment analysis of pea chloroplast RNP along with RNPs reported from the other plant sources revealed that the pea 33RNP is very closely related to Nicotiana sylvestris 31RNP and 28RNP and also to 31RNP and 28RNP of Arabidopsis and spinach, respectively. The pea 33RNP was expressed in Escherichia coli and purified to homogeneity. The in vitro import of precursor protein into chloroplasts confirmed that the N-terminus putative transit peptide is a bona fide transit peptide and 33RNP is localized in the chloroplast. The nucleic acid-binding properties of the recombinant protein, as revealed by South-Western analysis, showed that 33RNP has higher binding affinity for poly (U) and oligo dT than for ssDNA and dsDNA. The steady state transcript level was higher in leaves than in roots and the expression of this gene is light stimulated. Sequence analysis of the genomic clone revealed that the gene contains four exons and three introns. We have also isolated and analyzed the 5' flanking region of the pea 33RNP gene.

  4. Hinge residue I174 is critical for proper dNTP selection by DNA polymerase beta.

    PubMed

    Yamtich, Jen; Starcevic, Daniela; Lauper, Julia; Smith, Elenoe; Shi, Idina; Rangarajan, Sneha; Jaeger, Joachim; Sweasy, Joann B

    2010-03-23

    DNA polymerase beta (pol beta) is the key gap-filling polymerase in base excision repair, the DNA repair pathway responsible for repairing up to 20000 endogenous lesions per cell per day. Pol beta is also widely used as a model polymerase for structure and function studies, and several structural regions have been identified as being critical for the fidelity of the enzyme. One of these regions is the hydrophobic hinge, a network of hydrophobic residues located between the palm and fingers subdomains. Previous work by our lab has shown that hinge residues Y265, I260, and F272 are critical for polymerase fidelity by functioning in discrimination of the correct from incorrect dNTP during ground state binding. Our work aimed to elucidate the role of hinge residue I174 in polymerase fidelity. To study this residue, we conducted a genetic screen to identify mutants with a substitution at residue I174 that resulted in a mutator polymerase. We then chose the mutator mutant I174S for further study and found that it follows the same general kinetic pathway as and has an overall protein folding similar to that of wild-type (WT) pol beta. Using single-turnover kinetic analysis, we found that I174S exhibits decreased fidelity when inserting a nucleotide opposite a template base G, and this loss of fidelity is due primarily to a loss of discrimination during ground state dNTP binding. Molecular dynamics simulations show that mutation of residue I174 to serine results in an overall tightening of the hinge region, resulting in aberrant protein dynamics and fidelity. These results point to the hinge region as being critical in the maintenance of the proper geometry of the dNTP binding pocket.

  5. MCM ring hexamerization is a prerequisite for DNA-binding

    DOE PAGES

    Froelich, Clifford A.; Nourse, Amanda; Enemark, Eric J.

    2015-09-13

    The hexameric Minichromosome Maintenance (MCM) protein complex forms a ring that unwinds DNA at the replication fork in eukaryotes and archaea. Our recent crystal structure of an archaeal MCM N-terminal domain bound to single-stranded DNA (ssDNA) revealed ssDNA associating across tight subunit interfaces but not at the loose interfaces, indicating that DNA-binding is governed not only by the DNA-binding residues of the subunits (MCM ssDNA-binding motif, MSSB) but also by the relative orientation of the subunits. We now extend these findings to show that DNA-binding by the MCM N-terminal domain of the archaeal organism Pyrococcus furiosus occurs specifically in themore » hexameric oligomeric form. We show that mutants defective for hexamerization are defective in binding ssDNA despite retaining all the residues observed to interact with ssDNA in the crystal structure. One mutation that exhibits severely defective hexamerization and ssDNA-binding is at a conserved phenylalanine that aligns with the mouse Mcm4(Chaos3) mutation associated with chromosomal instability, cancer, and decreased intersubunit association.« less

  6. Investigations on the Interactions of 5-Fluorouracil with Herring Sperm DNA: Steady State/Time Resolved and Molecular Modeling Studies

    NASA Astrophysics Data System (ADS)

    Chinnathambi, Shanmugavel; Karthikeyan, Subramani; Velmurugan, Devadasan; Hanagata, Nobutaka; Aruna, Prakasarao; Ganesan, Singaravelu

    2015-04-01

    In the present study, the interaction of 5-Fluorouracil with herring sperm DNA is reported using spectroscopic and molecular modeling techniques. This binding study of 5-FU with hs-DNA is of paramount importance in understanding chemico-biological interactions for drug design, pharmacy and biochemistry without altering the original structure. The challenge of the study was to find the exact binding mode of the drug 5-Fluorouracil with hs-DNA. From the absorption studies, a hyperchromic effect was observed for the herring sperm DNA in the presence of 5-Fluorouracil and a binding constant of 6.153 × 103 M-1 for 5-Fluorouracil reveals the existence of weak interaction between the 5-Fluorouracil and herring sperm DNA. Ethidium bromide loaded herring sperm DNA showed a quenching in the fluorescence intensity after the addition of 5-Fluorouracil. The binding constants for 5-Fluorouracil stranded DNA and competitive bindings of 5-FU interacting with DNA-EB systems were examined by fluorescence spectra. The Stern-Volmer plots and fluorescence lifetime results confirm the static quenching nature of the drug-DNA complex. The binding constant Kb was 2.5 × 104 L mol-1 and the number of binding sites are 1.17. The 5-FU on DNA system was calculated using double logarithmic plot. From the Forster nonradiative energy transfer study it has been found that the distance of 5-FU from DNA was 4.24 nm. In addition to the spectroscopic results, the molecular modeling studies also revealed the major groove binding as well as the partial intercalation mode of binding between the 5-Fluorouracil and herring sperm DNA. The binding energy and major groove binding as -6.04 kcal mol-1 and -6.31 kcal mol-1 were calculated from the modeling studies. All the testimonies manifested that binding modes between 5-Fluorouracil and DNA were evidenced to be groove binding and in partial intercalative mode.

  7. A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor.

    PubMed Central

    Mink, S; Härtig, E; Jennewein, P; Doppler, W; Cato, A C

    1992-01-01

    Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites. Images PMID:1328867

  8. Epigenetic modifications during sex change repress gonadotropin stimulation of cyp19a1a in a teleost ricefield eel (Monopterus albus).

    PubMed

    Zhang, Yang; Zhang, Shen; Liu, Zhixin; Zhang, Lihong; Zhang, Weimin

    2013-08-01

    In vertebrates, cytochrome P450 aromatase, encoded by cyp19a1, converts androgens to estrogens and plays important roles in gonadal differentiation and development. The present study examines whether epigenetic mechanisms are involved in cyp19a1a expression and subsequent gonadal development in the hermaphroditic ricefield eel. The expression of the ricefield eel cyp19a1a was stimulated by gonadotropin via the cAMP pathway in the ovary but not the ovotestis or testis. The CpG within the cAMP response element (CRE) of the cyp19a1a promoter was hypermethylated in the ovotestis and testis compared with the ovary. The methylation levels of CpG sites around CRE in the distal region (region II) and around steroidogenic factor 1/adrenal 4 binding protein sites and TATA box in the proximal region (region I) were inversely correlated with cyp19a1a expression during the natural sex change from female to male. In vitro DNA methylation decreased the basal and forskolin-induced activities of cyp19a1a promoter. Chromatin immunoprecipitation assays indicated that histone 3 (Lys9) in both regions I and II of the cyp19a1a promoter were deacetylated and trimethylated in the testis, and in contrast to the ovary, phosphorylated CRE-binding protein failed to bind to these regions. Lastly, the DNA methylation inhibitor 5-aza-2'-deoxycytidine reversed the natural sex change of ricefield eels. These results suggested that epigenetic mechanisms involving DNA methylation and histone deacetylation and methylation may abrogate the stimulation of cyp19a1a by gonadotropins in a male-specific fashion. This may be a mechanism widely used to drive natural sex change in teleosts as well as gonadal differentiation in other vertebrates.

  9. The glycine-rich motif of Pyrococcus abyssi DNA polymerase D is critical for protein stability.

    PubMed

    Castrec, Benoît; Laurent, Sébastien; Henneke, Ghislaine; Flament, Didier; Raffin, Jean-Paul

    2010-03-05

    A glycine-rich motif described as being involved in human polymerase delta proliferating cell nuclear antigen (PCNA) binding has also been identified in all euryarchaeal DNA polymerase D (Pol D) family members. We redefined the motif as the (G)-PYF box. In the present study, Pol D (G)-PYF box motif mutants from Pyrococcus abyssi were generated to investigate its role in functional interactions with the cognate PCNA. We demonstrated that this motif is not essential for interactions between PabPol D (P. abyssi Pol D) and PCNA, using surface plasmon resonance and primer extension studies. Interestingly, the (G)-PYF box is located in a hydrophobic region close to the active site. The (G)-PYF box mutants exhibited altered DNA binding properties. In addition, the thermal stability of all mutants was reduced compared to that of wild type, and this effect could be attributed to increased exposure of the hydrophobic region. These studies suggest that the (G)-PYF box motif mediates intersubunit interactions and that it may be crucial for the thermostability of PabPol D. (c) 2010 Elsevier Ltd. All rights reserved.

  10. Multiple conformational states of DnaA protein regulate its interaction with DnaA boxes in the initiation of DNA replication.

    PubMed

    Patel, Meera J; Bhatia, Lavesh; Yilmaz, Gulden; Biswas-Fiss, Esther E; Biswas, Subhasis B

    2017-09-01

    DnaA protein is the initiator of genomic DNA replication in prokaryotes. It binds to specific DNA sequences in the origin of DNA replication and unwinds small AT-rich sequences downstream for the assembly of the replisome. The mechanism of activation of DnaA that enables it to bind and organize the origin DNA and leads to replication initiation remains unclear. In this study, we have developed double-labeled fluorescent DnaA probes to analyze conformational states of DnaA protein upon binding DNA, nucleotide, and Soj sporulation protein using Fluorescence Resonance Energy Transfer (FRET). Our studies demonstrate that DnaA protein undergoes large conformational changes upon binding to substrates and there are multiple distinct conformational states that enable it to initiate DNA replication. DnaA protein adopted a relaxed conformation by expanding ~15Å upon binding ATP and DNA to form the ATP·DnaA·DNA complex. Hydrolysis of bound ATP to ADP led to a contraction of DnaA within the complex. The relaxed conformation of DnaA is likely required for the formation of the multi-protein ATP·DnaA·DNA complex. In the initiation of sporulation, Soj binding to DnaA prevented relaxation of its conformation. Soj·ADP appeared to block the activation of DnaA, suggesting a mechanism for Soj·ADP in switching initiation of DNA replication to sporulation. Our studies demonstrate that multiple conformational states of DnaA protein regulate its binding to DNA in the initiation of DNA replication. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Investigation of arc repressor DNA-binding specificity by comparative molecular dynamics simulations.

    PubMed

    Song, Wei; Guo, Jun-Tao

    2015-01-01

    Transcription factors regulate gene expression through binding to specific DNA sequences. How transcription factors achieve high binding specificity is still not well understood. In this paper, we investigated the role of protein flexibility in protein-DNA-binding specificity by comparative molecular dynamics (MD) simulations. Protein flexibility has been considered as a key factor in molecular recognition, which is intrinsically a dynamic process involving fine structural fitting between binding components. In this study, we performed comparative MD simulations on wild-type and F10V mutant P22 Arc repressor in both free and complex conformations. The F10V mutant has lower DNA-binding specificity though both the bound and unbound main-chain structures between the wild-type and F10V mutant Arc are highly similar. We found that the DNA-binding motif of wild-type Arc is structurally more flexible than the F10V mutant in the unbound state, especially for the six DNA base-contacting residues in each dimer. We demonstrated that the flexible side chains of wild-type Arc lead to a higher DNA-binding specificity through forming more hydrogen bonds with DNA bases upon binding. Our simulations also showed a possible conformational selection mechanism for Arc-DNA binding. These results indicate the important roles of protein flexibility and dynamic properties in protein-DNA-binding specificity.

  12. Increased expression of Aspergillus parasiticus aflR, encoding a sequence-specific DNA-binding protein, relieves nitrate inhibition of aflatoxin biosynthesis.

    PubMed Central

    Chang, P K; Ehrlich, K C; Yu, J; Bhatnagar, D; Cleveland, T E

    1995-01-01

    The aflR gene from Aspergillus parasiticus and Aspergillus flavus may be involved in the regulation of aflatoxin biosynthesis. The aflR gene product, AFLR, possesses a GAL4-type binuclear zinc finger DNA-binding domain. A transformant, SU1-N3 (pHSP), containing an additional copy of aflR, showed increased transcription of aflR and the aflatoxin pathway structural genes, nor-1, ver-1, and omt-1, when cells were grown in nitrate medium, which normally suppresses aflatoxin production. Electrophoretic mobility shift assays showed that the recombinant protein containing the DNA-binding domain, AFLR1, bound specifically to the palindromic sequence, TTAGGCCTAA, 120 bp upstream of the AFLR translation start site. Expression of aflR thus appears to be autoregulated. Increased expression of aflatoxin biosynthetic genes in the transformant might result from an elevated basal level of AFLR, allowing it to overcome nitrate inhibition and to bind to the aflR promotor region, thereby initiating aflatoxin biosynthesis. Results further suggest that aflR is involved in the regulation of multiple parts of the aflatoxin biosynthetic pathway. PMID:7793958

  13. TopoIIα prevents telomere fragility and formation of ultra thin DNA bridges during mitosis through TRF1-dependent binding to telomeres.

    PubMed

    d'Alcontres, Martina Stagno; Palacios, Jose Alejandro; Mejias, Diego; Blasco, Maria A

    2014-01-01

    Telomeres are repetitive nucleoprotein structures at the ends of chromosomes. Like most genomic regions consisting of repetitive DNA, telomeres are fragile sites prone to replication fork stalling and generation of chromosomal instability. In particular, abrogation of the TRF1 telomere binding protein leads to stalled replication forks and aberrant telomere structures known as "multitelomeric signals". Here, we report that TRF1 deficiency also leads to the formation of "ultra-fine bridges" (UFB) during mitosis, and to an increased time to complete mitosis mediated by the spindle assembly checkpoint proteins (SAC). We find that topoisomerase IIα (TopoIIα), an enzyme essential for resolution of DNA replication intermediates, binds telomeres in a TRF1-mediated manner. Indeed, similar to TRF1 abrogation, TopoIIα downregulation leads to telomere fragility and UFB, suggesting that these phenotypes are due to decreased TopoIIα at telomeres. We find that SAC proteins bind telomeres in vivo, and that this is disrupted upon TRF1 deletion. These findings suggest that TRF1 links TopoIIα and SAC proteins in a pathway that ensures correct telomere replication and mitotic segregation, unveiling how TRF1 protects from telomere fragility and mitotic defects.

  14. Mutation of the C/EBP binding sites in the Rous sarcoma virus long terminal repeat and gag enhancers.

    PubMed Central

    Ryden, T A; de Mars, M; Beemon, K

    1993-01-01

    Several C/EBP binding sites within the Rous sarcoma virus (RSV) long terminal repeat (LTR) and gag enhancers were mutated, and the effect of these mutations on viral gene expression was assessed. Minimal site-specific mutations in each of three adjacent C/EBP binding sites in the LTR reduced steady-state viral RNA levels. Double mutation of the two 5' proximal LTR binding sites resulted in production of 30% of wild-type levels of virus. DNase I footprinting analysis of mutant DNAs indicated that the mutations blocked C/EBP binding at the affected sites. Additional C/EBP binding sites were identified upstream of the 3' LTR and within the 5' end of the LTRs. Point mutations in the RSV gag intragenic enhancer region, which blocked binding of C/EBP at two of three adjacent C/EBP sites, also reduced virus production significantly. Nuclear extracts prepared from both chicken embryo fibroblasts (CEFs) and chicken muscle contained proteins binding to the same RSV DNA sites as did C/EBP, and mutations that prevented C/EBP binding also blocked binding of these chicken proteins. It appears that CEFs and chicken muscle contain distinct proteins binding to these RSV DNA sites; the CEF binding protein was heat stable, as is C/EBP, while the chicken muscle protein was heat sensitive. Images PMID:8386280

  15. MTBP, the partner of Treslin, contains a novel DNA-binding domain that is essential for proper initiation of DNA replication.

    PubMed

    Kumagai, Akiko; Dunphy, William G

    2017-11-01

    Treslin, which is essential for incorporation of Cdc45 into the replicative helicase, possesses a partner called MTBP (Mdm2-binding protein). We have analyzed Xenopus and human MTBP to assess its role in DNA replication. Depletion of MTBP from Xenopus egg extracts, which also removes Treslin, abolishes DNA replication. These extracts be can rescued with recombinant Treslin-MTBP but not Treslin or MTBP alone. Thus, Treslin-MTBP is collectively necessary for replication. We have identified a C-terminal region of MTBP (the CTM domain) that binds efficiently to both double-stranded DNA and G-quadruplex (G4) DNA. This domain also exhibits homology with budding yeast Sld7. Mutants of MTBP without a functional CTM domain are defective for DNA replication in Xenopus egg extracts. These mutants display an impaired localization to chromatin and the inability to support loading of Cdc45. Human cells harboring such a mutant also display severe S-phase defects. Thus, the CTM domain of MTBP plays a critical role in localizing Treslin-MTBP to the replication apparatus for initiation. © 2017 Kumagai and Dunphy. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  16. Genetics Home Reference: aniridia

    MedlinePlus

    ... PAX6 protein attaches (binds) to specific regions of DNA and regulates the activity of other genes. On the basis of this role, the PAX6 protein is called a transcription factor. Following birth, the PAX6 protein regulates several ...

  17. Single-molecule FRET studies of the cooperative and non-cooperative binding kinetics of the bacteriophage T4 single-stranded DNA binding protein (gp32) to ssDNA lattices at replication fork junctions

    PubMed Central

    Lee, Wonbae; Gillies, John P.; Jose, Davis; Israels, Brett A.; von Hippel, Peter H.; Marcus, Andrew H.

    2016-01-01

    Gene 32 protein (gp32) is the single-stranded (ss) DNA binding protein of the bacteriophage T4. It binds transiently and cooperatively to ssDNA sequences exposed during the DNA replication process and regulates the interactions of the other sub-assemblies of the replication complex during the replication cycle. We here use single-molecule FRET techniques to build on previous thermodynamic studies of gp32 binding to initiate studies of the dynamics of the isolated and cooperative binding of gp32 molecules within the replication complex. DNA primer/template (p/t) constructs are used as models to determine the effects of ssDNA lattice length, gp32 concentration, salt concentration, binding cooperativity and binding polarity at p/t junctions. Hidden Markov models (HMMs) and transition density plots (TDPs) are used to characterize the dynamics of the multi-step assembly pathway of gp32 at p/t junctions of differing polarity, and show that isolated gp32 molecules bind to their ssDNA targets weakly and dissociate quickly, while cooperatively bound dimeric or trimeric clusters of gp32 bind much more tightly, can ‘slide’ on ssDNA sequences, and exhibit binding dynamics that depend on p/t junction polarities. The potential relationships of these binding dynamics to interactions with other components of the T4 DNA replication complex are discussed. PMID:27694621

  18. DNA-aptamers binding aminoglycoside antibiotics.

    PubMed

    Nikolaus, Nadia; Strehlitz, Beate

    2014-02-21

    Aptamers are short, single stranded DNA or RNA oligonucleotides that are able to bind specifically and with high affinity to their non-nucleic acid target molecules. This binding reaction enables their application as biorecognition elements in biosensors and assays. As antibiotic residues pose a problem contributing to the emergence of antibiotic-resistant pathogens and thereby reducing the effectiveness of the drug to fight human infections, we selected aptamers targeted against the aminoglycoside antibiotic kanamycin A with the aim of constructing a robust and functional assay that can be used for water analysis. With this work we show that aptamers that were derived from a Capture-SELEX procedure targeting against kanamycin A also display binding to related aminoglycoside antibiotics. The binding patterns differ among all tested aptamers so that there are highly substance specific aptamers and more group specific aptamers binding to a different variety of aminoglycoside antibiotics. Also the region of the aminoglycoside antibiotics responsible for aptamer binding can be estimated. Affinities of the different aptamers for their target substance, kanamycin A, are measured with different approaches and are in the micromolar range. Finally, the proof of principle of an assay for detection of kanamycin A in a real water sample is given.

  19. The Influence of Spatial Variation in Chromatin Density Determined by X-Ray Tomograms on the Time to Find DNA Binding Sites

    PubMed Central

    Larabell, Carolyn A.; Le Gros, Mark A.; McQueen, David M.; Peskin, Charles S.

    2014-01-01

    In this work, we examine how volume exclusion caused by regions of high chromatin density might influence the time required for proteins to find specific DNA binding sites. The spatial variation of chromatin density within mouse olfactory sensory neurons is determined from soft X-ray tomography reconstructions of five nuclei. We show that there is a division of the nuclear space into regions of low-density euchromatin and high-density heterochromatin. Volume exclusion experienced by a diffusing protein caused by this varying density of chromatin is modeled by a repulsive potential. The value of the potential at a given point in space is chosen to be proportional to the density of chromatin at that location. The constant of proportionality, called the volume exclusivity, provides a model parameter that determines the strength of volume exclusion. Numerical simulations demonstrate that the mean time for a protein to locate a binding site localized in euchromatin is minimized for a finite, nonzero volume exclusivity. For binding sites in heterochromatin, the mean time is minimized when the volume exclusivity is zero (the protein experiences no volume exclusion). An analytical theory is developed to explain these results. The theory suggests that for binding sites in euchromatin there is an optimal level of volume exclusivity that balances a reduction in the volume searched in finding the binding site, with the height of effective potential barriers the protein must cross during the search process. PMID:23955281

  20. KDM1A triggers androgen-induced miRNA transcription via H3K4me2 demethylation and DNA oxidation.

    PubMed

    Yang, Shu; Zhang, Jiyuan; Zhang, Yalong; Wan, Xuechao; Zhang, Congzhe; Huang, Xiaohui; Huang, Wenhua; Pu, Honglei; Pei, Chaohan; Wu, Hai; Huang, Yan; Huang, Shengdong; Li, Yao

    2015-06-15

    Androgen receptor (AR) is a ligand dependent transcription factor that regulates the transcription of target genes. AR activity is closely involved in the maintenance and progression of prostate cancer. After the binding with androgen, AR moves into nucleus and binds to DNA sequence containing androgen response elements (ARE). Flavin-dependent monoamine oxidase KDM1A is necessary for AR driven transcription while the mechanism remains unclear. The association between androgen-dependent transcription and oxidation was tested through pharmaceutical inhibitions and siRNA knockdown of DNA oxidation repair components in prostate cancer cells. The recruitment of involved proteins and the histone methylation dynamics on ARE region was explored by chromatin immunoprecipitation (ChIP). Oxidation inhibition reduced AR dependent expression of KLK3, TMPRSS2, hsa-miR-125b2, and hsa-miR-133b. And such reduction could be restored by H2 O2 treatment. KDM1A recruitment and H3K4me2 demethylation on ARE regions, which produce H2 O2 , are associated with AR targets transcription. AR targets transcription and coupled oxidation recruit 8-oxoguanine-DNA glycosylase (OGG1) and the nuclease APEX1 to ARE regions. Such recruitment depends on KDM1A, and is necessary for AR targets transcription. Our work underlined the importance of histone demethylation and DNA oxidation/repairing machinery in androgen-dependent transcription. The present finds have implications for research into new druggable targets for prostate cancer relying on the cascade of AR activity regulation. © 2015 Wiley Periodicals, Inc.

  1. RPA physically interacts with the human DNA glycosylase NEIL1 to regulate excision of oxidative DNA base damage in primer-template structures.

    PubMed

    Theriot, Corey A; Hegde, Muralidhar L; Hazra, Tapas K; Mitra, Sankar

    2010-06-04

    The human DNA glycosylase NEIL1, activated during the S-phase, has been shown to excise oxidized base lesions in single-strand DNA substrates. Furthermore, our previous work demonstrating functional interaction of NEIL1 with PCNA and flap endonuclease 1 (FEN1) suggested its involvement in replication-associated repair. Here we show interaction of NEIL1 with replication protein A (RPA), the heterotrimeric single-strand DNA binding protein that is essential for replication and other DNA transactions. The NEIL1 immunocomplex isolated from human cells contains RPA, and its abundance in the complex increases after exposure to oxidative stress. NEIL1 directly interacts with the large subunit of RPA (K(d) approximately 20 nM) via the common interacting interface (residues 312-349) in NEIL1's disordered C-terminal region. RPA inhibits the base excision activity of both wild-type NEIL1 (389 residues) and its C-terminal deletion CDelta78 mutant (lacking the interaction domain) for repairing 5-hydroxyuracil (5-OHU) in a primer-template structure mimicking the DNA replication fork. This inhibition is reduced when the damage is located near the primer-template junction. Contrarily, RPA moderately stimulates wild-type NEIL1 but not the CDelta78 mutant when 5-OHU is located within the duplex region. While NEIL1 is inhibited by both RPA and Escherichia coli single-strand DNA binding protein, only inhibition by RPA is relieved by PCNA. These results showing modulation of NEIL1's activity on single-stranded DNA substrate by RPA and PCNA support NEIL1's involvement in repairing the replicating genome. Copyright 2010 Elsevier B.V. All rights reserved.

  2. Interactions of DNA binding proteins with G-Quadruplex structures at the single molecule level

    NASA Astrophysics Data System (ADS)

    Ray, Sujay

    Guanine-rich nucleic acid (DNA/RNA) sequences can form non-canonical secondary structures, known as G-quadruplex (GQ). Numerous in vivo and in vitro studies have demonstrated formation of these structures in telomeric and non-telomeric regions of the genome. Telomeric GQs protect the chromosome ends whereas non-telomeric GQs either act as road blocks or recognition sites for DNA metabolic machinery. These observations suggest the significance of these structures in regulation of different metabolic processes, such as replication and repair. GQs are typically thermodynamically more stable than the corresponding Watson-Crick base pairing formed by G-rich and C-rich strands, making protein activity a crucial factor for their destabilization. Inside the cell, GQs interact with different proteins and their enzymatic activity is the determining factor for their stability. We studied interactions of several proteins with GQs to understand the underlying principles of protein-GQ interactions using single-molecule FRET and other biophysical techniques. Replication Protein-A (RPA), a single stranded DNA (ssDNA) binding protein, is known to posses GQ unfolding activity. First, we compared the thermal stability of three potentially GQ-forming DNA sequences (PQS) to their stability against RPA-mediated unfolding. One of these sequences is the human telomeric repeat and the other two, located in the promoter region of tyrosine hydroxylase gene, are highly heterogeneous sequences that better represent PQS in the genome. The thermal stability of these structures do not necessarily correlate with their stability against protein-mediated unfolding. We conclude that thermal stability is not necessarily an adequate criterion for predicting the physiological viability of GQ structures. To determine the critical structural factors that influence protein-GQ interactions we studied two groups of GQ structures that have systematically varying loop lengths and number of G-tetrad layers. We observed a linear increase in the steady-state stability of the GQ against RPA-mediated unfolding with increasing number of layers or decreasing loop length. The stability demonstrated by different GQ structures varied by at least three orders of magnitude. Finally, we studied another protein-GQ system where a protein complex works synergistically with a GQ to suppress DNA damage signals by preventing RPA to bind to telomeric DNA. Human telomeres that terminate with a single-stranded 3' G-overhang can be recognized as a DNA damage site by RPA. The protection of telomere-1 (POT1) and POT1-interacting protein (TPP1) heterodimer, binds specifically to telomeric DNA and protects it against RPA binding. Using model telomeric DNA, we studied the competition between POT1/TPP1 and RPA to access telomeric GQs in vitro. Under physiological salt and pH conditions, POT1/TPP1 stably load to a minimal DNA sequence adjacent to a folded GQ and unfolds the anti-parallel GQ as the parallel conformation remains folded. We showed that GQ formation of telomeres enhances the ability of POT1/TPP1 to block RPA's access to telomeres by two orders of magnitude and contributes to suppress DNA damage signals.

  3. Context influences on TALE–DNA binding revealed by quantitative profiling

    PubMed Central

    Rogers, Julia M.; Barrera, Luis A.; Reyon, Deepak; Sander, Jeffry D.; Kellis, Manolis; Joung, J Keith; Bulyk, Martha L.

    2015-01-01

    Transcription activator-like effector (TALE) proteins recognize DNA using a seemingly simple DNA-binding code, which makes them attractive for use in genome engineering technologies that require precise targeting. Although this code is used successfully to design TALEs to target specific sequences, off-target binding has been observed and is difficult to predict. Here we explore TALE–DNA interactions comprehensively by quantitatively assaying the DNA-binding specificities of 21 representative TALEs to ∼5,000–20,000 unique DNA sequences per protein using custom-designed protein-binding microarrays (PBMs). We find that protein context features exert significant influences on binding. Thus, the canonical recognition code does not fully capture the complexity of TALE–DNA binding. We used the PBM data to develop a computational model, Specificity Inference For TAL-Effector Design (SIFTED), to predict the DNA-binding specificity of any TALE. We provide SIFTED as a publicly available web tool that predicts potential genomic off-target sites for improved TALE design. PMID:26067805

  4. Context influences on TALE-DNA binding revealed by quantitative profiling.

    PubMed

    Rogers, Julia M; Barrera, Luis A; Reyon, Deepak; Sander, Jeffry D; Kellis, Manolis; Joung, J Keith; Bulyk, Martha L

    2015-06-11

    Transcription activator-like effector (TALE) proteins recognize DNA using a seemingly simple DNA-binding code, which makes them attractive for use in genome engineering technologies that require precise targeting. Although this code is used successfully to design TALEs to target specific sequences, off-target binding has been observed and is difficult to predict. Here we explore TALE-DNA interactions comprehensively by quantitatively assaying the DNA-binding specificities of 21 representative TALEs to ∼5,000-20,000 unique DNA sequences per protein using custom-designed protein-binding microarrays (PBMs). We find that protein context features exert significant influences on binding. Thus, the canonical recognition code does not fully capture the complexity of TALE-DNA binding. We used the PBM data to develop a computational model, Specificity Inference For TAL-Effector Design (SIFTED), to predict the DNA-binding specificity of any TALE. We provide SIFTED as a publicly available web tool that predicts potential genomic off-target sites for improved TALE design.

  5. TFBSshape: a motif database for DNA shape features of transcription factor binding sites.

    PubMed

    Yang, Lin; Zhou, Tianyin; Dror, Iris; Mathelier, Anthony; Wasserman, Wyeth W; Gordân, Raluca; Rohs, Remo

    2014-01-01

    Transcription factor binding sites (TFBSs) are most commonly characterized by the nucleotide preferences at each position of the DNA target. Whereas these sequence motifs are quite accurate descriptions of DNA binding specificities of transcription factors (TFs), proteins recognize DNA as a three-dimensional object. DNA structural features refine the description of TF binding specificities and provide mechanistic insights into protein-DNA recognition. Existing motif databases contain extensive nucleotide sequences identified in binding experiments based on their selection by a TF. To utilize DNA shape information when analysing the DNA binding specificities of TFs, we developed a new tool, the TFBSshape database (available at http://rohslab.cmb.usc.edu/TFBSshape/), for calculating DNA structural features from nucleotide sequences provided by motif databases. The TFBSshape database can be used to generate heat maps and quantitative data for DNA structural features (i.e., minor groove width, roll, propeller twist and helix twist) for 739 TF datasets from 23 different species derived from the motif databases JASPAR and UniPROBE. As demonstrated for the basic helix-loop-helix and homeodomain TF families, our TFBSshape database can be used to compare, qualitatively and quantitatively, the DNA binding specificities of closely related TFs and, thus, uncover differential DNA binding specificities that are not apparent from nucleotide sequence alone.

  6. TFBSshape: a motif database for DNA shape features of transcription factor binding sites

    PubMed Central

    Yang, Lin; Zhou, Tianyin; Dror, Iris; Mathelier, Anthony; Wasserman, Wyeth W.; Gordân, Raluca; Rohs, Remo

    2014-01-01

    Transcription factor binding sites (TFBSs) are most commonly characterized by the nucleotide preferences at each position of the DNA target. Whereas these sequence motifs are quite accurate descriptions of DNA binding specificities of transcription factors (TFs), proteins recognize DNA as a three-dimensional object. DNA structural features refine the description of TF binding specificities and provide mechanistic insights into protein–DNA recognition. Existing motif databases contain extensive nucleotide sequences identified in binding experiments based on their selection by a TF. To utilize DNA shape information when analysing the DNA binding specificities of TFs, we developed a new tool, the TFBSshape database (available at http://rohslab.cmb.usc.edu/TFBSshape/), for calculating DNA structural features from nucleotide sequences provided by motif databases. The TFBSshape database can be used to generate heat maps and quantitative data for DNA structural features (i.e., minor groove width, roll, propeller twist and helix twist) for 739 TF datasets from 23 different species derived from the motif databases JASPAR and UniPROBE. As demonstrated for the basic helix-loop-helix and homeodomain TF families, our TFBSshape database can be used to compare, qualitatively and quantitatively, the DNA binding specificities of closely related TFs and, thus, uncover differential DNA binding specificities that are not apparent from nucleotide sequence alone. PMID:24214955

  7. Phosphorylation Affects DNA-Binding of the Senescence-Regulating bZIP Transcription Factor GBF1

    PubMed Central

    Smykowski, Anja; Fischer, Stefan M.; Zentgraf, Ulrike

    2015-01-01

    Massive changes in the transcriptome of Arabidopsis thaliana during onset and progression of leaf senescence imply a central role for transcription factors. While many transcription factors are themselves up- or down-regulated during senescence, the bZIP transcription factor G-box-binding factor 1 (GBF1/bZIP41) is constitutively expressed in Arabidopsis leaf tissue but at the same time triggers the onset of leaf senescence, suggesting posttranscriptional mechanisms for senescence-specific GBF1 activation. Here we show that GBF1 is phosphorylated by the threonine/serine CASEIN KINASE II (CKII) in vitro and that CKII phosphorylation had a negative effect on GBF1 DNA-binding to G-boxes of two direct target genes, CATALASE2 and RBSCS1a. Phosphorylation mimicry at three serine positions in the basic region of GBF1 also had a negative effect on DNA-binding. Kinase assays revealed that CKII phosphorylates at least one serine in the basic domain but has additional phosphorylation sites outside this domain. Two different ckII α subunit1 and one α subunit2 T-DNA insertion lines showed no visible senescence phenotype, but in all lines the expression of the senescence marker gene SAG12 was remarkably diminished. A model is presented suggesting that senescence-specific GBF1 activation might be achieved by lowering the phosphorylation of GBF1 by CKII. PMID:27135347

  8. Variola Type IB DNA Topoisomerase: DNA Binding and Supercoil Unwinding Using Engineered DNA Minicircles

    PubMed Central

    2015-01-01

    Type IB topoisomerases unwind positive and negative DNA supercoils and play a key role in removing supercoils that would otherwise accumulate at replication and transcription forks. An interesting question is whether topoisomerase activity is regulated by the topological state of the DNA, thereby providing a mechanism for targeting the enzyme to highly supercoiled DNA domains in genomes. The type IB enzyme from variola virus (vTopo) has proven to be useful in addressing mechanistic questions about topoisomerase function because it forms a reversible 3′-phosphotyrosyl adduct with the DNA backbone at a specific target sequence (5′-CCCTT-3′) from which DNA unwinding can proceed. We have synthesized supercoiled DNA minicircles (MCs) containing a single vTopo target site that provides highly defined substrates for exploring the effects of supercoil density on DNA binding, strand cleavage and ligation, and unwinding. We observed no topological dependence for binding of vTopo to these supercoiled MC DNAs, indicating that affinity-based targeting to supercoiled DNA regions by vTopo is unlikely. Similarly, the cleavage and religation rates of the MCs were not topologically dependent, but topoisomers with low superhelical densities were found to unwind more slowly than highly supercoiled topoisomers, suggesting that reduced torque at low superhelical densities leads to an increased number of cycles of cleavage and ligation before a successful unwinding event. The K271E charge reversal mutant has an impaired interaction with the rotating DNA segment that leads to an increase in the number of supercoils that were unwound per cleavage event. This result provides evidence that interactions of the enzyme with the rotating DNA segment can restrict the number of supercoils that are unwound. We infer that both superhelical density and transient contacts between vTopo and the rotating DNA determine the efficiency of supercoil unwinding. Such determinants are likely to be important in regulating the steady-state superhelical density of DNA domains in the cell. PMID:24945825

  9. Screening for Protein-DNA Interactions by Automatable DNA-Protein Interaction ELISA

    PubMed Central

    Schüssler, Axel; Kolukisaoglu, H. Üner; Koch, Grit; Wallmeroth, Niklas; Hecker, Andreas; Thurow, Kerstin; Zell, Andreas; Harter, Klaus; Wanke, Dierk

    2013-01-01

    DNA-binding proteins (DBPs), such as transcription factors, constitute about 10% of the protein-coding genes in eukaryotic genomes and play pivotal roles in the regulation of chromatin structure and gene expression by binding to short stretches of DNA. Despite their number and importance, only for a minor portion of DBPs the binding sequence had been disclosed. Methods that allow the de novo identification of DNA-binding motifs of known DBPs, such as protein binding microarray technology or SELEX, are not yet suited for high-throughput and automation. To close this gap, we report an automatable DNA-protein-interaction (DPI)-ELISA screen of an optimized double-stranded DNA (dsDNA) probe library that allows the high-throughput identification of hexanucleotide DNA-binding motifs. In contrast to other methods, this DPI-ELISA screen can be performed manually or with standard laboratory automation. Furthermore, output evaluation does not require extensive computational analysis to derive a binding consensus. We could show that the DPI-ELISA screen disclosed the full spectrum of binding preferences for a given DBP. As an example, AtWRKY11 was used to demonstrate that the automated DPI-ELISA screen revealed the entire range of in vitro binding preferences. In addition, protein extracts of AtbZIP63 and the DNA-binding domain of AtWRKY33 were analyzed, which led to a refinement of their known DNA-binding consensi. Finally, we performed a DPI-ELISA screen to disclose the DNA-binding consensus of a yet uncharacterized putative DBP, AtTIFY1. A palindromic TGATCA-consensus was uncovered and we could show that the GATC-core is compulsory for AtTIFY1 binding. This specific interaction between AtTIFY1 and its DNA-binding motif was confirmed by in vivo plant one-hybrid assays in protoplasts. Thus, the value and applicability of the DPI-ELISA screen for de novo binding site identification of DBPs, also under automatized conditions, is a promising approach for a deeper understanding of gene regulation in any organism of choice. PMID:24146751

  10. DEPPDB - DNA electrostatic potential properties database. Electrostatic properties of genome DNA elements.

    PubMed

    Osypov, Alexander A; Krutinin, Gleb G; Krutinina, Eugenia A; Kamzolova, Svetlana G

    2012-04-01

    Electrostatic properties of genome DNA are important to its interactions with different proteins, in particular, related to transcription. DEPPDB - DNA Electrostatic Potential (and other Physical) Properties Database - provides information on the electrostatic and other physical properties of genome DNA combined with its sequence and annotation of biological and structural properties of genomes and their elements. Genomes are organized on taxonomical basis, supporting comparative and evolutionary studies. Currently, DEPPDB contains all completely sequenced bacterial, viral, mitochondrial, and plastids genomes according to the NCBI RefSeq, and some model eukaryotic genomes. Data for promoters, regulation sites, binding proteins, etc., are incorporated from established DBs and literature. The database is complemented by analytical tools. User sequences calculations are available. Case studies discovered electrostatics complementing DNA bending in E.coli plasmid BNT2 promoter functioning, possibly affecting host-environment metabolic switch. Transcription factors binding sites gravitate to high potential regions, confirming the electrostatics universal importance in protein-DNA interactions beyond the classical promoter-RNA polymerase recognition and regulation. Other genome elements, such as terminators, also show electrostatic peculiarities. Most intriguing are gene starts, exhibiting taxonomic correlations. The necessity of the genome electrostatic properties studies is discussed.

  11. Radiation damage to DNA in DNA-protein complexes.

    PubMed

    Spotheim-Maurizot, M; Davídková, M

    2011-06-03

    The most aggressive product of water radiolysis, the hydroxyl (OH) radical, is responsible for the indirect effect of ionizing radiations on DNA in solution and aerobic conditions. According to radiolytic footprinting experiments, the resulting strand breaks and base modifications are inhomogeneously distributed along the DNA molecule irradiated free or bound to ligands (polyamines, thiols, proteins). A Monte-Carlo based model of simulation of the reaction of OH radicals with the macromolecules, called RADACK, allows calculating the relative probability of damage of each nucleotide of DNA irradiated alone or in complexes with proteins. RADACK calculations require the knowledge of the three dimensional structure of DNA and its complexes (determined by X-ray crystallography, NMR spectroscopy or molecular modeling). The confrontation of the calculated values with the results of the radiolytic footprinting experiments together with molecular modeling calculations show that: (1) the extent and location of the lesions are strongly dependent on the structure of DNA, which in turns is modulated by the base sequence and by the binding of proteins and (2) the regions in contact with the protein can be protected against the attack by the hydroxyl radicals via masking of the binding site and by scavenging of the radicals. 2011 Elsevier B.V. All rights reserved.

  12. Molecular and biochemical evidence for the involvement of calcium/calmodulin in auxin action

    NASA Technical Reports Server (NTRS)

    Yang, T.; Poovaiah, B. W.

    2000-01-01

    The use of (35)S-labeled calmodulin (CaM) to screen a corn root cDNA expression library has led to the isolation of a CaM-binding protein, encoded by a cDNA with sequence similarity to small auxin up RNAs (SAURs), a class of early auxin-responsive genes. The cDNA designated as ZmSAUR1 (Zea mays SAURs) was expressed in Escherichia coli, and the recombinant protein was purified by CaM affinity chromatography. The CaM binding assay revealed that the recombinant protein binds to CaM in a calcium-dependent manner. Deletion analysis revealed that the CaM binding site was located at the NH(2)-terminal domain. A synthetic peptide of amino acids 20-45, corresponding to the potential CaM binding region, was used for calcium-dependent mobility shift assays. The synthetic peptide formed a stable complex with CaM only in the presence of calcium. The CaM affinity assay indicated that ZmSAUR1 binds to CaM with high affinity (K(d) approximately 15 nM) in a calcium-dependent manner. Comparison of the NH(2)-terminal portions of all of the characterized SAURs revealed that they all contain a stretch of the basic alpha-amphiphilic helix similar to the CaM binding region of ZmSAUR1. CaM binds to the two synthetic peptides from the NH(2)-terminal regions of Arabidopsis SAUR-AC1 and soybean 10A5, suggesting that this is a general phenomenon for all SAURs. Northern analysis was carried out using the total RNA isolated from auxin-treated corn coleoptile segments. ZmSAUR1 gene expression began within 10 min, increased rapidly between 10 and 60 min, and peaked around 60 min after 10 microM alpha-naphthaleneacetic acid treatment. These results indicate that ZmSAUR1 is an early auxin-responsive gene. The CaM antagonist N-(6-aminohexyl)5-chloro-1-naphthalenesulfonamide hydrochloride inhibited the auxin-induced cell elongation but not the auxin-induced expression of ZmSAUR1. This suggests that calcium/CaM do not regulate ZmSAUR1 at the transcriptional level. CaM binding to ZmSAUR1 in a calcium-dependent manner suggests that calcium/CaM regulate ZmSAUR1 at the post-translational level. Our data provide the first direct evidence for the involvement of calcium/CaM-mediated signaling in auxin-mediated signal transduction.

  13. Determinants of affinity and mode of DNA binding at the carboxy terminus of the bacteriophage SPO1-encoded type II DNA-binding protein, TF1.

    PubMed

    Andera, L; Geiduschek, E P

    1994-03-01

    The role of the carboxy-terminal amino acids of the bacteriophage SPO1-encoded type II DNA-binding protein, TF1, in DNA binding was analyzed. Chain-terminating mutations truncating the normally 99-amino-acid TF1 at amino acids 96, 97, and 98 were constructed, as were missense mutations substituting cysteine, arginine, and serine for phenylalanine at amino acid 97 and tryptophan for lysine at amino acid 99. The binding of the resulting proteins to a synthetic 44-bp binding site in 5-(hydroxymethyl)uracil DNA, to binding sites in larger SPO1 [5-(hydroxymethyl)uracil-containing] DNA fragments, and to thymine-containing homologous DNA was analyzed by gel retardation and also by DNase I and hydroxy radical footprinting. We conclude that the C tail up to and including phenylalanine at amino acid 97 is essential for DNA binding and that the two C-terminal amino acids, 98 and 99, are involved in protein-protein interactions between TF1 dimers bound to DNA.

  14. Functional interaction of the DNA-binding transcription factor Sp1 through its DNA-binding domain with the histone chaperone TAF-I.

    PubMed

    Suzuki, Toru; Muto, Shinsuke; Miyamoto, Saku; Aizawa, Kenichi; Horikoshi, Masami; Nagai, Ryozo

    2003-08-01

    Transcription involves molecular interactions between general and regulatory transcription factors with further regulation by protein-protein interactions (e.g. transcriptional cofactors). Here we describe functional interaction between DNA-binding transcription factor and histone chaperone. Affinity purification of factors interacting with the DNA-binding domain of the transcription factor Sp1 showed Sp1 to interact with the histone chaperone TAF-I, both alpha and beta isoforms. This interaction was specific as Sp1 did not interact with another histone chaperone CIA nor did other tested DNA-binding regulatory factors (MyoD, NFkappaB, p53) interact with TAF-I. Interaction of Sp1 and TAF-I occurs both in vitro and in vivo. Interaction with TAF-I results in inhibition of DNA-binding, and also likely as a result of such, inhibition of promoter activation by Sp1. Collectively, we describe interaction between DNA-binding transcription factor and histone chaperone which results in negative regulation of the former. This novel regulatory interaction advances our understanding of the mechanisms of eukaryotic transcription through DNA-binding regulatory transcription factors by protein-protein interactions, and also shows the DNA-binding domain to mediate important regulatory interactions.

  15. Deppdb--DNA electrostatic potential properties database: electrostatic properties of genome DNA.

    PubMed

    Osypov, Alexander A; Krutinin, Gleb G; Kamzolova, Svetlana G

    2010-06-01

    The electrostatic properties of genome DNA influence its interactions with different proteins, in particular, the regulation of transcription by RNA-polymerases. DEPPDB--DNA Electrostatic Potential Properties Database--was developed to hold and provide all available information on the electrostatic properties of genome DNA combined with its sequence and annotation of biological and structural properties of genome elements and whole genomes. Genomes in DEPPDB are organized on a taxonomical basis. Currently, the database contains all the completely sequenced bacterial and viral genomes according to NCBI RefSeq. General properties of the genome DNA electrostatic potential profile and principles of its formation are revealed. This potential correlates with the GC content but does not correspond to it exactly and strongly depends on both the sequence arrangement and its context (flanking regions). Analysis of the promoter regions for bacterial and viral RNA polymerases revealed a correspondence between the scale of these proteins' physical properties and electrostatic profile patterns. We also discovered a direct correlation between the potential value and the binding frequency of RNA polymerase to DNA, supporting the idea of the role of electrostatics in these interactions. This matches a pronounced tendency of the promoter regions to possess higher values of the electrostatic potential.

  16. A damaged DNA binding protein 2 mutation disrupting interaction with proliferating-cell nuclear antigen affects DNA repair and confers proliferation advantage.

    PubMed

    Perucca, Paola; Mocchi, Roberto; Guardamagna, Isabella; Bassi, Elisabetta; Sommatis, Sabrina; Nardo, Tiziana; Prosperi, Ennio; Stivala, Lucia Anna; Cazzalini, Ornella

    2018-06-01

    In mammalian cells, Nucleotide Excision Repair (NER) plays a role in removing DNA damage induced by UV radiation. In Global Genome-NER subpathway, DDB2 protein forms a complex with DDB1 (UV-DDB), recognizing photolesions. During DNA repair, DDB2 interacts directly with PCNA through a conserved region in N-terminal tail and this interaction is important for DDB2 degradation. In this work, we sought to investigate the role of DDB2-PCNA association in DNA repair and cell proliferation after UV-induced DNA damage. To this end, stable clones expressing DDB2 Wt and DDB2 PCNA- were used. We have found that cells expressing a mutant DDB2 show inefficient photolesions removal, and a concomitant lack of binding to damaged DNA in vitro. Unexpected cellular behaviour after DNA damage, such as UV-resistance, increased cell growth and motility were found in DDB2 PCNA- stable cell clones, in which the most significant defects in cell cycle checkpoint were observed, suggesting a role in the new cellular phenotype. Based on these findings, we propose that DDB2-PCNA interaction may contribute to a correct DNA damage response for maintaining genome integrity. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. DNA breathing dynamics distinguish binding from nonbinding consensus sites for transcription factor YY1 in cells.

    PubMed

    Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny

    2012-11-01

    The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.

  18. Binding of DNA-binding alkaloids berberine and palmatine to tRNA and comparison to ethidium: Spectroscopic and molecular modeling studies

    NASA Astrophysics Data System (ADS)

    Islam, Md. Maidul; Pandya, Prateek; Chowdhury, Sebanti Roy; Kumar, Surat; Kumar, Gopinatha Suresh

    2008-11-01

    The interaction of two natural protoberberine plant alkaloids berberine and palmatine with tRNA phe was studied using various biophysical techniques and molecular modeling and the data were compared with the binding of the classical DNA intercalator, ethidium. Circular dichroic studies revealed that the tRNA conformation was moderately perturbed on binding of the alkaloids. The cooperative binding of both the alkaloids and ethidium to tRNA was revealed from absorbance and fluorescence studies. Fluorescence quenching studies advanced a conclusion that while berberine and palmatine are partially intercalated, ethidium is fully intercalated on the tRNA molecule. The binding of the alkaloids as well as ethidium stabilized the tRNA melting, and the binding constant evaluated from the averaged optical melting temperature data was in agreement with fluorescence spectral-binding data. Differential scanning calorimetry revealed that the tRNA melting showed three close transitions that were affected on binding of these small molecules. Molecular docking calculations performed showed the preferred regions of binding of these small molecules on the tRNA. Taken together, the results suggest that the binding of the alkaloids berberine and palmatine on the tRNA structure appears to be mostly by partial intercalation while ethidium intercalates fully on the tRNA. These results further advance our knowledge on the molecular aspects on the interaction of these alkaloids to tRNA.

  19. Nuclear magnetic resonance-based model of a TF1/HmU-DNA complex.

    PubMed

    Silva, M V; Pasternack, L B; Kearns, D R

    1997-12-15

    Transcription factor 1 (TF1), a type II DNA-binding protein encoded by the Bacillus subtilis bacteriophage SPO1, has the capacity for sequence-selective DNA binding and a preference for 5-hydroxymethyl-2'-deoxyuridine (HmU)-containing DNA. In NMR studies of the TF1/HmU-DNA complex, intermolecular NOEs indicate that the flexible beta-ribbon and C-terminal alpha-helix are involved in the DNA-binding site of TF1, placing it in the beta-sheet category of DNA-binding proteins proposed to bind by wrapping two beta-ribbon "arms" around the DNA. Intermolecular and intramolecular NOEs were used to generate an energy-minimized model of the protein-DNA complex in which both DNA bending and protein structure changes are evident.

  20. The 32-Kilodalton Subunit of Replication Protein A Interacts with Menin, the Product of the MEN1 Tumor Suppressor Gene

    PubMed Central

    Sukhodolets, Karen E.; Hickman, Alison B.; Agarwal, Sunita K.; Sukhodolets, Maxim V.; Obungu, Victor H.; Novotny, Elizabeth A.; Crabtree, Judy S.; Chandrasekharappa, Settara C.; Collins, Francis S.; Spiegel, Allen M.; Burns, A. Lee; Marx, Stephen J.

    2003-01-01

    Menin is a 70-kDa protein encoded by MEN1, the tumor suppressor gene disrupted in multiple endocrine neoplasia type 1. In a yeast two-hybrid system based on reconstitution of Ras signaling, menin was found to interact with the 32-kDa subunit (RPA2) of replication protein A (RPA), a heterotrimeric protein required for DNA replication, recombination, and repair. The menin-RPA2 interaction was confirmed in a conventional yeast two-hybrid system and by direct interaction between purified proteins. Menin-RPA2 binding was inhibited by a number of menin missense mutations found in individuals with multiple endocrine neoplasia type 1, and the interacting regions were mapped to the N-terminal portion of menin and amino acids 43 to 171 of RPA2. This region of RPA2 contains a weak single-stranded DNA-binding domain, but menin had no detectable effect on RPA-DNA binding in vitro. Menin bound preferentially in vitro to free RPA2 rather than the RPA heterotrimer or a subcomplex consisting of RPA2 bound to the 14-kDa subunit (RPA3). However, the 70-kDa subunit (RPA1) was coprecipitated from HeLa cell extracts along with RPA2 by menin-specific antibodies, suggesting that menin binds to the RPA heterotrimer or a novel RPA1-RPA2-containing complex in vivo. This finding was consistent with the extensive overlap in the nuclear localization patterns of endogenous menin, RPA2, and RPA1 observed by immunofluorescence. PMID:12509449

Top